WorldWideScience

Sample records for wing drosophila drosophila

  1. A Drosophila wing spot test

    International Nuclear Information System (INIS)

    Ayaki, Toshikazu; Yoshikawa, Isao; Niikawa, Norio; Hoshi, Masaharu.

    1986-01-01

    A Drosophila wing spot test system was used to investigate the effects of low doses of X-rays, gamma rays, and both 2.3 and 14.1 MeV neutrons on somatic chromosome mutation (SCM) induction. The incidence of SCM was significantly increased with any type of radiation, with evident linear dose-response relationship within the range of 3 to 20 cGy. It was estimated that relative biological effectiveness value for SCM induction of 2.3 MeV neutrons to X-rays and gamma rays is much higher than that of 14.1 MeV neutrons to those photons (2.4 vs 8.0). The Drosophila wing spot test system seems to become a promising in vivo experimental method for higher animals in terms of the lack of necessity for a marvelously large number of materials required in conventional test system. (Namekawa, K.)

  2. Semi-automated quantitative Drosophila wings measurements.

    Science.gov (United States)

    Loh, Sheng Yang Michael; Ogawa, Yoshitaka; Kawana, Sara; Tamura, Koichiro; Lee, Hwee Kuan

    2017-06-28

    Drosophila melanogaster is an important organism used in many fields of biological research such as genetics and developmental biology. Drosophila wings have been widely used to study the genetics of development, morphometrics and evolution. Therefore there is much interest in quantifying wing structures of Drosophila. Advancement in technology has increased the ease in which images of Drosophila can be acquired. However such studies have been limited by the slow and tedious process of acquiring phenotypic data. We have developed a system that automatically detects and measures key points and vein segments on a Drosophila wing. Key points are detected by performing image transformations and template matching on Drosophila wing images while vein segments are detected using an Active Contour algorithm. The accuracy of our key point detection was compared against key point annotations of users. We also performed key point detection using different training data sets of Drosophila wing images. We compared our software with an existing automated image analysis system for Drosophila wings and showed that our system performs better than the state of the art. Vein segments were manually measured and compared against the measurements obtained from our system. Our system was able to detect specific key points and vein segments from Drosophila wing images with high accuracy.

  3. New record for the invasive Spotted Wing Drosophila, Drosophila suzukii Matsumura (Diptera: Drosophilidae) in Anillaco, Argentina

    Science.gov (United States)

    The invasive Spotted Wing Drosophila (SWD), Drosophila suzukii Matsumura, is reported for the first time in La Rioja, Argentina. This represents a major range expansion for this species. The natural enemies of SWD, Leptopilina clavipes and Ganaspis hookeri were also collected with the SWD at the s...

  4. Effect of non-nutritive sugars to decrease the survivorship of spotted wing drosophila, Drosophila suzukii

    Science.gov (United States)

    In this study, we investigated the effects of non-nutritive sugars and sugar alcohols on the survivorship of spotted wing drosophila, Drosophila suzukii, and found erythritol and erythrose as potentially toxic to the fly. In a dose-dependent study, erythritol and erythrose significantly reduced fly ...

  5. Multidimensional analysis of Drosophila wing variation in Evolution ...

    Indian Academy of Sciences (India)

    In this study, using Drosophila melanogaster isofemale lines derived from wild flies collected on both slopes of the canyon, we investigated the effect of developmental temperature upon the different components of phenotypic variation of a complex trait: the wing. Combining geometric and traditional morphometrics, we find ...

  6. Investigating Biological Controls to Suppress Spotted Wing Drosophila Populations

    Science.gov (United States)

    The spotted wing drosophila has become a major cherry pest in California. To develop sustainable management options for this highly mobile pest, we worked with cooperators at Oregon State University and the USDA to discover and import natural enemies of the fly from its native range in South Korea ...

  7. First record of spotted wing drosophila Drosophila suzukii (Diptera: Drosophilidae in Montenegro

    Directory of Open Access Journals (Sweden)

    Snježana Hrnčić

    2015-01-01

    Full Text Available The spotted wing drosophila Drosophila suzukii Matsumura (Diptera: Drosophilidae is an invasive pest originating from Southeast Asia. It was detected for the first time in Europe in 2008 (Spain and Italy and subsequently in other European countries. It is a highly polyphagous pest that infests healthy, ripening fruit and presents a serious threat to fruit production, particularly of soft skinned fruit. In the first half of October 2013, a new fruit fly species was unexpectedly detected in Tephri traps baited with the three-component female-biased attractant BioLure that is regularly used for monitoring the Mediterranean fruit fly Ceratitis capitata Wiedem. (Diptera: Tephritidae in Montenegro. Brief visual inspection identified the new species as the spotted wing drosophila D. suzukii. The pest was first recorded in several localities on the Montenegrin seacoast around Boka Kotor Bay. After the finding, all Drosophila specimens were collected from traps for further laboratory observation. A quick follow-up monitoring of other Tephri traps was carried out within the next few days on the rest of the seacoast (localities from Tivat to Ulcinj. Additionally, Tephri traps were set up around Lake Skadar and in the city of Podgorica, as well as on fresh fruit markets in Podgorica. The results of this preliminary study showed that D. suzukii was present in all surveyed locations and adults were captured until late December. Both sexes were found in traps with BioLure. Our data show that D. suzukii is present in southern parts of Montenegro and there is a serious threat of its further spreading, particularly towards northern parts of the country where the main raspberry and blueberry production is placed. The results also show that Tephri traps baited with BioLure can be used for detection and monitoring of spotted wing drosophila.

  8. Rapid and highly accurate detection of Drosophila suzukii, spotted wing Drosophila (Diptera: Drosophilidae) by loop-mediated isothermal amplification assays

    Science.gov (United States)

    Drosophila suzukii, the spotted wing drosophila (SWD), is currently a major pest that causes severe economic losses to thin-skinned, small fruit growers in North America and Europe. The monitoring and early detection of SWD in the field is of the utmost importance for its proper management. Althou...

  9. Sexual selection on wing interference patterns in Drosophila melanogaster.

    Science.gov (United States)

    Katayama, Natsu; Abbott, Jessica K; Kjærandsen, Jostein; Takahashi, Yuma; Svensson, Erik I

    2014-10-21

    Animals with color vision use color information in intra- and interspecific communication, which in turn may drive the evolution of conspicuous colored body traits via natural and sexual selection. A recent study found that the transparent wings of small flies and wasps in lower-reflectance light environments display vivid and stable structural color patterns, called "wing interference patterns" (WIPs). Such WIPs were hypothesized to function in sexual selection among small insects with wing displays, but this has not been experimentally verified. Here, to our knowledge we present the first experimental evidence that WIPs in males of Drosophila melanogaster are targets of mate choice from females, and that two different color traits--saturation and hue--experience directional and stabilizing sexual selection, respectively. Using isogenic lines from the D. melanogaster Genetic Reference Panel, we compare attractiveness of different male WIPs against black and white visual backgrounds. We show that males with more vivid wings are more attractive to females than are males with dull wings. Wings with a large magenta area (i.e., intermediate trait values) were also preferred over those with a large blue or yellow area. These experimental results add a visual element to the Drosophila mating array, integrating sexual selection with elements of genetics and evo-devo, potentially applicable to a wide array of small insects with hyaline wings. Our results further underscore that the mode of sexual selection on such visual signals can differ profoundly between different color components, in this case hue and saturation.

  10. NOVEL ASPECTS OF SPOTTED WING DROSOPHILA BIOLOGY AND IMPROVED METHODS OF REARING

    Science.gov (United States)

    Drosophila suzukii (Mats.) or the spotted wing Drosophila (SWD), is a global pest of soft fruits that can now be reared on a standard Drosophila diet containing the fly's own natural food: soft-skinned berries. The techniques tested here can thwart bacterial and fungal disease that can destroy more ...

  11. Evaluation of Off-season Potential Breeding Sources for Spotted Wing Drosophila (Drosophila suzukii Matsumura) in Michigan.

    Science.gov (United States)

    Bal, Harit K; Adams, Christopher; Grieshop, Matthew

    2017-12-05

    It has been suggested that fruit wastes including dropped and unharvested fruits, and fruit byproducts (i.e., pomace) found in fruit plantings and cideries or wine-making facilities could serve as potential off-season breeding sites for spotted wing Drosophila (Drosophila suzukii Matsumura (Diptera: Drosophilidae)). This idea, however, has yet to be widely tested. The goal of our study was to determine the potential of dropped fruit and fruit wastes as Fall spotted wing Drosophila breeding resources in Michigan, USA. Fruit waste samples were collected from 15 farms across the lower peninsula of Michigan and were evaluated for spotted wing Drosophila and other drosophilid emergence and used in host suitability bioassays. All of the dropped apples, pears, grapes, and raspberries and 40% of apple and 100% of grape fruit pomace evaluated were found to contain spotted wing Drosophila with the highest numbers collected from dropped grapes and pears. Greater spotted wing Drosophila recovery was found in fruit wastes at sites attached with cideries and wine-making facilities and with multiple cultivated fruit crops than sites with no cideries and only one crop. Females oviposited in raspberry, pear, apple, grape, apple pomace and grape pomace samples with the highest rates of reproduction in raspberries. Our results demonstrate that fruit wastes including dropped berry, pomme and stone fruits, as well as fruit compost may be important late season reproductive resources for spotted wing Drosophila. © The Author(s) 2017. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  12. Quantifying host potentials: indexing postharvest fresh fruits for spotted wing Drosophila, Drosophila suzukii.

    Directory of Open Access Journals (Sweden)

    David E Bellamy

    Full Text Available Novel methodology is presented for indexing the relative potential of hosts to function as resources. A Host Potential Index (HPI was developed as a practical framework to express relative host potential based on combining results from one or more independent studies, such as those examining host selection, utilization, and physiological development of the organism resourcing the host. Several aspects of the HPI are addressed including: 1 model derivation; 2 influence of experimental design on establishing host rankings for a study type (no choice, two-choice, and multiple-choice; and, 3 variable selection and weighting associated with combining multiple studies. To demonstrate application of the HPI, results from the interactions of spotted wing drosophila (SWD, Drosophila suzukii Matsumura (Diptera: Drosophilidae, with seven "reported" hosts (blackberries, blueberries, sweet cherries, table grapes, peaches, raspberries, and strawberries in a postharvest scenario were analyzed. Four aspects of SWD-host interaction were examined: attraction to host volatiles; population-level oviposition performance; individual-level oviposition performance; and key developmental factors. Application of HPI methodology indicated that raspberries ( (meanHPIvaried  = 301.9±8.39; rank 1 of 7 have the greatest potential to serve as a postharvest host for SWD relative to the other fruit hosts, with grapes ( (meanHPIvaried  = 232.4±3.21; rank 7 of 7 having the least potential.

  13. Spotted wing drosophila prefer low hanging fruit: insights into foraging behavior and management strategies

    Science.gov (United States)

    Spotted wing drosophila (SWD), Drosophila suzukii, is an invasive insect that attacks ripe, small fruit such as raspberries, blackberries, and blueberries. Little is known about SWD foraging ecology, and current trapping and monitoring systems are ineffective at commercial scales. In caged foragin...

  14. Susceptibility of Bunch Grape and Muscadine Cultivars to Berry Splitting and Spotted-Wing Drosophila Oviposition

    Science.gov (United States)

    One of the main disorders that widely reduces fruit quality and commercial value is fruit splitting. Fruit splitting is a physiological disorder that produces surface cracks that promotes disease and insect damage. Moreover, the spotted wing Drosophila (SWD), Drosophila suzukii (Matsumura), is a spe...

  15. A single basis for developmental buffering of Drosophila wing shape.

    Directory of Open Access Journals (Sweden)

    Casper J Breuker

    2006-12-01

    Full Text Available The nature of developmental buffering processes has been debated extensively, based on both theoretical reasoning and empirical studies. In particular, controversy has focused on the question of whether distinct processes are responsible for canalization, the buffering against environmental or genetic variation, and for developmental stability, the buffering against random variation intrinsic in developmental processes. Here, we address this question for the size and shape of Drosophila melanogaster wings in an experimental design with extensively replicated and fully controlled genotypes. The amounts of variation among individuals and of fluctuating asymmetry differ markedly among genotypes, demonstrating a clear genetic basis for size and shape variability. For wing shape, there is a high correlation between the amounts of variation among individuals and fluctuating asymmetry, which indicates a correspondence between the two types of buffering. Likewise, the multivariate patterns of shape variation among individuals and of fluctuating asymmetry show a close association. For wing size, however, the amounts of individual variation and fluctuating asymmetry are not correlated. There was a significant link between the amounts of variation between wing size and shape, more so for fluctuating asymmetry than for variation among individuals. Overall, these experiments indicate a considerable degree of shared control of individual variation and fluctuating asymmetry, although it appears to differ between traits.

  16. Notch inhibits Yorkie activity in Drosophila wing discs.

    Directory of Open Access Journals (Sweden)

    Alexandre Djiane

    Full Text Available During development, tissues and organs must coordinate growth and patterning so they reach the right size and shape. During larval stages, a dramatic increase in size and cell number of Drosophila wing imaginal discs is controlled by the action of several signaling pathways. Complex cross-talk between these pathways also pattern these discs to specify different regions with different fates and growth potentials. We show that the Notch signaling pathway is both required and sufficient to inhibit the activity of Yorkie (Yki, the Salvador/Warts/Hippo (SWH pathway terminal transcription activator, but only in the central regions of the wing disc, where the TEAD factor and Yki partner Scalloped (Sd is expressed. We show that this cross-talk between the Notch and SWH pathways is mediated, at least in part, by the Notch target and Sd partner Vestigial (Vg. We propose that, by altering the ratios between Yki, Sd and Vg, Notch pathway activation restricts the effects of Yki mediated transcription, therefore contributing to define a zone of low proliferation in the central wing discs.

  17. Erythritol and Lufenuron detrimentally alter age structure of Wild Spotted Wing Drosophila (SWD) Drosophila suzukii (Diptera: Drosophilidae) populations in blueberry and blackberry

    Science.gov (United States)

    We report on the efficacy of 0.5 M (61,000 ppm) Erythritol (E) in Truvia Baking Blend®, 10 ppm Lufenuron (L), and their combination (LE) to reduce egg and larval densities of wild populations of spotted wing Drosophila, Drosophila suzukii (Matsumura) (SWD) infesting fields of rabbiteye blueberries (...

  18. Peptidergic control of a fruit crop pest: the spotted-wing drosophila, Drosophila suzukii

    Science.gov (United States)

    Neuropeptides play an important role in the regulation of feeding in insects and offer potential targets for the development of new chemicals to control insect pests. A pest that has attracted much recent attention is the highly invasive Drosophila suzukii, a polyphagous pest that can cause serious...

  19. Irradiated cocoa tested in the wing spot assay in Drosophila melanogaster

    International Nuclear Information System (INIS)

    Zimmering, S.; Olvera, O.; Cruces, M.P.; Pimentel, E.; Arceo, C.; Rosa, M.E. de la; Guzman, J.

    1992-01-01

    The result of treatment of Drosophila melanogaster with irradiated cocoa as scored in the somatic wing spot test is described. The test has been used previously in the evaluation of irradiated food and has registrated a significantly greater number of positives among chemicals tested than germ line counterparts. Irradiated cocoa has thus far been reported negative in other mutagenicity assays including those employing salmonella and Drosophila germ cells and mammalian cells. The wing spot test as described in Graf et al. was employed. Females of the genotype mwh were mated with flr 3 /TM3; Ser males. (author). 9 refs.; 1 tab

  20. Local elasticity and adhesion of nanostructures on Drosophila melanogaster wing membrane studied using atomic force microscopy

    Energy Technology Data Exchange (ETDEWEB)

    Wagner, Ryan, E-mail: rbwagner@purdue.edu [School of Mechanical Engineering, Purdue University, West Lafayette (United States); Brick Nanotechnology Center, Purdue University, West Lafayette (United States); Pittendrigh, Barry R. [Department of Entomology, University of Illinois, Champaign (United States); Raman, Arvind, E-mail: raman@purdue.edu [School of Mechanical Engineering, Purdue University, West Lafayette (United States); Brick Nanotechnology Center, Purdue University, West Lafayette (United States)

    2012-10-15

    Highlights: Black-Right-Pointing-Pointer We studied the wing membrane of Drosophila melanogaster with atomic force microscopy. Black-Right-Pointing-Pointer We report the structure, elasticity, and adhesion on the wing membrane in air and nitrogen environments. Black-Right-Pointing-Pointer Results provide insight into the nature of the wing membrane enabling the development of biomimetic surface and micro air vehicles. - Abstract: Insect wings have a naturally occurring, complex, functional, hierarchical microstructure and nanostructure, which enable a remarkably water-resistant and self-cleaning surface. Insect wings are used as a basis for engineering biomimetic materials; however, the material properties of these nanostructures such as local elastic modulus and adhesion are poorly understood. We studied the wings of the Canton-S strain of Drosophila melanogaster (hereafter referred to as Drosophila) with atomic force microscopy (AFM) to quantify the local material properties of Drosophila wing surface nanostructures. The wings are found to have a hierarchical structure of 10-20 {mu}m long, 0.5-1 {mu}m diameter hair, and at a much smaller scale, 100 nm diameter and 30-60 nm high bumps. The local properties of these nanoscale bumps were studied under ambient and dry conditions with force-volume AFM. The wing membrane was found to have a elastic modulus on the order of 1000 MPa and the work of adhesion between the probe and wing membrane surface was found to be on the order of 100 mJ/m{sup 2}, these properties are the same order of magnitude as common thermoplastic polymers such as polyethylene. The difference in work of adhesion between the nanoscale bump and membrane does not change significantly between ambient (relative humidity of 30%) or dry conditions. This suggests that the nanoscale bumps and the surrounding membrane are chemically similar and only work to increase hydrophobicity though surface roughening or the geometric lotus effect.

  1. Local elasticity and adhesion of nanostructures on Drosophila melanogaster wing membrane studied using atomic force microscopy

    International Nuclear Information System (INIS)

    Wagner, Ryan; Pittendrigh, Barry R.; Raman, Arvind

    2012-01-01

    Highlights: ► We studied the wing membrane of Drosophila melanogaster with atomic force microscopy. ► We report the structure, elasticity, and adhesion on the wing membrane in air and nitrogen environments. ► Results provide insight into the nature of the wing membrane enabling the development of biomimetic surface and micro air vehicles. - Abstract: Insect wings have a naturally occurring, complex, functional, hierarchical microstructure and nanostructure, which enable a remarkably water-resistant and self-cleaning surface. Insect wings are used as a basis for engineering biomimetic materials; however, the material properties of these nanostructures such as local elastic modulus and adhesion are poorly understood. We studied the wings of the Canton-S strain of Drosophila melanogaster (hereafter referred to as Drosophila) with atomic force microscopy (AFM) to quantify the local material properties of Drosophila wing surface nanostructures. The wings are found to have a hierarchical structure of 10–20 μm long, 0.5–1 μm diameter hair, and at a much smaller scale, 100 nm diameter and 30–60 nm high bumps. The local properties of these nanoscale bumps were studied under ambient and dry conditions with force-volume AFM. The wing membrane was found to have a elastic modulus on the order of 1000 MPa and the work of adhesion between the probe and wing membrane surface was found to be on the order of 100 mJ/m 2 , these properties are the same order of magnitude as common thermoplastic polymers such as polyethylene. The difference in work of adhesion between the nanoscale bump and membrane does not change significantly between ambient (relative humidity of 30%) or dry conditions. This suggests that the nanoscale bumps and the surrounding membrane are chemically similar and only work to increase hydrophobicity though surface roughening or the geometric lotus effect.

  2. Local elasticity and adhesion of nanostructures on Drosophila melanogaster wing membrane studied using atomic force microscopy

    Science.gov (United States)

    Wagner, Ryan; Pittendrigh, Barry R.; Raman, Arvind

    2012-10-01

    Insect wings have a naturally occurring, complex, functional, hierarchical microstructure and nanostructure, which enable a remarkably water-resistant and self-cleaning surface. Insect wings are used as a basis for engineering biomimetic materials; however, the material properties of these nanostructures such as local elastic modulus and adhesion are poorly understood. We studied the wings of the Canton-S strain of Drosophila melanogaster (hereafter referred to as Drosophila) with atomic force microscopy (AFM) to quantify the local material properties of Drosophila wing surface nanostructures. The wings are found to have a hierarchical structure of 10-20 μm long, 0.5-1 μm diameter hair, and at a much smaller scale, 100 nm diameter and 30-60 nm high bumps. The local properties of these nanoscale bumps were studied under ambient and dry conditions with force-volume AFM. The wing membrane was found to have a elastic modulus on the order of 1000 MPa and the work of adhesion between the probe and wing membrane surface was found to be on the order of 100 mJ/m2, these properties are the same order of magnitude as common thermoplastic polymers such as polyethylene. The difference in work of adhesion between the nanoscale bump and membrane does not change significantly between ambient (relative humidity of 30%) or dry conditions. This suggests that the nanoscale bumps and the surrounding membrane are chemically similar and only work to increase hydrophobicity though surface roughening or the geometric lotus effect.

  3. The function of the frizzled pathway in the Drosophila wing is dependent on inturned and fuzzy.

    OpenAIRE

    Lee, Haeryun; Adler, Paul N

    2002-01-01

    The Drosophila epidermis is characterized by a dramatic planar or tissue polarity. The frizzled pathway has been shown to be a key regulator of planar polarity for hairs on the wing, ommatidia in the eye, and sensory bristles on the notum. We have investigated the genetic relationships between putative frizzled pathway downstream genes inturned, fuzzy, and multiple wing hairs (inturned-like genes) and upstream genes such as frizzled, prickle, and starry night (frizzled-like genes). Previous d...

  4. Expression of Genes Involved in Drosophila Wing Morphogenesis and Vein Patterning Are Altered by Spaceflight

    Science.gov (United States)

    Parsons-Wingerter, Patricia A.; Hosamani, Ravikumar; Bhattacharya, Sharmila

    2015-01-01

    Imaginal wing discs of Drosophila melanogaster (fruit fly) defined during embryogenesis ultimately result in mature wings of stereotyped (specific) venation patterning. Major regulators of wing disc development are the epidermal growth factor receptor (EGF), Notch, Hedgehog (Hh), Wingless (Wg), and Dpp signaling pathways. Highly stereotyped vascular patterning is also characteristic of tissues in other organisms flown in space such as the mouse retina and leaves of Arabidopsis thaliana. Genetic and other adaptations of vascular patterning to space environmental factors have not yet been systematically quantified, despite widespread recognition of their critical importance for terrestrial and microgravity applications. Here we report changes in gene expression with space flight related to Drosophila wing morphogenesis and vein patterning. In addition, genetically modified phenotypes of increasingly abnormal ectopic wing venation in the Drosophila wing1 were analyzed by NASA's VESsel GENeration Analysis (VESGEN) software2. Our goal is to further develop insightful vascular mappings associated with bioinformatic dimensions of genetic or other molecular phenotypes for correlation with genetic and other molecular profiling relevant to NASA's GeneLab and other Space Biology exploration initiatives.

  5. Interplay of cell dynamics and epithelial tension during morphogenesis of the Drosophila pupal wing

    OpenAIRE

    Etournay, Raphaël; Popović, Marko; Merkel, Matthias; Nandi, Amitabha; Blasse, Corinna; Aigouy, Benoît; Brandl, Holger; Myers, Gene; Salbreux, Guillaume; Jülicher, Frank; Eaton, Suzanne

    2015-01-01

    eLife digest The individual cells in a developing animal embryo organize themselves into tissues with specific and reproducible shapes, which requires the cells to communicate with one another. Cells in tissues exert forces on their neighbors, and respond to being pushed and pulled by the cells around them. In the fruit fly Drosophila melanogaster, each wing consists mainly of a framework of proteins and other molecules that is built by epithelial cells. These epithelial cells divide and grow...

  6. Photo-elastic properties of the wing imaginal disc of Drosophila

    OpenAIRE

    Schluck, T; Aegerter, C M

    2010-01-01

    In the study of developmental biology, the physical properties and constraints of the developing tissues are of great importance. In spite of this, not much is known about the elastic properties of biologically relevant tissues that are studied in biology labs. Here, we characterize properties of the wing imaginal disc of Drosophila, which is a precursor organ intensely studied in the framework of growth control and cell polarity. In order to determine the possibility of measuring mechanical ...

  7. Nano-architecture of gustatory chemosensory bristles and trachea in Drosophila wings.

    Science.gov (United States)

    Valmalette, Jean Christophe; Raad, Hussein; Qiu, Nan; Ohara, Satoshi; Capovilla, Maria; Robichon, Alain

    2015-09-18

    In the Drosophila wing anterior margin, the dendrites of gustatory neurons occupy the interior of thin and long bristles that present tiny pores at their extremities. Many attempts to measure ligand-evoked currents in insect wing gustatory neurons have been unsuccessful for technical reasons. The functions of this gustatory activity therefore remain elusive and controversial. To advance our knowledge on this understudied tissue, we investigated the architecture of the wing chemosensory bristles and wing trachea using Raman spectroscopy and fluorescence microscopy. We hypothesized that the wing gustatory hair, an open-ended capillary tube, and the wing trachea constitute biological systems similar to nano-porous materials. We present evidence that argues in favour of the existence of a layer or a bubble of air beneath the pore inside the gustatory hair. We demonstrate that these hollow hairs and wing tracheal tubes fulfil conditions for which the physics of fluids applied to open-ended capillaries and porous materials are relevant. We also document that the wing gustatory hair and tracheal architectures are capable of trapping volatile molecules from the environment, which might increase the efficiency of their spatial detection by way of wing vibrations or during flight.

  8. Photo-elastic properties of the wing imaginal disc of Drosophila.

    Science.gov (United States)

    Schluck, T; Aegerter, C M

    2010-10-01

    In the study of developmental biology, the physical properties and constraints of the developing tissues are of great importance. In spite of this, not much is known about the elastic properties of biologically relevant tissues that are studied in biology labs. Here, we characterize properties of the wing imaginal disc of Drosophila, which is a precursor organ intensely studied in the framework of growth control and cell polarity. In order to determine the possibility of measuring mechanical stresses inside the tissue during development, we quantify the photo-elastic properties of the tissue by direct mechanical manipulation. We obtain a photo-elastic constant of 2 x 10(-10) Pa(-1).

  9. Assessing genotoxicity of diuron on Drosophila melanogaster by the wing-spot test and the wing imaginal disk comet assay.

    Science.gov (United States)

    Peraza-Vega, Ricardo I; Castañeda-Sortibrán, América N; Valverde, Mahara; Rojas, Emilio; Rodríguez-Arnaiz, Rosario

    2017-05-01

    The aim of this study was to evaluate the genotoxicity of the herbicide diuron in the wing-spot test and a novel wing imaginal disk comet assay in Drosophila melanogaster. The wing-spot test was performed with standard (ST) and high-bioactivation (HB) crosses after providing chronic 48 h treatment to third instar larvae. A positive dose-response effect was observed in both crosses, but statistically reduced spot frequencies were registered for the HB cross compared with the ST. This latter finding suggests that metabolism differences play an important role in the genotoxic effect of diuron. To verify diuron's ability to produce DNA damage, a wing imaginal disk comet assay was performed after providing 24 h diuron treatment to ST and HB third instar larvae. DNA damage induced by the herbicide had a significantly positive dose-response effect even at very low concentrations in both strains. However, as noted for the wing-spot test, a significant difference between strains was not observed that could be related to the duration of exposure between both assays. A positive correlation between the comet assay and the wing-spot test was found with regard to diuron genotoxicity.

  10. Timed Knickkopf function is essential for wing cuticle formation in Drosophila melanogaster.

    Science.gov (United States)

    Li, Kaixia; Zhang, Xubo; Zuo, Ying; Liu, Weimin; Zhang, Jianzhen; Moussian, Bernard

    2017-10-01

    The insect cuticle is an extracellular matrix that consists of the polysaccharide chitin, proteins, lipids and organic molecules that are arranged in distinct horizontal layers. In Drosophila melanogaster, these layers are not formed sequentially, but, at least partially, at the same time. Timing of the underlying molecular mechanisms is conceivably crucial for cuticle formation. To study this issue, we determined the time period during which the function of Knickkopf (Knk), a key factor of chitin organization, is required for wing cuticle differentiation in D. melanogaster. Although knk is expressed throughout metamorphosis, we demonstrate that its expression 30 h prior and 48 h after pupariation is essential for correct wing cuticle formation. In other words, expression beyond this period is futile. Importantly, manipulation of Knk expression during this time causes wing bending suggesting an effect of Knk amounts on the physical properties of the wing cuticle. Manipulation of Knk expression also interferes with the structure and function of the cuticle surface. First, we show that the shape of surface nano-structures depends on the expression levels of knk. Second, we find that cuticle impermeability is compromised in wings with reduced knk expression. In summary, despite the extended supply of Knk during metamorphosis, controlled amounts of Knk are important for correct wing cuticle differentiation and function in a concise period of time. Copyright © 2017 Elsevier Ltd. All rights reserved.

  11. Consequences of outbreeding on phenotypic plasticity in Drosophila mercatorum wings

    DEFF Research Database (Denmark)

    Krag, Kristian; Thomsen, Hans Paarup; Faurby, Søren

    2009-01-01

    for the wing shape. For all the other treatments higher DI was found in the F1 when the difference was significant, which is suggestive of outbreeding depression. These findings are difficult to interpret since an apparent heterotic effect of size at 25°C is accompanied by higher DI (though not significant...

  12. Genotoxicity of lapachol evaluated by wing spot test of Drosophila melanogaster

    Directory of Open Access Journals (Sweden)

    Wender Ferreira Costa

    2010-01-01

    Full Text Available This study investigated the genotoxicity of Lapachol (LAP evaluated by wing spot test of Drosophila melanogaster in the descendants from standard (ST and high bioactivation (HB crosses. This assay detects the loss of heterozygosity of marker genes expressed phenotypically on the fly's wings. Drosophila has extensive genetic homology to mammals, which makes it a suitable model organism for genotoxic investigations. Three-day-old larvae from ST crosses (females flr³/TM3, Bd s x males mwh/mwh, with basal levels of the cytochrome P450 and larvae of high metabolic bioactivity capacity (HB cross (females ORR; flr³/TM3, Bd s x males mwh/mwh, were used. The results showed that LAP is a promutagen, exhibiting genotoxic activity in larvae from the HB cross. In other words, an increase in the frequency of spots is exclusive of individuals with a high level of the cytochrome P450. The results also indicate that recombinogenicity is the main genotoxic event induced by LAP.

  13. Genotoxicity of lapachol evaluated by wing spot test of Drosophila melanogaster.

    Science.gov (United States)

    Costa, Wender Ferreira; de Oliveira, Alaide Braga; Nepomuceno, Júlio César

    2010-07-01

    This study investigated the genotoxicity of Lapachol (LAP) evaluated by wing spot test of Drosophila melanogaster in the descendants from standard (ST) and high bioactivation (HB) crosses. This assay detects the loss of heterozygosity of marker genes expressed phenotypically on the fly's wings. Drosophila has extensive genetic homology to mammals, which makes it a suitable model organism for genotoxic investigations. Three-day-old larvae from ST crosses (females flr(3)/TM3, Bd(s) x males mwh/mwh), with basal levels of the cytochrome P450 and larvae of high metabolic bioactivity capacity (HB cross) (females ORR; flr(3)/TM3, Bd(s) x males mwh/mwh), were used. The results showed that LAP is a promutagen, exhibiting genotoxic activity in larvae from the HB cross. In other words, an increase in the frequency of spots is exclusive of individuals with a high level of the cytochrome P450. The results also indicate that recombinogenicity is the main genotoxic event induced by LAP.

  14. Molecular Mechanisms for High Hydrostatic Pressure-Induced Wing Mutagenesis in Drosophila melanogaster.

    Science.gov (United States)

    Wang, Hua; Wang, Kai; Xiao, Guanjun; Ma, Junfeng; Wang, Bingying; Shen, Sile; Fu, Xueqi; Zou, Guangtian; Zou, Bo

    2015-10-08

    Although High hydrostatic pressure (HHP) as an important physical and chemical tool has been increasingly applied to research of organism, the response mechanisms of organism to HHP have not been elucidated clearly thus far. To identify mutagenic mechanisms of HHP on organisms, here, we treated Drosophila melanogaster (D. melanogaster) eggs with HHP. Approximately 75% of the surviving flies showed significant morphological abnormalities from the egg to the adult stages compared with control flies (p melanogaster induced by HHP were used to investigate the mutagenic mechanisms of HHP on organism. Thus 285 differentially expressed genes associated with wing mutations were identified using Affymetrix Drosophila Genome Array 2.0 and verified with RT-PCR. We also compared wing development-related central genes in the mutant flies with control flies using DNA sequencing to show two point mutations in the vestigial (vg) gene. This study revealed the mutagenic mechanisms of HHP-induced mutagenesis in D. melanogaster and provided a new model for the study of evolution on organisms.

  15. Heat stress and age induced maternal effects on wing size and shape in parthenogenetic Drosophila mercatorum

    DEFF Research Database (Denmark)

    Andersen, DH; Pertoldi, C; Scali, V

    2005-01-01

    and progeny from heat stressed flies in both size and shape with increased maternal heat stress temperature. The effects of maternal age, however, led to different responses in size and shape between the different progeny groups. The observed variation in landmark displacements was similar, and in both cases......Maternal effects on progeny wing size and shape in a homozygous parthenogenetic strain of Drosophila mercatorum were investigated. The impact of external maternal factors (heat stress) and the impact of internal maternal factors (different maternal and grand maternal age) were studied...... in landmark displacement was visualized by principal component analysis. Both kinds of maternal effects had a significant impact on progeny wing size and shape. Maternal heat stress led to the same pattern of response in size and shape among the progeny, with increased difference between the control group...

  16. The histone deacetylase HDAC1 positively regulates Notch signaling during Drosophila wing development

    Directory of Open Access Journals (Sweden)

    Zehua Wang

    2018-02-01

    Full Text Available The Notch signaling pathway is highly conserved across different animal species and plays crucial roles in development and physiology. Regulation of Notch signaling occurs at multiple levels in different tissues and cell types. Here, we show that the histone deacetylase HDAC1 acts as a positive regulator of Notch signaling during Drosophila wing development. Depletion of HDAC1 causes wing notches on the margin of adult wing. Consistently, the expression of Notch target genes is reduced in the absence of HDAC1 during wing margin formation. We further provide evidence that HDAC1 acts upstream of Notch activation. Mechanistically, we show that HDAC1 regulates Notch protein levels by promoting Notch transcription. Consistent with this, the HDAC1-associated transcriptional co-repressor Atrophin (Atro is also required for transcriptional activation of Notch in the wing disc. In summary, our results demonstrate that HDAC1 positively regulates Notch signaling and reveal a previously unidentified function of HDAC1 in Notch signaling.

  17. The biochemical adaptations of spotted wing drosophila (Diptera: Drosophilidae) to fresh fruits reduced fructose concentrations and glutathione-S transferase activities

    Science.gov (United States)

    Spotted wing drosophila (SWD), Drosophila suzukii, is an invasive and economically damaging pest in Europe and North America, because the females have a serrated ovipositor enabling them to infest ripening almost all small fruits before harvest. Also flies are strongly attracted to fresh fruits rath...

  18. 454-Pyrosequencing survey of microbiota in adult Spotted Wing Drosophila (SWD) corroborates a core microbiome and additional symbiotic and entomopathogenic bacterial associates

    Science.gov (United States)

    Complete surveys of insect endosymbionts including species of economic importance have until recently been hampered by a lack of high-throughput genetic assays. We used 454-pyrosequencing of the 16S rRNA gene amplicon of adult spotted wing Drosophila (SWD) Drosophila suzukii (Matsumura) from souther...

  19. Wing defects in Drosophila xenicid mutant clones are caused by C-terminal deletion of additional sex combs (Asx).

    Science.gov (United States)

    Bischoff, Kara; Ballew, Anna C; Simon, Michael A; O'Reilly, Alana M

    2009-12-01

    The coordinated action of genes that control patterning, cell fate determination, cell size, and cell adhesion is required for proper wing formation in Drosophila. Defects in any of these basic processes can lead to wing aberrations, including blisters. The xenicid mutation was originally identified in a screen designed to uncover regulators of adhesion between wing surfaces [1]. Here, we demonstrate that expression of the betaPS integrin or the patterning protein Engrailed are not affected in developing wing imaginal discs in xenicid mutants. Instead, expression of the homeotic protein Ultrabithorax (Ubx) is strongly increased in xenicid mutant cells. Our results suggest that upregulation of Ubx transforms cells from a wing blade fate to a haltere fate, and that the presence of haltere cells within the wing blade is the primary defect leading to the adult wing phenotypes observed.

  20. Wing defects in Drosophila xenicid mutant clones are caused by C-terminal deletion of additional sex combs (Asx.

    Directory of Open Access Journals (Sweden)

    Kara Bischoff

    2009-12-01

    Full Text Available The coordinated action of genes that control patterning, cell fate determination, cell size, and cell adhesion is required for proper wing formation in Drosophila. Defects in any of these basic processes can lead to wing aberrations, including blisters. The xenicid mutation was originally identified in a screen designed to uncover regulators of adhesion between wing surfaces [1].Here, we demonstrate that expression of the betaPS integrin or the patterning protein Engrailed are not affected in developing wing imaginal discs in xenicid mutants. Instead, expression of the homeotic protein Ultrabithorax (Ubx is strongly increased in xenicid mutant cells.Our results suggest that upregulation of Ubx transforms cells from a wing blade fate to a haltere fate, and that the presence of haltere cells within the wing blade is the primary defect leading to the adult wing phenotypes observed.

  1. Mathematical modeling of planar cell polarity signaling in the Drosophila melanogaster wing

    Science.gov (United States)

    Amonlirdviman, Keith

    Planar cell polarity (PCP) signaling refers to the coordinated polarization of cells within the plane of various epithelial tissues to generate sub-cellular asymmetry along an axis orthogonal to their apical-basal axes. For example, in the Drosophila wing, PCP is seen in the parallel orientation of hairs that protrude from each of the approximately 30,000 epithelial cells to robustly point toward the wing tip. Through a poorly understood mechanism, cell clones mutant for some PCP signaling components, including some, but not all alleles of the receptor frizzled, cause polarity disruptions of neighboring, wild-type cells, a phenomenon referred to as domineering nonautonomy. Previous models have proposed diffusible factors to explain nonautonomy, but no such factors have yet been found. This dissertation describes the mathematical modeling of PCP in the Drosophila wing, based on a contact dependent signaling hypothesis derived from experimental results. Intuition alone is insufficient to deduce that this hypothesis, which relies on a local feedback loop acting at the cell membrane, underlies the complex patterns observed in large fields of cells containing mutant clones, and others have argued that it cannot account for observed phenotypes. Through reaction-diffusion, partial differential equation modeling and simulation, the feedback loop is shown to fully reproduce PCP phenotypes, including domineering nonautonomy. The sufficiency of this model and the experimental validation of model predictions argue that previously proposed diffusible factors need not be invoked to explain PCP signaling and reveal how specific protein-protein interactions lead to autonomy or domineering nonautonomy. Based on these results, an ordinary differential equation model is derived to study the relationship of the feedback loop with upstream signaling components. The cadherin Fat transduces a cue to the local feedback loop, biasing the polarity direction of each cell toward the wing tip

  2. Inwardly rectifying potassium channels influence Drosophila wing morphogenesis by regulating Dpp release.

    Science.gov (United States)

    Dahal, Giri Raj; Pradhan, Sarala Joshi; Bates, Emily Anne

    2017-08-01

    Loss of embryonic ion channel function leads to morphological defects, but the underlying reason for these defects remains elusive. Here, we show that inwardly rectifying potassium (Irk) channels regulate release of the Drosophila bone morphogenetic protein Dpp in the developing fly wing and that this is necessary for developmental signaling. Inhibition of Irk channels decreases the incidence of distinct Dpp-GFP release events above baseline fluorescence while leading to a broader distribution of Dpp-GFP. Work by others in different cell types has shown that Irk channels regulate peptide release by modulating membrane potential and calcium levels. We found calcium transients in the developing wing, and inhibition of Irk channels reduces the duration and amplitude of calcium transients. Depolarization with high extracellular potassium evokes Dpp release. Taken together, our data implicate Irk channels as a requirement for regulated release of Dpp, highlighting the importance of the temporal pattern of Dpp presentation for morphogenesis of the wing. © 2017. Published by The Company of Biologists Ltd.

  3. Use of the Drosophila wing spot test in the genotoxicity testing of different herbicides.

    Science.gov (United States)

    Kaya, B; Creus, A; Yanikoğlu, A; Cabré, O; Marcos, R

    2000-01-01

    Four herbicides, namely propanil, maleic hydrazide, glyphosate, and 2,4,5-trichlorophenoxyacetic acid (2,4,5-T), were investigated for genotoxicity in the wing spot test of Drosophila melanogaster. The herbicides were administered by chronic feeding to 3-day-old larvae. Two different crosses, a standard (ST) and a high-bioactivation (HB) cross, involving the flare-3 (flr(3)) and the multiple wing hairs (mwh) markers, were used. The HB cross uses flies characterized by an increased cytochrome P-450-dependent bioactivation capacity, which permits a more efficient biotransformation of promutagens and procarcinogens. In both crosses, the wings of the two types of progeny, which are inversion-free marker heterozygotes and balancer heterozygotes, were analyzed. Maleic hydrazide and glyphosate proved to be more genotoxic in the ST cross, whereas propanil appeared to be slightly more genotoxic in the HB cross. On the other hand, the herbicide 2,4,5-T increased the mutation frequency for only the small single spots in the ST cross. Copyright 2000 Wiley-Liss, Inc.

  4. Drosophila Big bang regulates the apical cytocortex and wing growth through junctional tension.

    Science.gov (United States)

    Tsoumpekos, Giorgos; Nemetschke, Linda; Knust, Elisabeth

    2018-03-05

    Growth of epithelial tissues is regulated by a plethora of components, including signaling and scaffolding proteins, but also by junctional tension, mediated by the actomyosin cytoskeleton. However, how these players are spatially organized and functionally coordinated is not well understood. Here, we identify the Drosophila melanogaster scaffolding protein Big bang as a novel regulator of growth in epithelial cells of the wing disc by ensuring proper junctional tension. Loss of big bang results in the reduction of the regulatory light chain of nonmuscle myosin, Spaghetti squash. This is associated with an increased apical cell surface, decreased junctional tension, and smaller wings. Strikingly, these phenotypic traits of big bang mutant discs can be rescued by expressing constitutively active Spaghetti squash. Big bang colocalizes with Spaghetti squash in the apical cytocortex and is found in the same protein complex. These results suggest that in epithelial cells of developing wings, the scaffolding protein Big bang controls apical cytocortex organization, which is important for regulating cell shape and tissue growth. © 2018 Tsoumpekos et al.

  5. Scaling the Drosophila Wing: TOR-Dependent Target Gene Access by the Hippo Pathway Transducer Yorkie.

    Science.gov (United States)

    Parker, Joseph; Struhl, Gary

    2015-10-01

    Organ growth is controlled by patterning signals that operate locally (e.g., Wingless/Ints [Wnts], Bone Morphogenetic Proteins [BMPs], and Hedgehogs [Hhs]) and scaled by nutrient-dependent signals that act systemically (e.g., Insulin-like peptides [ILPs] transduced by the Target of Rapamycin [TOR] pathway). How cells integrate these distinct inputs to generate organs of the appropriate size and shape is largely unknown. The transcriptional coactivator Yorkie (Yki, a YES-Associated Protein, or YAP) acts downstream of patterning morphogens and other tissue-intrinsic signals to promote organ growth. Yki activity is regulated primarily by the Warts/Hippo (Wts/Hpo) tumour suppressor pathway, which impedes nuclear access of Yki by a cytoplasmic tethering mechanism. Here, we show that the TOR pathway regulates Yki by a separate and novel mechanism in the Drosophila wing. Instead of controlling Yki nuclear access, TOR signaling governs Yki action after it reaches the nucleus by allowing it to gain access to its target genes. When TOR activity is inhibited, Yki accumulates in the nucleus but is sequestered from its normal growth-promoting target genes--a phenomenon we term "nuclear seclusion." Hence, we posit that in addition to its well-known role in stimulating cellular metabolism in response to nutrients, TOR also promotes wing growth by liberating Yki from nuclear seclusion, a parallel pathway that we propose contributes to the scaling of wing size with nutrient availability.

  6. Genotoxic evaluation of two oral antidiabetic agents in the Drosophila wing spot test.

    Science.gov (United States)

    Gürbüzel, Mehmet; Çapoğlu, Ilyas; Kızılet, Halit; Halıcı, Zekai; Özçiçek, Fatih; Demirtaş, Levent

    2014-05-01

    In this study, two sulfonylureas--glimepiride and glipizide--commonly used in type 2 diabetes mellitus were investigated for genotoxicity in the Drosophila wing spot test. For this purpose, three-day-old transheterozygous larvae were treated with three mutagenic compounds, and the results obtained were compared with the control group. Mutational or recombinogenic changes were recorded in two recessive genes--multiple wing hairs (mwh) and flare (flr (3)). Two recessive markers were located on the left arm of chromosome 3, mwh in map position 0.3, and flare-3 (flr3) at 38.8, while the centromere was located in position 47.7. Wing spot tests are targeted on the loss of heterozygosity, which may be grounded in different genetic mechanisms such as mutation, mitotic recombination, deletion, half-translocation, chromosome loss, or nondisjunction. Genetic changes formatting in somatic cells of the imaginal discs cause nascence different mutant cloning in different body parts of adult flies. Our in vivo experiments demonstrated that glimepiride and glipizide show the genotoxicity, which is especially dependent on homologous somatic recombination.

  7. Functional dissection of a neuronal network required for cuticle tanning and wing expansion in Drosophila.

    Science.gov (United States)

    Luan, Haojiang; Lemon, William C; Peabody, Nathan C; Pohl, Jascha B; Zelensky, Paul K; Wang, Ding; Nitabach, Michael N; Holmes, Todd C; White, Benjamin H

    2006-01-11

    A subset of Drosophila neurons that expresses crustacean cardioactive peptide (CCAP) has been shown previously to make the hormone bursicon, which is required for cuticle tanning and wing expansion after eclosion. Here we present evidence that CCAP-expressing neurons (NCCAP) consist of two functionally distinct groups, one of which releases bursicon into the hemolymph and the other of which regulates its release. The first group, which we call NCCAP-c929, includes 14 bursicon-expressing neurons of the abdominal ganglion that lie within the expression pattern of the enhancer-trap line c929-Gal4. We show that suppression of activity within this group blocks bursicon release into the hemolymph together with tanning and wing expansion. The second group, which we call NCCAP-R, consists of NCCAP neurons outside the c929-Gal4 pattern. Because suppression of synaptic transmission and protein kinase A (PKA) activity throughout NCCAP, but not in NCCAP-c929, also blocks tanning and wing expansion, we conclude that neurotransmission and PKA are required in NCCAP-R to regulate bursicon secretion from NCCAP-c929. Enhancement of electrical activity in NCCAP-R by expression of the bacterial sodium channel NaChBac also blocks tanning and wing expansion and leads to depletion of bursicon from central processes. NaChBac expression in NCCAP-c929 is without effect, suggesting that the abdominal bursicon-secreting neurons are likely to be silent until stimulated to release the hormone. Our results suggest that NCCAP form an interacting neuronal network responsible for the regulation and release of bursicon and suggest a model in which PKA-mediated stimulation of inputs to normally quiescent bursicon-expressing neurons activates release of the hormone.

  8. Functional Interaction between HEXIM and Hedgehog Signaling during Drosophila Wing Development.

    Science.gov (United States)

    Nguyen, Duy; Fayol, Olivier; Buisine, Nicolas; Lecorre, Pierrette; Uguen, Patricia

    2016-01-01

    Studying the dynamic of gene regulatory networks is essential in order to understand the specific signals and factors that govern cell proliferation and differentiation during development. This also has direct implication in human health and cancer biology. The general transcriptional elongation regulator P-TEFb regulates the transcriptional status of many developmental genes. Its biological activity is controlled by an inhibitory complex composed of HEXIM and the 7SK snRNA. Here, we examine the function of HEXIM during Drosophila development. Our key finding is that HEXIM affects the Hedgehog signaling pathway. HEXIM knockdown flies display strong phenotypes and organ failures. In the wing imaginal disc, HEXIM knockdown initially induces ectopic expression of Hedgehog (Hh) and its transcriptional effector Cubitus interuptus (Ci). In turn, deregulated Hedgehog signaling provokes apoptosis, which is continuously compensated by apoptosis-induced cell proliferation. Thus, the HEXIM knockdown mutant phenotype does not result from the apoptotic ablation of imaginal disc; but rather from the failure of dividing cells to commit to a proper developmental program due to Hedgehog signaling defects. Furthermore, we show that ci is a genetic suppressor of hexim. Thus, HEXIM ensures the integrity of Hedgehog signaling in wing imaginal disc, by a yet unknown mechanism. To our knowledge, this is the first time that the physiological function of HEXIM has been addressed in such details in vivo.

  9. Functional Interaction between HEXIM and Hedgehog Signaling during Drosophila Wing Development.

    Directory of Open Access Journals (Sweden)

    Duy Nguyen

    Full Text Available Studying the dynamic of gene regulatory networks is essential in order to understand the specific signals and factors that govern cell proliferation and differentiation during development. This also has direct implication in human health and cancer biology. The general transcriptional elongation regulator P-TEFb regulates the transcriptional status of many developmental genes. Its biological activity is controlled by an inhibitory complex composed of HEXIM and the 7SK snRNA. Here, we examine the function of HEXIM during Drosophila development. Our key finding is that HEXIM affects the Hedgehog signaling pathway. HEXIM knockdown flies display strong phenotypes and organ failures. In the wing imaginal disc, HEXIM knockdown initially induces ectopic expression of Hedgehog (Hh and its transcriptional effector Cubitus interuptus (Ci. In turn, deregulated Hedgehog signaling provokes apoptosis, which is continuously compensated by apoptosis-induced cell proliferation. Thus, the HEXIM knockdown mutant phenotype does not result from the apoptotic ablation of imaginal disc; but rather from the failure of dividing cells to commit to a proper developmental program due to Hedgehog signaling defects. Furthermore, we show that ci is a genetic suppressor of hexim. Thus, HEXIM ensures the integrity of Hedgehog signaling in wing imaginal disc, by a yet unknown mechanism. To our knowledge, this is the first time that the physiological function of HEXIM has been addressed in such details in vivo.

  10. The Drosophila wings apart gene anchors a novel, evolutionarily conserved pathway of neuromuscular development.

    Science.gov (United States)

    Morriss, Ginny R; Jaramillo, Carmelita T; Mikolajczak, Crystal M; Duong, Sandy; Jaramillo, Maryann S; Cripps, Richard M

    2013-11-01

    wings apart (wap) is a recessive, semilethal gene located on the X chromosome in Drosophila melanogaster, which is required for normal wing-vein patterning. We show that the wap mutation also results in loss of the adult jump muscle. We use complementation mapping and gene-specific RNA interference to localize the wap locus to the proximal X chromosome. We identify the annotated gene CG14614 as the gene affected by the wap mutation, since one wap allele contains a non-sense mutation in CG14614, and a genomic fragment containing only CG14614 rescues the jump-muscle phenotypes of two wap mutant alleles. The wap gene lies centromere-proximal to touch-insensitive larva B and centromere-distal to CG14619, which is tentatively assigned as the gene affected in introverted mutants. In mutant wap animals, founder cell precursors for the jump muscle are specified early in development, but are later lost. Through tissue-specific knockdowns, we demonstrate that wap function is required in both the musculature and the nervous system for normal jump-muscle formation. wap/CG14614 is homologous to vertebrate wdr68, DDB1 and CUL4 associated factor 7, which also are expressed in neuromuscular tissues. Thus, our findings provide insight into mechanisms of neuromuscular development in higher animals and facilitate the understanding of neuromuscular diseases that may result from mis-expression of muscle-specific or neuron-specific genes.

  11. Attractiveness of fermentation and related products to spotted wing Drosophila (Diptera: drosophilidae).

    Science.gov (United States)

    Kleiber, Joseph R; Unelius, C Rikard; Lee, Jana C; Suckling, David Maxwell; Qian, Michael C; Bruck, Denny J

    2014-04-01

    Laboratory screening bioassays and field trapping experiments of spotted wing drosophila flies, Drosophila suzukii (Matsumura) (Diptera: Drosophilidae), were conducted to determine the attractiveness of 17 compounds as well as to compare attractant efficiency during peak fruit ripeness and postharvest captures late in the season. Compounds structurally related to each of the fermentation products acetic acid, ethanol, ethyl acetate, and 2-phenethyl alcohol were screened for attractiveness compared with a soap water control in greenhouse cage bioassays. The compounds determined to be attractive in the greenhouse bioassay (methanol, ethanol, propanol, formic acid, acetic acid, ethyl acetate, propyl acetate, phenethyl acetate, phenethyl propionate, and phenethyl butyrate) were individually tested in the field added to apple cider vinegar (ACV). The acids were also tested individually in neutralized ACV (NACV; pH ≍7). Combinations of the compounds were tested in NACV. The capture numbers in ACV traps were not significantly increased by the addition of any of the compounds tested, although significant deterrent effects of some of the compounds allowed differences between treatments to be observed. Compounds that are most prevalent in wine and vinegar (methanol, ethanol, acetic acid, and ethyl acetate) as well as phenethyl propionate and phenethyl butyrate were less deterrent than the other compounds tested in the field. Captures during peak fruit ripeness were compared with the postharvest period when fruit hosts were not available or were overripe. Although the total number of flies captured late in the season was lower, the trends in treatment performance were similar, indicating a consistent performance of these baits from peak fruit ripeness through postharvest.

  12. Mechanisms of Regulating Tissue Elongation in Drosophila Wing: Impact of Oriented Cell Divisions, Oriented Mechanical Forces, and Reduced Cell Size

    Science.gov (United States)

    Li, Yingzi; Naveed, Hammad; Kachalo, Sema; Xu, Lisa X.; Liang, Jie

    2014-01-01

    Regulation of cell growth and cell division plays fundamental roles in tissue morphogenesis. However, the mechanisms of regulating tissue elongation through cell growth and cell division are still not well understood. The wing imaginal disc of Drosophila provides a model system that has been widely used to study tissue morphogenesis. Here we use a recently developed two-dimensional cellular model to study the mechanisms of regulating tissue elongation in Drosophila wing. We simulate the effects of directional cues on tissue elongation. We also computationally analyze the role of reduced cell size. Our simulation results indicate that oriented cell divisions, oriented mechanical forces, and reduced cell size can all mediate tissue elongation, but they function differently. We show that oriented cell divisions and oriented mechanical forces act as directional cues during tissue elongation. Between these two directional cues, oriented mechanical forces have a stronger influence than oriented cell divisions. In addition, we raise the novel hypothesis that reduced cell size may significantly promote tissue elongation. We find that reduced cell size alone cannot drive tissue elongation. However, when combined with directional cues, such as oriented cell divisions or oriented mechanical forces, reduced cell size can significantly enhance tissue elongation in Drosophila wing. Furthermore, our simulation results suggest that reduced cell size has a short-term effect on cell topology by decreasing the frequency of hexagonal cells, which is consistent with experimental observations. Our simulation results suggest that cell divisions without cell growth play essential roles in tissue elongation. PMID:24504016

  13. Towards long term cultivation of Drosophila wing imaginal discs in vitro.

    Science.gov (United States)

    Handke, Björn; Szabad, János; Lidsky, Peter V; Hafen, Ernst; Lehner, Christian F

    2014-01-01

    The wing imaginal disc of Drosophila melanogaster is a prominent experimental system for research on control of cell growth, proliferation and death, as well as on pattern formation and morphogenesis during organogenesis. The precise genetic methodology applicable in this system has facilitated conceptual advances of fundamental importance for developmental biology. Experimental accessibility and versatility would gain further if long term development of wing imaginal discs could be studied also in vitro. For example, culture systems would allow live imaging with maximal temporal and spatial resolution. However, as clearly demonstrated here, standard culture methods result in a rapid cell proliferation arrest within hours of cultivation of dissected wing imaginal discs. Analysis with established markers for cells in S- and M phase, as well as with RGB cell cycle tracker, a novel reporter transgene, revealed that in vitro cultivation interferes with cell cycle progression throughout interphase and not just exclusively during G1. Moreover, quantification of EGFP expression from an inducible transgene revealed rapid adverse effects of disc culture on basic cellular functions beyond cell cycle progression. Disc transplantation experiments confirmed that these detrimental consequences do not reflect fatal damage of imaginal discs during isolation, arguing clearly for a medium insufficiency. Alternative culture media were evaluated, including hemolymph, which surrounds imaginal discs during growth in situ. But isolated larval hemolymph was found to be even less adequate than current culture media, presumably as a result of conversion processes during hemolymph isolation or disc culture. The significance of prominent growth-regulating pathways during disc culture was analyzed, as well as effects of insulin and disc co-culture with larval tissues as potential sources of endocrine factors. Based on our analyses, we developed a culture protocol that prolongs cell

  14. Towards long term cultivation of Drosophila wing imaginal discs in vitro.

    Directory of Open Access Journals (Sweden)

    Björn Handke

    Full Text Available The wing imaginal disc of Drosophila melanogaster is a prominent experimental system for research on control of cell growth, proliferation and death, as well as on pattern formation and morphogenesis during organogenesis. The precise genetic methodology applicable in this system has facilitated conceptual advances of fundamental importance for developmental biology. Experimental accessibility and versatility would gain further if long term development of wing imaginal discs could be studied also in vitro. For example, culture systems would allow live imaging with maximal temporal and spatial resolution. However, as clearly demonstrated here, standard culture methods result in a rapid cell proliferation arrest within hours of cultivation of dissected wing imaginal discs. Analysis with established markers for cells in S- and M phase, as well as with RGB cell cycle tracker, a novel reporter transgene, revealed that in vitro cultivation interferes with cell cycle progression throughout interphase and not just exclusively during G1. Moreover, quantification of EGFP expression from an inducible transgene revealed rapid adverse effects of disc culture on basic cellular functions beyond cell cycle progression. Disc transplantation experiments confirmed that these detrimental consequences do not reflect fatal damage of imaginal discs during isolation, arguing clearly for a medium insufficiency. Alternative culture media were evaluated, including hemolymph, which surrounds imaginal discs during growth in situ. But isolated larval hemolymph was found to be even less adequate than current culture media, presumably as a result of conversion processes during hemolymph isolation or disc culture. The significance of prominent growth-regulating pathways during disc culture was analyzed, as well as effects of insulin and disc co-culture with larval tissues as potential sources of endocrine factors. Based on our analyses, we developed a culture protocol that

  15. Economic analysis of revenue losses and control costs associated with the spotted wing drosophila, Drosophila suzukii (Matsumura), in the California raspberry industry.

    Science.gov (United States)

    Farnsworth, Derek; Hamby, Kelly A; Bolda, Mark; Goodhue, Rachael E; Williams, Jeffrey C; Zalom, Frank G

    2017-06-01

    The spotted wing drosophila (SWD), Drosophila suzukii (Matsumura), is an invasive vinegar fly with a preference for infesting commercially viable berries and stone fruits. SWD infestations can reduce yields significantly, necessitating additional management activities. This analysis estimates economic losses in the California raspberry industry that have resulted from the SWD invasion. California raspberry producers experienced considerable revenue losses and management costs in the first years following SWD's invasion of North America. Conventional producers have since developed effective chemical management programs, virtually eliminating revenue losses due to SWD and reducing the cost of management to that of purchasing and applying insecticides more often. Organic raspberry producers, who do not have access to the same chemical controls, continue to confront substantial SWD-related revenue losses. These losses can be mitigated only by applying expensive insecticides registered for organic use and by performing labor-intensive field sanitation. SWD's invasion into North America has caused extensive crop losses to berry and cherry crops in California and elsewhere. Agricultural producers and researchers have responded quickly to this pest by developing management programs that significantly reduce revenue losses. Economic losses are expected to continue to fall as producers learn to manage SWD more efficiently and as new control tactics become available. © 2016 Society of Chemical Industry. © 2016 Society of Chemical Industry.

  16. The invasive spotted-wing Drosophila (Diptera, Drosophilidae has been found in the city of São Paulo (Brazil

    Directory of Open Access Journals (Sweden)

    Carlos Ribeiro Vilela

    2014-12-01

    Full Text Available The invasive spotted-wing Drosophila (Diptera, Drosophilidae has been found in the city of São Paulo (Brazil. Drosophila suzukii (Matsumura, 1931, the cherry fly or spotted-wing Drosophila, a pest species from the Oriental and southeastern Palaearctic regions belonging to the melanogaster group, invaded the Nearctic and western countries of the Palaearctic regions late last decade (2008 and, more recently (2013, the southern Brazilian states of Rio Grande do Sul and Santa Catarina. Early in 2014 it was reared from blueberries produced in São Joaquim, state of Santa Catarina, that were bought at a São Paulo city grocery store. Despite being a cold-adapted species, after having arrived to the southeastern state of São Paulo, this invasive fly will probably expand its territory to other Brazilian states and South American countries through trade of cultivated soft skin small fruits, such as blueberries and strawberries, as well as naturally through the use of small wild fruits as breeding sites.

  17. Cellular basis of morphological variation and temperature-related plasticity in Drosophila melanogaster strains with divergent wing shapes.

    Science.gov (United States)

    Torquato, Libéria Souza; Mattos, Daniel; Matta, Bruna Palma; Bitner-Mathé, Blanche Christine

    2014-12-01

    Organ shape evolves through cross-generational changes in developmental patterns at cellular and/or tissue levels that ultimately alter tissue dimensions and final adult proportions. Here, we investigated the cellular basis of an artificially selected divergence in the outline shape of Drosophila melanogaster wings, by comparing flies with elongated or rounded wing shapes but with remarkably similar wing sizes. We also tested whether cellular plasticity in response to developmental temperature was altered by such selection. Results show that variation in cellular traits is associated with wing shape differences, and that cell number may play an important role in wing shape response to selection. Regarding the effects of developmental temperature, a size-related plastic response was observed, in that flies reared at 16 °C developed larger wings with larger and more numerous cells across all intervein regions relative to flies reared at 25 °C. Nevertheless, no conclusive indication of altered phenotypic plasticity was found between selection strains for any wing or cellular trait. We also described how cell area is distributed across different intervein regions. It follows that cell area tends to decrease along the anterior wing compartment and increase along the posterior one. Remarkably, such pattern was observed not only in the selected strains but also in the natural baseline population, suggesting that it might be canalized during development and was not altered by the intense program of artificial selection for divergent wing shapes.

  18. Mutagenic and recombinagenic activity of airborne particulates, PM10 and TSP, organic extracts in the Drosophila wing-spot test

    International Nuclear Information System (INIS)

    Rodrigues Dihl, Rafael; Grazielli Azevedo da Silva, Carla; Souza do Amaral, Viviane; Reguly, Maria Luiza; Rodrigues de Andrade, Heloisa Helena

    2008-01-01

    The genotoxicity associated with air pollution in the city of Canoas, Rio Grande do Sul (Brazil), was assessed in November (spring) and January (summer). We applied the somatic mutation and recombination test (SMART) in Drosophila melanogaster in its standard version with normal bioactivation (ST) and in its variant with increased cytochrome P450-dependent biotransformation capacity (HB). The data indicated the genotoxicity of TSP and PM10 collected in November, in both ST and HB crosses. The genotoxic activity of the PM10 material in the spring sample was exclusively associated with the induction of mitotic recombination, whereas the TSP genetic toxicity was due to both recombinational as well as point and/or chromosomal mutation events. Considering PM10 collected in January, a positive response-100% (17.10 m 3 /ml) concentration-was observed in the HB cross, which was not detected in the ST cross. - Drosophila Wing-Spot Test can be used for detection of airborne particulates mutagenesis

  19. Expanding signaling-molecule wavefront model of cell polarization in the Drosophila wing primordium.

    Science.gov (United States)

    Wortman, Juliana C; Nahmad, Marcos; Zhang, Peng Cheng; Lander, Arthur D; Yu, Clare C

    2017-07-01

    In developing tissues, cell polarization and proliferation are regulated by morphogens and signaling pathways. Cells throughout the Drosophila wing primordium typically show subcellular localization of the unconventional myosin Dachs on the distal side of cells (nearest the center of the disc). Dachs localization depends on the spatial distribution of bonds between the protocadherins Fat (Ft) and Dachsous (Ds), which form heterodimers between adjacent cells; and the Golgi kinase Four-jointed (Fj), which affects the binding affinities of Ft and Ds. The Fj concentration forms a linear gradient while the Ds concentration is roughly uniform throughout most of the wing pouch with a steep transition region that propagates from the center to the edge of the pouch during the third larval instar. Although the Fj gradient is an important cue for polarization, it is unclear how the polarization is affected by cell division and the expanding Ds transition region, both of which can alter the distribution of Ft-Ds heterodimers around the cell periphery. We have developed a computational model to address these questions. In our model, the binding affinity of Ft and Ds depends on phosphorylation by Fj. We assume that the asymmetry of the Ft-Ds bond distribution around the cell periphery defines the polarization, with greater asymmetry promoting cell proliferation. Our model predicts that this asymmetry is greatest in the radially-expanding transition region that leaves polarized cells in its wake. These cells naturally retain their bond distribution asymmetry after division by rapidly replenishing Ft-Ds bonds at new cell-cell interfaces. Thus we predict that the distal localization of Dachs in cells throughout the pouch requires the movement of the Ds transition region and the simple presence, rather than any specific spatial pattern, of Fj.

  20. Glia in Drosophila behavior.

    Science.gov (United States)

    Zwarts, L; Van Eijs, F; Callaerts, P

    2015-09-01

    Glial cells constitute about 10 % of the Drosophila nervous system. The development of genetic and molecular tools has helped greatly in defining different types of glia. Furthermore, considerable progress has been made in unraveling the mechanisms that control the development and differentiation of Drosophila glia. By contrast, the role of glia in adult Drosophila behavior is not well understood. We here summarize recent work describing the role of glia in normal behavior and in Drosophila models for neurological and behavioral disorders.

  1. Somatic mutation and recombination induced by fast neutrons in the wing spot test of Drosophila Melanogaster

    International Nuclear Information System (INIS)

    Guzman R, J.; Varela, A.; Policroniades, R.; Delfin, A.; Graf, U.

    1994-01-01

    In the last decades, a large number of studies have been undertaken to evaluate the biological effects of gamma and X rays in Drosophila melanogaster. The majority of these investigations were performed on female and male germ cells. However, comparatively little is known in relation to the biological effects of fast neutrons, and especially in relation to their effects in somatic cells. (Author)

  2. The role of the Suppressor of Hairy-wing insulator protein in Drosophila oogenesis

    Science.gov (United States)

    Baxley, Ryan M.; Soshnev, Alexey A.; Koryakov, Dmitry E.; Zhimulev, Igor F.; Geyer, Pamela K.

    2011-01-01

    The Drosophila Suppressor of Hairy wing [Su(Hw)] insulator protein has an essential role in the development of the female germline. Here we investigate the function of Su(Hw) in the ovary. We show that Su(Hw) is universally expressed in somatic cells, while germ cell expression is dynamic. Robust levels accumulate in post-mitotic germ cells, where Su(Hw) localization is limited to chromosomes within nurse cells, the specialized cells that support oocyte growth. Although loss of Su(Hw) causes global defects in nurse cell chromosome structure, we demonstrate that these architectural changes are not responsible for the block in oogenesis. Connections between the fertility and insulator functions of Su(Hw) were investigated through studies of the two gypsy insulator proteins, Modifier of (mdg4)67.2 (Mod67.2) and Centrosomal Protein of 190 kD (CP190). Accumulation of these proteins is distinct from Su(Hw), with Mod67.2 and CP190 showing uniform expression in all cells during early stages of oogenesis that diminishes in later stages. Although Mod67.2 and CP190 extensively co-localize with Su(Hw) on nurse cell chromosomes, neither protein is required for nurse cell chromosome development or oocyte production. These data indicate that while the gypsy insulator function requires both Mod67.2 and CP190, these proteins are not essential for oogenesis. These studies represent the first molecular investigations of Su(Hw) function in the germline, which uncover distinct requirements for Su(Hw) insulator and ovary functions. PMID:21651900

  3. Tests for the replication of an association between Egfr and natural variation in Drosophila melanogaster wing morphology

    Directory of Open Access Journals (Sweden)

    Dodgson James

    2005-08-01

    Full Text Available Abstract Background Quantitative differences between individuals stem from a combination of genetic and environmental factors, with the heritable variation being shaped by evolutionary forces. Drosophila wing shape has emerged as an attractive system for genetic dissection of multi-dimensional traits. We utilize several experimental genetic methods to validation of the contribution of several polymorphisms in the Epidermal growth factor receptor (Egfr gene to wing shape and size, that were previously mapped in populations of Drosophila melanogaster from North Carolina (NC and California (CA. This re-evaluation utilized different genetic testcrosses to generate heterozygous individuals with a variety of genetic backgrounds as well as sampling of new alleles from Kenyan stocks. Results Only one variant, in the Egfr promoter, had replicable effects in all new experiments. However, expanded genotyping of the initial sample of inbred lines rendered the association non-significant in the CA population, while it persisted in the NC sample, suggesting population specific modification of the quantitative trait nucleotide QTN effect. Conclusion Dissection of quantitative trait variation to the nucleotide level can identify sites with replicable effects as small as one percent of the segregating genetic variation. However, the testcross approach to validate QTNs is both labor intensive and time-consuming, and is probably less useful than resampling of large independent sets of outbred individuals.

  4. Cap-n-Collar Promotes Tissue Regeneration by Regulating ROS and JNK Signaling in the Drosophila melanogaster Wing Imaginal Disc.

    Science.gov (United States)

    Brock, Amanda R; Seto, Mabel; Smith-Bolton, Rachel K

    2017-07-01

    Regeneration is a complex process that requires an organism to recognize and repair tissue damage, as well as grow and pattern new tissue. Here, we describe a genetic screen to identify novel regulators of regeneration. We ablated the Drosophila melanogaster larval wing primordium by inducing apoptosis in a spatially and temporally controlled manner and allowed the tissue to regenerate and repattern. To identify genes that regulate regeneration, we carried out a dominant-modifier screen by assessing the amount and quality of regeneration in adult wings heterozygous for isogenic deficiencies. We have identified 31 regions on the right arm of the third chromosome that modify the regenerative response. Interestingly, we observed several distinct phenotypes: mutants that regenerated poorly, mutants that regenerated faster or better than wild-type, and mutants that regenerated imperfectly and had patterning defects. We mapped one deficiency region to cap-n-collar ( cnc ), the Drosophila Nrf2 ortholog, which is required for regeneration. Cnc regulates reactive oxygen species levels in the regenerating epithelium, and affects c-Jun N-terminal protein kinase (JNK) signaling, growth, debris localization, and pupariation timing. Here, we present the results of our screen and propose a model wherein Cnc regulates regeneration by maintaining an optimal level of reactive oxygen species to promote JNK signaling. Copyright © 2017 by the Genetics Society of America.

  5. The elongin complex antagonizes the chromatin factor Corto for vein versus intervein cell identity in Drosophila wings.

    Science.gov (United States)

    Rougeot, Julien; Renard, Myrtille; Randsholt, Neel B; Peronnet, Frédérique; Mouchel-Vielh, Emmanuèle

    2013-01-01

    Drosophila wings mainly consist of two cell types, vein and intervein cells. Acquisition of either fate depends on specific expression of genes that are controlled by several signaling pathways. The nuclear mechanisms that translate signaling into regulation of gene expression are not completely understood, but they involve chromatin factors from the Trithorax (TrxG) and Enhancers of Trithorax and Polycomb (ETP) families. One of these is the ETP Corto that participates in intervein fate through interaction with the Drosophila EGF Receptor--MAP kinase ERK pathway. Precise mechanisms and molecular targets of Corto in this process are not known. We show here that Corto interacts with the Elongin transcription elongation complex. This complex, that consists of three subunits (Elongin A, B, C), increases RNA polymerase II elongation rate in vitro by suppressing transient pausing. Analysis of phenotypes induced by EloA, B, or C deregulation as well as genetic interactions suggest that the Elongin complex might participate in vein vs intervein specification, and antagonizes corto as well as several TrxG genes in this process. Chromatin immunoprecipitation experiments indicate that Elongin C and Corto bind the vein-promoting gene rhomboid in wing imaginal discs. We propose that Corto and the Elongin complex participate together in vein vs intervein fate, possibly through tissue-specific transcriptional regulation of rhomboid.

  6. The elongin complex antagonizes the chromatin factor Corto for vein versus intervein cell identity in Drosophila wings.

    Directory of Open Access Journals (Sweden)

    Julien Rougeot

    Full Text Available Drosophila wings mainly consist of two cell types, vein and intervein cells. Acquisition of either fate depends on specific expression of genes that are controlled by several signaling pathways. The nuclear mechanisms that translate signaling into regulation of gene expression are not completely understood, but they involve chromatin factors from the Trithorax (TrxG and Enhancers of Trithorax and Polycomb (ETP families. One of these is the ETP Corto that participates in intervein fate through interaction with the Drosophila EGF Receptor--MAP kinase ERK pathway. Precise mechanisms and molecular targets of Corto in this process are not known. We show here that Corto interacts with the Elongin transcription elongation complex. This complex, that consists of three subunits (Elongin A, B, C, increases RNA polymerase II elongation rate in vitro by suppressing transient pausing. Analysis of phenotypes induced by EloA, B, or C deregulation as well as genetic interactions suggest that the Elongin complex might participate in vein vs intervein specification, and antagonizes corto as well as several TrxG genes in this process. Chromatin immunoprecipitation experiments indicate that Elongin C and Corto bind the vein-promoting gene rhomboid in wing imaginal discs. We propose that Corto and the Elongin complex participate together in vein vs intervein fate, possibly through tissue-specific transcriptional regulation of rhomboid.

  7. High-resolution two-dimensional gel analysis of proteins in wing imaginal discs: A data base of Drosophila

    International Nuclear Information System (INIS)

    Santaren, J.F.; Garcia-Bellido, A.

    1990-01-01

    An improved method of high-resolution two-dimensional gel electrophoresis has been used to study the patterns of protein synthesis in wing imaginal discs of late instar larvae of Drosophila melanogaster. A small number of discs were radiolabeled with a mixture of 14 C-labeled amino acids or with [ 35 S]methionine and the pattern of labeled proteins was analyzed. One thousand and twenty-five polypeptides (787 acidic (IEF) and 238 basic (NEPHGE)) from wing discs of several wild-type strains have so far been separated and cataloged. All these polypeptides have been numbered and presented in a reference map for further studies. When comparing patterns of label we have found small quantitative differences in rate of synthesis between individuals of the same strain, not due to sexual differences, and very few quantitative and qualitative differences between groups of individuals of different strains

  8. Evolution of multiple additive loci caused divergence between Drosophila yakuba and D. santomea in wing rowing during male courtship.

    Directory of Open Access Journals (Sweden)

    Jessica Cande

    Full Text Available In Drosophila, male flies perform innate, stereotyped courtship behavior. This innate behavior evolves rapidly between fly species, and is likely to have contributed to reproductive isolation and species divergence. We currently understand little about the neurobiological and genetic mechanisms that contributed to the evolution of courtship behavior. Here we describe a novel behavioral difference between the two closely related species D. yakuba and D. santomea: the frequency of wing rowing during courtship. During courtship, D. santomea males repeatedly rotate their wing blades to face forward and then back (rowing, while D. yakuba males rarely row their wings. We found little intraspecific variation in the frequency of wing rowing for both species. We exploited multiplexed shotgun genotyping (MSG to genotype two backcross populations with a single lane of Illumina sequencing. We performed quantitative trait locus (QTL mapping using the ancestry information estimated by MSG and found that the species difference in wing rowing mapped to four or five genetically separable regions. We found no evidence that these loci display epistasis. The identified loci all act in the same direction and can account for most of the species difference.

  9. Temperature-dependent sex-reversal by a transformer-2 gene-edited mutation in the spotted wing drosophila, Drosophila suzukii

    Science.gov (United States)

    Female to male sex reversal was achieved in an emerging agricultural insect pest, Drosophila suzukii, by creating a temperature-sensitive point mutation in the sex-determination gene, transformer-2 (tra-2) using CRISPR/Cas9 (clustered regularly interspaced palindromic repeats/ CRISPR-associated) hom...

  10. Genetic toxicity in surface water from Guaiba Hydrographic Region under the influence of industrial, urban and agricultural sewage in the Drosophila Wing-Spot Test

    International Nuclear Information System (INIS)

    Souza do Amaral, Viviane; Sinigaglia, Marialva; Reguly, Maria Luiza; Rodrigues de Andrade, Heloisa Helena

    2006-01-01

    Mutagenic and recombinagenic activity of surface waters in the Guaiba Hydrographic Region (RS, Brazil) was investigated using the SMART in Drosophila melanogaster. Two positive results in Cai River (September 2000 and August 2001) and in Taquari River (August 2001 and February 2002) - linked to direct recombinagenic toxicants were observed. In Jacui samples, an indirect mutagenic and recombinagenic action was detected in a September 2000 collection and a direct recombinational activity was observed in February 2002. Also in February 2002 - samples from Diluvio Brook and Guaiba Lake (GPC) were able to induce wing spots by mitotic recombinagenesis. The former sampling site showed toxicants to have a direct action, and the latter an increment in mitotic recombination that depended on metabolic action. The SMART wing test shows that all positive responses were mainly related to homologous mitotic recombination. - Drosophila Wing-Spot Test can be used for detection of environmental mutagenesis

  11. Quantitative structure-activity relationships for toxicity and genotoxicity of halogenated aliphatic compounds: wing spot test of Drosophila melanogaster.

    Science.gov (United States)

    Chroust, Karel; Pavlová, Martina; Prokop, Zbynek; Mendel, Jan; Bozková, Katerina; Kubát, Zdenek; Zajícková, Veronika; Damborský, Jiri

    2007-02-01

    Halogenated aliphatic compounds were evaluated for toxic and genotoxic effects in the somatic mutation and recombination test employing Drosophila melanogaster. The tested chemicals included chlorinated, brominated and iodinated; mono-, di- and tri-substituted; saturated and unsaturated alkanes: 1,2-dibromoethane, 1-bromo-2-chloroethane, 1-iodopropane, 2,3-dichloropropene, 3-bromo-1-propene, epibromohydrin, 2-iodobutane, 3-chloro-2-methylpropene, 1,2,3-trichloropropane, 1,2-dichloroethane, 1,2-dichlorobutane, 1-chloro-2-methylpropane, 1,3-dichloropropane, 1,2-dichloropropane, 2-chloroethymethylether, 1-bromo-2-methylpropane and 1-chloropentane. N-methyl-N-nitrosourea served as the positive and distilled water as the negative control. The set of chemicals for the toxicological testing was selected by the use of statistical experiment design. Group of unsaturated aliphatic hydrocarbons were generally more toxic than saturated analogues. The genotoxic effect was observed with 14 compounds in the wing spot test, while 3 substances did not show any genotoxicity by using the wing spot test at 50% lethal concentration. The highest number of wing spots was observed in genotoxicity assay with 1-bromo-2-chloroethane, 1,2-dichloroethane, 1,2-dibromoethane and 1-iodopropane. Nucleophilic superdelocalizability calculated by quantum mechanics appears to be a good parameter for prediction of both toxicity and genotoxicity effects of halogenated aliphatic compounds.

  12. Metabolomic Studies in Drosophila.

    Science.gov (United States)

    Cox, James E; Thummel, Carl S; Tennessen, Jason M

    2017-07-01

    Metabolomic analysis provides a powerful new tool for studies of Drosophila physiology. This approach allows investigators to detect thousands of chemical compounds in a single sample, representing the combined contributions of gene expression, enzyme activity, and environmental context. Metabolomics has been used for a wide range of studies in Drosophila , often providing new insights into gene function and metabolic state that could not be obtained using any other approach. In this review, we survey the uses of metabolomic analysis since its entry into the field. We also cover the major methods used for metabolomic studies in Drosophila and highlight new directions for future research. Copyright © 2017 by the Genetics Society of America.

  13. The insulator protein Suppressor of Hairy wing is required for proper ring canal development during oogenesis in Drosophila.

    Science.gov (United States)

    Hsu, Shih-Jui; Plata, Maria P; Ernest, Ben; Asgarifar, Saghi; Labrador, Mariano

    2015-07-01

    Chromatin insulators orchestrate gene transcription during embryo development and cell differentiation by stabilizing interactions between distant genomic sites. Mutations in genes encoding insulator proteins are generally lethal, making in vivo functional analyses of insulator proteins difficult. In Drosophila, however, mutations in the gene encoding the Suppressor of Hairy wing insulator protein [Su(Hw)] are viable and female sterile, providing an opportunity to study insulator function during oocyte development. Whereas previous reports suggest that the function of Su(Hw) in oogenesis is independent of its insulator activity, many aspects of the role of Su(Hw) in Drosophila oogenesis remain unexplored. Here we show that mutations in su(Hw) result in smaller ring canal lumens and smaller outer ring diameters, which likely obstruct molecular and vesicle passage from nurse cells to the oocyte. Fluorescence microscopy reveals that lack of Su(Hw) leads to excess accumulation of Kelch (Kel) and Filament-actin (F-actin) proteins in the ring canal structures of developing egg chambers. Furthermore, we found that misexpression of the Src oncogene at 64B (Src64B) may cause ring canal development defects as microarray analysis and real-time RT-PCR revealed there is a three fold decrease in Src64B expression in su(Hw) mutant ovaries. Restoration of Src64B expression in su(Hw) mutant female germ cells rescued the ring phenotype but did not restore fertility. We conclude that loss of su(Hw) affects expression of many oogenesis related genes and down-regulates Src64B, resulting in ring canal defects potentially contributing to obstruction of molecular flow and an eventual failure of egg chamber organization. Copyright © 2015 Elsevier Inc. All rights reserved.

  14. winged eye Induces Transdetermination of Drosophila Imaginal Disc by Acting in Concert with a Histone Methyltransferase, Su(var3-9

    Directory of Open Access Journals (Sweden)

    Keita Masuko

    2018-01-01

    Full Text Available Summary: Drosophila imaginal disc cells exhibit a remarkable ability to convert cell fates in response to various perturbations, a phenomenon called transdetermination (TD. We previously identified winged eye (wge as a factor that induces eye-to-wing TD upon overexpression in eye imaginal discs, but the molecular mechanisms underlying TD have remained largely unclear. Here, we found that wge induces various histone modifications and enhances the methylation of Lys9 on histone H3 (H3K9, a feature of heterochromatin. A histone methyltransferase, Su(var3-9, is required for wge-mediated H3K9 methylation and eye-to-wing TD. Su(var3-9 is also required for classical wound-induced TD but not for normal development, suggesting its involvement in several types of imaginal disc TDs. Transcriptome analysis revealed that wge represses eye identity genes independently of Su(var3-9 and activates TD-related genes by acting together with Su(var3-9. These findings provide new insights into diverse types of chromatin regulation at progressive steps of cell-fate conversions. : Drosophila imaginal discs switch disc identity by a process known as transdetermination. Masuko et al. demonstrate that expression of the winged eye gene induces transdetermination through histone modifications such as H3K9-methylation. winged eye regulates expression of transdetermination-related genes via a histone methyltransferase, Su(var3-9. Keywords: Drosophila, imaginal disc, transdetermination, heterochromatin, cell fate, winged eye, reprogramming, Su(var3-9

  15. Differences in wing melanization and pigmentation pattern in Drosophila buzzatii (Diptera: Drosophilidae under chemical stress

    Directory of Open Access Journals (Sweden)

    Nicolás MONGIARDINO KOCH

    2012-01-01

    Full Text Available Recientemente, hemos avanzado en nuestra comprensión de las bases genéticas y los mecanismos subyacentes al proceso de melanización durante el desarrollo, lo que permite el estudio de los procesos evolutivos que gobiernan la variabilidad de pigmentación presente en la naturaleza. Sin embargo, los factores ambientales que contribuyen a dicha variabilidad han recibido poca atención, aún cuando pueden conllevar profundas consecuencias a nivel ecológico. En este trabajo, presentamos un método para analizar los patrones de melanización alar de drosofílidos, de forma cualitativa y cuantitativa. Ponemos a prueba esta metodología comparando las alas de Drosophila buzzatii Patterson & Wheeler, criadas en medio control y con el agregado de alcaloides. Los alcaloides fueron extraídos del huésped secundario de estas moscas, Echinopsis terscheckii (Parm. ex Pfeiff. Friedrich & Rowley, los cuales, se sabe, presentan efectos negativos en el desarrollo de D. buzzatii. Las moscas criadas en un medio enriquecido con alcaloides mostraron una mayor melanización alar, junto con diferencias en la distribución espacial del pigmento. Planteamos modificaciones a nivel metabólico y de expresión génica para explicar los cambios que las condiciones de estrés inducen sobre el carácter. Proponemos la utilización de este procedimiento para el estudio de la dependencia ambiental de la melanización.

  16. Chip, a widely expressed chromosomal protein required for segmentation and activity of a remote wing margin enhancer in Drosophila.

    Science.gov (United States)

    Morcillo, P; Rosen, C; Baylies, M K; Dorsett, D

    1997-10-15

    The mechanisms allowing remote enhancers to regulate promoters several kilobase pairs away are unknown but are blocked by the Drosophila suppressor of Hairy-wing protein (Suhw) that binds to gypsy retrovirus insertions between enhancers and promoters. Suhw bound to a gypsy insertion in the cut gene also appears to act interchromosomally to antagonize enhancer-promoter interactions on the homologous chromosome when activity of the Chip gene is reduced. This implicates Chip in enhancer-promoter communication. We cloned Chip and find that it encodes a homolog of the recently discovered mouse Nli/Ldb1/Clim-2 and Xenopus Xldb1 proteins that bind nuclear LIM domain proteins. Chip protein interacts with the LIM domains in the Apterous homeodomain protein, and Chip interacts genetically with apterous, showing that these interactions are important for Apterous function in vivo. Importantly, Chip also appears to have broad functions beyond interactions with LIM domain proteins. Chip is present in all nuclei examined and at numerous sites along the salivary gland polytene chromosomes. Embryos without Chip activity lack segments and show abnormal gap and pair-rule gene expression, although no LIM domain proteins are known to regulate segmentation. We conclude that Chip is a ubiquitous chromosomal factor required for normal expression of diverse genes at many stages of development. We suggest that Chip cooperates with different LIM domain proteins and other factors to structurally support remote enhancer-promoter interactions.

  17. Essential roles of the Tap42-regulated protein phosphatase 2A (PP2A family in wing imaginal disc development of Drosophila melanogaster.

    Directory of Open Access Journals (Sweden)

    Ning Wang

    Full Text Available Protein ser/thr phosphatase 2A family members (PP2A, PP4, and PP6 are implicated in the control of numerous biological processes, but our understanding of the in vivo function and regulation of these enzymes is limited. In this study, we investigated the role of Tap42, a common regulatory subunit for all three PP2A family members, in the development of Drosophila melanogaster wing imaginal discs. RNAi-mediated silencing of Tap42 using the binary Gal4/UAS system and two disc drivers, pnr- and ap-Gal4, not only decreased survival rates but also hampered the development of wing discs, resulting in a remarkable thorax cleft and defective wings in adults. Silencing of Tap42 also altered multiple signaling pathways (HH, JNK and DPP and triggered apoptosis in wing imaginal discs. The Tap42(RNAi-induced defects were the direct result of loss of regulation of Drosophila PP2A family members (MTS, PP4, and PPV, as enforced expression of wild type Tap42, but not a phosphatase binding defective Tap42 mutant, rescued fly survivorship and defects. The experimental platform described herein identifies crucial roles for Tap42•phosphatase complexes in governing imaginal disc and fly development.

  18. Hearing regulates Drosophila aggression.

    Science.gov (United States)

    Versteven, Marijke; Vanden Broeck, Lies; Geurten, Bart; Zwarts, Liesbeth; Decraecker, Lisse; Beelen, Melissa; Göpfert, Martin C; Heinrich, Ralf; Callaerts, Patrick

    2017-02-21

    Aggression is a universal social behavior important for the acquisition of food, mates, territory, and social status. Aggression in Drosophila is context-dependent and can thus be expected to involve inputs from multiple sensory modalities. Here, we use mechanical disruption and genetic approaches in Drosophila melanogaster to identify hearing as an important sensory modality in the context of intermale aggressive behavior. We demonstrate that neuronal silencing and targeted knockdown of hearing genes in the fly's auditory organ elicit abnormal aggression. Further, we show that exposure to courtship or aggression song has opposite effects on aggression. Our data define the importance of hearing in the control of Drosophila intermale aggression and open perspectives to decipher how hearing and other sensory modalities are integrated at the neural circuit level.

  19. Drosophila suzukii population response to environment and management strategies

    Science.gov (United States)

    Spotted wing drosophila, Drosophila suzukii, quickly emerged as a devastating invasive pest of small and stone fruits in the Americas and Europe. To better understand the population dynamics of D. suzukii, we reviewed recent work on juvenile development, adult reproduction, and seasonal variation in...

  20. First foreign exploration for asian parasitoids of Drosophila suzukii

    Science.gov (United States)

    The invasive spotted wing drosophila, Drosophila suzukii Matsumura (Dipt.: Drosophilidae), is a native of East Asia and is now widely established in North America and Europe, where it is a serious pest of small and stone fruit crops. The lack of effective indigenous parasitoids of D. suzukii in the ...

  1. Effect of chemical ratios of a microbial-based feeding attractant on trap catch of spotted wing drosophila (Diptera: Drosophilidae)

    Science.gov (United States)

    Drosophila suzukii Matsumura (SWD) can be trapped with a feeding attractant based on wine and vinegar volatiles and consisting of acetic acid, ethanol, acetoin and methionol. Using that 4-component blend, we found that the catch of SWD increased with increases in the release rate of acetoin (from 0...

  2. The Drosophila melanogaster circadian pacemaker circuit

    Indian Academy of Sciences (India)

    2008-12-07

    Dec 7, 2008 ... large variety of tissues in the fly such as the eye, brain, pro- boscis, antennae, wings, abdomen, Malpighian tubules and testes (Plautz et al. 1997; Giebultowicz 2001). Although cell-autonomous circadian function is attributed to several tissues in Drosophila, circadian pacemaker neurons located in the brain ...

  3. Motor Control of Drosophila Courtship Song

    Directory of Open Access Journals (Sweden)

    Troy R. Shirangi

    2013-11-01

    Full Text Available Many animals utilize acoustic signals—or songs—to attract mates. During courtship, Drosophila melanogaster males vibrate a wing to produce trains of pulses and extended tone, called pulse and sine song, respectively. Courtship songs in the genus Drosophila are exceedingly diverse, and different song features appear to have evolved independently of each other. How the nervous system allows such diversity to evolve is not understood. Here, we identify a wing muscle in D. melanogaster (hg1 that is uniquely male-enlarged. The hg1 motoneuron and the sexually dimorphic development of the hg1 muscle are required specifically for the sine component of the male song. In contrast, the motoneuron innervating a sexually monomorphic wing muscle, ps1, is required specifically for a feature of pulse song. Thus, individual wing motor pathways can control separate aspects of courtship song and may provide a “modular” anatomical substrate for the evolution of diverse songs.

  4. Cancer in Drosophila

    DEFF Research Database (Denmark)

    Herranz, Héctor; Eichenlaub, Teresa; Cohen, Stephen M

    2016-01-01

    Cancer genomics has greatly increased our understanding of the complexity of the genetic and epigenetic changes found in human tumors. Understanding the functional relationships among these elements calls for the use of flexible genetic models. We discuss the use of Drosophila models to study...

  5. BMAA neurotoxicity in Drosophila.

    Science.gov (United States)

    Zhou, Xianchong; Escala, Wilfredo; Papapetropoulos, Spyridon; Bradley, Walter G; Zhai, R Grace

    2009-01-01

    We report the establishment of an in vivo model using the fruit fly Drosophila melanogaster to investigate the toxic effects of L-BMAA. We found that dietary intake of BMAA reduced the lifespan as well as the neurological functions of flies. Furthermore, we have developed an HPLC method to reliably detect both free and protein-bound BMAA in fly tissue extracts.

  6. Genotoxic and Antigenotoxic Potential of Momordica charantia Linn (Cucurbitaceae) in the Wing Spot Test of Drosophila melanogaster.

    Science.gov (United States)

    Guterres, Zaira Rosa; Zanetti, Thalita Alves; Sennes-Lopes, Tiago Felipe; da Silva, Ana Francisca Gomes

    2015-10-01

    Momordica charantia, popularly known as bitter melon, is a plant widely used in ethnobotanical medicine. It has antibacterial, antifungal, anthelmintic, antidiabetic, antiviral, and antimalarial activities, among others. The goal of this study was to evaluate the genotoxic and/or antigenotoxic activity of the aqueous extracts obtained from the aerial parts and fruit of this plant by means of the Drosophila melanogaster wing spot test. Third-stage larvae that obtained standard (ST) cross and high bioactivation (HB) cross were treated with aqueous extracts of the aerial parts (IQA) and fruit (IQF) of M. charantia, following two protocols (genotoxicity and antigenotoxicity). The aqueous extracts are not genotoxic in lower concentrations. The frequencies of mutant spots observed in the descendants of the ST and HB crosses treated with doxorubicin (DXR) alone were 8.65 and 9.25, respectively, whereas in those cotreated with IQA and DXR, the frequencies ranged from 15.90 to 29 in the ST cross and from 15.05 to 24.78 in the HB cross. In cotreatment with IQF, the frequencies ranged from 30.10 to 30.65 in the ST cross and from 13.60 to 14.50 in the HB cross, whereas the frequencies obtained with DXR were 32.50 in the ST cross and 26.00 in the HB cross. In conclusion, the IQA has a synergistic effect, enhancing the genotoxicity of DXR in the ST cross and the HB cross, whereas the IQF has antigenotoxic effects in the HB cross.

  7. Modeling Human Cancers in Drosophila.

    Science.gov (United States)

    Sonoshita, M; Cagan, R L

    2017-01-01

    Cancer is a complex disease that affects multiple organs. Whole-body animal models provide important insights into oncology that can lead to clinical impact. Here, we review novel concepts that Drosophila studies have established for cancer biology, drug discovery, and patient therapy. Genetic studies using Drosophila have explored the roles of oncogenes and tumor-suppressor genes that when dysregulated promote cancer formation, making Drosophila a useful model to study multiple aspects of transformation. Not limited to mechanism analyses, Drosophila has recently been showing its value in facilitating drug development. Flies offer rapid, efficient platforms by which novel classes of drugs can be identified as candidate anticancer leads. Further, we discuss the use of Drosophila as a platform to develop therapies for individual patients by modeling the tumor's genetic complexity. Drosophila provides both a classical and a novel tool to identify new therapeutics, complementing other more traditional cancer tools. © 2017 Elsevier Inc. All rights reserved.

  8. Temperature-dependent sex-reversal by a transformer-2 gene-edited mutation in the spotted wing drosophila, Drosophila suzukii.

    Science.gov (United States)

    Li, Jianwei; Handler, Alfred M

    2017-09-28

    Female to male sex reversal was achieved in an emerging agricultural insect pest, Drosophila suzukii, by creating a temperature-sensitive point mutation in the sex-determination gene, transformer-2 (tra-2), using CRISPR/Cas9 (clustered regularly interspaced palindromic repeats/CRISPR-associated) homology-directed repair gene-editing. Ds-tra-2 ts2 mutants developed as normal fertile XX and XY adults at permissive temperatures below 20 °C, but at higher restrictive temperatures (26 to 29 °C) chromosomal XX females developed as sterile intersexuals with a predominant male phenotype, while XY males developed with normal morphology, but were sterile. The temperature-dependent function of the Ds-TRA-2 ts2 protein was also evident by the up- and down-regulation of female-specific Ds-Yolk protein 1 (Ds-Yp1) gene expression by temperature shifts during adulthood. This study confirmed the temperature-dependent function of a gene-edited mutation and provides a new method for the more general creation of conditional mutations for functional genomic analysis in insects, and other organisms. Furthermore, it provides a temperature-dependent system for creating sterile male populations useful for enhancing the efficacy of biologically-based programs, such as the sterile insect technique (SIT), to control D. suzukii and other insect pest species of agricultural and medical importance.

  9. Independently Controlled Wing Stroke Patterns in the Fruit Fly Drosophila melanogaster

    Czech Academy of Sciences Publication Activity Database

    Chakraborty, Soma; Bartussek, Jan; Fry, S.N.; Zápotocký, Martin

    2015-01-01

    Roč. 10, č. 2 (2015), e0116813 E-ISSN 1932-6203 R&D Projects: GA ČR(CZ) GBP304/12/G069 Institutional support: RVO:67985823 Keywords : motor control * wing kinematics * independent component analysis Subject RIV: ED - Physiology Impact factor: 3.057, year: 2015

  10. Transgenesis in Drosophila melanogaster.

    Science.gov (United States)

    Ringrose, Leonie

    2009-01-01

    Transgenesis in Drosophila melanogaster relies upon direct microinjection of embryos and subsequent crossing of surviving adults. The necessity of crossing single flies to screen for transgenic events limits the range of useful transgenesis techniques to those that have a very high frequency of integration, so that about 1 in 10 to 1 in 100 surviving adult flies carry a transgene. Until recently, only random P-element transgenesis fulfilled these criteria. However, recent advances have brought homologous recombination and site-directed integration up to and beyond this level of efficiency. For all transgenesis techniques in Drosophila melanogaster, microinjection of embryos is the central procedure. This chapter gives a detailed protocol for microinjection, and aims to enable the reader to use it for both site-directed integration and for P-element transgenesis.

  11. Drosophila by the dozen

    Energy Technology Data Exchange (ETDEWEB)

    Celniker, Susan E.; Hoskins, Roger A.

    2007-07-13

    This year's conference on Drosophila research illustratedwell the current focus of Drosophila genomics on the comprehensiveidentification of functional elements in the genome sequence, includingmRNA transcripts arising from multiple alternative start sites and splicesites, a multiplicity of noncoding transcripts and small RNAs,identification of binding sites for transcription factors, sequenceconservation in related species and sequence variation within species.Resources and technologies for genetics and functional genomics aresteadily being improved, including the building of collections oftransposon insertion mutants and hairpin constructs for RNA interference(RNAi). The conference also highlighted progress in the use of genomicinformation by many laboratories to study diverse aspects of biology andmodels of human disease. Here we will review a few highlights of especialinterest to readers of Genome Biology.

  12. The Gene Expression Program for the Formation of Wing Cuticle in Drosophila.

    Directory of Open Access Journals (Sweden)

    Lukasz F Sobala

    2016-05-01

    Full Text Available The cuticular exoskeleton of insects and other arthropods is a remarkably versatile material with a complex multilayer structure. We made use of the ability to isolate cuticle synthesizing cells in relatively pure form by dissecting pupal wings and we used RNAseq to identify genes expressed during the formation of the adult wing cuticle. We observed dramatic changes in gene expression during cuticle deposition, and combined with transmission electron microscopy, we were able to identify candidate genes for the deposition of the different cuticular layers. Among genes of interest that dramatically change their expression during the cuticle deposition program are ones that encode cuticle proteins, ZP domain proteins, cuticle modifying proteins and transcription factors, as well as genes of unknown function. A striking finding is that mutations in a number of genes that are expressed almost exclusively during the deposition of the envelope (the thin outermost layer that is deposited first result in gross defects in the procuticle (the thick chitinous layer that is deposited last. An attractive hypothesis to explain this is that the deposition of the different cuticle layers is not independent with the envelope instructing the formation of later layers. Alternatively, some of the genes expressed during the deposition of the envelope could form a platform that is essential for the deposition of all cuticle layers.

  13. The Drosophila melanogaster host model

    Science.gov (United States)

    Igboin, Christina O.; Griffen, Ann L.; Leys, Eugene J.

    2012-01-01

    The deleterious and sometimes fatal outcomes of bacterial infectious diseases are the net result of the interactions between the pathogen and the host, and the genetically tractable fruit fly, Drosophila melanogaster, has emerged as a valuable tool for modeling the pathogen–host interactions of a wide variety of bacteria. These studies have revealed that there is a remarkable conservation of bacterial pathogenesis and host defence mechanisms between higher host organisms and Drosophila. This review presents an in-depth discussion of the Drosophila immune response, the Drosophila killing model, and the use of the model to examine bacterial–host interactions. The recent introduction of the Drosophila model into the oral microbiology field is discussed, specifically the use of the model to examine Porphyromonas gingivalis–host interactions, and finally the potential uses of this powerful model system to further elucidate oral bacterial-host interactions are addressed. PMID:22368770

  14. Genotoxicity studies in the ST cross of the Drosophila wing spot test of sunflower and soybean oils before and after frying and boiling procedures.

    Science.gov (United States)

    Demir, Eşref; Marcos, Ricard; Kaya, Bülent

    2012-10-01

    Sunflower and soybean oils were tested for genotoxicity in the Drosophila wing somatic mutation and recombination assay. Results indicate that both oils produce genotoxic effects when tested without any previous frying or boiling processes. Boiling sunflower oil during fifteen, thirty and sixty minutes significantly increased its genotoxic response; nevertheless, after frying potatoes this oil showed a significant decrease in the genotoxic activity. On the other hand, boiling and frying soybean oil in the same conditions results in a decrease of its genotoxic potential. We have also detected that the amount of total polar materials increases significantly in oils submitted to frying or boiling process. Nevertheless, in oils obtained after frying potatoes, the amount of TPM was higher than after boiling. It is suggested that this effect is probably due to the amount of non-volatile TPM, the fatty acid composition of the oils, the types of frying oil, the high frying temperature and time, and the number of boiling and frying. This is the first study reporting genotoxicity data in Drosophila for the boiling and frying of both sunflower and soybean oils. Copyright © 2012 Elsevier Ltd. All rights reserved.

  15. winged eye Induces Transdetermination of Drosophila Imaginal Disc by Acting in Concert with a Histone Methyltransferase, Su(var)3-9.

    Science.gov (United States)

    Masuko, Keita; Fuse, Naoyuki; Komaba, Kanae; Katsuyama, Tomonori; Nakajima, Rumi; Furuhashi, Hirofumi; Kurata, Shoichiro

    2018-01-02

    Drosophila imaginal disc cells exhibit a remarkable ability to convert cell fates in response to various perturbations, a phenomenon called transdetermination (TD). We previously identified winged eye (wge) as a factor that induces eye-to-wing TD upon overexpression in eye imaginal discs, but the molecular mechanisms underlying TD have remained largely unclear. Here, we found that wge induces various histone modifications and enhances the methylation of Lys9 on histone H3 (H3K9), a feature of heterochromatin. A histone methyltransferase, Su(var)3-9, is required for wge-mediated H3K9 methylation and eye-to-wing TD. Su(var)3-9 is also required for classical wound-induced TD but not for normal development, suggesting its involvement in several types of imaginal disc TDs. Transcriptome analysis revealed that wge represses eye identity genes independently of Su(var)3-9 and activates TD-related genes by acting together with Su(var)3-9. These findings provide new insights into diverse types of chromatin regulation at progressive steps of cell-fate conversions. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.

  16. The MAP kinase ERK and its scaffold protein MP1 interact with the chromatin regulator Corto during Drosophila wing tissue development.

    Science.gov (United States)

    Mouchel-Vielh, Emmanuèle; Rougeot, Julien; Decoville, Martine; Peronnet, Frédérique

    2011-03-14

    Mitogen-activated protein kinase (MAPK) cascades (p38, JNK, ERK pathways) are involved in cell fate acquisition during development. These kinase modules are associated with scaffold proteins that control their activity. In Drosophila, dMP1, that encodes an ERK scaffold protein, regulates ERK signaling during wing development and contributes to intervein and vein cell differentiation. Functional relationships during wing development between a chromatin regulator, the Enhancer of Trithorax and Polycomb Corto, ERK and its scaffold protein dMP1, are examined here. Genetic interactions show that corto and dMP1 act together to antagonize rolled (which encodes ERK) in the future intervein cells, thus promoting intervein fate. Although Corto, ERK and dMP1 are present in both cytoplasmic and nucleus compartments, they interact exclusively in nucleus extracts. Furthermore, Corto, ERK and dMP1 co-localize on several sites on polytene chromosomes, suggesting that they regulate gene expression directly on chromatin. Finally, Corto is phosphorylated. Interestingly, its phosphorylation pattern differs between cytoplasm and nucleus and changes upon ERK activation. Our data therefore suggest that the Enhancer of Trithorax and Polycomb Corto could participate in regulating vein and intervein genes during wing tissue development in response to ERK signaling.

  17. The MAP kinase ERK and its scaffold protein MP1 interact with the chromatin regulator Corto during Drosophila wing tissue development

    Directory of Open Access Journals (Sweden)

    Peronnet Frédérique

    2011-03-01

    Full Text Available Abstract Background Mitogen-activated protein kinase (MAPK cascades (p38, JNK, ERK pathways are involved in cell fate acquisition during development. These kinase modules are associated with scaffold proteins that control their activity. In Drosophila, dMP1, that encodes an ERK scaffold protein, regulates ERK signaling during wing development and contributes to intervein and vein cell differentiation. Functional relationships during wing development between a chromatin regulator, the Enhancer of Trithorax and Polycomb Corto, ERK and its scaffold protein dMP1, are examined here. Results Genetic interactions show that corto and dMP1 act together to antagonize rolled (which encodes ERK in the future intervein cells, thus promoting intervein fate. Although Corto, ERK and dMP1 are present in both cytoplasmic and nucleus compartments, they interact exclusively in nucleus extracts. Furthermore, Corto, ERK and dMP1 co-localize on several sites on polytene chromosomes, suggesting that they regulate gene expression directly on chromatin. Finally, Corto is phosphorylated. Interestingly, its phosphorylation pattern differs between cytoplasm and nucleus and changes upon ERK activation. Conclusions Our data therefore suggest that the Enhancer of Trithorax and Polycomb Corto could participate in regulating vein and intervein genes during wing tissue development in response to ERK signaling.

  18. Myoblast fusion in Drosophila

    International Nuclear Information System (INIS)

    Haralalka, Shruti; Abmayr, Susan M.

    2010-01-01

    The body wall musculature of a Drosophila larva is composed of an intricate pattern of 30 segmentally repeated muscle fibers in each abdominal hemisegment. Each muscle fiber has unique spatial and behavioral characteristics that include its location, orientation, epidermal attachment, size and pattern of innervation. Many, if not all, of these properties are dictated by founder cells, which determine the muscle pattern and seed the fusion process. Myofibers are then derived from fusion between a specific founder cell and several fusion competent myoblasts (FCMs) fusing with as few as 3-5 FCMs in the small muscles on the most ventral side of the embryo and as many as 30 FCMs in the larger muscles on the dorsal side of the embryo. The focus of the present review is the formation of the larval muscles in the developing embryo, summarizing the major issues and players in this process. We have attempted to emphasize experimentally-validated details of the mechanism of myoblast fusion and distinguish these from the theoretically possible details that have not yet been confirmed experimentally. We also direct the interested reader to other recent reviews that discuss myoblast fusion in Drosophila, each with their own perspective on the process . With apologies, we use gene nomenclature as specified by Flybase (http://flybase.org) but provide Table 1 with alternative names and references.

  19. SUMOylation in Drosophila Development

    Directory of Open Access Journals (Sweden)

    Albert J. Courey

    2012-07-01

    Full Text Available Small ubiquitin-related modifier (SUMO, an ~90 amino acid ubiquitin-like protein, is highly conserved throughout the eukaryotic domain. Like ubiquitin, SUMO is covalently attached to lysine side chains in a large number of target proteins. In contrast to ubiquitin, SUMO does not have a direct role in targeting proteins for proteasomal degradation. However, like ubiquitin, SUMO does modulate protein function in a variety of other ways. This includes effects on protein conformation, subcellular localization, and protein–protein interactions. Significant insight into the in vivo role of SUMOylation has been provided by studies in Drosophila that combine genetic manipulation, proteomic, and biochemical analysis. Such studies have revealed that the SUMO conjugation pathway regulates a wide variety of critical cellular and developmental processes, including chromatin/chromosome function, eggshell patterning, embryonic pattern formation, metamorphosis, larval and pupal development, neurogenesis, development of the innate immune system, and apoptosis. This review discusses our current understanding of the diverse roles for SUMO in Drosophila development.

  20. The apical scaffold big bang binds to spectrins and regulates the growth of Drosophila melanogaster wing discs.

    Science.gov (United States)

    Forest, Elodie; Logeay, Rémi; Géminard, Charles; Kantar, Diala; Frayssinoux, Florence; Heron-Milhavet, Lisa; Djiane, Alexandre

    2018-03-05

    During development, cell numbers are tightly regulated, ensuring that tissues and organs reach their correct size and shape. Recent evidence has highlighted the intricate connections between the cytoskeleton and the regulation of the key growth control Hippo pathway. Looking for apical scaffolds regulating tissue growth, we describe that Drosophila melanogaster big bang (Bbg), a poorly characterized multi-PDZ scaffold, controls epithelial tissue growth without affecting epithelial polarity and architecture. bbg -mutant tissues are smaller, with fewer cells that are less apically constricted than normal. We show that Bbg binds to and colocalizes tightly with the β-heavy-Spectrin/Kst subunit at the apical cortex and promotes Yki activity, F-actin enrichment, and the phosphorylation of the myosin II regulatory light chain Spaghetti squash. We propose a model in which the spectrin cytoskeleton recruits Bbg to the cortex, where Bbg promotes actomyosin contractility to regulate epithelial tissue growth. © 2018 Forest et al.

  1. Cytokines in Drosophila immunity.

    Science.gov (United States)

    Vanha-Aho, Leena-Maija; Valanne, Susanna; Rämet, Mika

    2016-02-01

    Cytokines are a large and diverse group of small proteins that can affect many biological processes, but most commonly cytokines are known as mediators of the immune response. In the event of an infection, cytokines are produced in response to an immune stimulus, and they function as key regulators of the immune response. Cytokines come in many shapes and sizes, and although they vary greatly in structure, their functions have been well conserved in evolution. The immune signaling pathways that respond to cytokines are remarkably conserved from fly to man. Therefore, Drosophila melanogaster, provides an excellent platform for studying the biology and function of cytokines. In this review, we will describe the cytokines and cytokine-like molecules found in the fly and discuss their roles in host immunity. Copyright © 2015 European Federation of Immunological Societies. Published by Elsevier B.V. All rights reserved.

  2. Humidity Sensing in Drosophila.

    Science.gov (United States)

    Enjin, Anders; Zaharieva, Emanuela E; Frank, Dominic D; Mansourian, Suzan; Suh, Greg S B; Gallio, Marco; Stensmyr, Marcus C

    2016-05-23

    Environmental humidity influences the fitness and geographic distribution of all animals [1]. Insects in particular use humidity cues to navigate the environment, and previous work suggests the existence of specific sensory mechanisms to detect favorable humidity ranges [2-5]. Yet, the molecular and cellular basis of humidity sensing (hygrosensation) remains poorly understood. Here we describe genes and neurons necessary for hygrosensation in the vinegar fly Drosophila melanogaster. We find that members of the Drosophila genus display species-specific humidity preferences related to conditions in their native habitats. Using a simple behavioral assay, we find that the ionotropic receptors IR40a, IR93a, and IR25a are all required for humidity preference in D. melanogaster. Yet, whereas IR40a is selectively required for hygrosensory responses, IR93a and IR25a mediate both humidity and temperature preference. Consistent with this, the expression of IR93a and IR25a includes thermosensory neurons of the arista. In contrast, IR40a is excluded from the arista but is expressed (and required) in specialized neurons innervating pore-less sensilla of the sacculus, a unique invagination of the third antennal segment. Indeed, calcium imaging showed that IR40a neurons directly respond to changes in humidity, and IR40a knockdown or IR93a mutation reduced their responses to stimuli. Taken together, our results suggest that the preference for a specific humidity range depends on specialized sacculus neurons, and that the processing of environmental humidity can happen largely in parallel to that of temperature. Copyright © 2016 Elsevier Ltd. All rights reserved.

  3. The sex-limited effects of mutations in the EGFR and TGF-β signaling pathways on shape and size sexual dimorphism and allometry in the Drosophila wing.

    Science.gov (United States)

    Testa, Nicholas D; Dworkin, Ian

    2016-06-01

    Much of the morphological diversity in nature-including among sexes within a species-is a direct consequence of variation in size and shape. However, disentangling variation in sexual dimorphism for both shape (SShD), size (SSD), and their relationship with one another remains complex. Understanding how genetic variation influences both size and shape together, and how this in turn influences SSD and SShD, is challenging. In this study, we utilize Drosophila wing size and shape as a model system to investigate how mutations influence size and shape as modulated by sex. Previous work has demonstrated that mutations in epidermal growth factor receptor (EGFR) and transforming growth factor-β (TGF-β) signaling components can influence both wing size and shape. In this study, we re-analyze this data to specifically address how they impact the relationship between size and shape in a sex-specific manner, in turn altering the pattern of sexual dimorphism. While most mutations influence shape overall, only a subset have a genotypic specific effect that influences SShD. Furthermore, while we observe sex-specific patterns of allometric shape variation, the effects of most mutations on allometry tend to be small. We discuss this within the context of using mutational analysis to understand sexual size and shape dimorphism.

  4. Genotoxic and Antigenotoxic Assessment of Chios Mastic Oil by the In Vitro Micronucleus Test on Human Lymphocytes and the In Vivo Wing Somatic Test on Drosophila.

    Science.gov (United States)

    Vlastos, Dimitris; Drosopoulou, Elena; Efthimiou, Ioanna; Gavriilidis, Maximos; Panagaki, Dimitra; Mpatziou, Krystalenia; Kalamara, Paraskevi; Mademtzoglou, Despoina; Mavragani-Tsipidou, Penelope

    2015-01-01

    Chios mastic oil (CMO), the essential oil derived from Pistacia lentiscus (L.) var. chia (Duham), has generated considerable interest because of its antimicrobial, anticancer, antioxidant and other beneficial properties. In the present study, the potential genotoxic activity of CMO as well as its antigenotoxic properties against the mutagenic agent mitomycin-C (MMC) were evaluated by employing the in vitro Cytokinesis Block MicroNucleus (CBMN) assay and the in vivo Somatic Mutation And Recombination Test (SMART). In the in vitro experiments, lymphocytes were treated with 0.01, 0.05 and 0.10% (v/v) of CMO with or without 0.05 μg/ml MMC, while in the in vivo assay Drosophila larvae were fed with 0.05, 0.10, 0.50 and 1.00% (v/v) of CMO with or without 2.50 μg/ml MMC. CMO did not significantly increase the frequency of micronuclei (MN) or total wing spots, indicating lack of mutagenic or recombinogenic activity. However, the in vitro analysis suggested cytotoxic activity of CMO. The simultaneous administration of MMC with CMO did not alter considerably the frequencies of MMC-induced MN and wing spots showing that CMO doesn't exert antigenotoxic or antirecombinogenic action. Therefore, CMO could be considered as a safe product in terms of genotoxic potential. Even though it could not afford any protection against DNA damage, at least under our experimental conditions, its cytotoxic potential could be of interest.

  5. Genotoxic and Antigenotoxic Assessment of Chios Mastic Oil by the In Vitro Micronucleus Test on Human Lymphocytes and the In Vivo Wing Somatic Test on Drosophila.

    Directory of Open Access Journals (Sweden)

    Dimitris Vlastos

    Full Text Available Chios mastic oil (CMO, the essential oil derived from Pistacia lentiscus (L. var. chia (Duham, has generated considerable interest because of its antimicrobial, anticancer, antioxidant and other beneficial properties. In the present study, the potential genotoxic activity of CMO as well as its antigenotoxic properties against the mutagenic agent mitomycin-C (MMC were evaluated by employing the in vitro Cytokinesis Block MicroNucleus (CBMN assay and the in vivo Somatic Mutation And Recombination Test (SMART. In the in vitro experiments, lymphocytes were treated with 0.01, 0.05 and 0.10% (v/v of CMO with or without 0.05 μg/ml MMC, while in the in vivo assay Drosophila larvae were fed with 0.05, 0.10, 0.50 and 1.00% (v/v of CMO with or without 2.50 μg/ml MMC. CMO did not significantly increase the frequency of micronuclei (MN or total wing spots, indicating lack of mutagenic or recombinogenic activity. However, the in vitro analysis suggested cytotoxic activity of CMO. The simultaneous administration of MMC with CMO did not alter considerably the frequencies of MMC-induced MN and wing spots showing that CMO doesn't exert antigenotoxic or antirecombinogenic action. Therefore, CMO could be considered as a safe product in terms of genotoxic potential. Even though it could not afford any protection against DNA damage, at least under our experimental conditions, its cytotoxic potential could be of interest.

  6. Drosophila VAMP7 regulates Wingless intracellular trafficking.

    Science.gov (United States)

    Gao, Han; He, Fang; Lin, Xinhua; Wu, Yihui

    2017-01-01

    Drosophila Wingless (Wg) is a morphogen that determines cell fate during development. Previous studies have shown that endocytic pathways regulate Wg trafficking and signaling. Here, we showed that loss of vamp7, a gene required for vesicle fusion, dramatically increased Wg levels and decreased Wg signaling. Interestingly, we found that levels of Dally-like (Dlp), a glypican that can interact with Wg to suppress Wg signaling at the dorsoventral boundary of the Drosophila wing, were also increased in vamp7 mutant cells. Moreover, Wg puncta in Rab4-dependent recycling endosomes were Dlp positive. We hypothesize that VAMP7 is required for Wg intracellular trafficking and the accumulation of Wg in Rab4-dependent recycling endosomes might affect Wg signaling.

  7. Use of Drosophila to study DNA repair

    International Nuclear Information System (INIS)

    Boyd, J.B.; Harris, P.V.; Sakaguchi, K.

    1988-01-01

    This paper discusses Drosophila, the premier metazoan organism for analyzing many fundamental features of eukaryotic gene regulation. The authors present adaptations of several approaches for studying DNA repair to an analysis of repair-defective mutants in Drosophila. A current understanding of Drosophila DNA repair is described

  8. Cold hardiness of winter-acclimated Drosophila suzukii (Diptera: Drosophilidae) adults

    Science.gov (United States)

    A.R. Stephens; M.K. Asplen; W.D. Hutchison; Robert C. Venette

    2015-01-01

    Drosophila suzukii Matsumura, often called spotted wing drosophila, is an exotic vinegar fly that is native to Southeast Asia and was first detected in the continental United States in 2008. Previous modeling studies have suggested that D. suzukii might not survive in portions of the northern United States or southern Canada...

  9. Two pests overlap: Drosophila suzukii (Diptera: Drosophilidae) use of fruit exposed to Halyomorpha halys (Hemiptera: Pentatomidae)

    Science.gov (United States)

    Spotted wing drosophila, Drosophila suzukii (Matsumura) (Diptera: Drosophilidae), and brown marmorated stink bug, Halyomorpha halys (Stål) (Hemiptera: Pentatomidae) are global economic pests. Both pests may co-occur on small fruits, and we investigated whether fruit recently exposed to H. halys woul...

  10. Biotic and abiotic factors impacting development, behavior, phenology, and reproductive biology of Drosophila suzukii

    Science.gov (United States)

    Spotted wing drosophila, Drosophila suzukii, quickly emerged as a devastating invasive pest of small and stone fruits in the Americas and Europe. To better understand the population dynamics of D. suzukii, we reviewed recent work on juvenile development, adult reproduction, and seasonal variation in...

  11. Non-crop plants used as hosts by Drosophila suzukii in Europe

    NARCIS (Netherlands)

    Kenis, Marc; Tonina, Lorenzo; Eschen, René; Sluis, van der Bart; Sancassani, Manuel; Mori, Nicola; Haye, Tim; Helsen, Herman

    2016-01-01

    The invasive spotted wing drosophila Drosophila suzukii, a fruit fly of Asian origin, is a major pest of a wide variety of berry and stone fruits in Europe. One of the characteristics of this fly is its wide host range. A better knowledge of its host range outside cultivated areas is essential to

  12. Modelling Cooperative Tumorigenesis in Drosophila

    Science.gov (United States)

    2018-01-01

    The development of human metastatic cancer is a multistep process, involving the acquisition of several genetic mutations, tumour heterogeneity, and interactions with the surrounding microenvironment. Due to the complexity of cancer development in mammals, simpler model organisms, such as the vinegar fly, Drosophila melanogaster, are being utilized to provide novel insights into the molecular mechanisms involved. In this review, we highlight recent advances in modelling tumorigenesis using the Drosophila model, focusing on the cooperation of oncogenes or tumour suppressors, and the interaction of mutant cells with the surrounding tissue in epithelial tumour initiation and progression. PMID:29693007

  13. Modulation of genotoxicity by extra-virgin olive oil and some of its distinctive components assessed by use of the Drosophila wing-spot test.

    Science.gov (United States)

    Anter, Jaouad; Campos-Sánchez, Juan; Hamss, Rachid El; Rojas-Molina, Mar; Muñoz-Serrano, Andrés; Analla, Mohamed; Alonso-Moraga, Angeles

    2010-12-21

    Olive oil is an important source of mono-unsaturated fat and a prime component of the Mediterranean diet. The beneficial health effects of olive oil are due to both its high content of mono-unsaturated fatty acids and its high content of anti-oxidative substances. The objective of this study was to investigate the basis for the epidemiological information relating to the health benefits associated with the consumption of extra-virgin olive oil (EVOO). For this purpose, the somatic mutation and recombination test (SMART) in wings of Drosophila melanogaster was applied to evaluate the antigenotoxic activity of six different EVOOs from four Spanish varieties (Hojiblanca, Nevadillo, Casta de Cabra, Picual). A two-level approach was followed: (1) determination of the lack of genotoxicity along with the antigenotoxic activity of EVOOs, through antigenotoxicity assays, with hydrogen peroxide as an oxidative genotoxin, and (2) evaluation of the properties of three major distinctive components of EVOOs that could be responsible for their antigenotoxic activity. The EVOOs tested are shown to be non-genotoxic; they exhibited antigenotoxic activity against the effects of hydrogen peroxide. Triolein, tyrosol and squalene did not show genotoxic effects in the proliferative imaginal cells of D. melanogaster. The three components were antigenotoxic when combined with soybean oil, only triolein and tyrosol showed a clear desmutagenic effect when combined with hydrogen peroxide. Our results confirm the safety of EVOOs and their health-protective effects. Published by Elsevier B.V.

  14. Thermal phenotypic plasticity of body size in Drosophila ...

    Indian Academy of Sciences (India)

    Thermal phenotypic plasticity of body size in Drosophila melanogaster: sexual dimorphism and genetic correlations. Jean R. David Amir Yassin ... Thirty isofemale lines collected in three different years from the same wild French population were grown at seven different temperatures (12–31°C). Two linear measures, wing ...

  15. Thermal phenotypic plasticity of body size in Drosophila ...

    Indian Academy of Sciences (India)

    ... body size in Drosophila melanogaster: sexual dimorphism and genetic correlations. Jean R. David, Amir Yassin, Jean-Claude Moreteau, Helene Legout and Brigitte Moreteau. J. Genet. 90, 295–302. Table 1. Correlations between wing and thorax length at the within (n = 420) and between line level (n = 30). Temperature.

  16. Intraspecific hybridization, developmental stability and fitness in Drosophila mercatorum

    DEFF Research Database (Denmark)

    Andersen, DH; Pertoldi, C; Scali, V

    2002-01-01

    (hybrid vigour) may be a result of hybridization, probably due to increased heterozygosity. Developmental stability is assumed to be correlated with fitness and is commonly measured as fluctuating asymmetry or phenotypic variance. Drosophila mercatorum is capable of reproducing sexually, but also....... Intraspecific hybridization between a parthenogenetic and a sexually reproducing strain of Drosophila mercatorum resulted in significant changes in fecundity as well as fluctuating asymmetry and phenotypic variance for the number of sternopleural bristles and in the length of two wing traits over three...

  17. Limited taste discrimination in Drosophila.

    Science.gov (United States)

    Masek, Pavel; Scott, Kristin

    2010-08-17

    In the gustatory systems of mammals and flies, different populations of sensory cells recognize different taste modalities, such that there are cells that respond selectively to sugars and others to bitter compounds. This organization readily allows animals to distinguish compounds of different modalities but may limit the ability to distinguish compounds within one taste modality. Here, we developed a behavioral paradigm in Drosophila melanogaster to evaluate directly the tastes that a fly distinguishes. These studies reveal that flies do not discriminate among different sugars, or among different bitter compounds, based on chemical identity. Instead, flies show a limited ability to distinguish compounds within a modality based on intensity or palatability. Taste associative learning, similar to olfactory learning, requires the mushroom bodies, suggesting fundamental similarities in brain mechanisms underlying behavioral plasticity. Overall, these studies provide insight into the discriminative capacity of the Drosophila gustatory system and the modulation of taste behavior.

  18. Studies on Drosophila radiosensitive strains

    International Nuclear Information System (INIS)

    Varentsova, E.P.; Zakharov, I.A.

    1976-01-01

    45 of radiosensitive strains of Drosophila melanogaster were isolated by Curly/Lobe technique after EMS treatment of Livadia population males. The lethality of non-Curly late larvae after gamma-irradiation (4000r) characterized radiosensitivity strains. Most of them exhibited higher frequency of the spontaneous dominant lethals (up to 69%). The males of 6 strains were semi-sterile. 5 of these strains exhibited higher frequency of X-chromosome non-disjunction

  19. Drosophila: Retrotransposons Making up Telomeres.

    Science.gov (United States)

    Casacuberta, Elena

    2017-07-19

    Drosophila and extant species are the best-studied telomerase exception. In this organism, telomere elongation is coupled with targeted retrotransposition of Healing Transposon (HeT-A) and Telomere Associated Retrotransposon (TART) with sporadic additions of Telomere Associated and HeT-A Related (TAHRE), all three specialized non-Long Terminal Repeat (non-LTR) retrotransposons. These three very special retroelements transpose in head to tail arrays, always in the same orientation at the end of the chromosomes but never in interior locations. Apparently, retrotransposon and telomerase telomeres might seem very different, but a detailed view of their mechanisms reveals similarities explaining how the loss of telomerase in a Drosophila ancestor could successfully have been replaced by the telomere retrotransposons. In this review, we will discover that although HeT-A, TART, and TAHRE are still the only examples to date where their targeted transposition is perfectly tamed into the telomere biology of Drosophila, there are other examples of retrotransposons that manage to successfully integrate inside and at the end of telomeres. Because the aim of this special issue is viral integration at telomeres, understanding the base of the telomerase exceptions will help to obtain clues on similar strategies that mobile elements and viruses could have acquired in order to ensure their survival in the host genome.

  20. Insulin receptor in Drosophila melanogaster

    International Nuclear Information System (INIS)

    Petruzzelli, L.; Herrera, R.; Rosen, O.

    1986-01-01

    A specific, high affinity insulin receptor is present in both adult Drosophila and in Drosophila embryos. Wheat germ lectin-enriched extracts of detergent-solubilized membranes from embryos and adults bind insulin with a K/sub d/ of 15 nM. Binding is specific for insulin; micromolar concentrations of proinsulin, IGFI, and IGFII are required to displace bound 125 I-insulin. Insulin-dependent protein tyrosine kinase activity appears during embryogenesis. It is evident between 6 and 12 hours of development, peaks between 12 and 18 hours and falls in the adult. During 0-6 hours of embryogenesis, and in the adult, a specific protein band (Mr = 135,000) is crosslinked to 125 I-insulin. During 6-12 and 12-18 hours of embryogenesis stages in which insulin-dependent protein tyrosine kinase is high, an additional band (Mr = 100,000) becomes crosslinked to 125 I-insulin. Isolation and DNA sequence analysis of genomic clones encoding the Drosophila insulin receptor will be presented as will the characterization of insulin receptor mRNA's during development

  1. 'Peer pressure' in larval Drosophila?

    Science.gov (United States)

    Niewalda, Thomas; Jeske, Ines; Michels, Birgit; Gerber, Bertram

    2014-06-06

    Understanding social behaviour requires a study case that is simple enough to be tractable, yet complex enough to remain interesting. Do larval Drosophila meet these requirements? In a broad sense, this question can refer to effects of the mere presence of other larvae on the behaviour of a target individual. Here we focused in a more strict sense on 'peer pressure', that is on the question of whether the behaviour of a target individual larva is affected by what a surrounding group of larvae is doing. We found that innate olfactory preference of a target individual was neither affected (i) by the level of innate olfactory preference in the surrounding group nor (ii) by the expression of learned olfactory preference in the group. Likewise, learned olfactory preference of a target individual was neither affected (iii) by the level of innate olfactory preference of the surrounding group nor (iv) by the learned olfactory preference the group was expressing. We conclude that larval Drosophila thus do not take note of specifically what surrounding larvae are doing. This implies that in a strict sense, and to the extent tested, there is no social interaction between larvae. These results validate widely used en mass approaches to the behaviour of larval Drosophila. © 2014. Published by The Company of Biologists Ltd.

  2. Quantification of Drosophila Grooming Behavior.

    Science.gov (United States)

    Barradale, Francesca; Sinha, Kairav; Lebestky, Tim

    2017-07-19

    Drosophila grooming behavior is a complex multi-step locomotor program that requires coordinated movement of both forelegs and hindlegs. Here we present a grooming assay protocol and novel chamber design that is cost-efficient and scalable for either small or large-scale studies of Drosophila grooming. Flies are dusted all over their body with Brilliant Yellow dye and given time to remove the dye from their bodies within the chamber. Flies are then deposited in a set volume of ethanol to solubilize the dye. The relative spectral absorbance of dye-ethanol samples for groomed versus ungroomed animals are measured and recorded. The protocol yields quantitative data of dye accumulation for individual flies, which can be easily averaged and compared across samples. This allows experimental designs to easily evaluate grooming ability for mutant animal studies or circuit manipulations. This efficient procedure is both versatile and scalable. We show work-flow of the protocol and comparative data between WT animals and mutant animals for the Drosophila type I Dopamine Receptor (DopR).

  3. Quantitative structure–activity relationships for toxicity and genotoxicity of halogenated aliphatic compounds: Wing spot test of Drosophila melanogaster

    Czech Academy of Sciences Publication Activity Database

    Chroust, K.; Pavlová, M.; Prokop, Z.; Mendel, Jan; Božková, K.; Kubát, Z.; Zajíčková, V.; Damborský, J.

    2007-01-01

    Roč. 67, č. 1 (2007), s. 152-159 ISSN 0045-6535 Institutional research plan: CEZ:AV0Z60930519 Keywords : toxicity * wing spot test * QSAR Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 2.739, year: 2007

  4. Radioresistance and radiosensitivity in Drosophila melanogaster

    International Nuclear Information System (INIS)

    Reguly, M.L.

    1983-01-01

    Studying the mechanisms controlling radioresistant in Drosophila the sensibility of four strains of Drosophila melanogaster to sex-linked recessive lethal mutations induced by 5kR Cobalt-60 gamma radiation and 0,006 M EMS or 0,25% of caffeine was determined. (M.A.C.) [pt

  5. Size control in development: lessons from Drosophila

    Indian Academy of Sciences (India)

    which mediates dosage compensation in Drosophila; Mol. Cell 4 117–122. Kelley R L, Meller V H, Gordadze P R, Roman G, Davis R L and Kuroda M I 1999 Epigenetic spreading of the Drosophila dosage compensation complex from rox RNA genes into flanking chromatin; Cell 98. 513–522. Lucchesi J C 1998 Dosage ...

  6. Flavonoids and oxidative stress in Drosophila melanogaster.

    Science.gov (United States)

    Sotibrán, América Nitxin Castañeda; Ordaz-Téllez, María Guadalupe; Rodríguez-Arnaiz, Rosario

    2011-11-27

    Flavonoids are a family of antioxidants that are widely represented in fruits, vegetables, dry legumes, and chocolate, as well as in popular beverages, such as red wine, coffee, and tea. The flavonoids chlorogenic acid, kaempferol, quercetin and quercetin 3β-d-glycoside were investigated for genotoxicity using the wing somatic mutation and recombination test (SMART). This test makes use of two recessive wing cell markers: multiple wing hairs (mwh) and flare (flr(3)), which are mutations located on the left arm of chromosome 3 of Drosophila melanogaster and are indicative of both mitotic recombination and various types of mutational events. In order to test the antioxidant capacities of the flavonoids, experiments were conducted with various combinations of oxidants and polyphenols. Oxidative stress was induced using hydrogen peroxide, the Fenton reaction and paraquat. Third-instar transheterozygous larvae were chronically treated for all experiments. The data obtained in this study showed that, at the concentrations tested, the flavonoids did not induce somatic mutations or recombination in D. melanogaster with the exception of quercetin, which proved to be genotoxic at only one concentration. The oxidants hydrogen peroxide and the Fenton reaction did not induce mutations in the wing somatic assay of D. melanogaster, while paraquat and combinations of flavonoids produced significant numbers of small single spots. Quercetin 3β-d-glycoside mixed with paraquat was shown to be desmutagenic. Combinations of the oxidants with the other flavonoids did not show any antioxidant activity. Copyright © 2011 Elsevier B.V. All rights reserved.

  7. Image tracking study on courtship behavior of Drosophila.

    Directory of Open Access Journals (Sweden)

    Hung-Yin Tsai

    Full Text Available BACKGROUND: In recent years, there have been extensive studies aimed at decoding the DNA. Identifying the genetic cause of specific changes in a simple organism like Drosophila may help scientists recognize how multiple gene interactions may make some people more susceptible to heart disease or cancer. Investigators have devised experiments to observe changes in the gene networks in mutant Drosophila that responds differently to light, or have lower or higher locomotor activity. However, these studies focused on the behavior of the individual fly or on pair-wise interactions in the study of aggression or courtship. The behavior of these activities has been captured on film and inspected by a well-trained researcher after repeatedly watching the recorded film. Some studies also focused on ways to reduce the inspection time and increase the accuracy of the behavior experiment. METHODOLOGY: In this study, the behavior of drosophila during courtship was analyzed automatically by machine vision. We investigated the position and behavior discrimination during courtship using the captured images. Identification of the characteristics of drosophila, including sex, size, heading direction, and wing angles, can be computed using image analysis techniques that employ the Gaussian mixture model. The behavior of multiple drosophilae can also be analyzed simultaneously using the motion-prediction model and the variation constraint of heading direction. CONCLUSIONS: The overlapped fruit flies can be identified based on the relationship between body centers. Moreover, the behaviors and profiles can be correctly recognized by image processing based on the constraints of the wing angle and the size of the body. Therefore, the behavior of the male fruit flies can be discriminated when two or three fruit flies form a close cluster. In this study, the courtship behavior, including wing songs and attempts, can currently be distinguished with accuracies of 95.8% and

  8. Two new Neotropical species of Drosophila peruensis species group (Diptera, Drosophilidae

    Directory of Open Access Journals (Sweden)

    Jonas S. Döge

    2011-12-01

    Full Text Available The Drosophila peruensis species group was recently proposed and includes four taxa: D. atalaia Vilela & Sene, 1982, D. boraceia Vilela & Val, 2004, D. pauliceia Ratcov & Vilela, 2007, and D. peruensis Wheeler, 1959. All these species have most of setae or setulae of mesonotum arinsing from dark spots, wings with crossveins darker (except in D. atalaia and hypandrium squared-shaped mostly fused to gonopods. Here, we describe two new species, Drosophila itacorubi sp. nov. and Drosophila paraitacorubi sp. nov., belonging to this species group. The male genitalia of these species are figured. An identification key to the D. peruensis species group is provided.

  9. Adaptive genic evolution in the Drosophila genomes

    DEFF Research Database (Denmark)

    Shapiro, Joshua A; Huang, Wei; Zhang, Chenhui

    2007-01-01

    and stable population. In this study, we sequenced 419 genes from 24 lines of Drosophila melanogaster and its close relatives. Together with data from Drosophila simulans, these data reveal the following. (i) Approximately 10% of the loci in regions of normal recombination are much less polymorphic at silent...... sites than expected, hinting at the action of selective sweeps. (ii) The level of polymorphism is negatively correlated with the rate of nonsynonymous divergence across loci. Thus, even under strict neutrality, the ratio of amino acid to silent nucleotide changes (A:S) between Drosophila species...

  10. Detection of cell death in Drosophila.

    Science.gov (United States)

    McCall, Kimberly; Peterson, Jeanne S; Pritchett, Tracy L

    2009-01-01

    Drosophila is a powerful model system for the identification of cell death genes and understanding the role of cell death in development. In this chapter, we describe three methods typically used for the detection of cell death in Drosophila. The TUNEL and acridine orange methods are used to detect dead or dying cells in a variety of tissues. We focus on methods for the embryo and the ovary, but these techniques can be used on other tissues as well. The third method is the detection of genetic interactions by expressing cell death genes in the Drosophila eye.

  11. Identification and evaluation of attractiveness of lactic acid bacteria as a bait for Drosophila suzukii Matsumura

    OpenAIRE

    Maddalena, Giuseppe

    2016-01-01

    The spotted-wing drosophila (SWD), Drosophila suzukii Matsumura (Diptera: Drosophilidae), native of Eastern Asia, is an invasive alien species in Europe and the Americas and is one of the main emerging pests of valuable crops, including soft fruits and wine grapes. The conventional approach to handle infestations of SWD involves the use of commercially available insecticides, but these do not seem able to ensure effective results; consequently, alternative strategies are strongly required. Ma...

  12. Studies on Drosophila radiosensitivity strains

    International Nuclear Information System (INIS)

    Varentsova, E.R.; Sharygin, V.I.; Khromykh, Yu.U.

    1985-01-01

    Fertility of radiosensitive mutant drosophila female strain rad (2) 201 61 after irradiation and frequency of dominant lethal mutations (DLM), induced by γ-radiation for 0-5 h and 5-7 days, are investigated. It is shown, that oocytes of the mutant strain are more radiosensitive as compared with cells of mongrel flies as to criterion of DLM appearance over the period of maturing. Early oocytes of stages 2-7 are the most sensitive, i.e. at the stages, corresponding to the manifestation of previously established recombination-defective properties of mutations rad (2) 201 61 . It is also sown, that doses of γ-rays, exceeding 10 Gy produce a strong sterilizing effect on mutant females due to destruction and resorption of egg chambers, irradiated at the stages of previtellogenetic growth of oocytes. In females, carrying mutation of radiosensitivity there is no direct correlation betwen sensitivity of oocytes proper to DLM induction and sensitivity of egg folleicles to resorbing effect of γ-rays. The ways of possible involvement of mutant locus studied into genetic processes in various specialized cells of drosophila

  13. Differentiation of Drosophila glial cells.

    Science.gov (United States)

    Sasse, Sofia; Neuert, Helen; Klämbt, Christian

    2015-01-01

    Glial cells are important constituents of the nervous system and a hallmark of these cells are their pronounced migratory abilities. In Drosophila, glial lineages have been well described and some of the molecular mechanisms necessary to guide migrating glial cells to their final target sites have been identified. With the onset of migration, glial cells are already specified into one of five main glial cell types. The perineurial and subperineurial glial cells are eventually located at the outer surface of the Drosophila nervous system and constitute the blood-brain barrier. The cortex glial cells ensheath all neuroblasts and their progeny and reside within the central nervous system. Astrocyte-like cells invade the neuropil to control synaptic function and ensheathing glial cells encase the entire neuropil. Within the peripheral nervous system, wrapping glial cells ensheath individual axons or axon fascicles. Here, we summarize the current knowledge on how differentiation of glial cells into the specific subtypes is orchestrated. Furthermore, we discuss sequencing data that will facilitate further analyses of glial differentiation in the fly nervous system. © 2015 Wiley Periodicals, Inc.

  14. Functional Analysis of Drosophila NF1

    National Research Council Canada - National Science Library

    Bernards, Andre

    2005-01-01

    ...) for Ras, yet homozygous loss of a highly conserved Drosophila NF1 ortholog results in several phenotypes that are insensitive to manipulating Ras signal transduction, but rescued by increasing...

  15. Drosophila melanogaster gene expression changes after spaceflight.

    Data.gov (United States)

    National Aeronautics and Space Administration — Gene expression levels were determined in 3rd instar and adult Drosophila melanogaster reared during spaceflight to elucidate the genetic and molecular mechanisms...

  16. Modeling tumor invasion and metastasis in Drosophila

    Directory of Open Access Journals (Sweden)

    Wayne O. Miles

    2011-11-01

    Full Text Available Conservation of major signaling pathways between humans and flies has made Drosophila a useful model organism for cancer research. Our understanding of the mechanisms regulating cell growth, differentiation and development has been considerably advanced by studies in Drosophila. Several recent high profile studies have examined the processes constraining the metastatic growth of tumor cells in fruit fly models. Cell invasion can be studied in the context of an in vivo setting in flies, enabling the genetic requirements of the microenvironment of tumor cells undergoing metastasis to be analyzed. This Perspective discusses the strengths and limitations of Drosophila models of cancer invasion and the unique tools that have enabled these studies. It also highlights several recent reports that together make a strong case for Drosophila as a system with the potential for both testing novel concepts in tumor progression and cell invasion, and for uncovering players in metastasis.

  17. BM2(reinverted) of Drosophila melanogaster is

    Indian Academy of Sciences (India)

    -chromosome (Lucchesi et al. 2005). Dosage compensation and the phenomenon of. Keywords. dosage compensation; histone acetylation; chromatin remodelling; H4K16; MOF; Drosophila. Journal of Genetics, Vol. 87, No. 3, December 2008.

  18. The Drosophila bipectinata species complex: phylogenetic ...

    Indian Academy of Sciences (India)

    PARUL BANERJEE

    c Indian Academy of Sciences. RESEARCH ARTICLE. The Drosophila bipectinata species complex: phylogenetic relationship among different members based on chromosomal variations. PARUL BANERJEE and BASHISTH N. SINGH. ∗. Genetics Laboratory, Department of Zoology, Banaras Hindu University, Varanasi ...

  19. Ecdysteroid receptors in Drosophila melanogaster adult females

    Science.gov (United States)

    Ecdysteroid receptors were identified and partially characterized from total cell extracts of whole animals and dissected tissues from Drosophila melanogaster adult females. Binding studies indicated the presence of two ecdysteroid binding components having high affinity and specificity consistent w...

  20. On the Morphology of the Drosophila Heart

    Directory of Open Access Journals (Sweden)

    Barbara Rotstein

    2016-04-01

    Full Text Available The circulatory system of Drosophila melanogaster represents an easily amenable genetic model whose analysis at different levels, i.e., from single molecules up to functional anatomy, has provided new insights into general aspects of cardiogenesis, heart physiology and cardiac aging, to name a few examples. In recent years, the Drosophila heart has also attracted the attention of researchers in the field of biomedicine. This development is mainly due to the fact that several genes causing human heart disease are also present in Drosophila, where they play the same or similar roles in heart development, maintenance or physiology as their respective counterparts in humans. This review will attempt to briefly introduce the anatomy of the Drosophila circulatory system and then focus on the different cell types and non-cellular tissue that constitute the heart.

  1. Bacterial diversity shift determined by different diets in the gut of the spotted wing fly Drosophila suzukii is primarily reflected on acetic acid bacteria

    KAUST Repository

    Vacchini, Violetta

    2016-11-25

    The pivotal role of diet in shaping gut microbiota has been evaluated in different animal models, including insects. Drosophila flies harbour an inconstant microbiota among which acetic acid bacteria (AAB) are important components. Here, we investigated the bacterial and AAB components of the invasive pest Drosophila suzukii microbiota, by studying the same insect population separately grown on fruit-based or non-fruit artificial diet. AAB were highly prevalent in the gut under both diets (90 and 92% infection rates with fruits and artificial diet, respectively). Fluorescent in situ hybridization and recolonization experiments with green fluorescent protein (Gfp)-labelled strains showed AAB capability to massively colonize insect gut. High-throughput sequencing on 16S rRNA gene indicated that the bacterial microbiota of guts fed with the two diets clustered separately. By excluding AAB-related OTUs from the analysis, insect bacterial communities did not cluster separately according to the diet, suggesting that diet-based diversification of the community is primarily reflected on the AAB component of the community. Diet influenced also AAB alpha-diversity, with separate OTU distributions based on diets. High prevalence, localization and massive recolonization, together with AAB clustering behaviour in relation to diet, suggest an AAB role in the D. suzukii gut response to diet modification. This article is protected by copyright. All rights reserved.

  2. Die induzierbare antivirale Immunantwort von Drosophila melanogaster

    OpenAIRE

    Kemp, Cordula

    2010-01-01

    In der vorliegenden Arbeit wurde Drosophila melanogaster als Modell ge- nutzt, um die angeborene Immunantwort gegen virale Infektionen zu studie- ren. Wir untersuchten mit Hilfe von genomweiten microarrays das Transkriptom von Fliegen, welche entweder mit dem Drosophila C Virus (DCV), dem Flock- house Virus (FHV) oder dem Sindbis Virus (SINV) infiziert waren. Infektion mit diesen drei positiv orientierten Einzelstrang RNS Viren führte zu einer starken transkriptionellen Antwort, welche deutlic...

  3. Mapping of gene mutations in drosophila melanogaster

    OpenAIRE

    Halvorsen, Charlotte Marie

    2004-01-01

    In this experiment, mutant genes of a given unknown mutant strain of Drosophila melanogaster were mapped to specific chromosomes. Drosophila melanogaster, commonly known as the fruit fly, was the appropriate choice for the organism to use in this specific experiment because of its relatively rapid life cycle of 10-14 days and because of the small amount of space and food neccessary for maintaining thousands of flies. The D. Melanogaster unknown strain specifically used in this experiment wa...

  4. A Drosophila Model for Screening Antiobesity Agents

    Directory of Open Access Journals (Sweden)

    Tran Thanh Men

    2016-01-01

    Full Text Available Although triacylglycerol, the major component for lipid storage, is essential for normal physiology, its excessive accumulation causes obesity in adipose tissue and is associated with organ dysfunction in nonadipose tissue. Here, we focused on the Drosophila model to develop therapeutics for preventing obesity. The brummer (bmm gene in Drosophila melanogaster is known to be homologous with human adipocyte triglyceride lipase, which is related to the regulation of lipid storage. We established a Drosophila model for monitoring bmm expression by introducing the green fluorescent protein (GFP gene as a downstream reporter of the bmm promoter. The third-instar larvae of Drosophila showed the GFP signal in all tissues observed and specifically in the salivary gland nucleus. To confirm the relationship between bmm expression and obesity, the effect of oral administration of glucose diets on bmm promoter activity was analyzed. The Drosophila flies given high-glucose diets showed higher lipid contents, indicating the obesity phenotype; this was suggested by a weaker intensity of the GFP signal as well as reduced bmm mRNA expression. These results demonstrated that the transgenic Drosophila model established in this study is useful for screening antiobesity agents. We also report the effects of oral administration of histone deacetylase inhibitors and some vegetables on the bmm promoter activity.

  5. Characterization of Autophagic Responses in Drosophila melanogaster.

    Science.gov (United States)

    Xu, T; Kumar, S; Denton, D

    2017-01-01

    Drosophila is an excellent model system for studying autophagy during animal development due to the availability of genetic reagents and opportunity for in vivo cell biological analysis. The regulation and mechanism of autophagy are highly evolutionarily conserved and the role of autophagy has been characterized during various stages of Drosophila development as well as following starvation. Studies in Drosophila have revealed novel insights into the role of distinct components of the autophagy machinery. This chapter describes protocols for examining autophagy during Drosophila development. A crucial step in the induction of autophagy is the incorporation of Atg8a into the autophagosome. This can be measured as autophagic puncta using live fluorescent imaging, immunostaining, or immunoblot analysis of LC3/Atg8a processing. The level of autophagy can also be examined using other specific components of the autophagy pathway as markers detected by immunofluorescent imaging. Based on the distinct morphology of autophagy, it can also be examined by transmission electron microscopy. In addition, one of the advantages of using Drosophila as a model is the ability to undertake genetic analysis of individual components of the autophagy machinery. Current approaches that can be used to monitor autophagy, including the overall flux and individual steps in Drosophila melanogaster, will be discussed. © 2017 Elsevier Inc. All rights reserved.

  6. Identification of four Drosophila allatostatins as the cognate ligands for the Drosophila orphan receptor DAR-2

    DEFF Research Database (Denmark)

    Lenz, C; Williamson, M; Hansen, G N

    2001-01-01

    to be the receptor for an intrinsic Drosophila A-type (cockroach-type) allatostatin. Here, we have permanently expressed DAR-2 in CHO cells and found that it is the cognate receptor for four Drosophila A-type allatostatins, the drostatins-A1 to -A4. Of all the drostatins, drostatin-A4 (Thr...

  7. Identification of four Drosophila allatostatins as the cognate ligands for the Drosophila orphan receptor DAR-2

    DEFF Research Database (Denmark)

    Lenz, C; Williamson, M; Hansen, G N

    2001-01-01

    The allatostatins are generally inhibitory insect neuropeptides. The Drosophila orphan receptor DAR-2 is a G-protein-coupled receptor, having 47% amino acid residue identity with another Drosophila receptor, DAR-1 (which is also called dros. GPCR, or DGR) that was previously shown...... to be the receptor for an intrinsic Drosophila A-type (cockroach-type) allatostatin. Here, we have permanently expressed DAR-2 in CHO cells and found that it is the cognate receptor for four Drosophila A-type allatostatins, the drostatins-A1 to -A4. Of all the drostatins, drostatin-A4 (Thr...... weakly in the brain. The Drosophila larval gut also contains about 20-30 endocrine cells, expressing the gene for the drostatins-A1 to -A4. We suggest, therefore, that DAR-2 mediates an allatostatin (drostatin)-induced inhibition of gut motility. This is the first report on the permanent and functional...

  8. Molecular neurobiology of Drosophila taste.

    Science.gov (United States)

    Freeman, Erica Gene; Dahanukar, Anupama

    2015-10-01

    Drosophila is a powerful model in which to study the molecular and cellular basis of taste coding. Flies sense tastants via populations of taste neurons that are activated by compounds of distinct categories. The past few years have borne witness to studies that define the properties of taste neurons, identifying functionally distinct classes of sweet and bitter taste neurons that express unique subsets of gustatory receptor (Gr) genes, as well as water, salt, and pheromone sensing neurons that express members of the pickpocket (ppk) or ionotropic receptor (Ir) families. There has also been significant progress in terms of understanding how tastant information is processed and conveyed to higher brain centers, and modulated by prior dietary experience or starvation. Copyright © 2015. Published by Elsevier Ltd.

  9. Gustatory Processing in Drosophila melanogaster.

    Science.gov (United States)

    Scott, Kristin

    2018-01-07

    The ability to identify nutrient-rich food and avoid toxic substances is essential for an animal's survival. Although olfaction and vision contribute to food detection, the gustatory system acts as a final checkpoint control for food acceptance or rejection. The vinegar fly Drosophila melanogaster tastes many of the same stimuli as mammals and provides an excellent model system for comparative studies of taste detection. The relative simplicity of the fly brain and behaviors, along with the molecular genetic and functional approaches available in this system, allow the examination of gustatory neural circuits from sensory input to motor output. This review discusses the molecules and cells that detect taste compounds in the periphery and the circuits that process taste information in the brain. These studies are providing insight into how the detection of taste compounds regulates feeding decisions.

  10. Single Nucleotide Polymorphism Markers for Genetic Mapping in Drosophila melanogaster

    OpenAIRE

    Hoskins, Roger A.; Phan, Alexander C.; Naeemuddin, Mohammed; Mapa, Felipa A.; Ruddy, David A.; Ryan, Jessica J.; Young, Lynn M.; Wells, Trent; Kopczynski, Casey; Ellis, Michael C.

    2001-01-01

    For nearly a century, genetic analysis in Drosophila melanogaster has been a powerful tool for analyzing gene function, yet Drosophila lacks the molecular genetic mapping tools that recently have revolutionized human, mouse, and plant genetics. Here, we describe the systematic characterization of a dense set of molecular markers in Drosophila by using a sequence tagged site-based physical map of the genome. We identify 474 biallelic markers in standard laboratory strains of Drosophila that sp...

  11. Effect of Hawthorn on Drosophila Melanogaster Antioxidant-Related ...

    African Journals Online (AJOL)

    Purpose: To study the effects of various doses of hawthorn extract on Drosophila lifespan, antioxidant enzyme activity and expression of antioxidant-related regulation genes. Methods: Experiments with Drosophila as an animal model were conducted. The effects of hawthorn on Drosophila melanogaster antioxidant related ...

  12. Gut-associated microbes of Drosophila melanogaster

    Science.gov (United States)

    Broderick, Nichole; Lemaitre, Bruno

    2012-01-01

    There is growing interest in using Drosophila melanogaster to elucidate mechanisms that underlie the complex relationships between a host and its microbiota. In addition to the many genetic resources and tools Drosophila provides, its associated microbiota is relatively simple (1–30 taxa), in contrast to the complex diversity associated with vertebrates (> 500 taxa). These attributes highlight the potential of this system to dissect the complex cellular and molecular interactions that occur between a host and its microbiota. In this review, we summarize what is known regarding the composition of gut-associated microbes of Drosophila and their impact on host physiology. We also discuss these interactions in the context of their natural history and ecology and describe some recent insights into mechanisms by which Drosophila and its gut microbiota interact. “Workers with Drosophila have been considered fortunate in that they deal with the first multicellular invertebrate to be cultured monoxenically (Delcourt and Guyenot, 1910); the first to be handled axenically on a semisynthetic diet (Guyenot, 1917); and the first to be grown on a defined diet (Schultz et al., 1946). This list of advantages is somewhat embarrassing, since it implies an interest in nutrition that, in reality, was only secondary. The very first studies were concerned with the reduction of variability in genetic experiments (Delcourt and Guyenot, 1910) and standardization of the nutritional environment.” -James Sang, 1959 Ann NY Acad 1 PMID:22572876

  13. Receptor Tyrosine Kinases in Drosophila Development

    Science.gov (United States)

    Sopko, Richelle; Perrimon, Norbert

    2013-01-01

    Tyrosine phosphorylation plays a significant role in a wide range of cellular processes. The Drosophila genome encodes more than 20 receptor tyrosine kinases and extensive studies in the past 20 years have illustrated their diverse roles and complex signaling mechanisms. Although some receptor tyrosine kinases have highly specific functions, others strikingly are used in rather ubiquitous manners. Receptor tyrosine kinases regulate a broad expanse of processes, ranging from cell survival and proliferation to differentiation and patterning. Remarkably, different receptor tyrosine kinases share many of the same effectors and their hierarchical organization is retained in disparate biological contexts. In this comprehensive review, we summarize what is known regarding each receptor tyrosine kinase during Drosophila development. Astonishingly, very little is known for approximately half of all Drosophila receptor tyrosine kinases. PMID:23732470

  14. Viruses and Antiviral Immunity in Drosophila

    Science.gov (United States)

    Xu, Jie; Cherry, Sara

    2013-01-01

    Viral pathogens present many challenges to organisms, driving the evolution of a myriad of antiviral strategies to combat infections. A wide variety of viruses infect invertebrates, including both natural pathogens that are insect-restricted, and viruses that are transmitted to vertebrates. Studies using the powerful tools available in the model organism Drosophila have expanded our understanding of antiviral defenses against diverse viruses. In this review, we will cover three major areas. First, we will describe the tools used to study viruses in Drosophila. Second, we will survey the major viruses that have been studied in Drosophila. And lastly, we will discuss the well-characterized mechanisms that are active against these diverse pathogens, focusing on non-RNAi mediated antiviral mechanisms. Antiviral RNAi is discussed in another paper in this issue. PMID:23680639

  15. Apoptosis in Drosophila: which role for mitochondria?

    Science.gov (United States)

    Clavier, Amandine; Rincheval-Arnold, Aurore; Colin, Jessie; Mignotte, Bernard; Guénal, Isabelle

    2016-03-01

    It is now well established that the mitochondrion is a central regulator of mammalian cell apoptosis. However, the importance of this organelle in non-mammalian apoptosis has long been regarded as minor, mainly because of the absence of a crucial role for cytochrome c in caspase activation. Recent results indicate that the control of caspase activation and cell death in Drosophila occurs at the mitochondrial level. Numerous proteins, including RHG proteins and proteins of the Bcl-2 family that are key regulators of Drosophila apoptosis, constitutively or transiently localize in mitochondria. These proteins participate in the cell death process at different levels such as degradation of Diap1, a Drosophila IAP, production of mitochondrial reactive oxygen species or stimulation of the mitochondrial fission machinery. Here, we review these mitochondrial events that might have their counterpart in human.

  16. Species Diversity in the Parasitoid Genus Asobara (Hymenoptera: Braconidae) from the Native Area of the Fruit Fly Pest Drosophila suzukii (Diptera: Drosophilidae)

    NARCIS (Netherlands)

    Guerrieri, E.; Giorgini, M.; Cascone, P.; Carpenito, S.; Achterberg, van C.

    Drosophila suzukii (Matsumura), commonly known as Spotted Wing Drosophila (SWD), is a worldwide serious economic threat to the production of berries and stone fruits. The chemical control widely used against this pest is often not able to preventing yield losses because wild flora offers an

  17. 3D Holographic Observatory for Long-term Monitoring of Complex Behaviors in Drosophila

    Science.gov (United States)

    Kumar, S. Santosh; Sun, Yaning; Zou, Sige; Hong, Jiarong

    2016-09-01

    Drosophila is an excellent model organism towards understanding the cognitive function, aging and neurodegeneration in humans. The effects of aging and other long-term dynamics on the behavior serve as important biomarkers in identifying such changes to the brain. In this regard, we are presenting a new imaging technique for lifetime monitoring of Drosophila in 3D at spatial and temporal resolutions capable of resolving the motion of limbs and wings using holographic principles. The developed system is capable of monitoring and extracting various behavioral parameters, such as ethograms and spatial distributions, from a group of flies simultaneously. This technique can image complicated leg and wing motions of flies at a resolution, which allows capturing specific landing responses from the same data set. Overall, this system provides a unique opportunity for high throughput screenings of behavioral changes in 3D over a long term in Drosophila.

  18. REDfly: a Regulatory Element Database for Drosophila.

    Science.gov (United States)

    Gallo, Steven M; Li, Long; Hu, Zihua; Halfon, Marc S

    2006-02-01

    Bioinformatics studies of transcriptional regulation in the metazoa are significantly hindered by the absence of readily available data on large numbers of transcriptional cis-regulatory modules (CRMs). Even the richly annotated Drosophila melanogaster genome lacks extensive CRM information. We therefore present here a database of Drosophila CRMs curated from the literature complete with both DNA sequence and a searchable description of the gene expression pattern regulated by each CRM. This resource should greatly facilitate the development of computational approaches to CRM discovery as well as bioinformatics analyses of regulatory sequence properties and evolution.

  19. Drosophila Myc is required for normal DREF gene expression

    International Nuclear Information System (INIS)

    Dang Thi Phuong Thao; Seto, Hirokazu; Yamaguchi, Masamitsu

    2008-01-01

    The Drosophila DNA replication-related element-binding factor (dDREF) is required for the expression of many proliferation-related genes carrying the DRE sequence, 5'-TATCGATA. Finding a canonical E-box, 5'-CACGTG, in the dDREF gene promoter prompted us to explore the possibility that the dDREF gene is a target of Drosophila Myc (dMyc). Luciferase transient expression assays combined with RNA interference in Drosophila S2 cells revealed that knockdown of dmyc reduced dDREF gene promoter activity by 35% to 82%, an effect at least partly mediated by the E-box in the promoter. dm 4 /Y hemizygous mutant larvae demonstrated no maternal dMyc and severe impairment of dDREF mRNA transcription. dMyc loss of function in dm 2 /dm 2 homozygous mutant follicle cell clones also resulted in loss of anti-dDREF immunostaining in nuclei. In contrast, co-expression of dMyc-dMax up-regulated dDREF promoter activity in S2 cells. Furthermore, dMyc over-expressing clones exhibited a high level of dDREF gene expression in wing and eye discs. These results taken together indicate that dMyc is indeed required for dDREF gene expression

  20. The wavy Mutation Maps to the Inositol 1,4,5-Trisphosphate 3-Kinase 2 (IP3K2) Gene of Drosophila and Interacts with IP3R to Affect Wing Development.

    Science.gov (United States)

    Dean, Derek M; Maroja, Luana S; Cottrill, Sarah; Bomkamp, Brent E; Westervelt, Kathleen A; Deitcher, David L

    2015-11-27

    Inositol 1,4,5-trisphosphate (IP3) regulates a host of biological processes from egg activation to cell death. When IP3-specific receptors (IP3Rs) bind to IP3, they release calcium from the ER into the cytoplasm, triggering a variety of cell type- and developmental stage-specific responses. Alternatively, inositol polyphosphate kinases can phosphorylate IP3; this limits IP3R activation by reducing IP3 levels, and also generates new signaling molecules altogether. These divergent pathways draw from the same IP3 pool yet cause very different cellular responses. Therefore, controlling the relative rates of IP3R activation vs. phosphorylation of IP3 is essential for proper cell functioning. Establishing a model system that sensitively reports the net output of IP3 signaling is crucial for identifying the controlling genes. Here we report that mutant alleles of wavy (wy), a classic locus of the fruit fly Drosophila melanogaster, map to IP3 3-kinase 2 (IP3K2), a member of the inositol polyphosphate kinase gene family. Mutations in wy disrupt wing structure in a highly specific pattern. RNAi experiments using GAL4 and GAL80(ts) indicated that IP3K2 function is required in the wing discs of early pupae for normal wing development. Gradations in the severity of the wy phenotype provide high-resolution readouts of IP3K2 function and of overall IP3 signaling, giving this system strong potential as a model for further study of the IP3 signaling network. In proof of concept, a dominant modifier screen revealed that mutations in IP3R strongly suppress the wy phenotype, suggesting that the wy phenotype results from reduced IP4 levels, and/or excessive IP3R signaling. Copyright © 2016 Dean et al.

  1. The wavy Mutation Maps to the Inositol 1,4,5-Trisphosphate 3-Kinase 2 (IP3K2 Gene of Drosophila and Interacts with IP3R to Affect Wing Development

    Directory of Open Access Journals (Sweden)

    Derek M. Dean

    2016-02-01

    Full Text Available Inositol 1,4,5-trisphosphate (IP3 regulates a host of biological processes from egg activation to cell death. When IP3-specific receptors (IP3Rs bind to IP3, they release calcium from the ER into the cytoplasm, triggering a variety of cell type- and developmental stage-specific responses. Alternatively, inositol polyphosphate kinases can phosphorylate IP3; this limits IP3R activation by reducing IP3 levels, and also generates new signaling molecules altogether. These divergent pathways draw from the same IP3 pool yet cause very different cellular responses. Therefore, controlling the relative rates of IP3R activation vs. phosphorylation of IP3 is essential for proper cell functioning. Establishing a model system that sensitively reports the net output of IP3 signaling is crucial for identifying the controlling genes. Here we report that mutant alleles of wavy (wy, a classic locus of the fruit fly Drosophila melanogaster, map to IP3 3-kinase 2 (IP3K2, a member of the inositol polyphosphate kinase gene family. Mutations in wy disrupt wing structure in a highly specific pattern. RNAi experiments using GAL4 and GAL80ts indicated that IP3K2 function is required in the wing discs of early pupae for normal wing development. Gradations in the severity of the wy phenotype provide high-resolution readouts of IP3K2 function and of overall IP3 signaling, giving this system strong potential as a model for further study of the IP3 signaling network. In proof of concept, a dominant modifier screen revealed that mutations in IP3R strongly suppress the wy phenotype, suggesting that the wy phenotype results from reduced IP4 levels, and/or excessive IP3R signaling.

  2. Phenotypic plasticity in Drosophila cactophilic species: the effect of competition, density, and breeding sites.

    Science.gov (United States)

    Fanara, Juan Jose; Werenkraut, Victoria

    2017-08-01

    Changes in the environmental conditions experienced by naturally occurring populations are frequently accompanied by changes in adaptive traits allowing the organism to cope with environmental unpredictability. Phenotypic plasticity is a major aspect of adaptation and it has been involved in population dynamics of interacting species. In this study, phenotypic plasticity (i.e., environmental sensitivity) of morphological adaptive traits were analyzed in the cactophilic species Drosophila buzzatii and Drosophila koepferae (Diptera: Drosophilidae) considering the effect of crowding conditions (low and high density), type of competition (intraspecific and interspecific competition) and cacti hosts (Opuntia and Columnar cacti). All traits (wing length, wing width, thorax length, wing loading and wing aspect) showed significant variation for each environmental factor considered in both Drosophila species. The phenotypic plasticity pattern observed for each trait was different within and between these cactophilic Drosophila species depending on the environmental factor analyzed suggesting that body size-related traits respond almost independently to environmental heterogeneity. The effects of ecological factors analyzed in this study are discussed in order to elucidate the causal factors investigated (type of competition, crowding conditions and alternative host) affecting the election of the breeding site and/or the range of distribution of these cactophilic species. © 2016 Institute of Zoology, Chinese Academy of Sciences.

  3. Genetic changeover in Drosophila populations

    International Nuclear Information System (INIS)

    Wallace, B.

    1986-01-01

    Three populations of Drosophila melanogaster that were daughter populations of two others with histories of high, continuous radiation exposure [population 5 (irradiated, small population size) gave rise to populations 17 (small) and 18 (large); population 6 (irradiated, large population size) gave rise to population 19 (large)] were maintained for 1 year with no radiation exposure. The frequency with which random combinations of second chromosomes taken from population 19 proved to be lethal changed abruptly after about 8 months, thus revealing the origin of a selectively favored element in that population. (This element may or may not have been the cause of the lethality.) A comparison of the loss of lethals in populations 17 and 18 with a loss that occurred concurrently in the still-irradiated population 5 suggests that a second, selectively favored element had arisen in that population just before populations 17 and 18 were split off. This element was on a nonlethal chromosome. The result in population 5 was the elimination of many lethals from that population, followed by a subsequent increase as mutations occurred in the favored nonlethal chromosome. Populations 17 and 18, with no radiation exposure, underwent a loss of lethals with no subsequent increase. The events described here, as well as others to be described elsewhere, suggest that populations may be subject to episodic periods of rapid gene frequency changes that occur under intense selection pressure. In the instances in which the changeover was revealed by the elimination of preexisting lethals, earlier lethal frequencies were reduced by approximately one-half; the selectively favored elements appear, then, to be favored in the heterozygous--not homozygous--condition

  4. Chromosomal localization of autosomal mutations in Drosophila ...

    Indian Academy of Sciences (India)

    Unknown

    1Drosophila Stock Centre, Department of Studies in Zoology, University of Mysore,. Manasagangotri, Mysore 570 006, ... of genetic markers. In the present study, we have exploited the differences in karyotypic composition between these two subspecies, and their cross-fertility, in order to localize some autosomal genes.

  5. Lamin C and chromatin organization in Drosophila

    Indian Academy of Sciences (India)

    wm4h; Su(var)205/lamCEX187 had nearly normal red eye colour with little evidence of variegation, in contrast to the variegated eyes of the PEV strains crossed to w1118 strains. (figure 5,A&B). Precise excisions of ..... 2003 A P- element insertion screen identified mutations in. 455 novel essential genes in Drosophila.

  6. Second-Order Conditioning in "Drosophila"

    Science.gov (United States)

    Tabone, Christopher J.; de Belle, J. Steven

    2011-01-01

    Associative conditioning in "Drosophila melanogaster" has been well documented for several decades. However, most studies report only simple associations of conditioned stimuli (CS, e.g., odor) with unconditioned stimuli (US, e.g., electric shock) to measure learning or establish memory. Here we describe a straightforward second-order conditioning…

  7. Behavioural reproductive isolation and speciation in Drosophila

    Indian Academy of Sciences (India)

    In the genus Drosophila, the phenomenon of behavioural reproductive isolation, which is an important type of premating (prezygotic) reproductive isolating mechanisms, has been extensively studied and interesting data have been documented. In many cases incomplete sexual isolation has been observed and the pattern ...

  8. The Drosophila melanogaster circadian pacemaker circuit

    Indian Academy of Sciences (India)

    2016-08-26

    Aug 26, 2016 ... As an experimental model system, the fruit fly Drosophila melanogaster has been seminal in shaping our understanding of the circadian clockwork. The wealth of genetic tools at our disposal over the past four decades has enabled discovery of the genetic and molecular bases of circadian rhythmicity.

  9. Functional Neuroanatomy of "Drosophila" Olfactory Memory Formation

    Science.gov (United States)

    Guven-Ozkan, Tugba; Davis, Ronald L.

    2014-01-01

    New approaches, techniques and tools invented over the last decade and a half have revolutionized the functional dissection of neural circuitry underlying "Drosophila" learning. The new methodologies have been used aggressively by researchers attempting to answer three critical questions about olfactory memories formed with appetitive…

  10. Biological effects of radon in Drosophila

    International Nuclear Information System (INIS)

    Pimentel P, A.E.; Tavera D, L.; Cruces M, M.P.; Arceo M, C.; Rosa D, M.E. de la

    1992-04-01

    The main objective of this investigation, is to study the biological effects of the Radon-222 at low dose in 'Drosophila melanogaster'. It is necessary to mention that these effects will analyze from the genetic point of view for: 1) To evaluate in which form the Radon-222 to low dose it influences in some genetic components of the adaptation in Drosophila, such as: fecundity, viability egg-adult and sex proportion. 2) To evaluate which is the genetic effect that induces the Radon to low dose by means of the SMART technique in Drosophila melanogaster, and this way to try of to identify which is the possible mechanism that causes the genetic damage to somatic level. The carried out investigation was divided in three stages: 1. Tests to the vacuum resistance. 2. Test of somatic mutation, and 3. Determination of the presence of radon daughters on the adult of Drosophila. It is necessary to point out that all the experiments were made by triplicate and in each one of them was placed detectors in preset places. Those obtained results are presented inside the 4 charts included in the present work. (Author)

  11. Egg-laying rhythm in Drosophila melanogaster

    Indian Academy of Sciences (India)

    Extensive research has been carried out to understand how circadian clocks regulate various physiological processes in organisms. The discovery of clock genes and the molecular clockwork has helped researchers to understand the possible role of these genes in regulating various metabolic processes. In Drosophila ...

  12. Radiation effects on the drosophila melanogaster genoma

    International Nuclear Information System (INIS)

    Arceo-Maldonado, C.

    1989-01-01

    When DNA of living beings has been damaged, the cells show different responses depending on their physiological state. Repair mechanisms can be classified into two groups: constitutive which are always present in the cells and inductible, which must be stimulated to show themselves. It is suggested that a repair mechanism exists in the drosophila ovules which act upon the damage present in mature spermatozoids. Our aim is to verify whether or not a radiation dosis applied to the female drosophila will modify the frequency of individuals which have lost the paternal sex chromosomes. YW/YW virgin females and XEZ males and fbb-/bS Y y + y were mated for two days in order to collect radiation treated spermatozoids. The results were consistent as to the parameters being evaluated and lead one to suppose that the radiation applied to the female drosophila produced some changes in the ovule metabolism which reduced the frequency of individuals with lost chromosomes. It is believed that ionizing radiation interferes with the repair mechanisms that are existent and constitutive, retarding and hindering the restoration of chromosome fragments and this brings about death of the zygote or death of the eggs which lessens the frequencies of individuals carriers of chromosomic aberrations. Ionizing radiations applied to the female drosophila modifies the frequency of loss of patternal chromosomes and comes about when the radiation dose to the female is 700 rad. (Author)

  13. Analysis of Phagocytosis in the Drosophila Ovary.

    Science.gov (United States)

    Meehan, Tracy L; Serizier, Sandy B; Kleinsorge, Sarah E; McCall, Kimberly

    2016-01-01

    Programmed cell death (PCD) is essential for health and development. Generally, the last step of PCD is clearance, or engulfment, by phagocytes. Engulfment can be broken down into five basic steps: attraction of the phagocyte, recognition of the dying cell, internalization, phagosome maturation, and acidification of the engulfed material. The Drosophila melanogaster ovary serves as an excellent model to study diverse types of PCD and engulfment by epithelial cells. Here, we describe several methods to detect and analyze multiple steps of engulfment in the Drosophila ovary: recognition, vesicle uptake, phagosome maturation, and acidification. Annexin V detects phosphatidylserine, which is flipped to the outer leaflet of the plasma membrane of apoptotic cells, serving as an "eat me" signal. Several germline markers including tral-GFP, Orb, and cleaved Dcp-1 can all be used to label the germline and visualize its uptake into engulfing follicle cells. Drosophila strains expressing GFP and mCherry protein fusions can enable a detailed analysis of phagosome maturation. LysoTracker labels highly acidified compartments, marking phagolysosomes. Together these labels can be used to mark the progression of engulfment in Drosophila follicle cells.

  14. Lamin C and chromatin organization in Drosophila

    Indian Academy of Sciences (India)

    Drosophila lamin C (LamC) is a developmentally regulated component of the nuclear lamina. The lamC gene is situated in the fifth intron of the essential gene tout velu (ttv). We carried out genetic analysis of lamC during development. Phenotypic analyses of RNAi-mediated downregulation of lamC expression as well as ...

  15. The Drosophila bipectinata species complex: phylogenetic ...

    Indian Academy of Sciences (India)

    Navya

    Acad. Sci India 82, 99-115. Tomimura Y., Matsuda, M. and Tobari, Y. N. 2005 Chromosomal phylogeny and geographical divergence in the Drosophila bipectinata complex. Genome 48, 487–502. White M. J. D. 1958 Restriction and recombination in grasshopper populations and species. Cold Spr. Harb. Symp. Quant. Biol.

  16. Sex determining signal in Drosophila melanogaster

    Indian Academy of Sciences (India)

    Administrator

    Drosophila; sex determination; X/A ratio; Sex-lethal. Sexual dimorphism is the most striking naturally occurring phenotypic variation that is a direct outcome of a simple. Mendelian segregation. Molecular genetic dissection of mechanisms underlying sexual development in organisms ranging from flies to humans has been a ...

  17. Radioresistance and radiosensitivity in Drosophila melanogaster

    International Nuclear Information System (INIS)

    Reguly, M.L.; Marques, E.K.

    1987-01-01

    The mechanisms of radioresistance in Drosophila are studied. The mutagenic effects of 5KR of 60 Cobalt gamma radiation and of 0,006M dose of ethyl methanesulfonate (EMS) on four D. Melanogaster strains (RC 1 , CO 3 , BUE and LEN) are investigated. (M.A.C.) [pt

  18. Drosophila Melanogaster as an Experimental Organism.

    Science.gov (United States)

    Rubin, Gerald M.

    1988-01-01

    Discusses the role of the fruit fly in genetics research requiring a multidisciplinary approach. Describes embryological and genetic methods used in the experimental analysis of this organism. Outlines the use of Drosophila in the study of the development and function of the nervous system. (RT)

  19. Drosophila melanogaster deoxyribonucleoside kinase activates gemcitabine

    DEFF Research Database (Denmark)

    Knecht, Wolfgang; Mikkelsen, N.E.; Clausen, A.R.

    2009-01-01

    Drosophila melanogaster multisubstrate deoxyribonucleoside kinase (Dm-dNK) can additionally sensitize human cancer cell lines towards the anti-cancer drug gemcitabine. We show that this property is based on the Dm-dNK ability to efficiently phosphorylate gemcitabine. The 2.2 angstrom resolution...

  20. Intersex (ix) mutations of Drosophila melanogaster cause ...

    Indian Academy of Sciences (India)

    In Drosophila, a hierarchy of regulatory genes control somatic sexual differences (Baker 1989; Burtis and ... also function independently of dsx to regulate other aspects of sexual differentiation in tissue-specific manner. .... bination, for facilitating the analysis of single and double mutant genotypes. Double homozygote males ...

  1. Mapping selection within Drosophila melanogaster embryo's anatomy

    DEFF Research Database (Denmark)

    Salvador-Martínez, Irepan; Coronado-Zamora, Marta; Castellano, David

    2018-01-01

    We present a survey of selection across Drosophila melanogaster embryonic anatomy. Our approach integrates genomic variation, spatial gene expression patterns and development, with the aim of mapping adaptation over the entire embryo's anatomy. Our adaptation map is based on analyzing spatial gen...

  2. Developing a Drosophila Model of Schwannomatosis

    Science.gov (United States)

    2013-02-01

    General Hospital Cancer Center, Harvard Medical School, Charlestown, Massachusetts 02129, USA; 2Computer Science and Artificial Intelligence Laboratory...1384–1387. 61. Petersen UM, Kadalayil L, Rehorn KP, Hoshizaki DK, Reuter R, et al. (1999) Serpent regulates Drosophila immunity genes in the larval

  3. Intersex (ix) mutations of Drosophila melanogaster cause ...

    Indian Academy of Sciences (India)

    In Drosophila melanogaster, the intersex (ix) is a terminally positioned gene in somatic sex determination hierarchy and function with the female specific product of double sex (DSXF) to implement female sexual differentiation. The null phenotype of ix is to transform diplo-X individuals into intersexes while leaving haplo-X ...

  4. The Drosophila bipectinata species complex: phylogenetic ...

    Indian Academy of Sciences (India)

    [Banerjee P. and Singh B. N. 2017 The Drosophila bipectinata species complex: phylogenetic relationship among different members based on chromosomal variations. J. Genet. 96, 97–107]. Introduction ..... loops touch the chromocenter and in our microphotograph. (depicting both the arms) too, the involvement of chromo-.

  5. Differences in wing melanization and pigmentation pattern in Drosophila buzzatii (Diptera: Drosophilidae under chemical stress Diferencias en la melanización y el patrón de pigmentación alar en Drosophila buzzatii (Diptera: Drosophilidae bajo estrés químico

    Directory of Open Access Journals (Sweden)

    Nicolás Mongiardino Koch

    2012-06-01

    Full Text Available Recently, the genetic basis and developmental mechanisms underlying the process of melanization have become progressively elucidated, allowing us to study the evolutionary processes that govern the huge variability of pigmentation observed in nature. However, environmental factors contributing to such variability have received little attention, even though they might have profound ecological consequences. Here we describe a method for analyzing the wing melanization patterns of drosophilids in both qualitative and quantitative ways. We test this method on wings of Drosophila buzzatii Patterson & Wheeler individuals, reared in control and alkaloid-enriched mediums. The alkaloids were extracted from the secondary host of these flies, Echinopsis terscheckii (Parm. ex Pfeiff. Friedrich & Rowley, and their effect on wing pigmentation is analyzed, bearing in mind the adverse effects that these compounds have on the development of D. buzzatii. Alkaloid-reared flies were shown to attain a higher degree of wing melanization, accompanied with differences in the spatial distribution of the pigment. Modifications at both metabolic and gene regulatory levels are proposed to explain the changes that chemical stressful conditions are shown to induce in this character. We propose the utilization of this procedure in studies of environmental dependence of pigmentation.Recientemente, hemos avanzado en nuestra comprensión de las bases genéticas y los mecanismos subyacentes al proceso de melanización durante el desarrollo, lo que permite el estudio de los procesos evolutivos que gobiernan la variabilidad de pigmentación presente en la naturaleza. Sin embargo, los factores ambientales que contribuyen a dicha variabilidad han recibido poca atención, aún cuando pueden conllevar profundas consecuencias a nivel ecológico. En este trabajo, presentamos un método para analizar los patrones de melanización alar de drosofílidos, de forma cualitativa y cuantitativa

  6. Drosophila increase exploration after visually detecting predators.

    Directory of Open Access Journals (Sweden)

    Miguel de la Flor

    Full Text Available Novel stimuli elicit behaviors that are collectively known as specific exploration. These behaviors allow the animal to become more familiar with the novel objects within its environment. Specific exploration is frequently suppressed by defensive reactions to predator cues. Herein, we examine if this suppression occurs in Drosophila melanogaster by measuring the response of these flies to wild harvested predators. The flies used in our experiments have been cultured and had not lived under predator threat for multiple decades. In a circular arena with centrally-caged predators, wild type Drosophila actively avoided the pantropical jumping spider, Plexippus paykulli, and the Texas unicorn mantis, Phyllovates chlorophaena, indicating an innate defensive reaction to these predators. Interestingly, wild type Drosophila males also avoided a centrally-caged mock spider, and the avoidance of the mock spider became exaggerated when it was made to move within the cage. Visually impaired Drosophila failed to detect and avoid the Plexippus paykulli and the moving mock spider, while the broadly anosmic orco2 mutants were fully capable of detecting and avoiding Plexippus paykulli, indicating that these flies principally relied upon vison to perceive the predator stimuli. During early exploration of the arena, exploratory activity increased in the presence of Plexippus paykulli and the moving mock spider. The elevated activity induced by Plexippus paykulli disappeared after the fly had finished exploring, suggesting the flies were capable of habituating the predator cues. Taken together, these results indicate that despite being isolated from predators for decades Drosophila will visually detect these predators, retain innate defensive behaviors, respond by increasing exploratory activity in the arena rather than suppressing activity, and may habituate to normal predator cues.

  7. Optogenetic pacing in Drosophila melanogaster (Conference Presentation)

    Science.gov (United States)

    Alex, Aneesh; Li, Airong; Men, Jing; Jerwick, Jason; Tanzi, Rudolph E.; Zhou, Chao

    2016-03-01

    A non-invasive, contact-less cardiac pacing technology can be a powerful tool in basic cardiac research and in clinics. Currently, electrical pacing is the gold standard for cardiac pacing. Although highly effective in controlling the cardiac function, the invasive nature, non-specificity to cardiac tissues and possible tissue damage limits its capabilities. Optical pacing of heart is a promising alternative, which is non-invasive and more specific, has high spatial and temporal precision, and avoids shortcomings in electrical stimulation. Optical coherence tomography has been proved to be an effective technique in non-invasive imaging in vivo with ultrahigh resolution and imaging speed. In the last several years, non-invasive specific optical pacing in animal hearts has been reported in quail, zebrafish, and rabbit models. However, Drosophila Melanogaster, which is a significant model with orthologs of 75% of human disease genes, has rarely been studied concerning their optical pacing in heart. Here, we combined optogenetic control of Drosophila heartbeat with optical coherence microscopy (OCM) technique for the first time. The light-gated cation channel, channelrhodopsin-2 (ChR2) was specifically expressed by transgene as a pacemaker in drosophila heart. By stimulating the pacemaker with 472 nm pulsed laser light at different frequencies, we achieved non-invasive and more specific optical control of the Drosophila heart rhythm, which demonstrates the wide potential of optical pacing for studying cardiac dynamics and development. Imaging capability of our customized OCM system was also involved to observe the pacing effect visually. No tissue damage was found after long exposure to laser pulses, which proved the safety of optogenetic control of Drosophila heart.

  8. Organization and evolution of Drosophila terminin: similarities and differences between Drosophila and human telomeres

    Directory of Open Access Journals (Sweden)

    Grazia Daniela Raffa

    2013-05-01

    Full Text Available Drosophila lacks telomerase and fly telomeres are elongated by occasional transposition of three specialized retroelements. Drosophila telomeres do not terminate with GC-rich repeats and are assembled independently of the sequence of chromosome ends. Recent work has shown that Drosophila telomeres are capped by the terminin complex, which includes the fast-evolving proteins HOAP, HipHop, Moi and Ver. These proteins are not conserves outside Drosophilidae and localize and function exclusively at telomeres, protecting them from fusion events. Other proteins required to prevent end-to-end fusion in flies include HP1, Eff/UbcD1, ATM, the components of the Mre11-Rad50-Nbs (MRN complex, and the Woc transcription factor. These proteins do not share the terminin properties; they are evolutionarily conserved non-fast-evolving proteins that do not accumulate only telomeres and do not serve telomere-specific functions. We propose that following telomerase loss, Drosophila rapidly evolved terminin to bind chromosome ends in a sequence-independent manner. This hypothesis suggests that terminin is the functional analog of the shelterin complex that protects human telomeres. The non-terminin proteins are instead likely to correspond to ancestral telomere-associated proteins that did not evolve as rapidly as terminin because of the functional constraints imposed by their involvement in diverse cellular processes. Thus, it appears that the main difference between Drosophila and human telomeres is in the protective complexes that specifically associate with the DNA termini. We believe that Drosophila telomeres offer excellent opportunities for investigations on human telomere biology. The identification of additional Drosophila genes encoding non-terminin proteins involved in telomere protection might lead to the discovery of novel components of human telomeres.

  9. The efficiency of aerodynamic force production in Drosophila.

    Science.gov (United States)

    Lehmann, F O

    2001-12-01

    Total efficiency of aerodynamic force production in insect flight depends on both the efficiency with which flight muscles turn metabolic energy into muscle mechanical power and the efficiency with which this power is converted into aerodynamic flight force by the flapping wings. Total efficiency has been estimated in tethered flying fruit flies Drosophila by modulating their power expenditures in a virtual reality flight simulator while simultaneously measuring stroke kinematics, locomotor performance and metabolic costs. During flight, muscle efficiency increases with increasing flight force production, whereas aerodynamic efficiency of lift production decreases with increasing forces. As a consequence of these opposite trends, total flight efficiency in Drosophila remains approximately constant within the kinematic working range of the flight motor. Total efficiency is broadly independent of different profile power estimates and typically amounts to 2-3%. The animal achieves maximum total efficiency near hovering flight conditions, when the beating wings produce flight forces that are equal to the body weight of the insect. It remains uncertain whether this small advantage in total efficiency during hovering flight was shaped by evolutionary factors or results from functional constraints on both the production of mechanical power by the indirect flight muscles and the unsteady aerodynamic mechanisms in flapping flight.

  10. Genotoxicity studies of organically grown broccoli (Brassica oleracea var. italica) and its interactions with urethane, methyl methanesulfonate and 4-nitroquinoline-1-oxide genotoxicity in the wing spot test of Drosophila melanogaster.

    Science.gov (United States)

    Heres-Pulido, María Eugenia; Dueñas-García, Irma; Castañeda-Partida, Laura; Santos-Cruz, Luis Felipe; Vega-Contreras, Viridiana; Rebollar-Vega, Rosa; Gómez-Luna, Juan Carlos; Durán-Díaz, Angel

    2010-01-01

    Broccoli (Brassica oleracea var. italica) has been defined as a cancer preventive food. Nevertheless, broccoli contains potentially genotoxic compounds as well. We performed the wing spot test of Drosophila melanogaster in treatments with organically grown broccoli (OGB) and co-treatments with the promutagen urethane (URE), the direct alkylating agent methyl methanesulfonate (MMS) and the carcinogen 4-nitroquinoline-1-oxide (4-NQO) in the standard (ST) and high bioactivation (HB) crosses with inducible and high levels of cytochrome P450s (CYPs), respectively. Larvae of both crosses were chronically fed with OGB or fresh market broccoli (FMB) as a non-organically grown control, added with solvents or mutagens solutions. In both crosses, the OGB added with Tween-ethanol yielded the expected reduction in the genotoxicity spontaneous rate. OGB co-treatments did not affect the URE effect, MMS showed synergy and 4-NQO damage was modulated in both crosses. In contrast, FMB controls produced damage increase; co-treatments modulated URE genotoxicity, diminished MMS damage, and did not change the 4-NQO damage. The high dietary consumption of both types of broccoli and its protective effects in D. melanogaster are discussed. Copyright 2009 Elsevier Ltd. All rights reserved.

  11. Verbascoside is not genotoxic in the ST and HB crosses of the Drosophila wing spot test, and its constituent, caffeic acid, decreases the spontaneous mutation rate in the ST cross.

    Science.gov (United States)

    Santos-Cruz, Luis Felipe; Ávila-Acevedo, José Guillermo; Ortega-Capitaine, Diego; Ojeda-Duplancher, Jesús Clemente; Perdigón-Moya, Juana Laura; Hernández-Portilla, Luis Barbo; López-Dionicio, Héctor; Durán-Díaz, Angel; Dueñas-García, Irma Elena; Castañeda-Partida, Laura; García-Bores, Ana María; Heres-Pulido, María Eugenia

    2012-03-01

    Verbascoside (VB) is a phenylpropanoid isolated from Buddleja species, some of which originate in Mexico, and was first described in the sixteenth century in the codices of Mexican traditional medicine. VB is present in alcohol extracts and is widely used in the north of Mexico as a sunscreen. VB absorbs UV-A and UV-B radiation and has high antioxidant and anti-inflammatory capacities. VB and its constituent caffeic acid (CA) were screened to determine their genotoxic activity using the Drosophila wing spot test. Third instar larvae (72±4 h) of the standard (ST) and high bioactivation (HB) crosses, with regulated and high levels of cytochrome P450s (Cyp450s), respectively, were exposed to VB or CA (0, 27, 57, 81, 135, and 173 mM). VB was not genotoxic at any of the concentrations tested in both crosses. The amount of VB residue as determined by HPLC in the adult flies that were fed with VB indicated a low metabolism of this compound, which explains the absence of genotoxicity. CA decreased the spontaneous frequencies of small and total spots and showed putative toxicity in the ST cross. Copyright © 2011 Elsevier Ltd. All rights reserved.

  12. FlyTED: the Drosophila Testis Gene Expression Database

    OpenAIRE

    Zhao, Jun; Klyne, Graham; Benson, Elizabeth; Gudmannsdottir, Elin; White-Cooper, Helen; Shotton, David

    2009-01-01

    FlyTED, the Drosophila Testis Gene Expression Database, is a biological research database for gene expression images from the testis of the fruit fly Drosophila melanogaster. It currently contains 2762 mRNA in situ hybridization images and ancillary metadata revealing the patterns of gene expression of 817 Drosophila genes in testes of wild type flies and of seven meiotic arrest mutant strains in which spermatogenesis is defective. This database has been built by adapting a widely used digita...

  13. Early Olfactory Processing in Drosophila: Mechanisms and Principles

    OpenAIRE

    Wilson, Rachel I.

    2013-01-01

    In the olfactory system of Drosophila melanogaster, it is relatively straightforward to make in vivo measurements of activity in neurons corresponding to targeted processing. This, together with the numerical simplicity of the Drosophila olfactory system, has produced rapid gains in our understanding of Drosophila olfaction. This review summarizes the neurophysiology of the first two layers of this system: the peripheral olfactory receptor neurons and their postsynaptic targets in the antenna...

  14. Molecular cloning, functional expression, and gene silencing of two Drosophila receptors for the Drosophila neuropeptide pyrokinin-2

    DEFF Research Database (Denmark)

    Rosenkilde, Carina; Cazzamali, Giuseppe; Williamson, Michael

    2003-01-01

    The database of the Drosophila Genome Project contains the sequences of two genes, CG8784 and CG8795, predicted to code for two structurally related G protein-coupled receptors. We have cloned these genes and expressed their coding parts in Chinese hamster ovary cells. We found that both receptors...... can be activated by low concentrations of the Drosophila neuropeptide pyrokinin-2 (CG8784, EC(50) for pyrokinin-2, 1x10(-9)M; CG8795, EC(50) for pyrokinin-2, 5 x 10(-10)M). The precise role of Drosophila pyrokinin-2 (SVPFKPRLamide) in Drosophila is unknown, but in other insects, pyrokinins have...... embryos and first instar larvae. In addition to the two Drosophila receptors, we also identified two probable pyrokinin receptors in the genomic database from the malaria mosquito Anopheles gambiae. The two Drosophila pyrokinin receptors are, to our knowledge, the first invertebrate pyrokinin receptors...

  15. Origin and Evolution of Y chromosomes: Drosophila tales

    Science.gov (United States)

    Carvalho, A. Bernardo; Koerich, Leonardo B.; Clark, Andrew G.

    2010-01-01

    Classically Y chromosomes are thought to originate from X chromosomes through a process of degeneration and gene loss. Now, the availability of 12 Drosophila genomes provides the opportunity to study the origin and evolution of Y chromosomes in an informative phylogenetic context. Surprisingly, the majority of Drosophila Y-linked genes are recent acquisitions from autosomes, and Y chromosome gene gains are more frequent than gene losses. Moreover, the D. pseudoobscura Y chromosome lacks homology with the Y of most Drosophila species. Thus the Drosophila Y has a different evolutionary history from canonical Y chromosomes (such as the mammalian Y), and it also might have a different origin. PMID:19443075

  16. Mutants dissecting development and behaviour in drosophila

    International Nuclear Information System (INIS)

    Joshi, Adita; Chandrashekaran, Shanti; Sharma, R.P.

    2005-01-01

    We have traced in this paper the progress in Drosophila genetics research from the 1960s, at the IARI, spearheaded by the visionary insight of M. S. Swaminathan. The work started with the study of indirect effect of radiation and the synergistic interaction of physical and chemical mutagens on chromosomal and genetic changes. This paved the way for the study of single gene mutants in dissecting developmental and behavioural processes. New genes discovered by us have been shown to encode conserved cell signalling molecules controlling developmental and behavioural pathways. With the complete sequencing of the Drosophila genome, in the year 2000, mounting evidence for the homology between Drosophila and human genes controlling genetic disorders became available. This has led to the fly becoming an indispensable tool for studying human diseases as well as a model to test for drugs and pharmaceuticals against human diseases and complex behavioural processes. For example wingless in Drosophila belongs to the conserved Wnt gene family and aberrant WNT signalling is linked to a range of human diseases, most notably cancer. Inhibition as well as activation of WNT signalling form the basis of an effective therapy for some cancers as well as several other clinical conditions. Recent experiments have shown that WNTs might also normally participate in self-renewal, proliferation or differentiation of stem cells and altering WNT signalling might be beneficial to the use of stem cells for therapeutic means. Likewise, the stambhA mutant of Drosophila which was discovered for its temperature-dependent paralytic behaviour is the fly homologue of Phospholipase Cβ. Phospholipase C mediated G protein signalling plays a central role in vital processes controlling epilepsy, vision, taste, and olfaction in animals. Proteins of the G-signalling pathway are of intense research interest since many human diseases involve defects in G-protein signalling pathways. In fact, approximately 50

  17. A nanobody-based toolset to investigate the role of protein localization and dispersal in Drosophila.

    Science.gov (United States)

    Harmansa, Stefan; Alborelli, Ilaria; Bieli, Dimitri; Caussinus, Emmanuel; Affolter, Markus

    2017-04-11

    The role of protein localization along the apical-basal axis of polarized cells is difficult to investigate in vivo, partially due to lack of suitable tools. Here, we present the GrabFP system, a collection of four nanobody-based GFP-traps that localize to defined positions along the apical-basal axis. We show that the localization preference of the GrabFP traps can impose a novel localization on GFP-tagged target proteins and results in their controlled mislocalization. These new tools were used to mislocalize transmembrane and cytoplasmic GFP fusion proteins in the Drosophila wing disc epithelium and to investigate the effect of protein mislocalization. Furthermore, we used the GrabFP system as a tool to study the extracellular dispersal of the Decapentaplegic (Dpp) protein and show that the Dpp gradient forming in the lateral plane of the Drosophila wing disc epithelium is essential for patterning of the wing imaginal disc.

  18. Transcriptome analysis of Drosophila neural stem cells.

    Science.gov (United States)

    Gold, Katrina S; Brand, Andrea H

    2012-01-01

    In Drosophila, the central nervous system is populated by a set of asymmetrically dividing neural stem cells called neuroblasts. Neuroblasts are derived from epithelial or neuroepithelial precursors, and divide along their apico-basal axes to produce a large apical neuroblast and a smaller basal ganglion mother cell. The ganglion mother cell will divide once again to produce two post-mitotic neurons or glia. In this chapter we outline a method for labeling different types of neural precursors in the Drosophila central nervous system, followed by their extraction and processing for transcriptome analysis. This technique has allowed us to capture and compare the expression profiles of neuroblasts and neuroepithelial cells, resulting in the identification of key genes required for the regulation of self-renewal and differentiation.

  19. Maintenance of a Drosophila melanogaster Population Cage.

    Science.gov (United States)

    Caravaca, Juan Manuel; Lei, Elissa P

    2016-03-15

    Large quantities of DNA, RNA, proteins and other cellular components are often required for biochemistry and molecular biology experiments. The short life cycle of Drosophila enables collection of large quantities of material from embryos, larvae, pupae and adult flies, in a synchronized way, at a low economic cost. A major strategy for propagating large numbers of flies is the use of a fly population cage. This useful and common tool in the Drososphila community is an efficient way to regularly produce milligrams to tens of grams of embryos, depending on uniformity of developmental stage desired. While a population cage can be time consuming to set up, maintaining a cage over months takes much less time and enables rapid collection of biological material in a short period. This paper describes a detailed and flexible protocol for the maintenance of a Drosophila melanogaster population cage, starting with 1.5 g of harvested material from the previous cycle.

  20. Adaptive Evolution of Gene Expression in Drosophila

    Directory of Open Access Journals (Sweden)

    Armita Nourmohammad

    2017-08-01

    Full Text Available Gene expression levels are important quantitative traits that link genotypes to molecular functions and fitness. In Drosophila, population-genetic studies have revealed substantial adaptive evolution at the genomic level, but the evolutionary modes of gene expression remain controversial. Here, we present evidence that adaptation dominates the evolution of gene expression levels in flies. We show that 64% of the observed expression divergence across seven Drosophila species are adaptive changes driven by directional selection. Our results are derived from time-resolved data of gene expression divergence across a family of related species, using a probabilistic inference method for gene-specific selection. Adaptive gene expression is stronger in specific functional classes, including regulation, sensory perception, sexual behavior, and morphology. Moreover, we identify a large group of genes with sex-specific adaptation of expression, which predominantly occurs in males. Our analysis opens an avenue to map system-wide selection on molecular quantitative traits independently of their genetic basis.

  1. Neural control of aggression in Drosophila.

    Science.gov (United States)

    Hoopfer, Eric D

    2016-06-01

    Like most animal species, fruit flies fight to obtain and defend resources essential to survival and reproduction. Aggressive behavior in Drosophila is genetically specified and also strongly influenced by the fly's social context, past experiences and internal states, making it an excellent framework for investigating the neural mechanisms that regulate complex social behaviors. Here, I summarize our current knowledge of the neural control of aggression in Drosophila and discuss recent advances in understanding the sensory pathways that influence the decision to fight or court, the neuromodulatory control of aggression, the neural basis by which internal states can influence both fighting and courtship, and how social experience modifies aggressive behavior. Copyright © 2016 Elsevier Ltd. All rights reserved.

  2. Counting Calories in Drosophila Diet Restriction

    Science.gov (United States)

    Min, Kyung-Jin; Flatt, Thomas; Kulaots, Indrek; Tatar, Marc

    2007-01-01

    The extension of life span by diet restriction in Drosophila has been argued to occur without limiting calories. Here we directly measure the calories assimilated by flies when maintained on full- and restricted-diets. We find that caloric intake is reduced on all diets that extend life span. Flies on low-yeast diet are long-lived and consume about half the calories of flies on high yeast diets, regardless of the energetic content of the diet itself. Since caloric intake correlates with yeast concentration and thus with the intake of every metabolite in this dietary component, it is premature to conclude for Drosophila that calories do not explain extension of life span. PMID:17125951

  3. The fabulous destiny of the Drosophila heart.

    Science.gov (United States)

    Medioni, Caroline; Sénatore, Sébastien; Salmand, Pierre-Adrien; Lalevée, Nathalie; Perrin, Laurent; Sémériva, Michel

    2009-10-01

    For the last 15 years the fly cardiovascular system has attracted developmental geneticists for its potential as a model system of organogenesis. Heart development in Drosophila indeed provides a remarkable system for elucidating the basic molecular and cellular mechanisms of morphogenesis and, more recently, for understanding the genetic control of cardiac physiology. The success of these studies can in part be attributed to multidisciplinary approaches, the multiplicity of existing genetic tools, and a detailed knowledge of the system. Striking similarities with vertebrate cardiogenesis have long been stressed, in particular concerning the conservation of key molecular regulators of cardiogenesis and the new data presented here confirm Drosophila cardiogenesis as a model not only for organogenesis but also for the study of molecular mechanisms of human cardiac disease.

  4. Remembering components of food in Drosophila

    Directory of Open Access Journals (Sweden)

    Gaurav eDas

    2016-02-01

    Full Text Available Remembering features of past feeding experience can refine foraging and food choice. Insects can learn to associate sensory cues with components of food, such as sugars, amino acids, water, salt, alcohol, toxins and pathogens. In the fruit fly Drosophila some food components activate unique subsets of dopaminergic neurons that innervate distinct functional zones on the mushroom bodies. This architecture suggests that the overall dopaminergic neuron population could provide a potential cellular substrate through which the fly might learn to value a variety of food components. In addition, such an arrangement predicts that individual component memories reside in unique locations. Dopaminergic neurons are also critical for food memory consolidation and deprivation-state dependent motivational control of the expression of food-relevant memories. Here we review our current knowledge of how nutrient-specific memories are formed, consolidated and specifically retrieved in insects, with a particular emphasis on Drosophila.

  5. Development of larval motor circuits in Drosophila.

    Science.gov (United States)

    Kohsaka, Hiroshi; Okusawa, Satoko; Itakura, Yuki; Fushiki, Akira; Nose, Akinao

    2012-04-01

    How are functional neural circuits formed during development? Despite recent advances in our understanding of the development of individual neurons, little is known about how complex circuits are assembled to generate specific behaviors. Here, we describe the ways in which Drosophila motor circuits serve as an excellent model system to tackle this problem. We first summarize what has been learned during the past decades on the connectivity and development of component neurons, in particular motor neurons and sensory feedback neurons. We then review recent progress in our understanding of the development of the circuits as well as studies that apply optogenetics and other innovative techniques to dissect the circuit diagram. New approaches using Drosophila as a model system are now making it possible to search for developmental rules that regulate the construction of neural circuits. © 2012 The Authors Development, Growth & Differentiation © 2012 Japanese Society of Developmental Biologists.

  6. The translation factors of Drosophila melanogaster.

    Science.gov (United States)

    Marygold, Steven J; Attrill, Helen; Lasko, Paul

    2017-01-02

    Synthesis of polypeptides from mRNA (translation) is a fundamental cellular process that is coordinated and catalyzed by a set of canonical 'translation factors'. Surprisingly, the translation factors of Drosophila melanogaster have not yet been systematically identified, leading to inconsistencies in their nomenclature and shortcomings in functional (Gene Ontology, GO) annotations. Here, we describe the complete set of translation factors in D. melanogaster, applying nomenclature already in widespread use in other species, and revising their functional annotation. The collection comprises 43 initiation factors, 12 elongation factors, 3 release factors and 6 recycling factors, totaling 64 of which 55 are cytoplasmic and 9 are mitochondrial. We also provide an overview of notable findings and particular insights derived from Drosophila about these factors. This catalog, together with the incorporation of the improved nomenclature and GO annotation into FlyBase, will greatly facilitate access to information about the functional roles of these important proteins.

  7. Exquisite light sensitivity of Drosophila melanogaster cryptochrome.

    Directory of Open Access Journals (Sweden)

    Pooja Vinayak

    Full Text Available Drosophila melanogaster shows exquisite light sensitivity for modulation of circadian functions in vivo, yet the activities of the Drosophila circadian photopigment cryptochrome (CRY have only been observed at high light levels. We studied intensity/duration parameters for light pulse induced circadian phase shifts under dim light conditions in vivo. Flies show far greater light sensitivity than previously appreciated, and show a surprising sensitivity increase with pulse duration, implying a process of photic integration active up to at least 6 hours. The CRY target timeless (TIM shows dim light dependent degradation in circadian pacemaker neurons that parallels phase shift amplitude, indicating that integration occurs at this step, with the strongest effect in a single identified pacemaker neuron. Our findings indicate that CRY compensates for limited light sensitivity in vivo by photon integration over extraordinarily long times, and point to select circadian pacemaker neurons as having important roles.

  8. Plasticity in the Drosophila larval visual System

    Directory of Open Access Journals (Sweden)

    Abud J Farca-Luna

    2013-07-01

    Full Text Available The remarkable ability of the nervous system to modify its structure and function is mostly experience and activity modulated. The molecular basis of neuronal plasticity has been studied in higher behavioral processes, such as learning and memory formation. However, neuronal plasticity is not restricted to higher brain functions, but may provide a basic feature of adaptation of all neural circuits. The fruit fly Drosophila melanogaster provides a powerful genetic model to gain insight into the molecular basis of nervous system development and function. The nervous system of the larvae is again a magnitude simpler than its adult counter part, allowing the genetic assessment of a number of individual genetically identifiable neurons. We review here recent progress on the genetic basis of neuronal plasticity in developing and functioning neural circuits focusing on the simple visual system of the Drosophila larva.

  9. Rapid matching in Drosophila place learning

    Science.gov (United States)

    Zars, Melissa; Zars, Troy

    2009-08-01

    The level of conditioned behavior in animals is proportional to the intensity, amount, frequency, or probability of reinforcement. Interestingly, this matching can be dynamic, with performance levels following, for example, a switch in the probability of reinforcement with a short delay. We previously found that conditioned performance levels in Drosophila match reinforcement intensity in a place conditioning paradigm. Whether Drosophila can match conditioned behavior to a change in reinforcement intensity was an open question. In this study, we found that both conditioned behavior and memory levels match reinforcement intensity after a switch, and this rapid matching occurs within 2 min. Thus, fruit flies can dynamically match conditioned behavior and memory levels to a change in reinforcement intensity.

  10. Genetics and neurobiology of aggression in Drosophila

    OpenAIRE

    Zwarts, Liesbeth; Versteven, Marijke; Callaerts, Patrick

    2012-01-01

    Aggressive behavior is widely present throughout the animal kingdom and is crucial to ensure survival and reproduction. Aggressive actions serve to acquire territory, food, or mates and in defense against predators or rivals; while in some species these behaviors are involved in establishing a social hierarchy. Aggression is a complex behavior, influenced by a broad range of genetic and environmental factors. Recent studies in Drosophila provide insight into the genetic basis and control of a...

  11. Structure and Development of Glia in Drosophila

    OpenAIRE

    Hartenstein, Volker

    2011-01-01

    Insect glia represents a conspicuous and diverse population of cells and plays a role in controlling neuronal progenitor proliferation, axonal growth, neuronal differentiation and maintenance, and neuronal function. Genetic studies in Drosophila have elucidated many aspects of glial structure, function and development. Just as in vertebrates, it appears as if different classes of glial cells are specialized for different functions. Based on topology and cell shape, glial cells of the central ...

  12. Ultrastructural Analysis of Myoblast Fusion in Drosophila

    OpenAIRE

    Zhang, Shiliang; Chen, Elizabeth H.

    2008-01-01

    Myoblast fusion in Drosophila has become a powerful genetic system with which to unravel the mechanisms underlying cell fusion. The identification of important components of myoblast fusion by genetic analysis has led to a molecular pathway toward our understanding of this cellular process. In addition to the application of immunohistochemistry and live imaging techniques to visualize myoblast fusion at the light microscopic level, ultrastructural analysis using electron microscopy remains an...

  13. Organization Of The Drosophila Larval Visual Circuit

    OpenAIRE

    Fritsch, Pauline; Gendre, Nanae; Maier, Larisa; Fetter, Rick; Schneider-Mizell, Casey; Truman, James; Zlatic, Marta; Cardona, Albert; Larderet, Ivan; Sprecher, Simon

    2017-01-01

    Visual systems transduce, process and transmit light-dependent environmental cues. Computation of visual features depends on the types of photoreceptor neurons (PR) present, the organization of the eye and the wiring of the underlying neural circuit. Here, we describe the circuit architecture of the visual system of Drosophila larvae by mapping the synaptic wiring diagram and neurotransmitters. By contacting different targets, the two larval PR-subtypes create parallel circuits potentially un...

  14. A Drosophila Model to Image Phagosome Maturation

    Directory of Open Access Journals (Sweden)

    Douglas A. Brooks

    2013-03-01

    Full Text Available Phagocytosis involves the internalization of extracellular material by invagination of the plasma membrane to form intracellular vesicles called phagosomes, which have functions that include pathogen degradation. The degradative properties of phagosomes are thought to be conferred by sequential fusion with endosomes and lysosomes; however, this maturation process has not been studied in vivo. We employed Drosophila hemocytes, which are similar to mammalian professional macrophages, to establish a model of phagosome maturation. Adult Drosophila females, carrying transgenic Rab7-GFP endosome and Lamp1-GFP lysosome markers, were injected with E. coli DH5α and the hemocytes were collected at 15, 30, 45 and 60 minutes after infection. In wild-type females, E. coli were detected within enlarged Rab7-GFP positive phagosomes at 15 to 45 minutes after infection; and were also observed in enlarged Lamp1-GFP positive phagolysosomes at 45 minutes. Two-photon imaging of hemocytes in vivo confirmed this vesicle morphology, including enlargement of Rab7-GFP and Lamp1-GFP structures that often appeared to protrude from hemocytes. The interaction of endosomes and lysosomes with E. coli phagosomes observed in Drosophila hemocytes was consistent with that previously described for phagosome maturation in human ex vivo macrophages. We also tested our model as a tool for genetic analysis using 14-3-3e mutants, and demonstrated altered phagosome maturation with delayed E. coli internalization, trafficking and/or degradation. These findings demonstrate that Drosophila hemocytes provide an appropriate, genetically amenable, model for analyzing phagosome maturation ex vivo and in vivo.

  15. Adaptive dynamics of cuticular hydrocarbons in Drosophila

    Czech Academy of Sciences Publication Activity Database

    Rajpurohit, S.; Hanus, Robert; Vrkoslav, Vladimír; Behrman, E. L.; Bergland, A. O.; Petrov, D.; Cvačka, Josef; Schmidt, P. S.

    2017-01-01

    Roč. 30, č. 1 (2017), s. 66-80 ISSN 1010-061X R&D Projects: GA ČR GAP206/12/1093 Institutional support: RVO:61388963 Keywords : cuticular hydrocarbons * Drosophila * experimental evolution * spatiotemporal variation * thermal plasticity Subject RIV: EB - Genetics ; Molecular Biology OBOR OECD: Biology (theoretical, mathematical, thermal, cryobiology, biological rhythm), Evolutionary biology Impact factor: 2.792, year: 2016 http://onlinelibrary.wiley.com/doi/10.1111/jeb.12988/full

  16. Neurophysiology of Drosophila Models of Parkinson's Disease

    OpenAIRE

    West, Ryan J. H.; Furmston, Rebecca; Williams, Charles A. C.; Elliott, Christopher J. H.

    2015-01-01

    We provide an insight into the role Drosophila has played in elucidating neurophysiological perturbations associated with Parkinson's disease- (PD-) related genes. Synaptic signalling deficits are observed in motor, central, and sensory systems. Given the neurological impact of disease causing mutations within these same genes in humans the phenotypes observed in fly are of significant interest. As such we observe four unique opportunities provided by fly nervous system models of Parkinson's ...

  17. Three-dimensional imaging of Drosophila melanogaster.

    Directory of Open Access Journals (Sweden)

    Leeanne McGurk

    2007-09-01

    Full Text Available The major hindrance to imaging the intact adult Drosophila is that the dark exoskeleton makes it impossible to image through the cuticle. We have overcome this obstacle and describe a method whereby the internal organs of adult Drosophila can be imaged in 3D by bleaching and clearing the adult and then imaging using a technique called optical projection tomography (OPT. The data is displayed as 2D optical sections and also in 3D to provide detail on the shape and structure of the adult anatomy.We have used OPT to visualize in 2D and 3D the detailed internal anatomy of the intact adult Drosophila. In addition this clearing method used for OPT was tested for imaging with confocal microscopy. Using OPT we have visualized the size and shape of neurodegenerative vacuoles from within the head capsule of flies that suffer from age-related neurodegeneration due to a lack of ADAR mediated RNA-editing. In addition we have visualized tau-lacZ expression in 2D and 3D. This shows that the wholemount adult can be stained without any manipulation and that this stain penetrates well as we have mapped the localization pattern with respect to the internal anatomy.We show for the first time that the intact adult Drosophila can be imaged in 3D using OPT, also we show that this method of clearing is also suitable for confocal microscopy to image the brain from within the intact head. The major advantage of this is that organs can be represented in 3D in their natural surroundings. Furthermore optical sections are generated in each of the three planes and are not prone to the technical limitations that are associated with manual sectioning. OPT can be used to dissect mutant phenotypes and to globally map gene expression in both 2D and 3D.

  18. Studies on maternal repair in Drosophila melanogaster

    International Nuclear Information System (INIS)

    Mendelson, D.

    1976-01-01

    The work reported in this thesis is mainly concerned with studies on the nature of the repair mechanism(s) operating in Drosophila oocytes, and which act on chromosome damage induced by X-irradiation of post-meiotic male germ-cells. Caffeine treatment of the females has been used as an analytical tool to gain an insight into the nature of this repair mechanism and its genetic basis

  19. ‘Peer pressure’ in larval Drosophila?

    Directory of Open Access Journals (Sweden)

    Thomas Niewalda

    2014-06-01

    Full Text Available Understanding social behaviour requires a study case that is simple enough to be tractable, yet complex enough to remain interesting. Do larval Drosophila meet these requirements? In a broad sense, this question can refer to effects of the mere presence of other larvae on the behaviour of a target individual. Here we focused in a more strict sense on ‘peer pressure’, that is on the question of whether the behaviour of a target individual larva is affected by what a surrounding group of larvae is doing. We found that innate olfactory preference of a target individual was neither affected (i by the level of innate olfactory preference in the surrounding group nor (ii by the expression of learned olfactory preference in the group. Likewise, learned olfactory preference of a target individual was neither affected (iii by the level of innate olfactory preference of the surrounding group nor (iv by the learned olfactory preference the group was expressing. We conclude that larval Drosophila thus do not take note of specifically what surrounding larvae are doing. This implies that in a strict sense, and to the extent tested, there is no social interaction between larvae. These results validate widely used en mass approaches to the behaviour of larval Drosophila.

  20. An automated paradigm for Drosophila visual psychophysics.

    Science.gov (United States)

    Evans, Oliver; Paulk, Angelique C; van Swinderen, Bruno

    2011-01-01

    Mutations that cause learning and memory defects in Drosophila melanogaster have been found to also compromise visual responsiveness and attention. A better understanding of attention-like defects in such Drosophila mutants therefore requires a more detailed characterization of visual responsiveness across a range of visual parameters. We designed an automated behavioral paradigm for efficiently dissecting visual responsiveness in Drosophila. Populations of flies walk through multiplexed serial choice mazes while being exposed to moving visuals displayed on computer monitors, and infra-red fly counters at the end of each maze automatically score the responsiveness of a strain. To test our new design, we performed a detailed comparison between wild-type flies and a learning and memory mutant, dunce(1). We first confirmed that the learning mutant dunce(1) displays increased responsiveness to a black/green moving grating compared to wild type in this new design. We then extended this result to explore responses to a wide range of psychophysical parameters for moving gratings (e.g., luminosity, contrast, spatial frequency, velocity) as well as to a different stimulus, moving dots. Finally, we combined these visuals (gratings versus dots) in competition to investigate how dunce(1) and wild-type flies respond to more complex and conflicting motion effects. We found that dunce(1) responds more strongly than wild type to high contrast and highly structured motion. This effect was found for simple gratings, dots, and combinations of both stimuli presented in competition.

  1. An automated paradigm for Drosophila visual psychophysics.

    Directory of Open Access Journals (Sweden)

    Oliver Evans

    Full Text Available BACKGROUND: Mutations that cause learning and memory defects in Drosophila melanogaster have been found to also compromise visual responsiveness and attention. A better understanding of attention-like defects in such Drosophila mutants therefore requires a more detailed characterization of visual responsiveness across a range of visual parameters. METHODOLOGY/PRINCIPAL FINDINGS: We designed an automated behavioral paradigm for efficiently dissecting visual responsiveness in Drosophila. Populations of flies walk through multiplexed serial choice mazes while being exposed to moving visuals displayed on computer monitors, and infra-red fly counters at the end of each maze automatically score the responsiveness of a strain. To test our new design, we performed a detailed comparison between wild-type flies and a learning and memory mutant, dunce(1. We first confirmed that the learning mutant dunce(1 displays increased responsiveness to a black/green moving grating compared to wild type in this new design. We then extended this result to explore responses to a wide range of psychophysical parameters for moving gratings (e.g., luminosity, contrast, spatial frequency, velocity as well as to a different stimulus, moving dots. Finally, we combined these visuals (gratings versus dots in competition to investigate how dunce(1 and wild-type flies respond to more complex and conflicting motion effects. CONCLUSIONS/SIGNIFICANCE: We found that dunce(1 responds more strongly than wild type to high contrast and highly structured motion. This effect was found for simple gratings, dots, and combinations of both stimuli presented in competition.

  2. Neurophysiology of Drosophila models of Parkinson's disease.

    Science.gov (United States)

    West, Ryan J H; Furmston, Rebecca; Williams, Charles A C; Elliott, Christopher J H

    2015-01-01

    We provide an insight into the role Drosophila has played in elucidating neurophysiological perturbations associated with Parkinson's disease- (PD-) related genes. Synaptic signalling deficits are observed in motor, central, and sensory systems. Given the neurological impact of disease causing mutations within these same genes in humans the phenotypes observed in fly are of significant interest. As such we observe four unique opportunities provided by fly nervous system models of Parkinson's disease. Firstly, Drosophila models are instrumental in exploring the mechanisms of neurodegeneration, with several PD-related mutations eliciting related phenotypes including sensitivity to energy supply and vesicular deformities. These are leading to the identification of plausible cellular mechanisms, which may be specific to (dopaminergic) neurons and synapses rather than general cellular phenotypes. Secondly, models show noncell autonomous signalling within the nervous system, offering the opportunity to develop our understanding of the way pathogenic signalling propagates, resembling Braak's scheme of spreading pathology in PD. Thirdly, the models link physiological deficits to changes in synaptic structure. While the structure-function relationship is complex, the genetic tractability of Drosophila offers the chance to separate fundamental changes from downstream consequences. Finally, the strong neuronal phenotypes permit relevant first in vivo drug testing.

  3. Transcriptional regulation of xenobiotic detoxification in Drosophila

    Science.gov (United States)

    Misra, Jyoti R.; Horner, Michael A.; Lam, Geanette; Thummel, Carl S.

    2011-01-01

    Living organisms, from bacteria to humans, display a coordinated transcriptional response to xenobiotic exposure, inducing enzymes and transporters that facilitate detoxification. Several transcription factors have been identified in vertebrates that contribute to this regulatory response. In contrast, little is known about this pathway in insects. Here we show that the Drosophila Nrf2 (NF-E2-related factor 2) ortholog CncC (cap ‘n’ collar isoform-C) is a central regulator of xenobiotic detoxification responses. A binding site for CncC and its heterodimer partner Maf (muscle aponeurosis fibromatosis) is sufficient and necessary for robust transcriptional responses to three xenobiotic compounds: phenobarbital (PB), chlorpromazine, and caffeine. Genetic manipulations that alter the levels of CncC or its negative regulator, Keap1 (Kelch-like ECH-associated protein 1), lead to predictable changes in xenobiotic-inducible gene expression. Transcriptional profiling studies reveal that more than half of the genes regulated by PB are also controlled by CncC. Consistent with these effects on detoxification gene expression, activation of the CncC/Keap1 pathway in Drosophila is sufficient to confer resistance to the lethal effects of the pesticide malathion. These studies establish a molecular mechanism for the regulation of xenobiotic detoxification in Drosophila and have implications for controlling insect populations and the spread of insect-borne human diseases. PMID:21896655

  4. The Ran pathway in Drosophila melanogaster mitosis

    Directory of Open Access Journals (Sweden)

    James G Wakefield

    2015-11-01

    Full Text Available Over the last two decades, the small GTPase Ran has emerged as a central regulator of both mitosis and meiosis, particularly in the generation, maintenance and regulation of the microtubule (MT-based bipolar spindle. Ran-regulated pathways in mitosis bear many similarities to the well-characterized functions of Ran in nuclear transport and, as with transport, the majority of these mitotic effects are mediated through affecting the physical interaction between karyopherins and Spindle Assembly Factors (SAFs - a loose term describing proteins or protein complexes involved in spindle assembly through promoting nucleation, stabilization, and/or depolymerization of MTs, through anchoring MTs to specific structures such as centrosomes, chromatin or kinetochores, or through sliding MTs along each other to generate the force required to achieve bipolarity. As such, the Ran-mediated pathway represents a crucial functional module within the wider spindle assembly landscape. Research into mitosis using the model organism Drosophila melanogaster has contributed substantially to our understanding of centrosome and spindle function. However, in comparison to mammalian systems, very little is known about the contribution of Ran-mediated pathways in Drosophila mitosis. This article sets out to summarize our understanding of the roles of the Ran pathway components in Drosophila mitosis, focusing on the syncytial blastoderm embryo, arguing that, far from being superfluous, it can provide important insights into the conserved functions on Ran during spindle formation.

  5. Pervasive natural selection in the Drosophila genome?

    Directory of Open Access Journals (Sweden)

    Guy Sella

    2009-06-01

    Full Text Available Over the past four decades, the predominant view of molecular evolution saw little connection between natural selection and genome evolution, assuming that the functionally constrained fraction of the genome is relatively small and that adaptation is sufficiently infrequent to play little role in shaping patterns of variation within and even between species. Recent evidence from Drosophila, reviewed here, suggests that this view may be invalid. Analyses of genetic variation within and between species reveal that much of the Drosophila genome is under purifying selection, and thus of functional importance, and that a large fraction of coding and noncoding differences between species are adaptive. The findings further indicate that, in Drosophila, adaptations may be both common and strong enough that the fate of neutral mutations depends on their chance linkage to adaptive mutations as much as on the vagaries of genetic drift. The emerging evidence has implications for a wide variety of fields, from conservation genetics to bioinformatics, and presents challenges to modelers and experimentalists alike.

  6. Tet protein function during Drosophila development.

    Directory of Open Access Journals (Sweden)

    Fei Wang

    Full Text Available The TET (Ten-eleven translocation 1, 2 and 3 proteins have been shown to function as DNA hydroxymethylases in vertebrates and their requirements have been documented extensively. Recently, the Tet proteins have been shown to also hydroxylate 5-methylcytosine in RNA. 5-hydroxymethylcytosine (5hmrC is enriched in messenger RNA but the function of this modification has yet to be elucidated. Because Cytosine methylation in DNA is barely detectable in Drosophila, it serves as an ideal model to study the biological function of 5hmrC. Here, we characterized the temporal and spatial expression and requirement of Tet throughout Drosophila development. We show that Tet is essential for viability as Tet complete loss-of-function animals die at the late pupal stage. Tet is highly expressed in neuronal tissues and at more moderate levels in somatic muscle precursors in embryos and larvae. Depletion of Tet in muscle precursors at early embryonic stages leads to defects in larval locomotion and late pupal lethality. Although Tet knock-down in neuronal tissue does not cause lethality, it is essential for neuronal function during development through its affects upon locomotion in larvae and the circadian rhythm of adult flies. Further, we report the function of Tet in ovarian morphogenesis. Together, our findings provide basic insights into the biological function of Tet in Drosophila, and may illuminate observed neuronal and muscle phenotypes observed in vertebrates.

  7. Use of Early Ripening Cultivars to Avoid Infestation and Mass Trapping to Manage Drosophila suzukii (Diptera: Drosophilidae) in Vaccinium corymbosum (Ericales: Ericaceae).

    Science.gov (United States)

    Hampton, Emily; Koski, Carissa; Barsoian, Olivia; Faubert, Heather; Cowles, Richard S; Alm, Steven R

    2014-10-01

    Use of early ripening highbush blueberry cultivars to avoid infestation and mass trapping were evaluated for managing spotted wing drosophila, Drosophila suzukii (Matsumura). Fourteen highbush blueberry cultivars were sampled for spotted wing drosophila infestation. Most 'Earliblue', 'Bluetta', and 'Collins' fruit were harvested before spotted wing drosophila oviposition commenced, and so escaped injury. Most fruit from 'Bluejay', 'Blueray', and 'Bluehaven' were also harvested before the first week of August, after which spotted wing drosophila activity led to high levels of blueberry infestation. In a separate experiment, damage to cultivars was related to the week in which fruit were harvested, with greater damage to fruit observed as the season progressed. Attractant traps placed within blueberry bushes increased nearby berry infestation by 5%, irrespective of cultivar and harvest date. The significant linear reduction in infestation with increasing distance from the attractant trap suggests that traps are influencing fly behavior to at least 5.5 m. Insecticides applied to the exterior of traps, compared with untreated traps, revealed that only 10-30% of flies visiting traps enter the traps and drown. Low trap efficiency may jeopardize surrounding fruits by increasing local spotted wing drosophila activity. To protect crops, traps for mass trapping should be placed in a perimeter outside fruit fields and insecticides need to be applied to the surface of traps or on nearby fruit to function as an attract-and-kill strategy. © 2014 Entomological Society of America.

  8. Protein crosslinking by transglutaminase controls cuticle morphogenesis in Drosophila.

    Directory of Open Access Journals (Sweden)

    Toshio Shibata

    Full Text Available Transglutaminase (TG plays important and diverse roles in mammals, such as blood coagulation and formation of the skin barrier, by catalyzing protein crosslinking. In invertebrates, TG is known to be involved in immobilization of invading pathogens at sites of injury. Here we demonstrate that Drosophila TG is an important enzyme for cuticle morphogenesis. Although TG activity was undetectable before the second instar larval stage, it dramatically increased in the third instar larval stage. RNA interference (RNAi of the TG gene caused a pupal semi-lethal phenotype and abnormal morphology. Furthermore, TG-RNAi flies showed a significantly shorter life span than their counterparts, and approximately 90% of flies died within 30 days after eclosion. Stage-specific TG-RNAi before the third instar larval stage resulted in cuticle abnormality, but the TG-RNAi after the late pupal stage did not, indicating that TG plays a key role at or before the early pupal stage. Immediately following eclosion, acid-extractable protein from wild-type wings was nearly all converted to non-extractable protein due to wing maturation, whereas several proteins remained acid-extractable in the mature wings of TG-RNAi flies. We identified four proteins--two cuticular chitin-binding proteins, larval serum protein 2, and a putative C-type lectin-as TG substrates. RNAi of their corresponding genes caused a lethal phenotype or cuticle abnormality. Our results indicate that TG-dependent protein crosslinking in Drosophila plays a key role in cuticle morphogenesis and sclerotization.

  9. Genetic monitoring of irradiated Drosophila populations treated with antimutagen melanine

    International Nuclear Information System (INIS)

    Mosseh, I.B.; Savchenko, V.K.; Lyakh, I.P.

    1986-01-01

    It was shown that viability of irradiated Drosophila is, on an average, lower than in intact populations. The fertility first decreases then increases exceeding the control level. Melanine added to the diet increases fertility and viability of both exposed and intact Drosophila populations

  10. Drosophila Courtship Conditioning As a Measure of Learning and Memory

    NARCIS (Netherlands)

    Koemans, T.S.; Oppitz, C.; Donders, R.; Bokhoven, H. van; Schenck, A.; Keleman, K.; Kramer, J.M.

    2017-01-01

    Many insights into the molecular mechanisms underlying learning and memory have been elucidated through the use of simple behavioral assays in model organisms such as the fruit fly, Drosophila melanogaster. Drosophila is useful for understanding the basic neurobiology underlying cognitive deficits

  11. Medium-term changes in Drosophila subobscura chromosomal ...

    Indian Academy of Sciences (India)

    2015-06-02

    Jun 2, 2015 ... [Zivanovic G., Arenas C. and Mestres F. 2015 Medium-term changes in Drosophila subobscura chromosomal inversion polymorphism: a possible relation with global warming? J. Genet. 94, 343–346]. Introduction. Drosophila subobscura is a species with a rich chromosomal polymorphism for inversions.

  12. Ultradian rhythm unmasked in the Pdf clock mutant of Drosophila

    Indian Academy of Sciences (India)

    2014-07-20

    Jul 20, 2014 ... temperature compensated. Our results suggest that Drosophila has an endogenous ultradian oscillator that is masked by circadian rhythmic behaviours. [Seki Y and Tanimura T 2014 Ultradian rhythm unmasked in the Pdf clock mutant of Drosophila. J. Biosci. 39 585-594]. DOI 10.1007/s12038-014-9450-z.

  13. Ionizing radiation causes the stress response in Drosophila melanogaster

    International Nuclear Information System (INIS)

    Gruntenko, N.E.; Zakharenko, L.P.; Raushenbakh, I.Yu.

    1998-01-01

    Potentiality of the stress-reaction arising in Drosophila melanogaster under gamma-irradiation of the source with 137 Cs (irradiation dose is 10 Gy , radiation dose rate amounts 180 c Gy/min) is studied. It is shown that radiation induces the stress-reaction in Drosophila resulting in alterations in energetic metabolism (biogenic amines metabolic system) and in reproductive function [ru

  14. Status of research on Drosophila ananassae at global level

    Indian Academy of Sciences (India)

    Abstract. Drosophila, a dipteran insect, has been found to be the best biological model for different kinds of studies. D melanogaster was first described by Meigen in 1830, is most extensively studied species of the genus Drosophila and a number of investigations employing this species have been documented in areas ...

  15. The developmental transcriptome of Drosophila melanogaster

    Energy Technology Data Exchange (ETDEWEB)

    University of Connecticut; Graveley, Brenton R.; Brooks, Angela N.; Carlson, Joseph W.; Duff, Michael O.; Landolin, Jane M.; Yang, Li; Artieri, Carlo G.; van Baren, Marijke J.; Boley, Nathan; Booth, Benjamin W.; Brown, James B.; Cherbas, Lucy; Davis, Carrie A.; Dobin, Alex; Li, Renhua; Lin, Wei; Malone, John H.; Mattiuzzo, Nicolas R.; Miller, David; Sturgill, David; Tuch, Brian B.; Zaleski, Chris; Zhang, Dayu; Blanchette, Marco; Dudoit, Sandrine; Eads, Brian; Green, Richard E.; Hammonds, Ann; Jiang, Lichun; Kapranov, Phil; Langton, Laura; Perrimon, Norbert; Sandler, Jeremy E.; Wan, Kenneth H.; Willingham, Aarron; Zhang, Yu; Zou, Yi; Andrews, Justen; Bicke, Peter J.; Brenner, Steven E.; Brent, Michael R.; Cherbas, Peter; Gingeras, Thomas R.; Hoskins, Roger A.; Kaufman, Thomas C.; Oliver, Brian; Celniker, Susan E.

    2010-12-02

    Drosophila melanogaster is one of the most well studied genetic model organisms; nonetheless, its genome still contains unannotated coding and non-coding genes, transcripts, exons and RNA editing sites. Full discovery and annotation are pre-requisites for understanding how the regulation of transcription, splicing and RNA editing directs the development of this complex organism. Here we used RNA-Seq, tiling microarrays and cDNA sequencing to explore the transcriptome in 30 distinct developmental stages. We identified 111,195 new elements, including thousands of genes, coding and non-coding transcripts, exons, splicing and editing events, and inferred protein isoforms that previously eluded discovery using established experimental, prediction and conservation-based approaches. These data substantially expand the number of known transcribed elements in the Drosophila genome and provide a high-resolution view of transcriptome dynamics throughout development. Drosophila melanogaster is an important non-mammalian model system that has had a critical role in basic biological discoveries, such as identifying chromosomes as the carriers of genetic information and uncovering the role of genes in development. Because it shares a substantial genic content with humans, Drosophila is increasingly used as a translational model for human development, homeostasis and disease. High-quality maps are needed for all functional genomic elements. Previous studies demonstrated that a rich collection of genes is deployed during the life cycle of the fly. Although expression profiling using microarrays has revealed the expression of, 13,000 annotated genes, it is difficult to map splice junctions and individual base modifications generated by RNA editing using such approaches. Single-base resolution is essential to define precisely the elements that comprise the Drosophila transcriptome. Estimates of the number of transcript isoforms are less accurate than estimates of the number of genes

  16. Effect of Chemical Ratios of a Microbial-Based Feeding Attractant on Trap Catch of Drosophila suzukii (Diptera: Drosophilidae).

    Science.gov (United States)

    Cha, Dong H; Landolt, Peter J; Adams, Todd B

    2017-08-01

    Drosophila suzukii Matsumura, spotted wing drosophila, can be trapped with a feeding attractant based on wine and vinegar volatiles and consisting of acetic acid, ethanol, acetoin, and methionol. Using that four-component blend, we found that the catch of spotted wing drosophila increased with increases in the release rate of acetoin (from 0.5 mg/d to 34 mg/d) from polyethylene sachet dispensers, and with increases in the concentrations of acetic acid (from 0.25% to 4%) or ethanol (from 0.08% to 2%) when dispensed in the trap drowning solution. However, we saw no increase in spotted wing drosophila trapped with increase of the methionol release rate from 0.4 mg/d to 4.9 mg/d or from 0.19 mg/d to 0.8 mg/d, from sachets. A new formulation based on optimized amounts of these four chemicals yielded a doubling of spotted wing drosophila trapped compared to a previously reported formulation. Further field testing confirmed that the simultaneous increases in the release rate of acetoin from a dispenser and the amount of acetic acid in the trap drowning solution provided the increased spotted wing drosophila trap response to the new formulation. These findings provide a practical means to improve the power of this lure to detect and monitor D. suzukii. Published by Oxford University Press on behalf of Entomological Society of America 2017. This work is written by US Government employees and is in the public domain in the US.

  17. Rhodopsin 7–The unusual Rhodopsin in Drosophila

    Directory of Open Access Journals (Sweden)

    Pingkalai R. Senthilan

    2016-09-01

    Full Text Available Rhodopsins are the major photopigments in the fruit fly Drosophila melanogaster. Drosophila express six well-characterized Rhodopsins (Rh1–Rh6 with distinct absorption maxima and expression pattern. In 2000, when the Drosophila genome was published, a novel Rhodopsin gene was discovered: Rhodopsin 7 (Rh7. Rh7 is highly conserved among the Drosophila genus and is also found in other arthropods. Phylogenetic trees based on protein sequences suggest that the seven Drosophila Rhodopsins cluster in three different groups. While Rh1, Rh2 and Rh6 form a “vertebrate-melanopsin-type”–cluster, and Rh3, Rh4 and Rh5 form an “insect-type”-Rhodopsin cluster, Rh7 seem to form its own cluster. Although Rh7 has nearly all important features of a functional Rhodopsin, it differs from other Rhodopsins in its genomic and structural properties, suggesting it might have an overall different role than other known Rhodopsins.

  18. Intestinal stem cells in the adult Drosophila midgut

    International Nuclear Information System (INIS)

    Jiang, Huaqi; Edgar, Bruce A.

    2011-01-01

    Drosophila has long been an excellent model organism for studying stem cell biology. Notably, studies of Drosophila's germline stem cells have been instrumental in developing the stem cell niche concept. The recent discovery of somatic stem cells in adult Drosophila, particularly the intestinal stem cells (ISCs) of the midgut, has established Drosophila as an exciting model to study stem cell-mediated adult tissue homeostasis and regeneration. Here, we review the major signaling pathways that regulate the self-renewal, proliferation and differentiation of Drosophila ISCs, discussing how this regulation maintains midgut homeostasis and mediates regeneration of the intestinal epithelium after injury. -- Highlights: ► The homeostasis and regeneration of adult fly midguts are mediated by ISCs. ► Damaged enterocytes induce the proliferation of intestinal stem cells (ISC). ► EGFR and Jak/Stat signalings mediate compensatory ISC proliferation. ► Notch signaling regulates ISC self-renewal and differentiation.

  19. Drosophila melanogaster as a model organism to study nanotoxicity.

    Science.gov (United States)

    Ong, Cynthia; Yung, Lin-Yue Lanry; Cai, Yu; Bay, Boon-Huat; Baeg, Gyeong-Hun

    2015-05-01

    Drosophila melanogaster has been used as an in vivo model organism for the study of genetics and development since 100 years ago. Recently, the fruit fly Drosophila was also developed as an in vivo model organism for toxicology studies, in particular, the field of nanotoxicity. The incorporation of nanomaterials into consumer and biomedical products is a cause for concern as nanomaterials are often associated with toxicity in many in vitro studies. In vivo animal studies of the toxicity of nanomaterials with rodents and other mammals are, however, limited due to high operational cost and ethical objections. Hence, Drosophila, a genetically tractable organism with distinct developmental stages and short life cycle, serves as an ideal organism to study nanomaterial-mediated toxicity. This review discusses the basic biology of Drosophila, the toxicity of nanomaterials, as well as how the Drosophila model can be used to study the toxicity of various types of nanomaterials.

  20. Detecting novel low-abundant transcripts in Drosophila

    DEFF Research Database (Denmark)

    Lee, Sanggyu; Bao, Jingyue; Zhou, Guolin

    2005-01-01

    Increasing evidence suggests that low-abundant transcripts may play fundamental roles in biological processes. In an attempt to estimate the prevalence of low-abundant transcripts in eukaryotic genomes, we performed a transcriptome analysis in Drosophila using the SAGE technique. We collected 244......,313 SAGE tags from transcripts expressed in Drosophila embryonic, larval, pupae, adult, and testicular tissue. From these SAGE tags, we identified 40,823 unique SAGE tags. Our analysis showed that 55% of the 40,823 unique SAGE tags are novel without matches in currently known Drosophila transcripts...... in the Drosophila genome. Our study reveals the presence of a significant number of novel low-abundant transcripts in Drosophila, and highlights the need to isolate these novel low-abundant transcripts for further biological studies. Udgivelsesdato: 2005-Jun...

  1. Genetic and Environmental Control of Neurodevelopmental Robustness in Drosophila.

    Directory of Open Access Journals (Sweden)

    David J Mellert

    Full Text Available Interindividual differences in neuronal wiring may contribute to behavioral individuality and affect susceptibility to neurological disorders. To investigate the causes and potential consequences of wiring variation in Drosophila melanogaster, we focused on a hemilineage of ventral nerve cord interneurons that exhibits morphological variability. We find that late-born subclasses of the 12A hemilineage are highly sensitive to genetic and environmental variation. Neurons in the second thoracic segment are particularly variable with regard to two developmental decisions, whereas its segmental homologs are more robust. This variability "hotspot" depends on Ultrabithorax expression in the 12A neurons, indicating variability is cell-intrinsic and under genetic control. 12A development is more variable and sensitive to temperature in long-established laboratory strains than in strains recently derived from the wild. Strains with a high frequency of one of the 12A variants also showed a high frequency of animals with delayed spontaneous flight initiation, whereas other wing-related behaviors did not show such a correlation and were thus not overtly affected by 12A variation. These results show that neurodevelopmental robustness is variable and under genetic control in Drosophila and suggest that the fly may serve as a model for identifying conserved gene pathways that stabilize wiring in stressful developmental environments. Moreover, some neuronal lineages are variation hotspots and thus may be more amenable to evolutionary change.

  2. Effect of trap design, bait type, and age on captures of Drosophila suzukii (Diptera: Drosophilidae) in berry crops.

    Science.gov (United States)

    Iglesias, Lindsy E; Nyoike, Teresia W; Liburd, Oscar E

    2014-08-01

    Field experiments were conducted in commercial southern highbush blueberries and wild blackberries to evaluate the attractiveness of different trap designs, bait types, and bait age on captures of the spotted wing drosophila, Drosophila suzukii (Matsumura) (Diptera: Drosophilidae). During the 2012 trap design study, the five treatments evaluated were four 1-liter clear plastic cup traps (with and without a yellow visual stimulus or odorless dish detergent) and the fifth treatment was a Pherocon AM yellow sticky card trap. Cup traps were baited with 150 ml of apple cider vinegar (ACV) and the Pherocon AM trap had a 7.4-ml glass vial containing ACV. In 2013, the Pherocon AM yellow sticky card was omitted because of low spotted wing drosophila captures in 2012. The four treatments evaluated were four 1-liter cup traps with and without a yellow visual stimulus. One cup trap (with a yellow stimulus) was baited with yeast + sugar in place of ACV and the other cup traps were baited with ACV. In both years, there were no differences in spotted wing drosophila captures among cup traps baited with ACV with and without yellow visual stimulus. However, the cup trap baited with yeast + sugar and yellow visual stimulus captured more spotted wing drosophila than the ACV-baited cup traps irrespective of visual stimulus or detergent. In another study, four baits including 1) ACV, 2) yeast + sugar mixture, 3) yeast + flour mixture (yeast, sugar, water, whole wheat flour, and ACV), and 4) wine + vinegar mixture (rice vinegar and merlot wine) were evaluated in a commercial blueberry planting using 1-liter clear plastic cup traps (as described above). The experiment was repeated in wild blackberries but the yeast + flour bait was replaced with ACV + merlot wine + sugar. Results indicated that the two yeast baits captured significantly more spotted wing drosophila and more nontarget organisms than the vinegar baits. In the final study, although we found that the attraction of ACV and

  3. Isolation of protease-free alcohol dehydrogenase (ADH) from Drosophila simulans and several homozygous and heterozygous Drosophila melanogaster variants

    NARCIS (Netherlands)

    Smilda, T; Lamme, DA; Collu, G; Jekel, PA; Reinders, P; Beintema, JJ

    The enzyme alcohol dehydrogenase (ADH) from several naturally occurring ADH variants of Drosophila melanogaster and Drosophila simulans Lc,as isolated. Affinity chromatography with the ligand Cibacron Blue and elution with NAD(+) showed similar behavior for D. melanogaster ADH-FF, ADH-71k, and D.

  4. Biological effects of radon in Drosophila; Efectos biologicos del radon en Drosophila

    Energy Technology Data Exchange (ETDEWEB)

    Pimentel P, A.E.; Tavera D, L.; Cruces M, M.P.; Arceo M, C.; Rosa D, M.E. de la

    1992-04-15

    The main objective of this investigation, is to study the biological effects of the Radon-222 at low dose in 'Drosophila melanogaster'. It is necessary to mention that these effects will analyze from the genetic point of view for: 1) To evaluate in which form the Radon-222 to low dose it influences in some genetic components of the adaptation in Drosophila, such as: fecundity, viability egg-adult and sex proportion. 2) To evaluate which is the genetic effect that induces the Radon to low dose by means of the SMART technique in Drosophila melanogaster, and this way to try of to identify which is the possible mechanism that causes the genetic damage to somatic level. The carried out investigation was divided in three stages: 1. Tests to the vacuum resistance. 2. Test of somatic mutation, and 3. Determination of the presence of radon daughters on the adult of Drosophila. It is necessary to point out that all the experiments were made by triplicate and in each one of them was placed detectors in preset places. Those obtained results are presented inside the 4 charts included in the present work. (Author)

  5. Nematocytes: Discovery and characterization of a novel anculeate hemocyte in Drosophila falleni and Drosophila phalerata.

    Directory of Open Access Journals (Sweden)

    Julianna Bozler

    Full Text Available Immune challenges, such as parasitism, can be so pervasive and deleterious that they constitute an existential threat to a species' survival. In response to these ecological pressures, organisms have developed a wide array of novel behavioral, cellular, and molecular adaptations. Research into these immune defenses in model systems has resulted in a revolutionary understanding of evolution and functional biology. As the field has expanded beyond the limited number of model organisms our appreciation of evolutionary innovation and unique biology has widened as well. With this in mind, we have surveyed the hemolymph of several non-model species of Drosophila. Here we identify and describe a novel hemocyte, type-II nematocytes, found in larval stages of numerous Drosophila species. Examined in detail in Drosophila falleni and Drosophila phalerata, we find that these remarkable cells are distinct from previously described hemocytes due to their anucleate state (lacking a nucleus and unusual morphology. Type-II nematocytes are long, narrow cells with spindle-like projections extending from a cell body with high densities of mitochondria and microtubules, and exhibit the ability to synthesize proteins. These properties are unexpected for enucleated cells, and together with our additional characterization, we demonstrate that these type-II nematocytes represent a biological novelty. Surprisingly, despite the absence of a nucleus, we observe through live cell imaging that these cells remain motile with a highly dynamic cellular shape. Furthermore, these cells demonstrate the ability to form multicellular structures, which we suggest may be a component of the innate immune response to macro-parasites. In addition, live cell imaging points to a large nucleated hemocyte, type-I nematocyte, as the progenitor cell, leading to enucleation through a budding or asymmetrical division process rather than nuclear ejection: This study is the first to report such a

  6. Antigenotoxic effects of Citrus aurentium L. fruit peel oil on mutagenicity of two alkylating agents and two metals in the Drosophila wing spot test.

    Science.gov (United States)

    Demir, Eşref; Kocaoğlu, Serap; Cetin, Huseyin; Kaya, Bülent

    2009-07-01

    Antigenotoxic effects of Citrus aurentium L. (Rutaceae) fruit peel oil (CPO) in combination with mutagenic metals and alkylating agents were studied using the wing spot test of D. melanogaster. The four reference mutagens, potassium dichromate (K2Cr2O7), cobalt chloride (CoCl2), ethylmethanesulfonate (EMS), and N-ethyl-N-nitrosourea (ENU) were clearly genotoxic. CPO alone at doses from 0.1 to 0.5% in Tween 80 was not mutagenic and did not enhance the mutagenic effect of the reference mutagens. However, antigenotoxic effects of CPO were clearly demonstrated in chronic cotreatments with mutagens and oil, by a significant decrease in wing spots induced by all four mutagens. The D. melanogaster wing spot test was found to be a suitable assay for detecting antigenotoxic effects in vivo. Copyright 2009 Wiley-Liss, Inc.

  7. Whole genome phylogenies for multiple Drosophila species

    Directory of Open Access Journals (Sweden)

    Seetharam Arun

    2012-12-01

    Full Text Available Abstract Background Reconstructing the evolutionary history of organisms using traditional phylogenetic methods may suffer from inaccurate sequence alignment. An alternative approach, particularly effective when whole genome sequences are available, is to employ methods that don’t use explicit sequence alignments. We extend a novel phylogenetic method based on Singular Value Decomposition (SVD to reconstruct the phylogeny of 12 sequenced Drosophila species. SVD analysis provides accurate comparisons for a high fraction of sequences within whole genomes without the prior identification of orthologs or homologous sites. With this method all protein sequences are converted to peptide frequency vectors within a matrix that is decomposed to provide simplified vector representations for each protein of the genome in a reduced dimensional space. These vectors are summed together to provide a vector representation for each species, and the angle between these vectors provides distance measures that are used to construct species trees. Results An unfiltered whole genome analysis (193,622 predicted proteins strongly supports the currently accepted phylogeny for 12 Drosophila species at higher dimensions except for the generally accepted but difficult to discern sister relationship between D. erecta and D. yakuba. Also, in accordance with previous studies, many sequences appear to support alternative phylogenies. In this case, we observed grouping of D. erecta with D. sechellia when approximately 55% to 95% of the proteins were removed using a filter based on projection values or by reducing resolution by using fewer dimensions. Similar results were obtained when just the melanogaster subgroup was analyzed. Conclusions These results indicate that using our novel phylogenetic method, it is possible to consult and interpret all predicted protein sequences within multiple whole genomes to produce accurate phylogenetic estimations of relatedness between

  8. The intimate genetics of Drosophila fertilization

    Science.gov (United States)

    Loppin, Benjamin; Dubruille, Raphaëlle; Horard, Béatrice

    2015-01-01

    The union of haploid gametes at fertilization initiates the formation of the diploid zygote in sexually reproducing animals. This founding event of embryogenesis includes several fascinating cellular and nuclear processes, such as sperm–egg cellular interactions, sperm chromatin remodelling, centrosome formation or pronuclear migration. In comparison with other aspects of development, the exploration of animal fertilization at the functional level has remained so far relatively limited, even in classical model organisms. Here, we have reviewed our current knowledge of fertilization in Drosophila melanogaster, with a special emphasis on the genes involved in the complex transformation of the fertilizing sperm nucleus into a replicated set of paternal chromosomes. PMID:26246493

  9. Drosophila melanogaster deoxyribonucleoside kinase activates gemcitabine

    Energy Technology Data Exchange (ETDEWEB)

    Knecht, Wolfgang [BioCentrum-DTU, Technical University of Denmark, DK-2800 Lyngby (Denmark); Mikkelsen, Nils Egil [Department of Molecular Biology, Swedish University of Agricultural Sciences, Biomedical Centre, SE-751 24 Uppsala (Sweden); Clausen, Anders Ranegaard [Cell and Organism Biology, Lund University, Soelvegatan 35, SE-22362 Lund (Sweden); Willer, Mette [ZGene A/S, Agern Alle 7, DK-2970 Horsholm (Denmark); Eklund, Hans [Department of Molecular Biology, Swedish University of Agricultural Sciences, Biomedical Centre, SE-751 24 Uppsala (Sweden); Gojkovic, Zoran [ZGene A/S, Agern Alle 7, DK-2970 Horsholm (Denmark); Piskur, Jure, E-mail: Jure.Piskur@cob.lu.se [BioCentrum-DTU, Technical University of Denmark, DK-2800 Lyngby (Denmark); Cell and Organism Biology, Lund University, Soelvegatan 35, SE-22362 Lund (Sweden)

    2009-05-01

    Drosophila melanogaster multisubstrate deoxyribonucleoside kinase (Dm-dNK) can additionally sensitize human cancer cell lines towards the anti-cancer drug gemcitabine. We show that this property is based on the Dm-dNK ability to efficiently phosphorylate gemcitabine. The 2.2 A resolution structure of Dm-dNK in complex with gemcitabine shows that the residues Tyr70 and Arg105 play a crucial role in the firm positioning of gemcitabine by extra interactions made by the fluoride atoms. This explains why gemcitabine is a good substrate for Dm-dNK.

  10. Crystal structure of enolase from Drosophila melanogaster.

    Science.gov (United States)

    Sun, Congcong; Xu, Baokui; Liu, Xueyan; Zhang, Zhen; Su, Zhongliang

    2017-04-01

    Enolase is an important enzyme in glycolysis and various biological processes. Its dysfunction is closely associated with diseases. Here, the enolase from Drosophila melanogaster (DmENO) was purified and crystallized. A crystal of DmENO diffracted to 2.0 Å resolution and belonged to space group R32. The structure was solved by molecular replacement. Like most enolases, DmENO forms a homodimer with conserved residues in the dimer interface. DmENO possesses an open conformation in this structure and contains conserved elements for catalytic activity. This work provides a structural basis for further functional and evolutionary studies of enolase.

  11. Genome, evolution, Drosophila and beyond: the new dimensions.

    Science.gov (United States)

    Prigent, Stéphane R; Rajpurohit, Subhash

    2007-01-01

    A century ago a little fly with red eyes was first used for genetic studies. That insignificant fly, called at that time Drosophila ampelophila, revolutionized biology while becoming the model we know today under the name of Drosophila melanogaster. Since then its study has never ceased, but the field of interest has somewhat changed during the century. To caricature a little, today we essentially learn from Drosophila meetings that the fly has a brain! It is true that the fly is a tremendous model organism for neurobiology. But this fly is, in fact, an appropriate and recognized model for the whole of biology. Indeed, Drosophila meetings are exceptional opportunities to gather biologists of diverse backgrounds together. There we not only learn about the latest improvements in our field of interest, but surely appreciate learning another bit of biology. From this biological melting pot has emerged a culture very specific to the fly community. Thus besides neurobiology, cell biology and development, a diversity of other research fields exist; they all have their own place in the cultural and historical dimension of the "drosophila" model. Several communications from those diverse research fields were presented at the 8th Japanese Drosophila Research Conference (JDRC8) and are briefly covered here. We believe it more judicious to call the model "drosophila" without a capital initial, as the model has never really been limited to only the Drosophila genus. The vernacular name "drosophila" is currently used to designate any fly of the Drosophilidae family and we believe the term more appropriate than "small fruit fly" or "vinegar fly" to better include the species and ecological diversity of the model.

  12. Chromosomal inversions effect body size and shape in different breeding resources in Drosophila buzzatii.

    Science.gov (United States)

    Fernández Iriarte, P J; Norry, F M; Hasson, E R

    2003-07-01

    The cactophilic Drosophila buzzatii provides an excellent model for the study of reaction norms across discrete environments because it breeds on rotting tissues (rots) of very different cactus species. Here we test the possible effects of second chromosome inversions on body size and shape (wing loading) across suitable natural breeding substrates. Using homokaryotypic stocks derived from several lines homozygous for four naturally occurring chromosomal inversions, we show that arrangements significantly affect size-related traits and wing loading. In addition, karyotypes show differing effects, across natural breeding resources, for wing loading. The 2st and 2jz(3) arrangements decrease and the 2j arrangement increases wing loading. For thorax length and wing loading, karyotypic correlations across host plants are slightly lower in females than in males. These results support the hypothesis that these traits have a genetic basis associated with the inversion polymorphism.

  13. Patterned Anchorage to the Apical Extracellular Matrix Defines Tissue Shape in the Developing Appendages of Drosophila

    Science.gov (United States)

    Ray, Robert P.; Matamoro-Vidal, Alexis; Ribeiro, Paulo S.; Tapon, Nic; Houle, David; Salazar-Ciudad, Isaac; Thompson, Barry J.

    2015-01-01

    Summary How tissues acquire their characteristic shape is a fundamental unresolved question in biology. While genes have been characterized that control local mechanical forces to elongate epithelial tissues, genes controlling global forces in epithelia have yet to be identified. Here, we describe a genetic pathway that shapes appendages in Drosophila by defining the pattern of global tensile forces in the tissue. In the appendages, shape arises from tension generated by cell constriction and localized anchorage of the epithelium to the cuticle via the apical extracellular-matrix protein Dumpy (Dp). Altering Dp expression in the developing wing results in predictable changes in wing shape that can be simulated by a computational model that incorporates only tissue contraction and localized anchorage. Three other wing shape genes, narrow, tapered, and lanceolate, encode components of a pathway that modulates Dp distribution in the wing to refine the global force pattern and thus wing shape. PMID:26190146

  14. Sigma virus and mutation in Drosophila melanogaster

    International Nuclear Information System (INIS)

    Paquin, S.L.A.

    1977-01-01

    - The objectives of these experiments have been (1) to verify and evidence more fully the action of sigma in causing recessive lethal mutation on the X chromosome of Drosophila, both in the male and the female germ line; (2) to extend the study of sigma-induced recessive lethal mutation to the Drosophila autosomes; (3) to explore the possibility that this mutagenesis is site-directed; (4) to study the effects of sigma virus in conjunction with radiation in increasing non-disjunction and dominant lethality. The virus increases the rate of radiation-induced nondisjunction by altering meiotic chromosomal behavior. Percentage of non-disjunction with 500 rads of x-rays in the virus-free flies was 0.176, while in sigma-containing lines it was 0.333. With high doses of either x or neutron radiation, the presence of the virus enhances the frequency of dominant lethality. The difference is especially significant with the fast neutrons. The results indicate that sigma, and presumably other viruses, are indeed environmental mutagens and are, therefore, factors in the rate of background or spontaneous mutation

  15. Modeling Fragile X Syndrome in Drosophila

    Science.gov (United States)

    Drozd, Małgorzata; Bardoni, Barbara; Capovilla, Maria

    2018-01-01

    Intellectual disability (ID) and autism are hallmarks of Fragile X Syndrome (FXS), a hereditary neurodevelopmental disorder. The gene responsible for FXS is Fragile X Mental Retardation gene 1 (FMR1) encoding the Fragile X Mental Retardation Protein (FMRP), an RNA-binding protein involved in RNA metabolism and modulating the expression level of many targets. Most cases of FXS are caused by silencing of FMR1 due to CGG expansions in the 5′-UTR of the gene. Humans also carry the FXR1 and FXR2 paralogs of FMR1 while flies have only one FMR1 gene, here called dFMR1, sharing the same level of sequence homology with all three human genes, but functionally most similar to FMR1. This enables a much easier approach for FMR1 genetic studies. Drosophila has been widely used to investigate FMR1 functions at genetic, cellular, and molecular levels since dFMR1 mutants have many phenotypes in common with the wide spectrum of FMR1 functions that underlay the disease. In this review, we present very recent Drosophila studies investigating FMRP functions at genetic, cellular, molecular, and electrophysiological levels in addition to research on pharmacological treatments in the fly model. These studies have the potential to aid the discovery of pharmacological therapies for FXS.

  16. Imaging fictive locomotor patterns in larval Drosophila

    Science.gov (United States)

    Bayley, Timothy G.; Taylor, Adam L.; Berni, Jimena; Bate, Michael; Hedwig, Berthold

    2015-01-01

    We have established a preparation in larval Drosophila to monitor fictive locomotion simultaneously across abdominal and thoracic segments of the isolated CNS with genetically encoded Ca2+ indicators. The Ca2+ signals closely followed spiking activity measured electrophysiologically in nerve roots. Three motor patterns are analyzed. Two comprise waves of Ca2+ signals that progress along the longitudinal body axis in a posterior-to-anterior or anterior-to-posterior direction. These waves had statistically indistinguishable intersegmental phase delays compared with segmental contractions during forward and backward crawling behavior, despite being ∼10 times slower. During these waves, motor neurons of the dorsal longitudinal and transverse muscles were active in the same order as the muscle groups are recruited during crawling behavior. A third fictive motor pattern exhibits a left-right asymmetry across segments and bears similarities with turning behavior in intact larvae, occurring equally frequently and involving asymmetry in the same segments. Ablation of the segments in which forward and backward waves of Ca2+ signals were normally initiated did not eliminate production of Ca2+ waves. When the brain and subesophageal ganglion (SOG) were removed, the remaining ganglia retained the ability to produce both forward and backward waves of motor activity, although the speed and frequency of waves changed. Bilateral asymmetry of activity was reduced when the brain was removed and abolished when the SOG was removed. This work paves the way to studying the neural and genetic underpinnings of segmentally coordinated motor pattern generation in Drosophila with imaging techniques. PMID:26311188

  17. Structure of PCNA from Drosophila melanogaster

    International Nuclear Information System (INIS)

    Wang, Ke; Shi, Zhubing; Zhang, Min; Cheng, Dianlin

    2013-01-01

    Proliferating cell nuclear antigen (PCNA) plays essential roles in DNA replication, DNA repair, cell-cycle regulation and chromatin metabolism. The PCNA from Drosophila melanogaster (DmPCNA) has been purified and crystallized. Proliferating cell nuclear antigen (PCNA) plays essential roles in DNA replication, DNA repair, cell-cycle regulation and chromatin metabolism. The PCNA from Drosophila melanogaster (DmPCNA) was purified and crystallized. The crystal of DmPCNA diffracted to 2.0 Å resolution and belonged to space group H3, with unit-cell parameters a = b = 151.16, c = 38.28 Å. The structure of DmPCNA was determined by molecular replacement. DmPCNA forms a symmetric homotrimer in a head-to-tail manner. An interdomain connector loop (IDCL) links the N- and C-terminal domains. Additionally, the N-terminal and C-terminal domains contact each other through hydrophobic associations. Compared with human PCNA, the IDCL of DmPCNA has conformational changes, which may explain their difference in function. This work provides a structural basis for further functional and evolutionary studies of PCNA

  18. Adaptive Evolution of Gene Expression in Drosophila.

    Science.gov (United States)

    Nourmohammad, Armita; Rambeau, Joachim; Held, Torsten; Kovacova, Viera; Berg, Johannes; Lässig, Michael

    2017-08-08

    Gene expression levels are important quantitative traits that link genotypes to molecular functions and fitness. In Drosophila, population-genetic studies have revealed substantial adaptive evolution at the genomic level, but the evolutionary modes of gene expression remain controversial. Here, we present evidence that adaptation dominates the evolution of gene expression levels in flies. We show that 64% of the observed expression divergence across seven Drosophila species are adaptive changes driven by directional selection. Our results are derived from time-resolved data of gene expression divergence across a family of related species, using a probabilistic inference method for gene-specific selection. Adaptive gene expression is stronger in specific functional classes, including regulation, sensory perception, sexual behavior, and morphology. Moreover, we identify a large group of genes with sex-specific adaptation of expression, which predominantly occurs in males. Our analysis opens an avenue to map system-wide selection on molecular quantitative traits independently of their genetic basis. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

  19. Quantification of food intake in Drosophila.

    Directory of Open Access Journals (Sweden)

    Richard Wong

    2009-06-01

    Full Text Available Measurement of food intake in the fruit fly Drosophila melanogaster is often necessary for studies of behaviour, nutrition and drug administration. There is no reliable and agreed method for measuring food intake of flies in undisturbed, steady state, and normal culture conditions. We report such a method, based on measurement of feeding frequency by proboscis-extension, validated by short-term measurements of food dye intake. We used the method to demonstrate that (a female flies feed more frequently than males, (b flies feed more often when housed in larger groups and (c fly feeding varies at different times of the day. We also show that alterations in food intake are not induced by dietary restriction or by a null mutation of the fly insulin receptor substrate chico. In contrast, mutation of takeout increases food intake by increasing feeding frequency while mutation of ovo(D increases food intake by increasing the volume of food consumed per proboscis-extension. This approach provides a practical and reliable method for quantification of food intake in Drosophila under normal, undisturbed culture conditions.

  20. The smell of love in Drosophila

    Directory of Open Access Journals (Sweden)

    Anna B. eZiegler

    2013-04-01

    Full Text Available Odors are key sensory signals for social communication and food search in animals including insects. Drosophila melanogaster, is a powerful neurogenetic model commonly used to reveal molecular and cellular mechanisms involved in odorant detection. Males use olfaction together with other sensory modalities to find their mates. Here, we review known olfactory signals, their related olfactory receptors, and the corresponding neuronal architecture impacting courtship. OR67d receptor detects 11-cis-Vaccenyl Acetate (cVA, a male specific pheromone transferred to the female during copulation. Transferred cVA is able to reduce female attractiveness for other males after mating, and is also suspected to decrease male-male courtship. cVA can also serve as an aggregation signal, maybe through another OR. OR47b was shown to be activated by fly odors, and to enhance courtship depending on taste pheromones. IR84a detects phenylacetic acid (PAA and phenylacetaldehyde. These two odors are not pheromones produced by flies, but are present in various fly food sources. PAA enhances male courtship, acting as a food aphrodisiac. Drosophila males have thus developed complementary olfactory strategies to help them to select their mates.

  1. Odd-Paired: The Drosophila Zic Gene.

    Science.gov (United States)

    Hursh, Deborah A; Stultz, Brian G

    2018-01-01

    Zinc finger in the cerebellum (Zic) proteins are a family of transcription factors with multiple roles during development, particularly in neural tissues. The founding member of the Zic family is the Drosophila odd-paired (opa) gene. The Opa protein has a DNA binding domain containing five Cys2His2-type zinc fingers and has been shown to act as a sequence-specific DNA binding protein. Opa has significant homology to mammalian Zic1, Zic2, and Zic3 within the zinc finger domain and in two other conserved regions outside that domain. opa was initially identified as a pair-rule gene, part of the hierarchy of genes that establish the segmental body plan of the early Drosophila embryo. However, its wide expression pattern during embryogenesis indicates it plays additional roles. Embryos deficient in opa die before hatching with aberrant segmentation but also with defects in larval midgut formation. Post-embryonically, opa plays important roles in adult head development and circadian rhythm. Based on extensive neural expression, opa is predicted to be involved in many aspects of neural development and behavior, like other proteins of the Zic family. Consensus DNA binding sites have been identified for Opa and have been shown to activate transcription in vivo. However, there is evidence Opa may serve as a transcriptional regulator in the absence of direct DNA binding, as has been seen for other Zic proteins.

  2. Genetic variation for cardiac dysfunction in Drosophila.

    Directory of Open Access Journals (Sweden)

    Karen A Ocorr

    Full Text Available BACKGROUND: Common diseases may be attributed to combinations of variant alleles, but there are few model systems where the interactions among such variants can be studied in controlled genetic crosses. While association studies are designed to detect common polymorphisms of moderate effect, new approaches are required to characterize the impact on disease of interactions among rare alleles. METHODOLOGY/PRINCIPAL FINDINGS: We show that wild populations of Drosophila melanogaster harbor rare polymorphisms of major effect (RAME that predispose flies to a specific disease phenotype, age-dependent cardiac dysfunction. A screen of fifty inbred wild-type lines revealed a continuous spectrum of pacing-induced heart failure that generally increases in frequency with age. High-speed video analysis of the inbred lines with high rates of inducible heart failure indicates specific defects in cardiac function, including arrhythmias and contractile disorders ('cardiomyopathies'. A combination of bulked segregant analysis and single feature polymorphism (SFP detection localizes one of the cardiac susceptibility loci to the 97C interval on the fly genome. CONCLUSIONS/SIGNIFICANCE: Wild-type Drosophila, like humans, are predisposed to cardiac dysfunction. Identification of factors associated with these naturally occurring cardiac traits promises to provide important insights into the epidemiology of cardiac disease.

  3. Molecular Cloning and Genomic Organization of a Novel Receptor from Drosophila melanogaster Structurally Related to Mammalian Galanin Receptors

    DEFF Research Database (Denmark)

    Lenz, Camilla; Søndergaard, L.; Grimmelikhuijzen, Cornelis J.P.

    2000-01-01

    neurobiologi, molekylærbiologi, zoologi, neurohormonereceptor, allatostatin, galanin, insekt, Drosophila......neurobiologi, molekylærbiologi, zoologi, neurohormonereceptor, allatostatin, galanin, insekt, Drosophila...

  4. Mutagenic/recombinogenic effects of four lipid peroxidation products in Drosophila.

    Science.gov (United States)

    Demir, Eşref; Turna, Fatma; Kaya, Bülent; Creus, Amadeu; Marcos, Ricard

    2013-03-01

    The human diet is an important factor in the development of different diseases. Lipid peroxidation during frying in edible vegetable liquid oils of food components is a mechanism leading to the formation of free radicals. Such radicals induce tissue damage and are implicated in diverse pathological conditions, including aging, atherosclerosis, brain disorders, cancer, lung disorders and various liver disorders. In the present study, we decided to investigate the genotoxic effects of four lipid peroxidation products in the in vivo Drosophila wing somatic mutation and recombination test. In this test, point mutation, chromosome breakage and mitotic recombination produce single spots; while twin spots are produced only by mitotic recombination. Drosophila is a suitable eukaryotic organism for mutagenicity studies and also its metabolism is quite similar to that of mammalians. Since conflicting data exist on the possible risk of several lipid peroxidation products for humans, we have selected four of them, namely acrolein, crotonaldehyde, 4-hydroxy-hexenal (4-HHE) and 4-oxo-2-nonenal (4-ONE). Especially at the highest concentrations tested all exert both mutagenic and recombinogenic effects in the Drosophila SMART assay, showing a direct dose-effect relationship. This is the first study reporting genotoxicity data in Drosophila for these compounds. Copyright © 2012 Elsevier Ltd. All rights reserved.

  5. The Genetic Basis of Pigmentation Differences Within and Between Drosophila Species.

    Science.gov (United States)

    Massey, J H; Wittkopp, P J

    2016-01-01

    In Drosophila, as well as in many other plants and animals, pigmentation is highly variable both within and between species. This variability, combined with powerful genetic and transgenic tools as well as knowledge of how pigment patterns are formed biochemically and developmentally, has made Drosophila pigmentation a premier system for investigating the genetic and molecular mechanisms responsible for phenotypic evolution. In this chapter, we review and synthesize findings from a rapidly growing body of case studies examining the genetic basis of pigmentation differences in the abdomen, thorax, wings, and pupal cases within and between Drosophila species. A core set of genes, including genes required for pigment synthesis (eg, yellow, ebony, tan, Dat) as well as developmental regulators of these genes (eg, bab1, bab2, omb, Dll, and wg), emerge as the primary sources of this variation, with most genes having been shown to contribute to pigmentation differences both within and between species. In cases where specific genetic changes contributing to pigmentation divergence were identified in these genes, the changes were always located in noncoding sequences and affected cis-regulatory activity. We conclude this chapter by discussing these and other lessons learned from evolutionary genetic studies of Drosophila pigmentation and identify topics we think should be the focus of future work with this model system. © 2016 Elsevier Inc. All rights reserved.

  6. Genome-wide comparative analysis of four Indian Drosophila species.

    Science.gov (United States)

    Mohanty, Sujata; Khanna, Radhika

    2017-12-01

    Comparative analysis of multiple genomes of closely or distantly related Drosophila species undoubtedly creates excitement among evolutionary biologists in exploring the genomic changes with an ecology and evolutionary perspective. We present herewith the de novo assembled whole genome sequences of four Drosophila species, D. bipectinata, D. takahashii, D. biarmipes and D. nasuta of Indian origin using Next Generation Sequencing technology on an Illumina platform along with their detailed assembly statistics. The comparative genomics analysis, e.g. gene predictions and annotations, functional and orthogroup analysis of coding sequences and genome wide SNP distribution were performed. The whole genome of Zaprionus indianus of Indian origin published earlier by us and the genome sequences of previously sequenced 12 Drosophila species available in the NCBI database were included in the analysis. The present work is a part of our ongoing genomics project of Indian Drosophila species.

  7. Neurogenetics of female reproductive behaviors in Drosophila melanogaster

    NARCIS (Netherlands)

    Laturney, Meghan; Billeter, Jean-Christophe; Friedmann, T; Dunlap, JC; Goodwin, SF

    2014-01-01

    We follow an adult Drosophila melanogaster female through the major reproductive decisions she makes during her lifetime, including habitat selection, precopulatory mate choice, postcopulatory physiological changes, polyandry, and egg-laying site selection. In the process, we review the molecular

  8. Neuromodulation and Strategic Action Choice in Drosophila Aggression.

    Science.gov (United States)

    Asahina, Kenta

    2017-07-25

    In this review, I discuss current knowledge and outstanding questions on the neuromodulators that influence aggressive behavior of the fruit fly Drosophila melanogaster. I first present evidence that Drosophila exchange information during an agonistic interaction and choose appropriate actions based on this information. I then discuss the influence of several biogenic amines and neuropeptides on aggressive behavior. One striking characteristic of neuromodulation is that it can configure a neural circuit dynamically, enabling one circuit to generate multiple outcomes. I suggest a consensus effect of each neuromodulatory molecule on Drosophila aggression, as well as effects of receptor proteins where relevant data are available. Lastly, I consider neuromodulation in the context of strategic action choices during agonistic interactions. Genetic components of neuromodulatory systems are highly conserved across animals, suggesting that molecular and cellular mechanisms controlling Drosophila aggression can shed light on neural principles governing action choice during social interactions.

  9. NF-1 Dependent Gene Regulation in Drosophila Melanogaster

    National Research Council Canada - National Science Library

    Zhong, Yi

    2004-01-01

    .... We have used an Affymetrix whole genome chip, containing all 13,500 genes of the fruit fly Drosophila, to identify 93 genes with altered expression patterns in flies that have no NF1 protein compared...

  10. Induction of morphological aberrations by enzyme inhibition in Drosophila melanogaster

    NARCIS (Netherlands)

    Bos, M.; Scharloo, W.; Bijlsma, R.; de Boer, I.M.; den Hollander, J.

    1969-01-01

    Zusatz zum Futter vonDrosophila melanogaster von 5-Fluoro-2-deoxyuridin oder Aminopterin induziert überzählige Skutellar- und Dorsozentralborsten sowie gekerbte Flügel. Diese Modifikationen wurden als Konsequenz von Enzymhemmung interpretiert.

  11. Drosophila C Virus Systemic Infection Leads to Intestinal Obstruction

    OpenAIRE

    Chtarbanova, Stanislava; Lamiable, Olivier; Lee, Kwang-Zin; Galiana, Delphine; Troxler, Laurent; Meignin, Carine; Hetru, Charles; Hoffmann, Jules A.; Daeffler, Laurent; Imler, Jean-Luc

    2014-01-01

    Drosophila C virus (DCV) is a positive-sense RNA virus belonging to the Dicistroviridae family. This natural pathogen of the model organism Drosophila melanogaster is commonly used to investigate antiviral host defense in flies, which involves both RNA interference and inducible responses. Although lethality is used routinely as a readout for the efficiency of the antiviral immune response in these studies, virus-induced pathologies in flies still are poorly understood. Here, we characterize ...

  12. The Persistence of Facultative Parthenogenesis in Drosophila albomicans

    OpenAIRE

    Chang, Chia-chen; Ting, Chau-Ti; Chang, Ching-Ho; Fang, Shu; Chang, Hwei-yu

    2014-01-01

    Parthenogenesis has evolved independently in more than 10 Drosophila species. Most cases are tychoparthenogenesis, which is occasional or accidental parthenogenesis in normally bisexual species with a low hatching rate of eggs produced by virgin females; this form is presumed to be an early stage of parthenogenesis. To address how parthenogenesis and sexual reproduction coexist in Drosophila populations, we investigated several reproductive traits, including the fertility, parthenogenetic cap...

  13. Dietary glucose regulates yeast consumption in adult Drosophila males

    OpenAIRE

    Lebreton, S?bastien; Witzgall, Peter; Olsson, Marie; Becher, Paul G.

    2014-01-01

    The adjustment of feeding behavior in response to hunger and satiety contributes to homeostatic regulation in animals. The fruit fly Drosophila melanogaster feeds on yeasts growing on overripe fruit, providing nutrients required for adult survival, reproduction and larval growth. Here, we present data on how the nutritional value of food affects subsequent yeast consumption in Drosophila adult males. After a period of starvation, flies showed intensive yeast consumption. In comparison, flies ...

  14. Molecular characterization of the Drosophila responses towards nematodes

    OpenAIRE

    Arefin, Md. Badrul

    2016-01-01

    A sophisticated evolutionary conserved innate immune system has evolved in insects to fight pathogens and to restrict damage in harmful (danger) situations including cancer. A significant amount of knowledge about different infection models in Drosophila has been generated in past decades, which revealed functional resemblances and implications for vertebrate systems. However, how Drosophila responds towards multicellular parasitic nematodes and in danger situations is still little understood...

  15. Genomic and karyotypic variation in Drosophila parasitoids (Hymenoptera, Cynipoidea, Figitidae

    Directory of Open Access Journals (Sweden)

    Vladimir Gokhman

    2011-08-01

    Full Text Available Drosophila melanogaster Meigen, 1830 has served as a model insect for over a century. Sequencing of the 11 additional Drosophila Fallen, 1823 species marks substantial progress in comparative genomics of this genus. By comparison, practically nothing is known about the genome size or genome sequences of parasitic wasps of Drosophila. Here, we present the first comparative analysis of genome size and karyotype structures of Drosophila parasitoids of the Leptopilina Förster, 1869 and Ganaspis Förster, 1869 species. The gametic genome size of Ganaspis xanthopoda (Ashmead, 1896 is larger than those of the three Leptopilina species studied. The genome sizes of all parasitic wasps studied here are also larger than those known for all Drosophila species. Surprisingly, genome sizes of these Drosophila parasitoids exceed the average value known for all previously studied Hymenoptera. The haploid chromosome number of both Leptopilina heterotoma (Thomson, 1862 and L. victoriae Nordlander, 1980 is ten. A chromosomal fusion appears to have produced a distinct karyotype for L. boulardi (Barbotin, Carton et Keiner-Pillault, 1979 (n = 9, whose genome size is smaller than that of wasps of the L. heterotoma clade. Like L. boulardi, the haploid chromosome number for G. xanthopoda is also nine. Our studies reveal a positive, but non linear, correlation between the genome size and total chromosome length in Drosophila parasitoids. These Drosophila parasitoids differ widely in their host range, and utilize different infection strategies to overcome host defense. Their comparative genomics, in relation to their exceptionally well-characterized hosts, will prove to be valuable for understanding the molecular basis of the host-parasite arms race and how such mechanisms shape the genetic structures of insect communities.

  16. Reassignment of Drosophila willistoni Genome Scaffolds to Chromosome II Arms

    OpenAIRE

    Garcia, Carolina; Delprat, Alejandra; Ruiz, Alfredo; Valente, Vera L. S.

    2015-01-01

    Drosophila willistoni is a geographically widespread Neotropical species. The genome of strain Gd-H4-1 from Guadeloupe Island (Caribbean) was sequenced in 2007 as part of the 12 Drosophila Genomes Project. The assembled scaffolds were joined based on conserved linkage and assigned to polytene chromosomes based on a handful of genetic and physical markers. This paucity of markers was particularly striking in the metacentric chromosome II, comprised two similarly sized arms, IIL and IIR, tradit...

  17. Drosophila molting neurohormone bursicon is a heterodimer and the natural agonist of the orphan receptor DLGR2

    DEFF Research Database (Denmark)

    Mendive, Fernando M; Van Loy, Tom; Claeysen, Sylvie

    2005-01-01

    Bursicon is a neurohumoral agent responsible for tanning and hardening of the cuticle and expansion of the wings during the final phase of insect metamorphosis. Although the hormonal activity was described more than 40 years ago, the molecular nature of bursicon has remained elusive. We identify...... here Drosophila bioactive bursicon as a heterodimer made of two cystine knot polypeptides. This conclusion was reached in part from the unexpected observation that in the genome of the honey bee, the orthologs of the two Drosophila proteins are predicted to be fused in a single open reading frame...

  18. The influence of sterol metabolism upon radiation-induced aneuploidy of Drosophila melanogaster in the yeast-drosophila system

    International Nuclear Information System (INIS)

    Savitsij, V.V.; Luchnikova, E.M.; Inge-Vechtomov, S.I.

    1985-01-01

    The influence of sterol metabolism upon induced Drosophila melanogaster mutagenesis in an ecology-genetic yeast-drosophila system has been studied. The sterol deficit in fly organism has been created for account of using as food substrate for fremales of biomass of saccharomyces cerevisiae living cells of 9-2-PZ12 train with nyssup(r1) locus mutation which blocks the ergosterol synthesis. It has been found that the Drosophila females content on mutant yeast increases the frequency of losses and non discrepancy of X-chromosomes induced by X-radiation (1000 R). Addition into yeast biomass of 0.1 % cholesterol solution in 10 %-ethanol reduces the oocytes resistance to X-radiation up to control level. Possible hormonal and membrane mechanisms of increasing radiation-induced aneuploidy of Drosophila and the role of sterol metabolism in organism resistance to damaging factors are discussed

  19. Dissection of Drosophila Visual Circuits Implicative in Figure Motion

    Science.gov (United States)

    Kelley, Ross G.

    The Drosophila visual system offers a model to study the foundations of how motion signals are computed from raw visual input and transformed into behavioral output. My studies focus on how specific cells in the Drosophila nervous system implement this input-output transformation. The individual cell types are known from classical studies using Golgi impregnations, but the assembly of motion processing circuits and the behavioral outputs remain poorly understood. Using an electronic flight simulator for flies and a white-noise analysis developed by Aptekar et al., I screen specific neurons in the optic lobes for behavioral ramifications. This approach produces wing responses to both the spatial and temporal dynamics of motion signals. The results of these experiments give Spatiotemporal Action Fields (STAFs) across the entire visual panorama. Genetically inactivating a distinct grouping of cells in the third optic ganglion, the Lobula Plate, the Horizontal System (HS) cell group, produced a robust phenotype through STAF analysis. Using the Gal4-UAS transgene expression system, we selectively inactivated the HS cells by expressing in their membrane inward rectifying potassium channels (Kir2.1) to hyperpolarize these cells, preventing their role in synaptic signaling. The results of the experiments show mutants lose steering responses to several distinct categories of figure motion and reduced behavioral responses to figure motion set against a contrasting moving background, highlighting their role in figure tracking behavior. Finally, a synapse inactivating protein, tetanus toxin (TNT), expressed in the HS cell group, produces a different behavioral phenotype than overexpressing inward rectifier. TNT, a bacterial neurotoxin, cleaves SNARE proteins resulting in loss of synaptic output of the cell, but the dendrites are intact and signal normally, preserving dendro-dendritic interactions known to sculpt the visual receptive fields of these cells. The two distinct

  20. Cytoplasmic Streaming in the Drosophila Oocyte.

    Science.gov (United States)

    Quinlan, Margot E

    2016-10-06

    Objects are commonly moved within the cell by either passive diffusion or active directed transport. A third possibility is advection, in which objects within the cytoplasm are moved with the flow of the cytoplasm. Bulk movement of the cytoplasm, or streaming, as required for advection, is more common in large cells than in small cells. For example, streaming is observed in elongated plant cells and the oocytes of several species. In the Drosophila oocyte, two stages of streaming are observed: relatively slow streaming during mid-oogenesis and streaming that is approximately ten times faster during late oogenesis. These flows are implicated in two processes: polarity establishment and mixing. In this review, I discuss the underlying mechanism of streaming, how slow and fast streaming are differentiated, and what we know about the physiological roles of the two types of streaming.

  1. [Ulysses retrotransposon aspartate proteinase (Drosophila virilis)].

    Science.gov (United States)

    Volkov, D A; Savvateeva, L V; Dergousova, N I; Rumsh, L D

    2002-01-01

    Retrotransposones are mobile genetic elements occurring in genomes of bacteria, plants or animals. Retrotransposones were found to contain nucleotide sequences encoding proteins which are homological to retroviral aspartic proteinases. Our research has been focused on Ulysses which is mobile genetic element found in Drosophila virilis. We suggested a primary structure of Ulysses proteinase using comparative analysis of amino acid sequences of retroviral proteinases and proteinases from retrotransposones. The appropriate cDNA fragment has been cloned and expressed in E. coli. The purification of recombinant protein (12 kD) has been carried out by affinity chromatography using pepstatine-agarose. The obtained protein has proteolytic activity at optimum pH 5.5 like the majority of aspartic proteinases.

  2. Organization of the Drosophila larval visual circuit

    Science.gov (United States)

    Gendre, Nanae; Neagu-Maier, G Larisa; Fetter, Richard D; Schneider-Mizell, Casey M; Truman, James W; Zlatic, Marta; Cardona, Albert

    2017-01-01

    Visual systems transduce, process and transmit light-dependent environmental cues. Computation of visual features depends on photoreceptor neuron types (PR) present, organization of the eye and wiring of the underlying neural circuit. Here, we describe the circuit architecture of the visual system of Drosophila larvae by mapping the synaptic wiring diagram and neurotransmitters. By contacting different targets, the two larval PR-subtypes create two converging pathways potentially underlying the computation of ambient light intensity and temporal light changes already within this first visual processing center. Locally processed visual information then signals via dedicated projection interneurons to higher brain areas including the lateral horn and mushroom body. The stratified structure of the larval optic neuropil (LON) suggests common organizational principles with the adult fly and vertebrate visual systems. The complete synaptic wiring diagram of the LON paves the way to understanding how circuits with reduced numerical complexity control wide ranges of behaviors.

  3. Phenotypic plasticity of the Drosophila transcriptome.

    Directory of Open Access Journals (Sweden)

    Shanshan Zhou

    Full Text Available Phenotypic plasticity is the ability of a single genotype to produce different phenotypes in response to changing environments. We assessed variation in genome-wide gene expression and four fitness-related phenotypes of an outbred Drosophila melanogaster population under 20 different physiological, social, nutritional, chemical, and physical environments; and we compared the phenotypically plastic transcripts to genetically variable transcripts in a single environment. The environmentally sensitive transcriptome consists of two transcript categories, which comprise ∼15% of expressed transcripts. Class I transcripts are genetically variable and associated with detoxification, metabolism, proteolysis, heat shock proteins, and transcriptional regulation. Class II transcripts have low genetic variance and show sexually dimorphic expression enriched for reproductive functions. Clustering analysis of Class I transcripts reveals a fragmented modular organization and distinct environmentally responsive transcriptional signatures for the four fitness-related traits. Our analysis suggests that a restricted environmentally responsive segment of the transcriptome preserves the balance between phenotypic plasticity and environmental canalization.

  4. Studying cytokinesis in Drosophila epithelial tissues.

    Science.gov (United States)

    Pinheiro, D; Bellaïche, Y

    2017-01-01

    Epithelial tissue cohesiveness is ensured through cell-cell junctions that maintain both adhesion and mechanical coupling between neighboring cells. During development, epithelial tissues undergo intensive cell proliferation. Cell division, and particularly cytokinesis, is coupled to the formation of new adhesive contacts, thereby preserving tissue integrity and propagating cell polarity. Remarkably, the geometry of the new interfaces is determined by the combined action of the dividing cell and its neighbors. To further understand the interplay between the dividing cell and its neighbors, as well as the role of cell division for tissue morphogenesis, it is important to analyze cytokinesis in vivo. Here we present methods to perform live imaging of cell division in Drosophila epithelial tissues and discuss some aspects of image processing and analysis. Copyright © 2017 Elsevier Inc. All rights reserved.

  5. Longevity and the stress response in Drosophila

    DEFF Research Database (Denmark)

    Vermeulen, Corneel J.; Loeschcke, Volker

    2007-01-01

    to affect lifespan. The progress in modern genetic techniques has allowed researchers to test this idea. The general stress response involves the expression of stress proteins, such as chaperones and antioxidative proteins, downregulation of genes involved in energy metabolism and the release of protective......The concept that lifespan is a function of the capacity to withstand extrinsic stress is very old. In concordance with this, long-lived individuals often have increased resistance against a variety of stresses throughout life. Genes underlying the stress response may therefore have the ability...... briefly review the state of the art of research on ageing and longevity in the model organism Drosophila, with focus on the role of the general stress response. We will conclude by contemplating some of the implications of the findings in this research and will suggest several directions for future...

  6. Taste Preference Assay for Adult Drosophila.

    Science.gov (United States)

    Bantel, Andrew P; Tessier, Charles R

    2016-09-08

    Olfactory and gustatory perception of the environment is vital for animal survival. The most obvious application of these chemosenses is to be able to distinguish good food sources from potentially dangerous food sources. Gustation requires physical contact with a chemical compound which is able to signal through taste receptors that are expressed on the surface of neurons. In insects, these gustatory neurons can be located across the animal's body allowing taste to play an important role in many different behaviors. Insects typically prefer compounds containing sugars, while compounds that are considered bitter tasting are avoided. Given the basic biological importance of taste, there is intense interest in understanding the molecular mechanisms underlying this sensory modality. We describe an adult Drosophila taste assay which reflects the preference of the animals for a given tastant compound. This assay may be applied to animals of any genetic background to examine the taste preference for a desired soluble compound.

  7. MicroRNA function in Drosophila melanogaster.

    Science.gov (United States)

    Carthew, Richard W; Agbu, Pamela; Giri, Ritika

    2017-05-01

    Over the last decade, microRNAs have emerged as critical regulators in the expression and function of animal genomes. This review article discusses the relationship between microRNA-mediated regulation and the biology of the fruit fly Drosophila melanogaster. We focus on the roles that microRNAs play in tissue growth, germ cell development, hormone action, and the development and activity of the central nervous system. We also discuss the ways in which microRNAs affect robustness. Many gene regulatory networks are robust; they are relatively insensitive to the precise values of reaction constants and concentrations of molecules acting within the networks. MicroRNAs involved in robustness appear to be nonessential under uniform conditions used in conventional laboratory experiments. However, the robust functions of microRNAs can be revealed when environmental or genetic variation otherwise has an impact on developmental outcomes. Copyright © 2016 Elsevier Ltd. All rights reserved.

  8. Proteome reference map of Drosophila melanogaster head.

    Science.gov (United States)

    Lee, Tian-Ren; Huang, Shun-Hong; Lee, Chi-Ching; Lee, Hsiao-Yun; Chan, Hsin-Tzu; Lin, Kuo-Sen; Chan, Hong-Lin; Lyu, Ping-Chiang

    2012-06-01

    Drosophila melanogaster has been used as a genetic model organism to understand the fundamental molecular mechanisms in human biology including memory formation that has been reported involving protein synthesis and/or post-translational modification. In this study, we employed a proteomic platform based on fluorescent 2DE and MALDI-TOF MS to build a standard D. melanogaster head proteome map for proteome-proteome comparison. In order to facilitate the comparison, an interactive database has been constructed for systematically integrating and analyzing the proteomes from different conditions and further implicated to study human diseases related to D. melanogaster model. In summary, the fundamental head proteomic database and bioinformatic analysis will be useful for further elucidating the biological mechanisms such as memory formation and neurodegenerative diseases. © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  9. Origin of meiotic nondisjunction in Drosophila females

    International Nuclear Information System (INIS)

    Grell, R.F.

    1978-01-01

    Meiotic nondisjunction can be induced by external agents, such as heat, radiation, and chemicals, and by internal genotypic alterations, namely, point mutations and chromosomal rearrangements. In many cases nondisjunction arises from a reduction or elimination of crossing-over, leading to the production of homologous univalents which fail to co-orient on the metaphase plate and to disjoin properly. In some organisms, e.g., Drosophila and perhaps man, distributive pairing [i.e., a post-exchange, size-dependent pairing] ensures the regular segregation of such homologous univalents. When a nonhomologous univalent is present, which falls within a size range permitting nonhomologous recognition and pairing, distributive nondisjunction of the homologues may follow. Examples of nondisjunction induced by inversion heterozygosity, translocation heterozygosity, chromosome fragments, radiation, heat, and recombination-defective mutants are presented

  10. A microsatellite linkage map of Drosophila mojavensis

    Directory of Open Access Journals (Sweden)

    Schully Sheri

    2004-05-01

    Full Text Available Abstract Background Drosophila mojavensis has been a model system for genetic studies of ecological adaptation and speciation. However, despite its use for over half a century, no linkage map has been produced for this species or its close relatives. Results We have developed and mapped 90 microsatellites in D. mojavensis, and we present a detailed recombinational linkage map of 34 of these microsatellites. A slight excess of repetitive sequence was observed on the X-chromosome relative to the autosomes, and the linkage groups have a greater recombinational length than the homologous D. melanogaster chromosome arms. We also confirmed the conservation of Muller's elements in 23 sequences between D. melanogaster and D. mojavensis. Conclusions The microsatellite primer sequences and localizations are presented here and made available to the public. This map will facilitate future quantitative trait locus mapping studies of phenotypes involved in adaptation or reproductive isolation using this species.

  11. Genetic control of Drosophila nerve cord development

    Science.gov (United States)

    Skeath, James B.; Thor, Stefan

    2003-01-01

    The Drosophila ventral nerve cord has been a central model system for studying the molecular genetic mechanisms that control CNS development. Studies show that the generation of neural diversity is a multistep process initiated by the patterning and segmentation of the neuroectoderm. These events act together with the process of lateral inhibition to generate precursor cells (neuroblasts) with specific identities, distinguished by the expression of unique combinations of regulatory genes. The expression of these genes in a given neuroblast restricts the fate of its progeny, by activating specific combinations of downstream genes. These genes in turn specify the identity of any given postmitotic cell, which is evident by its cellular morphology and choice of neurotransmitter.

  12. A new paramutation-like example at the Delta gene of Drosophila.

    Directory of Open Access Journals (Sweden)

    Maria Capovilla

    Full Text Available The hereditary transmission of a phenotype independent from DNA sequence implies epigenetic effects. Paramutation is a heritable epigenetic phenomenon observed in plants and animals. To investigate paramutation in Drosophila, we used the P{ry+t7.2 = PZ}Dl05151 P-element insertion in the Drosophila melanogaster genome that causes a dominant visible phenotype: the presence of characteristic extra-veins in the fly wings. This extra-vein phenotype presents variable expressivity and incomplete penetrance. The insert is a PZ element located 680 bp upstream from the ATG of the Delta (Dl gene, encoding the Notch ligand involved in wing vein development, and acts as a null allele. In the G2 offspring from a cross between the heterozygous transgenic stock and wild-type flies, we observed the transmission of the extra-vein phenotype to wild-type flies without the transgene, independently of gender and across many generations. This is a "paramutation-like" example in the fly: the heritable transmission of a phenotypic change not linked to a classical genetic mutation. A "paramutagenic" allele in heterozygotes transmits the phenotype of the heterozygotes to the wild-type allele ("paramutant" in a stable manner through generations. Distinct from paramutation events so far described in Drosophila, here we deal with a dominant effect on a single gene involving variable hereditary signals.

  13. Transcription profiling of Drosophila exposed to a levitation magnet for different lengths of time

    Data.gov (United States)

    National Aeronautics and Space Administration — Drosophila samples were exposed to the levitation magnet inside a 25mm diameter tubes with 3 ml of yeast-based Drosophila food in the bottom and a chamber of only 5...

  14. Chloride channels in the plasma membrane of a foetal Drosophila cell line, S2

    DEFF Research Database (Denmark)

    Asmild, Margit; Willumsen, Niels J.

    2000-01-01

    S2 cells, Cl- Channels, Expression system, Drosophila, Inward rectifier, Outward rectifier, Patch clamp......S2 cells, Cl- Channels, Expression system, Drosophila, Inward rectifier, Outward rectifier, Patch clamp...

  15. Structure and Development of Glia in Drosophila

    Science.gov (United States)

    Hartenstein, Volker

    2014-01-01

    Insect glia represents a conspicuous and diverse population of cells and plays a role in controlling neuronal progenitor proliferation, axonal growth, neuronal differentiation and maintenance, and neuronal function. Genetic studies in Drosophila have elucidated many aspects of glial structure, function and development. Just as in vertebrates, it appears as if different classes of glial cells are specialized for different functions. Based on topology and cell shape, glial cells of the central nervous system fall into three classes (Fig. 1A–C): (i) surface glia that extend sheath-like processes to wrap around the entire brain; (ii) cortex glia (also called cell body-associated glia) that encapsulate neuronal somata and neuroblasts which form the outer layer (cortex) of the central nervous system; (iii) neuropile glia that are located at the interface between the cortex and the neuropile, the central domain of the nervous system formed by the highly branched neuronal processes and their synaptic contacts. Surface glia is further subdivided into an outer, perineurial layer, and an inner, subperineurial layer. Likewise, neuropile glia comprises a class of cells that remain at the surface of the neuropile (ensheathing glia), and a second class that forms profuse lamellar processes around nerve fibers within the neuropile (astrocyte-like or reticular glia). Glia also surrounds the peripheral nerves and sensory organs; here, one also recognizes perineurial and subperineurial glia, and a third type called “wrapping glia” that most likely corresponds to the ensheathing glia of the central nervous system. Much more experimental work is needed to determine how fundamental these differences between classes of glial cells are, or how and when during development they are specified. To aid in this work the following review will briefly summarize our knowledge of the classes of glial cells encountered in the Drosophila nervous system, and then survey their development from

  16. Unique properties of Drosophila spermatocyte primary cilia

    Directory of Open Access Journals (Sweden)

    Maria Giovanna Riparbelli

    2013-09-01

    The primary cilium is an essential organelle required for animal development and adult homeostasis that is found on most animal cells. The primary cilium contains a microtubule-based axoneme cytoskeleton that typically grows from the mother centriole in G0/G1 phase of the cell cycle as a membrane-bound compartment that protrudes from the cell surface. A unique system of bidirectional transport, intraflagellar transport (IFT, maintains the structure and function of cilia. While the axoneme is dynamic, growing and shrinking at its tip, at the same time it is very stable to the effects of microtubule-targeting drugs. The primary cilia found on Drosophila spermatocytes diverge from the general rules of primary cilium biology in several respects. Among these unique attributes, spermatocyte cilia assemble from all four centrioles in an IFT-independent manner in G2 phase, and persist continuously through two cell divisions. Here, we show that Drosophila spermatocyte primary cilia are extremely sensitive to microtubule-targeting drugs, unlike their mammalian counterparts. Spermatocyte cilia and their axonemes fail to assemble or be maintained upon nocodazole treatment, while centriole replication appears unperturbed. On the other hand, paclitaxel (Taxol, a microtubule-stabilizing drug, disrupted transition zone assembly and anchoring to the plasma membrane while causing spermatocyte primary cilia to grow extensively long during the assembly/elongation phase, but did not overtly affect the centrioles. However, once assembled to their mature length, spermatocyte cilia appeared unaffected by Taxol. The effects of these drugs on axoneme dynamics further demonstrate that spermatocyte primary cilia are endowed with unique assembly properties.

  17. Maximum likelihood estimation of ancestral codon usage bias parameters in Drosophila

    DEFF Research Database (Denmark)

    Nielsen, Rasmus; Bauer DuMont, Vanessa L; Hubisz, Melissa J

    2007-01-01

    : the selection coefficient for optimal codon usage (S), allowing joint maximum likelihood estimation of S and the dN/dS ratio. We apply the method to previously published data from Drosophila melanogaster, Drosophila simulans, and Drosophila yakuba and show, in accordance with previous results, that the D...

  18. Drosophila-based in vivo assay for the validation of inhibitors of the ...

    Indian Academy of Sciences (India)

    Photoshop 7.0. 3. Results. In order to identify the suitability of the Drosophila model system for screening TKIs, sequence similarity of the. TK domain of EGFR between humans and Drosophila melanogaster was compared. In silico docking results of the. TKIs to the modelled Drosophila TK domain of EGFR were.

  19. Study of radioadaptive response in Drosophila melanogaster at different oogenesis stages

    International Nuclear Information System (INIS)

    Glushkova, I.V.; Aksyutik, T.V.

    2005-01-01

    We study radioadaptive response in the Canton-S strain of Drosophila melanogaster at different oogenesis stages using the test of dominant lethal mutations (DLM). AR was not revealed at the stages of 14-7 and 7--1 oocytes in the studied Drosophila stock. It is likely to be associated with a genetic constitution of the Drosophila strain under study. (authors)

  20. 40 CFR 798.5955 - Heritable translocation test in drosophila melanogaster.

    Science.gov (United States)

    2010-07-01

    ... drosophila melanogaster. 798.5955 Section 798.5955 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY....5955 Heritable translocation test in drosophila melanogaster. (a) Purpose. The heritable translocation test in Drosophila measures the induction of chromosomal translocations in germ cells of insects...

  1. The dopaminergic system in the aging brain of Drosophila

    Directory of Open Access Journals (Sweden)

    Katherine E White

    2010-12-01

    Full Text Available Drosophila models of Parkinson’s disease are characterised by two principal phenotypes: the specific loss of dopaminergic neurons in the aging brain and defects in motor behavior. However, an age-related analysis of these baseline parameters in wildtype Drosophila is lacking. Here we analysed the dopaminergic system and motor behavior in aging Drosophila. Dopaminergic neurons in the adult brain can be grouped into bilateral symmetric clusters, each comprising a stereotypical number of cells. Analysis of TH>mCD8::GFP and cell type-specific MARCM clones revealed that dopaminergic neurons show cluster-specific, stereotypical projection patterns with terminal arborization in target regions that represent distinct functional areas of the adult brain. Target areas include the mushroom bodies, involved in memory formation and motivation, and the central complex, involved in the control of motor behavior, indicating that similar to the mammalian brain, dopaminergic neurons in the fly brain are involved in the regulation of specific behaviors. Behavioral analysis revealed that Drosophila show an age-related decline in startle-induced locomotion and negative geotaxis. Motion tracking however, revealed that walking activity and exploration behavior, but not centrophobism increase at late stages of life. Analysis of TH>Dcr2, mCD8::GFP revealed a specific effect of Dcr2 expression on walking activity but not on exploratory or centrophobic behavior, indicating that the siRNA pathway may modulate distinct dopaminergic behaviors in Drosophila. Moreover, dopaminergic neurons were maintained between early- and late life, as quantified by TH>mCD8::GFP and anti-TH labelling, indicating that adult onset, age-related degeneration of dopaminergic neurons does not occur in the aging brain of Drosophila. Taken together, our data establish baseline parameters in Drosophila for the study of Parkinson’s disease as well as other disorders affecting dopaminergic neurons

  2. The dopaminergic system in the aging brain of Drosophila.

    Science.gov (United States)

    White, Katherine E; Humphrey, Dickon M; Hirth, Frank

    2010-01-01

    Drosophila models of Parkinson's disease are characterized by two principal phenotypes: the specific loss of dopaminergic (DA) neurons in the aging brain and defects in motor behavior. However, an age-related analysis of these baseline parameters in wildtype Drosophila is lacking. Here we analyzed the DA system and motor behavior in aging Drosophila. DA neurons in the adult brain can be grouped into bilateral symmetric clusters, each comprising a stereotypical number of cells. Analysis of TH > mCD8::GFP and cell type-specific MARCM clones revealed that DA neurons show cluster-specific, stereotypical projection patterns with terminal arborization in target regions that represent distinct functional areas of the adult brain. Target areas include the mushroom bodies, involved in memory formation and motivation, and the central complex, involved in the control of motor behavior, indicating that similar to the mammalian brain, DA neurons in the fly brain are involved in the regulation of specific behaviors. Behavioral analysis revealed that Drosophila show an age-related decline in startle-induced locomotion and negative geotaxis. Motion tracking however, revealed that walking activity, and exploration behavior, but not centrophobism increase at late stages of life. Analysis of TH > Dcr2, mCD8::GFP revealed a specific effect of Dcr2 expression on walking activity but not on exploratory or centrophobic behavior, indicating that the siRNA pathway may modulate distinct DA behaviors in Drosophila. Moreover, DA neurons were maintained between early- and late life, as quantified by TH > mCD8::GFP and anti-TH labeling, indicating that adult onset, age-related degeneration of DA neurons does not occur in the aging brain of Drosophila. Taken together, our data establish baseline parameters in Drosophila for the study of Parkinson's disease as well as other disorders affecting DA neurons and movement control.

  3. Bioimage Informatics in the context of Drosophila research.

    Science.gov (United States)

    Jug, Florian; Pietzsch, Tobias; Preibisch, Stephan; Tomancak, Pavel

    2014-06-15

    Modern biological research relies heavily on microscopic imaging. The advanced genetic toolkit of Drosophila makes it possible to label molecular and cellular components with unprecedented level of specificity necessitating the application of the most sophisticated imaging technologies. Imaging in Drosophila spans all scales from single molecules to the entire populations of adult organisms, from electron microscopy to live imaging of developmental processes. As the imaging approaches become more complex and ambitious, there is an increasing need for quantitative, computer-mediated image processing and analysis to make sense of the imagery. Bioimage Informatics is an emerging research field that covers all aspects of biological image analysis from data handling, through processing, to quantitative measurements, analysis and data presentation. Some of the most advanced, large scale projects, combining cutting edge imaging with complex bioimage informatics pipelines, are realized in the Drosophila research community. In this review, we discuss the current research in biological image analysis specifically relevant to the type of systems level image datasets that are uniquely available for the Drosophila model system. We focus on how state-of-the-art computer vision algorithms are impacting the ability of Drosophila researchers to analyze biological systems in space and time. We pay particular attention to how these algorithmic advances from computer science are made usable to practicing biologists through open source platforms and how biologists can themselves participate in their further development. Copyright © 2014 The Authors. Published by Elsevier Inc. All rights reserved.

  4. big bang gene modulates gut immune tolerance in Drosophila.

    Science.gov (United States)

    Bonnay, François; Cohen-Berros, Eva; Hoffmann, Martine; Kim, Sabrina Y; Boulianne, Gabrielle L; Hoffmann, Jules A; Matt, Nicolas; Reichhart, Jean-Marc

    2013-02-19

    Chronic inflammation of the intestine is detrimental to mammals. Similarly, constant activation of the immune response in the gut by the endogenous flora is suspected to be harmful to Drosophila. Therefore, the innate immune response in the gut of Drosophila melanogaster is tightly balanced to simultaneously prevent infections by pathogenic microorganisms and tolerate the endogenous flora. Here we describe the role of the big bang (bbg) gene, encoding multiple membrane-associated PDZ (PSD-95, Discs-large, ZO-1) domain-containing protein isoforms, in the modulation of the gut immune response. We show that in the adult Drosophila midgut, BBG is present at the level of the septate junctions, on the apical side of the enterocytes. In the absence of BBG, these junctions become loose, enabling the intestinal flora to trigger a constitutive activation of the anterior midgut immune response. This chronic epithelial inflammation leads to a reduced lifespan of bbg mutant flies. Clearing the commensal flora by antibiotics prevents the abnormal activation of the gut immune response and restores a normal lifespan. We now provide genetic evidence that Drosophila septate junctions are part of the gut immune barrier, a function that is evolutionarily conserved in mammals. Collectively, our data suggest that septate junctions are required to maintain the subtle balance between immune tolerance and immune response in the Drosophila gut, which represents a powerful model to study inflammatory bowel diseases.

  5. Transmembrane channel-like (tmc) gene regulates Drosophila larval locomotion.

    Science.gov (United States)

    Guo, Yanmeng; Wang, Yuping; Zhang, Wei; Meltzer, Shan; Zanini, Damiano; Yu, Yue; Li, Jiefu; Cheng, Tong; Guo, Zhenhao; Wang, Qingxiu; Jacobs, Julie S; Sharma, Yashoda; Eberl, Daniel F; Göpfert, Martin C; Jan, Lily Yeh; Jan, Yuh Nung; Wang, Zuoren

    2016-06-28

    Drosophila larval locomotion, which entails rhythmic body contractions, is controlled by sensory feedback from proprioceptors. The molecular mechanisms mediating this feedback are little understood. By using genetic knock-in and immunostaining, we found that the Drosophila melanogaster transmembrane channel-like (tmc) gene is expressed in the larval class I and class II dendritic arborization (da) neurons and bipolar dendrite (bd) neurons, both of which are known to provide sensory feedback for larval locomotion. Larvae with knockdown or loss of tmc function displayed reduced crawling speeds, increased head cast frequencies, and enhanced backward locomotion. Expressing Drosophila TMC or mammalian TMC1 and/or TMC2 in the tmc-positive neurons rescued these mutant phenotypes. Bending of the larval body activated the tmc-positive neurons, and in tmc mutants this bending response was impaired. This implicates TMC's roles in Drosophila proprioception and the sensory control of larval locomotion. It also provides evidence for a functional conservation between Drosophila and mammalian TMCs.

  6. Molecular cloning and genomic organization of a second probable allatostatin receptor from Drosophila melanogaster

    DEFF Research Database (Denmark)

    Lenz, C; Williamson, M; Grimmelikhuijzen, C J

    2000-01-01

    We (C. Lenz et al. (2000) Biochem. Biophys. Res. Commun. 269, 91-96) and others (N. Birgül et al. (1999) EMBO J. 18, 5892-5900) have recently cloned a Drosophila receptor that was structurally related to the mammalian galanin receptors, but turned out to be a receptor for a Drosophila peptide...... with a Drosophila genomic database clone that contained a DNA sequence coding for a protein having, again, structural similarities with the rat galanin receptors. Using PCR with primers coding for the presumed exons of this second Drosophila receptor gene, 5'- and 3'-RACE, and Drosophila cDNA as template, we...

  7. Biological radiation effects of Radon in Drosophila

    International Nuclear Information System (INIS)

    Pimentel P, A.E.

    1995-01-01

    In order to contribute to the knowledge on the effects of radon and its decay products, the aim of this investigation is to study the biological effects of radon using Drosophila melanogaster throught the somatic mutation and recombination test (SMART) and the analysis of some adaptative factors exposing larvaes to controlled radon atmosphers, considering that this insect could be used as biological monitor. Using the somatic mutation test a mutagenic effect was observed proportional to radon concentration, into an interval of 1 ± 0.3 to 111 ± 7.4 KBq/m 3 equivalent to doses under 0.0106 Gy. The correlation analysis gives a linear (r=0.80) relationship with a positive slope of 0.2217. The same happens when gamma rays are used in the interval of 1 to 20 Gy, given a linear dose-dependent effect (r=0.878) is obtained; nevetheless the slop is smaller (m=0.003) than for radon. Analysing the results of adaptative factors of the nine exposed generations, it was found that probably radon exposition induced dominant lethals during gametogenesis or/and a selection of the more component gamets of the treated individuals in larval state. It was reflected in the significant decrease on fecundity of the generation exposed. Nevertheless the laying eggs had an increase in egg-to-adult viability and the develop velocity was higher than in control for 3 KBq/m 3 , this suggest that radon concentrations used were able to induce repair mechanisms. These data agree with the Hormesis hypothesis that says: low doses have positive effects on health. It was not possible to obtain a dose-effect relationship except with the develop velocity where it was found a dose-effect inverse proportion. In conclusion, Drosophila melanogaster could be a good system to obtain in vivo damaged induction concentration dependent of radon and its decay products, as well as to study the effects in an exposed population by the analysis of adaptative factors. (Author)

  8. Identification and characterization of novel natural pathogen of Drosophila melanogaster isolated from wild captured Drosophila spp.

    Science.gov (United States)

    Singh, Karan; Zulkifli, Mohammad; Prasad, N G

    2016-12-01

    Drosophila melanogaster is an emerging model system for the study of evolutionary ecology of immunity. However, a large number of studies have used non natural pathogens as very few natural pathogens have been isolated and identified. Our aim was to isolate and characterize natural pathogen/s of D. melanogaster. A bacterial pathogen was isolated from wild caught Drosophila spp., identified as a new strain of Staphylococcus succinus subsp. succinus and named PK-1. This strain induced substantial mortality (36-62%) in adults of several laboratory populations of D. melanogaster. PK-1 grew rapidly within the body of the flies post infection and both males and females had roughly same number of colony forming units. Mortality was affected by mode of infection and dosage of the pathogen. However mating status of the host had no effect on mortality post infection. Given that there are very few known natural bacterial pathogens of D. melanogaster and that PK-1 can establish a sustained infection across various outbred and inbred populations of D. melanogaster this new isolate is a potential resource for future studies on immunity. Copyright © 2016 Institut Pasteur. Published by Elsevier Masson SAS. All rights reserved.

  9. Comparative population genomics of latitudinal variation in Drosophila simulans and Drosophila melanogaster.

    Science.gov (United States)

    Machado, Heather E; Bergland, Alan O; O'Brien, Katherine R; Behrman, Emily L; Schmidt, Paul S; Petrov, Dmitri A

    2016-02-01

    Examples of clinal variation in phenotypes and genotypes across latitudinal transects have served as important models for understanding how spatially varying selection and demographic forces shape variation within species. Here, we examine the selective and demographic contributions to latitudinal variation through the largest comparative genomic study to date of Drosophila simulans and Drosophila melanogaster, with genomic sequence data from 382 individual fruit flies, collected across a spatial transect of 19 degrees latitude and at multiple time points over 2 years. Consistent with phenotypic studies, we find less clinal variation in D. simulans than D. melanogaster, particularly for the autosomes. Moreover, we find that clinally varying loci in D. simulans are less stable over multiple years than comparable clines in D. melanogaster. D. simulans shows a significantly weaker pattern of isolation by distance than D. melanogaster and we find evidence for a stronger contribution of migration to D. simulans population genetic structure. While population bottlenecks and migration can plausibly explain the differences in stability of clinal variation between the two species, we also observe a significant enrichment of shared clinal genes, suggesting that the selective forces associated with climate are acting on the same genes and phenotypes in D. simulans and D. melanogaster. © 2015 John Wiley & Sons Ltd.

  10. Autophagy in Drosophila: From Historical Studies to Current Knowledge

    Science.gov (United States)

    Mulakkal, Nitha C.; Nagy, Peter; Takats, Szabolcs; Tusco, Radu; Juhász, Gábor; Nezis, Ioannis P.

    2014-01-01

    The discovery of evolutionarily conserved Atg genes required for autophagy in yeast truly revolutionized this research field and made it possible to carry out functional studies on model organisms. Insects including Drosophila are classical and still popular models to study autophagy, starting from the 1960s. This review aims to summarize past achievements and our current knowledge about the role and regulation of autophagy in Drosophila, with an outlook to yeast and mammals. The basic mechanisms of autophagy in fruit fly cells appear to be quite similar to other eukaryotes, and the role that this lysosomal self-degradation process plays in Drosophila models of various diseases already made it possible to recognize certain aspects of human pathologies. Future studies in this complete animal hold great promise for the better understanding of such processes and may also help finding new research avenues for the treatment of disorders with misregulated autophagy. PMID:24949430

  11. Localized expression pattern of miR-184 in Drosophila.

    Science.gov (United States)

    Li, Ping; Peng, Jianjian; Hu, Jiangbo; Xu, Zhongxin; Xie, Wei; Yuan, Liudi

    2011-01-01

    MicroRNAs (miRNAs) are a kind of endogenous non-coding small RNAs whose specific functions in animals are generally important. Although functions of some miRNAs have been identified, the role of miR-184 remains unknown. Here, we determined the temporal and spatial expression pattern of miR-184 during the different development stages and tissues in Drosophila. Strikingly, miR-184 is expressed ubiquitously in Drosophila embryos, larvae and adults, its expression pattern shows a dynamic changes during the development of embryo, especially in the central nervous system. This expression profile suggests that miR-184 may act important function in Drosophila development.

  12. Analysis of Cell Cycle Switches in Drosophila Oogenesis.

    Science.gov (United States)

    Jia, Dongyu; Huang, Yi-Chun; Deng, Wu-Min

    2015-01-01

    The study of Drosophila oogenesis provides invaluable information about signaling pathway regulation and cell cycle programming. During Drosophila oogenesis, a string of egg chambers in each ovariole progressively develops toward maturity. Egg chamber development consists of 14 stages. From stage 1 to stage 6 (mitotic cycle), main-body follicle cells undergo mitotic divisions. From stage 7 to stage 10a (endocycle), follicle cells cease mitosis but continue three rounds of endoreduplication. From stage 10b to stage 13 (gene amplification), instead of whole genome duplication, follicle cells selectively amplify specific genomic regions, mostly for chorion production. So far, Drosophila oogenesis is one of the most well studied model systems used to understand cell cycle switches, which furthers our knowledge about cell cycle control machinery and sheds new light on potential cancer treatments. Here, we give a brief summary of cell cycle switches, the associated signaling pathways and factors, and the detailed experimental procedures used to study the cell cycle switches.

  13. Evolution of genes and genomes on the Drosophila phylogeny.

    Science.gov (United States)

    Clark, Andrew G; Eisen, Michael B; Smith, Douglas R; Bergman, Casey M; Oliver, Brian; Markow, Therese A; Kaufman, Thomas C; Kellis, Manolis; Gelbart, William; Iyer, Venky N; Pollard, Daniel A; Sackton, Timothy B; Larracuente, Amanda M; Singh, Nadia D; Abad, Jose P; Abt, Dawn N; Adryan, Boris; Aguade, Montserrat; Akashi, Hiroshi; Anderson, Wyatt W; Aquadro, Charles F; Ardell, David H; Arguello, Roman; Artieri, Carlo G; Barbash, Daniel A; Barker, Daniel; Barsanti, Paolo; Batterham, Phil; Batzoglou, Serafim; Begun, Dave; Bhutkar, Arjun; Blanco, Enrico; Bosak, Stephanie A; Bradley, Robert K; Brand, Adrianne D; Brent, Michael R; Brooks, Angela N; Brown, Randall H; Butlin, Roger K; Caggese, Corrado; Calvi, Brian R; Bernardo de Carvalho, A; Caspi, Anat; Castrezana, Sergio; Celniker, Susan E; Chang, Jean L; Chapple, Charles; Chatterji, Sourav; Chinwalla, Asif; Civetta, Alberto; Clifton, Sandra W; Comeron, Josep M; Costello, James C; Coyne, Jerry A; Daub, Jennifer; David, Robert G; Delcher, Arthur L; Delehaunty, Kim; Do, Chuong B; Ebling, Heather; Edwards, Kevin; Eickbush, Thomas; Evans, Jay D; Filipski, Alan; Findeiss, Sven; Freyhult, Eva; Fulton, Lucinda; Fulton, Robert; Garcia, Ana C L; Gardiner, Anastasia; Garfield, David A; Garvin, Barry E; Gibson, Greg; Gilbert, Don; Gnerre, Sante; Godfrey, Jennifer; Good, Robert; Gotea, Valer; Gravely, Brenton; Greenberg, Anthony J; Griffiths-Jones, Sam; Gross, Samuel; Guigo, Roderic; Gustafson, Erik A; Haerty, Wilfried; Hahn, Matthew W; Halligan, Daniel L; Halpern, Aaron L; Halter, Gillian M; Han, Mira V; Heger, Andreas; Hillier, LaDeana; Hinrichs, Angie S; Holmes, Ian; Hoskins, Roger A; Hubisz, Melissa J; Hultmark, Dan; Huntley, Melanie A; Jaffe, David B; Jagadeeshan, Santosh; Jeck, William R; Johnson, Justin; Jones, Corbin D; Jordan, William C; Karpen, Gary H; Kataoka, Eiko; Keightley, Peter D; Kheradpour, Pouya; Kirkness, Ewen F; Koerich, Leonardo B; Kristiansen, Karsten; Kudrna, Dave; Kulathinal, Rob J; Kumar, Sudhir; Kwok, Roberta; Lander, Eric; Langley, Charles H; Lapoint, Richard; Lazzaro, Brian P; Lee, So-Jeong; Levesque, Lisa; Li, Ruiqiang; Lin, Chiao-Feng; Lin, Michael F; Lindblad-Toh, Kerstin; Llopart, Ana; Long, Manyuan; Low, Lloyd; Lozovsky, Elena; Lu, Jian; Luo, Meizhong; Machado, Carlos A; Makalowski, Wojciech; Marzo, Mar; Matsuda, Muneo; Matzkin, Luciano; McAllister, Bryant; McBride, Carolyn S; McKernan, Brendan; McKernan, Kevin; Mendez-Lago, Maria; Minx, Patrick; Mollenhauer, Michael U; Montooth, Kristi; Mount, Stephen M; Mu, Xu; Myers, Eugene; Negre, Barbara; Newfeld, Stuart; Nielsen, Rasmus; Noor, Mohamed A F; O'Grady, Patrick; Pachter, Lior; Papaceit, Montserrat; Parisi, Matthew J; Parisi, Michael; Parts, Leopold; Pedersen, Jakob S; Pesole, Graziano; Phillippy, Adam M; Ponting, Chris P; Pop, Mihai; Porcelli, Damiano; Powell, Jeffrey R; Prohaska, Sonja; Pruitt, Kim; Puig, Marta; Quesneville, Hadi; Ram, Kristipati Ravi; Rand, David; Rasmussen, Matthew D; Reed, Laura K; Reenan, Robert; Reily, Amy; Remington, Karin A; Rieger, Tania T; Ritchie, Michael G; Robin, Charles; Rogers, Yu-Hui; Rohde, Claudia; Rozas, Julio; Rubenfield, Marc J; Ruiz, Alfredo; Russo, Susan; Salzberg, Steven L; Sanchez-Gracia, Alejandro; Saranga, David J; Sato, Hajime; Schaeffer, Stephen W; Schatz, Michael C; Schlenke, Todd; Schwartz, Russell; Segarra, Carmen; Singh, Rama S; Sirot, Laura; Sirota, Marina; Sisneros, Nicholas B; Smith, Chris D; Smith, Temple F; Spieth, John; Stage, Deborah E; Stark, Alexander; Stephan, Wolfgang; Strausberg, Robert L; Strempel, Sebastian; Sturgill, David; Sutton, Granger; Sutton, Granger G; Tao, Wei; Teichmann, Sarah; Tobari, Yoshiko N; Tomimura, Yoshihiko; Tsolas, Jason M; Valente, Vera L S; Venter, Eli; Venter, J Craig; Vicario, Saverio; Vieira, Filipe G; Vilella, Albert J; Villasante, Alfredo; Walenz, Brian; Wang, Jun; Wasserman, Marvin; Watts, Thomas; Wilson, Derek; Wilson, Richard K; Wing, Rod A; Wolfner, Mariana F; Wong, Alex; Wong, Gane Ka-Shu; Wu, Chung-I; Wu, Gabriel; Yamamoto, Daisuke; Yang, Hsiao-Pei; Yang, Shiaw-Pyng; Yorke, James A; Yoshida, Kiyohito; Zdobnov, Evgeny; Zhang, Peili; Zhang, Yu; Zimin, Aleksey V; Baldwin, Jennifer; Abdouelleil, Amr; Abdulkadir, Jamal; Abebe, Adal; Abera, Brikti; Abreu, Justin; Acer, St Christophe; Aftuck, Lynne; Alexander, Allen; An, Peter; Anderson, Erica; Anderson, Scott; Arachi, Harindra; Azer, Marc; Bachantsang, Pasang; Barry, Andrew; Bayul, Tashi; Berlin, Aaron; Bessette, Daniel; Bloom, Toby; Blye, Jason; Boguslavskiy, Leonid; Bonnet, Claude; Boukhgalter, Boris; Bourzgui, Imane; Brown, Adam; Cahill, Patrick; Channer, Sheridon; Cheshatsang, Yama; Chuda, Lisa; Citroen, Mieke; Collymore, Alville; Cooke, Patrick; Costello, Maura; D'Aco, Katie; Daza, Riza; De Haan, Georgius; DeGray, Stuart; DeMaso, Christina; Dhargay, Norbu; Dooley, Kimberly; Dooley, Erin; Doricent, Missole; Dorje, Passang; Dorjee, Kunsang; Dupes, Alan; Elong, Richard; Falk, Jill; Farina, Abderrahim; Faro, Susan; Ferguson, Diallo; Fisher, Sheila; Foley, Chelsea D; Franke, Alicia; Friedrich, Dennis; Gadbois, Loryn; Gearin, Gary; Gearin, Christina R; Giannoukos, Georgia; Goode, Tina; Graham, Joseph; Grandbois, Edward; Grewal, Sharleen; Gyaltsen, Kunsang; Hafez, Nabil; Hagos, Birhane; Hall, Jennifer; Henson, Charlotte; Hollinger, Andrew; Honan, Tracey; Huard, Monika D; Hughes, Leanne; Hurhula, Brian; Husby, M Erii; Kamat, Asha; Kanga, Ben; Kashin, Seva; Khazanovich, Dmitry; Kisner, Peter; Lance, Krista; Lara, Marcia; Lee, William; Lennon, Niall; Letendre, Frances; LeVine, Rosie; Lipovsky, Alex; Liu, Xiaohong; Liu, Jinlei; Liu, Shangtao; Lokyitsang, Tashi; Lokyitsang, Yeshi; Lubonja, Rakela; Lui, Annie; MacDonald, Pen; Magnisalis, Vasilia; Maru, Kebede; Matthews, Charles; McCusker, William; McDonough, Susan; Mehta, Teena; Meldrim, James; Meneus, Louis; Mihai, Oana; Mihalev, Atanas; Mihova, Tanya; Mittelman, Rachel; Mlenga, Valentine; Montmayeur, Anna; Mulrain, Leonidas; Navidi, Adam; Naylor, Jerome; Negash, Tamrat; Nguyen, Thu; Nguyen, Nga; Nicol, Robert; Norbu, Choe; Norbu, Nyima; Novod, Nathaniel; O'Neill, Barry; Osman, Sahal; Markiewicz, Eva; Oyono, Otero L; Patti, Christopher; Phunkhang, Pema; Pierre, Fritz; Priest, Margaret; Raghuraman, Sujaa; Rege, Filip; Reyes, Rebecca; Rise, Cecil; Rogov, Peter; Ross, Keenan; Ryan, Elizabeth; Settipalli, Sampath; Shea, Terry; Sherpa, Ngawang; Shi, Lu; Shih, Diana; Sparrow, Todd; Spaulding, Jessica; Stalker, John; Stange-Thomann, Nicole; Stavropoulos, Sharon; Stone, Catherine; Strader, Christopher; Tesfaye, Senait; Thomson, Talene; Thoulutsang, Yama; Thoulutsang, Dawa; Topham, Kerri; Topping, Ira; Tsamla, Tsamla; Vassiliev, Helen; Vo, Andy; Wangchuk, Tsering; Wangdi, Tsering; Weiand, Michael; Wilkinson, Jane; Wilson, Adam; Yadav, Shailendra; Young, Geneva; Yu, Qing; Zembek, Lisa; Zhong, Danni; Zimmer, Andrew; Zwirko, Zac; Jaffe, David B; Alvarez, Pablo; Brockman, Will; Butler, Jonathan; Chin, CheeWhye; Gnerre, Sante; Grabherr, Manfred; Kleber, Michael; Mauceli, Evan; MacCallum, Iain

    2007-11-08

    Comparative analysis of multiple genomes in a phylogenetic framework dramatically improves the precision and sensitivity of evolutionary inference, producing more robust results than single-genome analyses can provide. The genomes of 12 Drosophila species, ten of which are presented here for the first time (sechellia, simulans, yakuba, erecta, ananassae, persimilis, willistoni, mojavensis, virilis and grimshawi), illustrate how rates and patterns of sequence divergence across taxa can illuminate evolutionary processes on a genomic scale. These genome sequences augment the formidable genetic tools that have made Drosophila melanogaster a pre-eminent model for animal genetics, and will further catalyse fundamental research on mechanisms of development, cell biology, genetics, disease, neurobiology, behaviour, physiology and evolution. Despite remarkable similarities among these Drosophila species, we identified many putatively non-neutral changes in protein-coding genes, non-coding RNA genes, and cis-regulatory regions. These may prove to underlie differences in the ecology and behaviour of these diverse species.

  14. Evolution of Drosophila ribosomal protein gene core promoters.

    Science.gov (United States)

    Ma, Xiaotu; Zhang, Kangyu; Li, Xiaoman

    2009-03-01

    The coordinated expression of ribosomal protein genes (RPGs) has been well documented in many species. Previous analyses of RPG promoters focus only on Fungi and mammals. Recognizing this gap and using a comparative genomics approach, we utilize a motif-finding algorithm that incorporates cross-species conservation to identify several significant motifs in Drosophila RPG promoters. As a result, significant differences of the enriched motifs in RPG promoter are found among Drosophila, Fungi, and mammals, demonstrating the evolutionary dynamics of the ribosomal gene regulatory network. We also report a motif present in similar numbers of RPGs among Drosophila species which does not appear to be conserved at the individual RPG gene level. A module-wise stabilizing selection theory is proposed to explain this observation. Overall, our results provide significant insight into the fast-evolving nature of transcriptional regulation in the RPG module.

  15. Drosophila as a genetic model for studying pathogenic human viruses.

    Science.gov (United States)

    Hughes, Tamara T; Allen, Amanda L; Bardin, Joseph E; Christian, Megan N; Daimon, Kansei; Dozier, Kelsey D; Hansen, Caom L; Holcomb, Lisa M; Ahlander, Joseph

    2012-02-05

    Viruses are infectious particles whose viability is dependent on the cells of living organisms, such as bacteria, plants, and animals. It is of great interest to discover how viruses function inside host cells in order to develop therapies to treat virally infected organisms. The fruit fly Drosophila melanogaster is an excellent model system for studying the molecular mechanisms of replication, amplification, and cellular consequences of human viruses. In this review, we describe the advantages of using Drosophila as a model system to study human viruses, and highlight how Drosophila has been used to provide unique insight into the gene function of several pathogenic viruses. We also propose possible directions for future research in this area. Copyright © 2011 Elsevier Inc. All rights reserved.

  16. Patterns of mutation and selection at synonymous sites in Drosophila

    DEFF Research Database (Denmark)

    Singh, Nadia D; Bauer DuMont, Vanessa L; Hubisz, Melissa J

    2007-01-01

    That natural selection affects molecular evolution at synonymous sites in protein-coding sequences is well established and is thought to predominantly reflect selection for translational efficiency/accuracy mediated through codon bias. However, a recently developed maximum likelihood framework......, when applied to 18 coding sequences in 3 species of Drosophila, confirmed an earlier report that the Notch gene in Drosophila melanogaster was evolving under selection in favor of those codons defined as unpreferred in this species. This finding opened the possibility that synonymous sites may...... be subject to a variety of selective pressures beyond weak selection for increased frequencies of the codons currently defined as "preferred" in D. melanogaster. To further explore patterns of synonymous site evolution in Drosophila in a lineage-specific manner, we expanded the application of the maximum...

  17. RNA editing in Drosophila melanogaster: new targets and functionalconsequences

    Energy Technology Data Exchange (ETDEWEB)

    Stapleton, Mark; Carlson, Joseph W.; Celniker, Susan E.

    2006-09-05

    Adenosine deaminases that act on RNA (ADARs) catalyze the site-specific conversion of adenosine to inosine in primary mRNA transcripts. These re-coding events affect coding potential, splice-sites, and stability of mature mRNAs. ADAR is an essential gene and studies in mouse, C. elegans, and Drosophila suggest its primary function is to modify adult behavior by altering signaling components in the nervous system. By comparing the sequence of isogenic cDNAs to genomic DNA, we have identified and experimentally verified 27 new targets of Drosophila ADAR. Our analyses lead us to identify new classes of genes whose transcripts are targets of ADAR including components of the actin cytoskeleton, and genes involved in ion homeostasis and signal transduction. Our results indicate that editing in Drosophila increases the diversity of the proteome, and does so in a manner that has direct functional consequences on protein function.

  18. The effect of stress on motor function in Drosophila.

    Directory of Open Access Journals (Sweden)

    Abhishek Chadha

    Full Text Available Exposure to unpredictable and uncontrollable conditions causes animals to perceive stress and change their behavior. It is unclear how the perception of stress modifies the motor components of behavior and which molecular pathways affect the behavioral change. In order to understand how stress affects motor function, we developed an experimental platform that quantifies walking motions in Drosophila. We found that stress induction using electrical shock results in backwards motions of the forelegs at the end of walking strides. These leg retrogressions persisted during repeated stimulation, although they habituated substantially. The motions also continued for several strides after the end of the shock, indicating that stress induces a behavioral aftereffect. Such aftereffect could also be induced by restricting the motion of the flies via wing suspension. Further, the long-term effects could be amplified by combining either immobilization or electric shock with additional stressors. Thus, retrogression is a lingering form of response to a broad range of stressful conditions, which cause the fly to search for a foothold when it faces extreme and unexpected challenges. Mutants in the cAMP signaling pathway enhanced the stress response, indicating that this pathway regulates the behavioral response to stress. Our findings identify the effect of stress on a specific motor component of behavior and define the role of cAMP signaling in this stress response.

  19. Defects and Disorder in the Drosophila Eye

    Science.gov (United States)

    Kim, Sangwoo; Carthew, Richard; Hilgenfeldt, Sascha

    Cell division and differentiation tightly control the regular pattern in the normal eye of the Drosophila fruit fly while certain genetic mutations introduce disorder in the form of topological defects. Analyzing data from pupal retinas, we develop a model based on Voronoi construction that explains the defect statistics as a consequence of area variation of individual facets (ommatidia). The analysis reveals a previously unknown systematic long-range area variation that spans the entire eye, with distinct effects on topological disorder compared to local fluctuations. The internal structure of the ommatidia and the stiffness of their interior cells also plays a crucial role in the defect generation. Accurate predictions of the correlation between the area variation and the defect density in both normal and mutant animals are obtained without free parameters. This approach can potentially be applied to cellular systems in many other contexts to identify size-topology correlations near the onset of symmetry breaking. This work has been supported by the NIH (GM098077) and the NSF (Grant No. 1504301).

  20. Healthy aging – insights from Drosophila

    Directory of Open Access Journals (Sweden)

    Konstantin G Iliadi

    2012-04-01

    Full Text Available Human life expectancy has nearly doubled in the past century due, in part, to social and economic development, and a wide range of new medical technologies and treatments. As the number of elderly increase it becomes of vital importance to understand what factors contribute to healthy aging. Human longevity is a complex process that is affected by both environmental and genetic factors and interactions between them. Unfortunately, it is currently difficult to identify the role of genetic components in human longevity. In contrast, model organisms such as C. elegans, Drosophila and rodents have facilitated the search for specific genes that affect lifespan. Experimental evidence obtained from studies in model organisms suggests that mutations in a single gene may increase longevity and delay the onset of age-related symptoms including motor impairments, sexual and reproductive and immune dysfunction, cardiovascular disease and cognitive decline. Furthermore, the high degree of conservation between diverse species in the genes and pathways that regulate longevity suggests that work in model organisms can both expand our theoretical knowledge of aging and perhaps provide new therapeutic targets for the treatment of age-related disorders.

  1. Active forgetting of olfactory memories in Drosophila.

    Science.gov (United States)

    Berry, Jacob A; Davis, Ronald L

    2014-01-01

    Failure to remember, or forgetting, is a phenomenon familiar to everyone and despite more than a century of scientific inquiry, why we forget what we once knew remains unclear. If the brain marshals significant resources to form and store memories, why is it that these memories become lost? In the last century, psychological studies have divided forgetting into decay theory, in which memory simply dissipates with time, and interference theory, in which additional learning or mental activity hinders memory by reducing its stability or retrieval (for review, Dewar et al., 2007; Wixted, 2004). Importantly, these psychological models of forgetting posit that forgetting is a passive property of the brain and thus a failure of the brain to retain memories. However, recent neuroscience research on olfactory memory in Drosophila has offered evidence for an alternative conclusion that forgetting is an "active" process, with specific, biologically regulated mechanisms that remove existing memories (Berry et al., 2012; Shuai et al., 2010). Similar to the bidirectional regulation of cell number by mitosis and apoptosis, protein concentration by translation and lysosomal or proteomal degradation, and protein phosphate modification by kinases and phosphatases, biologically regulated memory formation and removal would be yet another example in biological systems where distinct and separate pathways regulate the creation and destruction of biological substrates. © 2014 Elsevier B.V. All rights reserved.

  2. Functional neuroanatomy of Drosophila olfactory memory formation.

    Science.gov (United States)

    Guven-Ozkan, Tugba; Davis, Ronald L

    2014-10-01

    New approaches, techniques and tools invented over the last decade and a half have revolutionized the functional dissection of neural circuitry underlying Drosophila learning. The new methodologies have been used aggressively by researchers attempting to answer three critical questions about olfactory memories formed with appetitive and aversive reinforcers: (1) Which neurons within the olfactory nervous system mediate the acquisition of memory? (2) What is the complete neural circuitry extending from the site(s) of acquisition to the site(s) controlling memory expression? (3) How is information processed across this circuit to consolidate early-forming, disruptable memories to stable, late memories? Much progress has been made and a few strong conclusions have emerged: (1) Acquisition occurs at multiple sites within the olfactory nervous system but is mediated predominantly by the γ mushroom body neurons. (2) The expression of long-term memory is completely dependent on the synaptic output of α/β mushroom body neurons. (3) Consolidation occurs, in part, through circuit interactions between mushroom body and dorsal paired medial neurons. Despite this progress, a complete and unified model that details the pathway from acquisition to memory expression remains elusive. © 2014 Guven-Ozkan and Davis; Published by Cold Spring Harbor Laboratory Press.

  3. Host plant adaptation in Drosophila mettleri populations.

    Directory of Open Access Journals (Sweden)

    Sergio Castrezana

    Full Text Available The process of local adaptation creates diversity among allopatric populations, and may eventually lead to speciation. Plant-feeding insect populations that specialize on different host species provide an excellent opportunity to evaluate the causes of ecological specialization and the subsequent consequences for diversity. In this study, we used geographically separated Drosophila mettleri populations that specialize on different host cacti to examine oviposition preference for and larval performance on an array of natural and non-natural hosts (eight total. We found evidence of local adaptation in performance on saguaro cactus (Carnegiea gigantea for populations that are typically associated with this host, and to chemically divergent prickly pear species (Opuntia spp. in a genetically isolated population on Santa Catalina Island. Moreover, each population exhibited reduced performance on the alternative host. This finding is consistent with trade-offs associated with adaptation to these chemically divergent hosts, although we also discuss alternative explanations for this pattern. For oviposition preference, Santa Catalina Island flies were more likely to oviposit on some prickly pear species, but all populations readily laid eggs on saguaro. Experiments with non-natural hosts suggest that factors such as ecological opportunity may play a more important role than host plant chemistry in explaining the lack of natural associations with some hosts.

  4. Exploring strategies for protein trapping in Drosophila

    Energy Technology Data Exchange (ETDEWEB)

    Quinones-Coello, Ana T.; Petrella, Lisa N.; Ayers, Kathleen; Melillo, Anthony; Mazzalupo, Stacy; Hudson, Andrew M.; Wang, Shu; Castiblanco, Claudia; Buszczak, Michael; Hoskins, Roger A.; Cooley, Lynn

    2006-12-18

    The use of fluorescent protein tags has had a huge impact oncell biological studies in virtually every experimental system.Incorporation of coding sequence for fluorescent proteins such as greenfluorescent protein (GFP) into genes at their endogenous chromosomalposition is especially useful for generating GFP-fusion proteins thatprovide accurate cellular and subcellular expression data. We testedmodifications of a transposon-based protein trap screening procedure inDrosophila to optimize the rate of recovering useful protein traps andtheir analysis. Transposons carrying the GFP-coding sequence flanked bysplice acceptor and donor sequences were mobilized, and new insertionsthat resulted in production of GFP were captured using an automatedembryo sorter. Individual stocks were established, GFP expression wasanalyzed during oogenesis, and insertion sites were determined bysequencing genomic DNA flanking the insertions. The resulting collectionincludes lines with protein traps in which GFP was spliced into mRNAs andembedded within endogenous proteins or enhancer traps in which GFPexpression depended on splicing into transposon-derived RNA. We report atotal of 335 genes associated with protein or enhancer traps and aweb-accessible database for viewing molecular information and expressiondata for these genes.

  5. The sexually antagonistic genes of Drosophila melanogaster.

    Directory of Open Access Journals (Sweden)

    Paolo Innocenti

    2010-03-01

    Full Text Available When selective pressures differ between males and females, the genes experiencing these conflicting evolutionary forces are said to be sexually antagonistic. Although the phenotypic effect of these genes has been documented in both wild and laboratory populations, their identity, number, and location remains unknown. Here, by combining data on sex-specific fitness and genome-wide transcript abundance in a quantitative genetic framework, we identified a group of candidate genes experiencing sexually antagonistic selection in the adult, which correspond to 8% of Drosophila melanogaster genes. As predicted, the X chromosome is enriched for these genes, but surprisingly they represent only a small proportion of the total number of sex-biased transcripts, indicating that the latter is a poor predictor of sexual antagonism. Furthermore, the majority of genes whose expression profiles showed a significant relationship with either male or female adult fitness are also sexually antagonistic. These results provide a first insight into the genetic basis of intralocus sexual conflict and indicate that genetic variation for fitness is dominated and maintained by sexual antagonism, potentially neutralizing any indirect genetic benefits of sexual selection.

  6. Structure of full-length Drosophila cryptochrome

    Energy Technology Data Exchange (ETDEWEB)

    Zoltowski, Brian D.; Vaidya, Anand T.; Top, Deniz; Widom, Joanne; Young, Michael W.; Crane, Brian R. (Cornell); (Rockefeller)

    2011-12-15

    The cryptochrome/photolyase (CRY/PL) family of photoreceptors mediates adaptive responses to ultraviolet and blue light exposure in all kingdoms of life. Whereas PLs function predominantly in DNA repair of cyclobutane pyrimidine dimers (CPDs) and 6-4 photolesions caused by ultraviolet radiation, CRYs transduce signals important for growth, development, magnetosensitivity and circadian clocks. Despite these diverse functions, PLs/CRYs preserve a common structural fold, a dependence on flavin adenine dinucleotide (FAD) and an internal photoactivation mechanism. However, members of the CRY/PL family differ in the substrates recognized (protein or DNA), photochemical reactions catalysed and involvement of an antenna cofactor. It is largely unknown how the animal CRYs that regulate circadian rhythms act on their substrates. CRYs contain a variable carboxy-terminal tail that appends the conserved PL homology domain (PHD) and is important for function. Here, we report a 2.3-{angstrom} resolution crystal structure of Drosophila CRY with an intact C terminus. The C-terminal helix docks in the analogous groove that binds DNA substrates in PLs. Conserved Trp536 juts into the CRY catalytic centre to mimic PL recognition of DNA photolesions. The FAD anionic semiquinone found in the crystals assumes a conformation to facilitate restructuring of the tail helix. These results help reconcile the diverse functions of the CRY/PL family by demonstrating how conserved protein architecture and photochemistry can be elaborated into a range of light-driven functions.

  7. How Food Controls Aggression in Drosophila

    Science.gov (United States)

    Lim, Rod S.; Eyjólfsdóttir, Eyrún; Shin, Euncheol; Perona, Pietro; Anderson, David J.

    2014-01-01

    How animals use sensory information to weigh the risks vs. benefits of behavioral decisions remains poorly understood. Inter-male aggression is triggered when animals perceive both the presence of an appetitive resource, such as food or females, and of competing conspecific males. How such signals are detected and integrated to control the decision to fight is not clear. For instance, it is unclear whether food increases aggression directly, or as a secondary consequence of increased social interactions caused by attraction to food. Here we use the vinegar fly, Drosophila melanogaster, to investigate the manner by which food influences aggression. We show that food promotes aggression in flies, and that it does so independently of any effect on frequency of contact between males, increase in locomotor activity or general enhancement of social interactions. Importantly, the level of aggression depends on the absolute amount of food, rather than on its surface area or concentration. When food resources exceed a certain level, aggression is diminished, suggestive of reduced competition. Finally, we show that detection of sugar via Gr5a+ gustatory receptor neurons (GRNs) is necessary for food-promoted aggression. These data demonstrate that food exerts a specific effect to promote aggression in male flies, and that this effect is mediated, at least in part, by sweet-sensing GRNs. PMID:25162609

  8. Ferritin Assembly in Enterocytes of Drosophila melanogaster

    Directory of Open Access Journals (Sweden)

    Abraham Rosas-Arellano

    2016-02-01

    Full Text Available Ferritins are protein nanocages that accumulate inside their cavity thousands of oxidized iron atoms bound to oxygen and phosphates. Both characteristic types of eukaryotic ferritin subunits are present in secreted ferritins from insects, but here dimers between Ferritin 1 Heavy Chain Homolog (Fer1HCH and Ferritin 2 Light Chain Homolog (Fer2LCH are further stabilized by disulfide-bridge in the 24-subunit complex. We addressed ferritin assembly and iron loading in vivo using novel transgenic strains of Drosophila melanogaster. We concentrated on the intestine, where the ferritin induction process can be controlled experimentally by dietary iron manipulation. We showed that the expression pattern of Fer2LCH-Gal4 lines recapitulated iron-dependent endogenous expression of the ferritin subunits and used these lines to drive expression from UAS-mCherry-Fer2LCH transgenes. We found that the Gal4-mediated induction of mCherry-Fer2LCH subunits was too slow to effectively introduce them into newly formed ferritin complexes. Endogenous Fer2LCH and Fer1HCH assembled and stored excess dietary iron, instead. In contrast, when flies were genetically manipulated to co-express Fer2LCH and mCherry-Fer2LCH simultaneously, both subunits were incorporated with Fer1HCH in iron-loaded ferritin complexes. Our study provides fresh evidence that, in insects, ferritin assembly and iron loading in vivo are tightly regulated.

  9. A Model of Drosophila Larva Chemotaxis.

    Directory of Open Access Journals (Sweden)

    Alex Davies

    2015-11-01

    Full Text Available Detailed observations of larval Drosophila chemotaxis have characterised the relationship between the odour gradient and the runs, head casts and turns made by the animal. We use a computational model to test whether hypothesised sensorimotor control mechanisms are sufficient to account for larval behaviour. The model combines three mechanisms based on simple transformations of the recent history of odour intensity at the head location. The first is an increased probability of terminating runs in response to gradually decreasing concentration, the second an increased probability of terminating head casts in response to rapidly increasing concentration, and the third a biasing of run directions up concentration gradients through modulation of small head casts. We show that this model can be tuned to produce behavioural statistics comparable to those reported for the larva, and that this tuning results in similar chemotaxis performance to the larva. We demonstrate that each mechanism can enable odour approach but the combination of mechanisms is most effective, and investigate how these low-level control mechanisms relate to behavioural measures such as the preference indices used to investigate larval learning behaviour in group assays.

  10. Place learning overrides innate behaviors in Drosophila.

    Science.gov (United States)

    Baggett, Vincent; Mishra, Aditi; Kehrer, Abigail L; Robinson, Abbey O; Shaw, Paul; Zars, Troy

    2018-03-01

    Animals in a natural environment confront many sensory cues. Some of these cues bias behavioral decisions independent of experience, and action selection can reveal a stimulus-response (S-R) connection. However, in a changing environment it would be a benefit for an animal to update behavioral action selection based on experience, and learning might modify even strong S-R relationships. How animals use learning to modify S-R relationships is a largely open question. Three sensory stimuli, air, light, and gravity sources were presented to individual Drosophila melanogaster in both naïve and place conditioning situations. Flies were tested for a potential modification of the S-R relationships of anemotaxis, phototaxis, and negative gravitaxis by a contingency that associated place with high temperature. With two stimuli, significant S-R relationships were abandoned when the cue was in conflict with the place learning contingency. The role of the dunce ( dnc ) cAMP-phosphodiesterase and the rutabaga ( rut ) adenylyl cyclase were examined in all conditions. Both dnc 1 and rut 2080 mutant flies failed to display significant S-R relationships with two attractive cues, and have characteristically lower conditioning scores under most conditions. Thus, learning can have profound effects on separate native S-R relationships in multiple contexts, and mutation of the dnc and rut genes reveal complex effects on behavior. © 2018 Baggett et al.; Published by Cold Spring Harbor Laboratory Press.

  11. Meiotic transmission of Drosophila pseudoobscura chromosomal arrangements.

    Directory of Open Access Journals (Sweden)

    Richard P Meisel

    Full Text Available Drosophila pseudoobscura harbors a rich gene arrangement polymorphism on the third chromosome generated by a series of overlapping paracentric inversions. The arrangements suppress recombination in heterokaryotypic individuals, which allows for the selective maintenance of coadapted gene complexes. Previous mapping experiments used to determine the degree to which recombination is suppressed in gene arrangement heterozygotes produced non-recombinant progeny in non-Mendelian ratios. The deviations from Mendelian expectations could be the result of viability differences between wild and mutant chromosomes, meiotic drive because of achiasmate pairing of homologues in heterokaryotypic females during meiosis, or a combination of both mechanisms. The possibility that the frequencies of the chromosomal arrangements in natural populations are affected by mechanisms other than adaptive selection led us to consider these hypotheses. We performed reciprocal crosses involving both heterozygous males and females to determine if the frequency of the non-recombinant progeny deviates significantly from Mendelian expectations and if the frequencies deviate between reciprocal crosses. We failed to observe non-Mendelian ratios in multiple crosses, and the frequency of the non-recombinant classes differed in only one of five pairs of reciprocal crosses despite sufficient power to detect these differences in all crosses. Our results indicate that deviations from Mendelian expectations in recombination experiments involving the D. pseudoobscura inversion system are most likely due to fitness differences of gene arrangement karyotypes in different environments.

  12. Tools for neuroanatomy and neurogenetics in Drosophila

    Energy Technology Data Exchange (ETDEWEB)

    Pfeiffer, Barret D.; Jenett, Arnim; Hammonds, Ann S.; Ngo, Teri-T B.; Misra, Sima; Murphy, Christine; Scully, Audra; Carlson, Joseph W.; Wan, Kenneth H.; Laverty, Todd R.; Mungall, Chris; Svirskas, Rob; Kadonaga, James T.; Doe, Chris Q.; Eisen, Michael B.; Celniker, Susan E.; Rubin, Gerald M.

    2008-08-11

    We demonstrate the feasibility of generating thousands of transgenic Drosophila melanogaster lines in which the expression of an exogenous gene is reproducibly directed to distinct small subsets of cells in the adult brain. We expect the expression patterns produced by the collection of 5,000 lines that we are currently generating to encompass all neurons in the brain in a variety of intersecting patterns. Overlapping 3-kb DNA fragments from the flanking noncoding and intronic regions of genes thought to have patterned expression in the adult brain were inserted into a defined genomic location by site-specific recombination. These fragments were then assayed for their ability to function as transcriptional enhancers in conjunction with a synthetic core promoter designed to work with a wide variety of enhancer types. An analysis of 44 fragments from four genes found that >80% drive expression patterns in the brain; the observed patterns were, on average, comprised of <100 cells. Our results suggest that the D. melanogaster genome contains >50,000 enhancers and that multiple enhancers drive distinct subsets of expression of a gene in each tissue and developmental stage. We expect that these lines will be valuable tools for neuroanatomy as well as for the elucidation of neuronal circuits and information flow in the fly brain.

  13. In-vivo Centrifugation of Drosophila Embryos

    Science.gov (United States)

    Tran, Susan L.; Welte, Michael A.

    2010-01-01

    A major strategy for purifying and isolating different types of intracellular organelles is to separate them from each other based on differences in buoyant density. However, when cells are disrupted prior to centrifugation, proteins and organelles in this non-native environment often inappropriately stick to each other. Here we describe a method to separate organelles by density in intact, living Drosophila embryos. Early embryos before cellularization are harvested from population cages, and their outer egg shells are removed by treatment with 50% bleach. Embryos are then transferred to a small agar plate and inserted, posterior end first, into small vertical holes in the agar. The plates containing embedded embryos are centrifuged for 30 min at 3000g. The agar supports the embryos and keeps them in a defined orientation. Afterwards, the embryos are dug out of the agar with a blunt needle. Centrifugation separates major organelles into distinct layers, a stratification easily visible by bright-field microscopy. A number of fluorescent markers are available to confirm successful stratification in living embryos. Proteins associated with certain organelles will be enriched in a particular layer, demonstrating colocalization. Individual layers can be recovered for biochemical analysis or transplantation into donor eggs. This technique is applicable for organelle separation in other large cells, including the eggs and oocytes of diverse species. PMID:20613707

  14. Insulin signaling mediates sexual attractiveness in Drosophila.

    Directory of Open Access Journals (Sweden)

    Tsung-Han Kuo

    Full Text Available Sexually attractive characteristics are often thought to reflect an individual's condition or reproductive potential, but the underlying molecular mechanisms through which they do so are generally unknown. Insulin/insulin-like growth factor signaling (IIS is known to modulate aging, reproduction, and stress resistance in several species and to contribute to variability of these traits in natural populations. Here we show that IIS determines sexual attractiveness in Drosophila through transcriptional regulation of genes involved in the production of cuticular hydrocarbons (CHC, many of which function as pheromones. Using traditional gas chromatography/mass spectrometry (GC/MS together with newly introduced laser desorption/ionization orthogonal time-of-flight mass spectrometry (LDI-MS we establish that CHC profiles are significantly affected by genetic manipulations that target IIS. Manipulations that reduce IIS also reduce attractiveness, while females with increased IIS are significantly more attractive than wild-type animals. IIS effects on attractiveness are mediated by changes in CHC profiles. Insulin signaling influences CHC through pathways that are likely independent of dFOXO and that may involve the nutrient-sensing Target of Rapamycin (TOR pathway. These results suggest that the activity of conserved molecular regulators of longevity and reproductive output may manifest in different species as external characteristics that are perceived as honest indicators of fitness potential.

  15. Effects of Spaceflight on Drosophila Neural Development

    Science.gov (United States)

    Keshishian, Haig S.

    1997-01-01

    The major goal from the animal side, however, has been achieved, namely to develop Drosophila lines where we can assay individual neuromuscular endings directly without dissection. This was achieved by means of using the GAL4-UAS system, where we have succeeded in establishing stocks of flies where the key neuromuscular connections can be assayed directly in undissected larvae by means of the expression of endogenously fluorescent reporters in the specific motor endings. The green fluorescent protein (GFP) as a reporter allows scoring of neural anatomy en-masse in whole mount using fluorescent microscopy without the need for either dissection or specific labeling. Two stocks have been developed. The first, which we developed first, uses the S65T mutant form, which has a dramatically brighter expression than the native protein. This animal will use GAL4 drivers with expression under the control of the elav gene, and which will ensure expression in all neurons of the embryo and larva. The second transgenic animal we have developed is of a novel kind, and makes use of dicistronic design, so that two copies of the protein will be expressed per insert. We have also developed a tricistronic form, but this has not yet been transformed into flies, and we do not imagine that this third line will be ready in time for the flight.

  16. Quantifying Abdominal Pigmentation in Drosophila melanogaster.

    Science.gov (United States)

    Saleh Ziabari, Omid; Shingleton, Alexander W

    2017-06-01

    Pigmentation is a morphologically simple but highly variable trait that often has adaptive significance. It has served extensively as a model for understanding the development and evolution of morphological phenotypes. Abdominal pigmentation in Drosophila melanogaster has been particularly useful, allowing researchers to identify the loci that underlie inter- and intraspecific variations in morphology. Hitherto, however, D. melanogaster abdominal pigmentation has been largely assayed qualitatively, through scoring, rather than quantitatively, which limits the forms of statistical analysis that can be applied to pigmentation data. This work describes a new methodology that allows for the quantification of various aspects of the abdominal pigmentation pattern of adult D. melanogaster. The protocol includes specimen mounting, image capture, data extraction, and analysis. All the software used for image capture and analysis feature macros written for open-source image analysis. The advantage of this approach is the ability to precisely measure pigmentation traits using a methodology that is highly reproducible across different imaging systems. While the technique has been used to measure variation in the tergal pigmentation patterns of adult D. melanogaster, the methodology is flexible and broadly applicable to pigmentation patterns in myriad different organisms.

  17. Drosophila as a genetically tractable model for social insect behaviour

    Directory of Open Access Journals (Sweden)

    Alison L Camiletti

    2016-04-01

    Full Text Available The relatively simple communication, breeding and egg-making systems that govern reproduction in female Drosophila retain homology to eusocial species in which these same systems are modified to the social condition. Despite having no parental care, division of labour or subfertile caste, Drosophila may nonetheless offer a living test of certain sociobiological hypotheses framed around gene function. In this review, we make this case, and do so around the recent discovery that the non-social fly, Drosophila melanogaster, can respond to the ovary-suppressing queen pheromone of the honey bee Apis meliffera. Here, we first explain the sociobiological imperative to reconcile kin theory with molecular biology, and qualify a potential role for Drosophila. Then, we offer three applications for the fly-pheromone assay. First, the availability and accessibility of massive mutant libraries makes immediately feasible any number of open or targeted gene screens against the ovary-inhibiting response. The sheer tractability of Drosophila may therefore help to accelerate the search for genes in pheromone-responsive pathways that regulate female reproduction, including potentially any that are preserved with modification to regulate worker sterility in response to queen pheromones in eusocial taxa. Secondly, Drosophila’s powerful Gal4/UAS expression system can complement the pheromone assay by driving target gene expression into living tissue, which could be well applied to the functional testing of genes presumed to drive ovary activation or de-activation in the honey bee or other eusocial taxa. Finally, coupling Gal4 with UAS-RNAi lines can facilitate loss-of-function experiments against perception and response to the ovary inhibiting pheromone, and do so for large numbers of candidates in systematic fashion. Drosophila's utility as an adjunct to the field of insect sociobiology is not ideal, but retains surprising potential.

  18. Getting started : an overview on raising and handling Drosophila.

    Science.gov (United States)

    Stocker, Hugo; Gallant, Peter

    2008-01-01

    Drosophila melanogaster has long been a prime model organism for developmental biologists. During their work, they have established a large collection of techniques and reagents. This in turn has made fruit flies an attractive system for many other biomedical researchers who have otherwise no background in fly biology. This review intends to help Drosophila neophytes in setting up a fly lab. It briefly introduces the biological properties of fruit flies, describes the minimal equipment required for working with flies, and offers some basic advice for maintaining fly lines and setting up and analyzing experiments.

  19. Using the Drosophila Nephrocyte to Model Podocyte Function and Disease

    Directory of Open Access Journals (Sweden)

    Martin Helmstädter

    2017-12-01

    Full Text Available Glomerular disorders are a major cause of end-stage renal disease and effective therapies are often lacking. Nephrocytes are considered to be part of the Drosophila excretory system and form slit diaphragms across cellular membrane invaginations. Nehphrocytes have been shown to share functional, morphological, and molecular features with podocytes, which form the glomerular filter in vertebrates. Here, we report the progress and the evolving tool-set of this model system. Combining a functional, accessible slit diaphragm with the power of the genetic tool-kit in Drosophila, the nephrocyte has the potential to greatly advance our understanding of the glomerular filtration barrier in health and disease.

  20. Mutagenic effects of irradiated glucose in Drosophila melanogaster

    International Nuclear Information System (INIS)

    Varma, M.B.; Rao, K.P.; Nandan, S.D.; Rao, M.S.

    1982-01-01

    The mutagenic effects of irradiated glucose were studied using the sex-linked recessive lethal test in Drosophila melanogaster. Oregon K males of D. melanogaster reared on a medium containing 20 or 40% glucose irradiated with a dose of 0.02, 0.10, 0.20, 2 or 5 Mrad #betta#-rays were scored for the induction of sex-linked recessive lethals. The results showed no significant increase in the frequency of X-lethals in Drosophila at any of the dose levels. (author)

  1. Polytene chromosome map and inversion polymorphism in Drosophila mediopunctata

    Directory of Open Access Journals (Sweden)

    Galina Ananina

    2002-07-01

    Full Text Available Drosophila mediopunctata belongs to the tripunctata group, and is one of the commonest Drosophila species collected in some places in Brazil, especially in the winter. A standard map of the polytene chromosomes is presented. The breakpoints of the naturally occurring chromosomal rearrangements are marked on the map. The distribution of breaking points through the chromosomes of D. mediopunctata is apparently non-random. Chromosomes X, II and IV show inversion polymorphisms. Chromosome II is the most polymorphic, with 17 inversions, 8 inversions in the distal region and 9 in the proximal region. Chromosome X has four different gene arrangements, while chromosome IV has only two.

  2. Genetic analysis of a Drosophila microtubule-associated protein

    OpenAIRE

    1992-01-01

    The 205-kD microtubule-associated protein (205K MAP) is one of the principal MAPs in Drosophila. 205K MAP is similar to the HeLa 210K/MAP4 family of MAPs since it shares the following biochemical properties: it is present in several isoforms, has a molecular mass of approximately 200 kD, and is thermostable. Furthermore, immuno-crossreactivity has been observed between mouse MAP4, HeLa 210K, and Drosophila 205K MAP. Currently, there is little information concerning the biological function of ...

  3. Egg size, embryonic development time and ovoviviparity in Drosophila species.

    Science.gov (United States)

    Markow, T A; Beall, S; Matzkin, L M

    2009-02-01

    Lengths, widths and volumes of eggs from 11 species of Drosophila whose genomes have been fully sequenced exhibit significant variation that is not explained by their phylogenetic relationships. Furthermore, egg size differences are unrelated to embryonic development time in these species. In addition, two of the species, Drosophila sechellia and, to a lesser degree, D. yakuba, both ecological specialists, exhibit ovoviviparity, suggesting that female control over oviposition in these species differs from what is observed in D. melanogaster. The interspecific differences in these reproductive characters, coupled with the availability of whole genome sequences for each, provide an unprecedented opportunity to examine their evolution.

  4. Detection of genetically altered copper levels in Drosophila tissues by synchrotron x-ray fluorescence microscopy.

    Directory of Open Access Journals (Sweden)

    Jessica C Lye

    Full Text Available Tissue-specific manipulation of known copper transport genes in Drosophila tissues results in phenotypes that are presumably due to an alteration in copper levels in the targeted cells. However direct confirmation of this has to date been technically challenging. Measures of cellular copper content such as expression levels of copper-responsive genes or cuproenzyme activity levels, while useful, are indirect. First-generation copper-sensitive fluorophores show promise but currently lack the sensitivity required to detect subtle changes in copper levels. Moreover such techniques do not provide information regarding other relevant biometals such as zinc or iron. Traditional techniques for measuring elemental composition such as inductively coupled plasma mass spectroscopy are not sensitive enough for use with the small tissue amounts available in Drosophila research. Here we present synchrotron x-ray fluorescence microscopy analysis of two different Drosophila tissues, the larval wing imaginal disc, and sectioned adult fly heads and show that this technique can be used to detect changes in tissue copper levels caused by targeted manipulation of known copper homeostasis genes.

  5. Oral intake of zirconia nanoparticle alters neuronal development and behaviour of Drosophila melanogaster

    Science.gov (United States)

    Mishra, Monalisa; Sabat, Debabrat; Ekka, Basanti; Sahu, Swetapadma; P, Unnikannan; Dash, Priyabrat

    2017-08-01

    Zirconia nanoparticles (ZrO2 NPs) have been extensively used in teeth and bone implants and thus get a chance to interact with the physiological system. The current study investigated the oral administration of various concentrations of ZrO2 NPs synthesized by the hydrothermal method (0.25 to 5.0 mg L-1) on Drosophila physiology and behaviour. The size of the currently studied nanoparticle varies from 10 to 12 nm. ZrO2 NPs accumulated within the gut in a concentration-dependent manner and generate reactive oxygen species (ROS) only at 2.5 and 5.0 mg L-1 concentrations. ROS was detected by nitroblue tetrazolium (NBT) assay and 2',7'-dichlorofluorescein http://www.ncbi.nlm.nih.gov/pubmed/20370560 (H2DCF) staining. The ROS toxicity alters the larval gut structure as revealed by DAPI staining. The NP stress of larvae affects the Drosophila development by distressing pupa count and varying the phenotypic changes in sensory organs (eye, thorax bristle, wings). Besides phenotypic changes, flawed climbing behaviour against gravity was seen in ZrO2 NP-treated flies. All together, for the first time, we have reported that a ROS-mediated ZrO2 NP toxicity alters neuronal development and functioning using Drosophila as a model organism. [Figure not available: see fulltext.

  6. Are larger and/or more symmetrical Drosophila melanogaster (Diptera, Drosophilidae males more successful in matings in nature?

    Directory of Open Access Journals (Sweden)

    Sofija Pavković-Lučić

    Full Text Available Are larger and/or more symmetrical Drosophila melanogaster (Diptera, Drosophilidae males more successful in matings in nature? Sexual selection in Drosophila melanogaster, related to body size and fluctuating asymmetry in wing length and number of sex comb teeth in males, was tested in natural conditions. Males collected in copula were significantly larger than those collected as a single, while no difference in mean number of sex comb teeth between copulating and single males was observed. On the other hand, single males had greater asymmetry both for wing length and number of sex comb teeth than their mating counterparts. It looks like that symmetry of these bilateral traits also may play a role in sexual selection in this dipteran species in nature.

  7. The effect of lead on the developmental stability of Drosophila subobscura through selection in laboratory conditions

    Directory of Open Access Journals (Sweden)

    Kurbalija Zorana

    2010-01-01

    Full Text Available Fluctuating asymmetry (FA, the increased variation of bilateral symmetry in a sample of individuals, can indicate disturbance in developmental stability caused by environmental and/or genomic stress. This developmental instability was analyzed in Drosophila subobscura maintained for seven generations on two different concentrations of lead in laboratory conditions. The FA4 index showed that the genotypes reared on the higher lead concentration were in developmental homeostasis, except for males in the F7 generation, for both wing size parameters. The results show that different degrees of lead pollution cause different responses to selection of the exposed population in laboratory conditions.

  8. Expressionof Drosophila FOXO regulates growth and can phenocopy starvation

    Directory of Open Access Journals (Sweden)

    Lockyer Joseph M

    2003-07-01

    Full Text Available Abstract Background Components of theinsulin signaling pathway are important regulators of growth. TheFOXO (forkhead box, sub-group "O" transcriptionfactors regulate cellular processes under conditions of low levelsof insulin signaling. Studies in mammalian cell culture show thatactivation of FOXO transcription factors causes cell death or cellcycle arrest. The Caenorhabiditis elegans homologue ofFOXO, Daf-16, is required for the formation of dauer larvae in responseto nutritional stress. In addition, FOXO factors have been implicatedin stress resistance and longevity. Results We have identifiedthe Drosophila melanogaster homologue of FOXO (dFOXO,which is conserved in amino acid sequence compared with the mammalianFOXO homologues and Daf-16. Expression of dFOXO during early larvaldevelopment causes inhibition of larval growth and alterations infeeding behavior. Inhibition of larval growth is reversible upondiscontinuation of dFOXO expression. Expression of dFOXO duringthe third larval instar or at low levels during development leadsto the generation of adults that are reduced in size. Analysis ofthe wings and eyes of these small flies indicates that the reductionin size is due to decreases in cell size and cell number. Overexpressionof dFOXO in the developing eye leads to a characteristic phenotypewith reductions in cell size and cell number. This phenotype canbe rescued by co-expression of upstream insulin signaling components,dPI3K and dAkt, however, this rescue is not seen when FOXO is mutatedto a constitutively active form. Conclusions dFOXO is conservedin both sequence and regulatory mechanisms when compared with otherFOXO homologues. The establishment of Drosophila as a model forthe study of FOXO transcription factors should prove beneficialto determining the biological role of these signaling molecules.The alterations in larval development seen upon overexpression ofdFOXO closely mimic the phenotypic effects of starvation, suggestinga

  9. Unique and Overlapping Functions of Formins Frl and DAAM During Ommatidial Rotation and Neuronal Development in Drosophila

    OpenAIRE

    Dollar, Gretchen; Gombos, Rita; Barnett, Austen A.; Sanchez Hernandez, David; Maung, Saw M. T.; Mih?ly, Jozsef; Jenny, Andreas

    2016-01-01

    The noncanonical Frizzled/planar cell polarity (PCP) pathway regulates establishment of polarity within the plane of an epithelium to generate diversity of cell fates, asymmetric, but highly aligned structures, or to orchestrate the directional migration of cells during convergent extension during vertebrate gastrulation. In Drosophila, PCP signaling is essential to orient actin wing hairs and to align ommatidia in the eye, in part by coordinating the movement of groups of photoreceptor cells...

  10. Selector genes display tumor cooperation and inhibition in Drosophila epithelium in a developmental context-dependent manner

    OpenAIRE

    Ram Prakash Gupta; Anjali Bajpai; Pradip Sinha

    2017-01-01

    During animal development, selector genes determine identities of body segments and those of individual organs. Selector genes are also misexpressed in cancers, although their contributions to tumor progression per se remain poorly understood. Using a model of cooperative tumorigenesis, we show that gain of selector genes results in tumor cooperation, but in only select developmental domains of the wing, haltere and eye-antennal imaginal discs of Drosophila larva. Thus, the field selector, Ey...

  11. Selector genes display tumor cooperation and inhibition in Drosophila epithelium in a developmental context-dependent manner

    OpenAIRE

    Gupta, Ram Prakash; Bajpai, Anjali; Sinha, Pradip

    2017-01-01

    ABSTRACT During animal development, selector genes determine identities of body segments and those of individual organs. Selector genes are also misexpressed in cancers, although their contributions to tumor progression per se remain poorly understood. Using a model of cooperative tumorigenesis, we show that gain of selector genes results in tumor cooperation, but in only select developmental domains of the wing, haltere and eye-antennal imaginal discs of Drosophila larva. Thus, the field sel...

  12. Expression of the rubber-like protein, resilin, in developing and functional insect cuticle determined using a Drosophila anti-Rec 1 resilin antibody.

    Science.gov (United States)

    Wong, Darren C C; Pearson, Roger D; Elvin, Christopher M; Merritt, David J

    2012-02-01

    The natural elastomeric protein, insect resilin, is the most efficient elastic material known, used to store energy for jumping and flight in a variety of insects. Here, an antibody to recombinant Drosophila melanogaster pro-resilin is used to examine resilin expression in Drosophila and a wider range of insects. Immunostaining of Drosophila embryos reveals anti-resilin reactivity in epidermal patches that exhibit a dynamic spatial and temporal expression through late embryogenesis. Resilin is also detected in stretch receptors in the embryo. In developing adult Drosophila, resilin pads are described at the base of wings and at the base of flexible sensory hairs in pupae. Resilin is also detected in embryos of the tephritid fruitfly, Bactrocera tryoni, and two well-known concentrations of insect resilin: the flight muscle tendon of the dragonfly and the pleural arch of the flea. The anti-Rec1 antibody antibody developed using Drosophila pro-resilin as antigen is cross-reactive and is useful for detection of resilin in diverse insects. For the first time, resilin expression has been detected during embryogenesis, revealing segmental patches of resilin in the developing epidermis of Drosophila. Copyright © 2011 Wiley Periodicals, Inc.

  13. Modeling peripheral olfactory coding in Drosophila larvae.

    Directory of Open Access Journals (Sweden)

    Derek J Hoare

    Full Text Available The Drosophila larva possesses just 21 unique and identifiable pairs of olfactory sensory neurons (OSNs, enabling investigation of the contribution of individual OSN classes to the peripheral olfactory code. We combined electrophysiological and computational modeling to explore the nature of the peripheral olfactory code in situ. We recorded firing responses of 19/21 OSNs to a panel of 19 odors. This was achieved by creating larvae expressing just one functioning class of odorant receptor, and hence OSN. Odor response profiles of each OSN class were highly specific and unique. However many OSN-odor pairs yielded variable responses, some of which were statistically indistinguishable from background activity. We used these electrophysiological data, incorporating both responses and spontaneous firing activity, to develop a bayesian decoding model of olfactory processing. The model was able to accurately predict odor identity from raw OSN responses; prediction accuracy ranged from 12%-77% (mean for all odors 45.2% but was always significantly above chance (5.6%. However, there was no correlation between prediction accuracy for a given odor and the strength of responses of wild-type larvae to the same odor in a behavioral assay. We also used the model to predict the ability of the code to discriminate between pairs of odors. Some of these predictions were supported in a behavioral discrimination (masking assay but others were not. We conclude that our model of the peripheral code represents basic features of odor detection and discrimination, yielding insights into the information available to higher processing structures in the brain.

  14. moleculares de insectos (Drosophila y de primates

    Directory of Open Access Journals (Sweden)

    Enio Hernández Aguirre

    2006-01-01

    Full Text Available La mayoría de las especies poseen un macho heterogamético XY y una hembra homogamética XX. En el macho XY sólo se conservan unas regiones donde se intercambian información entre el X y el Y (Xpter y Ypter durante la meiosis, que se le llama región seudoautosómica (RSA. Se ha planteado la hipótesis que el cromosoma Y se deriva del cromosoma X, y que antiguamente eran homólogos en toda su extensión. Un posible mecanismo biológico implicado en este proceso evolutivo son fragmentos de ADN que pueden moverse a través del genoma. En general se llaman elementos genéticos móviles. Con base en los elementos génicos móviles y en los genes de la cutícula larval (Lcp se han realizado estudios en los cromosomas sexuales de Drosophila melanogaster, D. Permisilis, D. Seudooscura y D. Miranda. Los análisis moleculares realizados en D. Miranda son una clara evidencia científica de cómo un evento de translocacion cromosómica asociados a procesos biológicos naturales y normales del ADN, como lo es la transposición, pudieron generar un cromosoma “Y” a través de la evolución, que en su forma prístina fue homólogo del cromosoma X.

  15. The mode of evolution of aggregation pheromones in Drosophila species

    NARCIS (Netherlands)

    Symonds, MRE; Wertheim, B

    Aggregation pheromones are used by fruit flies of the genus Drosophila to assemble on breeding substrates, where they feed, mate and oviposit communally. These pheromones consist of species-specific blends of chemicals. Here, using a phylogenetic framework, we examine how differences among species

  16. Comprehensive functional analysis of Rab GTPases in Drosophila nephrocytes.

    Science.gov (United States)

    Fu, Yulong; Zhu, Jun-Yi; Zhang, Fujian; Richman, Adam; Zhao, Zhanzheng; Han, Zhe

    2017-06-01

    The Drosophila nephrocyte is a critical component of the fly renal system and bears structural and functional homology to podocytes and proximal tubule cells of the mammalian kidney. Investigations of nephrocyte cell biological processes are fundamental to understanding the insect renal system. Nephrocytes are highly active in endocytosis and vesicle trafficking. Rab GTPases regulate endocytosis and trafficking but specific functions of nephrocyte Rabs remain undefined. We analyzed Rab GTPase expression and function in Drosophila nephrocytes and found that 11 out of 27 Drosophila Rabs were required for normal activity. Rabs 1, 5, 7, 11 and 35 were most important. Gene silencing of the nephrocyte-specific Rab5 eliminated all intracellular vesicles and the specialized plasma membrane structures essential for nephrocyte function. Rab7 silencing dramatically increased clear vacuoles and reduced lysosomes. Rab11 silencing increased lysosomes and reduced clear vacuoles. Our results suggest that Rab5 mediates endocytosis that is essential for the maintenance of functionally critical nephrocyte plasma membrane structures and that Rabs 7 and 11 mediate alternative downstream vesicle trafficking pathways leading to protein degradation and membrane recycling, respectively. Elucidating molecular pathways underlying nephrocyte function has the potential to yield important insights into human kidney cell physiology and mechanisms of cell injury that lead to disease. The Drosophila nephrocyte is emerging as a useful in vivo model system for molecular target identification and initial testing of therapeutic approaches in humans.

  17. Resources for Functional Genomics Studies in Drosophila melanogaster

    Science.gov (United States)

    Mohr, Stephanie E.; Hu, Yanhui; Kim, Kevin; Housden, Benjamin E.; Perrimon, Norbert

    2014-01-01

    Drosophila melanogaster has become a system of choice for functional genomic studies. Many resources, including online databases and software tools, are now available to support design or identification of relevant fly stocks and reagents or analysis and mining of existing functional genomic, transcriptomic, proteomic, etc. datasets. These include large community collections of fly stocks and plasmid clones, “meta” information sites like FlyBase and FlyMine, and an increasing number of more specialized reagents, databases, and online tools. Here, we introduce key resources useful to plan large-scale functional genomics studies in Drosophila and to analyze, integrate, and mine the results of those studies in ways that facilitate identification of highest-confidence results and generation of new hypotheses. We also discuss ways in which existing resources can be used and might be improved and suggest a few areas of future development that would further support large- and small-scale studies in Drosophila and facilitate use of Drosophila information by the research community more generally. PMID:24653003

  18. A map of taste neuron projections in the Drosophila CNS

    Indian Academy of Sciences (India)

    We provide a map of the projections of taste neurons in the CNS of Drosophila. Using a collection of 67 GAL4 drivers representing the entire repertoire of Gr taste receptors, we systematically map the projections of neurons expressing these drivers in the thoracico-abdominal ganglion and the suboesophageal ganglion ...

  19. Dynamical Analysis of bantam-Regulated Drosophila Circadian Rhythm Model

    Science.gov (United States)

    Li, Ying; Liu, Zengrong

    MicroRNAs (miRNAs) interact with 3‧untranslated region (UTR) elements of target genes to regulate mRNA stability or translation, and play a crucial role in regulating many different biological processes. bantam, a conserved miRNA, is involved in several functions, such as regulating Drosophila growth and circadian rhythm. Recently, it has been discovered that bantam plays a crucial role in the core circadian pacemaker. In this paper, based on experimental observations, a detailed dynamical model of bantam-regulated circadian clock system is developed to show the post-transcriptional behaviors in the modulation of Drosophila circadian rhythm, in which the regulation of bantam is incorporated into a classical model. The dynamical behaviors of the model are consistent with the experimental observations, which shows that bantam is an important regulator of Drosophila circadian rhythm. The sensitivity analysis of parameters demonstrates that with the regulation of bantam the system is more sensitive to perturbations, indicating that bantam regulation makes it easier for the organism to modulate its period against the environmental perturbations. The effectiveness in rescuing locomotor activity rhythms of mutated flies shows that bantam is necessary for strong and sustained rhythms. In addition, the biological mechanisms of bantam regulation are analyzed, which may help us more clearly understand Drosophila circadian rhythm regulated by other miRNAs.

  20. Species and genetic diversity in the genus Drosophila inhabiting the ...

    Indian Academy of Sciences (India)

    Genus Drosophila belongs to the family Drosophilidae (class Insecta, order Diptera), characterized by rich species diversity at global level and also in India, which is a megadiverse country. At global level, more than 1500 species have been described and several thousands estimated. Hawaiian Islands are particularly rich ...

  1. Is premating isolation in Drosophila overestimated due to ...

    Indian Academy of Sciences (India)

    ... give rise to statistically significant results in multiple-choice mating tests, leading to positive isolation values and the artifactual inference of sexual isolation between populations. This fact agrees with a nonrandom excess of significant positive tests found in a review of the literature of Drosophila intraspecific mating choice.

  2. Evolution of genes and genomes on the Drosophila phylogeny

    DEFF Research Database (Denmark)

    Clark, Andrew G; Eisen, Michael B; Smith, Douglas R

    2007-01-01

    Comparative analysis of multiple genomes in a phylogenetic framework dramatically improves the precision and sensitivity of evolutionary inference, producing more robust results than single-genome analyses can provide. The genomes of 12 Drosophila species, ten of which are presented here for the ...

  3. Fluctuation-Driven Neural Dynamics Reproduce Drosophila Locomotor Patterns.

    Directory of Open Access Journals (Sweden)

    Andrea Maesani

    2015-11-01

    Full Text Available The neural mechanisms determining the timing of even simple actions, such as when to walk or rest, are largely mysterious. One intriguing, but untested, hypothesis posits a role for ongoing activity fluctuations in neurons of central action selection circuits that drive animal behavior from moment to moment. To examine how fluctuating activity can contribute to action timing, we paired high-resolution measurements of freely walking Drosophila melanogaster with data-driven neural network modeling and dynamical systems analysis. We generated fluctuation-driven network models whose outputs-locomotor bouts-matched those measured from sensory-deprived Drosophila. From these models, we identified those that could also reproduce a second, unrelated dataset: the complex time-course of odor-evoked walking for genetically diverse Drosophila strains. Dynamical models that best reproduced both Drosophila basal and odor-evoked locomotor patterns exhibited specific characteristics. First, ongoing fluctuations were required. In a stochastic resonance-like manner, these fluctuations allowed neural activity to escape stable equilibria and to exceed a threshold for locomotion. Second, odor-induced shifts of equilibria in these models caused a depression in locomotor frequency following olfactory stimulation. Our models predict that activity fluctuations in action selection circuits cause behavioral output to more closely match sensory drive and may therefore enhance navigation in complex sensory environments. Together these data reveal how simple neural dynamics, when coupled with activity fluctuations, can give rise to complex patterns of animal behavior.

  4. Coexistence of three different Drosophila species by rescheduling ...

    Indian Academy of Sciences (India)

    We present evidence for coexistence of three different Drosophila species by rescheduling their life history traits in a natural population using the same resource, at the ... Genetics Laboratory, Department of Zoology, Banaras Hindu University, Varanasi 221 005, India; Department of Zoology, Institute of Basic Sciences, ...

  5. Drosophila phosphopantothenoylcysteine synthetase is required for tissue morphogenesis during oogenesis

    NARCIS (Netherlands)

    Bosveld, Floris; Rana, Anil; Lemstra - Wierenga, Willemina; Kampinga, Harm; Sibon, Ody

    2008-01-01

    Background: Coenzyme A (CoA) is an essential metabolite, synthesized from vitamin B5 by the subsequent action of five enzymes: PANK, PPCS, PPCDC, PPAT and DPCK. Mutations in Drosophila dPPCS disrupt female fecundity and in this study we analyzed the female sterile phenotype of dPPCS mutants in

  6. Odour avoidance learning in the larva of Drosophila melanogaster

    Indian Academy of Sciences (India)

    2008-12-11

    Dec 11, 2008 ... Drosophila larvae can be trained to avoid odours associated with electric shock. We describe here, an improved method of aversive conditioning and a procedure for decomposing learning retention curve that enables us to do a quantitative analysis of memory phases, short term (STM), middle term (MTM) ...

  7. Muscarinic ACh Receptors Contribute to Aversive Olfactory Learning in Drosophila.

    Science.gov (United States)

    Silva, Bryon; Molina-Fernández, Claudia; Ugalde, María Beatriz; Tognarelli, Eduardo I; Angel, Cristian; Campusano, Jorge M

    2015-01-01

    The most studied form of associative learning in Drosophila consists in pairing an odorant, the conditioned stimulus (CS), with an unconditioned stimulus (US). The timely arrival of the CS and US information to a specific Drosophila brain association region, the mushroom bodies (MB), can induce new olfactory memories. Thus, the MB is considered a coincidence detector. It has been shown that olfactory information is conveyed to the MB through cholinergic inputs that activate acetylcholine (ACh) receptors, while the US is encoded by biogenic amine (BA) systems. In recent years, we have advanced our understanding on the specific neural BA pathways and receptors involved in olfactory learning and memory. However, little information exists on the contribution of cholinergic receptors to this process. Here we evaluate for the first time the proposition that, as in mammals, muscarinic ACh receptors (mAChRs) contribute to memory formation in Drosophila. Our results show that pharmacological and genetic blockade of mAChRs in MB disrupts olfactory aversive memory in larvae. This effect is not explained by an alteration in the ability of animals to respond to odorants or to execute motor programs. These results show that mAChRs in MB contribute to generating olfactory memories in Drosophila.

  8. Limitations of the RAPD technique in phylogeny reconstruction in Drosophila

    NARCIS (Netherlands)

    van de Zande, Louis; Bijlsma, R.

    In this study the limitations of the RAPD technique for phylogenetic analysis of very closely related and less related species of Drosophila are examined. In addition, assumptions of positional homology of amplified fragments in different species are examined by cross-hybridization of RAPD

  9. Active sampling and decision making in Drosophila chemotaxis

    NARCIS (Netherlands)

    Gomez-Marin, Alex; Stephens, Greg J; Louis, Matthieu

    2011-01-01

    The ability to respond to chemical stimuli is fundamental to the survival of motile organisms, but the strategies underlying odour tracking remain poorly understood. Here we show that chemotaxis in Drosophila melanogaster larvae is an active sampling process analogous to sniffing in vertebrates.

  10. Gene structure of Drosophila diaphorase-1: diversity of transcripts in ...

    Indian Academy of Sciences (India)

    Moreover, we obtained only the third transcript (CG4199-RC) in the sample of testis from adult flies and the fourth transcript (CG4199-RD) in an embryo sample. None of the other five transcripts were found in the samples of different organs and in the samples obtained at different stages of Drosophila development.

  11. The Drosophila bipectinata species complex: degree of sterility and ...

    Indian Academy of Sciences (India)

    Genetica 140, 75–81. Banerjee P. and Singh B. N. 2015 Interspecific hybridization does not affect the level of fluctuating asymmetry (FA) in the. Drosophila bipectinata species complex. Genetica 143, 459–471. Barbash B. A., Awadalla P. and Parone A. M. 2004 Functional divergence caused by ancient positive selection of ...

  12. Odour avoidance learning in the larva of Drosophila melanogaster

    Indian Academy of Sciences (India)

    Prakash

    with electric shock in normal and mutant larvae and Tully et al. reported the passage of olfactory ... Drosophila larvae can be trained to avoid odours associated with electric shock. We describe here, an improved method of ..... Pairing odour with shock drives the larvae to the opposite zone. Preference learning index PLI.

  13. Gene structure of Drosophila diaphorase-1: diversity of transcripts in ...

    Indian Academy of Sciences (India)

    Drosophila culture. Adult D. melanogaster were maintained on a standard corn- meal/agar medium at 25. ◦. C. Embryos (2 h), larvae (third in- star), pupae (light and dark) were selected from mass cul- tures. The different organs (ovaries, testes and heads) were collected from adult flies. RT-PCR. The cDNA samples from ...

  14. Drosophila simulans Lethal hybrid rescue mutation (Lhr) rescues ...

    Indian Academy of Sciences (India)

    Home; Journals; Journal of Genetics; Volume 86; Issue 3. Drosophila simulans Lethal hybrid rescue mutation (Lhr) rescues inviable hybrids by restoring X chromosomal dosage compensation and causes fluctuating asymmetry of development. R. N. Chatterjee P. Chatterjee A. Pal M. Pal-Bhadra. Research Article Volume 86 ...

  15. Immunohistological techniques for studying the Drosophila male germline stem cell.

    Science.gov (United States)

    Singh, Shree Ram; Hou, Steven X

    2008-01-01

    Stem cells are undifferentiated cells that have a remarkable ability to self-renew and produce differentiated cells that support normal development and tissue homeostasis. This unique capacity makes stem cells a powerful tool for future regenerative medicine and gene therapy. Accumulative evidence suggests that stem cell self-renewal or differentiation is controlled by both intrinsic and extrinsic factors, and that deregulation of stem cell behavior results in cancer formation, tissue degeneration, and premature aging. The Drosophila testis provides an excellent in vivo model for studying and understanding the fundamental cellular and molecular mechanisms controlling stem cell behavior and the relationship between niches and stem cells. At the tip of the Drosophila testes, germline stem cells (GSCs) and somatic stem cells (SSCs) contact each other and share common niches (known as a hub) to maintain spermatogenesis. Signaling pathways, such as the Janus kinase (JAK)/signal transducer and activator of transcription (STAT), bone morphogenetic protein (BMP), ras-associated protein-guanine nucleotide exchange factor for small GTPase (Rap-GEF), and epidermal growth factor receptor (EGFR)/mitogen-activated protein kinase (MAPK), are known to regulate self-renewal or differentiation of Drosophila male germline stem cells. We describe the detailed in vivo immunohistological protocols that mark GSCs, SSCs, and their progeny in Drosophila testes.

  16. Drosophila simulans Lethal hybrid rescue mutation (Lhr) rescues ...

    Indian Academy of Sciences (India)

    yellow (y), and (c) wild type strain of D. simulans (Califor- nia 0251.163 strain) were used for present investigation. Flies were raised on standard Drosophila food medium containing corn-meal – molasses – yeast – agar-agar. Propi- onic acid was added as a mold inhibitor. Adults and all de- velopmental stages were reared ...

  17. Coexistence of three different Drosophila species by rescheduling ...

    Indian Academy of Sciences (India)

    Unknown

    We present evidence for coexistence of three different Drosophila species by rescheduling their life history traits in a natural population using the same resource, at the same time and same place. D. ananassae has faster larval develop- ment time (DT) and faster DT(egg-fly) than other two species thus utilizing the ...

  18. Monitoring Drosophila suzukii Matsumura in Oregon, USA sweet cherry orchards.

    Science.gov (United States)

    Drosophila suzukii rapidly became a significant cherry pest in the western United States after it was observed damaging cherries in 2009 in California. It has caused significant damage to ripening cherries in all major USA cherry production districts leading to increased management costs and reduced...

  19. Ultradian rhythm unmasked in the Pdf clock mutant of Drosophila

    Indian Academy of Sciences (India)

    2014-07-20

    Jul 20, 2014 ... A diverse range of organisms shows physiological and behavioural rhythms with various periods. Extensive studies have been performed to elucidate the molecular mechanisms of circadian rhythms with an approximately 24 h period in both Drosophila and mammals, while less attention has been paid to ...

  20. Ultradian rhythm unmasked in the Pdf clock mutant of Drosophila

    Indian Academy of Sciences (India)

    A diverse range of organisms shows physiological and behavioural rhythms with various periods. Extensive studies have been performed to elucidate the molecular mechanisms of circadian rhythms with an approximately 24 h period in both Drosophila and mammals, while less attention has been paid to ultradian rhythms ...

  1. is pupation height affected by circadian organization in Drosophila ...

    Indian Academy of Sciences (India)

    Unknown

    and reproduction related events that constitute the life- history of an .... of light are not perceived by the Drosophila circadian system. (Chandrashekaran et al. 1973) ..... J. Insect. Physiol. 13, 1547–1568. Rizki M. T. M. and Davis C. G. Jr. 1953 Light as an ecological determinant of interspecific competition between D. willistoni.

  2. DIRECT SELECTION ON LIFE-SPAN IN DROSOPHILA-MELANOGASTER

    NARCIS (Netherlands)

    ZWAAN, B; BIJLSMA, R; HOEKSTRA, RE

    An important issue in the study of the evolution of aging in Drosophila melanogaster is whether decreased early fecundity is inextricably coupled with increased life span in selection experiments on age at reproduction. Here, this problem has been tackled using an experimental design in which

  3. Genotype–environment interaction for total fitness in Drosophila

    Indian Academy of Sciences (India)

    2008-12-23

    Dec 23, 2008 ... A fundamental assumption of models for the maintenance of genetic variation by environmental heterogeneity is that selection favours different genotypes in different environments. Here, I use a method for measuring total fitness of chromosomal heterozygotes in Drosophila melanogaster to assess ...

  4. Metabolic Activity of Radish Sprouts Derived Isothiocyanates in Drosophila melanogaster

    Science.gov (United States)

    Baenas, Nieves; Piegholdt, Stefanie; Schloesser, Anke; Moreno, Diego A.; García-Viguera, Cristina; Rimbach, Gerald; Wagner, Anika E.

    2016-01-01

    We used Drosophila melanogaster as a model system to study the absorption, metabolism and potential health benefits of plant bioactives derived from radish sprouts (Raphanus sativus cv. Rambo), a Brassicaceae species rich in glucosinolates and other phytochemicals. Flies were subjected to a diet supplemented with lyophilized radish sprouts (10.6 g/L) for 10 days, containing high amounts of glucoraphenin and glucoraphasatin, which can be hydrolyzed by myrosinase to the isothiocyanates sulforaphene and raphasatin, respectively. We demonstrate that Drosophila melanogaster takes up and metabolizes isothiocyanates from radish sprouts through the detection of the metabolite sulforaphane-cysteine in fly homogenates. Moreover, we report a decrease in the glucose content of flies, an upregulation of spargel expression, the Drosophila homolog of the mammalian PPARγ-coactivator 1 α, as well as the inhibition of α-amylase and α-glucosidase in vitro. Overall, we show that the consumption of radish sprouts affects energy metabolism in Drosophila melanogaster which is reflected by lower glucose levels and an increased expression of spargel, a central player in mitochondrial biogenesis. These processes are often affected in chronic diseases associated with aging, including type II diabetes mellitus. PMID:26901196

  5. Genetic Analysis of Micro-environmental Plasticity in Drosophila melanogaster

    DEFF Research Database (Denmark)

    Morgante, Fabio; Sorensen, Daniel A; Sørensen, Peter

    be genetically variable. This study utilized the Drosophila Genetic Reference Panel (DGRP) to accurately estimate the genetic variance of micro-environmental plasticity for chill coma recovery time and startle response. Estimates of broad sense heritabilities for both traits are substantial (from 0.51 to 0...

  6. Modern aspects of Drosophila melanogaster radiobiology. Apoptosis and aging

    International Nuclear Information System (INIS)

    Zajnulin, V.G.; Moskalev, A.A.; Shaposhnikov, M.V.; Taskaev, A.I.

    1999-01-01

    An attempt is made to explain the radioinduced change in life span of multicell organisms by deregulation of apoptosis processes. Radiation capacity to induce the apoptosis is shown in Drosophila as well. Assumption is made that radiation changes the rate of natural organism aging deregulating the control of apoptosis mechanisms [ru

  7. Nearly Neutral Evolution Across the Drosophila melanogaster Genome

    DEFF Research Database (Denmark)

    Esteve, David Castellano; James, Jennifer; Eyre-Walker, Adam

    2017-01-01

    Under the nearly neutral theory of molecular evolution the proportion of effectively neutral mutations is expected to depend upon the effective population size (Ne). Here we investigate whether this is the case across the genome of Drosophila melanogaster using polymorphism data from 128 North...

  8. P element excision in drosophila melanogaster and related drosophilids

    Science.gov (United States)

    The frequency of P element excision and the structure of the resulting excision products were determined in three drosophilid species, Drosophila melanogaster, D. virilis, and Chymomyza procnemis. A transient P element mobility assay was conducted in the cells of developing insect embryos, but unlik...

  9. mutations of Drosophila melanogaster cause nonrandom cell death ...

    Indian Academy of Sciences (India)

    In Drosophila melanogaster, the intersex (ix) is a terminally positioned gene in somatic sex determination hierarchy and function with the female specific product of double sex (DSXF) to implement female sexual differentiation. The null phenotype of ix is to transform diplo-X individuals into intersexes while leaving haplo-X ...

  10. Handling Alters Aggression and "Loser" Effect Formation in "Drosophila Melanogaster"

    Science.gov (United States)

    Trannoy, Severine; Chowdhury, Budhaditya; Kravitz, Edward A.

    2015-01-01

    In "Drosophila," prior fighting experience influences the outcome of later contests: losing a fight increases the probability of losing second contests, thereby revealing "loser" effects that involve learning and memory. In these experiments, to generate and quantify the behavioral changes observed as consequences of losing…

  11. The metabolic profile of long-lived Drosophila melanogaster

    DEFF Research Database (Denmark)

    Sarup, Pernille Merete; Pedersen, Simon Metz Mariendal; Nielsen, Niels Chr

    2012-01-01

    We investigated the age-related changes in the metabolic profile of male Drosophila melanogaster and compared the metabolic profile of flies selected for increased longevity to that of control flies of equal age. We found clear differences in metabolite composition between selection regimes...

  12. Inbreeding affects locomotor activity in Drosophila melanogaster at different ages

    DEFF Research Database (Denmark)

    Manenti, Tommaso; Pertoldi, Cino; Nasiri Moghadam, Neda

    2015-01-01

    The ability to move is essential for many behavioural traits closely related to fitness. Here we studied the effect of inbreeding on locomotor activity (LA) of Drosophila melanogaster at different ages under both dark and light regimes. We expected to find a decreased LA in inbred lines compared...

  13. Characterization of reproductive dormancy in male Drosophila melanogaster

    Czech Academy of Sciences Publication Activity Database

    Kubrak, O. I.; Kučerová, Lucie; Theopold, U.; Nylin, S.; Nässel, D. R.

    2016-01-01

    Roč. 7, NOV 24 (2016), č. článku 572. ISSN 1664-042X Institutional support: RVO:60077344 Keywords : Drosophila melanogaster * diapause * reproduction Subject RIV: ED - Physiology Impact factor: 4.134, year: 2016 http://journal.frontiersin.org/article/10.3389/fphys.2016.00572/full

  14. Late replication domains are evolutionary conserved in the Drosophila genome.

    Science.gov (United States)

    Andreyenkova, Natalya G; Kolesnikova, Tatyana D; Makunin, Igor V; Pokholkova, Galina V; Boldyreva, Lidiya V; Zykova, Tatyana Yu; Zhimulev, Igor F; Belyaeva, Elena S

    2013-01-01

    Drosophila chromosomes are organized into distinct domains differing in their predominant chromatin composition, replication timing and evolutionary conservation. We show on a genome-wide level that genes whose order has remained unaltered across 9 Drosophila species display late replication timing and frequently map to the regions of repressive chromatin. This observation is consistent with the existence of extensive domains of repressive chromatin that replicate extremely late and have conserved gene order in the Drosophila genome. We suggest that such repressive chromatin domains correspond to a handful of regions that complete replication at the very end of S phase. We further demonstrate that the order of genes in these regions is rarely altered in evolution. Substantial proportion of such regions significantly coincide with large synteny blocks. This indicates that there are evolutionary mechanisms maintaining the integrity of these late-replicating chromatin domains. The synteny blocks corresponding to the extremely late-replicating regions in the D. melanogaster genome consistently display two-fold lower gene density across different Drosophila species.

  15. Dosage compensation and demasculinization of X chromosomes in Drosophila.

    Science.gov (United States)

    Bachtrog, Doris; Toda, Nicholas R T; Lockton, Steven

    2010-08-24

    The X chromosome of Drosophila shows a deficiency of genes with male-biased expression, whereas mammalian X chromosomes are enriched for spermatogenesis genes expressed premeiosis and multicopy testis genes. Meiotic X-inactivation and sexual antagonism can only partly account for these patterns. Here, we show that dosage compensation (DC) in Drosophila may contribute substantially to the depletion of male genes on the X. To equalize expression between X-linked and autosomal genes in the two sexes, male Drosophila hypertranscribe their single X, whereas female mammals silence one of their two X chromosomes. We combine fine-scale mapping data of dosage compensated regions with genome-wide expression profiles and show that most male-biased genes on the D. melanogaster X are located outside dosage compensated regions. Additionally, X-linked genes that have newly acquired male-biased expression in D. melanogaster are less likely to be dosage compensated, and parental X-linked genes that gave rise to an autosomal male-biased retrocopy are more likely located within compensated regions. This suggests that DC contributes to the observed demasculinization of X chromosomes in Drosophila, both by limiting the emergence of male-biased expression patterns of existing X genes, and by contributing to gene trafficking of male genes off the X. Copyright 2010 Elsevier Ltd. All rights reserved.

  16. Gene structure of Drosophila diaphorase-1: diversity of transcripts in ...

    Indian Academy of Sciences (India)

    [Ivanova P. M., Dunkov B. H. and Ralchev K. H. 2008 Gene structure of Drosophila diaphorase-1: diversity of transcripts in adult males and females, in different ... ditions, close to 60 kD, indicating a monomeric structure. (Ralchev et al. .... Diversity in the exon–intron organization of diaphorase-1 gene. The six transcripts with ...

  17. Species and genetic diversity in the genus Drosophila inhabiting the ...

    Indian Academy of Sciences (India)

    These species are D. ananassae, D. melanogaster,. D. bipectinata, D. nasuta and a few others. The work done was with particular reference to inversion and allozyme poly- morphisms and .... species diversity, the scenario of Drosophila research is not ..... vary in their susceptibility to starvation owing to the differ- ence in ...

  18. Status of research on Drosophila ananassae at global level

    Indian Academy of Sciences (India)

    Extensive research work on D. ananassae has been done by numerous researchers per- taining to ... Also, the polytene chromosomes of. Keywords. genetic peculiarities; status of research; global level; Drosophila ananassae. Journal of Genetics, Vol. 94, No. ..... starvation because of difference in their propensity to store.

  19. Ultradian rhythm unmasked in the Pdf clock mutant of Drosophila

    Indian Academy of Sciences (India)

    ... kept under constant dark conditions. In particular, the Pigment-dispersing factor mutant (Pdf01) demonstrated a precise and robust ultradian rhythmicity, which was not temperature compensated. Our results suggest that Drosophila has an endogenous ultradian oscillator that is masked by circadian rhythmic behaviours.

  20. The route of infection determines Wolbachia antibacterial protection in Drosophila

    Science.gov (United States)

    Gupta, Vanika; Vasanthakrishnan, Radhakrishnan B.; Siva-Jothy, Jonathon; Monteith, Katy M.; Brown, Sam P.

    2017-01-01

    Bacterial symbionts are widespread among metazoans and provide a range of beneficial functions. Wolbachia-mediated protection against viral infection has been extensively demonstrated in Drosophila. In mosquitoes that are artificially transinfected with Drosophila melanogaster Wolbachia (wMel), protection from both viral and bacterial infections has been demonstrated. However, no evidence for Wolbachia-mediated antibacterial protection has been demonstrated in Drosophila to date. Here, we show that the route of infection is key for Wolbachia-mediated antibacterial protection. Drosophila melanogaster carrying Wolbachia showed reduced mortality during enteric—but not systemic—infection with the opportunist pathogen Pseudomonas aeruginosa. Wolbachia-mediated protection was more pronounced in male flies and is associated with increased early expression of the antimicrobial peptide Attacin A, and also increased expression of a reactive oxygen species detoxification gene (Gst D8). These results highlight that the route of infection is important for symbiont-mediated protection from infection, that Wolbachia can protect hosts by eliciting a combination of resistance and disease tolerance mechanisms, and that these effects are sexually dimorphic. We discuss the importance of using ecologically relevant routes of infection to gain a better understanding of symbiont-mediated protection. PMID:28592678

  1. Tandem Duplications and the Limits of Natural Selection in Drosophila yakuba and Drosophila simulans.

    Directory of Open Access Journals (Sweden)

    Rebekah L Rogers

    Full Text Available Tandem duplications are an essential source of genetic novelty, and their variation in natural populations is expected to influence adaptive walks. Here, we describe evolutionary impacts of recently-derived, segregating tandem duplications in Drosophila yakuba and Drosophila simulans. We observe an excess of duplicated genes involved in defense against pathogens, insecticide resistance, chorion development, cuticular peptides, and lipases or endopeptidases associated with the accessory glands across both species. The observed agreement is greater than expectations on chance alone, suggesting large amounts of convergence across functional categories. We document evidence of widespread selection on the D. simulans X, suggesting adaptation through duplication is common on the X. Despite the evidence for positive selection, duplicates display an excess of low frequency variants consistent with largely detrimental impacts, limiting the variation that can effectively facilitate adaptation. Standing variation for tandem duplications spans less than 25% of the genome in D. yakuba and D. simulans, indicating that evolution will be strictly limited by mutation, even in organisms with large population sizes. Effective whole gene duplication rates are low at 1.17 × 10-9 per gene per generation in D. yakuba and 6.03 × 10-10 per gene per generation in D. simulans, suggesting long wait times for new mutations on the order of thousands of years for the establishment of sweeps. Hence, in cases where adaptation depends on individual tandem duplications, evolution will be severely limited by mutation. We observe low levels of parallel recruitment of the same duplicated gene in different species, suggesting that the span of standing variation will define evolutionary outcomes in spite of convergence across gene ontologies consistent with rapidly evolving phenotypes.

  2. Positive and purifying selection on the Drosophila Y chromosome.

    Science.gov (United States)

    Singh, Nadia D; Koerich, Leonardo B; Carvalho, Antonio Bernardo; Clark, Andrew G

    2014-10-01

    Y chromosomes, with their reduced effective population size, lack of recombination, and male-limited transmission, present a unique collection of constraints for the operation of natural selection. Male-limited transmission may greatly increase the efficacy of selection for male-beneficial mutations, but the reduced effective size also inflates the role of random genetic drift. Together, these defining features of the Y chromosome are expected to influence rates and patterns of molecular evolution on the Y as compared with X-linked or autosomal loci. Here, we use sequence data from 11 genes in 9 Drosophila species to gain insight into the efficacy of natural selection on the Drosophila Y relative to the rest of the genome. Drosophila is an ideal system for assessing the consequences of Y-linkage for molecular evolution in part because the gene content of Drosophila Y chromosomes is highly dynamic, with orthologous genes being Y-linked in some species whereas autosomal in others. Our results confirm the expectation that the efficacy of natural selection at weakly selected sites is reduced on the Y chromosome. In contrast, purifying selection on the Y chromosome for strongly deleterious mutations does not appear to be compromised. Finally, we find evidence of recurrent positive selection for 4 of the 11 genes studied here. Our results thus highlight the variable nature of the mode and impact of natural selection on the Drosophila Y chromosome. © The Author 2014. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  3. Cellular and developmental adaptations to hypoxia: a Drosophila perspective.

    Science.gov (United States)

    Romero, Nuria Magdalena; Dekanty, Andrés; Wappner, Pablo

    2007-01-01

    The fruit fly Drosophila melanogaster, a widely utilized genetic model, is highly resistant to oxygen starvation and is beginning to be used for studying physiological, developmental, and cellular adaptations to hypoxia. The Drosophila respiratory (tracheal) system has features in common with the mammalian circulatory system so that an angiogenesis-like response occurs upon exposure of Drosophila larvae to hypoxia. A hypoxia-responsive system homologous to mammalian hypoxia-inducible factor (HIF) has been described in the fruit fly, where Fatiga is a Drosophila oxygen-dependent HIF prolyl hydroxylase, and the basic helix-loop-helix Per/ARNT/Sim (bHLH-PAS) proteins Sima and Tango are, respectively, the Drosophila homologues of mammalian HIF-alpha (alpha) and HIF-beta (beta). Tango is constitutively expressed regardless of oxygen tension and, like in mammalian cells, Sima is controlled at the level of protein degradation and subcellular localization. Sima is critically required for development in hypoxia, but, unlike mammalian model systems, it is dispensable for development in normoxia. In contrast, fatiga mutant alleles are all lethal; however, strikingly, viability to adulthood is restored in fatiga sima double mutants, although these double mutants are not entirely normal, suggesting that Fatiga has Sima-independent functions in fly development. Studies in cell culture and in vivo have revealed that Sima is activated by the insulin receptor (InR) and target-of-rapamycin (TOR) pathways. Paradoxically, Sima is a negative regulator of growth. This suggests that Sima is engaged in a negative feedback loop that limits growth upon stimulation of InR/TOR pathways.

  4. Effect of sterol metabolism in the yeast-Drosophila system on the frequency of radiation-induced aneuploidy in the Drosophila melanogaster oocytes

    International Nuclear Information System (INIS)

    Savitskii, V.V.; Luchnikova, E.M.; Inge-Vechtomov, S.G.

    1986-01-01

    The effect of sterol metabolism on induced mutagenesis of Drosophila melanogaster was studied in the ecogenetic system of yeast-Drosophila. Sterol deficiency was created in Drosophila by using the biomass of live cells of Saccharomyces cerevisiae strain 9-2-P712 till mutation in locus nys/sup r1/ blocking the synthesis of ergosterol as the food. It was found that rearing of Drosophila females on the mutant yeast increases the frequency of loss and nondisjunction of X chromosomes induced in mature oocytes by X rays (1000 R). Addition of 0.1% of cholesterol solution in 10% ethanol to the yeast biomass restores the resistance of oocyte to X irradiation to the control level. The possible hormonal effect on membrane leading to increased radiation-induced aneuploidy in Drosophila and the role of sterol metabolism in determining the resistance to various damaging factors are discussed

  5. Genome-wide identification of phospho-regulators of Wnt signaling in Drosophila.

    Science.gov (United States)

    Swarup, Sharan; Pradhan-Sundd, Tirthadipa; Verheyen, Esther M

    2015-04-15

    Evolutionarily conserved intercellular signaling pathways regulate embryonic development and adult tissue homeostasis in metazoans. The precise control of the state and amplitude of signaling pathways is achieved in part through the kinase- and phosphatase-mediated reversible phosphorylation of proteins. In this study, we performed a genome-wide in vivo RNAi screen for kinases and phosphatases that regulate the Wnt pathway under physiological conditions in the Drosophila wing disc. Our analyses have identified 54 high-confidence kinases and phosphatases capable of modulating the Wnt pathway, including 22 novel regulators. These candidates were also assayed for a role in the Notch pathway, and numerous phospho-regulators were identified. Additionally, each regulator of the Wnt pathway was evaluated in the wing disc for its ability to affect the mechanistically similar Hedgehog pathway. We identified 29 dual regulators that have the same effect on the Wnt and Hedgehog pathways. As proof of principle, we established that Cdc37 and Gilgamesh/CK1γ inhibit and promote signaling, respectively, by functioning at analogous levels of these pathways in both Drosophila and mammalian cells. The Wnt and Hedgehog pathways function in tandem in multiple developmental contexts, and the identification of several shared phospho-regulators serve as potential nodes of control under conditions of aberrant signaling and disease. © 2015. Published by The Company of Biologists Ltd.

  6. Asymmetrical reinforcement and Wolbachia infection in Drosophila.

    Directory of Open Access Journals (Sweden)

    John Jaenike

    2006-10-01

    Full Text Available Reinforcement refers to the evolution of increased mating discrimination against heterospecific individuals in zones of geographic overlap and can be considered a final stage in the speciation process. One the factors that may affect reinforcement is the degree to which hybrid matings result in the permanent loss of genes from a species' gene pool. Matings between females of Drosophila subquinaria and males of D. recens result in high levels of offspring mortality, due to interspecific cytoplasmic incompatibility caused by Wolbachia infection of D. recens. Such hybrid inviability is not manifested in matings between D. recens females and D. subquinaria males. Here we ask whether the asymmetrical hybrid inviability is associated with a corresponding asymmetry in the level of reinforcement. The geographic ranges of D. recens and D. subquinaria were found to overlap across a broad belt of boreal forest in central Canada. Females of D. subquinaria from the zone of sympatry exhibit much stronger levels of discrimination against males of D. recens than do females from allopatric populations. In contrast, such reproductive character displacement is not evident in D. recens, consistent with the expected effects of unidirectional cytoplasmic incompatibility. Furthermore, there is substantial behavioral isolation within D. subquinaria, because females from populations sympatric with D. recens discriminate against allopatric conspecific males, whereas females from populations allopatric with D. recens show no discrimination against any conspecific males. Patterns of general genetic differentiation among populations are not consistent with patterns of behavioral discrimination, which suggests that the behavioral isolation within D. subquinaria results from selection against mating with Wolbachia-infected D. recens. Interspecific cytoplasmic incompatibility may contribute not only to post-mating isolation, an effect already widely recognized, but also to

  7. System identification of Drosophila olfactory sensory neurons.

    Science.gov (United States)

    Kim, Anmo J; Lazar, Aurel A; Slutskiy, Yevgeniy B

    2011-02-01

    The lack of a deeper understanding of how olfactory sensory neurons (OSNs) encode odors has hindered the progress in understanding the olfactory signal processing in higher brain centers. Here we employ methods of system identification to investigate the encoding of time-varying odor stimuli and their representation for further processing in the spike domain by Drosophila OSNs. In order to apply system identification techniques, we built a novel low-turbulence odor delivery system that allowed us to deliver airborne stimuli in a precise and reproducible fashion. The system provides a 1% tolerance in stimulus reproducibility and an exact control of odor concentration and concentration gradient on a millisecond time scale. Using this novel setup, we recorded and analyzed the in-vivo response of OSNs to a wide range of time-varying odor waveforms. We report for the first time that across trials the response of OR59b OSNs is very precise and reproducible. Further, we empirically show that the response of an OSN depends not only on the concentration, but also on the rate of change of the odor concentration. Moreover, we demonstrate that a two-dimensional (2D) Encoding Manifold in a concentration-concentration gradient space provides a quantitative description of the neuron's response. We then use the white noise system identification methodology to construct one-dimensional (1D) and two-dimensional (2D) Linear-Nonlinear-Poisson (LNP) cascade models of the sensory neuron for a fixed mean odor concentration and fixed contrast. We show that in terms of predicting the intensity rate of the spike train, the 2D LNP model performs on par with the 1D LNP model, with a root mean-square error (RMSE) increase of about 5 to 10%. Surprisingly, we find that for a fixed contrast of the white noise odor waveforms, the nonlinear block of each of the two models changes with the mean input concentration. The shape of the nonlinearities of both the 1D and the 2D LNP model appears to be

  8. A genomic investigation of ecological differentiation between free-living and Drosophila-associated bacteria.

    Science.gov (United States)

    Winans, Nathan J; Walter, Alec; Chouaia, Bessem; Chaston, John M; Douglas, Angela E; Newell, Peter D

    2017-09-01

    Various bacterial taxa have been identified both in association with animals and in the external environment, but the extent to which related bacteria from the two habitat types are ecologically and evolutionarily distinct is largely unknown. This study investigated the scale and pattern of genetic differentiation between bacteria of the family Acetobacteraceae isolated from the guts of Drosophila fruit flies, plant material and industrial fermentations. Genome-scale analysis of the phylogenetic relationships and predicted functions was conducted on 44 Acetobacteraceae isolates, including newly sequenced genomes from 18 isolates from wild and laboratory Drosophila. Isolates from the external environment and Drosophila could not be assigned to distinct phylogenetic groups, nor are their genomes enriched for any different sets of genes or category of predicted gene functions. In contrast, analysis of bacteria from laboratory Drosophila showed they were genetically distinct in their universal capacity to degrade uric acid (a major nitrogenous waste product of Drosophila) and absence of flagellar motility, while these traits vary among wild Drosophila isolates. Analysis of the competitive fitness of Acetobacter discordant for these traits revealed a significant fitness deficit for bacteria that cannot degrade uric acid in culture with Drosophila. We propose that, for wild populations, frequent cycling of Acetobacter between Drosophila and the external environment prevents genetic differentiation by maintaining selection for traits adaptive in both the gut and external habitats. However, laboratory isolates bear the signs of adaptation to persistent association with the Drosophila host under tightly defined environmental conditions. © 2017 John Wiley & Sons Ltd.

  9. Environmental and facility conditions promote singular gravity responses of transcriptome during Drosophila metamorphosis

    Data.gov (United States)

    National Aeronautics and Space Administration — Genome-wide transcriptional profiling showed that reducing gravity levels in the International Space Station (ISS) causes important alterations in Drosophila gene...

  10. Pupal development and pigmentation process of a polka-dotted fruit fly, Drosophila guttifera (Insecta, Diptera).

    Science.gov (United States)

    Fukutomi, Yuichi; Matsumoto, Keiji; Agata, Kiyokazu; Funayama, Noriko; Koshikawa, Shigeyuki

    2017-06-01

    Various organisms have color patterns on their body surfaces, and these color patterns are thought to contribute to physiological regulation, communication with conspecifics, and signaling with the environment. An adult fly of Drosophila guttifera (Insecta: Diptera: Drosophilidae) has melanin pigmentation patterns on its body and wings. Though D. guttifera has been used for research into color pattern formation, how its pupal development proceeds and when the pigmentation starts have not been well studied. In this study, we defined the pupal stages of D. guttifera and measured the pigment content of wing spots from the pupal period to the period after eclosion. Using a transgenic line which carries eGFP connected with an enhancer of yellow, a gene necessary for melanin synthesis, we analyzed the timing at which the yellow enhancer starts to drive eGFP. We also analyzed the distribution of Yellow-producing cells, as indicated by the expression of eGFP during pupal and young adult periods. The results suggested that Yellow-producing cells were removed from wings within 3 h after eclosion, and wing pigmentation continued without epithelial cells. Furthermore, the results of vein cutting experiments showed that the transport of melanin precursors through veins was necessary for wing pigmentation. These results showed the importance of melanin precursors transported through veins and of extracellular factors which were secreted from epithelial cells and left in the cuticle.

  11. Descripción de tres especies nuevas del género Drosophila (Diptera, Drosophilidae en el Ecuador

    Directory of Open Access Journals (Sweden)

    María Luna Figuero

    2013-09-01

    Full Text Available Se encontraron tres especies nuevas de Drosophila entre los individuos colectados en diferentes localidades del Ecuador. Una de las especies nuevas pertenecen al grupo Drosophila willistoni y otra al grupo Drosophila asiri, la tercera especie se encuentra sin agrupar. En todos los muestreos realizados se usaron trampas fabricadas con botellas de plástico agujereadas con cebo de banano y levadura. Las tres especies son: D. (Sophophora neocapnoptera sp. nov., esta especie es similar a D. capnoptera Patterson & Mainland, 1944, sin embargo presentan algunas diferencias en el ala que permiten distinguirlas. Drosophila (Drosophila neoasiri sp. nov., una especie similar a D. asiri Vela & Rafael, 2005, la diferencia más relevante entre las dos especies se observa a nivel del edeago y Drosophila (Drosophila papallacta sp. nov. que por el momento no se encuentra relacionada a ningún grupo de especies del género Drosophila.

  12. RBE-LET relationships of high-LET radiations in drosophila mutations

    International Nuclear Information System (INIS)

    Yoshikawa, Isao; Takatsuji, Toshihiro; Nagano, Masaaki; Takada, Jun; Endo, Satoru; Hoshi, Masaharu

    1999-01-01

    The relative biological effectiveness (RBE) of 252 Cf neutrons and synchrotron-generated high-energy charged particles for mutation induction was evaluated as a function of linear energy transfer (LET), using the loss of heterozygosity for wing-hair mutations and the reversion of the mutant white-ivory eye-color in Drosophila melanogaster. Loss of heterozygosity for wing-hair mutations results predominantly from mitotic crossing over induced in wing anlage cells of larvae, while the reverse mutation of eye-color is due to an intragenic structural change (2.96 kb-DNA excision) in the white locus on the X-chromosome. The measurements were performed in a combined mutation assay system so that induced mutant wing-hair clones as well as revertant eye-color clone can be detected simultaneously in the same individual. Larvae were irradiated at the age of 3 days post oviposition with 252 Cf neutrons, carbon beam or neon beam. For the neutron irradiation, the RBE values for wing-hair mutations were larger than that for eye-color mutation by about 7 fold. The RBE of carbon ions for producing the wing-hair mutations increased with increase in LET. The estimated RBE values were found to be in the range 2 to 6.5 for the wing-hair. For neon beam irradiation, the RBE values for wing-hair mutations peak near 150 keV/μm and decrease with further increase in LET. On the other hand, the RBE values for the induction of the eye-color mutation are nearly unity in 252 Cf neutrons and both ions throughout the LET range irradiated. We discuss the relationships between the initial DNA damage and LET in considering the mechanism of somatic mutation induction. (author)

  13. The costae presenting in high-temperature-induced vestigial wings ...

    Indian Academy of Sciences (India)

    Most of the wings have defects in the wing blade and partially formed wing margin, which are the result of autonomous cell death in the ... [Yang D. 2007 The costae presenting in high-temperature-induced vestigial wings of Drosophila: implications for anterior wing margin formation. J. Genet. .... The relevant gene(s) may be.

  14. Sleep, aging, and lifespan in Drosophila

    Directory of Open Access Journals (Sweden)

    Tononi Giulio

    2010-04-01

    Full Text Available Abstract Background Epidemiological studies in humans suggest that a decrease in daily sleep duration is associated with reduced lifespan, but this issue remains controversial. Other studies in humans also show that both sleep quantity and sleep quality decrease with age. Drosophila melanogaster is a useful model to study aging and sleep, and inheriting mutations affecting the potassium current Shaker results in flies that sleep less and have a shorter lifespan. However, whether the link between short sleep and reduced longevity exists also in wild-type flies is unknown. Similarly, it is unknown whether such a link depends on sleep amount per se, rather than on other factors such as waking activity. Also, sleep quality has been shown to decrease in old flies, but it remains unclear whether aging-related sleep fragmentation is a generalized phenomenon. Results We compared 3 short sleeping mutant lines (Hk1, HkY and Hk2 carrying a mutation in Hyperkinetic, which codes for the beta subunit of the Shaker channel, to wild-type siblings throughout their entire lifespan (all flies kept at 20°C. Hk1 and HkY mutants were short sleeping relative to wild-type controls from day 3 after eclosure, and Hk2 flies became short sleepers about two weeks later. All 3 Hk mutant lines had reduced lifespan relative to wild-type flies. Total sleep time showed a trend to increase in all lines with age, but the effect was most pronounced in Hk1 and HkY flies. In both mutant and wild-type lines sleep quality did not decay with age, but the strong preference for sleep at night declined starting in "middle age". Using Cox regression analysis we found that in Hk1 and HkY mutants and their control lines there was a negative relationship between total sleep amount during the first 2 and 4 weeks of age and hazard (individual risk of death, while no association was found in Hk2 flies and their wild-type controls. Hk1 and HkY mutants and their control lines also showed an

  15. Extracellular matrix and its receptors in Drosophila neural development

    Science.gov (United States)

    Broadie, Kendal; Baumgartner, Stefan; Prokop, Andreas

    2011-01-01

    Extracellular matrix (ECM) and matrix receptors are intimately involved in most biological processes. The ECM plays fundamental developmental and physiological roles in health and disease, including processes underlying the development, maintenance and regeneration of the nervous system. To understand the principles of ECM-mediated functions in the nervous system, genetic model organisms like Drosophila provide simple, malleable and powerful experimental platforms. This article provides an overview of ECM proteins and receptors in Drosophila. It then focuses on their roles during three progressive phases of neural development: 1) neural progenitor proliferation, 2) axonal growth and pathfinding and 3) synapse formation and function. Each section highlights known ECM and ECM-receptor components and recent studies done in mutant conditions to reveal their in vivo functions, all illustrating the enormous opportunities provided when merging work on the nervous system with systematic research into ECM-related gene functions. PMID:21688401

  16. A pulsed magnetic stress applied to Drosophila melanogaster flies

    International Nuclear Information System (INIS)

    Delle Side, D; Giuffreda, E; Nassisi, V; Velardi, L; Bozzetti, M P; Friscini, A; Specchia, V

    2014-01-01

    We report the development of a system to feed pulsed magnetic stress to biological samples. The device is based on a RLC circuit that transforms the energy stored in a high voltage capacitor into a magnetic field inside a coil. The field has been characterized and we found that charging the capacitor with 24 kV results in a peak field of 0.4 T. In order to test its effect, we applied such a stress to the Drosophila melanogaster model and we examined its bio-effects. We analysed, in the germ cells, the effects on the control of specific DNA repetitive sequences that are activated after different environmental stresses. The deregulation of these sequences causes genomic instability and chromosomes breaks leading to sterility. The magnetic field treatment did not produce effects on repetitive sequences in the germ cells of Drosophila. Hence, this field doesn't produce deleterious effects linked to repetitive sequences derepression.

  17. Dissecting neural pathways for forgetting in Drosophila olfactory aversive memory.

    Science.gov (United States)

    Shuai, Yichun; Hirokawa, Areekul; Ai, Yulian; Zhang, Min; Li, Wanhe; Zhong, Yi

    2015-12-01

    Recent studies have identified molecular pathways driving forgetting and supported the notion that forgetting is a biologically active process. The circuit mechanisms of forgetting, however, remain largely unknown. Here we report two sets of Drosophila neurons that account for the rapid forgetting of early olfactory aversive memory. We show that inactivating these neurons inhibits memory decay without altering learning, whereas activating them promotes forgetting. These neurons, including a cluster of dopaminergic neurons (PAM-β'1) and a pair of glutamatergic neurons (MBON-γ4>γ1γ2), terminate in distinct subdomains in the mushroom body and represent parallel neural pathways for regulating forgetting. Interestingly, although activity of these neurons is required for memory decay over time, they are not required for acute forgetting during reversal learning. Our results thus not only establish the presence of multiple neural pathways for forgetting in Drosophila but also suggest the existence of diverse circuit mechanisms of forgetting in different contexts.

  18. Drosophila DNA-Binding Proteins in Polycomb Repression

    Directory of Open Access Journals (Sweden)

    Maksim Erokhin

    2018-01-01

    Full Text Available The formation of individual gene expression patterns in different cell types is required during differentiation and development of multicellular organisms. Polycomb group (PcG proteins are key epigenetic regulators responsible for gene repression, and dysregulation of their activities leads to developmental abnormalities and diseases. PcG proteins were first identified in Drosophila, which still remains the most convenient system for studying PcG-dependent repression. In the Drosophila genome, these proteins bind to DNA regions called Polycomb response elements (PREs. A major role in the recruitment of PcG proteins to PREs is played by DNA-binding factors, several of which have been characterized in detail. However, current knowledge is insufficient for comprehensively describing the mechanism of this process. In this review, we summarize and discuss the available data on the role of DNA-binding proteins in PcG recruitment to chromatin.

  19. Measurement of larval activity in the Drosophila activity monitor.

    Science.gov (United States)

    McParland, Aidan L; Follansbee, Taylor L; Ganter, Geoffrey K

    2015-04-30

    Drosophila larvae are used in many behavioral studies, yet a simple device for measuring basic parameters of larval activity has not been available. This protocol repurposes an instrument often used to measure adult activity, the TriKinetics Drosophila activity monitor (MB5 Multi-Beam Activity Monitor) to study larval activity. The instrument can monitor the movements of animals in 16 individual 8 cm glass assay tubes, using 17 infrared detection beams per tube. Logging software automatically saves data to a computer, recording parameters such as number of moves, times sensors were triggered, and animals' positions within the tubes. The data can then be analyzed to represent overall locomotion and/or position preference as well as other measurements. All data are easily accessible and compatible with basic graphing and data manipulation software. This protocol will discuss how to use the apparatus, how to operate the software and how to run a larval activity assay from start to finish.

  20. Sensory integration and neuromodulatory feedback facilitate Drosophila mechanonociceptive behavior.

    Science.gov (United States)

    Hu, Chun; Petersen, Meike; Hoyer, Nina; Spitzweck, Bettina; Tenedini, Federico; Wang, Denan; Gruschka, Alisa; Burchardt, Lara S; Szpotowicz, Emanuela; Schweizer, Michaela; Guntur, Ananya R; Yang, Chung-Hui; Soba, Peter

    2017-08-01

    Nociception is an evolutionarily conserved mechanism to encode and process harmful environmental stimuli. Like most animals, Drosophila melanogaster larvae respond to a variety of nociceptive stimuli, including noxious touch and temperature, with stereotyped escape responses through activation of multimodal nociceptors. How behavioral responses to these different modalities are processed and integrated by the downstream network remains poorly understood. By combining trans-synaptic labeling, ultrastructural analysis, calcium imaging, optogenetics and behavioral analyses, we uncovered a circuit specific for mechanonociception but not thermonociception. Notably, integration of mechanosensory input from innocuous and nociceptive sensory neurons is required for robust mechanonociceptive responses. We further show that neurons integrating mechanosensory input facilitate primary nociceptive output by releasing short neuropeptide F, the Drosophila neuropeptide Y homolog. Our findings unveil how integration of somatosensory input and neuropeptide-mediated modulation can produce robust modality-specific escape behavior.

  1. Learning the specific quality of taste reinforcement in larval Drosophila.

    Science.gov (United States)

    Schleyer, Michael; Miura, Daisuke; Tanimura, Teiichi; Gerber, Bertram

    2015-01-27

    The only property of reinforcement insects are commonly thought to learn about is its value. We show that larval Drosophila not only remember the value of reinforcement (How much?), but also its quality (What?). This is demonstrated both within the appetitive domain by using sugar vs amino acid as different reward qualities, and within the aversive domain by using bitter vs high-concentration salt as different qualities of punishment. From the available literature, such nuanced memories for the quality of reinforcement are unexpected and pose a challenge to present models of how insect memory is organized. Given that animals as simple as larval Drosophila, endowed with but 10,000 neurons, operate with both reinforcement value and quality, we suggest that both are fundamental aspects of mnemonic processing-in any brain.

  2. Mitochondrial apoptotic pathways induced by Drosophila programmed cell death regulators

    International Nuclear Information System (INIS)

    Claveria, Cristina; Torres, Miguel

    2003-01-01

    Multicellular organisms eliminate unwanted or damaged cells by cell death, a process essential to the maintenance of tissue homeostasis. Cell death is a tightly regulated event, whose alteration by excess or defect is involved in the pathogenesis of many diseases such as cancer, autoimmune syndromes, and neurodegenerative processes. Studies in model organisms, especially in the nematode Caenorhabditis elegans, have been crucial in identifying the key molecules implicated in the regulation and execution of programmed cell death. In contrast, the study of cell death in Drosophila melanogaster, often an excellent model organism, has identified regulators and mechanisms not obviously conserved in other metazoans. Recent molecular and cellular analyses suggest, however, that the mechanisms of action of the main programmed cell death regulators in Drosophila include a canonical mitochondrial pathway

  3. Context generalization in Drosophila visual learning requires the mushroom bodies

    Science.gov (United States)

    Liu, Li; Wolf, Reinhard; Ernst, Roman; Heisenberg, Martin

    1999-08-01

    The world is permanently changing. Laboratory experiments on learning and memory normally minimize this feature of reality, keeping all conditions except the conditioned and unconditioned stimuli as constant as possible. In the real world, however, animals need to extract from the universe of sensory signals the actual predictors of salient events by separating them from non-predictive stimuli (context). In principle, this can be achieved ifonly those sensory inputs that resemble the reinforcer in theirtemporal structure are taken as predictors. Here we study visual learning in the fly Drosophila melanogaster, using a flight simulator,, and show that memory retrieval is, indeed, partially context-independent. Moreover, we show that the mushroom bodies, which are required for olfactory but not visual or tactile learning, effectively support context generalization. In visual learning in Drosophila, it appears that a facilitating effect of context cues for memory retrieval is the default state, whereas making recall context-independent requires additional processing.

  4. Automated protein-DNA interaction screening of Drosophila regulatory elements.

    Science.gov (United States)

    Hens, Korneel; Feuz, Jean-Daniel; Isakova, Alina; Iagovitina, Antonina; Massouras, Andreas; Bryois, Julien; Callaerts, Patrick; Celniker, Susan E; Deplancke, Bart

    2011-10-30

    Drosophila melanogaster has one of the best characterized metazoan genomes in terms of functionally annotated regulatory elements. To explore how these elements contribute to gene regulation, we need convenient tools to identify the proteins that bind to them. Here we describe the development and validation of a high-throughput yeast one-hybrid platform, which enables screening of DNA elements versus an array of full-length, sequence-verified clones containing over 85% of predicted Drosophila transcription factors. Using six well-characterized regulatory elements, we identified 33 transcription factor-DNA interactions of which 27 were previously unidentified. To simultaneously validate these interactions and locate the binding sites of involved transcription factors, we implemented a powerful microfluidics-based approach that enabled us to retrieve DNA-occupancy data for each transcription factor throughout the respective target DNA elements. Finally, we biologically validated several interactions and identified two new regulators of sine oculis gene expression and hence eye development.

  5. Analysis of Glial Cell Development and Function in Drosophila

    Science.gov (United States)

    Stork, Tobias; Bernardos, Rebecca; Freeman, Marc R.

    2016-01-01

    Glial cells are the most abundant cell type in our brains, yet we understand very little about their development and function. An accumulating body of work over the last decade has revealed that glia are critical regulators of nervous system development, function, and health. Based on morphological and molecular criteria, glia in Drosophila melanogaster are very similar to their mammalian counterparts, suggesting that a detailed investigation of fly glia has the potential to add greatly to our understanding of fundamental aspects of glial cell biology. In this article, we provide an overview of the subtypes of glial cells found in Drosophila and discuss our current understanding of their functions, the development of a subset of well-defined glial lineages, and the molecular-genetic tools available for manipulating glial subtypes in vivo. PMID:22194269

  6. Drosophila Cancer Models Identify Functional Differences between Ret Fusions

    Directory of Open Access Journals (Sweden)

    Sarah Levinson

    2016-09-01

    Full Text Available We generated and compared Drosophila models of RET fusions CCDC6-RET and NCOA4-RET. Both RET fusions directed cells to migrate, delaminate, and undergo EMT, and both resulted in lethality when broadly expressed. In all phenotypes examined, NCOA4-RET was more severe than CCDC6-RET, mirroring their effects on patients. A functional screen against the Drosophila kinome and a library of cancer drugs found that CCDC6-RET and NCOA4-RET acted through different signaling networks and displayed distinct drug sensitivities. Combining data from the kinome and drug screens identified the WEE1 inhibitor AZD1775 plus the multi-kinase inhibitor sorafenib as a synergistic drug combination that is specific for NCOA4-RET. Our work emphasizes the importance of identifying and tailoring a patient’s treatment to their specific RET fusion isoform and identifies a multi-targeted therapy that may prove effective against tumors containing the NCOA4-RET fusion.

  7. Unraveling the Neurobiology of Sleep and Sleep Disorders Using Drosophila.

    Science.gov (United States)

    Chakravarti, L; Moscato, E H; Kayser, M S

    2017-01-01

    Sleep disorders in humans are increasingly appreciated to be not only widespread but also detrimental to multiple facets of physical and mental health. Recent work has begun to shed light on the mechanistic basis of sleep disorders like insomnia, restless legs syndrome, narcolepsy, and a host of others, but a more detailed genetic and molecular understanding of how sleep goes awry is lacking. Over the past 15 years, studies in Drosophila have yielded new insights into basic questions regarding sleep function and regulation. More recently, powerful genetic approaches in the fly have been applied toward studying primary human sleep disorders and other disease states associated with dysregulated sleep. In this review, we discuss the contribution of Drosophila to the landscape of sleep biology, examining not only fundamental advances in sleep neurobiology but also how flies have begun to inform pathological sleep states in humans. © 2017 Elsevier Inc. All rights reserved.

  8. Resolving the prevalence of somatic transposition inDrosophila.

    Science.gov (United States)

    Treiber, Christoph D; Waddell, Scott

    2017-07-25

    Somatic transposition in mammals and insects could increase cellular diversity and neural mobilization has been implicated in age-dependent decline. To understand the impact of transposition in somatic cells it is essential to reliably measure the frequency and map locations of new insertions. Here we identified thousands of putative somatic transposon insertions in neurons from individual Drosophila melanogaster using whole-genome sequencing. However, the number of de novo insertions did not correlate with transposon expression or fly age. Analysing our data with exons as 'immobile genetic elements' revealed a similar frequency of unexpected exon translocations. A new sequencing strategy that recovers transposon: chromosome junction information revealed most putative de novo transposon and exon insertions likely result from unavoidable chimeric artefacts. Reanalysis of other published data suggests similar artefacts are often mistaken for genuine somatic transposition. We conclude that somatic transposition is less prevalent in Drosophila than previously envisaged.

  9. A Drosophila model of high sugar diet-induced cardiomyopathy.

    Directory of Open Access Journals (Sweden)

    Jianbo Na

    Full Text Available Diets high in carbohydrates have long been linked to progressive heart dysfunction, yet the mechanisms by which chronic high sugar leads to heart failure remain poorly understood. Here we combine diet, genetics, and physiology to establish an adult Drosophila melanogaster model of chronic high sugar-induced heart disease. We demonstrate deterioration of heart function accompanied by fibrosis-like collagen accumulation, insulin signaling defects, and fat accumulation. The result was a shorter life span that was more severe in the presence of reduced insulin and P38 signaling. We provide evidence of a role for hexosamine flux, a metabolic pathway accessed by glucose. Increased hexosamine flux led to heart function defects and structural damage; conversely, cardiac-specific reduction of pathway activity prevented sugar-induced heart dysfunction. Our data establish Drosophila as a useful system for exploring specific aspects of diet-induced heart dysfunction and emphasize enzymes within the hexosamine biosynthetic pathway as candidate therapeutic targets.

  10. Sensory Conflict Disrupts Activity of the Drosophila Circadian Network

    Directory of Open Access Journals (Sweden)

    Ross E.F. Harper

    2016-11-01

    Full Text Available Periodic changes in light and temperature synchronize the Drosophila circadian clock, but the question of how the fly brain integrates these two input pathways to set circadian time remains unanswered. We explore multisensory cue combination by testing the resilience of the circadian network to conflicting environmental inputs. We show that misaligned light and temperature cycles can lead to dramatic changes in the daily locomotor activities of wild-type flies during and after exposure to sensory conflict. This altered behavior is associated with a drastic reduction in the amplitude of PERIOD (PER oscillations in brain clock neurons and desynchronization between light- and temperature-sensitive neuronal subgroups. The behavioral disruption depends heavily on the phase relationship between light and temperature signals. Our results represent a systematic quantification of multisensory integration in the Drosophila circadian system and lend further support to the view of the clock as a network of coupled oscillatory subunits.

  11. Drosophila melanogaster as a Model Organism of Brain Diseases

    Directory of Open Access Journals (Sweden)

    Werner Paulus

    2009-02-01

    Full Text Available Drosophila melanogaster has been utilized to model human brain diseases. In most of these invertebrate transgenic models, some aspects of human disease are reproduced. Although investigation of rodent models has been of significant impact, invertebrate models offer a wide variety of experimental tools that can potentially address some of the outstanding questions underlying neurological disease. This review considers what has been gleaned from invertebrate models of neurodegenerative diseases, including Alzheimer’s disease, Parkinson’s disease, metabolic diseases such as Leigh disease, Niemann-Pick disease and ceroid lipofuscinoses, tumor syndromes such as neurofibromatosis and tuberous sclerosis, epilepsy as well as CNS injury. It is to be expected that genetic tools in Drosophila will reveal new pathways and interactions, which hopefully will result in molecular based therapy approaches.

  12. New research resources at the Bloomington Drosophila Stock Center.

    Science.gov (United States)

    Cook, Kevin R; Parks, Annette L; Jacobus, Luke M; Kaufman, Thomas C; Matthews, Kathleen A

    2010-01-01

    The Bloomington Drosophila Stock Center (BDSC) is a primary source of Drosophila stocks for researchers all over the world. It houses over 27,000 unique fly lines and distributed over 160,000 samples of these stocks this past year. This report provides a brief overview of significant recent events at the BDSC with a focus on new stock sets acquired in the past year, including stocks for phiC31 transformation, RNAi knockdown of gene expression, and SNP and quantitative trait loci discovery. We also describe additions to sets of insertions and molecularly defined chromosomal deficiencies, the creation of a new Deficiency Kit, and planned additions of X chromosome duplication sets.

  13. A horseshoe crab receptor structurally related to Drosophila Toll.

    Science.gov (United States)

    Inamori, K; Koori, K; Mishima, C; Muta, T; Kawabata, S

    2000-01-01

    Innate immunity against microbial pathogens relies on the pattern recognition of cell wall components on invading microbes. Recent evidence has shown that a mammalian Toll-like receptor (TLR) is activated by bacterial lipopolysaccharides (LPS). The innate immunity in invertebrates is also triggered by LPS, as seen in the hemolymph coagulation in horseshoe crab. We report the cloning of a TLR from the Japanese horseshoe crab Tachypleus tridentatus. A cDNA coding for Tachypleus Toll was isolated from a hemocyte cDNA library and the open reading frame codes for a proprotein including a signal sequence. Like Drosophila Toll, Tachypleus Toll is a type I transmembrane protein with an extracellular domain consisting of two leucine-rich repeats flanked by two cystein-rich clusters and a cytoplasmic domain exhibiting striking similarity with the cytoplasmic domain of interleukin-1 receptor. Tachypleus Toll is most similar to Drosophila Toll in the domain architecture and the overall length.

  14. A pulsed magnetic stress applied to Drosophila melanogaster flies

    Science.gov (United States)

    Delle Side, D.; Bozzetti, M. P.; Friscini, A.; Giuffreda, E.; Nassisi, V.; Specchia, V.; Velardi, L.

    2014-04-01

    We report the development of a system to feed pulsed magnetic stress to biological samples. The device is based on a RLC circuit that transforms the energy stored in a high voltage capacitor into a magnetic field inside a coil. The field has been characterized and we found that charging the capacitor with 24 kV results in a peak field of 0.4 T. In order to test its effect, we applied such a stress to the Drosophila melanogaster model and we examined its bio-effects. We analysed, in the germ cells, the effects on the control of specific DNA repetitive sequences that are activated after different environmental stresses. The deregulation of these sequences causes genomic instability and chromosomes breaks leading to sterility. The magnetic field treatment did not produce effects on repetitive sequences in the germ cells of Drosophila. Hence, this field doesn't produce deleterious effects linked to repetitive sequences derepression.

  15. GABAA receptor-expressing neurons promote consumption in Drosophila melanogaster.

    Science.gov (United States)

    Cheung, Samantha K; Scott, Kristin

    2017-01-01

    Feeding decisions are highly plastic and bidirectionally regulated by neurons that either promote or inhibit feeding. In Drosophila melanogaster, recent studies have identified four GABAergic interneurons that act as critical brakes to prevent incessant feeding. These GABAergic neurons may inhibit target neurons that drive consumption. Here, we tested this hypothesis by examining GABA receptors and neurons that promote consumption. We find that Resistance to dieldrin (RDL), a GABAA type receptor, is required for proper control of ingestion. Knockdown of Rdl in a subset of neurons causes overconsumption of tastants. Acute activation of these neurons is sufficient to drive consumption of appetitive substances and non-appetitive substances and acute silencing of these neurons decreases consumption. Taken together, these studies identify GABAA receptor-expressing neurons that promote Drosophila ingestive behavior and provide insight into feeding regulation.

  16. Generating patterns from fields of cells. Examples from Drosophila segmentation.

    Science.gov (United States)

    Sanson, B

    2001-12-01

    In Drosophila, a cascade of maternal, gap, pair-rule and segment polarity genes subdivides the antero/posterior axis of the embryo into repeating segmental stripes. This review summarizes what happens next, i.e. how an intrasegmental pattern is generated and controls the differentiation of specific cell types in the epidermis. Within each segment, cells secreting the signalling molecules Wingless (the homologue of vertebrate Wnt-1) and Hedgehog are found in narrow stripes on both sides of the parasegmental boundary. The Wingless and Hedgehog organizing activities help to establish two more stripes per segment that localize ligands for the Epidermal Growth Factor and the Notch signalling pathways, respectively. These four signals then act at short range and in concert to control epidermal differentiation at the single cell level across the segment. This example from Drosophila provides a paradigm for how organizers generate precise patterns, and ultimately different cell types, in a naïve field of cells.

  17. Conserved family of glycerol kinase loci in Drosophila melanogaster

    Science.gov (United States)

    Martinez Agosto, Julian A.; McCabe, Edward R.B.

    2009-01-01

    Glycerol kinase (GK) is an enzyme that catalyzes the formation of glycerol 3-phosphate from ATP and glycerol, the rate-limiting step in glycerol utilization. We analyzed the genome of the model organism Drosophila melanogaster and identified five GK orthologs, including two loci with sequence homology to the mammalian Xp21 GK protein. Using a combination of sequence analysis and evolutionary comparisons of orthologs between species, we characterized functional domains in the protein required for GK activity. Our findings include additional conserved domains that suggest novel nuclear and mitochondrial functions for glycerol kinase in apoptosis and transcriptional regulation. Investigation of GK function in Drosophila will inform us about the role of this enzyme in development and will provide us with a tool to examine genetic modifiers of human metabolic disorders. PMID:16545593

  18. Fluorescent visualization of macromolecules in Drosophila whole mounts.

    Science.gov (United States)

    Ramos, Ricardo Guelerman Pinheiro; Machado, Luciana Claudia Herculano; Moda, Livia Maria Rosatto

    2010-01-01

    The ability to determine the expression dynamics of individual genes "in situ" by visualizing the precise spatial and temporal distribution of their products in whole mounts by histochemical and immunocytochemical reactions has revolutionized our understanding of cellular processes. Drosophila developmental genetics was one of the fields that benefited most from these technologies, and a variety of fluorescent methods were specifically designed for investigating the localization of developmentally important proteins and cell markers during embryonic and post embryonic stages of this model organism. In this chapter we present detailed protocols for fluorescence immunocytochemistry of whole mount embryos, imaginal discs, pupal retinas, and salivary glands of Drosophila melanogaster, as well as methods for fluorescent visualization of specific subcellular structures in these tissues.

  19. Feature Integration Drives Probabilistic Behavior in the Drosophila Escape Response.

    Science.gov (United States)

    von Reyn, Catherine R; Nern, Aljoscha; Williamson, W Ryan; Breads, Patrick; Wu, Ming; Namiki, Shigehiro; Card, Gwyneth M

    2017-06-21

    Animals rely on dedicated sensory circuits to extract and encode environmental features. How individual neurons integrate and translate these features into behavioral responses remains a major question. Here, we identify a visual projection neuron type that conveys predator approach information to the Drosophila giant fiber (GF) escape circuit. Genetic removal of this input during looming stimuli reveals that it encodes angular expansion velocity, whereas other input cell type(s) encode angular size. Motor program selection and timing emerge from linear integration of these two features within the GF. Linear integration improves size detection invariance over prior models and appropriately biases motor selection to rapid, GF-mediated escapes during fast looms. Our findings suggest feature integration, and motor control may occur as simultaneous operations within the same neuron and establish the Drosophila escape circuit as a model system in which these computations may be further dissected at the circuit level. VIDEO ABSTRACT. Copyright © 2017 Elsevier Inc. All rights reserved.

  20. Maternal control of the Drosophila dorsal–ventral body axis

    Science.gov (United States)

    Stein, David S.; Stevens, Leslie M.

    2016-01-01

    The pathway that generates the dorsal–ventral (DV) axis of the Drosophila embryo has been the subject of intense investigation over the previous three decades. The initial asymmetric signal originates during oogenesis by the movement of the oocyte nucleus to an anterior corner of the oocyte, which establishes DV polarity within the follicle through signaling between Gurken, the Drosophila Transforming Growth Factor (TGF)-α homologue secreted from the oocyte, and the Drosophila Epidermal Growth Factor Receptor (EGFR) that is expressed by the follicular epithelium cells that envelop the oocyte. Follicle cells that are not exposed to Gurken follow a ventral fate and express Pipe, a sulfotransferase that enzymatically modifies components of the inner vitelline membrane layer of the eggshell, thereby transferring DV spatial information from the follicle to the egg. These ventrally sulfated eggshell proteins comprise a localized cue that directs the ventrally restricted formation of the active Spätzle ligand within the perivitelline space between the eggshell and the embryonic membrane. Spätzle activates Toll, a transmembrane receptor in the embryonic membrane. Transmission of the Toll signal into the embryo leads to the formation of a ventral-to-dorsal gradient of the transcription factor Dorsal within the nuclei of the syncytial blastoderm stage embryo. Dorsal controls the spatially specific expression of a large constellation of zygotic target genes, the Dorsal gene regulatory network, along the embryonic DV circumference. This article reviews classic studies and integrates them with the details of more recent work that has advanced our understanding of the complex pathway that establishes Drosophila embryo DV polarity. PMID:25124754

  1. Fungal diversity associated with Hawaiian Drosophila host plants.

    Directory of Open Access Journals (Sweden)

    Brian S Ort

    Full Text Available Hawaiian Drosophila depend primarily, sometimes exclusively, on specific host plants for oviposition and larval development, and most specialize further on a particular decomposing part of that plant. Differences in fungal community between host plants and substrate types may establish the basis for host specificity in Hawaiian Drosophila. Fungi mediate decomposition, releasing plant micronutrients and volatiles that can indicate high quality substrates and serve as cues to stimulate oviposition. This study addresses major gaps in our knowledge by providing the first culture-free, DNA-based survey of fungal diversity associated with four ecologically important tree genera in the Hawaiian Islands. Three genera, Cheirodendron, Clermontia, and Pisonia, are important host plants for Drosophila. The fourth, Acacia, is not an important drosophilid host but is a dominant forest tree. We sampled fresh and rotting leaves from all four taxa, plus rotting stems from Clermontia and Pisonia. Based on sequences from the D1/D2 domain of the 26S rDNA gene, we identified by BLAST search representatives from 113 genera in 13 fungal classes. A total of 160 operational taxonomic units, defined on the basis of ≥97% genetic similarity, were identified in these samples, but sampling curves show this is an underestimate of the total fungal diversity present on these substrates. Shannon diversity indices ranged from 2.0 to 3.5 among the Hawaiian samples, a slight reduction compared to continental surveys. We detected very little sharing of fungal taxa among the substrates, and tests of community composition confirmed that the structure of the fungal community differed significantly among the substrates and host plants. Based on these results, we hypothesize that fungal community structure plays a central role in the establishment of host preference in the Hawaiian Drosophila radiation.

  2. A Modified Cooling Method and Its Application in "Drosophila" Experiments

    Science.gov (United States)

    Qu, Wen-hui; Zhu, Tong-bo; Yang, Da-Xiang

    2015-01-01

    Chilling is a cost-effective and safe method of immobilising flies in "Drosophila" experiments. However, should condensation form on the plate, it would be fatal to the flies. Here we describe a modified cooling method using reusable commercial ice pack(s) (ca. 400 ml, 2-3 cm tall) rather than crushed ice. The ice pack is covered with a…

  3. EFFECT OF SOME BEVERAGES ON THE DROSOPHILA MELANOGASTER SURVIVAL PERCENTAGE

    OpenAIRE

    SARIKAYA, Rabia; KARABAY, Kübra; ERKOÇ, Figen

    2018-01-01

     Energy drinksare a group of products that are advertised as being able to provide alertnessand energy, and conteract sleepiness. In this study, different types of energydrinks and some beverages have been evaluated for toxic effectsin Drosophilamelanogaster individual. During the experiments, 1.5 g medium waswettedwith5mLbeverages and100 third-instar larvae were chronically fed with theDrosophila instant medium. Feeding ended with pupation of the surviving larvae.The experiments wer...

  4. Genome-Wide Approaches to Drosophila Heart Development

    Directory of Open Access Journals (Sweden)

    Manfred Frasch

    2016-05-01

    Full Text Available The development of the dorsal vessel in Drosophila is one of the first systems in which key mechanisms regulating cardiogenesis have been defined in great detail at the genetic and molecular level. Due to evolutionary conservation, these findings have also provided major inputs into studies of cardiogenesis in vertebrates. Many of the major components that control Drosophila cardiogenesis were discovered based on candidate gene approaches and their functions were defined by employing the outstanding genetic tools and molecular techniques available in this system. More recently, approaches have been taken that aim to interrogate the entire genome in order to identify novel components and describe genomic features that are pertinent to the regulation of heart development. Apart from classical forward genetic screens, the availability of the thoroughly annotated Drosophila genome sequence made new genome-wide approaches possible, which include the generation of massive numbers of RNA interference (RNAi reagents that were used in forward genetic screens, as well as studies of the transcriptomes and proteomes of the developing heart under normal and experimentally manipulated conditions. Moreover, genome-wide chromatin immunoprecipitation experiments have been performed with the aim to define the full set of genomic binding sites of the major cardiogenic transcription factors, their relevant target genes, and a more complete picture of the regulatory network that drives cardiogenesis. This review will give an overview on these genome-wide approaches to Drosophila heart development and on computational analyses of the obtained information that ultimately aim to provide a description of this process at the systems level.

  5. Architecture of the primary taste center of Drosophila melanogaster larvae

    OpenAIRE

    Colomb, Julien; Grillenzoni, Nicola; Ramaekers, Ariane; Stocker, Reinhard F.

    2007-01-01

    A simple nervous system combined with stereotypic behavioral responses to tastants, together with powerful genetic and molecular tools, have turned Drosophila larvae into a very promising model for studying gustatory coding. Using the Gal4/UAS system and confocal microscopy for visualizing gustatory afferents, we provide a description of the primary taste center in the larval central nervous system. Essentially, gustatory receptor neurons target different areas of the subesophageal ganglion (...

  6. Geographic polymorphism of P element in populations of Drosophila sturtevanti

    Directory of Open Access Journals (Sweden)

    Luciane M. de Almeida

    2003-01-01

    Full Text Available The aim of this report was to detect full-sized P element sequences in eight strains of Drosophila sturtevanti populations from distant geographic regions and to assess the structural geographic variation among P element sequences. PCR analysis confirmed the presence of a putative complete P element in all strains. Southern blot analysis indicated bands shared by all strains, and bands restricted to geographically related strains. Parsimony analysis corroborated the hybridization pattern that reflected the geographic relationships.

  7. Drosophila lowfat, a novel modulator of Fat signaling

    OpenAIRE

    Mao, Yaopan; Kucuk, Binnaz; Irvine, Kenneth D.

    2009-01-01

    The Fat-Hippo-Warts signaling network regulates both transcription and planar cell polarity. Despite its crucial importance to the normal control of growth and planar polarity, we have only a limited understanding of the mechanisms that regulate Fat. We report here the identification of a conserved cytoplasmic protein, Lowfat (Lft), as a modulator of Fat signaling. Drosophila Lft, and its human homologs LIX1 and LIX1-like, bind to the cytoplasmic domains of the Fat lig...

  8. A role for adenosine deaminase in Drosophila larval development

    Czech Academy of Sciences Publication Activity Database

    Doležal, T.; Doleželová, Eva; Žurovec, Michal; Bryant, P. J.

    2005-01-01

    Roč. 3, č. 7 (2005), s. 1213-1224 ISSN 1544-9173 R&D Projects: GA ČR(CZ) GA204/04/1205; GA AV ČR(CZ) IAA5007107 Grant - others:United States National Science Foundation(US) 440860-21565 Institutional research plan: CEZ:AV0Z50070508 Keywords : Drosophila Subject RIV: ED - Physiology Impact factor: 14.672, year: 2005

  9. Contribution of photoreceptor subtypes to spectral wavelength preference in Drosophila

    OpenAIRE

    Yamaguchi, Satoko; Desplan, Claude; Heisenberg, Martin

    2010-01-01

    The visual systems of most species contain photoreceptors with distinct spectral sensitivities that allow animals to distinguish lights by their spectral composition. In Drosophila, photoreceptors R1–R6 have the same spectral sensitivity throughout the eye and are responsible for motion detection. In contrast, photoreceptors R7 and R8 exhibit heterogeneity and are important for color vision. We investigated how photoreceptor types contribute to the attractiveness of light by blocking the func...

  10. CULTURE OF EMBRYONIC CELLS OF DROSOPHILA MELANOGASTER IN VITRO.

    Science.gov (United States)

    HORIKAWA, M; FOX, A S

    1964-09-25

    Embryonic cells isolated from eggs ofDrosophila melanogasterhave been cultured continuously in a new medium. Generation time for cell division is 30 hours. Chromosome number remains constant for at least 10 days. Cells from embryos of the mutant maroon-like grow at the same rate as those from wild-type embryos, but cells from rosy-2 grow slower and at a lower optimum temperature.

  11. Hox gene regulation in the central nervous system of Drosophila

    Directory of Open Access Journals (Sweden)

    Maheshwar eGummalla

    2014-04-01

    Full Text Available Hox genes specify the structures that form along the anteroposterior (AP axis of bilateria. Within the genome, they often form clusters where, remarkably enough, their position within the clusters reflects the relative positions of the structures they specify along the AP axis. This correspondence between genomic organization and gene expression pattern has been conserved through evolution and provides a unique opportunity to study how chromosomal context affects gene regulation. In Drosophila, a general rule, often called posterior dominance, states that Hox genes specifying more posterior structures repress the expression of more anterior Hox genes. This rule explains the apparent spatial complementarity of Hox gene expression patterns in Drosophila. Here we review a noticeable exception to this rule where the more-posteriorly expressed Abd-B hox gene fails to repress the more-anterior abd-A gene in cells of the central nervous system (CNS. While Abd-B is required to repress ectopic expression of abd-A in the posterior epidermis, abd-A repression in the posterior CNS is accomplished by a different mechanism that involves a large 92kb long non-coding RNA (lncRNA encoded by the intergenic region separating abd-A and Abd-B (the iab8ncRNA. Dissection of this lncRNA revealed that abd-A is repressed by the lncRNA using two redundant mechanisms. The 1st mechanism is mediated by a microRNA (mir-iab-8 encoded by intronic sequence within the large iab8-ncRNA. Meanwhile, the second mechanism seems to involve transcriptional interference by the long iab-8 ncRNA on the abd-A promoter. Recent work demonstrating CNS-specific regulation of genes by ncRNAs in Drosophila, seem to highlight a potential role for the iab-8-ncRNA in the evolution of the Drosophila hox complexes

  12. Genetic Analysis of Micro-environmental Plasticity in Drosophila melanogaster

    OpenAIRE

    Morgante, Fabio; Sorensen, Daniel A; Sørensen, Peter; Maltecca, Christian; Mackay, Trudy F C

    2014-01-01

    Quantitative genetic models recognize the potential for genotype by environment interaction, whereby different genotypes have different plastic responses to changes in macro-environmental conditions. Recently, it has been recognized that micro-environmental plasticity (‘residual’ variance) may also be genetically variable. This study utilized the Drosophila Genetic Reference Panel (DGRP) to accurately estimate the genetic variance of micro-environmental plasticity for chill coma recovery time...

  13. Intraspecific hybridization, developmental stability and fitness in Drosophila mercatorum

    DEFF Research Database (Denmark)

    Andersen, DH; Pertoldi, C; Scali, V

    2002-01-01

    One of the possible effects of intraspecific hybridization is outbreeding depression, due to a breakdown of coadapted gene complexes, which can lead to reduced fitness and decreased developmental stability in hybrids. Alternatively, increased fitness and increased developmental stability in hybrids...... (hybrid vigour) may be a result of hybridization, probably due to increased heterozygosity. Developmental stability is assumed to be correlated with fitness and is commonly measured as fluctuating asymmetry or phenotypic variance. Drosophila mercatorum is capable of reproducing sexually, but also...

  14. Functional Analysis of Human NF1 in Drosophila

    Science.gov (United States)

    2007-01-01

    Stratagene Chameleon kit with a pBSK-specific phosphorylated selection primer (50 pCCGCCACCGCGATGTAGCTCCAATTCGC 30) and mutation -specific mutagenesis...identified by examining the phenotypes of mutated human gene expressed in Drosophila NF1 null mutants. We also propose that Gsα/NF1-activated AC...With this paradigm established, we further tested the effects of different hNF1 deletion mutations our lab created have on the stimulation event. We

  15. The Immune Phenotype of Three Drosophila Leukemia Models

    Directory of Open Access Journals (Sweden)

    Badrul Arefin

    2017-07-01

    Full Text Available Many leukemia patients suffer from dysregulation of their immune system, making them more susceptible to infections and leading to general weakening (cachexia. Both adaptive and innate immunity are affected. The fruit fly Drosophila melanogaster has an innate immune system, including cells of the myeloid lineage (hemocytes. To study Drosophila immunity and physiology during leukemia, we established three models by driving expression of a dominant-active version of the Ras oncogene (RasV12 alone or combined with knockdowns of tumor suppressors in Drosophila hemocytes. Our results show that phagocytosis, hemocyte migration to wound sites, wound sealing, and survival upon bacterial infection of leukemic lines are similar to wild type. We find that in all leukemic models the two major immune pathways (Toll and Imd are dysregulated. Toll–dependent signaling is activated to comparable extents as after wounding wild-type larvae, leading to a proinflammatory status. In contrast, Imd signaling is suppressed. Finally, we notice that adult tissue formation is blocked and degradation of cell masses during metamorphosis of leukemic lines, which is akin to the state of cancer-dependent cachexia. To further analyze the immune competence of leukemic lines, we used a natural infection model that involves insect-pathogenic nematodes. We identified two leukemic lines that were sensitive to nematode infections. Further characterization demonstrates that despite the absence of behavioral abnormalities at the larval stage, leukemic larvae show reduced locomotion in the presence of nematodes. Taken together, this work establishes new Drosophila models to study the physiological, immunological, and behavioral consequences of various forms of leukemia.

  16. A high-quality catalog of the Drosophila melanogaster proteome

    DEFF Research Database (Denmark)

    Brunner, Erich; Ahrens, Christian H.; Mohanty, Sonaly

    2007-01-01

    % of the predicted Drosophila melanogaster proteome by detecting 9,124 proteins from 498,000 redundant and 72,281 distinct peptide identifications. This unprecedented high proteome coverage for a complex eukaryote was achieved by combining sample diversity, multidimensional biochemical fractionation and analysis...... matching approximately 50% of D. melanogaster gene models. This library of proteotypic peptides should enable fast, targeted and quantitative proteomic studies to elucidate the systems biology of this model organism....

  17. Male killing Spiroplasma protects Drosophila melanogaster against two parasitoid wasps

    Science.gov (United States)

    Xie, J; Butler, S; Sanchez, G; Mateos, M

    2014-01-01

    Maternally transmitted associations between endosymbiotic bacteria and insects are diverse and widespread in nature. Owing to imperfect vertical transmission, many heritable microbes have evolved compensational mechanisms to enhance their persistence in host lineages, such as manipulating host reproduction and conferring fitness benefits to host. Symbiont-mediated defense against natural enemies of hosts is increasingly recognized as an important mechanism by which endosymbionts enhance host fitness. Members of the genus Spiroplasma associated with distantly related Drosophila hosts are known to engage in either reproductive parasitism (i.e., male killing) or defense against natural enemies (the parasitic wasp Leptopilina heterotoma and a nematode). A male-killing strain of Spiroplasma (strain Melanogaster Sex Ratio Organism (MSRO)) co-occurs with Wolbachia (strain wMel) in certain wild populations of the model organism Drosophila melanogaster. We examined the effects of Spiroplasma MSRO and Wolbachia wMel on Drosophila survival against parasitism by two common wasps, Leptopilina heterotoma and Leptopilina boulardi, that differ in their host ranges and host evasion strategies. The results indicate that Spiroplasma MSRO prevents successful development of both wasps, and confers a small, albeit significant, increase in larva-to-adult survival of flies subjected to wasp attacks. We modeled the conditions under which defense can contribute to Spiroplasma persistence. Wolbachia also confers a weak, but significant, survival advantage to flies attacked by L. heterotoma. The host protective effects exhibited by Spiroplasma and Wolbachia are additive and may provide the conditions for such cotransmitted symbionts to become mutualists. Occurrence of Spiroplasma-mediated protection against distinct parasitoids in divergent Drosophila hosts suggests a general protection mechanism. PMID:24281548

  18. Splinkerette PCR for mapping transposable elements in Drosophila.

    OpenAIRE

    Christopher J Potter; Liqun Luo

    2010-01-01

    Transposable elements (such as the P-element and piggyBac) have been used to introduce thousands of transgenic constructs into the Drosophila genome. These transgenic constructs serve many roles, from assaying gene/cell function, to controlling chromosome arm rearrangement. Knowing the precise genomic insertion site for the transposable element is often desired. This enables identification of genomic enhancer regions trapped by an enhancer trap, identification of the gene mutated by a transpo...

  19. Cadmium resistance in Drosophila: a small cadmium binding substance

    International Nuclear Information System (INIS)

    Jacobson, K.B.; Williams, M.W.; Richter, L.J.; Holt, S.E.; Hook, G.J.; Knoop, S.M.; Sloop, F.V.; Faust, J.B.

    1985-01-01

    A small cadmium-binding substance (CdBS) has been observed in adult Drosophila melanogaster that were raised for their entire growth cycle on a diet that contained 0.15 mM CdCl 2 . Induction of CdBS was observed in strains that differed widely in their sensitivity of CdCl 2 . This report describes the induction of CdBS and some of its characteristics. 17 refs., 4 figs., 1 tab

  20. Caffeine promotes wakefulness via dopamine signaling in Drosophila

    OpenAIRE

    Aleksandra H. Nall; Iryna Shakhmantsir; Karol Cichewicz; Serge Birman; Jay Hirsh; Amita Sehgal

    2016-01-01

    Caffeine is the most widely-consumed psychoactive drug in the world, but our understanding of how caffeine affects our brains is relatively incomplete. Most studies focus on effects of caffeine on adenosine receptors, but there is evidence for other, more complex mechanisms. In the fruit fly Drosophila melanogaster, which shows a robust diurnal pattern of sleep/wake activity, caffeine reduces nighttime sleep behavior independently of the one known adenosine receptor. Here, we show that dopami...

  1. Dopamine modulates metabolic rate and temperature sensitivity in Drosophila melanogaster.

    Directory of Open Access Journals (Sweden)

    Taro Ueno

    Full Text Available Homeothermal animals, such as mammals, maintain their body temperature by heat generation and heat dissipation, while poikilothermal animals, such as insects, accomplish it by relocating to an environment of their favored temperature. Catecholamines are known to regulate thermogenesis and metabolic rate in mammals, but their roles in other animals are poorly understood. The fruit fly, Drosophila melanogaster, has been used as a model system for the genetic studies of temperature preference behavior. Here, we demonstrate that metabolic rate and temperature sensitivity of some temperature sensitive behaviors are regulated by dopamine in Drosophila. Temperature-sensitive molecules like dTrpA1 and shi(ts induce temperature-dependent behavioral changes, and the temperature at which the changes are induced were lowered in the dopamine transporter-defective mutant, fumin. The mutant also displays a preference for lower temperatures. This thermophobic phenotype was rescued by the genetic recovery of the dopamine transporter in dopamine neurons. Flies fed with a dopamine biosynthesis inhibitor (3-iodo-L-tyrosine, which diminishes dopamine signaling, exhibited preference for a higher temperature. Furthermore, we found that the metabolic rate is up-regulated in the fumin mutant. Taken together, dopamine has functions in the temperature sensitivity of behavioral changes and metabolic rate regulation in Drosophila, as well as its previously reported functions in arousal/sleep regulation.

  2. Human Intellectual Disability Genes Form Conserved Functional Modules in Drosophila

    Science.gov (United States)

    Oortveld, Merel A. W.; Keerthikumar, Shivakumar; Oti, Martin; Nijhof, Bonnie; Fernandes, Ana Clara; Kochinke, Korinna; Castells-Nobau, Anna; van Engelen, Eva; Ellenkamp, Thijs; Eshuis, Lilian; Galy, Anne; van Bokhoven, Hans; Habermann, Bianca; Brunner, Han G.; Zweier, Christiane; Verstreken, Patrik; Huynen, Martijn A.; Schenck, Annette

    2013-01-01

    Intellectual Disability (ID) disorders, defined by an IQ below 70, are genetically and phenotypically highly heterogeneous. Identification of common molecular pathways underlying these disorders is crucial for understanding the molecular basis of cognition and for the development of therapeutic intervention strategies. To systematically establish their functional connectivity, we used transgenic RNAi to target 270 ID gene orthologs in the Drosophila eye. Assessment of neuronal function in behavioral and electrophysiological assays and multiparametric morphological analysis identified phenotypes associated with knockdown of 180 ID gene orthologs. Most of these genotype-phenotype associations were novel. For example, we uncovered 16 genes that are required for basal neurotransmission and have not previously been implicated in this process in any system or organism. ID gene orthologs with morphological eye phenotypes, in contrast to genes without phenotypes, are relatively highly expressed in the human nervous system and are enriched for neuronal functions, suggesting that eye phenotyping can distinguish different classes of ID genes. Indeed, grouping genes by Drosophila phenotype uncovered 26 connected functional modules. Novel links between ID genes successfully predicted that MYCN, PIGV and UPF3B regulate synapse development. Drosophila phenotype groups show, in addition to ID, significant phenotypic similarity also in humans, indicating that functional modules are conserved. The combined data indicate that ID disorders, despite their extreme genetic diversity, are caused by disruption of a limited number of highly connected functional modules. PMID:24204314

  3. A computational model of conditioning inspired by Drosophila olfactory system.

    Science.gov (United States)

    Faghihi, Faramarz; Moustafa, Ahmed A; Heinrich, Ralf; Wörgötter, Florentin

    2017-03-01

    Recent studies have demonstrated that Drosophila melanogaster (briefly Drosophila) can successfully perform higher cognitive processes including second order olfactory conditioning. Understanding the neural mechanism of this behavior can help neuroscientists to unravel the principles of information processing in complex neural systems (e.g. the human brain) and to create efficient and robust robotic systems. In this work, we have developed a biologically-inspired spiking neural network which is able to execute both first and second order conditioning. Experimental studies demonstrated that volume signaling (e.g. by the gaseous transmitter nitric oxide) contributes to memory formation in vertebrates and invertebrates including insects. Based on the existing knowledge of odor encoding in Drosophila, the role of retrograde signaling in memory function, and the integration of synaptic and non-synaptic neural signaling, a neural system is implemented as Simulated fly. Simulated fly navigates in a two-dimensional environment in which it receives odors and electric shocks as sensory stimuli. The model suggests some experimental research on retrograde signaling to investigate neural mechanisms of conditioning in insects and other animals. Moreover, it illustrates a simple strategy to implement higher cognitive capabilities in machines including robots. Copyright © 2016 Elsevier Ltd. All rights reserved.

  4. Drosophila cuticular hydrocarbons revisited: mating status alters cuticular profiles.

    Directory of Open Access Journals (Sweden)

    Claude Everaerts

    2010-03-01

    Full Text Available Most living organisms use pheromones for inter-individual communication. In Drosophila melanogaster flies, several pheromones perceived either by contact/at a short distance (cuticular hydrocarbons, CHs, or at a longer distance (cis-vaccenyl acetate, cVA, affect courtship and mating behaviours. However, it has not previously been possible to precisely identify all potential pheromonal compounds and simultaneously monitor their variation on a time scale. To overcome this limitation, we combined Solid Phase Micro-Extraction with gas-chromatography coupled with mass-spectrometry. This allowed us (i to identify 59 cuticular compounds, including 17 new CHs; (ii to precisely quantify the amount of each compound that could be detected by another fly, and (iii to measure the variation of these substances as a function of aging and mating. Sex-specific variation appeared with age, while mating affected cuticular compounds in both sexes with three possible patterns: variation was (i reciprocal in the two sexes, suggesting a passive mechanical transfer during mating, (ii parallel in both sexes, such as for cVA which strikingly appeared during mating, or (iii unilateral, presumably as a result of sexual interaction. We provide a complete reassessment of all Drosophila CHs and suggest that the chemical conversation between male and female flies is far more complex than is generally accepted. We conclude that focusing on individual compounds will not provide a satisfactory understanding of the evolution and function of chemical communication in Drosophila.

  5. Ack kinase regulates CTP synthase filaments during Drosophila oogenesis.

    Science.gov (United States)

    Strochlic, Todd I; Stavrides, Kevin P; Thomas, Sam V; Nicolas, Emmanuelle; O'Reilly, Alana M; Peterson, Jeffrey R

    2014-11-01

    The enzyme CTP synthase (CTPS) dynamically assembles into macromolecular filaments in bacteria, yeast, Drosophila, and mammalian cells, but the role of this morphological reorganization in regulating CTPS activity is controversial. During Drosophila oogenesis, CTPS filaments are transiently apparent in ovarian germline cells during a period of intense genomic endoreplication and stockpiling of ribosomal RNA. Here, we demonstrate that CTPS filaments are catalytically active and that their assembly is regulated by the non-receptor tyrosine kinase DAck, the Drosophila homologue of mammalian Ack1 (activated cdc42-associated kinase 1), which we find also localizes to CTPS filaments. Egg chambers from flies deficient in DAck or lacking DAck catalytic activity exhibit disrupted CTPS filament architecture and morphological defects that correlate with reduced fertility. Furthermore, ovaries from these flies exhibit reduced levels of total RNA, suggesting that DAck may regulate CTP synthase activity. These findings highlight an unexpected function for DAck and provide insight into a novel pathway for the developmental control of an essential metabolic pathway governing nucleotide biosynthesis. © 2014 The Authors.

  6. The impact of host diet on Wolbachia titer in Drosophila.

    Directory of Open Access Journals (Sweden)

    Laura R Serbus

    2015-03-01

    Full Text Available While a number of studies have identified host factors that influence endosymbiont titer, little is known concerning environmental influences on titer. Here we examined nutrient impact on maternally transmitted Wolbachia endosymbionts in Drosophila. We demonstrate that Drosophila reared on sucrose- and yeast-enriched diets exhibit increased and reduced Wolbachia titers in oogenesis, respectively. The yeast-induced Wolbachia depletion is mediated in large part by the somatic TOR and insulin signaling pathways. Disrupting TORC1 with the small molecule rapamycin dramatically increases oocyte Wolbachia titer, whereas hyper-activating somatic TORC1 suppresses oocyte titer. Furthermore, genetic ablation of insulin-producing cells located in the Drosophila brain abolished the yeast impact on oocyte titer. Exposure to yeast-enriched diets altered Wolbachia nucleoid morphology in oogenesis. Furthermore, dietary yeast increased somatic Wolbachia titer overall, though not in the central nervous system. These findings highlight the interactions between Wolbachia and germline cells as strongly nutrient-sensitive, and implicate conserved host signaling pathways by which nutrients influence Wolbachia titer.

  7. Preference for and learning of amino acids in larval Drosophila

    Directory of Open Access Journals (Sweden)

    Nana Kudow

    2017-03-01

    Full Text Available Relative to other nutrients, less is known about how animals sense amino acids and how behaviour is organized accordingly. This is a significant gap in our knowledge because amino acids are required for protein synthesis − and hence for life as we know it. Choosing Drosophila larvae as a case study, we provide the first systematic analysis of both the preference behaviour for, and the learning of, all 20 canonical amino acids in Drosophila. We report that preference for individual amino acids differs according to the kind of amino acid, both in first-instar and in third-instar larvae. Our data suggest that this preference profile changes across larval instars, and that starvation during the third instar also alters this profile. Only aspartic acid turns out to be robustly attractive across all our experiments. The essentiality of amino acids does not appear to be a determinant of preference. Interestingly, although amino acids thus differ in their innate attractiveness, we find that all amino acids are equally rewarding. Similar discrepancies between innate attractiveness and reinforcing effect have previously been reported for other tastants, including sugars, bitter substances and salt. The present analyses will facilitate the ongoing search for the receptors, sensory neurons, and internal, homeostatic amino acid sensors in Drosophila.

  8. Specialized Cortex Glial Cells Accumulate Lipid Droplets in Drosophila melanogaster

    Science.gov (United States)

    Kis, Viktor; Barti, Benjámin; Lippai, Mónika; Sass, Miklós

    2015-01-01

    Lipid droplets (LDs) are common organelles of the majority of eukaryotic cell types. Their biological significance has been extensively studied in mammalian liver cells and white adipose tissue. Although the central nervous system contains the highest relative amount and the largest number of different lipid species, neither the spatial nor the temporal distribution of LDs has been described. In this study, we used the brain of the fruitfly, Drosophila melanogaster, to investigate the neuroanatomy of LDs. We demonstrated that LDs are exclusively localised in glial cells but not in neurons in the larval nervous system. We showed that the brain’s LD pool, rather than being constant, changes dynamically during development and reaches its highest value at the beginning of metamorphosis. LDs are particularly enriched in cortex glial cells located close to the brain surface. These specialized superficial cortex glial cells contain the highest amount of LDs among glial cell types and encapsulate neuroblasts and their daughter cells. Superficial cortex glial cells, combined with subperineurial glial cells, express the Drosophila fatty acid binding protein (Dfabp), as we have demonstrated through light- and electron microscopic immunocytochemistry. To the best of our best knowledge this is the first study that describes LD neuroanatomy in the Drosophila larval brain. PMID:26148013

  9. Specialized Cortex Glial Cells Accumulate Lipid Droplets in Drosophila melanogaster.

    Science.gov (United States)

    Kis, Viktor; Barti, Benjámin; Lippai, Mónika; Sass, Miklós

    2015-01-01

    Lipid droplets (LDs) are common organelles of the majority of eukaryotic cell types. Their biological significance has been extensively studied in mammalian liver cells and white adipose tissue. Although the central nervous system contains the highest relative amount and the largest number of different lipid species, neither the spatial nor the temporal distribution of LDs has been described. In this study, we used the brain of the fruitfly, Drosophila melanogaster, to investigate the neuroanatomy of LDs. We demonstrated that LDs are exclusively localised in glial cells but not in neurons in the larval nervous system. We showed that the brain's LD pool, rather than being constant, changes dynamically during development and reaches its highest value at the beginning of metamorphosis. LDs are particularly enriched in cortex glial cells located close to the brain surface. These specialized superficial cortex glial cells contain the highest amount of LDs among glial cell types and encapsulate neuroblasts and their daughter cells. Superficial cortex glial cells, combined with subperineurial glial cells, express the Drosophila fatty acid binding protein (Dfabp), as we have demonstrated through light- and electron microscopic immunocytochemistry. To the best of our best knowledge this is the first study that describes LD neuroanatomy in the Drosophila larval brain.

  10. The Persistence of Facultative Parthenogenesis in Drosophila albomicans

    Science.gov (United States)

    Chang, Ching-Ho; Fang, Shu; Chang, Hwei-yu

    2014-01-01

    Parthenogenesis has evolved independently in more than 10 Drosophila species. Most cases are tychoparthenogenesis, which is occasional or accidental parthenogenesis in normally bisexual species with a low hatching rate of eggs produced by virgin females; this form is presumed to be an early stage of parthenogenesis. To address how parthenogenesis and sexual reproduction coexist in Drosophila populations, we investigated several reproductive traits, including the fertility, parthenogenetic capability, diploidization mechanisms, and mating propensity of parthenogenetic D. albomicans. The fertility of mated parthenogenetic females was significantly higher than that of virgin females. The mated females could still produce parthenogenetic offspring but predominantly produced offspring by sexual reproduction. Both mated parthenogenetic females and their parthenogenetic-sexual descendants were capable of parthenogenesis. The alleles responsible for parthenogenesis can be propagated through both parthenogenesis and sexual reproduction. As diploidy is restored predominantly by gamete duplication, heterozygosity would be very low in parthenogenetic individuals. Hence, genetic variation in parthenogenetic genomes would result from sexual reproduction. The mating propensity of females after more than 20 years of isolation from males was decreased. If mutations reducing mating propensities could occur under male-limited conditions in natural populations, decreased mating propensity might accelerate tychoparthenogenesis through a positive feedback mechanism. This process provides an opportunity for the evolution of obligate parthenogenesis. Therefore, the persistence of facultative parthenogenesis may be an adaptive reproductive strategy in Drosophila when a few founders colonize a new niche or when small populations are distributed at the edge of a species' range, consistent with models of geographical parthenogenesis. PMID:25415200

  11. The persistence of facultative parthenogenesis in Drosophila albomicans.

    Science.gov (United States)

    Chang, Chia-chen; Ting, Chau-Ti; Chang, Ching-Ho; Fang, Shu; Chang, Hwei-yu

    2014-01-01

    Parthenogenesis has evolved independently in more than 10 Drosophila species. Most cases are tychoparthenogenesis, which is occasional or accidental parthenogenesis in normally bisexual species with a low hatching rate of eggs produced by virgin females; this form is presumed to be an early stage of parthenogenesis. To address how parthenogenesis and sexual reproduction coexist in Drosophila populations, we investigated several reproductive traits, including the fertility, parthenogenetic capability, diploidization mechanisms, and mating propensity of parthenogenetic D. albomicans. The fertility of mated parthenogenetic females was significantly higher than that of virgin females. The mated females could still produce parthenogenetic offspring but predominantly produced offspring by sexual reproduction. Both mated parthenogenetic females and their parthenogenetic-sexual descendants were capable of parthenogenesis. The alleles responsible for parthenogenesis can be propagated through both parthenogenesis and sexual reproduction. As diploidy is restored predominantly by gamete duplication, heterozygosity would be very low in parthenogenetic individuals. Hence, genetic variation in parthenogenetic genomes would result from sexual reproduction. The mating propensity of females after more than 20 years of isolation from males was decreased. If mutations reducing mating propensities could occur under male-limited conditions in natural populations, decreased mating propensity might accelerate tychoparthenogenesis through a positive feedback mechanism. This process provides an opportunity for the evolution of obligate parthenogenesis. Therefore, the persistence of facultative parthenogenesis may be an adaptive reproductive strategy in Drosophila when a few founders colonize a new niche or when small populations are distributed at the edge of a species' range, consistent with models of geographical parthenogenesis.

  12. Distinct Biochemical Activities of Eyes absent During Drosophila Eye Development

    Science.gov (United States)

    Jin, Meng; Mardon, Graeme

    2016-01-01

    Eyes absent (Eya) is a highly conserved transcriptional coactivator and protein phosphatase that plays vital roles in multiple developmental processes from Drosophila to humans. Eya proteins contain a PST (Proline-Serine-Threonine)-rich transactivation domain, a threonine phosphatase motif (TPM), and a tyrosine protein phosphatase domain. Using a genomic rescue system, we find that the PST domain is essential for Eya activity and Dac expression, and the TPM is required for full Eya function. We also find that the threonine phosphatase activity plays only a minor role during Drosophila eye development and the primary function of the PST and TPM domains is transactivation that can be largely substituted by the heterologous activation domain VP16. Along with our previous results that the tyrosine phosphatase activity of Eya is dispensable for normal Eya function in eye formation, we demonstrate that a primary function of Eya during Drosophila eye development is as a transcriptional coactivator. Moreover, the PST/TPM and the threonine phosphatase activity are not required for in vitro interaction between retinal determination factors. Finally, this work is the first report of an Eya-Ey physical interaction. These findings are particularly important because they highlight the need for an in vivo approach that accurately dissects protein function. PMID:26980695

  13. Olfactory attraction of Drosophila suzukii by symbiotic acetic acid bacteria

    KAUST Repository

    Mazzetto, Fabio

    2016-03-24

    Some species of acetic acid bacteria (AAB) play relevant roles in the metabolism and physiology of Drosophila spp. and in some cases convey benefits to their hosts. The pest Drosophila suzukii harbors a set of AAB similar to those of other Drosophila species. Here, we investigate the potential to exploit the ability of AAB to produce volatile substances that attract female D. suzukii. Using a two-way olfactometer bioassay, we investigate the preference of D. suzukii for strains of AAB, and using solid-phase microextraction gas chromatography–mass spectrometry we specifically characterize their volatile profiles to identify attractive and non-attractive components produced by strains from the genera Acetobacter, Gluconobacter, and Komagataeibacter. Flies had a preference for one strain of Komagataeibacter and two strains of Gluconobacter. Analyses of the volatile profiles from the preferred Gluconobacter isolates found that acetic acid is distinctively emitted even after 2 days of bacterial growth, confirming the relevance of this volatile in the profile of this isolate for attracting flies. Analyses of the volatile profile from the preferred Komagataeibacter isolate showed that a different volatile in its profile could be responsible for attracting D. suzukii. Moreover, variation in the concentration of butyric acid derivatives found in some strains may influence the preference of D. suzukii. Our results indicate that Gluconobacter and Komagataeibacter strains isolated from D. suzukii have the potential to provide substances that could be exploited to develop sustainable mass-trapping-based control approaches. © 2016 Springer-Verlag Berlin Heidelberg

  14. Genetic control of muscle development: learning from Drosophila.

    Science.gov (United States)

    Maqbool, Tariq; Jagla, Krzysztof

    2007-01-01

    Muscle development involves a complex sequence of time and spatially regulated cellular events leading to the formation of highly specialised syncytial muscle cells displaying a common feature, the capacity of contraction. Analyses of mechanisms controlling muscle development reveals that the main steps of muscle formation including myogenic determination, diversification of muscle precursors, myoblast fusion and terminal differentiation involve the actions of evolutionarily conserved genes. Thus dissecting the genetic control of muscle development in simple model organisms appears to be an attractive way to get insights into core genetic cascade that orchestrate myogenesis. In this respect, particularly insightful have been data generated using Drosophila as a model system. Notably, the interplay between intrinsic and extrinsic cues that determine the early myogenic decisions leading to the specification of muscle progenitors and those controlling myoblasts fusion are much better characterised in Drosophila than in vertebrate species. Also, adult Drosophila myogenesis, which leads to the formation of vertebrate-like multi-fibre muscles, emerges as a particularly well-adapted system to study normal and aberrant muscle development.

  15. Odor-taste learning assays in Drosophila larvae.

    Science.gov (United States)

    Gerber, Bertram; Biernacki, Roland; Thum, Jeannette

    2013-03-01

    The Drosophila larva is an emerging model for studies in behavioral neurogenetics because of its simplicity in terms of cell number. Despite this simplicity, basic features of neuronal organization and key behavior faculties are shared with adult flies and with mammals. Here, we describe a pavlovian-type learning assay in fruit fly larvae. A group of larvae is sequentially exposed to specific odors in the presence or the absence of sugar, and then tested to determine whether they prefer the odor previously experienced with the reward. The protocol uses a two-group, reciprocal training design: One group of Drosophila larvae is exposed to n-amyl acetate (AM) with a sugar reward (+), then subsequently exposed to 1-octanol (OCT) with no reward (denoted AM+/OCT). The other group receives the reciprocal training (AM/OCT+). The two groups of larvae are then tested for their choices between AM and OCT. Relatively higher preferences for AM after AM+/OCT training than after AM/OCT+ training reflect associative learning and are quantified by the learning index (LI). This method offers a robust, simple, cheap, and reasonably quick test for learning ability (an aversive version is available as well, using either high-concentration salt or quinine as punishment). With the concerted efforts of the Drosophila research community, we anticipate it will allow us to unravel the full circuitry underlying odor-taste learning on a single-cell level.

  16. Cooperativity, Specificity, and Evolutionary Stability of Polycomb Targeting in Drosophila

    Directory of Open Access Journals (Sweden)

    Bernd Schuettengruber

    2014-10-01

    Full Text Available Summary: Metazoan genomes are partitioned into modular chromosomal domains containing active or repressive chromatin. In flies, Polycomb group (PcG response elements (PREs recruit PHO and other DNA-binding factors and act as nucleation sites for the formation of Polycomb repressive domains. The sequence specificity of PREs is not well understood. Here, we use comparative epigenomics and transgenic assays to show that Drosophila domain organization and PRE specification are evolutionarily conserved despite significant cis-element divergence within Polycomb domains, whereas cis-element evolution is strongly correlated with transcription factor binding divergence outside of Polycomb domains. Cooperative interactions of PcG complexes and their recruiting factor PHO stabilize PHO recruitment to low-specificity sequences. Consistently, PHO recruitment to sites within Polycomb domains is stabilized by PRC1. These data suggest that cooperative rather than hierarchical interactions among low-affinity sequences, DNA-binding factors, and the Polycomb machinery are giving rise to specific and strongly conserved 3D structures in Drosophila. : Schuettengruber et al. present an extensive comparative epigenomics data set, providing new insights into cis-driven versus buffered evolution of Polycomb recruitment and Polycomb domain specificity. Using chromatin immunoprecipitation sequencing and transgenic assays, they demonstrate an extremely high conservation of Polycomb repressive domains in five Drosophila species. Using Hi-C and knockout experiments, they challenge the standard hierarchical Polycomb recruitment model and demonstrate that cooperative rather than hierarchical interactions among DNA motifs, transcription factors, and Polycomb group complexes define Polycomb domains.

  17. Neurophysiology of Drosophila Models of Parkinson’s Disease

    Directory of Open Access Journals (Sweden)

    Ryan J. H. West

    2015-01-01

    Full Text Available We provide an insight into the role Drosophila has played in elucidating neurophysiological perturbations associated with Parkinson’s disease- (PD- related genes. Synaptic signalling deficits are observed in motor, central, and sensory systems. Given the neurological impact of disease causing mutations within these same genes in humans the phenotypes observed in fly are of significant interest. As such we observe four unique opportunities provided by fly nervous system models of Parkinson’s disease. Firstly, Drosophila models are instrumental in exploring the mechanisms of neurodegeneration, with several PD-related mutations eliciting related phenotypes including sensitivity to energy supply and vesicular deformities. These are leading to the identification of plausible cellular mechanisms, which may be specific to (dopaminergic neurons and synapses rather than general cellular phenotypes. Secondly, models show noncell autonomous signalling within the nervous system, offering the opportunity to develop our understanding of the way pathogenic signalling propagates, resembling Braak’s scheme of spreading pathology in PD. Thirdly, the models link physiological deficits to changes in synaptic structure. While the structure-function relationship is complex, the genetic tractability of Drosophila offers the chance to separate fundamental changes from downstream consequences. Finally, the strong neuronal phenotypes permit relevant first in vivo drug testing.

  18. Heavy metals effect in Drosophila melanogaster germinal cells

    International Nuclear Information System (INIS)

    Rosa Duque de la, M.E.

    1984-01-01

    Heavy metals occur naturally and some of them are very important in cellular metabolism. Industrial development has increased metal concentration in the environment and in the living organisms tissues. This increase promotes the human risk to suffer teratogenesis, carcinogenesis and mutagenesis. Different biological systems have been used to proof the genetic effect of heavy metals including Drosophila. In the present work chromium, cadmium, lead, zinc and arsenic salts were administered to Drosophila females and males adults in order to determine the genetic effect produced by these compounds, in both femenine and masculine germinal cells. The mating system used (''Oster males'' and y 2 wsup(a)/y 2 wsup(a); e/e females) permited to determine among two succesive generations, the mutagenic effects produced by heavy metals in Drosophila. The salts administration to adult flies was made by injection. Non-disjunction, X-chromosome loss, and sex linked recessive lethals frequency was increased by heavy metals. It was observed a fertility disminution between F 1 descendants from individuals treated with the metalic salts. It was demonstrated that heavy metals can interact with genetic material at different levels in the two types of gametic cells to produce genetic damage. (author)

  19. FMRFamide signaling promotes stress-induced sleep in Drosophila.

    Science.gov (United States)

    Lenz, Olivia; Xiong, Jianmei; Nelson, Matthew D; Raizen, David M; Williams, Julie A

    2015-07-01

    Enhanced sleep in response to cellular stress is a conserved adaptive behavior across multiple species, but the mechanism of this process is poorly understood. Drosophila melanogaster increases sleep following exposure to septic or aseptic injury, and Caenorhabditis elegans displays sleep-like quiescence following exposure to high temperatures that stress cells. We show here that, similar to C. elegans, Drosophila responds to heat stress with an increase in sleep. In contrast to Drosophila infection-induced sleep, heat-induced sleep is not sensitive to the time-of-day of the heat pulse. Moreover, the sleep response to heat stress does not require Relish, the NFκB transcription factor that is necessary for infection-induced sleep, indicating that sleep is induced by multiple mechanisms from different stress modalities. We identify a sleep-regulating role for a signaling pathway involving FMRFamide neuropeptides and their receptor FR. Animals mutant for either FMRFamide or for the FMRFamide receptor (FR) have a reduced recovery sleep in response to heat stress. FR mutants, in addition, show reduced sleep responses following infection with Serratia marcescens, and succumb to infection at a faster rate than wild-type controls. Together, these findings support the hypothesis that FMRFamide and its receptor promote an adaptive increase in sleep following stress. Because an FMRFamide-like neuropeptide plays a similar role in C. elegans, we propose that FRMFamide neuropeptide signaling is an ancient regulator of recovery sleep which occurs in response to cellular stress. Copyright © 2015 Elsevier Inc. All rights reserved.

  20. The annealing helicase and branch migration activities of Drosophila HARP.

    Directory of Open Access Journals (Sweden)

    George A Kassavetis

    Full Text Available HARP (SMARCAL1, MARCAL1 is an annealing helicase that functions in the repair and restart of damaged DNA replication forks through its DNA branch migration and replication fork regression activities. HARP is conserved among metazoans. HARP from invertebrates differs by the absence of one of the two HARP-specific domain repeats found in vertebrates. The annealing helicase and branch migration activity of invertebrate HARP has not been documented. We found that HARP from Drosophila melanogaster retains the annealing helicase activity of human HARP, the ability to disrupt D-loops and to branch migrate Holliday junctions, but fails to regress model DNA replication fork structures. A comparison of human and Drosophila HARP on additional substrates revealed that both HARPs are competent in branch migrating a bidirectional replication bubble composed of either DNA:DNA or RNA:DNA hybrid. Human, but not Drosophila, HARP is also capable of regressing a replication fork structure containing a highly stable poly rG:dC hybrid. Persistent RNA:DNA hybrids in vivo can lead to replication fork arrest and genome instability. The ability of HARP to strand transfer hybrids may signify a hybrid removal function for this enzyme, in vivo.

  1. Drosophila Melanogaster as an Emerging Translational Model of Human Nephrolithiasis

    Science.gov (United States)

    Miller, Joe; Chi, Thomas; Kapahi, Pankaj; Kahn, Arnold J.; Kim, Man Su; Hirata, Taku; Romero, Michael F.; Dow, Julian A.T.; Stoller, Marshall L.

    2013-01-01

    Purpose The limitations imposed by human clinical studies and mammalian models of nephrolithiasis have hampered the development of effective medical treatments and preventative measures for decades. The simple but elegant Drosophila melanogaster is emerging as a powerful translational model of human disease, including nephrolithiasis and may provide important information essential to our understanding of stone formation. We present the current state of research using D. melanogaster as a model of human nephrolithiasis. Materials and Methods A comprehensive review of the English language literature was performed using PUBMED. When necessary, authoritative texts on relevant subtopics were consulted. Results The genetic composition, anatomic structure and physiologic function of Drosophila Malpighian tubules are remarkably similar to those of the human nephron. The direct effects of dietary manipulation, environmental alteration, and genetic variation on stone formation can be observed and quantified in a matter of days. Several Drosophila models of human nephrolithiasis, including genetically linked and environmentally induced stones, have been developed. A model of calcium oxalate stone formation is among the most recent fly models of human nephrolithiasis. Conclusions The ability to readily manipulate and quantify stone formation in D. melanogaster models of human nephrolithiasis presents the urologic community with a unique opportunity to increase our understanding of this enigmatic disease. PMID:23500641

  2. Transcriptomic Response of Drosophila Melanogaster Pupae Developed in Hypergravity

    Science.gov (United States)

    Hosamani, Ravikumar; Hateley, Shannon; Bhardwaj, Shilpa R.; Pachter, Lior; Bhattacharya, Sharmila

    2016-01-01

    The metamorphosis of Drosophila is evolutionarily adapted to Earth's gravity, and is a tightly regulated process. Deviation from 1g to microgravity or hypergravity can influence metamorphosis, and alter associated gene expression. Understanding the relationship between an altered gravity environment and developmental processes is important for NASA's space travel goals. In the present study, 20 female and 20 male synchronized (Canton S, 2 to 3day old) flies were allowed to lay eggs while being maintained in a hypergravity environment (3g). Centrifugation was briefly stopped to discard the parent flies after 24hrs of egg laying, and then immediately continued until the eggs developed into P6-staged pupae (25 - 43 hours after pupation initiation). Post hypergravity exposure, P6-staged pupae were collected, total RNA was extracted using Qiagen RNeasy mini kits. We used RNA-Seq and qRT-PCR techniques to profile global transcriptomic changes in early pupae exposed to chronic hypergravity. During the pupal stage, Drosophila relies upon gravitational cues for proper development. Assessing gene expression changes in the pupa under altered gravity conditions helps highlight gravity dependent genetic pathways. A robust transcriptional response was observed in hypergravity-exposed pupae compared to controls, with 1,513 genes showing a significant (q Drosophila pupae in response to hypergravity.

  3. Dopamine Modulates Serotonin Innervation in the Drosophila Brain

    Directory of Open Access Journals (Sweden)

    Janna Niens

    2017-10-01

    Full Text Available Parkinson’s disease (PD results from a progressive degeneration of the dopaminergic nigrostriatal system leading to a decline in movement control, with resting tremor, rigidity and postural instability. Several aspects of PD can be modeled in the fruit fly, Drosophila melanogaster, including α-synuclein-induced degeneration of dopaminergic neurons, or dopamine (DA loss by genetic elimination of neural DA synthesis. Defective behaviors in this latter model can be ameliorated by feeding the DA precursor L-DOPA, analogous to the treatment paradigm for PD. Secondary complication from L-DOPA treatment in PD patients are associated with ectopic synthesis of DA in serotonin (5-HT-releasing neurons, leading to DA/5-HT imbalance. Here we examined the neuro-anatomical adaptations resulting from imbalanced DA/5-HT signaling in Drosophila mutants lacking neural DA. We find that, similar to rodent models of PD, lack of DA leads to increased 5-HT levels and arborizations in specific brain regions. Conversely, increased DA levels by L-DOPA feeding leads to reduced connectivity of 5-HT neurons to their target neurons in the mushroom body (MB. The observed alterations of 5-HT neuron plasticity indicate that loss of DA signaling is not solely responsible for the behavioral disorders observed in Drosophila models of PD, but rather a combination of the latter with alterations of 5-HT circuitry.

  4. Tissue design: how Drosophila tumors remodel their neighborhood.

    Science.gov (United States)

    Patel, Parthive H; Edgar, Bruce A

    2014-04-01

    Drosophila genetics has long been appreciated as a powerful approach for discovering the normal functions of genes that act as oncogenes and tumor suppressors in human cancer. Recent studies have also highlighted its advantages for deciphering how such genes function during tumorigenesis itself. Here we detail studies relating to how tumors, generated in developing organs and adult stem cell-based tissues, remodel the tissue landscape to their benefit. Like mammalian tumors, insect tumors can dissolve extracellular matrix, recruit blood cells, migrate and invade other tissues. While much is known about how mammalian fibroblasts, immune cells and vasculature promote late tumorigenesis, less is understood about the very earliest stages of tumor development in mammals. Because Drosophila has fewer mitotic cells and a simpler tissue architecture, it affords easy detection and analysis of early clonal tumor growth. Drosophila studies have revealed both cooperative and competitive interactions between tumor and normal cells during early tumor growth. During development, these interactions typically occur with other proliferative progenitor cells, but in adult stem cell-based tissues, the stem cell niche can fuel tumor growth. Copyright © 2014 Elsevier Ltd. All rights reserved.

  5. Nomadic enhancers: tissue-specific cis-regulatory elements of yellow have divergent genomic positions among Drosophila species.

    Directory of Open Access Journals (Sweden)

    Gizem Kalay

    2010-11-01

    Full Text Available cis-regulatory DNA sequences known as enhancers control gene expression in space and time. They are central to metazoan development and are often responsible for changes in gene regulation that contribute to phenotypic evolution. Here, we examine the sequence, function, and genomic location of enhancers controlling tissue- and cell-type specific expression of the yellow gene in six Drosophila species. yellow is required for the production of dark pigment, and its expression has evolved largely in concert with divergent pigment patterns. Using Drosophila melanogaster as a transgenic host, we examined the expression of reporter genes in which either 5' intergenic or intronic sequences of yellow from each species controlled the expression of Green Fluorescent Protein. Surprisingly, we found that sequences controlling expression in the wing veins, as well as sequences controlling expression in epidermal cells of the abdomen, thorax, and wing, were located in different genomic regions in different species. By contrast, sequences controlling expression in bristle-associated cells were located in the intron of all species. Differences in the precise pattern of spatial expression within the developing epidermis of D. melanogaster transformants usually correlated with adult pigmentation in the species from which the cis-regulatory sequences were derived, which is consistent with cis-regulatory evolution affecting yellow expression playing a central role in Drosophila pigmentation divergence. Sequence comparisons among species favored a model in which sequential nucleotide substitutions were responsible for the observed changes in cis-regulatory architecture. Taken together, these data demonstrate frequent changes in yellow cis-regulatory architecture among Drosophila species. Similar analyses of other genes, combining in vivo functional tests of enhancer activity with in silico comparative genomics, are needed to determine whether the pattern of

  6. Neuron-specific knockdown of the Drosophila fat induces reduction of life span, deficient locomotive ability, shortening of motoneuron terminal branches and defects in axonal targeting.

    Science.gov (United States)

    Nakamura, Aya; Tanaka, Ryo; Morishita, Kazushige; Yoshida, Hideki; Higuchi, Yujiro; Takashima, Hiroshi; Yamaguchi, Masamitsu

    2017-07-01

    Mutations in FAT4 gene, one of the human FAT family genes, have been identified in Van Maldergem syndrome (VMS) and Hennekam lymphangiectasia-lymphedema syndrome (HS). The FAT4 gene encodes a large protein with extracellular cadherin repeats, EGF-like domains and Laminin G-like domains. FAT4 plays a role in tumor suppression and planar cell polarity. Drosophila contains a human FAT4 homologue, fat. Drosophila fat has been mainly studied with Drosophila eye and wing systems. Here, we specially knocked down Drosophila fat in nerve system. Neuron-specific knockdown of fat shortened the life span and induced the defect in locomotive abilities of adult flies. In consistent with these phenotypes, defects in synapse structure at neuromuscular junction were observed in neuron-specific fat-knockdown flies. In addition, aberrations in axonal targeting of photoreceptor neuron in third-instar larvae were also observed, suggesting that fat involves in axonal targeting. Taken together, the results indicate that Drosophila fat plays an essential role in formation and/or maintenance of neuron. Both VMS and HS show mental retardation and neuronal defects. We therefore consider that these two rare human diseases could possibly be caused by the defect in FAT4 function in neuronal cells. © 2017 Molecular Biology Society of Japan and John Wiley & Sons Australia, Ltd.

  7. New yeast/E. coli/Drosophila triple shuttle vectors for efficient generation of Drosophila P element transformation constructs.

    Science.gov (United States)

    Paululat, Achim; Heinisch, Jürgen J

    2012-12-15

    We have generated a set of novel triple shuttle vectors that facilitate the construction of Drosophila-P-element transformations vectors. These YED-vectors allow the insertion of any kind of sequence at any chosen position due to the presence of a yeast casette which ensures replication and allows for homologous recombination in Saccharomyces cerevisiae. As a proof of principle we generated several reporter constructs and tested them in transgenic flies for expression and correct subcellular localization. YED-vectors can be used for many purposes including promoter analysis or the expression of tagged or truncated proteins. Thus, time-consuming conventional restriction site based multi-step cloning procedures can be circumvented by using the new YED-vectors. The new set of triple shuttle vectors will be highly beneficial for the rapid construction of complex Drosophila transformation plasmids. Copyright © 2012 Elsevier B.V. All rights reserved.

  8. Multistate Comparison of Attractants for Monitoring Drosophila suzukii (Diptera: Drosophilidae) in Blueberries and Caneberries.

    Science.gov (United States)

    Burrack, Hannah J; Asplen, Mark; Bahder, Luz; Collins, Judith; Drummond, Francis A; Guédot, Christelle; Isaacs, Rufus; Johnson, Donn; Blanton, Anna; Lee, Jana C; Loeb, Gregory; Rodriguez-Saona, Cesar; van Timmeren, Steven; Walsh, Douglas; McPhie, Douglas R

    2015-06-01

    Drosophila suzukii Matsumara, also referred to as the spotted wing drosophila, has recently expanded its global range with significant consequences for its primary host crops: blueberries, blackberries, raspberries, cherries, and strawberries. D. suzukii populations can increase quickly, and their infestation is difficult to predict and prevent. The development of effective tools to detect D. suzukii presence in new areas, to time the beginning of activity within a crop, to track seasonal activity patterns, and to gauge the effectiveness of management efforts has been a key research goal. We compared the efficiency, selectivity, and relationship to fruit infestation of a range of commonly used homemade baits and a synthetic formulated lure across a wide range of environments in 10 locations throughout the United States. Several homemade baits were more efficient than apple cider vinegar, a commonly used standard, and a commercially formulated lure was, in some configurations and environments, comparable with the most effective homemade attractant as well as potentially more selective. All alternative attractants also captured flies between 1 and 2 wk earlier than apple cider vinegar, and detected the presence of D. suzukii prior to the development of fruit infestation. Over half the Drosophila spp. flies captured in traps baited with any of the attractants were not D. suzukii, which may complicate their adoption by nonexpert users. The alternative D. suzukii attractants tested are improvement on apple cider vinegar and may be useful in the development of future synthetic lures. © The Authors 2015. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  9. Drosophila p115 is required for Cdk1 activation and G2/M cell cycle transition.

    Science.gov (United States)

    Ibar, Consuelo; Glavic, Álvaro

    2017-04-01

    Golgi complex inheritance and its relationship with the cell cycle are central in cell biology. Golgi matrix proteins, known as golgins, are one of the components that underlie the shape and functionality of this organelle. In mammalian cells, golgins are phosphorylated during mitosis to allow fragmentation of the Golgi ribbon and they also participate in spindle dynamics; both processes are required for cell cycle progression. Little is known about the function of golgins during mitosis in metazoans in vivo. This is particularly significant in Drosophila, in which the Golgi architecture is distributed in numerous units scattered throughout the cytoplasm, in contrast with mammalian cells. We examined the function of the ER/cis-Golgi golgin p115 during the proliferative phase of the Drosophila wing imaginal disc. Knockdown of p115 decreased tissue size. This phenotype was not caused by programmed cell death or cell size reductions, but by a reduction in the final cell number due to an accumulation of cells at the G2/M transition. This phenomenon frequently allows mitotic bypass and re-replication of DNA. These outcomes are similar to those observed following the partial loss of function of positive regulators of Cdk1 in Drosophila. In agreement with this, Cdk1 activation was reduced upon p115 knockdown. Interestingly, these phenotypes were fully rescued by Cdk1 overexpression and partially rescued by Myt1 depletion, but not by String (also known as Cdc25) overexpression. Additionally, we confirmed the physical interaction between p115 and Cdk1, suggesting that the formation of a complex where both proteins are present is essential for the full activation of Cdk1 and thus the correct progression of mitosis in proliferating tissues. Copyright © 2017 Elsevier B.V. All rights reserved.

  10. Is Drosophila-microbe association species-specific or region specific? A study undertaken involving six Indian Drosophila species.

    Science.gov (United States)

    Singhal, Kopal; Khanna, Radhika; Mohanty, Sujata

    2017-06-01

    The present work aims to identify the microbial diversity associated with six Indian Drosophila species using next generation sequencing (NGS) technology and to discover the nature of their distribution across species and eco-geographic regions. Whole fly gDNA of six Drosophila species were used to generate sequences in an Illumina platform using NGS technology. De novo based assembled raw reads were blasted against the NR database of NCBI using BLASTn for identification of their bacterial loads. We have tried to include Drosophila species from different taxonomical groups and subgroups and from three different eco-climatic regions India; four species belong to Central India, while the rest two, D. melanogaster and D. ananassae, belong to West and South India to determine both their species-wise and region-wide distribution. We detected the presence of 33 bacterial genera across all six study species, predominated by the class Proteobacteria. Amongst all, D. melanogaster was found to be the most diverse by carrying around 85% of the bacterial diversity. Our findings infer both species-specific and environment-specific nature of the bacterial species inhabiting the Drosophila host. Though the present results are consistent with most of the earlier studies, they also remain incoherent with some. The present study outcome on the host-bacteria association and their species specific adaptation may provide some insight to understand the host-microbial interactions and the phenotypic implications of microbes on the host physiology. The knowledge gained may be importantly applied into the recent insect and pest population control strategy going to implement through gut microflora in India and abroad.

  11. Systematic Study of Drosophila MicroRNA Functions Using a Collection of Targeted Knockout Mutations

    DEFF Research Database (Denmark)

    Chen, Ya-Wen; Song, Shilin; Weng, Ruifen

    2014-01-01

    MicroRNAs are abundant in animal genomes, yet little is known about their functions in vivo. Here, we report the production of 80 new Drosophila miRNA mutants by targeted homologous recombination. These mutants remove 104 miRNAs. Together with 15 previously reported mutants, this collection inclu...... analysis of the biological roles of Drosophila miRNAs....

  12. The nutritional and hedonic value of food modulate sexual receptivity in Drosophila melanogaster females

    NARCIS (Netherlands)

    Gorter, Jenke A; Jagadeesh, Samyukta; Gahr, Christoph; Boonekamp, Jelle J; Levine, Joel D; Billeter, Jean-Christophe

    2016-01-01

    Food and sex often go hand in hand because of the nutritional cost of reproduction. For Drosophila melanogaster females, this relationship is especially intimate because their offspring develop on food. Since yeast and sugars are important nutritional pillars for Drosophila, availability of these

  13. Effect of tempol on redox homeostasis and stress tolerance in mimetically aged Drosophila

    NARCIS (Netherlands)

    Aksu, Ugur; Yanar, Karolin; Terzioglu, Duygu; Erkol, Tugçe; Ece, Evrim; Aydin, Seval; Uslu, Ezel; Çakatay, Ufuk

    2014-01-01

    We aimed to test our hypothesis that scavenging reactive oxygen species (ROS) with tempol, a membrane permeable antioxidant, affects the type and magnitude of oxidative damage and stress tolerance through mimetic aging process in Drosophila. Drosophila colonies were randomly divided into three

  14. Drosophila melanogaster as a Versatile Model Organism in Food and Nutrition Research.

    Science.gov (United States)

    Staats, Stefanie; Lüersen, Kai; Wagner, Anika E; Rimbach, Gerald

    2018-04-18

    Drosophila melanogaster has been widely used in the biological sciences as a model organism. Drosophila has a relatively short life span of 60-80 days, which makes it attractive for life span studies. Moreover, approximately 60% of the fruit fly genes are orthologs to mammals. Thus, metabolic and signal transduction pathways are highly conserved. Maintenance and reproduction of Drosophila do not require sophisticated equipment and are rather cheap. Furthermore, there are fewer ethical issues involved in experimental Drosophila research compared with studies in laboratory rodents, such as rats and mice. Drosophila is increasingly recognized as a model organism in food and nutrition research. Drosophila is often fed complex solid diets based on yeast, corn, and agar. There are also so-called holidic diets available that are defined in terms of their amino acid, fatty acid, carbohydrate, vitamin, mineral, and trace element compositions. Feed intake, body composition, locomotor activity, intestinal barrier function, microbiota, cognition, fertility, aging, and life span can be systematically determined in Drosophila in response to dietary factors. Furthermore, diet-induced pathophysiological mechanisms including inflammation and stress responses may be evaluated in the fly under defined experimental conditions. Here, we critically evaluate Drosophila melanogaster as a versatile model organism in experimental food and nutrition research, review the corresponding data in the literature, and make suggestions for future directions of research.

  15. Hsp27 gene in Drosophila ananassae subgroup was split by a ...

    Indian Academy of Sciences (India)

    Abstract. In Drosophila, heat shock protein 27 (Hsp27) is a critical single-copy intron-free nuclear gene involved in the defense response against fungi and bacteria, and is a regulator of adult lifespan. In the present study, 33 homologous Hsp27 nucleotide sequences from different Drosophila species were amplified by PCR ...

  16. Recombinagenic activity of integerrimine, a pyrrolizidine alkaloid from Senecio brasiliensis, in somatic cells of Drosophila melanogaster.

    Science.gov (United States)

    Campesato, V R; Graf, U; Reguly, M L; de Andrade, H H

    1997-01-01

    Integerrimine (ITR), a pyrrolizidine alkaloid from Senecio brasiliensis, was tested for genotoxicity using the wing somatic mutation and recombination test (SMART) in Drosophila melanogaster. The compound was administered by chronic feeding (48 hours) of 3-day-old larvae. Two different crosses involving the markers flare (flr) and multiple wing hairs (mwh) were used, that is, the standard (ST) cross and the high bioactivation (HB) cross, which has a high cytochrome P450-dependent bioactivation capacity. In both crosses, the wings of two types of progeny were analyzed, that is, inversion-free marker heterozygotes and balancer heterozygotes carrying multiple inversions. ITR was found to be equally potent in inducing spots in a dose-related manner in the marker heterozygotes of both crosses. This indicates that the bioactivation capacity present in larvae of the ST cross is sufficient to reveal the genotoxic activity of ITR. In the balancer heterozygotes of both crosses, where all recombinational events are eliminated due to the inversions, the frequencies of induced spots were considerably reduced which documents the recombinagenic activity of ITR. Linear regression analysis of the dose response relationships for both genotypes shows that 85% to 90% of the wing spots are due to mitotic recombination.

  17. P1 interneurons promote a persistent internal state that enhances inter-male aggression in Drosophila

    Science.gov (United States)

    Hoopfer, Eric D; Jung, Yonil; Inagaki, Hidehiko K; Rubin, Gerald M; Anderson, David J

    2015-01-01

    How brains are hardwired to produce aggressive behavior, and how aggression circuits are related to those that mediate courtship, is not well understood. A large-scale screen for aggression-promoting neurons in Drosophila identified several independent hits that enhanced both inter-male aggression and courtship. Genetic intersections revealed that 8-10 P1 interneurons, previously thought to exclusively control male courtship, were sufficient to promote fighting. Optogenetic experiments indicated that P1 activation could promote aggression at a threshold below that required for wing extension. P1 activation in the absence of wing extension triggered persistent aggression via an internal state that could endure for minutes. High-frequency P1 activation promoted wing extension and suppressed aggression during photostimulation, whereas aggression resumed and wing extension was inhibited following photostimulation offset. Thus, P1 neuron activation promotes a latent, internal state that facilitates aggression and courtship, and controls the overt expression of these social behaviors in a threshold-dependent, inverse manner. DOI: http://dx.doi.org/10.7554/eLife.11346.001 PMID:26714106

  18. The induction of somatic mutations by high-LET radiation observed using the Drosophila assay system

    International Nuclear Information System (INIS)

    Yoshikawa, Isao; Takatsuji, Toshihiro; Nagano, Masaaki; Hoshi, Masaharu; Takada, Jun; Endo, Satoru

    1999-01-01

    To evaluate the mutagenic potential of high-LET radiation, an analysis was made on the production of somatic mutations by 252 Cf fission neutron s and heavy particle ions accelerated by a synchrotron. A Drosophila strain that allows simultaneous detection of two types of mutations in an identical fly was constructed. One was a wing-hair mutation and the other was an eye-color mosaic spot mutation. Measurements were made using a combined assay system of both mutation assays. Larvae were exposed to radiation at the age of post-ovipositional day-3. The efficiency of 252 Cf neutrons for inducing wing-hair mosaic spots was very high, the relative biological effectiveness (RBE) = 8.5, but the efficiency for eye-color mosaic spot was nearly equal (RBE = 1.2) to that of 137 Cs γ-rays. The RBE of carbon ions for inducing wing-hair mosaic spots increased as an increase in LET values. The RBE for the induction of eye-color mutants did not change with LET. These relationships suggest that more complex types of DNA damages such as non-rejoinable strand break or clustered double strand break, which increase with LET may be responsible for the induction of wing-hair mutation, while simpler forms of molecular damage may induce a reversion in the white-ivory allele. (M.N.)

  19. Drosophila C virus systemic infection leads to intestinal obstruction.

    Science.gov (United States)

    Chtarbanova, Stanislava; Lamiable, Olivier; Lee, Kwang-Zin; Galiana, Delphine; Troxler, Laurent; Meignin, Carine; Hetru, Charles; Hoffmann, Jules A; Daeffler, Laurent; Imler, Jean-Luc

    2014-12-01

    Drosophila C virus (DCV) is a positive-sense RNA virus belonging to the Dicistroviridae family. This natural pathogen of the model organism Drosophila melanogaster is commonly used to investigate antiviral host defense in flies, which involves both RNA interference and inducible responses. Although lethality is used routinely as a readout for the efficiency of the antiviral immune response in these studies, virus-induced pathologies in flies still are poorly understood. Here, we characterize the pathogenesis associated with systemic DCV infection. Comparison of the transcriptome of flies infected with DCV or two other positive-sense RNA viruses, Flock House virus and Sindbis virus, reveals that DCV infection, unlike those of the other two viruses, represses the expression of a large number of genes. Several of these genes are expressed specifically in the midgut and also are repressed by starvation. We show that systemic DCV infection triggers a nutritional stress in Drosophila which results from intestinal obstruction with the accumulation of peritrophic matrix at the entry of the midgut and the accumulation of the food ingested in the crop, a blind muscular food storage organ. The related virus cricket paralysis virus (CrPV), which efficiently grows in Drosophila, does not trigger this pathology. We show that DCV, but not CrPV, infects the smooth muscles surrounding the crop, causing extensive cytopathology and strongly reducing the rate of contractions. We conclude that the pathogenesis associated with systemic DCV infection results from the tropism of the virus for an important organ within the foregut of dipteran insects, the crop. DCV is one of the few identified natural viral pathogens affecting the model organism Drosophila melanogaster. As such, it is an important virus for the deciphering of host-virus interactions in insects. We characterize here the pathogenesis associated with DCV infection in flies and show that it results from the tropism of the

  20. Generation of genome-modified Drosophila cell lines using SwAP.

    Science.gov (United States)

    Franz, Alexandra; Brunner, Erich; Basler, Konrad

    2017-10-02

    The ease of generating genetically modified animals and cell lines has been markedly increased by the recent development of the versatile CRISPR/Cas9 tool. However, while the isolation of isogenic cell populations is usually straightforward for mammalian cell lines, the generation of clonal Drosophila cell lines has remained a longstanding challenge, hampered by the difficulty of getting Drosophila cells to grow at low densities. Here, we describe a highly efficient workflow to generate clonal Cas9-engineered Drosophila cell lines using a combination of cell pools, limiting dilution in conditioned medium and PCR with allele-specific primers, enabling the efficient selection of a clonal cell line with a suitable mutation profile. We validate the protocol by documenting the isolation, selection and verification of eight independently Cas9-edited armadillo mutant Drosophila cell lines. Our method provides a powerful and simple workflow that improves the utility of Drosophila cells for genetic studies with CRISPR/Cas9.