WorldWideScience

Sample records for wound-inducible bzip dna-binding

  1. Molecular cloning and characterization of a tomato cDNA encoding a systemically wound-inducible bZIP DNA-binding protein

    Science.gov (United States)

    Stankovic, B.; Vian, A.; Henry-Vian, C.; Davies, E.

    2000-01-01

    Localized wounding of one leaf in intact tomato (Lycopersicon esculentum Mill.) plants triggers rapid systemic transcriptional responses that might be involved in defense. To better understand the mechanism(s) of intercellular signal transmission in wounded tomatoes, and to identify the array of genes systemically up-regulated by wounding, a subtractive cDNA library for wounded tomato leaves was constructed. A novel cDNA clone (designated LebZIP1) encoding a DNA-binding protein was isolated and identified. This clone appears to be encoded by a single gene, and belongs to the family of basic leucine zipper domain (bZIP) transcription factors shown to be up-regulated by cold and dark treatments. Analysis of the mRNA levels suggests that the transcript for LebZIP1 is both organ-specific and up-regulated by wounding. In wounded wild-type tomatoes, the LebZIP1 mRNA levels in distant tissue were maximally up-regulated within only 5 min following localized wounding. Exogenous abscisic acid (ABA) prevented the rapid wound-induced increase in LebZIP1 mRNA levels, while the basal levels of LebZIP1 transcripts were higher in the ABA mutants notabilis (not), sitiens (sit), and flacca (flc), and wound-induced increases were greater in the ABA-deficient mutants. Together, these results suggest that ABA acts to curtail the wound-induced synthesis of LebZIP1 mRNA.

  2. Differential Gene Regulation by Selective Association of Transcriptional Coactivators and bZIP DNA-Binding Domains†

    OpenAIRE

    Miotto, Benoit; Struhl, Kevin

    2006-01-01

    bZIP DNA-binding domains are targets for viral and cellular proteins that function as transcriptional coactivators. Here, we show that MBF1 and the related Chameau and HBO1 histone acetylases interact with distinct subgroups of bZIP proteins, whereas pX does not discriminate. Selectivity of Chameau and MBF1 for bZIP proteins is mediated by residues in the basic region that lie on the opposite surface from residues that contact DNA. Chameau functions as a specific coactivator for the AP-1 clas...

  3. Differential gene regulation by selective association of transcriptional coactivators and bZIP DNA-binding domains.

    Science.gov (United States)

    Miotto, Benoit; Struhl, Kevin

    2006-08-01

    bZIP DNA-binding domains are targets for viral and cellular proteins that function as transcriptional coactivators. Here, we show that MBF1 and the related Chameau and HBO1 histone acetylases interact with distinct subgroups of bZIP proteins, whereas pX does not discriminate. Selectivity of Chameau and MBF1 for bZIP proteins is mediated by residues in the basic region that lie on the opposite surface from residues that contact DNA. Chameau functions as a specific coactivator for the AP-1 class of bZIP proteins via two arginine residues. A conserved glutamic acid/glutamine in the linker region underlies MBF1 specificity for a subgroup of bZIP factors. Chameau and MBF1 cannot synergistically coactivate transcription due to competitive interactions with the basic region, but either protein can synergistically coactivate with pX. Analysis of Jun derivatives that selectively interact with these coactivators reveals that MBF1 is crucial for the response to oxidative stress, whereas Chameau is important for the response to chemical and osmotic stress. Thus, the bZIP domain mediates selective interactions with coactivators and hence differential regulation of gene expression.

  4. Differential Gene Regulation by Selective Association of Transcriptional Coactivators and bZIP DNA-Binding Domains†

    Science.gov (United States)

    Miotto, Benoit; Struhl, Kevin

    2006-01-01

    bZIP DNA-binding domains are targets for viral and cellular proteins that function as transcriptional coactivators. Here, we show that MBF1 and the related Chameau and HBO1 histone acetylases interact with distinct subgroups of bZIP proteins, whereas pX does not discriminate. Selectivity of Chameau and MBF1 for bZIP proteins is mediated by residues in the basic region that lie on the opposite surface from residues that contact DNA. Chameau functions as a specific coactivator for the AP-1 class of bZIP proteins via two arginine residues. A conserved glutamic acid/glutamine in the linker region underlies MBF1 specificity for a subgroup of bZIP factors. Chameau and MBF1 cannot synergistically coactivate transcription due to competitive interactions with the basic region, but either protein can synergistically coactivate with pX. Analysis of Jun derivatives that selectively interact with these coactivators reveals that MBF1 is crucial for the response to oxidative stress, whereas Chameau is important for the response to chemical and osmotic stress. Thus, the bZIP domain mediates selective interactions with coactivators and hence differential regulation of gene expression. PMID:16880509

  5. The DNA binding properties of the parsley bZIP transcription factor CPRF4a are regulated by light.

    Science.gov (United States)

    Wellmer, F; Schäfer, E; Harter, K

    2001-03-02

    The common plant regulatory factors (CPRFs) from parsley are transcription factors with a basic leucine zipper motif that bind to cis-regulatory elements frequently found in promoters of light-regulated genes. Recent studies have revealed that certain CPRF proteins are regulated in response to light by changes in their expression level and in their intracellular localization. Here, we describe an additional mechanism contributing to the light-dependent regulation of CPRF proteins. We show that the DNA binding activity of the factor CPRF4a is modulated in a phosphorylation-dependent manner and that cytosolic components are involved in the regulation of this process. Moreover, we have identified a cytosolic kinase responsible for CPRF4a phosphorylation. Modification of recombinant CPRF4a by this kinase, however, is insufficient to cause a full activation of the factor, suggesting that additional modifications are required. Furthermore, we demonstrate that the DNA binding activity of the factor is modified upon light treatment. The results of additional irradiation experiments suggest that this photoresponse is controlled by different photoreceptor systems. We discuss the possible role of CPRF4a in light signal transduction as well as the emerging regulatory network controlling CPRF activities in parsley.

  6. Deciphering the Combinatorial DNA-binding Code of the CCAAT-binding Complex and the Iron-regulatory Basic Region Leucine Zipper (bZIP) Transcription Factor HapX*

    Science.gov (United States)

    Hortschansky, Peter; Ando, Eriko; Tuppatsch, Katja; Arikawa, Hisashi; Kobayashi, Tetsuo; Kato, Masashi; Haas, Hubertus; Brakhage, Axel A.

    2015-01-01

    The heterotrimeric CCAAT-binding complex (CBC) is evolutionarily conserved in eukaryotic organisms, including fungi, plants, and mammals. The CBC consists of three subunits, which are named in the filamentous fungus Aspergillus nidulans HapB, HapC, and HapE. HapX, a fourth CBC subunit, was identified exclusively in fungi, except for Saccharomyces cerevisiae and the closely related Saccharomycotina species. The CBC-HapX complex acts as the master regulator of iron homeostasis. HapX belongs to the class of basic region leucine zipper transcription factors. We demonstrated that the CBC and HapX bind cooperatively to bipartite DNA motifs with a general HapX/CBC/DNA 2:1:1 stoichiometry in a class of genes that are repressed by HapX-CBC in A. nidulans during iron limitation. This combinatorial binding mode requires protein-protein interaction between the N-terminal domain of HapE and the N-terminal CBC binding domain of HapX as well as sequence-specific DNA binding of both the CBC and HapX. Initial binding of the CBC to CCAAT boxes is mandatory for DNA recognition of HapX. HapX specifically targets the minimal motif 5′-GAT-3′, which is located at a distance of 11–12 bp downstream of the respective CCAAT box. Single nucleotide substitutions at the 5′- and 3′-end of the GAT motif as well as different spacing between the CBC and HapX DNA-binding sites revealed a remarkable promiscuous DNA-recognition mode of HapX. This flexible DNA-binding code may have evolved as a mechanism for fine-tuning the transcriptional activity of CBC-HapX at distinct target promoters. PMID:25589790

  7. Sequence-Specific DNA Binding by a Short Peptide Dimer

    Science.gov (United States)

    Talanian, Robert V.; McKnight, C. James; Kim, Peter S.

    1990-08-01

    A recently described class of DNA binding proteins is characterized by the "bZIP" motif, which consists of a basic region that contacts DNA and an adjacent "leucine zipper" that mediates protein dimerization. A peptide model for the basic region of the yeast transcriptional activator GCN4 has been developed in which the leucine zipper has been replaced by a disulfide bond. The 34-residue peptide dimer, but not the reduced monomer, binds DNA with nanomolar affinity at 4^circC. DNA binding is sequence-specific as judged by deoxyribonuclease I footprinting. Circular dichroism spectroscopy suggests that the peptide adopts a helical structure when bound to DNA. These results demonstrate directly that the GCN4 basic region is sufficient for sequence-specific DNA binding and suggest that a major function of the GCN4 leucine zipper is simply to mediate protein dimerization. Our approach provides a strategy for the design of short sequence-specific DNA binding peptides.

  8. bZIPs and WRKYs: two large transcription factor families executing two different functional strategies

    Directory of Open Access Journals (Sweden)

    Carles eMarco Llorca

    2014-04-01

    Full Text Available bZIPs and WRKYs are two important plant transcription factor families regulating diverse developmental and stress-related processes. Since a partial overlap in these biological processes is obvious, it can be speculated that they fulfill non-redundant functions in a complex regulatory network. Here, we focus on the regulatory mechanisms that are so far described for bZIPs and WRKYs. bZIP factors need to heterodimerize for DNA-binding and regulation of transcription, and based on a bioinformatics approach, bZIPs can build up more than the double of protein interactions than WRKYs. In contrast, an enrichment of the WRKY DNA-binding motifs can be found in WRKY promoters, a phenomenon which is not observed for the bZIP family. Thus, the two transcription factor families follow two different functional strategies in which WRKYs regulate each other’s transcription in a transcriptional network whereas bZIP action relies on intensive heterodimerization.

  9. Allosteric communication between DNA-binding and light-responsive domains of diatom class I aureochromes

    Science.gov (United States)

    Banerjee, Ankan; Herman, Elena; Serif, Manuel; Maestre-Reyna, Manuel; Hepp, Sebastian; Pokorny, Richard; Kroth, Peter G.; Essen, Lars-Oliver; Kottke, Tilman

    2016-01-01

    The modular architecture of aureochrome blue light receptors, found in several algal groups including diatoms, is unique by having the LOV-type photoreceptor domain fused to the C-terminus of its putative effector, an N-terminal DNA-binding bZIP module. The structural and functional understanding of aureochromes’ light-dependent signaling mechanism is limited, despite their promise as an optogenetic tool. We show that class I aureochromes 1a and 1c from the diatom Phaeodactylum tricornutum are regulated in a light-independent circadian rhythm. These aureochromes are capable to form functional homo- and heterodimers, which recognize the ACGT core sequence within the canonical ‘aureo box’, TGACGT, in a light-independent manner. The bZIP domain holds a more folded and less flexible but extended conformation in the duplex DNA-bound state. FT-IR spectroscopy in the absence and the presence of DNA shows light-dependent helix unfolding in the LOV domain, which leads to conformational changes in the bZIP region. The solution structure of DNA bound to aureochrome points to a tilted orientation that was further validated by molecular dynamics simulations. We propose that aureochrome signaling relies on an allosteric pathway from LOV to bZIP that results in conformational changes near the bZIP-DNA interface without major effects on the binding affinity. PMID:27179025

  10. Genome-wide analysis and expression profile of the bZIP transcription factor gene family in grapevine (Vitis vinifera).

    Science.gov (United States)

    Liu, Jinyi; Chen, Nana; Chen, Fei; Cai, Bin; Dal Santo, Silvia; Tornielli, Giovanni Battista; Pezzotti, Mario; Cheng, Zong-Ming Max

    2014-04-13

    Basic leucine zipper (bZIP) transcription factor gene family is one of the largest and most diverse families in plants. Current studies have shown that the bZIP proteins regulate numerous growth and developmental processes and biotic and abiotic stress responses. Nonetheless, knowledge concerning the specific expression patterns and evolutionary history of plant bZIP family members remains very limited. We identified 55 bZIP transcription factor-encoding genes in the grapevine (Vitis vinifera) genome, and divided them into 10 groups according to the phylogenetic relationship with those in Arabidopsis. The chromosome distribution and the collinearity analyses suggest that expansion of the grapevine bZIP (VvbZIP) transcription factor family was greatly contributed by the segment/chromosomal duplications, which may be associated with the grapevine genome fusion events. Nine intron/exon structural patterns within the bZIP domain and the additional conserved motifs were identified among all VvbZIP proteins, and showed a high group-specificity. The predicted specificities on DNA-binding domains indicated that some highly conserved amino acid residues exist across each major group in the tree of land plant life. The expression patterns of VvbZIP genes across the grapevine gene expression atlas, based on microarray technology, suggest that VvbZIP genes are involved in grapevine organ development, especially seed development. Expression analysis based on qRT-PCR indicated that VvbZIP genes are extensively involved in drought- and heat-responses, with possibly different mechanisms. The genome-wide identification, chromosome organization, gene structures, evolutionary and expression analyses of grapevine bZIP genes provide an overall insight of this gene family and their potential involvement in growth, development and stress responses. This will facilitate further research on the bZIP gene family regarding their evolutionary history and biological functions.

  11. Adenovirus DNA binding protein: helix destabilising properties.

    OpenAIRE

    Monaghan, A; Webster, A; Hay, R T

    1994-01-01

    Adenovirus DNA binding protein is a multifunctional protein essential for viral DNA replication. To investigate the role of the DNA binding protein in this process its interaction with partial DNA duplexes was examined. Duplex regions of DNA, created when a short DNA strand is annealed to its complementary sequence present in the single stranded form of M13 phage DNA, were efficiently unwound by DNA binding protein in a reaction that required neither ATP nor MgCl2. The unwinding activity of D...

  12. New DNA-binding radioprotectors

    Science.gov (United States)

    Martin, Roger

    The normal tissue damage associated with cancer radiotherapy has motivated the development at Peter Mac of a new class of DNA-binding radioprotecting drugs that could be applied top-ically to normal tissues at risk. Methylproamine (MP), the lead compound, reduces radiation induced cell kill at low concentrations. For example, experiments comparing the clonogenic survival of transformed human keratinocytes treated with 30 micromolar MP before and dur-ing various doses of ionising radiation, with the radiation dose response for untreated cells, indicate a dose reduction factor (DRF) of 2. Similar survival curve experiments using various concentrations of MP, with parallel measurements of uptake of MP into cell nuclei, have en-abled the relationship between drug uptake and extent of radioprotection to be established. Radioprotection has also been demonstrated after systemic administration to mice, for three different endpoints, namely lung, jejunum and bone marrow (survival at 30 days post-TBI). The results of pulse radiolysis studies indicated that the drugs act by reduction of transient radiation-induced oxidative species on DNA. This hypothesis was substantiated by the results of experiments in which MP radioprotection of radiation-induced DNA double-strand breaks, assessed as -H2AX foci, in the human keratinocyte cell line. For both endpoints, the extent of radioprotection increased with MP concentration up to a maximal value. These results are consistent with the hypothesis that radioprotection by MP is mediated by attenuation of the extent of initial DNA damage. However, although MP is a potent radioprotector, it becomes cytotoxic at higher concentrations. This limitation has been addressed in an extensive program of lead optimisation and some promising analogues have emerged from which the next lead will be selected. Given the clinical potential of topical radioprotection, the new analogues are being assessed in terms of delivery to mouse oral mucosa. This is

  13. The transcription factor bZIP14 regulates the TCA cycle in the diatom Phaeodactylum tricornutum.

    Science.gov (United States)

    Matthijs, Michiel; Fabris, Michele; Obata, Toshihiro; Foubert, Imogen; Franco-Zorrilla, José Manuel; Solano, Roberto; Fernie, Alisdair R; Vyverman, Wim; Goossens, Alain

    2017-06-01

    Diatoms are amongst the most important marine microalgae in terms of biomass, but little is known concerning the molecular mechanisms that regulate their versatile metabolism. Here, the pennate diatom Phaeodactylum tricornutum was studied at the metabolite and transcriptome level during nitrogen starvation and following imposition of three other stresses that impede growth. The coordinated upregulation of the tricarboxylic acid (TCA) cycle during the nitrogen stress response was the most striking observation. Through co-expression analysis and DNA binding assays, the transcription factor bZIP14 was identified as a regulator of the TCA cycle, also beyond the nitrogen starvation response, namely in diurnal regulation. Accordingly, metabolic and transcriptional shifts were observed upon overexpression of bZIP14 in transformed P. tricornutum cells. Our data indicate that the TCA cycle is a tightly regulated and important hub for carbon reallocation in the diatom cell during nutrient starvation and that bZIP14 is a conserved regulator of this cycle. © 2017 The Authors.

  14. Activator Protein-1: redox switch controlling structure and DNA-binding

    Energy Technology Data Exchange (ETDEWEB)

    Yin, Zhou; Machius, Mischa; Nestler, Eric J.; Rudenko, Gabby

    2017-09-07

    The transcription factor, activator protein-1 (AP-1), binds to cognate DNA under redox control; yet, the underlying mechanism has remained enigmatic. A series of crystal structures of the AP-1 FosB/JunD bZIP domains reveal ordered DNA-binding regions in both FosB and JunD even in absence DNA. However, while JunD is competent to bind DNA, the FosB bZIP domain must undergo a large conformational rearrangement that is controlled by a ‘redox switch’ centered on an inter-molecular disulfide bond. Solution studies confirm that FosB/JunD cannot undergo structural transition and bind DNA when the redox-switch is in the ‘OFF’ state, and show that the mid-point redox potential of the redox switch affords it sensitivity to cellular redox homeostasis. The molecular and structural studies presented here thus reveal the mechanism underlying redox-regulation of AP-1 Fos/Jun transcription factors and provide structural insight for therapeutic interventions targeting AP-1 proteins.

  15. Differential Regulation of Wound-Induced 1-Aminocyclopropane-1 ...

    African Journals Online (AJOL)

    Northern blot nalysis was applied to total RNNA using labeled probes prepared by a multiprimer DNA labeling system and α-[32P]dCTP with a Hindi> III fragment from pCMW33, a wound inducible ACC synthase gene as a template. CO2 suppressed wound-induced ethylene production, ACC synthase and ACC oxidase ...

  16. A Cationic Smart Copolymer for DNA Binding

    Directory of Open Access Journals (Sweden)

    Tânia Ribeiro

    2017-11-01

    Full Text Available A new block copolymer with a temperature-responsive block and a cationic block was prepared by reversible addition-fragmentation chain transfer (RAFT polymerization, with good control of its size and composition. The first block is composed by di(ethylene glycol methyl ether methacrylate (DEGMA and oligo(ethylene glycol methyl ether methacrylate (OEGMA, with the ratio DEGMA/OEGMA being used to choose the volume phase transition temperature of the polymer in water, tunable from ca. 25 to above 90 °C. The second block, of trimethyl-2-methacroyloxyethylammonium chloride (TMEC, is positively charged at physiological pH values and is used for DNA binding. The coacervate complexes between the block copolymer and a model single strand DNA are characterized by fluorescence correlation spectroscopy and fluorescence spectroscopy. The new materials offer good prospects for biomedical application, for example in controlled gene delivery.

  17. Comparative footprinting of DNA-binding proteins.

    Science.gov (United States)

    Contreras-Moreira, Bruno; Collado-Vides, Julio

    2006-07-15

    Comparative modelling is a computational method used to tackle a variety of problems in molecular biology and biotechnology. Traditionally it has been applied to model the structure of proteins on their own or bound to small ligands, although more recently it has also been used to model protein-protein interfaces. This work is the first to systematically analyze whether comparative models of protein-DNA complexes could be built and be useful for predicting DNA binding sites. First, we describe the structural and evolutionary conservation of protein-DNA interfaces, and the limits they impose on modelling accuracy. Second, we find that side-chains from contacting residues can be reasonably modeled and therefore used to identify contacting nucleotides. Third, the DNASITE protocol is implemented and different parameters are benchmarked on a set of 85 regulators from Escherichia coli. Results show that comparative footprinting can make useful predictions based solely on structural data, depending primarily on the interface identity with respect to the template used. DNASITE code available on request from the authors.

  18. SUMO-1 possesses DNA binding activity

    Directory of Open Access Journals (Sweden)

    Wieruszeski Jean-Michel

    2010-05-01

    Full Text Available Abstract Background Conjugation of small ubiquitin-related modifiers (SUMOs is a frequent post-translational modification of proteins. SUMOs can also temporally associate with protein-targets via SUMO binding motifs (SBMs. Protein sumoylation has been identified as an important regulatory mechanism especially in the regulation of transcription and the maintenance of genome stability. The precise molecular mechanisms by which SUMO conjugation and association act are, however, not understood. Findings Using NMR spectroscopy and protein-DNA cross-linking experiments, we demonstrate here that SUMO-1 can specifically interact with dsDNA in a sequence-independent fashion. We also show that SUMO-1 binding to DNA can compete with other protein-DNA interactions at the example of the regulatory domain of Thymine-DNA Glycosylase and, based on these competition studies, estimate the DNA binding constant of SUMO1 in the range 1 mM. Conclusion This finding provides an important insight into how SUMO-1 might exert its activity. SUMO-1 might play a general role in destabilizing DNA bound protein complexes thereby operating in a bottle-opener way of fashion, explaining its pivotal role in regulating the activity of many central transcription and DNA repair complexes.

  19. DNA binding studies of tartrazine food additive.

    Science.gov (United States)

    Kashanian, Soheila; Zeidali, Sahar Heidary

    2011-07-01

    The interaction of native calf thymus DNA with tartrazine in 10 mM Tris-HCl aqueous solution at neutral pH 7.4 was investigated. Tartrazine is a nitrous derivative and may cause allergic reactions, with a potential of toxicological risk. Also, tartrazine induces oxidative stress and DNA damage. Its DNA binding properties were studied by UV-vis and circular dichroism spectra, competitive binding with Hoechst 33258, and viscosity measurements. Tartrazine molecules bind to DNA via groove mode as illustrated by hyperchromism in the UV absorption band of tartrazine, decrease in Hoechst-DNA solution fluorescence, unchanged viscosity of DNA, and conformational changes such as conversion from B-like to C-like in the circular dichroism spectra of DNA. The binding constants (K(b)) of DNA with tartrazine were calculated at different temperatures. Enthalpy and entropy changes were calculated to be +37 and +213 kJ mol(-1), respectively, according to the Van't Hoff equation, which indicated that the reaction is predominantly entropically driven. Also, tartrazine does not cleave plasmid DNA. Tartrazine interacts with calf thymus DNA via a groove interaction mode with an intrinsic binding constant of 3.75 × 10(4) M(-1).

  20. Tuning genetic clocks employing DNA binding sites.

    Directory of Open Access Journals (Sweden)

    Shridhar Jayanthi

    Full Text Available Periodic oscillations play a key role in cell physiology from the cell cycle to circadian clocks. The interplay of positive and negative feedback loops among genes and proteins is ubiquitous in these networks. Often, delays in a negative feedback loop and/or degradation rates are a crucial mechanism to obtain sustained oscillations. How does nature control delays and kinetic rates in feedback networks? Known mechanisms include proper selection of the number of steps composing a feedback loop and alteration of protease activity, respectively. Here, we show that a remarkably simple means to control both delays and effective kinetic rates is the employment of DNA binding sites. We illustrate this design principle on a widely studied activator-repressor clock motif, which is ubiquitous in natural systems. By suitably employing DNA target sites for the activator and/or the repressor, one can switch the clock "on" and "off" and precisely tune its period to a desired value. Our study reveals a design principle to engineer dynamic behavior in biomolecular networks, which may be largely exploited by natural systems and employed for the rational design of synthetic circuits.

  1. Structures of DNA-binding mutant zinc finger domains: implications for DNA binding.

    Science.gov (United States)

    Hoffman, R C; Horvath, S J; Klevit, R E

    1993-06-01

    Studies of Cys2-His2 zinc finger domains have revealed that the structures of individual finger domains in solution determined by NMR spectroscopy are strikingly similar to the structure of fingers bound to DNA determined by X-ray diffraction. Therefore, detailed structural analyses of single finger domains that contain amino acid substitutions known to affect DNA binding in the whole protein can yield information concerning the structural ramifications of such mutations. We have used this approach to study two mutants in the N-terminal finger domain of ADR1, a yeast transcription factor that contains two Cys2-His2 zinc finger sequences spanning residues 102-159. Two point mutants at position 118 in the N-terminal zinc finger (ADR1b: 102-130) that adversely affect the DNA-binding activity of ADR1 have previously been identified: H118A and H118Y. The structures of wild-type ADR1b and the two mutant zinc finger domains were determined using two-dimensional nuclear magnetic resonance spectroscopy and distance geometry and were refined using a complete relaxation matrix method approach (REPENT) to improve agreement between the models and the nuclear Overhauser effect spectroscopy data from which they were generated. The molecular architecture of the refined wild-type ADR1b domain is presented in detail. Comparisons of wild-type ADR1b and the two mutants revealed that neither mutation causes a significant structural perturbation. The structures indicate that the DNA binding properties of the His 118 mutants are dependent on the identity of the side chain at position 118, which has been postulated to make a direct DNA contact in the wild-type ADR1 protein. The results suggest that the identity of the side chain at the middle DNA contact position in Cys2-His2 zinc fingers may be changed with impunity regarding the domain structure and can affect the affinity of the protein-DNA interaction.

  2. Rapid identification of DNA-binding proteins by mass spectrometry

    DEFF Research Database (Denmark)

    Nordhoff, E; Krogsdam, A M; Jorgensen, H F

    1999-01-01

    We report a protocol for the rapid identification of DNA-binding proteins. Immobilized DNA probes harboring a specific sequence motif are incubated with cell or nuclear extract. Proteins are analyzed directly off the solid support by matrix-assisted laser desorption/ionization time-of-flight mass...... was validated by the identification of known prokaryotic and eukaryotic DNA-binding proteins, and its use provided evidence that poly(ADP-ribose) polymerase exhibits DNA sequence-specific binding to DNA....

  3. DNA binding site analysis of Burkholderia thailandensis response regulators.

    Science.gov (United States)

    Nowak-Lovato, Kristy L; Hickmott, Alexana J; Maity, Tuhin S; Bulyk, Martha L; Dunbar, John; Hong-Geller, Elizabeth

    2012-07-01

    Bacterial response regulators (RR) that function as transcription factors in two component signaling pathways are crucial for ensuring tight regulation and coordinated expression of the genome. Currently, consensus DNA binding sites in the promoter for very few bacterial RRs have been identified. A systematic method to characterize these DNA binding sites for RRs would enable prediction of specific gene expression patterns in response to extracellular stimuli. To identify RR DNA binding sites, we functionally activated RRs using beryllofluoride and applied them to a protein-binding microarray (PBM) to discover DNA binding motifs for RRs expressed in Burkholderia, a Gram-negative bacterial genus. We identified DNA binding motifs for conserved RRs in Burkholderia thailandensis, including KdpE, RisA, and NarL, as well as for a previously uncharacterized RR at locus BTH_II2335 and its ortholog in the human pathogen Burkholderia pseudomallei at locus BPSS2315. We further demonstrate RR binding of predicted genomic targets for the two orthologs using gel shift assays and reveal a pattern of RR regulation of expression of self and other two component systems. Our studies illustrate the use of PBMs to identify DNA binding specificities for bacterial RRs and enable prediction of gene regulatory networks in response to two component signaling. Published by Elsevier B.V.

  4. Optimizing the Photocontrol of bZIP Coiled Coils with Azobenzene Crosslinkers: Role of the Crosslinking Site.

    Science.gov (United States)

    Ali, Ahmed M; Forbes, Matthew W; Woolley, G Andrew

    2015-08-17

    DNA binding by bZIP-type coiled-coil proteins can be inhibited by dominant negative versions of the proteins in which the N-terminal basic region is replaced by an acidic extension. Photocontrol of bZIP function can be achieved by introducing intramolecular azobenzene-based crosslinkers into dominant negatives. We show that the largest degree of photocontrol is achieved when the crosslinker is introduced into the zipper region of the dominant negative between Cys residues placed at f sites in the heptad segment showing the highest intrinsic helical propensity. The overall affinity of the dominant negative can then be tuned by varying the length of the acidic extension. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  5. The function and transcriptome analysis of a bZIP transcription factor CgAP1 in Colletotrichum gloeosporioides.

    Science.gov (United States)

    Li, Xiaoyu; Wu, Yateng; Liu, Zhiqiang; Zhang, Chenghui

    2017-04-01

    Colletotrichum gloeosporioides is an important pathogen of anthracnose, which is able to infect numerous crops in tropical and subtropical regions, causing great economic losses. To investigate the fungal response to host-generated reactive oxygen species (ROS), we cloned and characterized the CgAP1 gene of C. gloeosporioides. CgAP1 encoded a bZIP transcription factor which had a bZIP DNA-binding domain and two cysteine-rich domains structurally and functionally related to Saccharomyces cerevisiae YAP1. Deletion of CgAP1 in C. gloeosporioides resulted in increasing sensitivity to H2O2, changes in cell wall integrity and loss of pathogenicity. To understand the regulatory network of CgAP1, RNA sequencing was used to identify differentially expressed genes in the CgAP1 mutant. It was shown that several genes involved in ROS detoxification and cell wall integrity were affected by CgAP1. Moreover, CgAP1 was also involved in many biological processes especially ribosome, cellular transport and amino acid metabolism. In conclusion, CgAP1 is an important transcription factor involved in oxidative stress, cell wall integrity and pathogenicity in C. gloeosporioides. Copyright © 2017 Elsevier GmbH. All rights reserved.

  6. Visually Relating Gene Expression and in vivo DNA Binding Data

    Energy Technology Data Exchange (ETDEWEB)

    Huang, Min-Yu; Mackey, Lester; Ker?,; nen, Soile V. E.; Weber, Gunther H.; Jordan, Michael I.; Knowles, David W.; Biggin, Mark D.; Hamann, Bernd

    2011-09-20

    Gene expression and in vivo DNA binding data provide important information for understanding gene regulatory networks: in vivo DNA binding data indicate genomic regions where transcription factors are bound, and expression data show the output resulting from this binding. Thus, there must be functional relationships between these two types of data. While visualization and data analysis tools exist for each data type alone, there is a lack of tools that can easily explore the relationship between them. We propose an approach that uses the average expression driven by multiple of ciscontrol regions to visually relate gene expression and in vivo DNA binding data. We demonstrate the utility of this tool with examples from the network controlling early Drosophila development. The results obtained support the idea that the level of occupancy of a transcription factor on DNA strongly determines the degree to which the factor regulates a target gene, and in some cases also controls whether the regulation is positive or negative.

  7. Spectral characterization and DNA binding properties of lanthanide(III)

    African Journals Online (AJOL)

    ... with CT-DNA was investigated using absorption spectrophotometry. Based on spectral changes, groove binding of complexes to DNA is suggested. KEY WORDS: Lanthanide(III) complexes, 2-Acetylpyridine isonicotinoylhydrazone, Spectral characterization, DNA binding. Bull. Chem. Soc. Ethiop. 2016, 30(2), 221-230.

  8. Cytotoxic, DNA binding, DNA cleavage and antibacterial studies of ...

    Indian Academy of Sciences (India)

    Six new Ru(II) and Ru(III) complexes have been synthesized and characterized by elemental analysis, LC-MS, electronic spectra, IR spectra and magnetic moment measurements. DNA-binding properties of Ru complexes have been studied by means of absorption spectrophotometry and viscosity measurements as well as ...

  9. Cytotoxic, DNA binding, DNA cleavage and antibacterial studies of ...

    Indian Academy of Sciences (India)

    Abstract. Six new Ru(II) and Ru(III) complexes have been synthesized and characterized by elemental ana- lysis, LC-MS, electronic spectra, IR spectra and magnetic moment measurements. DNA-binding properties of. Ru complexes have been studied by means of absorption spectrophotometry and viscosity measurements ...

  10. Synthesis, DNA binding and cytotoxic evaluation of aminoquinoline ...

    Indian Academy of Sciences (India)

    DNA binding studies of selected isomeric compounds showed interaction withDNA via intercalation mode with higher binding affinity of 4-substituted ... Universiti Sains Malaysia, Minden 11800, Penang, Malaysia; New Drug Discovery Research, Department of Medicinal Chemistry, Alwar Pharmacy College, Alwar, ...

  11. Prediction of DNA-binding specificity in zinc finger proteins

    Indian Academy of Sciences (India)

    2012-06-25

    Jun 25, 2012 ... Zinc finger proteins interact via their individual fingers to three base pair subsites on the target DNA. The four key ... [Roy S, Dutta S, Khanna K, Singla S and Sundar D 2012 Prediction of DNA-binding specificity in zinc finger proteins. J. Biosci. .... well as protection from HIV infection (Reynolds, et al. 2003).

  12. NAD+ Modulates p53 DNA Binding Specificity and Function

    Science.gov (United States)

    McLure, Kevin G.; Takagi, Masatoshi; Kastan, Michael B.

    2004-01-01

    DNA damage induces p53 DNA binding activity, which affects tumorigenesis, tumor responses to therapies, and the toxicities of cancer therapies (B. Vogelstein, D. Lane, and A. J. Levine, Nature 408:307-310, 2000; K. H. Vousden and X. Lu, Nat. Rev. Cancer 2:594-604, 2002). Both transcriptional and transcription-independent activities of p53 contribute to DNA damage-induced cell cycle arrest, apoptosis, and aneuploidy prevention (M. B. Kastan et al., Cell 71:587-597, 1992; K. H. Vousden and X. Lu, Nat. Rev. Cancer 2:594-604, 2002). Small-molecule manipulation of p53 DNA binding activity has been an elusive goal, but here we show that NAD+ binds to p53 tetramers, induces a conformational change, and modulates p53 DNA binding specificity in vitro. Niacinamide (vitamin B3) increases the rate of intracellular NAD+ synthesis, alters radiation-induced p53 DNA binding specificity, and modulates activation of a subset of p53 transcriptional targets. These effects are likely due to a direct effect of NAD+ on p53, as a molecule structurally related to part of NAD+, TDP, also inhibits p53 DNA binding, and the TDP precursor, thiamine (vitamin B1), inhibits intracellular p53 activity. Niacinamide and thiamine affect two p53-regulated cellular responses to ionizing radiation: rereplication and apoptosis. Thus, niacinamide and thiamine form a novel basis for the development of small molecules that affect p53 function in vivo, and these results suggest that changes in cellular energy metabolism may regulate p53. PMID:15509798

  13. Wound induced tanscriptional regulation of benzylisoquinoline pathway and characterization of wound inducible PsWRKY transcription factor from Papaver somniferum.

    Directory of Open Access Journals (Sweden)

    Sonal Mishra

    Full Text Available Wounding is required to be made in the walls of the green seed pod of Opium poppy prior exudation of latex. To withstand this kind of trauma plants regulate expression of some metabolites through an induced transcript level. 167 unique wound-inducible ESTs were identified by a repetitive round of cDNA subtraction after 5 hours of wounding in Papaver somniferum seedlings. Further repetitive reverse northern analysis of these ESTs revealed 80 transcripts showing more than two fold induction, validated through semi-quantitative RT-PCR & real time expression analysis. One of the major classified categories among identified ESTs belonged to benzylisoquinoline transcripts. Tissue specific metabolite analysis of benzylisoquinoline alkaloids (BIAs in response to wounding revealed increased accumulation of narcotine and papaverine. Promoter analysis of seven transcripts of BIAs pathway showed the presence of W-box cis-element with the consensus sequence of TGAC, which is the proposed binding site for WRKY type transcription factors. One of the Wound inducible 'WRKY' EST isolated from our subtracted library was made full-length and named as 'PsWRKY'. Bacterially expressed PsWRKY interacted with the W-box element having consensus sequence TTGACT/C present in the promoter region of BIAs biosynthetic pathway genes. PsWRKY further activated the TYDC promoter in yeast and transiently in tobacco BY2 cells. Preferential expression of PsWRKY in straw and capsule and its interaction with consensus W-box element present in BIAs pathway gene transcripts suggest its possible involvement in the wound induced regulation of BIAs pathway.

  14. Drosophila DNA-Binding Proteins in Polycomb Repression

    Directory of Open Access Journals (Sweden)

    Maksim Erokhin

    2018-01-01

    Full Text Available The formation of individual gene expression patterns in different cell types is required during differentiation and development of multicellular organisms. Polycomb group (PcG proteins are key epigenetic regulators responsible for gene repression, and dysregulation of their activities leads to developmental abnormalities and diseases. PcG proteins were first identified in Drosophila, which still remains the most convenient system for studying PcG-dependent repression. In the Drosophila genome, these proteins bind to DNA regions called Polycomb response elements (PREs. A major role in the recruitment of PcG proteins to PREs is played by DNA-binding factors, several of which have been characterized in detail. However, current knowledge is insufficient for comprehensively describing the mechanism of this process. In this review, we summarize and discuss the available data on the role of DNA-binding proteins in PcG recruitment to chromatin.

  15. Unexpected regiospecific formation and DNA binding of new 3 ...

    Indian Academy of Sciences (India)

    DOI 10.1007/s12039-015-1023-7. Unexpected regiospecific formation and DNA binding of new. 3-(acridin-9-yl)methyl-2-iminothiazolidin-4-ones. JÁN IMRICHa∗, DANICA SABOLOVÁb, MÁRIA VILKOVÁa and JÚLIA KUDLÁ ˇCOVÁb. aDepartment of Organic Chemistry bDepartment of Biochemistry, Institute of Chemistry,.

  16. Building an automated classification of DNA-binding protein domains.

    Science.gov (United States)

    Ponomarenko, Julia V; Bourne, Philip E; Shindyalov, Ilya N

    2002-01-01

    Intensive growth in 3D structure data on DNA-protein complexes as reflected in the Protein Data Bank (PDB) demands new approaches to the annotation and characterization of these data and will lead to a new understanding of critical biological processes involving these data. These data and those from other protein structure classifications will become increasingly important for the modeling of complete proteomes. We propose a fully automated classification of DNA-binding protein domains based on existing 3D-structures from the PDB. The classification, by domain, relies on the Protein Domain Parser (PDP) and the Combinatorial Extension (CE) algorithm for structural alignment. The approach involves the analysis of 3D-interaction patterns in DNA-protein interfaces, assignment of structural domains interacting with DNA, clustering of domains based on structural similarity and DNA-interacting patterns. Comparison with existing resources on describing structural and functional classifications of DNA-binding proteins was used to validate and improve the approach proposed here. In the course of our study we defined a set of criteria and heuristics allowing us to automatically build a biologically meaningful classification and define classes of functionally related protein domains. It was shown that taking into consideration interactions between protein domains and DNA considerably improves the classification accuracy. Our approach provides a high-throughput and up-to-date annotation of DNA-binding protein families which can be found at http://spdc.sdsc.edu.

  17. Phylogenetic relationships between Arabidopsis and sugarcane bZIP transcriptional regulatory factors

    Directory of Open Access Journals (Sweden)

    Vincentz Michel

    2001-01-01

    Full Text Available We built a complete and non-redundant database of bZIP transcriptional regulatory factors from the Arabidopsis reference genome. These Arabidopsis bZIP factors were ordered into thirteen families of evolutionary related proteins and this classification was used to identify and organize sugarcane cDNAs encoding bZIP proteins. We also show how this classification should help in defining putative clusters of orthologous groups of higher plant bZIP regulators and briefly discuss the expected benefits of this procedure to efficiently characterize sugarcane bZIP transcriptional regulators.

  18. N-terminal segments modulate the α-helical propensities of the intrinsically disordered basic regions of bZIP proteins.

    Science.gov (United States)

    Das, Rahul K; Crick, Scott L; Pappu, Rohit V

    2012-02-17

    Basic region leucine zippers (bZIPs) are modular transcription factors that play key roles in eukaryotic gene regulation. The basic regions of bZIPs (bZIP-bRs) are necessary and sufficient for DNA binding and specificity. Bioinformatic predictions and spectroscopic studies suggest that unbound monomeric bZIP-bRs are uniformly disordered as isolated domains. Here, we test this assumption through a comparative characterization of conformational ensembles for 15 different bZIP-bRs using a combination of atomistic simulations and circular dichroism measurements. We find that bZIP-bRs have quantifiable preferences for α-helical conformations in their unbound monomeric forms. This helicity varies from one bZIP-bR to another despite a significant sequence similarity of the DNA binding motifs (DBMs). Our analysis reveals that intramolecular interactions between DBMs and eight-residue segments directly N-terminal to DBMs are the primary modulators of bZIP-bR helicities. We test the accuracy of this inference by designing chimeras of bZIP-bRs to have either increased or decreased overall helicities. Our results yield quantitative insights regarding the relationship between sequence and the degree of intrinsic disorder within bZIP-bRs, and might have general implications for other intrinsically disordered proteins. Understanding how natural sequence variations lead to modulation of disorder is likely to be important for understanding the evolution of specificity in molecular recognition through intrinsically disordered regions (IDRs). Copyright © 2011 Elsevier Ltd. All rights reserved.

  19. In vitro DNA binding studies of Aspartame, an artificial sweetener.

    Science.gov (United States)

    Kashanian, Soheila; Khodaei, Mohammad Mehdi; Kheirdoosh, Fahimeh

    2013-03-05

    A number of small molecules bind directly and selectively to DNA, by inhibiting replication, transcription or topoisomerase activity. In this work the interaction of native calf thymus DNA (CT-DNA) with Aspartame (APM), an artificial sweeteners was studied at physiological pH. DNA binding study of APM is useful to understand APM-DNA interaction mechanism and to provide guidance for the application and design of new and safer artificial sweeteners. The interaction was investigated using spectrophotometric, spectrofluorometric competition experiment and circular dichroism (CD). Hypochromism and red shift are shown in UV absorption band of APM. A strong fluorescence quenching reaction of DNA to APM was observed and the binding constants (Kf) of DNA with APM and corresponding number of binding sites (n) were calculated at different temperatures. Thermodynamic parameters, enthalpy changes (ΔH) and entropy changes (ΔS) were calculated to be +181kJmol(-1) and +681Jmol(-1)K(-1) according to Van't Hoff equation, which indicated that reaction is predominantly entropically driven. Moreover, spectrofluorometric competition experiment and circular dichroism (CD) results are indicative of non-intercalative DNA binding nature of APM. We suggest that APM interacts with calf thymus DNA via groove binding mode with an intrinsic binding constant of 5×10(+4)M(-1). Copyright © 2013 Elsevier B.V. All rights reserved.

  20. The interaction of membrane DNA-binding protein with DNA

    Science.gov (United States)

    Gabrielyan, A. G.; Arakhelyan, H. H.; Zakharyan, R. A.

    1994-07-01

    A 31-kDa protein specifically binding to double-stranded DNA (ds-DNA) was isolated from plasmatic membranes of rat liver cells by means of affinity chromatography and high performance liquid chromatography (HPLC). Some of the properties of this protein were determined. Judging by the UV and circular dichroism spectroscopic data, the protein forms a complex with DNA, stabilizing its native structure, mainly in the regions rich in AT pairs. The 31-kDa protein-pAO3 plasmid DNA binding constant was determined by nitrocellulose filter analysis of protein labelled DNA complexes. The results obtained correspond to cooperative binding with DNA molecules of extended interacting ligands, having AT specificity. A possible role of the 31-kDa protein in DNA transmembrane transition processes is discussed.

  1. Design of sequence-specific DNA-binding molecules.

    Science.gov (United States)

    Dervan, P B

    1986-04-25

    Base sequence information can be stored in the local structure of right-handed double-helical DNA (B-DNA). The question arises as to whether a set of rules for the three-dimensional readout of the B-DNA helix can be developed. This would allow the design of synthetic molecules that bind DNA of any specific sequence and site size. There are four stages of development for each new synthetic sequence-specific DNA-binding molecule: design, synthesis, testing for sequence specificity, and reevaluation of the design. This approach has produced bis(distamycin)fumaramide, a synthetic, crescent-shaped oligopeptide that binds nine contiguous adenine-thymine base pairs in the minor groove of double-helical DNA.

  2. Damage-specific DNA-binding proteins from human cells

    Energy Technology Data Exchange (ETDEWEB)

    Kanjilal, S.

    1992-01-01

    The primary objective of the study was to detect and characterize factors from human cells that bind DNA damaged by ultraviolet radiation. An application of the gel-shift assay was devised in which a DNA probe was UV-irradiated and compared with non-irradiated probe DNA for the ability to bind to such factors in cell extracts. UV-dose dependent binding proteins were identified. Formation of the DNA-protein complexes was independent of the specific sequence, form or source of the DNA. There was a marked preference for lesions on double stranded DNA over those on single stranded DNA. DNA irradiated with gamma rays did not compete with UV-irradiated DNA for the binding activities. Cell lines from patients with genetic diseases associated with disorders of the DNA repair system were screened for the presence of damaged-DNA-binding activities. Simultaneous occurrence of the clinical symptoms of some of these diseases had been previously documented and possible links between the syndromes proposed. However, supporting biochemical or molecular evidence for such associations were lacking. The data from the present investigations indicate that some cases of Xeroderma Pigmentosum group A, Cockayne's Syndrome, Bloom's Syndrome and Ataxia Telangiectasia, all of which exhibit sensitivity to UV or gamma radiation, share an aberrant damaged-DNA-binding factor. These findings support the hypothesis that some of the repair disorder diseases are closely related and may have arisen from a common defect. Partial purification of the binding activities from HeLa cells was achieved. Size-exclusion chromatography resolved the activities into various peaks, one of which was less damage-specific than the others as determined by competition studies using native or UV-irradiated DNA. Some of the activities were further separated by ion-exchange chromatography. On using affinity chromatography methods, the major damage-binding factor could be eluted in the presence of 2 M KCl and 1

  3. Stress sensing in plants by the ER stress sensor/transducer, bZIP28

    Directory of Open Access Journals (Sweden)

    Renu eSrivastava

    2014-02-01

    Full Text Available Two classes of ER stress sensors are known in plants, membrane associated bZIP transcription factors and RNA splicing factors. ER stress occurs under adverse environmental conditions and results from the accumulation of misfolded or unfolded proteins in the ER lumen. One of the membrane-associated transcription factors activated by heat and ER stress agents is bZIP28. In its inactive form, bZIP28 is a type II protein with a single pass transmembrane domain, residing in the ER. bZIP28’s N-terminus, containing a transcriptional activation domain, is oriented towards the cytoplasm and its C-terminal tail is inserted into the ER lumen. In response to stress, bZIP28 exits the ER and moves to the Golgi where it is proteolytically processed, liberating its cytosolic component which relocates to the nucleus to upregulate stress-response genes. bZIP28 is thought to sense stress through its interaction with the major ER chaperone, BIP. BiP binds to bZIP28’s lumenal domain under unstressed conditions and retains it in the ER. BIP binds to the intrinsically disordered regions on bZIP28’s lumen-facing tail. A truncated form of bZIP28, without its C-terminal tail is not retained in the ER but migrates constitutively to the nucleus. Upon stress, BiP releases bZIP28 allowing it to exit the ER. One model to account for the release of bZIP28 by BiP is that BiP is competed away from bZIP28 by the accumulation of misfolded proteins in the ER. However, other forces such as changes in energy charge levels, redox conditions or interaction with DNAJ proteins may also promote release of bZIP28 from BiP. Movement of bZIP28 from the ER to the Golgi is assisted by the interaction of elements of the COPII machinery with the cytoplasmic domain of bZIP28. Thus, the mobilization of bZIP28 in response to stress involves the dissociation of factors that retain it in the ER and the association of factors that mediate its further organelle-to-organelle movement.

  4. The human mitochondrial single-stranded DNA-binding protein displays distinct kinetics and thermodynamics of DNA binding and exchange.

    Science.gov (United States)

    Qian, Yufeng; Johnson, Kenneth A

    2017-08-04

    The human mitochondrial ssDNA-binding protein (mtSSB) is a homotetrameric protein, involved in mtDNA replication and maintenance. Although mtSSB is structurally similar to SSB from Escherichia coli (EcoSSB), it lacks the C-terminal disordered domain, and little is known about the biophysics of mtSSB-ssDNA interactions. Here, we characterized the kinetics and thermodynamics of mtSSB binding to ssDNA by equilibrium titrations and stopped-flow kinetic measurements. We show that the mtSSB tetramer can bind to ssDNA in two distinct binding modes: (SSB) 30 and (SSB) 60 , defined by DNA binding site sizes of 30 and 60 nucleotides, respectively. We found that the binding mode is modulated by magnesium ion and NaCl concentration, but unlike EcoSSB, the mtSSB does not show negative intersubunit cooperativity. Global fitting of both the equilibrium and kinetic data afforded estimates for the rate and equilibrium constants governing the formation of (SSB) 60 and (SSB) 30 complexes and for the transitions between the two binding modes. We found that the mtSSB tetramer binds to ssDNA with a rate constant near the diffusion limit (2 × 10 9 m -1 s -1 ) and that longer DNA (≥60 nucleotides) rapidly wraps around all four monomers, as revealed by FRET assays. We also show that the mtSSB tetramer can directly transfer from one ssDNA molecule to another via an intermediate with two DNA molecules bound to the mtSSB. In conclusion, our results indicate that human mtSSB shares many physicochemical properties with EcoSSB and that the differences may be explained by the lack of an acidic, disordered C-terminal tail in human mtSSB protein. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  5. Crystal structure of the mineralocorticoid receptor DNA binding domain in complex with DNA.

    Science.gov (United States)

    Hudson, William H; Youn, Christine; Ortlund, Eric A

    2014-01-01

    The steroid hormone receptors regulate important physiological functions such as reproduction, metabolism, immunity, and electrolyte balance. Mutations within steroid receptors result in endocrine disorders and can often drive cancer formation and progression. Despite the conserved three-dimensional structure shared among members of the steroid receptor family and their overlapping DNA binding preference, activation of individual steroid receptors drive unique effects on gene expression. Here, we present the first structure of the human mineralocorticoid receptor DNA binding domain, in complex with a canonical DNA response element. The overall structure is similar to the glucocorticoid receptor DNA binding domain, but small changes in the mode of DNA binding and lever arm conformation may begin to explain the differential effects on gene regulation by the mineralocorticoid and glucocorticoid receptors. In addition, we explore the structural effects of mineralocorticoid receptor DNA binding domain mutations found in type I pseudohypoaldosteronism and multiple types of cancer.

  6. The function of DNA binding protein nucleophosmin in AAV replication.

    Science.gov (United States)

    Satkunanathan, Stifani; Thorpe, Robin; Zhao, Yuan

    2017-10-01

    Adeno-associated viruses (AAV) contain minimal viral proteins necessary for their replication. During virus assembly, AAV acquire, inherently and submissively, various cellular proteins. Our previous studies identified the association of AAV vectors with the DNA binding protein nucleophosmin (NPM1). Nucleophosmin has been reported to enhance AAV infection by mobilizing AAV capsids into and out of the nucleolus, indicating the importance of NPM1 in the AAV life cycle; however the role of NPM1 in AAV production remains unknown. In this study, we systematically investigated NPM1 function on AAV production using NPM1 knockdown cells and revealing for the first time the presence of G-quadruplex DNA sequences (GQRS) in the AAV genome, the synergistic NPM1-GQRS function in AAV production and the significant enhancement of NPM1 gene knockdown on AAV vector production. Understanding the role of cellular proteins in the AAV life cycle will greatly facilitate high titre production of AAV vectors for clinical use. Crown Copyright © 2017. Published by Elsevier Inc. All rights reserved.

  7. Reprogramming of metabolism by the Arabidopsis thaliana bZIP11 transcription factor

    NARCIS (Netherlands)

    Ma, J.

    2012-01-01

    The Arabidopsis bZIP11 transcription factor is known to regulate amino acid metabolism, and transcriptomic analysis suggests that bZIP11 has a broader regulatory effects in metabolism. Moreover, sucrose controls its translation via its uORF and all the available evidences point to the fact that

  8. An Overview of the Prediction of Protein DNA-Binding Sites

    Directory of Open Access Journals (Sweden)

    Jingna Si

    2015-03-01

    Full Text Available Interactions between proteins and DNA play an important role in many essential biological processes such as DNA replication, transcription, splicing, and repair. The identification of amino acid residues involved in DNA-binding sites is critical for understanding the mechanism of these biological activities. In the last decade, numerous computational approaches have been developed to predict protein DNA-binding sites based on protein sequence and/or structural information, which play an important role in complementing experimental strategies. At this time, approaches can be divided into three categories: sequence-based DNA-binding site prediction, structure-based DNA-binding site prediction, and homology modeling and threading. In this article, we review existing research on computational methods to predict protein DNA-binding sites, which includes data sets, various residue sequence/structural features, machine learning methods for comparison and selection, evaluation methods, performance comparison of different tools, and future directions in protein DNA-binding site prediction. In particular, we detail the meta-analysis of protein DNA-binding sites. We also propose specific implications that are likely to result in novel prediction methods, increased performance, or practical applications.

  9. Identification of procollagen promoter DNA-binding proteins: effects of dexamethasone

    Energy Technology Data Exchange (ETDEWEB)

    Sweeney, C.; Cutroneo, K.R.

    1987-05-01

    Glucocorticoids selectively decrease procollagen synthesis by decreasing procollagen mRNA transcription. Dexamethasone coordinately decreased total cellular type I and type III procollagen mRNAs in mouse embryonic skin fibroblasts. Since sequence specific DNA-binding proteins are known to modulate eukaryotic gene expression the authors identified in mouse fibroblasts nuclear proteins which bind to types I and III procollagen promoter DNAs. Nuclear proteins were electrophoresed, blotted onto nitrocellulose and probed with /sup 32/P-end-labeled type I and type III procollagen promoter DNAs in the presence of equimolar amounts of /sup 32/P-end-labeled vector DNA. Differences in total DNA binding were noted by the densitometric scans of the nuclear proteins. Dexamethasone treatment enhanced total DNA binding. Increasing the NaCl concentration decreased the number of promoter DNA-binding proteins without altering the relative specificity for the promoter DNAs. Promoter DNA binding to nuclear proteins was also inhibited by increasing concentrations of E. coli DNA. The number of DNA-binding proteins was greater for type III procollagen promoter DNA. The effect of dexamethasone treatment on promoter DNA binding to nuclear proteins was determined.

  10. Roles of the human Rad51 L1 and L2 loops in DNA binding.

    Science.gov (United States)

    Matsuo, Yusuke; Sakane, Isao; Takizawa, Yoshimasa; Takahashi, Masayuki; Kurumizaka, Hitoshi

    2006-07-01

    The human Rad51 protein, a eukaryotic ortholog of the bacterial RecA protein, is a key enzyme that functions in homologous recombination and recombinational repair of double strand breaks. The Rad51 protein contains two flexible loops, L1 and L2, which are proposed to be sites for DNA binding, based on a structural comparison with RecA. In the present study, we performed mutational and fluorescent spectroscopic analyses on the L1 and L2 loops to examine their role in DNA binding. Gel retardation and DNA-dependent ATP hydrolysis measurements revealed that the substitution of the tyrosine residue at position 232 (Tyr232) within the L1 loop with alanine, a short side chain amino acid, significantly decreased the DNA-binding ability of human Rad51, without affecting the protein folding or the salt-induced, DNA-independent ATP hydrolysis. Even the conservative replacement with tryptophan affected the DNA binding, indicating that Tyr232 is involved in DNA binding. The importance of the L1 loop was confirmed by the fluorescence change of a tryptophan residue, replacing the Asp231, Ser233, or Gly236 residue, upon DNA binding. The alanine replacement of phenylalanine at position 279 (Phe279) within the L2 loop did not affect the DNA-binding ability of human Rad51, unlike the Phe203 mutation of the RecA L2 loop. The Phe279 side chain may not be directly involved in the interaction with DNA. However, the fluorescence intensity of the tryptophan replacing the Rad51-Phe279 residue was strongly reduced upon DNA binding, indicating that the L2 loop is also close to the DNA-binding site.

  11. Identification and characterization of the bZIP transcription factor involved in zinc homeostasis in cereals.

    Science.gov (United States)

    Henriques, A R; Farias, D da R; Costa de Oliveira, A

    2017-06-29

    Members of the basic leucine zipper family, as bZIP19, are considered to be essential regulators of the adaptation to zinc deficiency. Knowing that this gene as well as its targets are conserved in the plant kingdom, we followed an in silico approach to identify and characterize the bzip19 gene in cereals. Through BLASTp in Phytozome database, 33 bzip19 genes were identified on the genomes of Oryza sativa, Sorghum bicolor, Zea mays, Glycine max, Triticum aestivum, and Brachypodium distachyon. The analysis of conserved motifs and bZIP domains was performed using MEME and PFAM databases. In 25 of these genes, CysHis-motifs at the basic N-terminal region were found. This motif is conserved in group bZIP and suggested to play a role as a Zn-sensor. Regarding their phylogeny, it was possible to infer orthologous groups and explore the evolutionary relationship between these BZIP19 proteins. Data mining allowed us to select eight putative orthologous whose expression profile was analyzed under stress conditions in the Genevestigator platform. The comparison between the expression profiles of these eight putative orthologous and the original Arabidopsis bzip19 also seems to indicate conserved transcriptional regulation. Thus, considering that modified expression of bZIP19 genes has already been confirmed as an efficient tool to improve Arabidopsis tolerance to Zn deficiency, and that these new bZIP orthologous have a high level of conservation when compared to the original bZIP19 sequence, they can be useful for the development of tolerant crops enabling plants to grow in areas of low zinc bioavailability.

  12. Evaluation of a Solid Phase DNA Binding Matrix for Downstream PCR Analysis

    National Research Council Canada - National Science Library

    Bader, Douglas E; Fisher, Glen R; Stratilo, Chad W

    2005-01-01

    A commercially available solid-phase DNA binding matrix (FTA cards) was evaluated for its ability to capture and release DNA for downstream gene amplification and detection assays using polymerase chain reaction (PCR...

  13. Adsorption of DNA binding proteins to functionalized carbon nanotube surfaces with and without DNA wrapping.

    Science.gov (United States)

    Ishibashi, Yu; Oura, Shusuke; Umemura, Kazuo

    2017-09-01

    We examined the adsorption of DNA binding proteins on functionalized, single-walled carbon nanotubes (SWNTs). When SWNTs were functionalized with polyethylene glycol (PEG-SWNT), moderate adsorption of protein molecules was observed. In contrast, nanotubes functionalized with CONH 2 groups (CONH 2 -SWNT) exhibited very strong interactions between the CONH 2 -SWNT and DNA binding proteins. Instead, when these SWNT surfaces were wrapped with DNA molecules (thymine 30-mers), protein binding was a little decreased. Our results revealed that DNA wrapped PEG-SWNT was one of the most promising candidates to realize DNA nanodevices involving protein reactions on DNA-SWNT surfaces. In addition, the DNA binding protein RecA was more adhesive than single-stranded DNA binding proteins to the functionalized SWNT surfaces.

  14. Methylated DNA-binding protein is present in various mammalian cell types

    Energy Technology Data Exchange (ETDEWEB)

    Supakar, P.C.; Weist, D.; Zhang, D.; Inamdar, N.; Zhang, Xianyang; Khan, R.; Ehrlich, M. (Tulane Medical School, New Orleans, LA (USA)); Ehrlich, K.C. (Department of Agriculture, New Orleans, LA (USA))

    1988-08-25

    A DNA-binding protein from human placenta, methylated DNA-binding protein (MDBP), binds to certain DNA sequences only when they contain 5-methylcytosine (m{sup 5}C) residues at specific positions. The authors found a very similar DNA-binding activity in nuclear extracts of rat tissues, calf thymus, human embryonal carcinoma cells, HeLa cells, and mouse LTK cells. Like human placental MDBP, the analogous DNA-binding proteins from the above mammalian cell lines formed a number of different low-electrophoretic-mobility complexes with a 14-bp MDBP-specific oligonucleotide duplex. All of these complexes exhibited the same DNA methylation specificity and DNA sequence specificity. Although MDBP activity was found in various mammalian cell types, it was not detected in extracts of cultured mosquito cells and so may be associated only with cells with vertebrate-type DNA methylation.

  15. Identification of DNA-binding proteins using support vector machines and evolutionary profiles

    Directory of Open Access Journals (Sweden)

    Gromiha Michael M

    2007-11-01

    Full Text Available Abstract Background Identification of DNA-binding proteins is one of the major challenges in the field of genome annotation, as these proteins play a crucial role in gene-regulation. In this paper, we developed various SVM modules for predicting DNA-binding domains and proteins. All models were trained and tested on multiple datasets of non-redundant proteins. Results SVM models have been developed on DNAaset, which consists of 1153 DNA-binding and equal number of non DNA-binding proteins, and achieved the maximum accuracy of 72.42% and 71.59% using amino acid and dipeptide compositions, respectively. The performance of SVM model improved from 72.42% to 74.22%, when evolutionary information in form of PSSM profiles was used as input instead of amino acid composition. In addition, SVM models have been developed on DNAset, which consists of 146 DNA-binding and 250 non-binding chains/domains, and achieved the maximum accuracy of 79.80% and 86.62% using amino acid composition and PSSM profiles. The SVM models developed in this study perform better than existing methods on a blind dataset. Conclusion A highly accurate method has been developed for predicting DNA-binding proteins using SVM and PSSM profiles. This is the first study in which evolutionary information in form of PSSM profiles has been used successfully for predicting DNA-binding proteins. A web-server DNAbinder has been developed for identifying DNA-binding proteins and domains from query amino acid sequences http://www.imtech.res.in/raghava/dnabinder/.

  16. Identification of a Second DNA Binding Site in the Human Rad52 Protein*S⃞

    OpenAIRE

    Kagawa, Wataru; Kagawa, Ako; Saito, Kengo; Ikawa, Shukuko; Shibata, Takehiko; Kurumizaka, Hitoshi; Yokoyama, Shigeyuki

    2008-01-01

    Rad52 plays essential roles in homology-dependent double-strand break repair. Various studies have established the functions of Rad52 in Rad51-dependent and Rad51-independent repair processes. However, the precise molecular mechanisms of Rad52 in these processes remain unknown. In the present study we have identified a novel DNA binding site within Rad52 by a structure-based alanine scan mutagenesis. This site is closely aligned with the putative single-stranded DNA binding ...

  17. bZIPDB: a database of regulatory information for human bZIP transcription factors.

    Science.gov (United States)

    Ryu, Taewoo; Jung, Juhyun; Lee, Sunjae; Nam, Ho Jung; Hong, Sun Woo; Yoo, Jae Wook; Lee, Dong-ki; Lee, Doheon

    2007-05-30

    Basic region-leucine zipper (bZIP) proteins are a class of transcription factors (TFs) that play diverse roles in eukaryotes. Malfunctions in these proteins lead to cancer and various other diseases. For detailed characterization of these TFs, further public resources are required. We constructed a database, designated bZIPDB, containing information on 49 human bZIP TFs, by means of automated literature collection and manual curation. bZIPDB aims to provide public data required for deciphering the gene regulatory network of the human bZIP family, e.g., evaluation or reference information for the identification of regulatory modules. The resources provided by bZIPDB include (1) protein interaction data including direct binding, phosphorylation and functional associations between bZIP TFs and other cellular proteins, along with other types of interactions, (2) bZIP TF-target gene relationships, (3) the cellular network of bZIP TFs in particular cell lines, and (4) gene information and ontology. In the current version of the database, 721 protein interactions and 560 TF-target gene relationships are recorded. bZIPDB is annually updated for the newly discovered information. bZIPDB is a repository of detailed regulatory information for human bZIP TFs that is collected and processed from the literature, designed to facilitate analysis of this protein family. bZIPDB is available for public use at http://biosoft.kaist.ac.kr/bzipdb.

  18. Mapping arm-DNA-binding domain interactions in AraC.

    Science.gov (United States)

    Wu, M; Schleif, R

    2001-04-06

    AraC protein, the regulator of the l-arabinose operon in Escherichia coli has been postulated to function by a light switch mechanism. According to this mechanism, it should be possible to find mutations in the DNA-binding domain of AraC that result in weaker arm-DNA-binding domain interactions and which make the protein constitutive, that is, it no longer requires arabinose to activate transcription. We isolated such mutations by randomizing three contiguous leucine residues in the DNA-binding domain, and then by systematically scanning surface residues of the DNA-binding domain with alanine and glutamic acid. As a result, a total of 20 constitutive mutations were found at ten different positions. They form a contiguous trail on the DNA-distal face of the DNA-binding domain, and likely define the region where the N-terminal arm that extends from the N-terminal dimerization domain contacts the C-terminal DNA-binding domain. Copyright 2001 Academic Press.

  19. [Design of artificial DNA binding proteins toward control and elucidation of cellular functions].

    Science.gov (United States)

    Imanishi, Miki

    2012-01-01

    An artificial transcription factor that can regulate the expression of specific genes at a desired time is very useful for research in chemical biology, cell biology, and future gene therapy. A C2H2 zinc finger motif, one of zinc-containing proteins, is known as the most ubiquitous DNA binding motif. The motif is attractive for designing artificial transcription factors with desired DNA binding specificities because of its characteristic DNA binding properties: (1) recognition of 3 bp per motif, (2) tandemly connected modular structure, and (3) binding to non-palindrome sequences as a monomer. Taking advantage of these properties, artificial DNA binding proteins with new DNA binding characteristics have been designed. By changing the linker region between two 3-zinc finger domains, artificial 6-zinc finger proteins were developed and shown to skip DNA sequences. Zinc-responsive transcription factors were created by altering one of the zinc ligands. An artificial zinc finger transcription factor targeting a core clock gene induced phase shifts of the cellular "circadian rhythm". Herein, I will summarize creation and function of the above-mentioned artificial zinc finger-type DNA binding proteins and transcription factors.

  20. Genome-Wide Motif Statistics are Shaped by DNA Binding Proteins over Evolutionary Time Scales

    Directory of Open Access Journals (Sweden)

    Long Qian

    2016-10-01

    Full Text Available The composition of a genome with respect to all possible short DNA motifs impacts the ability of DNA binding proteins to locate and bind their target sites. Since nonfunctional DNA binding can be detrimental to cellular functions and ultimately to organismal fitness, organisms could benefit from reducing the number of nonfunctional DNA binding sites genome wide. Using in vitro measurements of binding affinities for a large collection of DNA binding proteins, in multiple species, we detect a significant global avoidance of weak binding sites in genomes. We demonstrate that the underlying evolutionary process leaves a distinct genomic hallmark in that similar words have correlated frequencies, a signal that we detect in all species across domains of life. We consider the possibility that natural selection against weak binding sites contributes to this process, and using an evolutionary model we show that the strength of selection needed to maintain global word compositions is on the order of point mutation rates. Likewise, we show that evolutionary mechanisms based on interference of protein-DNA binding with replication and mutational repair processes could yield similar results and operate with similar rates. On the basis of these modeling and bioinformatic results, we conclude that genome-wide word compositions have been molded by DNA binding proteins acting through tiny evolutionary steps over time scales spanning millions of generations.

  1. The identification of FANCD2 DNA binding domains reveals nuclear localization sequences.

    Science.gov (United States)

    Niraj, Joshi; Caron, Marie-Christine; Drapeau, Karine; Bérubé, Stéphanie; Guitton-Sert, Laure; Coulombe, Yan; Couturier, Anthony M; Masson, Jean-Yves

    2017-08-21

    Fanconi anemia (FA) is a recessive genetic disorder characterized by congenital abnormalities, progressive bone-marrow failure, and cancer susceptibility. The FA pathway consists of at least 21 FANC genes (FANCA-FANCV), and the encoded protein products interact in a common cellular pathway to gain resistance against DNA interstrand crosslinks. After DNA damage, FANCD2 is monoubiquitinated and accumulates on chromatin. FANCD2 plays a central role in the FA pathway, using yet unidentified DNA binding regions. By using synthetic peptide mapping and DNA binding screen by electromobility shift assays, we found that FANCD2 bears two major DNA binding domains predominantly consisting of evolutionary conserved lysine residues. Furthermore, one domain at the N-terminus of FANCD2 bears also nuclear localization sequences for the protein. Mutations in the bifunctional DNA binding/NLS domain lead to a reduction in FANCD2 monoubiquitination and increase in mitomycin C sensitivity. Such phenotypes are not fully rescued by fusion with an heterologous NLS, which enable separation of DNA binding and nuclear import functions within this domain that are necessary for FANCD2 functions. Collectively, our results enlighten the importance of DNA binding and NLS residues in FANCD2 to activate an efficient FA pathway. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  2. Characterization and DNA-binding specificities of Ralstonia TAL-like effectors

    KAUST Repository

    Li, Lixin

    2013-07-01

    Transcription activator-like effectors (TALEs) from Xanthomonas sp. have been used as customizable DNA-binding modules for genome-engineering applications. Ralstonia solanacearum TALE-like proteins (RTLs) exhibit similar structural features to TALEs, including a central DNA-binding domain composed of 35 amino acid-long repeats. Here, we characterize the RTLs and show that they localize in the plant cell nucleus, mediate DNA binding, and might function as transcriptional activators. RTLs have a unique DNA-binding architecture and are enriched in repeat variable di-residues (RVDs), which determine repeat DNA-binding specificities. We determined the DNA-binding specificities for the RVD sequences ND, HN, NP, and NT. The RVD ND mediates highly specific interactions with C nucleotide, HN interacts specifically with A and G nucleotides, and NP binds to C, A, and G nucleotides. Moreover, we developed a highly efficient repeat assembly approach for engineering RTL effectors. Taken together, our data demonstrate that RTLs are unique DNA-targeting modules that are excellent alternatives to be tailored to bind to user-selected DNA sequences for targeted genomic and epigenomic modifications. These findings will facilitate research concerning RTL molecular biology and RTL roles in the pathogenicity of Ralstonia spp. © 2013 The Author.

  3. MOCCS: Clarifying DNA-binding motif ambiguity using ChIP-Seq data.

    Science.gov (United States)

    Ozaki, Haruka; Iwasaki, Wataru

    2016-08-01

    As a key mechanism of gene regulation, transcription factors (TFs) bind to DNA by recognizing specific short sequence patterns that are called DNA-binding motifs. A single TF can accept ambiguity within its DNA-binding motifs, which comprise both canonical (typical) and non-canonical motifs. Clarification of such DNA-binding motif ambiguity is crucial for revealing gene regulatory networks and evaluating mutations in cis-regulatory elements. Although chromatin immunoprecipitation sequencing (ChIP-seq) now provides abundant data on the genomic sequences to which a given TF binds, existing motif discovery methods are unable to directly answer whether a given TF can bind to a specific DNA-binding motif. Here, we report a method for clarifying the DNA-binding motif ambiguity, MOCCS. Given ChIP-Seq data of any TF, MOCCS comprehensively analyzes and describes every k-mer to which that TF binds. Analysis of simulated datasets revealed that MOCCS is applicable to various ChIP-Seq datasets, requiring only a few minutes per dataset. Application to the ENCODE ChIP-Seq datasets proved that MOCCS directly evaluates whether a given TF binds to each DNA-binding motif, even if known position weight matrix models do not provide sufficient information on DNA-binding motif ambiguity. Furthermore, users are not required to provide numerous parameters or background genomic sequence models that are typically unavailable. MOCCS is implemented in Perl and R and is freely available via https://github.com/yuifu/moccs. By complementing existing motif-discovery software, MOCCS will contribute to the basic understanding of how the genome controls diverse cellular processes via DNA-protein interactions. Copyright © 2016 Elsevier Ltd. All rights reserved.

  4. Functional characterization of the Arabidopsis transcription factor bZIP29 reveals its role in leaf and root development.

    Science.gov (United States)

    Van Leene, Jelle; Blomme, Jonas; Kulkarni, Shubhada R; Cannoot, Bernard; De Winne, Nancy; Eeckhout, Dominique; Persiau, Geert; Van De Slijke, Eveline; Vercruysse, Leen; Vanden Bossche, Robin; Heyndrickx, Ken S; Vanneste, Steffen; Goossens, Alain; Gevaert, Kris; Vandepoele, Klaas; Gonzalez, Nathalie; Inzé, Dirk; De Jaeger, Geert

    2016-10-01

    Plant bZIP group I transcription factors have been reported mainly for their role during vascular development and osmosensory responses. Interestingly, bZIP29 has been identified in a cell cycle interactome, indicating additional functions of bZIP29 in plant development. Here, bZIP29 was functionally characterized to study its role during plant development. It is not present in vascular tissue but is specifically expressed in proliferative tissues. Genome-wide mapping of bZIP29 target genes confirmed its role in stress and osmosensory responses, but also identified specific binding to several core cell cycle genes and to genes involved in cell wall organization. bZIP29 protein complex analyses validated interaction with other bZIP group I members and provided insight into regulatory mechanisms acting on bZIP dimers. In agreement with bZIP29 expression in proliferative tissues and with its binding to promoters of cell cycle regulators, dominant-negative repression of bZIP29 altered the cell number in leaves and in the root meristem. A transcriptome analysis on the root meristem, however, indicated that bZIP29 might regulate cell number through control of cell wall organization. Finally, ectopic dominant-negative repression of bZIP29 and redundant factors led to a seedling-lethal phenotype, pointing to essential roles for bZIP group I factors early in plant development. © The Author 2016. Published by Oxford University Press on behalf of the Society for Experimental Biology.

  5. Artificial zinc finger DNA binding domains: versatile tools for genome engineering and modulation of gene expression.

    Science.gov (United States)

    Hossain, Mir A; Barrow, Joeva J; Shen, Yong; Haq, Md Imdadul; Bungert, Jörg

    2015-11-01

    Genome editing and alteration of gene expression by synthetic DNA binding activities gained a lot of momentum over the last decade. This is due to the development of new DNA binding molecules with enhanced binding specificity. The most commonly used DNA binding modules are zinc fingers (ZFs), TALE-domains, and the RNA component of the CRISPR/Cas9 system. These binding modules are fused or linked to either nucleases that cut the DNA and induce DNA repair processes, or to protein domains that activate or repress transcription of genes close to the targeted site in the genome. This review focuses on the structure, design, and applications of ZF DNA binding domains (ZFDBDs). ZFDBDs are relatively small and have been shown to penetrate the cell membrane without additional tags suggesting that they could be delivered to cells without a DNA or RNA intermediate. Advanced algorithms that are based on extensive knowledge of the mode of ZF/DNA interactions are used to design the amino acid composition of ZFDBDs so that they bind to unique sites in the genome. Off-target binding has been a concern for all synthetic DNA binding molecules. Thus, increasing the specificity and affinity of ZFDBDs will have a significant impact on their use in analytical or therapeutic settings. © 2015 Wiley Periodicals, Inc.

  6. Zinc-regulated DNA binding of the yeast Zap1 zinc-responsive activator.

    Directory of Open Access Journals (Sweden)

    Avery G Frey

    Full Text Available The Zap1 transcription factor of Saccharomyces cerevisiae plays a central role in zinc homeostasis by controlling the expression of genes involved in zinc metabolism. Zap1 is active in zinc-limited cells and repressed in replete cells. At the transcriptional level, Zap1 controls its own expression via positive autoregulation. In addition, Zap1's two activation domains are regulated independently of each other by zinc binding directly to those regions and repressing activation function. In this report, we show that Zap1 DNA binding is also inhibited by zinc. DMS footprinting showed that Zap1 target gene promoter occupancy is regulated with or without transcriptional autoregulation. These results were confirmed using chromatin immunoprecipitation. Zinc regulation of DNA binding activity mapped to the DNA binding domain indicating other parts of Zap1 are unnecessary for this control. Overexpression of Zap1 overrode DNA binding regulation and resulted in constitutive promoter occupancy. Under these conditions of constitutive binding, both the zinc dose response of Zap1 activity and cellular zinc accumulation were altered suggesting the importance of DNA binding control to zinc homeostasis. Thus, our results indicated that zinc regulates Zap1 activity post-translationally via three independent mechanisms, all of which contribute to the overall zinc responsiveness of Zap1.

  7. Zinc-Regulated DNA Binding of the Yeast Zap1 Zinc-Responsive Activator

    Science.gov (United States)

    Frey, Avery G.; Bird, Amanda J.; Evans-Galea, Marguerite V.; Blankman, Elizabeth; Winge, Dennis R.; Eide, David J.

    2011-01-01

    The Zap1 transcription factor of Saccharomyces cerevisiae plays a central role in zinc homeostasis by controlling the expression of genes involved in zinc metabolism. Zap1 is active in zinc-limited cells and repressed in replete cells. At the transcriptional level, Zap1 controls its own expression via positive autoregulation. In addition, Zap1's two activation domains are regulated independently of each other by zinc binding directly to those regions and repressing activation function. In this report, we show that Zap1 DNA binding is also inhibited by zinc. DMS footprinting showed that Zap1 target gene promoter occupancy is regulated with or without transcriptional autoregulation. These results were confirmed using chromatin immunoprecipitation. Zinc regulation of DNA binding activity mapped to the DNA binding domain indicating other parts of Zap1 are unnecessary for this control. Overexpression of Zap1 overrode DNA binding regulation and resulted in constitutive promoter occupancy. Under these conditions of constitutive binding, both the zinc dose response of Zap1 activity and cellular zinc accumulation were altered suggesting the importance of DNA binding control to zinc homeostasis. Thus, our results indicated that zinc regulates Zap1 activity post-translationally via three independent mechanisms, all of which contribute to the overall zinc responsiveness of Zap1. PMID:21799889

  8. DNA binding by the plant-specific NAC transcription factors in crystal and solution

    DEFF Research Database (Denmark)

    Welner, Ditte Hededam; Lindemose, Søren; Grossmann, J. Günter

    2012-01-01

    angle X-ray scattering on complexes with oligonucleotides, mutagenesis and (DNase I and uranyl photo-) footprinting, is combined to form a structural view of DNA-binding, and for the first time provide experimental evidence for the speculated relationship between plant-specific NAC proteins, WRKY....... The structure of the DNA-binding NAC domain of ANAC019 has previously been determined by X-ray crystallography, revealing a dimeric and predominantly ß-fold structure, but the mode of binding to cognate DNA has remained elusive. In the present study, information from low resolution X-ray structures and small...... transcription factors and the mammalian GCM (Glial cell missing) transcription factors, which all use a ß-strand motif for DNA-binding. The structure shows that the NAC domain inserts the edge of its core ß-sheet into the major groove, while leaving the DNA largely undistorted. The structure of the NAC-DNA...

  9. HMMBinder: DNA-Binding Protein Prediction Using HMM Profile Based Features

    Directory of Open Access Journals (Sweden)

    Rianon Zaman

    2017-01-01

    Full Text Available DNA-binding proteins often play important role in various processes within the cell. Over the last decade, a wide range of classification algorithms and feature extraction techniques have been used to solve this problem. In this paper, we propose a novel DNA-binding protein prediction method called HMMBinder. HMMBinder uses monogram and bigram features extracted from the HMM profiles of the protein sequences. To the best of our knowledge, this is the first application of HMM profile based features for the DNA-binding protein prediction problem. We applied Support Vector Machines (SVM as a classification technique in HMMBinder. Our method was tested on standard benchmark datasets. We experimentally show that our method outperforms the state-of-the-art methods found in the literature.

  10. Analysis and classification of DNA-binding sites in single-stranded and double-stranded DNA-binding proteins using protein information.

    Science.gov (United States)

    Wang, Wei; Liu, Juan; Xiong, Yi; Zhu, Lida; Zhou, Xionghui

    2014-08-01

    Single-stranded DNA-binding proteins (SSBs) and double-stranded DNA-binding proteins (DSBs) play different roles in biological processes when they bind to single-stranded DNA (ssDNA) or double-stranded DNA (dsDNA). However, the underlying binding mechanisms of SSBs and DSBs have not yet been fully understood. Here, the authors firstly constructed two groups of ssDNA and dsDNA specific binding sites from two non-redundant sets of SSBs and DSBs. They further analysed the relationship between the two classes of binding sites and a newly proposed set of features (residue charge distribution, secondary structure and spatial shape). To assess and utilise the predictive power of these features, they trained a classification model using support vector machine to make predictions about the ssDNA and the dsDNA binding sites. The author's analysis and prediction results indicated that the two classes of binding sites can be distinguishable by the three types of features, and the final classifier using all the features achieved satisfactory performance. In conclusion, the proposed features will deepen their understanding of the specificity of proteins which bind to ssDNA or dsDNA.

  11. Predicting target DNA sequences of DNA-binding proteins based on unbound structures.

    Directory of Open Access Journals (Sweden)

    Chien-Yu Chen

    Full Text Available DNA-binding proteins such as transcription factors use DNA-binding domains (DBDs to bind to specific sequences in the genome to initiate many important biological functions. Accurate prediction of such target sequences, often represented by position weight matrices (PWMs, is an important step to understand many biological processes. Recent studies have shown that knowledge-based potential functions can be applied on protein-DNA co-crystallized structures to generate PWMs that are considerably consistent with experimental data. However, this success has not been extended to DNA-binding proteins lacking co-crystallized structures. This study aims at investigating the possibility of predicting the DNA sequences bound by DNA-binding proteins from the proteins' unbound structures (structures of the unbound state. Given an unbound query protein and a template complex, the proposed method first employs structure alignment to generate synthetic protein-DNA complexes for the query protein. Once a complex is available, an atomic-level knowledge-based potential function is employed to predict PWMs characterizing the sequences to which the query protein can bind. The evaluation of the proposed method is based on seven DNA-binding proteins, which have structures of both DNA-bound and unbound forms for prediction as well as annotated PWMs for validation. Since this work is the first attempt to predict target sequences of DNA-binding proteins from their unbound structures, three types of structural variations that presumably influence the prediction accuracy were examined and discussed. Based on the analyses conducted in this study, the conformational change of proteins upon binding DNA was shown to be the key factor. This study sheds light on the challenge of predicting the target DNA sequences of a protein lacking co-crystallized structures, which encourages more efforts on the structure alignment-based approaches in addition to docking- and homology

  12. nDNA-Prot: identification of DNA-binding proteins based on unbalanced classification.

    Science.gov (United States)

    Song, Li; Li, Dapeng; Zeng, Xiangxiang; Wu, Yunfeng; Guo, Li; Zou, Quan

    2014-09-08

    DNA-binding proteins are vital for the study of cellular processes. In recent genome engineering studies, the identification of proteins with certain functions has become increasingly important and needs to be performed rapidly and efficiently. In previous years, several approaches have been developed to improve the identification of DNA-binding proteins. However, the currently available resources are insufficient to accurately identify these proteins. Because of this, the previous research has been limited by the relatively unbalanced accuracy rate and the low identification success of the current methods. In this paper, we explored the practicality of modelling DNA binding identification and simultaneously employed an ensemble classifier, and a new predictor (nDNA-Prot) was designed. The presented framework is comprised of two stages: a 188-dimension feature extraction method to obtain the protein structure and an ensemble classifier designated as imDC. Experiments using different datasets showed that our method is more successful than the traditional methods in identifying DNA-binding proteins. The identification was conducted using a feature that selected the minimum Redundancy and Maximum Relevance (mRMR). An accuracy rate of 95.80% and an Area Under the Curve (AUC) value of 0.986 were obtained in a cross validation. A test dataset was tested in our method and resulted in an 86% accuracy, versus a 76% using iDNA-Prot and a 68% accuracy using DNA-Prot. Our method can help to accurately identify DNA-binding proteins, and the web server is accessible at http://datamining.xmu.edu.cn/~songli/nDNA. In addition, we also predicted possible DNA-binding protein sequences in all of the sequences from the UniProtKB/Swiss-Prot database.

  13. Human T-cell leukemia virus type 1 bZIP factor selectively suppresses the classical pathway of NF-kappaB.

    Science.gov (United States)

    Zhao, Tiejun; Yasunaga, Jun-ichirou; Satou, Yorifumi; Nakao, Mitsuyoshi; Takahashi, Masahiko; Fujii, Masahiro; Matsuoka, Masao

    2009-03-19

    Adult T-cell leukemia (ATL) is a highly aggressive T-cell malignancy caused by human T-cell leukemia virus type 1 (HTLV-1). The activation of NF-kappaB by Tax has been reported to play a crucial role in HTLV-1-induced transformation. The HTLV-1 bZIP factor (HBZ), which is encoded by an mRNA of the opposite polarity of the viral genomic RNA, is involved in both T cell proliferation and suppression of Tax-mediated viral gene transcription, suggesting that HBZ cooperates closely with Tax. In the present study, we observed that HBZ specifically suppressed NF-kappaB-driven transcription mediated by p65 (the classical pathway) without inhibiting the alternative NF-kappaB signaling pathway. In an immunoprecipitation assay, HBZ bound to p65 and diminished the DNA binding capacity of p65. In addition, HBZ induced p65 degradation through increasing the expression of the PDLIM2 gene, which encodes a ubiquitin E3 ligase for p65. Finally, HBZ actually repressed the transcription of some classical NF-kappaB target genes, such as IL-8, IL2RA, IRF4, VCAM-1, and VEGF. Selective suppression of the classical NF-kappaB pathway by HBZ renders the alternative NF-kappaB pathway predominant after activation of NF-kappaB by Tax or other stimuli, which might be critical for oncogenesis.

  14. Binding mode and affinity studies of DNA-binding agents using topoisomerase I DNA unwinding assay.

    Science.gov (United States)

    McKnight, Ruel E; Gleason, Aaron B; Keyes, James A; Sahabi, Sadia

    2007-02-15

    A topoisomerase I DNA unwinding assay has been used to determine the relative DNA-binding affinities of a model pair of homologous naphthalene diimides. Binding affinity data were corroborated using calorimetric (ITC) and spectrophotometric (titration and T(m)) studies, with substituent size playing a significant role in binding. The assay was also used to investigate the mode of binding adopted by several known DNA-binding agents, including SYBR Green and PicoGreen. Some of the compounds exhibited unexpected binding modes.

  15. DNA-binding polarity of human replication protein A positions nucleases in nucleotide excision repair

    NARCIS (Netherlands)

    W.L. de Laat (Wouter); E. Appeldoorn (Esther); K. Sugasawa (Kaoru); E.P.W.C. Weterings (Eric); J.H.J. Hoeijmakers (Jan); N.G.J. Jaspers (Nicolaas)

    1998-01-01

    textabstractThe human single-stranded DNA-binding replication A protein (RPA) is involved in various DNA-processing events. By comparing the affinity of hRPA for artificial DNA hairpin structures with 3'- or 5'-protruding single-stranded arms, we found that hRPA binds ssDNA with a

  16. Synthesis, DNA Binding, and Antiproliferative Activity of Novel Acridine-Thiosemicarbazone Derivatives

    Science.gov (United States)

    de Almeida, Sinara Mônica Vitalino; Lafayette, Elizabeth Almeida; Gomes da Silva, Lúcia Patrícia Bezerra; Amorim, Cézar Augusto da Cruz; de Oliveira, Tiago Bento; Gois Ruiz, Ana Lucia Tasca; de Carvalho, João Ernesto; de Moura, Ricardo Olímpio; Beltrão, Eduardo Isidoro Carneiro; de Lima, Maria do Carmo Alves; de Carvalho Júnior, Luiz Bezerra

    2015-01-01

    In this work, the acridine nucleus was used as a lead-compound for structural modification by adding different substituted thiosemicarbazide moieties. Eight new (Z)-2-(acridin-9-ylmethylene)-N-phenylhydrazinecarbothioamide derivatives (3a–h) were synthesized, their antiproliferative activities were evaluated, and DNA binding properties were performed with calf thymus DNA (ctDNA) by electronic absorption and fluorescence spectroscopies. Both hyperchromic and hypochromic effects, as well as red or blue shifts were demonstrated by addition of ctDNA to the derivatives. The calculated binding constants ranged from 1.74 × 104 to 1.0 × 106 M−1 and quenching constants from −0.2 × 104 to 2.18 × 104 M−1 indicating high affinity to ctDNA base pairs. The most efficient compound in binding to ctDNA in vitro was (Z)-2-(acridin-9-ylmethylene)-N-(4-chlorophenyl) hydrazinecarbothioamide (3f), while the most active compound in antiproliferative assay was (Z)-2-(acridin-9-ylmethylene)-N-phenylhydrazinecarbothioamide (3a). There was no correlation between DNA-binding and in vitro antiproliferative activity, but the results suggest that DNA binding can be involved in the biological activity mechanism. This study may guide the choice of the size and shape of the intercalating part of the ligand and the strategic selection of substituents that increase DNA-binding or antiproliferative properties. PMID:26068233

  17. Regulation of DNA Metabolism by DNA-Binding Proteins Probed by Single Molecule Spectroscopy

    Science.gov (United States)

    2006-12-05

    Recent advances in single - molecule force spectroscopy of DNA make it possible to study the thermodynamics and kinetics of DNA binding proteins under...to transient single-stranded DNA regions due to thermal fluctuations. The model is used to analyze recent single - molecule spectroscopy data of this system.

  18. CRITERIA FOR AN UPDATED CLASSIFICATION OF HUMAN TRANSCRIPTION FACTOR DNA-BINDING DOMAINS

    NARCIS (Netherlands)

    Wingender, Edgar

    By binding to cis-regulatory elements in a sequence-specific manner, transcription factors regulate the activity of nearby genes. Here, we discuss the criteria for a comprehensive classification of human TFs based on their DNA-binding domains. In particular, classification of basic leucine zipper

  19. DNA binding and cleavage activity by a mononuclear iron (II) Schiff ...

    Indian Academy of Sciences (India)

    DNA binding and cleavage activity by a mononuclear iron(II)Schiff base complex: Synthesis and structural characterization. Abhijit Pal Bhaskar Biswas Merry Mitra Subramaniyam Rajalakshmi Chandra Shekhar Purohit Soumitra Hazra Gopinatha Suresh Kumar Balachandran Unni Nair Rajarshi Ghosh. Volume 125 Issue 5 ...

  20. New non detrimental DNA binding mutants of the Escherichia coli initiator protein DnaA

    DEFF Research Database (Denmark)

    Asklund, Marlene; Atlung, Tove

    2004-01-01

    gave rise to 30 single amino acid substitutions and, including double substitutions, more than 100 mutants functional in initiation of chromosome replication were characterized. The analysis indicated that all regions of the DNA-binding domain are involved in DNA binding, but the most important amino......The initiator protein DnaA has several unique DNA-binding features. It binds with high affinity as a monomer to the nonamer DnaA box. In the ATP form, DnaA binds cooperatively to the low-affinity ATP-DnaA boxes, and to single-stranded DNA in the 13mer region of the origin. We have carried out...... an extensive mutational analysis of the DNA-binding domain of the Escherichia coli DnaA protein using mutagenic PCR. We analyzed mutants exhibiting more or less partial activity by selecting for complementation of a dnaA(Ts) mutant strain at different expression levels of the new mutant proteins. The selection...

  1. DNA binding and cleavage activity of a structurally characterized Ni(II)

    Indian Academy of Sciences (India)

    1375–1381. c Indian Academy of Sciences. DOI 10.1007/s12039-015-0900-4. DNA binding and cleavage activity of a structurally characterized Ni(II). Schiff base complex. SARAT CHANDRA KUMARa, ABHIJIT PALa, MERRY MITRAa,. V M MANIKANDAMATHAVANb, CHIA -HER LINc, BALACHANDRAN UNNI NAIRb,∗.

  2. Prospects of nanoparticle-DNA binding and its implications in medical biotechnology.

    Science.gov (United States)

    An, Hongjie; Jin, Bo

    2012-01-01

    Bio-nanotechnology is a new interdisciplinary R&D area that integrates engineering and physical science with biology through the development of multifunctional devices and systems, focusing biology inspired processes or their applications, in particular in medical biotechnology. DNA based nanotechnology, in many ways, has been one of the most intensively studied fields in recent years that involves the use and the creation of bio-inspired materials and their technologies for highly selective biosensing, nanoarchitecture engineering and nanoelectronics. Increasing researches have been offered to a fundamental understanding how the interactions between the nanoparticles and DNA molecules could alter DNA molecular structure and its biochemical activities. This minor review describes the mechanisms of the nanoparticle-DNA binding and molecular interactions. We present recent discoveries and research progresses how the nanoparticle-DNA binding could vary DNA molecular structure, DNA detection, and gene therapy. We report a few case studies associated with the application of the nanoparticle-DNA binding devices in medical detection and biotechnology. The potential impacts of the nanoparticles via DNA binding on toxicity of the microorganisms are briefly discussed. The nanoparticle-DNA interactions and their impact on molecular and microbial functionalities have only drown attention in recent a few years. The information presented in this review can provide useful references for further studies on biomedical science and technology. Copyright © 2012 Elsevier Inc. All rights reserved.

  3. Synthesis, X-ray crystal structure, DNA binding and Nuclease activity ...

    Indian Academy of Sciences (India)

    ... lanthanum complex and 10-coordinated in the cerium complex. The coordination polyhedra around the lanthanum and cerium were found to have distorted icosahedron and distorted bicapped square antiprism respectively. DNA binding and nuclease activity of these complexes were also investigated in the present work.

  4. Bacterial single-stranded DNA-binding proteins are phosphorylated on tyrosine

    DEFF Research Database (Denmark)

    Mijakovic, Ivan; Petranovic, Dina; Macek, B

    2006-01-01

    Single-stranded DNA-binding proteins (SSBs) are required for repair, recombination and replication in all organisms. Eukaryotic SSBs are regulated by phosphorylation on serine and threonine residues. To our knowledge, phosphorylation of SSBs in bacteria has not been reported. A systematic search ...... of SSBs is a conserved process of post-translational modification in taxonomically distant bacteria....

  5. DNA binding by Corynebacterium glutamicum TetR-type transcription regulator AmtR

    Directory of Open Access Journals (Sweden)

    Sticht Heinrich

    2009-07-01

    Full Text Available Abstract Background The TetR family member AmtR is the central regulator of nitrogen starvation response in Corynebacterium glutamicum. While the AmtR regulon was physiologically characterized in great detail up to now, mechanistic questions of AmtR binding were not addressed. This study presents a characterization of functionally important amino acids in the DNA binding domain of AmtR and of crucial nucleotides in the AmtR recognition motif. Results Site-directed mutagenesis, the characterization of corresponding mutant proteins by gel retardation assays and surface plasmon resonance and molecular modelling revealed several amino acids, which are directly involved in DNA binding, while others have more structural function. Furthermore, we could show that the spacing of the binding motif half sites is crucial for repression of transcription by AmtR. Conclusion Although the DNA binding domain of TetR-type repressors is highly conserved and a core binding motif was identified for AmtR and TetR(D, the AmtR binding domain shows individual properties compared to other TetR proteins. Besides by distinct amino acids of AmtR, DNA binding is influenced by nucleotides not only of the conserved binding motif but also by spacing nucleotides in C. glutamicum.

  6. Differential Expression of Two Paralogous Genes of Bacillus subtilis Encoding Single-Stranded DNA Binding Protein

    NARCIS (Netherlands)

    Lindner, Cordula; Nijland, Reindert; Hartskamp, Mariska van; Bron, Sierd; Hamoen, Leendert W.; Kuipers, Oscar P.

    The Bacillus subtilis genome comprises two paralogous single-stranded DNA binding protein (SSB) genes, ssb and ywpH, which show distinct expression patterns. The main ssb gene is strongly expressed during exponential growth and is coregulated with genes encoding the ribosomal proteins S6 and S18.

  7. DNA binding of centromere protein C (CENPC is stabilized by single-stranded RNA.

    Directory of Open Access Journals (Sweden)

    Yaqing Du

    2010-02-01

    Full Text Available Centromeres are the attachment points between the genome and the cytoskeleton: centromeres bind to kinetochores, which in turn bind to spindles and move chromosomes. Paradoxically, the DNA sequence of centromeres has little or no role in perpetuating kinetochores. As such they are striking examples of genetic information being transmitted in a manner that is independent of DNA sequence (epigenetically. It has been found that RNA transcribed from centromeres remains bound within the kinetochore region, and this local population of RNA is thought to be part of the epigenetic marking system. Here we carried out a genetic and biochemical study of maize CENPC, a key inner kinetochore protein. We show that DNA binding is conferred by a localized region 122 amino acids long, and that the DNA-binding reaction is exquisitely sensitive to single-stranded RNA. Long, single-stranded nucleic acids strongly promote the binding of CENPC to DNA, and the types of RNAs that stabilize DNA binding match in size and character the RNAs present on kinetochores in vivo. Removal or replacement of the binding module with HIV integrase binding domain causes a partial delocalization of CENPC in vivo. The data suggest that centromeric RNA helps to recruit CENPC to the inner kinetochore by altering its DNA binding characteristics.

  8. DNA-binding specificity and molecular functions of NAC transcription factors

    DEFF Research Database (Denmark)

    Olsen, Addie Nina; Ernst, Heidi Asschenfeldt; Lo Leggio, Leila

    2005-01-01

    . The ability of NAC proteins to dimerize and to bind DNAwas analysed by structure-based mutagenesis. This identified two salt bridge-forming residues essential for NAC protein dimerization. Alteration of basic residues in a loop region containing several highly conserved residues abolished DNA binding. Thus...

  9. Identification of a Second DNA Binding Site in the Human Rad52 Protein*S⃞

    Science.gov (United States)

    Kagawa, Wataru; Kagawa, Ako; Saito, Kengo; Ikawa, Shukuko; Shibata, Takehiko; Kurumizaka, Hitoshi; Yokoyama, Shigeyuki

    2008-01-01

    Rad52 plays essential roles in homology-dependent double-strand break repair. Various studies have established the functions of Rad52 in Rad51-dependent and Rad51-independent repair processes. However, the precise molecular mechanisms of Rad52 in these processes remain unknown. In the present study we have identified a novel DNA binding site within Rad52 by a structure-based alanine scan mutagenesis. This site is closely aligned with the putative single-stranded DNA binding site determined previously. Mutations in this site impaired the ability of the Rad52-single-stranded DNA complex to form a ternary complex with double-stranded DNA and subsequently catalyze the formation of D-loops. We found that Rad52 introduces positive supercoils into double-stranded DNA and that the second DNA binding site is essential for this activity. Our findings suggest that Rad52 aligns two recombining DNA molecules within the first and second DNA binding sites to stimulate the homology search and strand invasion processes. PMID:18593704

  10. Synthesis, DNA Binding, and Antiproliferative Activity of Novel Acridine-Thiosemicarbazone Derivatives

    Directory of Open Access Journals (Sweden)

    Sinara Mônica Vitalino de Almeida

    2015-06-01

    Full Text Available In this work, the acridine nucleus was used as a lead-compound for structural modification by adding different substituted thiosemicarbazide moieties. Eight new (Z-2-(acridin-9-ylmethylene-N-phenylhydrazinecarbothioamide derivatives (3a–h were synthesized, their antiproliferative activities were evaluated, and DNA binding properties were performed with calf thymus DNA (ctDNA by electronic absorption and fluorescence spectroscopies. Both hyperchromic and hypochromic effects, as well as red or blue shifts were demonstrated by addition of ctDNA to the derivatives. The calculated binding constants ranged from 1.74 × 104 to 1.0 × 106 M−1 and quenching constants from −0.2 × 104 to 2.18 × 104 M−1 indicating high affinity to ctDNA base pairs. The most efficient compound in binding to ctDNA in vitro was (Z-2-(acridin-9-ylmethylene-N- (4-chlorophenyl hydrazinecarbothioamide (3f, while the most active compound in antiproliferative assay was (Z-2-(acridin-9-ylmethylene-N-phenylhydrazinecarbothioamide (3a. There was no correlation between DNA-binding and in vitro antiproliferative activity, but the results suggest that DNA binding can be involved in the biological activity mechanism. This study may guide the choice of the size and shape of the intercalating part of the ligand and the strategic selection of substituents that increase DNA-binding or antiproliferative properties.

  11. Predicting DNA-binding sites of proteins from amino acid sequence

    Directory of Open Access Journals (Sweden)

    Wu Feihong

    2006-05-01

    Full Text Available Abstract Background Understanding the molecular details of protein-DNA interactions is critical for deciphering the mechanisms of gene regulation. We present a machine learning approach for the identification of amino acid residues involved in protein-DNA interactions. Results We start with a Naïve Bayes classifier trained to predict whether a given amino acid residue is a DNA-binding residue based on its identity and the identities of its sequence neighbors. The input to the classifier consists of the identities of the target residue and 4 sequence neighbors on each side of the target residue. The classifier is trained and evaluated (using leave-one-out cross-validation on a non-redundant set of 171 proteins. Our results indicate the feasibility of identifying interface residues based on local sequence information. The classifier achieves 71% overall accuracy with a correlation coefficient of 0.24, 35% specificity and 53% sensitivity in identifying interface residues as evaluated by leave-one-out cross-validation. We show that the performance of the classifier is improved by using sequence entropy of the target residue (the entropy of the corresponding column in multiple alignment obtained by aligning the target sequence with its sequence homologs as additional input. The classifier achieves 78% overall accuracy with a correlation coefficient of 0.28, 44% specificity and 41% sensitivity in identifying interface residues. Examination of the predictions in the context of 3-dimensional structures of proteins demonstrates the effectiveness of this method in identifying DNA-binding sites from sequence information. In 33% (56 out of 171 of the proteins, the classifier identifies the interaction sites by correctly recognizing at least half of the interface residues. In 87% (149 out of 171 of the proteins, the classifier correctly identifies at least 20% of the interface residues. This suggests the possibility of using such classifiers to identify

  12. Characterization of in vivo DNA-binding events of plant transcription factors by ChIP-seq

    NARCIS (Netherlands)

    Mourik, Van Hilda; Muiño, J.M.; Pajoro, Alice; Angenent, G.C.; Kaufmann, Kerstin

    2015-01-01

    Chromatin immunoprecipitation followed by next-generation sequencing (ChIP-seq) is a powerful technique for genome-wide identification of in vivo binding sites of DNA-binding proteins. The technique had been used to study many DNA-binding proteins in a broad variety of species. The basis of the

  13. Autoinhibition of ETV6 DNA Binding Is Established by the Stability of Its Inhibitory Helix.

    Science.gov (United States)

    De, Soumya; Okon, Mark; Graves, Barbara J; McIntosh, Lawrence P

    2016-04-24

    The ETS transcriptional repressor ETV6 (or TEL) is autoinhibited by an α-helix that sterically blocks its DNA-binding ETS domain. The inhibitory helix is marginally stable and unfolds when ETV6 binds to either specific or non-specific DNA. Using NMR spectroscopy, we show that folding of the inhibitory helix requires a buried charge-dipole interaction with helix H1 of the ETS domain. This interaction also contributes directly to autoinhibition by precluding a highly conserved dipole-enhanced hydrogen bond between the phosphodiester backbone of bound DNA and the N terminus of helix H1. To probe further the thermodynamic basis of autoinhibition, ETV6 variants were generated with amino acid substitutions introduced along the solvent exposed surface of the inhibitory helix. These changes were designed to increase the intrinsic helical propensity of the inhibitory helix without perturbing its packing interactions with the ETS domain. NMR-monitored amide hydrogen exchange measurements confirmed that the stability of the folded inhibitory helix increases progressively with added helix-promoting substitutions. This also results in progressively reinforced autoinhibition and decreased DNA-binding affinity. Surprisingly, locking the inhibitory helix onto the ETS domain by a disulfide bridge severely impairs, but does not abolish DNA binding. Weak interactions still occur via an interface displaced from the canonical ETS domain DNA-binding surface. Collectively, these studies establish a direct thermodynamic linkage between inhibitory helix stability and ETV6 autoinhibition, and demonstrate that helix unfolding does not strictly precede DNA binding. Modulating inhibitory helix stability provides a potential route for the in vivo regulation of ETV6 activity. Copyright © 2016 Elsevier Ltd. All rights reserved.

  14. Genomic identification of bZIP family genes involved in drought and heat stresses in strawberry (Fragaria vesca)

    Science.gov (United States)

    Basic leucine zipper (bZIP) genes are known to play dominant roles in plant response to development signals, as well as abiotic or biotic stress stimuli. Fifty bZIP genes across the woodland strawberry (Fragaria vesca) genome were identified and analyzed. They can be divided into 10 clades according...

  15. Wounding induces local resistance but systemic susceptibility to Botrytis cinerea in pepper plants.

    Science.gov (United States)

    García, Tania; Gutiérrez, Jorge; Veloso, Javier; Gago-Fuentes, Raquel; Díaz, José

    2015-03-15

    Cotyledon wounding in pepper caused the early generation of hydrogen peroxide both locally (cotyledons) and systemically (upper true leaves). However, 72 h later there is a different wound response between local and systemic organs, as shown by resistance to the pathogenic fungus Botrytis cinerea, that increased locally and decreased systemically. Signaling by ethylene and jasmonic acid was assessed by using two inhibitors: 1-methylcyclopropene (MCP, inhibitor of ethylene receptors) and ibuprofen (inhibitor of jasmonate biosynthesis). MCP did not affect the modulation of resistance levels to Botrytis by wounding, ruling out the involvement of ethylene signaling. Ibuprofen did not inhibit wound-induced resistance at the local level, but inhibited wound-induced systemic susceptibility. Moreover, changes of biochemical and structural defenses in response to wounding were studied. Peroxidase activity and the expression of a peroxidase gene (CAPO1) increased locally as a response to wounding, but no changes were observed systemically. Lignin deposition was induced in wounded cotyledons, but was repressed in systemic leaves of wounded plants, whereas soluble phenolics did not change locally and decreased systemically. The expression of two other genes involved in plant defense (CABPR1 and CASC1) was also differentially regulated locally and systemically, pointing to a generalized increase in plant defenses at the local level and a systemic decrease as a response to wounding. Wound-induced defenses at the local level coincided with resistance to the necrotroph fungus B. cinerea, whereas depleted defenses in systemic leaves of wounded plants correlated to induced susceptibility against this pathogen. It may be that the local response acts as a sink of energy resources to mount a defense against pathogens, whereas in systemic organs the resources for defense are lower. Copyright © 2015 Elsevier GmbH. All rights reserved.

  16. Wound-induced proteinase inhibitor in Salix viminalis and its association with defence against insects

    Energy Technology Data Exchange (ETDEWEB)

    Saarikoski, P. [Swedish Univ. of Agricultural Sciences, Uppsala (Sweden). Dept. of Forest Genetics

    1997-09-01

    For successful traditional breeding, the plant material has to be screened for genetic variation for the desired traits. By screening Salix clones for wound-induced proteinase inhibitor (PI) activity and ethylene evolution, it was possible to identify variation for both characters among the Salix clones tested. However, no correlation was observed with insect and pathogen resistance. Since there was no simple relationship between wound-induced ethylene production, accumulation of PI and pest resistance, a more systematic investigation of Salix PIs was begun. A gene (swin1.1) encoding a 21 kDa trypsin inhibitor with characteristics of Kunitz-type of PI was sequenced. The trypsin inhibitor encoded by the isolated swin1.1 gene was shown to be functional in vitro and exhibit specificity for trypsin. It is therefore likely that this PI is involved in the plant defence in Salix, since many insects have trypsin as their major digestive protease. In further support of this view, in bio-tests with poplar the mortality of the first instar larvae (Lymantria dispar) was significantly increased, both after application of the trypsin inhibitor encoded by swin1.1 directly on poplar leaves and after feeding the larvae with transgenic poplar over-expressing the swin1.1 gene. In Salix, the swin1.1 gene was shown to be induced by mechanical wounding, insect feeding and by treatment with the signalling substances salicylic and jasmonic acid. The locally wound-induced response (mechanical and insect) was greater than the systemic response. Other swin1 gene family members were also differentially expressed after the inductive treatment. 187 refs., 3 figs., 2 tabs.

  17. Synthesis, crystal structure, DNA binding and molecular docking studies of zinc(II) carboxylates

    Science.gov (United States)

    Muhammad, Niaz; Ikram, Muhammad; Wadood, Abdul; Rehman, Sadia; Shujah, Shaukat; Erum; Ghufran, Mehreen; Rahim, Shahnaz; Shah, Muzamil; Schulzke, Carola

    2018-02-01

    New zinc(II) carboxylate complexes [Zn(3-F-C6H4CH2COO)2]n (1), [Zn3(3-F-C6H4CH2COO)6(Phen)2] (2) and [Zn3(3-F-C6H4CH2COO)6(bipy)2] (3) were synthesized and characterized by atomic absorption, single crystal structural analysis and IR studies. Complex 1 crystallizes as a coordination polymer constituting a web of μ - η1,η1 carboxylate bridged tetrahedral zinc centers. Complexes 2 and 3 comprise trinuclear zinc centers with two terminal fivefold coordinated slightly distorted square-pyramidal and central sixfold coordinated octahedral zinc centers. The complexes were also assessed for their DNA binding ability by UV/- Vis spectroscopy and their behavior rationalized theoretically by molecular docking studies. A DNA binding study has shown groove binding interactions with the complexes.

  18. Statistical-mechanical lattice models for protein-DNA binding in chromatin

    CERN Document Server

    Teif, Vladimir B

    2010-01-01

    Statistical-mechanical lattice models for protein-DNA binding are well established as a method to describe complex ligand binding equilibriums measured in vitro with purified DNA and protein components. Recently, a new field of applications has opened up for this approach since it has become possible to experimentally quantify genome-wide protein occupancies in relation to the DNA sequence. In particular, the organization of the eukaryotic genome by histone proteins into a nucleoprotein complex termed chromatin has been recognized as a key parameter that controls the access of transcription factors to the DNA sequence. New approaches have to be developed to derive statistical mechanical lattice descriptions of chromatin-associated protein-DNA interactions. Here, we present the theoretical framework for lattice models of histone-DNA interactions in chromatin and investigate the (competitive) DNA binding of other chromosomal proteins and transcription factors. The results have a number of applications for quant...

  19. The Positively Charged Surface of Herpes Simplex Virus UL42 Mediates DNA Binding*S

    Science.gov (United States)

    Komazin-Meredith, Gloria; Santos, Webster L.; Filman, David J.; Hogle, James M.; Verdine, Gregory L.; Coen, Donald M.

    2010-01-01

    Herpes simplex virus DNA polymerase is a heterodimer composed of UL30, a catalytic subunit, and UL42, a processivity subunit. Mutations that decrease DNA binding by UL42 decrease long chain DNA synthesis by the polymerase. The crystal structure of UL42 bound to the C terminus of UL30 revealed an extensive positively charged surface (“back face”). We tested two hypotheses, 1) the C terminus of UL30 affects DNA binding and 2) the positively charged back face mediates DNA binding. Addressing the first hypothesis, we found that the presence of a peptide corresponding to the UL30 C terminus did not result in altered binding of UL42 to DNA. Addressing the second hypothesis, previous work showed that substitution of four conserved arginine residues on the basic face with alanines resulted in decreased DNA affinity. We tested the affinities for DNA and the stimulation of long chain DNA synthesis of mutants in which the four conserved arginine residues were substituted individually or together with lysines and also a mutant in which a conserved glutamine residue was substituted with an arginine to increase positive charge on the back face. We also engineered cysteines onto this surface to permit disulfide cross-linking studies. Last, we assayed the effects of ionic strength on DNA binding by UL42 to estimate the number of ions released upon binding. Our results taken together strongly suggest that the basic back face of UL42 contacts DNA and that positive charge on this surface is important for this interaction. PMID:18178550

  20. Delineation of Methyl-DNA Binding Protein Interactions in the Prostate Cancer Genome (PC110091)

    Science.gov (United States)

    2014-03-01

    association regions or sites for each protein. The genes that overlap these common sites were identified and the genes among these with increased or decreased...regions, a major difference from “typical” DNA-binding proteins such as CREB or C/EBP which bind relatively small and discrete recognition sites ...from three matched sets of malignant prostate cancer and normal/benign prostate tissue were sequenced using the Ion Torrent (Life Technologies

  1. BRCA1 DNA-binding activity is stimulated by BARD1.

    Science.gov (United States)

    Simons, Amanda M; Horwitz, Andrew A; Starita, Lea M; Griffin, Karen; Williams, R Scott; Glover, J N Mark; Parvin, Jeffrey D

    2006-02-15

    The breast- and ovarian-specific tumor suppressor BRCA1 has been implicated in numerous cellular processes, including transcription, ubiquitination, and DNA repair. Its tumor suppression activity is tightly linked to that of BARD1, a protein that heterodimerizes with BRCA1. It has been previously shown that BRCA1 binds to DNA, an interesting functional observation in light of the genetic data linking BRCA1 to DNA repair pathways. In this work, we reexamine the DNA-binding properties of BRCA1, comparing them with the DNA-binding properties of the BRCA1/BARD1 heterodimer. Because nuclear BRCA1 exists as a heterodimer with BARD1, it is likely that in vitro studies of the heterodimer will provide a more accurate model of physiologic conditions. Our results indicate that whereas BARD1 cannot directly bind DNA, it does enhance DNA binding by BRCA1. This is a surprising observation as both DNA-binding domains are distal to the BARD1-interacting RING domain of BRCA1. Further analysis of the dimerization reveals that the BRCA1/BARD1 interaction is not limited to the amino-terminal RING domains of each protein. The carboxyl terminus of BRCA1 contributes significantly to the stability of the heterodimer. We also show that the presence of BARD1 has a secondary effect, as autoubiquitination of BRCA1/BARD1 heterodimers additionally enhances the affinity of BRCA1 for DNA. Together, these data suggest that BRCA1 and BARD1 heterodimerization is stabilized via domains not previously thought to interact and that BARD1 acts in both ubiquitination-dependent and ubiquitination-independent ways to influence the role of BRCA1 in DNA repair.

  2. Wound-induced endogenous jasmonates stunt plant growth by inhibiting mitosis.

    Directory of Open Access Journals (Sweden)

    Yi Zhang

    Full Text Available When plants are repeatedly injured their growth is stunted and the size of organs such as leaves is greatly reduced. The basis of this effect is not well-understood however, even though it reduces yield of crops injured by herbivory, and produces dramatic effects exemplified in ornamental bonsai plants. We have investigated the genetic and physiological basis of this "bonsai effect" by repeatedly wounding leaves of the model plant Arabidopsis. This treatment stunted growth by 50% and increased the endogenous content of jasmonate (JA, a growth inhibitor, by seven-fold. Significantly, repeated wounding did not stunt the growth of the leaves of mutants unable to synthesise JA, or unable to respond to JA including coi1, jai3, myc2, but not jar1. The stunted growth did not result from reduced cell size, but resulted instead from reduced cell number, and was associated with reduced expression of CycB1;2. Wounding caused systemic disappearance of constitutively expressed JAZ1::GUS. Wounding also activates plant immunity. We show that a gene, 12-oxo-phytodienoate reductase, which catalyses a step in JA biosynthesis, and which we confirm is not required for defence, is however required for wound-induced stunting. Our data suggest that intermediates in the JA biosynthetic pathway activate defence, but a primary function of wound-induced JA is to stunt growth through the suppression of mitosis.

  3. Wound-induced endogenous jasmonates stunt plant growth by inhibiting mitosis.

    Science.gov (United States)

    Zhang, Yi; Turner, John G

    2008-01-01

    When plants are repeatedly injured their growth is stunted and the size of organs such as leaves is greatly reduced. The basis of this effect is not well-understood however, even though it reduces yield of crops injured by herbivory, and produces dramatic effects exemplified in ornamental bonsai plants. We have investigated the genetic and physiological basis of this "bonsai effect" by repeatedly wounding leaves of the model plant Arabidopsis. This treatment stunted growth by 50% and increased the endogenous content of jasmonate (JA), a growth inhibitor, by seven-fold. Significantly, repeated wounding did not stunt the growth of the leaves of mutants unable to synthesise JA, or unable to respond to JA including coi1, jai3, myc2, but not jar1. The stunted growth did not result from reduced cell size, but resulted instead from reduced cell number, and was associated with reduced expression of CycB1;2. Wounding caused systemic disappearance of constitutively expressed JAZ1::GUS. Wounding also activates plant immunity. We show that a gene, 12-oxo-phytodienoate reductase, which catalyses a step in JA biosynthesis, and which we confirm is not required for defence, is however required for wound-induced stunting. Our data suggest that intermediates in the JA biosynthetic pathway activate defence, but a primary function of wound-induced JA is to stunt growth through the suppression of mitosis.

  4. Innate sensing of microbial products promotes wound-induced skin cancer

    Science.gov (United States)

    Hoste, Esther; Arwert, Esther N.; Lal, Rohit; South, Andrew P.; Salas-Alanis, Julio C.; Murrell, Dedee F.; Donati, Giacomo; Watt, Fiona M.

    2015-01-01

    The association between tissue damage, chronic inflammation and cancer is well known. However, the underlying mechanisms are unclear. Here we characterize a mouse model in which constitutive epidermal extracellular-signal-regulated kinase-MAP-kinase signalling results in epidermal inflammation, and skin wounding induces tumours. We show that tumour incidence correlates with wound size and inflammatory infiltrate. Ablation of tumour necrosis factor receptor (TNFR)-1/-2, Myeloid Differentiation primary response gene 88 or Toll-like receptor (TLR)-5, the bacterial flagellin receptor, but not other innate immune sensors, in radiosensitive leukocytes protects against tumour formation. Antibiotic treatment inhibits, whereas injection of flagellin induces, tumours in a TLR-5-dependent manner. TLR-5 is also involved in chemical-induced skin carcinogenesis in wild-type mice. Leukocytic TLR-5 signalling mediates upregulation of the alarmin HMGB1 (High Mobility Group Box 1) in wound-induced papillomas. HMGB1 is elevated in tumours of patients with Recessive Dystrophic Epidermolysis Bullosa, a disease characterized by chronic skin damage. We conclude that in our experimental model the combination of bacteria, chronic inflammation and wounding cooperate to trigger skin cancer. PMID:25575023

  5. Discovering protein–DNA binding sequence patterns using association rule mining

    Science.gov (United States)

    Wong, Ka-Chun; Chan, Tak-Ming; Wong, Man-Hon; Lee, Kin-Hong; Lau, Chi-Kong; Tsui, Stephen K. W.

    2010-01-01

    Protein–DNA bindings between transcription factors (TFs) and transcription factor binding sites (TFBSs) play an essential role in transcriptional regulation. Over the past decades, significant efforts have been made to study the principles for protein–DNA bindings. However, it is considered that there are no simple one-to-one rules between amino acids and nucleotides. Many methods impose complicated features beyond sequence patterns. Protein-DNA bindings are formed from associated amino acid and nucleotide sequence pairs, which determine many functional characteristics. Therefore, it is desirable to investigate associated sequence patterns between TFs and TFBSs. With increasing computational power, availability of massive experimental databases on DNA and proteins, and mature data mining techniques, we propose a framework to discover associated TF–TFBS binding sequence patterns in the most explicit and interpretable form from TRANSFAC. The framework is based on association rule mining with Apriori algorithm. The patterns found are evaluated by quantitative measurements at several levels on TRANSFAC. With further independent verifications from literatures, Protein Data Bank and homology modeling, there are strong evidences that the patterns discovered reveal real TF–TFBS bindings across different TFs and TFBSs, which can drive for further knowledge to better understand TF–TFBS bindings. PMID:20529874

  6. Functional importance of the DNA binding activity of Candida albicans Czf1p.

    Directory of Open Access Journals (Sweden)

    Ivana Petrovska

    Full Text Available The human opportunistic pathogen Candida albicans undergoes a reversible morphological transition between the yeast and hyphal states in response to a variety of signals. One such environmental trigger is growth within a semisolid matrix such as agar medium. This growth condition is of interest because it may mimic the growth of C. albicans in contact with host tissue during infection. During growth within a semisolid matrix, hyphal growth is positively regulated by the transcriptional regulator Czf1p and negatively by a second key transcriptional regulator, Efg1p. Genetic studies indicate that Czf1p, a member of the zinc-cluster family of transcriptional regulators, exerts its function by opposing the inhibitory influence of Efg1p on matrix-induced filamentous growth. We examined the importance of the two known activities of Czf1p, DNA-binding and interaction with Efg1p. We found that the two activities were separable by mutation allowing us to demonstrate that the DNA-binding activity of Czf1p was essential for its role as a positive regulator of morphogenesis. Surprisingly, however, interactions with Efg1p appeared to be largely dispensable. Our studies provide the first evidence of a key role for the DNA-binding activity of Czf1p in the morphological yeast-to-hyphal transition triggered by matrix-embedded growth.

  7. Halenaquinone, a chemical compound that specifically inhibits the secondary DNA binding of RAD51.

    Science.gov (United States)

    Takaku, Motoki; Kainuma, Takashi; Ishida-Takaku, Takako; Ishigami, Shintaro; Suzuki, Hidekazu; Tashiro, Satoshi; van Soest, Rob W M; Nakao, Yoichi; Kurumizaka, Hitoshi

    2011-04-01

    Mutations and single-nucleotide polymorphisms affecting RAD51 gene function have been identified in several tumors, suggesting that the inappropriate expression of RAD51 activity may cause tumorigenesis. RAD51 is an essential enzyme for the homologous recombinational repair (HRR) of DNA double-strand breaks. In the HRR pathway, RAD51 catalyzes the homologous pairing between single-stranded DNA (ssDNA) and double-stranded DNA (dsDNA), which is the central step of the HRR pathway. To identify a chemical compound that regulates the homologous-pairing activity of RAD51, in the present study, we screened crude extract fractions from marine sponges by the RAD51-mediated homologous-pairing assay. Halenaquinone was identified as an inhibitor of the RAD51 homologous-pairing activity. A surface plasmon resonance analysis indicated that halenaquinone directly bound to RAD51. Intriguingly, halenaquinone specifically inhibited dsDNA binding by RAD51 alone or the RAD51-ssDNA complex, but only weakly affected the RAD51-ssDNA binding. In vivo, halenaquinone significantly inhibited the retention of RAD51 at double-strand break sites. Therefore, halenaquinone is a novel type of RAD51 inhibitor that specifically inhibits the RAD51-dsDNA binding. © 2011 The Authors. Journal compilation © 2011 by the Molecular Biology Society of Japan/Blackwell Publishing Ltd.

  8. Structure of p73 DNA-binding domain tetramer modulates p73 transactivation

    Science.gov (United States)

    Ethayathulla, Abdul S.; Tse, Pui-Wah; Monti, Paola; Nguyen, Sonha; Inga, Alberto; Fronza, Gilberto; Viadiu, Hector

    2012-01-01

    The transcription factor p73 triggers developmental pathways and overlaps stress-induced p53 transcriptional pathways. How p53-family response elements determine and regulate transcriptional specificity remains an unsolved problem. In this work, we have determined the first crystal structures of p73 DNA-binding domain tetramer bound to response elements with spacers of different length. The structure and function of the adaptable tetramer are determined by the distance between two half-sites. The structures with zero and one base-pair spacers show compact p73 DNA-binding domain tetramers with large tetramerization interfaces; a two base-pair spacer results in DNA unwinding and a smaller tetramerization interface, whereas a four base-pair spacer hinders tetramerization. Functionally, p73 is more sensitive to spacer length than p53, with one base-pair spacer reducing 90% of transactivation activity and longer spacers reducing transactivation to basal levels. Our results establish the quaternary structure of the p73 DNA-binding domain required as a scaffold to promote transactivation. PMID:22474346

  9. Structure and DNA-binding traits of the transition state regulator AbrB.

    Science.gov (United States)

    Olson, Andrew L; Tucker, Ashley T; Bobay, Benjamin G; Soderblom, Erik J; Moseley, M Arthur; Thompson, Richele J; Cavanagh, John

    2014-11-04

    The AbrB protein from Bacillus subtilis is a DNA-binding global regulator controlling the onset of a vast array of protective functions under stressful conditions. Such functions include biofilm formation, antibiotic production, competence development, extracellular enzyme production, motility, and sporulation. AbrB orthologs are known in a variety of prokaryotic organisms, most notably in all infectious strains of Clostridia, Listeria, and Bacilli. Despite its central role in bacterial response and defense, its structure has been elusive because of its highly dynamic character. Orienting its N- and C-terminal domains with respect to one another has been especially problematic. Here, we have generated a structure of full-length, tetrameric AbrB using nuclear magnetic resonance, chemical crosslinking, and mass spectrometry. We note that AbrB possesses a strip of positive electrostatic potential encompassing its DNA-binding region and that its C-terminal domain aids in DNA binding. Copyright © 2014 Elsevier Ltd. All rights reserved.

  10. Identification of DNA-Binding Proteins Using Mixed Feature Representation Methods.

    Science.gov (United States)

    Qu, Kaiyang; Han, Ke; Wu, Song; Wang, Guohua; Wei, Leyi

    2017-09-22

    DNA-binding proteins play vital roles in cellular processes, such as DNA packaging, replication, transcription, regulation, and other DNA-associated activities. The current main prediction method is based on machine learning, and its accuracy mainly depends on the features extraction method. Therefore, using an efficient feature representation method is important to enhance the classification accuracy. However, existing feature representation methods cannot efficiently distinguish DNA-binding proteins from non-DNA-binding proteins. In this paper, a multi-feature representation method, which combines three feature representation methods, namely, K-Skip-N-Grams, Information theory, and Sequential and structural features (SSF), is used to represent the protein sequences and improve feature representation ability. In addition, the classifier is a support vector machine. The mixed-feature representation method is evaluated using 10-fold cross-validation and a test set. Feature vectors, which are obtained from a combination of three feature extractions, show the best performance in 10-fold cross-validation both under non-dimensional reduction and dimensional reduction by max-relevance-max-distance. Moreover, the reduced mixed feature method performs better than the non-reduced mixed feature technique. The feature vectors, which are a combination of SSF and K-Skip-N-Grams, show the best performance in the test set. Among these methods, mixed features exhibit superiority over the single features.

  11. Identification of DNA-Binding Proteins Using Mixed Feature Representation Methods

    Directory of Open Access Journals (Sweden)

    Kaiyang Qu

    2017-09-01

    Full Text Available DNA-binding proteins play vital roles in cellular processes, such as DNA packaging, replication, transcription, regulation, and other DNA-associated activities. The current main prediction method is based on machine learning, and its accuracy mainly depends on the features extraction method. Therefore, using an efficient feature representation method is important to enhance the classification accuracy. However, existing feature representation methods cannot efficiently distinguish DNA-binding proteins from non-DNA-binding proteins. In this paper, a multi-feature representation method, which combines three feature representation methods, namely, K-Skip-N-Grams, Information theory, and Sequential and structural features (SSF, is used to represent the protein sequences and improve feature representation ability. In addition, the classifier is a support vector machine. The mixed-feature representation method is evaluated using 10-fold cross-validation and a test set. Feature vectors, which are obtained from a combination of three feature extractions, show the best performance in 10-fold cross-validation both under non-dimensional reduction and dimensional reduction by max-relevance-max-distance. Moreover, the reduced mixed feature method performs better than the non-reduced mixed feature technique. The feature vectors, which are a combination of SSF and K-Skip-N-Grams, show the best performance in the test set. Among these methods, mixed features exhibit superiority over the single features.

  12. POT1-independent single-strand telomeric DNA binding activities in Brassicaceae.

    Science.gov (United States)

    Shakirov, Eugene V; McKnight, Thomas D; Shippen, Dorothy E

    2009-06-01

    Telomeres define the ends of linear eukaryotic chromosomes and are required for genome maintenance and continued cell proliferation. The extreme ends of telomeres terminate in a single-strand protrusion, termed the G-overhang, which, in vertebrates and fission yeast, is bound by evolutionarily conserved members of the POT1 (protection of telomeres) protein family. Unlike most other model organisms, the flowering plant Arabidopsis thaliana encodes two divergent POT1-like proteins. Here we show that the single-strand telomeric DNA binding activity present in A. thaliana nuclear extracts is not dependent on POT1a or POT1b proteins. Furthermore, in contrast to POT1 proteins from yeast and vertebrates, recombinant POT1a and POT1b proteins from A. thaliana, and from two additional Brassicaceae species, Arabidopsis lyrata and Brassica oleracea (cauliflower), fail to bind single-strand telomeric DNA in vitro under the conditions tested. Finally, although we detected four single-strand telomeric DNA binding activities in nuclear extracts from B. oleracea, partial purification and DNA cross-linking analysis of these complexes identified proteins that are smaller than the predicted sizes of BoPOT1a or BoPOT1b. Taken together, these data suggest that POT1 proteins are not the major single-strand telomeric DNA binding activities in A. thaliana and its close relatives, underscoring the remarkable functional divergence of POT1 proteins from plants and other eukaryotes.

  13. Human single-stranded DNA binding proteins are essential for maintaining genomic stability

    Science.gov (United States)

    2013-01-01

    The double-stranded conformation of cellular DNA is a central aspect of DNA stabilisation and protection. The helix preserves the genetic code against chemical and enzymatic degradation, metabolic activation, and formation of secondary structures. However, there are various instances where single-stranded DNA is exposed, such as during replication or transcription, in the synthesis of chromosome ends, and following DNA damage. In these instances, single-stranded DNA binding proteins are essential for the sequestration and processing of single-stranded DNA. In order to bind single-stranded DNA, these proteins utilise a characteristic and evolutionary conserved single-stranded DNA-binding domain, the oligonucleotide/oligosaccharide-binding (OB)-fold. In the current review we discuss a subset of these proteins involved in the direct maintenance of genomic stability, an important cellular process in the conservation of cellular viability and prevention of malignant transformation. We discuss the central roles of single-stranded DNA binding proteins from the OB-fold domain family in DNA replication, the restart of stalled replication forks, DNA damage repair, cell cycle-checkpoint activation, and telomere maintenance. PMID:23548139

  14. Thermodynamic effects of multiple protein conformations on stability and DNA binding.

    Science.gov (United States)

    Inaba, Satomi; Fukada, Harumi; Ikegami, Takahisa; Oda, Masayuki

    2013-09-15

    The side-chain conformations of amino acids in the hydrophobic core are important for protein folding and function. A previous NMR study has shown that a mutant protein of transcriptional activator c-Myb, I155L/I181L R3, has multiple conformations and increased fluctuation in comparison with the wild type. To elucidate the quantitative correlation of structural fluctuation with stability and function, we analyzed the thermodynamic effects of I155L and I181L mutations, using R2R3 that encompasses the minimum specific DNA-binding region. Circular dichroism and differential scanning calorimetry measurements showed that the mutation of I155L had little effect on stability, while the I181L mutation significantly destabilized the protein. It is noteworthy that the decreased stability resulting from the I181L mutation was mainly due to decreased enthalpy change, which is partially compensated by decreased entropy change. Isothermal titration calorimetry measurements showed that the specific DNA-binding affinity was decreased owing to the I181L mutation, which was due to decreased binding entropy change. Entropy in the folded state, which corresponds to the DNA-free state, increases due to the I181L mutation because of the increased conformational fluctuation observed in I155L/I181L mutant of R2R3 by CLEANEX-PM NMR analysis, which in turn results in decreased folding entropy and DNA-binding entropy changes. Copyright © 2013 Elsevier Inc. All rights reserved.

  15. The structural basis for dynamic DNA binding and bridging interactions which condense the bacterial centromere.

    Science.gov (United States)

    Fisher, Gemma Lm; Pastrana, César L; Higman, Victoria A; Koh, Alan; Taylor, James A; Butterer, Annika; Craggs, Timothy; Sobott, Frank; Murray, Heath; Crump, Matthew P; Moreno-Herrero, Fernando; Dillingham, Mark S

    2017-12-15

    The ParB protein forms DNA bridging interactions around parS to condense DNA and earmark the bacterial chromosome for segregation. The molecular mechanism underlying the formation of these ParB networks is unclear. We show here that while the central DNA binding domain is essential for anchoring at parS , this interaction is not required for DNA condensation. Structural analysis of the C-terminal domain reveals a dimer with a lysine-rich surface that binds DNA non-specifically and is essential for DNA condensation in vitro. Mutation of either the dimerisation or the DNA binding interface eliminates ParB-GFP foci formation in vivo. Moreover, the free C-terminal domain can rapidly decondense ParB networks independently of its ability to bind DNA. Our work reveals a dual role for the C-terminal domain of ParB as both a DNA binding and bridging interface, and highlights the dynamic nature of ParB networks in Bacillus subtilis .

  16. Cloning of two sea urchin DNA-binding proteins involved in mitochondrial DNA replication and transcription.

    Science.gov (United States)

    Loguercio Polosa, Paola; Megli, Fiammetta; Di Ponzio, Barbara; Gadaleta, Maria Nicola; Cantatore, Palmiro; Roberti, Marina

    2002-03-06

    The cloning of the cDNA for two mitochondrial proteins involved in sea urchin mtDNA replication and transcription is reported here. The cDNA for the mitochondrial D-loop binding protein (mtDBP) from the sea urchin Strongylocentrotus purpuratus has been cloned by a polymerase chain reaction-based approach. The protein displays a very high similarity with the Paracentrotus lividus homologue as it contains also the two leucine zipper-like domains which are thought to be involved in intramolecular interactions needed to expose the two DNA binding domains in the correct position for contacting DNA. The cDNA for the mitochondrial single-stranded DNA-binding protein (mtSSB) from P. lividus has been also cloned by a similar approach. The precursor protein is 146 amino acids long with a presequence of 16 residues. The deduced amino acid sequence shows the highest homology with the Xenopus laevis protein and the lowest with the Drosophila mtSSB. The computer modeling of the tertiary structure of P. lividus mtSSB shows a structure very similar to that experimentally determined for human mtSSB, with the conservation of the main residues involved in protein tetramerization and in DNA binding.

  17. Effects of copper ions on DNA binding and cytotoxic activity of a chiral salicylidene Schiff base.

    Science.gov (United States)

    Fei, Bao-Li; Xu, Wu-Shuang; Tao, Hui-Wen; Li, Wen; Zhang, Yu; Long, Jian-Ying; Liu, Qing-Bo; Xia, Bing; Sun, Wei-Yin

    2014-03-05

    A chiral Schiff base HL N-(5-bromo-salicylaldehyde)dehydroabietylamine (1) and its chiral dinuclear copper complex [Cu2L4]·4DMF (2) have been synthesized and fully characterized. The interactions of 1 and 2 with salmon sperm DNA have been investigated by viscosity measurements, UV, fluorescence and circular dichroism (CD) spectroscopic techniques. Absorption spectral (Kb=3.30 × 10(5)M(-)(1) (1), 6.63 × 10(5)M(-)(1)(2)), emission spectral (Ksv=7.58 × 10(3)M(-)(1) (1), 1.52 × 10(4)M(-)(1) (2)), and viscosity measurements reveal that 1 and 2 interact with DNA through intercalation and 2 exhibits a higher DNA binding ability. In addition, CD study indicates 2 cause a more evident perturbation on the base stacking and helicity of B-DNA upon binding to it. In fluorimetric studies, the enthalpy (ΔH>0) and entropy (ΔS>0) changes of the reactions between the compounds with DNA demonstrate hydrophobic interactions. 1 and 2 were also screened for their cytotoxic ability and 2 demonstrates higher growth inhibition of the selected cancer cells at concentration of 50 μM, this result is identical with their DNA binding ability order. All the experimental results show that the involvement of Cu (II) centers has some interesting effect on DNA binding ability and cytotoxicity of the chiral Schiff base. Copyright © 2014 Elsevier B.V. All rights reserved.

  18. Structure and DNA-binding of meiosis-specific protein Hop2

    Science.gov (United States)

    Zhou, Donghua; Moktan, Hem; Pezza, Roberto

    2014-03-01

    Here we report structure elucidation of the DNA binding domain of homologous pairing protein 2 (Hop2), which is important to gene diversity when sperms and eggs are produced. Together with another protein Mnd1, Hop2 enhances the strand invasion activity of recombinase Dmc1 by over 30 times, facilitating proper synapsis of homologous chromosomes. However, the structural and biochemical bases for the function of Hop2 and Mnd1 have not been well understood. As a first step toward such understanding, we recently solved the structure for the N-terminus of Hop2 (1-84) using solution NMR. This fragment shows a typical winged-head conformation with recognized DNA binding activity. DNA interacting sites were then investigated by chemical shift perturbations in a titration experiment. Information of these sites was used to guide protein-DNA docking with MD simulation, revealing that helix 3 is stably lodged in the DNA major groove and that wing 1 (connecting strands 2 and 3) transiently comes in contact with the minor groove in nanosecond time scale. Mutagenesis analysis further confirmed the DNA binding sites in this fragment of the protein.

  19. Multiple DNA binding proteins contribute to timing of chromosome replication in E. coli

    DEFF Research Database (Denmark)

    Riber, Leise; Frimodt-Møller, Jakob; Charbon, Godefroid

    2016-01-01

    Chromosome replication in Escherichia coli is initiated from a single origin, oriC. Initiation involves a number of DNA binding proteins, but only DnaA is essential and specific for the initiation process. DnaA is an AAA+ protein that binds both ATP and ADP with similar high affinities. Dna...... replication is initiated, or the time window in which all origins present in a single cell are initiated, i.e. initiation synchrony, or both. Overall, these DNA binding proteins modulate the initiation frequency from oriC by: (i) binding directly to oriC to affect DnaA binding, (ii) altering the DNA topology...... in or around oriC, (iii) altering the nucleotide bound status of DnaA by interacting with non-coding chromosomal sequences, distant from oriC, that are important for DnaA activity. Thus, although DnaA is the key protein for initiation of replication, other DNA-binding proteins act not only on ori...

  20. BINDING OF A BZIP PROTEIN TO THE ESTROGEN-INDUCIBLE APOVLDL-II PROMOTER

    NARCIS (Netherlands)

    SMIDT, MP; WIJNHOLDS, J; SNIPPE, L; VANKEULEN, G; AB, G

    1994-01-01

    Activation of the very low density apolipoprotein II (apoVLDL II) gene in chicken liver by estrogen results in the binding of a variety of nuclear proteins including members of the steroid receptor superfamily and the bZip superfamily to the immediate 5' flanking region. In the present study, we

  1. Evidence for an Important Role of WRKY DNA Binding Proteins in the Regulation of NPR1 Gene Expression

    National Research Council Canada - National Science Library

    Yu, Diqiu; Chen, Chunhong; Chen, Zhixiang

    2001-01-01

    .... In the present study, we report the identification of W-box sequences in the promoter region of the NPR1 gene that are recognized specifically by SA-induced WRKY DNA binding proteins from Arabidopsis...

  2. DNA Bending is Induced in an Enhancer by the DNA-Binding Domain of the Bovine Papillomavirus E2 Protein

    Science.gov (United States)

    Moskaluk, Christopher; Bastia, Deepak

    1988-03-01

    The E2 gene of bovine papillomavirus type 1 has been shown to encode a DNA-binding protein and to trans-activate the viral enhancer. We have localized the DNA-binding domain of the E2 protein to the carboxyl-terminal 126 amino acids of the E2 open reading frame. The DNA-binding domain has been expressed in Escherichia coli and partially purified. Gel retardation and DNase I ``footprinting'' on the bovine papillomavirus type 1 enhancer identify the sequence motif ACCN6GGT (in which N = any nucleotide) as the E2 binding site. Using electrophoretic methods we have shown that the DNA-binding domain changes conformation of the enhancer by inducing significant DNA bending.

  3. Applications of Engineered DNA-Binding Molecules Such as TAL Proteins and the CRISPR/Cas System in Biology Research

    Directory of Open Access Journals (Sweden)

    Toshitsugu Fujita

    2015-09-01

    Full Text Available Engineered DNA-binding molecules such as transcription activator-like effector (TAL or TALE proteins and the clustered regularly interspaced short palindromic repeats (CRISPR and CRISPR-associated proteins (Cas (CRISPR/Cas system have been used extensively for genome editing in cells of various types and species. The sequence-specific DNA-binding activities of these engineered DNA-binding molecules can also be utilized for other purposes, such as transcriptional activation, transcriptional repression, chromatin modification, visualization of genomic regions, and isolation of chromatin in a locus-specific manner. In this review, we describe applications of these engineered DNA-binding molecules for biological purposes other than genome editing.

  4. In vitro selection of zinc fingers with altered DNA-binding specificity.

    Science.gov (United States)

    Jamieson, A C; Kim, S H; Wells, J A

    1994-05-17

    We have used random mutagenesis and phage display to alter the DNA-binding specificity of Zif268, a transcription factor that contains three zinc finger domains. Four residues in the helix of finger 1 of Zif268 that potentially mediate DNA binding were identified from an X-ray structure of the Zif268-DNA complex. A library was constructed in which these residues were randomly mutated and the Zif268 variants were fused to a truncated version of the gene III coat protein on the surface of M13 filamentous phage particles. The phage displayed the mutant proteins in a monovalent fashion and were sorted by repeated binding and elution from affinity matrices containing different DNA sequences. When the matrix contained the natural nine base pair operator sequence 5'-GCG-TGG-GCG-3', native-like zinc fingers were isolated. New finger 1 variants were found by sorting with two different operators in which the singly modified triplets, GTG and TCG, replaced the native finger 1 triplet, GCG. Overall, the selected finger 1 variants contained a preponderance of polar residues at the four sites. Interestingly, the net charge of the four residues in any selected finger never derived more that one unit from neutrality despite the fact that about half the variants contained three or four charged residues over the four sites. Measurements of the dissociation constants for two of these purified finger 1 variants by gel-shift assay showed their specificities to vary over a 10-fold range, with the greatest affinity being for the DNA binding site for which they were sorted.(ABSTRACT TRUNCATED AT 250 WORDS)

  5. CETCh-seq: CRISPR epitope tagging ChIP-seq of DNA-binding proteins.

    Science.gov (United States)

    Savic, Daniel; Partridge, E Christopher; Newberry, Kimberly M; Smith, Sophia B; Meadows, Sarah K; Roberts, Brian S; Mackiewicz, Mark; Mendenhall, Eric M; Myers, Richard M

    2015-10-01

    Chromatin immunoprecipitation followed by next-generation DNA sequencing (ChIP-seq) is a widely used technique for identifying transcription factor (TF) binding events throughout an entire genome. However, ChIP-seq is limited by the availability of suitable ChIP-seq grade antibodies, and the vast majority of commercially available antibodies fail to generate usable data sets. To ameliorate these technical obstacles, we present a robust methodological approach for performing ChIP-seq through epitope tagging of endogenous TFs. We used clustered regularly interspaced short palindromic repeats (CRISPR)/Cas9-based genome editing technology to develop CRISPR epitope tagging ChIP-seq (CETCh-seq) of DNA-binding proteins. We assessed the feasibility of CETCh-seq by tagging several DNA-binding proteins spanning a wide range of endogenous expression levels in the hepatocellular carcinoma cell line HepG2. Our data exhibit strong correlations between both replicate types as well as with standard ChIP-seq approaches that use TF antibodies. Notably, we also observed minimal changes to the cellular transcriptome and to the expression of the tagged TF. To examine the robustness of our technique, we further performed CETCh-seq in the breast adenocarcinoma cell line MCF7 as well as mouse embryonic stem cells and observed similarly high correlations. Collectively, these data highlight the applicability of CETCh-seq to accurately define the genome-wide binding profiles of DNA-binding proteins, allowing for a straightforward methodology to potentially assay the complete repertoire of TFs, including the large fraction for which ChIP-quality antibodies are not available. © 2015 Savic et al.; Published by Cold Spring Harbor Laboratory Press.

  6. Retinoblastoma-binding Protein 1 Has an Interdigitated Double Tudor Domain with DNA Binding Activity*

    Science.gov (United States)

    Gong, Weibin; Wang, Jinfeng; Perrett, Sarah; Feng, Yingang

    2014-01-01

    Retinoblastoma-binding protein 1 (RBBP1) is a tumor and leukemia suppressor that binds both methylated histone tails and DNA. Our previous studies indicated that RBBP1 possesses a Tudor domain, which cannot bind histone marks. In order to clarify the function of the Tudor domain, the solution structure of the RBBP1 Tudor domain was determined by NMR and is presented here. Although the proteins are unrelated, the RBBP1 Tudor domain forms an interdigitated double Tudor structure similar to the Tudor domain of JMJD2A, which is an epigenetic mark reader. This indicates the functional diversity of Tudor domains. The RBBP1 Tudor domain structure has a significant area of positively charged surface, which reveals a capability of the RBBP1 Tudor domain to bind nucleic acids. NMR titration and isothermal titration calorimetry experiments indicate that the RBBP1 Tudor domain binds both double- and single-stranded DNA with an affinity of 10–100 μm; no apparent DNA sequence specificity was detected. The DNA binding mode and key interaction residues were analyzed in detail based on a model structure of the Tudor domain-dsDNA complex, built by HADDOCK docking using the NMR data. Electrostatic interactions mediate the binding of the Tudor domain with DNA, which is consistent with NMR experiments performed at high salt concentration. The DNA-binding residues are conserved in Tudor domains of the RBBP1 protein family, resulting in conservation of the DNA-binding function in the RBBP1 Tudor domains. Our results provide further insights into the structure and function of RBBP1. PMID:24379399

  7. Retinoblastoma-binding protein 1 has an interdigitated double Tudor domain with DNA binding activity.

    Science.gov (United States)

    Gong, Weibin; Wang, Jinfeng; Perrett, Sarah; Feng, Yingang

    2014-02-21

    Retinoblastoma-binding protein 1 (RBBP1) is a tumor and leukemia suppressor that binds both methylated histone tails and DNA. Our previous studies indicated that RBBP1 possesses a Tudor domain, which cannot bind histone marks. In order to clarify the function of the Tudor domain, the solution structure of the RBBP1 Tudor domain was determined by NMR and is presented here. Although the proteins are unrelated, the RBBP1 Tudor domain forms an interdigitated double Tudor structure similar to the Tudor domain of JMJD2A, which is an epigenetic mark reader. This indicates the functional diversity of Tudor domains. The RBBP1 Tudor domain structure has a significant area of positively charged surface, which reveals a capability of the RBBP1 Tudor domain to bind nucleic acids. NMR titration and isothermal titration calorimetry experiments indicate that the RBBP1 Tudor domain binds both double- and single-stranded DNA with an affinity of 10-100 μM; no apparent DNA sequence specificity was detected. The DNA binding mode and key interaction residues were analyzed in detail based on a model structure of the Tudor domain-dsDNA complex, built by HADDOCK docking using the NMR data. Electrostatic interactions mediate the binding of the Tudor domain with DNA, which is consistent with NMR experiments performed at high salt concentration. The DNA-binding residues are conserved in Tudor domains of the RBBP1 protein family, resulting in conservation of the DNA-binding function in the RBBP1 Tudor domains. Our results provide further insights into the structure and function of RBBP1.

  8. Zuotin, a putative Z-DNA binding protein in Saccharomyces cerevisiae

    Science.gov (United States)

    Zhang, S.; Lockshin, C.; Herbert, A.; Winter, E.; Rich, A.

    1992-01-01

    A putative Z-DNA binding protein, named zuotin, was purified from a yeast nuclear extract by means of a Z-DNA binding assay using [32P]poly(dG-m5dC) and [32P]oligo(dG-Br5dC)22 in the presence of B-DNA competitor. Poly(dG-Br5dC) in the Z-form competed well for the binding of a zuotin containing fraction, but salmon sperm DNA, poly(dG-dC) and poly(dA-dT) were not effective. Negatively supercoiled plasmid pUC19 did not compete, whereas an otherwise identical plasmid pUC19(CG), which contained a (dG-dC)7 segment in the Z-form was an excellent competitor. A Southwestern blot using [32P]poly(dG-m5dC) as a probe in the presence of MgCl2 identified a protein having a molecular weight of 51 kDa. The 51 kDa zuotin was partially sequenced at the N-terminal and the gene, ZUO1, was cloned, sequenced and expressed in Escherichia coli; the expressed zuotin showed similar Z-DNA binding activity, but with lower affinity than zuotin that had been partially purified from yeast. Zuotin was deduced to have a number of potential phosphorylation sites including two CDC28 (homologous to the human and Schizosaccharomyces pombe cdc2) phosphorylation sites. The hexapeptide motif KYHPDK was found in zuotin as well as in several yeast proteins, DnaJ of E.coli, csp29 and csp32 proteins of Drosophila and the small t and large T antigens of the polyoma virus. A 60 amino acid segment of zuotin has similarity to several histone H1 sequences. Disruption of ZUO1 in yeast resulted in a slow growth phenotype.

  9. DNA binding and unwinding by Hel308 helicase requires dual functions of a winged helix domain.

    Science.gov (United States)

    Northall, Sarah J; Buckley, Ryan; Jones, Nathan; Penedo, J Carlos; Soultanas, Panos; Bolt, Edward L

    2017-09-01

    Hel308 helicases promote genome stability linked to DNA replication in archaea, and have homologues in metazoans. In the crystal structure of archaeal Hel308 bound to a tailed DNA duplex, core helicase domains encircle single-stranded DNA (ssDNA) in a "ratchet" for directional translocation. A winged helix domain (WHD) is also present, but its function is mysterious. We investigated the WHD in full-length Hel308, identifying that mutations in a solvent exposed α-helix resulted in reduced DNA binding and unwinding activities. When isolated from the rest of Hel308, the WHD protein alone bound to duplex DNA but not ssDNA, and DNA binding by WHD protein was abolished by the same mutations as were analyzed in full-length Hel308. Isolated WHD from a human Hel308 homologue (HelQ) also bound to duplex DNA. By disrupting the interface between the Hel308 WHD and a RecA-like domain, a topology typical of Ski2 helicases, we show that this is crucial for ATPase and helicase activities. The data suggest a model in which the WHD promotes activity of Hel308 directly, through binding to duplex DNA that is distinct from ssDNA binding by core helicase, and indirectly through interaction with the RecA-like domain. We propose how the WHD may contribute to ssDNA translocation, resulting in DNA helicase activity or in removal of other DNA bound proteins by "reeling" ssDNA. Copyright © 2017 Elsevier B.V. All rights reserved.

  10. Structure solution of DNA-binding proteins and complexes with ARCIMBOLDO libraries

    Energy Technology Data Exchange (ETDEWEB)

    Pröpper, Kevin [University of Göttingen, (Germany); Instituto de Biologia Molecular de Barcelona (IBMB-CSIC), (Spain); Meindl, Kathrin; Sammito, Massimo [Instituto de Biologia Molecular de Barcelona (IBMB-CSIC), (Spain); Dittrich, Birger; Sheldrick, George M. [University of Göttingen, (Germany); Pohl, Ehmke, E-mail: ehmke.pohl@durham.ac.uk [Durham University, (United Kingdom); Usón, Isabel, E-mail: ehmke.pohl@durham.ac.uk [Instituto de Biologia Molecular de Barcelona (IBMB-CSIC), (Spain); Institucio Catalana de Recerca i Estudis Avancats (ICREA), (Spain); University of Göttingen, (Germany)

    2014-06-01

    The structure solution of DNA-binding protein structures and complexes based on the combination of location of DNA-binding protein motif fragments with density modification in a multi-solution frame is described. Protein–DNA interactions play a major role in all aspects of genetic activity within an organism, such as transcription, packaging, rearrangement, replication and repair. The molecular detail of protein–DNA interactions can be best visualized through crystallography, and structures emphasizing insight into the principles of binding and base-sequence recognition are essential to understanding the subtleties of the underlying mechanisms. An increasing number of high-quality DNA-binding protein structure determinations have been witnessed despite the fact that the crystallographic particularities of nucleic acids tend to pose specific challenges to methods primarily developed for proteins. Crystallographic structure solution of protein–DNA complexes therefore remains a challenging area that is in need of optimized experimental and computational methods. The potential of the structure-solution program ARCIMBOLDO for the solution of protein–DNA complexes has therefore been assessed. The method is based on the combination of locating small, very accurate fragments using the program Phaser and density modification with the program SHELXE. Whereas for typical proteins main-chain α-helices provide the ideal, almost ubiquitous, small fragments to start searches, in the case of DNA complexes the binding motifs and DNA double helix constitute suitable search fragments. The aim of this work is to provide an effective library of search fragments as well as to determine the optimal ARCIMBOLDO strategy for the solution of this class of structures.

  11. DNA binding during expanded bed adsorption and factors affecting adsorbent aggregation

    DEFF Research Database (Denmark)

    Arpanaei, Ayyoob; Mathiasen, N.; Hobley, Timothy John

    2008-01-01

    DNA-induced aggregation and contraction of expanded bed adsorption chromatography beds have been examined using strong anion exchanger Q HyperZ and calf thymus DNA in buffers containing added NaCl. Two batches of adsorbent with different ionic capacities were used allowing the effects of different...... tolerance of anion exchangers when binding DNA. However, more importantly. with the adsorbents examined here. attempts to reduce bed aggregation by feedstock conditioning with added salt may increase DNA binding leading to a reduction in expanded bed adsorption performance compromising protein capture...

  12. Molecular mechanism of DNA association with single-stranded DNA binding protein.

    Science.gov (United States)

    Maffeo, Christopher; Aksimentiev, Aleksei

    2017-12-01

    During DNA replication, the single-stranded DNA binding protein (SSB) wraps single-stranded DNA (ssDNA) with high affinity to protect it from degradation and prevent secondary structure formation. Although SSB binds ssDNA tightly, it can be repositioned along ssDNA to follow the advancement of the replication fork. Using all-atom molecular dynamics simulations, we characterized the molecular mechanism of ssDNA association with SSB. Placed in solution, ssDNA-SSB assemblies were observed to change their structure spontaneously; such structural changes were suppressed in the crystallographic environment. Repeat simulations of the SSB-ssDNA complex under mechanical tension revealed a multitude of possible pathways for ssDNA to come off SSB punctuated by prolonged arrests at reproducible sites at the SSB surface. Ensemble simulations of spontaneous association of short ssDNA fragments with SSB detailed a three-dimensional map of local affinity to DNA; the equilibrium amount of ssDNA bound to SSB was found to depend on the electrolyte concentration but not on the presence of the acidic tips of the SSB tails. Spontaneous formation of ssDNA bulges and their diffusive motion along SSB surface was directly observed in multiple 10-µs-long simulations. Such reptation-like motion was confined by DNA binding to high-affinity spots, suggesting a two-step mechanism for SSB diffusion. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  13. Generalizing and learning protein-DNA binding sequence representations by an evolutionary algorithm

    KAUST Repository

    Wong, Ka Chun

    2011-02-05

    Protein-DNA bindings are essential activities. Understanding them forms the basis for further deciphering of biological and genetic systems. In particular, the protein-DNA bindings between transcription factors (TFs) and transcription factor binding sites (TFBSs) play a central role in gene transcription. Comprehensive TF-TFBS binding sequence pairs have been found in a recent study. However, they are in one-to-one mappings which cannot fully reflect the many-to-many mappings within the bindings. An evolutionary algorithm is proposed to learn generalized representations (many-to-many mappings) from the TF-TFBS binding sequence pairs (one-to-one mappings). The generalized pairs are shown to be more meaningful than the original TF-TFBS binding sequence pairs. Some representative examples have been analyzed in this study. In particular, it shows that the TF-TFBS binding sequence pairs are not presumably in one-to-one mappings. They can also exhibit many-to-many mappings. The proposed method can help us extract such many-to-many information from the one-to-one TF-TFBS binding sequence pairs found in the previous study, providing further knowledge in understanding the bindings between TFs and TFBSs. © 2011 Springer-Verlag.

  14. 9-Hydroxyellipticine alters the conformation and DNA binding characteristics of mutated p53 protein.

    Science.gov (United States)

    Sugikawa, E; Tsunoda, S; Nakanishi, N; Ohashi, M

    2001-01-01

    The tumor suppressor protein p53 is a phosphoprotein which shows growth and transformation suppression functions. Mutational loss of p53 function is the most frequently detected genetic event in human cancers. We examined whether 9-hydroxyellipticine (9HE), a cytotoxic agent, affected the tertiary structure of mutant p53 and DNA binding characteristics. Although several types of p53 mutants were resistant to degradation by calpain, the p53 mutants treated with 9HE were markedly sensitive to calpain as well as wild-type p53. Furthermore, mutant p53 proteins isolated from 9HE-treated cells regained the ability to bind a wild-type-specific p53 DNA consensus sequence. Wild-type p53 proteins prepared from both untreated and 9HE-treated cells bound the p53 consensus sequence and were degradaded by calpain equally well. These results suggest that 9HE affects the tertiary structure of mutated p53, which results in the restoration of DNA binding characteristics.

  15. DNA binding mechanism revealed by high resolution crystal structure of Arabidopsis thaliana WRKY1 protein.

    Science.gov (United States)

    Duan, Ming-Rui; Nan, Jie; Liang, Yu-He; Mao, Peng; Lu, Lu; Li, Lanfen; Wei, Chunhong; Lai, Luhua; Li, Yi; Su, Xiao-Dong

    2007-01-01

    WRKY proteins, defined by the conserved WRKYGQK sequence, are comprised of a large superfamily of transcription factors identified specifically from the plant kingdom. This superfamily plays important roles in plant disease resistance, abiotic stress, senescence as well as in some developmental processes. In this study, the Arabidopsis WRKY1 was shown to be involved in the salicylic acid signaling pathway and partially dependent on NPR1; a C-terminal domain of WRKY1, AtWRKY1-C, was constructed for structural studies. Previous investigations showed that DNA binding of the WRKY proteins was localized at the WRKY domains and these domains may define novel zinc-binding motifs. The crystal structure of the AtWRKY1-C determined at 1.6 A resolution has revealed that this domain is composed of a globular structure with five beta strands, forming an antiparallel beta-sheet. A novel zinc-binding site is situated at one end of the beta-sheet, between strands beta4 and beta5. Based on this high-resolution crystal structure and site-directed mutagenesis, we have defined and confirmed that the DNA-binding residues of AtWRKY1-C are located at beta2 and beta3 strands. These results provided us with structural information to understand the mechanism of transcriptional control and signal transduction events of the WRKY proteins.

  16. Crystal Structure of Human SSRP1 Middle Domain Reveals a Role in DNA Binding.

    Science.gov (United States)

    Zhang, Wenjuan; Zeng, Fuxing; Liu, Yiwei; Shao, Chen; Li, Sai; Lv, Hui; Shi, Yunyu; Niu, Liwen; Teng, Maikun; Li, Xu

    2015-12-21

    SSRP1 is a subunit of the FACT complex, an important histone chaperone required for transcriptional regulation, DNA replication and damage repair. SSRP1 also plays important roles in transcriptional regulation independent of Spt16 and interacts with other proteins. Here, we report the crystal structure of the middle domain of SSRP1. It consists of tandem pleckstrin homology (PH) domains. These domains differ from the typical PH domain in that PH1 domain has an extra conserved βαβ topology. SSRP1 contains the well-characterized DNA-binding HMG-1 domain. Our studies revealed that SSRP1-M can also participate in DNA binding, and that this binding involves one positively charged patch on the surface of the structure. In addition, SSRP1-M did not bind to histones, which was assessed through pull-down assays. This aspect makes the protein different from other related proteins adopting the double PH domain structure. Our studies facilitate the understanding of SSRP1 and provide insights into the molecular mechanisms of interaction with DNA and histones of the FACT complex.

  17. NMR characterization of the DNA binding properties of a novel Hoechst 33258 analogue peptide building block

    DEFF Research Database (Denmark)

    Bunkenborg, Jakob; Behrens, Carsten; Jacobsen, Jens Peter

    2002-01-01

    A novel aryl-bis-benzimidazole amino acid analogue of the DNA-binding compound Hoechst 33258 has recently been designed for incorporation in peptide combinatorial libraries by replacing the N-methylpiperazine group with a carboxyl group and the hydroxy group with an amino-methyl group. The DNA......-binding properties of the aryl-bis-benzimidazole monomer with the C-terminus derivatized with 3-(dimethylamino)-propylamine has been investigated in this paper by (1)H NMR studies of two different complexes with two different DNA sequences: A(5) d(5'-GCCA(5)CG-3'):d(5'-CGT(5)GGC-3') and A(3)T(3) d(5'-CGA(3)T(3)CG-3......')(2). Chemical shift footprinting shows that the ligand binds at the center of the A(3)T(3) sequence but at the 3'-end of A(5). A large number of NOEs show a well-defined complex with the ligand situated at the center of the palindromic A(3)T(3) but with the asymmetric A(5) the ligand binds with an orientational...

  18. In vivo footprinting and DNA affinity chromatography for analysis of p53 DNA binding ability.

    Science.gov (United States)

    Molina, Maria Patricia; Cain, Christine; Bargonetti, Jill

    2003-01-01

    p53 is a sequence-specific DNA binding protein. The p53 consensus is two copies of 5'- RRRC(A/T)(T/A)GYYY-3'. The interaction of p53 with specific DNA binding sites (DBS) has been analyzed extensively using electrophoretic mobility shift analysis (EMSA). These studies do not address the interaction of p53 with nuclear chromatin or the stability of p53-DBS interactions. In vivo footprinting examines the dynamic interactions of p53 protein in nuclear chromatin. p53 DBS affinity chromatography compares the stability of p53 from different cellular extracts with different DBS. Isogenic strains expressing high p53 levels, and deleted for p53, are required for controlled experiments using both methods. Different systems can be used to generate sufficient p53 protein (including DNA damage), and this results in the analysis of different forms of p53. A comparison of different cellular sources of high levels of p53 (in the presence and absence of DNA damage) vs different p53 DBS is required to appreciate the complexity of the regulation. Methods for comparing p53 from three different cellular sources with different DBS are presented here. The p53 research community needs to expand this analysis to complete the picture of how p53 differentially regulates transcription of target genes in nuclear chromatin.

  19. Characterization of a mitochondrially targeted single-stranded DNA-binding protein in Arabidopsis thaliana.

    Science.gov (United States)

    Edmondson, Andrew C; Song, Daqing; Alvarez, Luis A; Wall, Melisa K; Almond, David; McClellan, David A; Maxwell, Anthony; Nielsen, Brent L

    2005-04-01

    A gene encoding a predicted mitochondrially targeted single-stranded DNA binding protein (mtSSB) was identified in the Arabidopsis thaliana genome sequence. This gene (At4g11060) codes for a protein of 201 amino acids, including a 28-residue putative mitochondrial targeting transit peptide. Protein sequence alignment shows high similarity between the mtSSB protein and single-stranded DNA binding proteins (SSB) from bacteria, including residues conserved for SSB function. Phylogenetic analysis indicates a close relationship between this protein and other mitochondrially targeted SSB proteins. The predicted targeting sequence was fused with the GFP coding region, and the organellar localization of the expressed fusion protein was determined. Specific targeting to mitochondria was observed in in-vitro import experiments and by transient expression of a GFP fusion construct in Arabidopsis leaves after microprojectile bombardment. The mature mtSSB coding region was overexpressed in Escherichia coli and the protein was purified for biochemical characterization. The purified protein binds single-stranded, but not double-stranded, DNA. MtSSB stimulates the homologous strand-exchange activity of E. coli RecA. These results indicate that mtSSB is a functional homologue of the E. coli SSB, and that it may play a role in mitochondrial DNA recombination.

  20. Solution structure and DNA binding of the zinc-finger domain from DNA ligase IIIalpha.

    Science.gov (United States)

    Kulczyk, Arkadiusz W; Yang, Ji-Chun; Neuhaus, David

    2004-08-13

    DNA ligase IIIalpha carries out the final ligation step in the base excision repair (BER) and single strand break repair (SSBR) mechanisms of DNA repair. The enzyme recognises single-strand nicks and other damage features in double-stranded DNA, both through the catalytic domain and an N-terminal domain containing a single zinc finger. The latter is homologous to other zinc fingers that recognise damaged DNA, two in the N terminus of poly(adenosine-ribose)polymerase and three in the N terminus of the Arabidopsis thaliana nick-sensing DNA 3'-phosphoesterase. Here, we present the solution structure of the zinc-finger domain of human DNA ligase IIIalpha, the first structure of a finger from this group. It is related to that of the erythroid transcription factor GATA-1, but has an additional N-terminal beta-strand and C-terminal alpha-helix. Chemical shift mapping using a DNA ligand containing a single-stranded break showed that the DNA-binding surface of the DNA-ligase IIIalpha zinc finger is substantially different from that of GATA-1, consistent with the fact that the two proteins recognise very different features in the DNA. Likely implications for DNA binding are discussed.

  1. Characterization and DNA binding studies of unexplored imidazolidines by electronic absorption spectroscopy and cyclic voltammetry.

    Science.gov (United States)

    Shah, Afzal; Nosheen, Erum; Munir, Shamsa; Badshah, Amin; Qureshi, Rumana; Rehman, Zia-Ur-; Muhammad, Niaz; Hussain, Hidayat

    2013-03-05

    UV-Vis spectroscopic behavior of four imidazolidine derivatives i.e., [5-benzylideneimidazolidine-2,4-dione (NBI), 5-(2-hydroxybenzylidene)imidazolidine-2,4-dione (HBI), 5-(4-methoxybenzylidene)imidazolidine-2,4-dione (MBI) and 5-(3,4-di-methoxybenzylidene)imidazolidine-2,4-dione (DBI)] was studied in a wide pH range. Spectroscopic response of the studied compounds was found sensitive to pH and the attached substituents. Incited by anti-tumor activity, structural miscellany and biological applications of imidazolidines, the DNA binding affinity of some novel derivatives of this class of compounds was examined by cyclic voltammetry (CV) and UV-Vis spectroscopy at pH values of blood (7.4) and lysosomes (4.5). The CV results showed the following order of binding strength: KNBI (6.40×10(6)M(-1))>KHBI (1.77×10(5)M(-1))>KMBI (2.06×10(4)M(-1))>KDBI (1.01×10(4)M(-1)) at pH 7.4. The same order was also obtained from UV-Vis spectroscopy. The greater affinity of NBI justified its preferred candidature as an effective anti-cancer drug. The DNA binding propensity of these compounds was found comparable or greater than most of the clinically used anticancer drugs. Copyright © 2013 Elsevier B.V. All rights reserved.

  2. ACETYLATION INCREASES EWS-FLI1 DNA BINDING AND TRANSCRIPTIONAL ACTIVITY

    Directory of Open Access Journals (Sweden)

    Silke eSchlottmann

    2012-09-01

    Full Text Available Ewing Sarcoma (ES is associated with a balanced chromosomal translocation that in most cases leads to the expression of the oncogenic fusion protein and transcription factor EWS-FLI1. EWS-FLI1 has been shown to be crucial for ES cell survival and tumor growth. However, its regulation is still enigmatic. To date, no functionally significant posttranslational modifications of EWS-FLI1 have been shown. Since ES are sensitive to histone deacetylase inhibitors, and these inhibitors are advancing in clinical trials, we sought to identify if EWS-FLI1 is directly acetylated. We convincingly show acetylation of the C-terminal FLI1 (FLI1-CTD domain, which is the DNA binding domain of EWS-FLI1. In vitro acetylation studies showed that acetylated FLI1-CTD has higher DNA binding activity than the non-acetylated protein. Over-expression of PCAF or treatment with histone deacetylase inhibitors (HDI increased the transcriptional activity of EWS-FLI1, when co-expressed in COS7 cells. However, our data that evaluates the acetylation of ful-length EWS-FLI1 remains unclear, despite creating acetylation specific antibodies to four potential acetylation sites. We conclude that EWS-FLI1 may either gain access to chromatin as a result of histone acetylation or undergo regulation by direct acetylation. These data should be considered when patients are treated with HDAC inhibitors. Further investigation of this phenomenon will reveal if this potential acetylation has an impact on tumor response.

  3. Understanding the effect of polylysine architecture on DNA binding using molecular dynamics simulations.

    Science.gov (United States)

    Elder, Robert M; Emrick, Todd; Jayaraman, Arthi

    2011-11-14

    Polycations with varying chemistries and architectures have been synthesized and used in DNA transfection. In this paper we connect poly-L-lysine (PLL) architecture to DNA-binding strength, and in turn transfection efficiency, since experiments have shown that graft-type oligolysine architectures [e.g., poly(cyclooctene-g-oligolysine)] exhibit higher transfection efficiency than linear PLL. We use atomistic molecular dynamics simulations to study structural and thermodynamic effects of polycation-DNA binding for linear PLL and grafted oligolysines of varying graft lengths. Structurally, linear PLL binds in a concerted manner, while each oligolysine graft binds independently of its neighbors in the grafted architecture. Additionally, the presence of a hydrophobic backbone in the grafted architecture weakens binding to DNA compared to linear PLL. The binding free energy varies nonmonotonically with the graft length primarily due to entropic contributions. The binding free energy normalized to the number of bound amines is similar between the grafted and linear architectures at the largest (Poly5) and smallest (Poly2) graft length and stronger than the intermediate graft lengths (Poly3 and Poly4). These trends agree with experimental results that show higher transfection efficiency for Poly3 and Poly4 grafted oligolysines than for Poly5, Poly2, and linear PLL.

  4. A conformational checkpoint between DNA binding and cleavage by CRISPR-Cas9

    Science.gov (United States)

    Dagdas, Yavuz S.; Chen, Janice S.; Sternberg, Samuel H.; Doudna, Jennifer A.; Yildiz, Ahmet

    2017-01-01

    The Cas9 endonuclease is widely used for genome engineering applications by programming its single-guide RNA, and ongoing work is aimed at improving the accuracy and efficiency of DNA targeting. DNA cleavage of Cas9 is controlled by the conformational state of the HNH nuclease domain, but the mechanism that governs HNH activation at on-target DNA while reducing cleavage activity at off-target sites remains poorly understood. Using single-molecule Förster resonance energy transfer, we identified an intermediate state of Streptococcus pyogenes Cas9, representing a conformational checkpoint between DNA binding and cleavage. Upon DNA binding, the HNH domain transitions between multiple conformations before docking into its active state. HNH docking requires divalent cations, but not strand scission, and this docked conformation persists following DNA cleavage. Sequence mismatches between the DNA target and guide RNA prevent transitions from the checkpoint intermediate to the active conformation, providing selective avoidance of DNA cleavage at stably bound off-target sites. PMID:28808686

  5. Evolution of the B3 DNA binding superfamily: new insights into REM family gene diversification.

    Directory of Open Access Journals (Sweden)

    Elisson A C Romanel

    Full Text Available BACKGROUND: The B3 DNA binding domain includes five families: auxin response factor (ARF, abscisic acid-insensitive3 (ABI3, high level expression of sugar inducible (HSI, related to ABI3/VP1 (RAV and reproductive meristem (REM. The release of the complete genomes of the angiosperm eudicots Arabidopsis thaliana and Populus trichocarpa, the monocot Orysa sativa, the bryophyte Physcomitrella patens,the green algae Chlamydomonas reinhardtii and Volvox carteri and the red algae Cyanidioschyzon melorae provided an exceptional opportunity to study the evolution of this superfamily. METHODOLOGY: In order to better understand the origin and the diversification of B3 domains in plants, we combined comparative phylogenetic analysis with exon/intron structure and duplication events. In addition, we investigated the conservation and divergence of the B3 domain during the origin and evolution of each family. CONCLUSIONS: Our data indicate that showed that the B3 containing genes have undergone extensive duplication events, and that the REM family B3 domain has a highly diverged DNA binding. Our results also indicate that the founding member of the B3 gene family is likely to be similar to the ABI3/HSI genes found in C. reinhardtii and V. carteri. Among the B3 families, ABI3, HSI, RAV and ARF are most structurally conserved, whereas the REM family has experienced a rapid divergence. These results are discussed in light of their functional and evolutionary roles in plant development.

  6. Bombyx mori nucleopolyhedrovirus encodes a DNA-binding protein capable of destabilizing duplex DNA.

    Science.gov (United States)

    Mikhailov, V S; Mikhailova, A L; Iwanaga, M; Gomi, S; Maeda, S

    1998-04-01

    A DNA-binding protein (designated DBP) with an apparent molecular mass of 38 kDa was purified to homogeneity from BmN cells (derived from Bombyx mori) infected with the B. mori nucleopolyhedrovirus (BmNPV). Six peptides obtained after digestion of the isolated protein with Achromobacter protease I were partially or completely sequenced. The determined amino acid sequences indicated that DBP was encoded by an open reading frame (ORF16) located at nucleotides (nt) 16189 to 17139 in the BmNPV genome (GenBank accession no. L33180). This ORF (designated dbp) is a homolog of Autographa californica multicapsid NPV ORF25, whose product has not been identified. BmNPV DBP is predicted to contain 317 amino acids (calculated molecular mass of 36.7 kDa) and to have an isoelectric point of 7.8. DBP showed a tendency to multimerization in the course of purification and was found to bind preferentially to single-stranded DNA. When bound to oligonucleotides, DBP protected them from hydrolysis by phage T4 DNA polymerase-associated 3'-->5' exonuclease. The sizes of the protected fragments indicated that a binding site size for DBP is about 30 nt per protein monomer. DBP, but not BmNPV LEF-3, was capable of unwinding partial DNA duplexes in an in vitro system. This helix-destabilizing ability is consistent with the prediction that DBP functions as a single-stranded DNA binding protein in virus replication.

  7. Porcine bocavirus NP1 negatively regulates interferon signaling pathway by targeting the DNA-binding domain of IRF9

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Ruoxi [State Key Laboratory of Agricultural Microbiology, College of Veterinary Medicine, Huazhong Agricultural University, Wuhan 430070 (China); The Cooperative Innovation Center for Sustainable Pig Production, Wuhan 430070 (China); Fang, Liurong, E-mail: fanglr@mail.hzau.edu.cn [State Key Laboratory of Agricultural Microbiology, College of Veterinary Medicine, Huazhong Agricultural University, Wuhan 430070 (China); The Cooperative Innovation Center for Sustainable Pig Production, Wuhan 430070 (China); Wang, Dang; Cai, Kaimei; Zhang, Huan [State Key Laboratory of Agricultural Microbiology, College of Veterinary Medicine, Huazhong Agricultural University, Wuhan 430070 (China); The Cooperative Innovation Center for Sustainable Pig Production, Wuhan 430070 (China); Xie, Lilan; Li, Yi [College of Life Science and Technology, Wuhan Institute of Bioengineering, Wuhan 430415 (China); Chen, Huanchun; Xiao, Shaobo [State Key Laboratory of Agricultural Microbiology, College of Veterinary Medicine, Huazhong Agricultural University, Wuhan 430070 (China); The Cooperative Innovation Center for Sustainable Pig Production, Wuhan 430070 (China)

    2015-11-15

    To subvert host antiviral immune responses, many viruses have evolved countermeasures to inhibit IFN signaling pathway. Porcine bocavirus (PBoV), a newly identified porcine parvovirus, has received attention because it shows clinically high co-infection prevalence with other pathogens in post-weaning multisystemic wasting syndrome (PWMS) and diarrheic piglets. In this study, we screened the structural and non-structural proteins encoded by PBoV and found that the non-structural protein NP1 significantly suppressed IFN-stimulated response element (ISRE) activity and subsequent IFN-stimulated gene (ISG) expression. However, NP1 affected neither the activation and translocation of STAT1/STAT2, nor the formation of the heterotrimeric transcription factor complex ISGF3 (STAT1/STAT2/IRF9). Detailed analysis demonstrated that PBoV NP1 blocked the ISGF3 DNA-binding activity by combining with the DNA-binding domain (DBD) of IRF9. In summary, these results indicate that PBoV NP1 interferes with type I IFN signaling pathway by blocking DNA binding of ISGF3 to attenuate innate immune responses. - Highlights: • Porcine bocavirus (PBoV) NP1 interferes with the IFN α/β signaling pathway. • PBoV NP1 does not prevent STAT1/STAT2 phosphorylation and nuclear translocation. • PBoV NP1 inhibits the DNA-binding activity of ISGF3. • PBoV NP1 interacts with the DNA-binding domain of IRF9.

  8. Coupled binding-bending-folding: The complex conformational dynamics of protein-DNA binding studied by atomistic molecular dynamics simulations.

    Science.gov (United States)

    van der Vaart, Arjan

    2015-05-01

    Protein-DNA binding often involves dramatic conformational changes such as protein folding and DNA bending. While thermodynamic aspects of this behavior are understood, and its biological function is often known, the mechanism by which the conformational changes occur is generally unclear. By providing detailed structural and energetic data, molecular dynamics simulations have been helpful in elucidating and rationalizing protein-DNA binding. This review will summarize recent atomistic molecular dynamics simulations of the conformational dynamics of DNA and protein-DNA binding. A brief overview of recent developments in DNA force fields is given as well. Simulations have been crucial in rationalizing the intrinsic flexibility of DNA, and have been instrumental in identifying the sequence of binding events, the triggers for the conformational motion, and the mechanism of binding for a number of important DNA-binding proteins. Molecular dynamics simulations are an important tool for understanding the complex binding behavior of DNA-binding proteins. With recent advances in force fields and rapid increases in simulation time scales, simulations will become even more important for future studies. This article is part of a Special Issue entitled Recent developments of molecular dynamics. Copyright © 2014. Published by Elsevier B.V.

  9. Functional characterization of a conserved archaeal viral operon revealing single-stranded DNA binding, annealing and nuclease activities

    DEFF Research Database (Denmark)

    Guo, Yang; Kragelund, Birthe Brandt; White, Malcolm F.

    2015-01-01

    encoding proteins of unknown function and forming an operon with ORF207 (gp19). SIRV2 gp17 was found to be a single-stranded DNA (ssDNA) binding protein different in structure from all previously characterized ssDNA binding proteins. Mutagenesis of a few conserved basic residues suggested a U......-shaped binding path for ssDNA. The recombinant gp18 showed an ssDNA annealing activity often associated with helicases and recombinases. To gain insight into the biological role of the entire operon, we characterized SIRV2 gp19 and showed it to possess a 5'→3' ssDNA exonuclease activity, in addition...... for rudiviruses and the close interaction among the ssDNA binding, annealing and nuclease proteins strongly point to a role of the gene operon in genome maturation and/or DNA recombination that may function in viral DNA replication/repair....

  10. Structure and Cellular Dynamics of Deinococcus radiodurans Single-stranded DNA (ssDNA)-binding Protein (SSB)-DNA Complexes*

    Science.gov (United States)

    George, Nicholas P.; Ngo, Khanh V.; Chitteni-Pattu, Sindhu; Norais, Cédric A.; Battista, John R.; Cox, Michael M.; Keck, James L.

    2012-01-01

    The single-stranded DNA (ssDNA)-binding protein from the radiation-resistant bacterium Deinococcus radiodurans (DrSSB) functions as a homodimer in which each monomer contains two oligonucleotide-binding (OB) domains. This arrangement is exceedingly rare among bacterial SSBs, which typically form homotetramers of single-OB domain subunits. To better understand how this unusual structure influences the DNA binding and biological functions of DrSSB in D. radiodurans radiation resistance, we have examined the structure of DrSSB in complex with ssDNA and the DNA damage-dependent cellular dynamics of DrSSB. The x-ray crystal structure of the DrSSB-ssDNA complex shows that ssDNA binds to surfaces of DrSSB that are analogous to those mapped in homotetrameric SSBs, although there are distinct contacts in DrSSB that mediate species-specific ssDNA binding. Observations by electron microscopy reveal two salt-dependent ssDNA-binding modes for DrSSB that strongly resemble those of the homotetrameric Escherichia coli SSB, further supporting a shared overall DNA binding mechanism between the two classes of bacterial SSBs. In vivo, DrSSB levels are heavily induced following exposure to ionizing radiation. This accumulation is accompanied by dramatic time-dependent DrSSB cellular dynamics in which a single nucleoid-centric focus of DrSSB is observed within 1 h of irradiation but is dispersed by 3 h after irradiation. These kinetics parallel those of D. radiodurans postirradiation genome reconstitution, suggesting that DrSSB dynamics could play important organizational roles in DNA repair. PMID:22570477

  11. Ethylene and not embolism is required for wound-induced tylose development in stems of grapevines.

    Science.gov (United States)

    Sun, Qiang; Rost, Thomas L; Reid, Michael S; Matthews, Mark A

    2007-12-01

    The pruning of actively growing grapevines (Vitis vinifera) resulted in xylem vessel embolisms and a stimulation of tylose formation in the vessels below the pruning wound. Pruning was also followed by a 10-fold increase in the concentration of ethylene at the cut surface. When the pruning cut was made under water and maintained in water, embolisms were prevented, but there was no reduction in the formation of tyloses or the accumulation of ethylene. Treatment of the stems with inhibitors of ethylene biosynthesis (aminoethoxyvinylglycine) and/or action (silver thiosulfate) delayed and greatly reduced the formation of tyloses in xylem tissue and the size and number of those that formed in individual vessels. Our data are consistent with the hypotheses that wound ethylene production is the cause of tylose formation and that embolisms in vessels are not directly required for wound-induced tylosis in pruned grapevines. The possible role of ethylene in the formation of tyloses in response to other stresses and during development, maturation, and senescence is discussed.

  12. C-terminal diversity within the p53 family accounts for differences in DNA binding and transcriptional activity

    OpenAIRE

    Sauer, Markus; Bretz, Anne Catherine; Beinoraviciute-Kellner, Rasa; Beitzinger, Michaela; Burek, Christof; Rosenwald, Andreas; Harms, Gregory S.; Stiewe, Thorsten

    2008-01-01

    The p53 family is known as a family of transcription factors with functions in tumor suppression and development. Whereas the central DNA-binding domain is highly conserved among the three family members p53, p63 and p73, the C-terminal domains (CTDs) are diverse and subject to alternative splicing and post-translational modification. Here we demonstrate that the CTDs strongly influence DNA binding and transcriptional activity: while p53 and the p73 isoform p73γ have basic CTDs and form weak ...

  13. Role of teh Rad52 Amino-terminal DNA Binding Activity in DNA Strand Capture in Homologous Recombination

    DEFF Research Database (Denmark)

    Shi, Idina; Hallwyl, Swee Chuang Lim; Seong, Changhyun

    2009-01-01

    -terminal DNA binding domain, is capable of Rad51 delivery to DNA but is deficient in DNA annealing. Results from chromatin immunoprecipitation experiments find that rad52-R70A associates with DNA double-strand breaks and promotes recruitment of Rad51 as efficiently as wild-type Rad52. Analysis of gene...... conversion intermediates reveals that rad52-R70A cells can mediate DNA strand invasion but are unable to complete the recombination event. These results provide evidence that DNA binding by the evolutionarily conserved amino terminus of Rad52 is needed for the capture of the second DNA end during homologous...

  14. Campylobacter jejuni DNA-binding protein from starved cells in Guillain-Barré syndrome patients.

    Science.gov (United States)

    Kawamura, Nobutoshi; Piao, Hua; Minohara, Motozumi; Matsushita, Takuya; Kusunoki, Susumu; Matsumoto, Hiroshi; Ikenaka, Kazuhiro; Mizunoe, Yoshimitsu; Kira, Jun-ichi

    2011-12-15

    Campylobacter jejuni enteritis is frequently associated with an axonal form of Guillain-Barré syndrome (GBS) and C. jejuni DNA-binding protein from starved cells (C-Dps) induces paranodal myelin detachment and axonal degeneration through binding with sulfatide in vivo. Here we investigated the invasion of C-Dps into hosts with C. jejuni-related GBS. Our analyses of patient sera found that both C-Dps and anti-C-Dps antibodies were most commonly detected in sera from C. jejuni-related GBS patients (5/27, 14.8% and 15/24, 62.5%; respectively). These findings suggest that C-Dps invades the host and may potentially contribute to the peripheral nerve damage in C. jejuni-related GBS. Copyright © 2011 Elsevier B.V. All rights reserved.

  15. Single-Molecule Studies of ssDNA-Binding Proteins Exchange.

    Science.gov (United States)

    Yang, Olivia; Ha, Taekjip

    2018-01-01

    Single-stranded DNA-binding protein (SSB) is important not only for the protection of single-stranded DNA (ssDNA) but also for the recruitment of other proteins for DNA replication, recombination, and repair. The interaction of SSB with ssDNA is highly dynamic as it exists as an intermediate during cellular processes that unwind dsDNA. It has been proposed that SSB redistributes itself among multiple ssDNA segments, but transient intermediates are difficult to observe in bulk experiments. We can use single-molecule FRET microscopy to observe intermediates of the transfer of a single Escherichia coli SSB from one ssDNA strand to another or exchange of one SSB for another on a single ssDNA in real time. This single-molecule approach can be further applicable to understand relative binding affinities and competitive dynamics for other SSBs and variants across various systems. © 2018 Elsevier Inc. All rights reserved.

  16. MARs Wars: heterogeneity and clustering of DNA-binding domains in the nuclear matrix

    Directory of Open Access Journals (Sweden)

    Ioudinkova E. S.

    2009-12-01

    Full Text Available Aim. CO326 is a chicken nuclear scaffold/matrix attachment region (MAR associated with the nuclear matrix in several types of chicken cells. It contains a binding site for a sequence-specific DNA-binding protein, F326. We have studied its interaction with the nuclear matrix. Methods. We have used an in vitro MAR assay with isolated matrices from chicken HD3 cells. Results. We have found that an oligonucleotide binding site for the F326 inhibits binding of the CO326 to the nuclear matrix. At the same time, the binding of heterologous MARs is enhanced. Conclusions. Taken together, these data suggest that there exist several classes of MARs and MAR-binding domains and that the MAR-binding proteins may be clustered in the nuclear matrix.

  17. Synthesis, characterization, DNA binding and cleavage studies of mixed-ligand copper (II complexes

    Directory of Open Access Journals (Sweden)

    M. Sunita

    2017-05-01

    Full Text Available New two copper complexes of type [Cu(Bzimpy(LH2O]SO4 (where L = 2,2′ bipyridine (bpy, and ethylene diamine (en, Bzimpy = 2,6-bis(benzimidazole-2ylpyridine have been synthesized and characterized by elemental analyses, molar conductance measurements, magnetic susceptibility measurements, mass, IR, electronic and EPR spectral studies. Based on elemental and spectral studies six coordinated geometries were assigned to the two complexes. DNA-binding properties of these metal complexes were investigated using absorption spectroscopy, fluorescence spectroscopy, viscosity measurements and thermal denaturation methods. Experimental studies suggest that the complexes bind to DNA through intercalation. These complexes also promote the cleavage of plasmid pBR322, in the presence of H2O2.

  18. Footprinting: a method for determining the sequence selectivity, affinity and kinetics of DNA-binding ligands.

    Science.gov (United States)

    Hampshire, Andrew J; Rusling, David A; Broughton-Head, Victoria J; Fox, Keith R

    2007-06-01

    Footprinting is a simple method for assessing the sequence selectivity of DNA-binding ligands. The method is based on the ability of the ligand to protect DNA from cleavage at its binding site. This review describes the use of DNase I and hydroxyl radicals, the most commonly used footprinting probes, in footprinting experiments. The success of a footprinting experiment depends on using an appropriate DNA substrate and we describe how these can best be chosen or designed. Although footprinting was originally developed for assessing a ligand's sequence selectivity, it can also be employed to estimate the binding strength (quantitative footprinting) and to assess the association and dissociation rate constants for slow binding reactions.

  19. The role of DNA binding sites and slow unbinding kinetics in titration-based oscillators

    CERN Document Server

    Karapetyan, Sargis

    2015-01-01

    Genetic oscillators, such as circadian clocks, are constantly perturbed by molecular noise arising from the small number of molecules involved in gene regulation. One of the strongest sources of stochasticity is the binary noise that arises from the binding of a regulatory protein to a promoter in the chromosomal DNA. In this study, we focus on two minimal oscillators based on activator titration and repressor titration to understand the key parameters that are important for oscillations and for overcoming binary noise. We show that the rate of unbinding from the DNA, despite traditionally being considered a fast parameter, needs to be slow to broaden the space of oscillatory solutions. The addition of multiple, independent DNA binding sites further expands the oscillatory parameter space for the repressor-titration oscillator and lengthens the period of both oscillators. This effect is a combination of increased effective delay of the unbinding kinetics due to multiple binding sites and increased promoter ul...

  20. Synthesis, DNA-binding, and photocleavage properties of a serious of porphyrin-daunomycin hybrids.

    Science.gov (United States)

    Zhao, Ping; Lu, Jia-Zheng; He, Juan; Chen, Wan-Hua; Chen, Pan-Pan; Chen, Dian-Wen; Bin, Qian-Yun

    2014-01-01

    It is widely accepted that the pharmacological activities of anthracyclines antitumor agents express when the quinone-containing chromophore intercalates into base pairs of the duplex DNA. We have successfully synthesized and investigated the DNA-interactions of hybrids composed with quinone chromophore and cationic porphyrin. Herein, a clinic anticancer drug, daunomycin, is introduced to the porphyrin hybrids through different lengths of amide alkyl linkages, and their interactions and cleavage to DNA were studied compared with the previous porphyrin-quinone hybrids. Spectral results and the determined binding affinity constants (Kb) show that the attachment of daunomycin to porphyrin could improve the DNA-binding and photocleaving abilities. The porphyrin-daunomycin hybrids may find useful employment in investigating the ligand-DNA interaction.

  1. Purification, properties and identification of a serum DNA binding protein (64DP) and its microheterogeneity.

    Science.gov (United States)

    Tsuda, M; Ohkubo, T; Kamiguchi, H; Suzuki, K; Nakasaki, H; Mitomi, T; Katsunuma, T

    1982-03-01

    A DNA binding protein with a molecular weight of 64,000, designated 64DP, has been purified and characterized. This protein was isolated from adult human pooled serum by DEAE Sephadex column Chromatography, DNA cellulose affinity column chromatography, ammonium sulfate fractionation and Sephadex G-150 gel filtration. The final preparation of 64DP was homogeneous, as judged from polyacrylamide gel electrophoresis with or without sodium dodecyl sulfate and sedimentation experiments. Physicochemical and immunochemical properties of this protein were very similar or identical to those of alpha-1-antichymotrypsin with some differences in electric mobility and th pattern of isoelectric focusing. Furthermore, the general properties of 64DP from various sera were practically similar with the exception that isolectric focusing analysis showed microheterogeneity among 64DP purified from various sera.

  2. The inhibition of anti-DNA binding to DNA by nucleic acid binding polymers.

    Directory of Open Access Journals (Sweden)

    Nancy A Stearns

    Full Text Available Antibodies to DNA (anti-DNA are the serological hallmark of systemic lupus erythematosus (SLE and can mediate disease pathogenesis by the formation of immune complexes. Since blocking immune complex formation can attenuate disease manifestations, the effects of nucleic acid binding polymers (NABPs on anti-DNA binding in vitro were investigated. The compounds tested included polyamidoamine dendrimer, 1,4-diaminobutane core, generation 3.0 (PAMAM-G3, hexadimethrine bromide, and a β-cylodextrin-containing polycation. As shown with plasma from patients with SLE, NABPs can inhibit anti-DNA antibody binding in ELISA assays. The inhibition was specific since the NABPs did not affect binding to tetanus toxoid or the Sm protein, another lupus autoantigen. Furthermore, the polymers could displace antibody from preformed complexes. Together, these results indicate that NABPs can inhibit the formation of immune complexes and may represent a new approach to treatment.

  3. Phylogenetic and functional analysis of the bacteriophage P1 single-stranded DNA-binding protein

    DEFF Research Database (Denmark)

    Bendtsen, Jannick Dyrløv; Nilsson, A.S.; Lehnherr, H.

    2002-01-01

    Bacteriophage P1 encodes a single-stranded DNA-binding protein (SSB-P1), which shows 66% amino acid sequence identity to the SSB protein of the host bacterium Escherichia coli. A phylogenetic analysis indicated that the P1 ssb gene coexists with its E. coli counterpart as an independent unit....... Expression studies showed that the P1 ssb gene is transcribed only, in an rpoS-independent fashion, during stationary-phase growth in E. coli. Mixed infection experiments demonstrated that a wild-type phage has a selective advantage over an ssb-null mutant when exposed to a bacterial host in the stationary...... phase. These results reconciled the observed evolutionary conservation with the seemingly redundant presence of ssb genes in many bacteriophages and conjugative plasmids....

  4. Association of condensin with chromosomes depends on DNA binding by its HEAT-repeat subunits.

    Science.gov (United States)

    Piazza, Ilaria; Rutkowska, Anna; Ori, Alessandro; Walczak, Marta; Metz, Jutta; Pelechano, Vicent; Beck, Martin; Haering, Christian H

    2014-06-01

    Condensin complexes have central roles in the three-dimensional organization of chromosomes during cell divisions, but how they interact with chromatin to promote chromosome segregation is largely unknown. Previous work has suggested that condensin, in addition to encircling chromatin fibers topologically within the ring-shaped structure formed by its SMC and kleisin subunits, contacts DNA directly. Here we describe the discovery of a binding domain for double-stranded DNA formed by the two HEAT-repeat subunits of the Saccharomyces cerevisiae condensin complex. From detailed mapping data of the interfaces between the HEAT-repeat and kleisin subunits, we generated condensin complexes that lack one of the HEAT-repeat subunits and consequently fail to associate with chromosomes in yeast and human cells. The finding that DNA binding by condensin's HEAT-repeat subunits stimulates the SMC ATPase activity suggests a multistep mechanism for the loading of condensin onto chromosomes.

  5. Steps in the process of DNA binding and entry in transformation. [Pneumococcus

    Energy Technology Data Exchange (ETDEWEB)

    Lacks, S

    1978-01-01

    The DNA uptake phase of genetic transformation in S. pheumoniae is reviewed with emphasis on molecular interactions at each step. An initial, reversible binding appears to be dependent on the molecular concentration of donor DNA. Subsequent irreversible binding, limited to the numbr of molecules corresponding to a fixed number of receptor sites, requires potassium ions and energy. Competition of different DNAs for uptake occurs at the initial step, but depends on the size of the DNA as well as its molecular concentration. Single-strand breakage accompanies irreversible binding of DNA. The frequency of breaks does not appear to depend on DNA concentration. Entry of DNA follows irreversible binding. The entry step, in which donor DNA is converted to single strands, requires action of a membrane nuclease. In the membrane this nuclease is part ofa specific multiprotein structure, which may function as a unit in DNA binding and entry.

  6. BuD, a helix–loop–helix DNA-binding domain for genome modification

    Energy Technology Data Exchange (ETDEWEB)

    Stella, Stefano [Spanish National Cancer Research Centre (CNIO), Calle de Melchor Fernández Almagro 3, 28029 Madrid (Spain); University of Copenhagen, Blegdamsvej 3B, 2200 Copenhagen (Denmark); Molina, Rafael; López-Méndez, Blanca [Spanish National Cancer Research Centre (CNIO), Calle de Melchor Fernández Almagro 3, 28029 Madrid (Spain); Juillerat, Alexandre; Bertonati, Claudia; Daboussi, Fayza [Cellectis, 8 Rue de la Croix Jarry, 75013 Paris (France); Campos-Olivas, Ramon [Spanish National Cancer Research Centre (CNIO), Calle de Melchor Fernández Almagro 3, 28029 Madrid (Spain); Duchateau, Phillippe [Cellectis, 8 Rue de la Croix Jarry, 75013 Paris (France); Montoya, Guillermo, E-mail: guillermo.montoya@cpr.ku.dk [Spanish National Cancer Research Centre (CNIO), Calle de Melchor Fernández Almagro 3, 28029 Madrid (Spain); University of Copenhagen, Blegdamsvej 3B, 2200 Copenhagen (Denmark)

    2014-07-01

    Crystal structures of BurrH and the BurrH–DNA complex are reported. DNA editing offers new possibilities in synthetic biology and biomedicine for modulation or modification of cellular functions to organisms. However, inaccuracy in this process may lead to genome damage. To address this important problem, a strategy allowing specific gene modification has been achieved through the addition, removal or exchange of DNA sequences using customized proteins and the endogenous DNA-repair machinery. Therefore, the engineering of specific protein–DNA interactions in protein scaffolds is key to providing ‘toolkits’ for precise genome modification or regulation of gene expression. In a search for putative DNA-binding domains, BurrH, a protein that recognizes a 19 bp DNA target, was identified. Here, its apo and DNA-bound crystal structures are reported, revealing a central region containing 19 repeats of a helix–loop–helix modular domain (BurrH domain; BuD), which identifies the DNA target by a single residue-to-nucleotide code, thus facilitating its redesign for gene targeting. New DNA-binding specificities have been engineered in this template, showing that BuD-derived nucleases (BuDNs) induce high levels of gene targeting in a locus of the human haemoglobin β (HBB) gene close to mutations responsible for sickle-cell anaemia. Hence, the unique combination of high efficiency and specificity of the BuD arrays can push forward diverse genome-modification approaches for cell or organism redesign, opening new avenues for gene editing.

  7. Nonequilibrium synthesis and assembly of hybrid inorganic-protein nanostructures using an engineered DNA binding protein.

    Science.gov (United States)

    Dai, Haixia; Choe, Woo-Seok; Thai, Corrine K; Sarikaya, Mehmet; Traxler, Beth A; Baneyx, François; Schwartz, Daniel T

    2005-11-09

    We show that a protein with no intrinsic inorganic synthesis activity can be endowed with the ability to control the formation of inorganic nanostructures under thermodynamically unfavorable (nonequilibrium) conditions, reproducing a key feature of biological hard-tissue growth and assembly. The nonequilibrium synthesis of Cu(2)O nanoparticles is accomplished using an engineered derivative of the DNA-binding protein TraI in a room-temperature precursor electrolyte. The functional TraI derivative (TraIi1753::CN225) is engineered to possess a cysteine-constrained 12-residue Cu(2)O binding sequence, designated CN225, that is inserted into a permissive site in TraI. When TraIi1753::CN225 is included in the precursor electrolyte, stable Cu(2)O nanoparticles form, even though the concentrations of [Cu(+)] and [OH(-)] are at 5% of the solubility product (K(sp,Cu2O)). Negative control experiments verify that Cu(2)O formation is controlled by inclusion of the CN225 binding sequence. Transmission electron microscopy and electron diffraction reveal a core-shell structure for the nonequilibrium nanoparticles: a 2 nm Cu(2)O core is surrounded by an adsorbed protein shell. Quantitative protein adsorption studies show that the unexpected stability of Cu(2)O is imparted by the nanomolar surface binding affinity of TraIi1753::CN225 for Cu(2)O (K(d) = 1.2 x 10(-)(8) M), which provides favorable interfacial energetics (-45 kJ/mol) for the core-shell configuration. The protein shell retains the DNA-binding traits of TraI, as evidenced by the spontaneous organization of nanoparticles onto circular double-stranded DNA.

  8. Quantitation of glucocorticoid receptor DNA-binding dynamics by single-molecule microscopy and FRAP.

    Science.gov (United States)

    Groeneweg, Femke L; van Royen, Martin E; Fenz, Susanne; Keizer, Veer I P; Geverts, Bart; Prins, Jurrien; de Kloet, E Ron; Houtsmuller, Adriaan B; Schmidt, Thomas S; Schaaf, Marcel J M

    2014-01-01

    Recent advances in live cell imaging have provided a wealth of data on the dynamics of transcription factors. However, a consistent quantitative description of these dynamics, explaining how transcription factors find their target sequences in the vast amount of DNA inside the nucleus, is still lacking. In the present study, we have combined two quantitative imaging methods, single-molecule microscopy and fluorescence recovery after photobleaching, to determine the mobility pattern of the glucocorticoid receptor (GR) and the mineralocorticoid receptor (MR), two ligand-activated transcription factors. For dexamethasone-activated GR, both techniques showed that approximately half of the population is freely diffusing, while the remaining population is bound to DNA. Of this DNA-bound population about half the GRs appeared to be bound for short periods of time (∼ 0.7 s) and the other half for longer time periods (∼ 2.3 s). A similar pattern of mobility was seen for the MR activated by aldosterone. Inactive receptors (mutant or antagonist-bound receptors) show a decreased DNA binding frequency and duration, but also a higher mobility for the diffusing population. Likely, very brief (≤ 1 ms) interactions with DNA induced by the agonists underlie this difference in diffusion behavior. Surprisingly, different agonists also induce different mobilities of both receptors, presumably due to differences in ligand-induced conformational changes and receptor complex formation. In summary, our data provide a consistent quantitative model of the dynamics of GR and MR, indicating three types of interactions with DNA, which fit into a model in which frequent low-affinity DNA binding facilitates the search for high-affinity target sequences.

  9. Quantitation of glucocorticoid receptor DNA-binding dynamics by single-molecule microscopy and FRAP.

    Directory of Open Access Journals (Sweden)

    Femke L Groeneweg

    Full Text Available Recent advances in live cell imaging have provided a wealth of data on the dynamics of transcription factors. However, a consistent quantitative description of these dynamics, explaining how transcription factors find their target sequences in the vast amount of DNA inside the nucleus, is still lacking. In the present study, we have combined two quantitative imaging methods, single-molecule microscopy and fluorescence recovery after photobleaching, to determine the mobility pattern of the glucocorticoid receptor (GR and the mineralocorticoid receptor (MR, two ligand-activated transcription factors. For dexamethasone-activated GR, both techniques showed that approximately half of the population is freely diffusing, while the remaining population is bound to DNA. Of this DNA-bound population about half the GRs appeared to be bound for short periods of time (∼ 0.7 s and the other half for longer time periods (∼ 2.3 s. A similar pattern of mobility was seen for the MR activated by aldosterone. Inactive receptors (mutant or antagonist-bound receptors show a decreased DNA binding frequency and duration, but also a higher mobility for the diffusing population. Likely, very brief (≤ 1 ms interactions with DNA induced by the agonists underlie this difference in diffusion behavior. Surprisingly, different agonists also induce different mobilities of both receptors, presumably due to differences in ligand-induced conformational changes and receptor complex formation. In summary, our data provide a consistent quantitative model of the dynamics of GR and MR, indicating three types of interactions with DNA, which fit into a model in which frequent low-affinity DNA binding facilitates the search for high-affinity target sequences.

  10. NeuroD Factors Discriminate Mineralocorticoid From Glucocorticoid Receptor DNA Binding in the Male Rat Brain.

    Science.gov (United States)

    van Weert, Lisa T C M; Buurstede, Jacobus C; Mahfouz, Ahmed; Braakhuis, Pamela S M; Polman, J Annelies E; Sips, Hetty C M; Roozendaal, Benno; Balog, Judit; de Kloet, E Ronald; Datson, Nicole A; Meijer, Onno C

    2017-05-01

    In the limbic brain, mineralocorticoid receptors (MRs) and glucocorticoid receptors (GRs) both function as receptors for the naturally occurring glucocorticoids (corticosterone/cortisol) but mediate distinct effects on cellular physiology via transcriptional mechanisms. The transcriptional basis for specificity of these MR- vs GR-mediated effects is unknown. To address this conundrum, we have identified the extent of MR/GR DNA-binding selectivity in the rat hippocampus using chromatin immunoprecipitation followed by sequencing. We found 918 and 1450 nonoverlapping binding sites for MR and GR, respectively. Furthermore, 475 loci were co-occupied by MR and GR. De novo motif analysis resulted in a similar binding motif for both receptors at 100% of the target loci, which matched the known glucocorticoid response element (GRE). In addition, the Atoh/NeuroD consensus sequence was found in co-occurrence with all MR-specific binding sites but was absent for GR-specific or MR-GR overlapping sites. Basic helix-loop-helix family members Neurod1, Neurod2, and Neurod6 showed hippocampal expression and were hypothesized to bind the Atoh motif. Neurod2 was detected at rat hippocampal MR binding sites but not at GR-exclusive sites. All three NeuroD transcription factors acted as DNA-binding-dependent coactivators for both MR and GR in reporter assays in heterologous HEK293 cells, likely via indirect interactions with the receptors. In conclusion, a NeuroD family member binding to an additional motif near the GRE seems to drive specificity for MR over GR binding at hippocampal binding sites. Copyright © 2017 Endocrine Society.

  11. Multiple DNA-binding modes for the ETS family transcription factor PU.1.

    Science.gov (United States)

    Esaki, Shingo; Evich, Marina G; Erlitzki, Noa; Germann, Markus W; Poon, Gregory M K

    2017-09-29

    The eponymous DNA-binding domain of ETS ( E 26 t ransformation- s pecific) transcription factors binds a single sequence-specific site as a monomer over a single helical turn. Following our previous observation by titration calorimetry that the ETS member PU.1 dimerizes sequentially at a single sequence-specific DNA-binding site to form a 2:1 complex, we have carried out an extensive spectroscopic and biochemical characterization of site-specific PU.1 ETS complexes. Whereas 10 bp of DNA was sufficient to support PU.1 binding as a monomer, additional flanking bases were required to invoke sequential dimerization of the bound protein. NMR spectroscopy revealed a marked loss of signal intensity in the 2:1 complex, and mutational analysis implicated the distal surface away from the bound DNA as the dimerization interface. Hydroxyl radical DNA footprinting indicated that the site-specifically bound PU.1 dimers occupied an extended DNA interface downstream from the 5'-GGAA-3' core consensus relative to its 1:1 counterpart, thus explaining the apparent site size requirement for sequential dimerization. The site-specifically bound PU.1 dimer resisted competition from nonspecific DNA and showed affinities similar to other functionally significant PU.1 interactions. As sequential dimerization did not occur with the ETS domain of Ets-1, a close structural homolog of PU.1, 2:1 complex formation may represent an alternative autoinhibitory mechanism in the ETS family at the protein-DNA level. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  12. Neighboring genes for DNA-binding proteins rescue male sterility in Drosophila hybrids.

    Science.gov (United States)

    Liénard, Marjorie A; Araripe, Luciana O; Hartl, Daniel L

    2016-07-19

    Crosses between closely related animal species often result in male hybrids that are sterile, and the molecular and functional basis of genetic factors for hybrid male sterility is of great interest. Here, we report a molecular and functional analysis of HMS1, a region of 9.2 kb in chromosome 3 of Drosophila mauritiana, which results in virtually complete hybrid male sterility when homozygous in the genetic background of sibling species Drosophila simulans. The HMS1 region contains two strong candidate genes for the genetic incompatibility, agt and Taf1 Both encode unrelated DNA-binding proteins, agt for an alkyl-cysteine-S-alkyltransferase and Taf1 for a subunit of transcription factor TFIID that serves as a multifunctional transcriptional regulator. The contribution of each gene to hybrid male sterility was assessed by means of germ-line transformation, with constructs containing complete agt and Taf1 genomic sequences as well as various chimeric constructs. Both agt and Taf1 contribute about equally to HMS1 hybrid male sterility. Transgenes containing either locus rescue sterility in about one-half of the males, and among fertile males the number of offspring is in the normal range. This finding suggests compensatory proliferation of the rescued, nondysfunctional germ cells. Results with chimeric transgenes imply that the hybrid incompatibilities result from interactions among nucleotide differences residing along both agt and Taf1 Our results challenge a number of preliminary generalizations about the molecular and functional basis of hybrid male sterility, and strongly reinforce the role of DNA-binding proteins as a class of genes contributing to the maintenance of postzygotic reproductive isolation.

  13. An Mcm10 Mutant Defective in ssDNA Binding Shows Defects in DNA Replication Initiation.

    Science.gov (United States)

    Perez-Arnaiz, Patricia; Kaplan, Daniel L

    2016-11-20

    Mcm10 is an essential protein that functions to initiate DNA replication after the formation of the replication fork helicase. In this manuscript, we identified a budding yeast Mcm10 mutant (Mcm10-m2,3,4) that is defective in DNA binding in vitro. Moreover, this Mcm10-m2,3,4 mutant does not stimulate the phosphorylation of Mcm2 by Dbf4-dependent kinase (DDK) in vitro. When we expressed wild-type levels of mcm10-m2,3,4 in budding yeast cells, we observed a severe growth defect and a substantially decreased DNA replication. We also observed a substantially reduced replication protein A- chromatin immunoprecipitation signal at origins of replication, reduced levels of DDK-phosphorylated Mcm2, and diminished Go, Ichi, Ni, and San (GINS) association with Mcm2-7 in vivo. mcm5-bob1 bypasses the growth defect conferred by DDK-phosphodead Mcm2 in budding yeast. However, the growth defect observed by expressing mcm10-m2,3,4 is not bypassed by the mcm5-bob1 mutation. Furthermore, origin melting and GINS association with Mcm2-7 are substantially decreased for cells expressing mcm10-m2,3,4 in the mcm5-bob1 background. Thus, the origin melting and GINS-Mcm2-7 interaction defects we observed for mcm10-m2,3,4 are not explained by decreased Mcm2 phosphorylation by DDK, since the defects persist in an mcm5-bob1 background. These data suggest that DNA binding by Mcm10 is essential for the initiation of DNA replication. Copyright © 2016 Elsevier Ltd. All rights reserved.

  14. Miz-1 activates gene expression via a novel consensus DNA binding motif.

    Directory of Open Access Journals (Sweden)

    Bonnie L Barrilleaux

    Full Text Available The transcription factor Miz-1 can either activate or repress gene expression in concert with binding partners including the Myc oncoprotein. The genomic binding of Miz-1 includes both core promoters and more distal sites, but the preferred DNA binding motif of Miz-1 has been unclear. We used a high-throughput in vitro technique, Bind-n-Seq, to identify two Miz-1 consensus DNA binding motif sequences--ATCGGTAATC and ATCGAT (Mizm1 and Mizm2--bound by full-length Miz-1 and its zinc finger domain, respectively. We validated these sequences directly as high affinity Miz-1 binding motifs. Competition assays using mutant probes indicated that the binding affinity of Miz-1 for Mizm1 and Mizm2 is highly sequence-specific. Miz-1 strongly activates gene expression through the motifs in a Myc-independent manner. MEME-ChIP analysis of Miz-1 ChIP-seq data in two different cell types reveals a long motif with a central core sequence highly similar to the Mizm1 motif identified by Bind-n-Seq, validating the in vivo relevance of the findings. Miz-1 ChIP-seq peaks containing the long motif are predominantly located outside of proximal promoter regions, in contrast to peaks without the motif, which are highly concentrated within 1.5 kb of the nearest transcription start site. Overall, our results indicate that Miz-1 may be directed in vivo to the novel motif sequences we have identified, where it can recruit its specific binding partners to control gene expression and ultimately regulate cell fate.

  15. Arabidopsis IRE1 catalyses unconventional splicing of bZIP60 mRNA to produce the active transcription factor

    KAUST Repository

    Nagashima, Yukihiro

    2011-07-01

    IRE1 plays an essential role in the endoplasmic reticulum (ER) stress response in yeast and mammals. We found that a double mutant of Arabidopsis IRE1A and IRE1B (ire1a/ire1b) is more sensitive to the ER stress inducer tunicamycin than the wild-type. Transcriptome analysis revealed that genes whose induction was reduced in ire1a/ire1b largely overlapped those in the bzip60 mutant. We observed that the active form of bZIP60 protein detected in the wild-type was missing in ire1a/ire1b. We further demonstrated that bZIP60 mRNA is spliced by ER stress, removing 23 ribonucleotides and therefore causing a frameshift that replaces the C-terminal region of bZIP60 including the transmembrane domain (TMD) with a shorter region without a TMD. This splicing was detected in ire1a and ire1b single mutants, but not in the ire1a/ire1b double mutant. We conclude that IRE1A and IRE1B catalyse unconventional splicing of bZIP60 mRNA to produce the active transcription factor.

  16. The phylogeny of C/S1 bZIP transcription factors reveals a shared algal ancestry and the pre-angiosperm translational regulation of S1 transcripts

    NARCIS (Netherlands)

    Peviani, Alessia; Lastdrager, Jeroen; Hanson, Johannes; Snel, Berend

    2016-01-01

    Basic leucine zippers (bZIPs) form a large plant transcription factor family. C and S1 bZIP groups can heterodimerize, fulfilling crucial roles in seed development and stress response. S1 sequences also harbor a unique regulatory mechanism, termed Sucrose-Induced Repression of Translation (SIRT).

  17. Crystal structure of the gamma-2 herpesvirus LANA DNA binding domain identifies charged surface residues which impact viral latency.

    Directory of Open Access Journals (Sweden)

    Bruno Correia

    Full Text Available Latency-associated nuclear antigen (LANA mediates γ2-herpesvirus genome persistence and regulates transcription. We describe the crystal structure of the murine gammaherpesvirus-68 LANA C-terminal domain at 2.2 Å resolution. The structure reveals an alpha-beta fold that assembles as a dimer, reminiscent of Epstein-Barr virus EBNA1. A predicted DNA binding surface is present and opposite this interface is a positive electrostatic patch. Targeted DNA recognition substitutions eliminated DNA binding, while certain charged patch mutations reduced bromodomain protein, BRD4, binding. Virus containing LANA abolished for DNA binding was incapable of viable latent infection in mice. Virus with mutations at the charged patch periphery exhibited substantial deficiency in expansion of latent infection, while central region substitutions had little effect. This deficiency was independent of BRD4. These results elucidate the LANA DNA binding domain structure and reveal a unique charged region that exerts a critical role in viral latent infection, likely acting through a host cell protein(s.

  18. Predicting DNA-binding amino acid residues from electrostatic stabilization upon mutation to Asp/Glu and evolutionary conservation.

    Science.gov (United States)

    Chen, Yao Chi; Wu, Chih Yuan; Lim, Carmay

    2007-05-15

    Binding of polyanionic DNA depends on the cluster of electropositive atoms in the binding site of a DNA-binding protein. Such a cluster of electropositive protein atoms would be electrostatically unfavorable without stabilizing interactions from the respective electronegative DNA atoms and would likely be evolutionary conserved due to its critical biological role. Consequently, our strategy for predicting DNA-binding residues is based on detecting a cluster of evolutionary conserved surface residues that are electrostatically stabilized upon mutation to negatively charged Asp/Glu residues. The method requires as input the protein structure and sufficient sequence homologs to define each residue's relative conservation, and it yields as output experimentally testable residues that are predicted to bind DNA. By incorporating characteristic DNA-binding site features (i.e., electrostatic strain and amino acid conservation), the new method yields a prediction accuracy of 83%, which is much higher than methods based on only electrostatic strain (57%) or conservation alone (50%). It is also less sensitive to protein conformational changes upon DNA binding than methods that mainly depend on the 3D protein structure. 2007 Wiley-Liss, Inc.

  19. 7-(Benzofuran-2-yl)-7-deazadeoxyguanosine as a fluorescence turn-ON probe for single-strand DNA binding protein.

    Science.gov (United States)

    Tokugawa, Munefumi; Masaki, Yoshiaki; Canggadibrata, Jan Christian; Kaneko, Kazuhei; Shiozawa, Takashi; Kanamori, Takashi; Grøtli, Morten; Wilhelmsson, L Marcus; Sekine, Mitsuo; Seio, Kohji

    2016-03-07

    7-(Benzofuran-2-yl)-7-deazadeoxyguanosine ((BF)dG) was synthesized and incorporated into an oligodeoxynucleotide (ODN). The single-stranded ODN containing (BF)dG shows 91-fold fluorescence enhancement upon binding of single-strand DNA binding protein.

  20. Acetylation regulates protein stability and DNA-binding ability of HilD to modulate Salmonella Typhimurium virulence.

    Science.gov (United States)

    Sang, Yu; Ren, Jie; Qin, Ran; Liu, Shuting; Cui, Zhongli; Cheng, Sen; Liu, Xiaoyun; Lu, Jie; Tao, Jing; Yao, Yu-Feng

    2017-02-24

    HilD, a dominant regulator of Salmonella pathogenicity island 1 (SPI-1), can be acetylated by acetyltransferase Pat in Salmonella Typhimurium, and the acetylation is beneficial to its stability. However, the underlying mechanism of HilD stability regulated by acetylation is not clear. We show here that lysine 297 (K297) located in the helix-turn-helix motif, can be acetylated by Pat. Acetylation of K297 increases HilD stability, but reduces its DNA-binding affinity. In turn, the deacetylated K297 enhances the DNA-binding ability, but decreases HilD stability. Under SPI-1 inducing condition, the acetylation level of K297 is down-regulated. The acetylated K297 (mimicked by glutamine substitution) causes attenuated invasion in HeLa cells as well as impaired virulence in mouse model compared with the deacetylated K297 (mimicked by arginine substitution), suggesting that deacetylation of K297 is essential for Salmonella virulence. These findings demonstrate that the acetylation of K297 can regulate both protein stability and DNA-binding ability. This regulation mediated by acetylation not only degrades redundant HilD to keep a moderate protein level to facilitate S. Typhimurium growth but also maintains an appropriate DNA-binding activity of HilD to ensure bacterial pathogenicity. © The Author 2017. Published by Oxford University Press for the Infectious Diseases Society of America. All rights reserved. For permissions, e-mail journals.permissions@oup.com.

  1. Predicting Protein-DNA Binding Residues by Weightedly Combining Sequence-Based Features and Boosting Multiple SVMs.

    Science.gov (United States)

    Hu, Jun; Li, Yang; Zhang, Ming; Yang, Xibei; Shen, Hong-Bin; Yu, Dong-Jun

    2017-01-01

    Protein-DNA interactions are ubiquitous in a wide variety of biological processes. Correctly locating DNA-binding residues solely from protein sequences is an important but challenging task for protein function annotations and drug discovery, especially in the post-genomic era where large volumes of protein sequences have quickly accumulated. In this study, we report a new predictor, named TargetDNA, for targeting protein-DNA binding residues from primary sequences. TargetDNA uses a protein's evolutionary information and its predicted solvent accessibility as two base features and employs a centered linear kernel alignment algorithm to learn the weights for weightedly combining the two features. Based on the weightedly combined feature, multiple initial predictors with SVM as classifiers are trained by applying a random under-sampling technique to the original dataset, the purpose of which is to cope with the severe imbalance phenomenon that exists between the number of DNA-binding and non-binding residues. The final ensembled predictor is obtained by boosting the multiple initially trained predictors. Experimental simulation results demonstrate that the proposed TargetDNA achieves a high prediction performance and outperforms many existing sequence-based protein-DNA binding residue predictors. The TargetDNA web server and datasets are freely available at http://csbio.njust.edu.cn/bioinf/TargetDNA/ for academic use.

  2. Cultivated single stranded DNA phages that infect marine Bacteroidetes prove difficult to detect with DNA binding stains

    DEFF Research Database (Denmark)

    Holmfeldt, Karin; Odic, Dusko; Sullivan, Matthew B.

    2012-01-01

    This is the first description of cultivated icosahedral single stranded DNA (ssDNA) phages isolated on heterotrophic marine bacterioplankton and with Bacteroidetes hosts. None of the 8 phages stained well with DNA binding stains, suggesting that in situ abundances of ssDNA phages are drastically...

  3. A New Design Strategy and Diagnostic to Tailor the DNA-Binding Mechanism of Small Organic Molecules and Drugs.

    Science.gov (United States)

    Doan, Phi; Pitter, Demar R G; Kocher, Andrea; Wilson, James N; Goodson, Theodore

    2016-11-18

    The classical model for DNA groove binding states that groove binding molecules should adopt a crescent shape that closely matches the helical groove of DNA. Here, we present a new design strategy that does not obey this classical model. The DNA-binding mechanism of small organic molecules was investigated by synthesizing and examining a series of novel compounds that bind with DNA. This study has led to the emergence of structure-property relationships for DNA-binding molecules and/or drugs, which reveals that the structure can be designed to either intercalate or groove bind with calf thymus dsDNA by modifying the electron acceptor properties of the central heterocyclic core. This suggests that the electron accepting abilities of the central core play a key role in the DNA-binding mechanism. These small molecules were characterized by steady-state and ultrafast nonlinear spectroscopies. Bioimaging experiments were performed in live cells to evaluate cellular uptake and localization of the novel small molecules. This report paves a new route for the design and development of small organic molecules, such as therapeutics, targeted at DNA as their performance and specificity is dependent on the DNA-binding mechanism.

  4. Probing the relation between protein–protein interactions and DNA binding for a linker mutant of the bacterial nucleoid protein H-NS

    NARCIS (Netherlands)

    Giangrossi, M.; Wintraecken, K.; Spurio, R.; Vries, de R.J.

    2014-01-01

    We have investigated the relationship between oligomerization in solution and DNA binding for the bacterial nucleoid protein H-NS. This was done by comparing oligomerization and DNA binding of H-NS with that of a H-NS D68V-D71V linker mutant. The double linker mutation D68V-D71V, that makes the

  5. ThrR, a DNA-binding transcription factor involved in controlling threonine biosynthesis in Bacillus subtilis.

    Science.gov (United States)

    Rosenberg, Jonathan; Müller, Peter; Lentes, Sabine; Thiele, Martin J; Zeigler, Daniel R; Tödter, Dominik; Paulus, Henry; Brantl, Sabine; Stülke, Jörg; Commichau, Fabian M

    2016-09-01

    The threonine dehydratase IlvA is part of the isoleucine biosynthesis pathway in the Gram-positive model bacterium Bacillus subtilis. Consequently, deletion of ilvA causes isoleucine auxotrophy. It has been reported that ilvA pseudo-revertants having a derepressed hom-thrCB operon appear in the presence of threonine. Here we have characterized two classes of ilvA pseudo-revertants. In the first class the hom-thrCB operon was derepressed unmasking the threonine dehydratase activity of the threonine synthase ThrC. In the second class of mutants, threonine biosynthesis was more broadly affected. The first class of ilvA pseudo-revertants had a mutation in the Phom promoter (P*hom ), resulting in constitutive expression of the hom-thrCB operon. In the second class of ilvA pseudo-revertants, the thrR gene encoding a putative DNA-binding protein was inactivated, also resulting in constitutive expression of the hom-thrCB operon. Here we demonstrate that ThrR is indeed a DNA-binding transcription factor that regulates the hom-thrCB operon and the thrD aspartokinase gene. DNA binding assays uncovered the DNA-binding site of ThrR and revealed that the repressor competes with the RNA polymerase for DNA binding. This study also revealed that ThrR orthologs are ubiquitous in genomes from the Gram-positive phylum Firmicutes and in some Gram-negative bacteria. © 2016 John Wiley & Sons Ltd.

  6. Single-stranded DNA binding by F TraI relaxase and helicase domains is coordinately regulated.

    Science.gov (United States)

    Dostál, Lubomír; Schildbach, Joel F

    2010-07-01

    Transfer of conjugative plasmids requires relaxases, proteins that cleave one plasmid strand sequence specifically. The F plasmid relaxase TraI (1,756 amino acids) is also a highly processive DNA helicase. The TraI relaxase activity is located within the N-terminal approximately 300 amino acids, while helicase motifs are located in the region comprising positions 990 to 1450. For efficient F transfer, the two activities must be physically linked. The two TraI activities are likely used in different stages of transfer; how the protein regulates the transition between activities is unknown. We examined TraI helicase single-stranded DNA (ssDNA) recognition to complement previous explorations of relaxase ssDNA binding. Here, we show that TraI helicase-associated ssDNA binding is independent of and located N-terminal to all helicase motifs. The helicase-associated site binds ssDNA oligonucleotides with nM-range equilibrium dissociation constants and some sequence specificity. Significantly, we observe an apparent strong negative cooperativity in ssDNA binding between relaxase and helicase-associated sites. We examined three TraI variants having 31-amino-acid insertions in or near the helicase-associated ssDNA binding site. B. A. Traxler and colleagues (J. Bacteriol. 188:6346-6353) showed that under certain conditions, these variants are released from a form of negative regulation, allowing them to facilitate transfer more efficiently than wild-type TraI. We find that these variants display both moderately reduced affinity for ssDNA by their helicase-associated binding sites and a significant reduction in the apparent negative cooperativity of binding, relative to wild-type TraI. These results suggest that the apparent negative cooperativity of binding to the two ssDNA binding sites of TraI serves a major regulatory function in F transfer.

  7. Single-Stranded DNA Binding by F TraI Relaxase and Helicase Domains Is Coordinately Regulated▿

    Science.gov (United States)

    Dostál, Lubomír; Schildbach, Joel F.

    2010-01-01

    Transfer of conjugative plasmids requires relaxases, proteins that cleave one plasmid strand sequence specifically. The F plasmid relaxase TraI (1,756 amino acids) is also a highly processive DNA helicase. The TraI relaxase activity is located within the N-terminal ∼300 amino acids, while helicase motifs are located in the region comprising positions 990 to 1450. For efficient F transfer, the two activities must be physically linked. The two TraI activities are likely used in different stages of transfer; how the protein regulates the transition between activities is unknown. We examined TraI helicase single-stranded DNA (ssDNA) recognition to complement previous explorations of relaxase ssDNA binding. Here, we show that TraI helicase-associated ssDNA binding is independent of and located N-terminal to all helicase motifs. The helicase-associated site binds ssDNA oligonucleotides with nM-range equilibrium dissociation constants and some sequence specificity. Significantly, we observe an apparent strong negative cooperativity in ssDNA binding between relaxase and helicase-associated sites. We examined three TraI variants having 31-amino-acid insertions in or near the helicase-associated ssDNA binding site. B. A. Traxler and colleagues (J. Bacteriol. 188:6346-6353) showed that under certain conditions, these variants are released from a form of negative regulation, allowing them to facilitate transfer more efficiently than wild-type TraI. We find that these variants display both moderately reduced affinity for ssDNA by their helicase-associated binding sites and a significant reduction in the apparent negative cooperativity of binding, relative to wild-type TraI. These results suggest that the apparent negative cooperativity of binding to the two ssDNA binding sites of TraI serves a major regulatory function in F transfer. PMID:20435720

  8. Effect of DNA binding on geminate CO recombination kinetics in CO-sensing transcription factor CooA.

    Science.gov (United States)

    Benabbas, Abdelkrim; Karunakaran, Venugopal; Youn, Hwan; Poulos, Thomas L; Champion, Paul M

    2012-06-22

    Carbon monoxide oxidation activator (CooA) proteins are heme-based CO-sensing transcription factors. Here we study the ultrafast dynamics of geminate CO rebinding in two CooA homologues, Rhodospirillum rubrum (RrCooA) and Carboxydothermus hydrogenoformans (ChCooA). The effects of DNA binding and the truncation of the DNA-binding domain on the CO geminate recombination kinetics were specifically investigated. The CO rebinding kinetics in these CooA complexes take place on ultrafast time scales but remain non-exponential over many decades in time. We show that this non-exponential kinetic response is due to a quenched enthalpic barrier distribution resulting from a distribution of heme geometries that is frozen or slowly evolving on the time scale of CO rebinding. We also show that, upon CO binding, the distal pocket of the heme in the CooA proteins relaxes to form a very efficient hydrophobic trap for CO. DNA binding further tightens the narrow distal pocket and slightly weakens the iron-proximal histidine bond. Comparison of the CO rebinding kinetics of RrCooA, truncated RrCooA, and DNA-bound RrCooA proteins reveals that the uncomplexed and inherently flexible DNA-binding domain adds additional structural heterogeneity to the heme doming coordinate. When CooA forms a complex with DNA, the flexibility of the DNA-binding domain decreases, and the distribution of the conformations available in the heme domain becomes restricted. The kinetic studies also offer insights into how the architecture of the heme environment can tune entropic barriers in order to control the geminate recombination of CO in heme proteins, whereas spin selection rules play a minor or non-existent role.

  9. Effect of DNA Binding on Geminate CO Recombination Kinetics in CO-sensing Transcription Factor CooA*

    Science.gov (United States)

    Benabbas, Abdelkrim; Karunakaran, Venugopal; Youn, Hwan; Poulos, Thomas L.; Champion, Paul M.

    2012-01-01

    Carbon monoxide oxidation activator (CooA) proteins are heme-based CO-sensing transcription factors. Here we study the ultrafast dynamics of geminate CO rebinding in two CooA homologues, Rhodospirillum rubrum (RrCooA) and Carboxydothermus hydrogenoformans (ChCooA). The effects of DNA binding and the truncation of the DNA-binding domain on the CO geminate recombination kinetics were specifically investigated. The CO rebinding kinetics in these CooA complexes take place on ultrafast time scales but remain non-exponential over many decades in time. We show that this non-exponential kinetic response is due to a quenched enthalpic barrier distribution resulting from a distribution of heme geometries that is frozen or slowly evolving on the time scale of CO rebinding. We also show that, upon CO binding, the distal pocket of the heme in the CooA proteins relaxes to form a very efficient hydrophobic trap for CO. DNA binding further tightens the narrow distal pocket and slightly weakens the iron-proximal histidine bond. Comparison of the CO rebinding kinetics of RrCooA, truncated RrCooA, and DNA-bound RrCooA proteins reveals that the uncomplexed and inherently flexible DNA-binding domain adds additional structural heterogeneity to the heme doming coordinate. When CooA forms a complex with DNA, the flexibility of the DNA-binding domain decreases, and the distribution of the conformations available in the heme domain becomes restricted. The kinetic studies also offer insights into how the architecture of the heme environment can tune entropic barriers in order to control the geminate recombination of CO in heme proteins, whereas spin selection rules play a minor or non-existent role. PMID:22544803

  10. The single-stranded DNA-binding protein of Deinococcus radiodurans

    Directory of Open Access Journals (Sweden)

    Wood Elizabeth

    2004-01-01

    Full Text Available Abstract Background Deinococcus radiodurans R1 is one of the most radiation-resistant organisms known and is able to repair an unusually large amount of DNA damage without induced mutation. Single-stranded DNA-binding (SSB protein is an essential protein in all organisms and is involved in DNA replication, recombination and repair. The published genomic sequence from Deinococcus radiodurans includes a putative single-stranded DNA-binding protein gene (ssb; DR0100 requiring a translational frameshift for synthesis of a complete SSB protein. The apparently tripartite gene has inspired considerable speculation in the literature about potentially novel frameshifting or RNA editing mechanisms. Immediately upstream of the ssb gene is another gene (DR0099 given an ssb-like annotation, but left unexplored. Results A segment of the Deinococcus radiodurans strain R1 genome encompassing the ssb gene has been re-sequenced, and two errors involving omitted guanine nucleotides have been documented. The corrected sequence incorporates both of the open reading frames designated DR0099 and DR0100 into one contiguous ssb open reading frame (ORF. The corrected gene requires no translational frameshifts and contains two predicted oligonucleotide/oligosaccharide-binding (OB folds. The protein has been purified and its sequence is closely related to the Thermus thermophilus and Thermus aquaticus SSB proteins. Like the Thermus SSB proteins, the SSBDr functions as a homodimer. The Deinococcus radiodurans SSB homodimer stimulates Deinococcus radiodurans RecA protein and Escherichia coli RecA protein-promoted DNA three-strand exchange reactions with at least the same efficiency as the Escherichia coli SSB homotetramer. Conclusions The correct Deinococcus radiodurans ssb gene is a contiguous open reading frame that codes for the largest bacterial SSB monomer identified to date. The Deinococcus radiodurans SSB protein includes two OB folds per monomer and functions as a

  11. Novel approach for selecting the best predictor for identifying the binding sites in DNA binding proteins.

    Science.gov (United States)

    Nagarajan, R; Ahmad, Shandar; Gromiha, M Michael

    2013-09-01

    Protein-DNA complexes play vital roles in many cellular processes by the interactions of amino acids with DNA. Several computational methods have been developed for predicting the interacting residues in DNA-binding proteins using sequence and/or structural information. These methods showed different levels of accuracies, which may depend on the choice of data sets used in training, the feature sets selected for developing a predictive model, the ability of the models to capture information useful for prediction or a combination of these factors. In many cases, different methods are likely to produce similar results, whereas in others, the predictors may return contradictory predictions. In this situation, a priori estimates of prediction performance applicable to the system being investigated would be helpful for biologists to choose the best method for designing their experiments. In this work, we have constructed unbiased, stringent and diverse data sets for DNA-binding proteins based on various biologically relevant considerations: (i) seven structural classes, (ii) 86 folds, (iii) 106 superfamilies, (iv) 194 families, (v) 15 binding motifs, (vi) single/double-stranded DNA, (vii) DNA conformation (A, B, Z, etc.), (viii) three functions and (ix) disordered regions. These data sets were culled as non-redundant with sequence identities of 25 and 40% and used to evaluate the performance of 11 different methods in which online services or standalone programs are available. We observed that the best performing methods for each of the data sets showed significant biases toward the data sets selected for their benchmark. Our analysis revealed important data set features, which could be used to estimate these context-specific biases and hence suggest the best method to be used for a given problem. We have developed a web server, which considers these features on demand and displays the best method that the investigator should use. The web server is freely available at

  12. The genomic DNA immobilization on microcrystalline cellulose and its application to separate DNA-binding proteins from kumquat (Fortunella margarita Swingle).

    Science.gov (United States)

    Yang, Hua; Li, Huang; Guo, Chun; Li, Meng-Yun; Rao, Li-Qun; Liu, Ting

    2014-01-01

    A method of immobilizing genomic DNA on microcrystalline cellulose was described to isolate DNA-binding proteins. At first, DNA fragments were prepared by sonication and immobilized on cellulose phase. After the immobilization, DNA duplex formation was done. Using this microcrystalline cellulose affinity chromatography technique, DNA-binding proteins from kumquat (Fortunella margarita Swingle) leaf samples were isolated and then analyzed by Liquid Chromatography-Mass Spectrometry (LC-MS/MS). LC-MS/MS analysis showed that twenty-eight kinds of protein mainly including histones, protein-synthetic proteins and other DNA-binding proteins were identified. The identification list consists with the results in previous research on DNA-binding proteins isolation. It further suggests that the technique developed in this study can be applied to the effective isolation of DNA-binding proteins.

  13. Structure and DNA binding of alkylation response protein AidB

    Energy Technology Data Exchange (ETDEWEB)

    Bowles, Timothy; Metz, Audrey H.; O' Quin, Jami; Wawrzak, Zdzislaw; Eichman, Brandt F. (Vanderbilt); (NWU)

    2009-01-12

    Exposure of Escherichia coli to alkylating agents activates expression of AidB in addition to DNA repair proteins Ada, AlkA, and AlkB. AidB was recently shown to possess a flavin adenine dinucleotide (FAD) cofactor and to bind to dsDNA, implicating it as a flavin-dependent DNA repair enzyme. However, the molecular mechanism by which AidB acts to reduce the mutagenic effects of specific DNA alkylators is unknown. We present a 1.7-{angstrom} crystal structure of AidB, which bears superficial resemblance to the acyl-CoA dehydrogenase superfamily of flavoproteins. The structure reveals a unique quaternary organization and a distinctive FAD active site that provides a rationale for AidB's limited dehydrogenase activity. A highly electropositive C-terminal domain not present in structural homologs was identified by mutational analysis as the DNA binding site. Structural analysis of the DNA and FAD binding sites provides evidence against AidB-catalyzed DNA repair and supports a model in which AidB acts to prevent alkylation damage by protecting DNA and destroying alkylating agents that have yet to reach their DNA target.

  14. DNA binding of sunitinib: Spectroscopic evidence via circular dichroism and nuclear magnetic resonance.

    Science.gov (United States)

    Kiss, Eszter; Mirzahosseini, Arash; Hubert, Ágnes; Ambrus, Attila; Őrfi, László; Horváth, Péter

    2018-02-20

    Sunitinib is a non-selective tyrosine kinase inhibitor, but in its chemical structure there can be discovered certain features, which suggest the ability to bind to DNA. These elements are the planar aromatic system and the tertiary amine function, which is protonated at the pH of the organism. In this study, the binding of the drug sunitinib to DNA was investigated using circular dichroism (CD), 1 H NMR and UV spectroscopies, along with CD melting. For these studies DNA was isolated from calf thymus (CT), salmon fish sperm (SS), and chicken erythrocyte (CE), however for our purposes an artificially constructed and highly purified plasmid DNA (pUC18) preparation proved to be the most suitable. DNA binding of the drug was confirmed by shifts in the characteristic CD bands of the DNA, the appearance of an induced CD (ICD) signal in the upper absorption region of sunitinib (300 nm-500 nm), and the evidence from CD melting studies and the NMR. Based on the CD and NMR measurements, it can be assumed that sunitinib has a multiple-step binding mechanism. Copyright © 2017 Elsevier B.V. All rights reserved.

  15. The N-terminus of TDP-43 promotes its oligomerization and enhances DNA binding affinity

    Energy Technology Data Exchange (ETDEWEB)

    Chang, Chung-ke [Institute of Biomedical Sciences, Academia Sinica, Taipei 115, Taiwan (China); Wu, Tzong-Huah [Institute of Chemistry, Academia Sinica, Taipei 115, Taiwan (China); Chemical Biology and Molecular Biophysics Program, Taiwan International Graduate Program, Institute of Biochemistry, Academia Sinica, Taipei 115, Taiwan (China); Institute of Bioinformatics and Structural Biology, National Tsing Hua University, Hsinchu 300, Taiwan (China); Wu, Chu-Ya [Institute of Chemistry, Academia Sinica, Taipei 115, Taiwan (China); Graduate Institute of Engineering, National Taiwan University of Science and Technology, Taipei 106, Taiwan (China); Chiang, Ming-hui; Toh, Elsie Khai-Woon [Institute of Biomedical Sciences, Academia Sinica, Taipei 115, Taiwan (China); Hsu, Yin-Chih; Lin, Ku-Feng [Institute of Chemistry, Academia Sinica, Taipei 115, Taiwan (China); Liao, Yu-heng [Institute of Biomedical Sciences, Academia Sinica, Taipei 115, Taiwan (China); Huang, Tai-huang, E-mail: bmthh@gate.sinica.edu.tw [Institute of Biomedical Sciences, Academia Sinica, Taipei 115, Taiwan (China); Department of Physics, National Taiwan Normal University, Taipei 106, Taiwan (China); Huang, Joseph Jen-Tse, E-mail: jthuang@chem.sinica.edu.tw [Institute of Chemistry, Academia Sinica, Taipei 115, Taiwan (China)

    2012-08-24

    Highlights: Black-Right-Pointing-Pointer The N-terminus of TDP-43 contains an independently folded structural domain (NTD). Black-Right-Pointing-Pointer The structural domains of TDP-43 are arranged in a beads-on-a-string fashion. Black-Right-Pointing-Pointer The NTD promotes TDP-43 oligomerization in a concentration-dependent manner. Black-Right-Pointing-Pointer The NTD may assist nucleic acid-binding activity of TDP-43. -- Abstract: TDP-43 is a DNA/RNA-binding protein associated with different neurodegenerative diseases such as amyotrophic lateral sclerosis (ALS) and frontotemporal lobar degeneration (FTLD-U). Here, the structural and physical properties of the N-terminus on TDP-43 have been carefully characterized through a combination of nuclear magnetic resonance (NMR), circular dichroism (CD) and fluorescence anisotropy studies. We demonstrate for the first time the importance of the N-terminus in promoting TDP-43 oligomerization and enhancing its DNA-binding affinity. An unidentified structural domain in the N-terminus is also disclosed. Our findings provide insights into the N-terminal domain function of TDP-43.

  16. Novel Pt(II) complexes containing pyrrole oxime; synthesis, characterization and DNA binding studies

    Science.gov (United States)

    Erdogan, Deniz Altunoz; Özalp-Yaman, Şeniz

    2014-05-01

    Since the discovery of anticancer activity and subsequent clinical success of cisplatin (cis-[PtCl2(NH3)2]), platinum-based compounds have since been widely synthesized and studied as potential chemotherapeutic agents. In this sense, three novel nuclease active Pt(II) complexes with general formula; [Pt(NH3)Cl(L)] (1), [Pt(L)2] (2), and K[PtCl2(L)] (3) in which L is 1-H-pyrrole-2-carbaldehyde oxime were synthesized. Characterization of complexes was performed by elemental analysis, FT-IR, 1H NMR and mass spectroscopy measurements. Interaction of complexes (1-3) with calf thymus deoxyribonucleic acid (ct-DNA) was investigated by using electrochemical, spectroelectrochemical methods and cleavage studies. The hyperchromic change in the electronic absorption spectrum of the Pt(II) complexes indicates an electrostatic interaction between the complexes and ct-DNA. Binding constant values between 4.42 × 103 and 5.09 × 103 M-1 and binding side size values between 2 and 3 base pairs were determined from cyclic voltammetry (CV) and differential pulse voltammetry (DPV) studies.

  17. Mutation and Methylation Analysis of the Chromodomain-Helicase-DNA Binding 5 Gene in Ovarian Cancer

    Directory of Open Access Journals (Sweden)

    Kylie L. Gorringe

    2008-11-01

    Full Text Available Chromodomain, helicase, DNA binding 5 (CHD5 is a member of a subclass of the chromatin remodeling Swi/Snf proteins and has recently been proposed as a tumor suppressor in a diverse range of human cancers. We analyzed all 41 coding exons of CHD5 for somatic mutations in 123 primary ovarian cancers as well as 60 primary breast cancers using high-resolution melt analysis. We also examined methylation of the CHD5 promoter in 48 ovarian cancer samples by methylation-specific single-stranded conformation polymorphism and bisulfite sequencing. In contrast to previous studies, no mutations were identified in the breast cancers, but somatic heterozygous missense mutations were identified in 3 of 123 ovarian cancers. We identified promoter methylation in 3 of 45 samples with normal CHD5 and in 2 of 3 samples with CHD5 mutation, suggesting these tumors may have biallelic inactivation of CHD5. Hemizygous copy number loss at CHD5 occurred in 6 of 85 samples as assessed by single nucleotide polymorphism array. Tumors with CHD5 mutation or methylation were more likely to have mutation of KRAS or BRAF (P = .04. The aggregate frequency of CHD5 haploinsufficiency or inactivation is 16.2% in ovarian cancer. Thus, CHD5 may play a role as a tumor suppressor gene in ovarian cancer; however, it is likely that there is another target of the frequent copy number neutral loss of heterozygosity observed at 1p36.

  18. CpG methylation increases the DNA binding of 9-aminoacridine carboxamide Pt analogues.

    Science.gov (United States)

    Kava, Hieronimus W; Murray, Vincent

    2016-10-01

    This study investigated the effect of CpG methylation on the DNA binding of cisplatin analogues with an attached aminoacridine intercalator. DNA-targeted 9-aminoacridine carboxamide Pt complexes are known to bind at 5'-CpG sequences. Their binding to methylated and non-methylated 5'-CpG sequences was determined and compared with cisplatin. The damage profiles of each platinum compound were quantified via a polymerase stop assay with fluorescently labelled primers and capillary electrophoresis. Methylation at 5'-CpG was shown to significantly increase the binding intensity for the 9-aminoacridine carboxamide compounds, whereas no significant increase was found for cisplatin. 5'-CpG methylation had the largest effect on the 9-ethanolamine-acridine carboxamide Pt complex, followed by the 9-aminoacridine carboxamide Pt complex and the 7-fluoro complex. The methylation state of a cell's genome is important in maintaining normal gene expression, and is often aberrantly altered in cancer cells. An analogue of cisplatin which differentially targets methylated DNA may be able to improve its therapeutic activity, or alter its range of targets and evade the chemoresistance which hampers cisplatin efficacy in clinical use. Copyright © 2016 Elsevier Ltd. All rights reserved.

  19. Crystal structure of Arabidopsis thaliana calmodulin7 and insight into its mode of DNA binding.

    Science.gov (United States)

    Kumar, Sanjeev; Mazumder, Mohit; Gupta, Nisha; Chattopadhyay, Sudip; Gourinath, Samudrala

    2016-09-01

    Calmodulin (CaM) is a Ca(2+) sensor that participates in several cellular signaling cascades by interacting with various targets, including DNA. It has been shown that Arabidopsis thaliana CaM7 (AtCaM7) interacts with Z-box DNA and functions as a transcription factor [Kushwaha R et al. (2008) Plant Cell 20, 1747-1759; Abbas N et al. (2014) Plant Cell 26, 1036-1052]. The crystal structure of AtCaM7, and a model of the AtCAM7-Z-box complex suggest that Arg-127 determines the DNA-binding ability by forming crucial interactions with the guanine base. We validated the model using biolayer interferometry, which confirmed that AtCaM7 interacts with Z-box DNA with high affinity. In contrast, the AtCaM2/3/5 isoform does not show any binding, although it differs from AtCaM7 by only a single residue. © 2016 Federation of European Biochemical Societies.

  20. PDNAsite: Identification of DNA-binding Site from Protein Sequence by Incorporating Spatial and Sequence Context.

    Science.gov (United States)

    Zhou, Jiyun; Xu, Ruifeng; He, Yulan; Lu, Qin; Wang, Hongpeng; Kong, Bing

    2016-06-10

    Protein-DNA interactions are involved in many fundamental biological processes essential for cellular function. Most of the existing computational approaches employed only the sequence context of the target residue for its prediction. In the present study, for each target residue, we applied both the spatial context and the sequence context to construct the feature space. Subsequently, Latent Semantic Analysis (LSA) was applied to remove the redundancies in the feature space. Finally, a predictor (PDNAsite) was developed through the integration of the support vector machines (SVM) classifier and ensemble learning. Results on the PDNA-62 and the PDNA-224 datasets demonstrate that features extracted from spatial context provide more information than those from sequence context and the combination of them gives more performance gain. An analysis of the number of binding sites in the spatial context of the target site indicates that the interactions between binding sites next to each other are important for protein-DNA recognition and their binding ability. The comparison between our proposed PDNAsite method and the existing methods indicate that PDNAsite outperforms most of the existing methods and is a useful tool for DNA-binding site identification. A web-server of our predictor (http://hlt.hitsz.edu.cn:8080/PDNAsite/) is made available for free public accessible to the biological research community.

  1. Synthesis, DNA Binding and Topoisomerase I Inhibition Activity of Thiazacridine and Imidazacridine Derivatives

    Directory of Open Access Journals (Sweden)

    Elizabeth Almeida Lafayette

    2013-12-01

    Full Text Available Thiazacridine and imidazacridine derivatives have shown promising results as tumors suppressors in some cancer cell lines. For a better understanding of the mechanism of action of these compounds, binding studies of 5-acridin-9-ylmethylidene-3-amino-2-thioxo-thiazolidin-4-one, 5-acridin-9-ylmethylidene-2-thioxo-thiazolidin-4-one, 5-acridin-9-ylmethylidene-2-thioxo-imidazolidin-4-one and 3-acridin-9-ylmethyl-thiazolidin-2,4-dione with calf thymus DNA (ctDNA by electronic absorption and fluorescence spectroscopy and circular dichroism spectroscopy were performed. The binding constants ranged from 1.46 × 104 to 6.01 × 104 M−1. UV-Vis, fluorescence and circular dichroism measurements indicated that the compounds interact effectively with ctDNA, both by intercalation or external binding. They demonstrated inhibitory activities to human topoisomerase I, except for 5-acridin-9-ylmethylidene-2-thioxo-1,3-thiazolidin-4-one. These results provide insight into the DNA binding mechanism of imidazacridines and thiazacridines.

  2. DNA-binding studies and biological activities of new nitrosubstituted acyl thioureas

    Science.gov (United States)

    Tahir, Shaista; Badshah, Amin; Hussain, Raja Azadar; Tahir, Muhammad Nawaz; Tabassum, Saira; Patujo, Jahangir Ali; Rauf, Muhammad Khawar

    2015-11-01

    Four new nitrosubstituted acylthioureas i.e. 1-acetyl-3-(4-nitrophenyl)thiourea (TU1), 1-acetyl-3-(2-methyl-4-nitrophenyl)thiourea (TU2), 1-acetyl-3-(2-methoxy-4-nitrophenyl)thiourea (TU3) and 1-acetyl-3-(4-chloro-3-nitrophenyl)thiourea (TU4) have been synthesized and characterized (by C13 and H1 nuclear magnetic resonance, Fourier transform infrared spectroscopy and single crystal X-ray diffraction). As a preliminary investigation of the anti-cancer potencies of the said compounds, DNA interaction studies have been carried out using cyclic voltammetry and UV-vis spectroscopy along with verification from computational studies. The drug-DNA binding constants are found to be in the order, KTU3 9.04 × 106 M-1 > KTU4 8.57 × 106 M-1 > KTU2 6.05 × 106 M-1 > KTU1 1.16 × 106 M-1. Furthermore, the antioxidant, cytotoxic, antibacterial and antifungal activities have been carried out against DPPH (1,1-diphenyl-2-dipicrylhydrazyl), Brine shrimp eggs, gram positive (Micrococcus luteus, Staphylococcus aureus) and gram negative (Bordetella bronchiseptica, Salmonella typhimurium, Enterobacter aerogens) and fungal cultures (Aspergillus fumigatus, Mucor species, Aspergillus niger, Aspergillus flavus) respectively.

  3. HU histone-like DNA-binding protein from Thermus thermophilus: structural and evolutionary analyses.

    Science.gov (United States)

    Papageorgiou, Anna C; Adam, Panagiotis S; Stavros, Philemon; Nounesis, George; Meijers, Rob; Petratos, Kyriacos; Vorgias, Constantinos E

    2016-09-01

    The histone-like DNA-binding proteins (HU) serve as model molecules for protein thermostability studies, as they function in different bacteria that grow in a wide range of temperatures and show sequence diversity under a common fold. In this work, we report the cloning of the hutth gene from Thermus thermophilus, the purification and crystallization of the recombinant HUTth protein, as well as its X-ray structure determination at 1.7 Å. Detailed structural and thermodynamic analyses were performed towards the understanding of the thermostability mechanism. The interaction of HUTth protein with plasmid DNA in solution has been determined for the first time with MST. Sequence conservation of an exclusively thermophilic order like Thermales, when compared to a predominantly mesophilic order (Deinococcales), should be subject, to some extent, to thermostability-related evolutionary pressure. This hypothesis was used to guide our bioinformatics and evolutionary studies. We discuss the impact of thermostability adaptation on the structure of HU proteins, based on the detailed evolutionary analysis of the Deinococcus-Thermus phylum, where HUTth belongs. Furthermore, we propose a novel method of engineering thermostable proteins, by combining consensus-based design with ancestral sequence reconstruction. Finally, through the structure of HUTth, we are able to examine the validity of these predictions. Our approach represents a significant advancement, as it explores for the first time the potential of ancestral sequence reconstruction in the divergence between a thermophilic and a mainly mesophilic taxon, combined with consensus-based engineering.

  4. Nε-lysine acetylation of a bacterial transcription factor inhibits Its DNA-binding activity.

    Directory of Open Access Journals (Sweden)

    Sandy Thao

    Full Text Available Evidence suggesting that eukaryotes and archaea use reversible N(ε-lysine (N(ε-Lys acetylation to modulate gene expression has been reported, but evidence for bacterial use of N(ε-Lys acetylation for this purpose is lacking. Here, we report data in support of the notion that bacteria can control gene expression by modulating the acetylation state of transcription factors (TFs. We screened the E. coli proteome for substrates of the bacterial Gcn5-like protein acetyltransferase (Pat. Pat acetylated four TFs, including the RcsB global regulatory protein, which controls cell division, and capsule and flagellum biosynthesis in many bacteria. Pat acetylated residue Lys180 of RcsB, and the NAD(+-dependent Sir2 (sirtuin-like protein deacetylase (CobB deacetylated acetylated RcsB (RcsB(Ac, demonstrating that N(ε-Lys acetylation of RcsB is reversible. Analysis of RcsB(Ac and variant RcsB proteins carrying substitutions at Lys180 provided biochemical and physiological evidence implicating Lys180 as a critical residue for RcsB DNA-binding activity. These findings further the likelihood that reversible N(ε-Lys acetylation of transcription factors is a mode of regulation of gene expression used by all cells.

  5. Structural insights into single-stranded DNA binding and cleavage by F factor TraI.

    Science.gov (United States)

    Datta, Saumen; Larkin, Chris; Schildbach, Joel F

    2003-11-01

    Conjugative plasmid transfer between bacteria disseminates antibiotic resistance and diversifies prokaryotic genomes. Relaxases, proteins essential for conjugation, cleave one plasmid strand sequence specifically prior to transfer. Cleavage occurs through a Mg(2+)-dependent transesterification involving a tyrosyl hydroxyl and a DNA phosphate. The structure of the F plasmid TraI relaxase domain, described here, is a five-strand beta sheet flanked by alpha helices. The protein resembles replication initiator protein AAV-5 Rep but is circularly permuted, yielding a different topology. The beta sheet forms a binding cleft lined with neutral, nonaromatic residues, unlike most single-stranded DNA binding proteins which use aromatic and charged residues. The cleft contains depressions, suggesting base recognition occurs in a knob-into-hole fashion. Unlike most nucleases, three histidines but no acidic residues coordinate a Mg(2+) located near the catalytic tyrosine. The full positive charge on the Mg(2+) and the architecture of the active site suggest multiple roles for Mg(2+) in DNA cleavage.

  6. Model based analysis of real-time PCR data from DNA binding dye protocols

    Directory of Open Access Journals (Sweden)

    Salibe Mariano C

    2007-03-01

    Full Text Available Abstract Background Reverse transcription followed by real-time PCR is widely used for quantification of specific mRNA, and with the use of double-stranded DNA binding dyes it is becoming a standard for microarray data validation. Despite the kinetic information generated by real-time PCR, most popular analysis methods assume constant amplification efficiency among samples, introducing strong biases when amplification efficiencies are not the same. Results We present here a new mathematical model based on the classic exponential description of the PCR, but modeling amplification efficiency as a sigmoidal function of the product yield. The model was validated with experimental results and used for the development of a new method for real-time PCR data analysis. This model based method for real-time PCR data analysis showed the best accuracy and precision compared with previous methods when used for quantification of in-silico generated and experimental real-time PCR results. Moreover, the method is suitable for the analyses of samples with similar or dissimilar amplification efficiency. Conclusion The presented method showed the best accuracy and precision. Moreover, it does not depend on calibration curves, making it ideal for fully automated high-throughput applications.

  7. A Structural Analysis of DNA Binding by Myelin Transcription Factor 1 Double Zinc Fingers*

    Science.gov (United States)

    Gamsjaeger, Roland; O'Connell, Mitchell R.; Cubeddu, Liza; Shepherd, Nicholas E.; Lowry, Jason A.; Kwan, Ann H.; Vandevenne, Marylene; Swanton, Michael K.; Matthews, Jacqueline M.; Mackay, Joel P.

    2013-01-01

    Myelin transcription factor 1 (MyT1/NZF2), a member of the neural zinc-finger (NZF) protein family, is a transcription factor that plays a central role in the developing central nervous system. It has also recently been shown that, in combination with two other transcription factors, the highly similar paralog MyT1L is able to direct the differentiation of murine and human stem cells into functional neurons. MyT1 contains seven zinc fingers (ZFs) that are highly conserved throughout the protein and throughout the NZF family. We recently presented a model for the interaction of the fifth ZF of MyT1 with a DNA sequence derived from the promoter of the retinoic acid receptor (RARE) gene. Here, we have used NMR spectroscopy, in combination with surface plasmon resonance and data-driven molecular docking, to delineate the mechanism of DNA binding for double ZF polypeptides derived from MyT1. Our data indicate that a two-ZF unit interacts with the major groove of the entire RARE motif and that both fingers bind in an identical manner and with overall two-fold rotational symmetry, consistent with the palindromic nature of the target DNA. Several key residues located in one of the irregular loops of the ZFs are utilized to achieve specific binding. Analysis of the human and mouse genomes based on our structural data reveals three putative MyT1 target genes involved in neuronal development. PMID:24097990

  8. Synthesis, G-quadruplexes DNA binding, and photocytotoxicity of novel cationic expanded porphyrins.

    Science.gov (United States)

    Jin, Shu-fang; Zhao, Ping; Xu, Lian-cai; Zheng, Min; Lu, Jia-zheng; Zhao, Peng-liang; Su, Qiu-lan; Chen, Hui-xian; Tang, Ding-tong; Chen, Jiong; Lin, Jia-qi

    2015-06-01

    Intensive reports allowed the conclusion that molecules with extended aromatic surfaces always do good jobs in the DNA interactions. Inspired by the previous successful researches, herein, we designed a series of cationic porphyrins with expanded planar substituents, and evaluated their binding behaviors to G-quadruplex DNA using the combination of surface-enhanced raman, circular dichroism, absorption spectroscopy and fluorescence resonance energy transfer melting assays. Asymmetrical tetracationic porphyrin with one phenyl-4-N-methyl-4-pyridyl group and three N-methyl-4-pyridyl groups exhibit the best G4-DNA binding affinities among all the designed compounds, suggesting that the bulk of the substituents should be matched to the width of the grooves they putatively lie in. Theoretical calculations applying the density functional theory have been carried out and explain the binding properties of these porphyrins reasonably. Meanwhile, these porphyrins were proved to be potential photochemotherapeutic agents since they have photocytotoxic activities against both myeloma cell (Ag8.653) and gliomas cell (U251) lines. Copyright © 2015 Elsevier Inc. All rights reserved.

  9. DNA binding mode of novel tetradentate amino acid based 2-hydroxybenzylidene-4-aminoantipyrine complexes

    Science.gov (United States)

    Raman, N.; Sobha, S.; Selvaganapathy, M.; Mahalakshmi, R.

    2012-10-01

    Few transition metal complexes of tetradentate N2O2 donor Schiff base ligands containing 2-hydroxybenzylidene-4-aminoantipyrine and amino acids (alanine/valine) abbreviated to KHL1/KHL2 have been synthesized. All the metal complexes have been fully characterized with the help of elemental analyses, molecular weights, molar conductance values, magnetic moments and spectroscopic data. The Schiff bases KHL1/KHL2 are found to act as tetradentate ligands using N2O2 donor set of atoms leading to a square-planar geometry for the complexes around the metal ions. The binding behaviors of the complexes to calf thymus DNA have been investigated by absorption spectra, viscosity measurements and cyclic voltammetry. The DNA binding constants reveal that all these complexes interact with DNA through minor groove binding mode. The studies on mechanism of photocleavage reveal that singlet oxygen (1O2) and superoxide anion radical (O2rad -) may play an important role in the photocleavage. The Schiff bases and their metal complexes have been screened for their in vitro antibacterial activities against Staphylococcus aureus, Pseudomonas aeruginosa, Escherichia coli, Staphylococcus epidermidis, Klebsiella pneumoniae and antifungal activities against Aspergillus niger, Fusarium solani, Culvularia lunata, Rhizoctonia bataicola and Candida albicans by MIC method.

  10. Novel FOXC2 Mutation in Hereditary Distichiasis Impairs DNA-Binding Activity and Transcriptional Activation.

    Science.gov (United States)

    Zhang, Leilei; He, Jie; Han, Bing; Lu, Linna; Fan, Jiayan; Zhang, He; Ge, Shengfang; Zhou, Yixiong; Jia, Renbing; Fan, Xianqun

    2016-01-01

    Distichiasis presents as double rows of eyelashes arising from aberrant differentiation of the meibomian glands of the eyelids, and it may be sporadic or hereditary. FOXC2 gene mutations in hereditary distichiasis are rarely reported. Here, we examined two generations of a Chinese family with hereditary distichiasis but without lymphedema or other features of LD syndrome. The FOXC2 gene was amplified and sequenced in all family members. Subcellular localization and luciferase assays were performed to assess the activity of the mutant FOXC2 protein. Clinical examinations showed distichiasis, lower eyelid ectropion, congenital ptosis and photophobia in all affected individuals. Sequence analysis revealed a novel frameshift mutation, c.964_965insG, in the coding region of the FOXC2 gene. This mutation caused protein truncation due to the presence of a premature stop codon. A fluorescence assay showed that this mutation did not change the nuclear localization of the protein. However, it impaired DNA-binding activity and decreased transcriptional activation. This is the first report of a FOXC2 mutation in hereditary distichiasis in the Chinese population. The findings of our study expand the FOXC2 mutation spectrum and contribute to the understanding of the genotype-phenotype correlation of this disease.

  11. Single-Molecule Counting of Point Mutations by Transient DNA Binding

    Science.gov (United States)

    Su, Xin; Li, Lidan; Wang, Shanshan; Hao, Dandan; Wang, Lei; Yu, Changyuan

    2017-03-01

    High-confidence detection of point mutations is important for disease diagnosis and clinical practice. Hybridization probes are extensively used, but are hindered by their poor single-nucleotide selectivity. Shortening the length of DNA hybridization probes weakens the stability of the probe-target duplex, leading to transient binding between complementary sequences. The kinetics of probe-target binding events are highly dependent on the number of complementary base pairs. Here, we present a single-molecule assay for point mutation detection based on transient DNA binding and use of total internal reflection fluorescence microscopy. Statistical analysis of single-molecule kinetics enabled us to effectively discriminate between wild type DNA sequences and single-nucleotide variants at the single-molecule level. A higher single-nucleotide discrimination is achieved than in our previous work by optimizing the assay conditions, which is guided by statistical modeling of kinetics with a gamma distribution. The KRAS c.34 A mutation can be clearly differentiated from the wild type sequence (KRAS c.34 G) at a relative abundance as low as 0.01% mutant to WT. To demonstrate the feasibility of this method for analysis of clinically relevant biological samples, we used this technology to detect mutations in single-stranded DNA generated from asymmetric RT-PCR of mRNA from two cancer cell lines.

  12. Quantifying the Impact of Non-coding Variants on Transcription Factor-DNA Binding.

    Science.gov (United States)

    Zhao, Jingkang; Li, Dongshunyi; Seo, Jungkyun; Allen, Andrew S; Gordân, Raluca

    2017-05-01

    Many recent studies have emphasized the importance of genetic variants and mutations in cancer and other complex human diseases. The overwhelming majority of these variants occur in non-coding portions of the genome, where they can have a functional impact by disrupting regulatory interactions between transcription factors (TFs) and DNA. Here, we present a method for assessing the impact of non-coding mutations on TF-DNA interactions, based on regression models of DNA-binding specificity trained on high-throughput in vitro data. We use ordinary least squares (OLS) to estimate the parameters of the binding model for each TF, and we show that our predictions of TF-binding changes due to DNA mutations correlate well with measured changes in gene expression. In addition, by leveraging distributional results associated with OLS estimation, for each predicted change in TF binding we also compute a normalized score (z-score) and a significance value (p-value) reflecting our confidence that the mutation affects TF binding. We use this approach to analyze a large set of pathogenic non-coding variants, and we show that these variants lead to significant differences in TF binding between alleles, compared to a control set of common variants. Thus, our results indicate that there is a strong regulatory component to the pathogenic non-coding variants identified thus far.

  13. Biochemical characterization of DNA-binding proteins from Pyrobaculum aerophilum and Aeropyrum pernix.

    Science.gov (United States)

    Hardy, Christine D; Martin, Patrick K

    2008-03-01

    Several representatives of the Crenarchaeal branch of the Archaea contain highly abundant, small, positively charged proteins exemplified by the Sso7d protein from Sulfolobus solfataricus. These proteins bind to DNA in a non-sequence-specific manner. Using publicly available genomic sequence information, we identified a second class of small Crenarchaeal DNA-binding proteins represented by the Pyrobaculum aerophilum open reading frame 3192-encoded (Pae3192) protein and its paralogs. We investigated the biochemical properties of the Pae3192 protein and an orthologous protein (Ape1322b) from Aeropyrum pernix in side-by-side experiments with the Sso7d protein. We demonstrate that the recombinant Ape1322b, Pae3192 and Sso7d proteins bind to DNA and that the DNA-protein complexes formed are slightly different for each protein. We show that like Sso7d, Pae3192 constrains negative supercoils in DNA. In addition, we show that all three proteins raise the melting temperature of duplex DNA upon binding. Finally, we present the equilibrium affinity constants and kinetic association constants of each protein for single-stranded and double-stranded DNA.

  14. Competition for DNA binding sites using Promega DNA IQ™ paramagnetic beads.

    Science.gov (United States)

    Frégeau, Chantal J; De Moors, Anick

    2012-09-01

    The Promega DNA IQ™ system is easily amenable to automation and has been an integral part of standard operating procedures for many forensic laboratories including those of the Royal Canadian Mounted Police (RCMP) since 2004. Due to some failure to extract DNA from samples that should have produced DNA using our validated automated DNA IQ™-based protocol, the competition for binding sites on the DNA IQ™ magnetic beads was more closely examined. Heme from heavily blooded samples interfered slightly with DNA binding. Increasing the concentration of Proteinase K during lysis of these samples did not enhance DNA recovery. However, diluting the sample lysate following lysis prior to DNA extraction overcame the reduction in DNA yield and preserved portions of the lysates for subsequent manual or automated extraction. Dye/chemicals from black denim lysates competed for binding sites on the DNA IQ™ beads and significantly reduced DNA recovery. Increasing the size or number of black denim cuttings during lysis had a direct adverse effect on DNA yield from various blood volumes. The dilution approach was successful on these samples and permitted the extraction of high DNA yields. Alternatively, shortening the incubation time for cell lysis to 30 min instead of the usual overnight at 56 °C prevented competition from black denim dye/chemicals and increased DNA yields. Crown Copyright © 2011. Published by Elsevier Ireland Ltd. All rights reserved.

  15. Synthesis, characterization, anti-microbial, DNA binding and cleavage studies of Schiff base metal complexes

    Directory of Open Access Journals (Sweden)

    Poomalai Jayaseelan

    2016-09-01

    Full Text Available A novel Schiff base ligand has been prepared by the condensation between butanedione monoxime with 3,3′-diaminobenzidine. The ligand and metal complexes have been characterized by elemental analysis, UV, IR, 1H NMR, conductivity measurements, EPR and magnetic studies. The molar conductance studies of Cu(II, Ni(II, Co(II and Mn(II complexes showed non-electrolyte in nature. The ligand acts as dibasic with two N4-tetradentate sites and can coordinate with two metal ions to form binuclear complexes. The spectroscopic data of metal complexes indicated that the metal ions are complexed with azomethine nitrogen and oxyimino nitrogen atoms. The binuclear metal complexes exhibit octahedral arrangements. DNA binding properties of copper(II metal complex have been investigated by electronic absorption spectroscopy. Results suggest that the copper(II complex bind to DNA via an intercalation binding mode. The nucleolytic cleavage activities of the ligand and their complexes were assayed on CT-DNA using gel electrophoresis in the presence and absence of H2O2. The ligand showed increased nuclease activity when administered as copper complex and copper(II complex behave as efficient chemical nucleases with hydrogen peroxide activation. The anti-microbial activities and thermal studies have also been studied. In anti-microbial activity all complexes showed good anti-microbial activity higher than ligand against gram positive, gram negative bacteria and fungi.

  16. DNA binding and cleavage studies of copper(II) complexes with 2'-deoxyadenosine modified histidine moiety.

    Science.gov (United States)

    Borowska, Justyna; Sierant, Malgorzata; Sochacka, Elzbieta; Sanna, Daniele; Lodyga-Chruscinska, Elzbieta

    2015-09-01

    This work is focused on the study of DNA binding and cleavage properties of 2'-deoxyadenosines modified with ester/amide of histidine (his(6)dA ester, his(6)dA amide) and their copper(II) complexes. To determine the coordination mode of the complex species potentiometric and spectroscopic (UV-visible, CD, EPR) studies have been performed. The analysis of electronic absorption and fluorescence spectra has been used to find the nature of the interactions between the compounds and calf thymus DNA (CT-DNA). There is significant influence of the -NH2 and -OCH3 groups on binding of the ligands or the complexes to DNA. Only amide derivative and its complex reveal intercalative ability. In the case of his(6)dA ester and Cu(II)-his(6)dA ester the main interactions can be groove binding. DNA cleavage activities of the compounds have been examined by gel electrophoresis. The copper complexes have promoted the cleavage of plasmid DNA, but none of the ligands exhibited any chemical nuclease activity. The application of different scavengers of reactive oxygen species provided a conclusion that DNA cleavage caused by copper complexes might occur via hydrolytic pathway.

  17. Enantiopure copper(II) complex of natural product rosin derivative: DNA binding, DNA cleavage and cytotoxicity.

    Science.gov (United States)

    Fei, Bao-Li; Yin, Bin; Li, Dong-Dong; Xu, Wu-Shuang; Lu, Yang

    2016-12-01

    To develop chiral anticancer drug candidates for molecular target DNA, the synthesis and characterization of a novel enantiomerically pure copper(II) complex [Cu 1 Cl 2 ] (2) of an optically pure ligand N-(pyridin-2-ylmethylene) dehydroabietylamine (1) was carried out. The coordination geometry of the copper center is a distorted square-planar arrangement. The interactions of 1 and 2 with salmon sperm DNA were investigated by viscosity measurements, UV, fluorescence and circular dichroism (CD) spectroscopic techniques. All the results reveal that 1 and 2 interacted with DNA through intercalation and 2 exhibited a higher DNA binding ability. Further, 1 and 2 could cleave supercoiled pBR322 DNA by single strand and 2 displayed stronger cleavage ability in the presence of ascorbic acid. In vitro cytotoxicity of 1 and 2 against HeLa, SiHa, HepG-2 and A431 cancer cell lines was studied using CCK-8 assay. The results indicate that 2 had a superior cytotoxicity than 1 and the widely used drug cisplatin under identical conditions. Flow cytometry analysis demonstrates 2 produced death of HeLa cancer cells through an apoptotic pathway. Cell cycle analysis shows that 2 mainly arrested HeLa cells at the S phase. A novel enantiomerically pure copper(II) complex [Cu 1 Cl 2 ] (2) of an optically pure ligand N-(pyridin-2-ylmethylene) dehydroabietylamine (1), based on natural product rosin has been synthesized. 2 has the potential to act as effective anticancer drug.

  18. Design, synthesis and DNA-binding study of some novel morpholine linked thiazolidinone derivatives

    Science.gov (United States)

    War, Javeed Ahmad; Srivastava, Santosh Kumar; Srivastava, Savitri Devi

    2017-02-01

    The emergence of multiple drug resistance amongst bacterial strains resulted in many clinical drugs to be ineffective. Being vulnerable to bacterial infections any lack in the development of new antimicrobial drugs could pose a serious threat to public health. Here we report design and synthesis of a novel class of morpholine linked thiazolidinone hybrid molecules. The compounds were characterized by FT-IR, NMR and HRMS techniques. Susceptibility tests showed that most of the synthesized molecules were highly active against multiple bacterial strains. Compound 3f displayed MIC values which were better than the standard drug for most of the tested strains. DNA being a well defined target for many antimicrobial drugs was probed as possible target for these synthetic molecules. DNA-binding study of 3f with sm-DNA was probed through UV-vis absorption, fluorescence quenching, gel electrophoresis and molecular docking techniques. The studies revealed that compound 3f has strong affinity towards DNA and binds at the minor groove. The docking studies revealed that the compound 3f shows preferential binding towards A/T residues.

  19. Identification of inhibitors for single-stranded DNA-binding proteins in eubacteria.

    Science.gov (United States)

    Glanzer, Jason G; Endres, Jennifer L; Byrne, Brendan M; Liu, Shengqin; Bayles, Kenneth W; Oakley, Greg G

    2016-12-01

    The increasing threat of drug-resistant bacteria establishes a continuing need for the development of new strategies to fight infection. We examine the inhibition of the essential single-stranded DNA-binding proteins (SSBs) SSBA and SSBB as a potential antimicrobial therapy due to their importance in DNA replication, activating the SOS response and promoting competence-based mechanisms of resistance by incorporating new DNA. Purified recombinant SSBs from Gram-positive (Staphylococcus aureus and Bacillus anthracis) and Gram-negative (Escherichia coli and Francisella tularensis) bacteria were assessed in a high-throughput screen for inhibition of duplex DNA unwinding by small molecule inhibitors. Secondary electrophoretic mobility shift assays further validated the top hits that were then tested for MICs using in vitro assays. We have identified compounds that show cross-reactivity in vitro, as well as inhibition of both F. tularensis and B. anthracis SSBA. Five compounds were moderately toxic to at least two of the four bacterial strains in vivo, including two compounds that were selectively non-toxic to human cells, 9-hydroxyphenylfluoron and purpurogallin. Three of the SSBA inhibitors also inhibited S. aureus SSBB in Gram-positive bacteria. Results from our study support the potential for SSB inhibitors as broad-spectrum antibacterial agents, with dual targeting capabilities against Gram-positive bacteria. © The Author 2016. Published by Oxford University Press on behalf of the British Society for Antimicrobial Chemotherapy. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  20. Interaction with Single-stranded DNA-binding Protein Stimulates Escherichia coli Ribonuclease HI Enzymatic Activity*

    Science.gov (United States)

    Petzold, Christine; Marceau, Aimee H.; Miller, Katherine H.; Marqusee, Susan; Keck, James L.

    2015-01-01

    Single-stranded (ss) DNA-binding proteins (SSBs) bind and protect ssDNA intermediates formed during replication, recombination, and repair reactions. SSBs also directly interact with many different genome maintenance proteins to stimulate their enzymatic activities and/or mediate their proper cellular localization. We have identified an interaction formed between Escherichia coli SSB and ribonuclease HI (RNase HI), an enzyme that hydrolyzes RNA in RNA/DNA hybrids. The RNase HI·SSB complex forms by RNase HI binding the intrinsically disordered C terminus of SSB (SSB-Ct), a mode of interaction that is shared among all SSB interaction partners examined to date. Residues that comprise the SSB-Ct binding site are conserved among bacterial RNase HI enzymes, suggesting that RNase HI·SSB complexes are present in many bacterial species and that retaining the interaction is important for its cellular function. A steady-state kinetic analysis shows that interaction with SSB stimulates RNase HI activity by lowering the reaction Km. SSB or RNase HI protein variants that disrupt complex formation nullify this effect. Collectively our findings identify a direct RNase HI/SSB interaction that could play a role in targeting RNase HI activity to RNA/DNA hybrid substrates within the genome. PMID:25903123

  1. Interaction with Single-stranded DNA-binding Protein Stimulates Escherichia coli Ribonuclease HI Enzymatic Activity.

    Science.gov (United States)

    Petzold, Christine; Marceau, Aimee H; Miller, Katherine H; Marqusee, Susan; Keck, James L

    2015-06-05

    Single-stranded (ss) DNA-binding proteins (SSBs) bind and protect ssDNA intermediates formed during replication, recombination, and repair reactions. SSBs also directly interact with many different genome maintenance proteins to stimulate their enzymatic activities and/or mediate their proper cellular localization. We have identified an interaction formed between Escherichia coli SSB and ribonuclease HI (RNase HI), an enzyme that hydrolyzes RNA in RNA/DNA hybrids. The RNase HI·SSB complex forms by RNase HI binding the intrinsically disordered C terminus of SSB (SSB-Ct), a mode of interaction that is shared among all SSB interaction partners examined to date. Residues that comprise the SSB-Ct binding site are conserved among bacterial RNase HI enzymes, suggesting that RNase HI·SSB complexes are present in many bacterial species and that retaining the interaction is important for its cellular function. A steady-state kinetic analysis shows that interaction with SSB stimulates RNase HI activity by lowering the reaction Km. SSB or RNase HI protein variants that disrupt complex formation nullify this effect. Collectively our findings identify a direct RNase HI/SSB interaction that could play a role in targeting RNase HI activity to RNA/DNA hybrid substrates within the genome. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  2. DNA binding domains in diverse nuclear receptors function as nuclear export signals.

    Science.gov (United States)

    Black, B E; Holaska, J M; Rastinejad, F; Paschal, B M

    2001-11-13

    The nuclear receptor superfamily of transcription factors directs gene expression through DNA sequence-specific interactions with target genes. Nuclear import of these receptors involves recognition of a nuclear localization signal (NLS) by importins, which mediate translocation into the nucleus. Nuclear receptors lack a leucine-rich nuclear export signal (NES), and export is insensitive to leptomycin B, indicating that nuclear export is not mediated by Crm1. We set out to define the NES in the glucocorticoid receptor (GR) and to characterize the export pathway. We found that the 69 amino acid DNA binding domain (DBD) of GR, which is unrelated to any known NES, is necessary and sufficient for export. Mutational analysis revealed that a 15 amino acid sequence between the two zinc binding loops in the GR-DBD confers nuclear export to a GFP reporter protein, and alanine-scanning mutagenesis was used to identify the residues within this sequence that are critical for export. The DBD is highly related (41%-88% identity) in steroid, nonsteroid, and orphan nuclear receptors, and we found that the DBDs from ten different nuclear receptors all function as export signals. DBD-dependent nuclear export is saturable, and prolonged nuclear localization of the GR increases its transcriptional activity. Multiple members of the nuclear receptor superfamily use a common pathway to exit the nucleus. We propose that NLS-mediated import and DBD-mediated export define a shuttling cycle that integrates the compartmentalization and activity of nuclear receptors.

  3. Role of tomato lipoxygenase D in wound-induced jasmonate biosynthesis and plant immunity to insect herbivores.

    Directory of Open Access Journals (Sweden)

    Liuhua Yan

    Full Text Available In response to insect attack and mechanical wounding, plants activate the expression of genes involved in various defense-related processes. A fascinating feature of these inducible defenses is their occurrence both locally at the wounding site and systemically in undamaged leaves throughout the plant. Wound-inducible proteinase inhibitors (PIs in tomato (Solanum lycopersicum provide an attractive model to understand the signal transduction events leading from localized injury to the systemic expression of defense-related genes. Among the identified intercellular molecules in regulating systemic wound response of tomato are the peptide signal systemin and the oxylipin signal jasmonic acid (JA. The systemin/JA signaling pathway provides a unique opportunity to investigate, in a single experimental system, the mechanism by which peptide and oxylipin signals interact to coordinate plant systemic immunity. Here we describe the characterization of the tomato suppressor of prosystemin-mediated responses8 (spr8 mutant, which was isolated as a suppressor of (prosystemin-mediated signaling. spr8 plants exhibit a series of JA-dependent immune deficiencies, including the inability to express wound-responsive genes, abnormal development of glandular trichomes, and severely compromised resistance to cotton bollworm (Helicoverpa armigera and Botrytis cinerea. Map-based cloning studies demonstrate that the spr8 mutant phenotype results from a point mutation in the catalytic domain of TomLoxD, a chloroplast-localized lipoxygenase involved in JA biosynthesis. We present evidence that overexpression of TomLoxD leads to elevated wound-induced JA biosynthesis, increased expression of wound-responsive genes and, therefore, enhanced resistance to insect herbivory attack and necrotrophic pathogen infection. These results indicate that TomLoxD is involved in wound-induced JA biosynthesis and highlight the application potential of this gene for crop protection against

  4. Genome-Wide Identification and Structural Analysis of bZIP Transcription Factor Genes in Brassica napus

    Directory of Open Access Journals (Sweden)

    Yan Zhou

    2017-10-01

    Full Text Available The basic region/leucine zipper motif (bZIP transcription factor family is one of the largest families of transcriptional regulators in plants. bZIP genes have been systematically characterized in some plants, but not in rapeseed (Brassica napus. In this study, we identified 247 BnbZIP genes in the rapeseed genome, which we classified into 10 subfamilies based on phylogenetic analysis of their deduced protein sequences. The BnbZIP genes were grouped into functional clades with Arabidopsis genes with similar putative functions, indicating functional conservation. Genome mapping analysis revealed that the BnbZIPs are distributed unevenly across all 19 chromosomes, and that some of these genes arose through whole-genome duplication and dispersed duplication events. All expression profiles of 247 bZIP genes were extracted from RNA-sequencing data obtained from 17 different B. napus ZS11 tissues with 42 various developmental stages. These genes exhibited different expression patterns in various tissues, revealing that these genes are differentially regulated. Our results provide a valuable foundation for functional dissection of the different BnbZIP homologs in B. napus and its parental lines and for molecular breeding studies of bZIP genes in B. napus.

  5. Genome-Wide Identification and Structural Analysis of bZIP Transcription Factor Genes in Brassica napus

    Science.gov (United States)

    Zhou, Yan; Xu, Daixiang; Jia, Ledong; Huang, Xiaohu; Ma, Guoqiang; Wang, Shuxian; Zhu, Meichen; Zhang, Aoxiang; Guan, Mingwei; Xu, Xinfu; Wang, Rui; Li, Jiana

    2017-01-01

    The basic region/leucine zipper motif (bZIP) transcription factor family is one of the largest families of transcriptional regulators in plants. bZIP genes have been systematically characterized in some plants, but not in rapeseed (Brassica napus). In this study, we identified 247 BnbZIP genes in the rapeseed genome, which we classified into 10 subfamilies based on phylogenetic analysis of their deduced protein sequences. The BnbZIP genes were grouped into functional clades with Arabidopsis genes with similar putative functions, indicating functional conservation. Genome mapping analysis revealed that the BnbZIPs are distributed unevenly across all 19 chromosomes, and that some of these genes arose through whole-genome duplication and dispersed duplication events. All expression profiles of 247 bZIP genes were extracted from RNA-sequencing data obtained from 17 different B. napus ZS11 tissues with 42 various developmental stages. These genes exhibited different expression patterns in various tissues, revealing that these genes are differentially regulated. Our results provide a valuable foundation for functional dissection of the different BnbZIP homologs in B. napus and its parental lines and for molecular breeding studies of bZIP genes in B. napus. PMID:29064393

  6. IRE1/bZIP60-mediated unfolded protein response plays distinct roles in plant immunity and abiotic stress responses.

    Directory of Open Access Journals (Sweden)

    Adrian A Moreno

    Full Text Available Endoplasmic reticulum (ER-mediated protein secretion and quality control have been shown to play an important role in immune responses in both animals and plants. In mammals, the ER membrane-located IRE1 kinase/endoribonuclease, a key regulator of unfolded protein response (UPR, is required for plasma cell development to accommodate massive secretion of immunoglobulins. Plant cells can secrete the so-called pathogenesis-related (PR proteins with antimicrobial activities upon pathogen challenge. However, whether IRE1 plays any role in plant immunity is not known. Arabidopsis thaliana has two copies of IRE1, IRE1a and IRE1b. Here, we show that both IRE1a and IRE1b are transcriptionally induced during chemically-induced ER stress, bacterial pathogen infection and treatment with the immune signal salicylic acid (SA. However, we found that IRE1a plays a predominant role in the secretion of PR proteins upon SA treatment. Consequently, the ire1a mutant plants show enhanced susceptibility to a bacterial pathogen and are deficient in establishing systemic acquired resistance (SAR, whereas ire1b is unaffected in these responses. We further demonstrate that the immune deficiency in ire1a is due to a defect in SA- and pathogen-triggered, IRE1-mediated cytoplasmic splicing of the bZIP60 mRNA, which encodes a transcription factor involved in the expression of UPR-responsive genes. Consistently, IRE1a is preferentially required for bZIP60 splicing upon pathogen infection, while IRE1b plays a major role in bZIP60 processing upon Tunicamycin (Tm-induced stress. We also show that SA-dependent induction of UPR-responsive genes is altered in the bzip60 mutant resulting in a moderate susceptibility to a bacterial pathogen. These results indicate that the IRE1/bZIP60 branch of UPR is a part of the plant response to pathogens for which the two Arabidopsis IRE1 isoforms play only partially overlapping roles and that IRE1 has both bZIP60-dependent and bZIP60-independent

  7. IRE1/bZIP60-Mediated Unfolded Protein Response Plays Distinct Roles in Plant Immunity and Abiotic Stress Responses

    Science.gov (United States)

    Blanco, Francisca; Boatwright, Jon Lucas; Moreno, Ignacio; Jordan, Melissa R.; Chen, Yani; Brandizzi, Federica; Dong, Xinnian

    2012-01-01

    Endoplasmic reticulum (ER)-mediated protein secretion and quality control have been shown to play an important role in immune responses in both animals and plants. In mammals, the ER membrane-located IRE1 kinase/endoribonuclease, a key regulator of unfolded protein response (UPR), is required for plasma cell development to accommodate massive secretion of immunoglobulins. Plant cells can secrete the so-called pathogenesis-related (PR) proteins with antimicrobial activities upon pathogen challenge. However, whether IRE1 plays any role in plant immunity is not known. Arabidopsis thaliana has two copies of IRE1, IRE1a and IRE1b. Here, we show that both IRE1a and IRE1b are transcriptionally induced during chemically-induced ER stress, bacterial pathogen infection and treatment with the immune signal salicylic acid (SA). However, we found that IRE1a plays a predominant role in the secretion of PR proteins upon SA treatment. Consequently, the ire1a mutant plants show enhanced susceptibility to a bacterial pathogen and are deficient in establishing systemic acquired resistance (SAR), whereas ire1b is unaffected in these responses. We further demonstrate that the immune deficiency in ire1a is due to a defect in SA- and pathogen-triggered, IRE1-mediated cytoplasmic splicing of the bZIP60 mRNA, which encodes a transcription factor involved in the expression of UPR-responsive genes. Consistently, IRE1a is preferentially required for bZIP60 splicing upon pathogen infection, while IRE1b plays a major role in bZIP60 processing upon Tunicamycin (Tm)-induced stress. We also show that SA-dependent induction of UPR-responsive genes is altered in the bzip60 mutant resulting in a moderate susceptibility to a bacterial pathogen. These results indicate that the IRE1/bZIP60 branch of UPR is a part of the plant response to pathogens for which the two Arabidopsis IRE1 isoforms play only partially overlapping roles and that IRE1 has both bZIP60-dependent and bZIP60-independent functions in

  8. Plasticity of BRCA2 function in homologous recombination: genetic interactions of the PALB2 and DNA binding domains.

    Directory of Open Access Journals (Sweden)

    Nicolas Siaud

    2011-12-01

    Full Text Available The breast cancer suppressor BRCA2 is essential for the maintenance of genomic integrity in mammalian cells through its role in DNA repair by homologous recombination (HR. Human BRCA2 is 3,418 amino acids and is comprised of multiple domains that interact with the RAD51 recombinase and other proteins as well as with DNA. To gain insight into the cellular function of BRCA2 in HR, we created fusions consisting of various BRCA2 domains and also introduced mutations into these domains to disrupt specific protein and DNA interactions. We find that a BRCA2 fusion peptide deleted for the DNA binding domain and active in HR is completely dependent on interaction with the PALB2 tumor suppressor for activity. Conversely, a BRCA2 fusion peptide deleted for the PALB2 binding domain is dependent on an intact DNA binding domain, providing a role for this conserved domain in vivo; mutagenesis suggests that both single-stranded and double-stranded DNA binding activities in the DNA binding domain are required for its activity. Given that PALB2 itself binds DNA, these results suggest alternative mechanisms to deliver RAD51 to DNA. In addition, the BRCA2 C terminus contains both RAD51-dependent and -independent activities which are essential to HR in some contexts. Finally, binding the small peptide DSS1 is essential for activity when its binding domain is present, but not when it is absent. Our results reveal functional redundancy within the BRCA2 protein and emphasize the plasticity of this large protein built for optimal HR function in mammalian cells. The occurrence of disease-causing mutations throughout BRCA2 suggests sub-optimal HR from a variety of domain modulations.

  9. C-Terminal Domain Swapping of SSB Changes the Size of the ssDNA Binding Site

    Directory of Open Access Journals (Sweden)

    Yen-Hua Huang

    2014-01-01

    Full Text Available Single-stranded DNA-binding protein (SSB plays an important role in DNA metabolism, including DNA replication, repair, and recombination, and is therefore essential for cell survival. Bacterial SSB consists of an N-terminal ssDNA-binding/oligomerization domain and a flexible C-terminal protein-protein interaction domain. We characterized the ssDNA-binding properties of Klebsiella pneumoniae SSB (KpSSB, Salmonella enterica Serovar Typhimurium LT2 SSB (StSSB, Pseudomonas aeruginosa PAO1 SSB (PaSSB, and two chimeric KpSSB proteins, namely, KpSSBnStSSBc and KpSSBnPaSSBc. The C-terminal domain of StSSB or PaSSB was exchanged with that of KpSSB through protein chimeragenesis. By using the electrophoretic mobility shift assay, we characterized the stoichiometry of KpSSB, StSSB, PaSSB, KpSSBnStSSBc, and KpSSBnPaSSBc, complexed with a series of ssDNA homopolymers. The binding site sizes were determined to be 26±2, 21±2, 29±2, 21±2, and 29±2 nucleotides (nt, respectively. Comparison of the binding site sizes of KpSSB, KpSSBnStSSBc, and KpSSBnPaSSBc showed that the C-terminal domain swapping of SSB changes the size of the binding site. Our observations suggest that not only the conserved N-terminal domain but also the C-terminal domain of SSB is an important determinant for ssDNA binding.

  10. Mutational analysis of an archaeal minichromosome maintenance protein exterior hairpin reveals critical residues for helicase activity and DNA binding

    Directory of Open Access Journals (Sweden)

    Brewster Aaron S

    2010-08-01

    Full Text Available Abstract Background The mini-chromosome maintenance protein (MCM complex is an essential replicative helicase for DNA replication in Archaea and Eukaryotes. While the eukaryotic complex consists of six homologous proteins (MCM2-7, the archaeon Sulfolobus solfataricus has only one MCM protein (ssoMCM, six subunits of which form a homohexamer. We have recently reported a 4.35Å crystal structure of the near full-length ssoMCM. The structure reveals a total of four β-hairpins per subunit, three of which are located within the main channel or side channels of the ssoMCM hexamer model generated based on the symmetry of the N-terminal Methanothermobacter thermautotrophicus (mtMCM structure. The fourth β-hairpin, however, is located on the exterior of the hexamer, near the exit of the putative side channels and next to the ATP binding pocket. Results In order to better understand this hairpin's role in DNA binding and helicase activity, we performed a detailed mutational and biochemical analysis of nine residues on this exterior β-hairpin (EXT-hp. We examined the activities of the mutants related to their helicase function, including hexamerization, ATPase, DNA binding and helicase activities. The assays showed that some of the residues on this EXT-hp play a role for DNA binding as well as for helicase activity. Conclusions These results implicate several current theories regarding helicase activity by this critical hexameric enzyme. As the data suggest that EXT-hp is involved in DNA binding, the results reported here imply that the EXT-hp located near the exterior exit of the side channels may play a role in contacting DNA substrate in a manner that affects DNA unwinding.

  11. Regulation of the Escherichia coli L-arabinose operon studied by gel electrophoresis DNA binding assay.

    Science.gov (United States)

    Hendrickson, W; Schleif, R F

    1984-09-25

    DNA binding properties of the proteins required for induction of the Escherichia coli L-arabinose operon were measured using a polyacrylamide gel electrophoresis assay. The mechanisms of induction and repression were studied by observing the multiple interactions of RNA polymerase, cyclic AMP receptor protein and araC protein with short DNA fragments containing either the araC or araBAD promoter regions. These studies show that binding of araC protein to the operator site, araO1, directly blocks RNA polymerase binding at the araC promoter, pC. We find that cyclic AMP receptor protein and araC protein do not bind co-operatively at their respective sites to linear DNA fragments containing the pBAD promoter. Nevertheless, both these positive effectors must be present on the DNA to stimulate binding of RNA polymerase. Additionally, binding of the proteins to the DNA is not sufficient; araC protein must also be in the inducing state, for RNA polymerase to bind. Equilibrium binding constraints and kinetics were determined for araC protein binding to the araI and the araO1 sites. In the presence of inducer, L-arabinose, araC protein binds with equal affinity to DNA fragments containing either of these sites. In the presence of anti-inducer, D-fucose, the affinity for both sites is reduced 40-fold. The apparent equilibrium binding constants for both states of the protein vary in parallel with the buffer salt concentration. This result suggests that the inducing and repressing forms of araC protein displace a similar number of cations upon binding DNA.

  12. A hotspot in the glucocorticoid receptor DNA-binding domain susceptible to loss of function mutation.

    Science.gov (United States)

    Banuelos, Jesus; Shin, Soon Cheon; Lu, Nick Z

    2015-04-01

    Glucocorticoids (GCs) are used to treat a variety of inflammatory disorders and certain cancers. However, GC resistance occurs in subsets of patients. We found that EL4 cells, a GC-resistant mouse thymoma cell line, harbored a point mutation in their GC receptor (GR) gene, resulting in the substitution of arginine 493 by a cysteine in the second zinc finger of the DNA-binding domain. Allelic discrimination analyses revealed that the R493C mutation occurred on both alleles. In the absence of GCs, the GR in EL4 cells localized predominantly in the cytoplasm and upon dexamethasone treatment underwent nuclear translocation, suggesting that the ligand binding ability of the GR in EL4 cells was intact. In transient transfection assays, the R493C mutant could not transactivate the MMTV-luciferase reporter. Site-directed mutagenesis to revert the R493C mutation restored the transactivation activity. Cotransfection experiments showed that the R493C mutant did not inhibit the transcriptional activities of the wild-type GR. In addition, the R493C mutant did not repress either the AP-1 or NF-κB reporters as effectively as WT GR. Furthermore, stable expression of the WT GR in the EL4 cells enabled GC-mediated gene regulation, specifically upregulation of IκBα and downregulation of interferon γ and interleukin 17A. Arginine 493 is conserved among multiple species and all human nuclear receptors and its mutation has also been found in the human GR, androgen receptor, and mineralocorticoid receptor. Thus, R493 is necessary for the transcriptional activity of the GR and a hotspot for mutations that result in GC resistance. Copyright © 2015 Elsevier Inc. All rights reserved.

  13. The TCF C-clamp DNA binding domain expands the Wnt transcriptome via alternative target recognition.

    Science.gov (United States)

    Hoverter, Nate P; Zeller, Michael D; McQuade, Miriam M; Garibaldi, Angela; Busch, Anke; Selwan, Elizabeth M; Hertel, Klemens J; Baldi, Pierre; Waterman, Marian L

    2014-12-16

    LEF/TCFs direct the final step in Wnt/β-catenin signalling by recruiting β-catenin to genes for activation of transcription. Ancient, non-vertebrate TCFs contain two DNA binding domains, a High Mobility Group box for recognition of the Wnt Response Element (WRE; 5'-CTTTGWWS-3') and the C-clamp domain for recognition of the GC-rich Helper motif (5'-RCCGCC-3'). Two vertebrate TCFs (TCF-1/TCF7 and TCF-4/TCF7L2) use the C-clamp as an alternatively spliced domain to regulate cell-cycle progression, but how the C-clamp influences TCF binding and activity genome-wide is not known. Here, we used a doxycycline inducible system with ChIP-seq to assess how the C-clamp influences human TCF1 binding genome-wide. Metabolic pulse-labeling of nascent RNA with 4'Thiouridine was used with RNA-seq to connect binding to the Wnt transcriptome. We find that the C-clamp enables targeting to a greater number of gene loci for stronger occupancy and transcription regulation. The C-clamp uses Helper sites concurrently with WREs for gene targeting, but it also targets TCF1 to sites that do not have readily identifiable canonical WREs. The coupled ChIP-seq/4'Thiouridine-seq analysis identified new Wnt target genes, including additional regulators of cell proliferation. Thus, C-clamp containing isoforms of TCFs are potent transcriptional regulators with an expanded transcriptome directed by C-clamp-Helper site interactions. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

  14. Damaged DNA binding protein 2 plays a role in breast cancer cell growth.

    Directory of Open Access Journals (Sweden)

    Zilal Kattan

    Full Text Available The Damaged DNA binding protein 2 (DDB2, is involved in nucleotide excision repair as well as in other biological processes in normal cells, including transcription and cell cycle regulation. Loss of DDB2 function may be related to tumor susceptibility. However, hypothesis of this study was that DDB2 could play a role in breast cancer cell growth, resulting in its well known interaction with the proliferative marker E2F1 in breast neoplasia. DDB2 gene was overexpressed in estrogen receptor (ER-positive (MCF-7 and T47D, but not in ER-negative breast cancer (MDA-MB231 and SKBR3 or normal mammary epithelial cell lines. In addition, DDB2 expression was significantly (3.0-fold higher in ER-positive than in ER-negative tumor samples (P = 0.0208 from 16 patients with breast carcinoma. Knockdown of DDB2 by small interfering RNA in MCF-7 cells caused a decrease in cancer cell growth and colony formation. Inversely, introduction of the DDB2 gene into MDA-MB231 cells stimulated growth and colony formation. Cell cycle distribution and 5 Bromodeoxyuridine incorporation by flow cytometry analysis showed that the growth-inhibiting effect of DDB2 knockdown was the consequence of a delayed G1/S transition and a slowed progression through the S phase of MCF-7 cells. These results were supported by a strong decrease in the expression of S phase markers (Proliferating Cell Nuclear Antigen, cyclin E and dihydrofolate reductase. These findings demonstrate for the first time that DDB2 can play a role as oncogene and may become a promising candidate as a predictive marker in breast cancer.

  15. Synthesis, crystal structure and electrochemical and DNA binding studies of oxygen bridged-copper(II) carboxylate

    Science.gov (United States)

    Iqbal, Muhammad; Ali, Saqib; Tahir, Muhammad Nawaz; Muhammad, Niaz; Shah, Naseer Ali; Sohail, Manzar; Pandarinathan, Vedapriya

    2015-08-01

    A new binuclear O-bridged Cu(II) complex with 4-chlorophenyl acetate and 2,2‧-bipyridine has been synthesized and characterized using FT-IR, powder and single crystal XRD and electrochemical solution studies. The results revealed that the two penta-coordinated Cu(II) centers are linked by two carboxylate ligands in end-on bonding fashion. The coordination geometry is slightly distorted square pyramidal (SP) with bridging oxygen atoms occupying the apical position and other ligands lying in the equatorial plane. The striking difference in Cu-O bond distance of the bridging oxygen atom in the complex may be responsible for the SP geometry of Cu(II) ion. The complex gave rise to metal centered irreversible electro-activity where one electron Cu(II)/Cu(III) oxidation process and a single step two electron Cu(II)/Cu(0) reduction process was observed. The redox processes were found predominantly adsorption controlled. The values of diffusion coefficient and heterogeneous rate constant for oxidation process were 6.98 × 10-7 cm2 s-1 and 4.60 × 10-5 cm s-1 while the corresponding values for reduction were 5.30 × 10-8 cm2 s-1 and 5.41 × 10-6 cm s-1, respectively. The formal potential and charge transfer coefficient were also calculated. The DNA-binding ability was explored through cyclic voltammetry and UV-Visible spectroscopy. Diminution in the value of Do for oxidation indicated the binding of the complex with DNA corresponding to Kb = 8.58 × 104 M-1. UV-Visible spectroscopy yielded ε = 49 L mol-1 cm-1 and Kb = 2.96 × 104 M-1. The data of both techniques support each other. The self-induced redox activation of the complex, as indicated by cyclic voltammetry heralds its potential applications in redox catalysis and anticancer activity.

  16. Mechanism of RecO recruitment to DNA by single-stranded DNA binding protein

    Energy Technology Data Exchange (ETDEWEB)

    Ryzhikov, Mikhail; Koroleva, Olga; Postnov, Dmitri; Tran, Andrew; Korolev, Sergey (St. Louis-MED)

    2011-08-25

    RecO is a recombination mediator protein (RMP) important for homologous recombination, replication repair and DNA annealing in bacteria. In all pathways, the single-stranded (ss) DNA binding protein, SSB, plays an inhibitory role by protecting ssDNA from annealing and recombinase binding. Conversely, SSB may stimulate each reaction through direct interaction with RecO. We present a crystal structure of Escherichia coli RecO bound to the conserved SSB C-terminus (SSB-Ct). SSB-Ct binds the hydrophobic pocket of RecO in a conformation similar to that observed in the ExoI/SSB-Ct complex. Hydrophobic interactions facilitate binding of SSB-Ct to RecO and RecO/RecR complex in both low and moderate ionic strength solutions. In contrast, RecO interaction with DNA is inhibited by an elevated salt concentration. The SSB mutant lacking SSB-Ct also inhibits RecO-mediated DNA annealing activity in a salt-dependent manner. Neither RecO nor RecOR dissociates SSB from ssDNA. Therefore, in E. coli, SSB recruits RMPs to ssDNA through SSB-Ct, and RMPs are likely to alter the conformation of SSB-bound ssDNA without SSB dissociation to initiate annealing or recombination. Intriguingly, Deinococcus radiodurans RecO does not bind SSB-Ct and weakly interacts with the peptide in the presence of RecR, suggesting the diverse mechanisms of DNA repair pathways mediated by RecO in different organisms.

  17. Binding dynamics of single-stranded DNA binding proteins to fluctuating bubbles in breathing DNA

    Energy Technology Data Exchange (ETDEWEB)

    Ambjoernsson, Tobias; Metzler, Ralf [NORDITA-Nordic Institute for Theoretical Physics, Blegdamsvej 17, DK-2100 Copenhagen Oe (Denmark)

    2005-05-25

    We investigate the dynamics of a single local denaturation zone in a DNA molecule, a so-called DNA bubble, in the presence of single-stranded DNA binding proteins (SSBs). In particular, we develop a dynamical description of the process in terms of a two-dimensional master equation for the time evolution of the probability distribution of having a bubble of size m with n bound SSBs, for the case when m and n are the slowest variables in the system. We derive explicit expressions for the equilibrium statistical weights for a given m and n, which depend on the statistical weight u associated with breaking a base-pair interaction, the loop closure exponent c, the cooperativity parameter {sigma}{sub 0}, the SSB size {lambda}, and binding strength {kappa}. These statistical weights determine, through the detailed balance condition, the transfer coefficient in the master equation. For the case of slow and fast binding dynamics the problem can be reduced to one-dimensional master equations. In the latter case, we perform explicitly the adiabatic elimination of the fast variable n. Furthermore, we find that for the case that the loop closure is neglected and the binding dynamics is vanishing (but with arbitrary {sigma}{sub 0}) the eigenvalues and the eigenvectors of the master equation can be obtained analytically, using an orthogonal polynomial approach. We solve the general case numerically (i.e., including SSB binding and the loop closure) as a function of statistical weight u, binding protein size {lambda}, and binding strength {kappa}, and compare to the fast and slow binding limits. In particular, we find that the presence of SSBs in general increases the relaxation time, compared to the case when no binding proteins are present. By tuning the parameters, we can drive the system from regular bubble fluctuation in the absence of SSBs to full denaturation, reflecting experimental and in vivo situations.

  18. Probing concentration-dependent behavior of DNA-binding proteins on a single-molecule level illustrated by Rad51.

    Science.gov (United States)

    Frykholm, Karolin; Freitag, Camilla; Persson, Fredrik; Tegenfeldt, Jonas O; Granéli, Annette

    2013-12-15

    Low throughput is an inherent problem associated with most single-molecule biophysical techniques. We have developed a versatile tool for high-throughput analysis of DNA and DNA-binding molecules by combining microfluidic and dense DNA arrays. We use an easy-to-process microfluidic flow channel system in which dense DNA arrays are prepared for simultaneous imaging of large amounts of DNA molecules with single-molecule resolution. The Y-shaped microfluidic design, where the two inlet channels can be controlled separately and precisely, enables the creation of a concentration gradient across the microfluidic channel as well as rapid and repeated addition and removal of substances from the measurement region. A DNA array stained with the fluorescent DNA-binding dye YOYO-1 in a gradient manner illustrates the method and serves as a proof of concept. We have applied the method to studies of the repair protein Rad51 and could directly probe the concentration-dependent DNA-binding behavior of human Rad51 (HsRad51). In the low-concentration regime used (100 nM HsRad51 and below), we detected binding to double-stranded DNA (dsDNA) without positive cooperativity. Copyright © 2013 Elsevier Inc. All rights reserved.

  19. C-terminal diversity within the p53 family accounts for differences in DNA binding and transcriptional activity

    Science.gov (United States)

    Sauer, Markus; Bretz, Anne Catherine; Beinoraviciute-Kellner, Rasa; Beitzinger, Michaela; Burek, Christof; Rosenwald, Andreas; Harms, Gregory S.; Stiewe, Thorsten

    2008-01-01

    The p53 family is known as a family of transcription factors with functions in tumor suppression and development. Whereas the central DNA-binding domain is highly conserved among the three family members p53, p63 and p73, the C-terminal domains (CTDs) are diverse and subject to alternative splicing and post-translational modification. Here we demonstrate that the CTDs strongly influence DNA binding and transcriptional activity: while p53 and the p73 isoform p73γ have basic CTDs and form weak sequence-specific protein–DNA complexes, the major p73 isoforms have neutral CTDs and bind DNA strongly. A basic CTD has been previously shown to enable sliding along the DNA backbone and to facilitate the search for binding sites in the complex genome. Our experiments, however, reveal that a basic CTD also reduces protein–DNA complex stability, intranuclear mobility, promoter occupancy in vivo, target gene activation and induction of cell cycle arrest or apoptosis. A basic CTD therefore provides both positive and negative regulatory functions presumably to enable rapid switching of protein activity in response to stress. The different DNA-binding characteristics of the p53 family members could therefore reflect their predominant role in the cellular stress response (p53) or developmental processes (p73). PMID:18267967

  20. Biochemical studies on the DNA binding function of the cyclic-amp reactor protein of Escherichia coli

    Energy Technology Data Exchange (ETDEWEB)

    Angulo, J.A.

    1986-01-01

    The cAMP receptor protein (CRP) is an allosteric protein in which binding of cAMP effects a conformational change with a consequent increased affinity for DNA. Binding of double-stranded deoxyribopolynucleotides and calf thymus DNA by cAMP-CRP confers protection against attack by trypsin, subtilisin, Staph. aureus V8 protease and clostripain. Of the single-stranded deoxy- and ribopolynucleotides tested, only r(I)/sub n/ and r(A)/sub n/ gave significant protection against attack by these proteases. In the absence of cAMP, CRP is resistant to proteolysis. Incubation of CRP-DNA with trypsin results in the accumulation of two novel fragments. CRP-DNA is partially sensitive to digestion by chymotrypsin but resistant to attack by subtilisin, the Staph. aureus V8 protease and clostripain. Cleavage of CRP-DNA to fragments is accompanied by the loss of /sup 3/H-cAMP binding activity. Modification of the arginines with phenylglyoxal or butanedione results in loss of DNA binding activity. cAMP-CRP incorporates more /sup 14/C-phenylglyoxal than unliganded CRP. Titration of the arginines with /sup 14/C-phenylglyoxal to where over 90% of the DNA binding activity is lost results in incorporation of one mole of reagent per mole of subunit.

  1. Reactivation of mutant p53: Constraints on mechanism highlighted by principal component analysis of the DNA binding domain.

    Science.gov (United States)

    Ouaray, Zahra; ElSawy, Karim M; Lane, David P; Essex, Jonathan W; Verma, Chandra

    2016-10-01

    Most p53 mutations associated with cancer are located in its DNA binding domain (DBD). Many structures (X-ray and NMR) of this domain are available in the protein data bank (PDB) and a vast conformational heterogeneity characterizes the various free and complexed states. The major difference between the apo and the holo-complexed states appears to lie in the L1 loop. In particular, the conformations of this loop appear to depend intimately on the sequence of DNA to which it binds. This conclusion builds upon recent observations that implicate the tetramerization and the C-terminal domains (respectively TD and Cter) in DNA binding specificity. Detailed PCA analysis of the most recent collection of DBD structures from the PDB have been carried out. In contrast to recommendations that small molecules/drugs stabilize the flexible L1 loop to rescue mutant p53, our study highlights a need to retain the flexibility of the p53 DNA binding surface (DBS). It is the adaptability of this region that enables p53 to engage in the diverse interactions responsible for its functionality. Proteins 2016; 84:1443-1461. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

  2. The DNA-binding box of human SPARTAN contributes to the targeting of Polη to DNA damage sites.

    Science.gov (United States)

    Toth, Agnes; Hegedus, Lili; Juhasz, Szilvia; Haracska, Lajos; Burkovics, Peter

    2017-01-01

    Inappropriate repair of UV-induced DNA damage results in human diseases such as Xeroderma pigmentosum (XP), which is associated with an extremely high risk of skin cancer. A variant form of XP is caused by the absence of Polη, which is normally able to bypass UV-induced DNA lesions in an error-free manner. However, Polη is highly error prone when replicating undamaged DNA and, thus, the regulation of the proper targeting of Polη is crucial for the prevention of mutagenesis and UV-induced cancer formation. Spartan is a novel regulator of the damage tolerance pathway, and its association with Ub-PCNA has a role in Polη targeting; however, our knowledge about its function is only rudimentary. Here, we describe a new biochemical property of purified human SPARTAN by showing that it is a DNA-binding protein. Using a DNA binding mutant, we provide in vivo evidence that DNA binding by SPARTAN regulates the targeting of Polη to damage sites after UV exposure, and this function contributes highly to its DNA-damage tolerance function. Copyright © 2016 Elsevier B.V. All rights reserved.

  3. Eubacterial SpoVG homologs constitute a new family of site-specific DNA-binding proteins.

    Directory of Open Access Journals (Sweden)

    Brandon L Jutras

    Full Text Available A site-specific DNA-binding protein was purified from Borrelia burgdorferi cytoplasmic extracts, and determined to be a member of the highly conserved SpoVG family. This is the first time a function has been attributed to any of these ubiquitous bacterial proteins. Further investigations into SpoVG orthologues indicated that the Staphylococcus aureus protein also binds DNA, but interacts preferentially with a distinct nucleic acid sequence. Site-directed mutagenesis and domain swapping between the S. aureus and B. burgdorferi proteins identified that a 6-residue stretch of the SpoVG α-helix contributes to DNA sequence specificity. Two additional, highly conserved amino acid residues on an adjacent β-sheet are essential for DNA-binding, apparently by contacts with the DNA phosphate backbone. Results of these studies thus identified a novel family of bacterial DNA-binding proteins, developed a model of SpoVG-DNA interactions, and provide direction for future functional studies on these wide-spread proteins.

  4. Molecular mechanisms of ligand-mediated attenuation of DNA binding by MarR family transcriptional regulators.

    Science.gov (United States)

    Perera, Inoka C; Grove, Anne

    2010-10-01

    Bacteria and archaea encode members of the large multiple antibiotic resistance regulator (MarR) family of transcriptional regulators. Generally, MarR homologs regulate activity of genes involved in antibiotic resistance, stress responses, virulence or catabolism of aromatic compounds. They constitute a diverse group of transcriptional regulators that includes both repressors and activators, and the conventional mode of regulation entails a genetic locus in which the MarR homolog and a gene under its regulation are encoded divergently; binding of the MarR homolog to the intergenic region typically represses transcription of both genes, while binding of a specific ligand to the transcription factor results in attenuated DNA binding and hence activated gene expression. For many homologs, the natural ligand is unknown. Crystal structures reveal a common architecture with a characteristic winged helix domain for DNA binding, and recent structural information of homologs solved both in the absence and presence of their respective ligands, as well as biochemical data, is finally converging to illuminate the mechanisms by which ligand-binding causes attenuated DNA binding. As MarR homologs regulate pathways that are critical to bacterial physiology, including virulence, a molecular understanding of mechanisms by which ligands affect a regulation of gene activity is essential. Specifying the position of ligand-binding pockets further has the potential to aid in identifying the ligands for MarR homologs for which the ligand remains unknown.

  5. Structural characterization of the DNA-binding mechanism underlying the copper(II)-sensing MarR transcriptional regulator.

    Science.gov (United States)

    Zhu, Rongfeng; Hao, Ziyang; Lou, Hubing; Song, Yanqun; Zhao, Jingyi; Chen, Yuqing; Zhu, Jiuhe; Chen, Peng R

    2017-07-01

    Multiple antibiotic resistance regulator (MarR) family proteins are widely conserved transcription factors that control bacterial resistance to antibiotics, environmental stresses, as well as the regulation of virulence determinants. Escherichia coli MarR, the prototype member of this family, has recently been shown to undergo copper(II)-catalyzed inter-dimer disulfide bond formation via a unique cysteine residue (Cys80) residing in its DNA-binding domain. However, despite extensive structural characterization of the MarR family proteins, the structural mechanism for DNA binding of this copper(II)-sensing MarR factor remains elusive. Here, we report the crystal structures of DNA-bound forms of MarR, which revealed a unique, concerted generation of two new helix-loop-helix motifs that facilitated MarR's DNA binding. Structural analysis and electrophoretic mobility shift assays (EMSA) show that the flexibility of Gly116 in the center of helix α5 and the extensive hydrogen-bonding interactions at the N-terminus of helix α1 together assist the reorientation of the wHTH domains and stabilize MarR's DNA-bound conformation.

  6. Mechanical wounding-induced laticifer differentiation in rubber tree: An indicative role of dehydration, hydrogen peroxide, and jasmonates.

    Science.gov (United States)

    Tian, Wei-Min; Yang, Shu-Guang; Shi, Min-Jing; Zhang, Shi-Xin; Wu, Ji-Lin

    2015-06-15

    The secondary laticifer in the secondary phloem of rubber tree are a specific tissue differentiating from vascular cambia. The number of the secondary laticifers is closely related to the rubber productivity of Hevea. Factors involved in the mechanical wounding-induced laticifer differentiation were analyzed by using paraffin section, gas chromatography-mass spectrometry (GC-MS), and Northern-blot techniques. Dehydration of the wounded bark tissues triggered a burst of hydrogen peroxide, abscisic acid, and jasmonates and up-regulated the expression of HbAOSa, which was associated with the secondary laticifer differentiation strictly limited to the wounded area. Application of exogenous hydrogen peroxide, methyl jasmonate, and polyethylene glycol 6000 (PEG6000) could induce the secondary laticifer differentiation, respectively. Moreover, 6-Benzylaminopurine, a synthetic cytokinin, enhanced the methyl jasmonate-induced secondary laticifer differentiation. However, the dehydration-induced secondary laticifer differentiation was inhibited by exogenous abscisic acid. Diphenyleneiodonium chloride (DPI), a specific inhibitor of NADPH oxidase, was effective in inhibiting the accumulation of hydrogen peroxide as well as of jasmonates upon dehydration. It blocked the dehydration-induced but not the methyl jasmonate-induced secondary laticifer differentiation. The results suggested a stress signal pathway mediating the wound-induced secondary laticifer differentiation in rubber tree. Copyright © 2015 Elsevier GmbH. All rights reserved.

  7. Toll pathway is required for wound-induced expression of barrier repair genes in the Drosophila epidermis

    Science.gov (United States)

    Capilla, Amalia; Karachentsev, Dmitry; Patterson, Rachel A.; Hermann, Anita; Juarez, Michelle T.; McGinnis, William

    2017-01-01

    The epidermis serves as a protective barrier in animals. After epidermal injury, barrier repair requires activation of many wound response genes in epidermal cells surrounding wound sites. Two such genes in Drosophila encode the enzymes dopa decarboxylase (Ddc) and tyrosine hydroxylase (ple). In this paper we explore the involvement of the Toll/NF-κB pathway in the localized activation of wound repair genes around epidermal breaks. Robust activation of wound-induced transcription from ple and Ddc requires Toll pathway components ranging from the extracellular ligand Spätzle to the Dif transcription factor. Epistasis experiments indicate a requirement for Spätzle ligand downstream of hydrogen peroxide and protease function, both of which are known activators of wound-induced transcription. The localized activation of Toll a few cell diameters from wound edges is reminiscent of local activation of Toll in early embryonic ventral hypoderm, consistent with the hypothesis that the dorsal–ventral patterning function of Toll arose from the evolutionary cooption of a morphogen-responsive function in wound repair. Furthermore, the combinatorial activity of Toll and other signaling pathways in activating epidermal barrier repair genes can help explain why developmental activation of the Toll, ERK, or JNK pathways alone fail to activate wound repair loci. PMID:28289197

  8. EL_PSSM-RT: DNA-binding residue prediction by integrating ensemble learning with PSSM Relation Transformation.

    Science.gov (United States)

    Zhou, Jiyun; Lu, Qin; Xu, Ruifeng; He, Yulan; Wang, Hongpeng

    2017-08-29

    Prediction of DNA-binding residue is important for understanding the protein-DNA recognition mechanism. Many computational methods have been proposed for the prediction, but most of them do not consider the relationships of evolutionary information between residues. In this paper, we first propose a novel residue encoding method, referred to as the Position Specific Score Matrix (PSSM) Relation Transformation (PSSM-RT), to encode residues by utilizing the relationships of evolutionary information between residues. PDNA-62 and PDNA-224 are used to evaluate PSSM-RT and two existing PSSM encoding methods by five-fold cross-validation. Performance evaluations indicate that PSSM-RT is more effective than previous methods. This validates the point that the relationship of evolutionary information between residues is indeed useful in DNA-binding residue prediction. An ensemble learning classifier (EL_PSSM-RT) is also proposed by combining ensemble learning model and PSSM-RT to better handle the imbalance between binding and non-binding residues in datasets. EL_PSSM-RT is evaluated by five-fold cross-validation using PDNA-62 and PDNA-224 as well as two independent datasets TS-72 and TS-61. Performance comparisons with existing predictors on the four datasets demonstrate that EL_PSSM-RT is the best-performing method among all the predicting methods with improvement between 0.02-0.07 for MCC, 4.18-21.47% for ST and 0.013-0.131 for AUC. Furthermore, we analyze the importance of the pair-relationships extracted by PSSM-RT and the results validates the usefulness of PSSM-RT for encoding DNA-binding residues. We propose a novel prediction method for the prediction of DNA-binding residue with the inclusion of relationship of evolutionary information and ensemble learning. Performance evaluation shows that the relationship of evolutionary information between residues is indeed useful in DNA-binding residue prediction and ensemble learning can be used to address the data imbalance

  9. New Frontiers for the NFIL3 bZIP Transcription Factor in Cancer, Metabolism and Beyond

    Science.gov (United States)

    Keniry, Megan; Dearth, Robert K.; Persans, Michael; Parsons, Ramon

    2015-01-01

    The bZIP transcription factor NFIL3 (Nuclear factor Interleukin 3 regulated, also known as E4 binding protein 4, E4BP4) regulates diverse biological processes from circadian rhythm to cellular viability. Recently, a host of novel roles have been identified for NFIL3 in immunological signal transduction, cancer, aging and metabolism. Elucidating the signaling pathways that are impacted by NFIL3 and the regulatory mechanisms that it targets, inhibits or activates will be critical for developing a clearer picture of its physiological roles in disease and normal processes. This review will discuss the recent advances and emerging issues regarding NFIL3-mediated transcriptional regulation of CEBPβ and FOXO1 activated genes and signal transduction. PMID:26539561

  10. Relationship of structure and function of DNA-binding domain in vitamin D receptor.

    Science.gov (United States)

    Wan, Lin-Yan; Zhang, Yan-Qiong; Chen, Meng-Di; Liu, Chang-Bai; Wu, Jiang-Feng

    2015-07-07

    While the structure of the DNA-binding domain (DBD) of the vitamin D receptor (VDR) has been determined in great detail, the roles of its domains and how to bind the motif of its target genes are still under debate. The VDR DBD consists of two zinc finger modules and a C-terminal extension (CTE), at the end of the C-terminal of each structure presenting α-helix. For the first zinc finger structure, N37 and S-box take part in forming a dimer with 9-cis retinoid X receptor (RXR), while V26, R50, P-box and S-box participate in binding with VDR response elements (VDRE). For the second zinc finger structure, P61, F62 and H75 are essential in the structure of the VDR homodimer with the residues N37, E92 and F93 of the downstream of partner VDR, which form the inter-DBD interface. T-box of the CTE, especially the F93 and I94, plays a critical role in heterodimerization and heterodimers-VDRE binding. Six essential residues (R102, K103, M106, I107, K109, and R110) of the CTE α-helix of VDR construct one interaction face, which packs against the DBD core of the adjacent symmetry mate. In 1,25(OH)2D3-activated signaling, the VDR-RXR heterodimer may bind to DR3-type VDRE and ER9-type VDREs of its target gene directly resulting in transactivation and also bind to DR3-liked nVDRE of its target gene directly resulting in transrepression. Except for this, 1α,25(OH)2D3 ligand VDR-RXR may bind to 1αnVDRE indirectly through VDIR, resulting in transrepression of the target gene. Upon binding of 1α,25(OH)2D3, VDR can transactivate and transrepress its target genes depending on the DNA motif that DBD binds.

  11. Relationship of Structure and Function of DNA-Binding Domain in Vitamin D Receptor

    Directory of Open Access Journals (Sweden)

    Lin-Yan Wan

    2015-07-01

    Full Text Available While the structure of the DNA-binding domain (DBD of the vitamin D receptor (VDR has been determined in great detail, the roles of its domains and how to bind the motif of its target genes are still under debate. The VDR DBD consists of two zinc finger modules and a C-terminal extension (CTE, at the end of the C-terminal of each structure presenting α-helix. For the first zinc finger structure, N37 and S-box take part in forming a dimer with 9-cis retinoid X receptor (RXR, while V26, R50, P-box and S-box participate in binding with VDR response elements (VDRE. For the second zinc finger structure, P61, F62 and H75 are essential in the structure of the VDR homodimer with the residues N37, E92 and F93 of the downstream of partner VDR, which form the inter-DBD interface. T-box of the CTE, especially the F93 and I94, plays a critical role in heterodimerization and heterodimers–VDRE binding. Six essential residues (R102, K103, M106, I107, K109, and R110 of the CTE α-helix of VDR construct one interaction face, which packs against the DBD core of the adjacent symmetry mate. In 1,25(OH2D3-activated signaling, the VDR-RXR heterodimer may bind to DR3-type VDRE and ER9-type VDREs of its target gene directly resulting in transactivation and also bind to DR3-liked nVDRE of its target gene directly resulting in transrepression. Except for this, 1α,25(OH2D3 ligand VDR-RXR may bind to 1αnVDRE indirectly through VDIR, resulting in transrepression of the target gene. Upon binding of 1α,25(OH2D3, VDR can transactivate and transrepress its target genes depending on the DNA motif that DBD binds.

  12. Structural basis of DNA recognition by PCG2 reveals a novel DNA binding mode for winged helix-turn-helix domains

    Science.gov (United States)

    Liu, Junfeng; Huang, Jinguang; Zhao, Yanxiang; Liu, Huaian; Wang, Dawei; Yang, Jun; Zhao, Wensheng; Taylor, Ian A.; Peng, You-Liang

    2015-01-01

    The MBP1 family proteins are the DNA binding subunits of MBF cell-cycle transcription factor complexes and contain an N terminal winged helix-turn-helix (wHTH) DNA binding domain (DBD). Although the DNA binding mechanism of MBP1 from Saccharomyces cerevisiae has been extensively studied, the structural framework and the DNA binding mode of other MBP1 family proteins remains to be disclosed. Here, we determined the crystal structure of the DBD of PCG2, the Magnaporthe oryzae orthologue of MBP1, bound to MCB–DNA. The structure revealed that the wing, the 20-loop, helix A and helix B in PCG2–DBD are important elements for DNA binding. Unlike previously characterized wHTH proteins, PCG2–DBD utilizes the wing and helix-B to bind the minor groove and the major groove of the MCB–DNA whilst the 20-loop and helix A interact non-specifically with DNA. Notably, two glutamines Q89 and Q82 within the wing were found to recognize the MCB core CGCG sequence through making hydrogen bond interactions. Further in vitro assays confirmed essential roles of Q89 and Q82 in the DNA binding. These data together indicate that the MBP1 homologue PCG2 employs an unusual mode of binding to target DNA and demonstrate the versatility of wHTH domains. PMID:25550425

  13. Activation of the Arabidopsis membrane-bound transcription factor bZIP28 is mediated by site-2 protease, but not site-1 protease.

    Science.gov (United States)

    Iwata, Yuji; Ashida, Makoto; Hasegawa, Chisa; Tabara, Kazuki; Mishiba, Kei-Ichiro; Koizumi, Nozomu

    2017-08-01

    The unfolded protein response (UPR) is a homeostatic cellular response conserved in eukaryotic cells to alleviate the accumulation of unfolded proteins in the endoplasmic reticulum (ER). Arabidopsis bZIP28 is a membrane-bound transcription factor activated by proteolytic cleavage in response to ER stress, thereby releasing its cytosolic portion containing the bZIP domain from the membrane to translocate into the nucleus where it induces the transcription of genes encoding ER-resident molecular chaperones and folding enzymes. It has been widely recognized that the proteolytic activation of bZIP28 is mediated by the sequential cleavage of site-1 protease (S1P) and site-2 protease (S2P). In the present study we provide evidence that bZIP28 protein is cleaved by S2P, but not by S1P. We demonstrated that wild-type and s1p mutant plants produce the active, nuclear form of bZIP28 in response to the ER stress inducer tunicamycin. In contrast, tunicamycin-treated s2p mutants do not accumulate the active, nuclear form of bZIP28. Consistent with these observations, s2p mutants, but not s1p mutants, exhibited a defective transcriptional response of ER stress-responsive genes and significantly higher sensitivity to tunicamycin. Interestingly, s2p mutants accumulate two membrane-bound bZIP28 fragments with a shorter ER lumen-facing C-terminal domain. Importantly, the predicted cleavage sites are located far from the canonical S1P recognition motif previously described. We propose that ER stress-induced proteolytic activation of bZIP28 is mediated by the sequential actions of as-yet-unidentified protease(s) and S2P, and does not require S1P. © 2017 The Authors The Plant Journal © 2017 John Wiley & Sons Ltd.

  14. bZIP67 regulates the omega-3 fatty acid content of Arabidopsis seed oil by activating fatty acid desaturase3.

    Science.gov (United States)

    Mendes, Ana; Kelly, Amélie A; van Erp, Harrie; Shaw, Eve; Powers, Stephen J; Kurup, Smita; Eastmond, Peter J

    2013-08-01

    Arabidopsis thaliana seed maturation is accompanied by the deposition of storage oil, rich in the essential ω-3 polyunsaturated fatty acid α-linolenic acid (ALA). The synthesis of ALA is highly responsive to the level of fatty acid desaturase3 (FAD3) expression, which is strongly upregulated during embryogenesis. By screening mutants in leafy cotyledon1 (LEC1)-inducible transcription factors using fatty acid profiling, we identified two mutants (lec1-like and bzip67) with a seed lipid phenotype. Both mutants share a substantial reduction in seed ALA content. Using a combination of in vivo and in vitro assays, we show that bZIP67 binds G-boxes in the FAD3 promoter and enhances FAD3 expression but that activation is conditional on bZIP67 association with LEC1-like (L1L) and nuclear factor-YC2 (NF-YC2). Although FUSCA3 and abscisic acid insensitive3 are required for L1L and bZIP67 expression, neither protein is necessary for [bZIP67:L1L:NF-YC2] to activate FAD3. We conclude that a transcriptional complex containing L1L, NF-YC2, and bZIP67 is induced by LEC1 during embryogenesis and specifies high levels of ALA production for storage oil by activating FAD3 expression.

  15. Acute stress reduces wound-induced activation of microbicidal potential of ex vivo isolated human monocyte-derived macrophages.

    Directory of Open Access Journals (Sweden)

    Ulrike Kuebler

    Full Text Available BACKGROUND: Psychological stress delays wound healing but the precise underlying mechanisms are unclear. Macrophages play an important role in wound healing, in particular by killing microbes. We hypothesized that (a acute psychological stress reduces wound-induced activation of microbicidal potential of human monocyte-derived macrophages (HMDM, and (b that these reductions are modulated by stress hormone release. METHODS: Fourty-one healthy men (mean age 35 ± 13 years were randomly assigned to either a stress or stress-control group. While the stress group underwent a standardized short-term psychological stress task after catheter-induced wound infliction, stress-controls did not. Catheter insertion was controlled. Assessing the microbicidal potential, we investigated PMA-activated superoxide anion production by HMDM immediately before and 1, 10 and 60 min after stress/rest. Moreover, plasma norepinephrine and epinephrine and salivary cortisol were repeatedly measured. In subsequent in vitro studies, whole blood was incubated with norepinephrine in the presence or absence of phentolamine (norepinephrine blocker before assessing HMDM microbicidal potential. RESULTS: Compared with stress-controls, HMDM of the stressed subjects displayed decreased superoxide anion-responses after stress (p's <.05. Higher plasma norepinephrine levels statistically mediated lower amounts of superoxide anion-responses (indirect effect 95% CI: 4.14-44.72. Norepinephrine-treated HMDM showed reduced superoxide anion-production (p<.001. This effect was blocked by prior incubation with phentolamine. CONCLUSIONS: Our results suggest that acute psychological stress reduces wound-induced activation of microbicidal potential of HMDM and that this reduction is mediated by norepinephrine. This might have implications for stress-induced impairment in wound healing.

  16. In silico engineering and optimization of Transcription Activator-Like Effectors and their derivatives for improved DNA binding predictions.

    KAUST Repository

    Piatek, Marek J.

    2015-12-01

    Transcription Activator-Like Effectors (TALEs) can be used as adaptable DNAbinding modules to create site-specific chimeric nucleases or synthetic transcriptional regulators. The central repeat domain mediates specific DNA binding via hypervariable repeat di-residues (RVDs). This DNA-Binding Domain can be engineered to bind preferentially to any user-selected DNA sequence if engineered appropriately. Therefore, TALEs and their derivatives have become indispensable molecular tools in site-specific manipulation of genes and genomes. This thesis revolves around two problems: in silico design and improved binding site prediction of TALEs. In the first part, a study is shown where TALEs are successfully designed in silico and validated in laboratory to yield the anticipated effects on selected genes. Software is developed to accompany the process of designing and prediction of binding sites. I expanded the functionality of the software to be used as a more generic set of tools for the design, target and offtarget searching. Part two contributes a method and associated toolkit developed to allow users to design in silico optimized synthetic TALEs with user-defined specificities for various experimental purposes. This method is based on a mutual relationship of three consecutive tandem repeats in the DNA-binding domain. This approach revealed positional and compositional bias behind the binding of TALEs to DNA. In conclusion, I developed methods, approaches, and software to enhance the functionality of synthetic TALEs, which should improve understanding of TALEs biology and will further advance genome-engineering applications in various organisms and cell types.

  17. Synthesis, crystal structure, DFT calculation and DNA binding studies of new water-soluble derivatives of dppz

    Science.gov (United States)

    Aminzadeh, Mohammad; Eslami, Abbas; Kia, Reza; Aleeshah, Roghayeh

    2017-10-01

    Diquaternarization of dipyrido-[2,3-a:2‧,3‧-c]-phenazine,(dppz) and its analogous dipyrido-[2,3-a:2‧,3‧-c]-dimethylphenazine,(dppx) using 1,3-dibromopropane afford new water-soluble derivatives of phenazine, propylene-bipyridyldiylium-phenazine (1) and propylene-bipyridyldiylium-dimethylphenazine (2). The compounds have been characterized by means of FT-IR, NMR, elemental analysis and conductometric measurements and their structure were determined by X-ray crystallography. The experimental studies on the compounds have been accompanied computationally by Density Functional Theory (DFT) calculations. The DNA binding properties of both compounds to calf thymus DNA (ctDNA) were investigated by UV-Vis absorption and emission methods. The expanded UV-Vis spectral data matrix was analyzed by multivariate curve resolution-alternating least squares (MCR-ALS) technique to obtain the concentration profile and pure spectra of all reaction species which existed in the interaction procedure. Multivariate curve resolution may help us to give a better understanding of the 1(Cl)2-ctDNA and 2(Cl)2-ctDNA interaction mechanism. The results suggest that both compounds bind tightly to DNA through intercalation mechanism and the DNA binding affinity of 2 is slightly lower than that of 1 due to steric hindrance of the methyl group. Also, thermal denaturation studies reveal that these compounds show strong affinity for binding with calf thymus DNA. The thermodynamic parameters of the DNA binding process were obtained from the temperature dependence of the binding constants and the results showed that binding of both compounds to DNA is an enthalpically driven process that is in agreement with proposed DNA intercalation capability of these compounds.

  18. Characterization of exceptionally thermostable single-stranded DNA-binding proteins from Thermotoga maritima and Thermotoga neapolitana

    Directory of Open Access Journals (Sweden)

    Mickiewicz Małgorzata

    2010-10-01

    Full Text Available Abstract Background In recent years, there has been an increasing interest in SSBs because they find numerous applications in diverse molecular biology and analytical methods. Results We report the characterization of single-stranded DNA binding proteins (SSBs from the thermophilic bacteria Thermotoga maritima (TmaSSB and Thermotoga neapolitana (TneSSB. They are the smallest known bacterial SSB proteins, consisting of 141 and 142 amino acid residues with a calculated molecular mass of 16.30 and 16.58 kDa, respectively. The similarity between amino acid sequences of these proteins is very high: 90% identity and 95% similarity. Surprisingly, both TmaSSB and TneSSB possess a quite low sequence similarity to Escherichia coli SSB (36 and 35% identity, 55 and 56% similarity, respectively. They are functional as homotetramers containing one single-stranded DNA binding domain (OB-fold in each monomer. Agarose mobility assays indicated that the ssDNA-binding site for both proteins is salt independent, and fluorescence spectroscopy resulted in a size of 68 ± 2 nucleotides. The half-lives of TmaSSB and TneSSB were 10 h and 12 h at 100°C, respectively. When analysed by differential scanning microcalorimetry (DSC the melting temperature (Tm was 109.3°C and 112.5°C for TmaSSB and TneSSB, respectively. Conclusion The results showed that TmaSSB and TneSSB are the most thermostable SSB proteins identified to date, offering an attractive alternative to TaqSSB and TthSSB in molecular biology applications, especially with using high temperature e. g. polymerase chain reaction (PCR.

  19. TnpA product encoded by the transposable element En-1 of Zea mays is a DNA binding protein.

    OpenAIRE

    Gierl, A.; Lütticke, S; Saedler, H

    1988-01-01

    TnpA protein, the function encoded by the most abundant transcript of En-1 was expressed in Escherichia coli. DNA binding experiments with partially purified tnpA protein revealed that it binds to the subterminal repetitive region of En-1. TnpA protein recognizes a 12-bp-long sequence motif which is reiterated several times at the termini of En-1. Binding is reduced if the cytosine residues of CG dinucleotides and CNG trinucleotides within the motif are methylated. These data suggest a model ...

  20. Crystal structure of the trithorax group protein ASH2L reveals a forkhead-like DNA binding domain

    Energy Technology Data Exchange (ETDEWEB)

    Sarvan, Sabina; Avdic, Vanja; Tremblay, Véronique; Chaturvedi, Chandra-Prakash; Zhang, Pamela; Lanouette, Sylvain; Blais, Alexandre; Brunzelle, Joseph S; Brand, Marjorie; Couture, Jean-François (Ottawa Hosp.); (Ottawa); (NWU)

    2012-05-02

    Absent, small or homeotic discs-like 2 (ASH2L) is a trithorax group (TrxG) protein and a regulatory subunit of the SET1 family of lysine methyltransferases. Here we report that ASH2L binds DNA using a forkhead-like helix-wing-helix (HWH) domain. In vivo, the ASH2L HWH domain is required for binding to the {beta}-globin locus control region, histone H3 Lys4 (H3K4) trimethylation and maximal expression of the {beta}-globin gene (Hbb-1), validating the functional importance of the ASH2L DNA binding domain.

  1. Obstruction of Water Uptake in cut Chrysanthemum Stems after Dry Storage: Role of Wound-induced Increase in Enzyme Activities and Air Emboli

    NARCIS (Netherlands)

    Meeteren, van U.; Arevalo-Galarza, L.

    2009-01-01

    Hydraulic conductance of cut chrysanthemum stems was lowered by the aspiration of air as well as by a wound-induced plant response. By measuring the hydraulic conductance of stem segments in which air could be introduced into and/or removed from the xylem vessels at various times after harvest, we

  2. Interactions of DNA binding proteins with G-Quadruplex structures at the single molecule level

    Science.gov (United States)

    Ray, Sujay

    Guanine-rich nucleic acid (DNA/RNA) sequences can form non-canonical secondary structures, known as G-quadruplex (GQ). Numerous in vivo and in vitro studies have demonstrated formation of these structures in telomeric and non-telomeric regions of the genome. Telomeric GQs protect the chromosome ends whereas non-telomeric GQs either act as road blocks or recognition sites for DNA metabolic machinery. These observations suggest the significance of these structures in regulation of different metabolic processes, such as replication and repair. GQs are typically thermodynamically more stable than the corresponding Watson-Crick base pairing formed by G-rich and C-rich strands, making protein activity a crucial factor for their destabilization. Inside the cell, GQs interact with different proteins and their enzymatic activity is the determining factor for their stability. We studied interactions of several proteins with GQs to understand the underlying principles of protein-GQ interactions using single-molecule FRET and other biophysical techniques. Replication Protein-A (RPA), a single stranded DNA (ssDNA) binding protein, is known to posses GQ unfolding activity. First, we compared the thermal stability of three potentially GQ-forming DNA sequences (PQS) to their stability against RPA-mediated unfolding. One of these sequences is the human telomeric repeat and the other two, located in the promoter region of tyrosine hydroxylase gene, are highly heterogeneous sequences that better represent PQS in the genome. The thermal stability of these structures do not necessarily correlate with their stability against protein-mediated unfolding. We conclude that thermal stability is not necessarily an adequate criterion for predicting the physiological viability of GQ structures. To determine the critical structural factors that influence protein-GQ interactions we studied two groups of GQ structures that have systematically varying loop lengths and number of G-tetrad layers. We

  3. Delta9-tetrahydrocannabinol increases sequence-specific AP-1 DNA-binding activity and Fos-related antigens in the rat brain.

    Science.gov (United States)

    Porcella, A; Gessa, G L; Pani, L

    1998-05-01

    Delta-9-tetrahydrocannabinol (delta9-THC), the psychoactive principle of marijuana, has been shown to upregulate the mRNA levels of immediate-early genes in the rat brain. Using electrophoretic mobility-shift assay and one-dimensional Western blot, we here report that delta9-THC increases Activator protein-1 (AP-1) DNA-binding and Fos-related antigen activity in discrete areas of the rat brain. One hour after the intraperitoneal administration of delta9-THC at a dose of 10 or 15 mg/kg, AP-1 DNA-binding activity in the nucleus accumbens increased by 33 and 49%, respectively, while Western blot showed an increase in both c-Fos, FosB, Fra-1 (Fos-related antigen) and Fra-2. In the cingulate cortex and caudate-putamen, delta9-THC significantly increased AP-1 DNA-binding activity only at the highest dose used (57 and 71%, respectively). While in the caudate-putamen the increase in AP-1 DNA binding was mainly due to an elevation of the c-Fos and FosB proteins, the same phenomenon depended on the FosB, Fra-1 and Fra-2 peptides in the cingulate cortex. The effect of delta9-THC on the AP-1 DNA binding and the Fos-related antigens in the nucleus accumbens was blocked by the specific cannabinoid antagonist SR141716 A (3 mg/kg i.p.). delta9-THC failed to modify Specificity protein 1 (Sp1) DNA-binding activity. The results indicate that delta9-THC activates gene coding for AP-1 DNA-binding proteins by acting on cannabinoid receptors, and induces a different transcriptional program on the early-immediate gene of the Fos family, in different areas in the rat brain, suggesting that this mechanism might be involved in the central actions of cannabinoids.

  4. Ligand-binding pocket bridges DNA-binding and dimerization domains of the urate-responsive MarR homologue MftR from Burkholderia thailandensis.

    Science.gov (United States)

    Gupta, Ashish; Grove, Anne

    2014-07-15

    Members of the multiple antibiotic resistance regulator (MarR) family often regulate gene activity by responding to a specific ligand. In the absence of ligand, most MarR proteins function as repressors, while ligand binding causes attenuated DNA binding and therefore increased gene expression. Previously, we have shown that urate is a ligand for MftR (major facilitator transport regulator), which is encoded by the soil bacterium Burkholderia thailandensis. We show here that both mftR and the divergently oriented gene mftP encoding a major facilitator transport protein are upregulated in the presence of urate. MftR binds two cognate sites in the mftR-mftP intergenic region with equivalent affinity and sensitivity to urate. Mutagenesis of four conserved residues previously reported to be involved in urate binding to Deinococcus radiodurans HucR and Rhizobium radiobacter PecS significantly reduced protein stability and DNA binding affinity but not ligand binding. These data suggest that residues equivalent to those implicated in ligand binding to HucR and PecS serve structural roles and that MftR relies on distinct residues for ligand binding. MftR exhibits a two-step melting transition suggesting independent unfolding of the dimerization and DNA-binding regions; urate binding or mutations in the predicted ligand-binding sites result in one-step unfolding transitions. We suggest that MftR binds the ligand in a cleft between the DNA-binding lobes and the dimer interface but that the mechanism of ligand-mediated attenuation of DNA binding differs from that proposed for other urate-responsive MarR homologues. Since DNA binding by MftR is attenuated at 37 °C, our data also suggest that MftR responds to both ligand and a thermal upshift by attenuated DNA binding and upregulation of the genes under its control.

  5. Enhancement of biomass and lipid productivity by overexpression of a bZIP transcription factor in Nannochloropsis salina.

    Science.gov (United States)

    Kwon, Sohee; Kang, Nam Kyu; Koh, Hyun Gi; Shin, Sung-Eun; Lee, Bongsoo; Jeong, Byeong-Ryool; Chang, Yong Keun

    2018-02-01

    Microalgae are considered as excellent platforms for biomaterial production that can replace conventional fossil fuel-based fuels and chemicals. Genetic engineering of microalgae is prerequisite to maximize production of materials and to reduce costs for the production. Transcription factors (TFs) are emerging as key regulators of metabolic pathways to enhance production of molecules for biofuels and other materials. TFs with the basic leucine zipper (bZIP) domain have been known as stress regulators and are associated with lipid metabolism in plants. We overexpressed a bZIP TF, NsbZIP1, in Nannochloropsis salina, and found that transformants showed enhanced growth with concomitant increase in lipid contents. The improved phenotypes were also notable under stress conditions including N limitation and high salt. To understand the mechanism underlying improved phenotypes, we analyzed expression patterns of predicted target genes involved in lipid metabolism via quantitative RT-PCR, confirming increases transcript levels. NsbZIP1 appeared to be one of type C bZIPs in plants that has been known to regulate lipid metabolism under stress. Taken together, we demonstrated that NsbZIP1 could improve both growth and lipid production, and TF engineering can serve as an excellent genetic engineering tool for production of biofuels and biomaterials in microalgae. © 2017 Wiley Periodicals, Inc.

  6. Evidence for an important role of WRKY DNA binding proteins in the regulation of NPR1 gene expression.

    Science.gov (United States)

    Yu, D; Chen, C; Chen, Z

    2001-07-01

    The Arabidopsis NPR1 gene is a positive regulator of inducible plant disease resistance. Expression of NPR1 is induced by pathogen infection or treatment with defense-inducing compounds such as salicylic acid (SA). Transgenic plants overexpressing NPR1 exhibit enhanced resistance to a broad spectrum of microbial pathogens, whereas plants underexpressing the gene are more susceptible to pathogen infection. These results suggest that regulation of NPR1 gene expression is important for the activation of plant defense responses. In the present study, we report the identification of W-box sequences in the promoter region of the NPR1 gene that are recognized specifically by SA-induced WRKY DNA binding proteins from Arabidopsis. Mutations in these W-box sequences abolished their recognition by WRKY DNA binding proteins, rendered the promoter unable to activate a downstream reporter gene, and compromised the ability of NPR1 to complement npr1 mutants for SA-induced defense gene expression and disease resistance. These results provide strong evidence that certain WRKY genes act upstream of NPR1 and positively regulate its expression during the activation of plant defense responses. Consistent with this model, we found that SA-induced expression of a number of WRKY genes was independent of NPR1.

  7. Scaffold protein enigma homolog 1 overcomes the repression of myogenesis activation by inhibitor of DNA binding 2

    Energy Technology Data Exchange (ETDEWEB)

    Nakatani, Miyuki [Graduate School of Bioagricultural Sciences, Nagoya University, Furo-cho, Nagoya, 464-8106 (Japan); Ito, Jumpei [Graduate School of Bioagricultural Sciences, Nagoya University, Furo-cho, Nagoya, 464-8106 (Japan); Japan Society for the Promotion of Science, Tokyo, 102-0083 (Japan); Koyama, Riko [Graduate School of Bioagricultural Sciences, Nagoya University, Furo-cho, Nagoya, 464-8106 (Japan); Iijima, Masumi; Yoshimoto, Nobuo [The Institute of Scientific and Industrial Research, Osaka University, 8-1 Mihogaoka, Ibaraki, Osaka, 567-0047 (Japan); Niimi, Tomoaki [Graduate School of Bioagricultural Sciences, Nagoya University, Furo-cho, Nagoya, 464-8106 (Japan); Kuroda, Shun' ichi [Graduate School of Bioagricultural Sciences, Nagoya University, Furo-cho, Nagoya, 464-8106 (Japan); The Institute of Scientific and Industrial Research, Osaka University, 8-1 Mihogaoka, Ibaraki, Osaka, 567-0047 (Japan); Maturana, Andrés D., E-mail: maturana@agr.nagoya-u.ac.jp [Graduate School of Bioagricultural Sciences, Nagoya University, Furo-cho, Nagoya, 464-8106 (Japan)

    2016-05-27

    Enigma Homolog 1 (ENH1) is a scaffold protein for signaling proteins and transcription factors. Previously, we reported that ENH1 overexpression promotes the differentiation of C2C12 myoblasts. However, the molecular mechanism underlying the role of ENH1 in the C2C12 cells differentiation remains elusive. ENH1 was shown to inhibit the proliferation of neuroblastoma cells by sequestering Inhibitor of DNA binding protein 2 (Id2) in the cytosol. Id2 is a repressor of basic Helix-Loop-Helix transcription factors activity and prevents myogenesis. Here, we found that ENH1 overcome the Id2 repression of C2C12 cells myogenic differentiation and that ENH1 overexpression promotes mice satellite cells activation, the first step toward myogenic differentiation. In addition, we show that ENH1 interacted with Id2 in C2C12 cells and mice satellite cells. Collectively, our results suggest that ENH1 plays an important role in the activation of myogenesis through the repression of Id2 activity. -- Highlights: •Enigma Homolog 1 (ENH1) is a scaffold protein. •ENH1 binds to inhibitor of DNA binding 2 (Id2) in myoblasts. •ENH1 overexpression overcomes the Id2's repression of myogenesis. •The Id2-ENH1 complex play an important role in the activation of myogenesis.

  8. Directing an artificial zinc finger protein to new targets by fusion to a non-DNA-binding domain.

    Science.gov (United States)

    Lim, Wooi F; Burdach, Jon; Funnell, Alister P W; Pearson, Richard C M; Quinlan, Kate G R; Crossley, Merlin

    2016-04-20

    Transcription factors are often regarded as having two separable components: a DNA-binding domain (DBD) and a functional domain (FD), with the DBD thought to determine target gene recognition. While this holds true for DNA bindingin vitro, it appears thatin vivoFDs can also influence genomic targeting. We fused the FD from the well-characterized transcription factor Krüppel-like Factor 3 (KLF3) to an artificial zinc finger (AZF) protein originally designed to target the Vascular Endothelial Growth Factor-A (VEGF-A) gene promoter. We compared genome-wide occupancy of the KLF3FD-AZF fusion to that observed with AZF. AZF bound to theVEGF-Apromoter as predicted, but was also found to occupy approximately 25,000 other sites, a large number of which contained the expected AZF recognition sequence, GCTGGGGGC. Interestingly, addition of the KLF3 FD re-distributes the fusion protein to new sites, with total DNA occupancy detected at around 50,000 sites. A portion of these sites correspond to known KLF3-bound regions, while others contained sequences similar but not identical to the expected AZF recognition sequence. These results show that FDs can influence and may be useful in directing AZF DNA-binding proteins to specific targets and provide insights into how natural transcription factors operate. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  9. 14-3-3 mediates transcriptional regulation by modulating nucleocytoplasmic shuttling of tobacco DNA-binding protein phosphatase-1.

    Science.gov (United States)

    Carrasco, José L; Castelló, María José; Vera, Pablo

    2006-08-11

    Tobacco DBP1 is the founding member of a novel class of plant transcription factors featuring sequence-specific DNA binding and protein phosphatase activity. To understand the mechanisms underlying the function of this family of transcriptional regulators, we have identified the tobacco 14-3-3 isoform G as the first protein interacting with a DBP factor. 14-3-3 recognition involves the N-terminal region of DBP1, which also supports the DNA binding activity attributed to DBP1. The relevance of this interaction is reinforced by its conservation in Arabidopsis plants, where the closest relative of DBP1 in this species also interacts with a homologous 14-3-3 protein through its N-terminal region. Furthermore, we show that in planta 14-3-3 G is directly involved in regulating DBP1 function by promoting nuclear export and subsequent cytoplasmic retention of DBP1 under conditions that in turn alleviate DBP1-mediated repression of target gene expression.

  10. A Comparative Structure/Function Analysis of Two Type IV Pilin DNA Receptors Defines a Novel Mode of DNA Binding.

    Science.gov (United States)

    Berry, Jamie-Lee; Xu, Yingqi; Ward, Philip N; Lea, Susan M; Matthews, Stephen J; Pelicic, Vladimir

    2016-06-07

    DNA transformation is a widespread process allowing bacteria to capture free DNA by using filamentous nano-machines composed of type IV pilins. These proteins can act as DNA receptors as demonstrated by the finding that Neisseria meningitidis ComP minor pilin has intrinsic DNA-binding ability. ComP binds DNA better when it contains the DNA-uptake sequence (DUS) motif abundant in this species genome, playing a role in its trademark ability to selectively take up its own DNA. Here, we report high-resolution structures for meningococcal ComP and Neisseria subflava ComPsub, which recognize different DUS motifs. We show that they are structurally identical type IV pilins that pack readily into filament models and display a unique DD region delimited by two disulfide bonds. Functional analysis of ComPsub defines a new mode of DNA binding involving the DD region, adapted for exported DNA receptors. Copyright © 2016 The Author(s). Published by Elsevier Ltd.. All rights reserved.

  11. Rif1 provides a new DNA-binding interface for the Bloom syndrome complex to maintain normal replication.

    Science.gov (United States)

    Xu, Dongyi; Muniandy, Parameswary; Leo, Elisabetta; Yin, Jinhu; Thangavel, Saravanabhavan; Shen, Xi; Ii, Miki; Agama, Keli; Guo, Rong; Fox, David; Meetei, Amom Ruhikanta; Wilson, Lauren; Nguyen, Huy; Weng, Nan-ping; Brill, Steven J; Li, Lei; Vindigni, Alessandro; Pommier, Yves; Seidman, Michael; Wang, Weidong

    2010-09-15

    BLM, the helicase defective in Bloom syndrome, is part of a multiprotein complex that protects genome stability. Here, we show that Rif1 is a novel component of the BLM complex and works with BLM to promote recovery of stalled replication forks. First, Rif1 physically interacts with the BLM complex through a conserved C-terminal domain, and the stability of Rif1 depends on the presence of the BLM complex. Second, Rif1 and BLM are recruited with similar kinetics to stalled replication forks, and the Rif1 recruitment is delayed in BLM-deficient cells. Third, genetic analyses in vertebrate DT40 cells suggest that BLM and Rif1 work in a common pathway to resist replication stress and promote recovery of stalled forks. Importantly, vertebrate Rif1 contains a DNA-binding domain that resembles the αCTD domain of bacterial RNA polymerase α; and this domain preferentially binds fork and Holliday junction (HJ) DNA in vitro and is required for Rif1 to resist replication stress in vivo. Our data suggest that Rif1 provides a new DNA-binding interface for the BLM complex to restart stalled replication forks.

  12. Quantitative characterization of conformational-specific protein-DNA binding using a dual-spectral interferometric imaging biosensor

    Science.gov (United States)

    Zhang, Xirui; Daaboul, George G.; Spuhler, Philipp S.; Dröge, Peter; Ünlü, M. Selim

    2016-03-01

    DNA-binding proteins play crucial roles in the maintenance and functions of the genome and yet, their specific binding mechanisms are not fully understood. Recently, it was discovered that DNA-binding proteins recognize specific binding sites to carry out their functions through an indirect readout mechanism by recognizing and capturing DNA conformational flexibility and deformation. High-throughput DNA microarray-based methods that provide large-scale protein-DNA binding information have shown effective and comprehensive analysis of protein-DNA binding affinities, but do not provide information of DNA conformational changes in specific protein-DNA complexes. Building on the high-throughput capability of DNA microarrays, we demonstrate a quantitative approach that simultaneously measures the amount of protein binding to DNA and nanometer-scale DNA conformational change induced by protein binding in a microarray format. Both measurements rely on spectral interferometry on a layered substrate using a single optical instrument in two distinct modalities. In the first modality, we quantitate the amount of binding of protein to surface-immobilized DNA in each DNA spot using a label-free spectral reflectivity technique that accurately measures the surface densities of protein and DNA accumulated on the substrate. In the second modality, for each DNA spot, we simultaneously measure DNA conformational change using a fluorescence vertical sectioning technique that determines average axial height of fluorophores tagged to specific nucleotides of the surface-immobilized DNA. The approach presented in this paper, when combined with current high-throughput DNA microarray-based technologies, has the potential to serve as a rapid and simple method for quantitative and large-scale characterization of conformational specific protein-DNA interactions.DNA-binding proteins play crucial roles in the maintenance and functions of the genome and yet, their specific binding mechanisms are

  13. Heterogeneous dynamics in DNA site discrimination by the structurally homologous DNA-binding domains of ETS-family transcription factors

    Science.gov (United States)

    He, Gaofei; Tolic, Ana; Bashkin, James K.; Poon, Gregory M. K.

    2015-01-01

    The ETS family of transcription factors exemplifies current uncertainty in how eukaryotic genetic regulators with overlapping DNA sequence preferences achieve target site specificity. PU.1 and Ets-1 represent archetypes for studying site discrimination by ETS proteins because their DNA-binding domains are the most divergent in sequence, yet they share remarkably superimposable DNA-bound structures. To gain insight into the contrasting thermodynamics and kinetics of DNA recognition by these two proteins, we investigated the structure and dynamics of site discrimination by their DNA-binding domains. Electrophoretic mobilities of complexes formed by the two homologs with circularly permuted binding sites showed significant dynamic differences only for DNA complexes of PU.1. Free solution measurements by dynamic light scattering showed PU.1 to be more dynamic than Ets-1; moreover, dynamic changes are strongly coupled to site discrimination by PU.1, but not Ets-1. Interrogation of the protein/DNA interface by DNA footprinting showed similar accessibility to dimethyl sulfate for PU.1/DNA and Ets-1/DNA complexes, indicating that the dynamics of PU.1/DNA complexes reside primarily outside that interface. An information-based analysis of the two homologs’ binding motifs suggests a role for dynamic coupling in PU.1's ability to enforce a more stringent sequence preference than Ets-1 and its proximal sequence homologs. PMID:25824951

  14. Characterization of the single stranded DNA binding protein SsbB encoded in the Gonoccocal Genetic Island.

    Directory of Open Access Journals (Sweden)

    Samta Jain

    Full Text Available Most strains of Neisseria gonorrhoeae carry a Gonococcal Genetic Island which encodes a type IV secretion system involved in the secretion of ssDNA. We characterize the GGI-encoded ssDNA binding protein, SsbB. Close homologs of SsbB are located within a conserved genetic cluster found in genetic islands of different proteobacteria. This cluster encodes DNA-processing enzymes such as the ParA and ParB partitioning proteins, the TopB topoisomerase, and four conserved hypothetical proteins. The SsbB homologs found in these clusters form a family separated from other ssDNA binding proteins.In contrast to most other SSBs, SsbB did not complement the Escherichia coli ssb deletion mutant. Purified SsbB forms a stable tetramer. Electrophoretic mobility shift assays and fluorescence titration assays, as well as atomic force microscopy demonstrate that SsbB binds ssDNA specifically with high affinity. SsbB binds single-stranded DNA with minimal binding frames for one or two SsbB tetramers of 15 and 70 nucleotides. The binding mode was independent of increasing Mg(2+ or NaCl concentrations. No role of SsbB in ssDNA secretion or DNA uptake could be identified, but SsbB strongly stimulated Topoisomerase I activity.We propose that these novel SsbBs play an unknown role in the maintenance of genetic islands.

  15. Conformational changes in DNA-binding proteins: relationships with precomplex features and contributions to specificity and stability.

    Science.gov (United States)

    Andrabi, Munazah; Mizuguchi, Kenji; Ahmad, Shandar

    2014-05-01

    Both Proteins and DNA undergo conformational changes in order to form functional complexes and also to facilitate interactions with other molecules. These changes have direct implications for the stability and specificity of the complex, as well as the cooperativity of interactions between multiple entities. In this work, we have extensively analyzed conformational changes in DNA-binding proteins by superimposing DNA-bound and unbound pairs of protein structures in a curated database of 90 proteins. We manually examined each of these pairs, unified the authors' annotations, and summarized our observations by classifying conformational changes into six structural categories. We explored a relationship between conformational changes and functional classes, binding motifs, target specificity, biophysical features of unbound proteins, and stability of the complex. In addition, we have also investigated the degree to which the intrinsic flexibility can explain conformational changes in a subset of 52 proteins with high quality coordinate data. Our results indicate that conformational changes in DNA-binding proteins contribute significantly to both the stability of the complex and the specificity of targets recognized by them. We also conclude that most conformational changes occur in proteins interacting with specific DNA targets, even though unbound protein structures may have sufficient information to interact with DNA in a nonspecific manner. Copyright © 2013 Wiley Periodicals, Inc.

  16. New silver(I) complex with diazafluorene based ligand: Synthesis, characterization, investigation of in vitro DNA binding and antimicrobial studies

    Science.gov (United States)

    Movahedi, Elaheh; Rezvani, Ali Reza

    2017-07-01

    A novel diazafluorene based complex with silver, [Ag(dian)2 ] NO3 , where dian is N-(4,5-diazafluoren-9-ylidene)aniline, has been prepared and characterized by elemental analysis, IR spectroscopy, 1HNMR, UV-Vis spectroscopy and cyclic voltammetry. In order to explore the relationship between the structure and biological properties, DNA binding propensity and in vitro antibacterial property have also been studied. The mode of DNA-complex interaction has been investigated by electronic absorption titration, luminescence titration, competitive binding experiment, effect of ionic strength, thermodynamic studies, viscometric evaluation, circular dichroism spectroscopy and cyclic voltammetry. The results reveal that the complex binds to CT-DNA in a moderate intercalation capability with the partial insertion of a planar dian ligand between the base stacks of double-stranded DNA with binding constant (Kb) of 2.4 × 105 M-1. The viscosities and CD spectra of the DNA provide strong evidence for the intercalation. An in vitro antibacterial efficacy of the Ag(I) complex on a series of Gram-positive bacteria (Staphylococcus aureus, Enterococcus faecalis) and Gram-negative bacteria (Escherichia coli, Pseudomonas aeruginosa) indicates that the complex exhibits a marked antibacterial activity. The minimum inhibitory concentrations of the complex indicate that it exhibits much higher antibacterial effect on standard bacterial strains of Escherichia coli and Staphylococcus aureus than those of silver nitrate, silver sulfadiazine. The bacterial inhibitions of the silver(I) complex are closely agreed to its DNA binding affinities.

  17. Differential requirement for Gata1 DNA binding and transactivation between primitive and definitive stages of hematopoiesis in zebrafish

    Science.gov (United States)

    Belele, Christiane L.; English, Milton A.; Chahal, Jagman; Burnetti, Anthony; Finckbeiner, Steven M.; Gibney, Gretchen; Kirby, Martha; Sood, Raman

    2009-01-01

    The transcription factor Gata1 is required for the development of erythrocytes and megakaryocytes. Previous studies with a complementation rescue approach showed that the zinc finger domains are required for both primitive and definitive hematopoiesis. Here we report a novel zebrafish gata1 mutant with an N-ethyl-N-nitrosourea–induced point mutation in the C-finger (gata1T301K). The Gata1 protein with this mutation bound to its DNA target sequence with reduced affinity and transactivated inefficiently in a reporter assay. gata1T301K/T301K fish had a decreased number of erythrocytes during primitive hematopoiesis but normal adult hematopoiesis. We crossed the gata1T301K/T301K fish with those carrying the R339X mutation, also known as vlad tepes (vlt), which abolishes DNA binding and transactivation activities. As we reported previously, gata1vlt/vlt embryos were “bloodless” and died approximately 11 to 15 days after fertilization. Interestingly, the gata1T301K/vlt fish had nearly a complete block of primitive hematopoiesis, but they resumed hematopoiesis between 7 and 14 days after fertilization and grew to phenotypically normal fish with normal adult hematopoiesis. Our findings suggest that the impact of Gata1 on hematopoiesis correlates with its DNA-binding ability and that primitive hematopoiesis is more sensitive to reduction in Gata1 function than definitive hematopoiesis. PMID:19843882

  18. Biological Impact of Pd (II Complexes: Synthesis, Spectral Characterization, In Vitro Anticancer, CT-DNA Binding, and Antioxidant Activities

    Directory of Open Access Journals (Sweden)

    Nitin Kumar Sharma

    2016-01-01

    Full Text Available A new series of Pd (II complexes of methyl substituted benzylamine ligands (BLs has been synthesized and characterized via spectroscopic techniques such as UV/Vis. FTIR, LCMS, 1H, and 13C NMR. The UV/Vis study in DMSO, DMSO + water, and DMSO + PBS buffer (pH = 7.2 confirmed their molecular sustainability in liquids. Their in vitro anticancer activity against breast cancer cell lines such as MCF-7 and MDA-MB-231 makes them interesting for in vivo analysis. Their stronger DNA binding activity (DBA compared with free ligand suggested them as a good DNA binder. DBA was further confirmed by physicochemical studies such as surface tension and viscosity of complex + DNA which inferred the disruption of DNA and intercalation of complexes, respectively. Their % binding activity, % disruption of DNA base pairs (DNABP, and % intercalating strength are reported in this paper for the first time for better understanding of DNA binding mechanism. Along with this, their scavenging activity (SA determined through DPPH free radical and the results indicate good antioxidant behaviour of complexes.

  19. Regulation of Bacterial DNA Packaging in Early Stationary Phase by Competitive DNA Binding of Dps and IHF.

    Science.gov (United States)

    Lee, Sin Yi; Lim, Ci Ji; Dröge, Peter; Yan, Jie

    2015-12-14

    The bacterial nucleoid, a bacterial genome packed by nucleoid binding proteins, forms the physical basis for cellular processes such as gene transcription and DNA replication. Bacteria need to dynamically modulate their nucleoid structures at different growth phases and in response to environmental changes. At the nutrients deficient stationary phase, DNA-binding proteins from starved cells (Dps) and Integration host factors (IHF) are the two most abundant nucleoid associated proteins in E. coli. Yet, it remains unclear how the nucleoid architecture is controlled by the interplay between these two proteins, as well as the nucleoid's response to environmental changes. This question is addressed here using single DNA manipulation approach. Our results reveal that the two proteins are differentially selected for DNA binding, which can be tuned by changing environmental factors over physiological ranges including KCl (50-300 mM), MgCl2 (0-10 mM), pH (6.5-8.5) and temperature (23-37 °C). Increasing pH and MgCl2 concentrations switch from Dps-binding to IHF-binding. Stable Dps-DNA and IHF-DNA complexes are insensitive to temperature changes for the range tested. The environment dependent selection between IHF and Dps results in different physical organizations of DNA. Overall, our findings provide important insights into E. coli nucleoid architecture.

  20. Structural modeling and DNA binding autoinhibition analysis of Ergp55, a critical transcription factor in prostate cancer.

    Directory of Open Access Journals (Sweden)

    Shanti P Gangwar

    Full Text Available BACKGROUND: The Ergp55 protein belongs to Ets family of transcription factor. The Ets proteins are highly conserved in their DNA binding domain and involved in various development processes and regulation of cancer metabolism. To study the structure and DNA binding autoinhibition mechanism of Ergp55 protein, we have produced full length and smaller polypeptides of Ergp55 protein in E. coli and characterized using various biophysical techniques. RESULTS: The Ergp55 polypeptides contain large amount of α-helix and random coil structures as measured by circular dichorism spectroscopy. The full length Ergp55 forms a flexible and elongated molecule as revealed by molecular modeling, dynamics simulation and structural prediction algorithms. The binding analyses of Ergp55 polypeptides with target DNA sequences of E74 and cfos promoters indicate that longer fragments of Ergp55 (beyond the Ets domain showed the evidence of auto-inhibition. This study also revealed the parts of Ergp55 protein that mediate auto-inhibition. SIGNIFICANCE: The current study will aid in designing the compounds that stabilize the inhibited form of Ergp55 and inhibit its binding to promoter DNA. It will contribute in the development of drugs targeting Ergp55 for the prostate cancer treatment.

  1. Serum-regulated transcription by serum response factor (SRF): a novel role for the DNA binding domain.

    Science.gov (United States)

    Hill, C S; Wynne, J; Treisman, R

    1994-01-01

    The transcription factors Serum Response Factor (SRF) and Ternary Complex Factor (TCF) form a ternary complex at the c-fos Serum Response Element (SRE). We show that in NIH3T3 cells TCF binding is required for regulated transcription in response to stimulation by phorbol myristate acetate (PMA), but not by whole serum. We constructed a novel transcriptionally inactive SRE variant whose serum-regulated activity can be partially restored by overexpression of SRF in the absence of bound TCF. Activation by SRF does not require the SRF N-terminal phosphorylation sites, but is potentiated 2- to 3-fold by the SRF C-terminal activation domain. Mutations in the SRF DNA binding domain, which do not affect the ability of SRF to bind DNA, abolish its ability to mediate TCF-independent serum-regulated activation and reduce activation by the SRF/TCF(Elk-1) ternary complex. Efficient activation requires that SRF be targeted to DNA via its own DNA binding domain. Images PMID:7957108

  2. A DNA-binding-site landscape and regulatory network analysis for NAC transcription factors in Arabidopsis thaliana

    DEFF Research Database (Denmark)

    Lindemose, Søren; Jensen, Michael Krogh; de Velde, Jan Van

    2014-01-01

    Target gene identification for transcription factors is a prerequisite for the systems wide understanding of organismal behaviour. NAM-ATAF1/2-CUC2 (NAC) transcription factors are amongst the largest transcription factor families in plants, yet limited data exist from unbiased approaches to resol...... with the workflow associated with functional modules offer a strong resource to unravel the regulatory potential of NAC genes and that this workflow could be used to study other families of transcription factors.......Target gene identification for transcription factors is a prerequisite for the systems wide understanding of organismal behaviour. NAM-ATAF1/2-CUC2 (NAC) transcription factors are amongst the largest transcription factor families in plants, yet limited data exist from unbiased approaches to resolve...... regulatory networks of 12 NAC transcription factors. Our data offer specific single-base resolution fingerprints for most TFs studied and indicate that NAC DNA-binding specificities might be predicted from their DNA-binding domain's sequence. The developed methodology, including the application...

  3. The single-strand DNA binding activity of human PC4 preventsmutagenesis and killing by oxidative DNA damage

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Jen-Yeu; Sarker, Altaf Hossain; Cooper, Priscilla K.; Volkert, Michael R.

    2004-02-01

    Human positive cofactor 4 (PC4) is a transcriptional coactivator with a highly conserved single-strand DNA (ssDNA) binding domain of unknown function. We identified PC4 as a suppressor of the oxidative mutator phenotype of the Escherichia coli fpg mutY mutant and demonstrate that this suppression requires its ssDNA binding activity. Yeast mutants lacking their PC4 ortholog Sub1 are sensitive to hydrogen peroxide and exhibit spontaneous and peroxide induced hypermutability. PC4 expression suppresses the peroxide sensitivity of the yeast sub l{Delta} mutant, suggesting that the human protein has a similar function. A role for yeast and human proteins in DNA repair is suggested by the demonstration that Sub1 acts in a peroxide-resistance pathway involving Rad2 and by the physical interaction of PC4 with the human Rad2 homolog XPG. We show XPG recruits PC4 to a bubble-containing DNA substrate with resulting displacement of XPG and formation of a PC4-DNA complex. We discuss the possible requirement for PC4 in either global or transcription-coupled repair of oxidative DNA damage to mediate the release of XPG bound to its substrate.

  4. Identification and characterization of preferred DNA-binding sites for the Thermus thermophilus transcriptional regulator FadR.

    Directory of Open Access Journals (Sweden)

    Minwoo Lee

    Full Text Available One of the primary transcriptional regulators of fatty acid homeostasis in many prokaryotes is the protein FadR. To better understand its biological function in the extreme thermophile Thermus thermophilus HB8, we sought to first determine its preferred DNA-binding sequences in vitro using the combinatorial selection method Restriction Endonuclease Protection, Selection, and Amplification (REPSA and then use this information to bioinformatically identify potential regulated genes. REPSA determined a consensus FadR-binding sequence 5´-TTRNACYNRGTNYAA-3´, which was further characterized using quantitative electrophoretic mobility shift assays. With this information, a search of the T. thermophilus HB8 genome found multiple operons potentially regulated by FadR. Several of these were identified as encoding proteins involved in fatty acid biosynthesis and degradation; however, others were novel and not previously identified as targets of FadR. The role of FadR in regulating these genes was validated by physical and functional methods, as well as comparative genomic approaches to further characterize regulons in related organisms. Taken together, our study demonstrates that a systematic approach involving REPSA, biophysical characterization of protein-DNA binding, and bioinformatics can be used to postulate biological roles for potential transcriptional regulators.

  5. The Structure of DdrB from Deinococcus: a New Fold for Single-stranded DNA Binding Proteins

    Energy Technology Data Exchange (ETDEWEB)

    Sugiman-Marangos, S.; Junop, M

    2010-01-01

    Deinococcus spp. are renowned for their amazing ability to recover rapidly from severe genomic fragmentation as a result of exposure to extreme levels of ionizing radiation or desiccation. Despite having been originally characterized over 50 years ago, the mechanism underlying this remarkable repair process is still poorly understood. Here, we report the 2.8 {angstrom} structure of DdrB, a single-stranded DNA (ssDNA) binding protein unique to Deinococcus spp. that is crucial for recovery following DNA damage. DdrB forms a pentameric ring capable of binding single-stranded but not double-stranded DNA. Unexpectedly, the crystal structure reveals that DdrB comprises a novel fold that is structurally and topologically distinct from all other single-stranded binding (SSB) proteins characterized to date. The need for a unique ssDNA binding function in response to severe damage, suggests a distinct role for DdrB which may encompass not only standard SSB protein function in protection of ssDNA, but also more specialized roles in protein recruitment or DNA architecture maintenance. Possible mechanisms of DdrB action in damage recovery are discussed.

  6. Elucidating the evolutionary conserved DNA-binding specificities of WRKY transcription factors by molecular dynamics and in vitro binding assays

    Science.gov (United States)

    Brand, Luise H.; Fischer, Nina M.; Harter, Klaus; Kohlbacher, Oliver; Wanke, Dierk

    2013-01-01

    WRKY transcription factors constitute a large protein family in plants that is involved in the regulation of developmental processes and responses to biotic or abiotic stimuli. The question arises how stimulus-specific responses are mediated given that the highly conserved WRKY DNA-binding domain (DBD) exclusively recognizes the ‘TTGACY’ W-box consensus. We speculated that the W-box consensus might be more degenerate and yet undetected differences in the W-box consensus of WRKYs of different evolutionary descent exist. The phylogenetic analysis of WRKY DBDs suggests that they evolved from an ancestral group IIc-like WRKY early in the eukaryote lineage. A direct descent of group IIc WRKYs supports a monophyletic origin of all other group II and III WRKYs from group I by loss of an N-terminal DBD. Group I WRKYs are of paraphyletic descent and evolved multiple times independently. By homology modeling, molecular dynamics simulations and in vitro DNA–protein interaction-enzyme-linked immunosorbent assay with AtWRKY50 (IIc), AtWRKY33 (I) and AtWRKY11 (IId) DBDs, we revealed differences in DNA-binding specificities. Our data imply that other components are essentially required besides the W-box-specific binding to DNA to facilitate a stimulus-specific WRKY function. PMID:23975197

  7. Studies on DNA-binding selectivity of WRKY transcription factors lend structural clues into WRKY-domain function.

    Science.gov (United States)

    Ciolkowski, Ingo; Wanke, Dierk; Birkenbihl, Rainer P; Somssich, Imre E

    2008-09-01

    WRKY transcription factors have been shown to play a major role in regulating, both positively and negatively, the plant defense transcriptome. Nearly all studied WRKY factors appear to have a stereotypic binding preference to one DNA element termed the W-box. How specificity for certain promoters is accomplished therefore remains completely unknown. In this study, we tested five distinct Arabidopsis WRKY transcription factor subfamily members for their DNA binding selectivity towards variants of the W-box embedded in neighboring DNA sequences. These studies revealed for the first time differences in their binding site preferences, which are partly dependent on additional adjacent DNA sequences outside of the TTGACY-core motif. A consensus WRKY binding site derived from these studies was used for in silico analysis to identify potential target genes within the Arabidopsis genome. Furthermore, we show that even subtle amino acid substitutions within the DNA binding region of AtWRKY11 strongly impinge on its binding activity. Additionally, all five factors were found localized exclusively to the plant cell nucleus and to be capable of trans-activating expression of a reporter gene construct in vivo.

  8. Molecular simulations of polycation-DNA binding exploring the effect of peptide chemistry and sequence in nuclear localization sequence based polycations.

    Science.gov (United States)

    Elder, Robert M; Jayaraman, Arthi

    2013-10-10

    Gene therapy relies on the delivery of DNA into cells, and polycations are one class of vectors enabling efficient DNA delivery. Nuclear localization sequences (NLS), cationic oligopeptides that target molecules for nuclear entry, can be incorporated into polycations to improve their gene delivery efficiency. We use simulations to study the effect of peptide chemistry and sequence on the DNA-binding behavior of NLS-grafted polycations by systematically mutating the residues in the grafts, which are based on the SV40 NLS (peptide sequence PKKKRKV). Replacing arginine (R) with lysine (K) reduces binding strength by eliminating arginine-DNA interactions, but placing R in a less hindered location (e.g., farther from the grafting point to the polycation backbone) has surprisingly little effect on polycation-DNA binding strength. Changing the positions of the hydrophobic proline (P) and valine (V) residues relative to the polycation backbone changes hydrophobic aggregation within the polycation and, consequently, changes the conformational entropy loss that occurs upon polycation-DNA binding. Since conformational entropy loss affects the free energy of binding, the positions of P and V in the grafts affect DNA binding affinity. The insight from this work guides synthesis of polycations with tailored DNA binding affinity and, in turn, efficient DNA delivery.

  9. Type III restriction endonuclease EcoP15I is a heterotrimeric complex containing one Res subunit with several DNA-binding regions and ATPase activity.

    Science.gov (United States)

    Wyszomirski, Karol H; Curth, Ute; Alves, Jürgen; Mackeldanz, Petra; Möncke-Buchner, Elisabeth; Schutkowski, Mike; Krüger, Detlev H; Reuter, Monika

    2012-04-01

    For efficient DNA cleavage, the Type III restriction endonuclease EcoP15I communicates with two inversely oriented recognition sites in an ATP-dependent process. EcoP15I consists of methylation (Mod) and restriction (Res) subunits forming a multifunctional enzyme complex able to methylate or to cleave DNA. In this study, we determined by different analytical methods that EcoP15I contains a single Res subunit in a Mod(2)Res stoichiometry. The Res subunit comprises a translocase (Tr) domain carrying functional motifs of superfamily 2 helicases and an endonuclease domain with a PD..D/EXK motif. We show that the isolated Tr domain retains ATP-hydrolyzing activity and binds single- and double-stranded DNA in a sequence-independent manner. To localize the regions of DNA binding, we screened peptide arrays representing the entire Res sequence for their ability to interact with DNA. We discovered four DNA-binding regions in the Tr domain and two DNA-binding regions in the endonuclease domain. Modelling of the Tr domain shows that these multiple DNA-binding regions are located on the surface, free to interact with DNA. Interestingly, the positions of the DNA-binding regions are conserved among other Type III restriction endonucleases.

  10. Phosphorylation of the parsley bZIP transcription factor CPRF2 is regulated by light.

    Science.gov (United States)

    Wellmer, F; Kircher, S; Rügner, A; Frohnmeyer, H; Schäfer, E; Harter, K

    1999-10-08

    The analysis of the complex network of signal transduction chains has demonstrated the importance of transcription factor activities for the control of gene expression. To understand how transcription factor activities in plants are regulated in response to light, we analyzed the common plant regulatory factor 2 (CPRF2) from parsley (Petroselinum crispum L.) that interacts with promoter elements of light-regulated genes. Here, we demonstrate that CPRF2 is a phosphoprotein in vivo and that its phosphorylation state is rapidly increased in response to light. Phosphorylation in vitro as well as in vivo occurs primarily within the C-terminal half of the factor, and is caused by a cytosolic 40-kDa protein serine kinase. In contrast to other plant basic leucine-zipper motif factors, phosphorylation of CPRF2 does not alter its DNA binding activity. Therefore, we discuss alternative functions of the light-dependent phosphorylation of CPRF2 including the regulation of its nucleocytoplasmic partitioning.

  11. The bZIP transcription factor PERIANTHIA: A multifunctional hub for meristem control

    Directory of Open Access Journals (Sweden)

    Jan eLohmann

    2011-11-01

    Full Text Available As sessile organisms, plants are exposed to extreme variations in environmental conditions over the course of their lives. Since plants grow and initiate new organs continuously, they have to modulate the underlying developmental program accordingly to cope with this challenge. At the heart of this extraordinary developmental plasticity are pluripotent stem cells, which are maintained during the entire life-cycle of the plant and that are embedded within dynamic stem cell niches. While the complex regulatory principles of plant stem cell control under artificial constant growth conditions begin to emerge, virtually nothing is known about how this circuit adapts to variations in the environment. In addition to the local feedback system constituted by the homeodomain transcription factor WUSCHEL (WUS and the CLAVATA signaling cascade in the center of the shoot apical meristem (SAM, the bZIP transcription factor PERIANTHIA (PAN not only has a broader expression domain in SAM and flowers, but also carries out more diverse functions in meristem maintenance: pan mutants show alterations in environmental response, shoot meristem size, floral organ number and exhibit severe defects in termination of floral stem cells in an environment dependent fashion. Genetic and genomic analyses indicate that PAN interacts with a plethora of developmental pathways including light, plant hormone and meristem control systems, suggesting that PAN is as an important regulatory node in the network of plant stem cell control.

  12. Control of Drosophila head segment identity by the bZIP homeotic gene cnc.

    Science.gov (United States)

    Mohler, J; Mahaffey, J W; Deutsch, E; Vani, K

    1995-01-01

    Mutational analysis of cap'n'collar (cnc), a bZIP transcription factor closely related to the mammalian erythroid factor NF-E2 (p45), indicates that it acts as a segment-specific selector gene controlling the identity of two cephalic segments. In the mandibular segment, cnc has a classical homeotic effect: mandibular structures are missing in cnc mutant larvae and replaced with duplicate maxillary structures. We propose that cnc functions in combination with the homeotic gene Deformed to specify mandibular development. Labral structures are also missing in cnc mutant larvae, where a distinct labral primordia is not properly maintained in the developing foregut, as observed by the failure to maintain and elaborate patterns of labral-specific segment polarity gene expression. Instead, the labral primordium fuses with the esophageal primordium to contribute to formation of the esophagus. The role of cnc in labral development is reciprocal to the role of homeotic gene forkhead, which has an identical function in the maintenance of the esophageal primordium. This role of homeotic selector genes for the segment-specific maintenance of segment polarity gene expression is a unique feature of segmentation in the preoral head region of Drosophila.

  13. Wounding induces changes in cytokinin and auxin content in potato tuber, but does not induce formation of gibberellins.

    Science.gov (United States)

    Lulai, Edward C; Suttle, Jeffrey C; Olson, Linda L; Neubauer, Jonathan D; Campbell, Larry G; Campbell, Michael A

    2016-02-01

    Cytokinin, auxin and gibberellin contents in resting and wound-responding potato tubers have not been fully determined and coordinated with wound-healing processes. Using a well-defined wound-healing model system, hormone content and expression of genes associated with hormone turnover were determined in tubers following wounding. Changes in hormone content were coordinated with: (I) formation and completion of the wound closing layer (0-5/6 days), and (II) initiation of phellogen and wound periderm formation (∼ 7 days). Quantifiable amounts of biologically active cytokinins (Z, DZ and IP) were not detected in resting or wound-responding tubers. However, the precursor IPA and catabolic product c-ZOG were found in small amounts in resting and wound-responding tubers. Wound-induced activation of cytokinin biosynthesis was suggested by an increase in t-ZR and c-ZR content at 0.5 days and large increases in IPA and c-ZR content by 3 days and throughout 7 days after wounding suggesting roles in II, but little or no role in I. Expression of key genes involved in cytokinin metabolism followed similar profiles with transcripts decreasing through 3 days and then increasing at 5-7 days after wounding. Both free IAA and IAA-Asp were present in resting tubers. While IAA-Asp was no longer present by 3 days after wounding, IAA content nearly doubled by 5 days and was more than 4-fold greater at 7 days compared to that in resting tuber (0 day) suggesting roles in II, but little or no role in I. Gibberellins were not present in quantifiable amounts in resting or wound-responding tubers. These results suggest that bio-active cytokinins are wound-induced, but their residency is temporal and highly regulated. The transient presence of active cytokinins and corresponding increases in IAA content strongly suggest their involvement in the regulation of wound periderm development. The absence of gibberellins indicates that they are not a regulatory component of wound-healing processes

  14. Crystal structures, metal activation, and DNA-binding properties of two-domain IdeR from Mycobacterium tuberculosis.

    Science.gov (United States)

    Wisedchaisri, Goragot; Chou, C James; Wu, Meiting; Roach, Claudia; Rice, Adrian E; Holmes, Randall K; Beeson, Craig; Hol, Wim G J

    2007-01-16

    The iron-dependent regulator IdeR is a key transcriptional regulator of iron uptake in Mycobacterium tuberculosis. In order to increase our insight into the role of the SH3-like third domain of this essential regulator, the metal-binding and DNA-binding properties of two-domain IdeR (2D-IdeR) whose SH3-like domain has been truncated were characterized. The equilibrium dissociation constants for Co2+ and Ni2+ activation of 2D-IdeR for binding to the fxbA operator and the DNA-binding affinities of 2D-IdeR in the presence of excess metal ions were estimated using fluorescence spectroscopy. 2D-IdeR binds to fxbA operator DNA with similar affinity as full-length IdeR in the presence of excess metal ion. However, the Ni2+ concentrations required to activate 2D-IdeR for DNA binding appear to be smaller than that for full-length IdeR while the concentration of Co2+ required for activation remains the same. We have determined the crystal structures of Ni2+-activated 2D-IdeR at 1.96 A resolution and its double dimer complex with the mbtA-mbtB operator DNA in two crystal forms at 2.4 A and 2.6 A, the highest resolutions for DNA complexes for any structures of iron-dependent regulator family members so far. The 2D-IdeR-DNA complex structures confirm the specificity of Ser37 and Pro39 for thymine bases and suggest preferential contacts of Gln43 to cytosine bases of the DNA. In addition, our 2D-IdeR structures reveal a remarkable property of the TEV cleavage sequence remaining after removal of the C-terminal His6. This C-terminal tail promotes crystal contacts by forming a beta-sheet with the corresponding tail of neighboring subunits in two unrelated structures of 2D-IdeR, one with and one without DNA. The contact-promoting properties of this C-terminal TEV cleavage sequence may be beneficial for crystallizing other proteins.

  15. Nanopore-based DNA-probe sequence-evolution method unveiling characteristics of protein-DNA binding phenomena in a nanoscale confined space.

    Science.gov (United States)

    Liu, Nannan; Yang, Zekun; Lou, Xiaoding; Wei, Benmei; Zhang, Juntao; Gao, Pengcheng; Hou, Ruizuo; Xia, Fan

    2015-04-07

    Almost all of the important functions of DNA are realized by proteins which interact with specific DNA, which actually happens in a limited space. However, most of the studies about the protein-DNA binding are in an unconfined space. Here, we propose a new method, nanopore-based DNA-probe sequence-evolution (NDPSE), which includes up to 6 different DNA-probe systems successively designed in a nanoscale confined space which unveil the more realistic characteristics of protein-DNA binding phenomena. There are several features; for example, first, the edge-hindrance and core-hindrance contribute differently for the binding events, and second, there is an equilibrium between protein-DNA binding and DNA-DNA hybridization.

  16. DNA-binding by Haemophilus influenzae and Escherichia coli YbaB, members of a widely-distributed bacterial protein family

    Directory of Open Access Journals (Sweden)

    Miller M Clarke

    2009-07-01

    Full Text Available Abstract Background Genes orthologous to the ybaB loci of Escherichia coli and Haemophilus influenzae are widely distributed among eubacteria. Several years ago, the three-dimensional structures of the YbaB orthologs of both E. coli and H. influenzae were determined, revealing a novel "tweezer"-like structure. However, a function for YbaB had remained elusive, with an early study of the H. influenzae ortholog failing to detect DNA-binding activity. Our group recently determined that the Borrelia burgdorferi YbaB ortholog, EbfC, is a DNA-binding protein. To reconcile those results, we assessed the abilities of both the H. influenzae and E. coli YbaB proteins to bind DNA to which B. burgdorferi EbfC can bind. Results Both the H. influenzae and the E. coli YbaB proteins bound to tested DNAs. DNA-binding was not well competed with poly-dI-dC, indicating some sequence preferences for those two proteins. Analyses of binding characteristics determined that both YbaB orthologs bind as homodimers. Different DNA sequence preferences were observed between H. influenzae YbaB, E. coli YbaB and B. burgdorferi EbfC, consistent with amino acid differences in the putative DNA-binding domains of these proteins. Conclusion Three distinct members of the YbaB/EbfC bacterial protein family have now been demonstrated to bind DNA. Members of this protein family are encoded by a broad range of bacteria, including many pathogenic species, and results of our studies suggest that all such proteins have DNA-binding activities. The functions of YbaB/EbfC family members in each bacterial species are as-yet unknown, but given the ubiquity of these DNA-binding proteins among Eubacteria, further investigations are warranted.

  17. Overproduction, purification and structural characterization of the functional N-terminal DNA-binding domain of the fru repressor from Escherichia coli K-12.

    Science.gov (United States)

    Scarabel, M; Penin, F; Bonod-Bidaud, C; Nègre, D; Cozzone, A J; Cortay, J C

    1995-02-03

    A DNA fragment encoding the DNA-binding domain (amino acids 1-60) of the Escherichia coli fru transcriptional regulator was cloned into the pGEX-KT vector and expressed in frame with the fused gene encoding glutathione S-transferase. The fusion protein was purified to homogeneity by affinity chromatography on immobilized glutathione, and then cleaved with thrombin. After separation by a cation-exchange chromatography step, the DNA-binding domain exhibited proper folding, as shown by proton NMR analysis. Furthermore, it showed specific interaction with the operator region of the ace operon, as checked by gel retardation and DNA methylation-protection experiments.

  18. Ethylene and Not Embolism Is Required for Wound-Induced Tylose Development in Stems of Grapevines1[C][OA

    Science.gov (United States)

    Sun, Qiang; Rost, Thomas L.; Reid, Michael S.; Matthews, Mark A.

    2007-01-01

    The pruning of actively growing grapevines (Vitis vinifera) resulted in xylem vessel embolisms and a stimulation of tylose formation in the vessels below the pruning wound. Pruning was also followed by a 10-fold increase in the concentration of ethylene at the cut surface. When the pruning cut was made under water and maintained in water, embolisms were prevented, but there was no reduction in the formation of tyloses or the accumulation of ethylene. Treatment of the stems with inhibitors of ethylene biosynthesis (aminoethoxyvinylglycine) and/or action (silver thiosulfate) delayed and greatly reduced the formation of tyloses in xylem tissue and the size and number of those that formed in individual vessels. Our data are consistent with the hypotheses that wound ethylene production is the cause of tylose formation and that embolisms in vessels are not directly required for wound-induced tylosis in pruned grapevines. The possible role of ethylene in the formation of tyloses in response to other stresses and during development, maturation, and senescence is discussed. PMID:17921344

  19. Effect of Hevea brasiliensis latex sap gel on healing of acute skin wounds induced on the back of rats

    Directory of Open Access Journals (Sweden)

    Maria Vitória Carmo Penhavel

    Full Text Available Objective : to evaluate the effect of topical delivery of latex cream-gel in acute cutaneous wounds induced on the back of rats. Methods : we subjected sixteen rats to dermo-epidermal excision of a round dorsal skin flap, with 2.5cm diameter. We divided the animals into two groups: Latex Group: application of cream-gel-based latex throughout the wound bed on postoperative days zero, three, six and nine; Control group: no treatment on the wound. Photographs of the lesions were taken on the procedure day and on the 6th and 14th postoperative days, for analyzing the area and the larger diameter of the wound. We carried out euthanasia of all animals on the 14th postoperative day, when we resected he dorsal skin and the underlying muscle layer supporting the wound for histopathological study. Results : there was no statistically significant difference in the percentage of wound closure, in the histopathological findings or in the reduction of the area and of the largest diameter of the wounds among the groups studied on the 14th postoperative day. Conclusion : according to the experimental conditions in which the study was conducted, latex cream-gel did not interfere in the healing of acute cutaneous wounds in rats.

  20. A forkhead Transcription Factor Is Wound-Induced at the Planarian Midline and Required for Anterior Pole Regeneration

    Science.gov (United States)

    Scimone, M. Lucila; Lapan, Sylvain W.; Reddien, Peter W.

    2014-01-01

    Planarian regeneration requires positional information to specify the identity of tissues to be replaced as well as pluripotent neoblasts capable of differentiating into new cell types. We found that wounding elicits rapid expression of a gene encoding a Forkhead-family transcription factor, FoxD. Wound-induced FoxD expression is specific to the ventral midline, is regulated by Hedgehog signaling, and is neoblast-independent. FoxD is subsequently expressed within a medial subpopulation of neoblasts at wounds involving head regeneration. Ultimately, FoxD is co-expressed with multiple anterior markers at the anterior pole. Inhibition of FoxD with RNA interference (RNAi) results in the failure to specify neoblasts expressing anterior markers (notum and prep) and in anterior pole formation defects. FoxD(RNAi) animals fail to regenerate a new midline and to properly pattern the anterior blastema, consistent with a role for the anterior pole in organizing pattern of the regenerating head. Our results suggest that wound signaling activates a forkhead transcription factor at the midline and, if the head is absent, FoxD promotes specification of neoblasts at the prior midline for anterior pole regeneration. PMID:24415944

  1. Regurgitant derived from the tea geometrid Ectropis obliqua suppresses wound-induced polyphenol oxidases activity in tea plants.

    Science.gov (United States)

    Yang, Zi-Wei; Duan, Xiao-Na; Jin, Shan; Li, Xi-Wang; Chen, Zong-Mao; Ren, Bing-Zhong; Sun, Xiao-Ling

    2013-06-01

    Polyphenol oxidases (PPOs) have been reported to play an important role in protecting plants from attack by herbivores. However, little is known about their role in tea. Here, we investigated the effect of PPOs on interactions between tea plants and the tea geometrid Ectropis obliqua, one of the most important insect pests of tea. Jasmonic acid (JA) treatment resulted in increases in PPO activity, and the effect of JA was dose dependent. Ectropis obliqua caterpillars grew and developed more slowly on JA-treated tea plants than on control plants, and larval weight gains depended on the JA dosage. Artificial diet complemented with PPOs reduced the growth and survival rate of E. obliqua caterpillars, and there was a negative relationship between PPO level and larval growth and survival. Unlike mechanical wounding, which is an effective inducer of tea plant PPO activity, wounding plus the herbivore regurgitant or herbivore infestation suppressed the wound-induced PPO activities, especially at 4 days after treatment. These results suggest that PPOs are an important anti-herbivore factor in tea plants, defending them against E. obliqua larvae, and that E. obliqua larvae have evolved to elude the tea plant's defense by inhibiting the production of PPOs.

  2. Effect of Hevea brasiliensis latex sap gel on healing of acute skin wounds induced on the back of rats.

    Science.gov (United States)

    Penhavel, Maria Vitória Carmo; Tavares, Victor Henrique; Carneiro, Fabiana Pirani; Sousa, João Batista de

    2016-02-01

    to evaluate the effect of topical delivery of latex cream-gel in acute cutaneous wounds induced on the back of rats. we subjected sixteen rats to dermo-epidermal excision of a round dorsal skin flap, with 2.5cm diameter. We divided the animals into two groups: Latex Group: application of cream-gel-based latex throughout the wound bed on postoperative days zero, three, six and nine; no treatment on the wound. Photographs of the lesions were taken on the procedure day and on the 6th and 14th postoperative days, for analyzing the area and the larger diameter of the wound. We carried out euthanasia of all animals on the 14th postoperative day, when we resected he dorsal skin and the underlying muscle layer supporting the wound for histopathological study. there was no statistically significant difference in the percentage of wound closure, in the histopathological findings or in the reduction of the area and of the largest diameter of the wounds among the groups studied on the 14th postoperative day. according to the experimental conditions in which the study was conducted, latex cream-gel did not interfere in the healing of acute cutaneous wounds in rats.

  3. A forkhead transcription factor is wound-induced at the planarian midline and required for anterior pole regeneration.

    Directory of Open Access Journals (Sweden)

    M Lucila Scimone

    2014-01-01

    Full Text Available Planarian regeneration requires positional information to specify the identity of tissues to be replaced as well as pluripotent neoblasts capable of differentiating into new cell types. We found that wounding elicits rapid expression of a gene encoding a Forkhead-family transcription factor, FoxD. Wound-induced FoxD expression is specific to the ventral midline, is regulated by Hedgehog signaling, and is neoblast-independent. FoxD is subsequently expressed within a medial subpopulation of neoblasts at wounds involving head regeneration. Ultimately, FoxD is co-expressed with multiple anterior markers at the anterior pole. Inhibition of FoxD with RNA interference (RNAi results in the failure to specify neoblasts expressing anterior markers (notum and prep and in anterior pole formation defects. FoxD(RNAi animals fail to regenerate a new midline and to properly pattern the anterior blastema, consistent with a role for the anterior pole in organizing pattern of the regenerating head. Our results suggest that wound signaling activates a forkhead transcription factor at the midline and, if the head is absent, FoxD promotes specification of neoblasts at the prior midline for anterior pole regeneration.

  4. De-novo protein function prediction using DNA binding and RNA binding proteins as a test case.

    Science.gov (United States)

    Peled, Sapir; Leiderman, Olga; Charar, Rotem; Efroni, Gilat; Shav-Tal, Yaron; Ofran, Yanay

    2016-11-21

    Of the currently identified protein sequences, 99.6% have never been observed in the laboratory as proteins and their molecular function has not been established experimentally. Predicting the function of such proteins relies mostly on annotated homologs. However, this has resulted in some erroneous annotations, and many proteins have no annotated homologs. Here we propose a de-novo function prediction approach based on identifying biophysical features that underlie function. Using our approach, we discover DNA and RNA binding proteins that cannot be identified based on homology and validate these predictions experimentally. For example, FGF14, which belongs to a family of secreted growth factors was predicted to bind DNA. We verify this experimentally and also show that FGF14 is localized to the nucleus. Mutating the predicted binding site on FGF14 abrogated DNA binding. These results demonstrate the feasibility of automated de-novo function prediction based on identifying function-related biophysical features.

  5. Crystal structure of an archaeal specific DNA-binding protein (Ape10b2) from Aeropyrum pernix K1.

    Science.gov (United States)

    Kumarevel, Thirumananseri; Sakamoto, Keiko; Gopinath, Subash C B; Shinkai, Akeo; Kumar, Penmetcha K R; Yokoyama, Shigeyuki

    2008-05-15

    DNA binding proteins are essential in all organisms, and they play important roles in both compacting and regulating the genetic material. All thermophilic and hyperthermophilic archaea encode one or more copies of Alba or Sso10b, which is a small, abundant, basic protein that binds DNA. Here, we present the crystal structure of Ape10b2 from Aeropyrum pernix K1 at 1.70 A. Although the overall structure resembles the known Alba protein fold, a significant conformational change was observed in the loop regions. Specifically, the L5 loop is slightly longer, as compared to those of other known proteins, and the flexibility of this loop may facilitate the interaction with double stranded DNA. In addition, we showed that Ape10b2 binds to 16 and 39 bp duplex DNAs with high affinity. On the basis of our analyses, we have created a putative protein-DNA complex model. 2007 Wiley-Liss, Inc.

  6. Crystal Structure of a Bacterial Topoisomerase IB in Complex with DNA Reveals a Secondary DNA Binding Site

    Energy Technology Data Exchange (ETDEWEB)

    Patel, Asmita; Yakovleva, Lyudmila; Shuman, Stewart; Mondragón, Alfonso (NWU); (SKI)

    2010-10-22

    Type IB DNA topoisomerases (TopIB) are monomeric enzymes that relax supercoils by cleaving and resealing one strand of duplex DNA within a protein clamp that embraces a {approx}21 DNA segment. A longstanding conundrum concerns the capacity of TopIB enzymes to stabilize intramolecular duplex DNA crossovers and form protein-DNA synaptic filaments. Here we report a structure of Deinococcus radiodurans TopIB in complex with a 12 bp duplex DNA that demonstrates a secondary DNA binding site located on the surface of the C-terminal domain. It comprises a distinctive interface with one strand of the DNA duplex and is conserved in all TopIB enzymes. Modeling of a TopIB with both DNA sites suggests that the secondary site could account for DNA crossover binding, nucleation of DNA synapsis, and generation of a filamentous plectoneme. Mutations of the secondary site eliminate synaptic plectoneme formation without affecting DNA cleavage or supercoil relaxation.

  7. NMR elucidation of monomer-dimer transition and conformational heterogeneity in histone-like DNA binding protein of Helicobacter pylori.

    Science.gov (United States)

    Jaiswal, Nancy; Raikwal, Nisha; Pandey, Himanshu; Agarwal, Nipanshu; Arora, Ashish; Poluri, Krishna Mohan; Kumar, Dinesh

    2017-12-14

    Helicobacter pylori (H. pylori) colonizes under harsh acidic/oxidative stress conditions of human gastrointestinal tract and can survive there for infinitely longer durations of host life. The bacterium expresses several harbinger proteins to facilitate its persistent colonization under such conditions. One such protein in H. pylori is histone-like DNA binding protein (Hup), which in its homo-dimeric form binds to DNA to perform various DNA dependent cellular activities. Further, it also plays an important role in protecting the genomic DNA from oxidative stress and acidic denaturation. Legitimately, if the binding of Hup to DNA is suppressed, it will directly impact on the survival of the bacterium, thus making Hup a potential therapeutic target for developing new anti-H. pylori agents. However, to inhibit the binding of Hup to DNA, it is necessary to gain detailed insights into the molecular and structural basis of Hup-dimerization and its binding mechanism to DNA. As a first step in this direction, we report here the nuclear magnetic resonance (NMR) assignments and structural features of Hup at pH 6.0. The study revealed the occurrence of dynamic equilibrium between its monomer and dimer conformations. The dynamic equilibrium was found to shifting towards dimer both at low temperature and low pH; whereas DNA binding studies evidenced that the protein binds to DNA in its dimeric form. These preliminary investigations correlate very well with the diverse functionality of protein and will form the basis for future studies aiming to develop novel anti-H. pylori agents employing structure-based-rational drug discovery approach. Copyright © 2017 John Wiley & Sons, Ltd.

  8. Structural and Dynamics Studies of Pax5 Reveal Asymmetry in Stability and DNA Binding by the Paired Domain.

    Science.gov (United States)

    Perez-Borrajero, Cecilia; Okon, Mark; McIntosh, Lawrence P

    2016-06-05

    The eukaryotic transcription factor Pax5 or B-cell specific activator protein (BSAP) is central to B-cell development and has been implicated in a large number of cellular malignancies resulting from loss- or gain-of-function mutations. In this study, we characterized the DNA-binding Paired domain (PD) of Pax5 in its free and DNA-bound forms using NMR spectroscopy. In isolation, the PD folds as two independent helical bundle subdomains separated by a conformationally disordered linker. The two subdomains differ in stability, with the C-terminal subdomain (CTD) being ~10-fold more protected from amide hydrogen exchange (HX) than the N-terminal subdomain (NTD). Upon binding DNA, the linker and an induced N-terminal β-hairpin become ordered with significantly dampened motions and increased HX protection. Both subdomains of the PD contribute to specific DNA binding, resulting in an equilibrium dissociation constant more than three orders of magnitude lower than exhibited by the separate subdomains for their respective half-sites (nM versus μM). The isolated CTD binds non-specific DNA sequences with only ~10-fold weaker affinity than cognate sequences. In contrast, the NTD associates very poorly with non-specific DNA. We propose that the more stable CTD has evolved to provide relatively low affinity non-specific contacts with DNA. In contrast, the more dynamic NTD discriminates between cognate and non-specific sites. The distinct roles of the PD subdomains may enable efficient searching of genomic DNA by Pax5 while retaining specificity for functional regulatory sites. Copyright © 2016 Elsevier Ltd. All rights reserved.

  9. The genes encoding the DNA binding protein and the 23K protease of adenovirus types 40 and 41.

    Science.gov (United States)

    Vos, H L; van der Lee, F M; Reemst, A M; van Loon, A E; Sussenbach, J S

    1988-03-01

    The adenovirus (Ad) single-stranded DNA binding protein (DBP) is a multifunctional protein. It is thought to consist of two domains, the amino-terminal domain involved in host-range determination and the carboxyl-terminal domain functioning in DNA replication and DNA binding. We have determined the nucleotide sequences of the DBP genes of Ad40 and Ad41, two human adenoviral serotypes that differ significantly from other adenoviruses. Regions of structural and functional importance in the corresponding proteins could be identified by comparison of the amino acid sequences with those of other known DBPs. In addition, the nucleotide sequences of the DBP early promoters, of the 23K protease genes, and of parts of the hexon and 100K protein genes have been determined. It can be deduced from the nucleotide sequences, that the Ad40 and Ad41 DBPs are relatively small (473 and 474 amino acids (a.a.), respectively, versus 529 a.a. for the Ad5 DBP). This is caused by the presence of very small amino-terminal domains of 119 a.a. (Ad40) and 120 a.a. (Ad41), as compared to 173 a.a. for the corresponding Ad5 domain. Only a few amino acids in this domain have been conserved in all known DBPs. The carboxyl-terminal domains show a higher degree of sequence conservation. In this domain, four strongly conserved regions can be identified, one of which might form a metal-binding site. The 23K proteases of both Ad40 and Ad41 show a strong homology to the Ad2 and Ad5 proteins, with the exception of the carboxyl-terminal end of the proteins. The 23K protease gene of Ad41 has an open reading frame that extends beyond the polyadenylation signal, in contrast to the Ad40 gene that ends well in front of the signal.

  10. The Dictyostelium prestalk inducer DIF-1 directs phosphorylation of a bZIP transcription factor.

    Science.gov (United States)

    Yamada, Yoko; Kubohara, Yuzuru; Kikuchi, Haruhisa; Oshima, Yoshiteru; Wang, Hong-Yu; Ross, Susan; Williams, Jeffrey G

    2013-01-01

    DIF-1, a chlorinated hexaphenone produced by developing Dictyostelium cells, induces prestalk differentiation. DimB is a bZIP transcription factor that accumulates in the nucleus upon exposure to DIF-1, where it directly activates transcription of DIF-responsive genes. The signaling steps upstream of DimB and downstream of DIF-1 are entirely unknown. Analysis by mass spectrometry shows that incubation with DIF-1 rapidly stimulates phosphorylation at several sites in DimB. We characterize the most highly responsive site, S590, which is located very close to the C terminus. A point mutation in this site, S590A, does not inhibit DimB nuclear accumulation in response to DIF. However, this seems likely to reflect functional redundancy with other sites; because a panel of chemical variants on the structure of DIF-1 show a correlation between their potencies as inducers of DimB nuclear accumulation and their potencies as inducers of phosphorylation at S590. Furthermore, the S590A mutant is fully active in mutant rescue of a dimB null strain, arguing against an alternative role in transcriptional activation of target genes. We conclude that i) DIF-1 directs phosphorylation at S590, ii) although it is not essential for nuclear accumulation in response to DIF-1 correlative evidence, based upon a panel of DIF-1 related molecules, suggests that this modification may play a redundant role in the process. iii) We also present evidence that the kinase activity, which phosphorylates S590, is non-nuclear and that this signalling pathway is, in part at least, independent of the DIF-regulated STATc activation pathway.

  11. Oligomerization of Hmo1 mediated by box A is essential for DNA binding in vitro and in vivo.

    Science.gov (United States)

    Kasahara, Koji; Higashino, Ayako; Unzai, Satoru; Yoshikawa, Hirofumi; Kokubo, Tetsuro

    2016-12-01

    Hmo1, a member of HMGB family proteins in Saccharomyces cerevisiae, binds to and regulates the transcription of genes encoding ribosomal RNA and ribosomal proteins. The functional motifs of Hmo1 include two HMG-like motifs, box A and box B, and a C-terminal tail. To elucidate the molecular roles of the HMG-like boxes in DNA binding in vivo, we analyzed the DNA-binding activity of various Hmo1 mutants using ChIP or reporter assays that enabled us to conveniently detect Hmo1 binding to the promoter of RPS5, a major target gene of Hmo1. Our mutational analyses showed that box B is a bona fide DNA-binding motif and that it also plays other important roles in cell growth. However, box A, especially its first α-helix, contributes to DNA binding of Hmo1 by inducing self-assembly of Hmo1. Intriguingly, box A mediated formation of oligomers of more than two proteins on DNA in vivo. Furthermore, duplication of the box B partially alleviates the requirement for box A. These findings suggest that the principal role of box A is to assemble multiple box B in the appropriate orientation, thereby stabilizing the binding of Hmo1 to DNA and nucleating specific chromosomal architecture on its target genes. © 2016 Molecular Biology Society of Japan and John Wiley & Sons Australia, Ltd.

  12. A C-terminal Myb extension domain defines a novel family of double-strand telomeric DNA-binding proteins in Arabidopsis.

    Science.gov (United States)

    Karamysheva, Zemfira N; Surovtseva, Yulia V; Vespa, Laurent; Shakirov, Eugene V; Shippen, Dorothy E

    2004-11-12

    Little is known about the protein composition of plant telomeres. We queried the Arabidopsis thaliana genome data base in search of genes with similarity to the human telomere proteins hTRF1 and hTRF2. hTRF1/hTRF2 are distinguished by the presence of a single Myb-like domain in their C terminus that is required for telomeric DNA binding in vitro. Twelve Arabidopsis genes fitting this criterion, dubbed TRF-like (TRFL), fell into two distinct gene families. Notably, TRFL family 1 possessed a highly conserved region C-terminal to the Myb domain called Myb-extension (Myb-ext) that is absent in TRFL family 2 and hTRF1/hTRF2. Immunoprecipitation experiments revealed that recombinant proteins from TRFL family 1, but not those from family 2, formed homodimers and heterodimers in vitro. DNA binding studies with isolated C-terminal fragments from TRFL family 1 proteins, but not family 2, showed specific binding to double-stranded plant telomeric DNA in vitro. Removal of the Myb-ext domain from TRFL1, a family 1 member, abolished DNA binding. However, when the Myb-ext domain was introduced into the corresponding region in TRFL3, a family 2 member, telomeric DNA binding was observed. Thus, Myb-ext is required for binding plant telomeric DNA and defines a novel class of proteins in Arabidopsis.

  13. Identification, cloning and expression of p25, an AT-rich DNA-binding protein from the extreme thermophile, Thermus aquaticus YT-1.

    Science.gov (United States)

    Du, X; Pène, J J

    1999-01-01

    Although the G+C content of Thermus aquaticus YT-1 chromosomal DNA is 67.4%, regions with lower G+C content have also been observed. AT-rich DNA-binding proteins may contribute to the thermostability and biological functions of these DNA regions at Thermus growth temperatures. Using double-stranded DNA (dsDNA)-cellulose chromatography, a T.aquaticus YT-1 protein, designated as p25, was identified to bind preferentially to AT-rich DNA. The gene encoding p25 was cloned and sequenced after immunoscreening T.aquaticus YT-1 expression libraries. The deduced primary structure of p25 is 211 amino acids in length with a molecular weight of 23 225 Da. Native p25 was purified and characterized as a homodimer with modification possibly at lysine and arginine residues. Its preferential and temperature-dependent binding to AT-rich DNA was confirmed with mobility-shift DNA-binding assays. The protein was demonstrated to bind preferentially to dsDNA instead of single-stranded DNA. The binding of p25 to dsDNA also improved the thermotolerence of this protein. Overexpression study of fusion p25 suggested that the N-terminus of the protein might form the DNA-binding domain or be closely involved in DNA-binding activity. PMID:10076001

  14. The Tomato Nucleotide-binding Leucine-rich Repeat (NLR) Immune Receptor I-2 Couples DNA-Binding to Nucleotide-Binding Domain Nucleotide Exchange

    NARCIS (Netherlands)

    Fenyk, S.; Dixon, C.H.; Gittens, W.H.; Townsend, P.D.; Sharples, G.J.; Pålsson, L.O.; Takken, F.L.W.; Cann, M.J.

    2016-01-01

    Plant nucleotide-binding leucine-rich repeat (NLR) proteins enable plants to recognise and respond to pathogen attack. Previously, we demonstrated that the Rx1 NLR of potato is able to bind and bend DNA in vitro. DNA binding in situ requires its genuine activation following pathogen perception.

  15. 3D structure of Thermus aquaticus single-stranded DNA-binding protein gives insight into the functioning of SSB proteins

    National Research Council Canada - National Science Library

    Fedorov, Roman; Witte, Gregor; Urbanke, Claus; Manstein, Dietmar J; Curth, Ute

    2006-01-01

    .... We solved the crystal structures of the SSB protein from Thermus aquaticus (TaqSSB) and a deletion mutant of the protein and show the structure of their ssDNA binding domains to be similar to the structure of tetrameric SSBs...

  16. The effect of metal and substituent on DNA binding, cleavage activity, and cytotoxicity of new synthesized Schiff base ligands and Zn(II) complex

    Science.gov (United States)

    Asadi, Zahra; Nasrollahi, Neda

    2017-11-01

    New water soluble Schiff base ligands [N,Nʹ-bis{5-[(triphenylphosphonium percholorate)-methyl]salicylidine}-1,3-diamino-2-propanol] (L1) and [N,Nʹ-bis(salicylidine)-1,3-diamino-2-propanol] (L2) and zinc (II) complex of L1: [N,Nʹ-bis{5-[(triphenylphosphonium percholorate)-methyl]salicylidine}-1,3-diamino-2-propanol]Zn(II) were synthesized and characterized by elemental analysis, FT-IR, 1HNMR and UV-Vis spectroscopy. In vitro DNA binding of the compounds were investigated by UV-Vis absorption spectroscopy, viscosity measurement, cyclic voltammetry, fluorescence spectroscopy, and gel electrophoresis. The present study aimed to investigate the effect of metal and substituent on DNA binding, cleavage activity and cytotoxicity of new synthesized Schiff base ligands and Zn(II) complex. The order of DNA binding affinity (Kb) calculated from the absorption spectroscopy was: ZnL1 > L2 > L1. Molecular docking studies explore more details on the mode of binding and binding energies. Although the compounds revealed strong DNA binding affinity but electrophoresis studies don't show any effects on the DNA structure and single or double strand breaks. The cytotoxicity experiments against human Hepatoma (HepG2) showed the order: L1 > ZnL1 > L2.

  17. [TSP-2 suppresses the expression and DNA-binding activity of nuclear factor-κB p65 protein in mice with ulcerative colitis].

    Science.gov (United States)

    Lai, Mingguang; Wang, Lisheng; Yao, Jun; Wei, Chen

    2013-03-01

    To observe the effect of TSP-2, the antibody of Toll-like receptor 2 extracellular domain, on the expression and DNA-binding activity of nuclear factor-κB (NF-κB) p65 protein in mice with ulcerative colitis (UC). Sixty BALB/c mice were randomized equally into normal control group, UC model group, TSP-2 treatment group, and rabbit IgG treatment group. In the latter 3 groups, the mice were fed with 5% DSS (C6H7Na3O14S3) solution for 7 days to induced UC, followed then by treatment with daily injections of TSP-2 or rabbit IgG as appropriate for 7 days. The disease activity index was recorded during the treatment. The colitis tissues were collected after the treatments for HE staining and detecting the expression and DNA-binding activity of NF-κB p65 in the colon mucosa by Western blotting and ELISA. The DNA binding activity and expressions of NF-κB P65 protein increased significantly in UC model group (PTSP-2 treatment group significantly decreased the disease activity index (P0.05). TSP-2 can suppress the DNA-binding activity and protein expressions of NF-κB P65 and regulate excessive immune response in the intestines to ameliorate ulcerative colitis in mice.

  18. Primary metabolism of chickpea is the initial target of wound inducing early sensed Fusarium oxysporum f. sp. ciceri race I.

    Directory of Open Access Journals (Sweden)

    Sumanti Gupta

    Full Text Available BACKGROUND: Biotrophic interaction between host and pathogen induces generation of reactive oxygen species that leads to programmed cell death of the host tissue specifically encompassing the site of infection conferring resistance to the host. However, in the present study, biotrophic relationship between Fusarium oxysporum and chickpea provided some novel insights into the classical concepts of defense signaling and disease perception where ROS (reactive oxygen species generation followed by hypersensitive responses determined the magnitude of susceptibility or resistant potentiality of the host. METHODOLOGY/PRINCIPAL FINDINGS: Microscopic observations detected wound mediated in planta pathogenic establishment and its gradual progression within the host vascular tissue. cDNA-AFLP showed differential expression of many defense responsive elements. Real time expression profiling also validated the early recognition of the wound inducing pathogen by the host. The interplay between fungus and host activated changes in primary metabolism, which generated defense signals in the form of sugar molecules for combating pathogenic encounter. CONCLUSIONS/SIGNIFICANCE: The present study showed the limitations of hypersensitive response mediated resistance, especially when foreign encounters involved the food production as well as the translocation machinery of the host. It was also predicted from the obtained results that hypersensitivity and active species generation failed to impart host defense in compatible interaction between chickpea and Fusarium. On the contrary, the defense related gene(s played a critical role in conferring natural resistance to the resistant host. Thus, this study suggests that natural selection is the decisive factor for selecting and segregating out the suitable type of defense mechanism to be undertaken by the host without disturbing its normal metabolism, which could deviate from the known classical defense mechanisms.

  19. DNABind: a hybrid algorithm for structure-based prediction of DNA-binding residues by combining machine learning- and template-based approaches.

    Science.gov (United States)

    Liu, Rong; Hu, Jianjun

    2013-11-01

    Accurate prediction of DNA-binding residues has become a problem of increasing importance in structural bioinformatics. Here, we presented DNABind, a novel hybrid algorithm for identifying these crucial residues by exploiting the complementarity between machine learning- and template-based methods. Our machine learning-based method was based on the probabilistic combination of a structure-based and a sequence-based predictor, both of which were implemented using support vector machines algorithms. The former included our well-designed structural features, such as solvent accessibility, local geometry, topological features, and relative positions, which can effectively quantify the difference between DNA-binding and nonbinding residues. The latter combined evolutionary conservation features with three other sequence attributes. Our template-based method depended on structural alignment and utilized the template structure from known protein-DNA complexes to infer DNA-binding residues. We showed that the template method had excellent performance when reliable templates were found for the query proteins but tended to be strongly influenced by the template quality as well as the conformational changes upon DNA binding. In contrast, the machine learning approach yielded better performance when high-quality templates were not available (about 1/3 cases in our dataset) or the query protein was subject to intensive transformation changes upon DNA binding. Our extensive experiments indicated that the hybrid approach can distinctly improve the performance of the individual methods for both bound and unbound structures. DNABind also significantly outperformed the state-of-art algorithms by around 10% in terms of Matthews's correlation coefficient. The proposed methodology could also have wide application in various protein functional site annotations. DNABind is freely available at http://mleg.cse.sc.edu/DNABind/. Copyright © 2013 Wiley Periodicals, Inc.

  20. Role of cysteines in the stability and DNA-binding activity of the hypochlorite-specific transcription factor HypT.

    Directory of Open Access Journals (Sweden)

    Adrian Drazic

    Full Text Available Reactive oxygen species are important components of the immune response. Hypochlorite (HOCl is produced by neutrophils to kill invading microorganisms. The bactericidal activity of HOCl is due to proteome-wide unfolding and oxidation of proteins at cysteine and methionine residues. Escherichia coli cells are protected from HOCl-killing by the previously identified dodecameric transcription factor HypT (YjiE. Here, we aimed to unravel whether HOCl activates HypT directly or via a reaction product of HOCl with a cellular component. Bacterial viability assays and analysis of target gene regulation indicate that HypT is highly specific to activation by HOCl and that no reaction products of HOCl such as monochloramine, hydroxyl radicals, or methionine sulfoxide activate HypT in vivo. Surprisingly, purified HypT lost its DNA-binding activity upon incubation with HOCl or reaction products that oxidize HypT to form a disulfide-linked dimer, and regained DNA-binding activity upon reduction. Thus, we postulate that the cysteines in HypT contribute to control the DNA-binding activity of HypT in vitro. HypT contains five cysteine residues; a HypT mutant with all cysteines substituted by serine is aggregation-prone and forms tetramers in addition to the typical dodecamers. Using single and multiple cysteine-to-serine mutants, we identified Cys150 to be required for stability and Cys4 being important for oligomerization of HypT to dodecamers. Further, oxidation of Cys4 is responsible for the loss of DNA-binding of HypT upon oxidation in vitro. It appears that Cys4 oxidation upon conditions that are insufficient to stimulate the DNA-binding activity of HypT prevents unproductive interactions of HypT with DNA. Thus, Cys4 oxidation may be a check point in the activation process of HypT.

  1. The individual and common repertoire of DNA-binding transcriptional regulators of Corynebacterium glutamicum, Corynebacterium efficiens, Corynebacterium diphtheriae and Corynebacterium jeikeium deduced from the complete genome sequences

    Directory of Open Access Journals (Sweden)

    Kalinowski Jörn

    2005-06-01

    Full Text Available Abstract Background The genus Corynebacterium includes Gram-positive microorganisms of great biotechnologically importance, such as Corynebacterium glutamicum and Corynebacterium efficiens, as well as serious human pathogens, such as Corynebacterium diphtheriae and Corynebacterium jeikeium. Although genome sequences of the respective species have been determined recently, the knowledge about the repertoire of transcriptional regulators and the architecture of global regulatory networks is scarce. Here, we apply a combination of bioinformatic tools and a comparative genomic approach to identify and characterize a set of conserved DNA-binding transcriptional regulators in the four corynebacterial genomes. Results A collection of 127 DNA-binding transcriptional regulators was identified in the C. glutamicum ATCC 13032 genome, whereas 103 regulators were detected in C. efficiens YS-314, 63 in C. diphtheriae NCTC 13129 and 55 in C. jeikeium K411. According to amino acid sequence similarities and protein structure predictions, the DNA-binding transcriptional regulators were grouped into 25 regulatory protein families. The common set of DNA-binding transcriptional regulators present in the four corynebacterial genomes consists of 28 proteins that are apparently involved in the regulation of cell division and septation, SOS and stress response, carbohydrate metabolism and macroelement and metal homeostasis. Conclusion This work describes characteristic features of a set of conserved DNA-binding transcriptional regulators present within the corynebacterial core genome. The knowledge on the physiological function of these proteins should not only contribute to our understanding of the regulation of gene expression but will also provide the basis for comprehensive modeling of transcriptional regulatory networks of these species.

  2. Effect of pH on the Structure and DNA Binding of the FOXP2 Forkhead Domain.

    Science.gov (United States)

    Blane, Ashleigh; Fanucchi, Sylvia

    2015-06-30

    Forkhead box P2 (FOXP2) is a transcription factor expressed in cardiovascular, intestinal, and neural tissues during embryonic development and is implicated in language development. FOXP2 like other FOX proteins contains a DNA binding domain known as the forkhead domain (FHD). The FHD interacts with DNA by inserting helix 3 into the major groove. One of these DNA-protein interactions is a direct hydrogen bond that is formed with His554. FOXP2 is localized in the nuclear compartment that has a pH of 7.5. Histidine contains an imidazole side chain in which the amino group typically has a pKa of ~6.5. It seems possible that pH fluctuations around 6.5 may result in changes in the protonation state of His554 and thus the ability of the FOXP2 FHD to bind DNA. To investigate the effect of pH on the FHD, both the structure and the binding affinity were studied in the pH range of 5-9. This was done in the presence and absence of DNA. The structure was assessed using size exclusion chromatography, far-UV circular dichroism, and intrinsic and extrinsic fluorescence. The results indicated that while pH did not affect the secondary structure in the presence or absence of DNA, the tertiary structure was pH sensitive and the protein was less compact at low pH. Furthermore, the presence of DNA caused the protein to become more compact at low pH and also had the potential to increase the dimerization propensity. Fluorescence anisotropy was used to investigate the effect of pH on the FOXP2 FHD DNA binding affinity. It was found that pH had a direct effect on binding affinity. This was attributed to the altered hydrogen bonding patterns upon protonation or deprotonation of His554. These results could implicate pH as a means of regulating transcription by the FOXP2 FHD, which may also have repercussions for the behavior of this protein in cancer cells.

  3. Glucocorticoid coordinate regulation of type I procollagen gene expression and procollagen DNA-binding proteins in chick skin fibroblasts

    Energy Technology Data Exchange (ETDEWEB)

    Cockayne, D.; Cutroneo, K.R.

    1988-04-19

    Nuclei were isolated from control and dexamethasone-treated (2 h) embryonic chick skin fibroblasts and transcribed in vitro. Nuclei isolated from dexamethasone-treated fibroblasts transcribed less pro..cap alpha..1(I) and pro..cap alpha..2(I) mRNAs but not ..beta..-actin mRNA. Fibroblasts receiving dexamethasone and (5,6-/sup 3/H)uridine also demonstrated decreased synthesis of nuclear type I procollagen mRNAs but not ..beta..-actin mRNA. In fibroblasts treated with cycloheximide the newly synthesized nuclear type I procollagen mRNA species were markedly decreased. An enhanced inhibitory effect was observed when fibroblasts were treated with cycloheximide plus dexamethasone. Since the studies above demonstrate that active protein synthesis is required to maintain the constitutive expression of the type I procollagen genes, the authors determined if glucocorticoids regulate DNA-binding proteins with sequence specificity for the ..cap alpha..2(I) procollagen gene. Nuclear protein blots were probed with the /sup 32/P-end-labeled pBR322 vector DNA and /sup 32/P-end-labeled ..cap alpha..2(I) procollagen promoter containing DNA. Nonhistone proteins remained bound to labeled DNA at stringency washes of 0.05 and 0.1 M NaCl. As the ionic strength was increased to 0.2 and 0.3 M NaCl, the nonhistone-protein DNA binding was preferentially lost. Only the low molecular weight proteins remained bound to labeled DNA at the highest ionic strength, indicating nonspecific binding of these nuclear proteins. Dexamethasone treatment resulted in an increase of binding of nonhistone proteins to vector- and promoter-labeled DNAs over that observed in control fibroblasts at stringency washes of 0.05 and 0.1 M NaCl and to a lesser extent at 0.2 M NaCl. The binding specificities of nonhistone proteins for the ..cap alpha..2(I) procollagen promoter containing DNA were calculated.

  4. Genome-Wide Identification and Characterization of bZIP Transcription Factors in Brassica oleracea under Cold Stress.

    Science.gov (United States)

    Hwang, Indeok; Manoharan, Ranjith Kumar; Kang, Jong-Goo; Chung, Mi-Young; Kim, Young-Wook; Nou, Ill-Sup

    2016-01-01

    Cabbages (Brassica oleracea L.) are an important vegetable crop around world, and cold temperature is among the most significant abiotic stresses causing agricultural losses, especially in cabbage crops. Plant bZIP transcription factors play diverse roles in biotic/abiotic stress responses. In this study, 119 putative BolbZIP transcription factors were identified using amino acid sequences from several bZIP domain consensus sequences. The BolbZIP members were classified into 63 categories based on amino acid sequence similarity and were also compared with BrbZIP and AtbZIP transcription factors. Based on this BolbZIP identification and classification, cold stress-responsive BolbZIP genes were screened in inbred lines, BN106 and BN107, using RNA sequencing data and qRT-PCR. The expression level of the 3 genes, Bol008071, Bol033132, and Bol042729, was significantly increased in BN107 under cold conditions and was unchanged in BN106. The upregulation of these genes in BN107, a cold-susceptible inbred line, suggests that they might be significant components in the cold response. Among three identified genes, Bol033132 has 97% sequence similarity to Bra020735, which was identified in a screen for cold-related genes in B. rapa and a protein containing N-rich regions in LCRs. The results obtained in this study provide valuable information for understanding the potential function of BolbZIP transcription factors in cold stress responses.

  5. Interaction between Drosophila bZIP proteins Atf3 and Jun prevents replacement of epithelial cells during metamorphosis

    Science.gov (United States)

    Sekyrova, Petra; Bohmann, Dirk; Jindra, Marek; Uhlirova, Mirka

    2010-01-01

    Epithelial sheet spreading and fusion underlie important developmental processes. Well-characterized examples of such epithelial morphogenetic events have been provided by studies in Drosophila, and include embryonic dorsal closure, formation of the adult thorax and wound healing. All of these processes require the basic region-leucine zipper (bZIP) transcription factors Jun and Fos. Much less is known about morphogenesis of the fly abdomen, which involves replacement of larval epidermal cells (LECs) with adult histoblasts that divide, migrate and finally fuse to form the adult epidermis during metamorphosis. Here, we implicate Drosophila Activating transcription factor 3 (Atf3), the single ortholog of human ATF3 and JDP2 bZIP proteins, in abdominal morphogenesis. During the process of the epithelial cell replacement, transcription of the atf3 gene declines. When this downregulation is experimentally prevented, the affected LECs accumulate cell-adhesion proteins and their extrusion and replacement with histoblasts are blocked. The abnormally adhering LECs consequently obstruct the closure of the adult abdominal epithelium. This closure defect can be either mimicked and further enhanced by knockdown of the small GTPase Rho1 or, conversely, alleviated by stimulating ecdysone steroid hormone signaling. Both Rho and ecdysone pathways have been previously identified as effectors of the LEC replacement. To elicit the gain-of-function effect, Atf3 specifically requires its binding partner Jun. Our data thus identify Atf3 as a new functional partner of Drosophila Jun during development. PMID:20023169

  6. A novel wheat bZIP transcription factor, TabZIP60, confers multiple abiotic stress tolerances in transgenic Arabidopsis.

    Science.gov (United States)

    Zhang, Lina; Zhang, Lichao; Xia, Chuan; Zhao, Guangyao; Liu, Ji; Jia, Jizeng; Kong, Xiuying

    2015-04-01

    The basic region/leucine zipper (bZIP) transcription factors (TFs) play vital roles in the response to abiotic stress. However, little is known about the function of bZIP genes in wheat abiotic stress. In this study, we report the isolation and functional characterization of the TabZIP60 gene. Three homologous genome sequences of TabZIP60 were isolated from hexaploid wheat and mapped to the wheat homoeologous group 6. A subcellular localization analysis indicated that TabZIP60 is a nuclear-localized protein that activates transcription. Furthermore, TabZIP60 gene transcripts were strongly induced by polyethylene glycol, salt, cold and exogenous abscisic acid (ABA) treatments. Further analysis showed that the overexpression of TabZIP60 in Arabidopsis resulted in significantly improved tolerances to drought, salt, freezing stresses and increased plant sensitivity to ABA in seedling growth. Meanwhile, the TabZIP60 was capable of binding ABA-responsive cis-elements that are present in promoters of many known ABA-responsive genes. A subsequent analysis showed that the overexpression of TabZIP60 led to enhanced expression levels of some stress-responsive genes and changes in several physiological parameters. Taken together, these results suggest that TabZIP60 enhances multiple abiotic stresses through the ABA signaling pathway and that modifications of its expression may improve multiple stress tolerances in crop plants. © 2014 Scandinavian Plant Physiology Society.

  7. Mutations on the DNA binding surface of TBP discriminate between yeast TATA and TATA-less gene transcription.

    Science.gov (United States)

    Kamenova, Ivanka; Warfield, Linda; Hahn, Steven

    2014-08-01

    Most RNA polymerase (Pol) II promoters lack a TATA element, yet nearly all Pol II transcription requires TATA binding protein (TBP). While the TBP-TATA interaction is critical for transcription at TATA-containing promoters, it has been unclear whether TBP sequence-specific DNA contacts are required for transcription at TATA-less genes. Transcription factor IID (TFIID), the TBP-containing coactivator that functions at most TATA-less genes, recognizes short sequence-specific promoter elements in metazoans, but analogous promoter elements have not been identified in Saccharomyces cerevisiae. We generated a set of mutations in the yeast TBP DNA binding surface and found that most support growth of yeast. Both in vivo and in vitro, many of these mutations are specifically defective for transcription of two TATA-containing genes with only minor defects in transcription of two TATA-less, TFIID-dependent genes. TBP binds several TATA-less promoters with apparent high affinity, but our results suggest that this binding is not important for transcription activity. Our results are consistent with the model that sequence-specific TBP-DNA contacts are not important at yeast TATA-less genes and suggest that other general transcription factors or coactivator subunits are responsible for recognition of TATA-less promoters. Our results also explain why yeast TBP derivatives defective for TATA binding appear defective in activated transcription. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

  8. DNA binding, DNA cleavage, antioxidant and cytotoxicity studies on ruthenium(II) complexes of benzaldehyde 4-methyl-3-thiosemicarbazones

    Science.gov (United States)

    Sampath, Krishnan; Sathiyaraj, Subbaiyan; Jayabalakrishnan, Chinnasamy

    2013-03-01

    Four new ruthenium(II) complexes with N(4)-methyl thiosemicarbazone ligands, (E)-2-(2-chlorobenzylidene)-N-methylhydrazinecarbothioamide (HL1) and (E)-N-methyl-2-(2-nitrobenzylidene)hydrazinecarbothioamide (HL2), were prepared and fully characterized by various spectro-analytical techniques. The Schiff bases act as bidentate, monobasic chelating ligands with S and N as the donor sites and are preferably found in the thiol form in all the complexes studied. The molecular structure of HL1 and HL2 were determined by single crystal X-ray diffraction method. DNA binding of the compounds was investigated by absorption spectroscopy which indicated that the complexes bind to DNA via intercalation. The oxidative cleavage of the complexes with CT-DNA inferred that the effects of cleavage are dose dependent. Antioxidant studies of the ligands and complexes showed the significant antioxidant activity against DPPH radical. In addition, the in vitro cytotoxicity of the ligands and complexes against MCF-7 cell line was assayed which showed higher cytotoxic activity with the lower IC50 values indicating their efficiency in killing the cancer cells even at low concentrations.

  9. Scaffold protein enigma homolog 1 overcomes the repression of myogenesis activation by inhibitor of DNA binding 2.

    Science.gov (United States)

    Nakatani, Miyuki; Ito, Jumpei; Koyama, Riko; Iijima, Masumi; Yoshimoto, Nobuo; Niimi, Tomoaki; Kuroda, Shun'ichi; Maturana, Andrés D

    2016-05-27

    Enigma Homolog 1 (ENH1) is a scaffold protein for signaling proteins and transcription factors. Previously, we reported that ENH1 overexpression promotes the differentiation of C2C12 myoblasts. However, the molecular mechanism underlying the role of ENH1 in the C2C12 cells differentiation remains elusive. ENH1 was shown to inhibit the proliferation of neuroblastoma cells by sequestering Inhibitor of DNA binding protein 2 (Id2) in the cytosol. Id2 is a repressor of basic Helix-Loop-Helix transcription factors activity and prevents myogenesis. Here, we found that ENH1 overcome the Id2 repression of C2C12 cells myogenic differentiation and that ENH1 overexpression promotes mice satellite cells activation, the first step toward myogenic differentiation. In addition, we show that ENH1 interacted with Id2 in C2C12 cells and mice satellite cells. Collectively, our results suggest that ENH1 plays an important role in the activation of myogenesis through the repression of Id2 activity. Copyright © 2016 Elsevier Inc. All rights reserved.

  10. In Vitro Antitumor Activity of a Keggin Vanadium-Substituted Polyoxomolybdate and Its ctDNA Binding Properties

    Directory of Open Access Journals (Sweden)

    Wen Qi

    2015-01-01

    Full Text Available A Keggin vanadium-substituted polyoxomolybdate, K5PMo10V2O40 (PMo10V2, has been synthesized and it’s antitumor effect against Hela cells was investigated. The calf thymus DNA (ctDNA binding ability of PMo10V2 was also evaluated by UV-Vis absorption spectra and fluorescence spectra. The identity and high purity of PMo10V2 was confirmed by elemental analysis and IR analysis. And the antitumor activity test of PMo10V2 was carried out on Hela cancer cells line by MTT assay. The results of MTT assay show that PMo10V2 significantly reduced the viability of Hela cells in a dose-dependent manner and exhibited stronger inhibitory activity against Hela cells at an IC50 of 800 μg/mL, which is more effective than the positive control, 5-Fu (P<0.05. The results of the UV-Vis absorption spectra and fluorescence spectra indicated the groove or outside stacking binding between PMo10V2 and ctDNA. These results show that the antitumor activity of PMo10V2 may be caused by the interactions between DNA and PMo10V2.

  11. Solution structure and DNA-binding properties of the winged helix domain of the meiotic recombination HOP2 protein.

    Science.gov (United States)

    Moktan, Hem; Guiraldelli, Michel F; Eyster, Craig A; Zhao, Weixing; Lee, Chih-Ying; Mather, Timothy; Camerini-Otero, R Daniel; Sung, Patrick; Zhou, Donghua H; Pezza, Roberto J

    2014-05-23

    The HOP2 protein is required for efficient double-strand break repair which ensures the proper synapsis of homologous chromosomes and normal meiotic progression. We previously showed that in vitro HOP2 shows two distinctive activities: when it is incorporated into a HOP2-MND1 heterodimer, it stimulates DMC1 and RAD51 recombination activities, and the purified HOP2 alone is proficient in promoting strand invasion. The structural and biochemical basis of HOP2 action in recombination are poorly understood; therefore, they are the focus of this work. Herein, we present the solution structure of the amino-terminal portion of mouse HOP2, which contains a typical winged helix DNA-binding domain. Together with NMR spectral changes in the presence of double-stranded DNA, protein docking on DNA, and mutation analysis to identify the amino acids involved in DNA coordination, our results on the three-dimensional structure of HOP2 provide key information on the fundamental structural and biochemical requirements directing the interaction of HOP2 with DNA. These results, in combination with mutational experiments showing the role of a coiled-coil structural feature involved in HOP2 self-association, allow us to explain important aspects of the function of HOP2 in recombination. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.

  12. DNA synthesis determines the binding mode of the human mitochondrial single-stranded DNA-binding protein.

    Science.gov (United States)

    Morin, José A; Cerrón, Fernando; Jarillo, Javier; Beltran-Heredia, Elena; Ciesielski, Grzegorz L; Arias-Gonzalez, J Ricardo; Kaguni, Laurie S; Cao, Francisco J; Ibarra, Borja

    2017-07-07

    Single-stranded DNA-binding proteins (SSBs) play a key role in genome maintenance, binding and organizing single-stranded DNA (ssDNA) intermediates. Multimeric SSBs, such as the human mitochondrial SSB (HmtSSB), present multiple sites to interact with ssDNA, which has been shown in vitro to enable them to bind a variable number of single-stranded nucleotides depending on the salt and protein concentration. It has long been suggested that different binding modes might be used selectively for different functions. To study this possibility, we used optical tweezers to determine and compare the structure and energetics of long, individual HmtSSB-DNA complexes assembled on preformed ssDNA and on ssDNA generated gradually during 'in situ' DNA synthesis. We show that HmtSSB binds to preformed ssDNA in two major modes, depending on salt and protein concentration. However, when protein binding was coupled to strand-displacement DNA synthesis, only one of the two binding modes was observed under all experimental conditions. Our results reveal a key role for the gradual generation of ssDNA in modulating the binding mode of a multimeric SSB protein and consequently, in generating the appropriate nucleoprotein structure for DNA synthetic reactions required for genome maintenance. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  13. Systematic functional comparative analysis of four single-stranded DNA-binding proteins and their affection on viral RNA metabolism.

    Directory of Open Access Journals (Sweden)

    Haiyan Shi

    Full Text Available The accumulation of single-stranded DNA-binding (SSB proteins is essential for organisms and has various applications. However, no study has simultaneously and systematically compared the characteristics of SSB proteins. In addition, SSB proteins may bind RNA and play an unknown biological role in RNA metabolism. Here, we expressed a novel species of SSB protein derived from Thermococcus kodakarensis KOD1 (KOD, as well as SSB proteins from Thermus thermophilus (TTH, Escherichia coli, and Sulfolobus Solfataricus P2 (SSOB, abbreviated kod, tth, bl21, and ssob, respectively. These SSB proteins could bind ssDNA and viral RNA. bl21 resisted heat treatment for more than 9 h, Ssob and kod could withstand 95°C for 10 h and retain its ssDNA- and RNA-binding ability. Four SSB proteins promoted the specificity of the DNA polymerase in PCR-based 5- and 9-kb genome fragment amplification. kod also increased the amplification of a 13-kb PCR product, and SSB protein-bound RNA resisted Benzonase digestion. The SSB proteins could also enter the host cell bound to RNA, which resulted in modulation of viral RNA metabolism, particularly ssob and bl21.

  14. Influence of Solvent Polarity and DNA-Binding on Spectral Properties of Quaternary Benzo[c]phenanthridine Alkaloids.

    Directory of Open Access Journals (Sweden)

    Michal Rájecký

    Full Text Available Quaternary benzo[c]phenanthridine alkaloids are secondary metabolites of the plant families Papaveraceae, Rutaceae, and Ranunculaceae with anti-inflammatory, antifungal, antimicrobial and anticancer activities. Their spectral changes induced by the environment could be used to understand their interaction with biomolecules as well as for analytical purposes. Spectral shifts, quantum yield and changes in lifetime are presented for the free form of alkaloids in solvents of different polarity and for alkaloids bound to DNA. Quantum yields range from 0.098 to 0.345 for the alkanolamine form and are below 0.033 for the iminium form. Rise of fluorescence lifetimes (from 2-5 ns to 3-10 ns and fluorescence intensity are observed after binding of the iminium form to the DNA for most studied alkaloids. The alkanolamine form does not bind to DNA. Acid-base equilibrium constant of macarpine is determined to be 8.2-8.3. Macarpine is found to have the highest increase of fluorescence upon DNA binding, even under unfavourable pH conditions. This is probably a result of its unique methoxy substitution at C12 a characteristic not shared with other studied alkaloids. Association constant for macarpine-DNA interaction is 700000 M(-1.

  15. Novel amidino substituted benzimidazole and benzothiazole benzo[b]thieno-2-carboxamides exert strong antiproliferative and DNA binding properties.

    Science.gov (United States)

    Cindrić, Maja; Jambon, Samy; Harej, Anja; Depauw, Sabine; David-Cordonnier, Marie-Hélène; Kraljević Pavelić, Sandra; Karminski-Zamola, Grace; Hranjec, Marijana

    2017-08-18

    Within this manuscript design, synthesis of novel 2-imidazolinyl substituted benzo[b]thieno-2-carboxamides bearing either benzimidazole or benzothiazole subunit and biological activity are presented and described. The antiproliferative activities were assessed in vitro on a panel of human cancer cell lines. Tested compounds showed moderate activity while cytotoxicity on normal fibroblasts was lower in comparison with 5-fluorouracile. The variations of 2-imidazolinyl substituent at heteroaromatic subunits in different positions led to different cytotoxic properties. The strongest selective activity against HeLa cells was observed for the benzothiazole derivative 4d with 2-imidazolinyl group at the benzo[b]thiophene subunit with a corresponding IC50 = 1.16 μM. Additionally, several biological experiments were performed to explain the mode of biological action. Fluorescence microscopy evidenced nuclear subcellular localization of compounds 3a, 4a and 4c. Additionally, detailed DNA binding studies confirmed a strong DNA groove binding for derivatives 4a and 4c while DNase I footprinting experiments evidenced sequence-selective binding of compound 4c in the A-T rich side. Furthermore, topoisomerase suppressive effect was for compounds 4a-4c. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

  16. Peroxisome proliferator-activated receptorα agonists differentially regulate inhibitor of DNA binding expression in rodents and human cells.

    Science.gov (United States)

    González, María Del Carmen; Corton, J Christopher; Acero, Nuria; Muñoz-Mingarro, Dolores; Quirós, Yolanda; Alvarez-Millán, Juan José; Herrera, Emilio; Bocos, Carlos

    2012-01-01

    Inhibitor of DNA binding (Id2) is a helix-loop-helix (HLH) transcription factor that participates in cell differentiation and proliferation. Id2 has been linked to the development of cardiovascular diseases since thiazolidinediones, antidiabetic agents and peroxisome proliferator-activated receptor (PPAR) gamma agonists, have been reported to diminish Id2 expression in human cells. We hypothesized that PPARα activators may also alter Id2 expression. Fenofibrate diminished hepatic Id2 expression in both late pregnant and unmated rats. In 24 hour fasted rats, Id2 expression was decreased under conditions known to activate PPARα. In order to determine whether the fibrate effects were mediated by PPARα, wild-type mice and PPARα-null mice were treated with Wy-14,643 (WY). WY reduced Id2 expression in wild-type mice without an effect in PPARα-null mice. In contrast, fenofibrate induced Id2 expression after 24 hours of treatment in human hepatocarcinoma cells (HepG2). MK-886, a PPARα antagonist, did not block fenofibrate-induced activation of Id2 expression, suggesting a PPARα-independent effect was involved. These findings confirm that Id2 is a gene responsive to PPARα agonists. Like other genes (apolipoprotein A-I, apolipoprotein A-V), the opposite directional transcriptional effect in rodents and a human cell line further emphasizes that PPARα agonists have different effects in rodents and humans.

  17. Phosphorylation of the leukemic oncoprotein EVI1 on serine 196 modulates DNA binding, transcriptional repression and transforming ability.

    Directory of Open Access Journals (Sweden)

    Daniel J White

    Full Text Available The EVI1 (ecotropic viral integration site 1 gene at 3q26 codes for a transcriptional regulator with an essential role in haematopoiesis. Overexpression of EVI1 in acute myeloid leukaemia (AML is frequently associated with 3q26 rearrangements and confers extremely poor prognosis. EVI1 mediates transcriptional regulation, signalling, and epigenetic modifications by interacting with DNA, proteins and protein complexes. To explore to what extent protein phosphorylation impacts on EVI1 functions, we analysed endogenous EVI1 protein from a high EVI1 expressing Fanconi anaemia (FA derived AML cell line. Mass spectrometric analysis of immunoprecipitated EVI1 revealed phosphorylation at serine 196 (S196 in the sixth zinc finger of the N-terminal zinc finger domain. Mutated EVI1 with an aspartate substitution at serine 196 (S196D, which mimics serine phosphorylation of this site, exhibited reduced DNA-binding and transcriptional repression from a gene promotor selectively targeted by the N-terminal zinc finger domain. Forced expression of the S196D mutant significantly reduced EVI1 mediated transformation of Rat1 fibroblasts. While EVI1-mediated serial replating of murine haematopoietic progenitors was maintained by EVI1-S196D, this was associated with significantly higher Evi1-trancript levels compared with WT-EVI1 or EVI1-S196A, mimicking S196 non-phosphorylated EVI1. These data suggest that EVI1 function is modulated by phosphorylation of the first zinc finger domain.

  18. SOD activity and DNA binding properties of a new symmetric porphyrin Schiff base ligand and its metal complexes.

    Science.gov (United States)

    Çay, Sevim; Köse, Muhammet; Tümer, Ferhan; Gölcü, Ayşegül; Tümer, Mehmet

    2015-12-05

    4-Methoxy-2,6-bis(hydroxymethyl)phenol (1) was prepared from the reaction of 4-methoxyphenol and formaldehyde. The compound (1) was then oxidized to the 4-methoxy-2,6-diformylphenol (2) compound. Molecular structure of compound (2) was determined by X-ray diffraction method. A new symmetric porphyrin Schiff base ligand 4-methoxy-2,6-bis[5-(4-iminophenyl)-10,15,20-triphenylporphyrin]phenol (L) was prepared from the reaction of the 5-(4-aminophenyl)-10,15,20-triphenylporphyrin (TTP-NH2) and the compound (2) in the toluene solution. The metal complexes (Cu(II), Fe(III), Mn(III), Pt(II) and Zn(II)) of the ligand (L) were synthesized and characterized by the spectroscopic and analytical methods. The DNA (fish sperm FSdsDNA) binding studies of the ligand and its complexes were performed using UV-vis spectroscopy. Additionally, superoxide dismutase activities of the porphyrin Schiff base metal complexes were investigated. Additionally, electrochemical, photoluminescence and thermal properties of the compounds were investigated. Copyright © 2015 Elsevier B.V. All rights reserved.

  19. The DNA-Binding Domain of S. pombe Mrc1 (Claspin Acts to Enhance Stalling at Replication Barriers.

    Directory of Open Access Journals (Sweden)

    Juergen Zech

    Full Text Available During S-phase replication forks can stall at specific genetic loci. At some loci, the stalling events depend on the replisome components Schizosaccharomyces pombe Swi1 (Saccharomyces cerevisiae Tof1 and Swi3 (S. cerevisiae Csm3 as well as factors that bind DNA in a site-specific manner. Using a new genetic screen we identified Mrc1 (S. cerevisiae Mrc1/metazoan Claspin as a replisome component involved in replication stalling. Mrc1 is known to form a sub-complex with Swi1 and Swi3 within the replisome and is required for the intra-S phase checkpoint activation. This discovery is surprising as several studies show that S. cerevisiae Mrc1 is not required for replication barrier activity. In contrast, we show that deletion of S. pombe mrc1 leads to an approximately three-fold reduction in barrier activity at several barriers and that Mrc1's role in replication fork stalling is independent of its role in checkpoint activation. Instead, S. pombe Mrc1 mediated fork stalling requires the presence of a functional copy of its phylogenetically conserved DNA binding domain. Interestingly, this domain is on the sequence level absent from S. cerevisiae Mrc1. Our study indicates that direct interactions between the eukaryotic replisome and the DNA are important for site-specific replication stalling.

  20. DNA binding by PHF1 prolongs PRC2 residence time on chromatin and thereby promotes H3K27 methylation.

    Science.gov (United States)

    Choi, Jeongyoon; Bachmann, Andreas Linus; Tauscher, Katharina; Benda, Christian; Fierz, Beat; Müller, Jürg

    2017-12-01

    Polycomb repressive complex 2 (PRC2) trimethylates histone H3 at lysine 27 to mark genes for repression. We measured the dynamics of PRC2 binding on recombinant chromatin and free DNA at the single-molecule level using total internal reflection fluorescence (TIRF) microscopy. PRC2 preferentially binds free DNA with multisecond residence time and midnanomolar affinity. PHF1, a PRC2 accessory protein of the Polycomblike family, extends PRC2 residence time on DNA and chromatin. Crystallographic and functional studies reveal that Polycomblike proteins contain a winged-helix domain that binds DNA in a sequence-nonspecific fashion. DNA binding by this winged-helix domain accounts for the prolonged residence time of PHF1-PRC2 on chromatin and makes it a more efficient H3K27 methyltranferase than PRC2 alone. Together, these studies establish that interactions with DNA provide the predominant binding affinity of PRC2 for chromatin. Moreover, they reveal the molecular basis for how Polycomblike proteins stabilize PRC2 on chromatin and stimulate its activity.

  1. Physical organization of DNA by multiple non-specific DNA-binding modes of integration host factor (IHF.

    Directory of Open Access Journals (Sweden)

    Jie Lin

    Full Text Available The integration host factor (IHF is an abundant nucleoid-associated protein and an essential co-factor for phage λ site-specific recombination and gene regulation in E. coli. Introduction of a sharp DNA kink at specific cognate sites is critical for these functions. Interestingly, the intracellular concentration of IHF is much higher than the concentration needed for site-specific interactions, suggesting that non-specific binding of IHF to DNA plays a role in the physical organization of bacterial chromatin. However, it is unclear how non-specific DNA association contributes to DNA organization. By using a combination of single DNA manipulation and atomic force microscopy imaging methods, we show here that distinct modes of non-specific DNA binding of IHF result in complex global DNA conformations. Changes in KCl and IHF concentrations, as well as tension applied to DNA, dramatically influence the degree of DNA-bending. In addition, IHF can crosslink DNA into a highly compact DNA meshwork that is observed in the presence of magnesium at low concentration of monovalent ions and high IHF-DNA stoichiometries. Our findings provide important insights into how IHF contributes to bacterial chromatin organization, gene regulation, and biofilm formation.

  2. Folding thermodynamics of c-Myb DNA-binding domain in correlation with its α-helical contents.

    Science.gov (United States)

    Inaba, Satomi; Fukada, Harumi; Oda, Masayuki

    2016-01-01

    The conformational and thermal stabilities of the minimum functional unit for c-Myb DNA-binding domain, tandem repeat 2 and 3 (R2R3), were analyzed under different pH conditions, ranging from 4.0 to 7.5, using circular dichroism and differential scanning calorimetry. Secondary structure analysis showed that the solution pH largely affects the conformational stability of the protein domain. Of all conditions analyzed, the α-helical content was maximal at pH 6.5, and the thermal stability was highest at pH 5.0. Thermodynamic parameters for thermal unfolding of R2R3 were determined using differential scanning calorimetry, and the origin of folding thermodynamics at the different pHs and its correlation with the α-helical content were further analyzed. It should be noted that the α-helical content correlates well with the enthalpy change in the pH range from 4.5 to 7.5, suggesting that the strength of hydrogen bonds and salt bridges needed for maintenance of helical structure is related to enthalpy in the native state. Under physiological pH conditions, c-Myb R2R3 exists in the enthalpically unstable but entropically stable state. Due to loss of rigid structure and high stability, the protein can now obtain structural flexibility, befitting its function. Copyright © 2015 Elsevier B.V. All rights reserved.

  3. The IRE1/bZIP60 pathway and Bax inhibitor 1 suppress systemic accumulation of potyviruses and potexviruses in Arabidopsis and Nicotiana benthamiana plants

    Science.gov (United States)

    The inositol requiring enzyme (IRE1) is an endoplasmic reticulum (ER) stress sensor and when activated it splices the bZIP60 mRNA producing a truncated transcription factor that upregulates expression of genes involved in the unfolded protein response (UPR). Bax inhibitor 1 (BI-1) is another ER stre...

  4. Characterization of pollen-expressed bZIP protein interactions and the role of ATbZIP18 in the male gametophyte

    Czech Academy of Sciences Publication Activity Database

    Gibalová, A.; Steinbachová, L.; Hafidh, S.; Bláhová, Veronika; Gadiou, Z.; Michailidis, Ch.; Müller, K.; Pleskot, Roman; Dupľáková, N.; Honys, D.

    2017-01-01

    Roč. 30, č. 1 (2017), s. 1-17 ISSN 2194-7953 Institutional support: RVO:67985823 ; RVO:61388963 Keywords : bZIP * transcription factors * regulatory network * male gametophyte * Y2H * pollen development Subject RIV: ED - Physiology Impact factor: 2.629, year: 2016

  5. Sequence based prediction of DNA-binding proteins based on hybrid feature selection using random forest and Gaussian naïve Bayes.

    Directory of Open Access Journals (Sweden)

    Wangchao Lou

    Full Text Available Developing an efficient method for determination of the DNA-binding proteins, due to their vital roles in gene regulation, is becoming highly desired since it would be invaluable to advance our understanding of protein functions. In this study, we proposed a new method for the prediction of the DNA-binding proteins, by performing the feature rank using random forest and the wrapper-based feature selection using forward best-first search strategy. The features comprise information from primary sequence, predicted secondary structure, predicted relative solvent accessibility, and position specific scoring matrix. The proposed method, called DBPPred, used Gaussian naïve Bayes as the underlying classifier since it outperformed five other classifiers, including decision tree, logistic regression, k-nearest neighbor, support vector machine with polynomial kernel, and support vector machine with radial basis function. As a result, the proposed DBPPred yields the highest average accuracy of 0.791 and average MCC of 0.583 according to the five-fold cross validation with ten runs on the training benchmark dataset PDB594. Subsequently, blind tests on the independent dataset PDB186 by the proposed model trained on the entire PDB594 dataset and by other five existing methods (including iDNA-Prot, DNA-Prot, DNAbinder, DNABIND and DBD-Threader were performed, resulting in that the proposed DBPPred yielded the highest accuracy of 0.769, MCC of 0.538, and AUC of 0.790. The independent tests performed by the proposed DBPPred on completely a large non-DNA binding protein dataset and two RNA binding protein datasets also showed improved or comparable quality when compared with the relevant prediction methods. Moreover, we observed that majority of the selected features by the proposed method are statistically significantly different between the mean feature values of the DNA-binding and the non DNA-binding proteins. All of the experimental results indicate that

  6. Predicting and analyzing DNA-binding domains using a systematic approach to identifying a set of informative physicochemical and biochemical properties

    Science.gov (United States)

    2011-01-01

    Background Existing methods of predicting DNA-binding proteins used valuable features of physicochemical properties to design support vector machine (SVM) based classifiers. Generally, selection of physicochemical properties and determination of their corresponding feature vectors rely mainly on known properties of binding mechanism and experience of designers. However, there exists a troublesome problem for designers that some different physicochemical properties have similar vectors of representing 20 amino acids and some closely related physicochemical properties have dissimilar vectors. Results This study proposes a systematic approach (named Auto-IDPCPs) to automatically identify a set of physicochemical and biochemical properties in the AAindex database to design SVM-based classifiers for predicting and analyzing DNA-binding domains/proteins. Auto-IDPCPs consists of 1) clustering 531 amino acid indices in AAindex into 20 clusters using a fuzzy c-means algorithm, 2) utilizing an efficient genetic algorithm based optimization method IBCGA to select an informative feature set of size m to represent sequences, and 3) analyzing the selected features to identify related physicochemical properties which may affect the binding mechanism of DNA-binding domains/proteins. The proposed Auto-IDPCPs identified m=22 features of properties belonging to five clusters for predicting DNA-binding domains with a five-fold cross-validation accuracy of 87.12%, which is promising compared with the accuracy of 86.62% of the existing method PSSM-400. For predicting DNA-binding sequences, the accuracy of 75.50% was obtained using m=28 features, where PSSM-400 has an accuracy of 74.22%. Auto-IDPCPs and PSSM-400 have accuracies of 80.73% and 82.81%, respectively, applied to an independent test data set of DNA-binding domains. Some typical physicochemical properties discovered are hydrophobicity, secondary structure, charge, solvent accessibility, polarity, flexibility, normalized Van Der

  7. The Arabidopsis bZIP11 transcription factor links low-energy signalling to auxin-mediated control of primary root growth.

    Science.gov (United States)

    Weiste, Christoph; Pedrotti, Lorenzo; Selvanayagam, Jebasingh; Muralidhara, Prathibha; Fröschel, Christian; Novák, Ondřej; Ljung, Karin; Hanson, Johannes; Dröge-Laser, Wolfgang

    2017-02-01

    Plants have to tightly control their energy homeostasis to ensure survival and fitness under constantly changing environmental conditions. Thus, it is stringently required that energy-consuming stress-adaptation and growth-related processes are dynamically tuned according to the prevailing energy availability. The evolutionary conserved SUCROSE NON-FERMENTING1 RELATED KINASES1 (SnRK1) and the downstream group C/S1 basic leucine zipper (bZIP) transcription factors (TFs) are well-characterised central players in plants' low-energy management. Nevertheless, mechanistic insights into plant growth control under energy deprived conditions remains largely elusive. In this work, we disclose the novel function of the low-energy activated group S1 bZIP11-related TFs as regulators of auxin-mediated primary root growth. Whereas transgenic gain-of-function approaches of these bZIPs interfere with the activity of the root apical meristem and result in root growth repression, root growth of loss-of-function plants show a pronounced insensitivity to low-energy conditions. Based on ensuing molecular and biochemical analyses, we propose a mechanistic model, in which bZIP11-related TFs gain control over the root meristem by directly activating IAA3/SHY2 transcription. IAA3/SHY2 is a pivotal negative regulator of root growth, which has been demonstrated to efficiently repress transcription of major auxin transport facilitators of the PIN-FORMED (PIN) gene family, thereby restricting polar auxin transport to the root tip and in consequence auxin-driven primary root growth. Taken together, our results disclose the central low-energy activated SnRK1-C/S1-bZIP signalling module as gateway to integrate information on the plant's energy status into root meristem control, thereby balancing plant growth and cellular energy resources.

  8. The Arabidopsis bZIP11 transcription factor links low-energy signalling to auxin-mediated control of primary root growth

    Science.gov (United States)

    Weiste, Christoph; Pedrotti, Lorenzo; Muralidhara, Prathibha; Ljung, Karin; Dröge-Laser, Wolfgang

    2017-01-01

    Plants have to tightly control their energy homeostasis to ensure survival and fitness under constantly changing environmental conditions. Thus, it is stringently required that energy-consuming stress-adaptation and growth-related processes are dynamically tuned according to the prevailing energy availability. The evolutionary conserved SUCROSE NON-FERMENTING1 RELATED KINASES1 (SnRK1) and the downstream group C/S1 basic leucine zipper (bZIP) transcription factors (TFs) are well-characterised central players in plants’ low-energy management. Nevertheless, mechanistic insights into plant growth control under energy deprived conditions remains largely elusive. In this work, we disclose the novel function of the low-energy activated group S1 bZIP11-related TFs as regulators of auxin-mediated primary root growth. Whereas transgenic gain-of-function approaches of these bZIPs interfere with the activity of the root apical meristem and result in root growth repression, root growth of loss-of-function plants show a pronounced insensitivity to low-energy conditions. Based on ensuing molecular and biochemical analyses, we propose a mechanistic model, in which bZIP11-related TFs gain control over the root meristem by directly activating IAA3/SHY2 transcription. IAA3/SHY2 is a pivotal negative regulator of root growth, which has been demonstrated to efficiently repress transcription of major auxin transport facilitators of the PIN-FORMED (PIN) gene family, thereby restricting polar auxin transport to the root tip and in consequence auxin-driven primary root growth. Taken together, our results disclose the central low-energy activated SnRK1-C/S1-bZIP signalling module as gateway to integrate information on the plant’s energy status into root meristem control, thereby balancing plant growth and cellular energy resources. PMID:28158182

  9. Synthesis, in vitro antitumor evaluation and DNA-binding study of novel tetrahydroquinolines and some derived tricyclic and tetracyclic ring systems.

    Science.gov (United States)

    Faidallah, Hassan M; Rostom, Sherif A F

    2013-05-01

    The synthesis of some new tetrahydroquinolines, tetrahydropyrimido[4,5-b]quinolines, and tetrahydropentaazacyclopenta[a]anthracenes structurally related to some DNA intercalators is described. Fifteen compounds were evaluated for their antitumor activity by the National Cancer Institute (NCI), in vitro disease oriented antitumor screening. The most active tricyclic pyrimido[4,5-b]quinolines 3b, 6b, 7b and 8b were further subjected to DNA-binding investigation in an attempt to rationalize their activity. Compound 8b proved to be the most active member in this study as evidenced from its remarkable growth inhibitory potential against some individual cell lines, and its broad spectrum of antitumor activity (GI50, TGI and LC50 values 46.9, 85.3 and 97.4, respectively), together with a good DNA-binding affinity. Copyright © 2013 Elsevier Masson SAS. All rights reserved.

  10. The Regulatory T Cell Lineage Factor Foxp3 Regulates Gene Expression through Several Distinct Mechanisms Mostly Independent of Direct DNA Binding.

    Directory of Open Access Journals (Sweden)

    Xin Xie

    2015-06-01

    Full Text Available The lineage factor Foxp3 is essential for the development and maintenance of regulatory T cells, but little is known about the mechanisms involved. Here, we demonstrate that an N-terminal proline-rich interaction region is crucial for Foxp3's function. Subdomains within this key region link Foxp3 to several independent mechanisms of transcriptional regulation. Our study suggests that Foxp3, even in the absence of its DNA-binding forkhead domain, acts as a bridge between DNA-binding interaction partners and proteins with effector function permitting it to regulate a large number of genes. We show that, in one such mechanism, Foxp3 recruits class I histone deacetylases to the promoters of target genes, counteracting activation-induced histone acetylation and thereby suppressing their expression.

  11. Toxin inhibition in C. crescentus VapBC1 is mediated by a flexible pseudo-palindromic protein motif and modulated by DNA binding

    DEFF Research Database (Denmark)

    Bendtsen, Kirstine L; Xu, Kehan; Luckmann, Majbritt

    2017-01-01

    interaction with the antitoxin. Here, we determine crystal structures of the complete 90 kDa heterooctameric VapBC1 complex from Caulobacter crescentus CB15 both in isolation and bound to its cognate DNA operator sequence at 1.6 and 2.7 Å resolution, respectively. DNA binding is associated with a dramatic......Expression of bacterial type II toxin-antitoxin (TA) systems is regulated at the transcriptional level through direct binding of the antitoxin to pseudo-palindromic sequences on operator DNA. In this context, the toxin functions as a co-repressor by stimulating DNA binding through direct...... for binding and inactivation of the VapC1 toxin dimer. Sequence analysis of 4127 orthologous VapB sequences reveals that such palindromic protein sequences are widespread and unique to bacterial and archaeal VapB antitoxins suggesting a general principle governing regulation of VapBC TA systems. Finally...

  12. Bacillus subtilis single-stranded DNA-binding protein SsbA is phosphorylated at threonine 38 by the serine/threonine kinase YabT

    DEFF Research Database (Denmark)

    Derouiche, Abderahmane; Petranovic, Dina; Macek, Boris

    2016-01-01

    Background and purpose: Single-stranded DNA-binding proteins participate in all stages of DNA metabolism that involve single-stranded DNA, from replication, recombination, repair of DNA damage, to natural competence in species such as Bacillus subtilis. B. subtilis single-stranded DNA...... phosphorylation of SsbA purified from B. subtilis cells. The detected phosphorylation site was assessed for its influence on DNA-binding in vitro, using electrophoretic mobility shift assays. The ability of B. subtilis serine/threonine kinases to phosphorylate SsbA was assessed using in vitro phosphorylation...... assays.Results: In addition to the known tyrosine phosphorylation of SsbA on tyrosine 82, we identified a new phosphorylation site: threonine 38. The in vitro assays demonstrated that SsbA is preferentially phosphorylated by the B. subtilis Hanks-type kinase YabT, and phosphorylation of threonine 38...

  13. iDNA-Prot|dis: identifying DNA-binding proteins by incorporating amino acid distance-pairs and reduced alphabet profile into the general pseudo amino acid composition.

    Science.gov (United States)

    Liu, Bin; Xu, Jinghao; Lan, Xun; Xu, Ruifeng; Zhou, Jiyun; Wang, Xiaolong; Chou, Kuo-Chen

    2014-01-01

    Playing crucial roles in various cellular processes, such as recognition of specific nucleotide sequences, regulation of transcription, and regulation of gene expression, DNA-binding proteins are essential ingredients for both eukaryotic and prokaryotic proteomes. With the avalanche of protein sequences generated in the postgenomic age, it is a critical challenge to develop automated methods for accurate and rapidly identifying DNA-binding proteins based on their sequence information alone. Here, a novel predictor, called "iDNA-Prot|dis", was established by incorporating the amino acid distance-pair coupling information and the amino acid reduced alphabet profile into the general pseudo amino acid composition (PseAAC) vector. The former can capture the characteristics of DNA-binding proteins so as to enhance its prediction quality, while the latter can reduce the dimension of PseAAC vector so as to speed up its prediction process. It was observed by the rigorous jackknife and independent dataset tests that the new predictor outperformed the existing predictors for the same purpose. As a user-friendly web-server, iDNA-Prot|dis is accessible to the public at http://bioinformatics.hitsz.edu.cn/iDNA-Prot_dis/. Moreover, for the convenience of the vast majority of experimental scientists, a step-by-step protocol guide is provided on how to use the web-server to get their desired results without the need to follow the complicated mathematic equations that are presented in this paper just for the integrity of its developing process. It is anticipated that the iDNA-Prot|dis predictor may become a useful high throughput tool for large-scale analysis of DNA-binding proteins, or at the very least, play a complementary role to the existing predictors in this regard.

  14. Androgen Insensitivity Syndrome in a Family of Warmblood Horses Caused by a 25-bp Deletion of the DNA-Binding Domain of the Androgen Receptor Gene

    DEFF Research Database (Denmark)

    Eastman Welsford, G.; Munk, Rikke; Villagómez, Daniel A.F.

    2017-01-01

    Testicular feminization, an earlier term coined for describing a syndrome resulting from failure of masculinization of target organs by androgen secretions during embryo development, has been well documented not only in humans but also in the domestic horse. The pathology, actually referred to as...... pedigree segregating AIS, where the molecular analyses of the androgen receptor gene in the family provided evidences that a 25-bp deletion of the DNA-binding domain is causative of this equine syndrome....

  15. Effects of Temperature on the p53-DNA Binding Interactions and Their Dynamical Behavior: Comparing the Wild Type to the R248Q Mutant

    Science.gov (United States)

    Barakat, Khaled; Issack, Bilkiss B.; Stepanova, Maria; Tuszynski, Jack

    2011-01-01

    Background The protein p53 plays an active role in the regulation of cell cycle. In about half of human cancers, the protein is inactivated by mutations located primarily in its DNA-binding domain. Interestingly, a number of these mutations possess temperature-induced DNA-binding characteristics. A striking example is the mutation of Arg248 into glutamine or tryptophan. These mutants are defective for binding to DNA at 310 K although they have been shown to bind specifically to several p53 response elements at sub-physiological temperatures (298–306 K). Methodology/Principal Findings This important experimental finding motivated us to examine the effects of temperature on the structure and configuration of R248Q mutant and compare it to the wild type protein. Our aim is to determine how and where structural changes of mutant variants take place due to temperature changes. To answer these questions, we compared the mutant to the wild-type proteins from two different aspects. First, we investigated the systems at the atomistic level through their DNA-binding affinity, hydrogen bond networks and spatial distribution of water molecules. Next, we assessed changes in their long-lived conformational motions at the coarse-grained level through the collective dynamics of their side-chain and backbone atoms separately. Conclusions The experimentally observed effect of temperature on the DNA-binding properties of p53 is reproduced. Analysis of atomistic and coarse-grained data reveal that changes in binding are determined by a few key residues and provide a rationale for the mutant-loss of binding at physiological temperatures. The findings can potentially enable a rescue strategy for the mutant structure. PMID:22110706

  16. Unbiased mutagenesis of MHV68 LANA reveals a DNA-binding domain required for LANA function in vitro and in vivo.

    Directory of Open Access Journals (Sweden)

    Clinton R Paden

    2012-09-01

    Full Text Available The Latency-Associated Nuclear Antigen (LANA, encoded by ORF73, is a conserved gene among the γ2-herpesviruses (rhadinoviruses. The Kaposi's Sarcoma-Associated Herpesvirus (KSHV LANA is consistently expressed in KSHV-associated malignancies. In the case of the rodent γ2-herpesvirus, murine gammaherpesvirus 68 (MHV68, the LANA homolog (mLANA is required for efficient virus replication, reactivation from latency and immortalization of murine fetal liver-derived B cells. To gain insights into mLANA function(s, knowing that KSHV LANA binds DNA and can modulate transcription of a variety of promoters, we sought out and identified a mLANA-responsive promoter which maps to the terminal repeat (TR of MHV68. Notably, mLANA strongly repressed activity from this promoter. We extended these analyses to demonstrate direct, sequence-specific binding of recombinant mLANA to TR DNA by DNase I footprinting. To assess whether the DNA-binding and/or transcription modulating function is important in the known mLANA phenotypes, we generated an unbiased library of mLANA point mutants using error-prone PCR, and screened a large panel of mutants for repression of the mLANA-responsive promoter to identify loss of function mutants. Notably, among the mutant mLANA proteins recovered, many of the mutations are in a predicted EBNA-1-like DNA-binding domain. Consistent with this prediction, those tested displayed loss of DNA binding activity. We engineered six of these mLANA mutants into the MHV68 genome and tested the resulting mutant viruses for: (i replication fitness; (ii efficiency of latency establishment; and (iii reactivation from latency. Interestingly, each of these mLANA-mutant viruses exhibited phenotypes similar to the mLANA-null mutant virus, indicating that DNA-binding is critical for mLANA function.

  17. Effects of temperature on the p53-DNA binding interactions and their dynamical behavior: comparing the wild type to the R248Q mutant.

    Directory of Open Access Journals (Sweden)

    Khaled Barakat

    Full Text Available BACKGROUND: The protein p53 plays an active role in the regulation of cell cycle. In about half of human cancers, the protein is inactivated by mutations located primarily in its DNA-binding domain. Interestingly, a number of these mutations possess temperature-induced DNA-binding characteristics. A striking example is the mutation of Arg248 into glutamine or tryptophan. These mutants are defective for binding to DNA at 310 K although they have been shown to bind specifically to several p53 response elements at sub-physiological temperatures (298-306 K. METHODOLOGY/PRINCIPAL FINDINGS: This important experimental finding motivated us to examine the effects of temperature on the structure and configuration of R248Q mutant and compare it to the wild type protein. Our aim is to determine how and where structural changes of mutant variants take place due to temperature changes. To answer these questions, we compared the mutant to the wild-type proteins from two different aspects. First, we investigated the systems at the atomistic level through their DNA-binding affinity, hydrogen bond networks and spatial distribution of water molecules. Next, we assessed changes in their long-lived conformational motions at the coarse-grained level through the collective dynamics of their side-chain and backbone atoms separately. CONCLUSIONS: The experimentally observed effect of temperature on the DNA-binding properties of p53 is reproduced. Analysis of atomistic and coarse-grained data reveal that changes in binding are determined by a few key residues and provide a rationale for the mutant-loss of binding at physiological temperatures. The findings can potentially enable a rescue strategy for the mutant structure.

  18. Characterization of a Single-Stranded DNA-Binding-Like Protein from Nanoarchaeum equitans--A Nucleic Acid Binding Protein with Broad Substrate Specificity.

    Directory of Open Access Journals (Sweden)

    Marcin Olszewski

    Full Text Available SSB (single-stranded DNA-binding proteins play an essential role in all living cells and viruses, as they are involved in processes connected with ssDNA metabolism. There has recently been an increasing interest in SSBs, since they can be applied in molecular biology techniques and analytical methods. Nanoarchaeum equitans, the only known representative of Archaea phylum Nanoarchaeota, is a hyperthermophilic, nanosized, obligatory parasite/symbiont of Ignicoccus hospitalis.This paper reports on the ssb-like gene cloning, gene expression and characterization of a novel nucleic acid binding protein from Nanoarchaeum equitans archaeon (NeqSSB-like protein. This protein consists of 243 amino acid residues and one OB fold per monomer. It is biologically active as a monomer like as SSBs from some viruses. The NeqSSB-like protein displays a low sequence similarity to the Escherichia coli SSB, namely 10% identity and 29% similarity, and is the most similar to the Sulfolobus solfataricus SSB (14% identity and 32% similarity. The NeqSSB-like protein binds to ssDNA, although it can also bind mRNA and, surprisingly, various dsDNA forms, with no structure-dependent preferences as evidenced by gel mobility shift assays. The size of the ssDNA binding site, which was estimated using fluorescence spectroscopy, is 7 ± 1 nt. No salt-dependent binding mode transition was observed. NeqSSB-like protein probably utilizes a different model for ssDNA binding than the SSB proteins studied so far. This protein is highly thermostable; the half-life of the ssDNA binding activity is 5 min at 100 °C and melting temperature (T(m is 100.2 °C as shown by differential scanning calorimetry (DSC analysis.NeqSSB-like protein is a novel highly thermostable protein which possesses a unique broad substrate specificity and is able to bind all types of nucleic acids.

  19. Analysis of the DNA-Binding Activities of the Arabidopsis R2R3-MYB Transcription Factor Family by One-Hybrid Experiments in Yeast.

    Directory of Open Access Journals (Sweden)

    Zsolt Kelemen

    Full Text Available The control of growth and development of all living organisms is a complex and dynamic process that requires the harmonious expression of numerous genes. Gene expression is mainly controlled by the activity of sequence-specific DNA binding proteins called transcription factors (TFs. Amongst the various classes of eukaryotic TFs, the MYB superfamily is one of the largest and most diverse, and it has considerably expanded in the plant kingdom. R2R3-MYBs have been extensively studied over the last 15 years. However, DNA-binding specificity has been characterized for only a small subset of these proteins. Therefore, one of the remaining challenges is the exhaustive characterization of the DNA-binding specificity of all R2R3-MYB proteins. In this study, we have developed a library of Arabidopsis thaliana R2R3-MYB open reading frames, whose DNA-binding activities were assayed in vivo (yeast one-hybrid experiments with a pool of selected cis-regulatory elements. Altogether 1904 interactions were assayed leading to the discovery of specific patterns of interactions between the various R2R3-MYB subgroups and their DNA target sequences and to the identification of key features that govern these interactions. The present work provides a comprehensive in vivo analysis of R2R3-MYB binding activities that should help in predicting new DNA motifs and identifying new putative target genes for each member of this very large family of TFs. In a broader perspective, the generated data will help to better understand how TF interact with their target DNA sequences.

  20. Corrigendum to "Synthesis, crystal structure and electrochemical and DNA binding studies of oxygen bridged-copper(II) carboxylate" [J. Mol. Struct. 1093 (2015) 135-143

    Science.gov (United States)

    Iqbal, Muhammad; Ali, Saqib; Tahir, Muhammad Nawaz; Muhammad, Niaz; Shah, Naseer Ali; Sohail, Manzar; Pandarinathan, Vedapriya

    2017-04-01

    The authors regret to inform that Scheme 1 in the article titled 'Synthesis, crystal structure and electrochemical and DNA binding studies of oxygen bridged-copper(II) carboxylate' in vol. 1093 of the Journal of Molecular Structure is incorrect. The corrected scheme is as shown in this correction. This is purely a copy error. The error does not affect the conclusion in paper. The authors would like to apologize for any inconvenience caused.

  1. Lack of Ligand-Selective Binding of the Aryl Hydrocarbon Receptor to Putative DNA Binding Sites Regulating Expression of Bax and Paraoxonase 1 Genes

    OpenAIRE

    DeGroot, Danica E.; Hayashi, Ai; Michael S Denison

    2013-01-01

    The aryl hydrocarbon receptor (AhR) is a ligand-dependent transcription factor that mediates the biological and toxicological effects of structurally diverse chemicals through its ability to bind specific DNA recognition sites (dioxin responsive elements (DREs)), and activate transcription of adjacent genes. While the DRE has a highly conserved consensus sequence, it has been suggested that the nucleotide specificity of AhR DNA binding may be ligand-dependent. The upstream regulatory regions ...

  2. EPR spectroscopy and catalase activity of manganese-bound DNA-binding protein from nutrient starved cells.

    Science.gov (United States)

    Hayden, Joshua Allen; Hendrich, Michael P

    2010-06-01

    DNA-binding proteins from nutrient-starved cells (DPS) protect cells from oxidative stress by removing H(2)O(2) and iron. A new class of DPS-like proteins has recently been identified, with DPS-like protein from Sulfolobus solfataricus (SsDPS) being the best characterized to date. SsDPS protects cells from oxidative stress and is upregulated in response to H(2)O(2) but also in response to iron depletion. The ferroxidase active site of SsDPS is structurally similar to the active sites of manganese catalase and rat liver arginase. The present work shows that the ferroxidase center in SsDPS binds two Mn(2+) ions with K (D) = (1/K (1) K (2))(1/2) = 48(3) microM. The binding constant of the second Mn(2+) is significantly higher than that of the first, inducing dinuclear Mn(II) cluster formation for all but the lowest concentrations of added Mn(2+). In competition experiments, equimolar amounts of Fe(2+) were unable to displace the bound manganese. EPR spectroscopy of the Mn(2) (2+) cluster showed signals comparable to those of other characterized dimanganese clusters. The exchange coupling for the cluster was determined, J = -1.4(3) cm(-1) (H = -2JS (1) S (2)), and is within the range expected for a mu(1,1)-carboxylato bridge between the manganese ions. Manganese-bound SsDPS showed catalase activity at a rate 10-100 times slower than for manganese catalases. EPR spectra of SsDPS after addition of H(2)O(2) showed the appearance of an intermediate in the reaction with H(2)O(2).

  3. Mutation of androgen receptor N-terminal phosphorylation site Tyr-267 leads to inhibition of nuclear translocation and DNA binding.

    Directory of Open Access Journals (Sweden)

    Mehmet Karaca

    Full Text Available Reactivation of androgen receptor (AR may drive recurrent prostate cancer in castrate patients. Ack1 tyrosine kinase is overexpressed in prostate cancer and promotes castrate resistant xenograft tumor growth and enhances androgen target gene expression and AR recruitment to enhancers. Ack1 phosphorylates AR at Tyr-267 and possibly Tyr-363, both in the N-terminal transactivation domain. In this study, the role of these phosphorylation sites was investigated by characterizing the phosphorylation site mutants in the context of full length and truncated AR lacking the ligand-binding domain. Y267F and Y363F mutants showed decreased transactivation of reporters. Expression of wild type full length and truncated AR in LNCaP cells increased cell proliferation in androgen-depleted conditions and increased colony formation. However, the Y267F mutant of full length and truncated AR was defective in stimulating cell proliferation. The Y363F mutant was less severely affected than the Y267F mutant. The full length AR Y267F mutant was defective in nuclear translocation induced by androgen or Ack1 kinase. The truncated AR was constitutively localized to the nucleus. Chromatin immunoprecipitation analysis showed that it was recruited to the target enhancers without androgen. The truncated Y267F AR mutant did not exhibit constitutive nuclear localization and androgen enhancer binding activity. These results support the concept that phosphorylation of Tyr-267, and to a lesser extent Tyr-363, is required for AR nuclear translocation and recruitment and DNA binding and provide a rationale for development of novel approaches to inhibit AR activity.

  4. Mutation of androgen receptor N-terminal phosphorylation site Tyr-267 leads to inhibition of nuclear translocation and DNA binding.

    Science.gov (United States)

    Karaca, Mehmet; Liu, Yuanbo; Zhang, Zhentao; De Silva, Dinuka; Parker, Joel S; Earp, H Shelton; Whang, Young E

    2015-01-01

    Reactivation of androgen receptor (AR) may drive recurrent prostate cancer in castrate patients. Ack1 tyrosine kinase is overexpressed in prostate cancer and promotes castrate resistant xenograft tumor growth and enhances androgen target gene expression and AR recruitment to enhancers. Ack1 phosphorylates AR at Tyr-267 and possibly Tyr-363, both in the N-terminal transactivation domain. In this study, the role of these phosphorylation sites was investigated by characterizing the phosphorylation site mutants in the context of full length and truncated AR lacking the ligand-binding domain. Y267F and Y363F mutants showed decreased transactivation of reporters. Expression of wild type full length and truncated AR in LNCaP cells increased cell proliferation in androgen-depleted conditions and increased colony formation. However, the Y267F mutant of full length and truncated AR was defective in stimulating cell proliferation. The Y363F mutant was less severely affected than the Y267F mutant. The full length AR Y267F mutant was defective in nuclear translocation induced by androgen or Ack1 kinase. The truncated AR was constitutively localized to the nucleus. Chromatin immunoprecipitation analysis showed that it was recruited to the target enhancers without androgen. The truncated Y267F AR mutant did not exhibit constitutive nuclear localization and androgen enhancer binding activity. These results support the concept that phosphorylation of Tyr-267, and to a lesser extent Tyr-363, is required for AR nuclear translocation and recruitment and DNA binding and provide a rationale for development of novel approaches to inhibit AR activity.

  5. ZNF509S1 downregulates PUMA by inhibiting p53K382 acetylation and p53-DNA binding.

    Science.gov (United States)

    Jeon, Bu-Nam; Yoon, Jae-Hyeon; Han, Dohyun; Kim, Min-Kyeong; Kim, Youngsoo; Choi, Seo-Hyun; Song, Jiyang; Kim, Kyung-Sup; Kim, Kunhong; Hur, Man-Wook

    2017-09-01

    Expression of the POK family protein ZNF509L, and -its S1 isoform, is induced by p53 upon exposure to genotoxic stress. Due to alternative splicing of the ZNF509 primary transcript, ZNF509S1 lacks the 6 zinc-fingers and C-terminus of ZNF509L, resulting in only one zinc-finger. ZNF509L and -S1 inhibit cell proliferation by activating p21/CDKN1A and RB transcription, respectively. When cells are exposed to severe DNA damage, p53 activates PUMA (p53-upregulated modulator of apoptosis) transcription. Interestingly, apoptosis due to transcriptional activation of PUMA by p53 is attenuated by ZNF509S1. Thus we investigated the molecular mechanism(s) underlying the transcriptional attenuation and anti-apoptotic effects of ZNF509S1. We show that ZNF509S1 modulation of p53 activity is important in PUMA gene transcription by modulating post-translational modification of p53 by p300. ZNF509S1 directly interacts with p53 and inhibits p300-mediated acetylation of p53 lysine K382, with deacetylation of p53 K382 leading to decreased DNA binding at the p53 response element 1 of the PUMA promoter. ZNF509S1 may play a role not only in cell cycle arrest, by activating RB expression, but also in rescuing cells from apoptotic death by repressing PUMA expression in cells exposed to severe DNA damage. Copyright © 2017 Elsevier B.V. All rights reserved.

  6. Nucleotide fluctuation of radiation-resistant Halobacterium sp. NRC-1 single-stranded DNA-binding protein (RPA) genes

    Science.gov (United States)

    Holden, Todd; Tremberger, G., Jr.; Cheung, E.; Subramaniam, R.; Gadura, N.; Schneider, P.; Sullivan, R.; Flamholz, A.; Lieberman, D.; Cheung, T. D.

    2009-08-01

    The Single-Stranded DNA-Binding Protein (RPA) Genes in gamma ray radiation-resistant halophilic archaeon Halobacterium sp. NRC-1 were analyzed in terms of their nucleotide fluctuations. In an ATCG sequence, each base was assigned a number equal to its atomic number. The resulting numerical sequence was the basis of the statistical analysis in this study. Fractal analysis using the Higuchi method gave fractal dimensions of 2.04 and 2.06 for the gene sequences VNG2160 and VNG2162, respectively. The 16S rRNA sequence has a fractal dimension of 1.99. The di-nucleotide Shannon entropy values were found to be negatively correlated with the observed fractal dimensions (R2~ 0.992, N=3). Inclusion of Deinococcus radiodurans Rad-A in the regression analysis decreases the R2 slightly to 0.98 (N=4). A third VNG2163 RPA gene of unknown function but with upregulation activity under irradiation was found to have a fractal dimension of 2.05 and a Shannon entropy of 3.77 bits. The above results are similar to those found in bacterial Deinococcus radiodurans and suggest that their high radiation resistance property would have favored selection of CG di-nucleotide pairs. The two transcription factors TbpD (VNG7114) and TfbA (VNG 2184) were also studied. Using VNG7114, VNG2184, and VNG2163; the regression analysis of fractal dimension versus Shannon entropy shows that R2 ~ 0.997 for N =3. The VNG2163 unknown function may be related to the pathways with transcriptions closely regulated to sequences VNG7114 and VNG2184.

  7. Functional studies of ssDNA binding ability of MarR family protein TcaR from Staphylococcus epidermidis.

    Science.gov (United States)

    Chang, Yu-Ming; Chen, Cammy K-M; Chang, Yuan-Chih; Jeng, Wen-Yih; Hou, Ming-Hon; Wang, Andrew H-J

    2012-01-01

    The negative transcription regulator of the ica locus, TcaR, regulates proteins involved in the biosynthesis of poly-N-acetylglucosamine (PNAG). Absence of TcaR increases PNAG production and promotes biofilm formation in Staphylococci. Previously, the 3D structure of TcaR in its apo form and its complex structure with several antibiotics have been analyzed. However, the detailed mechanism of multiple antibiotic resistance regulator (MarR) family proteins such as TcaR is unclear and only restricted on the binding ability of double-strand DNA (dsDNA). Here we show by electrophoretic mobility shift assay (EMSA), electron microscopy (EM), circular dichroism (CD), and Biacore analysis that TcaR can interact strongly with single-stranded DNA (ssDNA), thereby identifying a new role in MarR family proteins. Moreover, we show that TcaR preferentially binds 33-mer ssDNA over double-stranded DNA and inhibits viral ssDNA replication. In contrast, such ssDNA binding properties were not observed for other MarR family protein and TetR family protein, suggesting that the results from our studies are not an artifact due to simple charge interactions between TcaR and ssDNA. Overall, these results suggest a novel role for TcaR in regulation of DNA replication. We anticipate that the results of this work will extend our understanding of MarR family protein and broaden the development of new therapeutic strategies for Staphylococci.

  8. Ternary copper(II) complexes with amino acid chains and heterocyclic bases: DNA binding, cytotoxic and cell apoptosis induction properties.

    Science.gov (United States)

    Ma, Tieliang; Xu, Jun; Wang, Yuan; Yu, Hao; Yang, Yong; Liu, Yang; Ding, Weiliang; Zhu, Wenjiao; Chen, Ruhua; Ge, Zhijun; Tan, Yongfei; Jia, Lei; Zhu, Taofeng

    2015-03-01

    Nowadays, chemotherapy is a common means of oncology. However, it is difficult to find excellent chemotherapy drugs. Here we reported three new ternary copper(II) complexes which have potential chemotherapy characteristics with reduced Schiff base ligand and heterocyclic bases (TBHP), [Cu(phen)(TBHP)]H2O (1), [Cu(dpz)(TBHP)]H2O (2) and [Cu(dppz)(TBHP)]H2O (3) (phen=1,10-phenanthroline, dpz=dipyrido [3,2:2',3'-f]quinoxaline, dppz=dipyrido [3,2-a:2',3'-c]phenazine, H2TBHP=2-(3,5-di-tert-butyl-2-hydroxybenzylamino)-2-benzyl-acetic acid). The DNA-binding properties of the complexes were investigated by spectrometric titrations, ethidium bromide displacement experiments and viscosity measurements. The results indicated that the three complexes, especially the complex 13, can strongly bind to calf-thymus DNA (CT-DNA). The intrinsic binding constants Kb of the ternary copper(II) complexes with CT-DNA were 1.37×10(5), 1.81×10(5) and 3.21×10(5) for 1, 2 and 3 respectively. Comparative cytotoxic activities of the copper(II) complexes were also determined by 3-(4,5-dimethylthiazol-2yl)-2,5-diphenyltetrazolium bromide (MTT) assay. The results showed that the ternary copper(II) complexes had significant cytotoxic activity against the human lung cancer (A549), human esophageal cancer (Eca109) and human gastric cancer (SGC7901) cell lines. Cell apoptosis were detected by AnnexinV/PI flow cytometry and by Western blotting with the protein expression of p53, Bax and Bcl-2. All the three copper complexes can effectively induce apoptosis of the three human tumor cells. Copyright © 2014 Elsevier Inc. All rights reserved.

  9. In vitro DNA binding studies of the sweetening agent saccharin and its copper(II) and zinc(II) complexes.

    Science.gov (United States)

    Icsel, Ceyda; Yilmaz, Veysel T

    2014-01-05

    The interactions of fish sperm DNA (FS-DNA) with the sodium salt of sweetener saccharin (sacH) and its copper and zinc complexes, namely [M(sac)2(H2O)4]·2H2O (M=Cu(II) or Zn(II)) were studied by using UV-Vis titration, fluorometric competition, thermal denaturation, viscosity and gel electrophoresis measurements. The intrinsic binding constants (Kb) obtained from absorption titrations were estimated to be 2.86 (±0.06)×10(4)M(-1) for Na(sac), 6.67 (±0.12)×10(4)M(-1) for Cu-sac and 4.01 (±0.08)×10(4)M(-1) for Zn-sac. The Cu-sac complex binds to FS-DNA via intercalation with a KA value of 50.12 (±0.22)×10(4)M(-1) as evidenced by competitive binding studies with ethidium bromide. Moreover, competition experiments with Hoechst 33258 are indicative of a groove binding mode of Na(sac) and Zn-sac with binding constants of 3.13 (±0.16)×10(4)M(-1) and 5.25 (±0.22)×10(4)M(-1), respectively. The spectroscopic measurements indicate a moderate DNA binding affinity of Na(sac) and its metal complexes. The suggested binding modes are further confirmed by the thermal denaturation and viscosity measurements. In addition, Cu-sac and Zn-sac show weak ability to damage to pBR322 supercoiled plasmid DNA. Copyright © 2013 Elsevier B.V. All rights reserved.

  10. Two novel copper complexes of 2,2'-bipyridine: evaluation of the DNA binding and cytotoxic activity.

    Science.gov (United States)

    Fei, Bao-Li; Li, Wen; Xu, Wu-Shuang; Li, Yang-Guang; Long, Jian-Ying; Liu, Qing-Bo; Shao, Kui-Zhan; Su, Zhong-Min; Sun, Wei-Yin

    2013-08-05

    Two novel copper-2,2'-bipyridine complexes [Cu(SAL)(2,2'-bipy)ClO4]2 (1) and [Cu(μ2-O)(2,2'-bipy)NO3]2 (2) (HSAL=salicylaldehyde) were synthesized and characterized by X-ray single-crystal diffraction, elemental analysis and IR spectra. The interactions of the complexes with salmon sperm DNA were investigated by viscosity analysis, UV, fluorescence and circular dichroism (CD) spectroscopic techniques. Absorption spectral (Kb=3.00×10(5)M(-1) (1), 3.49×10(5)M(-1)(2)), emission spectral ((Ksv) 3.33×10(4)M(-1) (1), 3.40×10(4)M(-1) (2)), and viscosity measurements reveal that 1 and 2 interact with DNA through intercalation. In fluorimetric studies, the enthalpy (ΔH>0) and entropy (ΔS>0) changes of the reactions between the Cu (II) complexes with DNA demonstrate hydrophobic interactions. In addition, CD study indicates the Cu (II) complexes cause a more B-like to a more A-like conformational change upon binding DNA. All the experimental results show that the interaction mode of the two complexes was greatly affected by the coordination environments of Cu (II) centers. Their in vitro cytotoxicity towards five selected tumor cell lines HepG-2, HeLa, NCI-H460, MCF-7 and HL-60 has been evaluated by MTT method, and 2 exhibits higher growth inhibition of the selected cell lines at concentration of 50 μM, this result is identical with their DNA binding ability order. Copyright © 2013 Elsevier B.V. All rights reserved.

  11. Interactions between the R2R3-MYB transcription factor, AtMYB61, and target DNA binding sites.

    Directory of Open Access Journals (Sweden)

    Michael B Prouse

    Full Text Available Despite the prominent roles played by R2R3-MYB transcription factors in the regulation of plant gene expression, little is known about the details of how these proteins interact with their DNA targets. For example, while Arabidopsis thaliana R2R3-MYB protein AtMYB61 is known to alter transcript abundance of a specific set of target genes, little is known about the specific DNA sequences to which AtMYB61 binds. To address this gap in knowledge, DNA sequences bound by AtMYB61 were identified using cyclic amplification and selection of targets (CASTing. The DNA targets identified using this approach corresponded to AC elements, sequences enriched in adenosine and cytosine nucleotides. The preferred target sequence that bound with the greatest affinity to AtMYB61 recombinant protein was ACCTAC, the AC-I element. Mutational analyses based on the AC-I element showed that ACC nucleotides in the AC-I element served as the core recognition motif, critical for AtMYB61 binding. Molecular modelling predicted interactions between AtMYB61 amino acid residues and corresponding nucleotides in the DNA targets. The affinity between AtMYB61 and specific target DNA sequences did not correlate with AtMYB61-driven transcriptional activation with each of the target sequences. CASTing-selected motifs were found in the regulatory regions of genes previously shown to be regulated by AtMYB61. Taken together, these findings are consistent with the hypothesis that AtMYB61 regulates transcription from specific cis-acting AC elements in vivo. The results shed light on the specifics of DNA binding by an important family of plant-specific transcriptional regulators.

  12. The mycobacterial DNA-binding protein 1 (MDP1 from Mycobacterium bovis BCG influences various growth characteristics

    Directory of Open Access Journals (Sweden)

    Maurischat Sven

    2008-06-01

    Full Text Available Abstract Background Pathogenic mycobacteria such as M. tuberculosis, M. bovis or M. leprae are characterised by their extremely slow growth rate which plays an important role in mycobacterial virulence and eradication of the bacteria. Various limiting factors influence the generation time of mycobacteria, and the mycobacterial DNA-binding protein 1 (MDP1 has also been implicated in growth regulation. Our strategy to investigate the role of MDP1 in mycobacterial growth consisted in the generation and characterisation of a M. bovis BCG derivative expressing a MDP1-antisense gene. Results The expression rate of the MDP1 protein in the recombinant M. bovis BCG containing the MDP1-antisense plasmid was reduced by about 50% compared to the reference strain M. bovis BCG containing the empty vector. In comparison to this reference strain, the recombinant M. bovis BCG grew faster in broth culture and reached higher cell masses in stationary phase. Likewise its intracellular growth in mouse and human macrophages was ameliorated. Bacterial clumping in broth culture was reduced by the antisense plasmid. The antisense plasmid increased the susceptibility of the bacteria towards Ampicillin. 2-D protein gels of bacteria maintained under oxygen-poor conditions demonstrated a reduction in the number and the intensity of many protein spots in the antisense strain compared to the reference strain. Conclusion The MDP1 protein has a major impact on various growth characteristics of M. bovis BCG. It plays an important role in virulence-related traits such as aggregate formation and intracellular multiplication. Its impact on the protein expression in a low-oxygen atmosphere indicates a role in the adaptation to the hypoxic conditions present in the granuloma.

  13. Transglutaminase-catalyzed incorporation of polyamines masks the DNA-binding region of the transcription factor Relish.

    Science.gov (United States)

    Maki, Kouki; Shibata, Toshio; Kawabata, Shun-Ichiro

    2017-04-14

    In Drosophila, the final immune deficiency (IMD) pathway-dependent signal is transmitted through proteolytic conversion of the nuclear factor-κB (NF-κB)-like transcription factor Relish to the active N-terminal fragment Relish-N. Relish-N is then translocated from the cytosol into the nucleus for the expression of IMD-controlled genes. We previously demonstrated that transglutaminase (TG) suppresses the IMD pathway by polymerizing Relish-N to inhibit its nuclear translocation. Conversely, we also demonstrated that orally ingested synthetic amines, such as monodansylcadaverine (DCA) and biotin-labeled pentylamine, are TG-dependently incorporated into Relish-N, causing the nuclear translocation of modified Relish-N in gut epithelial cells. It remains unclear, however, whether polyamine-containing Relish-N retains transcriptional activity. Here, we used mass spectrometry analysis of a recombinant Relish-N modified with DCA by TG activity after proteolytic digestion and show that the DCA-modified Gln residues are located in the DNA-binding region of Relish-N. TG-catalyzed DCA incorporation inhibited binding of Relish-N to the Rel-responsive element in the NF-κB-binding DNA sequence. Subcellular fractionation of TG-expressing Drosophila S2 cells indicated that TG was localized in both the cytosol and nucleus. Of note, natural polyamines, including spermidine and spermine, competitively inhibited TG-dependent DCA incorporation into Relish-N. Moreover, in vivo experiments demonstrated that Relish-N was modified by spermine and that this modification reduced transcription of IMD pathway-controlled cecropin A1 and diptericin genes. These findings suggest that intracellular TG regulates Relish-N-mediated transcriptional activity by incorporating polyamines into Relish-N and via protein-protein cross-linking. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  14. Functional studies of ssDNA binding ability of MarR family protein TcaR from Staphylococcus epidermidis.

    Directory of Open Access Journals (Sweden)

    Yu-Ming Chang

    Full Text Available The negative transcription regulator of the ica locus, TcaR, regulates proteins involved in the biosynthesis of poly-N-acetylglucosamine (PNAG. Absence of TcaR increases PNAG production and promotes biofilm formation in Staphylococci. Previously, the 3D structure of TcaR in its apo form and its complex structure with several antibiotics have been analyzed. However, the detailed mechanism of multiple antibiotic resistance regulator (MarR family proteins such as TcaR is unclear and only restricted on the binding ability of double-strand DNA (dsDNA. Here we show by electrophoretic mobility shift assay (EMSA, electron microscopy (EM, circular dichroism (CD, and Biacore analysis that TcaR can interact strongly with single-stranded DNA (ssDNA, thereby identifying a new role in MarR family proteins. Moreover, we show that TcaR preferentially binds 33-mer ssDNA over double-stranded DNA and inhibits viral ssDNA replication. In contrast, such ssDNA binding properties were not observed for other MarR family protein and TetR family protein, suggesting that the results from our studies are not an artifact due to simple charge interactions between TcaR and ssDNA. Overall, these results suggest a novel role for TcaR in regulation of DNA replication. We anticipate that the results of this work will extend our understanding of MarR family protein and broaden the development of new therapeutic strategies for Staphylococci.

  15. Semi-automated high-throughput fluorescent intercalator displacement-based discovery of cytotoxic DNA binding agents from a large compound library.

    Science.gov (United States)

    Glass, Lateca S; Bapat, Aditi; Kelley, Mark R; Georgiadis, Millie M; Long, Eric C

    2010-03-01

    High-throughput fluorescent intercalator displacement (HT-FID) was adapted to the semi-automated screening of a commercial compound library containing 60,000 molecules resulting in the discovery of cytotoxic DNA-targeted agents. Although commercial libraries are routinely screened in drug discovery efforts, the DNA binding potential of the compounds they contain has largely been overlooked. HT-FID led to the rapid identification of a number of compounds for which DNA binding properties were validated through demonstration of concentration-dependent DNA binding and increased thermal melting of A/T- or G/C-rich DNA sequences. Selected compounds were assayed further for cell proliferation inhibition in glioblastoma cells. Seven distinct compounds emerged from this screening procedure that represent structures unknown previously to be capable of targeting DNA leading to cell death. These agents may represent structures worthy of further modification to optimally explore their potential as cytotoxic anti-cancer agents. In addition, the general screening strategy described may find broader impact toward the rapid discovery of DNA targeted agents with biological activity. Copyright 2010 Elsevier Ltd. All rights reserved.

  16. The DNA binding property of PML/RARA but not the integrity of PML nuclear bodies is indispensable for leukemic transformation.

    Directory of Open Access Journals (Sweden)

    Xi Liu

    Full Text Available PML/RARA is the oncoprotein driving acute promyelocytic leukemia (APL. It suppresses genes expression by recruitment of a number of transcriptional repressors, resulting in differentiation block and malignant transformation of hematopoietic cells. Here, we found that mice primary hematopoietic progenitor cells (HPCs, transduced by DNA-binding-defective PML/RARA mutants, were deficient in colony formation. Further experiments showed that DNA-binding-defective PML/RARA mutants could not repress the transcription of retinoic acid regulated genes. Intriguingly, there were no significant differences of the micro-speckled intracellular distribution between the mutants and wild-type PML/RARA. Some retinoic acid target genes regulated by PML/RARA are involved in not only differentiation block but also hematopoietic cell self-renewal. Altogether, our data demonstrate that direct DNA-binding is essential for PML/RARA to immortalize hematopoietic cells, while disruption of PML-nuclear body does not seem to be a prerequisite for hematopoietic cell transformation.

  17. DNA and protein footprinting analysis of the modulation of DNA binding by the N-terminal domain of the Saccharomyces cerevisiae TATA binding protein.

    Science.gov (United States)

    Gupta, Sayan; Cheng, Huiyong; Mollah, A K M M; Jamison, Elizabeth; Morris, Stephanie; Chance, Mark R; Khrapunov, Sergei; Brenowitz, Michael

    2007-09-04

    Recombinant full-length Saccharomyces cerevisiae TATA binding protein (TBP) and its isolated C-terminal conserved core domain (TBPc) were prepared with measured high specific DNA-binding activities. Direct, quantitative comparison of TATA box binding by TBP and TBPc reveals greater affinity by TBPc for either of two high-affinity sequences at several different experimental conditions. TBPc associates more rapidly than TBP to TATA box bearing DNA and dissociates more slowly. The structural origins of the thermodynamic and kinetic effects of the N-terminal domain on DNA binding by TBP were explored in comparative studies of TBPc and TBP by "protein footprinting" with hydroxyl radical (*OH) side chain oxidation. Some residues within TBPc and the C-terminal domain of TBP are comparably protected by DNA, consistent with solvent accessibility changes calculated from core domain crystal structures. In contrast, the reactivity of some residues located on the top surface and the DNA-binding saddle of the C-terminal domain differs between TBP and TBPc in both the presence and absence of bound DNA; these results are not predicted from the crystal structures. A strikingly different pattern of side chain oxidation is observed for TBP when a nonionic detergent is present. Taken together, these results are consistent with the N-terminal domain actively modulating TATA box binding by TBP and nonionic detergent modulating the interdomain interaction.

  18. DNA and Protein Footprinting Analysis of the Modulation of DNA Binding by the N-Terminal Domain of the Saccharomyces cervisiae TATA Binding Protein

    Energy Technology Data Exchange (ETDEWEB)

    Gupta,S.; Cheng, H.; Mollah, A.; Jamison, E.; Morris, S.; Chance, M.; Khrapunov, S.; Brenowitz, M.

    2007-01-01

    Recombinant full-length Saccharomyces cerevisiae TATA binding protein (TBP) and its isolated C-terminal conserved core domain (TBPc) were prepared with measured high specific DNA-binding activities. Direct, quantitative comparison of TATA box binding by TBP and TBPc reveals greater affinity by TBPc for either of two high-affinity sequences at several different experimental conditions. TBPc associates more rapidly than TBP to TATA box bearing DNA and dissociates more slowly. The structural origins of the thermodynamic and kinetic effects of the N-terminal domain on DNA binding by TBP were explored in comparative studies of TBPc and TBP by 'protein footprinting' with hydroxyl radical ({center_dot}OH) side chain oxidation. Some residues within TBPc and the C-terminal domain of TBP are comparably protected by DNA, consistent with solvent accessibility changes calculated from core domain crystal structures. In contrast, the reactivity of some residues located on the top surface and the DNA-binding saddle of the C-terminal domain differs between TBP and TBPc in both the presence and absence of bound DNA; these results are not predicted from the crystal structures. A strikingly different pattern of side chain oxidation is observed for TBP when a nonionic detergent is present. Taken together, these results are consistent with the N-terminal domain actively modulating TATA box binding by TBP and nonionic detergent modulating the interdomain interaction.

  19. ALOG domains: provenance of plant homeotic and developmental regulators from the DNA-binding domain of a novel class of DIRS1-type retroposons

    Directory of Open Access Journals (Sweden)

    Iyer Lakshminarayan M

    2012-11-01

    Full Text Available Abstract Members of the Arabidopsis LSH1 and Oryza G1 (ALOG family of proteins have been shown to function as key developmental regulators in land plants. However, their precise mode of action remains unclear. Using sensitive sequence and structure analysis, we show that the ALOG domains are a distinct version of the N-terminal DNA-binding domain shared by the XerC/D-like, protelomerase, topoisomerase-IA, and Flp tyrosine recombinases. ALOG domains are distinguished by the insertion of an additional zinc ribbon into this DNA-binding domain. In particular, we show that the ALOG domain is derived from the XerC/D-like recombinases of a novel class of DIRS-1-like retroposons. Copies of this element, which have been recently inactivated, are present in several marine metazoan lineages, whereas the stramenopile Ectocarpus, retains an active copy of the same. Thus, we predict that ALOG domains help establish organ identity and differentiation by binding specific DNA sequences and acting as transcription factors or recruiters of repressive chromatin. They are also found in certain plant defense proteins, where they are predicted to function as DNA sensors. The evolutionary history of the ALOG domain represents a unique instance of a domain, otherwise exclusively found in retroelements, being recruited as a specific transcription factor in the streptophyte lineage of plants. Hence, they add to the growing evidence for derivation of DNA-binding domains of eukaryotic specific TFs from mobile and selfish elements.

  20. Eco-sustainable synthesis and biological evaluation of 2-phenyl 1,3-benzodioxole derivatives as anticancer, DNA binding and antibacterial agents

    Directory of Open Access Journals (Sweden)

    Sayan Dutta Gupta

    2016-11-01

    Full Text Available The current research and development scenario in medicinal chemistry demands small molecules synthesized in a simple, fast and effective way with enhanced activity and fewer side effects than the existing ones. Therefore, one-pot, microwave assisted green and efficient synthesis of a series of derivatives belonging to 2-phenyl 1,3-benzodioxole (1a–14a and 2-phenyl 1,3-benzodioxole-4-ol (1b–14b class were carried out and subsequently investigated for their anticancer, antibacterial and DNA binding potential. Compound 3c proved to be the most active one among the screened derivatives possessing anticancer and antibacterial potency greater than the standard reference compound (cisplatin and cinoxacin for anticancer and antibacterial activity, respectively. The most active compound in terms of DNA binding capacity was found to be 5b. A rewarding feature of the work is a facile, convenient, eco friendly one step synthesis of compounds demonstrating attenuated activity against cancer and bacterial cell with an inherent potential of binding to DNA. Subsequently, a hit molecule for further anticancer, antibacterial (compound 3c and DNA binding studies (compound 5b was also identified.

  1. Mutation-Induced Population Shift in the MexR Conformational Ensemble Disengages DNA Binding: A Novel Mechanism for MarR Family Derepression.

    Science.gov (United States)

    Anandapadamanaban, Madhanagopal; Pilstål, Robert; Andresen, Cecilia; Trewhella, Jill; Moche, Martin; Wallner, Björn; Sunnerhagen, Maria

    2016-08-02

    MexR is a repressor of the MexAB-OprM multidrug efflux pump operon of Pseudomonas aeruginosa, where DNA-binding impairing mutations lead to multidrug resistance (MDR). Surprisingly, the crystal structure of an MDR-conferring MexR mutant R21W (2.19 Å) presented here is closely similar to wild-type MexR. However, our extended analysis, by molecular dynamics and small-angle X-ray scattering, reveals that the mutation stabilizes a ground state that is deficient of DNA binding and is shared by both mutant and wild-type MexR, whereas the DNA-binding state is only transiently reached by the more flexible wild-type MexR. This population shift in the conformational ensemble is effected by mutation-induced allosteric coupling of contact networks that are independent in the wild-type protein. We propose that the MexR-R21W mutant mimics derepression by small-molecule binding to MarR proteins, and that the described allosteric model based on population shifts may also apply to other MarR family members. Copyright © 2016 Elsevier Ltd. All rights reserved.

  2. Relaxase DNA Binding and Cleavage Are Two Distinguishable Steps in Conjugative DNA Processing That Involve Different Sequence Elements of the nic Site*

    Science.gov (United States)

    Lucas, María; González-Pérez, Blanca; Cabezas, Matilde; Moncalian, Gabriel; Rivas, Germán; de la Cruz, Fernando

    2010-01-01

    TrwC, the relaxase of plasmid R388, catalyzes a series of concerted DNA cleavage and strand transfer reactions on a specific site (nic) of its origin of transfer (oriT). nic contains the cleavage site and an adjacent inverted repeat (IR2). Mutation analysis in the nic region indicated that recognition of the IR2 proximal arm and the nucleotides located between IR2 and the cleavage site were essential for supercoiled DNA processing, as judged either by in vitro nic cleavage or by mobilization of a plasmid containing oriT. Formation of the IR2 cruciform and recognition of the distal IR2 arm and loop were not necessary for these reactions to take place. On the other hand, IR2 was not involved in TrwC single-stranded DNA processing in vitro. For single-stranded DNA nic cleavage, TrwC recognized a sequence embracing six nucleotides upstream of the cleavage site and two nucleotides downstream. This suggests that TrwC DNA binding and cleavage are two distinguishable steps in conjugative DNA processing and that different sequence elements are recognized by TrwC in each step. IR2-proximal arm recognition was crucial for the initial supercoiled DNA binding. Subsequent recognition of the adjacent single-stranded DNA binding site was required to position the cleavage site in the active center of the protein so that the nic cleavage reaction could take place. PMID:20061574

  3. Relaxase DNA binding and cleavage are two distinguishable steps in conjugative DNA processing that involve different sequence elements of the nic site.

    Science.gov (United States)

    Lucas, María; González-Pérez, Blanca; Cabezas, Matilde; Moncalian, Gabriel; Rivas, Germán; de la Cruz, Fernando

    2010-03-19

    TrwC, the relaxase of plasmid R388, catalyzes a series of concerted DNA cleavage and strand transfer reactions on a specific site (nic) of its origin of transfer (oriT). nic contains the cleavage site and an adjacent inverted repeat (IR(2)). Mutation analysis in the nic region indicated that recognition of the IR(2) proximal arm and the nucleotides located between IR(2) and the cleavage site were essential for supercoiled DNA processing, as judged either by in vitro nic cleavage or by mobilization of a plasmid containing oriT. Formation of the IR(2) cruciform and recognition of the distal IR(2) arm and loop were not necessary for these reactions to take place. On the other hand, IR(2) was not involved in TrwC single-stranded DNA processing in vitro. For single-stranded DNA nic cleavage, TrwC recognized a sequence embracing six nucleotides upstream of the cleavage site and two nucleotides downstream. This suggests that TrwC DNA binding and cleavage are two distinguishable steps in conjugative DNA processing and that different sequence elements are recognized by TrwC in each step. IR(2)-proximal arm recognition was crucial for the initial supercoiled DNA binding. Subsequent recognition of the adjacent single-stranded DNA binding site was required to position the cleavage site in the active center of the protein so that the nic cleavage reaction could take place.

  4. Genome-wide mapping indicates that p73 and p63 co-occupy target sites and have similar dna-binding profiles in vivo.

    Directory of Open Access Journals (Sweden)

    Annie Yang

    2010-07-01

    Full Text Available The p53 homologs, p63 and p73, share approximately 85% amino acid identity in their DNA-binding domains, but they have distinct biological functions.Using chromatin immunoprecipitation and high-resolution tiling arrays covering the human genome, we identify p73 DNA binding sites on a genome-wide level in ME180 human cervical carcinoma cells. Strikingly, the p73 binding profile is indistinguishable from the previously described binding profile for p63 in the same cells. Moreover, the p73:p63 binding ratio is similar at all genomic loci tested, suggesting that there are few, if any, targets that are specific for one of these factors. As assayed by sequential chromatin immunoprecipitation, p63 and p73 co-occupy DNA target sites in vivo, suggesting that p63 and p73 bind primarily as heterotetrameric complexes in ME180 cells.The observation that p63 and p73 associate with the same genomic targets suggest that their distinct biological functions are due to cell-type specific expression and/or protein domains that involve functions other than DNA binding.

  5. The Fungal bZIP Transcription Factor AtfB Controls Virulence-Associated Processes in Aspergillus parasiticus

    Directory of Open Access Journals (Sweden)

    Josephine Wee

    2017-09-01

    Full Text Available Fungal basic leucine zipper (bZIP transcription factors mediate responses to oxidative stress. The ability to regulate stress response pathways in Aspergillus spp. was postulated to be an important virulence-associated cellular process, because it helps establish infection in humans, plants, and animals. Previous studies have demonstrated that the fungal transcription factor AtfB encodes a protein that is associated with resistance to oxidative stress in asexual conidiospores, and AtfB binds to the promoters of several stress response genes. Here, we conducted a gene silencing of AtfB in Aspergillus parasiticus, a well-characterized fungal pathogen of plants, animals, and humans that produces the secondary metabolite and carcinogen aflatoxin, in order to determine the mechanisms by which AtfB contributes to virulence. We show that AtfB silencing results in a decrease in aflatoxin enzyme levels, the down-regulation of aflatoxin accumulation, and impaired conidiospore development in AtfB-silenced strains. This observation is supported by a decrease of AtfB protein levels, and the down-regulation of many genes in the aflatoxin cluster, as well as genes involved in secondary metabolism and conidiospore development. Global expression analysis (RNA Seq demonstrated that AtfB functionally links oxidative stress response pathways to a broader and novel subset of target genes involved in cellular defense, as well as in actin and cytoskeleton arrangement/transport. Thus, AtfB regulates the genes involved in development, stress response, and secondary metabolism in A. parasiticus. We propose that the bZIP regulatory circuit controlled by AtfB provides a large number of excellent cellular targets to reduce fungal virulence. More importantly, understanding key players that are crucial to initiate the cellular response to oxidative stress will enable better control over its detrimental impacts on humans.

  6. Impact of cadmium, cobalt and nickel on sequence-specific DNA binding of p63 and p73 in vitro and in cells

    Energy Technology Data Exchange (ETDEWEB)

    Adámik, Matej [Institute of Biophysics, Academy of Science of the Czech Republic, v.v.i., Královopolská 135, 612 65 Brno (Czech Republic); Bažantová, Pavla [Institute of Biophysics, Academy of Science of the Czech Republic, v.v.i., Královopolská 135, 612 65 Brno (Czech Republic); Department of Biology and Ecology, Faculty of Science, University of Ostrava, Chittussiho 10, 701 03 Ostrava (Czech Republic); Navrátilová, Lucie; Polášková, Alena [Institute of Biophysics, Academy of Science of the Czech Republic, v.v.i., Královopolská 135, 612 65 Brno (Czech Republic); Pečinka, Petr [Institute of Biophysics, Academy of Science of the Czech Republic, v.v.i., Královopolská 135, 612 65 Brno (Czech Republic); Department of Biology and Ecology, Faculty of Science, University of Ostrava, Chittussiho 10, 701 03 Ostrava (Czech Republic); Holaňová, Lucie [Department of Chemical Drugs, Faculty of Pharmacy, University of Veterinary and Pharmaceutical Sciences, Palackého 1/3, 61242 Brno (Czech Republic); Tichý, Vlastimil [Institute of Biophysics, Academy of Science of the Czech Republic, v.v.i., Královopolská 135, 612 65 Brno (Czech Republic); Brázdová, Marie, E-mail: maruska@ibp.cz [Institute of Biophysics, Academy of Science of the Czech Republic, v.v.i., Královopolská 135, 612 65 Brno (Czech Republic); Department of Chemical Drugs, Faculty of Pharmacy, University of Veterinary and Pharmaceutical Sciences, Palackého 1/3, 61242 Brno (Czech Republic)

    2015-01-02

    Highlights: • DNA binding of p53 family core domains is inhibited by cadmium, cobalt and nickel. • Binding to DNA protects p53 family core domains from metal induced inhibition. • Cadmium, cobalt and nickel induced inhibition was reverted by EDTA in vitro. - Abstract: Site-specific DNA recognition and binding activity belong to common attributes of all three members of tumor suppressor p53 family proteins: p53, p63 and p73. It was previously shown that heavy metals can affect p53 conformation, sequence-specific binding and suppress p53 response to DNA damage. Here we report for the first time that cadmium, nickel and cobalt, which have already been shown to disturb various DNA repair mechanisms, can also influence p63 and p73 sequence-specific DNA binding activity and transactivation of p53 family target genes. Based on results of electrophoretic mobility shift assay and luciferase reporter assay, we conclude that cadmium inhibits sequence-specific binding of all three core domains to p53 consensus sequences and abolishes transactivation of several promoters (e.g. BAX and MDM2) by 50 μM concentrations. In the presence of specific DNA, all p53 family core domains were partially protected against loss of DNA binding activity due to cadmium treatment. Effective cadmium concentration to abolish DNA–protein interactions was about two times higher for p63 and p73 proteins than for p53. Furthermore, we detected partial reversibility of cadmium inhibition for all p53 family members by EDTA. DTT was able to reverse cadmium inhibition only for p53 and p73. Nickel and cobalt abolished DNA–p53 interaction at sub-millimolar concentrations while inhibition of p63 and p73 DNA binding was observed at millimolar concentrations. In summary, cadmium strongly inhibits p53, p63 and p73 DNA binding in vitro and in cells in comparison to nickel and cobalt. The role of cadmium inhibition of p53 tumor suppressor family in carcinogenesis is discussed.

  7. Picolinic acid based Cu(II) complexes with heterocyclic bases--crystal structure, DNA binding and cleavage studies.

    Science.gov (United States)

    Pulimamidi, Rabindra Reddy; Nomula, Raju; Pallepogu, Raghavaiah; Shaik, Hussain

    2014-05-22

    In view of the importance of picolinic acid (PA) in preventing cell growth and arresting cell cycle, new PA based metallonucleases were designed with a view to study their DNA binding and cleavage abilities. Three new Cu(II) complexes [Cu(II)(DPPA)].4H2O (1),[Cu(II)(DPPA)(bpy)].5H2O (2) and [Cu(II)(DPPA)(phen)].5H2O (3), were synthesized using a picolinic acid based bifunctional ligand (DPPA) and heterocyclic bases (where DPPA: Pyridine-2-carboxylic acid {2-phenyl-1-[(pyridin-2-ylmethyl)-carbonyl]-ethyl}-amide; bpy: 2, 2'-bipyridine and phen: 1, 10-phenanthroline). DPPA was obtained by coupling 2-picolinic acid and 2-picolyl amine with l-phenylalanine through amide bond‌‌. Complexes were structurally characterized by a single crystal X-ray crystallography. The molecular structure of 1 shows Cu(II) center essentially in a square planar coordination geometry, while complex 2 shows an approximate five coordinated square-pyramidal geometry. Eventhough we could not isolate single crystal for complex (3), its structure was established based on other techniques. The complex (3) also exhibits five coordinate square pyramidal geometry. The complexes show good binding affinity towards CT-DNA. The binding constants (Kb) decrease in the order 1.35 ± 0.01 × 10(5) (3) > 1.23 ± 0.01 × 10(5) (2) > 8.3 ± 0.01 × 10(4) (1) M(-1). They also exhibit efficient nuclease activity towards supercoiled pUC19 DNA both in the absence and presence of external agent (H2O2). The kinetic studies reveal that the hydrolytic cleavage reactions follow the pseudo first-order rate constant and the hydrolysis rates are in the range of (5.8-8.0) × 10(7) fold rate enhancement compared to non-catalyzed double stranded DNA (3.6 × 10(-8) h(-1)). Copyright © 2014 Elsevier Masson SAS. All rights reserved.

  8. Mutations in the DNA-binding domain of NR2E3 affect in vivo dimerization and interaction with CRX.

    Directory of Open Access Journals (Sweden)

    Raphael Roduit

    Full Text Available BACKGROUND: NR2E3 (PNR is an orphan nuclear receptor essential for proper photoreceptor determination and differentiation. In humans, mutations in NR2E3 have been associated with the recessively inherited enhanced short wavelength sensitive (S- cone syndrome (ESCS and, more recently, with autosomal dominant retinitis pigmentosa (adRP. NR2E3 acts as a suppressor of the cone generation program in late mitotic retinal progenitor cells. In adult rod photoreceptors, NR2E3 represses cone-specific gene expression and acts in concert with the transcription factors CRX and NRL to activate rod-specific genes. NR2E3 and CRX have been shown to physically interact in vitro through their respective DNA-binding domains (DBD. The DBD also contributes to homo- and heterodimerization of nuclear receptors. METHODOLOGY/PRINCIPAL FINDINGS: We analyzed NR2E3 homodimerization and NR2E3/CRX complex formation in an in vivo situation by Bioluminescence Resonance Energy Transfer (BRET(2. NR2E3 wild-type protein formed homodimers in transiently transfected HEK293T cells. NR2E3 homodimerization was impaired in presence of disease-causing mutations in the DBD, except for the p.R76Q and p.R104W mutant proteins. Strikingly, the adRP-linked p.G56R mutant protein interacted with CRX with a similar efficiency to that of NR2E3 wild-type and p.R311Q proteins. In contrast, all other NR2E3 DBD-mutant proteins did not interact with CRX. The p.G56R mutant protein was also more effective in abolishing the potentiation of rhodospin gene transactivation by the NR2E3 wild-type protein. In addition, the p.G56R mutant enhanced the transrepression of the M- and S-opsin promoter, while all other NR2E3 DBD-mutants did not. CONCLUSIONS/SIGNIFICANCE: These results suggest different disease mechanisms in adRP- and ESCS-patients carrying NR2E3 mutations. Titration of CRX by the p.G56R mutant protein acting as a repressor in trans may account for the severe clinical phenotype in adRP patients.

  9. PTD-mediated intracellular delivery of mutant NFAT minimum DNA binding domain inhibited the proliferation of T cells.

    Science.gov (United States)

    Liu, Xia; Zhao, Qianqian; Peng, Xin; Xia, Sheng; Shen, Weihong; Zong, Yangyong; Cheng, Jing; Wu, Weijiang; Zhang, Miaomiao; Du, Fengyi; Xu, Wenrong; Qian, Hui; Shao, Qixiang

    2014-03-01

    The nuclear factor of activated T cell (NFAT) family of calcium-regulated transcription factors plays a key role in the development and function of the immune system. Calcineurin, a protein phosphatase, activates NFAT by dephosphorylation. The activated NFAT is translocated into the nucleus, where it up-regulates the expression of interleukin 2 (IL-2) and other target genes. Calcineurin inhibitors such as cyclosporine A (CsA) and FK506 are effective immunosuppressant drugs and dramatically increase the success rate of organ transplantation procedures. However, since calcineurin is expressed in most tissues in the body and calcineurin inhibition alters many cellular processes besides immune cell activation, the therapeutic use of calcineurin inhibitors is limited by serious side effects. Thus inhibiting NFAT by other mechanisms such as blocking its binding to DNA could be a more selective and safer approach to target NFAT for therapeutic applications. In peripheral T cells, productive immune responses are dependent upon the cooperative binding of the NFAT/AP-1 transcriptional complex to the promoter regions of genes such as interleukin-2 (IL-2), while NFAT in the absence of AP-1 leads to T cell anergy. Protein transduction domains (PTDs) are able to penetrate cell membranes and can be used to transport exogenous proteins across the cell and nuclear membranes. In this study, we constructed a fusion protein of PTD and a minimum DNA binding domain of human NFAT1 (PTD-ΔNFATminiDBD), which contains two mutations (R466A and T533G) in the AP-1 binding sites. The delivery and functions of this fusion protein in T cells were investigated. The results indicated that PTD-ΔNFATminiDBD could be effectively delivered into T cells and transported into the nucleus. PTD-ΔNFATminiDBD attenuated IL-2 production in T cells and then inhibited T cell proliferation, likely through competing against endogenous NFAT for binding to the IL-2 gene promoter. These results demonstrated that

  10. Non-enolisable Knoevenagel condensate appended Schiff bases-metal (II) complexes: Spectral characteristics, DNA-binding and nuclease activities

    Science.gov (United States)

    Gubendran, Ammavasi; Kesavan, Mookkandi Palsamy; Ayyanaar, Srinivasan; Mitu, Liviu; Athappan, Periyakaruppan; Rajesh, Jegathalaprathaban

    2017-06-01

    New Schiff base complexes [Cu(L1)Cl] (1), [Ni(L1)Cl] (2), [Zn(L1)Cl] (3), and [Fe(L2)H2OCl] (4) {L1 = (4E)-3-(2-hydroxybenzylidene)-4-(2-hydroxyphenylimino)pentan-2-one, L2 = 2,2‧-(1E,1‧E)-(3-(2-hydroxybenzylidene)-pentane-2,4-diylidene)bis(azan-1-yl-1 idene)diphenol} have been synthesized and characterized by elemental analysis, UV-Vis, IR, FAB-mass, EPR, spectral studies and electrochemical studies, the ligands L1 &L2 were characterized by 1H and 13C NMR spectra. Complex 1 show a visible spectral d-d band near 600 nm and display cyclic voltammetric quasireversible response for the Cu(II)/Cu(I) couple vs Ag/AgCl in DMSO. The EPR spectrum of 1 show g‖ > g⊥ suggesting a square planar geometry around copper with dx2 - y2 as the ground state. The mass spectral results have confirmed the proposed structure for complexes 1-4. DNA binding properties of these complexes 1-4 have been investigated by absorption titrations, cyclic voltammetric studies and circular dichroism studies. On titration with DNA, the complexes 1-4 show hypochromism at the MLCT band (13-31%) with a red shift of 1-8 nm in the electronic spectrum and positive shift of voltammetric E1/2 in the CV studies are in favour of intercalative binding. CD spectra of 1 showed an increase in molar ellipticity (θ278) of the positive band with a minor red shift indicating the transition of B-form of DNA to A like form. DNA cleavage studies of complexes 1 and 4 with pUC18 DNA were studied by gel electrophoresis and complex 4 cleaves supercoiled pUC18 DNA in an oxidative manner in the presence of H2O2 and on photo irradiation at 312 nm.

  11. Synthesis, micellization behavior, antimicrobial and intercalative DNA binding of some novel surfactant copper(II) complexes containing modified phenanthroline ligands.

    Science.gov (United States)

    Nagaraj, Karuppiah; Ambika, Subramanian; Rajasri, Shanmugasundaram; Sakthinathan, Subramanian; Arunachalam, Sankaralingam

    2014-10-01

    The novel surfactant copper(II) complexes, [Cu(ip)2DA](ClO4)21, [Cu(dpqc)2DA](ClO4)22, [Cu(dppn)2DA](ClO4)23, where ip=imidazo[4,5-f][1,10]phenanthroline, dpqc=dipyrido[3,2-a:2',4'-c](6,7,8,9-tetrahydro)phenazine, dppn=benzo[1]dipyrido[3,2-a':2',3'-c]phenazine and DA-dodecylamine, were synthesized and characterized by physico-chemical and spectroscopic methods. In these complexes 1-3, the geometry of copper metal ions was described as square pyramidal. The critical micelle concentration (CMC) value of these surfactant copper(II) complexes in aqueous solution was found out from conductance measurements. Specific conductivity data at different temperatures served for the evaluation of the temperature-dependent CMC and the thermodynamics of micellization (ΔGm°, ΔHm° and ΔSm°). The binding interaction of these complexes with DNA (calf thymus DNA) in Tris buffer was studied by physico-chemical techniques. In the presence of the DNA UV-vis spectrum of complexes showed red shift of the absorption band along with significant hypochromicity indicating intercalation of our complexes with nucleic acids. Competitive binding study with ethidium bromide (EB) shows that the complexes exhibit the ability to displace the nucleic acid-bound EB indicating that the complexes bind to nucleic acids in strong competition with EB for the intercalative binding site. Observed changes in the circular dichoric spectra of DNA in the presence of surfactant complexes support the strong binding of complexes with DNA. CV results also confirm this mode of binding. Some significant thermodynamic parameters of the binding of the titled complexes to DNA have also been determined. The results reveal that the extent of DNA binding of 3 was greater than that of 1 and 2. The antibacterial and antifungal screening tests of these complexes have shown good results compared to its precursor chloride complexes. Copyright © 2014 Elsevier B.V. All rights reserved.

  12. DNA binding, BSA interaction and SOD activity of two new nickel(II) complexes with glutamine Schiff base ligands.

    Science.gov (United States)

    Wei, Qiang; Dong, Jianfang; Zhao, Peiran; Li, Manman; Cheng, Fengling; Kong, Jinming; Li, Lianzhi

    2016-08-01

    Two hexacoordinated octahedral nickel(II) complexes, [Ni(o-van-gln)(phen)(H2O)](1) and [Ni(sal-gln)(phen)(H2O)](2) [o-van-gln=a Schiff base derived from o-vanillin and glutamine, sal-gln=a Schiff base derived from salicylaldehyde and glutamine, phen=1,10-phenanthroline], have been synthesized and characterized by elemental analysis, IR spectra and single crystal X-ray diffraction. X-ray studies showed that nickel atoms of both 1 and 2 exhibit distorted NiN3O3 octahedral geometry. In each crystal, intermolecular hydrogen bonds form a two-dimensional network structure. DNA-binding properties of these two nickel(II) complexes were investigated by using UV-Vis absorption, fluorescence, circular dichroism (CD) spectroscopies and viscosity measurements. Results indicated that the two complexes can bind to calf thymus DNA (CT-DNA) via an intercalative mode, and complex 1 exhibits higher interaction with CT-DNA than complex 2. Furthermore, the interactions between the nickel(II) complexes with bovine serum albumin (BSA) have been studied by spectroscopies. The results indicated that both complexes could quench the intrinsic fluorescence of BSA in a static quenching process. The binding constants (Kb) and the numbers of binding sites (n) obtained are 1.10×10(5)M(-1) and 1.05 for complex 1 and 5.05×10(4)M(-1) and 0.997 for complex 2, respectively. Site-selective competitive binding investigation indicated that the binding sites of both the complexes are located in site I of sub-domains IIA of BSA. Assay of superoxide dismutase (SOD) activity of the nickel(II) complexes revealed that they exhibit significant superoxide scavenging activity with IC50=3.4×10(-5)M for complex 1 and 4.3×10(-5)M for complex 2, respectively. Copyright © 2016 Elsevier B.V. All rights reserved.

  13. Effects of exercise on cyclooxygenase-2 expression and nuclear factor-kappaB DNA binding in human peripheral blood mononuclear cells.

    Science.gov (United States)

    Kim, Si-Young; Jun, Tae-Won; Lee, Young-Soo; Na, Hye-Kyung; Surh, Young-Joon; Song, Wook

    2009-08-01

    There are multiple lines of compelling evidence supporting the beneficial effect of exercise on the prevention and/or improvement of certain chronic diseases. However, exhaustive or intense exercise causes oxygen free radical generation and oxidative stress, which can lead to injuries and chronic fatigue as well as inflammation. Abnormal upregulation of cyclooxygenase-2 (COX-2), a rate-limiting enzyme in prostaglandin biosynthesis, has been implicated in many inflammation-associated chronic disorders. Nuclear factor-kappaB (NF-kappaB) is a major transcription factor involved in regulation of COX-2 gene expression. To determine whether inflammation induction is dependent on intensity of exercise, COX-2 expression and NF-kappaB activation were adopted as the main targets. Thirteen volunteers who participated in the exercise program were subject to four exercise intensities [40, 60, 80, and 100% of heart rate reserve (HRR)] on a treadmill and to resting conditions. Isolated human peripheral blood mononuclear cells (PBMCs) were collected during the resting state and immediately after exercise and subjected to the electrophoretic mobility gel shift assay and Western blot analysis. As exercise intensity increased, both COX-2 expression and NF-kappaB DNA-binding activity were enhanced. The expression of IkappaB kinase alpha (IKKalpha) and IkappaBalpha were not significantly altered. However, exhaustive/vigorous exercise (100% HRR) could induce the phosphorylation of both IKKalpha and IkappaBalpha. In conclusion, a single bout of exercise induced COX-2 expression and DNA-binding activity of NF-kappaB in human PBMCs, and both COX-2 expression and DNA-binding activity of NF-kappaB were dependent on exercise intensity.

  14. Solution structure of the Arabidopsis thaliana telomeric repeat-binding protein DNA binding domain: a new fold with an additional C-terminal helix.

    Science.gov (United States)

    Sue, Shih-Che; Hsiao, Hsin-Hao; Chung, Ben C-P; Cheng, Ying-Hsien; Hsueh, Kuang-Lung; Chen, Chung Mong; Ho, Chia Hsing; Huang, Tai-Huang

    2006-02-10

    The double-stranded telomeric repeat-binding protein (TRP) AtTRP1 is isolated from Arabidopsis thaliana. Using gel retardation assays, we defined the C-terminal 97 amino acid residues, Gln464 to Val560 (AtTRP1(464-560)), as the minimal structured telomeric repeat-binding domain. This region contains a typical Myb DNA-binding motif and a C-terminal extension of 40 amino acid residues. The monomeric AtTRP1(464-560) binds to a 13-mer DNA duplex containing a single repeat of an A.thaliana telomeric DNA sequence (GGTTTAG) in a 1:1 complex, with a K(D) approximately 10(-6)-10(-7) M. Nuclear magnetic resonance (NMR) examination revealed that the solution structure of AtTRP1(464-560) is a novel four-helix tetrahedron rather than the three-helix bundle structure found in typical Myb motifs and other TRPs. Binding of the 13-mer DNA duplex to AtTRP1(464-560) induced significant chemical shift perturbations of protein amide resonances, which suggests that helix 3 (H3) and the flexible loop connecting H3 and H4 are essential for telomeric DNA sequence recognition. Furthermore, similar to that in hTRF1, the N-terminal arm likely contributes to or stabilizes DNA binding. Sequence comparisons suggested that the four-helix structure and the involvement of the loop residues in DNA binding may be features unique to plant TRPs.

  15. Neutralizing the function of a β-globin-associated cis-regulatory DNA element using an artificial zinc finger DNA-binding domain.

    Science.gov (United States)

    Barrow, Joeva J; Masannat, Jude; Bungert, Jörg

    2012-10-30

    Gene expression is primarily regulated by cis-regulatory DNA elements and trans-interacting proteins. Transcription factors bind in a DNA sequence-specific manner and recruit activities that modulate the association and activity of transcription complexes at specific genes. Often, transcription factors belong to families of related proteins that interact with similar DNA sequences. Furthermore, genes are regulated by multiple, sometimes redundant, cis-regulatory elements. Thus, the analysis of the role of a specific DNA regulatory sequence and the interacting proteins in the context of intact cells is challenging. In this study, we designed and functionally characterized an artificial DNA-binding domain that neutralizes the function of a cis-regulatory DNA element associated with adult β-globin gene expression. The zinc finger DNA-binding domain (ZF-DBD), comprising six ZFs, interacted specifically with a CACCC site located 90 bp upstream of the transcription start site (-90 β-ZF-DBD), which is normally occupied by KLF1, a major regulator of adult β-globin gene expression. Stable expression of the -90 β-ZF-DBD in mouse erythroleukemia cells reduced the binding of KLF1 with the β-globin gene, but not with locus control region element HS2, and led to reduced transcription. Transient transgenic embryos expressing the -90 β-ZF-DBD developed normally but revealed reduced expression of the adult β-globin gene. These results demonstrate that artificial DNA-binding proteins lacking effector domains are useful tools for studying and modulating the function of cis-regulatory DNA elements.

  16. A new mode of DNA binding distinguishes Capicua from other HMG-box factors and explains its mutation patterns in cancer.

    Science.gov (United States)

    Forés, Marta; Simón-Carrasco, Lucía; Ajuria, Leiore; Samper, Núria; González-Crespo, Sergio; Drosten, Matthias; Barbacid, Mariano; Jiménez, Gerardo

    2017-03-01

    HMG-box proteins, including Sox/SRY (Sox) and TCF/LEF1 (TCF) family members, bind DNA via their HMG-box. This binding, however, is relatively weak and both Sox and TCF factors employ distinct mechanisms for enhancing their affinity and specificity for DNA. Here we report that Capicua (CIC), an HMG-box transcriptional repressor involved in Ras/MAPK signaling and cancer progression, employs an additional distinct mode of DNA binding that enables selective recognition of its targets. We find that, contrary to previous assumptions, the HMG-box of CIC does not bind DNA alone but instead requires a distant motif (referred to as C1) present at the C-terminus of all CIC proteins. The HMG-box and C1 domains are both necessary for binding specific TGAATGAA-like sites, do not function via dimerization, and are active in the absence of cofactors, suggesting that they form a bipartite structure for sequence-specific binding to DNA. We demonstrate that this binding mechanism operates throughout Drosophila development and in human cells, ensuring specific regulation of multiple CIC targets. It thus appears that HMG-box proteins generally depend on auxiliary DNA binding mechanisms for regulating their appropriate genomic targets, but that each sub-family has evolved unique strategies for this purpose. Finally, the key role of C1 in DNA binding also explains the fact that this domain is a hotspot for inactivating mutations in oligodendroglioma and other tumors, while being preserved in oncogenic CIC-DUX4 fusion chimeras associated to Ewing-like sarcomas.

  17. Structure of a Novel DNA-binding Domain of Helicase-like Transcription Factor (HLTF) and Its Functional Implication in DNA Damage Tolerance.

    Science.gov (United States)

    Hishiki, Asami; Hara, Kodai; Ikegaya, Yuzu; Yokoyama, Hideshi; Shimizu, Toshiyuki; Sato, Mamoru; Hashimoto, Hiroshi

    2015-05-22

    HLTF (helicase-like transcription factor) is a yeast RAD5 homolog found in mammals. HLTF has E3 ubiquitin ligase and DNA helicase activities, and plays a pivotal role in the template-switching pathway of DNA damage tolerance. HLTF has an N-terminal domain that has been designated the HIRAN (HIP116 and RAD5 N-terminal) domain. The HIRAN domain has been hypothesized to play a role in DNA binding; however, the structural basis of, and functional evidence for, the HIRAN domain in DNA binding has remained unclear. Here we show for the first time the crystal structure of the HIRAN domain of human HLTF in complex with DNA. The HIRAN domain is composed of six β-strands and two α-helices, forming an OB-fold structure frequently found in ssDNA-binding proteins, including in replication factor A (RPA). Interestingly, this study reveals that the HIRAN domain interacts with not only with a single-stranded DNA but also with a duplex DNA. Furthermore, the structure unexpectedly clarifies that the HIRAN domain specifically recognizes the 3'-end of DNA. These results suggest that the HIRAN domain functions as a sensor to the 3'-end of the primer strand at the stalled replication fork and that the domain facilitates fork regression. HLTF is recruited to a damaged site through the HIRAN domain at the stalled replication fork. Furthermore, our results have implications for the mechanism of template switching. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  18. N-termini of fungal CSL transcription factors are disordered, enriched in regulatory motifs and inhibit DNA binding in fission yeast.

    Directory of Open Access Journals (Sweden)

    Martin Převorovský

    Full Text Available CSL (CBF1/RBP-Jκ/Suppressor of Hairless/LAG-1 transcription factors are the effector components of the Notch receptor signalling pathway, which is critical for metazoan development. The metazoan CSL proteins (class M can also function in a Notch-independent manner. Recently, two novel classes of CSL proteins, designated F1 and F2, have been identified in fungi. The role of the fungal CSL proteins is unclear, because the Notch pathway is not present in fungi. In fission yeast, the Cbf11 and Cbf12 CSL paralogs play antagonistic roles in cell adhesion and the coordination of cell and nuclear division. Unusually long N-terminal extensions are typical for fungal and invertebrate CSL family members. In this study, we investigate the functional significance of these extended N-termini of CSL proteins.We identify 15 novel CSL family members from 7 fungal species and conduct bioinformatic analyses of a combined dataset containing 34 fungal and 11 metazoan CSL protein sequences. We show that the long, non-conserved N-terminal tails of fungal CSL proteins are likely disordered and enriched in phosphorylation sites and PEST motifs. In a case study of Cbf12 (class F2, we provide experimental evidence that the protein is proteolytically processed and that the N-terminus inhibits the Cbf12-dependent DNA binding activity in an electrophoretic mobility shift assay.This study provides insight into the characteristics of the long N-terminal tails of fungal CSL proteins that may be crucial for controlling DNA-binding and CSL function. We propose that the regulation of DNA binding by Cbf12 via its N-terminal region represents an important means by which fission yeast strikes a balance between the class F1 and class F2 paralog activities. This mode of regulation might be shared with other CSL-positive fungi, some of which are relevant to human disease and biotechnology.

  19. Identification and characterization of C106R, a novel mutation in the DNA-binding domain of GCMB, in a family with autosomal-dominant hypoparathyroidism.

    Science.gov (United States)

    Yi, Hyon-Seung; Eom, Young Sil; Park, Ie Byung; Lee, Sangho; Hong, Suntaek; Jüppner, Harald; Mannstadt, Michael; Lee, Sihoon

    2012-05-01

    Glial cells missing B (GCMB) is a transcription factor that is expressed in the parathyroid hormone (PTH)-secreting cells of the parathyroid glands. Several mutations in GCMB have been reported to cause hypoparathyroidism (HP). We identified a family with two individuals in two generations (mother and son), who are affected by autosomal-dominant hypoparathyroidism (AD-HP). A novel heterozygous mutation in exon 2 of GCMB was identified in both affected individuals that changes cysteine at position 106 of the putative DNA-binding domain of GCMB to arginine (C106R). We performed mutational analysis of the genes encoding GCMB, pre-pro PTH, GATA3 and CaSR using polymerase chain reaction (PCR)-amplified genomic DNA. The identified GCMB mutant was characterized by functional studies including nuclear localization, electrophoretic mobility shift assays (EMSA) and luciferase reporter assays, and homology modelling was performed to generate a three-dimensional structural model for the DNA-binding domain of GCMB to predict the structural consequences of the identified mutation. The C106R mutant of GCMB failed to interact with the DNA consensus recognition motif, as determined by EMSA. Furthermore, in comparison with wild-type GCMB, the C106R mutant demonstrated reduced transactivation in luciferase reporter assays; however, the mutant GCMB failed to reduce the activity of the wild-type protein. Consistent with the EMSA findings, homology modelling analysis suggested that replacement of cysteine 106 with arginine would interfere with DNA binding. We have identified a novel GCMB mutation that may explain AD-HP in our family. However, the exact mechanism by which this heterozygous mutation leads to the disease in the described family remains to be elucidated. © 2012 Blackwell Publishing Ltd.

  20. Two glutamic acid residues in the DNA-binding domain are engaged in the release of STAT1 dimers from DNA

    Directory of Open Access Journals (Sweden)

    Koch Verena

    2012-08-01

    Full Text Available Abstract Background In interferon-γ-stimulated cells, the dimeric transcription factor STAT1 (signal transducer and activator of transcription 1 recognizes semi-palindromic motifs in the promoter regions of cytokine-driven target genes termed GAS (gamma-activated sites. However, the molecular steps that facilitate GAS binding and the subsequent liberation of STAT1 homodimers from these promoter elements are not well understood. Results Using a mutational approach, we identified two critical glutamyl residues within the DNA-binding domain adjacent to the phosphodiester backbone of DNA which efficiently release phospho-STAT1 from DNA. The release of STAT1 dimers from DNA enhances transcriptional activity on both interferon-driven reporter and endogenous target genes. A substitution of either of the two glutamic acid residues broadens the repertoire of putative binding sites on DNA and enhances binding affinity to GAS sites. However, despite elevated levels of tyrosine phosphorylation and a prolonged nuclear accumulation period, the STAT1 DNA-binding mutants show a significantly reduced transcriptional activity upon stimulation of cells with interferon-γ. This reduced transcriptional response may be explained by the deposition of oligomerized STAT1 molecules outside GAS sites. Conclusions Thus, two negatively charged amino acid residues in the DNA-binding domain are engaged in the liberation of STAT1 from DNA, resulting in a high dissociation rate from non-GAS sites as a key feature of STAT1 signal transduction, which positively regulates cytokine-dependent gene expression probably by preventing retention at transcriptionally inert sites.

  1. Two distinct disulfide bonds formed in human heat shock transcription factor 1 act in opposition to regulate its DNA binding activity.

    Science.gov (United States)

    Lu, Ming; Kim, Hee-Eun; Li, Chun-Ri; Kim, Sol; Kwak, Im-Jung; Lee, Yun-Ju; Kim, So-Sun; Moon, Ji-Young; Kim, Cho Hee; Kim, Dong-Kyoo; Kang, Ho Sung; Park, Jang-Su

    2008-06-03

    Under circumstances of heat stress, heat shock transcription factor 1 (HSF1) plays important roles in heat shock protein expression. In this study, an increasing concentration of dithiothreitol (DTT) was found to either enhance or inhibit the heat-induced trimerization of HSF1, suggesting the involvement of dual redox-dependent HSF1 activation mechanisms. Our in vitro experiments show that the heat-induced bonding between the cysteine C36 and C103 residues of HSF1 forms an intermolecular disulfide covalent bond (SS-I bond) and that it directly causes HSF1 to trimerize and bond to DNA. Gel filtration assays show that HSF1 can form intermolecular hydrophobic interaction-mediated (iHI-m) noncovalent oligomers. However, the lack of a trimerization domain prevents HSF1 activation, which suggests that iHI-m noncovalent trimerization is a precondition of SS-I bond formation. On the other hand, intramolecular SS-II bond (in which the C153, C373, and C378 residues of HSF1 participate) formation inhibits this iHI-m trimerization, thereby preventing SS-I bond formation and DNA binding. Thus, HSF1 activation is regulated positively by intermolecular SS-I bond formation and negatively by intramolecular SS-II bond formation. Importantly, these two SS bonds confer different DTT sensitivities (the SS-II bond is more sensitive). Therefore, a low concentration of DTT cleaves the SS-II bond but not the SS-I bond and thus improves DNA binding of HSF1, whereas a high concentration DTT cuts both SS bonds and inhibits HSF1 activation. We propose that these interesting effects further explain cellular HSF1 trimerization, DNA binding, and transcription when cells are under stress.

  2. Evidence on How a Conserved Glycine in the Hinge Region of HapR Regulates Its DNA Binding Ability: LESSONS FROM A NATURAL VARIANT.

    Energy Technology Data Exchange (ETDEWEB)

    M Dongre; N Singh; C Dureja; N Peddada; A Solanki; F Ashish; S Raychaudhuri

    2011-12-31

    HapR has been recognized as a quorum-sensing master regulator in Vibrio cholerae. Because it controls a plethora of disparate cellular events, the absence of a functional HapR affects the physiology of V. cholerae to a great extent. In the current study, we pursued an understanding of an observation of a natural protease-deficient non-O1, non-O139 variant V. cholerae strain V2. Intriguingly, a nonfunctional HapR (henceforth designated as HapRV2) harboring a substitution of glycine to aspartate at position 39 of the N-terminal hinge region has been identified. An in vitro gel shift assay clearly suggested the inability of HapRV2 to interact with various cognate promoters. Reinstatement of glycine at position 39 restores DNA binding ability of HapRV2 (HapRV2G), thereby rescuing the protease-negative phenotype of this strain. The elution profile of HapRV2 and HapRV2G proteins in size-exclusion chromatography and their circular dichroism spectra did not reflect any significant differences to explain the functional discrepancies between the two proteins. To gain insight into the structure-function relationship of these two proteins, we acquired small/wide angle x-ray scattering data from samples of the native and G39D mutant. Although Guinier analysis and indirect Fourier transformation of scattering indicated only a slight difference in the shape parameters, structure reconstruction using dummy amino acids concluded that although HapR adopts a 'Y' shape similar to its crystal structure, the G39D mutation in hinge drastically altered the DNA binding domains by bringing them in close proximity. This altered spatial orientation of the helix-turn-helix domains in this natural variant provides the first structural evidence on the functional role of the hinge region in quorum sensing-related DNA-binding regulatory proteins of Vibrio spp.

  3. Structures of p63 DNA binding domain in complexes with half-site and with spacer-containing full response elements.

    Science.gov (United States)

    Chen, Chen; Gorlatova, Natalia; Kelman, Zvi; Herzberg, Osnat

    2011-04-19

    Transcription factor p63, a p53 family member, plays a role in epithelial cell development, cell cycle arrest, apoptosis, and tumorigenesis. Point mutations, primarily in the DNA binding domain (p63DBD), lead to malformation syndromes. To gain insight into differences between p63 and p53 and the impact of mutations on the structure, we have determined two crystal structures of p63DBD in complex with A/T-rich response elements. One complex contains a 10-bp DNA half-site response element (5'AAACATGTTT3') and the other contains a 22-bp DNA full response element with a 2-bp spacer between two half-sites (5'AAACATGTTTTAAAACATGTTT3'). In both structures, each half-site binds a p63DBD dimer. The two p63DBD dimers do not interact in the presence of the DNA spacer, whereas they interact with one another in the p63DBD/10-bp complex where the DNA simulates a full response element by packing end-to-end. A unique dimer-dimer interaction involves a variable loop region, which differs in length and sequence from the counterpart loop of p53DBD. The DNA trajectories in both structures assume superhelical conformations. Surface plasmon resonance studies of p63DBD/DNA binding yielded K(d) = 11.7 μM for a continuous full response element, whereas binding was undetectable with the 22-bp DNA, suggesting an important contribution of a p63DBD interdimer interface to binding and establishing that p63DBD affinity to the response element is approximately 1,000-fold lower than that of p53DBD. Analyses of the structural consequences of p63DBD mutations that cause developmental defects show that, although some mutations affect DNA binding directly, the majority affects protein stability.

  4. Loop L1 governs the DNA-binding specificity and order for RecA-catalyzed reactions in homologous recombination and DNA repair

    Science.gov (United States)

    Shinohara, Takeshi; Ikawa, Shukuko; Iwasaki, Wakana; Hiraki, Toshiki; Hikima, Takaaki; Mikawa, Tsutomu; Arai, Naoto; Kamiya, Nobuo; Shibata, Takehiko

    2015-01-01

    In all organisms, RecA-family recombinases catalyze homologous joint formation in homologous genetic recombination, which is essential for genome stability and diversification. In homologous joint formation, ATP-bound RecA/Rad51-recombinases first bind single-stranded DNA at its primary site and then interact with double-stranded DNA at another site. The underlying reason and the regulatory mechanism for this conserved binding order remain unknown. A comparison of the loop L1 structures in a DNA-free RecA crystal that we originally determined and in the reported DNA-bound active RecA crystals suggested that the aspartate at position 161 in loop L1 in DNA-free RecA prevented double-stranded, but not single-stranded, DNA-binding to the primary site. This was confirmed by the effects of the Ala-replacement of Asp-161 (D161A), analyzed directly by gel-mobility shift assays and indirectly by DNA-dependent ATPase activity and SOS repressor cleavage. When RecA/Rad51-recombinases interact with double-stranded DNA before single-stranded DNA, homologous joint-formation is suppressed, likely by forming a dead-end product. We found that the D161A-replacement reduced this suppression, probably by allowing double-stranded DNA to bind preferentially and reversibly to the primary site. Thus, Asp-161 in the flexible loop L1 of wild-type RecA determines the preference for single-stranded DNA-binding to the primary site and regulates the DNA-binding order in RecA-catalyzed recombinase reactions. PMID:25561575

  5. Mutational analysis of the multiple-antibiotic resistance regulator MarR reveals a ligand binding pocket at the interface between the dimerization and DNA binding domains.

    Science.gov (United States)

    Duval, Valérie; McMurry, Laura M; Foster, Kimberly; Head, James F; Levy, Stuart B

    2013-08-01

    The Escherichia coli regulator MarR represses the multiple-antibiotic resistance operon marRAB and responds to phenolic compounds, including sodium salicylate, which inhibit its activity. Crystals obtained in the presence of a high concentration of salicylate indicated two possible salicylate sites, SAL-A and SAL-B. However, it was unclear whether these sites were physiologically significant or were simply a result of the crystallization conditions. A study carried out on MarR homologue MTH313 suggested the presence of a salicylate binding site buried at the interface between the dimerization and the DNA-binding domains. Interestingly, the authors of the study indicated a similar pocket conserved in the MarR structure. Since no mutagenesis analysis had been performed to test which amino acids were essential in salicylate binding, we examined the role of residues that could potentially interact with salicylate. We demonstrated that mutations in residues shown as interacting with salicylate at SAL-A and SAL-B in the MarR-salicylate structure had no effect on salicylate binding, indicating that these sites were not the physiological regulatory sites. However, some of these residues (P57, R86, M74, and R77) were important for DNA binding. Furthermore, mutations in residues R16, D26, and K44 significantly reduced binding to both salicylate and 2,4-dinitrophenol, while a mutation in residue H19 impaired the binding to 2,4-dinitrophenol only. These findings indicate, as for MTH313, the presence of a ligand binding pocket located between the dimerization and DNA binding domains.

  6. Fruit-specific overexpression of wound-induced tap1 under E8 promoter in tomato confers resistance to fungal pathogens at ripening stage.

    Science.gov (United States)

    Kesanakurti, Divya; Kolattukudy, Pappachan E; Kirti, Pulugurtha Bhardwaja

    2012-10-01

    Based on high economic importance and nutritious value of tomato fruits and as previous studies employed E8 promoter in fruit ripening-specific gene expression, we have developed transgenic tomato plants overexpressing tomato anionic peroxidase cDNA (tap1) under E8 promoter. Stable transgene integration was confirmed by polymerase chain reaction (PCR) and Southern analysis for nptII. Northern blotting confirmed elevated tap1 levels in the breaker- and red-ripe stages of T(1) transgenic fruits, whereas wild-type (WT) plants did not show tap1 expression in these developmental stages. Further, tap1 expression levels were significantly enhanced in response to wounding in breaker- and red-ripe stages of transgenic fruits, whereas wound-induced expression of tap1 was not detected in WT fruits. Confocal microscopy revealed high accumulation of phenolic compounds at the wound site in transgenic fruits suggesting a role of tap1 in wound-induced phenolic polymerization. Total peroxidase activity has increased remarkably in transgenic pericarp tissues in response to wounding, while very less or minimal levels were recorded in WT pericarp tissues. Transgenic fruits also displayed reduced post-harvest decay and increased resistance toward Alternaria alternata and Fusarium solani infection with noticeable inhibition in lesion formation. Conidiospore germination and mycelial growth of F. solani were severely inhibited when treated with E8-tap1 fruit extracts compared to WT fruits. 3-(4,5-Dimethylthiazol-2-yl)-2, 5-diphenyltetrazolium bromide assay showed reduced spore viability when incubated in E8-tap1 fruit extracts. Thus, fruit-specific expression of tap1 using E8 promoter is associated with enhanced total peroxidase activity and high phenolic accumulation in fruits with minimized post-harvest deterioration caused by wounding and fungal attack in tomato fruits. Copyright © Physiologia Plantarum 2012.

  7. Solution-state NMR investigation of DNA binding interactions in Escherichia coli formamidopyrimidine-DNA glycosylase (Fpg): a dynamic description of the DNA/protein interface.

    Science.gov (United States)

    Buchko, Garry W; McAteer, Kathleen; Wallace, Susan S; Kennedy, Michael A

    2005-03-02

    Formamidopyrimidine-DNA glycosylase (Fpg) is a base excision repair (BER) protein that removes oxidative DNA lesions. Recent crystal structures of Fpg bound to DNA revealed residues involved in damage recognition and enzyme catalysis, but failed to shed light on the dynamic nature of the processes. To examine the structural and dynamic changes that occur in solution when Fpg binds DNA, NMR spectroscopy was used to study Escherichia coli Fpg free in solution and bound to a double-stranded DNA oligomer containing 1,3-propanediol (13-PD), a non-hydrolyzable abasic-site analogue. Only 209 out of a possible 251 (83%) free-precession 15N/1H HSQC cross peaks were observed and 180 of these were assignable, indicating that approximately 30% of the residues undergo intermediate motion on the NMR timescale, broadening the resonances beyond detection or making them intractable in backbone assignment experiments. The majority of these affected residues were in the polypeptide linker region and the interface between the N- and C-terminal domains. DNA titration experiments revealed line broadening and chemical shift perturbations for backbone amides nearby and distant from the DNA binding surface, but failed to quench the intermediate timescale motion observed for free Fpg, including those residues directly involved in DNA binding, notwithstanding a nanomolar dissociation constant for 13-PD binding. Indeed, after binding to 13-PD, at least approximately 40% of the Fpg residues undergo intermediate timescale motion even though all other residues exhibit tight DNA binding characteristic of slow exchange. CPMG-HSQC experiments revealed millisecond to microsecond motion for the backbone amides of D91 and H92 that were quenched upon binding 13-PD. In free Fpg, heteronuclear 1H-15N NOE experiments detected picosecond timescale backbone motion in the alphaF-beta9 loop, the region primarily responsible for chemically discriminating 8-oxoguanine (8-oxoG) over normal guanine, that was

  8. Increased Stability and DNA Site Discrimination of Single Chain Variants of the Dimeric beta-Barrel DNA Binding Domain of the Human Papillomavirus E2 Transcriptional Regulator

    Energy Technology Data Exchange (ETDEWEB)

    Dellarole,M.; Sanchez, I.; Freire, E.; de Prat-Gay, G.

    2007-01-01

    Human papillomavirus infects millions of people worldwide and is a causal agent of cervical cancer in women. The HPV E2 protein controls the expression of all viral genes through binding of its dimeric C-terminal domain (E2C) to its target DNA site. We engineered monomeric versions of the HPV16 E2C, in order to probe the link of the dimeric {beta}-barrel fold to stability, dimerization, and DNA binding. Two single-chain variants, with 6 and 12 residue linkers (scE2C-6 and scE2C-12), were purified and characterized. Spectroscopy and crystallography show that the native structure is unperturbed in scE2C-12. The single chain variants are stabilized with respect to E2C, with effective concentrations of 0.6 to 6 mM. The early folding events of the E2C dimer and scE2C-12 are very similar and include formation of a compact species in the submillisecond time scale and a non-native monomeric intermediate with a half-life of 25 ms. However, monomerization changes the unfolding mechanism of the linked species from two-state to three-state, with a high-energy intermediate. Binding to the specific target site is up to 5-fold tighter in the single chain variants. Nonspecific DNA binding is up to 7-fold weaker in the single chain variants, leading to an overall 10-fold increased site discrimination capacity, the largest described so far for linked DNA binding domains. Titration calorimetric binding analysis, however, shows almost identical behavior for dimer and single-chain species, suggesting very subtle changes behind the increased specificity. Global analysis of the mechanisms probed suggests that the dynamics of the E2C domain, rather than the structure, are responsible for the differential properties. Thus, the plastic and dimeric nature of the domain did not evolve for a maximum affinity, specificity, and stability of the quaternary structure, likely because of regulatory reasons and for roles other than DNA binding played by partly folded dimeric or monomeric conformers.

  9. CSI-Tree: a regression tree approach for modeling binding properties of DNA-binding molecules based on cognate site identification (CSI) data.

    Science.gov (United States)

    Keleş, Sündüz; Warren, Christopher L; Carlson, Clayton D; Ansari, Aseem Z

    2008-06-01

    The identification and characterization of binding sites of DNA-binding molecules, including transcription factors (TFs), is a critical problem at the interface of chemistry, biology and molecular medicine. The Cognate Site Identification (CSI) array is a high-throughput microarray platform for measuring comprehensive recognition profiles of DNA-binding molecules. This technique produces datasets that are useful not only for identifying binding sites of previously uncharacterized TFs but also for elucidating dependencies, both local and nonlocal, between the nucleotides at different positions of the recognition sites. We have developed a regression tree technique, CSI-Tree, for exploring the spectrum of binding sites of DNA-binding molecules. Our approach constructs regression trees utilizing the CSI data of unaligned sequences. The resulting model partitions the binding spectrum into homogeneous regions of position specific nucleotide effects. Each homogeneous partition is then summarized by a position weight matrix (PWM). Hence, the final outcome is a binding intensity rank-ordered collection of PWMs each of which spans a different region in the binding spectrum. Nodes of the regression tree depict the critical position/nucleotide combinations. We analyze the CSI data of the eukaryotic TF Nkx-2.5 and two engineered small molecule DNA ligands and obtain unique insights into their binding properties. The CSI tree for Nkx-2.5 reveals an interaction between two positions of the binding profile and elucidates how different nucleotide combinations at these two positions lead to different binding affinities. The CSI trees for the engineered DNA ligands exhibit a common preference for the dinucleotide AA in the first two positions, which is consistent with preference for a narrow and relatively flat minor groove. We carry out a reanalysis of these data with a mixture of PWMs approach. This approach is an advancement over the simple PWM model and accommodates position

  10. Nuclear Import of the Parsley bZIP Transcription Factor CPRF2 Is Regulated by Phytochrome Photoreceptors

    Science.gov (United States)

    Kircher, Stefan; Wellmer, Frank; Nick, Peter; Rügner, Alexander; Schäfer, Eberhard; Harter, Klaus

    1999-01-01

    In plants, light perception by photoreceptors leads to differential expression of an enormous number of genes. An important step for differential gene expression is the regulation of transcription factor activities. To understand these processes in light signal transduction we analyzed the three well-known members of the common plant regulatory factor (CPRF) family from parsley (Petroselinum crispum). Here, we demonstrate that these CPRFs, which belong to the basic- region leucine-zipper (bZIP) domain-containing transcription factors, are differentially distributed within parsley cells, indicating different regulatory functions within the regulatory networks of the plant cell. In particular, we show by cell fractionation and immunolocalization approaches that CPRF2 is transported from the cytosol into the nucleus upon irradiation due to action of phytochrome photoreceptors. Two NH2-terminal domains responsible for cytoplasmic localization of CPRF2 in the dark were characterized by deletion analysis using a set of CPRF2-green fluorescent protein (GFP) gene fusion constructs transiently expressed in parsley protoplasts. We suggest that light-induced nuclear import of CPRF2 is an essential step in phytochrome signal transduction. PMID:9922448

  11. Development of T cell lymphoma in HTLV-1 bZIP factor and Tax double transgenic mice.

    Science.gov (United States)

    Zhao, Tiejun; Satou, Yorifumi; Matsuoka, Masao

    2014-07-01

    Adult T-cell leukemia (ATL) is an aggressive T-cell malignancy caused by human T-cell leukemia virus type 1 (HTLV-1). ATL cells possess a CD4+ CD25+ phenotype, similar to that of regulatory T cells (Tregs). Tax has been reported to play a crucial role in the leukemogenesis of HTLV-1. The HTLV-1 bZIP factor (HBZ), which is encoded by the minus strand of the viral genomic RNA, is expressed in all ATL cases and induces neoplastic and inflammatory disease in vivo. To test whether HBZ and Tax are both required for T cell malignancy, we generated HBZ/Tax double transgenic mice in which HBZ and Tax are expressed exclusively in CD4+ T cells. Survival was much reduced in HBZ/Tax double-transgenic mice compared with wild type littermates. Transgenic expression of HBZ and Tax induced skin lesions and T-cell lymphoma in mice, resembling diseases observed in HTLV-1 infected individuals. However, Tax single transgenic mice did not develop major health problems. In addition, memory CD4+ T cells and Foxp3+ Treg cells counts were increased in HBZ/Tax double transgenic mice, and their proliferation was enhanced. There was very little difference between HBZ single and HBZ/Tax double transgenic mice. Taken together, these results show that HBZ, in addition to Tax, plays a critical role in T-cell lymphoma arising from HTLV-1 infection.

  12. Tribbles ortholog NIPI-3 and bZIP transcription factor CEBP-1 regulate a Caenorhabditis elegans intestinal immune surveillance pathway.

    Science.gov (United States)

    McEwan, Deborah L; Feinbaum, Rhonda L; Stroustrup, Nicholas; Haas, Wilhelm; Conery, Annie L; Anselmo, Anthony; Sadreyev, Ruslan; Ausubel, Frederick M

    2016-12-07

    Many pathogens secrete toxins that target key host processes resulting in the activation of immune pathways. The secreted Pseudomonas aeruginosa toxin Exotoxin A (ToxA) disrupts intestinal protein synthesis, which triggers the induction of a subset of P. aeruginosa-response genes in the nematode Caenorhabditis elegans. We show here that one ToxA-induced C. elegans gene, the Tribbles pseudokinase ortholog nipi-3, is essential for host survival following exposure to P. aeruginosa or ToxA. We find that NIPI-3 mediates the post-developmental expression of intestinal immune genes and proteins and primarily functions in parallel to known immune pathways, including p38 MAPK signaling. Through mutagenesis screening, we identify mutants of the bZIP C/EBP transcription factor cebp-1 that suppress the hypersusceptibility defects of nipi-3 mutants. NIPI-3 is a negative regulator of CEBP-1, which in turn negatively regulates protective immune mechanisms. This pathway represents a previously unknown innate immune signaling pathway in intestinal epithelial cells that is involved in the surveillance of cellular homeostasis. Because NIPI-3 and CEBP-1 are also essential for C. elegans development, NIPI-3 is analogous to other key innate immune signaling molecules such as the Toll receptors in Drosophila that have an independent role during development.

  13. 5-Hydroxymethylcytosine in E-box motifs ACAT|GTG and ACAC|GTG increases DNA-binding of the B-HLH transcription factor TCF4.

    Science.gov (United States)

    Khund-Sayeed, Syed; He, Ximiao; Holzberg, Timothy; Wang, Jun; Rajagopal, Divya; Upadhyay, Shriyash; Durell, Stewart R; Mukherjee, Sanjit; Weirauch, Matthew T; Rose, Robert; Vinson, Charles

    2016-09-12

    We evaluated DNA binding of the B-HLH family members TCF4 and USF1 using protein binding microarrays (PBMs) containing double-stranded DNA probes with cytosine on both strands or 5-methylcytosine (5mC) or 5-hydroxymethylcytosine (5hmC) on one DNA strand and cytosine on the second strand. TCF4 preferentially bound the E-box motif (CAN|NTG) with strongest binding to the 8-mer CAG|GTGGT. 5mC uniformly decreases DNA binding of both TCF4 and USF1. The bulkier 5hmC also inhibited USF1 binding to DNA. In contrast, 5hmC dramatically enhanced TCF4 binding to E-box motifs ACAT|GTG and ACAC|GTG, being better bound than any 8-mer containing cytosine. Examination of X-ray structures of the closely related TCF3 and USF1 bound to DNA suggests TCF3 can undergo a conformational shift to preferentially bind to 5hmC while the USF1 basic region is bulkier and rigid precluding a conformation shift to bind 5hmC. These results greatly expand the regulatory DNA sequence landscape bound by TCF4.

  14. Crystal Structure of Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)-associated Csn2 Protein Revealed Ca[superscript 2+]-dependent Double-stranded DNA Binding Activity

    Energy Technology Data Exchange (ETDEWEB)

    Nam, Ki Hyun; Kurinov, Igor; Ke, Ailong (Cornell); (NWU)

    2012-05-22

    Clustered regularly interspaced short palindromic repeats (CRISPR) and their associated protein genes (cas genes) are widespread in bacteria and archaea. They form a line of RNA-based immunity to eradicate invading bacteriophages and malicious plasmids. A key molecular event during this process is the acquisition of new spacers into the CRISPR loci to guide the selective degradation of the matching foreign genetic elements. Csn2 is a Nmeni subtype-specific cas gene required for new spacer acquisition. Here we characterize the Enterococcus faecalis Csn2 protein as a double-stranded (ds-) DNA-binding protein and report its 2.7 {angstrom} tetrameric ring structure. The inner circle of the Csn2 tetrameric ring is {approx}26 {angstrom} wide and populated with conserved lysine residues poised for nonspecific interactions with ds-DNA. Each Csn2 protomer contains an {alpha}/{beta} domain and an {alpha}-helical domain; significant hinge motion was observed between these two domains. Ca{sup 2+} was located at strategic positions in the oligomerization interface. We further showed that removal of Ca{sup 2+} ions altered the oligomerization state of Csn2, which in turn severely decreased its affinity for ds-DNA. In summary, our results provided the first insight into the function of the Csn2 protein in CRISPR adaptation by revealing that it is a ds-DNA-binding protein functioning at the quaternary structure level and regulated by Ca{sup 2+} ions.

  15. Integrative modelling coupled with ion mobility mass spectrometry reveals structural features of the clamp loader in complex with single-stranded DNA binding protein.

    Science.gov (United States)

    Politis, Argyris; Park, Ah Young; Hall, Zoe; Ruotolo, Brandon T; Robinson, Carol V

    2013-11-29

    DNA polymerase III, a decameric 420-kDa assembly, simultaneously replicates both strands of the chromosome in Escherichia coli. A subassembly of this holoenzyme, the seven-subunit clamp loader complex, is responsible for loading the sliding clamp (β2) onto DNA. Here, we use structural information derived from ion mobility mass spectrometry (IM-MS) to build three-dimensional models of one form of the full clamp loader complex, γ3δδ'ψχ (254 kDa). By probing the interaction between the clamp loader and a single-stranded DNA (ssDNA) binding protein (SSB4) and by identifying two distinct conformational states, with and without ssDNA, we assemble models of ψχ-SSB4 (108 kDa) and the clamp loader-SSB4 (340 kDa) consistent with IM data. A significant increase in measured collision cross-section (~10%) of the clamp loader-SSB4 complex upon DNA binding suggests large conformational rearrangements. This DNA bound conformation represents the active state and, along with the presence of ψχ, stabilises the clamp loader-SSB4 complex. Overall, this study of a large heteromeric complex analysed by IM-MS, coupled with integrative modelling, highlights the potential of such an approach to reveal structural features of previously unknown complexes of high biological importance. Copyright © 2013 Elsevier Ltd. All rights reserved.

  16. Subunit-specific protein footprinting reveals significant structural rearrangements and a role for N-terminal Lys-14 of HIV-1 Integrase during viral DNA binding.

    Science.gov (United States)

    Zhao, Zhuojun; McKee, Christopher J; Kessl, Jacques J; Santos, Webster L; Daigle, Janet E; Engelman, Alan; Verdine, Gregory; Kvaratskhelia, Mamuka

    2008-02-29

    To identify functional contacts between HIV-1 integrase (IN) and its viral DNA substrate, we devised a new experimental strategy combining the following two methodologies. First, disulfide-mediated cross-linking was used to site-specifically link select core and C-terminal domain amino acids to respective positions in viral DNA. Next, surface topologies of free IN and IN-DNA complexes were compared using Lys- and Arg-selective small chemical modifiers and mass spectrometric analysis. This approach enabled us to dissect specific contacts made by different monomers within the multimeric complex. The foot-printing studies for the first time revealed the importance of a specific N-terminal domain residue, Lys-14, in viral DNA binding. In addition, a DNA-induced conformational change involving the connection between the core and C-terminal domains was observed. Site-directed mutagenesis experiments confirmed the importance of the identified contacts for recombinant IN activities and virus infection. These new findings provided major constraints, enabling us to identify the viral DNA binding channel in the active full-length IN multimer. The experimental approach described here has general application to mapping interactions within functional nucleoprotein complexes.

  17. Defining the DNA Binding Site Recognized by the Fission Yeast Zn2Cys6 Transcription Factor Pho7 and Its Role in Phosphate Homeostasis

    Directory of Open Access Journals (Sweden)

    Beate Schwer

    2017-08-01

    Full Text Available Fission yeast phosphate homeostasis entails transcriptional induction of genes encoding phosphate-mobilizing proteins under conditions of phosphate starvation. Transcription factor Pho7, a member of the Zn2Cys6 family of fungal transcription regulators, is the central player in the starvation response. The DNA binding sites in the promoters of phosphate-responsive genes have not been defined, nor have any structure-function relationships been established for the Pho7 protein. Here we narrow this knowledge gap by (i delineating an autonomous DNA-binding domain (DBD within Pho7 that includes the Zn2Cys6 module, (ii deploying recombinant Pho7 DBD in DNase I footprinting and electrophoretic mobility shift assays (EMSAs to map the Pho7 recognition sites in the promoters of the phosphate-regulated pho1 and tgp1 genes to a 12-nucleotide sequence motif [5′-TCG(G/C(A/TxxTTxAA], (iii independently identifying the same motif as a Pho7 recognition element via in silico analysis of available genome-wide ChIP-seq data, (iv affirming that mutations in the two Pho7 recognition sites in the pho1 promoter efface pho1 expression in vivo, and (v establishing that the zinc-binding cysteines and a pair of conserved arginines in the DBD are essential for Pho7 activity in vivo.

  18. An improved SELEX-Seq strategy for characterizing DNA-binding specificity of transcription factor: NF-κB as an example.

    Directory of Open Access Journals (Sweden)

    Guangming Gu

    Full Text Available SELEX-Seq is now the optimal high-throughput technique for characterizing DNA-binding specificities of transcription factors. In this study, we introduced an improved EMSA-based SELEX-Seq strategy with several advantages. The improvements of this strategy included: (1 using a FAM-labeled probe to track protein-DNA complex in polyacrylamide gel for rapidly recovering the protein-bound dsDNA without relying on traditional radioactive labeling or ethidium bromide staining; (2 monitoring the specificity of SELEX selection by detecting a positive and negative sequence doped into the input DNAs used in each round with PCR amplification; (3 using nested PCR to ensure the specificity of PCR amplification of the selected DNAs after each round; (4 using the nucleotides added at the 5' end of the nested PCR primers as the split barcode to code DNAs from various rounds for multiplexing sequencing samples. The split barcode minimized selection times and thus greatly simplified the current SELEX-Seq procedure. The reliability of the strategy was demonstrated by performing a successful SELEX-Seq of a well-known transcription factor, NF-κB. Therefore, this study provided a useful SELEX-Seq strategy for characterizing DNA-binding specificities of transcription factors.

  19. Deficiency of CCAAT/enhancer binding protein family DNA binding prevents malignant conversion of adenoma to carcinoma in NNK-induced lung carcinogenesis in the mouse

    Directory of Open Access Journals (Sweden)

    Kimura Shioko

    2012-12-01

    Full Text Available Abstract Background The CCAAT/enhancer binding proteins (C/EBPs play important roles in carcinogenesis of many tumors including the lung. Since multiple C/EBPs are expressed in lung, the combinatorial expression of these C/EBPs on lung carcinogenesis is not known. Methods A transgenic mouse line expressing a dominant negative A-C/EBP under the promoter of lung epithelial Clara cell secretory protein (CCSP gene in doxycycline dependent fashion was subjected to 4-(methylnitrosamino-1-(3-pyridyl-1-butanone (NNK-induced lung carcinogenesis bioassay in the presence and absence of doxycycline, and the effect of abolition of DNA binding activities of C/EBPs on lung carcinogenesis was examined. Results A-C/EBP expression was found not to interfere with tumor development; however, it suppressed the malignant conversion of adenoma to carcinoma during NNK-induced lung carcinogenesis. The results suggested that Ki67 may be used as a marker for lung carcinomas in mouse. Conclusions The DNA binding of C/EBP family members can be used as a potential molecular target for lung cancer therapy.

  20. Crystal structures of the DNA-binding domain tetramer of the p53 tumor suppressor family member p73 bound to different full-site response elements.

    Science.gov (United States)

    Ethayathulla, Abdul S; Nguyen, H Thien; Viadiu, Hector

    2013-02-15

    How cells choose between developmental pathways remains a fundamental biological question. In the case of the p53 protein family, its three transcription factors (p73, p63, and p53) each trigger a gene expression pattern that leads to specific cellular pathways. At the same time, these transcription factors recognize the same response element (RE) consensus sequences, and their transactivation of target genes overlaps. We aimed to understand target gene selectivity at the molecular level by determining the crystal structures of the p73 DNA-binding domain (DBD) in complex with full-site REs that vary in sequence. We report two structures of the p73 DBD bound as a tetramer to 20-bp full-site REs based on two distinct quarter-sites: GAACA and GAACC. Our study confirms that the DNA-binding residues are conserved within the p53 family, whereas the dimerization and tetramerization interfaces diverge. Moreover, a conserved lysine residue in loop L1 of the DBD senses the presence of guanines in positions 2 and 3 of the quarter-site RE, whereas a conserved arginine in loop 3 adapts to changes in position 5. Sequence variations in the RE elicit a p73 conformational response that might explain target gene specificity.

  1. Crystal structure of clustered regularly interspaced short palindromic repeats (CRISPR)-associated Csn2 protein revealed Ca2+-dependent double-stranded DNA binding activity.

    Science.gov (United States)

    Nam, Ki Hyun; Kurinov, Igor; Ke, Ailong

    2011-09-02

    Clustered regularly interspaced short palindromic repeats (CRISPR) and their associated protein genes (cas genes) are widespread in bacteria and archaea. They form a line of RNA-based immunity to eradicate invading bacteriophages and malicious plasmids. A key molecular event during this process is the acquisition of new spacers into the CRISPR loci to guide the selective degradation of the matching foreign genetic elements. Csn2 is a Nmeni subtype-specific cas gene required for new spacer acquisition. Here we characterize the Enterococcus faecalis Csn2 protein as a double-stranded (ds-) DNA-binding protein and report its 2.7 Å tetrameric ring structure. The inner circle of the Csn2 tetrameric ring is ∼26 Å wide and populated with conserved lysine residues poised for nonspecific interactions with ds-DNA. Each Csn2 protomer contains an α/β domain and an α-helical domain; significant hinge motion was observed between these two domains. Ca(2+) was located at strategic positions in the oligomerization interface. We further showed that removal of Ca(2+) ions altered the oligomerization state of Csn2, which in turn severely decreased its affinity for ds-DNA. In summary, our results provided the first insight into the function of the Csn2 protein in CRISPR adaptation by revealing that it is a ds-DNA-binding protein functioning at the quaternary structure level and regulated by Ca(2+) ions.

  2. The novel p.E89K mutation in the SRY gene inhibits DNA binding and causes the 46,XY disorder of sex development

    Directory of Open Access Journals (Sweden)

    J.L. Cunha

    2011-04-01

    Full Text Available Male sex determination in humans is controlled by the SRY gene, which encodes a transcriptional regulator containing a conserved high mobility group box domain (HMG-box required for DNA binding. Mutations in the SRY HMG-box affect protein function, causing sex reversal phenotypes. In the present study, we describe a 19-year-old female presenting 46,XY karyotype with hypogonadism and primary amenorrhea that led to the diagnosis of 46,XY complete gonadal dysgenesis. The novel p.E89K missense mutation in the SRY HMG-box was identified as a de novo mutation. Electrophoretic mobility shift assays showed that p.E89K almost completely abolished SRY DNA-binding activity, suggesting that it is the cause of SRY function impairment. In addition, we report the occurrence of the p.G95R mutation in a 46,XY female with complete gonadal dysgenesis. According to the three-dimensional structure of the human SRY HMG-box, the substitution of the conserved glutamic acid residue by the basic lysine at position 89 introduces an extra positive charge adjacent to and between the positively charged residues R86 and K92, important for stabilizing the HMG-box helix 2 with DNA. Thus, we propose that an electrostatic repulsion caused by the proximity of these positive charges could destabilize the tip of helix 2, abrogating DNA interaction.

  3. Combining H/D exchange mass spectroscopy and computational docking reveals extended DNA-binding surface on uracil-DNA glycosylase

    Science.gov (United States)

    Roberts, Victoria A.; Pique, Michael E.; Hsu, Simon; Li, Sheng; Slupphaug, Geir; Rambo, Robert P.; Jamison, Jonathan W.; Liu, Tong; Lee, Jun H.; Tainer, John A.; Ten Eyck, Lynn F.; Woods, Virgil L.

    2012-01-01

    X-ray crystallography provides excellent structural data on protein–DNA interfaces, but crystallographic complexes typically contain only small fragments of large DNA molecules. We present a new approach that can use longer DNA substrates and reveal new protein–DNA interactions even in extensively studied systems. Our approach combines rigid-body computational docking with hydrogen/deuterium exchange mass spectrometry (DXMS). DXMS identifies solvent-exposed protein surfaces; docking is used to create a 3-dimensional model of the protein–DNA interaction. We investigated the enzyme uracil-DNA glycosylase (UNG), which detects and cleaves uracil from DNA. UNG was incubated with a 30 bp DNA fragment containing a single uracil, giving the complex with the abasic DNA product. Compared with free UNG, the UNG–DNA complex showed increased solvent protection at the UNG active site and at two regions outside the active site: residues 210–220 and 251–264. Computational docking also identified these two DNA-binding surfaces, but neither shows DNA contact in UNG–DNA crystallographic structures. Our results can be explained by separation of the two DNA strands on one side of the active site. These non-sequence-specific DNA-binding surfaces may aid local uracil search, contribute to binding the abasic DNA product and help present the DNA product to APE-1, the next enzyme on the DNA-repair pathway. PMID:22492624

  4. De novo-engineered transcription activator-like effector (TALE) hybrid nuclease with novel DNA binding specificity creates double-strand breaks

    KAUST Repository

    Mahfouz, Magdy M.

    2011-01-24

    Site-specific and rare cutting nucleases are valuable tools for genome engineering. The generation of double-strand DNA breaks (DSBs) promotes homologous recombination in eukaryotes and can facilitate gene targeting, additions, deletions, and inactivation. Zinc finger nucleases have been used to generate DSBs and subsequently, for genome editing but with low efficiency and reproducibility. The transcription activator-like family of type III effectors (TALEs) contains a central domain of tandem repeats that could be engineered to bind specific DNA targets. Here, we report the generation of a Hax3-based hybrid TALE nuclease with a user-selected DNA binding specificity. We show that the engineered TALE nuclease can bind to its target sequence in vitro and that the homodimeric TALE nuclease can cleave double-stranded DNA in vitro if the DNA binding sites have the proper spacing and orientation. Transient expression assays in tobacco leaves suggest that the hybrid nuclease creates DSB in its target sequence, which is subsequently repaired by nonhomologous end-joining repair. Taken together, our data show the feasibility of engineering TALE-based hybrid nucleases capable of generating site-specific DSBs and the great potential for site-specific genome modification in plants and eukaryotes in general.

  5. C-terminal in Sp1-like artificial zinc-finger proteins plays crucial roles in determining their DNA binding affinity.

    Science.gov (United States)

    Zhang, Baozhen; Xiang, Shengyan; Yin, Yanru; Gu, Liankun; Deng, Dajun

    2013-12-01

    It is well known that the C-terminal zinc-finger-3 in transcription factor Sp1 contributes more than the N-terminal zinc-finger-1 in determining Sp1's DNA binding capacity. Sp1-like artificial poly-zinc-finger proteins (ZFPs) are powerful biotechnological tools for gene-specific recognization and manipulation. It is important to understand whether the C-terminal fingers in the Sp1-like artificial ZFPs remain crucial for their DNA binding ability. Recently, a set of p16 promoter-specific seven-ZFPs (7ZFPs) has been constructed to reactivate the expression of methylation-silenced p16. These 7ZFPs contain one N-terminal three-zinc-finger domain of Sp1 (3ZF), two Sp1-like two-zinc-finger domains derived from the Sp1 finger-2 and finger-3 (2ZF) in the middle and C-terminal regions. In the present study, sets of variants for several representative 7ZFPs with the p16-binding affinity were further constructed. This was accomplished through finger replacements and key amino acid mutations in the N-terminal fingers, C-terminal fingers, and linker peptide, respectively. Their p16-binding activity was analysed using gel mobility shift assays. Results showed that the motif replacement or a key amino acid mutation (S > R) at position +2 of the α-helix in the C-terminal 2ZF domain completely abolished their p16-binding affinity. Deletion of three amino acids in a consensus linker (TGEKP > TG) between finger-7 and the 6 × Histidine-tag in the C-terminal also dramatically abolished their binding affinity. In contrast, the replacement of the finger-3 in the N-terminal 3ZF domain did not affect their binding affinity, but decreased their binding stability. Altogether, the present study show that the C-terminal region may play crucial roles in determining the DNA binding affinity of Sp1-like artificial ZFPs.

  6. Suppression of Xo1-Mediated Disease Resistance in Rice by a Truncated, Non-DNA-Binding TAL Effector of Xanthomonas oryzae.

    Science.gov (United States)

    Read, Andrew C; Rinaldi, Fabio C; Hutin, Mathilde; He, Yong-Qiang; Triplett, Lindsay R; Bogdanove, Adam J

    2016-01-01

    Delivered into plant cells by type III secretion from pathogenic Xanthomonas species, TAL (transcription activator-like) effectors are nuclear-localized, DNA-binding proteins that directly activate specific host genes. Targets include genes important for disease, genes that confer resistance, and genes inconsequential to the host-pathogen interaction. TAL effector specificity is encoded by polymorphic repeats of 33-35 amino acids that interact one-to-one with nucleotides in the recognition site. Activity depends also on N-terminal sequences important for DNA binding and C-terminal nuclear localization signals (NLS) and an acidic activation domain (AD). Coding sequences missing much of the N- and C-terminal regions due to conserved, in-frame deletions are present and annotated as pseudogenes in sequenced strains of Xanthomonas oryzae pv. oryzicola (Xoc) and pv. oryzae (Xoo), which cause bacterial leaf streak and bacterial blight of rice, respectively. Here we provide evidence that these sequences encode proteins we call "truncTALEs," for "truncated TAL effectors." We show that truncTALE Tal2h of Xoc strain BLS256, and by correlation truncTALEs in other strains, specifically suppress resistance mediated by the Xo1 locus recently described in the heirloom rice variety Carolina Gold. Xo1-mediated resistance is triggered by different TAL effectors from diverse X. oryzae strains, irrespective of their DNA binding specificity, and does not require the AD. This implies a direct protein-protein rather than protein-DNA interaction. Similarly, truncTALEs exhibit diverse predicted DNA recognition specificities. And, in vitro, Tal2h did not bind any of several potential recognition sites. Further, a single candidate NLS sequence in Tal2h was dispensable for resistance suppression. Many truncTALEs have one 28 aa repeat, a length not observed previously. Tested in an engineered TAL effector, this repeat required a single base pair deletion in the DNA, suggesting that it or a

  7. Suppression of Xo1-mediated disease resistance in rice by a truncated, non-DNA-binding TAL effector of Xanthomonas oryzae

    Directory of Open Access Journals (Sweden)

    Andrew C. Read

    2016-10-01

    Full Text Available Delivered into plant cells by type III secretion from pathogenic Xanthomonas species, TAL (transcription activator-like effectors are nuclear-localized, DNA-binding proteins that directly activate specific host genes. Targets include genes important for disease, genes that confer resistance, and genes inconsequential to the host-pathogen interaction. TAL effector specificity is encoded by polymorphic repeats of 33-35 amino acids that interact one-to-one with nucleotides in the recognition site. Activity depends also on N-terminal sequences important for DNA binding and C-terminal nuclear localization signals (NLS and an acidic activation domain (AD. Coding sequences missing much of the N- and C-terminal regions due to conserved, in-frame deletions are present and annotated as pseudogenes in sequenced strains of X. oryzae pv. oryzicola (Xoc and pv. oryzae (Xoo, which cause bacterial leaf streak and bacterial blight of rice, respectively. Here we provide evidence that these sequences encode proteins we call ‘truncTALEs,’ for ‘truncated TAL effectors.’ We show that truncTALE Tal2h of Xoc strain BLS256, and by correlation truncTALEs in other strains, specifically suppress resistance mediated by the Xo1 locus recently described in the heirloom rice variety Carolina Gold. Xo1-mediated resistance is triggered by different TAL effectors from diverse X. oryzae strains, irrespective of their DNA binding specificity, and does not require the AD. This implies a direct protein-protein rather than protein-DNA interaction. Similarly, truncTALEs exhibit diverse predicted DNA recognition specificities. And, in vitro, Tal2h did not bind any of several potential recognition sites. Further, a single candidate NLS sequence in Tal2h was dispensable for resistance suppression. Many truncTALEs have one 28 aa repeat, a length not observed previously. Tested in an engineered TAL effector, this repeat required a single base pair deletion in the DNA, suggesting

  8. Genome-Wide Analysis of the bZIP Gene Family Identifies Two ABI5-Like bZIP Transcription Factors, BrABI5a and BrABI5b, as Positive Modulators of ABA Signalling in Chinese Cabbage.

    Directory of Open Access Journals (Sweden)

    Yili Bai

    Full Text Available bZIP (basic leucine zipper transcription factors coordinate plant growth and development and control responses to environmental stimuli. The genome of Chinese cabbage (Brassica rapa encodes 136 putative bZIP transcription factors. The bZIP transcription factors in Brassica rapa (BrbZIP are classified into 10 subfamilies. Phylogenetic relationship analysis reveals that subfamily A consists of 23 BrbZIPs. Two BrbZIPs within subfamily A, Bra005287 and Bra017251, display high similarity to ABI5 (ABA Insensitive 5. Expression of subfamily A BrbZIPs, like BrABI5a (Bra005287/BrbZIP14 and BrABI5b (Bra017251/BrbZIP13, are significantly induced by the plant hormone ABA. Subcellular localization assay reveal that both BrABI5a and BrABI5b have a nuclear localization. BrABI5a and BrABI5b could directly stimulate ABA Responsive Element-driven HIS (a HIS3 reporter gene, which confers His prototrophy or LUC (LUCIFERASE expression in yeast and Arabidopsis protoplast. Deletion of the bZIP motif abolished BrABI5a and BrABI5b transcriptional activity. The ABA insensitive phenotype of Arabidopsis abi5-1 is completely suppressed in transgenic lines expressing BrABI5a or BrABI5b. Overall, these results suggest that ABI5 orthologs, BrABI5a and BrABI5b, have key roles in ABA signalling in Chinese cabbage.

  9. Isolation and characterization of a gene from Medicago sativa L., encoding a bZIP transcription factor.

    Science.gov (United States)

    Li, Yan; Sun, Yan; Yang, Qingchuan; Fang, Feng; Kang, Junmei; Zhang, Tiejun

    2013-02-01

    A full-length cDNA of 1,537 nucleotides was cloned from Medicago sativa L. cv. "Zhongmu No. 1" by rapid amplification of cDNA ends. It was designated as MsZIP, encoding a protein of 340 amino acids. The protein molecular weight was 36.43 kDa, and the theoretical isoelectric point was 5.72. The MsZIP preferentially localized in nucleus and have signal peptide. Blast analysis revealed that MsZIP shared the highest homology with some bZIP proteins of M. truncatula. The transcript of MsZIP was strongly enriched in leaf compared with root and stem of mature alfalfa plants. MsZIP was strongly induced by 15 % PEG6000 (polyethylene glycol), 50 μM abscisic acid, 200 mM NaCl, 70 μM gibberellic acid, 5 mM salicylic acid and 200 μM methyl jasmonate. Physiological resistance parameters were measured in the transgenic tobacco. Malondialdehyde content, relative water content, soluble sugar content, soluble protein content and proline content in transgenic tobacco increased compared with non-transgenic tobacco under salt stress or drought stress. The results showed that accumulation of the MsZIP protein in the vegetative tissues of transgenic plants enhanced their tolerance to osmotic pressure stress. These results demonstrate a role for the MsZIP protein in stress protection and suggest the potential of the MsZIP gene for genetic engineering of salt tolerance and drought tolerance.

  10. ATF3, an HTLV-1 bZip factor binding protein, promotes proliferation of adult T-cell leukemia cells

    Directory of Open Access Journals (Sweden)

    Ohshima Koichi

    2011-03-01

    Full Text Available Abstract Background Adult T-cell leukemia (ATL is an aggressive malignancy of CD4+ T-cells caused by human T-cell leukemia virus type 1 (HTLV-1. The HTLV-1 bZIP factor (HBZ gene, which is encoded by the minus strand of the viral genome, is expressed as an antisense transcript in all ATL cases. By using yeast two-hybrid screening, we identified activating transcription factor 3 (ATF3 as an HBZ-interacting protein. ATF3 has been reported to be expressed in ATL cells, but its biological significance is not known. Results Immunoprecipitation analysis confirmed that ATF3 interacts with HBZ. Expression of ATF3 was upregulated in ATL cell lines and fresh ATL cases. Reporter assay revealed that ATF3 could interfere with the HTLV-1 Tax's transactivation of the 5' proviral long terminal repeat (LTR, doing so by affecting the ATF/CRE site, as well as HBZ. Suppressing ATF3 expression inhibited proliferation and strongly reduced the viability of ATL cells. As mechanisms of growth-promoting activity of ATF3, comparative expression profiling of ATF3 knockdown cells identified candidate genes that are critical for the cell cycle and cell death, including cell division cycle 2 (CDC2 and cyclin E2. ATF3 also enhanced p53 transcriptional activity, but this activity was suppressed by HBZ. Conclusions Thus, ATF3 expression has positive and negative effects on the proliferation and survival of ATL cells. HBZ impedes its negative effects, leaving ATF3 to promote proliferation of ATL cells via mechanisms including upregulation of CDC2 and cyclin E2. Both HBZ and ATF3 suppress Tax expression, which enables infected cells to escape the host immune system.

  11. Characterization of pollen-expressed bZIP protein interactions and the role of ATbZIP18 in the male gametophyte

    Czech Academy of Sciences Publication Activity Database

    Gibalová, Antónia; Steinbachová, Lenka; Hafidh, Said; Bláhová, Veronika; Gadiou, Zuzana; Michailidis, Christos; Müller, Karel; Pleskot, Roman; Dupľáková, Nikoleta; Honys, David

    2017-01-01

    Roč. 30, č. 1 (2017), s. 1-17 ISSN 2194-7953 R&D Projects: GA ČR GA15-22720S; GA ČR(CZ) GA14-32292S; GA ČR GP13-41444P; GA MŠk(CZ) LD14109 Institutional support: RVO:61389030 Keywords : reticulum stress-response * transcription factor * arabidopsis-thaliana * molecular-interactions * plant transformation * gene-expression * heterodimerization * dimerization * evolution * specificity * bZIP * Transcription factors * Regulatory network * Male gametophyte * y2h * Pollen development Subject RIV: ED - Physiology Impact factor: 2.629, year: 2016

  12. Novel de novo variant in EBF3 is likely to impact DNA binding in a patient with a neurodevelopmental disorder and expanded phenotypes: patient report, in silico functional assessment, and review of published cases

    OpenAIRE

    Blackburn, Patrick; Barnett, Sarah S.; Zimmermann, Michael T.; Cousin, Margot A.; Kaiwar, Charu; Pinto e Vairo,Filippo; Niu, Zhiyv; Ferber, Matthew J.; Urrutia, Raul A.; Selcen, Duygu; Eric W. Klee; Pichurin, Pavel N.

    2017-01-01

    Pathogenic variants in EBF3 were recently described in three back-to-back publications in association with a novel neurodevelopmental disorder characterized by intellectual disability, speech delay, ataxia, and facial dysmorphisms. In this report, we describe an additional patient carrying a de novo missense variant in EBF3 (c.487C>T, p.(Arg163Trp)) that falls within a conserved residue in the zinc knuckle motif of the DNA binding domain. Without a solved structure of the DNA binding domain, ...

  13. Crystal structure of family 4 uracil-DNA glycosylase from Sulfolobus tokodaii and a function of tyrosine 170 in DNA binding.

    Science.gov (United States)

    Kawai, Akito; Higuchi, Shigesada; Tsunoda, Masaru; Nakamura, Kazuo T; Yamagata, Yuriko; Miyamoto, Shuichi

    2015-09-14

    Uracil-DNA glycosylases (UDGs) excise uracil from DNA by catalyzing the N-glycosidic bond hydrolysis. Here we report the first crystal structures of an archaeal UDG (stoUDG). Compared with other UDGs, stoUDG has a different structure of the leucine-intercalation loop, which is important for DNA binding. The stoUDG-DNA complex model indicated that Leu169, Tyr170, and Asn171 in the loop are involved in DNA intercalation. Mutational analysis showed that Tyr170 is critical for substrate DNA recognition. These results indicate that Tyr170 occupies the intercalation site formed after the structural change of the leucine-intercalation loop required for the catalysis. Copyright © 2015 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.

  14. Biomolecular mirror-image recognition: reciprocal chiral-specific DNA binding of synthetic enantiomers of zinc finger domain from GAGA factor.

    Science.gov (United States)

    Negi, Shigeru; Dhanasekaran, Muthu; Hirata, Tsuyoshi; Urata, Hidehito; Sugiura, Yukio

    2006-05-05

    To experimentally demonstrate the mirror-image recognition in protein and DNA interaction, we have designed a small DNA-binding peptide based on the zinc-finger domain of GAGA transcription factor. Circular dichroism data suggest that the conformations of peptide enantiomers as well as the DNA enantiomers have a mirror-image relationship. The gel mobility shift assay showed that the synthetic enantiomers of the peptide showed reciprocal chiral-specific interactions with the DNA; the natural L-peptide binds specifically with the natural D-DNA substrate, and the unnatural D-peptide binds specifically with the unnatural L-DNA substrate. The present data imply that the folding of the L- and D-enantiomers of the peptide as well as the DNA substrates are exact mirror images of each other in 3-D structure and biological activity, and generalize the chiral-specific nature of biomolecular interaction. 2006 Wiley-Liss, Inc.

  15. DNA binding sites recognised in vitro by a knotted class 1 homeodomain protein encoded by the hooded gene, k, in barley (Hordeum vulgare)

    DEFF Research Database (Denmark)

    Krusell, L; Rasmussen, I; Gausing, K

    1997-01-01

    The homeodomain of the knotted classes of transcription factors from plants differs from the well characterized Antp/En type homeodomains from Drosophila at key amino acid residues contributing to the DNA binding. A cDNA, Hvh21, derived from the hooded gene and encoding a full length homolog...... of knotted1 from maize was isolated from barley seedlings and expressed as a maltose binding protein fusion in E. coli. The purified HvH21-fusion protein selected DNA fragments with 1-3 copies of the sequence TGAC. Gel shift experiments showed that the TGAC element was required for binding and the results...... further indicate that the HvH21-fusion protein binds DNA as a monomer. Udgivelsesdato: 1997-May-12...

  16. Synthesis, characterization, X-ray crystal structure, DFT calculation, DNA binding, and antimicrobial assays of two new mixed-ligand copper(II) complexes

    Science.gov (United States)

    Ebrahimipour, S. Yousef; Sheikhshoaie, Iran; Mohamadi, Maryam; Suarez, Sebastian; Baggio, Ricardo; Khaleghi, Moj; Torkzadeh-Mahani, Masoud; Mostafavi, Ali

    2015-05-01

    Two new Cu(II) complexes, [Cu(L)(phen)] (1), [Cu(L)(bipy)] (2), where L2- = (3-methoxy-2oxidobenzylidene)benzohydrazidato, phen = 1,10 phenanthroline, and bipy = 2,2‧ bipyridine, were prepared and fully characterized using elemental analyses, FT-IR, molar conductivity, and electronic spectra. The structures of both complexes were also determined by X-ray diffraction. It was found that, both complexes possessed square pyramidal coordination environment in which, Cu(II) ions were coordinated by donor atoms of HL and two nitrogens of heterocyclic bases. Computational studies were performed using DFT calculations at B3LYP/6-311+G(d,p) level of theory. DNA binding activities of these complexes were also investigated using electronic absorption, competitive fluorescence titration and cyclic voltammetry studies. The obtained results indicated that binding of the complexes to DNA was of intercalative mode. Furthermore, antimicrobial activities of these compounds were screened against microorganisms.

  17. Synthesis and structure elucidation of a copper(II) Schiff-base complex: in vitro DNA binding, pBR322 plasmid cleavage and HSA binding studies.

    Science.gov (United States)

    Tabassum, Sartaj; Ahmad, Musheer; Afzal, Mohd; Zaki, Mehvash; Bharadwaj, Parimal K

    2014-11-01

    New copper(II) complex with Schiff base ligand 4-[(2-Hydroxy-3-methoxy-benzylidene)-amino]-benzoic acid (H₂L) was synthesized and characterized by spectroscopic and analytical and single crystal X-ray diffraction studies which revealed that the complex 1 exist in a distorted octahedral environment. In vitro CT-DNA binding studies were performed by employing different biophysical technique which indicated that the 1 strongly binds to DNA in comparison to ligand via electrostatic binding mode. Complex 1 cleaves pBR322 DNA via hydrolytic pathway and recognizes minor groove of DNA double helix. The HSA binding results showed that ligand and complex 1 has ability to quench the fluorescence emission intensity of Trp 214 residue available in the subdomain IIA of HSA. Copyright © 2014 Elsevier B.V. All rights reserved.

  18. Toxin inhibition in C. crescentus VapBC1 is mediated by a flexible pseudo-palindromic protein motif and modulated by DNA binding

    DEFF Research Database (Denmark)

    Bendtsen, Kirstine Louise; Xu, Kehan; Luckmann, Majbritt

    2017-01-01

    Expression of bacterial type II toxin-antitoxin (TA) systems is regulated at the transcriptional level through direct binding of the antitoxin to pseudo-palindromic sequences on operator DNA. In this context, the toxin functions as a co-repressor by stimulating DNA binding through direct...... for binding and inactivation of the VapC1 toxin dimer. Sequence analysis of 4127 orthologous VapB sequences reveals that such palindromic protein sequences are widespread and unique to bacterial and archaeal VapB antitoxins suggesting a general principle governing regulation of VapBC TA systems. Finally......, a structure of C-terminally truncated VapB1 bound to VapC1 reveals discrete states of the TA interaction that suggest a structural basis for toxin activation in vivo....

  19. The Kaposi Sarcoma Herpesvirus Latency-associated Nuclear Antigen DNA Binding Domain Dorsal Positive Electrostatic Patch Facilitates DNA Replication and Episome Persistence.

    Science.gov (United States)

    Li, Shijun; Tan, Min; Juillard, Franceline; Ponnusamy, Rajesh; Correia, Bruno; Simas, J Pedro; Carrondo, Maria A; McVey, Colin E; Kaye, Kenneth M

    2015-11-20

    Kaposi sarcoma-associated herpesvirus (KSHV) has a causative role in several human malignancies. KSHV latency-associated nuclear antigen (LANA) mediates persistence of viral episomes in latently infected cells. LANA mediates KSHV DNA replication and segregates episomes to progeny nuclei. The structure of the LANA DNA binding domain was recently solved, revealing a positive electrostatic patch opposite the DNA binding surface, which is the site of BET protein binding. Here we investigate the functional role of the positive patch in LANA-mediated episome persistence. As expected, LANA mutants with alanine or glutamate substitutions in the central, peripheral, or lateral portions of the positive patch maintained the ability to bind DNA by EMSA. However, all of the substitution mutants were deficient for LANA DNA replication and episome maintenance. Mutation of the peripheral region generated the largest deficiencies. Despite these deficiencies, all positive patch mutants concentrated to dots along mitotic chromosomes in cells containing episomes, similar to LANA. The central and peripheral mutants, but not the lateral mutants, were reduced for BET protein interaction as assessed by co-immunoprecipitation. However, defects in BET protein binding were independent of episome maintenance function. Overall, the reductions in episome maintenance closely correlated with DNA replication deficiencies, suggesting that the replication defects account for the reduced episome persistence. Therefore, the electrostatic patch exerts a key role in LANA-mediated DNA replication and episome persistence and may act through a host cell partner(s) other than a BET protein or by inducing specific structures or complexes. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  20. Archaeal chromatin proteins histone HMtB and Alba have lost DNA-binding ability in laboratory strains of Methanothermobacter thermautotrophicus.

    Science.gov (United States)

    Sandman, Kathleen; Louvel, Hélène; Samson, Rachel Y; Pereira, Suzette L; Reeve, John N

    2008-11-01

    Alignments of the sequences of the all members of the archaeal histone and Alba1 families of chromatin proteins identified isoleucine residues, I19 in HMtB and I39 in MtAlba, in Methanothermobacter thermautotrophicus, at locations predicted to be directly involved in DNA binding. In all other HMfB family members, residue 19 is an arginine (R19), and either arginine or lysine is present in almost all other Alba1 family members at the structural site equivalent to I39 in MtAlba. Electrophoretic mobility shift assays revealed that recombinant HMtB and MtAlba do not bind DNA, but variants constructed with R19 and R39, respectively, bound DNA; and whereas MtAlba(I19) did not bind RNA, MtAlba(R19) bound both single stranded RNA and tRNA. Amplification and sequencing of MT0254 (encodes HMtB) and MT1483 (encodes MtAlba) from several Methanothermobacter thermautotrophicus lineages has revealed that HMtB and MtAlba had arginine residues at positions 19 and 39, respectively, in the original isolate and that spontaneous mutations must have occurred, and been fixed, in some laboratory lineages that now have HMtB(I19) and MtAlba(I39). The retention of these variants suggests some continuing functions and fusion of the HMtB(I19) sequence to HMtA2 resulted in a protein that folds to form a histone fold heterodimer that binds and compacts DNA. The loss of DNA binding by HMtB(I19) does not therefore prevent HMtB from participating in DNA interactions as one partner of an archaeal histone heterodimer.

  1. Distinct Structural Features of G Protein-Coupled Receptor Kinase 5 (GRK5) Regulate Its Nuclear Localization and DNA-Binding Ability

    Science.gov (United States)

    Johnson, Laura R.; Robinson, James D.; Lester, Katrina N.; Pitcher, Julie A.

    2013-01-01

    G protein-coupled receptor kinases (GRKs) act to desensitize G protein-coupled receptors (GPCRs). In addition to this role at the plasma membrane, a nuclear function for GRK5, a member of the GRK4 subfamily of GRKs, has been reported. GRK5 phosphorylates and promotes the nuclear export of the histone deacetylase, HDAC5. Here we demonstrate that the possession of a nuclear localization sequence (NLS) is a common feature of GRK4 subfamily members (GRKs 4, 5 and 6). However, the location of the NLS and the ability of these GRKs to bind DNA in vitro are different. The NLSs of GRK5 and 6 bind DNA in vitro, whilst the NLS of GRK4 does not. Using mutants of GRK5 we identify the regions of GRK5 required for DNA-binding in vitro and nuclear localization in cells. The DNA-binding ability of GRK5 requires both the NLS and an N-terminal calmodulin (CaM)-binding site. A functional nuclear export sequence (NES), required for CaM-dependent nuclear export of the kinase, is also identified. Based on our observations we propose a model to explain how nuclear localization of GRK5 may be regulated. Notably, the nuclear localization of GRK5 and 6 is differentially regulated. These results suggest subfamily specific nuclear functions for the GRK4 subfamily members. Identification of GRK specific small molecule inhibitors of nuclear localization and/or function for the GRK4 subfamily may thus be an achievable goal. PMID:23658733

  2. Visual Detection of Single-Base Mismatches in DNA Using Hairpin Oligonucleotide with Double-Target DNA Binding Sequences and Gold Nanoparticles

    Science.gov (United States)

    He, Yuqing; Zhang, Xibao; Zhang, Sanquan; Kris, Mak Ka Long; Man, Fong Chi; Liu, Guodong

    2014-01-01

    We describe a hairpin oligonucleotide (HO) with double-target DNA binding sequences in the loop and 11-base in the stem for visual detection of single-base mismatches (SBM) in DNA with highly specificity. The thiol-modified HO was immobilized on gold nanoparticle (Au-NP) surface through a self-assembling process. The strategy of detecting SBM depends on the unique molecular recognition properties of HO to the perfect-matched DNA and SBM to generate different quantities of duplex DNA on the Au-NP surface, which are captured on the test zone of lateral flow test strip via the DNA hybridization reaction between the duplex DNA and preimmobilized DNA probe. Accumulation of Au-NPs produces the characteristic red bands, enabling visual detection of SBM. It was found that the ability of HO to differentiate perfect-matched DNA and SBM was increased dramatically by incorporating double-target DNA binding sequences in the loop of HO. The signal ratio between perfect-matched DNA and SBM was up to 28, which is much higher than that of conventional HO or molecular beacon. The approach was applied to detect the mutation sites, Arg142Cys and Gly529Ile, of transglutaminase 1 gene in autosomal recessive congenital ichthyosis. The results presented here show that the new HO is a potential molecular recognition probe for the future development of nucleic acid-based biosensors and bioassays. The approach can be used for point-of-care diagnosis of genetic diseases and detecting infectious agents or warning against bio-warfare agents. PMID:22386491

  3. Linchpin DNA-binding residues serve as go/no-go controls in the replication factor C-catalyzed clamp-loading mechanism.

    Science.gov (United States)

    Liu, Juan; Zhou, Yayan; Hingorani, Manju M

    2017-09-22

    DNA polymerases depend on circular sliding clamps for processive replication. Clamps must be loaded onto primer-template DNA (ptDNA) by clamp loaders that open and close clamps around ptDNA in an ATP-fueled reaction. All clamp loaders share a core structure in which five subunits form a spiral chamber that binds the clamp at its base in a twisted open form and encloses ptDNA within, while binding and hydrolyzing ATP to topologically link the clamp and ptDNA. To understand how clamp loaders perform this complex task, here we focused on conserved arginines that might play a central coordinating role in the mechanism because they can alternately contact ptDNA or Walker B glutamate in the ATPase site and lie close to the clamp loader-clamp-binding interface. We mutated Arg-84, Arg-88, and Arg-101 in the ATPase-active B, C, and D subunits of Saccharomyces cerevisiae replication factor C (RFC) clamp loader, respectively, and assessed the impact on multiple transient events in the reaction: proliferating cell nuclear antigen (PCNA) clamp binding/opening/closure/release, ptDNA binding/release, and ATP hydrolysis/product release. The results show that these arginines relay critical information between the PCNA-binding, DNA-binding, and ATPase sites at all steps of the reaction, particularly at a checkpoint before RFC commits to ATP hydrolysis. Moreover, their actions are subunit-specific with RFC-C Arg-88 serving as an accelerator that enables rapid ATP hydrolysis upon contact with ptDNA and RFC-D Arg-101 serving as a brake that confers specificity for ptDNA as the correct substrate for loading PCNA. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  4. Single-Nucleotide-Specific Targeting of the Tf1 Retrotransposon Promoted by the DNA-Binding Protein Sap1 of Schizosaccharomyces pombe.

    Science.gov (United States)

    Hickey, Anthony; Esnault, Caroline; Majumdar, Anasuya; Chatterjee, Atreyi Ghatak; Iben, James R; McQueen, Philip G; Yang, Andrew X; Mizuguchi, Takeshi; Grewal, Shiv I S; Levin, Henry L

    2015-11-01

    Transposable elements (TEs) constitute a substantial fraction of the eukaryotic genome and, as a result, have a complex relationship with their host that is both adversarial and dependent. To minimize damage to cellular genes, TEs possess mechanisms that target integration to sequences of low importance. However, the retrotransposon Tf1 of Schizosaccharomyces pombe integrates with a surprising bias for promoter sequences of stress-response genes. The clustering of integration in specific promoters suggests that Tf1 possesses a targeting mechanism that is important for evolutionary adaptation to changes in environment. We report here that Sap1, an essential DNA-binding protein, plays an important role in Tf1 integration. A mutation in Sap1 resulted in a 10-fold drop in Tf1 transposition, and measures of transposon intermediates support the argument that the defect occurred in the process of integration. Published ChIP-Seq data on Sap1 binding combined with high-density maps of Tf1 integration that measure independent insertions at single-nucleotide positions show that 73.4% of all integration occurs at genomic sequences bound by Sap1. This represents high selectivity because Sap1 binds just 6.8% of the genome. A genome-wide analysis of promoter sequences revealed that Sap1 binding and amounts of integration correlate strongly. More important, an alignment of the DNA-binding motif of Sap1 revealed integration clustered on both sides of the motif and showed high levels specifically at positions +19 and -9. These data indicate that Sap1 contributes to the efficiency and position of Tf1 integration. Copyright © 2015 by the Genetics Society of America.

  5. THAP5 is a DNA-binding transcriptional repressor that is regulated in melanoma cells during DNA damage-induced cell death

    Energy Technology Data Exchange (ETDEWEB)

    Balakrishnan, Meenakshi P.; Cilenti, Lucia; Ambivero, Camilla [Biomolecular Science Center, Burnett School of Biomedical Sciences, College of Medicine, University of Central Florida, Orlando, FL (United States); Goto, Yamafumi [Department of Dermatology, Shinshu University School of Medicine, Matsumoto (Japan); Takata, Minoru [Department of Dermatology, Okayama University Graduate School of Medical Dentistry and Pharmaceutical Sciences, Okayama (Japan); Turkson, James; Li, Xiaoman Shawn [Biomolecular Science Center, Burnett School of Biomedical Sciences, College of Medicine, University of Central Florida, Orlando, FL (United States); Zervos, Antonis S., E-mail: azervos@mail.ucf.edu [Biomolecular Science Center, Burnett School of Biomedical Sciences, College of Medicine, University of Central Florida, Orlando, FL (United States)

    2011-01-07

    Research highlights: {yields} THAP5 is a DNA-binding protein and a transcriptional repressor. {yields} THAP5 is induced in melanoma cells upon exposure to UV or treatment with cisplatin. {yields} THAP5 induction correlates with the degree of apoptosis in melanoma cell population. {yields} THAP5 is a pro-apoptotic protein involved in melanoma cell death. -- Abstract: THAP5 was originally isolated as a specific interactor and substrate of the mitochondrial pro-apoptotic Omi/HtrA2 protease. It is a human zinc finger protein characterized by a restricted pattern of expression and the lack of orthologs in mouse and rat. The biological function of THAP5 is unknown but our previous studies suggest it could regulate G2/M transition in kidney cells and could be involved in human cardiomyocyte cell death associated with coronary artery disease (CAD). In this report, we expanded our studies on the properties and function of THAP5 in human melanoma cells. THAP5 was expressed in primary human melanocytes as well as in all melanoma cell lines that were tested. THAP5 protein level was significantly induced by UV irradiation or cisplatin treatment, conditions known to cause DNA damage. The induction of THAP5 correlated with a significant increase in apoptotic cell death. In addition, we show that THAP5 is a nuclear protein that could recognize and bind a specific DNA motif. THAP5 could also repress the transcription of a reporter gene in a heterologous system. Our work suggests that THAP5 is a DNA-binding protein and a transcriptional repressor. Furthermore, THAP5 has a pro-apoptotic function and it was induced in melanoma cells under conditions that promoted cell death.

  6. The WYL domain of the PIF1 helicase from the thermophilic bacterium Thermotoga elfii is an accessory single-stranded DNA binding module.

    Science.gov (United States)

    Andis, Nicholas M; Sausen, Christopher W; Alladin, Ashna; Bochman, Matthew

    2018-01-17

    PIF1 family helicases are conserved from bacteria to man. With the exception of the well-studied yeast PIF1 helicases (e.g., ScPif1 and ScRrm3), however, very little is known about how these enzymes help maintain genome stability. Indeed, we lack a basic understanding of the protein domains found N- and C-terminal to the characteristic central PIF1 helicase domain in these proteins. Here, using chimeric constructs, we show that the ScPif1 and ScRrm3 helicase domains are interchangeable and that the N-terminus of ScRrm3 is important for its function in vivo. This suggests that PIF1 family helicases evolved functional modules fused to a generic motor domain. To investigate this hypothesis, we characterized the biochemical activities of the PIF1 helicase from the thermophilic bacterium Thermotoga elfii (TePif1), which contains a C-terminal WYL domain of unknown function. Like helicases from other thermophiles, recombinant TePif1 was easily prepared, thermostable in vitro, and displayed activities similar to its eukaryotic homologs. We also found that the WYL domain was necessary for high-affinity single-stranded DNA (ssDNA) binding and affected both ATPase and helicase activities. Deleting the WYL domain from TePif1 or mutating conserved residues in the predicted ssDNA binding site uncoupled ATPase activity and DNA unwinding, leading to higher rates of ATP hydrolysis but less efficient DNA helicase activity. Our findings suggest that the domains of unknown function found in eukaryotic PIF1 helicases may also confer functional specificity and additional activities to these enzymes, which should be investigated in future work.

  7. Identification of DNA-binding protein target sequences by physical effective energy functions: free energy analysis of lambda repressor-DNA complexes.

    Directory of Open Access Journals (Sweden)

    Caselle Michele

    2007-09-01

    Full Text Available Abstract Background Specific binding of proteins to DNA is one of the most common ways gene expression is controlled. Although general rules for the DNA-protein recognition can be derived, the ambiguous and complex nature of this mechanism precludes a simple recognition code, therefore the prediction of DNA target sequences is not straightforward. DNA-protein interactions can be studied using computational methods which can complement the current experimental methods and offer some advantages. In the present work we use physical effective potentials to evaluate the DNA-protein binding affinities for the λ repressor-DNA complex for which structural and thermodynamic experimental data are available. Results The binding free energy of two molecules can be expressed as the sum of an intermolecular energy (evaluated using a molecular mechanics forcefield, a solvation free energy term and an entropic term. Different solvation models are used including distance dependent dielectric constants, solvent accessible surface tension models and the Generalized Born model. The effect of conformational sampling by Molecular Dynamics simulations on the computed binding energy is assessed; results show that this effect is in general negative and the reproducibility of the experimental values decreases with the increase of simulation time considered. The free energy of binding for non-specific complexes, estimated using the best energetic model, agrees with earlier theoretical suggestions. As a results of these analyses, we propose a protocol for the prediction of DNA-binding target sequences. The possibility of searching regulatory elements within the bacteriophage λ genome using this protocol is explored. Our analysis shows good prediction capabilities, even in absence of any thermodynamic data and information on the naturally recognized sequence. Conclusion This study supports the conclusion that physics-based methods can offer a completely complementary

  8. Crystal structure and DNA-binding property of the ATPase domain of bacterial mismatch repair endonuclease MutL from Aquifex aeolicus.

    Science.gov (United States)

    Fukui, Kenji; Iino, Hitoshi; Baba, Seiki; Kumasaka, Takashi; Kuramitsu, Seiki; Yano, Takato

    2017-09-01

    DNA mismatch repair (MMR) system corrects mismatched bases that are generated mainly by DNA replication errors. The repair system excises the error-containing single-stranded region and enables the re-synthesis of the strand. In the early reactions of MMR, MutL endonuclease incises the newly-synthesized/error-containing strand of the duplex to initiate the downstream excision reaction. MutL endonuclease consists of the N-terminal ATPase and C-terminal endonuclease domains. In this study, we report the crystal structure of the ATPase domain of MutL endonuclease from Aquifex aeolicus. The overall structure of the domain was similar to those of human MutL homologs and Escherichia coli MutL, although E. coli MutL has no endonuclease activity. The ATPase domain was comprised of two subdomains: the N-terminal ATP-binding subdomain and the C-terminal α-β sandwich subdomain. Site-directed mutagenesis experiment identified DNA-interacting eight basic amino acid residues, which were distributed across both the two subdomains and formed a DNA-binding cleft. Docking simulation between the structures of the ATPase and endonuclease domains generated a reliable model structure for the full-length A. aeolicus MutL, which satisfies our previous result of small-angle X-ray scattering analysis. On the basis of the model structure and further experimental results, we concluded that the two separate DNA-binding sites in the full-length A. aeolicus MutL simultaneously bind a dsDNA molecule. Copyright © 2017 Elsevier B.V. All rights reserved.

  9. B-Myb promotes S-phase independently of its sequence-specific DNA binding activity and interacts with polymerase delta-interacting protein 1 (Pdip1)

    Science.gov (United States)

    Werwein, Eugen; Schmedt, Thore; Hoffmann, Heiko; Usadel, Clemens; Obermann, Nora; Singer, Jeffrey D.; Klempnauer, Karl-Heinz

    2012-01-01

    B-Myb is a highly conserved member of the Myb transcription factor family, which plays an essential role in cell cycle progression by regulating the transcription of genes at the G2/M-phase boundary. The role of B-Myb in other parts of the cell cycle is less well-understood. By employing siRNA-mediated silencing of B-Myb expression, we found that B-Myb is required for efficient entry into S-phase. Surprisingly, a B-Myb mutant that lacks sequence-specific DNA-binding activity and is unable to activate transcription of B-Myb target genes is able to rescue the S-phase defect observed after B-Myb knockdown. Moreover, we have identified polymerase delta-interacting protein 1 (Pdip1), a BTB domain protein known to bind to the DNA replication and repair factor PCNA as a novel B-Myb interaction partner. We have shown that Pdip1 is able to interact with B-Myb and PCNA simultaneously. In addition, we found that a fraction of endogenous B-Myb can be co-precipitated via PCNA, suggesting that B-Myb might be involved in processes related to DNA replication or repair. Taken together, our work suggests a novel role for B-Myb in S-phase that appears to be independent of its sequence-specific DNA-binding activity and its ability to stimulate the expression of bona fide B-Myb target genes. PMID:23032261

  10. Structural analysis of DNA binding by C.Csp231I, a member of a novel class of R-M controller proteins regulating gene expression

    Energy Technology Data Exchange (ETDEWEB)

    Shevtsov, M. B.; Streeter, S. D.; Thresh, S.-J.; Swiderska, A.; McGeehan, J. E.; Kneale, G. G., E-mail: geoff.kneale@port.ac.uk [University of Portsmouth, Portsmouth PO1 2DY (United Kingdom)

    2015-02-01

    The structure of the new class of controller proteins (exemplified by C.Csp231I) in complex with its 21 bp DNA-recognition sequence is presented, and the molecular basis of sequence recognition in this class of proteins is discussed. An unusual extended spacer between the dimer binding sites suggests a novel interaction between the two C-protein dimers. In a wide variety of bacterial restriction–modification systems, a regulatory ‘controller’ protein (or C-protein) is required for effective transcription of its own gene and for transcription of the endonuclease gene found on the same operon. We have recently turned our attention to a new class of controller proteins (exemplified by C.Csp231I) that have quite novel features, including a much larger DNA-binding site with an 18 bp (∼60 Å) spacer between the two palindromic DNA-binding sequences and a very different recognition sequence from the canonical GACT/AGTC. Using X-ray crystallography, the structure of the protein in complex with its 21 bp DNA-recognition sequence was solved to 1.8 Å resolution, and the molecular basis of sequence recognition in this class of proteins was elucidated. An unusual aspect of the promoter sequence is the extended spacer between the dimer binding sites, suggesting a novel interaction between the two C-protein dimers when bound to both recognition sites correctly spaced on the DNA. A U-bend model is proposed for this tetrameric complex, based on the results of gel-mobility assays, hydrodynamic analysis and the observation of key contacts at the interface between dimers in the crystal.

  11. Embryonic neural inducing factor churchill is not a DNA-binding zinc finger protein: solution structure reveals a solvent-exposed beta-sheet and zinc binuclear cluster.

    Science.gov (United States)

    Lee, Brian M; Buck-Koehntop, Bethany A; Martinez-Yamout, Maria A; Dyson, H Jane; Wright, Peter E

    2007-08-31

    Churchill is a zinc-containing protein that is involved in neural induction during embryogenesis. At the time of its discovery, it was thought on the basis of sequence alignment to contain two zinc fingers of the C4 type. Further, binding of an N-terminal GST-Churchill fusion protein to a particular DNA sequence was demonstrated by immunoprecipitation selection assay, suggesting that Churchill may function as a transcriptional regulator by sequence-specific DNA binding. We show by NMR solution structure determination that, far from containing canonical C4 zinc fingers, the protein contains three bound zinc ions in novel coordination sites, including an unusual binuclear zinc cluster. The secondary structure of Churchill is also unusual, consisting of a highly solvent-exposed single-layer beta-sheet. Hydrogen-deuterium exchange and backbone relaxation measurements reveal that Churchill is unusually dynamic on a number of time scales, with the exception of regions surrounding the zinc coordinating sites, which serve to stabilize the otherwise unstructured N terminus and the single-layer beta-sheet. No binding of Churchill to the previously identified DNA sequence could be detected, and extensive searches using DNA sequence selection techniques could find no other DNA sequence that was bound by Churchill. Since the N-terminal amino acids of Churchill form part of the zinc-binding motif, the addition of a fusion protein at the N terminus causes loss of zinc and unfolding of Churchill. This observation most likely explains the published DNA-binding results, which would arise due to non-specific interaction of the unfolded protein in the immunoprecipitation selection assay. Since Churchill does not appear to bind DNA, we suggest that it may function in embryogenesis as a protein-interaction factor.

  12. Probing the functional impact of sequence variation on p53-DNA interactions using a novel microsphere assay for protein-DNA binding with human cell extracts.

    Directory of Open Access Journals (Sweden)

    Maher A Noureddine

    2009-05-01

    Full Text Available The p53 tumor suppressor regulates its target genes through sequence-specific binding to DNA response elements (REs. Although numerous p53 REs are established, the thousands more identified by bioinformatics are not easily subjected to comparative functional evaluation. To examine the relationship between RE sequence variation -- including polymorphisms -- and p53 binding, we have developed a multiplex format microsphere assay of protein-DNA binding (MAPD for p53 in nuclear extracts. Using MAPD we measured sequence-specific p53 binding of doxorubicin-activated or transiently expressed p53 to REs from established p53 target genes and p53 consensus REs. To assess the sensitivity and scalability of the assay, we tested 16 variants of the p21 target sequence and a 62-multiplex set of single nucleotide (nt variants of the p53 consensus sequence and found many changes in p53 binding that are not captured by current computational binding models. A group of eight single nucleotide polymorphisms (SNPs was examined and binding profiles closely matched transactivation capability tested in luciferase constructs. The in vitro binding characteristics of p53 in nuclear extracts recapitulated the cellular in vivo transactivation capabilities for eight well-established human REs measured by luciferase assay. Using a set of 26 bona fide REs, we observed distinct binding patterns characteristic of transiently expressed wild type and mutant p53s. This microsphere assay system utilizes biologically meaningful cell extracts in a multiplexed, quantitative, in vitro format that provides a powerful experimental tool for elucidating the functional impact of sequence polymorphism and protein variation on protein/DNA binding in transcriptional networks.

  13. Crystal structure of the DNA binding domain of the transcription factor T-bet suggests simultaneous recognition of distant genome sites.

    Science.gov (United States)

    Liu, Ce Feng; Brandt, Gabriel S; Hoang, Quyen Q; Naumova, Natalia; Lazarevic, Vanja; Hwang, Eun Sook; Dekker, Job; Glimcher, Laurie H; Ringe, Dagmar; Petsko, Gregory A

    2016-10-25

    The transcription factor T-bet (Tbox protein expressed in T cells) is one of the master regulators of both the innate and adaptive immune responses. It plays a central role in T-cell lineage commitment, where it controls the T H 1 response, and in gene regulation in plasma B-cells and dendritic cells. T-bet is a member of the Tbox family of transcription factors; however, T-bet coordinately regulates the expression of many more genes than other Tbox proteins. A central unresolved question is how T-bet is able to simultaneously recognize distant Tbox binding sites, which may be located thousands of base pairs away. We have determined the crystal structure of the Tbox DNA binding domain (DBD) of T-bet in complex with a palindromic DNA. The structure shows a quaternary structure in which the T-bet dimer has its DNA binding regions splayed far apart, making it impossible for a single dimer to bind both sites of the DNA palindrome. In contrast to most other Tbox proteins, a single T-bet DBD dimer binds simultaneously to identical half-sites on two independent DNA. A fluorescence-based assay confirms that T-bet dimers are able to bring two independent DNA molecules into close juxtaposition. Furthermore, chromosome conformation capture assays confirm that T-bet functions in the direct formation of chromatin loops in vitro and in vivo. The data are consistent with a looping/synapsing model for transcriptional regulation by T-bet in which a single dimer of the transcription factor can recognize and coalesce distinct genetic elements, either a promoter plus a distant regulatory element, or promoters on two different genes.

  14. Crystal structure of the Deinococcus radiodurans single-stranded DNA-binding protein suggests a mechanism for coping with DNA damage

    Energy Technology Data Exchange (ETDEWEB)

    Bernstein, Douglas A.; Eggington, Julie M.; Killoran, Michael P.; Misic, Ana M.; Cox, Michael M.; Keck, James L. (UW)

    2010-11-16

    Single-stranded DNA (ssDNA)-binding (SSB) proteins are uniformly required to bind and protect single-stranded intermediates in DNA metabolic pathways. All bacterial and eukaryotic SSB proteins studied to date oligomerize to assemble four copies of a conserved domain, called an oligonucleotide/oligosaccharide-binding (OB) fold, that cooperate in nonspecific ssDNA binding. The vast majority of bacterial SSB family members function as homotetramers, with each monomer contributing a single OB fold. However, SSB proteins from the Deinococcus-Thermus genera are exceptions to this rule, because they contain two OB folds per monomer. To investigate the structural consequences of this unusual arrangement, we have determined a 1.8-{angstrom}-resolution x-ray structure of Deinococcus radiodurans SSB. The structure shows that D. radiodurans SSB comprises two OB domains linked by a {beta}-hairpin motif. The protein assembles a four-OB-fold arrangement by means of symmetric dimerization. In contrast to homotetrameric SSB proteins, asymmetry exists between the two OB folds of D. radiodurans SSB because of sequence differences between the domains. These differences appear to reflect specialized roles that have evolved for each domain. Extensive crystallographic contacts link D. radiodurans SSB dimers in an arrangement that has important implications for higher-order structures of the protein bound to ssDNA. This assembly utilizes the N-terminal OB domain and the {beta}-hairpin structure that is unique to Deinococcus and Thermus species SSB proteins. We hypothesize that differences between D. radiodurans SSB and homotetrameric bacterial SSB proteins may confer a selective advantage to D. radiodurans cells that aids viability in environments that challenge genomic stability.

  15. The process of displacing the single-stranded DNA-binding protein from single-stranded DNA by RecO and RecR proteins

    Science.gov (United States)

    Inoue, Jin; Honda, Masayoshi; Ikawa, Shukuko; Shibata, Takehiko; Mikawa, Tsutomu

    2008-01-01

    The regions of single-stranded (ss) DNA that result from DNA damage are immediately coated by the ssDNA-binding protein (SSB). RecF pathway proteins facilitate the displacement of SSB from ssDNA, allowing the RecA protein to form protein filaments on the ssDNA region, which facilitates the process of recombinational DNA repair. In this study, we examined the mechanism of SSB displacement from ssDNA using purified Thermus thermophilus RecF pathway proteins. To date, RecO and RecR are thought to act as the RecOR complex. However, our results indicate that RecO and RecR have distinct functions. We found that RecR binds both RecF and RecO, and that RecO binds RecR, SSB and ssDNA. The electron microscopic studies indicated that SSB is displaced from ssDNA by RecO. In addition, pull-down assays indicated that the displaced SSB still remains indirectly attached to ssDNA through its interaction with RecO in the RecO-ssDNA complex. In the presence of both SSB and RecO, the ssDNA-dependent ATPase activity of RecA was inhibited, but was restored by the addition of RecR. Interestingly, the interaction of RecR with RecO affected the ssDNA-binding properties of RecO. These results suggest a model of SSB displacement from the ssDNA by RecF pathway proteins. PMID:18000001

  16. Assessment of DNA Binding and Oxidative DNA Damage by Acrylonitrile in Two Rat Target Tissues of Carcinogenicity: Implications for the Mechanism of Action.

    Science.gov (United States)

    Williams, Gary M; Kobets, Tetyana; Duan, Jian-Dong; Iatropoulos, Michael J

    2017-07-17

    Exposure to acrylonitrile induces formation of tumors at multiple sites in rats, with females being more sensitive. The present study assessed possible mechanisms of acrylonitrile tumorigenicity, covalent DNA binding, DNA breakage, and oxidative DNA damage, in two target tissues, the brain and Zymbal's glands, of sensitive female Fischer (F344) and Sprague-Dawley (SD) rats. One group received acrylonitrile in drinking water at 100 ppm for 28 days. Two other groups were administered either acrylonitrile in drinking water at 100 ppm or drinking water alone for 27 days, followed by a single oral gavage dose of 11 mg/kg bw (14)C-acrylonitrile on day 28. A positive control group received a single dose of 5 mg/kg bw of 7-(14)C-benzo[a]pyrene, on day 27 following the administration of drinking water for 26 days. Using liquid scintillation counting, no association of radiolabeled acrylonitrile with brain DNA was found. In accelerator mass spectrometry analysis, the association of (14)C of acrylonitrile with DNA in brains was detected and was similar in both strains, which may reflect acrylonitrile binding to protein as well as to DNA. Nucleotide (32)P-postlabeling assay analysis of brain samples from rats of both strains yielded no evidence of acrylonitrile DNA adducts. Negative conventional comet assay results indicate the absence of direct DNA strand breaks in the brain and Zymbal's gland in both strains of rats dosed with acrylonitrile. In both rat strains, positive results in an enhanced comet assay were found only in brain samples digested with formamidopyrimidine-DNA glycosylase but not with human 8-hydroxyguanine-DNA glycosylase, indicating possible oxidative DNA damage, other than 8-oxodG formation. In conclusion, definitive evidence of DNA binding of acrylonitrile in the brain and Zymbal's gland was not obtained under the test conditions. A role for oxidative stress in tumorigenesis in the brain but not Zymbal's gland may exist.

  17. A novel bZIP protein, Gsb1, is required for oxidative stress response, mating, and virulence in the human pathogen Cryptococcus neoformans.

    Science.gov (United States)

    Cheon, Seon Ah; Thak, Eun Jung; Bahn, Yong-Sun; Kang, Hyun Ah

    2017-06-22

    The human pathogen Cryptococcus neoformans, which causes life-threatening meningoencephalitis in immunocompromised individuals, normally faces diverse stresses in the human host. Here, we report that a novel, basic, leucine-zipper (bZIP) protein, designated Gsb1 (general stress-related bZIP protein 1), is required for its normal growth and diverse stress responses. C. neoformans gsb1Δ mutants grew slowly even under non-stressed conditions and showed increased sensitivity to high or low temperatures. The hypersensitivity of gsb1Δ to oxidative and nitrosative stresses was reversed by addition of a ROS scavenger. RNA-Seq analysis during normal growth revealed increased expression of a number of genes involved in mitochondrial respiration and cell cycle, but decreased expression of several genes involved in the mating-pheromone-responsive MAPK signaling pathway. Accordingly, gsb1Δ showed defective mating and abnormal cell-cycle progression. Reflecting these pleiotropic phenotypes, gsb1Δ exhibited attenuated virulence in a murine model of cryptococcosis. Moreover, RNA-Seq analysis under oxidative stress revealed that several genes involved in ROS defense, cell-wall remodeling, and protein glycosylation were highly induced in the wild-type strain but not in gsb1Δ. Gsb1 localized exclusively in the nucleus in response to oxidative stress. In conclusion, Gsb1 is a key transcription factor modulating growth, stress responses, differentiation, and virulence in C. neoformans.

  18. Identification of a novel bZIP transcription factor in Camellia sinensis as a negative regulator of freezing tolerance in transgenic arabidopsis.

    Science.gov (United States)

    Wang, Lu; Cao, Hongli; Qian, Wenjun; Yao, Lina; Hao, Xinyuan; Li, Nana; Yang, Yajun; Wang, Xinchao

    2017-05-01

    Basic region/leucine zipper (bZIP) transcription factors play vital roles in the abiotic stress response of plants. However, little is known about the function of bZIP genes in Camellia sinensis . CsbZIP6 was overexpressed in Arabidopsis thaliana . Effects of CsbZIP6 overexpression on abscisic acid (ABA) sensitivity, freezing tolerance and the expression of cold-responsive genes in arabidopsis were studied. CsbZIP6 was induced during cold acclimation in tea plant. Constitutive overexpression of CsbZIP6 in arabidopsis lowered the plants' tolerance to freezing stress and ABA exposure during seedling growth. Compared with wild-type (WT) plants, CsbZIP6 overexpression (OE) lines exhibited increased levels of electrolyte leakage (EL) and malondialdehyde (MDA) contents, and reduced levels of total soluble sugars (TSS) under cold stress conditions. Microarray analysis of transgenic arabidopsis revealed that many differentially expressed genes (DEGs) between OE lines and WT plants could be mapped to 'response to cold' and 'response to water deprivation' terms based on Gene Ontology analysis. Interestingly, CsbZIP6 overexpression repressed most of the cold- and drought-responsive genes as well as starch metabolism under cold stress conditions. The data suggest that CsbZIP6 functions as a negative regulator of the cold stress response in A. thaliana , potentially by down-regulating cold-responsive genes.

  19. Natural antioxidants exhibit chemopreventive characteristics through the regulation of CNC b-Zip transcription factors in estrogen-induced breast carcinogenesis.

    Science.gov (United States)

    Chatterjee, Anwesha; Ronghe, Amruta; Singh, Bhupendra; Bhat, Nimee K; Chen, Jie; Bhat, Hari K

    2014-12-01

    The objective of the present study was to characterize the role of resveratrol (Res) and vitamin C (VC) in prevention of estrogen-induced breast cancer through regulation of cap "n"collar (CNC) b-zip transcription factors. Human breast epithelial cell line MCF-10A was treated with 17β-estradiol (E2) and VC or Res with or without E2. mRNA and protein expression levels of CNC b-zip transcription factors nuclear factor erythroid 2-related factor 1 (Nrf1), nuclear factor erythroid 2 related factor 2 (Nrf2), nuclear factor erythroid 2 related factor 3 (Nrf3), and Nrf2-regulated antioxidant enzymes superoxide dismutase 3 (SOD3) and quinone oxidoreductase 1 (NQO1) were quantified. The treatment with E2 suppressed, whereas VC and Res prevented E2-mediated decrease in the expression levels of SOD3, NQO1, Nrf2 mRNA, and protein in MCF-10A cells. The treatment with E2, Res, or VC significantly increased mRNA and protein expression levels of Nrf1. 17β-Estradiol treatment significantly increased but VC or Res decreased Nrf3 mRNA and protein expression levels. Our studies demonstrate that estrogen-induced breast cancer might be prevented through upregulation of antioxidant enzymes via Nrf-dependent pathways. © 2014 Wiley Periodicals, Inc.

  20. DNA binding domains and nuclear localization signal of LEDGF: contribution of two helix-turn-helix (HTH)-like domains and a stretch of 58 amino acids of the N-terminal to the trans-activation potential of LEDGF.

    Science.gov (United States)

    Singh, Dhirendra P; Kubo, E; Takamura, Y; Shinohara, T; Kumar, A; Chylack, Leo T; Fatma, N

    2006-01-20

    Lens epithelium derived growth factor (LEDGF), a nuclear protein, plays a role in regulating the transcription of stress-associated genes such as heat shock proteins by binding to consensus core DNA sequences nAGGn or nGAAn or their repeats, and in doing so helps to provide cyto-protection. However, additional information is required to identify the specific structural features of LEDGF involved in gene transcription. Here we have investigated the functional domains activating and repressing DNA-binding modules, by using a DNA binding assay and trans-activation experiments performed by analyzing proteins prepared from deletion constructs. The results disclosed the DNA-binding domain of N-terminal LEDGF mapped between amino acid residues 5 and 62, a 58 amino acid residue stretch PWWP domain which binds to stress response elements (STRE; A/TGGGGA/T). C-terminal LEDGF contains activation domains, an extensive loop-region (aa 418-530) with two helix-turn-helix (HTH)-like domains, and binds to a heat shock element (HSE; nGAAn). A trans-activation assay using Hsp27 promoter revealed that both HTH domains contribute in a cooperative manner to the trans-activation potential of LEDGF. Interestingly, removal of N-terminal LEDGF (aa 1-187) significantly enhances the gene activation potential of C-terminal LEDGF (aa 199-530); thus the N-terminal domain (aa 5-62), exhibits auto-transcriptional repression activity. It appears that this domain is involved in stabilizing the LEDGF-DNA binding complex. Collectively, our results demonstrate that LEDGF contains three DNA-binding domains, which regulate gene expression depending on cellular microenvironment and thus modify the physiology of cells to maintain cellular homeostasis.

  1. DNA-Binding Properties of African Swine Fever Virus pA104R, a Histone-Like Protein Involved in Viral Replication and Transcription.

    Science.gov (United States)

    Frouco, Gonçalo; Freitas, Ferdinando B; Coelho, João; Leitão, Alexandre; Martins, Carlos; Ferreira, Fernando

    2017-06-15

    African swine fever virus (ASFV) codes for a putative histone-like protein (pA104R) with extensive sequence homology to bacterial proteins that are implicated in genome replication and packaging. Functional characterization of purified recombinant pA104R revealed that it binds to single-stranded DNA (ssDNA) and double-stranded DNA (dsDNA) over a wide range of temperatures, pH values, and salt concentrations and in an ATP-independent manner, with an estimated binding site size of about 14 to 16 nucleotides. Using site-directed mutagenesis, the arginine located in pA104R's DNA-binding domain, at position 69, was found to be relevant for efficient DNA-binding activity. Together, pA104R and ASFV topoisomerase II (pP1192R) display DNA-supercoiling activity, although none of the proteins by themselves do, indicating that the two cooperate in this process. In ASFV-infected cells, A104R transcripts were detected from 2 h postinfection (hpi) onward, reaching a maximum concentration around 16 hpi. pA104R was detected from 12 hpi onward, localizing with viral DNA replication sites and being found exclusively in the Triton-insoluble fraction. Small interfering RNA (siRNA) knockdown experiments revealed that pA104R plays a critical role in viral DNA replication and gene expression, with transfected cells showing lower viral progeny numbers (up to a reduction of 82.0%), lower copy numbers of viral genomes (-78.3%), and reduced transcription of a late viral gene (-47.6%). Taken together, our results strongly suggest that pA104R participates in the modulation of viral DNA topology, probably being involved in viral DNA replication, transcription, and packaging, emphasizing that ASFV mutants lacking the A104R gene could be used as a strategy to develop a vaccine against ASFV.IMPORTANCE Recently reintroduced in Europe, African swine fever virus (ASFV) causes a fatal disease in domestic pigs, causing high economic losses in affected countries, as no vaccine or treatment is currently

  2. Fusion of Taq DNA polymerase with single-stranded DNA binding-like protein of Nanoarchaeum equitans-Expression and characterization.

    Directory of Open Access Journals (Sweden)

    Marcin Olszewski

    Full Text Available DNA polymerases are present in all organisms and are important enzymes that synthesise DNA molecules. They are used in various fields of science, predominantly as essential components for in vitro DNA syntheses, known as PCR. Modern diagnostics, molecular biology and genetic engineering need DNA polymerases which demonstrate improved performance. This study was aimed at obtaining a new NeqSSB-TaqS fusion DNA polymerase from the Taq DNA Stoffel domain and a single-stranded DNA binding-like protein of Nanoarchaeum equitans in order to significantly improve the properties of DNA polymerase. The DNA coding sequence of Taq Stoffel DNA polymerase and the nonspecific DNA-binding protein of Nanoarchaeum equitans (NeqSSB-like protein were fused. A novel recombinant gene was obtained which was cloned into the pET-30 Ek/LIC vector and introduced into E. coli for expression. The recombinant enzyme was purified and its enzymatic properties including DNA polymerase activity, PCR amplification rate, thermostability, processivity and resistance to inhibitors, were tested. The yield of the target protein reached approximately 18 mg/l after 24 h of the IPTG induction. The specific activity of the polymerase was 2200 U/mg. The recombinant NeqSSB-TaqS exhibited a much higher extension rate (1000 bp template in 20 s, processivity (19 nt, thermostability (half-life 35 min at 95°C and higher tolerance to PCR inhibitors (0.3-1.25% of whole blood, 0.84-13.5 μg of lactoferrin and 4.7-150 ng of heparin than Taq Stoffel DNA polymerase. Furthermore, our studies show that NeqSSB-TaqS DNA polymerase has a high level of flexibility in relation to Mg2+ ions (from 1 to 5 mM and KCl or (NH42SO4 salts (more than 60 mM and 40 mM, respectively. Using NeqSSB-TaqS DNA polymerase instead of the Taq DNA polymerase could be a better choice in many PCR applications.

  3. Prevalence of transactive response DNA-binding protein 43 (TDP-43) proteinopathy in cognitively normal older adults: systematic review and meta-analysis.

    Science.gov (United States)

    Nascimento, C; Di Lorenzo Alho, A T; Bazan Conceição Amaral, C; Leite, R E P; Nitrini, R; Jacob-Filho, W; Pasqualucci, C A; Hokkanen, S R K; Hunter, S; Keage, H; Kovacs, G G; Grinberg, L T; Suemoto, C K

    2017-08-09

    To perform a systematic review and meta-analysis on the prevalence of transactive response DNA-binding protein 43 (TDP-43) proteinopathy in cognitively normal older adults. We systematically reviewed and performed a meta-analysis on the prevalence of TDP-43 proteinopathy in older adults with normal cognition, evaluated by the Mini-Mental State Examination or the Clinical Dementia Rating. We estimated the overall prevalence of TDP-43 using random-effect models, and stratified by age, sex, sample size, study quality, antibody used to assess TDP-43 aggregates, analysed brain regions, Braak stage, Consortium to Establish a Registry for Alzheimer's Disease score, hippocampal sclerosis and geographic location. A total of 505 articles were identified in the systematic review, and 7 were included in the meta-analysis with 1196 cognitively normal older adults. We found an overall prevalence of TDP-43 proteinopathy of 24%. Prevalence of TDP-43 proteinopathy varied widely across geographic location (North America: 37%, Asia: 29%, Europe: 14%, and Latin America: 11%). Estimated prevalence of TDP-43 proteinopathy also varied according to study quality (quality score >7: 22% vs. quality score diseases are needed. © 2017 British Neuropathological Society.

  4. Review: Prion-like mechanisms of transactive response DNA binding protein of 43 kDa (TDP-43) in amyotrophic lateral sclerosis (ALS).

    Science.gov (United States)

    Smethurst, Phillip; Sidle, Katie Claire Louise; Hardy, John

    2015-08-01

    Amyotrophic lateral sclerosis (ALS) is a fatal devastating neurodegenerative disorder which predominantly affects the motor neurons in the brain and spinal cord. The death of the motor neurons in ALS causes subsequent muscle atrophy, paralysis and eventual death. Clinical and biological evidence now demonstrates that ALS has many similarities to prion disease in terms of disease onset, phenotype variability and progressive spread. The pathognomonic ubiquitinated inclusions deposited in the neurons and glial cells in brains and spinal cords of patients with ALS and fronto-temporal lobar degeneration with ubiquitinated inclusions contain aggregated transactive response DNA binding protein of 43 kDa (TDP-43), and evidence now suggests that TDP-43 has cellular prion-like properties. The cellular mechanisms of prion protein misfolding and aggregation are thought to be responsible for the characteristics of prion disease. Therefore, there is a strong mechanistic basis for a prion-like behaviour of the TDP-43 protein being responsible for some characteristics of ALS. In this review, we compare the prion-like mechanisms of TDP-43 to the clinical and biological nature of ALS in order to investigate how this protein could be responsible for some of the characteristic properties of the disease. © 2014 The Authors. Neuropathology and Applied Neurobiology published by John Wiley & Sons Ltd on behalf of British Neuropathological Society.

  5. Quinoxaline based bio-active mixed ligand transition metal complexes: Synthesis, characterization, electrochemical, antimicrobial, DNA binding, cleavage, antioxidant and molecular docking studies.

    Science.gov (United States)

    Dhanaraj, C Justin; Johnson, Jijo

    2015-10-01

    Co(II), Ni(II), Cu(II) and Zn(II) mixed ligand complexes have been synthesized from N(2), N(3)-bis(4-nitrophenyl)quinoxaline-2,3-diamine and 1,10-phenanthroline. The compounds were characterized by elemental analyses, molar conductance, magnetic susceptibility, IR, UV-Vis., (1)H NMR, mass and ESR spectra. Octahedral geometry has been assigned for Co(II), Ni(II) and Zn(II) complexes and distorted octahedral geometry for Cu(II) complex. Electrochemical behavior of the synthesized complexes was studied using cyclic voltammetry. Grain size and surface morphologies of the complexes were determined by powder XRD and SEM analyses. The mixed ligand metal complexes were screened for antimicrobial activity against bacterial species Escherichia coli, Klebsiella pneumoniae, Pseudomonas aeruginosa and Staphylococcus aureus; fungal species Aspergillus niger, and Candida albicans by disc diffusion method. The DNA binding and DNA cleavage activities of the compounds were determined using electronic absorption titration and agarose gel electrophoresis respectively. The superoxide radical scavenging and free radical scavenging activities of the Cu(II) complex was also evaluated. Molecular docking studies of the synthesized mixed ligand metal complexes were carried out against B-DNA dodecamer and the protein Plasmodium falciparum dihydrofolate reductase (pf DHFR). Copyright © 2015 Elsevier B.V. All rights reserved.

  6. Evaluation of DNA-binding, DNA cleavage, antioxidant and cytotoxic activity of mononuclear ruthenium(II) carbonyl complexes of benzaldehyde 4-phenyl-3-thiosemicarbazones

    Science.gov (United States)

    Sampath, Krishnan; Sathiyaraj, Subbaiyan; Jayabalakrishnan, Chinnasamy

    2013-11-01

    Two 4-phenyl-3-thiosemicarbazone ligands, (E)-2-(2-chlorobenzylidene)-N-phenylhydrazinecarbothioamide (HL1) and (E)-2-(2-nitrobenzylidene)-N-phenylhydrazinecarbothioamide (HL2), and its ruthenium(II) complexes were synthesized and characterized by physico-chemical and spectroscopic methods. The Schiff bases act as bidentate, monobasic chelating ligands with S and N as the donor sites and are preferably found in the thiol form in all the complexes studied. The molecular structure of HL1 and HL2 were determined by single crystal X-ray diffraction method. DNA binding of the compounds was investigated by absorption spectroscopy which indicated that the compounds bind to DNA via intercalation. The oxidative cleavage of the complexes with CT-DNA inferred that the effects of cleavage are dose dependent. Antioxidant study of the ligands and complexes showed significant antioxidant activity against DPPH radical. In addition, the in vitro cytotoxicity of the ligands and complexes assayed against HeLa and MCF-7 cell lines showed higher cytotoxic activity with the lower IC50 values indicating their efficiency in killing the cancer cells even at low concentrations.

  7. Mixed ligand ruthenium(III) complexes of benzaldehyde 4-methyl-3-thiosemicarbazones with triphenylphosphine/triphenylarsine co-ligands: Synthesis, DNA binding, DNA cleavage, antioxidative and cytotoxic activity

    Science.gov (United States)

    Sampath, K.; Sathiyaraj, S.; Raja, G.; Jayabalakrishnan, C.

    2013-08-01

    The new ruthenium(III) complexes with 4-methyl-3-thiosemicarbazone ligands, (E)-2-(2-chlorobenzylidene)-N-methylhydrazinecarbothioamide (HL1) and (E)-2-(2-nitrobenzylidene)-N-methylhydrazinecarbothioamide (HL2), were prepared and characterized by various physico-chemical and spectroscopic methods. The title compounds act as bidentate, monobasic chelating ligands with S and N as the donor sites and are preferably found in the thiol form in all the complexes studied. The molecular structure of HL1 and HL2 were determined by single crystal X-ray diffraction method. DNA binding of the ligands and complexes were investigated by absorption spectroscopy and IR spectroscopy. It reveals that the compounds bind to nitrogenous bases of DNA via intercalation. The oxidative cleavage of the complexes with CT-DNA inferred that the effects of cleavage are dose dependent. Antioxidant study of the ligands and complexes showed the significant antioxidant activity against DPPH radical. In addition, the in vitro cytotoxicity of the ligands and complexes against MCF-7 cell line was assayed which showed higher cytotoxic activity with the lower IC50 values indicating their efficiency in killing the cancer cells even at low concentrations.

  8. DNA-binding, catalytic oxidation, C—C coupling reactions and antibacterial activities of binuclear Ru(II thiosemicarbazone complexes: Synthesis and spectral characterization

    Directory of Open Access Journals (Sweden)

    Arumugam Manimaran

    2012-07-01

    Full Text Available New hexa-coordinated binuclear Ru(II thiosemicarbazone complexes of the type {[(B(EPh3(COClRu]2L} (where, E = P or As; B = PPh3 or AsPh3 or pyridine; L = mononucleating NS donor of N-substituted thiosemicarbazones have been synthesized and characterized by elemental analysis, FT-IR, UV–vis and 31P{1H} NMR cyclic voltammetric studies. The DNA-binding studies of Ru(II complexes with calf thymus DNA (CT-DNA were investigated by UV–vis, viscosity measurements, gel-electrophoresis and fluorescence spectroscopy. The new complexes have been used as catalysts in C—C coupling reaction and in the oxidation of alcohols to their corresponding carbonyl compounds by using NMO as co-oxidant and molecular oxygen (O2 atmosphere at ambient temperature. Further, the new binucleating thiosemicarbazone ligands and their Ru(II complexes were also screened for their antibacterial activity against Klebsiella pneumoniae, Shigella sp., Micrococcus luteus, Escherichia coli and Salmonella typhi. From this study, it was found out that the activity of the complexes almost reaches the effectiveness of the conventional bacteriocide.

  9. Membrane Destruction and DNA Binding of Staphylococcus aureus Cells Induced by Carvacrol and Its Combined Effect with a Pulsed Electric Field.

    Science.gov (United States)

    Wang, Lang-Hong; Wang, Man-Sheng; Zeng, Xin-An; Zhang, Zhi-Hong; Gong, De-Ming; Huang, Yan-Bo

    2016-08-17

    Carvacrol (5-isopropyl-2-methylphenol, CAR) is an antibacterial ingredient that occurs naturally in the leaves of the plant Origanum vulgare. The antimicrobial mechanism of CAR against Staphylococcus aureus ATCC 43300 was investigated in the study. Analysis of the membrane fatty acids by gas chromatography-mass spectrometry (GC-MS) showed that exposure to CAR at low concentrations induced a marked increase in the level of unbranched fatty acids (from 34.90 ± 1.77% to 62.37 ± 4.26%). Moreover, CAR at higher levels severely damaged the integrity and morphologies of the S. aureus cell membrane. The DNA-binding properties of CAR were also investigated using fluorescence, circular dichroism, molecular modeling, and atomic-force microscopy. The results showed that CAR bound to DNA via the minor-groove mode, mildly perturbed the DNA secondary structure, and induced DNA molecules to be aggregated. Furthermore, a combination of CAR with a pulsed-electric field was found to exhibit strong synergistic effects on S. aureus.

  10. The molecular basis of conformational instability of the ecdysone receptor DNA binding domain studied by in silico and in vitro experiments.

    Directory of Open Access Journals (Sweden)

    Agnieszka Szamborska-Gbur

    Full Text Available The heterodimer of the ecdysone receptor (EcR and ultraspiracle (Usp, members of the nuclear receptors superfamily, regulates gene expression associated with molting and metamorphosis in insects. The DNA binding domains (DBDs of the Usp and EcR play an important role in their DNA-dependent heterodimerization. Analysis of the crystal structure of the UspDBD/EcRDBD heterocomplex from Drosophila melanogaster on the hsp27 gene response element, suggested an appreciable similarity between both DBDs. However, the chemical denaturation experiments showed a categorically lower stability for the EcRDBD in contrast to the UspDBD. The aim of our study was an elucidation of the molecular basis of this intriguing instability. Toward this end, we mapped the EcRDBD amino acid sequence positions which have an impact on the stability of the EcRDBD. The computational protein design and in vitro analyses of the EcRDBD mutants indicate that non-conserved residues within the α-helix 2, forming the EcRDBD hydrophobic core, represent a specific structural element that contributes to instability. In particular, the L58 appears to be a key residue which differentiates the hydrophobic cores of UspDBD and EcRDBD and is the main reason for the low stability of the EcRDBD. Our results might serve as a benchmark for further studies of the intricate nature of the EcR molecule.

  11. Sequence Discrimination by DNA-binding Domain of ETS Family Transcription Factor PU.1 Is Linked to Specific Hydration of Protein-DNA Interface*

    Science.gov (United States)

    Poon, Gregory M. K.

    2012-01-01

    PU.1 is an essential transcription factor in normal hematopoietic lineage development. It recognizes a large number of promoter sites differing only in bases flanking a core consensus of 5′-GGAA-3′. DNA binding is mediated by its ETS domain, whose sequence selectivity directly corresponds to the transactivational activity and frequency of binding sites for full-length PU.1 in vivo. To better understand the basis of sequence discrimination, we characterized its binding properties to a high affinity and low affinity site. Despite sharing a homologous structural framework as confirmed by DNase I and hydroxyl radical footprinting, the two complexes exhibit striking heterogeneity in terms of hydration properties. High affinity binding is destabilized by osmotic stress, whereas low affinity binding is insensitive. Dimethyl sulfate footprinting showed that the major groove at the core consensus is protected in the high affinity complex but accessible in the low affinity one. Finally, destabilization of low affinity binding by salt is in quantitative agreement with the number of phosphate contacts but is substantially attenuated in high affinity binding. These observations support a mechanism of sequence discrimination wherein specifically bound water molecules couple flanking backbone contacts with base-specific interactions in a sequestered cavity at the core consensus. The implications of this model with respect to other ETS paralogs are discussed. PMID:22474303

  12. Identification and characterization of PhbF: A DNA binding protein with regulatory role in the PHB metabolism of Herbaspirillum seropedicae SmR1

    Directory of Open Access Journals (Sweden)

    Pedrosa Fabio O

    2011-10-01

    Full Text Available Abstract Background Herbaspirillum seropedicae SmR1 is a nitrogen fixing endophyte