Von Willebrand disease protects against arterial thrombosis

NARCIS (Netherlands)

Sanders, Y.V.; Eikenboom, J.C.; De Wee, E.M.; Van Der Bom, J.G.; Cnossen, M.H.; Degenaar-Dujardin, M.E.; Fijnvandraat, K.; Kamphuisen, P.W.; Laros-Van Gorkum, B.A.; Meijer, K.; Mauser -Bunschoten, E.P.; Leebee k, F.W.

Background and Aims: Von Willebrand disease (VWD) is caused by reduced levels of or dysfunctional von Willebrand factor (VWF) and is characterized by a bleeding tendency. It is well known that individuals with high VWF levels have a higher risk for arterial thrombosis. Although it has never been

[Homocysteine and von Willebrand factor in chronic alcoholism].

Science.gov (United States)

Koriakin, A M; Epifantseva, N N; Dadyka, I V; Gorbatovskiĭ, Ia A

2010-04-01

The levels of homocysteine (HC) and von Willebrand factor (VWF) as cardiovascular risk factors were studied in patients with Stage II chronic alcoholism. Forty-one men with Stage II chronic alcoholism without clinical signs of somatic and infectious diseases were examined. Their median age was 37 (range 32-40) years; the alcoholization period was 12 (range 8-17) years. Plasma HC and VWF (amount and activity) levels were determined. In 63.4% of chronic alcoholic patients, HC levels was twice as high as in the controls; in 80.6%, both the content and activity of VWF were increased. There was no correlation between the levels of HC and VWF. Vascular endothelial damage concurrent with hyperhomocysteinemia increases a cardiovascular risk in patients with Stage II chronic alcoholism.

An ELISA for the quantitation of von Willebrand Factor

DEFF Research Database (Denmark)

Vinholt, Pernille Just; Overgaard, Martin; Diederichsen, Axel Cosmus Pyndt

2013-01-01

for measurement of von Willebrand factor-osteoprotegerin complex (VWF:OPG) in human plasma. Furthermore, the significance of VWF:OPG complex as a marker of cardiovascular disease (CVD) was evaluated. PATIENTS/METHODS: A sandwich ELISA for quantification of VWF:OPG was developed using a polyclonal rabbit anti...... with and without documented coronary calcification (total n=118). RESULTS AND CONCLUSIONS: The assay detected VWF:OPG complexes in human plasma, while no significant signal was observed when testing solutions containing VWF or recombinant OPG alone. Importantly, the ELISA assay was able to detect in vitro formed...

Single molecule force spectroscopy data and BD- and MD simulations on the blood protein von Willebrand factor

Directory of Open Access Journals (Sweden)

Sandra Posch

2016-09-01

Full Text Available We here give information for a deeper understanding of single molecule force spectroscopy (SMFS data through the example of the blood protein von Willebrand factor (VWF. It is also shown, how fitting of rupture forces versus loading rate profiles in the molecular dynamics (MD loading-rate range can be used to demonstrate the qualitative agreement between SMFS and MD simulations. The recently developed model by Bullerjahn, Sturm, and Kroy (BSK was used for this demonstration. Further, Brownian dynamics (BD simulations, which can be utilized to estimate the lifetimes of intramolecular VWF interactions under physiological shear, are described. For interpretation and discussion of the methods and data presented here, we would like to directly point the reader to the related research paper, “Mutual A domain interactions in the force sensing protein von Willebrand Factor” (Posch et al., 2016 [1]. Keywords: Atomic force microscopy, Single molecule force spectroscopy, Molecular dynamics simulation, Brownian dynamics simulation, von Willebrand factor

Interference from lupus anticoagulant on von Willebrand factor measurement in splenic marginal zone lymphoma

DEFF Research Database (Denmark)

Vinholt, Pernille J; Nybo, Mads

2015-01-01

We present a case concerning a patient with splenic marginal zone lymphoma (SMZL) and isolated prolonged activated partial thromboplastin time (aPTT) caused by lupus anticoagulant. Von Willebrand factor (VWF) activity and antigen were immeasurable by latex particle immunoturbidimetric assays...

Von Willebrand's disease: case report and review of literature.

Science.gov (United States)

Echahdi, Hanae; El Hasbaoui, Brahim; El Khorassani, Mohamed; Agadr, Aomar; Khattab, Mohamed

2017-01-01

Von Willebrand Disease (VWD) is the most common human inherited bleeding disorder due to a defect of Von Willebrand Factor (VWF), which a glycoprotein crucial for platelet adhesion to the subendothelium after vascular injury. VWD include quantitative defects of VWF, either partial (type 1 with VWF levels < 50 IU/dL) or virtually total (type 3 with undetectable VWF levels) and also qualitative defects of VWF (type 2 variants with discrepant antigenic and functional VWF levels). The most bleeding forms of VWD usually do not concern type 1 patients with the mildest VWF defects (VWF levels between 30 and 50IU/dL). Von willebrand factor is a complex multimeric protein with two functions: it forms a bridge between the platelets and areas of vascular damage and it binds to and stabilizes factor VIII, which is necessary for the clotting cascade. By taking a clinical history of bleeding (mucocutaneous bleeding symptoms suggestive of a primary haemostatic disorder, a quantitative or qualitative abnormality of VWF is possible) it is important to think about VWD and to make the appropriate diagnosis. If the VWD is suspected diagnostic tests should include an activated partial thromboplastin time, bleeding time, factor VIII: C Ristocetin cofactor and vWF antigen. Additional testing of ristocetin induced plattlet adhesion (RIPA) the multimeric structure and collagen binding test and genanalysis allow diagnosing the different types of von. Willebrand Disease. The treatment of choice in mild forms is the synthetic agent desmopressin. In patients with severe type 1, type 2B, 2N and type 3 or in people who do not response to desmopressin, the appropriate treatment is a factor VIII concentrate that is rich of VWF. We report a case of infant in 27-month-old boy who had been referred due to haemorrhagic shock. His birth histories, his familie's social history and developmental milestones were unremarkable. He was born at full term with no antenatal or perinatal complications. Prior to

Of von Willebrand factor and platelets.

Science.gov (United States)

Bryckaert, Marijke; Rosa, Jean-Philippe; Denis, Cécile V; Lenting, Peter J

2015-01-01

Hemostasis and pathological thrombus formation are dynamic processes that require multiple adhesive receptor-ligand interactions, with blood platelets at the heart of such events. Many studies have contributed to shed light on the importance of von Willebrand factor (VWF) interaction with its platelet receptors, glycoprotein (GP) Ib-IX-V and αIIbβ3 integrin, in promoting primary platelet adhesion and aggregation following vessel injury. This review will recapitulate our current knowledge on the subject from the rheological aspect to the spatio-temporal development of thrombus formation. We will also discuss the signaling events generated by VWF/GPIb-IX-V interaction, leading to platelet activation. Additionally, we will review the growing body of evidence gathered from the recent development of pathological mouse models suggesting that VWF binding to GPIb-IX-V is a promising target in arterial and venous pathological thrombosis. Finally, the pathological aspects of VWF and its impact on platelets will be addressed.

Pseudo (Platelet-type von Willebrand disease in pregnancy: a case report

Directory of Open Access Journals (Sweden)

Grover Neetu

2013-01-01

Full Text Available Abstract Background Pseudo (platelet-type-von Willebrand disease is a rare autosomal dominant bleeding disorder caused by an abnormal function of the glycoprotein lb protein; the receptor for von Willebrand factor. This leads to an increased removal of VWF multimers from the circulation as well as platelets and this results in a bleeding diathesis. Worldwide, less than 50 patients are reported with platelet type von Willebrand disease (PT-VWD. Case presentation We describe the management of platelet type von Willebrand disease in pregnancy of a 26 year old Caucasian primigravida. The initial diagnosis was made earlier following a significant haemorrhage post tonsillectomy several years prior to pregnancy. The patient was managed under a multidisciplinary team which included obstetricians, haematologists, anaesthetists and neonatologists. Care plans were made for the ante- natal, intra-partum and post-partum periods in partnership with the patient. The patient’s platelet count levels dropped significantly during the antenatal period. This necessitated the active exclusion of other causes of thrombocytopenia in pregnancy. A vaginal delivery was desired and plans were made for induction of labour at 38 weeks of gestation with platelet cover in view of the progressive fall of the platelet count. The patient however went into spontaneous labour on the day of induction. She was transfused two units of platelets before delivery. She had an unassisted vaginal delivery of a healthy baby. The successful antenatal counselling has encouraged the diagnosis of the same condition in her mother and sister. We found this to be a particularly interesting case as well as challenging to manage due to its rarity. Psuedo von Willebrand disease in pregnancy can be confused with a number of other differential diagnoses, such as gestational thrombocutopenia, idiopathatic thrombocytopenia, thrombotic thrombocytopenic purpura and pre-eclampsia; all need consideration

Acquired von Willebrand syndrome: A rare disorder of heterogeneous etiology

Directory of Open Access Journals (Sweden)

P Kasatkar

2013-01-01

Full Text Available Context: Acquired von Willebrand syndrome (AVWS is a rare bleeding disorder that mimics the inherited form of von Willebrand disease (VWD in terms of laboratory findings and clinical presentation. Aims: To study the etiology of acquired VWD. Settings and Design: The patients referred from various hospitals in and out of Mumbai were included in the study. Materials and Methods: Six patients with AVWS diagnosed at this center over the last 10 years were analyzed against 171 patients with inherited VWD. The differential diagnosis of AVWS was made based on reduced levels of von Willebrand antigen and von Willebrand ristocetin cofactor, decrease in ristocetin induced platelet aggregation, absence of correction in mixing studies with no prior history of bleeding problems and a negative family history for bleeding disorders. Results: In three patients, the disease was associated with systematic lupus erythematosus, out of which one was also associated with Kikuchi lymphadenitis and second with autoimmune hemolytic anemia. Fourth case was associated with hypothyroidism and fifth was a case of dermatitis and vitiligo. The last patient was a case of hemophilia A with Burkitts lymphoma, who developed autoantibodies to von Willebrand factor. Except two patients, all other patients responded to immune suppressive therapy with corticosteroids, while the patient with hypothyroidism responded to oral thyroxine. Conclusion: AVWS is a rare condition and may often be missed or diagnosed as inherited disease associated with heterogeneous disease conditions.

Von Willebrand's disease in the German shepherd dog : clinical communication

Directory of Open Access Journals (Sweden)

R.G. Lobetti

2000-07-01

Full Text Available Two litters of Germanshepherd dogs were evaluated for a haemorrhagic tendency that was characterised by excessive bleeding from the umbilicus at birth, haemorrhage and haematoma formation at vaccination, excessive bruising, and lameness due to haemarthrosis. Platelet counts, clotting times and Von Willebrand's factor (VWF assays were assessed in all dogs. Factor VIII determination was performed in 1 puppy and its parents. Based on the clotting times and VWF assay, 6 puppies (4 male and 2 female showed type I Von Willebrand's disease (VWD, 5 (4 male and 1 female possible type II VWD, and 4 were unaffected. One puppy with possible type II VWD had very low factor VIII activity; its sire had a normal factor activity, whereas the dam was in the low-normal range. This article reports type I and possible type II VWD in 2 related litters of German shepherd dogs, the latter being rare in German shepherd dogs.

Elevated levels of plasma von Willebrand factor and the risk of macro- and microvascular disease in type 2 diabetic patients with microalbuminuria

DEFF Research Database (Denmark)

Gaede, P; Vedel, P; Parving, H H

2001-01-01

BACKGROUND: The purpose of this study was to examine the concept suggesting that microalbuminuria in combination with high levels of plasma von Willebrand factor is a stronger predictor for cardiovascular disease and microvascular complications than microalbuminuria alone in type 2 diabetic...... patients. METHODS: One hundred and sixty patients with type 2 diabetes mellitus and persistent microalbuminuria were followed for an average of 3.8 (SD 0.3) years. 70% of the patients were treated with angiotensin converting enzyme (ACE)-inhibitors. Patients in this subanalysis were divided into two groups...... nephropathy or progression in diabetic retinopathy than microalbuminuria alone in patients with type 2 diabetes and persistent microalbuminuria....

The Molecular Genetics of von Willebrand Disease

Directory of Open Access Journals (Sweden)

Ergül Berber

2012-12-01

Full Text Available Quantitative and/or qualitative deficiency of von Willebrand factor (vWF is associated with the most common inherited bleeding disease von Willebrand disease (vWD. vWD is a complex disease with clinical and genetic heterogeneity. Incomplete penetrance and variable expression due to genetic and environmental factors contribute to its complexity. vWD also has a complex molecular pathogenesis. Some vWF gene mutations are associated with the affected vWF biosynthesis and multimerization, whereas others are associated with increased clearance and functional impairment. Moreover, in addition to a particular mutation, type O blood may result in the more severe phenotype. The present review aimed to provide a summary of the current literature on the molecular genetics of vWD.

The molecular genetics of von Willebrand disease.

Science.gov (United States)

Berber, Ergül

2012-12-01

Quantitative and/or qualitative deficiency of von Willebrand factor (vWF) is associated with the most common inherited bleeding disease von Willebrand disease (vWD). vWD is a complex disease with clinical and genetic heterogeneity. Incomplete penetrance and variable expression due to genetic and environmental factors contribute to its complexity. vWD also has a complex molecular pathogenesis. Some vWF gene mutations are associated with the affected vWF biosynthesis and multimerization, whereas others are associated with increased clearance and functional impairment. Moreover, in addition to a particular mutation, type O blood may result in the more severe phenotype. The present review aimed to provide a summary of the current literature on the molecular genetics of vWD. None declared.

Dynamics of von Willebrand factor reactivity in sickle cell disease during vaso-occlusive crisis and steady state

NARCIS (Netherlands)

Sins, J. W. R.; Schimmel, M.; Luken, B. M.; Nur, E.; Zeerleder, S. S.; van Tuijn, C. F. J.; Brandjes, D. P. M.; Kopatz, W. F.; Urbanus, R. T.; Meijers, J. C. M.; Biemond, B. J.; Fijnvandraat, K.

2017-01-01

Background: Endothelial activation plays a central role in the pathophysiology of vaso-occlusion in sickle cell disease (SCD), facilitating adhesive interactions with circulating blood cells. Upon activation, various adhesive molecules are expressed, including von Willebrand factor (VWF). Increased

Nordic Haemophilia Council's practical guidelines on diagnosis and management of von Willebrand disease

DEFF Research Database (Denmark)

Lassila, Riitta; Holme, Pål André; Landorph, Andrea

2011-01-01

Von Willebrand disease (VWD) is the most common inherited bleeding disorder characterized by spontaneous or tissue injury-related, mostly mucocutaneous, bleeding events. VWD affects both males and females and is caused by quantitative or qualitative deficiency of Von Willebrand factor. The diagno......Von Willebrand disease (VWD) is the most common inherited bleeding disorder characterized by spontaneous or tissue injury-related, mostly mucocutaneous, bleeding events. VWD affects both males and females and is caused by quantitative or qualitative deficiency of Von Willebrand factor...... subtyping may also be problematic. This article summarizes the guidelines of the Nordic Haemophilia Council (NHC), which are intended to serve as a practical tool and provide the standards for diagnosing and treating VWD patients. The complete Nordic Guidelines on VWD are available at the NHC Web site (http://nordhemophilia.org)....

Profile of von Willebrand factor antigen and von Willebrand factor propeptide in an overall TIA and ischaemic stroke population and amongst subtypes.

Science.gov (United States)

Tobin, W O; Kinsella, J A; Kavanagh, G F; O'Donnell, J S; McGrath, R T; Tierney, S; Egan, B; Feeley, T M; Coughlan, T; Collins, D R; O'Neill, D; Murphy, Sjx; Lim, S J; Murphy, R P; McCabe, Djh

2017-04-15

Von Willebrand factor propeptide (VWF:Ag II) is proposed to be a more sensitive marker of acute endothelial activation than von Willebrand factor antigen (VWF:Ag). Simultaneous data on VWF:Ag and VWF:Ag II profiles are very limited following TIA and ischaemic stroke. In this prospective, observational, case-control study, plasma VWF:Ag and VWF:Ag II levels were quantified in 164 patients≤4weeks of TIA or ischaemic stroke (baseline), and then ≥14days (14d) and ≥90days (90d) later, and compared with those from 27 healthy controls. TIA and stroke subtyping was performed according to the TOAST classification. The relationship between VWF:Ag and VWF:Ag II levels and platelet activation status was assessed. 'Unadjusted' VWF:Ag and VWF:Ag II levels were higher in patients at baseline, 14d and 90d than in controls (p≤0.03). VWF:Ag levels remained higher in patients than controls at baseline (p≤0.03), but not at 14d or 90d after controlling for differences in age or hypertension, and were higher in patients at baseline and 90d after controlling for smoking status (p≤0.04). 'Adjusted' VWF:Ag II levels were not higher in patients than controls after controlling for age, hypertension or smoking (p≥0.1). Patients with symptomatic carotid stenosis (N=46) had higher VWF:Ag and VWF:Ag II levels than controls at all time-points (p≤0.002). There was no significant correlation between platelet activation status and VWF:Ag or VWF:Ag II levels. VWF:Ag and VWF:Ag II levels are increased in an overall TIA and ischaemic stroke population, especially in patients with recently symptomatic carotid stenosis. VWF:Ag II was not superior to VWF:Ag at detecting acute endothelial activation in this cohort and might reflect timing of blood sampling in our study. Copyright © 2017 Elsevier B.V. All rights reserved.

A pilot study of homocyst(e)ine levels in essential hypertension: relationship to von Willebrand factor, an index of endothelial damage.

Science.gov (United States)

Lip, G Y; Edmunds, E; Martin, S C; Jones, A F; Blann, A D; Beevers, D G

2001-07-01

An interaction between homocyst(e)ine and the endothelium in hypertensive patients may promote thrombogenesis and atherogenesis, leading to adverse cardiovascular events. We hypothesized that homocyst(e)ine levels are abnormal in patients with essential hypertension, and that this may be related to an adverse effect on the vascular endothelium. Accordingly, we compared plasma levels of homocyst(e)ine and von Willebrand factor (marking endothelial damage) in 83 patients (43 men; mean age 54 +/- standard deviation 15.9 years) with essential hypertension (> 160/90 mm Hg), with levels in 25 healthy normotensive controls (13 men; mean age 56+/-11.8 years). Baseline levels of the markers and other clinical indices were then related to adverse cardiovascular events at follow-up. Plasma homocyst(e)ine (P = .0001) and von Willebrand factor (P = .031) levels were significantly higher in hypertensives compared to controls. After a mean follow-up of 76 patients for 45 months (range, 1 to 66 months), 17 subjects experienced an end point of either cardiovascular death (n = 10) or adverse cardiovascular event (n = 7). Comparing these 17 with the 59 free of an end point, the former were older (P = .0002) and had a longer duration of known hypertension (P = .018). There was a nonsignificant trend toward higher median plasma homocyst(e)ine levels in the patients sustaining a vascular end point (P = .07). In this pilot study, we suggest that essential hypertension may be associated with increased plasma homocyst(e)ine levels, but that this amino acid is unrelated to endothelial damage (von Willebrand factor), clinical indices, or prognosis.

Descripción de un inmunoensayo enzimático que reconoce anticuerpos anti-factor VIII/von Willebrand obtenidos a partir de hibridomas múridos Description of an enzime immunoassay that recognizes anti-factor VIII/von Willebrand antibodies obtained from murine hybridomas

Directory of Open Access Journals (Sweden)

Renée González Sampedro

1999-04-01

Full Text Available Se describe un inmunoensayo enzimático (ELISA que detecta anticuerpos anti-Factor-VIII/von Willebrand (FVIII/vW, con una relación de enlace > 5, que permite reconocer dichos anticuerpos tempranamente en los cultivos de hibridomas múridos. Para la adsorción de las placas del inmunoensayo se utilizaron preparados semipurificados de FVIII/vW obtenidos en Cuba. Se inmunizaron ratones Balb/c con la finalidad de generar los anticuerpos monoclonales detectados por este ELISA. Se obtuvo un clon con crecimiento estable y varios subclones positivos por el ELISA con actividad biológica específica de anticuerpos inhibidores de FVIIIAn enzime immunoassay (ELISA that detects anti-Factor VIII/von Willebrand (FVIII/vw antibodies with a binding relationship > 5 that allows the early recognition of such antibodies in the cultures of murine hybridomas is described. Semipurified preparations of FVIII/vw obtained in Cuba were used for the adsorption of the immunoassay plates. Balb/c mice were immunized in order to generate the monoclonal antibodies detected by this ELISA. A clone with stable growth and several positive subclones were obtained by ELISA with specific biological activity of FVIII-inhibiting antibodies

Paciente portadora de doença de von Willebrand submetida a cirurgia da valva mitral: uma estratégia para o controle da coagulopatia Patient with von Willebrand disease undergoing mitral valve repair: a strategy for the control of the coagulopathy

Directory of Open Access Journals (Sweden)

Ally Nader Roquetti Saroute

2007-01-01

Full Text Available Relatamos o caso de uma mulher de 60 anos portadora da doença de von Willebrand tipo I, submetida a cirurgia da valva mitral. A paciente necessitou de cuidados especiais em razão da coagulopatia e foi necessária a utilização de concentrado de fator VIII (VIIIf e fator de von Willebrand (vWf antes, durante e depois da cirurgia. Não houve complicações durante e após a cirurgia. Nove meses depois, a paciente encontra-se assintomática. A correção para valores adequados de VIIIf e vWf permitiu a realização da cirurgia com segurança.We report a case of a 60 year-old woman with von Willebrand disease type I that was submitted to a mitral valve repair. The patient needed special care due coagulopathy and needed VIII factor (VIIIf and von Willebrand factor (vWf, before, during and after surgery. There was no complication during or after surgery. Patient is asymptomatic nine months postoperatively. The correction of VIIIf and vWf allowed the realization of a safety surgery.

Dynamics of von Willebrand factor reactivity in sickle cell disease during vaso-occlusive crisis and steady state

NARCIS (Netherlands)

Sins, J. W.R.; Schimmel, Marein; Luken, Brenda M.; Nur, Erfan; Zeerleder, S.; van Tuijn, Charlotte F. J.; Brandjes, Dees P. M.; Kopatz, W. F.; Urbanus, R. T.; Meijers, Joost C. M.; Biemond, B. J.; Fijnvandraat, K.

2017-01-01

Essentials The role of von Willebrand Factor (VWF) in the pathophysiology of sickle cell disease is unclear. We assessed markers of VWF during admission for vaso-occlusive crisis (VOC) and steady state. VWF reactivity was higher during VOC and was associated with inflammation and neutrophil

Associations Between Diabetic Retinopathy and Plasma Levels of High-sensitive C-reactive Protein or Von Willebrand Factor in Long-term Type 1 Diabetic Patients

DEFF Research Database (Denmark)

Laursen, Jonas Vejvad Nørskov; Hoffmann, Stine Skovbo; Green, Anders

2013-01-01

.27 IU/ml (0.79-2.07 IU/ml), respectively. No or minimal DR (ETDRS-levels 10-20) was found in 16.4%, mild DR (ETDRS-level 35) in 19.4%, moderate DR (ETDRS-levels 43-47) in 11.0%, and 53.2% had proliferative diabetic retinopathy (PDR) corresponding to ETDRS-level 60 or more. In an age- and sex......Purpose: To evaluate high-sensitive C-reactive protein (hs-CRP) and von Willebrand factor as possible plasma markers of diabetic retinopathy in a population-based cohort of type 1 diabetic patients. Materials and Methods: This was a cross-sectional study of 201 type 1 diabetic patients from...... a population-based cohort from Fyn County, Denmark. Plasma levels of hs-CRP and von Willebrand factor antigen were measured and related to the level of diabetic retinopathy (DR) as evaluated by dilated nine-field 45 degree monoscopic fundus photos captured by Topcon TRC-NWS6 and graded according to the Early...

Establishment and characterization of a new and stable collagen-binding assay for the assessment of von Willebrand factor activity

Science.gov (United States)

Ni, Y; Nesrallah, J; Agnew, M; Geske, F J; Favaloro, E J

2013-01-01

Introduction Laboratory diagnosis of von Willebrand disease (VWD) requires determination of both von Willebrand factor (VWF) protein levels and activity. Current VWF activity tests include the ristocetin cofactor assay and the collagen-binding assay (VWF:CB). The goal of this investigation is to characterize a new collagen-binding assay and to determine its effectiveness in identifying VWD. Methods Analytical studies were carried out to characterize the performance of a new VWF:CB ELISA. Additionally, samples from a normal population were tested as were well-characterized type 1 and type 2 VWD samples. Results Repeatability and within-laboratory precision studies resulted in coefficients of variation (CVs) of ≤11%. A linear range of 1–354% (0.01–3.54 IU/mL) was determined, along with a limit of detection and a lower limit of quantitation of 1.6% and 4.0% (0.016 and 0.04 IU/mL), respectively. Samples tested from apparently healthy individuals resulted in a normal range of 54–217% (0.54–2.17 IU/mL). Known VWD type 1 and type 2 samples were also analyzed by the ELISA, with 99% of samples having VWF:CB below the normal reference range and an estimated 96% sensitivity and 87% specificity using a VWF collagen-binding/antigen cutoff ratio of 0.50. Conclusion This new VWF:CB ELISA provides an accurate measure of collagen-binding activity that aids in the diagnosis and differentiation of type 1 from type 2 VWD. PMID:23107512

Diagnosis and management of von Willebrand disease: a developing country perspective.

Science.gov (United States)

Nair, Sukesh Chandran; Viswabandya, Auro; Srivastava, Alok

2011-07-01

Special challenges exist in the management of patients with von Willebrand disease (VWD) because of limitations in diagnostic facilities and therapeutic options. However, even within these limitations, it is possible to establish comprehensive services for this condition. Our data show that among 202 patients with VWD, 107 were type 3, 62 were type 1, and the others different categories of type 2. Basic tests such as bleeding time and activated partial thromboplastin time with factor (F)VIII coagulant are able to diagnose most of those with severe disease. We have been able to adapt the specific tests such as von Willebrand factor (VWF) ristocetin cofactor and VWF antigen from the tedious batched manual methods to cost-effective automated methods on advanced coagulometers. Discriminatory tests such as VWF collagen binding, VWF:FVIIIB, ristocetin-induced platelet agglutination (RIPA) are done in batches. Therapeutic options and for the treatment of bleeding include desmopressin, cryoprecipitate, and intermediate purity VWF-containing clotting factor concentrates. Tranexamic acid is also widely used as well as hormonal therapy for menorrhagia. We have also shown that modest doses of intermediate purity FVIII (Koate DVI; Talecris Biotherapeutics, Raleigh, NC, USA) at 35 IU/kg preoperatively and 10 to 20 IU/kg after that are sufficient for surgical hemostasis in these patients. © Thieme Medical Publishers.

Regulation of plasma von Willebrand factor [version 1; referees: 3 approved

Directory of Open Access Journals (Sweden)

Karl C Desch

2018-01-01

Full Text Available Von Willebrand factor (VWF is a multimeric plasma glycoprotein that plays a central role in the initiation of blood coagulation. Through interactions between its specific functional domains, the vascular wall, coagulation factor VIII, and platelet receptors, VWF maintains hemostasis by binding to platelets and delivering factor VIII to the sites of vascular injury. In the healthy human population, plasma VWF levels vary widely. The important role of VWF is illustrated by individuals at the extremes of the normal distribution of plasma VWF concentrations where individuals with low VWF levels are more likely to present with mucocutaneous bleeding. Conversely, people with high VWF levels are at higher risk for venous thromboembolic disease, stroke, and coronary artery disease. This report will summarize recent advances in our understanding of environmental influences and the genetic control of VWF plasma variation in healthy and symptomatic populations and will also highlight the unanswered questions that are currently driving this field of study.

Testosterone and acute stress are associated with fibrinogen and von Willebrand factor in African men: the SABPA study.

Science.gov (United States)

Malan, Nicolaas T; von Känel, Roland; Schutte, Alta E; Huisman, Hugo W; Schutte, Rudolph; Smith, Wayne; Mels, Carina M; Kruger, Ruan; Meiring, Muriel; van Rooyen, Johannes M; Malan, Leoné

2013-10-12

Low testosterone, acute and chronic stress and hypercoagulation are all associated with hypertension and hypertension-related diseases. The interaction between these factors and future risk for coronary artery disease in Africans has not been fully elucidated. In this study, associations of testosterone, acute cardiovascular and coagulation stress responses with fibrinogen and von Willebrand factor in African and Caucasian men in a South African cohort were investigated. Cardiovascular variables were studied by means of beat-to-beat and ambulatory blood pressure monitoring. Fasting serum-, salivary testosterone and citrate coagulation markers were obtained from venous blood samples. Acute mental stress responses were evoked with the Stroop test. The African group demonstrated a higher cardiovascular risk compared to Caucasian men with elevated blood pressure, low-grade inflammation, chronic hyperglycemia (HbA1c), lower testosterone levels, and elevated von Willebrand factor (VWF) and fibrinogen levels. Blunted testosterone acute mental stress responses were demonstrated in African males. In multiple regression analyses, higher circulating levels of fibrinogen and VWF in Africans were associated with a low T environment (R(2) 0.24-0.28; p≤0.01), but only circulating fibrinogen in Caucasians. Regarding endothelial function, a low testosterone environment and a profile of augmented α-adrenergic acute mental stress responses (diastolic BP, D-dimer and testosterone) were associated with circulating VWF levels in Africans (Adj R(2) 0.24; pstress, salivary testosterone, D-dimer and vascular responses existed in African males in their association with circulating VWF but no interdependence of the independent variables occurred with fibrinogen levels. © 2013.

Von-Willebrand Disease Presenting as Intractable Epistaxis after Nasal Polypectomy

Directory of Open Access Journals (Sweden)

Jeong Jin Park

2014-01-01

Full Text Available Von-Willebrand disease (VWD is one of the platelet dysfunction disorders that results from a deficiency of Von-Willebrand factor, which is essential for hemostasis. VWD patients typically have normal laboratory results on screening for bleeding disorders. To suspect and diagnose VWD, a careful review of past medical history and laboratory tests is critical. A 59-year-old male patient presented with intractable nasal bleeding after nasal polypectomy. The bleeding was controlled by platelet transfusion, and he was later diagnosed with VWD.

Clinical and laboratory diagnosis of von Willebrand disease: A synopsis of the 2008 NHLBI/NIH guidelines

Science.gov (United States)

Nichols, William L.; Rick, Margaret E.; Ortel, Thomas L.; Montgomery, Robert R.; Sadler, J. Evan; Yawn, Barbara P.; James, Andra H.; Hultin, Mae B.; Manco-Johnson, Marilyn J.; Weinstein, Mark

2017-01-01

Von Willebrand factor (VWF) mediates blood platelet adhesion and accumulation at sites of blood vessel injury, and also carries coagulation factor VIII (FVIII) that is important for generating procoagulant activity. Von Willebrand disease (VWD), the most common inherited bleeding disorder, affects males and females, and reflects deficiency or defects of VWF that may also cause decreased FVIII. It may also occur less commonly as an acquired disorder (acquired von Willebrand syndrome). This article briefly summarizes selected features of the March 2008 evidence-based clinical and laboratory diagnostic recommendations from the National Heart, Lung, and Blood Institute (NHLBI) Expert Panel for assessment for VWD or other bleeding disorders or risks. Management of VWD is also addressed in the NHLBI guidelines, but is not summarized here. The VWD guidelines are available at the NHLBI Web site (http://www.nhlbi.nih.gov/guidelines/vwd). PMID:19415721

Characterization of Zebrafish von Willebrand Factor Reveals Conservation of Domain Structure, Multimerization, and Intracellular Storage

Directory of Open Access Journals (Sweden)

Arunima Ghosh

2012-01-01

Full Text Available von Willebrand disease (VWD is the most common inherited human bleeding disorder and is caused by quantitative or qualitative defects in von Willebrand factor (VWF. VWF is a secreted glycoprotein that circulates as large multimers. While reduced VWF is associated with bleeding, elevations in overall level or multimer size are implicated in thrombosis. The zebrafish is a powerful genetic model in which the hemostatic system is well conserved with mammals. The ability of this organism to generate thousands of offspring and its optical transparency make it unique and complementary to mammalian models of hemostasis. Previously, partial clones of zebrafish vwf have been identified, and some functional conservation has been demonstrated. In this paper we clone the complete zebrafish vwf cDNA and show that there is conservation of domain structure. Recombinant zebrafish Vwf forms large multimers and pseudo-Weibel-Palade bodies (WPBs in cell culture. Larval expression is in the pharyngeal arches, yolk sac, and intestinal epithelium. These results provide a foundation for continued study of zebrafish Vwf that may further our understanding of the mechanisms of VWD.

Association of von Willebrand factor blood levels with exercise hypertension.

Science.gov (United States)

Nikolic, Sonja B; Adams, Murray J; Otahal, Petr; Edwards, Lindsay M; Sharman, James E

2015-05-01

A hypertensive response to moderate intensity exercise (HRE) is associated with increased cardiovascular risk. The mechanisms of an HRE are unclear, although previous studies suggest this may be due to haemostatic and/or haemodynamic factors. We investigated the relationships between an HRE with haemostatic and hemodynamic indices. Sixty-four participants (57 ± 10 years, 71 % male) with indication for exercise stress testing underwent cardiovascular assessment at rest and during moderate intensity exercise, from which 20 participants developed an HRE (defined as moderate exercise systolic BP ≥ 170 mmHg/men and ≥ 160 mmHg/women). Rest, exercise and post-exercise blood samples were analysed for haemostatic markers, including von Willebrand factor (vWf), and haemodynamic measures of brachial and central blood pressure (BP), aortic stiffness and systemic vascular resistance index (SVRi). HRE participants had higher rest vWf compared with normotensive response to exercise (NRE) participants (1,927 mU/mL, 95 % CI 1,240-2,615, vs. 1,129 mU/mL, 95 % CI 871-1,386; p = 0.016). vWf levels significantly decreased from rest to post-exercise in HRE participants (p = 0.005), whereas vWf levels significantly increased from rest to exercise in NRE participants (p = 0.030). HRE participants also had increased triglycerides, rest BP, aortic stiffness and exercise SVRi (p HRE at moderate intensity.

Comparative analysis of von Willebrand factor profiles after implantation of left ventricular assist device and total artificial heart.

Science.gov (United States)

Reich, H J; Morgan, J; Arabia, F; Czer, L; Moriguchi, J; Ramzy, D; Esmailian, F; Lam, L; Dunhill, J; Volod, O

2017-08-01

Essentials Bleeding is a major source of morbidity during mechanical circulatory support. von Willebrand factor (VWF) multimer loss may contribute to bleeding. Different patterns of VWF multimer loss were seen with the two device types. This is the first report of total artificial heart associated VWF multimer loss. Background Bleeding remains a challenge during mechanical circulatory support and underlying mechanisms are incompletely understood. Functional von Willebrand factor (VWF) impairment because of loss of high-molecular-weight multimers (MWMs) produces acquired von Willebrand disease (VWD) after left ventricular assist device (LVAD). Little is known about VWF multimers with total artificial hearts (TAHs). Here, VWF profiles with LVADs and TAHs are compared using a VWD panel. Methods VWD evaluations for patients with LVAD or TAH (2013-14) were retrospectively analyzed and included: VWF activity (ristocetin cofactor, VWF:RCo), VWF antigen (VWF:Ag), ratio of VWF:RCo to VWF:Ag, and quantitative VWF multimeric analysis. Results Twelve patients with LVADs and 12 with TAHs underwent VWD evaluation. All had either normal (47.8%) or elevated (52.2%) VWF:RCo, normal (26.1%) or elevated (73.9%) VWF:Ag and 50.0% were disproportional (ratio ≤ 0.7). Multimeric analysis showed abnormal patterns in all patients with LVADs: seven with high MWM loss; five with highest MWM loss. With TAH, 10/12 patients had abnormal patterns: all with highest MWM loss. High MWM loss correlated with presence of LVAD and highest MWM loss with TAH. Increased low MWMs were detected in 22/24. Conclusion Using VWF multimeric analysis, abnormalities after LVAD or TAH were detected that would be missed with measurements of VWF level alone: loss of high MWM predominantly in LVAD, loss of highest MWM in TAH, and elevated levels of low MWM in both. This is the first study to describe TAH-associated highest MWM loss, which may contribute to bleeding. © 2017 International Society on Thrombosis and

Detection of von Willebrand factor and tissue factor in platelets-fibrin rich coronary thrombi in acute myocardial infarction.

Science.gov (United States)

Yamashita, Atsushi; Sumi, Takahiro; Goto, Shinya; Hoshiba, Yasunari; Nishihira, Kensaku; Kawamoto, Riichirou; Hatakeyama, Kinta; Date, Haruhiko; Imamura, Takuroh; Ogawa, Hisao; Asada, Yujiro

2006-01-01

The rapid closure of coronary arteries due to occlusive thrombi is the major cause of acute myocardial infarction. However, the mechanisms of coronary thrombus formation have not been elucidated. We immunohistochemically assessed the localizations and their changes over time of glycoprotein IIb/IIIa, fibrin, von Willebrand factor (vWF), and tissue factor (TF), after the onset of chest pain (platelets, fibrin, vWF, and TF from the early phase of onset, and glycoprotein IIb/IIIa and fibrin were closely associated with vWF and TF, respectively. vWF and/or TF may contribute to occlusive thrombus formation and be novel therapeutic candidates for treating patients with coronary thrombosis.

Von willebrand factor cleaving protease activity in the physiopathology of microangiopathic disorders Detección de la actividad de la proteasa que cliva al factor von Willebrand en la patofisiología de las microangiopatías

Directory of Open Access Journals (Sweden)

M. M. Amaral

2003-04-01

Full Text Available The von Willebrand factor cleaving protease (VWFCP modulates the von Willebrand factor (VWF multimeric size in normal plasma. VWFCP activity levels are decreased in different physiological and pathologic situations. Different techniques have been developed to unfold the purified VWF (perfusion at high shear rate, dialysis against urea in nitrocellulose filters, to detect the VWFCP activity on it (multimeric analysis of VWF, collagen binding to VWF assay and to use the patient plasma both as the source of the enzyme and substrate. In this paper we compared the above mentioned methods with new ones: normal plasma dialyzed on membranes instead of purified VWF, dialysis of the samples against urea in tubing instead of nitrocellulose filters, and sonicated plasma to remove the endogenous VWF. The perfusion assay and detection by multimeric analysis showed a limit of detection (25% of VWFCP activity. Dialysis against urea in both supports and detection by multimeric analysis, showed a better limit of detection (3%, but the recovery of the samples was not as efficient in nitrocellulose filters as it was in tubing. The detection by collagen binding to VWF has more advantages because it allows to analyze more samples than the multimeric analysis does in the same assay. The dialysis of plasma by membranes to obtain the source of exogenous VWF requires no complex equipment. The method, which uses patient plasma as the source of the enzyme and substrate, was inapplicable in our experience because the values could not be interpolated in the reference curve.La proteasa que cliva al factor von Willebrand (VWFCP controla el tamaño multimérico del factor von Willebrand (VWF en plasma normal. Sus niveles se encuentran disminuidos en diferentes situaciones fisiológicas y patológicas. Diferentes técnicas se desarrollaron para desplegar al VWF purificado (perfusión a alta fuerza de cizallamiento, diálisis contra urea en filtros de nitrocelulosa, para detectar

Translational Medicine Advances in von Willebrand Disease

Science.gov (United States)

Lillicrap, David

2014-01-01

Following the recognition of von Willebrand disease (VWD) in 1926 and the cloning of the gene for von Willebrand factor (VWF) in 1985, significant advances have been made in our fundamental knowledge of both the disease and the protein. Some of this new knowledge has also begun to impact the clinical management of VWD. First, the progressive increase in our understanding of the molecular genetic basis of VWD has resulted in rational applications of molecular testing to complement the current range of phenotypic tests for VWD. These molecular genetic strategies are most effectively directed at the prenatal diagnosis of type 3 VWD and confirmatory testing for types 2B and 2N disease. In contrast, the use of molecular testing to clarify the diagnosis of type 1 VWD is of marginal benefit, at best. In terms of VWD therapies, a new recombinant VWF concentrate has recently completed successful clinical trials and is now awaiting more widespread application. There have even been some pre-clinical successes with VWF gene transfer although the clinical rationale for this therapeutic strategy needs careful consideration. Much more remains to be learnt about the biology of VWF and further translational advances for the enhancement of VWD care will inevitably be realized. PMID:23809112

Aging and ABO blood type influence von Willebrand factor and factor VIII levels through interrelated mechanisms.

Science.gov (United States)

Albánez, S; Ogiwara, K; Michels, A; Hopman, W; Grabell, J; James, P; Lillicrap, D

2016-05-01

Essentials von Willebrand factor (VWF) and factor VIII (FVIII) levels are modulated by age and ABO status. The effect of aging and ABO blood type on VWF and FVIII was assessed in 207 normal individuals. Aging and ABO blood type showed combined and bidirectional influences on VWF and FVIII levels. Aging and ABO blood type influence VWF levels through both secretion and clearance mechanisms. Background The effect of aging and ABO blood type on plasma levels of von Willebrand factor (VWF) and factor VIII (FVIII) have been widely reported; however, a comprehensive analysis of their combined effect has not been performed and the mechanisms responsible for the age-related changes have not been determined. Objectives To assess the influence of aging and ABO blood type on VWF and FVIII levels, and to evaluate the contribution of VWF secretion and clearance to the age-related changes. Methods A cross-sectional observational study was performed in a cohort of 207 normal individuals, whose levels of VWF, FVIII, VWF propeptide (VWFpp), VWFpp/VWF:Ag ratio and blood type A antigen content on VWF (A-VWF) were quantified. Results Aging and ABO blood type exerted interrelated effects on VWF and FVIII plasma levels, because the age-related increase in both proteins was significantly higher in type non-O individuals (β = 0.011 vs. 0.005). This increase with age in non-O subjects drove the differences between blood types in VWF levels, as the mean difference increased from 0.13 U/mL in the young to 0.57 U/mL in the old. Moreover, A-VWF was associated with both VWF antigen (β = 0.29; 95% confidence interval [CI], 0.09, 0.50) and VWF clearance (β = -0.15; 95% CI, -0.25, -0.06). We also documented an effect of ABO blood type on VWF secretion with aging, as old individuals with blood type non-O showed higher levels of VWFpp (mean difference 0.29 U/mL). Conclusions Aging and ABO blood type have an interrelated effect on VWF and FVIII levels, where the effect of one is significantly

PROTEOLYTIC PROCESSING OF VON WILLEBRAND FACTOR BY ADAMTS13 AND LEUKOCYTE PROTEASES

Directory of Open Access Journals (Sweden)

Stefano Lancellotti

2013-09-01

Full Text Available ADAMTS13 is a 190 kDa zinc protease encoded by a gene located on chromosome 9q34.   This protease specifically hydrolyzes von Willebrand factor (VWF multimers, thus causing VWF size reduction. ADAMTS13 belongs to the A Disintegrin And Metalloprotease with ThromboSpondin type 1 repeats (ADAMTS family, involved in proteolytic processing of many matrix proteins. ADAMTS13 consists of numerous domains including a metalloprotease domain, a disintegrin domain, several thrombospondin type 1 (TSP1 repeats, a cysteine-rich domain, a spacer domain and 2 CUB (Complement c1r/c1s, sea Urchin epidermal growth factor, and Bone morphogenetic protein domains. ADAMTS13 cleaves a single peptide bond (Tyr1605-Met1606 in the central A2 domain of the VWF molecule. This proteolytic cleavage is essential to reduce the size of ultra-large VWF polymers, which, when exposed to high shear stress in the microcirculation, are prone to form with platelets clumps, which cause severe syndromes called thrombotic microangiopathies (TMAs. In this review, we a discuss the current knowledge of structure-function aspects of ADAMTS13 and its involvement in the pathogenesis of TMAs, b address the recent findings concerning proteolytic processing of VWF multimers by different proteases, such as the leukocyte-derived serine and metallo-proteases and c indicate the direction of future investigations

The structure of the TFIIH p34 subunit reveals a von Willebrand factor A like fold.

Directory of Open Access Journals (Sweden)

Dominik R Schmitt

Full Text Available RNA polymerase II dependent transcription and nucleotide excision repair are mediated by a multifaceted interplay of subunits within the general transcription factor II H (TFIIH. A better understanding of the molecular structure of TFIIH is the key to unravel the mechanism of action of this versatile protein complex within these vital cellular processes. The importance of this complex becomes further evident in the context of severe diseases like xeroderma pigmentosum, Cockayne's syndrome and trichothiodystrophy, that arise from single point mutations in TFIIH subunits. Here we describe the structure of the p34 subunit of the TFIIH complex from the eukaryotic thermophilic fungus Chaetomium thermophilum. The structure revealed that p34 contains a von Willebrand Factor A (vWA like domain, a fold which is generally known to be involved in protein-protein interactions. Within TFIIH p34 strongly interacts with p44, a positive regulator of the helicase XPD. Putative protein-protein interfaces are analyzed and possible binding sites for the p34-p44 interaction suggested.

Taq I polymorphism in the 5' region of the von Willebrand Factor (vWF) gene

Energy Technology Data Exchange (ETDEWEB)

Lavergne, J M; Bahnak, B R; Assouline, Z; Pietu, G; Kerbiriou-Nabias, D; Meulien, P; Pavirani, A; Meyer, D

1988-03-25

pvWFIPC8 is a 2.28 Kb partial cDNA clone for human von Willebrand factor (vWF) isolated from a human lung cDNA library and inserted into the EcoRI site of pUC9. The sequence includes the last 1330 nucleotides that encode for vWF propeptide and 950 nucleotides that encode for mature vWF. Taq I (TCGA) identifies plural invariant bands and two variant bands with alleles at 2.3 (Al) and 1.0 (A2). The frequency was determined in 33 unrelated European and North American caucasians. The extreme 3' region of pvWFIPC8 corresponds to the 5' boundary of an area that could possibly hybridize with similar sequences on human chromosome 22. The 5' 1.74 Kb portion of pvWFIPC8 generated by Bam HI digestion that corresponds to sequences only on chromosome 12 also demonstrates the polymorphism. Co-dominant segregation was demonstrated in 6 families of 48 individuals.

Von Willebrand protein binds to extracellular matrices independently of collagen.

OpenAIRE

Wagner, D D; Urban-Pickering, M; Marder, V J

1984-01-01

Von Willebrand protein is present in the extracellular matrix of endothelial cells where it codistributes with fibronectin and types IV and V collagen. Bacterial collagenase digestion of endothelial cells removed fibrillar collagen, but the pattern of fibronectin and of von Willebrand protein remained undisturbed. Exogenous von Willebrand protein bound to matrices of different cells, whether rich or poor in collagen. von Willebrand protein also decorated the matrix of cells grown in the prese...

Exercise-induced shear stress is associated with changes in plasma von Willebrand factor in older humans

OpenAIRE

Gonzales, Joaquin U.; Thistlethwaite, John R.; Thompson, Benjamin C.; Scheuermann, Barry W.

2009-01-01

Shear stress is the frictional force of blood against the endothelium, a stimulus for endothelial activation and the release of von Willebrand factor (vWF). This study tested the hypothesis that the increase in shear stress associated with exercise correlates with plasma vWF. Young (n = 14, 25.7 ± 5.4 y) and older (n = 13, 65.6 ± 10.7 y) individuals participated in 30 min of dynamic handgrip exercise at a moderate intensity. Brachial artery diameter and blood flow were measured using ultrasou...

Changes in bleeding patterns in von Willebrand disease after institution of long-term replacement therapy : results from the von Willebrand Disease Prophylaxis Network

NARCIS (Netherlands)

Holm, Elena; Abshire, Thomas C; Bowen, Joel; Álvarez, M Teresa; Bolton-Maggs, Paula; Carcao, Manuel; Federici, Augusto B; Gill, Joan Cox; Halimeh, Susan; Kempton, Christine; Key, Nigel S; Kouides, Peter; Lail, Alice; Landorph, Andrea; Leebeek, Frank; Makris, Michael; Mannucci, Pier; Mauser-Bunschoten, Eveline P; Nugent, Diane; Valentino, Leonard A; Winikoff, Rochelle; Berntorp, Erik

Clinically, the leading symptom in von Willebrand disease (VWD) is bleeding, chiefly of mucosal type, for example, epistaxis, gingival, or gastrointestinal bleeding, and menorrhagia. In severe forms of VWD with secondary deficiency of factor VIII, spontaneous joint bleeding, resembling that observed

Dogs with hearth diseases causing turbulent high-velocity blood flow have changes in patelet function and von Willebrand factor multimer distribution

DEFF Research Database (Denmark)

Tarnow, Inge; Kristensen, Annemarie Thuri; Olsen, Lisbeth Høier

2005-01-01

The purpose of this prospective study was to investigate platelet function using in vitro tests based on both high and low shear rates and von Willebrand factor (vWf) multimeric composition in dogs with cardiac disease and turbulent high-velocity blood flow. Client-owned asymptomatic, untreated d...

Increased active von Willebrand factor during disease development in the aging diabetic patient population.

Science.gov (United States)

Chen, Shuang Feng; Xia, Zuo Li; Han, Ji Ju; Wang, Yi Ting; Wang, Ji Yue; Pan, Shao Dong; Wu, Ya Ping; Zhang, Bin; Li, Guang Yao; Du, Jing Wei; Gao, Hen Qiang; de Groot, Philip G; de Laat, Bas; Hollestelle, Martine J

2013-02-01

Type 2 diabetes is known to cause endothelial activation resulting in the secretion of von Willebrand factor (VWF). We have shown that levels of VWF in a glycoprotein Ib-binding conformation are increased in specific clinical settings. The aim of the current study is to investigate whether active VWF levels increase during aging and the development of diabetes within the population of patients suffering from type 2 diabetes. Patients and controls were divided into two groups based on age: older and younger than 60 years of age. VWF antigen, VWF propeptide, VWF activation factor and total active VWF were measured. Patients older than 60 years of age had increased levels of total active VWF, VWF activation factor and VWF propeptide compared to younger patients and controls. All measured VWF parameters were associated with age in diabetic patients. Total active VWF and VWF propeptide correlated with the period of being diagnosed with diabetes. Regression analyses showed that especially the VWF activation factor was strongly associated with diabetes in patients older than 60 years of age. In conclusion, we found that the conformation of VWF could be involved in the disease process of diabetes and that the VWF in a glycoprotein Ib-binding conformation could play a role as risk marker during the development of diabetes in combination with an increase in age. Our study shows that the active quality of VWF was more important than the quantity.

Von Willebrand Factor Gene Variants Associate with Herpes simplex Encephalitis.

Directory of Open Access Journals (Sweden)

Nada Abdelmagid

Full Text Available Herpes simplex encephalitis (HSE is a rare complication of Herpes simplex virus type-1 infection. It results in severe parenchymal damage in the brain. Although viral latency in neurons is very common in the population, it remains unclear why certain individuals develop HSE. Here we explore potential host genetic variants predisposing to HSE. In order to investigate this we used a rat HSE model comparing the HSE susceptible SHR (Spontaneously Hypertensive Rats with the asymptomatic infection of BN (Brown Norway. Notably, both strains have HSV-1 spread to the CNS at four days after infection. A genome wide linkage analysis of 29 infected HXB/BXH RILs (recombinant inbred lines-generated from the prior two strains, displayed variable susceptibility to HSE enabling the definition of a significant QTL (quantitative trait locus named Hse6 towards the end of chromosome 4 (160.89-174Mb containing the Vwf (von Willebrand factor gene. This was the only gene in the QTL with both cis-regulation in the brain and included several non-synonymous SNPs (single nucleotide polymorphism. Intriguingly, in human chromosome 12 several SNPs within the intronic region between exon 43 and 44 of the VWF gene were associated with human HSE pathogenesis. In particular, rs917859 is nominally associated with an odds ratio of 1.5 (95% CI 1.11-2.02; p-value = 0.008 after genotyping in 115 HSE cases and 428 controls. Although there are possibly several genetic and environmental factors involved in development of HSE, our study identifies variants of the VWF gene as candidates for susceptibility in experimental and human HSE.

Modeling Shear Induced Von Willebrand Factor Binding to Collagen

Science.gov (United States)

Dong, Chuqiao; Wei, Wei; Morabito, Michael; Webb, Edmund; Oztekin, Alparslan; Zhang, Xiaohui; Cheng, Xuanhong

2017-11-01

Von Willebrand factor (vWF) is a blood glycoprotein that binds with platelets and collagen on injured vessel surfaces to form clots. VWF bioactivity is shear flow induced: at low shear, binding between VWF and other biological entities is suppressed; for high shear rate conditions - as are found near arterial injury sites - VWF elongates, activating its binding with platelets and collagen. Based on parameters derived from single molecule force spectroscopy experiments, we developed a coarse-grain molecular model to simulate bond formation probability as a function of shear rate. By introducing a binding criterion that depends on the conformation of a sub-monomer molecular feature of our model, the model predicts shear-induced binding, even for conditions where binding is highly energetically favorable. We further investigate the influence of various model parameters on the ability to predict shear-induced binding (vWF length, collagen site density and distribution, binding energy landscape, and slip/catch bond length) and demonstrate parameter ranges where the model provides good agreement with existing experimental data. Our results may be important for understanding vWF activity and also for achieving targeted drug therapy via biomimetic synthetic molecules. National Science Foundation (NSF),Division of Mathematical Sciences (DMS).

Prophylaxis escalation in severe von Willebrand disease: A prospective study from the von Willebrand Disease Prophylaxis Network

NARCIS (Netherlands)

T.C. Abshire (Thomas Calvin); J. Cox-Gill; C.L. Kempton; F.W.G. Leebeek (Frank); M. Carcao (M.); P. Kouides (P.); S. Donfield (S.); E. Berntorp

2015-01-01

textabstractBackground: Treatment of mucosal bleeding (epistaxis, gastrointestinal bleeding, and menorrhagia) and joint bleeding remains problematic in clinically severe von Willebrand disease (VWD). Patients are often unresponsive to treatment (e.g. desmopressin or antifibrinolytic therapy) and may

The impact of statin therapy on plasma levels of von Willebrand factor antigen. Systematic review and meta-analysis of randomised placebo-controlled trials

NARCIS (Netherlands)

Sahebkar, Amirhossein; Serban, Corina; Ursoniu, Sorin; Mikhailidis, Dimitri P.; Undas, Anetta; Lip, Gregory Y. H.; Bittner, Vera; Ray, Kausik; Watts, Gerald F.; Hovingh, G. Kees; Rysz, Jacek; Kastelein, John J. P.; Banach, Maciej

2016-01-01

Increased plasma levels of von Willebrand factor antigen (vWF:Ag) are associated with high risk of coronary artery disease. The effect of statin therapy on vWF:Ag levels remains uncertain. Therefore the aim of this meta-analysis was to evaluate the effect of statin therapy on vWF:Ag Levels. A

Thrombomodulin and von Willebrand factor as markers of radiation-induced endothelial injury

International Nuclear Information System (INIS)

Zhou Quansheng; Zhao Yimin; Li Peixia; Bai Xia; Ruan Changgeng

1992-02-01

Cultured confluent human umbilical vein endothelial cells were irradiated in vitro by 60 Co-gamma ray at doses from 0 to 50 Gy. After irradiation Thrombomodulin in the supernatants of endothelial cell culture medium, on the surface of the cells and within the cells was measured at different times over six days. At twenty-four hours after irradiation, an increase in the release of Thrombomodulin and von Willebrand factor from irradiated endothelial cells and an increase in the number of molecules and the activity of Thrombomodulin on the surface of the cells were observed, which were radiation-dose dependent. The capacity of the cells to produce and release Thrombomodulin was decreased from two to six days after exposure to 60 Co-gamma ray. Our data indicate that radiation can injure endothelial cells and that Thrombomodulin may be as a marker of radiation-induced endothelial cell injury. The relationship between dysfunction of irradiated endothelial cells and the pathological mechanisms of acute radiation sickness are discussed

Performance related factors are the main determinants of the von Willebrand factor response to exhaustive physical exercise.

Science.gov (United States)

van Loon, Janine E; Sonneveld, Michelle A H; Praet, Stephan F E; de Maat, Moniek P M; Leebeek, Frank W G

2014-01-01

Physical stress triggers the endothelium to release von Willebrand Factor (VWF) from the Weibel Palade bodies. Since VWF is a risk factor for arterial thrombosis, it is of great interest to discover determinants of VWF response to physical stress. We aimed to determine the main mediators of the VWF increase by exhaustive physical exercise. 105 healthy individuals (18-35 years) were included in this study. Each participant performed an incremental exhaustive exercise test on a cycle ergometer. Respiratory gas exchange measurements were obtained while cardiac function was continuously monitored. Blood was collected at baseline and directly after exhaustion. VWF antigen (VWF:Ag) levels, VWF collagen binding (VWF:CB) levels, ADAMTS13 activity and common variations in Syntaxin Binding Protein-5 (STXBP5, rs1039084 and rs9399599), Syntaxin-2 (STX2, rs7978987) and VWF (promoter, rs7965413) were determined. The median VWF:Ag level at baseline was 0.94 IU/mL [IQR 0.8-1.1] and increased with 47% [IQR 25-73] after exhaustive exercise to a median maximum VWF:Ag of 1.38 IU/mL [IQR 1.1-1.8] (pexercise (median increase 43% and 12%, both pexercise (females 1.2 IU/mL; males 1.7 IU/mL, p = 0.001), which was associated by a difference in performance. Genetic variations in STXBP5, STX2 and the VWF promoter were not associated with VWF:Ag levels at baseline nor with the VWF:Ag increase. VWF:Ag levels strongly increase upon exhaustive exercise and this increase is strongly determined by physical fitness level and the intensity of the exercise, while there is no clear effect of genetic variation in STXBP5, STX2 and the VWF promoter.

Pattern of von Willebrand factor in hypertensive patients in Lagos, Nigeria

Directory of Open Access Journals (Sweden)

Ann Abiola Ogbenna

2018-01-01

Full Text Available Background and Objective: Hypertension alone accounts for 50% of death from stroke. Its ability to induce endothelial dysfunction leads to the release of von Willebrand factor (vWF, a prothrombotic glycoprotein. The increase secretion of vWF may account for increased risk of stroke in hypertensive disorders. This study aimed to determine the vWF:antigen (Ag levels among hypertensives and assess its relationship with blood pressure and occurrence of stroke in hypertensives. Subjects and Methods: The study included 66 hypertensives, 33 with stroke (HS and 33 without stroke (HWS, and 33 controls matched for age and sex. Structured questionnaires were used to obtain biodata and clinical information. Blood pressure was taken after 15 min rest. Four milliliters of blood was collected into 0.1 ml of 3.2% trisodium citrate for vWF:Ag assay and 4 ml into K-ethylenediaminetetraacetic acid anticoagulant bottles for blood grouping and erythrocyte sedimentation rate. Data were analyzed with SPSS version 21. Confidence interval was set at 95%. Results: Mean vWF:Ag levels were significantly higher in hypertensives compared with nonhypertensives (P = 0.005, but no statistically significant difference was observed between HS and HWS (P = 0.874. A positive correlation of vWF with systolic blood pressure was observed (r = 0.335, P = 0.001. Conclusion: Our study suggests that higher systolic blood pressure is associated with higher levels of endothelial activation and release of vWF.

Elevated plasma factor VIII enhances venous thrombus formation in rabbits: contribution of factor XI, von Willebrand factor and tissue factor.

Science.gov (United States)

Sugita, Chihiro; Yamashita, Atsushi; Matsuura, Yunosuke; Iwakiri, Takashi; Okuyama, Nozomi; Matsuda, Shuntaro; Matsumoto, Tomoko; Inoue, Osamu; Harada, Aya; Kitazawa, Takehisa; Hattori, Kunihiro; Shima, Midori; Asada, Yujiro

2013-07-01

Elevated plasma levels of factor VIII (FVIII) are associated with increased risk of deep venous thrombosis. The aim of this study is to elucidate how elevated FVIII levels affect venous thrombus formation and propagation in vivo. We examined rabbit plasma FVIII activity, plasma thrombin generation, whole blood coagulation, platelet aggregation and venous wall thrombogenicity before and one hour after an intravenous infusion of recombinant human FVIII (rFVIII). Venous thrombus induced by the endothelial denudation of rabbit jugular veins was histologically assessed. Thrombus propagation was evaluated as indocyanine green fluorescence intensity. Argatroban, a thrombin inhibitor, and neutralised antibodies for tissue factor (TF), factor XI (FXI), and von Willebrand factor (VWF) were infused before or after thrombus induction to investigate their effects on venous thrombus formation or propagation. Recombinant FVIII (100 IU/kg) increased rabbit plasma FVIII activity two-fold and significantly enhanced whole blood coagulation and total plasma thrombin generation, but did not affect initial thrombin generation time, platelet aggregation and venous wall thrombogenicity. The rFVIII infusion also increased the size of venous thrombus 1 hour after thrombus induction. Argatroban and the antibodies for TF, FXI or VWF inhibited such enhanced thrombus formation and all except TF suppressed thrombus propagation. In conclusion, elevated plasma FVIII levels enhance venous thrombus formation and propagation. Excess thrombin generation by FXI and VWF-mediated FVIII recruitment appear to contribute to the growth of FVIII-driven venous thrombus.

Beneficial Effects of High-Density Lipoproteins on Acquired von Willebrand Syndrome in Aortic Valve Stenosis.

Science.gov (United States)

Gebhard, C; Maafi, F; Stähli, B E; Bonnefoy, A; Gebhard, C E; Nachar, W; de Oliveira Moraes, A Benjamim; Mecteau, M; Mihalache-Avram, T; Lavoie, V; Kernaleguen, A E; Shi, Y; Busseuil, D; Chabot-Blanchet, M; Perrault, L P; Rhainds, D; Rhéaume, E; Tardif, J C

2018-02-01

 Infusions of apolipoprotein A-I (apoA-I), the major protein component of high-density lipoproteins (HDL), result in aortic valve stenosis (AVS) regression in experimental models. Severe AVS can be complicated by acquired von Willebrand syndrome, a haemorrhagic disorder associated with loss of high-molecular-weight von Willebrand factor (vWF) multimers (HMWM), the latter being a consequence of increased shear stress and enhanced vWF-cleaving protease (ADAMTS-13) activity. Although antithrombotic actions of HDL have been described, its effects on ADAMTS-13 and vWF in AVS are unknown.  We assessed ADAMTS-13 activity in plasma derived from a rabbit model of AVS ( n  = 29) as well as in plasma collected from 64 patients with severe AVS (age 65.0 ± 10.4 years, 44 males) undergoing aortic valve replacement (AVR). In both human and rabbit AVS plasma, ADAMTS-13 activity was higher than that in controls ( p  AVS patients had less HMWM than controls (66.3 ± 27.2% vs. 97.2 ± 24.1%, p  AVS rabbits as compared with the placebo group (2.0 ± 0.5 RFU/sec vs. 3.8 ± 0.4 RFU/sec, p  AVS ( r  = -0.3, p  = 0.045).  Our data indicate that HDL levels are associated with reduced ADAMTS-13 activity and increased HMWM. HDL-based therapies may reduce the haematologic abnormalities of the acquired von Willebrand syndrome in AVS. Schattauer GmbH Stuttgart.

Neuropeptide delivery to the brain: a von Willebrand factor signal peptide to direct neuropeptide secretion

Directory of Open Access Journals (Sweden)

de Backer Marijke WA

2010-08-01

Full Text Available Abstract Background Multiple neuropeptides, sometimes with opposing functions, can be produced from one precursor gene. To study the roles of the different neuropeptides encoded by one large precursor we developed a method to overexpress minigenes and establish local secretion. Results We fused the signal peptide from the Von Willebrand Factor (VWF to a furin site followed by a processed form of the Agouti related protein (AgRP, AgRP83-132 or α-melanocyte stimulating hormone. In vitro, these minigenes were secreted and biologically active. Additionally, the proteins of the minigenes were not transported into projections of primary neurons, thereby ensuring local release. In vivo administration of VWF-AgRP83-132 , using an adeno-associated viral vector as a delivery vehicle, into the paraventricular hypothalamus increased body weight and food intake of these rats compared to rats which received a control vector. Conclusions This study demonstrated that removal of the N-terminal part of full length AgRP and addition of a VWF signal peptide is a successful strategy to deliver neuropeptide minigenes to the brain and establish local neuropeptide secretion.

Towards personalised therapy for von Willebrand disease: a future role for recombinant products.

Science.gov (United States)

Favaloro, Emmanuel J

2016-05-01

von Willebrand disease (VWD) is reportedly the most common bleeding disorder and is caused by deficiencies and/or defects in the adhesive plasma protein von Willebrand factor (VWF). Functionally, normal VWF prevents bleeding by promoting both primary and secondary haemostasis. In respect to primary haemostasis, VWF binds to both platelets and sub-endothelial matrix components, especially collagen, to anchor platelets to damaged vascular tissue and promote thrombus formation. VWF also stabilises and protects factor VIII in the circulation, delivering FVIII to the site of injury, which then facilitates secondary haemostasis and fibrin formation/thrombus stabilisation. As a result of this, patients with VWD suffer a bleeding diathesis reflective of a primary defect caused by defective/deficient VWF, which in some patients is compounded by a reduction in FVIII. Management of VWD, therefore, chiefly entails replacement of VWF, and sometimes also FVIII, to protect against bleeding. The current report principally focuses on the future potential for "personalised" management of VWD, given the emerging options in recombinant therapies. Recombinant VWF has been developed and is undergoing clinical trials, and this promising therapy may soon change the way in which VWD is managed. In particular, we can envisage a personalised treatment approach using recombinant VWF, with or without recombinant FVIII, depending on the type of VWD, the extent of deficiencies, and the period and duration of treatment.

Cesariana em paciente com doença de von Willebrand associada à infecção pelo HIV: relato de caso Cesárea en paciente con enfermedad de von Willebrand asociada a la infección por el HIV: relato de caso Anesthesia for cesarean section in patient with von Willebrand's disease and HIV infection: case report

Directory of Open Access Journals (Sweden)

Vanessa Rezende Balle

2004-12-01

Willebrand y HIV positiva sometida a cesárea. RELATO DEL CASO: Paciente de 24 años, portadora de anemia microcítica, enfermedad de von Willebrand y HIV, llegó a la emergencia obstétrica en inicio de trabajo de alumbramiento. No realizó prenatal. Fue indicada cesárea a fin de disminuir los riesgos de transmisión vertical en paciente con carga vírica de HIV desconocida. Presentaba hematomas por el cuerpo e historia de hematoma de pared abdominal en cesárea anterior. Los tests de coagulación estaban un poco alterados. Después de infusión de concentrado de factor VIII fue realizada anestesia general. Madre y recién nacido presentaron evolución satisfactoria. CONCLUSIONES: La evaluación de manifestaciones clínicas en pacientes con coagulopatia es fundamental en la decisión del tipo de anestesia que será indicada para cada paciente. La evaluación debe ser individualizada, considerando los riesgos y beneficios de la técnica escogida. En estas pacientes, se debe siempre restringir al máximo la indicación de interrupción de la gestación por vía alta, optándose siempre por los métodos menos invasivos. La terapia con concentrado de factor VIII es actualmente la mejor opción de tratamiento, corrigiendo la deficiencia específica y dismunuyendo los riesgos de transmisión vírica.BACKGROUND AND OBJECTIVES: Von Willebrand's disease is the most common hereditary coagulation disorder in young women. The incidence of HIV infection among women has been progressively increasing, and vertical transmission may account for 25% of cases. This report aimed at describing the case of an HIV-positive patient with von Willebrand's disease scheduled for cesarean section. CASE REPORT: Female HIV-positive patient, 24 years old, with microcytic anemia and von Willebrand's disease, admitted to the emergency room in early labor. She had no pre-natal care. Cesarean section was indicated to lower vertical transmission risks since HIV viral count was unknown. Patient had hematomas

Von Willebrand Factor as a Novel Player in Valvular Heart Disease: From Bench to Valve Replacement.

Science.gov (United States)

Gragnano, Felice; Crisci, Mario; Bigazzi, Maurizio Cappelli; Bianchi, Renatomaria; Sperlongano, Simona; Natale, Francesco; Fimiani, Fabio; Concilio, Claudia; Cesaro, Arturo; Pariggiano, Ivana; Diana, Vincenzo; Limongelli, Giuseppe; Cirillo, Plinio; Russo, Mariagiovanna; Golia, Enrica; Calabrò, Paolo

2018-02-01

von Willebrand Factor (vWF) is a well-known mediator of hemostasis and vascular inflammation. Its dynamic modulation in the bloodstream, according to hemodynamic conditions, makes it an appealing biomarker in patients with valvular heart disease (VHD). Recent studies highlight the close connection between vWF and VHD, with possible implications in the pathogenesis of VHD, promoting valve aging and calcification or favoring the development of infective endocarditis. Moreover, vWF has been recently proposed as a new diagnostic and prognostic tool in patients with valve stenosis or regurgitation, showing a strict correlation with severity of valve disease, outcome, and bleeding (Heyde syndrome). A novel role for vWF is also emerging in patients undergoing percutaneous or surgical valve repair/replacement to select and stratify patients, evaluate periprocedural bleeding risk, and detect procedural complications. We also report our single-center experience, suggesting, for the first time, possible clinical implications for vWF in percutaneous mitral valve repair (MitraClip). This review summarizes recent advances in the role of vWF in VHD with an updated overview going from bench to operating room.

The metal-ion-dependent adhesion site in the Von Willebrand factor-A domain of α2δ subunits is key to trafficking voltage-gated Ca2+ channels

Science.gov (United States)

Cantí, C.; Nieto-Rostro, M.; Foucault, I.; Heblich, F.; Wratten, J.; Richards, M. W.; Hendrich, J.; Douglas, L.; Page, K. M.; Davies, A.; Dolphin, A. C.

2005-01-01

All auxiliary α2δ subunits of voltage-gated Ca2+ (CaV) channels contain an extracellular Von Willebrand factor-A (VWA) domain that, in α2δ-1 and -2, has a perfect metal-ion-dependent adhesion site (MIDAS). Modeling of the α2δ-2 VWA domain shows it to be highly likely to bind a divalent cation. Mutating the three key MIDAS residues responsible for divalent cation binding resulted in a MIDAS mutant α2δ-2 subunit that was still processed and trafficked normally when it was expressed alone. However, unlike WT α2δ-2, the MIDAS mutant α2δ-2 subunit did not enhance and, in some cases, further diminished CaV1.2, -2.1, and -2.2 currents coexpressed with β1b by using either Ba2+ or Na+ as a permeant ion. Furthermore, expression of the MIDAS mutant α2δ-2 reduced surface expression and strongly increased the perinuclear retention of CaVα1 subunits at the earliest time at which expression was observed in both Cos-7 and NG108–15 cells. Despite the presence of endogenous α2δ subunits, heterologous expression of α2δ-2 in differentiated NG108–15 cells further enhanced the endogenous high-threshold Ca2+ currents, whereas this enhancement was prevented by the MIDAS mutations. Our results indicate that α2δ subunits normally interact with the CaVα1 subunit early in their maturation, before the appearance of functional plasma membrane channels, and an intact MIDAS motif in the α2δ subunit is required to promote trafficking of the α1 subunit to the plasma membrane by an integrin-like switch. This finding provides evidence for a primary role of a VWA domain in intracellular trafficking of a multimeric complex, in contrast to the more usual roles in binding extracellular ligands in other exofacial VWA domains. PMID:16061813

Performance related factors are the main determinants of the von Willebrand factor response to exhaustive physical exercise.

Directory of Open Access Journals (Sweden)

Janine E van Loon

Full Text Available Physical stress triggers the endothelium to release von Willebrand Factor (VWF from the Weibel Palade bodies. Since VWF is a risk factor for arterial thrombosis, it is of great interest to discover determinants of VWF response to physical stress. We aimed to determine the main mediators of the VWF increase by exhaustive physical exercise.105 healthy individuals (18-35 years were included in this study. Each participant performed an incremental exhaustive exercise test on a cycle ergometer. Respiratory gas exchange measurements were obtained while cardiac function was continuously monitored. Blood was collected at baseline and directly after exhaustion. VWF antigen (VWF:Ag levels, VWF collagen binding (VWF:CB levels, ADAMTS13 activity and common variations in Syntaxin Binding Protein-5 (STXBP5, rs1039084 and rs9399599, Syntaxin-2 (STX2, rs7978987 and VWF (promoter, rs7965413 were determined.The median VWF:Ag level at baseline was 0.94 IU/mL [IQR 0.8-1.1] and increased with 47% [IQR 25-73] after exhaustive exercise to a median maximum VWF:Ag of 1.38 IU/mL [IQR 1.1-1.8] (p<0.0001. VWF:CB levels and ADAMTS13 activity both also increased after exhaustive exercise (median increase 43% and 12%, both p<0.0001. The strongest determinants of the VWF:Ag level increase are performance related (p<0.0001. We observed a gender difference in VWF:Ag response to exercise (females 1.2 IU/mL; males 1.7 IU/mL, p = 0.001, which was associated by a difference in performance. Genetic variations in STXBP5, STX2 and the VWF promoter were not associated with VWF:Ag levels at baseline nor with the VWF:Ag increase.VWF:Ag levels strongly increase upon exhaustive exercise and this increase is strongly determined by physical fitness level and the intensity of the exercise, while there is no clear effect of genetic variation in STXBP5, STX2 and the VWF promoter.

Binding of von Willebrand factor to collagen type III: role of specific amino acids in the collagen binding domain of vWF and effects of neighboring domains

NARCIS (Netherlands)

van der Plas, R. M.; Gomes, L.; Marquart, J. A.; Vink, T.; Meijers, J. C.; de Groot, P. G.; Sixma, J. J.; Huizinga, E. G.

2000-01-01

Binding of von Willebrand Factor (vWF) to sites of vascular injury is the first step of hemostasis. Collagen types I and III are important binding sites for vWF. We have previously determined the three-dimensional structure of the collagen binding A3 domain of vWF (Huizinga et al., Structure 1997;

Influences of ABO blood group, age and gender on plasma coagulation factor VIII, fibrinogen, von Willebrand factor and ADAMTS13 levels in a Chinese population.

Science.gov (United States)

Wang, Zongkui; Dou, Miaomiao; Du, Xi; Ma, Li; Sun, Pan; Cao, Haijun; Ye, Shengliang; Jiang, Peng; Liu, Fengjuan; Lin, Fangzhao; Zhang, Rong; Li, Changqing

2017-01-01

ABO blood group is a hereditary factor of plasma levels of coagulation factor VIII (FVIII) and von Willebrand factor (VWF). Age and gender have been shown to influence FVIII, VWF, fibrinogen (Fbg), and ADAMTS13 (A disintegrin and metalloprotease with thrombospondin type 1 motif, 13). We investigated the effects of ABO type, age, and gender on plasma levels of FVIII, Fbg, VWF, and ADAMTS13 in a Chinese population. A total of 290 healthy volunteers were eligible for this study. ABO blood group was determined by indirect technique. FVIII:C and Fbg were measured by clotting assays. VWF antigen (VWF:Ag), collagen-binding activity (VWF:CBA), and ADAMTS13 antigen were assessed by ELISA, whereas VWF ristocetin cofactor activity (VWF:Rcof) was performed by agglutination of platelets with ristocetin. Mean FVIII:C and VWF levels (VWF:Ag, VWF:CBA, and VWF:Rcof) were significantly higher in non-O than in O type subjects ( p  blood group, age, and gender showed different effects on plasma levels of FVIII:C, Fbg, VWF:Ag, VWF:CBA, VWF:Rcof, and ADAMTS13 antigen. These new data on a Chinese population are quite helpful to compare with other ethnic groups.

Frequency of von willebrand disease in patients of heavy menstrual bleeding

International Nuclear Information System (INIS)

Anjum, N.; Shaheen, Z.; Altaf, C.

2016-01-01

Objective: To determine the frequency of Von Willebrand disease (vWD) in patients of heavy menstrual bleeding (HMB). Study Design: Hospital based cross sectional study. Place and Duration of Study: Study was conducted at the Gynecology and Obstetrics department, Military Hospital, Rawalpindi in collaboration with Haematology Department of Armed Forces Institute of Pathology (AFIP) Rawalpindi, from Jul to Dec 2015. Material and Methods: Women presenting with HMB were enrolled in the study after informed consent. HMB was defined as cyclical bleeding at normal intervals but patient is using more than 5 pads per day or increase in duration 8/28 or more for at least last 06 months. Venous blood samples were taken and screened for the hemoglobin level (Hb), platelet count, prothrombin time (PT), activated partial thromboplastin time (aPTT) and Von Willebrand antigen (vWF:Ag) in addition to bleeding time (BT) at the Armed Forces Institute of Pathology (AFIP). The demographic details (age, age at menarche), clinical features (menstrual history, quantity of bleeding) and laboratory findings were recorded on the study proforma. Results: A total of 200 patients were enrolled in this study with mean age of 32.3 +- 8.5 years. Mean flow of menstrual blood was 9.8 +- 2.5 pads / day. Mean Hb percent was 8.1 +- 1.4 g/dl. Twenty nine (14.5 percent) patients were having low level of vWF:Ag. Conclusion: There is high frequency of von Willebrand disease among females presenting with heavy menstrual bleeding in our set up. Therefore all patients with heavy menstrual bleeding except those with obvious causes like multiple fibroid should be screened for von Willebrand disease. (author)

Hemophilia and von Willebrand's disease: 1. Diagnosis, comprehensive care and assessment. Association of Hemophilia Clinic Directors of Canada.

Science.gov (United States)

1995-07-01

To present current strategies for the assessment and comprehensive care of patients with hemophilia and von Willebrand's disease. Hospital care, home care, single-provider care and multidisciplinary care. Morbidity and quality of life associated with bleeding and treatment. Relevant clinical studies and reports published from 1974 to 1994 were examined. A search was conducted of own reprint files, MEDLINE, citations in the articles reviewed and references provided by colleagues. In the MEDLINE search the following terms were used singly or in combination: "hemophilia," "von Willebrand's disease," "Factor VIII," "Factor IX," "von Willebrand factor," "diagnosis," "management," "home care," "comprehensive care," "inhibitor," "AIDS," "hepatitis," "life expectancy," "complications," "practice guidelines," "consensus statement" and "controlled trial." The in-depth review included only articles written in English from North America and Europe that were relevant to human disease and to a predetermined outline. The availability of treatment products in Canada was also considered. Minimizing morbidity and maximizing functional status and quality of life were given a high value. The optimal use of treatment procedures and home care offers patients the advantages of minimized disability, improved survival and financial benefit. It is also cost effective. Potential harm, including the risk of hepatitis B, hepatitis C and HIV infection, has now been minimized through viral inactivation of plasma-derived coagulation-factor concentrates and through the use of recombinant clotting factor concentrates and other non-plasma-derived hemostatic agents. Patients with hemophilia and severe von Willebrand's disease should be followed in comprehensive care centres that offer expertise in the diagnosis, assessment and management of bleeding and complications and that can meet the educational and counselling needs of patients, family members and health care providers. Eligible patients should

von Willebrand factor as a novel noninvasive predictor of portal hypertension and esophageal varices in hepatitis B patients with cirrhosis.

Science.gov (United States)

Wu, Hao; Yan, Shiping; Wang, Guangchuan; Cui, Shaobo; Zhang, Chunqing; Zhu, Qiang

2015-01-01

At present, there is no perfect noninvasive method to assess portal hypertension and esophageal varices. Early predicting esophageal varices can provide evidence for managing cirrhotic patients. We aimed to further investigate von Willebrand factor (vWF) as a noninvasive predictor of portal hypertension, especially of esophageal varices. A total of 60 hepatitis B patients with cirrhosis and 45 healthy subjects were enrolled in this study. Levels of six markers were examined. All patients underwent hepatic venous pressure gradient (HVPG) and esophagogastroduodenoscopy. We evaluated the performance of six factors for diagnosis of portal hypertension and esophageal varices. The vWF levels in liver tissues were observed by immunohistochemistry. Correlations between the level of vWF in liver tissues and HVPG and between levels of vWF in tissues and plasma were examined. Cutoff values of plasma vWF (1510.5 mU/mL and 1701 mU/mL) showed high positive predictive value (PPV, 90.2% and 87.5%) in predicting clinically significant portal hypertension and severe portal hypertension. Cutoff values of vWF (1414 mU/ml and 1990 mU/mL, PPV 90.3% and 86.3%, respectively) were provided to detect the presence and degree of esophageal varices. Linear correlations were observed between levels of vWF in liver tissues and HVPG (r(2) = 0.552, p portal hypertension and esophageal varices in hepatitis B patients with cirrhosis. Increased levels of vWF in liver tissues may induce the elevated plasma vWF levels, but molecular mechanism is needed for further study.

An immunoradiometric assay for procoagulant factor VIII antigen: results in haemophilia, von Willebrand's disease and fetal plasma and serum

International Nuclear Information System (INIS)

Peake, I.R.; Bloom, A.L.; Giddings, J.C.; Ludlam, C.A.

1979-01-01

An immunoradiometric assay (IRMA) has been developed based on the inhibitor which arose in a polytransfused severe haemophiliac. The two-site IRMA measured antigens closely associated with the procoagulant parts of the factor VIII complex, which are termed FVIIIC antigens or FVIIICAG. FVIIICAG was present in normal plasma and also, at a slightly lower concentration, in normal serum. In 37 patients with haemophilia A, 36 had FVIIICAG levels of less than 10% of the normal plasma pool. In patients with von Willebrand's disease the levels of FVIIIC and FVIIICAG were in good agreement, both before and after treatment with cryoprecipitate or DDAVP. FVIIICAG was relatively stable in plasma at 37 0 C and could also be detected in cord and fetal serum. The assay is of potential value for detecting reduced levels of factor VIII, for carrier detection and for the prenatal diagnosis of haemophilia. (author)

Analysis of expression of von Willebrand factor, endothelin-1, vascular endothelial growth factor in Budd-Chiari syndrome with membranous obstruction

International Nuclear Information System (INIS)

Han Xinqiang; Zu Maoheng

2011-01-01

Objective: To investigate whether the injured vascular endothelial plays an important role in the membranous formation of the inferior vena cava (IVC). Methods: There were 40 cases of membranous obstruction of inferior vena cava (MOVC) in the experimental group and 40 arrhythmic inpatients in the control group from affiliated hospital. There were 23 males and 17 females in experimental group while 21 males and 19 females in control group, and the age were (41.8±8.1) yrs and (43.2± 7.6) yrs respectively. All of them had no anti-coagulation (clotting) drug history and smoking history, no hypertension, no pulmonary artery hypertension, no coronary heart disease, no valvular disease, no myocardial disease, no blood disease, no diabetes, no connective tissue disease and malignancy, and liver and renal function must be normal. And then the serum concentrations of von Willebrand factor (vWF), endothelin-l (ET-1), vascular endothelial growth factor (VEGF) were defined by enzyme-linked immunosorbent assay (ELISA). The results were analyzed with independent sample t-test. Results: In MOVC patients, the serum concentrations of vWF, ET-1 and VEGF [(37.8±6.6) μg/L, (31.9± 6.0) ng/L, (20.84±5.78) μg/L] were higher than those in the control group [(3.3±1.3) μg/L, (5.3±1.8) ng/L, (4.2±1.2) μg/L. t=32.65, 26.70, 17.85, P<0.01, respectively]. Conclusions: The injury of vascular endothelium is related to the formation of membrane in the IVC. (authors)

Fluid-phase immunoradiometric assay for the detection of qualitative abnormalities of factor VIII/von Willebrand factor in variants of von Willebrand's disease

International Nuclear Information System (INIS)

Girma, J.P.; Ardaillou, N.; Meyer, D.; Lavergne, J.M.; Larrieu, M.J.

1979-01-01

Antigenic reactivity of F.VIII/WF in variants of von Willebrand's disease (vWd) was studied with both fluid-phase and solid-phase immunoradiometric assays. Two different (rabbit and goat) 125 I-labeled specific antibodies against purified F.VIII/WF were used in both their divalent (lgG) and their monovalent (Fab fragment) forms. Dose-response curves obtained by reacting a constant amount of antibody with serial dilutions of plasmas from normal or homozygous vWd demonstrated the specificity of the test. The accuracy was significantly higher with 125 I-Fab fragments of goat anti-F.VIII/WF antiserum than intact goat lgG or rabbit lgG or Fab fragments. The significant decrease of the slope of the dose-response curves obtained with plasma from variants of vWd has been interpreted as due to the presence of abnormal F.VIII/WF molecules with decreased antigenic reactivity. A similar anomaly was found in cryosupernatant prepared from normal plasma, paralleling similarities demonstrated between variants of vWd and cryosupernatant. Results of experiments performed by reacting constant plasma dilutions from control or variants of vWd and varying concentrations of anti-F.VIII/WF Fab fragments (rabbit or goat) confirmed the decreased antigenic reactivity of variant F.VIII/WF

Relationship between ABO blood groups and von Willebrand factor, ADAMTS13 and factor VIII in patients undergoing hemodialysis.

Science.gov (United States)

Rios, Danyelle R A; Fernandes, Ana Paula; Figueiredo, Roberta C; Guimarães, Daniela A M; Ferreira, Cláudia N; Simões E Silva, Ana C; Carvalho, Maria G; Gomes, Karina B; Dusse, Luci Maria Sant' Ana

2012-05-01

Several studies have demonstrated that non-O blood groups subjects present an increased VTE risk as compared to those carrying O blood group. The aim of this study was to investigate the ABO blood groups influence on factor VIII (FVIII) activity, von Willebrand factor (VWF), and ADAMTS13 plasma levels in patients undergoing hemodialysis (HD). Patients undergoing HD (N=195) and 80 healthy subjects (control group) were eligible for this cross-sectional study. The ABO blood group phenotyping was performed by the reverse technique. FVIII activity was measured through coagulometric method, and VWF and ADAMTS13 antigens were assessed by ELISA. FVIII activity and VWF levels were significantly higher and ADAMTS13 levels was decreased in HD patients, as compared to healthy subjects (P blood groups showed a significant increase in FVIII activity (P = 0.001) and VWF levels (P blood group. However, no significant difference was observed in ADAMTS13 levels (P = 0.767). In the control group, increased in FVIII activity (P = 0.001) and VWF levels (P = 0.002) and decreased in ADAMTS13 levels (P = 0.005) were observed in subjects carrying non-O blood groups as compared to carriers of O blood group.Our data confirmed that ABO blood group is an important risk factor for increased procoagulant factors in plasma, as FVIII and VWF. Admitting the possible role of kidneys in ADAMTS13 synthesis or on its metabolism, HD patients were not able to increase ADAMTS13 levels in order to compensate the increase of VWF levels mediated by ABO blood groups. Considering that non-O blood groups constitute a risk factor for thrombosis, it is reasonable to admit that A, B and AB HD patients need a careful and continuous follow-up in order to minimize thrombotic events.

Analysis of von Willebrand factor A domain-related protein (WARP polymorphism in temperate and tropical Plasmodium vivax field isolates

Directory of Open Access Journals (Sweden)

Zakeri Sedigheh

2009-06-01

Full Text Available Abstract Background The identification of key molecules is crucial for designing transmission-blocking vaccines (TBVs, among those ookinete micronemal proteins are candidate as a general class of malaria transmission-blocking targets. Here, the sequence analysis of an extra-cellular malaria protein expressed in ookinetes, named von Willebrand factor A domain-related protein (WARP, is reported in 91 Plasmodium vivax isolates circulating in different regions of Iran. Methods Clinical isolates were collected from north temperate and southern tropical regions in Iran. Primers have been designed based on P. vivax sequence (ctg_6991 which amplified a fragment of about 1044 bp with no size variation. Direct sequencing of PCR products was used to determine polymorphism and further bioinformatics analysis in P. vivax sexual stage antigen, pvwarp. Results Amplified pvwarp gene showed 886 bp in size, with no intron. BLAST analysis showed a similarity of 98–100% to P. vivax Sal-I strain; however, Iranian isolates had 2 bp mismatches in 247 and 531 positions that were non-synonymous substitution [T (ACT to A (GCT and R (AGA to S (AGT] in comparison with the Sal-I sequence. Conclusion This study presents the first large-scale survey on pvwarp polymorphism in the world, which provides baseline data for developing WARP-based TBV against both temperate and tropical P. vivax isolates.

Complex changes in von Willebrand factor-associated parameters are acquired during uncomplicated pregnancy.

Directory of Open Access Journals (Sweden)

Danielle N Drury-Stewart

Full Text Available The coagulation protein von Willebrand Factor (VWF is known to be elevated in pregnancy. However, the timing and nature of changes in VWF and associated parameters throughout pregnancy are not well understood.To better understand the changes in VWF provoked by pregnancy, we studied VWF-associated parameters in samples collected over the course of healthy pregnancies.We measured VWF antigen (VWF:Ag, VWF propeptide (VWFpp, Factor VIII (FVIII, and ADAMTS13 activity in samples collected from 46 women during pregnancy and at non-pregnant baseline. We also characterized pregnant vs. non-pregnant VWF multimer structure in 21 pregnancies, and performed isoelectric focusing (IEF of VWF in two pregnancies which had samples from multiple trimesters.VWF:Ag and FVIII levels were significantly increased during pregnancy. ADAMTS13 activity was unchanged. VWFpp levels increased much later in pregnancy than VWF:Ag, resulting in a progressive decrease in VWFpp:Ag ratios. FVIII:VWF ratios also decreased in pregnancy. Most pregnancies exhibited a clear loss of larger VWF multimers and altered VWF triplet structure. Further evidence of acquired VWF qualitative changes in pregnancy was found in progressive, reversible shifts in VWF IEF patterns over gestation.These data support a new view of pregnancy in which VWF can acquire qualitative changes associated with advancing gestational age. Modeling supports a scenario in which both increased VWF production and doubling of the VWF half-life would account for the data observed. We propose that gestation induces a prolongation in VWF survival, which likely contributes to increased total VWF levels and altered VWF structure.

Storage of factor VIII variants with impaired von Willebrand factor binding in Weibel-Palade bodies in endothelial cells.

Directory of Open Access Journals (Sweden)

Maartje van den Biggelaar

Full Text Available BACKGROUND: Point mutations resulting in reduced factor VIII (FVIII binding to von Willebrand factor (VWF are an important cause of mild/moderate hemophilia A. Treatment includes desmopressin infusion, which concomitantly increases VWF and FVIII plasma levels, apparently from storage pools containing both proteins. The source of these VWF/FVIII co-storage pools and the mechanism of granule biogenesis are not fully understood. METHODOLOGY/PRINCIPAL FINDINGS: We studied intracellular trafficking of FVIII variants implicated in mild/moderate hemophilia A together with VWF in HEK293 cells and primary endothelial cells. The role of VWF binding was addressed using FVIII variants displaying reduced VWF interaction. Binding studies using purified FVIII proteins revealed moderate (Arg2150His, Del2201, Pro2300Ser to severe (Tyr1680Phe, Ser2119Tyr VWF binding defects. Expression studies in HEK293 cells and primary endothelial cells revealed that all FVIII variants were present within VWF-containing organelles. Quantitative studies showed that the relative amount of FVIII storage was independent of various mutations. Substantial amounts of FVIII variants are co-stored in VWF-containing storage organelles, presumably by virtue of their ability to interact with VWF at low pH. CONCLUSIONS: Our data suggest that the potential of FVIII co-storage with VWF is not affected in mild/moderate hemophilia A caused by reduced FVIII/VWF interaction in the circulation. These data support the hypothesis that Weibel-Palade bodies comprise the desmopressin-releasable FVIII storage pool in vivo.

Percutaneous coronary intervention and the management of acute coronary syndromes in patients with von Willebrand disease.

Science.gov (United States)

Rathore, Sulaiman; Deleon, Dexter; Akram, Hafsa; Sane, David; Ball, Timothy

2013-04-01

Von Willebrand disease (vWD) results from quantitative or qualitative deficiency of von Willebrand factor (vWF). The occurrence of myocardial infarction is very rare in patients with vWD. A few case reports of acute coronary syndrome (ACS) in vWD patients are present in the literature, but no definite management recommendations are available for such patients. We report a case of successful percutaneous coronary intervention (PCI) with bare-metal stent (BMS) implantation in a 46-year-old woman with type 1 vWD and history of coronary artery disease (CAD). She received periprocedural dual-antiplatelet therapy for 2 weeks and then continued aspirin without any bleeding complications. The optimal management of patients with vWD and ACS is complex and presents a therapeutic challenge. We propose that dual-antiplatelet therapy can be used safely in most vWD patients presenting with ACS as most of them are type 1 vWD. PCI with BMS can be done safely. Long-term management of these patients requires a systemic approach including hematological consultation, ascertaining vWF levels, as well as patient education and close outpatient follow-up.

von Willebrand factor and its cleaving protease ADAMTS13 balance in coronary artery vessels: Lessons learned from thrombotic thrombocytopenic purpura. A narrative review.

Science.gov (United States)

Morici, Nuccia; Cantoni, Silvia; Panzeri, Francesco; Sacco, Alice; Rusconi, Chiara; Stucchi, Miriam; Oliva, Fabrizio; Cattaneo, Marco

2017-07-01

Deficiency of the von Willebrand factor-cleaving protease ADAMTS13 is central to the pathophysiology of thrombotic thrombocytopenic purpura (TTP), a microangiopathic syndrome that presents as an acute medical emergency. In this review we will explore the evidence of a two-way relationship between TTP and ACS. Moreover, we will review the evidence emerged from epidemiological studies of an inverse relationship between the plasma levels of ADAMTS13 and the risk of ACS. Pubmed, MEDLINE and EMBASE, CINHAL, COCHRANE and Google Scholar databases were searched from inception to January 2017. The search yielded 43 studies representing 23 unique patient cases, 5 case series, 5 cohort studies and 10 case-control studies. Most ACS cases developing in the setting of TTP resolved with standard treatment of the underlying microangiopathy, with only a few requiring coronary invasive management. Antiplatelet therapy was not usually prescribed and all of the currently used P2Y 12 were felt to be a potential trigger for a TTP-like syndrome, although our review revealed that the occurrence of TTP in patients treated with new P2Y 12 antagonists is rare. Most studies confirmed the inverse association among ADAMTS13 levels and ACS. The heart is a definite target organ in TTP. The clinical spectrum of its involvement is probably influenced by local factors that add on to the systemic deficiency characteristic of TTP. It follows that patients with TTP should be carefully monitored for ACS events, especially when multiple risk factors for coronary disease exist. Copyright © 2017 Elsevier Ltd. All rights reserved.

Consumption of nattokinase is associated with reduced blood pressure and von Willebrand factor, a cardiovascular risk marker: results from a randomized, double-blind, placebo-controlled, multicenter North American clinical trial

Directory of Open Access Journals (Sweden)

Jensen GS

2016-10-01

Full Text Available Gitte S Jensen,1 Miki Lenninger,1 Michael P Ero,2 Kathleen F Benson,1 1NIS Labs, Klamath Falls, OR, 2Machaon Diagnostics, Inc., Oakland, CA, USA Objective: The objective of this study is to evaluate the effects of consumption of nattokinase on hypertension in a North American hypertensive population with associated genetic, dietary, and lifestyle factors. This is in extension of, and contrast to, previous studies on Asian populations.Materials and methods: A randomized, double-blind, placebo-controlled, parallel-arm clinical study was performed to evaluate nattokinase (NSK-SD, a fermented soy extract nattō from which vitamin K2 has been removed. Based on the results from previous studies on Asian populations, 79 subjects were enrolled upon screening for elevated blood pressure (BP; systolic BP ≥130 or diastolic BP ≥90 mmHg who consumed placebo or 100 mg nattokinase/d for the 8-week study duration. Blood collections were performed at baseline and 8 weeks for testing plasma renin activity, von Willebrand factor (vWF, and platelet factor-4. Seventy-four people completed the study with good compliance.Results: Consumption of nattokinase was associated with a reduction in both systolic and diastolic BP. The reduction in systolic BP was seen for both sexes but was more robust in males consuming nattokinase. The average reduction in diastolic BP in the nattokinase group from 87 mmHg to 84 mmHg was statistically significant when compared to that in the group consuming placebo, where the average diastolic BP remained constant at 87 mmHg (P<0.05, and reached a high level of significance for males consuming nattokinase, where the average diastolic BP dropped from 86 mmHg to 81 mmHg (P<0.006. A decrease in vWF was seen in the female population consuming nattokinase (P<0.1. In the subpopulation with low plasma renin activity levels at baseline (<0.29 ng/mL/h, an increase was seen for 66% of the people after 8-week consumption of nattokinase (P

Association of ABO blood groups with von Willebrand factor, factor VIII and ADAMTS-13 in patients with lung cancer.

Science.gov (United States)

Liu, Xia; Chen, Xiaogang; Yang, Jiezuan; Guo, Renyong

2017-09-01

Coagulative and fibrinolytic disorders appear to be associated with the development of lung cancer. The aim of the present study was to determine plasma levels of von Willebrand factor (VWF) and a disintegrin and metalloproteinase with a thrombospondin type 1 motif 13 (ADAMTS-13), and factor VIII (FVIII) activity, in association with O and non-O blood groups in patients with lung cancer. Plasma levels of VWF and ADAMTS-13, and FVIII activity were measured in 115 patients with lung cancer and 98 healthy subjects. Phenotyping of the ABO blood groups was also performed for the two groups. Significantly increased VWF levels and FVIII activity, as well as significantly decreased ADAMTS-13 levels, were observed in patients with distant metastasis as compared with those without distant metastasis and the healthy controls. Plasma VWF levels and FVIII activity were significantly increased in subjects with non-O type blood compared with those with type O blood in the two groups. However, a significant decrease in ADAMTS-13 levels was observed only in the control group among those with non-O type blood, compared with those with type O blood. The results of the present study indicate that increased VWF and decreased ADAMTS-13 levels facilitate the invasiveness and metastasis of lung cancer. Non-O blood groups constitute a risk factor for increased VWF and FVIII in plasma. Continued monitoring of VWF and ADAMTS-13 levels, and of FVIII activity in patients with lung cancer with distinct blood groups may help to minimize the incidence of thrombotic events and improve assessment of disease progression.

Comparative study on collagen-binding enzyme-linked immunosorbent assay and ristocetin cofactor activity assays for detection of functional activity of von Willebrand factor.

Science.gov (United States)

Turecek, Peter L; Siekmann, Jürgen; Schwarz, Hans Peter

2002-04-01

For more than two decades, the ristocetin cofactor (RCo) assay, which measures the von Willebrand factor (vWF)-mediated agglutination of platelets in the presence of the antibiotic ristocetin, has been the most common method for measuring the functional activity of vWF. There is, however, general agreement among clinical analysts that this method has major practical disadvantages in performance and reproducibility. Today, collagen-binding assays (CBA) based on the enzyme-linked immunosorbent assay (ELISA) technique that measure the interaction of vWF and collagen are an alternative analytic procedure based on a more physiological function than that of the RCo procedure. We used both assay systems in a comparative study to assess the functional activity of vWF in plasma as well as in therapeutic preparations. We measured RCo activities of plasma from healthy donors and patients with different types of von Willebrand disease (vWD) and of vWF as a drug substance in factor (F) VIII/vWF concentrates using both the aggregometric and the macroscopic methods. In addition, we measured collagen-binding activity (vWF:CB) using a recently developed commercially available CBA system. To investigate the relation between the structure and the functional activity of vWF, we isolated vWF species with different numbers of multimers from FVIII/vWF concentrates by affinity chromatography on immobilized heparin. The vWF:RCo and vWF:CB of the different fractions were measured, and the multimeric structure of vWF was analyzed by sodium dodecyl sulfate (SDS) agarose gel electrophoresis. (vWF:CB and vWF:RCo are part of the nomenclature proposed by the International Society on Thrombosis and Hemostasis Scientific and Standardization Committee [ISTH SSC] subcommittee on von Willebrand factor, in Maastricht, Germany, June 16, 2000.) Measurement of functional vWF activity by CBA can be carried out with substantially higher interassay reproducibility than can measurement of RCo. Both assay

Multiple functions of the von Willebrand Factor A domain in matrilins: secretion, assembly, and proteolysis

Directory of Open Access Journals (Sweden)

Kanbe Katsuaki

2008-06-01

Full Text Available Abstract The von Willebrand Factor A (vWF A domain is one of the most widely distributed structural modules in cell-matrix adhesive molecules such as intergrins and extracellular matrix proteins. Mutations in the vWF A domain of matrilin-3 cause multiple epiphyseal dysplasia (MED, however the pathological mechanism remains to be determined. Previously we showed that the vWF A domain in matrilin-1 mediates formation of a filamentous matrix network through metal-ion dependent adhesion sites in the domain. Here we show two new functions of the vWF A domain in cartilage-specific matrilins (1 and 3. First, vWF A domain regulates oligomerization of matrilins. Insertion of a vWF A domain into matrilin-3 converts the formation of a mixture of matrilin-3 tetramer, trimer, and dimer into a tetramer only, while deletion of a vWF A domain from matrilin-1 converts the formation of the native matrilin-1 trimer into a mixture of trimer and dimer. Second, the vWF A domain protects matrilin-1 from proteolysis. We identified a latent proteolytic site next to the vWF A2 domain in matrilin-1, which is sensitive to the inhibitors of matrix proteases. Deletion of the abutting vWF A domain results in degradation of matrilin-1, presumably by exposing the adjacent proteolytic site. In addition, we also confirmed the vWF A domain is vital for the secretion of matrilin-3. Secretion of the mutant matrilin-3 harbouring a point mutation within the vWF A domain, as occurred in MED patients, is markedly reduced and delayed, resulting from intracellular retention of the mutant matrilin-3. Taken together, our data suggest that different mutations/deletions of the vWF A domain in matrilins may lead to distinct pathological mechanisms due to the multiple functions of the vWF A domain.

Exercise-induced shear stress is associated with changes in plasma von Willebrand factor in older humans.

Science.gov (United States)

Gonzales, Joaquin U; Thistlethwaite, John R; Thompson, Benjamin C; Scheuermann, Barry W

2009-07-01

Shear stress is the frictional force of blood against the endothelium, a stimulus for endothelial activation and the release of von Willebrand factor (vWF). This study tested the hypothesis that the increase in shear stress associated with exercise correlates with plasma vWF. Young (n = 14, 25.7 +/- 5.4 years) and older (n = 13, 65.6 +/- 10.7 years) individuals participated in 30 min of dynamic handgrip exercise at a moderate intensity. Brachial artery diameter and blood flow were measured using ultrasound Doppler and blood samples were collected before, immediately after, and following 30 min of recovery from exercise with plasma levels of vWF. Plasma levels of vWF increased (P exercise. The change in plasma vWF was linearly correlated with the increase in shear stress during exercise in older individuals (post-exercise: r = 0.78, 30 min recovery: r = 0.77, P < 0.01), but no association was found in the young individuals. These changes in plasma levels of vWF in humans suggest that aging influences endothelial activation and hemostasis.

Increased metastatic potential of tumor cells in von Willebrand factor-deficient mice.

Science.gov (United States)

Terraube, V; Pendu, R; Baruch, D; Gebbink, M F B G; Meyer, D; Lenting, P J; Denis, C V

2006-03-01

The key role played by von Willebrand factor (VWF) in platelet adhesion suggests a potential implication in various pathologies, where this process is involved. In cancer metastasis development, tumor cells interact with platelets and the vessel wall to extravasate from the circulation. As a potential mediator of platelet-tumor cell interactions, VWF could influence this early step of tumor spread and therefore play a role in cancer metastasis. To investigate whether VWF is involved in metastasis development. In a first step, we characterized the interaction between murine melanoma cells B16-BL6 and VWF in vitro. In a second step, an experimental metastasis model was used to compare the formation of pulmonary metastatic foci in C57BL/6 wild-type and VWF-null mice following the injection of B16-BL6 cells or Lewis lung carcinoma cells. In vitro adhesion assays revealed that VWF is able to promote a dose-dependent adhesion of B16-BL6 cells via its Arg-Gly-Asp (RGD) sequence. In the experimental metastasis model, we found a significant increase in the number of pulmonary metastatic foci in VWF-null mice compared with the wild-type mice, a phenotype that could be corrected by restoring VWF plasma levels. We also showed that increased survival of the tumor cells in the lungs during the first 24 h in the absence of VWF was the cause of this increased metastasis. These findings suggest that VWF plays a protective role against tumor cell dissemination in vivo. Underlying mechanisms remain to be investigated.

Decrease of hemostatic cardiovascular risk factors by aggressive vs. conventional atorvastatin treatment in patients with Type 2 diabetes mellitus.

NARCIS (Netherlands)

Ree, M.A. van de; Maat, M.P. de; Kluft, C.; Meinders, A.E.; Princen, H.M.; Huisman, M.V.

2003-01-01

BACKGROUND: Patients with Type 2 diabetes mellitus have increased levels of hemostatic risk variables for cardiovascular disease, such as fibrinogen, von Willebrand factor (VWF), factor (F)VIIa, d-dimer and plasminogen activator inhibitor-1 (PAI-1). OBJECTIVES: To evaluate the effect of aggressive

D-dimer, factor VIII and von Willebrand factor predict a non-dipping pattern of blood pressure in hypertensive patients.

Science.gov (United States)

Agorasti, Athanasia; Trivellas, Theodoros; Mourvati, Efthimia; Papadopoulos, Vasilios; Tsatalas, Konstantinos; Vargemezis, Vasilios; Passadakis, Ploumis

2013-06-01

The aim of this study is to assess whether the haemostatic markers D-dimer, factor VIII (FVIII) and von Willebrand factor (VWF) are predictive of non-dipping status in treated hypertensive patients; so, as easy available laboratory data can predict non-dipping pattern and help with the selection of the patients whom circadian blood pressure should be re-examined. Forty treated hypertensive patients with essential hypertension were included in the study. Twenty-four-hour ambulatory blood pressure monitoring was performed in all patients. Daytime and nocturnal average systolic, diastolic and mean blood pressures were calculated. Patients were characterised as "non-dippers" on the basis of a less than 10 % decline in nocturnal blood pressure (BP); either systolic or diastolic or mean (MAP). D-dimer as marker of fibrinolytic function, FVIII activity and VWF antigen as marker of endothelial dysfunction were measured on plasma. The predictive efficiency was analysed by receiver operating characteristic (ROC) curves. Youden index was used for the estimation of the cut-off points and the associated values for sensitivity and 1-specificity. Plasma levels of D-dimer, FVIII and VWF were significantly higher in non-dippers as compared with dippers, irrespective of the classification used (BP index); all P AUC(ROC) = 0.697, 0.715 and 0.774), FVIII (AUC(ROC) = 0.714, 0.692 and 0.755) and VWF (AUC(ROC) = 0.706, 0.740 and 0.708) in distinguishing non-dipping pattern (systolic, diastolic or mean) in the study population; all P 168 ng/ml (sensitivity/1-specificity for systolic BP non-dippers of 0.789/0.381, for diastolic BP non-dippers 0.923/0.444 and for MAP non-dippers 0.875/0.375). In conclusion, D-dimer has a good predictive value for non-dipping pattern and the decision for the 24-h ambulatory blood pressure re-monitoring among dippers could rely on its values.

Use of routine histopathology and factor VIII-related antigen/von Willebrand factor immunohistochemistry to differentiate primary hemangiosarcoma of bone from telangiectatic osteosarcoma in 54 dogs.

Science.gov (United States)

Giuffrida, M A; Bacon, N J; Kamstock, D A

2017-12-01

Hemangiosarcoma (HSA) of bone and telangiectatic osteosarcoma (tOSA) can appear similar histologically, but differ in histogenesis (malignant endothelial cells versus osteoblasts), and may warrant different treatments. Immunohistochemistry (IHC) for endothelial cell marker factor VIII-related antigen/von Willebrand factor (FVIII-RAg/vWF) is a well-documented ancillary test to confirm HSA diagnoses in soft tissues, but its use in osseous HSA is rarely described. Archived samples of 54 primary appendicular bone tumours previously diagnosed as HSA or tOSA were evaluated using combination routine histopathology (RHP) and IHC. Approximately 20% of tumours were reclassified on the basis of FVIII-RAg/vWF immunoreactivity, typically from an original diagnosis of tOSA to a reclassified diagnosis of HSA. No sample with tumour osteoid clearly identified on RHP was immunopositive for FVIII-RAg/vWF. RHP alone was specific but not sensitive for diagnosis of HSA, compared with combination RHP and IHC. Routine histopathological evaluation in combination with FVIII-RAg/vWF IHC can help differentiate canine primary appendicular HSA from tOSA. © 2016 John Wiley & Sons Ltd.

The thrombospondin-1 N700S polymorphism is associated with early myocardial infarction without altering von Willebrand factor multimer size.

Science.gov (United States)

Zwicker, Jeffrey I; Peyvandi, Flora; Palla, Roberta; Lombardi, Rossana; Canciani, Maria Teresa; Cairo, Andrea; Ardissino, Diego; Bernardinelli, Luisa; Bauer, Kenneth A; Lawler, Jack; Mannucci, Pier

2006-08-15

The N700S polymorphism of thrombospondin-1 (TSP-1) has been identified as a potential genetic risk factor for myocardial infarction (MI). In a large case-control study of 1425 individuals who survived a myocardial infarction prior to age 45, the N700S polymorphism was a significant risk factor for myocardial infarction in both homozygous (odds ratio [OR] 1.9, 95% confidence interval [CI] 1.1-3.3, P = .01) and heterozygous carriers of the S700 allele (OR 1.4, 95% CI 1.1-3.3, P = .01). TSP-1 has been shown to reduce von Willebrand factor (VWF) multimer size, and the domain responsible for VWF-reducing activity has been localized to the calcium-binding C-terminal sequence. As the N700S polymorphism was previously shown to alter the function of this domain, we investigated whether the altered VWF-reducing activity of TSP-1 underlies the observed prothrombotic phenotype. The TSP1 N700S polymorphism did not influence VWF multimer size in patients homozygous for either allele nor was there a significant reduction of VWF multimer size following incubation with recombinant N700S fragments or platelet-derived TSP-1.

One-pot preparation of conducting composite containing abundant amino groups on electrode surface for electrochemical detection of von willebrand factor

Science.gov (United States)

Wang, Wen; Ma, Chao; Li, Yi; Liu, Baihui; Tan, Liang

2018-03-01

A one-pot protocol based on cyclic voltammetric scan was employed to prepare new conducting composite that was abundant in amino groups. The scanning electron microscope, atomic force microscope, X-ray photoelectron spectroscopy and infrared spectrum characterization demonstrate that poly(azure A), gold nanoparticles, chitosan and cysteine were immobilized simultaneously on glassy carbon electrode surface. Von Willebrand factor (vWF) antibody (Ab) was subsequently assembled by using glutaraldehyde to construct the Ab/composite-modified electrode. The capture of vWF could inhibit the charge transfer between the ferri-/ferrocyanide probe and the electrode and exert the negative effect on the electrochemical response of the dye polymer in the conducting composite due to the strong steric hindrance effect. The DPV peak current change before and after the immunoreaction was found to be proportional to the logarithm of the vWF concentration from 0.001 to 100 μg mL-1 with a detection limit of 0.4 ng mL-1. The proposed label-free electrochemical method was employed in the investigation on the release of vWF by oxidation-injured vascular endothelial cells. The experimental results exhibit that the vWF content in growth medium was increased when the oxidation injury of the cells was intensified in the presence of H2O2.

Endothelial markers in malignant vascular tumours of the liver: superiority of QB-END/10 over von Willebrand factor and Ulex europaeus agglutinin 1.

Science.gov (United States)

Anthony, P P; Ramani, P

1991-01-01

A new monoclonal antibody, QB-END/10, raised against the CD34 antigen in human endothelial cell membranes and haemopoietic progenitor cells, was studied for its usefulness as a marker of neoplastic vascular cells in 21 angiosarcomas and seven malignant haemangioendotheliomas of the liver. QB-END/10 was both more sensitive and more specific than Von Willebrand factor (VWF) and Ulex europaeus 1 agglutinin (UEA-1) in labelling endothelial cells and it did not cross react with epithelia as UEA-1 often does. Staining was uniformly strong and clear in all histological variants of these two tumours. QB-END/10 should prove particularly useful in the differential diagnosis of malignant vascular tumours of the liver.

Plasmatic ADAMTS-13 metalloprotease and von Willebrand factor in children with cyanotic congenital heart disease

Energy Technology Data Exchange (ETDEWEB)

Soares, R.P.S. [Fundação Pró-Sangue Hemocentro de São Paulo, São Paulo, SP (Brazil); Bydlowski, S.P.; Nascimento, N.M. [Laboratório de Investigação Médica-31, Faculdade de Medicina, Universidade de São Paulo, São Paulo, SP (Brazil); Thomaz, A.M.; Bastos, E.N.M.; Lopes, A.A. [Faculdade de Medicina, Instituto do Coração, Universidade de São Paulo, São Paulo, SP (Brazil)

2013-04-05

Changes in plasma von Willebrand factor concentration (VWF:Ag) and ADAMTS-13 activity (the metalloprotease that cleaves VWF physiologically) have been reported in several cardiovascular disorders with prognostic implications. We therefore determined the level of these proteins in the plasma of children with cyanotic congenital heart disease (CCHD) undergoing surgical treatment. Forty-eight children were enrolled (age 0.83 to 7.58 years). Measurements were performed at baseline and 48 h after surgery. ELISA, collagen-binding assays and Western blotting were used to estimate antigenic and biological activities, and proteolysis of VWF multimers. Preoperatively, VWF:Ag and ADAMTS-13 activity were decreased (65 and 71% of normal levels considered as 113 (105-129) U/dL and 91 ± 24% respectively, P < 0.003) and correlated (r = 0.39, P = 0.0064). High molecular weight VWF multimers were not related, suggesting an interaction of VWF with cell membranes, followed by proteolytic cleavage. A low preoperative ADAMTS-13 activity, a longer activated partial thromboplastin time and the need for cardiopulmonary bypass correlated with postoperative bleeding (P < 0.05). Postoperatively, ADAMTS-13 activity increased but less extensively than VWF:Ag (respectively, 2.23 and 2.83 times baseline, P < 0.0001), resulting in an increased VWF:Ag/ADAMTS-13 activity ratio (1.20 to 1.54, respectively, pre- and postoperative median values, P = 0.0029). ADAMTS-13 consumption was further confirmed by decreased ADAMTS-13 antigenic concentration (0.91 ± 0.30 to 0.70 ± 0.25 µg/mL, P < 0.0001) and persistent proteolysis of VWF multimers. We conclude that, in pediatric CCHD, changes in circulating ADAMTS-13 suggest enzyme consumption, associated with abnormal structure and function of VWF.

A systematic review of the effects of hemophilia and von Willebrand disease on arterial trombosis

NARCIS (Netherlands)

Biere-Rafi, Sara; Zwiers, M.; Peters, Marjolein; Van Der Meer, Jan; Rosendaal, Frits R; Buller, Harry R; Kamphuisen, Pieter W

Background: Patients with hemophilia and von Willebrand disease (VWD) may be protected against arterial thrombosis, through a hy-pocoagulable state or atherosclerosis. We performed a systematic review to assess the association between these clotting disorders, arterial thrombosis and the prevalence

Identification and Characterization of Novel Variations in Platelet G-Protein Coupled Receptor (GPCR Genes in Patients Historically Diagnosed with Type 1 von Willebrand Disease.

Directory of Open Access Journals (Sweden)

Jacqueline Stockley

Full Text Available The clinical expression of type 1 von Willebrand disease may be modified by co-inheritance of other mild bleeding diatheses. We previously showed that mutations in the platelet P2Y12 ADP receptor gene (P2RY12 could contribute to the bleeding phenotype in patients with type 1 von Willebrand disease. Here we investigated whether variations in platelet G protein-coupled receptor genes other than P2RY12 also contributed to the bleeding phenotype. Platelet G protein-coupled receptor genes P2RY1, F2R, F2RL3, TBXA2R and PTGIR were sequenced in 146 index cases with type 1 von Willebrand disease and the potential effects of identified single nucleotide variations were assessed using in silico methods and heterologous expression analysis. Seven heterozygous single nucleotide variations were identified in 8 index cases. Two single nucleotide variations were detected in F2R; a novel c.-67G>C transversion which reduced F2R transcriptional activity and a rare c.1063C>T transition predicting a p.L355F substitution which did not interfere with PAR1 expression or signalling. Two synonymous single nucleotide variations were identified in F2RL3 (c.402C>G, p.A134 =; c.1029 G>C p.V343 =, both of which introduced less commonly used codons and were predicted to be deleterious, though neither of them affected PAR4 receptor expression. A third single nucleotide variation in F2RL3 (c.65 C>A; p.T22N was co-inherited with a synonymous single nucleotide variation in TBXA2R (c.6680 C>T, p.S218 =. Expression and signalling of the p.T22N PAR4 variant was similar to wild-type, while the TBXA2R variation introduced a cryptic splice site that was predicted to cause premature termination of protein translation. The enrichment of single nucleotide variations in G protein-coupled receptor genes among type 1 von Willebrand disease patients supports the view of type 1 von Willebrand disease as a polygenic disorder.

Identification and Characterization of Novel Variations in Platelet G-Protein Coupled Receptor (GPCR) Genes in Patients Historically Diagnosed with Type 1 von Willebrand Disease.

Science.gov (United States)

Stockley, Jacqueline; Nisar, Shaista P; Leo, Vincenzo C; Sabi, Essa; Cunningham, Margaret R; Eikenboom, Jeroen C; Lethagen, Stefan; Schneppenheim, Reinhard; Goodeve, Anne C; Watson, Steve P; Mundell, Stuart J; Daly, Martina E

2015-01-01

The clinical expression of type 1 von Willebrand disease may be modified by co-inheritance of other mild bleeding diatheses. We previously showed that mutations in the platelet P2Y12 ADP receptor gene (P2RY12) could contribute to the bleeding phenotype in patients with type 1 von Willebrand disease. Here we investigated whether variations in platelet G protein-coupled receptor genes other than P2RY12 also contributed to the bleeding phenotype. Platelet G protein-coupled receptor genes P2RY1, F2R, F2RL3, TBXA2R and PTGIR were sequenced in 146 index cases with type 1 von Willebrand disease and the potential effects of identified single nucleotide variations were assessed using in silico methods and heterologous expression analysis. Seven heterozygous single nucleotide variations were identified in 8 index cases. Two single nucleotide variations were detected in F2R; a novel c.-67G>C transversion which reduced F2R transcriptional activity and a rare c.1063C>T transition predicting a p.L355F substitution which did not interfere with PAR1 expression or signalling. Two synonymous single nucleotide variations were identified in F2RL3 (c.402C>G, p.A134 =; c.1029 G>C p.V343 =), both of which introduced less commonly used codons and were predicted to be deleterious, though neither of them affected PAR4 receptor expression. A third single nucleotide variation in F2RL3 (c.65 C>A; p.T22N) was co-inherited with a synonymous single nucleotide variation in TBXA2R (c.6680 C>T, p.S218 =). Expression and signalling of the p.T22N PAR4 variant was similar to wild-type, while the TBXA2R variation introduced a cryptic splice site that was predicted to cause premature termination of protein translation. The enrichment of single nucleotide variations in G protein-coupled receptor genes among type 1 von Willebrand disease patients supports the view of type 1 von Willebrand disease as a polygenic disorder.

Technological advances in diagnostic testing for von Willebrand disease: new approaches and challenges.

Science.gov (United States)

Hayward, C P M; Moffat, K A; Graf, L

2014-06-01

Diagnostic tests for von Willebrand disease (VWD) are important for the assessment of VWD, which is a commonly encountered bleeding disorder worldwide. Technical innovations have been applied to improve the precision and lower limit of detection of von Willebrand factor (VWF) assays, including the ristocetin cofactor activity assay (VWF:RCo) that uses the antibiotic ristocetin to induce plasma VWF binding to glycoprotein (GP) IbIXV on target platelets. VWF-collagen-binding assays, depending on the type of collagen used, can improve the detection of forms of VWD with high molecular weight VWF multimer loss, although the best method is debatable. A number of innovations have been applied to VWF:RCo (which is commonly performed on an aggregometer), including replacing the target platelets with immobilized GPIbα, and quantification by an enzyme-linked immunosorbent assay (ELISA), immunoturbidimetric, or chemiluminescent end-point. Some common polymorphisms in the VWF gene that do not cause bleeding are associated with falsely low VWF activity by ristocetin-dependent methods. To overcome the need for ristocetin, some new VWF activity assays use gain-of-function GPIbα mutants that bind VWF without the need for ristocetin, with an improved precision and lower limit of detection than measuring VWF:RCo by aggregometry. ELISA of VWF binding to mutated GPIbα shows promise as a method to identify gain-of-function defects from type 2B VWD. The performance characteristics of many new VWF activity assays suggest that the detection of VWD, and monitoring of VWD therapy, by clinical laboratories could be improved through adopting newer generation VWF assays. © 2014 John Wiley & Sons Ltd.

Molecular cloning of the human gene for von Willebrand factor and identification of the transcription initiation site

International Nuclear Information System (INIS)

Collins, C.J.; Underdahl, J.P.; Levene, R.B.; Ravera, C.P.; Morin, M.J.; Dombalagian, M.J.; Ricca, G.; Livingston, D.M.; Lynch, D.C.

1987-01-01

A series of overlapping cosmid genomic clones have been isolated that contain the entire coding unit of the human gene for van Willebrand factor (vWf), a major component of the hemostatic system. The cloned segments span ≅ 175 kilobases of human DNA sequence, and hybridization analysis suggest that the vWf coding unit is ≅150 kilobases in length. Within one of these clones, the vWF transcription initiation site has been mapped and a portion of the vWf promoter region has been sequenced, revealing a typical TATA box, a downstream CCAAT box, and a perfect downstream repeat of the 8 base pairs containing the transcription start site. Sequencing of a segment of another genomic clone has revealed the vWF translation termination codon. Where tested, comparative restriction analysis of cloned and chromosomal DNA segments strongly suggests that no major alterations occurred during cloning and that there is only one complete copy of the vWf gene in the human haploid genome. Similar analyses of DNA from vWf-producing endothelial cells and nonexpressing leukocytes suggest that vWf gene expression is not accompanied by gross genomic rearrangements. In addition, there is significant homology of C-terminal coding sequences among the vWf genes of several vertebrate species

The important role of von Willebrand factor in platelet-derived FVIII gene therapy for murine hemophilia A in the presence of inhibitory antibodies.

Science.gov (United States)

Shi, Q; Schroeder, J A; Kuether, E L; Montgomery, R R

2015-07-01

Our previous studies have demonstrated that targeting FVIII expression to platelets results in FVIII storage together with von Willebrand factor (VWF) in platelet α-granules and that platelet-derived FVIII (2bF8) corrects the murine hemophilia A phenotype even in the presence of high-titer anti-FVIII inhibitory antibodies (inhibitors). To explore how VWF has an impact on platelet gene therapy for hemophilia A with inhibitors. 2bF8 transgenic mice in the FVIII(-/-) background (2bF8(tg+/-) F8(-/-) ) with varying VWF phenotypes were used in this study. Animals were analyzed by VWF ELISA, FVIII activity assay, Bethesda assay and tail clip survival test. Only 18% of 2bF8(tg+/-) F8(-/-) VWF(-/-) animals, in which VWF was deficient, survived the tail clip challenge with inhibitor titers of 3-8000 BU mL(-1) . In contrast, 82% of 2bF8(tg+/-) F8(-/-) VWF(+/+) mice, which had normal VWF levels, survived tail clipping with inhibitor titers of 10-50,000 BU mL(-1) . All 2bF8(tg+/-) F8(-/-) VWF(-/-) mice without inhibitors survived tail clipping and no VWF(-/-) F8(-/-) mice survived this challenge. Because VWF is synthesized by endothelial cells and megakaryocytes and is distributed in both plasma and platelets in peripheral blood, we further investigated the effect of each compartment of VWF on platelet-FVIII gene therapy for hemophilia A with inhibitors. In the presence of inhibitors, 42% of animals survived tail clipping in the group with plasma-VWF and 50% survived in the platelet-VWF group. VWF is essential for platelet gene therapy for hemophilia A with inhibitors. Both platelet-VWF and plasma-VWF are required for optimal platelet-derived FVIII gene therapy for hemophilia A in the presence of inhibitors. © 2015 International Society on Thrombosis and Haemostasis.

Unconjugated Bilirubin Inhibits Proteolytic Cleavage of von Willebrand Factor by ADAMTS13 Protease

Science.gov (United States)

Lu, Rui-Nan; Yang, Shangbin; Wu, Haifeng M.; Zheng, X. Long

2015-01-01

Summary Background Bilirubin is a yellow breakdown product of heme catabolism. Increased serum levels of unconjugated bilirubin are conditions commonly seen in premature neonates and adults with acute hemolysis including thrombotic microangiopathy. Previous studies have shown that unconjugated bilirubin lowers plasma ADAMTS13 activity, but the mechanism is not fully understood. Objectives The study is to determine whether unconjugated bilirubin directly inhibits the cleavage of von Willebrand factor (VWF) and its analogs by ADAMTS13. Methods Fluorogenic, SELDI-TOF mass spectrometric assay, and Western blotting analyses were employed to address this question. Results Unconjugated bilirubin inhibits the cleavage of F485-rVWF73-H, D633-rVWF73-H, and GST-rVWF71-11K by ADAMTS13 in a concentration-dependent manner with a half-maximal inhibitory concentration (IC50) of ~13 μM, ~70 μM, and ~17 μM, respectively. Unconjugated bilirubin also dose-dependently inhibits the cleavage of multimeric VWF by ADAMTS13 under denaturing conditions. The inhibitory activity of bilirubin on the cleavage of D633-rVWF73-H and multimeric VWF, but not F485-rVWF73-H, was eliminated after incubation with bilirubin oxidase that converts bilirubin to biliverdin. Furthermore, plasma ADAMTS13 activity in patients with hyperbilirubinemia is lower prior to than after treatment with bilirubin oxidase. Conclusions unconjugated bilirubin directly inhibits ADAMTS13’s ability to cleave both peptidyl and native VWF substrates in addition to its interference with certain fluorogenic assays. Our findings may help proper interpretation of ADAMTS13 results under pathological conditions. Whether elevated serum unconjugated bilirubin has an adverse effect in vivo remains to be determined in our future study. PMID:25782102

Von Willebrand's Disease in Two Families of Doberman Pinschers

OpenAIRE

Johnstone, I. B.; Crane, S.

1981-01-01

The history, clinical symptoms and laboratory results in two families of Doberman pinschers with von Willebrand's disease are described. The affected animals illustrate the rather nonspecific bleeding problems that may be encountered in mild and moderate forms of this disease. In both families a bleeding diathesis was suspected when one member of the family underwent surgery with serious postoperative bleeding complications. These cases illustrate the importance of a thorough presurgical hist...

Coats' disease, Turner syndrome, and von Willebrand disease in a patient with Wildtype Norrie disease pseudoglioma.

Science.gov (United States)

Desai, Rajen U; Saffra, Norman A; Krishna, Rati P; Rosenberg, Steven E

2011-01-01

The authors describe a girl diagnosed as having Coats' disease, Turner syndrome (45X karyotype), and type 1 von Willebrand disease. She tested negative for the Norrie disease pseudoglioma (NDP) gene located on the X-chromosome, which has been suspected of contributing to Coats' disease. Copyright 2010, SLACK Incorporated.

A 12.3-kb Duplication Within the VWF Gene in Pigs Affected by Von Willebrand Disease Type 3

Directory of Open Access Journals (Sweden)

Stefanie Lehner

2018-02-01

Full Text Available Von Willebrand Disease (VWD type 3 is a serious and sometimes fatal hereditary bleeding disorder. In pigs, the disease has been known for decades, and affected animals are used as models for the human disease. Due to the recessive mode of inheritance of VWD type 3, severe bleeding is typically seen in homozygous individuals. We sequenced the complete porcine VWF (Von Willebrand Factor complementary DNA (cDNA and detected a tandem duplication of exons 17 and 18, causing a frameshift and a premature termination codon (p.Val814LeufsTer3 in the affected pig. Subsequent next generation sequencing on genomic DNA proved the existence of a 12.3-kb tandem duplication associated with VWD. This duplication putatively originates from porcine Short Interspersed Nuclear Elements (SINEs located within VWF introns 16 and 18 with high identity. The premature termination truncates the VWF open reading frame by a large part, resulting in an almost entire loss of the mature peptide. It is therefore supposed to account for the severe VWD type 3. Our results further indicate the presence of strong, nonsense-mediated decay in VWF messenger RNA (mRNA containing the duplication, which was supported by the almost complete absence of the complete VWF protein in immunohistochemistry analysis of the VWD-affected pig. In the past, differentiation of wild-type and heterozygous pigs in this VWD colony had to rely on clinical examinations and additional laboratory methods. The present study provides the basis to distinguish both genotypes by performing a rapid and simple genetic analysis.

Space and Time Resolved Detection of Platelet Activation and von Willebrand Factor Conformational Changes in Deep Suspensions.

Science.gov (United States)

Biasetti, Jacopo; Sampath, Kaushik; Cortez, Angel; Azhir, Alaleh; Gilad, Assaf A; Kickler, Thomas S; Obser, Tobias; Ruggeri, Zaverio M; Katz, Joseph

2017-01-01

Tracking cells and proteins' phenotypic changes in deep suspensions is critical for the direct imaging of blood-related phenomena in in vitro replica of cardiovascular systems and blood-handling devices. This paper introduces fluorescence imaging techniques for space and time resolved detection of platelet activation, von Willebrand factor (VWF) conformational changes, and VWF-platelet interaction in deep suspensions. Labeled VWF, platelets, and VWF-platelet strands are suspended in deep cuvettes, illuminated, and imaged with a high-sensitivity EM-CCD camera, allowing detection using an exposure time of 1 ms. In-house postprocessing algorithms identify and track the moving signals. Recombinant VWF-eGFP (rVWF-eGFP) and VWF labeled with an FITC-conjugated polyclonal antibody are employed. Anti-P-Selectin FITC-conjugated antibodies and the calcium-sensitive probe Indo-1 are used to detect activated platelets. A positive correlation between the mean number of platelets detected per image and the percentage of activated platelets determined through flow cytometry is obtained, validating the technique. An increase in the number of rVWF-eGFP signals upon exposure to shear stress demonstrates the technique's ability to detect breakup of self-aggregates. VWF globular and unfolded conformations and self-aggregation are also observed. The ability to track the size and shape of VWF-platelet strands in space and time provides means to detect pro- and antithrombotic processes.

Consumption of nattokinase is associated with reduced blood pressure and von Willebrand factor, a cardiovascular risk marker: results from a randomized, double-blind, placebo-controlled, multicenter North American clinical trial.

Science.gov (United States)

Jensen, Gitte S; Lenninger, Miki; Ero, Michael P; Benson, Kathleen F

2016-01-01

The objective of this study is to evaluate the effects of consumption of nattokinase on hypertension in a North American hypertensive population with associated genetic, dietary, and lifestyle factors. This is in extension of, and contrast to, previous studies on Asian populations. A randomized, double-blind, placebo-controlled, parallel-arm clinical study was performed to evaluate nattokinase (NSK-SD), a fermented soy extract nattō from which vitamin K2 has been removed. Based on the results from previous studies on Asian populations, 79 subjects were enrolled upon screening for elevated blood pressure (BP; systolic BP ≥130 or diastolic BP ≥90 mmHg) who consumed placebo or 100 mg nattokinase/d for the 8-week study duration. Blood collections were performed at baseline and 8 weeks for testing plasma renin activity, von Willebrand factor (vWF), and platelet factor-4. Seventy-four people completed the study with good compliance. Consumption of nattokinase was associated with a reduction in both systolic and diastolic BP. The reduction in systolic BP was seen for both sexes but was more robust in males consuming nattokinase. The average reduction in diastolic BP in the nattokinase group from 87 mmHg to 84 mmHg was statistically significant when compared to that in the group consuming placebo, where the average diastolic BP remained constant at 87 mmHg ( P nattokinase, where the average diastolic BP dropped from 86 mmHg to 81 mmHg ( P nattokinase ( P nattokinase ( P nattokinase consumption in a North American population is associated with beneficial changes to BP in a hypertensive population, indicating sex-specific mechanisms of action of nattokinase's effect on vWF and hypertension.

Growth differentiation factor-15 (GDF-15) suppresses in vitro angiogenesis through a novel interaction with connective tissue growth factor (CCN2).

Science.gov (United States)

Whitson, Ramon J; Lucia, Marshall Scott; Lambert, James R

2013-06-01

Growth differentiation factor-15 (GDF-15) and the CCN family member, connective tissue growth factor (CCN2), are associated with cardiac disease, inflammation, and cancer. The precise role and signaling mechanism for these factors in normal and diseased tissues remains elusive. Here we demonstrate an interaction between GDF-15 and CCN2 using yeast two-hybrid assays and have mapped the domain of interaction to the von Willebrand factor type C domain of CCN2. Biochemical pull down assays using secreted GDF-15 and His-tagged CCN2 produced in PC-3 prostate cancer cells confirmed a direct interaction between these proteins. To investigate the functional consequences of this interaction, in vitro angiogenesis assays were performed. We demonstrate that GDF-15 blocks CCN2-mediated tube formation in human umbilical vein endothelial (HUVEC) cells. To examine the molecular mechanism whereby GDF-15 inhibits CCN2-mediated angiogenesis, activation of αV β3 integrins and focal adhesion kinase (FAK) was examined. CCN2-mediated FAK activation was inhibited by GDF-15 and was accompanied by a decrease in αV β3 integrin clustering in HUVEC cells. These results demonstrate, for the first time, a novel signaling pathway for GDF-15 through interaction with the matricellular signaling molecule CCN2. Furthermore, antagonism of CCN2 mediated angiogenesis by GDF-15 may provide insight into the functional role of GDF-15 in disease states. Copyright © 2012 Wiley Periodicals, Inc.

Elevated Factor VIII and von Willebrand Factor Levels Predict Unfavorable Outcome in Stroke Patients Treated with Intravenous Thrombolysis

Directory of Open Access Journals (Sweden)

Noémi Klára Tóth

2018-01-01

Full Text Available IntroductionPlasma factor VIII (FVIII and von Willebrand factor (VWF levels have been associated with the rate and severity of arterial thrombus formation and have been linked to outcomes following thrombolytic therapy in acute myocardial infarction patients. Here, we aimed to investigate FVIII and VWF levels during the course of thrombolysis in acute ischemic stroke (AIS patients and to find out whether they predict long-term outcomes.Materials and methodsStudy population included 131 consecutive AIS patients (median age: 69 years, 60.3% men who underwent i.v. thrombolysis with recombinant tissue plasminogen activator (rt-PA. Blood samples were taken on admission, 1 and 24 h after rt-PA administration to measure FVIII activity and VWF antigen levels. Neurological deficit of patients was determined according to the National Institutes of Health Stroke Scale (NIHSS. ASPECT scores were assessed using computer tomography images taken before and 24 h after thrombolysis. Intracranial hemorrhage was classified according to the European Cooperative Acute Stroke Study (ECASS II criteria. Long-term functional outcome was determined at 90 days after the event by the modified Rankin scale (mRS.ResultsVWF levels on admission were significantly elevated in case of more severe AIS [median and IQR values: NIHSS <6:189.6% (151.9–233.2%; NIHSS 6–16: 199.6% (176.4–250.8%; NIHSS >16: 247.8% (199.9–353.8%, p = 0.013]; similar, but non-significant trend was observed for FVIII levels. FVIII and VWF levels correlated well on admission (r = 0.748, p < 0.001 but no significant correlation was found immediately after thrombolysis (r = 0.093, p = 0.299, most probably due to plasmin-mediated FVIII degradation. VWF levels at all investigated occasions and FVIII activity before and 24 h after thrombolysis were associated with worse 24 h post-lysis ASPECT scores. In a binary backward logistic regression analysis including age, gender

Von Willebrand factor indicates bacterial translocation, inflammation, and procoagulant imbalance and predicts complications independently of portal hypertension severity.

Science.gov (United States)

Mandorfer, M; Schwabl, P; Paternostro, R; Pomej, K; Bauer, D; Thaler, J; Ay, C; Quehenberger, P; Fritzer-Szekeres, M; Peck-Radosavljevic, M; Trauner, M; Reiberger, T; Ferlitsch, A

2018-04-01

Elevated plasma von Willebrand factor antigen (vWF) has been shown to indicate the presence of clinically significant portal hypertension, and thus, predicts the development of clinical events in patients with cirrhosis. To investigate the impact of bacterial translocation and inflammation on vWF, as well as the association between vWF and procoagulant imbalance. Moreover, we assessed whether vWF predicts complications of cirrhosis, independent of the severity of portal hypertension. Our study population comprised 225 patients with hepatic venous pressure gradient (HVPG) ≥ 10 mm Hg without active bacterial infections or hepatocellular carcinoma. vWF correlated with markers of bacterial translocation (lipopolysaccharide-binding protein [LBP; ρ = 0.201; P = 0.021]), inflammation (interleukin 6 [IL-6; ρ = 0.426; P protein [CRP; ρ = 0.249; P protein C ratio; ρ = 0.507; P model for transplant-free mortality. Finally, the independent prognostic value of vWF/CRP groups for mortality was confirmed by competing risk analysis. Our results demonstrate that vWF is not only a marker of portal hypertension but also independently linked to bacterial translocation, inflammation and procoagulant imbalance, which might explain its HVPG-independent association with most clinical events. Prognostic groups based on vWF/CRP efficiently discriminate between patients with a poor 5-year survival and patients with a favourable prognosis. © 2018 John Wiley & Sons Ltd.

Thrombomodulin, von Willebrand factor and E-selectin as plasma markers of endothelial damage/dysfunction and activation in pregnancy induced hypertension.

Science.gov (United States)

Nadar, Sunil K; Al Yemeni, Eman; Blann, Andrew D; Lip, Gregory Y H

2004-01-01

Endothelial disturbance (whether activation, dysfunction or damage) is a likely pathogenic mechanism in pre-eclampsia and pregnancy-induced hypertension (PIH). We set out to determine which of three plasma markers of endothelial disturbance, indicating endothelial activation (E-selectin) or damage/dysfunction (von Willebrand factor (vWf), soluble thrombomodulin), would provide the best discriminator of PIH compared to normotensive pregnancy. Cross-sectional study of 36 consecutive women with PIH (age 31+/-6 years) and 36 consecutive women with normotensive pregnancies (age 29+/-5 years) of similar parity. Plasma levels of vWf, E-selectin and thrombomodulin were measured using ELISA. As expected, women with PIH had significantly higher levels of plasma vWf (by 19%, p=0.003), E-selectin (by 40%, p<0.001) and thrombomodulin (by 61%, p=0.01) than normotensive women. However, on stepwise multiple regression analysis, only thrombomodulin was an independent significant predictor of the presence of PIH (p=0.023). We conclude that although vWf, E-selectin and thrombomodulin are all raised in PIH, only thrombomodulin was independently associated with PIH. This molecule could potentially be useful in monitoring and in providing clues in aetiology and pathophysiology, and may have implications for the clinical complications associated with PIH.

Molecular and clinical profile of von Willebrand disease in Spain (PCM-EVW-ES): comprehensive genetic analysis by next-generation sequencing of 480 patients.

Science.gov (United States)

Borràs, Nina; Batlle, Javier; Pérez-Rodríguez, Almudena; López-Fernández, María Fernanda; Rodríguez-Trillo, Ángela; Lourés, Esther; Cid, Ana Rosa; Bonanad, Santiago; Cabrera, Noelia; Moret, Andrés; Parra, Rafael; Mingot-Castellano, María Eva; Balda, Ignacia; Altisent, Carme; Pérez-Montes, Rocío; Fisac, Rosa María; Iruín, Gemma; Herrero, Sonia; Soto, Inmaculada; de Rueda, Beatriz; Jiménez-Yuste, Víctor; Alonso, Nieves; Vilariño, Dolores; Arija, Olga; Campos, Rosa; Paloma, María José; Bermejo, Nuria; Berrueco, Rubén; Mateo, José; Arribalzaga, Karmele; Marco, Pascual; Palomo, Ángeles; Sarmiento, Lizheidy; Iñigo, Belén; Nieto, María Del Mar; Vidal, Rosa; Martínez, María Paz; Aguinaco, Reyes; César, Jesús María; Ferreiro, María; García-Frade, Javier; Rodríguez-Huerta, Ana María; Cuesta, Jorge; Rodríguez-González, Ramón; García-Candel, Faustino; Cornudella, Rosa; Aguilar, Carlos; Vidal, Francisco; Corrales, Irene

2017-12-01

Molecular diagnosis of patients with von Willebrand disease is pending in most populations due to the complexity and high cost of conventional molecular analyses. The need for molecular and clinical characterization of von Willebrand disease in Spain prompted the creation of a multicenter project (PCM-EVW-ES) that resulted in the largest prospective cohort study of patients with all types of von Willebrand disease. Molecular analysis of relevant regions of the VWF , including intronic and promoter regions, was achieved in the 556 individuals recruited via the development of a simple, innovative, relatively low-cost protocol based on microfluidic technology and next-generation sequencing. A total of 704 variants (237 different) were identified along VWF , 155 of which had not been previously recorded in the international mutation database. The potential pathogenic effect of these variants was assessed by in silico analysis. Furthermore, four short tandem repeats were analyzed in order to evaluate the ancestral origin of recurrent mutations. The outcome of genetic analysis allowed for the reclassification of 110 patients, identification of 37 asymptomatic carriers (important for genetic counseling) and re-inclusion of 43 patients previously excluded by phenotyping results. In total, 480 patients were definitively diagnosed. Candidate mutations were identified in all patients except 13 type 1 von Willebrand disease, yielding a high genotype-phenotype correlation. Our data reinforce the capital importance and usefulness of genetics in von Willebrand disease diagnostics. The progressive implementation of molecular study as the first-line test for routine diagnosis of this condition will lead to increasingly more personalized and effective care for this patient population. Copyright© 2017 Ferrata Storti Foundation.

Platelet-type von Willebrand Disease: Diagnostic Challenges. Flaws and Pitfalls Experienced in the THROMKID Quality Project.

Science.gov (United States)

Maurer, M; Mesters, R; Schneppenheim, R; Knoefler, R; Streif, W

2015-05-01

Primary haemostasis defects comprise von Willebrand disease (VWD) and platelet disorders (PD). Although presenting with mild to moderate bleeding tendency in most cases, severe bleeding and blood loss may occur unexpectedly in trauma and surgery. Diagnosis of VWD and PD often remains difficult owing to the wide spectrum of clinical and laboratory manifestations. Platelet-type von Willebrand disease (PT-VWD) is frequently misdiagnosed as type 2B VWD. Discrimination between type 2B VWD and PT-VWD is crucial as treatment differs. A literature review revealed difficulties in diagnostic work-up and choice of optimal treatment of PT-VWD. Guidelines favour the therapeutic use of platelet concentrates. A telephone survey of diagnostic practice with regard to type 2B VWD/PT-VWD was conducted. The prevalence and incidence of type 2B and PT-VWD remained unclear, but PT-VWD may be underestimated. An international study estimated that PT-VWD constitutes up to 15% of the total number of patients diagnosed with type 2B VWD. Our survey confirmed difficulties with diagnosis and showed that some centres did not exclude PT-VWD in type 2B patients. Some authors emphasize that genetic testing is the gold standard for diagnosis, but functional testing allows immediate diagnosis. Due to the important therapeutic implications we suggest that type 2B VWD be confirmed by genetic testing and that in case of a negative result PT-VWD should be excluded. PT-VWD should be excluded in all suspected cases of type 2B. PT-VWD should be treated with platelet concentrates. © Georg Thieme Verlag KG Stuttgart · New York.

Characterization of an entomopathogenic fungi target integument protein, Bombyx mori single domain von Willebrand factor type C, in the silkworm, Bombyx mori.

Science.gov (United States)

Han, F; Lu, A; Yuan, Y; Huang, W; Beerntsen, B T; Huang, J; Ling, E

2017-06-01

The insect cuticle works as the first line of defence to protect insects from pathogenic infections and water evaporation. However, the old cuticle must be shed in order to enter the next developmental stage. During each ecdysis, moulting fluids are produced and secreted into the area among the old and new cuticles. In a previous study, the protein Bombyx mori single domain von Willebrand factor type C (BmSVWC; BGIBMGA011399) was identified in the moulting fluids of Bo. mori and demonstrated to regulate ecdysis. In this study we show that in Bo. mori larvae, BmSVWC primarily locates to the integument (epidermal cells and cuticle), wing discs and head. During the moulting stage, BmSVWC is released into the moulting fluids, and is then produced again by epidermal cells after ecdysis. Fungal infection was shown to decrease the amount of BmSVWC in the cuticle, which indicates that BmSVWC is a target protein of entomopathogenic fungi. Thus, BmSVWC is mainly involved in maintaining the integrity of the integument structure, which serves to protect insects from physical damage and pathogenic infection. © 2017 The Royal Entomological Society.

Neutrophil Protease Cleavage of Von Willebrand Factor in Glomeruli – An Anti-thrombotic Mechanism in the Kidney

Directory of Open Access Journals (Sweden)

Ramesh Tati

2017-02-01

Full Text Available Adequate cleavage of von Willebrand factor (VWF prevents formation of thrombi. ADAMTS13 is the main VWF-cleaving protease and its deficiency results in development of thrombotic microangiopathy. Besides ADAMTS13 other proteases may also possess VWF-cleaving activity, but their physiological importance in preventing thrombus formation is unknown. This study investigated if, and which, proteases could cleave VWF in the glomerulus. The content of the glomerular basement membrane (GBM was studied as a reflection of processes occurring in the subendothelial glomerular space. VWF was incubated with human GBMs and VWF cleavage was assessed by multimer structure analysis, immunoblotting and mass spectrometry. VWF was cleaved into the smallest multimers by the GBM, which contained ADAMTS13 as well as neutrophil proteases, elastase, proteinase 3 (PR3, cathepsin-G and matrix-metalloproteinase 9. The most potent components of the GBM capable of VWF cleavage were in the serine protease or metalloprotease category, but not ADAMTS13. Neutralization of neutrophil serine proteases inhibited GBM-mediated VWF-cleaving activity, demonstrating a marked contribution of elastase and/or PR3. VWF-platelet strings formed on the surface of primary glomerular endothelial cells, in a perfusion system, were cleaved by both elastase and the GBM, a process blocked by elastase inhibitor. Ultramorphological studies of the human kidney demonstrated neutrophils releasing elastase into the GBM. Neutrophil proteases may contribute to VWF cleavage within the subendothelium, adjacent to the GBM, and thus regulate thrombus size. This anti-thrombotic mechanism would protect the normal kidney during inflammation and could also explain why most patients with ADAMTS13 deficiency do not develop severe kidney failure.

Protéolyse du facteur Willebrand et cardiopathies à forces de cisaillement élevées : nouvelles approches diagnostiques et thérapeutiques

OpenAIRE

Rauch , Antoine

2014-01-01

In the first part of the thesis, we describe a novel approach based on antibody-based therapy to prevent the acquired von Willebrand factor (VWF) degradation observed in continuous-flow mechanical circulatory assist device therapy. Via a murine monoclonal antibody directed against VWF D4 domain and thus interfering with VWF-ADAMTS13 binding, a partial inhibition of VWF degradation is observed in whole blood using an ex vivo circulatory assist device model. In the second part of the thesis, we...

Identification and characterization of a novel P2Y 12 variant in a patient diagnosed with type 1 von Willebrand disease in the European MCMDM-1VWD study.

Science.gov (United States)

Daly, Martina E; Dawood, Ban B; Lester, William A; Peake, Ian R; Rodeghiero, Francesco; Goodeve, Anne C; Makris, Michael; Wilde, Jonathan T; Mumford, Andrew D; Watson, Stephen P; Mundell, Stuart J

2009-04-23

We investigated whether defects in the P2Y(12) ADP receptor gene (P2RY12) contribute to the bleeding tendency in 92 index cases enrolled in the European MCMDM-1VWD study. A heterozygous mutation, predicting a lysine to glutamate (K174E) substitution in P2Y(12), was identified in one case with mild type 1 von Willebrand disease (VWD) and a VWF defect. Platelets from the index case and relatives carrying the K174E defect changed shape in response to ADP, but showed reduced and reversible aggregation in response to 10 muM ADP, unlike the maximal, sustained aggregation observed in controls. The reduced response was associated with an approximate 50% reduction in binding of [(3)H]2MeS-ADP to P2Y(12), whereas binding to the P2Y(1) receptor was normal. A hemagglutinin-tagged K174E P2Y(12) variant showed surface expression in CHO cells, markedly reduced binding to [(3)H]2MeS-ADP, and minimal ADP-mediated inhibition of forskolin-induced adenylyl cyclase activity. Our results provide further evidence for locus heterogeneity in type 1 VWD.

Bleeding spectrum in children with moderate or severe von Willebrand disease: Relevance of pediatric-specific bleeding

NARCIS (Netherlands)

Sanders, Yvonne V.; Fijnvandraat, Karin; Boender, Johan; Mauser-Bunschoten, Evelien P.; van der Bom, Johanna G.; de Meris, Joke; Smiers, Frans J.; Granzen, Bernd; Brons, Paul; Tamminga, Rienk Y. J.; Cnossen, Marjon H.; Leebeek, Frank W. G.

2015-01-01

The bleeding phenotype of children with von Willebrand disease (VWD) needs to be characterized in detail to facilitate diagnosis during childhood and aid in the planning and assessment of treatment strategies. The objective was to evaluate the occurrence, type, and severity of bleeding in a large

Thalidomide for treatment of gastrointestinal bleedings due to angiodysplasia : a case report in acquired von Willebrand syndrome and review of the literature

NARCIS (Netherlands)

Engelen, E T; van Galen, K P M; Schutgens, R E G

INTRODUCTION: Acquired von Willebrand syndrome is a rare bleeding disorder and treatment of the associated gastrointestinal (GI) bleeding due to angiodysplasia is challenging. AIM: The aim of this study was to present a new case on the successful use of thalidomide in a patient with acquired von

Successful Ultrasound-Guided Femoral Nerve Blockade and Catheterization in a Patient with Von Willebrand Disease

Directory of Open Access Journals (Sweden)

Youmna E. DiStefano

2015-01-01

Full Text Available Peripheral nerve blockade (PNB is superior to neuraxial anesthesia and/or opioid therapy for perioperative analgesia in total knee replacement (TKR. Evidence on the safety of PNB in patients with coagulopathy is lacking. We describe the first documented account of continuous femoral PNB for perioperative analgesia in a patient with Von Willebrand Disease (vWD. Given her history of opioid tolerance and after an informative discussion, a continuous femoral PNB was planned for in this 34-year-old female undergoing TKR. A Humate-P intravenous infusion was started and the patient was positioned supinely. Using sterile technique with ultrasound guidance, a Contiplex 18 Gauge Tuohy needle was advanced in plane through the fascia iliaca towards the femoral nerve. A nerve catheter was threaded through the needle and secured without complications. Postoperatively, a levobupivacaine femoral catheter infusion was maintained, and twice daily Humate-P intravenous infusions were administered for 48 hours; enoxaparin thromboprophylaxis was initiated thereafter. The patient was discharged uneventfully on postoperative day 4. Given documentation of delayed, unheralded bleeding from PNB in coagulopathic patients, we recommend individualized PNB in vWD patients. Multidisciplinary team involvement is required to guide factor supplementation and thromboprophylaxis, as is close follow-up to elicit signs of bleeding throughout the delayed postoperative period.

Cyclical thrombocytosis, acquired von Willebrand syndrome and aggressive non-melanoma skin cancers are common in patients with Philadelphia-negative myeloproliferative neoplasms treated with hydroxyurea.

Science.gov (United States)

Verner, Emma; Forsyth, Cecily; Grigg, Andrew

2014-05-01

Abstract Cyclical thrombocytosis, acquired von Willebrand syndrome, aggressive non-melanoma skin cancers and other hydroxyurea complications have been reported in Philadelphia-negative myeloproliferative neoplasms (MPNs), but their incidence and clinical consequences have not been defined in a large cohort of patients. We conducted a retrospective analysis of 188 consecutive patients with MPNs specifically addressing the incidence of these complications. Cyclical thrombocytosis was documented in 29 patients (15%), the majority of whom were receiving hydroxyurea. Acquired von Willebrand syndrome was identified in 17 of the 84 screened patients (20%), but was not associated with any major bleeding complications. Non-melanoma skin cancers were reported in 51 patients (27%). Hydroxyurea-related fever occurred in nine of 149 patients (6%) who received hydroxyurea. Seventy-three patients (39%) experienced a total of 98 major thrombotic events, with the majority of these occurring prior to or within 3 months of the diagnosis. Cyclical thrombocytosis, acquired von Willebrand syndrome, aggressive non-melanoma skin cancers and other hydroxyurea-related complications are not infrequent in MPNs and have important clinical consequences for management.

Joint assessment in von Willebrand disease : Validation of the Haemophilia Joint Health score and Haemophilia Activities List

NARCIS (Netherlands)

van Galen, Karin P. M.; Timmer, Merel A.; de Kleijn, Piet; Fischer, Kathelijn; Foppen, Wouter; Schutgens, Roger E. G.; Eikenboom, Jeroen; Meijer, Karina; Cnossen, Marjon H.; Fijnvandraat, Karin; van der Bom, Johanna G.; Laros-van Gorkom, Britta A. P.; Leebeek, Frank W. G.; Mauser-Bunschoten, Eveline P.

Assessment of clinical outcome after joint bleeding is essential to identify joint damage and optimise treatment, to prevent disability. However, disease-specific tools to assess the musculoskeletal status in patients with von Willebrand disease (VWD) are lacking. We aimed to determine validity and

Decreased plasma ADAMTS-13 activity as a predictor of postoperative bleeding in cyanotic congenital heart disease

Directory of Open Access Journals (Sweden)

Rosangela P.S. Soares

2013-04-01

Full Text Available OBJECTIVE: To analyze the preoperative plasma antigenic concentration and activity of von Willebrand factor and its main cleaving protease ADAMTS-13 in pediatric patients with cyanotic congenital heart disease undergoing surgical treatment and investigate possible correlations with postoperative bleeding. METHODS: Plasma antigenic concentrations (von Willebrand factor:Ag and ADAMTS-13:Ag were measured using enzyme-linked immunoassays. Collagen-binding assays were developed to measure biological activities (von Willebrand factor:collagen binding and ADAMTS-13 activity. The multimeric structure of von Willebrand factor was analyzed using Western immunoblotting. Demographic, diagnostic, and general and specific laboratory data and surgery-related variables were subjected to univariate, bivariate, and multivariate analysis for the prediction of postoperative bleeding. RESULTS: Forty-eight patients were enrolled, with ages ranging from 9 months to 7.6 years (median 2.5 years. The plasma concentrations of von Willebrand factor:Ag and ADAMTS-13:Ag were decreased by 65 and 82%, respectively, in the patients compared with the controls (p<0.001. An increased density of low-molecular-weight fractions of von Willebrand factor, which are suggestive of proteolytic degradation (p = 0.0081, was associated with decreased ADAMTS-13 activity, which was likely due to ADAMTS-13 consumption (71% of controls, p = 0.0029 and decreased von Willebrand factor:collagen binding (76% of controls, p = 0.0004. Significant postoperative bleeding occurred in 13 patients. The preoperative ADAMTS-13 activity of <64.6% (mean level for the group, preoperative activated partial thromboplastin time, and the need for cardiopulmonary bypass were characterized as independent risk factors for postoperative bleeding, with respective hazard ratios of 22.35 (95% CI 1.69 to 294.79, 1.096 (95% CI 1.016 to 1.183, and 37.43 (95% CI 1.79 to 782.73. CONCLUSION: Low plasma ADAMTS-13

Expression of connective tissue growth factor (CTGF/CCN2) in breast cancer cells is associated with increased migration and angiogenesis.

Science.gov (United States)

Chien, Wenwen; O'Kelly, James; Lu, Daning; Leiter, Amanda; Sohn, Julia; Yin, Dong; Karlan, Beth; Vadgama, Jay; Lyons, Karen M; Koeffler, H Phillip

2011-06-01

Connective tissue growth factor (CTGF/CCN2) belongs to the CCN family of matricellular proteins, comprising Cyr61, CTGF, NovH and WISP1-3. The CCN proteins contain an N-terminal signal peptide followed by four conserved domains sharing sequence similarities with the insulin-like growth factor binding proteins, von Willebrand factor type C repeat, thrombospondin type 1 repeat, and a C-terminal growth factor cysteine knot domain. To investigate the role of CCN2 in breast cancer, we transfected MCF-7 cells with full-length CCN2, and with four mutant constructs in which one of the domains had been deleted. MCF-7 cells stably expressing full-length CCN2 demonstrated reduced cell proliferation, increased migration in Boyden chamber assays and promoted angiogenesis in chorioallantoic membrane assays compared to control cells. Deletion of the C-terminal cysteine knot domain, but not of any other domain-deleted mutants, abolished activities mediated by full-length CCN2. We have dissected the role of CCN2 in breast tumorigenesis on a structural basis.

Epidemiologic features of von Willebrand's disease in Doberman pinschers, Scottish terriers, and Shetland sheepdogs: 260 cases (1984-1988)

Science.gov (United States)

Brooks, M; Dodds, W J; Raymond, S L

1992-04-15

During a study period from 1985 through 1988, plasma von Willebrand's factor antigen (vWF:Ag) concentration was measured as a marker for prevalence of the von Willebrand's disease (vWD) trait in Doberman Pinschers (doberman, n = 5,554), Scottish Terriers (scottie, n = 1,363), and Shetland Sheepdogs (sheltie, n = 4,279). Significant increase in prevalence of the trait was seen in scotties and shelties during this period. In 1988, 73% of dobermans, 30% of scotties, and 28% of shelties tested had abnormal vWF:Ag concentration (less than 50% vWF:Ag). We found significant differences between breeds with respect to age and vWF:Ag concentration of clinically affected dogs at time of diagnosis. The affected dobermans were older (doberman mean age, 4.6 years; scottie mean age, 1.7 years; sheltie mean age, 1.9 years) and had higher concentration of plasma vWF:Ag (doberman mean vWF:Ag, 15%; scottie mean vWF:Ag, 0%; sheltie mean vWF:Ag, 8%). Bleeding in affected dogs of all 3 breeds was observed predominantly from mucosal surfaces and from cutaneous sites of surgery or trauma. The most common site of mucosal bleeding in scotties and shelties was oral or nasal cavity, and in dobermans was the urogenital tract. Differences in clinical manifestations of vWD in purebred dogs may reflect heterogeneous defects within the vWF gene, causing a variety of abnormalities in production, structure, and function of vWF protein. Analogous to vWD in human beings, acquired deficiencies of vWF may also contribute to the clinical variability of vWD in dogs.

Trp[superscript 2313]-His[superscript 2315] of Factor VIII C2 Domain Is Involved in Membrane Binding Structure of a Complex Between the C[subscript 2] Domain and an Inhibitor of Membrane Binding

Energy Technology Data Exchange (ETDEWEB)

Liu, Zhuo; Lin, Lin; Yuan, Cai; Nicolaes, Gerry A.F.; Chen, Liqing; Meehan, Edward J.; Furie, Bruce; Furie, Barbara; Huang, Mingdong (Harvard-Med); (UAH); (Maastricht); (Chinese Aca. Sci.)

2010-11-03

Factor VIII (FVIII) plays a critical role in blood coagulation by forming the tenase complex with factor IXa and calcium ions on a membrane surface containing negatively charged phospholipids. The tenase complex activates factor X during blood coagulation. The carboxyl-terminal C2 domain of FVIII is the main membrane-binding and von Willebrand factor-binding region of the protein. Mutations of FVIII cause hemophilia A, whereas elevation of FVIII activity is a risk factor for thromboembolic diseases. The C2 domain-membrane interaction has been proposed as a target of intervention for regulation of blood coagulation. A number of molecules that interrupt FVIII or factor V (FV) binding to cell membranes have been identified through high throughput screening or structure-based design. We report crystal structures of the FVIII C2 domain under three new crystallization conditions, and a high resolution (1.15 {angstrom}) crystal structure of the FVIII C2 domain bound to a small molecular inhibitor. The latter structure shows that the inhibitor binds to the surface of an exposed {beta}-strand of the C2 domain, Trp{sup 2313}-His{sup 2315}. This result indicates that the Trp{sup 2313}-His{sup 2315} segment is an important constituent of the membrane-binding motif and provides a model to understand the molecular mechanism of the C2 domain membrane interaction.

Cloning of the cDNA for murine von Willebrand factor and identification of orthologous genes reveals the extent of conservation among diverse species.

Science.gov (United States)

Chitta, Mohan S; Duhé, Roy J; Kermode, John C

2007-05-01

Interaction of von Willebrand factor (VWF) with circulating platelets promotes hemostasis when a blood vessel is injured. The A1 domain of VWF is responsible for the initial interaction with platelets and is well conserved among species. Knowledge of the cDNA and genomic DNA sequences for human VWF allowed us to predict the cDNA sequence for murine VWF in silico and amplify its entire coding region by RT-PCR. The murine VWF cDNA has an open reading frame of 8,442 bp, encoding a protein of 2,813 amino acid residues with 83% identity to human pre-pro-VWF. The same strategy was used to predict in silico the cDNA sequence for the ortholog of VWF in a further six species. Many of these predictions diverged substantially from the putative Reference Sequences derived by ab initio methods. Our predicted sequences indicated that the VWF gene has a conserved structure of 52 exons in all seven mammalian species examined, as well as in the chicken. There is a minor structural variation in the pufferfish Takifugu rubripes insofar as the VWF gene in this species has 53 exons. Comparison of the translated amino acid sequences also revealed a high degree of conservation. In particular, the cysteine residues are conserved precisely throughout both the pro-peptide and the mature VWF sequence in all species, with a minor exception in the pufferfish VWF ortholog where two adjacent cysteine residues are omitted. The marked conservation of cysteine residues emphasizes the importance of the intricate pattern of disulfide bonds in governing the structure of pro-VWF and regulating the function of the mature VWF protein. It should also be emphasized that many of the conserved features of the VWF gene and protein were obscured when the comparison among species was based on the putative Reference Sequences instead of our predicted cDNA sequences.

Storage and regulated secretion of factor VIII in blood outgrowth endothelial cells

NARCIS (Netherlands)

van den Biggelaar, M.; Bouwens, E.A.M.; Kootstra, N.A.; Hebbel, R.P.; Voorberg, J.; Mertens, K.

2009-01-01

Background Gene therapy provides an attractive alternative for protein replacement therapy in hemophilia A patients. Recent studies have shown the potential benefit of directing factor (F)VIII gene delivery to cells that also express its natural carrier protein von Willebrand factor (VWF). In this

Storage and regulated secretion of factor VIII in blood outgrowth endothelial cells

NARCIS (Netherlands)

van den Biggelaar, Maartje; Bouwens, Eveline A. M.; Kootstra, Neeltje A.; Hebbel, Robert P.; Voorberg, Jan; Mertens, Koen

2009-01-01

Gene therapy provides an attractive alternative for protein replacement therapy in hemophilia A patients. Recent studies have shown the potential benefit of directing factor (F)VIII gene delivery to cells that also express its natural carrier protein von Willebrand factor (VWF). In this study, we

Elevated levels of von Willebrand factor and high mobility group box 1 (HMGB1) are associated with disease severity and clinical outcome of scrub typhus.

Science.gov (United States)

Chen, Hongliu; Ning, Zong; Qiu, Ying; Liao, Yuanli; Chang, Haihua; Ai, Yuanyuan; Wei, Yinghua; Deng, Yiming; Shen, Ying

2017-08-01

This study aimed to investigate whether von Willebrand factor (vWF) and high mobility group box 1 (HMGB1) are associated with the severity and clinical outcome of scrub typhus and to seek novel biomarkers for surveillance and prediction of the prognosis of this infection. Serum concentrations of vWF and HMGB1 were measured twice by ELISA for scrub typhus patients (n=103), once prior to doxycycline therapy and then on day 7 of doxycycline therapy; concentrations were measured once for healthy controls (n=32). Among the total 103 patients enrolled, 38 had disease complicated by multiple organ dysfunction syndrome (MODS). Serum concentrations of vWF and HMGB1 were significantly higher in all the patients than in the healthy controls, both prior to doxycycline treatment and on day 7 of doxycycline treatment (pscrub typhus (area under the curve (AUC)=0.864, p=0.001, and AUC=0.862, p=0.001, respectively). Elevated levels of vWF and HMGB1 are associated with the severity and clinical outcome of scrub typhus. These represent possible new biomarkers for use in the assessment and prognostic prediction of this infection. Copyright © 2017 The Author(s). Published by Elsevier Ltd.. All rights reserved.

The Carmat Bioprosthetic Total Artificial Heart Is Associated With Early Hemostatic Recovery and no Acquired von Willebrand Syndrome in Calves.

Science.gov (United States)

Smadja, David M; Susen, Sophie; Rauch, Antoine; Cholley, Bernard; Latrémouille, Christian; Duveau, Daniel; Zilberstein, Luca; Méléard, Denis; Boughenou, Marie-Fazia; Belle, Eric Van; Gaussem, Pascale; Capel, Antoine; Jansen, Piet; Carpentier, Alain

2017-10-01

To determine hemostasis perturbations, including von Willebrand factor (VWF) multimers, after implantation of a new bioprosthetic and pulsatile total artificial heart (TAH). Preclinical study SETTING: Single-center biosurgical research laboratory. Female Charolais calves, 2-to-6 months old, weighing 102-to-122 kg. Surgical implantation of TAH through a mid-sternotomy approach. Four of 12 calves had a support duration of several days (4, 4, 8, and 10 days), allowing for the exploration of early steps of hemostasis parameters, including prothrombin time; coagulation factor levels (II, V, VII+X, and fibrinogen); and platelet count. Multimeric analysis of VWF was performed to detect a potential loss of high-molecular weight (HMW) multimers, as previously described for continuous flow rotary blood pumps. Despite the absence of anticoagulant treatment administered in the postoperative phase, no signs of coagulation activation were detected. Indeed, after an immediate postsurgery decrease of prothrombin time, platelet count, and coagulation factor levels, most parameters returned to baseline values. HMW multimers of VWF remained stable either after initiation or during days of support. Coagulation parameters and platelet count recovery in the postoperative phase of the Carmat TAH (Camat SA, Velizy Villacoublay Cedex, France) implantation in calves, in the absence of anticoagulant treatment and associated with the absence of decrease in HMW multimers of VWF, is in line with early hemocompatibility that is currently being validated in human clinical studies. Copyright © 2017 Elsevier Inc. All rights reserved.

Assembly and activation of alternative complement components on endothelial cell-anchored ultra-large von Willebrand factor links complement and hemostasis-thrombosis.

Directory of Open Access Journals (Sweden)

Nancy A Turner

Full Text Available Vascular endothelial cells (ECs express and release protein components of the complement pathways, as well as secreting and anchoring ultra-large von Willebrand factor (ULVWF multimers in long string-like structures that initiate platelet adhesion during hemostasis and thrombosis. The alternative complement pathway (AP is an important non-antibody-requiring host defense system. Thrombotic microangiopathies can be associated with defective regulation of the AP (atypical hemolytic-uremic syndrome or with inadequate cleavage by ADAMTS-13 of ULVWF multimeric strings secreted by/anchored to ECs (thrombotic thrombocytopenic purpura. Our goal was to determine if EC-anchored ULVWF strings caused the assembly and activation of AP components, thereby linking two essential defense mechanisms.We quantified gene expression of these complement components in cultured human umbilical vein endothelial cells (HUVECs by real-time PCR: C3 and C5; complement factor (CF B, CFD, CFP, CFH and CFI of the AP; and C4 of the classical and lectin (but not alternative complement pathways. We used fluorescent microscopy, monospecific antibodies against complement components, fluorescent secondary antibodies, and the analysis of >150 images to quantify the attachment of HUVEC-released complement proteins to ULVWF strings secreted by, and anchored to, the HUVECs (under conditions of ADAMTS-13 inhibition. We found that HUVEC-released C4 did not attach to ULVWF strings, ruling out activation of the classical and lectin pathways by the strings. In contrast, C3, FB, FD, FP and C5, FH and FI attached to ULVWF strings in quantitative patterns consistent with assembly of the AP components into active complexes. This was verified when non-functional FB blocked the formation of AP C3 convertase complexes (C3bBb on ULVWF strings.AP components are assembled and activated on EC-secreted/anchored ULVWF multimeric strings. Our findings provide one possible molecular mechanism for clinical

Effects of coagulation factors and inflammatory cytokines on ...

African Journals Online (AJOL)

Tropical Journal of Pharmaceutical Research April 2016; 15 (4): 827-831. ISSN: 1596-5996 (print); ... fibrinogen (Fg) and von Willebrand factor (vWF) in plasma were analyzed by enzyme-linked ... determined by Western blot analysis. Inflammatory ... Currently, coronary heart disease (CHD) has become one .... membrane.

A case of von Willebrand disease discovered during treatment of a sacral pressure ulcer.

Science.gov (United States)

Murakami, Masahiro; Fukaya, Sumiko; Furuya, Masaichi; Hyakusoku, Hiko

2010-12-01

A sacral pressure ulcer developed in a patient hospitalized for cerebral infarction. Each time necrotic tissue was debrided from the ulcer, pressure hemostasis was necessary to stop the bleeding. As treatment continued, the pressure required to stop the bleeding caused the ulcer to worsen, leading to a downward spiral in the patient's condition. While trying to determine the cause of this problem, we discovered that the patient had von Willebrand disease. Medication controlled the bleeding, and the pressure ulcer began to heal at the same time. It was clear to us that conservative treatment would lead to a complete cure but that the healing process would take a long time and require continued administration of an expensive drug. We decided, therefore, to close the wound with a fasciocutaneous flap so that the patient could be quickly transferred to a rehabilitation hospital. About 1 month after surgery, epithelialization was complete, we were able to discontinue medication, and the patient was discharged. This experience demonstrates the importance of determining the cause of any deviation from the normal course of healing in pressure ulcers. It also indicates that the use of fasciocutaneous flaps, which involve little intraoperative bleeding in short surgeries, is appropriate in cases like this one.

Vascular endothelial cell function and cardiovascular risk factors in patients with chronic renal failure

DEFF Research Database (Denmark)

Haaber, A B; Eidemak, I; Jensen, T

1995-01-01

Cardiovascular risk factors and markers of endothelial cell function were studied in nondiabetic patients with mild to moderate chronic renal failure. The transcapillary escape rate of albumin and the plasma concentrations of von Willebrand factor, fibrinogen, and plasma lipids were measured in 29...

Factor VIII and von Willebrand factor co-delivery by endothelial cells

NARCIS (Netherlands)

Bouwens, E.A.M.|info:eu-repo/dai/nl/314061894

2011-01-01

A defect in coagulation factor VIII (FVIII) results in the inherited bleeding disorder hemophilia A. Current treatment of hemophilia A is hampered by the need of frequent administration of costly FVIII products. Therefore gene therapy is an attractive alternative for protein replacement to treat

Haemodynamic responses and changes of haemostatic risk factors in cold-adapted humans.

Science.gov (United States)

De Lorenzo, F; Kadziola, Z; Mukherjee, M; Saba, N; Kakkar, V V

1999-09-01

Epidemiological studies have shown an increase in acute myocardial infarctions or deaths due to myocardial infarction in colder weather; the mechanisms most likely involve increased blood levels of haemostatic risk factors, and increases in arterial blood pressure and heart rate. We studied the relationship between cold adaptation, haemostatic risk factors and haemodynamic variables. Cold adaptation was obtained by a programme of immersion of the whole body up to the neck in a water-filled bath, the temperature of which was gradually decreased from 22 degrees C to 14 degrees C, time of exposure being increased from 5 to 20 min over a period of 90 days. We studied 428 patients (44% men) and measured blood levels of fibrinogen, plasminogen activator inhibitor 1 (PAI-1), tissue plasminogen activator antigen (t-PA), plasma viscosity, von Willebrand factor, D-dimer and platelet count, both at baseline and after 90 days of daily immersion. There were significant reductions in von Willebrand factor (-3%; p cold adaptation (-310; p = 0.004). Cold adaptation, compared with exposure to cold weather, induces different haemodynamic responses and changes of blood levels of haemostatic risk factors.

Influence of atrial fibrillation on plasma von willebrand factor, soluble E-selectin, and N-terminal pro B-type natriuretic peptide levels in systolic heart failure.

Science.gov (United States)

Freestone, Bethan; Gustafsson, Finn; Chong, Aun Yeong; Corell, Pernille; Kistorp, Caroline; Hildebrandt, Per; Lip, Gregory Y H

2008-05-01

Endothelial dysfunction is present in patients with heart failure (HF) due to left ventricular systolic dysfunction, as well as in patients with atrial fibrillation (AF) who have normal cardiac function. It is unknown whether AF influences the degree of endothelial dysfunction in patients with systolic HF. We measured levels of plasma von Willebrand factor (vWF) and E-selectin (as indexes of endothelial damage/dysfunction and endothelial activation, respectively; both enzyme-linked immunosorbent assay) in patients with AF and HF (AF-HF), who were compared to patients with sinus rhythm and HF (SR-HF), as well as in age-matched, healthy, control subjects. We also assessed the relationship of vWF and E-selectin to plasma N-terminal pro B-type natriuretic peptide (NTpro-BNP), a marker for HF severity and prognosis. One hundred ninety patients (73% men; mean age, 69.0 +/- 10.1 years [+/- SD]) with systolic HF were studied, who were compared to 117 healthy control subjects: 52 subjects (27%) were in AF, while 138 subjects (73%) were in sinus rhythm. AF-HF patients were older than SR-HF patients (p = 0.046), but left ventricular ejection fraction and New York Heart Association class were similar. There were significant differences in NT-proBNP (p NT-proBNP (p NT-proBNP levels (Spearman r = 0.139; p = 0.017). There is evidence of greater endothelial damage/dysfunction in AF-HF patients when compared to SR-HF patients. The clinical significance of this is unclear but may have prognostic value.

von Willebrand Factor Test

Science.gov (United States)

... with infections, inflammation, trauma, and with physical and emotional stressors. They are also increased with pregnancy and with the use of estrogen medications such as oral contraceptives. Is there anything else I should know? A ...

Incidence and risk factors of bleeding-related adverse events in patients with chronic lymphocytic leukemia treated with ibrutinib

Science.gov (United States)

Lipsky, Andrew H.; Farooqui, Mohammed Z.H.; Tian, Xin; Martyr, Sabrina; Cullinane, Ann M.; Nghiem, Khanh; Sun, Clare; Valdez, Janet; Niemann, Carsten U.; Herman, Sarah E. M.; Saba, Nakhle; Soto, Susan; Marti, Gerald; Uzel, Gulbu; Holland, Steve M.; Lozier, Jay N.; Wiestner, Adrian

2015-01-01

Ibrutinib is associated with bleeding-related adverse events of grade ≤2 in severity, and infrequently with grade ≥3 events. To investigate the mechanisms of bleeding and identify patients at risk, we prospectively assessed platelet function and coagulation factors in our investigator-initiated trial of single-agent ibrutinib for chronic lymphocytic leukemia. At a median follow-up of 24 months we recorded grade ≤2 bleeding-related adverse events in 55% of 85 patients. No grade ≥3 events occurred. Median time to event was 49 days. The cumulative incidence of an event plateaued by 6 months, suggesting that the risk of bleeding decreases with continued therapy. At baseline, von Willebrand factor and factor VIII levels were often high and normalized on treatment. Platelet function measured via the platelet function analyzer (PFA-100™) was impaired in 22 patients at baseline and in an additional 19 patients on ibrutinib (often transiently). Collagen and adenosine diphosphate induced platelet aggregation was tested using whole blood aggregometry. Compared to normal controls, response to both agonists was decreased in all patients with chronic lymphocytic leukemia, whether on ibrutinib or not. Compared to untreated chronic lymphocytic leukemia patients, response to collagen showed a mild further decrement on ibrutinib, while response to adenosine diphosphate improved. All parameters associated with a significantly increased risk of bleeding-related events were present at baseline, including prolonged epinephrine closure time (HR 2.74, P=0.012), lower levels of von Willebrand factor activity (HR 2.73, P=0.009) and factor VIII (HR 3.73, P=0.0004). In conclusion, both disease and treatment-related factors influence the risk of bleeding. Patients at greater risk for bleeding of grade ≤2 can be identified by clinical laboratory tests and counseled to avoid aspirin, non-steroidal anti-inflammatory drugs and fish oils. ClinicalTrials.gov identifier NCT01500733 PMID

Molecular modelling of the Norrie disease protein predicts a cystine knot growth factor tertiary structure.

Science.gov (United States)

Meitinger, T; Meindl, A; Bork, P; Rost, B; Sander, C; Haasemann, M; Murken, J

1993-12-01

The X-lined gene for Norrie disease, which is characterized by blindness, deafness and mental retardation has been cloned recently. This gene has been thought to code for a putative extracellular factor; its predicted amino acid sequence is homologous to the C-terminal domain of diverse extracellular proteins. Sequence pattern searches and three-dimensional modelling now suggest that the Norrie disease protein (NDP) has a tertiary structure similar to that of transforming growth factor beta (TGF beta). Our model identifies NDP as a member of an emerging family of growth factors containing a cystine knot motif, with direct implications for the physiological role of NDP. The model also sheds light on sequence related domains such as the C-terminal domain of mucins and of von Willebrand factor.

Generation and validation of the Condensed MCMDM-1VWD Bleeding Questionnaire for von Willebrand disease.

Science.gov (United States)

Bowman, M; Mundell, G; Grabell, J; Hopman, W M; Rapson, D; Lillicrap, D; James, P

2008-12-01

Given the challenges involved in obtaining accurate bleeding histories, attempts at standardization have occurred and the value of quantifying hemorrhagic symptoms has been recognized. An extensive validated bleeding questionnaire (MCMDM-1VWD) was condensed by eliminating all details that did not directly affect the bleeding score (BS) and the correlation between the two versions was tested. Additionally, the diagnostic utility of the condensed version was prospectively tested. Data on 259 individuals who were administered the questionnaire are presented here; 217 being prospectively investigated for von Willebrand disease (VWD) (group 1) and 42 previously known to have type 1, 2 or 3 VWD (group 2). Of the 217 prospectively investigated, 35 had positive BS (> or =4) and 182 had negative scores. Seven individuals (all with positive BS) had laboratory results consistent with type 1 VWD. This results in a sensitivity of 100% and a specificity of 87%. The positive predictive value is 0.20 and the negative predictive value is 1. The correlation between the full MCMDM-1VWD and condensed versions is excellent (Spearman's 0.97, P type 2 > type 1 VWD (anova P < 0.001). There is a strong inverse relationship between VWF:Ag level and BS (Spearman's -0.411, P < 0.001). The Condensed MCMDM-1VWD Bleeding Questionnaire is an efficient, effective tool in the evaluation of patients for VWD.

Functional characterisation of the type 1 von Willebrand disease candidate VWF gene variants: p.M771I, p.L881R and p.P1413L.

Science.gov (United States)

Berber, Ergul; Ozbil, Mehmet; Brown, Christine; Baslar, Zafer; Caglayan, S Hande; Lillicrap, David

2017-10-01

Abnormalities in the biosynthetic pathway or increased clearance of plasma von Willebrand factor (VWF) are likely to contribute to decreased plasma VWF levels in inherited type 1 von Willebrand disease (VWD). Recent studies demonstrated that 65% of type 1 VWD patients have candidate VWF mutations, the majority of which are missense variants. The purpose of this study was to explore the effects of three VWF missense mutations (p.M771I, p.L881R and p.P1413L) located in different functional domains of VWF, reported as candidate mutations in type 1 VWD patients in the course of the MCMDM-1VWD study. The focus of these studies was on the intracellular biosynthetic processing and localisation of VWF in a heterologous cell system. Molecular dynamic simulation for p.M771I and p.P1413L was also performed to analyse the conformational effects of the changes. As determined by immunofluorescence antibody staining and confocal microscopy of HEK293 cells, the intracellular localisation of recombinant VWF with the p.M771I variation was impaired. Transient transfection studies and phorbol myristate acetate stimulation in COS-7 cells revealed significant intracellular retention. In addition, major loss of VWF multimers was observed for only the p.M771I mutation. Molecular dynamic simulations on p.M771I mutant VWF revealed distinct structural rearrangements including a large deviation in the E' domain, and significant loss of β-sheet secondary structure. The pathogenic effects of candidate VWF gene mutations were explored in this study. In vitro expression studies in heterologous cell systems revealed impaired secretion of VWF and a dominant negative effect on the processing of the wild-type protein for only the p.M771I mutation and none of the mutations affected the regulated secretion.

Relationship between ADAMTS13 activity, von Willebrand factor antigen levels and platelet function in the early and late phases after TIA or ischaemic stroke.

Science.gov (United States)

McCabe, Dominick J H; Murphy, Stephen J X; Starke, Richard; Harrison, Paul; Brown, Martin M; Sidhu, Paul S; Mackie, Ian J; Scully, Marie; Machin, Samuel J

2015-01-15

Reduced ADAMTS13 activity is seen in thrombotic thrombocytopenic purpura (TTP), and may lead to accumulation of prothrombotic ultra-large von Willebrand factor (ULVWF) multimers in vivo. ADAMTS13 activity and its relationship with VWF antigen (VWF:Ag) levels and platelet function in 'non-TTP related' TIA or ischaemic stroke has not been comprehensively studied. In this prospective pilot observational analytical case-control study, ADAMTS13 activity and VWF:Ag levels were quantified in platelet poor plasma in 53 patients in the early phase (≤ 4 weeks) and 34 of these patients in the late phase (≥ 3 months) after TIA or ischaemic stroke on aspirin. Data were compared with those from 22 controls not on aspirin. The impact of ADAMTS13 on platelet function in whole blood was quantified by measuring Collagen-ADP (C-ADP) and Collagen-Epinephrine closure times on a platelet function analyser (PFA-100(®)). Median ADAMTS13 activity was significantly reduced in the early phase (71.96% vs. 95.5%, P TIA or stroke compared with controls (86.3% vs. 95.5%, P=0.19). There was a significant inverse relationship between ADAMTS13 activity and VWF:Ag levels in the early phase (r=-0.31; P=0.024), but not in the late phase after TIA or stroke (P=0.74). There was a positive correlation between ADAMTS13 activity and C-ADP closure times in early phase patients only, likely mediated via VWF:Ag levels. ADAMTS13 activity is reduced and VWF:Ag expression is increased within 4 weeks of TIA or ischaemic stroke onset, and can promote enhanced platelet adhesion and aggregation in response to stimulation with collagen and ADP via VWF-mediated pathways. These data improve our understanding of the dynamic haemostatic and thrombotic profiles of ischaemic cerebrovascular disease (CVD) patients, and are important in view of the potential future role that ADAMTS13 may have to play as an anti-thrombotic agent in CVD. Copyright © 2014 Elsevier B.V. All rights reserved.

Structural studies on B2-glycoprotein I and von Willebrand factor A3 domain

NARCIS (Netherlands)

Bouma, B.

2000-01-01

The integrity of blood circulation is a prerequisite for life; its malfunctioning is a leading cause of morbidity and mortality in developed countries. For that reason the haemostatic system is a critical component of homeostasis. In Chapter I an overview is given of the biophysical and biochemical

Endothelial dysfunction, ambulatory pulse pressure and albuminuria are associated in Type 2 diabetic subjects

DEFF Research Database (Denmark)

Knudsen, Søren Tang; Jeppesen, Peter; Frederiksen, Christian Alcaraz

2007-01-01

as three urinary albumin/creatinine ratios. Von Willebrand factor (vWF), fibrinogen, E-selectin and soluble intercellular adhesion molecule 1 (ICAM-1) were measured in plasma. RESULTS: Thirty-four patients had normoalbuminuria (group N) and 12 had micro- or macroalbuminuria (group A). PP levels increased...

Severe Plasmodium falciparum malaria is associated with circulating ultra-large von Willebrand multimers and ADAMTS13 inhibition.

LENUS (Irish Health Repository)

Larkin, Deirdre

2009-03-01

Plasmodium falciparum infection results in adhesion of infected erythrocytes to blood vessel endothelium, and acute endothelial cell activation, together with sequestration of platelets and leucocytes. We have previously shown that patients with severe infection or fulminant cerebral malaria have significantly increased circulatory levels of the adhesive glycoprotein von Willebrand factor (VWF) and its propeptide, both of which are indices of endothelial cell activation. In this prospective study of patients from Ghana with severe (n = 20) and cerebral (n = 13) P. falciparum malaria, we demonstrate that increased plasma VWF antigen (VWF:Ag) level is associated with disproportionately increased VWF function. VWF collagen binding (VWF:CB) was significantly increased in patients with cerebral malaria and severe malaria (medians 7.6 and 7.0 IU\\/ml versus 1.9 IU\\/ml; p<0.005). This increased VWF:CB correlated with the presence of abnormal ultra-large VWF multimers in patient rather than control plasmas. Concomitant with the increase in VWF:Ag and VWF:CB was a significant persistent reduction in the activity of the VWF-specific cleaving protease ADAMTS13 (approximately 55% of normal; p<0.005). Mixing studies were performed using P. falciparum patient plasma and normal pooled plasma, in the presence or absence of exogenous recombinant ADAMTS13. These studies demonstrated that in malarial plasma, ADAMTS13 function was persistently inhibited in a time-dependent manner. Furthermore, this inhibitory effect was not associated with the presence of known inhibitors of ADAMTS13 enzymatic function (interleukin-6, free haemoglobin, factor VIII or thrombospondin-1). These novel findings suggest that severe P. falciparum infection is associated with acute endothelial cell activation, abnormal circulating ULVWF multimers, and a significant reduction in plasma ADAMTS13 function which is mediated at least in part by an unidentified inhibitor.

Case report

African Journals Online (AJOL)

abp

2017-06-29

Jun 29, 2017 ... described by the Finish physician Erik von Willebrand in 1926. VWD ... on day 4 and showed normal factor IX level but factor VIII level was low at 16.6%. ... and hemophilia A or between VWD 2B and a platelet disorder.

Enhancing the 'real world' prediction of cardiovascular events and major bleeding with the CHA2DS2-VASc and HAS-BLED scores using multiple biomarkers.

Science.gov (United States)

Roldán, Vanessa; Rivera-Caravaca, José Miguel; Shantsila, Alena; García-Fernández, Amaya; Esteve-Pastor, María Asunción; Vilchez, Juan Antonio; Romera, Marta; Valdés, Mariano; Vicente, Vicente; Marín, Francisco; Lip, Gregory Y H

2018-02-01

Atrial fibrillation (AF)-European guidelines suggest the use of biomarkers to stratify patients for stroke and bleeding risks. We investigated if a multibiomarker strategy improved the predictive performance of CHA 2 DS 2 -VASc and HAS-BLED in anticoagulated AF patients. We included consecutive patients stabilized for six months on vitamin K antagonists (INRs 2.0-3.0). High sensitivity troponin T, NT-proBNP, interleukin-6, von Willebrand factor concentrations and glomerular filtration rate (eGFR; using MDRD-4 formula) were quantified at baseline. Time in therapeutic range (TTR) was recorded at six months after inclusion. Patients were follow-up during a median of 2375 (IQR 1564-2887) days and all adverse events were recorded. In 1361 patients, adding four blood biomarkers, TTR and MDRD-eGFR, the predictive value of CHA 2 DS 2 -VASc increased significantly by c-index (0.63 vs. 0.65; p = .030) and IDI (0.85%; p originals scores. Addition of biomarkers enhanced the predictive value of CHA 2 DS 2 -VASc and HAS-BLED, although the overall improvement was modest and the added predictive advantage over original scores was marginal. Key Messages Recent atrial fibrillation (AF)-European guidelines for the first time suggest the use of biomarkers to stratify patients for stroke and bleeding risks, but their usefulness in real world for risk stratification is still questionable. In this cohort study involving 1361 AF patients optimally anticoagulated with vitamin K antagonists, adding high sensitivity troponin T, N-terminal pro-B-type natriuretic peptide, interleukin 6, von Willebrand factor, glomerular filtration rate (by the MDRD-4 formula) and time in therapeutic range, increased the predictive value of CHA 2 DS 2 -VASc for cardiovascular events, but not the predictive value of HAS-BLED for major bleeding. Reclassification analyses did not show improvement adding multiple biomarkers. Despite the improvement observed, the added predictive advantage is marginal and

A Viral Nanoparticle with Dual Function as an Anthrax Antitoxin and Vaccine

Science.gov (United States)

Manayani, Darly J; Thomas, Diane; Dryden, Kelly A; Reddy, Vijay; Siladi, Marc E; Marlett, John M; Rainey, G. Jonah A; Pique, Michael E; Scobie, Heather M; Yeager, Mark; Young, John A. T; Manchester, Marianne; Schneemann, Anette

2007-01-01

The recent use of Bacillus anthracis as a bioweapon has stimulated the search for novel antitoxins and vaccines that act rapidly and with minimal adverse effects. B. anthracis produces an AB-type toxin composed of the receptor-binding moiety protective antigen (PA) and the enzymatic moieties edema factor and lethal factor. PA is a key target for both antitoxin and vaccine development. We used the icosahedral insect virus Flock House virus as a platform to display 180 copies of the high affinity, PA-binding von Willebrand A domain of the ANTXR2 cellular receptor. The chimeric virus-like particles (VLPs) correctly displayed the receptor von Willebrand A domain on their surface and inhibited lethal toxin action in in vitro and in vivo models of anthrax intoxication. Moreover, VLPs complexed with PA elicited a potent toxin-neutralizing antibody response that protected rats from anthrax lethal toxin challenge after a single immunization without adjuvant. This recombinant VLP platform represents a novel and highly effective, dually-acting reagent for treatment and protection against anthrax. PMID:17922572

Venom Concentrations and Clotting Factor Levels in a Prospective Cohort of Russell's Viper Bites with Coagulopathy.

Directory of Open Access Journals (Sweden)

Geoffrey K Isbister

Full Text Available Russell's viper envenoming is a major problem in South Asia and causes venom induced consumption coagulopathy. This study aimed to investigate the kinetics and dynamics of venom and clotting function in Russell's viper envenoming.In a prospective cohort of 146 patients with Russell's viper envenoming, we measured venom concentrations, international normalised ratio [INR], prothrombin time (PT, activated partial thromboplastin time (aPTT, coagulation factors I, II, V, VII, VIII, IX and X, and von Willebrand factor antigen. The median age was 39 y (16-82 y and 111 were male. The median peak INR was 6.8 (interquartile range [IQR]: 3.7 to >13, associated with low fibrinogen [median,3 at 6 h post-antivenom but had reduced to <2, by 24 h. The aPTT had also returned to close to normal (<50 sec at 24 h. Factor VII, VIII and IX levels were unusually high pre-antivenom, median peak concentrations of 393%, 307% and 468% respectively. Pre-antivenom venom concentrations and the INR (r = 0.20, p = 0.02 and aPTT (r = 0.19, p = 0.03 were correlated (non-parametric Spearman analysis.Russell's viper coagulopathy results in prolonged aPTT, INR, low fibrinogen, factors V, VIII and X which recover over 48 h. Severity of clotting abnormalities was associated with venom concentrations.

Acquired von Willebrand Syndrome Associated to Secondary IgM MGUS Emerging after Autologous Stem Cell Transplantation for AL Amyloidosis.

Science.gov (United States)

Qamar, Hina; Lee, Adrienne; Valentine, Karen; Skeith, Leslie; Jimenez-Zepeda, Victor H

2017-01-01

Acquired von Willebrand syndrome (AVWS) is a rare hemorrhagic disorder that occurs in patients with no prior personal or family history of bleeding. Here, we describe a case of AVWS occurring after autologous stem cell transplantation (ASCT). Interestingly, AVWS developed after bortezomib-based induction and conditioning regimens. Recent evidence suggests that the proximity of the bortezomib therapy to the collection of stem cells with consequent depletion of regulatory T cells after the conditioning regimen could explain some of the unusual autoimmune complications reported in patients receiving bortezomib prior to ASCT. In addition, this patient developed a secondary MGUS post-ASCT, which may have also contributed to the AVWS. To the best of our knowledge, this is the first case of post-ASCT AVWS reported. Prospective data is needed to better elucidate the mechanisms by which these unusual complications occur in patients receiving bortezomib prior to ASCT.

Acquired von Willebrand Syndrome associated to secondary IgM MGUS emerging after Autologous Stem Cell Transplantation for AL Amyloidosis

Directory of Open Access Journals (Sweden)

Victor H Jimenez-Zepeda

2017-05-01

Full Text Available Acquired von Willebrand syndrome (AVWS is a rare hemorrhagic disorder that occurs in patients with no prior personal or family history of bleeding. Here, we describe a case of AVWS occurring after autologous stem cell transplantation (ASCT. Interestingly, AVWS developed after bortezomib-based induction and conditioning regimens. Recent evidence suggests that the proximity of the bortezomib therapy to the collection of stem cells with consequent depletion of regulatory T cells after the conditioning regimen could explain some of the unusual autoimmune complications reported in patients receiving bortezomib prior to ASCT. In addition, this patient developed a secondary MGUS post-ASCT, which may have also contributed to the AVWS. To the best of our knowledge, this is the first case of post-ASCT AVWS reported. Prospective data is needed to better elucidate the mechanisms by which these unusual complications occur in patients receiving bortezomib prior to ASCT.

Cuidados nos pacientes com hemofilia e doença de von Willebrand na cirurgia eletiva otorrinolaringológica

Directory of Open Access Journals (Sweden)

Marques Marise P. C.

2003-01-01

Full Text Available FORMA DE ESTUDO Clínico prospectivo. MATERIAL E MÉTODO: Foi realizado um estudo prospectivo de 10 anos de 20 pacientes com hemofilias ou doença de von Willebrand (DvW com indicação de cirurgia otorrinolaringológica. Os pacientes foram submetidos a um total de 25 cirurgias otorrinolaringológicas eletivas. A idade média foi de 23,75 anos (2 a 62 anos. O grupo de estudo consistiu em 14 hemofílicos, 11 com hemofilia A grave (1 do sexo feminino, uma portadora com 30% de atividade de fator VIII (FVIII, um hemofílico B leve e uma com deficiência grave de fator X; 6 com DvW, 4 tinham o tipo 1 (3 mulheres, um o tipo 2A e um o tipo 3. Treze hemofílicos tinham síndrome de imunodeficiência adquirida. A duração média do procedimento foi de 1 hora e 37 minutos (15 minutos a 12 horas. O defeito da coagulação foi corrigido com desmopressina (DDAVP, com concentrado de FVIII de pureza intermediária 8Y, com criopreciptado ou com complexo protrombínico não ativado (PPSB, de acordo com os níveis plasmáticos do fator e da severidade da cirurgia. O ácido épsilon aminocapróico também foi usado em associação. Em 1 hemofílico A grave houve sangramento pós-operatório que se resolveu com a elevação do nível mínimo de FVIII para 80% e em 1 paciente com DvW do Tipo 3 houve sangramento pós-operatório pela dificuldade de identificação do melhor concentrado a ser reposto. Após o uso do concentrado de pureza intermediária 8Y, houve controle do sangramento. RESULTADO: Todos os outros pacientes apresentaram a hemostasia considerada normal ou excelente. CONCLUSÃO: Concluiu-se que pacientes com hemofilias ou DvW não apresentam um risco cirúrgico aumentado se for realizada uma terapia adequada.

A protective role of nuclear factor-erythroid 2-related factor-2 (Nrf2) in inflammatory disorders

International Nuclear Information System (INIS)

Kim, Jiyoung; Cha, Young-Nam; Surh, Young-Joon

2010-01-01

Nuclear factor-erythroid 2-related factor-2 (Nrf2) is a key transcription factor that plays a central role in cellular defense against oxidative and electrophilic insults by timely induction of antioxidative and phase-2 detoxifying enzymes and related stress-response proteins. The 5'-flanking regions of genes encoding these cytoprotective proteins contain a specific consensus sequence termed antioxidant response element (ARE) to which Nrf2 binds. Recent studies have demonstrated that Nrf2-ARE signaling is also involved in attenuating inflammation-associated pathogenesis, such as autoimmune diseases, rheumatoid arthritis, asthma, emphysema, gastritis, colitis and atherosclerosis. Thus, disruption or loss of Nrf2 signaling causes enhanced susceptibility not only to oxidative and electrophilic stresses but also to inflammatory tissue injuries. During the early-phase of inflammation-mediated tissue damage, activation of Nrf2-ARE might inhibit the production or expression of pro-inflammatory mediators including cytokines, chemokines, cell adhesion molecules, matrix metalloproteinases, cyclooxygenase-2 and inducible nitric oxide synthase. It is likely that the cytoprotective function of genes targeted by Nrf2 may cooperatively regulate the innate immune response and also repress the induction of pro-inflammatory genes. This review highlights the protective role of Nrf2 in inflammation-mediated disorders with special focus on the inflammatory signaling modulated by this redox-regulated transcription factor.

A protective role of nuclear factor-erythroid 2-related factor-2 (Nrf2) in inflammatory disorders

Energy Technology Data Exchange (ETDEWEB)

Kim, Jiyoung [National Research Laboratory, College of Pharmacy, Graduate School of Convergence Science and Technology, Seoul National University, Seoul 151-742 (Korea, Republic of); Cha, Young-Nam [Inha University College of Medicine, Incheon 382-751 (Korea, Republic of); Surh, Young-Joon, E-mail: surh@plaza.snu.ac.kr [National Research Laboratory, College of Pharmacy, Graduate School of Convergence Science and Technology, Seoul National University, Seoul 151-742 (Korea, Republic of); Department of Molecular Medicine and Biopharmaceutical Sciences, Graduate School of Convergence Science and Technology, Seoul National University, Seoul 151-742 (Korea, Republic of); Cancer Research Institute, Seoul National University, Seoul 110-799 (Korea, Republic of)

2010-08-07

Nuclear factor-erythroid 2-related factor-2 (Nrf2) is a key transcription factor that plays a central role in cellular defense against oxidative and electrophilic insults by timely induction of antioxidative and phase-2 detoxifying enzymes and related stress-response proteins. The 5'-flanking regions of genes encoding these cytoprotective proteins contain a specific consensus sequence termed antioxidant response element (ARE) to which Nrf2 binds. Recent studies have demonstrated that Nrf2-ARE signaling is also involved in attenuating inflammation-associated pathogenesis, such as autoimmune diseases, rheumatoid arthritis, asthma, emphysema, gastritis, colitis and atherosclerosis. Thus, disruption or loss of Nrf2 signaling causes enhanced susceptibility not only to oxidative and electrophilic stresses but also to inflammatory tissue injuries. During the early-phase of inflammation-mediated tissue damage, activation of Nrf2-ARE might inhibit the production or expression of pro-inflammatory mediators including cytokines, chemokines, cell adhesion molecules, matrix metalloproteinases, cyclooxygenase-2 and inducible nitric oxide synthase. It is likely that the cytoprotective function of genes targeted by Nrf2 may cooperatively regulate the innate immune response and also repress the induction of pro-inflammatory genes. This review highlights the protective role of Nrf2 in inflammation-mediated disorders with special focus on the inflammatory signaling modulated by this redox-regulated transcription factor.

Diagnosis and Treatment of Thrombotic Thrombocytopenic Purpura

African Journals Online (AJOL)

Abe Olugbenga

historical pentad of clinical features once thought to be needed to make the diagnosis include fever .... bond in the central A2 subunit of Von Willebrand Factor .... there were some catheter related and plasma ... and venous thrombosis (9).

Immunoexpression of vascular endothelial growth factor in periapical granulomas, radicular cysts, and residual radicular cysts.

Science.gov (United States)

Nonaka, Cassiano Francisco Weege; Maia, Alexandre Pinto; Nascimento, George João Ferreira do; de Almeida Freitas, Roseana; Batista de Souza, Lélia; Galvão, Hébel Cavalcanti

2008-12-01

Our aim was to assess and compare the immunoexpression of vascular endothelial growth factor (VEGF) in periapical granulomas (PGs), radicular cysts (RCs), and residual radicular cysts (RRCs), relating it to the angiogenic index and the intensity of the inflammatory infiltrate. Twenty PGs, 20 RCs, and 10 RRCs were evaluated by immunohistochemistry using anti-VEGF antibody. Angiogenic index was determined by microvessel count (MVC) using anti-von Willebrand factor antibody. The PGs and RCs showed higher expression of VEGF than the RRCs. Lesions presenting few inflammatory infiltrate revealed the lowest immunoexpression of VEGF (P .05). VEGF is present in periapical inflammatory lesions but at a lower level in RRCs. The expression of this proangiogenic factor is closely related to the intensity of the inflammatory infiltrate in these lesions.

Life-threatening subdural hematoma after aortic valve replacement in a patient with Heyde syndrome: a case report.

Science.gov (United States)

Uchida, Tetsuro; Hamasaki, Azumi; Ohba, Eiichi; Yamashita, Atsushi; Hayashi, Jun; Sadahiro, Mitsuaki

2017-08-08

Heyde syndrome is known as a triad of calcific aortic stenosis, anemia due to gastrointestinal bleeding from angiodysplasia, and acquired type 2A von Willebrand disease. This acquired hemorrhagic disorder is characterized by the loss of the large von Willebrand factor multimers due to the shear stress across the diseased aortic valve. The most frequently observed type of bleeding in these patients is mucosal or skin bleeding, such as epistaxis, followed by gastrointestinal bleeding. On the other hand, intracranial hemorrhage complicating Heyde syndrome is extremely rare. A 77-year-old woman presented to our hospital with severe aortic stenosis and severe anemia due to gastrointestinal bleeding and was diagnosed with Heyde syndrome. Although aortic valve replacement was performed without recurrent gastrointestinal bleeding, postoperative life-threatening acute subdural hematoma occurred with a marked midline shift. Despite prompt surgical evacuation of the hematoma, she did not recover consciousness and she died 1 month after the operation. Postoperative subdural hematoma is rare, but it should be kept in mind as a devastating hemorrhagic complication, especially in patients with Heyde syndrome.

Risk Factors for and Management of MPN-Associated Bleeding and Thrombosis.

Science.gov (United States)

Martin, Karlyn

2017-10-01

The Philadelphia chromosome-negative myeloproliferative neoplasms (MPN) are characterized by both thrombotic and bleeding complications. The purpose of this review is to describe the risk factors associated with bleeding and thrombosis in MPN, as well as to review prevention strategies and management of these complications. Well-described risk factors for thrombotic complications include older age and history of prior thrombosis, along with traditional cardiovascular and venous thromboembolic risk factors. More recently, JAK2 V617F mutation has been found to carry an increased risk of thrombotic complications, whereas CALR has a lower risk than JAK2 mutation. Factors associated with an increased risk of bleeding in MPN include a prior history of bleeding, acquired von Willebrand syndrome, and primary myelofibrosis. Recent findings suggest that thrombocytosis carries a higher risk of bleeding than thrombosis in MPN, and aspirin may exacerbate this risk of bleeding, particularly in CALR-mutated ET. Much of the management of MPN focuses on predicting risk of bleeding and thrombosis and initiating prophylaxis to prevent complications in those at high risk of thrombosis. Emerging evidence suggests that sub-populations may have bleeding risk that outweighs thrombotic risk, particularly in setting of antiplatelet therapy. Future work is needed to better characterize this balance. At present, a thorough assessment of the risks of bleeding and thrombosis should be undertaken for each patient, and herein, we review risk factors for and management of these complications.

Hepatocellular hypoxia-induced vascular endothelial growth factor expression and angiogenesis in experimental biliary cirrhosis.

Science.gov (United States)

Rosmorduc, O; Wendum, D; Corpechot, C; Galy, B; Sebbagh, N; Raleigh, J; Housset, C; Poupon, R

1999-10-01

We tested the potential role of vascular endothelial growth factor (VEGF) and of fibroblast growth factor-2 (FGF-2) in the angiogenesis associated with experimental liver fibrogenesis induced by common bile duct ligation in Sprague-Dawley rats. In normal rats, VEGF and FGF-2 immunoreactivities were restricted to less than 3% of hepatocytes. One week after bile duct ligation, hypoxia was demonstrated by the immunodetection of pimonidazole adducts unevenly distributed throughout the lobule. After 2 weeks, hypoxia and VEGF expression were detected in >95% of hepatocytes and coexisted with an increase in periportal vascular endothelial cell proliferation, as ascertained by Ki67 immunolabeling. Subsequently, at 3 weeks the density of von Willebrand-labeled vascular section in fibrotic areas significantly increased. Semiquantitative reverse transcription polymerase chain reaction showed that VEGF(120) and VEGF(164) transcripts, that correspond to secreted isoforms, increased within 2 weeks, while VEGF(188) transcripts remained unchanged. FGF-2 mainly consisting of a 22-kd isoform, according to Western blot, was identified by immunohistochemistry in 49% and 100% of hepatocytes at 3 and 7 weeks, respectively. Our data provide evidence that in biliary-type liver fibrogenesis, angiogenesis is stimulated primarily by VEGF in response to hepatocellular hypoxia while FGF-2 likely contributes to the maintenance of angiogenesis at later stages.

Prevalence of nucleic acid sequences specific for human parvoviruses, hepatitis A and hepatitis E viruses in coagulation factor concentrates.

Science.gov (United States)

Modrow, S; Wenzel, J J; Schimanski, S; Schwarzbeck, J; Rothe, U; Oldenburg, J; Jilg, W; Eis-Hübinger, A M

2011-05-01

Due to their high resistance to inactivation procedures, nonenveloped viruses such as parvovirus B19, human bocavirus (HBoV), human parvovirus 4 (PARV4), hepatitis A (HAV) and hepatitis E virus (HEV) pose a particular threat to blood products. Virus transmission to patients treated with blood products presents an additional burden to disease. We determined the frequency and the amount of nucleic acid specific for nonenveloped viruses in recently manufactured preparations of commercial coagulation factor concentrates. At least three different batches of each of 13 different plasma-derived and recombinant coagulation factor products were tested for the presence and the amount of nucleic acid for parvovirus B19, HBoV, human parvovirus 4, hepatitis A virus and HEV by using quantitative polymerase chain reaction. Whereas none of the recombinant products tested positive for any of these viruses, parvovirus B19 DNA with amounts ranging between 2×10(1) and 1.3×10(3) genome equivalents/ml was detected in five plasma-derived products. In addition to parvovirus B19 genotype 1, genotypes 2 and 3 were observed in two batches of a factor VIII/von-Willebrand factor product. In two products (one factor VIII concentrate and one activated prothrombin complex concentrate), a combination of both genotypes 1 and 2 of parvovirus B19 was detected. The data show that nucleic acids from several relevant nonenveloped viruses are not found at detectable levels in coagulation factor concentrates. In some cases, parvovirus B19 DNA was detectable at low levels. Testing of the plasma pools for the full range of parvovirus genotypes is advocated for ensuring product safety. © 2010 The Author(s). Vox Sanguinis © 2010 International Society of Blood Transfusion.

Renal arteriovenous fistula: A rare complication of electro-hydraulic ...

African Journals Online (AJOL)

A 62-year-old man with type 1 Von Willebrand's disease was electively admitted to a Northern Ireland district general hospital for endoscopic management of a 1 cm right lower pole calculus. After pre-operative administration of appropriate haematological factors, flexible ureteroscopic electro-hydraulic lithotripsy (EHL).

A case of refractory thrombotic thrombocytopenic purpura treated ...

African Journals Online (AJOL)

Background. Thrombotic thrombocytopenic purpura (TTP) is a rare, life-threaten- ing disorder that occurs due to deficiency of ADAMTS13 (a disintegrin and metalloproteinase with a thrombospondin type 1 motif, member. 13), which is a von Willebrand factor (VWF) cleaving protein.[1]. The absent or severely reduced activity ...

Novel targeted approaches to treating biliary tract cancer: the dual epidermal growth factor receptor and ErbB-2 tyrosine kinase inhibitor NVP-AEE788 is more efficient than the epidermal growth factor receptor inhibitors gefitinib and erlotinib.

Science.gov (United States)

Wiedmann, Marcus; Feisthammel, Jürgen; Blüthner, Thilo; Tannapfel, Andrea; Kamenz, Thomas; Kluge, Annett; Mössner, Joachim; Caca, Karel

2006-08-01

Aberrant activation of the epidermal growth factor receptor is frequently observed in neoplasia, notably in tumors of epithelial origin. Attempts to treat such tumors with epidermal growth factor receptor antagonists resulted in remarkable success in recent studies. Little is known, however, about the efficacy of this therapy in biliary tract cancer. Protein expression of epidermal growth factor receptor, ErbB-2, and vascular endothelial growth factor receptor-2 was assessed in seven human biliary tract cancer cell lines by immunoblotting. In addition, histological sections from 19 patients with extrahepatic cholangiocarcinoma were analyzed for epidermal growth factor receptor, ErbB-2 and vascular endothelial growth factor receptor-2 expression by immunohistochemistry. Moreover, we sequenced the cDNA products representing the entire epidermal growth factor receptor coding region of the seven cell lines, and searched for genomic epidermal growth factor receptor amplifications and polysomy by fluorescence in-situ hybridization. Cell growth inhibition by gefitinib erlotinib and NVP-AEE788 was studied in vitro by automated cell counting. In addition, the anti-tumoral effect of erlotinib and NVP-AEE788 was studied in a chimeric mouse model. The anti-tumoral drug mechanism in this model was assessed by MIB-1 antibody staining, terminal deoxynucleotidyl transfer-mediated dUTP nick end-labelling assay, von Willebrand factor staining, and immunoblotting for p-p42/44 (p-Erk1/2, p-MAPK) and p-AKT. Immunoblotting revealed expression of epidermal growth factor receptor, ErbB-2, and vascular endothelial growth factor receptor-2 in all biliary tract cancer cell lines. EGFR was detectable in six of 19 (32%) extrahepatic human cholangiocarcinoma tissue samples, ErbB-2 in 16 of 19 (84%), and vascular endothelial growth factor receptor-2 in nine of 19 (47%). Neither epidermal growth factor receptor mutations nor amplifications or polysomy were found in the seven biliary tract cancer

[Hemostasiological, lipidemic, and hemodynamic indicators associated with the risk of cardiovascular death in high- and very high-risk patients according to the SCORE scale].

Science.gov (United States)

Kachkovskiĭ, M A; Simerzin, V V; Rybanenko, O A; Kirichenko, N A

2014-01-01

To identify lipidemic, hemostasiological, and hemodynamic indicators associated with the risk of cardiovascular death in high- and very high-risk patients. One hundred and forty-eight patients whose mean age was 50.8 +/- 4.4 years were examined. All the patients were divided into high (1 group) and very high (2 group) cardiovascular death risk groups according to the SCORE scale. Lipid metabolism, hemostatic system parameters (fibrinogen, time of ADP-induced platelet aggregation initiation, D-dimer), endothelial dysfunction markers (von Willebrand factor), and echocardiographic findings were studied. Multivariate regression analysis showed that the odds ratio for a cardiovascular death risk was 1.8 (95% confidence interval (CI), 1.1 to 4.2; p = 0.04) in patients with a D-dimer level of greater than 1 mg/ml, 0.77 (95% CI, 0.6 to 0.97; p = 0.03) in those with an ADP-induced platelet aggregation initiation time of 13.5 sec, 1.04 (95% CI, 1.01 to 1.07; p = 0.02) in those with an end-diastolic volume of more than 123 ml, 1.1 (95% CI, 1.04 to 1.2; p = 0.003) in those with an end-diastolic dimension of more than 51 mm, 1.5 (95% CI, 1.1 to 2.0; p = 0.009) in those with a ventricular septal thickness of more than 11.5 mm, and 2.1 (95% CI, 1.03 to 3.2; p = 0.0032) in those with avon Willebrand factor level of more than 140%. The high levels of von Willebrand factor, D-dimer, ADP-induced platelet aggregation, triglycerides, end-diastolic volume, end-diastolic dimension, and ventricular septal thickness are independent predictors of cardiovascular death in very high-risk patients. These indicators bear out a close relationship between lipid metabolic and hemostatic disturbances and between endothelial dysfunction and intracardiac hemodynamic worsening in these patients.

Treatment of reperfusion injury with recombinant ADAMTS13 in a porcine model of acute myocardial infarction

NARCIS (Netherlands)

Eerenberg, E.S.; Teunissen, P.F.A.; Van Den Born, B.J.; Meijers, J.C.; Hollander, M.; Aly, M.; Niessen, H.W.M.; Kamphuisen, P.W.; Levi, M.; Van Royen, N.

Background: No reflow and decreased microvascular perfusion after percutaneous coronary intervention increase morbidity and mortality in ST-elevation myocardial infarction (STEMI) patients. No reflow may be mediated by platelet vessel wall interaction that is governed by von Willebrand factor.

Impact of metformin versus repaglinide on non-glycaemic cardiovascular risk markers related to inflammation and endothelial dysfunction in non-obese patients with type 2 diabetes

DEFF Research Database (Denmark)

Lund, Søren S; Tarnow, Lise; Stehouwer, Coen D A

2008-01-01

-month washout between interventions. RESULTS: Levels of tumour necrosis factor-alpha, plasminogen activator inhibitor-1 antigen, tissue-type plasminogen activator antigen, von Willebrand factor, soluble intercellular adhesion molecule-1 and soluble E-selectin were significantly lower during metformin...... versus repaglinide treatments. In contrast, Amadori albumin and heart rate were higher during metformin versus repaglinide. Levels of interleukin-6, fibrinogen, soluble vascular cell adhesion molecule-1, asymmetric dimethylarginine and advanced glycation end products as well as glycaemic levels...

Hypoxia-induced mitogenic factor enhances angiogenesis by promoting proliferation and migration of endothelial cells

International Nuclear Information System (INIS)

Tong Qiangsong; Zheng Liduan; Li Bo; Wang Danming; Huang Chuanshu; Matuschak, George M.; Li Dechun

2006-01-01

Our previous studies have indicated that hypoxia-induced mitogenic factor (HIMF) has angiogenic properties in an in vivo matrigel plug model and HIMF upregulates expression of vascular endothelial growth factor (VEGF) in mouse lungs and cultured lung epithelial cells. However, whether HIMF exerts angiogenic effects through modulating endothelial cell function remains unknown. In this study, mouse aortic rings cultured with recombinant HIMF protein resulted in enhanced vascular sprouting and increased endothelial cell spreading as confirmed by Dil-Ac-LDL uptake, von Willebrand factor and CD31 staining. In cultured mouse endothelial cell line SVEC 4-10, HIMF dose-dependently enhanced cell proliferation, in vitro migration and tubulogenesis, which was not attenuated by SU1498, a VEGFR2/Flk-1 receptor tyrosine kinase inhibitor. Moreover, HIMF stimulation resulted in phosphorylation of Akt, p38 and ERK1/2 kinases in SVEC 4-10 cells. Treatment of mouse aortic rings and SVEC 4-10 cells with LY294002, but not SB203580, PD098059 or U0126, abolished HIMF-induced vascular sprouting and angiogenic responses. In addition, transfection of a dominant-negative mutant of phosphatidylinositol 3-kinase (PI-3K), Δp85, blocked HIMF-induced phosphorylation of Akt, endothelial activation and tubulogenesis. These results indicate that HIMF enhances angiogenesis by promoting proliferation and migration of endothelial cells via activation of the PI-3K/Akt pathways

J-GLOBAL MeSH Dictionary: von Willebrand病 [MeCab user dictionary for science technology term[Archive

Lifescience Database Archive (English)

Full Text Available MeCab user dictionary for science technology term von Willebrand病 名詞 一般 * * * * von Willebrand...病 ... MeSH D014842 200906053707829497 C LS51 UNKNOWN_2 von Willebrand 病

Acquired Von Willebrand’s Syndrome in Systemic Lupus Erythematosus

Directory of Open Access Journals (Sweden)

Sara Taveras Alam

2014-01-01

Full Text Available Acquired von Willebrand syndrome (AVWS is an uncommon, underdiagnosed, and heterogeneous disease which is increasingly recognized as a cause of bleeding diatheses. Systemic lupus erythematosus (SLE is an infrequent cause of AVWS. Herein, we report a case of AVWS diagnosed during the initial presentation of SLE in a previously healthy young man with no family history of bleeding diathesis who presented with worsening epistaxis, gastrointestinal bleeding, and anasarca. He was found to have severe anemia and prolonged activated partial thromboplastin time (aPTT with severely decreased levels of von Willebrand factor (VWF measurements in addition to markedly decreased factor VIII levels. Further evaluation revealed nephrotic syndrome and interstitial lung disease due to SLE. He initially received combination therapy with intravenous immunoglobulin (IVIG and von Willebrand factor/factor VIII concentrates without significant improvement. Treatment with steroids, cyclophosphamide, and rituximab was followed by clinical improvement evidenced by cessation of bleeding. The short follow-up did not allow us to definitely prove the therapeutic effect of immunosuppressive treatment on AVWS in SLE patients. This case adds to the literature supporting the relationship between AVWS and SLE and highlights the importance of combination therapy in the treatment of severe AVWS as well as the role of IVIG, cyclophosphamide, and rituximab in AVWS associated with SLE.

Sodium-dependent vitamin C transporter 2 (SVCT2 expression and activity in brain capillary endothelial cells after transient ischemia in mice.

Directory of Open Access Journals (Sweden)

Burkhard Gess

Full Text Available Expression and transport activity of Sodium-dependent Vitamin C Transporter 2 (SVCT2 was shown in various tissues and organs. Vitamin C was shown to be cerebroprotective in several animal models of stroke. Data on expression, localization and transport activity of SVCT2 after cerebral ischemia, however, has been scarce so far. Thus, we studied the expression of SVCT2 after middle cerebral artery occlusion (MCAO in mice by immunohistochemistry. We found an upregulation of SVCT2 after stroke. Co-stainings with Occludin, Von-Willebrand Factor and CD34 demonstrated localization of SVCT2 in brain capillary endothelial cells in the ischemic area after stroke. Time-course analyses of SVCT2 expression by immunohistochemistry and western blots showed upregulation in the subacute phase of 2-5 days. Radioactive uptake assays using (14C-labelled ascorbic acid showed a significant increase of ascorbic acid uptake into the brain after stroke. Taken together, these results provide evidence for the expression and transport activity of SVCT2 in brain capillary endothelial cells after transient ischemia in mice. These results may lead to the development of novel neuroprotective strategies in stroke therapy.

Abnormal megakaryocyte development and platelet function in Nbeal2(-/-) mice.

Science.gov (United States)

Kahr, Walter H A; Lo, Richard W; Li, Ling; Pluthero, Fred G; Christensen, Hilary; Ni, Ran; Vaezzadeh, Nima; Hawkins, Cynthia E; Weyrich, Andrew S; Di Paola, Jorge; Landolt-Marticorena, Carolina; Gross, Peter L

2013-11-07

Gray platelet syndrome (GPS) is an inherited bleeding disorder associated with macrothrombocytopenia and α-granule-deficient platelets. GPS has been linked to loss of function mutations in NEABL2 (neurobeachin-like 2), and we describe here a murine GPS model, the Nbeal2(-/-) mouse. As in GPS, Nbeal2(-/-) mice exhibit splenomegaly, macrothrombocytopenia, and a deficiency of platelet α-granules and their cargo, including von Willebrand factor (VWF), thrombospondin-1, and platelet factor 4. The platelet α-granule membrane protein P-selectin is expressed at 48% of wild-type levels and externalized upon platelet activation. The presence of P-selectin and normal levels of VPS33B and VPS16B in Nbeal2(-/-) platelets suggests that NBEAL2 acts independently of VPS33B/VPS16B at a later stage of α-granule biogenesis. Impaired Nbeal2(-/-) platelet function was shown by flow cytometry, platelet aggregometry, bleeding assays, and intravital imaging of laser-induced arterial thrombus formation. Microscopic analysis detected marked abnormalities in Nbeal2(-/-) bone marrow megakaryocytes, which when cultured showed delayed maturation, decreased survival, decreased ploidy, and developmental abnormalities, including abnormal extracellular distribution of VWF. Our results confirm that α-granule secretion plays a significant role in platelet function, and they also indicate that abnormal α-granule formation in Nbeal2(-/-) mice has deleterious effects on megakaryocyte survival, development, and platelet production.

Purification and characterization of factor VIII 1,689-Cys: a nonfunctional cofactor occurring in a patient with severe hemophilia A.

Science.gov (United States)

O'Brien, D P; Tuddenham, E G

1989-06-01

We have purified the factor VIII from a CRM+ Hemophilia A plasma (90 U/dL VIII:Ag but 0 U/dL VIII:C) and analyzed the protein before and after thrombin activation by Western blotting with monoclonal antibodies (MoAbs). Normal or patient citrated plasma was ultracentrifuged, cryo-ethanol-precipitated and chromatographed on Sepharose 6B. The void volume fractions were reduced and subjected to ion exchange chromatography yielding material of specific activity approximately 1,000 U/mg protein (VIII:C or VIII:Ag). Factor VIII purified in this way from normal plasma is fully activatable by thrombin with proteolytic fragmentation as previously described by F. Rotblat et al (Biochemistry 24: 4294, 1985). Factor VIII 1,689-Cys has the normal distribution of factor VIII light and heavy chains prior to thrombin activation. After exposure to thrombin the heavy chain polypeptides were fully proteolysed but the light chain was totally resistant to cleavage. This is consistent with the demonstration in the patient's leucocyte DNA of a C to T transition in codon 1,689 converting Arg to Cys at the light chain thrombin cleavage site as previously described by J. Gitschier et al (Blood 72:1022, 1988). Uncleaved light chain of Factor VIII 1,689-Cys is not released from von Willebrand factor (vWF) by thrombin, but this is not the sole cause of the functional defect since the protein purified free of vWF has no coagulant activity. We conclude that the functional defect in factor VIII 1,689-Cys is a consequence of failure to release the acidic peptide from the light chain upon thrombin activation.

Idiopathic combined, autoantibody-mediated ADAMTS-13/factor H deficiency in thrombotic thrombocytopenic purpura-hemolytic uremic syndrome in a 17-year-old woman: a case report

Directory of Open Access Journals (Sweden)

Patschan Daniel

2011-12-01

Full Text Available Abstract Introduction Thrombotic thrombocytopenic purpura-hemolytic uremic syndrome is a life-threatening condition with various etiopathogeneses. Without therapy approximately 90% of all patients die from the disease. Case presentation We report the case of a 17-year-old Caucasian woman with widespread hematomas and headache. Due to hemolytic anemia, thrombocytopenia, and schistocytosis, thrombotic thrombocytopenic purpura-hemolytic uremic syndrome was suspected and plasma exchange therapy was initiated immediately. Since her thrombocyte level did not increase during the first week of therapy, plasma treatment had to be intensified to a twice-daily schedule. Further diagnostics showed markedly reduced activities of both ADAMTS-13 (a disintegrin and metalloproteinase with a thrombospondin type 1 motif, member 13 - also known as von Willebrand factor-cleaving protease and factor H. Test results for antibodies against both proteins were positive. While plasma exchange therapy was continued, rituximab was given once weekly for four consecutive weeks. After the last dose, thrombocytes and activities of ADAMTS-13 and factor H increased into the normal range. Our patient improved and was discharged from the hospital. Conclusions Since no clinical symptoms/laboratory findings indicated a malignant or specific autoimmune-mediated disorder, the diagnosis made was thrombotic thrombocytopenic purpura-hemolytic uremic syndrome due to idiopathic combined, autoantibody-mediated ADAMTS-13/factor H deficiency.

Regulation of Matrix Metalloproteinase-2 Activity by COX-2-PGE2-pAKT Axis Promotes Angiogenesis in Endometriosis

Science.gov (United States)

Ray, Amlan K.; DasMahapatra, Pramathes; Swarnakar, Snehasikta

2016-01-01

Endometriosis is characterized by the ectopic development of the endometrium which relies on angiogenesis. Although studies have identified the involvement of different matrix metalloproteinases (MMPs) in endometriosis, no study has yet investigated the role of MMP-2 in endometriosis-associated angiogenesis. The present study aims to understand the regulation of MMP-2 activity in endothelial cells and on angiogenesis during progression of ovarian endometriosis. Histological and biochemical data showed increased expressions of vascular endothelial growth factor (VEGF), VEGF receptor-2, cycloxygenase (COX)-2, von Willebrand factor along with angiogenesis during endometriosis progression. Women with endometriosis showed decreased MMP-2 activity in eutopic endometrium as compared to women without endometriosis. However, ectopic ovarian endometrioma showed significantly elevated MMP-2 activity with disease severity. In addition, increased MT1MMP and decreased tissue inhibitors of metalloproteinases (TIMP)-2 expressions were found in the late stages of endometriosis indicating more MMP-2 activation with disease progression. In vitro study using human endothelial cells showed that prostaglandin E2 (PGE2) significantly increased MMP-2 activity as well as tube formation. Inhibition of COX-2 and/or phosphorylated AKT suppressed MMP-2 activity and endothelial tube formation suggesting involvement of PGE2 in regulation of MMP-2 activity during angiogenesis. Moreover, specific inhibition of MMP-2 by chemical inhibitor significantly reduced cellular migration, invasion and tube formation. In ovo assay showed decreased angiogenic branching upon MMP-2 inhibition. Furthermore, a significant reduction of lesion numbers was observed upon inhibition of MMP-2 and COX-2 in mouse model of endometriosis. In conclusion, our study establishes the involvement of MMP-2 activity via COX-2-PGE2-pAKT axis in promoting angiogenesis during endometriosis progression. PMID:27695098

Bleeding from gastrointestinal angioectasias is not related to bleeding disorders - a case control study

Directory of Open Access Journals (Sweden)

Lärfars Gerd

2010-09-01

Full Text Available Abstract Background Angioectasias in the gastrointestinal tract can be found in up to 3% of the population. They are typically asymptomatic but may sometimes result in severe bleeding. The reasons for why some patients bleed from their angioectasias are not fully understood but it has been reported that it may be explained by an acquired von Willebrand syndrome (AVWS. This condition has similar laboratory findings to congenital von Willebrand disease with selective loss of large von Willebrand multimers. The aim of this study was to find out if AVWS or any other bleeding disorder was more common in patients with bleeding from angioectasias than in a control group. Methods We compared bleeding tests and coagulation parameters, including von Willebrand multimers, from a group of 23 patients with anemia caused by bleeding from angioectasias, with the results from a control group lacking angioectasias. Results No significant differences between the two groups were found in coagulation parameters, bleeding time or von Willebrand multimer levels. Conclusion These results do not support a need for routine bleeding tests in cases of bleeding from angioectasias and do not show an overall increased risk of AVWS among these patients.

Erythrocytes and von Willebrand factor in venous thrombosis

NARCIS (Netherlands)

Smeets, M.W.J.

2018-01-01

Venous thromboembolism represents the third leading vascular disease after myocardial infarction and stroke. Erythrocytes, the most abundant cells in venous thrombi, were thought to be innocent bystanders that become tangled up in the fibrin mesh of venous thrombi. However, this thesis describes

Bleeding complications in BCR-ABL negative myeloproliferative neoplasms: prevalence, type, and risk factors in a single-center cohort.

Science.gov (United States)

Kander, Elizabeth M; Raza, Sania; Zhou, Zheng; Gao, Juehua; Zakarija, Anaadriana; McMahon, Brandon J; Stein, Brady L

2015-11-01

The BCR-ABL1-negative myeloproliferative neoplasms (MPN) share an increased risk of thrombotic and hemorrhagic complications. Risk factors for hemorrhage are less well defined than those for thrombosis. Because patients with CALR mutations have higher platelet counts compared to JAK2 V617F-mutated patients, bleeding rates may be increased in this group. Our aim was to retrospectively evaluate whether acquired von Willebrand disease (AvWD), thrombocytosis, mutational status, or treatment history are associated with bleeding in a cohort of MPN patients. Using an electronic database, MPN patients seen between 2005 and 2013 were retrospectively identified using ICD-9 codes and billing records. A bleeding event was defined as one that was identified in the medical record and graded based on the Common Terminology Criteria for Adverse Event (CTCAE) version 4.0. Among 351 MPN patients, 15.6 % experienced 64 bleeding event types. There was no association of bleeding with mutational status, gender, MPN subtype, aspirin use, prior thrombosis, or platelet count at presentation. There was an association between bleeding and older age at diagnosis. aVWD was identified in six patients. In this single-center retrospective study, bleeding events were identified in 15 % of patients, and associated with older age at diagnosis. aVWD was rarely tested for in this cohort.

Extension of Tissue Plasminogen Activator Treatment Window by Granulocyte-Colony Stimulating Factor in a Thromboembolic Rat Model of Stroke

Directory of Open Access Journals (Sweden)

Ike C. dela Peña

2018-05-01

Full Text Available When given beyond 4.5 h of stroke onset, tissue plasminogen activator (tPA induces deleterious side effects in the ischemic brain, notably, hemorrhagic transformation (HT. We examined the efficacy of granulocyte-colony stimulating factor (G-CSF in reducing delayed tPA-induced HT, cerebral infarction, and neurological deficits in a thromboembolic (TE stroke model, and whether the effects of G-CSF were sustained for longer periods of recovery. After stroke induction, rats were given intravenous saline (control, tPA (10 mg/kg, or G-CSF (300 μg/kg + tPA 6 h after stroke. We found that G-CSF reduced delayed tPA-associated HT by 47%, decreased infarct volumes by 33%, and improved motor and neurological deficits by 15% and 25%, respectively. It also prevented delayed tPA treatment-induced mortality by 46%. Immunohistochemistry showed 1.5- and 1.8-fold enrichment of the endothelial progenitor cell (EPC markers CD34+ and VEGFR2 in the ischemic cortex and striatum, respectively, and 1.7- and 2.8-fold increases in the expression of the vasculogenesis marker von Willebrand factor (vWF in the ischemic cortex and striatum, respectively, in G-CSF-treated rats compared with tPA-treated animals. Flow cytometry revealed increased mobilization of CD34+ cells in the peripheral blood of rats given G-CSF. These results corroborate the efficacy of G-CSF in enhancing the therapeutic time window of tPA for stroke treatment via EPC mobilization and enhancement of vasculogenesis.

Disease: H00225 [KEGG MEDICUS

Lifescience Database Archive (English)

Full Text Available ID:18574040 ... AUTHORS ... Sadler JE ... TITLE ... Von Willebrand factor, ADAMTS13, and thrombotic thrombocytopen...MID:17124092 ... AUTHORS ... Sadler JE ... TITLE ... Thrombotic thrombocytopenic purpura: a moving target. ... JOURN

Vasa vasorum in the tunica media and tunica adventitia of the porcine aorta

Czech Academy of Sciences Publication Activity Database

Tonar, Z.; Tomášek, P.; Loskot, P.; Janáček, Jiří; Králíčková, M.; Witter, K.

2016-01-01

Roč. 205, č. 2016 (2016), s. 22-36 ISSN 0940-9602 Institutional support: RVO:67985823 Keywords : artery * microvessels * pig * stereology * vascular wall * von Willebrand factor Subject RIV: EA - Cell Biology Impact factor: 1.864, year: 2016

The effect of hyperthyroidism on procoagulant, anticoagulant and fibrinolytic factors: a systematic review and meta-analysis.

Science.gov (United States)

Stuijver, Danka J F; van Zaane, Bregje; Romualdi, Erica; Brandjes, Dees P M; Gerdes, Victor E A; Squizzato, Alessandro

2012-12-01

Several coagulation and fibrinolytic parameters appear to be affected by thyroid hormone excess; however, the net effect on the haemostatic system remains unclear. We aimed to update our previous review and systematically summarise and meta-analyse the data by assessing the effects of thyrotoxicosis on the coagulation and fibrinolytic system in vivo . Data sources included MEDLINE (2006-2012), EMBASE (2006-2012), and reference lists. The sources were combined with our previous search containing studies from 1980-2006. Eligible studies were all observational or experimental studies. Two investigators independently extracted data and rated study quality. Weighted mean proportion and 95% confidence intervals were calculated and pooled using a fixed and a random-effects model. A total of 29 articles consisting of 51 studies were included, as in several articles more than one study was described. We included four intervention (before and after treatment in hyperthyroid patients), five cross-sectional (hyperthyroid subjects and euthyroid controls), and four experimental (before and after use of thyroid hormone in euthyroid subjects) medium/high quality studies for meta-analysis. We found that thyrotoxicosis shifts the haemostatic balance towards a hypercoagulable and hypofibrinolytic state with a rise in factors VIII and IX, fibrinogen, von Willebrand factor, and plasminogen activator inhibitor-1. This was observed in endogenous and exogenous thyrotoxicosis, and in subclinical as well as overt hyperthyroidism. We conclude that both subclinical and overt hyperthyroidism induce a prothrombotic state, which is therefore likely to be a risk factor for venous thrombosis.

Industrial production of clotting factors: Challenges of expression, and choice of host cells.

Science.gov (United States)

Kumar, Sampath R

2015-07-01

The development of recombinant forms of blood coagulation factors as safer alternatives to plasma derived factors marked a major advance in the treatment of common coagulation disorders. These are complex proteins, mostly enzymes or co-enzymes, involving multiple post-translational modifications, and therefore are difficult to express. This article reviews the nature of the expression challenges for the industrial production of these factors, vis-à-vis the translational and post-translational bottlenecks, as well as the choice of host cell lines for high-fidelity production. For achieving high productivities of vitamin K dependent proteins, which include factors II (prothrombin), VII, IX and X, and protein C, host cell limitation of γ-glutamyl carboxylation is a major bottleneck. Despite progress in addressing this, involvement of yet unidentified protein(s) impedes a complete cell engineering solution. Human factor VIII expresses at very low levels due to limitations at several steps in the protein secretion pathway. Protein and cell engineering, vector improvement and alternate host cells promise improvement in the productivity. Production of Von Willebrand factor is constrained by its large size, complex structure, and the need for extensive glycosylation and disulfide-bonded oligomerization. All the licensed therapeutic factors are produced in CHO, BHK or HEK293 cells. While HEK293 is a recent adoption, BHK cells appear to be disfavored. Copyright © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Iron-Deficiency Anemia

Medline Plus

Full Text Available ... interferes with the body’s ability to make hemoglobin. Family history and genetics Von Willebrand disease is an ... deficiency anemia. Return to Risk Factors to review family history, lifestyle, unhealthy environments, or other factors that ...

A Novel Human TGF-β1 Fusion Protein in Combination with rhBMP-2 Increases Chondro-Osteogenic Differentiation of Bone Marrow Mesenchymal Stem Cells

Directory of Open Access Journals (Sweden)

Silvia Claros

2014-06-01

Full Text Available Transforming growth factor-beta (TGF-β is involved in processes related to the differentiation and maturation of osteoprogenitor cells into osteoblasts. Rat bone marrow (BM cells were cultured in a collagen-gel containing 0.5% fetal bovine serum (FBS for 10 days in the presence of rhTGF (recombinant human TGF-β1-F2, a fusion protein engineered to include a high-affinity collagen-binding decapeptide derived from von Willebrand factor. Subsequently, cells were moderately expanded in medium with 10% FBS for 4 days and treated with a short pulse of rhBMP (recombinant human bone morphogenetic protein-2 for 4 h. During the last 2 days, dexamethasone and β-glycerophosphate were added to potentiate osteoinduction. Concomitant with an up-regulation of cell proliferation, DNA synthesis levels were determined. Polymerase chain reaction was performed to reveal the possible stemness of these cells. Osteogenic differentiation was evaluated in terms of alkaline phosphatase activity and mineralized matrix formation as well as by mRNA expression of osteogenic marker genes. Moreover, cells were placed inside diffusion chambers and implanted subcutaneously into the backs of adult rats for 4 weeks. Histological study provided evidence of cartilage and bone-like tissue formation. This experimental procedure is capable of selecting cell populations from BM that, in the presence of rhTGF-β1-F2 and rhBMP-2, achieve skeletogenic potential in vitro and in vivo.

Abnormal megakaryocyte development and platelet function in Nbeal2−/− mice

Science.gov (United States)

Lo, Richard W.; Li, Ling; Pluthero, Fred G.; Christensen, Hilary; Ni, Ran; Vaezzadeh, Nima; Hawkins, Cynthia E.; Weyrich, Andrew S.; Di Paola, Jorge; Landolt-Marticorena, Carolina; Gross, Peter L.

2013-01-01

Gray platelet syndrome (GPS) is an inherited bleeding disorder associated with macrothrombocytopenia and α-granule-deficient platelets. GPS has been linked to loss of function mutations in NEABL2 (neurobeachin-like 2), and we describe here a murine GPS model, the Nbeal2−/− mouse. As in GPS, Nbeal2−/− mice exhibit splenomegaly, macrothrombocytopenia, and a deficiency of platelet α-granules and their cargo, including von Willebrand factor (VWF), thrombospondin-1, and platelet factor 4. The platelet α-granule membrane protein P-selectin is expressed at 48% of wild-type levels and externalized upon platelet activation. The presence of P-selectin and normal levels of VPS33B and VPS16B in Nbeal2−/− platelets suggests that NBEAL2 acts independently of VPS33B/VPS16B at a later stage of α-granule biogenesis. Impaired Nbeal2−/− platelet function was shown by flow cytometry, platelet aggregometry, bleeding assays, and intravital imaging of laser-induced arterial thrombus formation. Microscopic analysis detected marked abnormalities in Nbeal2−/− bone marrow megakaryocytes, which when cultured showed delayed maturation, decreased survival, decreased ploidy, and developmental abnormalities, including abnormal extracellular distribution of VWF. Our results confirm that α-granule secretion plays a significant role in platelet function, and they also indicate that abnormal α-granule formation in Nbeal2−/− mice has deleterious effects on megakaryocyte survival, development, and platelet production. PMID:23861251

Tumor endothelium marker-8 based decoys exhibit superiority over capillary morphogenesis protein-2 based decoys as anthrax toxin inhibitors.

Directory of Open Access Journals (Sweden)

Chenguang Cai

Full Text Available Anthrax toxin is the major virulence factor produced by Bacillus anthracis. The toxin consists of three protein subunits: protective antigen (PA, lethal factor, and edema factor. Inhibition of PA binding to its receptors, tumor endothelium marker-8 (TEM8 and capillary morphogenesis protein-2 (CMG2 can effectively block anthrax intoxication, which is particularly valuable when the toxin has already been overproduced at the late stage of anthrax infection, thus rendering antibiotics ineffectual. Receptor-like agonists, such as the mammalian cell-expressed von Willebrand factor type A (vWA domain of CMG2 (sCMG2, have demonstrated potency against the anthrax toxin. However, the soluble vWA domain of TEM8 (sTEM8 was ruled out as an anthrax toxin inhibitor candidate due to its inferior affinity to PA. In the present study, we report that L56A, a PA-binding-affinity-elevated mutant of sTEM8, could inhibit anthrax intoxication as effectively as sCMG2 in Fisher 344 rats. Additionally, pharmacokinetics showed that L56A and sTEM8 exhibit advantages over sCMG2 with better lung-targeting and longer plasma retention time, which may contribute to their enhanced protective ability in vivo. Our results suggest that receptor decoys based on TEM8 are promising anthrax toxin inhibitors and, together with the pharmacokinetic studies in this report, may contribute to the development of novel anthrax drugs.

Childhood subdural hemorrhage, macrocephaly, and coagulopathy associated with Prader-Willi syndrome: case report and review of the literature.

Science.gov (United States)

Carr, Robert B; Khanna, Paritosh C; Saneto, Russell P

2012-07-01

A 16-month-old girl with a history of Prader-Willi syndrome and progressive macrocephaly manifested large, bilateral, subdural hemorrhages of differing ages on magnetic resonance imaging. Subsequent evaluation revealed a deficiency of von Willebrand factor, but after repeated evaluations, no conclusive evidence of nonaccidental trauma became apparent. Subdural hemorrhages of varying ages are frequently associated with nonaccidental trauma during early childhood. However, several uncommon conditions may present as subdural hemorrhages and thus mimic nonaccidental trauma. Our patient demonstrates a combination of Prader-Willi syndrome, von Willebrand factor deficiency, and enlargement of the extra-axial spaces. All of these in isolation were associated with subdural hemorrhages. We review the scant literature on subdural hemorrhages in Prader-Willi syndrome and other conditions that mimic nonaccidental trauma. Copyright © 2012 Elsevier Inc. All rights reserved.

Coagulation, inflammatory, and stress responses in a randomized comparison of open and laparoscopic repair of recurrent inguinal hernia

DEFF Research Database (Denmark)

Rahr, H B; Bendix, J; Ahlburg, P

2006-01-01

BACKGROUND: In previous comparisons of inflammatory and stress responses to open (OR) and laparoscopic (LR) hernia repair, all operations were performed under general anesthesia. Since local anesthesia is widely used for OR, a comparison of this approach with LR seemed relevant. METHODS: Patients...... with recurrent inguinal hernia were randomized to OR under local anesthesia (n = 30) or LR under general anesthesia (n = 31). The magnitude of the surgical trauma was assessed by measuring markers of coagulation (prothrombin fragment 1 + 2), endothelial activation (von Willebrand factor), inflammation...... [leukocytes, interleukin-6, -8 and -10, granulocyte macrophage colony-stimulating factor, and C-reactive protein (CRP)], and endocrine stress (cortisol) in blood collected before operation, 4 h postincision, and on postoperative day 2. RESULTS: Leukocyte counts and interleukin-6 and CRP levels increased...

Estudo de fatores pró-trombóticos e pró-inflamatórios na cardiomiopatia chagásica Study of pro-thrombotic and pro-inflammatory factors in chagas cardiomyopathy

Directory of Open Access Journals (Sweden)

Leila Maria Magalhães Pessoa de Melo

2010-10-01

Full Text Available FUNDAMENTO: A relação entre atividade inflamatória e pró-trombótica na cardiomiopatia chagásica e em outras etiologias é obscura. OBJETIVO: Estudar o perfil de marcadores pró-trombóticos e pró-inflamatórios em pacientes com insuficiência cardíaca chagásica e compará-los com os de etiologia não chagásica. MÉTODOS: Coorte transversal. Critérios de inclusão: fração de ejeção do VE (FEVE um mês. Os pacientes foram divididos em dois grupos: grupo 1 (G1 - sorologias positivas para Chagas - e grupo 2 (G2 - sorologias negativas para Chagas. Fator pró-inflamatório: PCR ultrassensível. Fatores pró-trombóticos: fator trombina-antitrombina, fibrinogênio, antígeno do fator de von Willebrand, P-selectina plasmática e tromboelastograma. Amostra calculada para poder de 80%, assumindo-se diferença de 1/3 de desvio-padrão; p significativo se BACKGROUND: The relationship between inflammatory and prothrombotic activity in chagas cardiomyopathy and in other etiologies is unclear. OBJECTIVE: To study the profile of pro-thrombotic and pro-inflammatory markers in patients with Chagas' heart failure and compare them with patients of non-chagas etiology. METHODS: Cross-sectional cohort. Inclusion criteria: left ventricle ejection fraction (LVEF one month. The patients were divided into two groups: group 1 (G1 - seropositive for Chagas - and group 2 (G2 - seronegative for Chagas. Pro-inflammatory factor: Ultra-sensitive CRP. Pro-thrombotic factors: thrombin-antithrombin factor, fibrinogen, von Willebrand factor antigen, plasma P-selectin and thromboelastography. Sample calculated for 80% power, assuming a standard deviation difference of 1/3; significant p if it is < 0.05. Statistical analysis: Fisher's exact test for categorical variables; unpaired Student's t-test for parametric continuous variables and Mann-Whitney test for nonparametric continuous variables. RESULTS: Between January and June 2008, 150 patients were included, 80 in G1

Hypothermia and Platelet Dysfunction

National Research Council Canada - National Science Library

Michelson, A

1994-01-01

... (the GPIIb-IIIa complex). Circulating platelets are normally in a resting state and, despite the presence of platelet surface GPIb-IX and GPIIb-IIIa complexes, they bind neither plasma von Willebrand factor nor plasma fibrinogen...

Molecular characterization of exon 28 of von Willebrand's factor ...

African Journals Online (AJOL)

2016-05-12

May 12, 2016 ... were mostly among individuals with Arab ancestry.[3] In. Zimbabwe ... bleeding symptoms are epistaxis, menorrhagia (in women), easy bruising, oral cavity ... North American, British, and Japanese populations. rs1800383 ...

Hemistepsin A ameliorates acute inflammation in macrophages via inhibition of nuclear factor-κB and activation of nuclear factor erythroid 2-related factor 2.

Science.gov (United States)

Kim, Jae Kwang; Lee, Ji Eun; Jung, Eun Hye; Jung, Ji Yun; Jung, Dae Hwa; Ku, Sae Kwang; Cho, Il Je; Kim, Sang Chan

2018-01-01

Hemistepsin A (HsA) is a sesquiterpene lactone isolated from Hemistepta lyrata (Bunge) Bunge. We investigated the anti-inflammatory effects of HsA and sought to determine its mechanisms of action in macrophages. HsA pretreatment inhibited nitric oxide production, and reduced the expression of iNOS and COX-2 in Toll-like receptor ligand-stimulated RAW 264.7 cells. Additionally, HsA decreased the secretion of proinflammatory cytokines in lipopolysaccharide (LPS)-stimulated Kupffer cells as well as in RAW 264.7 cells. HsA inhibited phosphorylation of IKKα/β and degradation of IκBα, resulting in decreased nuclear translocation of nuclear factor-κB (NF-κB) and its transcriptional activity. Moreover, HsA phosphorylated nuclear factor erythroid 2-related factor 2 (Nrf2), increased expression levels of antioxidant genes, and attenuated LPS-stimulated H 2 O 2 production. Phosphorylation of p38 and c-Jun N-terminal kinase was required for HsA-mediated Nrf2 phosphorylation. In a D-galactosamine/LPS-induced liver injury model, HsA ameliorated D-galactosamine/LPS-induced hepatocyte degeneration and inflammatory cells infiltration. Moreover, immunohistochemical analyses using nitrotyrosine, 4-hydroxynonenal, and cleaved poly (ADP-ribose) polymerase antibodies revealed that HsA protected the liver from oxidative stress. Furthermore, HsA reduced the numbers of proinflammatory cytokine-positive cells in hepatic tissues. Thus, these results suggest HsA may be a promising natural product to manage inflammation-mediated tissue injuries through inhibition of NF-κB and activation of Nrf2. Copyright © 2017 Elsevier Ltd. All rights reserved.

Hypothermia and Platelet Dysfunction

National Research Council Canada - National Science Library

Michelson, Alan

1993-01-01

... (the OPlib-Illa complex).3 Circulating platelets are normally in a resting state and, despite the presence of platelet surface GPTh-IX and OPlib-Illa complexes, they bind neither plasma von Willebrand factor nor plasma fibrinogen...

Haemostatic disorders in reproductive age women with menorrhagia and effects on quality of life.

Science.gov (United States)

Hacioglu, Sibel; Karabulut, Aysun; Sari, Ismail; Keskin, Ali

2016-11-01

The aim of this study was to determine the frequency of haemostatic abnormalities in women with menorrhagia and to evaluate their effect on quality of life (QoL). The study population was composed of patients with menorrhagia seen in the outpatient clinic, having a score of >185 with a pictorial blood assessment chart. Structured questionnaires were used in the assessment of demographic characteristics and QoL, and patients were tested for bleeding disorders. Ninety women were recruited for the study. Bleeding disorders were detected in 40% of them: 11.1% had von Willebrand disease, 2.2% had low von Willebrand factor and 26.7% had platelet function disorders (PFD). In 22 (91.6%) cases with PFD the, defect was non-specific and impaired aggregation response to ristocetine (37.5%) was the most commonly detected problem. Bleeding disorders were not associated with any significant reduction in QoL (p > .05). Hereditary bleeding disorders may be the cause of unexplained menorrhagia even in the middle-aged women, but they had no prominent effect on QoL.

Intra-plaque production of platelet-activating factor correlates with neoangiogenesis in human carotid atherosclerotic lesions.

Science.gov (United States)

Lupia, Enrico; Pucci, Angela; Peasso, Paolo; Merlo, Maurizio; Baron, Paolo; Zanini, Cristina; Del Sorbo, Lorenzo; Rizea-Savu, Simona; Silvestro, Luigi; Forni, Marco; Emanuelli, Giorgio; Camussi, Giovanni; Montrucchio, Giuseppe

2003-09-01

Platelet-activating factor (PAF) is a phospholipid mediator synthesized by activated inflammatory and endothelial cells. Recently PAF has been shown to contribute to neoangiogenesis in several experimental models. Here we evaluated the presence of PAF and its potential role in neovascularization within human atherosclerotic plaques. The amount of PAF extracted from 18 carotid plaques (266.65+/-40.07 pg/100 mg dry tissue; mean +/- SE) was significantly higher than that extracted from 18 normal arterial specimens (6 from carotid artery and 12 from aorta) (4.72+/-2.31 pg/100 mg dry tissue; mean +/- SE). The levels of PAF significantly correlated with the infiltration of CD68-positive monocytes and the extent of neovascularization, detected as von Willebrand Factor-positive cells. The amount of PAF also correlated with the area occupied by TNF-alpha-expressing cells. The absence of enhanced level of PAF in the circulation of atherosclerotic patients suggests a local production of this mediator within the plaque. The lipid extracts of atherosclerotic plaques containing high levels of PAF-bioactivity, but not those of control arteries, were angiogenic in a murine Matrigel model. WEB 2170, a specific PAF receptor antagonist, significantly prevented angiogenesis induced by the lipid extracts of atherosclerotic plaques. Our results indicate a local production of PAF within the atherosclerotic plaques and suggest that it may contribute to intra-plaque neoangiogenesis.

Elevated urinary albumin excretion is associated with impaired arterial dilatory capacity in clinically healthy subjects

DEFF Research Database (Denmark)

Clausen, P; Jensen, J S; Jensen, G

2001-01-01

(endothelium-dependent, flow-associated dilation) and to nitroglycerin (endothelium-independent, nitroglycerin-induced dilation). Plasma concentrations of the endothelial markers nitrate/nitrite, thrombomodulin, and von Willebrand factor antigen were also measured. Both flow-associated and nitroglycerin...

CO2 Emission Factors for Coals

Directory of Open Access Journals (Sweden)

P. Orlović-Leko

2015-03-01

Full Text Available Emission factors are used in greenhouse gas inventories to estimate emissions from coal combustion. In the absence of direct measures, emissions factors are frequently used as a quick, low cost way to estimate emissions values. Coal combustion has been a major contributor to the CO2 flux into the atmosphere. Nearly all of the fuel carbon (99 % in coal is converted to CO2 during the combustion process. The carbon content is the most important coal parameter which is the measure of the degree of coalification (coal rank. Coalification is the alteration of vegetation to form peat, succeeded by the transformation of peat through lignite, sub-bituminous, bituminous to anthracite coal. During the geochemical or metamorphic stage, the progressive changes that occur within the coal are an increase in the carbon content and a decrease in the hydrogen and oxygen content resulting in a loss of volatiles. Heterogeneous composition of coal causes variation in CO2 emission from different coals. The IPCC (Intergovernmental Panel on Climate Change has produced guidelines on how to produce emission inventories which includes emission factors. Although 2006 IPCC Guidelines provided the default values specified according to the rank of the coal, the application of country-specific emission factors was recommended when estimating the national greenhouse gas emissions. This paper discusses the differences between country-specific emission factors and default IPCC CO2 emission factors, EF(CO2, for coals. Also, this study estimated EF(CO2 for two different types of coals and peat from B&H, on the basis fuel analyses. Carbon emission factors for coal mainly depend on the carbon content of the fuel and vary with both rank and geographic origin, which supports the idea of provincial variation of carbon emission factors. Also, various other factors, such as content of sulphur, minerals and macerals play an important role and influence EF(CO2 from coal. Carbonate minerals

NCBI nr-aa BLAST: CBRC-TTRU-01-0026 [SEVENS

Lifescience Database Archive (English)

Full Text Available CBRC-TTRU-01-0026 ref|YP_001642747.1| ATPase [Bacillus weihenstephanensis KBAB4] gb...|ABY46772.1| AAA ATPase containing von Willebrand factor type A (vWA)-like domain [Bacillus weihenstephanensis KBAB4] YP_001642747.1 5e-80 50% ...

Pigment epithelium derived factor inhibits the growth of human endometrial implants in nude mice and of ovarian endometriotic stromal cells in vitro.

Directory of Open Access Journals (Sweden)

Yanmei Sun

Full Text Available Angiogenesis is a prerequisite for the formation and development of endometriosis. Pigment epithelium derived factor (PEDF is a natural inhibitor of angiogenesis. We previously demonstrated a reduction of PEDF in the peritoneal fluid, serum and endometriotic lesions from women with endometriosis compared with women without endometriosis. Here, we aim to investigate the inhibitory effect of PEDF on human endometriotic cells in vivo and in vitro. We found that PEDF markedly inhibited the growth of human endometrial implants in nude mice and of ovarian endometriotic stromal cells in vitro by up-regulating PEDF expression and down-regulating vascular endothelial growth factor (VEGF expression. Moreover, apoptotic index was significantly increased in endometriotic lesions in vivo and endometriotic stromal cells in vitro when treated with PEDF. In mice treated with PEDF, decreased microvessel density labeled by Von Willebrand factor but not by α-Smooth Muscle Actin was observed in endometriotic lesions. And it showed no increase in PEDF expression of the ovary and uterus tissues. These findings suggest that PEDF gene therapy may be a new treatment for endometriosis.

Risk Factors for Type 2 Diabetes in Bangladesh: A Systematic Review

Directory of Open Access Journals (Sweden)

T Sal-sabil

2016-01-01

Full Text Available Diabetes is one of the most significant public health challenge in developing countries. The risk factors for diabetes are poorly understood among the Bangladeshi population. This study aimed to explore the potential risk factors for type 2 diabetes in Bangladesh. A systematic review was performed. Studies describing the risk factors for type 2 diabetes in Bangladesh published between 1994 to 2014 were included and summarized. Of the 35 studies identified, we included 14 studies that met the inclusion criteria. The prevalence of diabetes was higher among females compared to males. Fourteen common risk factors for diabetes in Bangladesh were identified, namely increased age, obesity, waist- hip ratio, social class, hypertension, family history, sedentary life style among others. The p otential risk factors differed by urban-rural areas and by gender. Several risk factors contribute to the increasing prevalence of type 2 diabetes. Our reviews suggest "metabolically-disadvantageous" body composition of more abdominal and visceral fat in Bangladeshi adults might cause higher diabetes risk at a lower BMI compared to Western population. Preventive strategies targeting to control risk factors for diabetes is a priority public health issue and should be considered for early intervention by clinicians and policy makers.

A homozygous missense variant in VWA2, encoding an interactor of the Fraser-complex, in a patient with vesicoureteral reflux.

Directory of Open Access Journals (Sweden)

Amelie T van der Ven

Full Text Available Congenital anomalies of the kidney and urinary tract (CAKUT are the most common cause (40-50% of chronic kidney disease (CKD in children. About 40 monogenic causes of CAKUT have so far been discovered. To date less than 20% of CAKUT cases can be explained by mutations in these 40 genes. To identify additional monogenic causes of CAKUT, we performed whole exome sequencing (WES and homozygosity mapping (HM in a patient with CAKUT from Indian origin and consanguineous descent. We identified a homozygous missense mutation (c.1336C>T, p.Arg446Cys in the gene Von Willebrand factor A domain containing 2 (VWA2. With immunohistochemistry studies on kidneys of newborn (P1 mice, we show that Vwa2 and Fraser extracellular matrix complex subunit 1 (Fras1 co-localize in the nephrogenic zone of the renal cortex. We identified a pronounced expression of Vwa2 in the basement membrane of the ureteric bud (UB and derivatives of the metanephric mesenchyme (MM. By applying in vitro assays, we demonstrate that the Arg446Cys mutation decreases translocation of monomeric VWA2 protein and increases translocation of aggregated VWA2 protein into the extracellular space. This is potentially due to the additional, unpaired cysteine residue in the mutated protein that is used for intermolecular disulfide bond formation. VWA2 is a known, direct interactor of FRAS1 of the Fraser-Complex (FC. FC-encoding genes and interacting proteins have previously been implicated in the pathogenesis of syndromic and/or isolated CAKUT phenotypes in humans. VWA2 therefore constitutes a very strong candidate in the search for novel CAKUT-causing genes. Our results from in vitro experiments indicate a dose-dependent neomorphic effect of the Arg446Cys homozygous mutation in VWA2.

Job Strain as a Risk Factor for Type 2 Diabetes

DEFF Research Database (Denmark)

Nyberg, Solja T; Fransson, Eleonor I; Heikkilä, Katriina

2014-01-01

with baseline questionnaires. Incident type 2 diabetes at follow-up was ascertained using national health registers, clinical screening, and self-reports. We analyzed data for each study using Cox regression and pooled the study-specific estimates in fixed-effect meta-analyses. RESULTS: There were 3,703 cases......OBJECTIVE: The status of psychosocial stress at work as a risk factor for type 2 diabetes is unclear because existing evidence is based on small studies and is subject to confounding by lifestyle factors, such as obesity and physical inactivity. This collaborative study examined whether stress...... at work, defined as "job strain," is associated with incident type 2 diabetes independent of lifestyle factors. RESEARCH DESIGN AND METHODS: We extracted individual-level data for 124,808 diabetes-free adults from 13 European cohort studies participating in the IPD-Work Consortium. We measured job strain...

l-2-Oxothiazolidine-4-Carboxylic Acid or α-Lipoic Acid Attenuates Airway Remodeling: Involvement of Nuclear Factor-κB (NF-κB, Nuclear Factor Erythroid 2p45-Related Factor-2 (Nrf2, and Hypoxia-Inducible Factor (HIF

Directory of Open Access Journals (Sweden)

Heung Bum Lee

2012-06-01

Full Text Available Reactive oxygen species (ROS play a crucial role in the pathogenesis of acute and chronic respiratory diseases. Antioxidants have been found to ameliorate airway inflammation and hyperresponsiveness in animal models employing short-term exposure to allergen. However, little data are available on the effect of antioxidants on airway remodeling and signaling pathways in chronic asthma. In the present study, we used a long-term exposure murine model of allergic airway disease to evaluate the effects of an antioxidant, l-2-oxothiazolidine-4-carboxylic acid (OTC or α-lipoic acid (LA on airway remodeling, focusing on the ROS-related hypoxia-inducible signaling. Long-term challenge of ovalbumin (OVA increased ROS production, airway inflammation, and airway hyperresponsiveness, and developed features of airway remodeling such as excessive mucus secretion, subepithelial fibrosis, and thickening of the peribronchial smooth muscle layer. Administration of OTC or LA reduced these features of asthma, including airway remodeling, which was accompanied by suppression of transforming growth factor-β1, vascular endothelial growth factor, and T-helper 2 cytokines. In addition, OVA-induced activation of nuclear factor-κB (NF-κB, nuclear factor erythroid 2p45-related factor-2 (Nrf2, hypoxia-inducible factor (HIF-1α, and HIF-2α was reduced by OTC or LA. Our results also showed that OTC or LA down-regulated phosphoinositide 3-kinase activity and decreased phosphorylation of p38 mitogen-activated protein kinase but not extracellular signal-regulated kinase 1/2 or c-Jun N-terminal kinase. These findings demonstrate that OTC and LA can inhibit activation of NF-κB, Nrf2, and HIF, leading to attenuate allergen-induced airway remodeling.

A Cross-Industry Review of B2B Critical Success Factors.

Science.gov (United States)

Eid, Riyad; Trueman, Myfanwy; Ahmed, Abdel Moneim

2002-01-01

Presents a comprehensive review of B2B (business-to- business) international Internet marketing and identifies 21 critical success factors in five categories: marketing strategy, including management support, strategic goals, and collaboration; Web site factors, including Web site design; global factors, including multilanguage sites and cultural…

Characterization of the coagulation profile in children with liver disease and extrahepatic portal vein obstruction or shunt.

Science.gov (United States)

Beattie, William; Magnusson, Maria; Hardikar, Winita; Monagle, Paul; Ignjatovic, Vera

2017-03-01

Research Institute; FII: factor II; FV: factor V; FVII: factor VII; FVIII: factor VIII; AT: antithrombin III; A2M: alpha-2-macroglobulin; vWF: Von Willebrand factor; PC: protein C; PS: protein S; ISTH-BAT: International Society on Thrombosis and Haemostasis Bleeding Assessment Tool.

A micro-fluidic study of whole blood behaviour on PMMA topographical nanostructures

Directory of Open Access Journals (Sweden)

Tsud Nataliya

2008-02-01

Full Text Available Abstract Background Polymers are attractive materials for both biomedical engineering and cardiovascular applications. Although nano-topography has been found to influence cell behaviour, no established method exists to understand and evaluate the effects of nano-topography on polymer-blood interaction. Results We optimized a micro-fluidic set-up to study the interaction of whole blood with nano-structured polymer surfaces under flow conditions. Micro-fluidic chips were coated with polymethylmethacrylate films and structured by polymer demixing. Surface feature size varied from 40 nm to 400 nm and feature height from 5 nm to 50 nm. Whole blood flow rate through the micro-fluidic channels, platelet adhesion and von Willebrand factor and fibrinogen adsorption onto the structured polymer films were investigated. Whole blood flow rate through the micro-fluidic channels was found to decrease with increasing average surface feature size. Adhesion and spreading of platelets from whole blood and von Willebrand factor adsorption from platelet poor plasma were enhanced on the structured surfaces with larger feature, while fibrinogen adsorption followed the opposite trend. Conclusion We investigated whole blood behaviour and plasma protein adsorption on nano-structured polymer materials under flow conditions using a micro-fluidic set-up. We speculate that surface nano-topography of polymer films influences primarily plasma protein adsorption, which results in the control of platelet adhesion and thrombus formation.

Factor structure and psychometric properties of a Spanish translation of the Body Appreciation Scale-2 (BAS-2).

Science.gov (United States)

Swami, Viren; García, Antonio Alías; Barron, David

2017-09-01

We examined the psychometric properties of a Spanish translation of the Body Appreciation Scale-2 (BAS-2) in a community sample of 411 women and 389 men in Almería, Spain. Participants completed the 10-item BAS-2 along with measures of appearance evaluation, body areas satisfaction, self-esteem, life satisfaction, and self-reported body mass index (BMI). Exploratory factor analyses with one split-half subsample revealed that BAS-2 scores had a one-dimensional factor structure in women and men. Confirmatory factor analysis with a second split-half subsample showed the one-dimensional factor structure had acceptable fit and was invariant across sex. There were no significant sex differences in BAS-2 scores. BAS-2 scores were significantly and positively correlated with appearance evaluation, body areas satisfaction, self-esteem, and life satisfaction. Body appreciation was significantly and negatively correlated with BMI in men, but associations in women were only significant in the second subsample. Results suggest that the Spanish BAS-2 has adequate psychometric properties. Copyright © 2017 Elsevier Ltd. All rights reserved.

Effect of exercise on platelet activation during aspirin or clopidogrel intake in healthy men

DEFF Research Database (Denmark)

Hjorth Madsen, Esben; Christiansen, Morten Krogh; Schmidt, Erik Berg

2009-01-01

aggregometry. A significant increase in plasma von Willebrand Factor was also found in response to exercise. In conclusion, platelet activation occurs during exercise in healthy individuals. This activation is not prevented by use of aspirin or clopidogrel, and may partly be explained by an increase in plasma...

Biomarkers of endothelial dysfunction are elevated and related to prognosis in chronic heart failure patients with diabetes but not in those without diabetes

DEFF Research Database (Denmark)

Kistorp, C.; Chong, A.Y.; Gustafsson, F.

2008-01-01

Biomarkers of endothelial dysfunction, such as soluble E-selectin, and von Willebrand factor (vWf) are elevated in patients with chronic heart failure (CHF). The impact of diabetes mellitus (DM) on these biomarkers, and their relation to prognosis remains unknown....

Platelet-vessel wall interaction in health and disease

NARCIS (Netherlands)

Löwenberg, E. C.; Meijers, J. C. M.; Levi, M. [=Marcel M.

2010-01-01

Upon vessel wall injury platelets rapidly adhere to the exposed subendothelial matrix which is mediated by several cellular receptors present on platelets or endothelial cells and various adhesive proteins such as von Willebrand factor, collagen and fibrinogen. Subsequent platelet activation results

Predictive value of ovarian stroma measurement for cardiovascular risk in polycyctic ovary syndrome: a case control study

Directory of Open Access Journals (Sweden)

Loverro Giuseppe

2010-11-01

Full Text Available Abstract Background To verify the feasibility of ovarian stromal evaluation and correlate ovarian parameteres (echogenicity and volume with hyperandrogenism, and both cardiovascular and metabolic risk factors in PCOS. Methods Twenty four young PCOS patients and twelve age-matched control women were enrolled. Diagnosis of PCOS was based on the Rotterdam criteria. Ultrasound ovarian study included ovarian volume, stromal volume, stromal area and stromal area/total ovarian area ratio (S/A. Concerning hormones, insulin, LH, FSH, estradiol, androstenedione, testosterone, DHEAS, 17-hydroxy-progesterone, and SHBG were measured during the early follicular phase (days 2-5. Cardiovascular risk factors were represented by fasting plasma levels of glucose, lipids (total and HDL-cholesterol, plasminogen activator inhibitor 1 (PAI-1, von-Willebrand factor (vWF, and adiponectin. Carotid intima-media thickness (C-IMT was measured as a parameter of cardiovascular risk. Results A positive correlation between the S/A ratio and plasma levels of testosterone (p Conclusions This study shows that the ultrasound measurement of ovarian stroma is a predicting factor of hyperandrogenism degree, prothrombotic factors and cardiovascular risk in patients with PCOS.

Human factor H-related protein 2 (CFHR2 regulates complement activation.

Directory of Open Access Journals (Sweden)

Hannes U Eberhardt

Full Text Available Mutations and deletions within the human CFHR gene cluster on chromosome 1 are associated with diseases, such as dense deposit disease, CFHR nephropathy or age-related macular degeneration. Resulting mutant CFHR proteins can affect complement regulation. Here we identify human CFHR2 as a novel alternative pathway complement regulator that inhibits the C3 alternative pathway convertase and terminal pathway assembly. CFHR2 is composed of four short consensus repeat domains (SCRs. Two CFHR2 molecules form a dimer through their N-terminal SCRs, and each of the two C-terminal ends can bind C3b. C3b bound CFHR2 still allows C3 convertase formation but the CFHR2 bound convertases do not cleave the substrate C3. Interestingly CFHR2 hardly competes off factor H from C3b. Thus CFHR2 likely acts in concert with factor H, as CFHR2 inhibits convertases while simultaneously allowing factor H assisted degradation by factor I.

Clinical experience with Optivate®, high-purity factor VIII (FVIII) product with von Willebrand factor (VWF) in young children with haemophilia A.

Science.gov (United States)

Matysiak, M; Bobrowska, H; Balwierz, W; Chybicka, A; Kowalczyk, J R; Shaikh-Zaidi, R; Gillanders, K; Dash, C H

2011-09-01

Optivate® is a high-purity FVIII/VWF product. Its safety, tolerability and efficacy in subjects ≥ 12 years have been demonstrated. This study was undertaken to assess Optivate® in children with haemophilia A. Twenty-five children, including one PUP (previously untreated patient), aged 1-6 years (mean 4.67 years) were treated with Optivate® for 26 weeks. Inhibitors were assessed every 3 months and viral status at the study start and end. Prophylaxis was used by five boys and on demand by twenty. The mean number of bleeds in the study was lower compared to the same period pre-study (12.0/child vs. 16.2/child), with fewer bleeds (P related events (5%), all were mild and non-serious. There were no clinically significant changes in vital signs, viral transmissions or inhibitors. In young children Optivate® was well tolerated, safe and efficacious. © 2011 Blackwell Publishing Ltd.

CD147 and matrix-metalloproteinase-2 expression in metastatic and non-metastatic uveal melanomas.

Science.gov (United States)

Lüke, Julia; Vukoja, Vlatka; Brandenbusch, Tim; Nassar, Khaled; Rohrbach, Jens Martin; Grisanti, Salvatore; Lüke, Matthias; Tura, Aysegül

2016-06-03

Extracellular matrix remodelling regulated by matrix-metalloproteinase (MMP) inducer (CD147) is a crucial process during tumor cell invasion and regulation of blood supply. In this study, we evaluated the correlation of CD147 and MMP-2 expression with major prognostic factors for uveal melanoma and the development of metastasis. The expression of CD147 and MMP-2 was analyzed in 49 samples of uveal melanomas. Triple immunofluorescence stainings using markers against glial cells (GFAP), endothelial cells (CD34) and macrophages (CD68) were performed to further analyse the exact localisation of CD147 and MMP-2 positivity. In 28 cases clinical metastatic disease were found. The remaining 21 cases showed no signs of metastatic disease for an average follow-up of 10 years. Correlation analysis (Pearson correlation) was performed to analyse the association of CD147 and MMP-2 expression with known prognostic factors, vasculogenic mimicry (VM), the mature vasculature (von Willebrand Factor) and tumor induced angiogenesis (by means of Endoglin expression). CD147 and MMP-2 were expressed in 47 (96.0 %) of the uveal melanomas. CD147 up-regulation was significantly correlated with a higher MMP-2 expression. The overall expression analysis revealed no significant difference in the metastatic (p = 0.777) and non-metastatic subgroup (p = 0.585). No correlation of CD147 expression and any system of blood supply was evident. In the non-metastatic sub-group a significant correlation of clustered CD147 positive cells with largest basal diameter (p = 0.039), height (p = 0.047) and TNM-stage (p = 0.013) was evident. These data may indicate that CD147 regulates MMP-2 expression in uveal melanoma cells.

H-2-incompatible bone marrow chimeras produce donor-H-2-restricted Ly-2 suppressor T-cell factor(s)

International Nuclear Information System (INIS)

Noguchi, M.; Onoe, K.; Ogasawara, M.; Iwabuchi, K.; Geng, L.; Ogasawara, K.; Good, R.A.; Morikawa, K.

1985-01-01

To study adaptive-differentiation phenomena of T lymphocytes, suppressor T-cell factors (TsF) produced by Ly-2+ splenic T cells from fully allogeneic mouse bone marrow chimeras were analyzed. AKR mice irradiated and reconstituted with B10 marrow cells (B10----AKR chimeras) produced an Ly-2+ TsF after hyperimmunization with sheep erythrocytes. The TsF suppressed primary antibody responses (to sheep erythrocytes) generated with spleen cells of mice of H-2b haplotype but not those of H-2k haplotype. Thus, this suppressor factor was donor-H-2-restricted. The immunoglobulin heavy chain variable region gene (Igh-V)-restricting element was not involved in this form of suppression. Similar results were obtained when TsF from B6----BALB/c and BALB/c----B6 chimeras were analyzed. The TsF from B10----AKR chimeras suppressed responses of B10.A(3R) and B10.A(5R) mice but not those of B10.A(4R). This finding showed that identity between the factor-producing cells and target spleen cells is required on the left-hand side of the E beta locus of the H-2 region and that the putative I-Jb locus is not involved in this form of suppression. The present results support the postulate that post-thymic differentiation in the presence of continued or repeated stimulation with antigen and donor-derived antigen-presenting cells generates donor-H-2-restricted T-cell clones that may predominate within the repertoire of the specific antigen being presented

Phenotypic approaches to gene mapping in platelet function disorders - identification of new variant of P2Y12, TxA2 and GPVI receptors.

Science.gov (United States)

Watson, S; Daly, M; Dawood, B; Gissen, P; Makris, M; Mundell, S; Wilde, J; Mumford, A

2010-01-01

Platelet number or function disorders cause a range of bleeding symptoms from mild to severe. Patients with platelet dysfunction but normal platelet number are the most prevalent and typically have mild bleeding symptoms. The study of this group of patients is particularly difficult because of the lack of a gold-standard test of platelet function and the variable penetrance of the bleeding phenotype among affected individuals. The purpose of this short review is to discuss the way in which this group of patients can be investigated through platelet phenotyping in combination with targeted gene sequencing. This approach has been used recently to identify patients with mutations in key platelet activation receptors, namely those for ADP, collagen and thromboxane A2 (TxA2). One interesting finding from this work is that for some patients, mild bleeding is associated with heterozygous mutations in platelet proteins that are co-inherited with other genetic disorders of haemostasis such as type 1 von Willebrand's disease. Thus, the phenotype of mild bleeding may be multifactorial in some patients and may be considered to be a complex trait.

Development and characterization of recombinant ovine coagulation factor VIII.

Directory of Open Access Journals (Sweden)

Philip M Zakas

Full Text Available Animal models of the bleeding disorder, hemophilia A, have been an integral component of the biopharmaceutical development process and have facilitated the development of recombinant coagulation factor VIII (fVIII products capable of restoring median survival of persons with hemophilia A to that of the general population. However, there remain several limitations to recombinant fVIII as a biotherapeutic, including invasiveness of intravenous infusion, short half-life, immunogenicity, and lack of availability to the majority of the world's population. The recently described ovine model of hemophilia A is the largest and most accurate phenocopy. Affected sheep die prematurely due to bleeding-related pathogenesis and display robust adaptive humoral immunity to non-ovine fVIII. Herein, we describe the development and characterization of recombinant ovine fVIII (ofVIII to support further the utility of the ovine hemophilia A model. Full-length and B-domain deleted (BDD ofVIII cDNAs were generated and demonstrated to facilitate greater biosynthetic rates than their human fVIII counterparts while both BDD constructs showed greater expression rates than the same-species full-length versions. A top recombinant BDD ofVIII producing baby hamster kidney clone was identified and used to biosynthesize raw material for purification and biochemical characterization. Highly purified recombinant BDD ofVIII preparations possess a specific activity nearly 2-fold higher than recombinant BDD human fVIII and display a differential glycosylation pattern. However, binding to the carrier protein, von Willebrand factor, which is critical for stability of fVIII in circulation, is indistinguishable. Decay of thrombin-activated ofVIIIa is 2-fold slower than human fVIII indicating greater intrinsic stability. Furthermore, intravenous administration of ofVIII effectively reverses the bleeding phenotype in the murine model of hemophilia A. Recombinant ofVIII should facilitate

Safety, tolerability, pharmacokinetics and pharmacodynamics of anti-VWF nanobody® ALX-0681 after single and multiple subcutaneous administrations to healthy volunteers

NARCIS (Netherlands)

Abd-Elaziz, Khalid; Kamphuisen, Pieter W; Lyssens, Christophe; Reuvers, Mariska; Den Daas, Izaak; Van Bockstaele, Femke; Vercruysse, Kristof; Ulrichts, Hans; Baumeister, Judith; Crabbe, Patricia; Compernolle, Veerle; Holz, Josefin-Beate

2009-01-01

ALX-0681 is a humanized bivalent Nanobody®, that binds to the A1 domain of von Willebrand factor (vWF) and hence blocks its interaction with platelet receptor GPIb-IX-V. Given its mode of action, ALX-0681 could provide an alternative treatment option for thrombotic thrombocytopenic purpura (TTP), a

Cross-reacting Material-positive Hemophilia A Diagnosed in a Patient with a Spontaneous Thigh Hemorrhage.

Science.gov (United States)

Saito, Tatsuya; Mukae, Jyunichi; Nakamura, Yosuke; Inaba, Hiroshi; Nogami, Keiji; Koyama, Takatoshi; Fukutake, Katsuyuki; Yamamoto, Koh

2017-01-01

A 53-year-old man, who had been diagnosed with mild hemophilia A (HA) at 35 years of age, was hospitalized with a thigh hematoma. His bleeding continued despite the administration of recombinant factor VIII (FVIII). The results of an FVIII/von Willebrand factor binding assay were normal. The patient's FVIII coagulant activity (FVIII:C) was low, but his FVIII antigen levels were within the normal limits, suggesting FVIII protein dysfunction. The FVIII:C measurements obtained by one-stage clotting and chromogenic assays were different. An FVIII gene analysis revealed a missense mutation p.Ser308Leu, which is rare in Japan. This case highlights that gene analyses and chromogenic assays are necessary to interpret the discrepancies between FVIII:C and the bleeding phenotype of patients with mild HA.

State of the art vs biological variability: Comparison on hematology parameters using Spanish EQAS data.

Science.gov (United States)

Molina, A; Guiñon, L; Perez, A; Segurana, A; Bedini, J L; Reverter, J C; Merino, A

2018-02-05

It is important for clinical laboratories to maintain under control the possible sources of error in its analytical determinations. The objective of this work is to perform an analysis of the total error committed by laboratories using the data extracted from the Spanish External Quality Assessment Program in Hematology and to compare them with the specifications based on the biological variability proposed by the Ricós group. We analyzed a total of 3 89 000 results during the period 2015-2016 from the following quantitative schemes of Spanish External Quality Assessment Program: complete blood count, blood coagulation tests, differential leukocyte count, reticulocytes, hemoglobin A 2 , antithrombin, factor VIII, protein C, and von Willebrand factor. It has been considered as an indicator of the current performance the value of total error that 90% of laboratories are able to achieve, taking into account 75% of their results. We found some magnitudes whose biological variability specifications are achievable by most of the laboratories for either minimum, desirable, or optimum criteria: white blood cells, red blood cells, hemoglobin, hematocrit, mean corpuscular volume, mean corpuscular hemoglobin, platelets, fibrinogen, neutrophils, lymphocytes, eosinophils, von Willebrand factor, and protein C. However, current performance for mean corpuscular hemoglobin concentration and hemoglobin A 2 only allows to meet the specifications based on the state of the art. Our results reflect the feasibility of establishing specifications based on biological variability criteria or the state of the art, which may help to select the proper criteria for each parameter. © 2018 John Wiley & Sons Ltd.

[Risk factors for schizophrenia patients with type 2 diabetes: a metaanalysis].

Science.gov (United States)

Zhou, Min; Xiao, Chuan; Yang, Min; Yuan, Ping; Liu, Yuanyuan

2015-03-01

To investigate risk factors for schizophrenia patients with complication of type 2 diabetes mellitus and to provide scientific evidence for prevention and management of this disease. Relevant studies on schizophrenia with type 2 diabetes mellitus in China were searched through PubMed, Medline, CBM, CNKI and VIP from 1997 to 2014. Meta-analysis was performed using RevMan 5.2 soft ware. A total of 26 studies involving 6 373 participants (including 957 cases and 5 416 controls) were included. The results of Meta-analysis showed that the risk factors for schizophrenic patients with complication of type 2 diabetes mellitus were: gender (female) (OR=1.28, 95%CI: 1.09-1.50), age (≥ 40 year) (OR=6.02, 95%CI: 4.48-8.09), overweight (OR=2.32, 95%CI: 1.52-2.88), family history of diabetes (OR=6.12, 95%CI: 3.16-11.86), duration of schizophrenia (>10 years) (OR=3.60, 95%CI: 2.39-5.41), triglycerides (MD=0.38, 95%CI: 0.05-0.71). Male, old age, overweight, family history of diabetes, longer duration and high level of triglycerides are risk factors for schizophrenic patients with complication of diabetes mellitus.

Fasting Induces Nuclear Factor E2-Related Factor 2 and ATP-Binding Cassette Transporters via Protein Kinase A and Sirtuin-1 in Mouse and Human

Science.gov (United States)

Kulkarni, Supriya R.; Donepudi, Ajay C.; Xu, Jialin; Wei, Wei; Cheng, Qiuqiong C.; Driscoll, Maureen V.; Johnson, Delinda A.; Johnson, Jeffrey A.; Li, Xiaoling

2014-01-01

Abstract Aims: The purpose of this study was to determine whether 3′-5′-cyclic adenosine monophosphate (cAMP)-protein kinase A (PKA) and Sirtuin-1 (SIRT1) dependent mechanisms modulate ATP-binding Cassette (ABC) transport protein expression. ABC transport proteins (ABCC2–4) are essential for chemical elimination from hepatocytes and biliary excretion. Nuclear factor-E2 related-factor 2 (NRF2) is a transcription factor that mediates ABCC induction in response to chemical inducers and liver injury. However, a role for NRF2 in the regulation of transporter expression in nonchemical models of liver perturbation is largely undescribed. Results: Here we show that fasting increased NRF2 target gene expression through NRF2- and SIRT1–dependent mechanisms. In intact mouse liver, fasting induces NRF2 target gene expression by at least 1.5 to 5-fold. In mouse and human hepatocytes, treatment with 8-Bromoadenosine-cAMP, a cAMP analogue, increased NRF2 target gene expression and antioxidant response element activity, which was decreased by the PKA inhibitor, H-89. Moreover, fasting induced NRF2 target gene expression was decreased in liver and hepatocytes of SIRT1 liver-specific null mice and NRF2-null mice. Lastly, NRF2 and SIRT1 were recruited to MAREs and Antioxidant Response Elements (AREs) in the human ABCC2 promoter. Innovation: Oxidative stress mediated NRF2 activation is well described, yet the influence of basic metabolic processes on NRF2 activation is just emerging. Conclusion: The current data point toward a novel role of nutrient status in regulation of NRF2 activity and the antioxidant response, and indicates that cAMP/PKA and SIRT1 are upstream regulators for fasting-induced activation of the NRF2-ARE pathway. Antioxid. Redox Signal. 20, 15–30. PMID:23725046

Meat Consumption as a Risk Factor for Type 2 Diabetes

Directory of Open Access Journals (Sweden)

Neal Barnard

2014-02-01

Full Text Available Disease risk factors identified in epidemiological studies serve as important public health tools, helping clinicians identify individuals who may benefit from more aggressive screening or risk-modification procedures, allowing policymakers to prioritize intervention programs, and encouraging at-risk individuals to modify behavior and improve their health. These factors have been based primarily on evidence from cross-sectional and prospective studies, as most do not lend themselves to randomized trials. While some risk factors are not modifiable, eating habits are subject to change through both individual action and broader policy initiatives. Meat consumption has been frequently investigated as a variable associated with diabetes risk, but it has not yet been described as a diabetes risk factor. In this article, we evaluate the evidence supporting the use of meat consumption as a clinically useful risk factor for type 2 diabetes, based on studies evaluating the risks associated with meat consumption as a categorical dietary characteristic (i.e., meat consumption versus no meat consumption, as a scalar variable (i.e., gradations of meat consumption, or as part of a broader dietary pattern.

Mouse podoplanin supports adhesion and aggregation of platelets under arterial shear: A novel mechanism of haemostasis.

Science.gov (United States)

Lombard, Stephanie E; Pollitt, Alice Y; Hughes, Craig E; Di, Ying; Mckinnon, Tom; O'callaghan, Chris A; Watson, Steve P

2017-11-01

The podoplanin-CLEC-2 axis is critical in mice for prevention of hemorrhage in the cerebral vasculature during mid-gestation. This raises the question as to how platelets are captured by podoplanin on neuroepithelial cells in a high shear environment. In this study, we demonstrate that mouse platelets form stable aggregates on mouse podoplanin at arterial shear through a CLEC-2 and Src kinase-dependent pathway. Adhesion and aggregation are also dependent on the platelet glycoprotein (GP) receptors, integrin αIIbβ3 and GPIb, and the feedback agonists ADP and thromboxane A 2 (TxA 2 ). CLEC-2 does not bind to von Willebrand factor (VWF) suggesting that the interaction with podoplanin is sufficient to both tether and activate platelets. Consistent with this, the surface plasmon resonance measurements reveal that mouse CLEC-2 binds to mouse podoplanin with nanomolar affinity. The present findings demonstrate a novel pathway of hemostasis in which podoplanin supports platelet capture and activation at arteriolar rates of shear.

Factors promoting development of renal tubulointerstitial lesions in patients with diabetes mellitus

Directory of Open Access Journals (Sweden)

Minara Shamkhalovna Shamkhalova

2010-09-01

Full Text Available Aim. To identify profibrogenic mediators, markers of endothelial dysfunction and hemostasis in patients with diabetes mellitus (DM and chronickidney disease (CKD. Materials and methods. The study included 120 patients with DM and 20 age-matched normotensive subjects without DM showing the glomerularfiltration rate (GFR > 60 ml/min/1.73 m3. Four groups of patients were distinguished: 1 - DM2 patients without renal pathology (n=33, 2 - DM2 patients with diabetic nephropathy (n=24, 3 - DM2 patients with ischemic nephropathy (IN (n=33 verified by contrast visualization techniques(multispiral CM of abdominal aorta and renal arteries, abdominal angiography of renal arteries or MR angiography of renal arteries and abdominal aorta, 4 - DM1 patients with DN (n=30. Clinical examination included assessment of complaints, analysis of medical history of the main diseaseand concomitant disorders, determination of the main clinical and biochemical characteristics of blood and urine, measurement of НbА1с and 24-hralbuminuria (AU by standard methods, estimation of GFR by the MDRD formula, ECG, echocardiography, 24-hr AP monitoring, counseling bycardiologist and ophthalmologist (fundal examination by ophthalmoscopy. Standard kits were used to detect profibrogenic mediators and markersof endothelial dysfunction including transforming growth factor-beta (TGF-b, angiotensin II (AT II, monocyte chemoattractant protein (MCP-1,regulated on activation normal T cell expressed and secreted (RANTES, adhesion factors (intracellular adhesion molecule (ICAM-1, vascular celladhesion molecule (VCAM-1 vascular endothelial growth factor (VEGF, interleukin-6 (IL-6, asymmetric dimethylargnine (ADMA, homocysteine(HCYST, metalloproteinases (MMP, von Willebrand factor (vWF, plasminogen activator inhibitor (PAI-I. Results. DM patients with CKD had elevated blood profibrogenic cytokine (MCP-1, TGF-1b, IL-6 and extracellular matrix degradation factor(MMP-9 levels compared with

Clinical Significance of von Willebrand Factor and Antithrombin in Diabetes Mellitus with Retinopathy%血管性血友病因子与抗凝血酶在糖尿病视网膜病变中的临床意义

Institute of Scientific and Technical Information of China (English)

张鹏; 汤荣华

2012-01-01

目的 探讨糖尿病微血管视网膜病变患者血管性血友病因子(vWF)、抗凝血酶(AT)的变化及临床意义.方法 将100例2型糖尿病患者分为两组,糖尿病无微血管视网膜病变并发症组53例,糖尿病微血管视网膜病变并发症组47例,设健康人群对照组50例.所有人群入院或体检时即采集静脉血,进行vWF:Ag、AT:A检测.结果 2型糖尿病无微血管视网膜病变并发症组患者血浆vWF:Ag含量较正常对照组增高(P＜0.05),2型糖尿病微血管视网膜病变并发症组患者血浆vWF:Ag含量与2型糖尿病无微血管视网膜病变并发症组及正常对照组相比有显著性差异(P＜0.05)；且2型糖尿病微血管视网膜病变并发症组中背景性病变和增殖性病变患者血浆vWF:Ag含量比较有显著性差异(P＜0.05).2型糖尿病无微血管视网膜病变并发症组患者血浆AT活性与正常对照组相比无显著性差异(P＞0.05),2型糖尿病微血管视网膜病变并发症组患者血浆AT活性与2型糖尿病无微血管视网膜病变并发症组及正常对照组相比有显著性差异(P＜0.05)；且2型糖尿病微血管视网膜病变并发症组中背景性病变和增殖性病变患者血浆AT活性比较有显著性差异(P＜0.05).结论 血浆vWF:Ag、AT:A的变化与糖尿病微血管视网膜病变的发生、发展有密切关系,监测其水平与活性对糖尿病微血管并发症的治疗和预防有重要的临床意义.%Objective To explore the changes of von Willebrand factor(vWF) and antithrombin(AT) in diabetic patients with retinopathy and its clinical implications. Methods 100 type 2 diabetes mellitus (T2DM) patients were divided into 2 groups,one group included 53 T2DM patients without retinopathy,another group included 47 T2DM patients with retinopathy, 50 healthy peoples were enrolled as control group. Venous blood was collected from all groups and vWF:Ag, AT; A were determined. Results The level of vWF;Ag in T2DM

Effects of Nuclear Factor-E2-related factor 2/Heme Oxygenase 1 on splanchnic hemodynamics in experimental cirrhosis with portal hypertension.

Science.gov (United States)

Qin, Jun; He, Yue; Duan, Ming; Luo, Meng

2017-05-01

We explored the effects of Nuclear Factor-E2-related factor 2 (Nrf2) and Heme Oxygenase 1 (HO-1) on splanchnic hemodynamics in portal hypertensive rats. Experimental cirrhosis with portal hypertension was induced by intraperitoneal injection of carbon tetrachloride. The expression of proteins was examined by immunoblotting. Hemodynamic studies were performed by radioactive microspheres. The vascular perfusion system was used to measure the contractile response of mesentery arterioles in rats. Nrf2 expression in the nucleus and HO-1 expression in cytoplasm was significantly enhanced in portal hypertensive rats. Portal pressure, as well as regional blood flow, increased significantly in portal hypertension and can be blocked by tin protoporphyrin IX. The expression of endogenous nitric oxide synthase and vascular endothelial growth factors increased significantly compared to normal rats, while HO-1 inhibition decreased the expression of these proteins significantly. The contractile response of mesenteric arteries decreased in portal hypertension, but can be partially recovered through tin protoporphyrin IX treatment. The expression of Nrf2/HO-1 increased in mesenteric arteries of portal hypertensive rats, which was related to oxidative stress. HO-1was involved in increased portal pressure and anomaly splanchnic hemodynamics in portal hypertensive rats. Copyright © 2016 Elsevier Inc. All rights reserved.

Van Willebrand's disease in the Western Cape

African Journals Online (AJOL)

agglutinate normal platelets but does not have an effect on platelets from patients with VWD. The ristocetin co-factor. (RiCo~ assay measures the ability of plasma to agglutinate fixed platelets and is therefore regarded as an indirect measure of VWF activity. Qualitative analysis of VWF antigen. 0JWF-Ag) is required for ...

Identification of a phosphorylation-dependent nuclear localization motif in interferon regulatory factor 2 binding protein 2.

Directory of Open Access Journals (Sweden)

Allen C T Teng

Full Text Available Interferon regulatory factor 2 binding protein 2 (IRF2BP2 is a muscle-enriched transcription factor required to activate vascular endothelial growth factor-A (VEGFA expression in muscle. IRF2BP2 is found in the nucleus of cardiac and skeletal muscle cells. During the process of skeletal muscle differentiation, some IRF2BP2 becomes relocated to the cytoplasm, although the functional significance of this relocation and the mechanisms that control nucleocytoplasmic localization of IRF2BP2 are not yet known.Here, by fusing IRF2BP2 to green fluorescent protein and testing a series of deletion and site-directed mutagenesis constructs, we mapped the nuclear localization signal (NLS to an evolutionarily conserved sequence (354ARKRKPSP(361 in IRF2BP2. This sequence corresponds to a classical nuclear localization motif bearing positively charged arginine and lysine residues. Substitution of arginine and lysine with negatively charged aspartic acid residues blocked nuclear localization. However, these residues were not sufficient because nuclear targeting of IRF2BP2 also required phosphorylation of serine 360 (S360. Many large-scale phosphopeptide proteomic studies had reported previously that serine 360 of IRF2BP2 is phosphorylated in numerous human cell types. Alanine substitution at this site abolished IRF2BP2 nuclear localization in C(2C(12 myoblasts and CV1 cells. In contrast, substituting serine 360 with aspartic acid forced nuclear retention and prevented cytoplasmic redistribution in differentiated C(2C(12 muscle cells. As for the effects of these mutations on VEGFA promoter activity, the S360A mutation interfered with VEGFA activation, as expected. Surprisingly, the S360D mutation also interfered with VEGFA activation, suggesting that this mutation, while enforcing nuclear entry, may disrupt an essential activation function of IRF2BP2.Nuclear localization of IRF2BP2 depends on phosphorylation near a conserved NLS. Changes in phosphorylation status

Kruppel-like factor 2 (KLF2) regulates proinflammatory activation of monocytes

Science.gov (United States)

Das, Hiranmoy; Kumar, Ajay; Lin, Zhiyong; Patino, Willmar D.; Hwang, Paul M.; Feinberg, Mark W.; Majumder, Pradip K.; Jain, Mukesh K.

2006-01-01

The mechanisms regulating activation of monocytes remain incompletely understood. Herein we provide evidence that Kruppel-like factor 2 (KLF2) inhibits proinflammatory activation of monocytes. In vitro, KLF2 expression in monocytes is reduced by cytokine activation or differentiation. Consistent with this observation, KLF2 expression in circulating monocytes is reduced in patients with chronic inflammatory conditions such as coronary artery disease. Adenoviral overexpression of KLF2 inhibits the LPS-mediated induction of proinflammatory factors, cytokines, and chemokines and reduces phagocytosis. Conversely, short interfering RNA-mediated reduction in KLF2 increased inflammatory gene expression. Reconstitution of immunodeficient mice with KLF2-overexpressing monocytes significantly reduced carrageenan-induced acute paw edema formation. Mechanistically, KLF2 inhibits the transcriptional activity of both NF-κB and activator protein 1, in part by means of recruitment of transcriptional coactivator p300/CBP-associated factor. These observations identify KLF2 as a novel negative regulator of monocytic activation. PMID:16617118

Dependence of plasmin-mediated degradation of platelet adhesive receptors on temperature and Ca2+

International Nuclear Information System (INIS)

Winters, K.J.; Eisenberg, P.R.; Jaffe, A.S.; Santoro, S.A.

1990-01-01

The effects of activation of plasminogen by streptokinase and tissue-type-plasminogen activator on platelet activation and the membrane glycoproteins (GPs) that mediate platelet adhesion and aggregation are not yet fully defined. To clarify effects on platelets during activation of plasminogen in vitro, we used monoclonal antibodies (MoAbs), flow cytometry, and platelets surface-labeled with 125 I to characterize changes in receptors for fibrinogen (GPIIb-IIIa), von Willebrand factor (GPIb), and collagen (GPIa-IIa). Activation of plasminogen in plasma with pharmacologic concentrations of plasminogen activators did not degrade GPIIb-IIIa or GPIb, and caused only a modest decrease in GPIa. In washed platelets GPIIb-IIIa was extensively degraded by plasmin at 37 degrees C in the absence of exogenous Ca 2+ , conditions that destabilize the IIb-IIIa complex. Degradation of GPIb in washed platelets displayed a similar although less-marked dependence on temperature and the absence of Ca 2+ . The binding of activation-specific MoAbs did not increase during activation of plasminogen in plasma. We conclude that during pharmacologic fibrinolysis, reported inhibition of platelet function in plasma is not due to degradation of platelet-adhesive receptors. In addition, platelet activation observed during thrombolytic therapy does not appear to be a direct consequence of plasminogen activation

Is exposure to chronic stressors a risk factor for Type 2 diabetes?

OpenAIRE

Kelly, Shona; Ismail, Mubarak

2014-01-01

Background - Current policy around Type 2 diabetes (T2D) interventions to reduce rates largely invokes a bio-behavioural model. This approach is also reflected in the research literature where most research that attempts to predict the development of diabetes is restricted to conventional clinical risk factors. However, a few researchers are now suggesting that psychosocial factors (PSF), acting via the physiologic stress response (PSR) systems, increases the risk of developing diabetes. Card...

[Prevalence and risk factors of extra-coronary artery disease in patients with diabetes which confirmed atherosclerosis of coronary arteries].

Science.gov (United States)

Gracheva, S A; Biragova, M S; Glazunova, A M; Klefortova, I I; Melkozerov, K V; Shamkhalova, M Sh; Dzhavelidze, M I; Soldatova, T V; Il'in, A V; Deev, A D; Shestakova, M V; Tugeeva, E F; Buziashvili, Iu I

2014-01-01

To assess prevalence and risk factors of extra-coronary artery disease (peripheral artery (PA) disease (D) of lower extremities (LE), brachiocephalic arterial (BCA) stenosis (S), renal arterial (RA) S in type 1 and 2 (T1 and T2) diabetes (D) patients (P) with confirmed atherosclerosis of coronary arteries (CA). 100 P (48 with T2D, 18 with T1D, 34 without diabetes - PWD), with hemodynamically significant atherosclerosis of CA confirmed by coronary angiography. All patients underwent duplex ultrasonography of PA LE, BCA, RA. Other studies included assessment of clinical characteristics and measurement of the following parameters: profibrogenic cytokines (transforming growth factor [TGF] beta1, matrix metalloproteinase 9 [MMP9], monocyte chemotactic protein-1 [MCP-1], regulated on activation normal T-cell expressed and secreted [RANTES), markers of endothelial dysfunction (von Willebrand factor [VWF], homocystein [HCYST], plasminogen activator inhibitor-1 [PAI-1], vascular cell adhesion molecule [VCAM], soluble intercellular adhesion molecules-1 [sICAM], vascular endothelial growth factor [VEGF], asymmetric dimethylarginine [ADMAD, N-terminal fragment of pro-brain natriuretic peptide (NT-pro BNP), fibroblast growth factor 23 (FGF-23), and fibrinogen. Portions of P with multivessel CA disease were similar in all three groups (T1D - 88.9, T2D - 85.5, WD - 82.3%). Coexistence of atherosclerosis in 2 or more vascular beds was identified in 85.3% of T2D and in 50% of WD P (p = 0.005). In T1D group 61.1 and 11.1% of P had atherosclerosis in 2 and 3 vascular beds, respectively. Levels of profibrogenic cytokines and factors of endothelial activation (RANTES, MMP-9, PAI-I, VCAM, sICAM, ADMA) were significantly higher in P with diabetes vs P WD. P with diabetes and multifocal atherosclerosis demonstrated significant increases of CRP, fibrinogen, NT-proBNP, VWF, PAI-1, ADMA, sICAM, and decrease of GFR compared with P with atherosclerosis in 1 vascular bed. Logistic regression

DNA repair helicase: a component of BTF2 (TFIIH) basic transcription factor. (research article)

NARCIS (Netherlands)

L. Schaeffer; R. Roy (Richard); S. Humbert; V. Moncollin; W. Vermeulen (Wim); J.H.J. Hoeijmakers (Jan); P. Chambon; J-M. Egly (Jean-Marc)

1993-01-01

textabstractThe human BTF2 basic transcription factor (also called TFIIH), which is similar to the delta factor in rat and factor b in yeast, is required for class II gene transcription. A strand displacement assay was used to show that highly purified preparation of BTF2 had an adenosine

A French National Survey on Clotting Disorders in Mastocytosis.

Science.gov (United States)

Carvalhosa, Ana B; Aouba, Achille; Damaj, Gandhi; Canioni, Danielle; Brouzes, Chantal; Gyan, Emmanuel; Durupt, Stéphane; Durieu, Isabelle; Cathebras, Pascal; Costédoat-Chalumeau, Nathalie; Launay, David; Pilmis, Benoit; Barete, Stephane; Frenzel, Laurent; Lortholary, Olivier; Hermine, Olivier; Hermans, Cedric; Chandesris, Marie-Olivia

2015-10-01

Mastocytosis is characterized by a clonal mast cell proliferation with organ infiltration and uncontrolled degranulation. Although not characteristic and poorly explained, some patients develop clotting abnormalities. We retrospectively identified patients with established diagnosis of mastocytosis and related clotting abnormalities (clinical and/or biological) using the national French Reference Centre for Mastocytosis database. From our cohort of 14 adult patients with clotting abnormalities (median age 46 years [range 26-75]), 4 had a presentation suggestive of a primary hemostasis disorder alone (by their symptoms and/or abnormal clotting tests [PFA, von Willebrand's disease [vWD] screening]) and 10 had a laboratory impairment of secondary hemostasis. Among these, 7 had bleeds characteristic of a coagulation cascade disorder (severe/life-threatening in 5 and mild in 2 patients). Clotting abnormalities were of variable severity, typically related to intense crisis of degranulation, such as anaphylactic reactions, and/or to severe organ infiltration by mast cells. Importantly, classical hemostatic management with platelet transfusion, fresh frozen plasma, or vitamin K infusions was unsuccessful, as opposed to the use of agents inhibiting mast cell activity, particularly steroids. This illustrates the crucial role of mast cell mediators such as tryptase and heparin, which interfere both with primary (mainly via inhibition of von Willebrand factor) and secondary hemostasis. There was interestingly an unusually high number of aggressive mastocytosis (particularly mast cell leukemia) and increased mortality in the group with secondary hemostasis disorders (n = 5, 36% of the whole cohort). Mast cell degranulation and/or high tumoral burden induce both specific biologic antiaggregant and anticoagulant states with a wide clinical spectrum ranging from asymptomatic to life-threatening bleeds. Hemostatic control is achieved by mast cell inhibitors such as steroids.

Complement activation, endothelial dysfunction, insulin resistance and chronic heart failure

DEFF Research Database (Denmark)

Bjerre, M.; Kistorp, C.; Hansen, T.K.

2010-01-01

CRP), endothelial activation (soluble E-selectin, sEsel)), endothelial damage/dysfunction (von Willebrand factor, vWf) and insulin resistance (IR) and prognosis in CHF remains unknown. Design. We investigated the association(s) between plasma sMAC, hsCRP, sEsel, vWf and IR (assessed by homeostatic model assessment...

The primary haemostasis is more preserved in thrombocytopenic patients with liver cirrhosis than cancer

DEFF Research Database (Denmark)

Vinholt, Pernille Just; Alnor, Anne B; Nybo, Mads

2018-01-01

aggregation using impedance aggregometry (Multiplate Analyzer), von Willebrand factor antigen (VWF:Ag), VWF:ristocetin-cofactor activity (VWF:RCo), activated partial thromboplastin time (aPTT), coagulation factor VIII, fibrinogen, and thrombin generation in adult hospitalized patients with platelet count less...... in patients with cirrhosis than cancer, 416 AU × min (IQR 257-676) versus 145 AU × min (IQR 50-326) for collagen-induced platelet aggregation, P time (aPTT), coagulation factor VIII, or thrombin generation between the patient groups...

Genome-Wide Identification of the Target Genes of AP2-O, a Plasmodium AP2-Family Transcription Factor.

Directory of Open Access Journals (Sweden)

Izumi Kaneko

2015-05-01

Full Text Available Stage-specific transcription is a fundamental biological process in the life cycle of the Plasmodium parasite. Proteins containing the AP2 DNA-binding domain are responsible for stage-specific transcriptional regulation and belong to the only known family of transcription factors in Plasmodium parasites. Comprehensive identification of their target genes will advance our understanding of the molecular basis of stage-specific transcriptional regulation and stage-specific parasite development. AP2-O is an AP2 family transcription factor that is expressed in the mosquito midgut-invading stage, called the ookinete, and is essential for normal morphogenesis of this stage. In this study, we identified the genome-wide target genes of AP2-O by chromatin immunoprecipitation-sequencing and elucidate how this AP2 family transcription factor contributes to the formation of this motile stage. The analysis revealed that AP2-O binds specifically to the upstream genomic regions of more than 500 genes, suggesting that approximately 10% of the parasite genome is directly regulated by AP2-O. These genes are involved in distinct biological processes such as morphogenesis, locomotion, midgut penetration, protection against mosquito immunity and preparation for subsequent oocyst development. This direct and global regulation by AP2-O provides a model for gene regulation in Plasmodium parasites and may explain how these parasites manage to control their complex life cycle using a small number of sequence-specific AP2 transcription factors.

Early Life Factors and Type 2 Diabetes Mellitus

Directory of Open Access Journals (Sweden)

Xinli Jiang

2013-01-01

Full Text Available Type 2 diabetes mellitus (T2DM is a multifactorial disease, and its aetiology involves a complex interplay between genetic, epigenetic, and environmental factors. In recent years, evidences from both human and animal experiments have correlated early life factors with programming diabetes risk in adult life. Fetal and neonatal period is crucial for organ development. Many maternal factors during pregnancy may increase the risk of diabetes of offsprings in later life, which include malnutrition, healthy (hyperglycemia and obesity, behavior (smoking, drinking, and junk food diet, hormone administration, and even stress. In neonates, catch-up growth, lactation, glucocorticoids administration, and stress have all been found to increase the risk of insulin resistance or T2DM. Unfavorable environments (socioeconomic situation and famine or obesity also has long-term negative effects on children by causing increased susceptibility to T2DM in adults. We also address the potential mechanisms that may underlie the developmental programming of T2DM. Therefore, it might be possible to prevent or delay the risk for T2DM by improving pre- and/or postnatal factors.

Data on the purification and crystallization of the loss-of-function von Willebrand disease variant (p.Gly1324Ser of the von Willebrand factor A1 domain

Directory of Open Access Journals (Sweden)

James C. Cambell

2016-06-01

In this data article we describe the production, quality control and crystallization of the p.Gly1324Ser vWD variant of the A1 domain of VWF. p.Gly1324Ser A1 was expressed in Escherichia coli as insoluble inclusion bodies. After the preparation of the inclusion bodies, the protein was solubilized, refolded, purified by affinity chromatography and crystallized. The crystal structure of the p.Gly1324Ser mutant of the A1 domain is deposited at the Protein Data Bank PDB: 5BV8

Blood coagulation abnormalities in multibacillary leprosy patients.

Science.gov (United States)

Silva, Débora Santos da; Teixeira, Lisandra Antonia Castro; Beghini, Daniela Gois; Ferreira, André Teixeira da Silva; Pinho, Márcia de Berredo Moreira; Rosa, Patricia Sammarco; Ribeiro, Marli Rambaldi; Freire, Monica Di Calafiori; Hacker, Mariana Andrea; Nery, José Augusto da Costa; Pessolani, Maria Cristina Vidal; Tovar, Ana Maria Freire; Sarno, Euzenir Nunes; Perales, Jonas; Bozza, Fernando Augusto; Esquenazi, Danuza; Monteiro, Robson Queiroz; Lara, Flavio Alves

2018-03-01

Leprosy is a chronic dermato-neurological disease caused by Mycobacterium leprae infection. In 2016, more than 200,000 new cases of leprosy were detected around the world, representing the most frequent cause of infectious irreversible deformities and disabilities. In the present work, we demonstrate a consistent procoagulant profile on 40 reactional and non-reactional multibacillary leprosy patients. A retrospective analysis in search of signs of coagulation abnormalities among 638 leprosy patients identified 35 leprosy patients (5.48%) which displayed a characteristic lipid-like clot formed between blood clot and serum during serum harvesting, herein named 'leprosum clot'. Most of these patients (n = 16, 45.7%) belonged to the lepromatous leprosy pole of the disease. In addition, formation of the leprosum clot was directly correlated with increased plasma levels of soluble tissue factor and von Willebrand factor. High performance thin layer chromatography demonstrated a high content of neutral lipids in the leprosum clot, and proteomic analysis demonstrated that the leprosum clot presented in these patients is highly enriched in fibrin. Remarkably, differential 2D-proteomics analysis between leprosum clots and control clots identified two proteins present only in leprosy patients clots: complement component 3 and 4 and inter-alpha-trypsin inhibitor family heavy chain-related protein (IHRP). In agreement with those observations we demonstrated that M. leprae induces hepatocytes release of IHRP in vitro. We demonstrated that leprosy MB patients develop a procoagulant status due to high levels of plasmatic fibrinogen, anti-cardiolipin antibodies, von Willebrand factor and soluble tissue factor. We propose that some of these components, fibrinogen for example, presents potential as predictive biomarkers of leprosy reactions, generating tools for earlier diagnosis and treatment of these events.

Enfermedades congénitas de la coagulación y manejo en Odontopediatría

Directory of Open Access Journals (Sweden)

Juan Manuel-Cortes-Ramírez

2012-02-01

Full Text Available El revisar un paciente en odontopediatría con hematomas y hemorragias es frecuente. El diagnóstico y el tratamiento dependen del conocimiento de los mecanismos normales de la hemostasia y de los laboratorios que los analizan1. Las manipulaciones en la cavidad bucal, máxime aquellas con extravasación de sangre, son un riesgo para los pacientes con trastornos de la coagulación, la prevención es la forma de evitar complicaciones, para ello debe disponer: de una historia clínica con énfasis en antecedentes personales y familiares de problemas hemorrágicos y del conocimiento de las patologías más frecuentes que lo originan así como su manejo2. Las hemorragias menores, son por factores locales, las graves por trastornos sistémicos de la hemostasia, como las coagulopatias congénitas2, grupo heterogéneo de enfermedades secundarias a alteraciones de las proteínas plasmáticas de la hemostasia primaria (ejemplo factor de von Willebrand, de la coagulación o de la fibrinólisis, defecto de un factor o combinación de 2 o más. Esta revisión se propone responder a estas interrogantes.

Uncertainty Evaluation of the Thermal Expansion of Gd2O3-ZrO2 with a System Calibration Factor

International Nuclear Information System (INIS)

Park, Chang Je; Kang, Kweon Ho; Na, Sang Ho; Song, Kee Chan

2007-01-01

Both gadolinia (Gd 2 O 3 ) and zirconia (ZrO 2 ) are widely used in the nuclear industry, including a burnable absorber and additives in the fabrication of a simulated fuel. Thermal expansions of a mixture of gadolinia (Gd 2 O 3 ) 20 mol% and zirconia (ZrO 2 ) 80 mol% were measured by using a dilatometer (DIL402C) from room temperature to 1500 .deg. C. Uncertainties in the measurement should be quantified based on statistics. Referring to the ISO (International Organization for Standardization) guide, the uncertainties of the thermal expansion were quantified for three parts - the initial length, the length variation, and the system calibration factor. The whole system, the dilatometer, is composed of many complex sub-systems and in fact it is difficult to consider all the uncertainties of the sub-systems. Thus, the system calibration factor was introduced with a standard material for the uncertainty evaluation. In this study, a new system calibration factor was formulated in a multiplicative way. Further, the effect of calibration factor with random deviation was investigated for the uncertainty evaluation of a thermal expansion

Resolution-limiting factors in 2-deoxyglucose autoradiography. I. Factors other than diffusion

Energy Technology Data Exchange (ETDEWEB)

Gallistel, C.R.; Nichols, S. (Pennsylvania Univ., Philadelphia, PA (USA). Dept. of Psychology)

1983-05-16

The authors measured the extent to which factors other than the diffusion of the radioactive label during tissue preparation limits the spatial resolving power of 2-deoxyglucose (2-DG) autoradiography. Radioactive swept frequency gratings were created using microcircuit lithography. The gratings consisted of alternating equal width radioactive and non-radioactive bars in groups of narrowing bar width (effective range 500-20 ..mu..m). The vertical thickness of the gratings ranged from 2.25 to 20 ..mu..m. The isotope in the radioactive bars was either /sup 14/C or /sup 3/H. A variety of X-ray films were exposed to these gratings and the resulting images scanned with microdensitometers or video digitizers to determine the fall off in image contrast (dark-bar values minus light-bar values) as a function of the number of dark bars (lines) per millimeter. The power of the isotope was the resolution limiting factor. Grating thickness and type of film made little difference. The limit of resolution with /sup 14/C was 10 lines/mm: with /sup 3/H it was 25 lines/mm. The microdensitometer itself is apt to be a resolution limiting factor; the resolving power of those commonly used in autoradiography is unlikely to exceed 10 lines/mm. From measurements of the steepness of gray-matter to white-matter transitions in the image from a tissue section, they conclude that the resolution in the image was no worse than 1.6-3.2 lines/mm. Either the isotope or diffusion of the 2-DG during tissue preparation must be the factor that limits resolution.

Nitric oxide level and von Willebrand factor (vWF) secretion are not ...

African Journals Online (AJOL)

Jane

2011-08-15

Aug 15, 2011 ... potassium channels; RBECs, rat brain capillary endothelial cells. and transport of ... addition, adenine nucleotides modulate the release of endothelial-derive ..... A cellular model of endothelial cell ischemia. J Surg Res. 44(5): ...

Mutation analysis and clinical implications of von Willebrand factor-cleaving protease deficiency.

NARCIS (Netherlands)

Assink, K.F.H.; Schiphorst, R.H.M.; Allford, S.; Karpman, D.; Etzioni, A.; Brichard, B.; Kar, N.C.A.J. van de; Monnens, L.A.H.; Heuvel, L.P.W.J. van den

2003-01-01

BACKGROUND: The pentad of thrombocytopenia, hemolytic anemia, mild renal dysfunction, neurologic signs, and fever, classically characterizes the syndrome of thrombotic thrombocytopenic purpura (TTP). TTP usually occurs in adults as an acquired form but a congenital form in children has also been

Antioxidant mechanism of black garlic extract involving nuclear factor erythroid 2-like factor 2 pathway.

Science.gov (United States)

Ha, Ae Wha; Kim, Woo Kyoung

2017-06-01

Although studies have revealed that black garlic is a potent antioxidant, its antioxidant mechanism remains unclear. The objective of this study was to determine black garlic's antioxidant activities and possible antioxidant mechanisms related to nuclear factor erythroid 2-like factor 2 (Nrf2)-Keap1 complex. After four weeks of feeding rats with a normal fat diet (NF), a high-fat diet (HF), a high-fat diet with 0.5% black garlic extract (HF+BGE 0.5), a high-fat diet with 1.0% black garlic extract (HF+BGE 1.0), or a high-fat diet with 1.5% black garlic extract (HF+BGE 1.5), plasma concentrations of glucose, insulin,homeostatic model assessment of insulin resistance (HOMA-IR) were determined. As oxidative stress indices, plasma concentrations of thiobarbituric acid reactive substances (TBARS) and 8-isoprostaglandin F2α (8-iso-PGF) were determined. To measure antioxidant capacities, plasma total antioxidant capacity (TAC) and activities of antioxidant enzymes in plasma and liver were determined. The mRNA expression levels of antioxidant related proteins such as Nrf2, NAD(P)H: quinone-oxidoreductase-1 (NQO1), heme oxygenase-1 (HO-1), glutathione reductase (GR), and glutathione S-transferase alpha 2 (GSTA2) were examined. Plasma glucose level, plasma insulin level, and HOMA-IR in black garlic supplemented groups were significantly ( P concentration and TAC in the HF+BGE 1.5 group were significantly decreased compared to those of the HF group. The activities of catalase and glutathione peroxidase were significantly ( P antioxidant systems in rats fed with black garlic extract were related to mRNA expression levels of Nrf2 related genes.

Genetic polymorphisms of hemostatic factors and thrombotic risk in non BCR-ABL myeloproliferative neoplasms: A pilot study

Directory of Open Access Journals (Sweden)

Dambrauskienė R

2017-06-01

Full Text Available The most important complications of Philadelphianegagive (non BCR-ABL myeloproliferative neoplasms (MPNs are vascular events. Our aim was to evaluate the effects of single nucleotide polymorphisms (SNPs, platelet glycoproteins (GPs (Ia/IIa, Ibα, IIb/IIIa and VI, von Willebrand factor (vWF, coagulation factor VII (FVII, β-fibrinogen, and the risk of thrombosis in patients with non BCR-ABL MPNs at the Lithuanian University of Health Sciences. Kaunas, Lithuania. Genotyping was done for 108 patients. The TT genotype of the GP Ia/IIa c.807C>T polymorphism was more frequently found in the group of MPN patients with arterial thrombosis compared to MPN patients who were thrombosis-free [26.5 vs. 11.5%, p = 0.049; odds ratio (OR 2.68; 95% confidence interval (95% CI 1.01-7.38]. The CT genotype of the β-fibrinogen c.-148C>T polymorphism occurred more frequently in MPN patients with arterial, and total thrombosis compared to the wild or homozygous genotype (57.7 vs. 40.0 vs. 12.5%; p = 0.027, (64.7 vs. 44.4 vs. 25%; p = 0.032, respectively. The carrier state for the c.-323P10 variant of FVII SNP (summation of P10/10 and P0/10 was more frequent in MPN patients with thrombosis compared to the wild-type genotype carriers (71.4 vs. 43.4%; p = 0.049; OR 3.26; 95% CI 1.01-11.31. The coexistence of heterozygous β-fibrinogen c.-148C>T and FVII c.-323P0/10 SNP, increased the risk of arterial thrombosis (21.1 vs. 3.7%, p = 0.008; OR 6.93; 95% CI 1.38-34.80. The TT genotype of GP Ia/IIa c.807C>T, the CT genotype of β-fibrinogen c.-148C>T and FVII c.-323P0/10 SNP could be associated with risk of thrombosis in MPN patients.

HEMOSTATIC SYSTEM CONDITION AND HEART REMODELING IN PATIENTS WITH Q-WAVE MYOCARDIAL INFARCTION WITH ACUTE ANEURYSMS AND LEFT VENTRICLE THROMBUS

Directory of Open Access Journals (Sweden)

V. D. Syvolap

2014-02-01

Full Text Available Introduction. Worldwide myocardial infarction (MI is one of the main causes of morbidity and mortality. Thanks to advances in modern cardiology we achieved a significant reduction in mortality and the incidence of fatal complications of acute Q-wave MI. However, keeping in mind the pathogenetic features of myocardial defeat of the left ventricle (LV cavity dilation and thinning at the focus of myocardial infarction, which increase the risk of left ventricular aneurysm development and parietal thrombus formation, it is impossible to reduce significantly the risk of these serious complications development. Post-infarction left ventricular aneurysm, extremely unfavorable prognostic factor complicates the course of Q-wave myocardial infarction in 30% of cases. The likelihood of parietal clot development in the anterior apical localization of aneurysms is 32%. The reasons of parietal clot formation are varied and are not fully disclosed, that is responsible for the relevance of this study. Aim: to investigate the serum level of protein C, von Willebrand factor, the expression of vascular adhesion molecules sVCAM-1, platelet aggregation properties and to evaluate their relationship with the structural and functional performance of the heart in patients with acute Q-wave myocardial infarction with aneurysm and parietal thrombus of LV. Methods. 110 patients (67 men and 43 women, mean age - 63,2 ± 5,7 years, with a diagnosis of acute Q-wave myocardial infarction were involved into the study. The first group included 72 patients with postinfarction left ventricular aneurysm, the second - 38 patients with postinfarction aneurysm and parietal thrombus of LV. Serum levels of protein C, von Willebrand factor, the expression of vascular adhesion molecules sVCAM-1, platelet aggregation properties were studied and their relationship with the structural and functional performance of the heart were evaluated. Results. There were revealed high activity of the key

Ambient hemolysis and activation of coagulation is different between HeartMate II and HeartWare left ventricular assist devices.

Science.gov (United States)

Birschmann, Ingvild; Dittrich, Marcus; Eller, Thomas; Wiegmann, Bettina; Reininger, Armin J; Budde, Ulrich; Strüber, Martin

2014-01-01

Thromboembolic and bleeding events in patients with a left ventricular assist device (LVAD) are still a major cause of complications. Therefore, the balance between anti-coagulant and pro-coagulant factors needs to be tightly controlled. The principle hypothesis of this study is that different pump designs may have an effect on hemolysis and activation of the coagulation system. Referring to this, the HeartMate II (HMII; Thoratec Corp, Pleasanton, CA) and the HeartWare HVAD (HeartWare International Inc, Framingham, MA) were investigated. For 20 patients with LVAD support (n = 10 each), plasma coagulation, full blood count, and clinical chemistry parameters were measured. Platelet function was monitored using platelet aggregometry, platelet function analyzer-100 system ( Siemens, Marburg, Germany), vasodilator-stimulated phosphoprotein phosphorylation assay, immature platelet fraction, platelet-derived microparticles, and von Willebrand diagnostic. Acquired von Willebrand syndrome could be detected in all patients. Signs of hemolysis, as measured by lactate dehydrogenase levels (mean, 470 U/liter HMII, 250 U/liter HVAD; p < 0.001), were more pronounced in the HMII patients. In contrast, D-dimer analysis indicated a significantly higher activation of the coagulation system in HVAD patients (mean, 0.94 mg/liter HMII, 2.01 mg/liter HVAD; p < 0.01). The efficacy of anti-platelet therapy using clopidogrel was not sufficient in more than 50% of the patients. Our results support the finding that all patients with rotary blood pumps suffered from von Willebrand syndrome. In addition, a distinct footprint of effects on hemolysis and the coagulation system can be attributed to different devices. As a consequence, the individual status of the coagulation system needs to be controlled in long-term patients. © 2013 Published by International Society for the Heart and Lung Transplantation on behalf of International Society for Heart and Lung Transplantation.

Data for a direct fibrinolytic metalloproteinase, barnettlysin-I from Bothrops barnetti (barnett,s pitviper) snake venom with anti-thrombotic effect

Science.gov (United States)

Sanchez, Eladio Flores; Richardson, Michael; Gremski, Luiza Helena; Veiga, Silvio Sanches; Yarleque, Armando; Niland, Stephan; Lima, Augusto Martins; Estevao-Costa, Maria Inácia; Eble, Johannes Andreas

2016-01-01

Initial association of platelets after vascular injury is mediated by glycoprotein (GP)Ib-IX-V binding to von Willebrand factor (vWf) immobilized on exposed collagens and eventually leads to thrombus formation. This article provides data about a new P-I class snake venom metalloproteinase (SVMP), barnettlysin-I (Bar-I), purified from the venom of Bothrops barnetti. This Data in Brief manuscript complements the main research article by providing additional data of the biochemical characterization of Bar-I 10.1016/j.bbagen.2015.12.021[1]. PMID:27222863

Ifit2 Is a Restriction Factor in Rabies Virus Pathogenicity.

Science.gov (United States)

Davis, Benjamin M; Fensterl, Volker; Lawrence, Tessa M; Hudacek, Andrew W; Sen, Ganes C; Schnell, Matthias J

2017-09-01

Understanding the interactions between rabies virus (RABV) and individual host cell proteins is critical for the development of targeted therapies. Here we report that interferon-induced protein with tetratricopeptide repeats 2 (Ifit2), an interferon-stimulated gene (ISG) with possible RNA-binding capacity, is an important restriction factor for rabies virus. When Ifit2 was depleted, RABV grew more quickly in mouse neuroblastoma cells in vitro This effect was replicated in vivo , where Ifit2 knockout mice displayed a dramatically more severe disease phenotype than wild-type mice after intranasal inoculation of RABV. This increase in pathogenicity correlated to an increase in RABV mRNA and live viral load in the brain, as well as to an accelerated spread to brain regions normally affected by this RABV model. These results suggest that Ifit2 exerts its antiviral effect mainly at the level of viral replication, as opposed to functioning as a mechanism that restricts viral entry/egress or transports RABV particles through axons. IMPORTANCE Rabies is a fatal zoonotic disease with a nearly 100% case fatality rate. Although there are effective vaccines for rabies, this disease still takes the lives of about 50,000 people each year. Victims tend to be children living in regions without comprehensive medical infrastructure who present to health care workers too late for postexposure prophylaxis. The protein discussed in our report, Ifit2, is found to be an important restriction factor for rabies virus, acting directly or indirectly against viral replication. A more nuanced understanding of this interaction may reveal a step of a pathway or site at which the system could be exploited for the development of a targeted therapy. Copyright © 2017 American Society for Microbiology.

The polymorphic integumentary mucin B.1 from Xenopus laevis contains the short consensus repeat.

Science.gov (United States)

Probst, J C; Hauser, F; Joba, W; Hoffmann, W

1992-03-25

The frog integumentary mucin B.1 (FIM-B.1), discovered by molecular cloning, contains a cysteine-rich C-terminal domain which is homologous with von Willebrand factor. With the help of the polymerase chain reaction, we now characterize a contiguous region 5' to the von Willebrand factor domain containing the short consensus repeat typical of many proteins from the complement system. Multiple transcripts have been cloned, which originate from a single animal and differ by a variable number of tandem repeats (rep-33 sequences). These different transcripts probably originate solely from two genes and are generated presumably by alternative splicing of an huge array of functional cassettes. This model is supported by analysis of genomic FIM-B.1 sequences from Xenopus laevis. Here, rep-33 sequences are arranged in an interrupted array of individual units. Additionally, results of Southern analysis revealed genetic polymorphism between different animals which is predicted to be within the tandem repeats. A first investigation of the predicted mucins with the help of a specific antibody against a synthetic peptide determined the molecular mass of FIM-B.1 to greater than 200 kDa. Here again, genetic polymorphism between different animals is detected.

Factor structure and psychometric properties of a Romanian translation of the Body Appreciation Scale-2.

Science.gov (United States)

Swami, Viren; Tudorel, Otilia; Goian, Cosmin; Barron, David; Vintila, Mona

2017-12-01

We examined the psychometric properties of a Romanian translation of the 10-item Body Appreciation Scale-2 (BAS-2). A total of 453 university students from Romania completed the BAS-2, along with measures of disordered eating, self-esteem, satisfaction with life, and subjective happiness. In addition, a separate sample of university students (N=109) completed only the BAS-2 at two time-points three weeks apart. Principal-axis factor analysis indicated that BAS-2 scores had a one-dimensional factor structure in both women and men. Confirmatory factor analysis indicated that this factor structure had adequate fit, but invariance across sex was not supported. Further analyses indicated that BAS-2 scores evidenced internal consistency, convergent validity, and test-retest reliability in both women and men. These results suggest that BAS-2 scores reduce to one dimension in Romanian adults, but the lack of sex invariance may indicate that the same latent construct is not being measured in women and men. Copyright © 2017 Elsevier Ltd. All rights reserved.

Two-body form factors at high Q2

International Nuclear Information System (INIS)

Gross, F.; Keister, B.D.

1983-02-01

The charge form factor of a scalar deuteron at high momentum transfer is examined in a model employing scalar nucleons and mesons. With an eye toward establishing consistency criteria for more realistic calculations, several aspects of the model are examined in detail: the role of nucleon and meson singularities in the one-loop impulse diagram, the role of positive-and negative-energy nucleons, and the relationship to time-ordered perturbation theory. It is found that at large Q 2 (1) the form factor is dominated by a term in which the spectator nucleon is on the mass shell, and (2) the meson singularity structure of the d-n-p vertex function is unimportant in determining the overall high-Q 2 behaviour of the form factor

Synergistic shortening of the bleeding time by desmopressin and ethamsylate in patients with various constitutional bleeding disorders.

Science.gov (United States)

Kobrinsky, N L; Israels, E D; Bickis, M G

1991-01-01

Desmopressin and ethamsylate were evaluated for possible synergistic effects on the bleeding time. The drugs were administered individually and together to 12 patients with markedly prolonged bleeding times known to be relatively or absolutely unresponsive to desmopressin alone. The bleeding disorders studied included Glanzmann's thrombasthenia (one), other disorders of platelet function (four), pseudo-von Willebrand disease (one), and von Willebrand disease type I (three), type II (two), and type III (one). Desmopressin alone shortened the bleeding time from 23.9 +/- 1.5 to 19.5 +/- 2.3 min (p = 0.03). Ethamsylate alone was without effect. Desmopressin and ethamsylate together shortened the bleeding time to 11.2 +/- 1.4 min (p less than 0.01 compared to baseline, p = 0.02 compared to desmopressin alone). The combination was ineffective in three patients, with Glanzmann's thrombasthenia (one), and von Willebrand disease type I (one) and type III (one). Toxic effects of the drugs were not observed. Five patients received desmopressin and ethamsylate prior to dental work with mandibular block (one), heart surgery requiring cardiopulmonary bypass (two), and adenotonsillectomy surgery (two). Normal hemostasis was achieved in each case. A synergistic shortening of the bleeding time was observed with the combination of desmopressin and ethamsylate in a wide range of bleeding disorders.

Nuclear factor erythroid 2-related factor 2 deletion impairs glucose tolerance and exacerbates hyperglycemia in type 1 diabetic mice.

Science.gov (United States)

Aleksunes, Lauren M; Reisman, Scott A; Yeager, Ronnie L; Goedken, Michael J; Klaassen, Curtis D

2010-04-01

The transcription factor nuclear factor erythroid 2-related factor 2 (Nrf2) induces a battery of cytoprotective genes after oxidative stress. Nrf2 aids in liver regeneration by altering insulin signaling; however, whether Nrf2 participates in hepatic glucose homeostasis is unknown. Compared with wild-type mice, mice lacking Nrf2 (Nrf2-null) have lower basal serum insulin and prolonged hyperglycemia in response to an intraperitoneal glucose challenge. In the present study, blood glucose, serum insulin, urine flow rate, and hepatic expression of glucose-related genes were quantified in male diabetic wild-type and Nrf2-null mice. Type 1 diabetes was induced with a single intraperitoneal dose (200 mg/kg) of streptozotocin (STZ). Histopathology and serum insulin levels confirmed depleted pancreatic beta-cells in STZ-treated mice of both genotypes. Five days after STZ, Nrf2-null mice had higher blood glucose levels than wild-type mice. Nine days after STZ, polyuria occurred in both genotypes with more urine output from Nrf2-null mice (11-fold) than wild-type mice (7-fold). Moreover, STZ-treated Nrf2-null mice had higher levels of serum beta-hydroxybutyrate, triglycerides, and fatty acids 10 days after STZ compared with wild-type mice. STZ reduced hepatic glycogen in both genotypes, with less observed in Nrf2-null mice. Increased urine output and blood glucose in STZ-treated Nrf2-null mice corresponded with enhanced gluconeogenesis (glucose-6-phosphatase and phosphoenolpyruvate carboxykinase)- and reduced glycolysis (pyruvate kinase)-related mRNA expression in their livers. Furthermore, the Nrf2 activator oltipraz lowered blood glucose in wild-type but not Nrf2-null mice administered STZ. Collectively, these data indicate that the absence of Nrf2 worsens hyperglycemia in type I diabetic mice and Nrf2 may represent a therapeutic target for reducing circulating glucose levels.

Identification and characterisation of a G-quadruplex forming sequence in the promoter region of nuclear factor (erythroid-derived 2)-like 2 (Nrf2)

Energy Technology Data Exchange (ETDEWEB)

Waller, Zoë A.E., E-mail: z.waller@uea.ac.uk; Howell, Lesley A.; MacDonald, Colin J.; O’Connell, Maria A.; Searcey, Mark, E-mail: m.searcey@uea.ac.uk

2014-04-25

Highlights: • Discovery of a G-quadruplex forming sequence in the promoter sequence of Nrf2. • Characterisation of the G-quadruplex by UV, CD and NMR. • Conformational switching of G-quadruplex induced by 9-aminoacridine. - Abstract: The transcription factor nuclear factor (erythroid-derived 2)-like 2 (Nrf2) regulates multiple antioxidants, Phase II detoxification enzymes and other cytoprotective enzymes in cells. Activation of Nrf2 is recognised as being of potential therapeutic benefit in inflammatory-diseases whereas more recently, it has become clear that the inhibition of Nrf2 may have benefit in the alleviation of resistance in some tumour types. A potential G-quadruplex forming sequence was identified in the promoter region of Nrf2, close to a number of putative transcription factor binding sites. Characterisation of the sequence 5’-d[GGGAAGGGAGCAAGGGCGGGAGGG]-3’ using CD spectroscopy, imino proton NMR resonances and UV melting experiments demonstrated the formation of a parallel intramolecular G-quadruplex in the presence of K{sup +} ions. Incubation with 9-aminoacridine ligands induced a switch from antiparallel to parallel forms. The presence of a G-quadruplex forming sequence in the promoter region of Nrf2 suggests an approach to targeting the production of the protein through stabilisation of the structure, thereby avoiding resistance to antitumour drugs.

Deficiency in the nuclear factor E2-related factor 2 renders pancreatic β-cells vulnerable to arsenic-induced cell damage

International Nuclear Information System (INIS)

Yang, Bei; Fu, Jingqi; Zheng, Hongzhi; Xue, Peng; Yarborough, Kathy; Woods, Courtney G.; Hou, Yongyong; Zhang, Qiang; Andersen, Melvin E.; Pi, Jingbo

2012-01-01

Chronic human exposure to inorganic arsenic (iAs), a potent environmental oxidative stressor, is associated with increased prevalence of type 2 diabetes, where impairment of pancreatic β-cell function is a key pathogenic factor. Nuclear factor E2-related factor 2 (Nrf2) is a central transcription factor regulating cellular adaptive response to oxidative stress. However, persistent activation of Nrf2 in response to chronic oxidative stress, including inorganic arsenite (iAs 3+ ) exposure, blunts glucose-triggered reactive oxygen species (ROS) signaling and impairs glucose-stimulated insulin secretion (GSIS). In the current study, we found that MIN6 pancreatic β-cells with stable knockdown of Nrf2 (Nrf2-KD) by lentiviral shRNA and pancreatic islets isolated from Nrf2-knockout (Nrf2−/−) mice exhibited reduced expression of several antioxidant and detoxification enzymes in response to acute iAs 3+ exposure. As a result, Nrf2-KD MIN6 cells and Nrf2−/− islets were more susceptible to iAs 3+ and monomethylarsonous acid (MMA 3+ )-induced cell damage, as measured by decreased cell viability, augmented apoptosis and morphological change. Pretreatment of MIN6 cells with Nrf2 activator tert-butylhydroquinone protected the cells from iAs 3+ -induced cell damage in an Nrf2-dependent fashion. In contrast, antioxidant N‐acetyl cysteine protected Nrf2-KD MIN6 cells against acute cytotoxicity of iAs 3+ . The present study demonstrates that Nrf2-mediated antioxidant response is critical in the pancreatic β-cell defense mechanism against acute cytotoxicity by arsenic. The findings here, combined with our previous results on the inhibitory effect of antioxidants on ROS signaling and GSIS, suggest that Nrf2 plays paradoxical roles in pancreatic β-cell dysfunction induced by environmental arsenic exposure. -- Highlights: ► Lack of Nrf2 reduced expression of antioxidant genes induced by iAs 3+ in β-cells. ► Deficiency of Nrf2 in β-cells sensitized to iAs 3+ and MMA 3

Deficiency in the nuclear factor E2-related factor 2 renders pancreatic β-cells vulnerable to arsenic-induced cell damage

Energy Technology Data Exchange (ETDEWEB)

Yang, Bei [Institute for Chemical Safety Sciences, The Hamner Institutes for Health Sciences, 6 Davis Drive, Research Triangle Park, NC 27709 (United States); Department of Histology and Embryology, College of Basic Medical Sciences, China Medical University, Shenyang 110001 (China); Fu, Jingqi; Zheng, Hongzhi; Xue, Peng; Yarborough, Kathy; Woods, Courtney G.; Hou, Yongyong; Zhang, Qiang; Andersen, Melvin E. [Institute for Chemical Safety Sciences, The Hamner Institutes for Health Sciences, 6 Davis Drive, Research Triangle Park, NC 27709 (United States); Pi, Jingbo, E-mail: jpi@thehamner.org [Institute for Chemical Safety Sciences, The Hamner Institutes for Health Sciences, 6 Davis Drive, Research Triangle Park, NC 27709 (United States)

2012-11-01

Chronic human exposure to inorganic arsenic (iAs), a potent environmental oxidative stressor, is associated with increased prevalence of type 2 diabetes, where impairment of pancreatic β-cell function is a key pathogenic factor. Nuclear factor E2-related factor 2 (Nrf2) is a central transcription factor regulating cellular adaptive response to oxidative stress. However, persistent activation of Nrf2 in response to chronic oxidative stress, including inorganic arsenite (iAs{sup 3+}) exposure, blunts glucose-triggered reactive oxygen species (ROS) signaling and impairs glucose-stimulated insulin secretion (GSIS). In the current study, we found that MIN6 pancreatic β-cells with stable knockdown of Nrf2 (Nrf2-KD) by lentiviral shRNA and pancreatic islets isolated from Nrf2-knockout (Nrf2−/−) mice exhibited reduced expression of several antioxidant and detoxification enzymes in response to acute iAs{sup 3+} exposure. As a result, Nrf2-KD MIN6 cells and Nrf2−/− islets were more susceptible to iAs{sup 3+} and monomethylarsonous acid (MMA{sup 3+})-induced cell damage, as measured by decreased cell viability, augmented apoptosis and morphological change. Pretreatment of MIN6 cells with Nrf2 activator tert-butylhydroquinone protected the cells from iAs{sup 3+}-induced cell damage in an Nrf2-dependent fashion. In contrast, antioxidant N‐acetyl cysteine protected Nrf2-KD MIN6 cells against acute cytotoxicity of iAs{sup 3+}. The present study demonstrates that Nrf2-mediated antioxidant response is critical in the pancreatic β-cell defense mechanism against acute cytotoxicity by arsenic. The findings here, combined with our previous results on the inhibitory effect of antioxidants on ROS signaling and GSIS, suggest that Nrf2 plays paradoxical roles in pancreatic β-cell dysfunction induced by environmental arsenic exposure. -- Highlights: ► Lack of Nrf2 reduced expression of antioxidant genes induced by iAs{sup 3+} in β-cells. ► Deficiency of Nrf2 in �

Glucose variability for cardiovascular risk factors in type 2 diabetes: a meta-analysis

OpenAIRE

Liang, Shuang; Yin, Hang; Wei, Chunxiang; Xie, Linjun; He, Hua; Liu, Xiaoquan

2017-01-01

Aims It is consensus that glucose variability (GV) plays an important role in maccomplications of type 2 diabetes, but whether GV has a causal role is not yet clear for cardiovascular disease (CVD). This study sought to explore the effect on GV for CVD risk factors with type 2 diabetes. Methods The systematic literature search was performed to identify all GV and CVD risk factors, including total cholesterol (TC), LDL cholesterol (LDL-C), triglyceride (TG), HDL cholesterol (HDL-C), Body Mass ...

Deuteron A(Q2) structure function and the neutron electric form factor

International Nuclear Information System (INIS)

Platchkov, S.; Amroun, A.; Auffret, S.; Cavedon, J.M.; Dreux, P.; Duclos, J.; Frois, B.; Goutte, D.; Hachemi, H.; Martino, J.

1989-01-01

We present new measurements of the deuteron A(Q 2 ) structure function in the momentum transfer region between 1 and 18 fm -2 . The accuracy of the data ranges from 2% to 6%. We investigate the sensitivity of A(Q 2 ) to the nucleon-nucleon interaction and to the neutron electric form factor G E n . Our analysis shows that below 20 fm -2 G E n can be inferred from these data with a significantly improved accuracy. The model dependence of this analysis is discussed

Iron-Deficiency Anemia

Medline Plus

Full Text Available ... trimester of pregnancy. Children between ages 1 and 2, especially if they drink a lot of cow’s milk. Cow’s milk is low in ... Willebrand disease is an inherited bleeding disorder ...

Prolonged activated prothromboplastin time and breed specific variation in haemostatic analytes in healthy adult Bernese Mountain dogs

DEFF Research Database (Denmark)

Nielsen, Lise; Wiinberg, Bo; Kjelgaard-Hansen, Mads

2011-01-01

Coagulation tests are often performed in dogs suspected of haemostatic dysfunction and are interpreted according to validated laboratory reference intervals (RIs). Breed specific RIs for haematological and biochemical analytes have previously been identified in Bernese Mountain dogs, but it remains...... to be determined if breed specific RIs are necessary for haemostasis tests. Activated prothromboplastin time (aPTT), prothrombin time (PT), selected coagulation factors, D-dimers, fibrinogen, von Willebrand factor and thromboelastography (TEG) were analyzed in healthy Bernese Mountain dogs using the CLSI model...

Blood coagulation abnormalities in multibacillary leprosy patients.

Directory of Open Access Journals (Sweden)

Débora Santos da Silva

2018-03-01

Full Text Available Leprosy is a chronic dermato-neurological disease caused by Mycobacterium leprae infection. In 2016, more than 200,000 new cases of leprosy were detected around the world, representing the most frequent cause of infectious irreversible deformities and disabilities.In the present work, we demonstrate a consistent procoagulant profile on 40 reactional and non-reactional multibacillary leprosy patients. A retrospective analysis in search of signs of coagulation abnormalities among 638 leprosy patients identified 35 leprosy patients (5.48% which displayed a characteristic lipid-like clot formed between blood clot and serum during serum harvesting, herein named 'leprosum clot'. Most of these patients (n = 16, 45.7% belonged to the lepromatous leprosy pole of the disease. In addition, formation of the leprosum clot was directly correlated with increased plasma levels of soluble tissue factor and von Willebrand factor. High performance thin layer chromatography demonstrated a high content of neutral lipids in the leprosum clot, and proteomic analysis demonstrated that the leprosum clot presented in these patients is highly enriched in fibrin. Remarkably, differential 2D-proteomics analysis between leprosum clots and control clots identified two proteins present only in leprosy patients clots: complement component 3 and 4 and inter-alpha-trypsin inhibitor family heavy chain-related protein (IHRP. In agreement with those observations we demonstrated that M. leprae induces hepatocytes release of IHRP in vitro.We demonstrated that leprosy MB patients develop a procoagulant status due to high levels of plasmatic fibrinogen, anti-cardiolipin antibodies, von Willebrand factor and soluble tissue factor. We propose that some of these components, fibrinogen for example, presents potential as predictive biomarkers of leprosy reactions, generating tools for earlier diagnosis and treatment of these events.

von Willebrand Disease

Science.gov (United States)

... results from a physical exam and tests. Medical History Your doctor will likely ask questions about your ... a medical center that specializes in high-risk obstetrics and has a hematologist on staff for prenatal ...

Identification of a novel A20-binding inhibitor of nuclear factor-kappa B activation termed ABIN-2.

Science.gov (United States)

Van Huffel, S; Delaei, F; Heyninck, K; De Valck, D; Beyaert, R

2001-08-10

The nuclear factor kappaB (NF-kappaB) plays a central role in the regulation of genes implicated in immune responses, inflammatory processes, and apoptotic cell death. The zinc finger protein A20 is a cellular inhibitor of NF-kappaB activation by various stimuli and plays a critical role in terminating NF-kappaB responses. The underlying mechanism for NF-kappaB inhibition by A20 is still unknown. A20 has been shown to interact with several proteins including tumor necrosis factor (TNF) receptor-associated factors 2 and 6, as well as the inhibitory protein of kappaB kinase (IKK) gamma protein. Here we report the cloning and characterization of ABIN-2, a previously unknown protein that binds to the COOH-terminal zinc finger domain of A20. NF-kappaB activation induced by TNF and interleukin-1 is inhibited by overexpression of ABIN-2. The latter also inhibits NF-kappaB activation induced by overexpression of receptor-interacting protein or TNF receptor-associated factor 2. In contrast, NF-kappaB activation by overexpression of IKKbeta or direct activators of the IKK complex, such as Tax, cannot be inhibited by ABIN-2. These results indicate that ABIN-2 interferes with NF-kappaB activation upstream of the IKK complex and that it might contribute to the NF-kappaB-inhibitory function of A20.

EphA2 is a functional receptor for the growth factor progranulin.

Science.gov (United States)

Neill, Thomas; Buraschi, Simone; Goyal, Atul; Sharpe, Catherine; Natkanski, Elizabeth; Schaefer, Liliana; Morrione, Andrea; Iozzo, Renato V

2016-12-05

Although the growth factor progranulin was discovered more than two decades ago, the functional receptor remains elusive. Here, we discovered that EphA2, a member of the large family of Ephrin receptor tyrosine kinases, is a functional signaling receptor for progranulin. Recombinant progranulin bound with high affinity to EphA2 in both solid phase and solution. Interaction of progranulin with EphA2 caused prolonged activation of the receptor, downstream stimulation of mitogen-activated protein kinase and Akt, and promotion of capillary morphogenesis. Furthermore, we found an autoregulatory mechanism of progranulin whereby a feed-forward loop occurred in an EphA2-dependent manner that was independent of the endocytic receptor sortilin. The discovery of a functional signaling receptor for progranulin offers a new avenue for understanding the underlying mode of action of progranulin in cancer progression, tumor angiogenesis, and perhaps neurodegenerative diseases. © 2016 Neill et al.

Inhibition of tumor metastasis by a growth factor receptor bound protein 2 Src homology 2 domain-binding antagonist.

Science.gov (United States)

Giubellino, Alessio; Gao, Yang; Lee, Sunmin; Lee, Min-Jung; Vasselli, James R; Medepalli, Sampath; Trepel, Jane B; Burke, Terrence R; Bottaro, Donald P

2007-07-01

Metastasis, the primary cause of death in most forms of cancer, is a multistep process whereby cells from the primary tumor spread systemically and colonize distant new sites. Blocking critical steps in this process could potentially inhibit tumor metastasis and dramatically improve cancer survival rates; however, our understanding of metastasis at the molecular level is still rudimentary. Growth factor receptor binding protein 2 (Grb2) is a widely expressed adapter protein with roles in epithelial cell growth and morphogenesis, as well as angiogenesis, making it a logical target for anticancer drug development. We have previously shown that a potent antagonist of Grb2 Src homology-2 domain-binding, C90, blocks growth factor-driven cell motility in vitro and angiogenesis in vivo. We now report that C90 inhibits metastasis in vivo in two aggressive tumor models, without affecting primary tumor growth rate. These results support the potential efficacy of this compound in reducing the metastatic spread of primary solid tumors and establish a critical role for Grb2 Src homology-2 domain-mediated interactions in this process.

Nuclear factor erythroid 2-related factor-2 activity controls 4-hydroxynonenal metabolism and activity in prostate cancer cells.

Science.gov (United States)

Pettazzoni, Piergiorgio; Ciamporcero, Eric; Medana, Claudio; Pizzimenti, Stefania; Dal Bello, Federica; Minero, Valerio Giacomo; Toaldo, Cristina; Minelli, Rosalba; Uchida, Koji; Dianzani, Mario Umberto; Pili, Roberto; Barrera, Giuseppina

2011-10-15

4-Hydroxynonenal (HNE) is an end product of lipoperoxidation with antiproliferative and proapoptotic properties in various tumors. Here we report a greater sensitivity to HNE in PC3 and LNCaP cells compared to DU145 cells. In contrast to PC3 and LNCaP cells, HNE-treated DU145 cells showed a smaller reduction in growth and did not undergo apoptosis. In DU145 cells, HNE did not induce ROS production and DNA damage and generated a lower amount of HNE-protein adducts. DU145 cells had a greater GSH and GST A4 content and GSH/GST-mediated HNE detoxification. Nuclear factor erythroid 2-related factor-2 (Nrf2) is a regulator of the antioxidant response. Nrf2 protein content and nuclear accumulation were higher in DU145 cells compared to PC3 and LNCaP cells, whereas the expression of KEAP1, the main negative regulator of Nrf2 activity, was lower. Inhibition of Nrf2 expression with specific siRNA resulted in a reduction in GST A4 expression and GS-HNE formation, indicating that Nrf2 controls HNE metabolism. In addition, Nrf2 knockdown sensitized DU145 cells to HNE-mediated antiproliferative and proapoptotic activity. In conclusion, we demonstrated that increased Nrf2 activity resulted in a reduction in HNE sensitivity in prostate cancer cells, suggesting a potential mechanism of resistance to pro-oxidant therapy. Copyright © 2011 Elsevier Inc. All rights reserved.

Empirical Study of Decomposition of CO2 Emission Factors in China

Directory of Open Access Journals (Sweden)

Yadong Ning

2013-01-01

Full Text Available China’s CO2 emissions increase has attracted world’s attention. It is of great importance to analyze China’s CO2 emission factors to restrain the CO2 rapid growing. The CO2 emissions of industrial and residential consumption sectors in China during 1980–2010 were calculated in this paper. The expanded decomposition model of CO2 emissions was set up by adopting factor-separating method based on the basic principle of the Kaya identities. The results showed that CO2 emissions of industrial and residential consumption sectors increase year after year, and the scale effect of GDP is the most important factor affecting CO2 emissions of industrial sector. Decreasing the specific gravity of secondary industry and energy intensity is more effective than decreasing the primary industry and tertiary industry. The emissions reduction effect of structure factor is better than the efficiency factor. For residential consumption sector, CO2 emissions increase rapidly year after year, and the economy factor (the increase of wealthy degree or income is the most important factor. In order to slow down the growth of CO2 emissions, it is an important way to change the economic growth mode, and the structure factor will become a crucial factor.

Cuf2 Is a Novel Meiosis-Specific Regulatory Factor of Meiosis Maturation

Science.gov (United States)

Ioannoni, Raphael; Beaudoin, Jude; Lopez-Maury, Luis; Codlin, Sandra; Bahler, Jurg; Labbe, Simon

2012-01-01

Background Meiosis is the specialized form of the cell cycle by which diploid cells produce the haploid gametes required for sexual reproduction. Initiation and progression through meiosis requires that the expression of the meiotic genes is precisely controlled so as to provide the correct gene products at the correct times. During meiosis, four temporal gene clusters are either induced or repressed by a cascade of transcription factors. Principal Findings In this report a novel copper-fist-type regulator, Cuf2, is shown to be expressed exclusively during meiosis. The expression profile of the cuf2+ mRNA revealed that it was induced during middle-phase meiosis. Both cuf2+ mRNA and protein levels are unregulated by copper addition or starvation. The transcription of cuf2+ required the presence of a functional mei4+ gene encoding a key transcription factor that activates the expression of numerous middle meiotic genes. Microscopic analyses of cells expressing a functional Cuf2-GFP protein revealed that Cuf2 co-localized with both homologous chromosomes and sister chromatids during the meiotic divisions. Cells lacking Cuf2 showed an elevated and sustained expression of several of the middle meiotic genes that persisted even during late meiosis. Moreover, cells carrying disrupted cuf2Δ/cuf2Δ alleles displayed an abnormal morphology of the forespore membranes and a dramatic reduction of spore viability. Significance Collectively, the results revealed that Cuf2 functions in the timely repression of the middle-phase genes during meiotic differentiation. PMID:22558440

The Role of Protein Elongation Factor EEF1A2 in Breast Cancer

National Research Council Canada - National Science Library

Lee, Jonathan M

2004-01-01

... overexpression can be used as a breast cancer prognostic factor. In addition, we proposed to test the idea that EEF1A2 expression modulates sensitivity to cisplatin and taxol and that EEF1A2-inactivation could be used as a treatment for breast cancer...

Is anti-platelet therapy needed in continuous flow left ventricular assist device patients? A single-centre experience.

Science.gov (United States)

Litzler, Pierre-Yves; Smail, Hassiba; Barbay, Virginie; Nafeh-Bizet, Catherine; Bouchart, François; Baste, Jean-Marc; Abriou, Caroline; Bessou, Jean-Paul

2014-01-01

We report our 5-year experience of continuous flow left ventricular assist device (LVAD) implantation without the use of anti-platelet therapy. Between February 2006 and September 2011, 27 patients (26 men; 1 woman) were implanted with a continuous flow LVAD (HeartMate II, Thoratec Corporation, Pleasanton, CA, USA). The mean age was 55.7 ± 9.9 years. The mean duration of support was 479 ± 436 (1-1555) days with 35.4 patient-years on support. Twenty-one patients were implanted as a bridge to transplantation and 6 for destination therapy. The anticoagulation regimen was fluindione for all patients, with aspirin for only 4 patients. At the beginning of our experience, aspirin was administered to 4 patients for 6, 15, 60 and 460 days. Due to gastrointestinal (GI) bleeding and epistaxis, aspirin was discontinued, and since August 2006, no patients have received anti-platelet therapy. At 3 years, the survival rate during support was 76%. The most common postoperative adverse event was GI bleeding (19%) and epistaxis (30%) (median time: 26 days) for patients receiving fluindione and aspirin. The mean International Normalized Ratio (INR) was 2.58 ± 0.74 during support. Fifteen patients have been tested for acquired Von Willebrand disease. A diminished ratio of collagen-binding capacity and ristocetin cofactor activity to Von Willebrand factor antigen was observed in 7 patients. In the postoperative period, 2 patients presented with ischaemic stroke at 1 and 8 months. One of these 2 patients had a previous history of carotid stenosis with ischaemic stroke. There were no patients with haemorrhagic stroke, transient ischaemic attack or pump thrombosis. The event rate of stroke (ischaemic and haemorrhagic) per patient-year was 0.059 among the patients without aspirin with fluindione regimen only. A fluindione regimen without aspirin in long-duration LVAD support appears to not increase thromboembolic events and could lead to a diminished risk of haemorrhagic stroke.

Daboxin P, a Major Phospholipase A2 Enzyme from the Indian Daboia russelii russelii Venom Targets Factor X and Factor Xa for Its Anticoagulant Activity.

Directory of Open Access Journals (Sweden)

Maitreyee Sharma

Full Text Available In the present study a major protein has been purified from the venom of Indian Daboia russelii russelii using gel filtration, ion exchange and Rp-HPLC techniques. The purified protein, named daboxin P accounts for ~24% of the total protein of the crude venom and has a molecular mass of 13.597 kDa. It exhibits strong anticoagulant and phospholipase A2 activity but is devoid of any cytotoxic effect on the tested normal or cancerous cell lines. Its primary structure was deduced by N-terminal sequencing and chemical cleavage using Edman degradation and tandem mass spectrometry. It is composed of 121 amino acids with 14 cysteine residues and catalytically active His48 -Asp49 pair. The secondary structure of daboxin P constitutes 42.73% of α-helix and 12.36% of β-sheet. It is found to be stable at acidic (pH 3.0 and neutral pH (pH 7.0 and has a Tm value of 71.59 ± 0.46°C. Daboxin P exhibits anticoagulant effect under in-vitro and in-vivo conditions. It does not inhibit the catalytic activity of the serine proteases but inhibits the activation of factor X to factor Xa by the tenase complexes both in the presence and absence of phospholipids. It also inhibits the tenase complexes when active site residue (His48 was alkylated suggesting its non-enzymatic mode of anticoagulant activity. Moreover, it also inhibits prothrombinase complex when pre-incubated with factor Xa prior to factor Va addition. Fluorescence emission spectroscopy and affinity chromatography suggest the probable interaction of daboxin P with factor X and factor Xa. Molecular docking analysis reveals the interaction of the Ca+2 binding loop; helix C; anticoagulant region and C-terminal region of daboxin P with the heavy chain of factor Xa. This is the first report of a phospholipase A2 enzyme from Indian viper venom which targets both factor X and factor Xa for its anticoagulant activity.

Real-time particle monitor calibration factors and PM2.5 emission factors for multiple indoor sources.

Science.gov (United States)

Dacunto, Philip J; Cheng, Kai-Chung; Acevedo-Bolton, Viviana; Jiang, Ruo-Ting; Klepeis, Neil E; Repace, James L; Ott, Wayne R; Hildemann, Lynn M

2013-08-01

Indoor sources can greatly contribute to personal exposure to particulate matter less than 2.5 μm in diameter (PM2.5). To accurately assess PM2.5 mass emission factors and concentrations, real-time particle monitors must be calibrated for individual sources. Sixty-six experiments were conducted with a common, real-time laser photometer (TSI SidePak™ Model AM510 Personal Aerosol Monitor) and a filter-based PM2.5 gravimetric sampler to quantify the monitor calibration factors (CFs), and to estimate emission factors for common indoor sources including cigarettes, incense, cooking, candles, and fireplaces. Calibration factors for these indoor sources were all significantly less than the factory-set CF of 1.0, ranging from 0.32 (cigarette smoke) to 0.70 (hamburger). Stick incense had a CF of 0.35, while fireplace emissions ranged from 0.44-0.47. Cooking source CFs ranged from 0.41 (fried bacon) to 0.65-0.70 (fried pork chops, salmon, and hamburger). The CFs of combined sources (e.g., cooking and cigarette emissions mixed) were linear combinations of the CFs of the component sources. The highest PM2.5 emission factors per time period were from burned foods and fireplaces (15-16 mg min(-1)), and the lowest from cooking foods such as pizza and ground beef (0.1-0.2 mg min(-1)).

International inequalities in per capita CO2 emissions: a decomposition methodology by Kaya factors

International Nuclear Information System (INIS)

Duro, J.A.; Universitat de Barcelona; Padilla, E.

2006-01-01

In this paper, we provide a methodology for decomposing international inequalities in per capita CO 2 emissions into Kaya (multiplicative) factors and two interaction terms. We use the Theil index of inequality and show that this decomposition methodology can be extended for analyzing between- and within-group inequality components. We can thus analyze the factors behind inequalities in per capita CO 2 emissions across countries, between groups of countries and within groups of countries. The empirical illustration for international data suggests some points. Firstly, international inequality in per capita CO 2 emissions is mainly attributable to inequalities in per capita income levels, which helps to explain its recent reduction, while differences in carbon intensity of energy and energy intensity have made a less significant contribution. This result is strongly influenced by the performance of China and India. Secondly, the between-group inequality component, which is the biggest component, is also largely explained by the income factor. Thirdly, the within-group inequality component increased slightly during the period, something mainly due to the change in the income factor and the interaction terms in a few regions. (author)

48 CFR 215.370-2 - Evaluation factor.

Science.gov (United States)

2010-10-01

... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Evaluation factor. 215.370..., DEPARTMENT OF DEFENSE CONTRACTING METHODS AND CONTRACT TYPES CONTRACTING BY NEGOTIATION Source Selection 215.370-2 Evaluation factor. In accordance with Section 819 of the National Defense Authorization Act for...

Fibroblast growth factor-2 induces osteogenic differentiation through a Runx2 activation in vascular smooth muscle cells

Energy Technology Data Exchange (ETDEWEB)

Nakahara, Takehiro; Sato, Hiroko; Shimizu, Takehisa; Tanaka, Toru; Matsui, Hiroki; Kawai-Kowase, Keiko; Sato, Mahito; Iso, Tatsuya; Arai, Masashi [Department of Medicine and Biological Science, Gunma University Graduate School of Medicine, 3-39-15 Showa-machi, Maebashi, Gunma 371-8511 (Japan); Kurabayashi, Masahiko, E-mail: mkuraba@med.gunma-u.ac.jp [Department of Medicine and Biological Science, Gunma University Graduate School of Medicine, 3-39-15 Showa-machi, Maebashi, Gunma 371-8511 (Japan)

2010-04-02

Expression of bone-associated proteins and osteoblastic transcription factor Runx2 in arterial cells has been implicated in the development of vascular calcification. However, the signaling upstream of the Runx2-mediated activation of osteoblastic program in vascular smooth muscle cells (VSMC) is poorly understood. We examined the effects of fibroblast growth factor-2 (FGF-2), an important regulator of bone formation, on osteoblastic differentiation of VSMC. Stimulation of cultured rat aortic SMC (RASMC) with FGF-2 induced the expression of the osteoblastic markers osteopontin (OPN) and osteocalcin. Luciferase assays showed that FGF-2 induced osteocyte-specific element (OSE)-dependent transcription. Downregulation of Runx2 by siRNA repressed the basal and FGF-2-stimulated expression of the OPN gene in RASMC. FGF-2 produced hydrogen peroxide in RASMC, as evaluated by fluorescent probe. Induction of OPN expression by FGF-2 was inhibited not only by PD98059 (MEK1 inhibitor) and PP1 (c-Src inhibitor), but also by an antioxidant, N-acetyl cysteine. Nuclear extracts from FGF-2-treated RASMC exhibited increased DNA-binding of Runx2 to its target sequence. Immunohistochemistry of human coronary atherectomy specimens and calcified aortic tissues showed that expression of FGF receptor-1 and Runx2 was colocalized. In conclusion, these results suggest that FGF-2 plays a role in inducing osteoblastic differentiation of VSMC by activating Runx2 through mitogen-activated protein kinase (MAPK)-dependent- and oxidative stress-sensitive-signaling pathways.

Virtual histology assessment of cardiac allograft vasculopathy following introduction of everolimus--results of a multicenter trial

DEFF Research Database (Denmark)

Arora, Stina Jørgensen; Erikstad, I; Ueland, T

2012-01-01

of cardiac allograft vasculopathy (CAV). Parallel measurement of a range of inflammatory markers was also performed. A similar rate of quantitative CAV progression was observed in the everolimus (n = 30) and standard CNI group (n = 48) (plaque index 1.9 ± 3.8% and 1.6 ± 3.9%, respectively; p = 0.65). However...... with time since HTx >5.1 years and was accompanied by a significant increase in levels of von Willebrand (vWF) factor (p = 0.04) and vascular cell adhesion molecule (VCAM) (p = 0.03). Conversion to everolimus and reduced CNI is associated with a significant increase in calcified and necrotic intimal...

The transcription factor, Nuclear factor, erythroid 2 (Nfe2), is a regulator of the oxidative stress response during Danio rerio development

Energy Technology Data Exchange (ETDEWEB)

Williams, Larissa M., E-mail: lwillia2@bates.edu [Biology Department, Bates College, 44 Campus Avenue, Lewiston, ME 04240 (United States); The MDI Biological Laboratory, 159 Old Bar Harbor Road, Bar Harbor, ME 04609 USA (United States); Lago, Briony A., E-mail: lagoba@mcmaster.ca [M.G. DeGroote Institute for Infectious Disease Research, Department of Biochemistry and Biomedical Sciences, DeGroote School of Medicine, McMaster University, Hamilton, ON L8S 4K1 (Canada); McArthur, Andrew G., E-mail: mcarthua@mcmaster.ca [M.G. DeGroote Institute for Infectious Disease Research, Department of Biochemistry and Biomedical Sciences, DeGroote School of Medicine, McMaster University, Hamilton, ON L8S 4K1 (Canada); Raphenya, Amogelang R., E-mail: raphenar@mcmaster.ca [M.G. DeGroote Institute for Infectious Disease Research, Department of Biochemistry and Biomedical Sciences, DeGroote School of Medicine, McMaster University, Hamilton, ON L8S 4K1 (Canada); Pray, Nicholas, E-mail: pray.nicholas@gmail.com [Biology Department, Bates College, 44 Campus Avenue, Lewiston, ME 04240 (United States); Saleem, Nabil, E-mail: nabilsaleem@gmail.com [Biology Department, Bates College, 44 Campus Avenue, Lewiston, ME 04240 (United States); The MDI Biological Laboratory, 159 Old Bar Harbor Road, Bar Harbor, ME 04609 USA (United States); Salas, Sophia, E-mail: sophia.salas2@gmail.com [Biology Department, Bates College, 44 Campus Avenue, Lewiston, ME 04240 (United States); The MDI Biological Laboratory, 159 Old Bar Harbor Road, Bar Harbor, ME 04609 USA (United States); Paulson, Katherine, E-mail: krpaulson@gmail.com [Biology Department, Bates College, 44 Campus Avenue, Lewiston, ME 04240 (United States); The MDI Biological Laboratory, 159 Old Bar Harbor Road, Bar Harbor, ME 04609 USA (United States); Mangar, Roshni S., E-mail: rmangar@coa.edu [The MDI Biological Laboratory, 159 Old Bar Harbor Road, Bar Harbor, ME 04609 USA (United States); College of the Atlantic, 105 Eden Street, Bar Harbor, ME 04609 (United States); and others

2016-11-15

Highlights: • Nfe2 is involved in erythropoiesis in zebrafish. • Nfe2 is a novel regulator of pro-oxidant induced oxidative stress. • Embryos mount a molecularly unique oxidative stress response compared to larvae. • Nfe2 regulates a wide-variety of genes beyond erythropoiesis. - Abstract: Development is a complex and well-defined process characterized by rapid cell proliferation and apoptosis. At this stage in life, a developmentally young organism is more sensitive to toxicants as compared to an adult. In response to pro-oxidant exposure, members of the Cap’n’Collar (CNC) basic leucine zipper (b-ZIP) transcription factor family (including Nfe2 and Nfe2-related factors, Nrfs) activate the expression of genes whose protein products contribute to reduced toxicity. Here, we studied the role of the CNC protein, Nfe2, in the developmental response to pro-oxidant exposure in the zebrafish (Danio rerio). Following acute waterborne exposures to diquat or tert-buytlhydroperoxide (tBOOH) at one of three developmental stages, wildtype (WT) and nfe2 knockout (KO) embryos and larvae were morphologically scored and their transcriptomes sequenced. Early in development, KO animals suffered from hypochromia that was made more severe through exposure to pro-oxidants; this phenotype in the KO may be linked to decreased expression of alas2, a gene involved in heme synthesis. WT and KO eleutheroembryos and larvae were phenotypically equally affected by exposure to pro-oxidants, where tBOOH caused more pronounced phenotypes as compared to diquat. Comparing diquat and tBOOH exposed embryos relative to the WT untreated control, a greater number of genes were up-regulated in the tBOOH condition as compared to diquat (tBOOH: 304 vs diquat: 148), including those commonly found to be differentially regulated in the vertebrate oxidative stress response (OSR) (e.g. hsp70.2, txn1, and gsr). When comparing WT and KO across all treatments and times, there were 1170 genes that were

Eukaryotic translation initiation factor 2B-beta (eIF2Bβ), a new class of plant virus resistance gene.

Science.gov (United States)

Shopan, Jannat; Mou, Haipeng; Zhang, Lili; Zhang, Changtong; Ma, Weiwei; Walsh, John A; Hu, Zhongyuan; Yang, Jinghua; Zhang, Mingfang

2017-06-01

Recessive resistances to plant viruses in the Potyvirus genus have been found to be based on mutations in the plant eukaryotic translation initiation factors, eIF4E and eIF4G or their isoforms. Here we report that natural, monogenic recessive resistance to the Potyvirus Turnip mosaic virus (TuMV) has been found in a number of mustard (Brassica juncea) accessions. Bulked segregant analysis and sequencing of resistant and susceptible plant lines indicated the resistance is controlled by a single recessive gene, recessive TuMV resistance 03 (retr03), an allele of the eukaryotic translation initiation factor 2B-beta (eIF2Bβ). Silencing of eIF2Bβ in a TuMV-susceptible mustard plant line and expression of eIF2Bβ from a TuMV-susceptible line in a TuMV-resistant mustard plant line confirmed the new resistance mechanism. A functional copy of a specific allele of eIF2Bβ is required for efficient TuMV infection. eIF2Bβ represents a new class of virus resistance gene conferring resistance to any pathogen. eIF2B acts as a guanine nucleotide exchange factor (GEF) for its GTP-binding protein partner eIF2 via interaction with eIF2·GTP at an early step in translation initiation. Further genotyping indicated that a single non-synonymous substitution (A120G) in the N-terminal region of eIF2Bβ was responsible for the TuMV resistance. A reproducible marker has been developed, facilitating marker-assisted selection for TuMV resistance in B. juncea. Our findings provide a new target for seeking natural resistance to potyviruses and new opportunities for the control of potyviruses using genome editing techniques targeted on eIF2Bβ. © 2017 The Authors The Plant Journal © 2017 John Wiley & Sons Ltd.

Nuclear Regulatory Commission Human Factors Program Plan. Revision 2

International Nuclear Information System (INIS)

1986-04-01

This document is the Second Annual Revision to the NRC Human Factors Program Plan. The first edition was published in August 1983. Revision 1 was published in July of 1984. Purpose of the NRC Human Factors Program is to ensure that proper consideration is given to human factors in the design and operation of nuclear power plants. This document describes the plans of the Office of Nuclear Reactor Regulation to address high priority human factors concerns of importance to reactor safety in FY 1986 and FY 1987. Revision 2 of the plan incorporates recent Commission decisions and policies bearing on the human factors aspects of reactor safety regulation. With a few exceptions, the principal changes from prior editions reflect a shift from developing new requirements to staff evaluation of industry progress in resolving human factors issues. The plan addresses seven major program elements: (1) Training, (2) Licensing Examinations, (3) Procedures, (4) Man-Machine Interface, (5) Staffing and Qualifications, (6) Management and Organization, and (7) Human Performance

Risk factors for type 2 diabetes mellitus among patients attending a rural Kenyan hospital

Directory of Open Access Journals (Sweden)

Masemiano P. Chege

2010-05-01

Objectives: To describe the risk factors for type 2 diabetes mellitus among patients attending the outpatient clinics in a rural mission hospital in Kenya. Method: Forty-five diabetics and forty-five non-diabetics, resident in this rural hospital’s catchment area for at least 10 years, were randomly selected from patients attending outpatient clinics. Diabetics in a stable condition (not requiring hospitalisation, whose fasting blood sugars were below 6.1 mmol/L, were matched for age and gender with the non-diabetics who came to the hospital for outpatient services. A pilot-tested questionnaire on demography, current and past dietary habits, social habits, and family history was used to collect data. Waist circumference, height and weight were measured and BMI calculated. Data was analysed using SPSS for Windows. The Kruskal–Wallis test was used to compare the medians for the continuous variables, while the chi-squared test was used for the categorical variables. The z-test was used to calculate the relative risk. Results: Ninety participants (26 males, 64 females. The mean age was 61.8 for diabetics and 61.4 for non-diabetics. Childhood starvation (relative risk 2.08, p = 0.0090 and use of cassava for sustenance during childhood starvation (relative risk 3.12, p = 0.0090 were identified as risk factors. Diabetes in close relatives, another risk factor for this population (relative risk 2.2, p = 0.0131. Abdominal obesity was a risk factor for this population (in females relative risk 2.0, p = 0.0010. Conclusion: The risk factors for type 2 diabetes mellitus described in this rural population include advancing age, diabetes in a first-degree relative and abdominal obesity. This is similar to what has been cited in other studies. At variance, we found that more than 50% of the diabetics reported having suffered malnutrition/starvation in childhood, with more than half of them reporting their dependence on cassava as the only food source during starvation.

Factor Structure, Internal Consistency, and Screening Sensitivity of the GARS-2 in a Developmental Disabilities Sample

OpenAIRE

Martin A. Volker; Elissa H. Dua; Christopher Lopata; Marcus L. Thomeer; Jennifer A. Toomey; Audrey M. Smerbeck; Jonathan D. Rodgers; Joshua R. Popkin; Andrew T. Nelson; Gloria K. Lee

2016-01-01

The Gilliam Autism Rating Scale-Second Edition (GARS-2) is a widely used screening instrument that assists in the identification and diagnosis of autism. The purpose of this study was to examine the factor structure, internal consistency, and screening sensitivity of the GARS-2 using ratings from special education teaching staff for a sample of 240 individuals with autism or other significant developmental disabilities. Exploratory factor analysis yielded a correlated three-factor solution si...

Form factors of descendant operators: reduction to perturbed M(2,2s+1) models

International Nuclear Information System (INIS)

Lashkevich, Michael; Pugai, Yaroslav

2015-01-01

In the framework of the algebraic approach to form factors in two-dimensional integrable models of quantum field theory we consider the reduction of the sine-Gordon model to the Φ 13 -perturbation of minimal conformal models of the M(2,2s+1) series. We find in an algebraic form the condition of compatibility of local operators with the reduction. We propose a construction that make it possible to obtain reduction compatible local operators in terms of screening currents. As an application we obtain exact multiparticle form factors for the compatible with the reduction conserved currents T ±2k , Θ ±(2k−2) , which correspond to the spin ±(2k−1) integrals of motion, for any positive integer k. Furthermore, we obtain all form factors of the operators T 2k T −2l , which generalize the famous TT̄ operator. The construction is analytic in the s parameter and, therefore, makes sense in the sine-Gordon theory.

EBP1 is a novel E2F target gene regulated by transforming growth factor-β.

Directory of Open Access Journals (Sweden)

David Judah

2010-11-01

Full Text Available Regulation of gene expression requires transcription factor binding to specific DNA elements, and a large body of work has focused on the identification of such sequences. However, it is becoming increasingly clear that eukaryotic transcription factors can exhibit widespread, nonfunctional binding to genomic DNA sites. Conversely, some of these proteins, such as E2F, can also modulate gene expression by binding to non-consensus elements. E2F comprises a family of transcription factors that play key roles in a wide variety of cellular functions, including survival, differentiation, activation during tissue regeneration, metabolism, and proliferation. E2F factors bind to the Erb3-binding protein 1 (EBP1 promoter in live cells. We now show that E2F binding to the EBP1 promoter occurs through two tandem DNA elements that do not conform to typical consensus E2F motifs. Exogenously expressed E2F1 activates EBP1 reporters lacking one, but not both sites, suggesting a degree of redundancy under certain conditions. E2F1 increases the levels of endogenous EBP1 mRNA in breast carcinoma and other transformed cell lines. In contrast, in non-transformed primary epidermal keratinocytes, E2F, together with the retinoblastoma family of proteins, appears to be involved in decreasing EBP1 mRNA abundance in response to growth inhibition by transforming growth factor-β1. Thus, E2F is likely a central coordinator of multiple responses that culminate in regulation of EBP1 gene expression, and which may vary depending on cell type and context.

EBP1 is a novel E2F target gene regulated by transforming growth factor-β.

Science.gov (United States)

Judah, David; Chang, Wing Y; Dagnino, Lina

2010-11-10

Regulation of gene expression requires transcription factor binding to specific DNA elements, and a large body of work has focused on the identification of such sequences. However, it is becoming increasingly clear that eukaryotic transcription factors can exhibit widespread, nonfunctional binding to genomic DNA sites. Conversely, some of these proteins, such as E2F, can also modulate gene expression by binding to non-consensus elements. E2F comprises a family of transcription factors that play key roles in a wide variety of cellular functions, including survival, differentiation, activation during tissue regeneration, metabolism, and proliferation. E2F factors bind to the Erb3-binding protein 1 (EBP1) promoter in live cells. We now show that E2F binding to the EBP1 promoter occurs through two tandem DNA elements that do not conform to typical consensus E2F motifs. Exogenously expressed E2F1 activates EBP1 reporters lacking one, but not both sites, suggesting a degree of redundancy under certain conditions. E2F1 increases the levels of endogenous EBP1 mRNA in breast carcinoma and other transformed cell lines. In contrast, in non-transformed primary epidermal keratinocytes, E2F, together with the retinoblastoma family of proteins, appears to be involved in decreasing EBP1 mRNA abundance in response to growth inhibition by transforming growth factor-β1. Thus, E2F is likely a central coordinator of multiple responses that culminate in regulation of EBP1 gene expression, and which may vary depending on cell type and context.

Tumorigenic and Antiproliferative Properties of the TALE-Transcription Factors MEIS2D and MEIS2A in Neuroblastoma.

Science.gov (United States)

Groß, Anja; Schulz, Catrine; Kolb, Jasmine; Koster, Jan; Wehner, Sibylle; Czaplinski, Sebastian; Khilan, Abdulghani; Rohrer, Hermann; Harter, Patrick N; Klingebiel, Thomas; Langer, Julian D; Geerts, Dirk; Schulte, Dorothea

2018-04-15

Neuroblastoma is one of only a few human cancers that can spontaneously regress even after extensive dissemination, a poorly understood phenomenon that occurs in as many as 10% of patients. In this study, we identify the TALE-homeodomain transcription factor MEIS2 as a key contributor to this phenomenon. We identified MEIS2 as a MYCN-independent factor in neuroblastoma and showed that in this setting the alternatively spliced isoforms MEIS2A and MEIS2D exert antagonistic functions. Specifically, expression of MEIS2A was low in aggressive stage 4 neuroblastoma but high in spontaneously regressing stage 4S neuroblastoma. Moderate elevation of MEIS2A expression reduced proliferation of MYCN -amplified human neuroblastoma cells, induced neuronal differentiation and impaired the ability of these cells to form tumors in mice. In contrast, MEIS2A silencing or MEIS2D upregulation enhanced the aggressiveness of the tumor phenotype. Mechanistically, MEIS2A uncoupled a negative feedback loop that restricts accumulation of cellular retinoic acid, an effective agent in neuroblastoma treatment. Overall, our results illuminate the basis for spontaneous regression in neuroblastoma and identify an MEIS2A-specific signaling network as a potential therapeutic target in this common pediatric malignancy. Significance: This study illuminates the basis for spontaneous regressions that can occur in a common pediatric tumor, with implications for the development of new treatment strategies. Cancer Res; 78(8); 1935-47. ©2018 AACR . ©2018 American Association for Cancer Research.

Human Platelet Senescence Study.

Science.gov (United States)

1980-03-01

ability to measure certain enzymes to their oxidation-reduc other enzymes which can be measured by o phosphatase , acid phosphatase , chymotryp...alkaline sin, trypsin, esterases (17)); M use of n A or wheat germ agglutinin in the second etect specific carbohydrate constituents. We have...Von Willebrand factor. Nurden and Caen also demonstrated that GPI was rich in sialic acid (5) and probably responsible for the platelets’ surface

Discontinuation of antithrombotic therapy for a year or more in patients with continuous-flow left ventricular assist devices.

Science.gov (United States)

Pereira, Naveen L; Chen, Dong; Kushwaha, Sudhir S; Park, Soon J

2010-10-01

The recommended anticoagulation regimen during continuous-flow axial left ventricular assist device (LVAD) support is aspirin and warfarin with a targeted international normalized ratio of 2.0-3.0. We report two patients in whom recurrent gastrointestinal bleeding during LVAD support necessitated discontinuation of this anti-thrombotic regimen for a year or more. Despite this, neither patients developed thrombotic complications during 29 patient-months of follow-up. An acquired von Willebrand factor (VWF) abnormality reflected by the absence or decreased abundance of the highest molecular weight multimers was demonstrated in both patients. The gold standard test for platelet function, light transmission platelet aggregometry was measured in one patient and was normal, indicative that the predominant abnormality in the coagulation profile of these patients is an acquired VWF syndrome. Clinical trials are required to address the question whether it is safe to discontinue anticoagulation in LVAD patients with acquired VWF abnormalities.

Study on molecule marker of pro-thromb state with diabetic retinopathy%糖尿病视网膜病变血栓前状态分子标志物的研究

Institute of Scientific and Technical Information of China (English)

周有利; 张健; 李明

2009-01-01

Objective To study the relationship between molecule marker of pro-thromb state and diabetic retinopathy by detecting the levels of thrombomodulin, yon Willebrand disease factor,plasminogen activator inhibitor-1 in blood plasma. Methods Sixty-three patients with type 2 diabetic mellitus were divided into two groups, 35 patients not complicated with diabetic retinopathy group and 28 patients with diabetic retinopathy. And the other 30 health people were as normal controls. The levels of thrombomodulin, yon Willebrand disease factor and plasminogen activator inhibitor-1 in plasma were detected and compared among the three groups. Results The levels of thrombomodulin, yon Willebrand disease factor and plasminogen activator inhibitor-1 of patients with type 2 diabetic mellitus were distinctly higher than those in control group(P<0.01) and in diabetic retinopathy group (P < 0.01). Conclusion The blood vessel endothelium damage, anticoagulation attenuating, degression of platelet adhering, aggregation and delicate dissolving activation may be a pathogenesis of diabetic retinopathy.%目的:观察糖尿病视网膜病变患者血浆中血栓调节蛋白、血管性血友病因子、纤溶酶原激活剂抑制物-1水平的变化,探讨血栓前状态分子标志物与糖尿病视网膜病变的关系.方法:将63例2型糖尿病患者分为:无糖尿病视网膜病变组35例,糖尿病视网膜病变组28例,同期健康体检者30例为对照组.测定各组血浆血栓调节蛋白、血管性血友病因子、纤溶酶原激活剂抑制物-1的水平,并对上述指标进行比较.结果:2型糖尿病患者血浆血栓调节蛋白、血管性血友病因子、纤溶酶原激活剂抑制物-1水平均明显高于对照组(P<0.01);糖尿病视网膜病变组也明显高于无糖尿病视网膜病变组(P<0.01).结论:糖尿病患者存在血管内皮损伤,抗凝作用减弱,血小板黏附与聚集,纤溶活性下降,可能是糖尿病视网膜病变的发病机制之一.

Intracranial Hemorrhage: A Devastating Outcome of Congenital Bleeding Disorders-Prevalence, Diagnosis, and Management, with a Special Focus on Congenital Factor XIII Deficiency.

Science.gov (United States)

Alavi, Seyed Ezatolla Rafiee; Jalalvand, Masumeh; Assadollahi, Vahideh; Tabibian, Shadi; Dorgalaleh, Akbar

2018-04-01

Intracranial hemorrhage (ICH) is a medical emergency. In congenital bleeding disorders, ICH is a devastating presentation accompanied with a high rate of morbidity and mortality. The prevalence of ICH is highly variable among congenital bleeding disorders, with the highest incidence observed in factor (F) XIII deficiency (FXIIID) (∼30%). This life-threatening presentation is less common in afibrinogenemia, FVIII, FIX, FVII, and FX deficiencies, and is rare in severe FV and FII deficiencies, type 3 von Willebrand disease and inherited platelet function disorders (IPFDs). In FXIIID, this diathesis most often occurs after trauma in children, whereas spontaneous ICH is more frequent in adults. About 15% of patients with FXIIID and ICH die; the bleeding causes 80% of deaths in this coagulopathy. Although in FXIIID, the bleed most commonly is intraparenchymal (> 90%), epidural, subdural, and subarachnoid hemorrhages also have been reported, albeit rarely. As this life-threatening bleeding causes neurological complications, early diagnosis can prevent further expansion of the hematoma and secondary damage. Neuroimaging plays a crucial role in the diagnosis of ICH, but signs and symptoms in patients with severe FXIIID should trigger replacement therapy even before establishment of the diagnosis. Although a high dose of FXIII concentrate can reduce the rate of morbidity and mortality of ICH in FXIIID, it may occasionally trigger inhibitor development, thus complicating ICH management and future prophylaxis. Nevertheless, replacement therapy is the mainstay of treatment for ICH in FXIIID. Neurosurgery is performed in patients with FXIIID and epidural hematoma and a hemorrhage diameter exceeding 2 cm or a volume of ICH is more than 30 cm 3 . Contact sports are not recommended in people with FXIIID as they can elicit ICH. However, a considerable number of safe sports and activities have been suggested to have more benefits than dangers for patients with congenital bleeding

Qing brick tea (QBT) aqueous extract protects monosodium glutamate-induced obese mice against metabolic syndrome and involves up-regulation Transcription Factor Nuclear Factor-Erythroid 2-Related Factor 2 (Nrf2) antioxidant pathway.

Science.gov (United States)

Gao, Wenqi; Xiao, Changyi; Hu, Jun; Chen, Biaoxin; Wang, Chunyan; Cui, Bangping; Deng, Pengyi; Yang, Jian; Deng, Zhifang

2018-04-18

Qing brick tea (QBT), traditional and popular beverage for Chinese people, is an important post-fermentation dark tea. Our present study was performed to investigate the ameliorative effects of QBT aqueous extract on metabolic syndrome (Mets) in monosodium glutamate-induced obese mice and the potential mechanisms. Monosodium glutamate-induced obese mice were used to evaluate the anti-Mets effects of QBT. Content levels of malonaldehyde (MDA), reactive oxygen species (ROS) and protein carbonylation, antioxidant enzyme activities of superoxide dismutase (SOD), glutathione peroxidase (GPx), catalase (CAT), glutathione reductase (GR) in the skeletal muscle were assessed by commercial kits, respectively. Western blot and Q-PCR were used to detect the expressions of Transcription Factor Nuclear Factor-Erythroid 2-Related Factor 2 (Nrf2) signaling pathway and downstream antioxidant factors. In addition, activity of AKT signaling and expression of glucose transporter type 4 (GLUT4) in the skeletal muscle were investigated by western blot. QBT treatment limited gain of body weight, waistline and LEE index, improved insulin resistance and glucose intolerance, reduced lipid level in MSG mice. Content levels of MDA, ROS and protein carbonylation in skeletal muscle of QBT group were significantly improved compared to those of MSG mice. The antioxidant enzyme activities of SOD, GPx, CAT, and GR were increased in skeletal muscle of MSG mice intervened with QBT. After 20-week QBT treatment, Nrf2 signaling pathway and downstream antioxidant factors were both increased in the skeletal muscle. In addition, QBT treatment improved insulin signaling by preferentially augmenting AKT signaling, as well as increased the protein expression of GLUT4 in the skeletal muscle. Our results showed that QBT intake was effective in protecting monosodium glutamate-induced obese mice against metabolic syndrome and involved in the Nrf2 signaling pathway in the skeletal muscle. Copyright © 2018

Protective Role of Nuclear Factor E2-Related Factor 2 against Acute Oxidative Stress-Induced Pancreatic β-Cell Damage

Directory of Open Access Journals (Sweden)

Jingqi Fu

2015-01-01

Full Text Available Oxidative stress is implicated in the pathogenesis of pancreatic β-cell dysfunction that occurs in both type 1 and type 2 diabetes. Nuclear factor E2-related factor 2 (NRF2 is a master regulator in the cellular adaptive response to oxidative stress. The present study found that MIN6 β-cells with stable knockdown of Nrf2 (Nrf2-KD and islets isolated from Nrf2-knockout mice expressed substantially reduced levels of antioxidant enzymes in response to a variety of stressors. In scramble MIN6 cells or wild-type islets, acute exposure to oxidative stressors, including hydrogen peroxide (H2O2 and S-nitroso-N-acetylpenicillamine, resulted in cell damage as determined by decrease in cell viability, reduced ATP content, morphology changes of islets, and/or alterations of apoptotic biomarkers in a concentration- and/or time-dependent manner. In contrast, silencing of Nrf2 sensitized MIN6 cells or islets to the damage. In addition, pretreatment of MIN6 β-cells with NRF2 activators, including CDDO-Im, dimethyl fumarate (DMF, and tert-butylhydroquinone (tBHQ, protected the cells from high levels of H2O2-induced cell damage. Given that reactive oxygen species (ROS are involved in regulating glucose-stimulated insulin secretion (GSIS and persistent activation of NRF2 blunts glucose-triggered ROS signaling and GSIS, the present study highlights the distinct roles that NRF2 may play in pancreatic β-cell dysfunction that occurs in different stages of diabetes.

Evaluation of E2 form factor = 24Mg

International Nuclear Information System (INIS)

Marinelli, J.R.; Moreira, J.R.

1988-11-01

Longitudinal and transverse electron scattering form factors for the 2 + state at 1.37 Mev of the 24 Mg nucleus was evaluated with rotational model wavefunctions. Four different approaches were used for the transverse E2 form factor: PHF, cranking model, ridig rotor and irrotational flow. For the nuclear intrinsic wavefunction, the Nilsson model was assumed in all approaches yielding the calculation of the form factor in PWBA and DWBA. The results are discussed and compared with a recent measurement performed with 180 0 electron scattered from this state. The DWBA calculation, taking into account first order corrections shows that PHF and irrotational flow models give the best agreements with the available data and compete in quality with more complex calculation performed under the 'shell model' approach. (author) [pt

Expression of Selected Markers in Immunohistochemical Diagnosis of Canine and Human Testicular Tumours

Directory of Open Access Journals (Sweden)

Ciaputa Rafał

2015-04-01

Full Text Available Immunohistochemical profiles of the most common canine testicular tumours, including the Leydig cell tumours, seminomas, and Sertoli cell tumours were analysed, and the results were compared with those obtained in the corresponding types of human testicular neoplasms. The expressions of vimentin, von Willebrand factor (FVIII, chromogranin A, synaptophysin, and MCM3 were quantified. In the case of Sertoli cell tumours, only canine ones were analysed, since this type of tumour is very rarely diagnosed in men. The expression of the analysed proteins in the testicular tumours was similar. The von Willebrand factor exhibited the strongest expression in Leydig cell tumours in dogs and men, while vimentin was expressed more strongly in dogs (96.7% had an intensity at +++ than in men (62.5% had +++ in the Leydigioma. The immunoexpression of MCM3 in seminomas was high in both men and dogs – 90% +++ and 100% +++ respectively. The lack of chromogranin A and synaptophysin was observed in almost 100% of seminomas in men and dogs. This differed from the results obtained for Leydigioma, where chromogranin A was expressed in 70% of dogs at +++ and in 100% of men at ++++. The results may indicate that the antibodies were selected correctly. Their analysis and interpretation provides valuable information concerning the nature of the studied tumours.

The nuclear factor-erythroid 2-related factor/heme oxygenase-1 axis is critical for the inflammatory features of type 2 diabetes-associated osteoarthritis.

Science.gov (United States)

Vaamonde-Garcia, Carlos; Courties, Alice; Pigenet, Audrey; Laiguillon, Marie-Charlotte; Sautet, Alain; Houard, Xavier; Kerdine-Römer, Saadia; Meijide, Rosa; Berenbaum, Francis; Sellam, Jérémie

2017-09-01

Epidemiological findings support the hypothesis that type 2 diabetes mellitus (T2DM) is a risk factor for osteoarthritis (OA). Moreover, OA cartilage from patients with T2DM exhibits a greater response to inflammatory stress, but the molecular mechanism is unclear. To investigate whether the antioxidant defense system participates in this response, we examined here the expression of nuclear factor-erythroid 2-related factor (Nrf-2), a master antioxidant transcription factor, and of heme oxygenase-1 (HO-1), one of its main target genes, in OA cartilage from T2DM and non-T2DM patients as well as in murine chondrocytes exposed to high glucose (HG). Ex vivo experiments indicated that Nrf-2 and HO-1 expression is reduced in T2DM versus non-T2DM OA cartilage (0.57-fold Nrf-2 and 0.34-fold HO-1), and prostaglandin E 2 (PGE 2 ) release was increased in samples with low HO-1 expression. HG-exposed, IL-1β-stimulated chondrocytes had lower Nrf-2 levels in vitro , particularly in the nuclear fraction, than chondrocytes exposed to normal glucose (NG). Accordingly, HO-1 levels were also decreased (0.49-fold) in these cells. The HO-1 inducer cobalt protoporphyrin IX more efficiently attenuated PGE 2 and IL-6 release in HG+IL-1β-treated cells than in NG+IL-1β-treated cells. Greater reductions in HO-1 expression and increase in PGE 2 /IL-6 production were observed in HG+IL-1β-stimulated chondrocytes from Nrf-2 -/- mice than in chondrocytes from wild-type mice. We conclude that the Nrf-2/HO-1 axis is a critical pathway in the hyperglucidic-mediated dysregulation of chondrocytes. Impairments in this antioxidant system may explain the greater inflammatory responsiveness of OA cartilage from T2DM patients and may inform treatments of such patients. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

Factor Structure, Internal Consistency, and Screening Sensitivity of the GARS-2 in a Developmental Disabilities Sample

Directory of Open Access Journals (Sweden)

Martin A. Volker

2016-01-01

Full Text Available The Gilliam Autism Rating Scale-Second Edition (GARS-2 is a widely used screening instrument that assists in the identification and diagnosis of autism. The purpose of this study was to examine the factor structure, internal consistency, and screening sensitivity of the GARS-2 using ratings from special education teaching staff for a sample of 240 individuals with autism or other significant developmental disabilities. Exploratory factor analysis yielded a correlated three-factor solution similar to that found in 2005 by Lecavalier for the original GARS. Though the three factors appeared to be reasonably consistent with the intended constructs of the three GARS-2 subscales, the analysis indicated that more than a third of the GARS-2 items were assigned to the wrong subscale. Internal consistency estimates met or exceeded standards for screening and were generally higher than those in previous studies. Screening sensitivity was .65 and specificity was .81 for the Autism Index using a cut score of 85. Based on these findings, recommendations are made for instrument revision.

The trypanocidal benznidazole promotes adaptive response to oxidative injury: Involvement of the nuclear factor-erythroid 2-related factor-2 (Nrf2) and multidrug resistance associated protein 2 (MRP2)

International Nuclear Information System (INIS)

Rigalli, Juan Pablo; Perdomo, Virginia Gabriela; Ciriaci, Nadia; Francés, Daniel Eleazar Antonio; Ronco, María Teresa; Bataille, Amy Michele; Ghanem, Carolina Inés; Ruiz, María Laura; Manautou, José Enrique; Catania, Viviana Alicia

2016-01-01

Oxidative stress is a frequent cause underlying drug-induced hepatotoxicity. Benznidazole (BZL) is the only trypanocidal agent available for treatment of Chagas disease in endemic areas. Its use is associated with side effects, including increases in biomarkers of hepatotoxicity. However, BZL potential to cause oxidative stress has been poorly investigated. Here, we evaluated the effect of a pharmacologically relevant BZL concentration (200 μM) at different time points on redox status and the counteracting mechanisms in the human hepatic cell line HepG2. BZL increased reactive oxygen species (ROS) after 1 and 3 h of exposure, returning to normality at 24 h. Additionally, BZL increased glutathione peroxidase activity at 12 h and the oxidized glutathione/total glutathione (GSSG/GSSG + GSH) ratio that reached a peak at 24 h. Thus, an enhanced detoxification of peroxide and GSSG formation could account for ROS normalization. GSSG/GSSG + GSH returned to control values at 48 h. Expression of the multidrug resistance-associated protein 2 (MRP2) and GSSG efflux via MRP2 were induced by BZL at 24 and 48 h, explaining normalization of GSSG/GSSG + GSH. BZL activated the nuclear erythroid 2-related factor 2 (Nrf2), already shown to modulate MRP2 expression in response to oxidative stress. Nrf2 participation was confirmed using Nrf2-knockout mice in which MRP2 mRNA expression was not affected by BZL. In summary, we demonstrated a ROS increase by BZL in HepG2 cells and a glutathione peroxidase- and MRP2 driven counteracting mechanism, being Nrf2 a key modulator of this response. Our results could explain hepatic alterations associated with BZL therapy. - Highlights: • BZL triggers a redox imbalance in the human hepatic cell line HepG2. • Concomitantly BZL triggers compensatory mechanisms to alleviate the redox injury. • Response mechanisms comprise an enhanced glutathione peroxidase and MRP2 activity. • Transcription factor Nrf2 plays a key role orchestrating

The trypanocidal benznidazole promotes adaptive response to oxidative injury: Involvement of the nuclear factor-erythroid 2-related factor-2 (Nrf2) and multidrug resistance associated protein 2 (MRP2)

Energy Technology Data Exchange (ETDEWEB)

Rigalli, Juan Pablo [Institute of Experimental Physiology (IFISE-CONICET), Suipacha 570, 2000 Rosario (Argentina); Department of Clinical Pharmacology and Pharmacoepidemiology, University of Heidelberg, Heidelberg (Germany); Perdomo, Virginia Gabriela; Ciriaci, Nadia; Francés, Daniel Eleazar Antonio; Ronco, María Teresa [Institute of Experimental Physiology (IFISE-CONICET), Suipacha 570, 2000 Rosario (Argentina); Bataille, Amy Michele [University of Connecticut, School of Pharmacy, Department of Pharmaceutical Sciences, Storrs, CT (United States); Ghanem, Carolina Inés [Institute of Pharmacological Investigations (ININFA-CONICET), University of Buenos Aires, Buenos Aires (Argentina); Ruiz, María Laura [Institute of Experimental Physiology (IFISE-CONICET), Suipacha 570, 2000 Rosario (Argentina); Manautou, José Enrique [University of Connecticut, School of Pharmacy, Department of Pharmaceutical Sciences, Storrs, CT (United States); Catania, Viviana Alicia, E-mail: vcatania@fbioyf.unr.edu.ar [Institute of Experimental Physiology (IFISE-CONICET), Suipacha 570, 2000 Rosario (Argentina)

2016-08-01

Oxidative stress is a frequent cause underlying drug-induced hepatotoxicity. Benznidazole (BZL) is the only trypanocidal agent available for treatment of Chagas disease in endemic areas. Its use is associated with side effects, including increases in biomarkers of hepatotoxicity. However, BZL potential to cause oxidative stress has been poorly investigated. Here, we evaluated the effect of a pharmacologically relevant BZL concentration (200 μM) at different time points on redox status and the counteracting mechanisms in the human hepatic cell line HepG2. BZL increased reactive oxygen species (ROS) after 1 and 3 h of exposure, returning to normality at 24 h. Additionally, BZL increased glutathione peroxidase activity at 12 h and the oxidized glutathione/total glutathione (GSSG/GSSG + GSH) ratio that reached a peak at 24 h. Thus, an enhanced detoxification of peroxide and GSSG formation could account for ROS normalization. GSSG/GSSG + GSH returned to control values at 48 h. Expression of the multidrug resistance-associated protein 2 (MRP2) and GSSG efflux via MRP2 were induced by BZL at 24 and 48 h, explaining normalization of GSSG/GSSG + GSH. BZL activated the nuclear erythroid 2-related factor 2 (Nrf2), already shown to modulate MRP2 expression in response to oxidative stress. Nrf2 participation was confirmed using Nrf2-knockout mice in which MRP2 mRNA expression was not affected by BZL. In summary, we demonstrated a ROS increase by BZL in HepG2 cells and a glutathione peroxidase- and MRP2 driven counteracting mechanism, being Nrf2 a key modulator of this response. Our results could explain hepatic alterations associated with BZL therapy. - Highlights: • BZL triggers a redox imbalance in the human hepatic cell line HepG2. • Concomitantly BZL triggers compensatory mechanisms to alleviate the redox injury. • Response mechanisms comprise an enhanced glutathione peroxidase and MRP2 activity. • Transcription factor Nrf2 plays a key role orchestrating

Transforming growth factor type β can act as a potent competence factor for AKR-2B cells

International Nuclear Information System (INIS)

Goustin, A.S.; Nuttall, G.A.; Leof, E.B.; Ranganathan, G.; Moses, H.L.

1987-01-01

Transforming growth factor type β (TGFβ) is a pleiotropic regulator of cell growth with specific high-affinity cell-surface receptors on a large number of cells; its mechanism of action, however, is poorly defined. In this report, the authors utilized the mouse fibroblast line AKR-2B to explore the question of the temporal requirements during the cell cycle in regard to both the growth inhibitory and the growth stimulatory action of TGFβ. The results indicate that AKR-2B cells are most sensitive to the inhibitory action of TGFβ during early to mid-G 1 . In addition, TGFβ need be present only briefly in order to exert its inhibitory effect on EGF-induced DNA synthesis. Likewise, the stimulatory effect of TGFβ in the absence of EGF requires only an equally brief exposure to TGFβ. Use of homogeneous 125 I-labeled TGFβ in a cell-binding assay demonstrates that TGFβ bound to cell-surface receptors can readily exchange into the culture medium, helping to rule out the possibility that persistent receptor-bound TGFβ is the source of a continuous stimulus. The data indicate that TGFβ exposure induces a stable state in the cell similar to but distinct from the state of competence induced by platelet-derived growth factor (PDGF)

A high ratio of insulin-like growth factor II/insulin-like growth factor binding protein 2 messenger RNA as a marker for anaplasia in meningiomas.

Science.gov (United States)

Nordqvist, A C; Peyrard, M; Pettersson, H; Mathiesen, T; Collins, V P; Dumanski, J P; Schalling, M

1997-07-01

Insulin-like growth factors (IGFs) I and II have been implicated as autocrine or paracrine growth promoters. These growth factors bind to specific receptors, and the response is modulated by interaction with IGF-binding proteins (IGFBPs). We observed a strong correlation between anaplastic/atypical histopathology and a high IGF-II/IGFBP-2 mRNA ratio in a set of 68 sporadic meningiomas. A strong correlation was also found between clinical outcome and IGF-II/IGFBP-2 ratio, whereas previously used histochemical markers were less correlated to outcome. We suggest that a high IGF-II/IGFBP-2 mRNA ratio may be a sign of biologically aggressive behavior in meningiomas that can influence treatment strategies. We propose that low IGFBP-2 levels in combination with increased levels of IGF-II would result in more free IGF-II and consequently greater stimulation of proliferation.

Association between the NF-E2 Related Factor 2 Gene Polymorphism and Oxidative Stress, Anti-Oxidative Status, and Newly-Diagnosed Type 2 Diabetes Mellitus in a Chinese Population

Directory of Open Access Journals (Sweden)

Xia Wang

2015-07-01

Full Text Available Oxidative stress is a major risk factor in the onset and progression of type 2 diabetes mellitus (T2DM. NF-E2 related factor 2 (NRF2 is a pivotal transcription factor in oxidative stress related illnesses. This study included 2174 subjects with 879 cases of newly-diagnosed T2DM and 1295 healthy controls. Compared to individuals with the CC genotype, those with the AA genotype had lower total anti-oxidative capacity, superoxide dismutase, catalase, glutathione, glutathione peroxidase activity; and lower homeostasis model assessment of β-cell function index. Those with the AA genotype also had a higher malondialdehyde concentration and homeostasis model assessment of insulin resistance index values. The frequency of allele A was significantly higher in T2DM subjects (29.4%, compared to control subjects (26.1%; p = 0.019. Individuals with the AA genotype had a significantly higher risk of developing T2DM (OR 1.56; 95% CI 1.11, 2.20; p = 0.011, relative to those with the CC genotype, even after adjusting for known T2DM risk factors. Our results suggest that the NRF2 rs6721961 polymorphism was significantly associated with oxidative stress, anti-oxidative status, and risk of newly-diagnosed T2DM. This polymorphism may also contribute to impaired insulin secretory capacity and increased insulin resistance in a Chinese population.

Detection of extracellular genomic DNA scaffold in human thrombus

DEFF Research Database (Denmark)

Oklu, Rahmi; Albadawi, Hassan; Watkins, Michael T

2012-01-01

into thrombus remodeling. MATERIALS AND METHODS: Ten human thrombus samples were collected during cases of thrombectomy and open surgical repair of abdominal aortic aneurysms (five samples 1 y old). Additionally, an acute murine hindlimb ischemia model was created to evaluate...... thrombus samples in mice. Human sections were immunostained for the H2A/H2B/DNA complex, myeloperoxidase, fibrinogen, and von Willebrand factor. Mouse sections were immunostained with the H2A antibody. All samples were further evaluated after hematoxylin and eosin and Masson trichrome staining. RESULTS......: An extensive network of extracellular histone/DNA complex was demonstrated in the matrix of human ex vivo thrombus. This network is present throughout the highly cellular acute thrombus. However, in chronic thrombi, detection of the histone/DNA network was predominantly in regions of low collagen content...

Reduced endothelial activation after exercise is associated with improved HbA1c in patients with type 2 diabetes and coronary artery disease.

Science.gov (United States)

Byrkjeland, Rune; Njerve, Ida U; Arnesen, Harald; Seljeflot, Ingebjørg; Solheim, Svein

2017-03-01

We have previously reported insignificant changes in HbA 1c after exercise in patients with both type 2 diabetes and coronary artery disease. In this study, we investigated the effect of exercise on endothelial function and possible associations between changes in endothelial function and HbA 1c . Patients with type 2 diabetes and coronary artery disease ( n = 137) were randomised to 12 months exercise or standard follow-up. Endothelial function was assessed by circulating biomarkers (E-selectin, intercellular adhesion molecule-1, vascular cell adhesion molecule-1, von Willebrand factor, tissue plasminogen activator antigen, asymmetric dimethylarginine and L-arginine/asymmetric dimethylarginine ratio). Differences between the randomised groups were analysed by analysis of covariance and correlations by Spearman's rho or Pearson's correlation. No effect of exercise on endothelial function was demonstrated. The changes in HbA 1c in the exercise group correlated with changes in E-selectin ( r = 0.56, p < 0.001), intercellular adhesion molecule-1 ( r = 0.27, p = 0.052), vascular cell adhesion molecule-1 ( r = 0.32, p = 0.022) and tissue plasminogen activator antigen ( r = 0.35, p =  0.011). HbA 1c decreased significantly more in patients with versus without a concomitant reduction in E-selectin ( p =  0.002), intercellular adhesion molecule-1 ( p =  0.011), vascular cell adhesion molecule-1 ( p =  0.028) and tissue plasminogen activator antigen ( p =  0.009). Exercise did not affect biomarkers of endothelial function in patients with both type 2 diabetes and coronary artery disease. However, changes in biomarkers of endothelial activation correlated with changes in HbA 1c , and reduced endothelial activation was associated with improved HbA 1c after exercise.

Measurements of thermal disadvantage factors in light-water moderated PuO2-UO2 and UO2 lattices

International Nuclear Information System (INIS)

Ohno, Akio; Kobayashi, Iwao; Tsuruta, Harumichi; Hashimoto, Masao; Suzaki, Takenori

1980-01-01

The disadvantage factor for thermal neutrons in light-water moderated PuO 2 -UO 2 and UO 2 square lattices were obtained from measurements of thermal neutron density distributions in a unit lattice cell, measured with Dy-Al wire detectors. The lattices consisted of 3.4 w/o PuO 2 .UO 2 and 2.6 w/o UO 2 fuel rods, and the water-to-fuel volume ratio within the unit cell was parametrically changed. The PuO 2 .UO 2 and UO 2 fuel rods were designed to realize equal fissile atomic number density. The disadvantage factors thus measured were 1.36 +- 0.07, 1.37 +- 0.08, 1.40 +- 0.06 and 1.38 +- 0.06 in the PuO 2 .UO 2 fuel lattices, and 1.30 +- 0.06, 1.31 +- 0.08, 1.30 +- 0.08 and 1.33 +- 0.06 in the UO 2 , for water-to-fuel volume ratios, of 1.76, 2.00, 2.38 and 2.95, respectively. This difference in disadvantage factor between PuO 2 .UO 2 and UO 2 fuel lattices corresponds to about 8%. Calculated results obtained by multigroup transport code LASER agreed well with the measured ones. (author)

Depression as a risk factor for the onser of type 2 diabetes mellitus. A meta-analysis.

NARCIS (Netherlands)

Knol, M.J.; Twisk, J.W.; Beekman, A.T.F.; Heine, R.J.; Snoek, F.J.; Pouwer, F.

2006-01-01

Aims/hypothesis: Evidence strongly suggests that depression and type 2 diabetes are associated, but the direction of the association is still unclear. Depression may occur as a consequence of having diabetes, but may also be a risk factor for the onset of type 2 diabetes. This study examined the

NOx and SO2 emission factors for Serbian lignite Kolubara

Directory of Open Access Journals (Sweden)

Jovanović Vladimir V.

2012-01-01

Full Text Available Emission factors are widely accepted tool for estimation of various pollutants emissions in USA and EU. Validity of emission factors is strongly related to experimental data on which they are based. This paper is a result of an effort to establish reliable NOx and SO2 emission factors for Serbian coals. The results of NOx and SO2 emissions estimations based on USA and EU emission factors from thermal power plants Nikola Tesla Obrenovac A and B utilizing the Serbian lignite Kolubara are compared with experimental data obtained during almost one decade (2000-2008 of emissions measurements. Experimental data are provided from regular annual emissions measurement along with operational parameters of the boiler and coal (lignite Kolubara ultimate and proximate analysis. Significant deviations of estimated from experimental data were observed for NOx, while the results for SO2 were satisfactory. Afterwards, the estimated and experimental data were plotted and linear regression between them established. Single parameter optimization was performed targeting the ideal slope of the regression line. Results of this optimization provided original NOx and SO2 emission factors for Kolubara lignite.

Herpes simplex virus type 2 (HSV-2) as a coronary atherosclerosis risk factor in HIV-infected men: multicenter AIDS cohort study.

Science.gov (United States)

Hechter, Rulin C; Budoff, Matthew; Hodis, Howard N; Rinaldo, Charles R; Jenkins, Frank J; Jacobson, Lisa P; Kingsley, Lawrence A; Taiwo, Babafemi; Post, Wendy S; Margolick, Joseph B; Detels, Roger

2012-08-01

We assessed associations of herpes simplex virus types 1 and 2 (HSV-1 and -2), cytomegalovirus (CMV), and human herpesvirus 8 (HHV-8) infection with subclinical coronary atherosclerosis in 291 HIV-infected men in the Multicenter AIDS Cohort Study. Coronary artery calcium (CAC) was measured by non-contrast coronary CT imaging. Markers for herpesviruses infection were measured in frozen specimens collected 10-12 years prior to case identification. Multivariable logistic regression models and ordinal logistic regression models were performed. HSV-2 seropositivity was associated with coronary atherosclerosis (adjusted odds ratio [AOR]=4.12, 95% confidence interval [CI]=1.58-10.85) after adjustment for age, race/ethnicity, cardiovascular risk factors, and HIV infection related factors. Infection with a greater number of herpesviruses was associated with elevated CAC levels (AOR=1.58, 95% CI=1.06-2.36). Our findings suggest HSV-2 may be a risk factor for subclinical coronary atherosclerosis in HIV-infected men. Infection with multiple herpesviruses may contribute to the increased burden of atherosclerosis. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.

International inequalities in per capita CO{sub 2} emissions: a decomposition methodology by Kaya factors

Energy Technology Data Exchange (ETDEWEB)

Duro, J.A. [Universitat Rovira i Virgili, Reus (Spain). Dept. d' Economia; Universitat de Barcelona (Spain). Inst. de Analisis Economico; Padilla, E. [Universitat de Barcelona (Spain). Dept. d' Economia Aplicada

2006-03-15

In this paper, we provide a methodology for decomposing international inequalities in per capita CO{sub 2} emissions into Kaya (multiplicative) factors and two interaction terms. We use the Theil index of inequality and show that this decomposition methodology can be extended for analyzing between- and within-group inequality components. We can thus analyze the factors behind inequalities in per capita CO{sub 2} emissions across countries, between groups of countries and within groups of countries. The empirical illustration for international data suggests some points. Firstly, international inequality in per capita CO{sub 2} emissions is mainly attributable to inequalities in per capita income levels, which helps to explain its recent reduction, while differences in carbon intensity of energy and energy intensity have made a less significant contribution. This result is strongly influenced by the performance of China and India. Secondly, the between-group inequality component, which is the biggest component, is also largely explained by the income factor. Thirdly, the within-group inequality component increased slightly during the period, something mainly due to the change in the income factor and the interaction terms in a few regions. (author)

Polycystic ovary syndrome: cardiovascular risk factors according to specific phenotypes.

Science.gov (United States)

Aziz, Mubeena; Sidelmann, Johannes J; Faber, Jens; Wissing, Marie-Louise M; Naver, Klara V; Mikkelsen, Anne-Lis; Nilas, Lisbeth; Skouby, Sven O

2015-10-01

Polycystic ovary syndrome (PCOS) is associated with obesity and insulin resistance. The objective of this cross-sectional study was to investigate the impact of insulin resistance and body mass index (BMI) on inflammatory and hemostatic variables associated with long-term risk of cardiovascular disease in women with PCOS. 149 premenopausal women with PCOS were recruited consecutively from April 2010 to February 2012 at three Danish University Hospitals. The study was conducted at the Department of Gynecology and Obstetrics, Herlev University Hospital, Denmark. PCOS was diagnosed in accordance with the Rotterdam criteria and the women were classified into four phenotypes according to BMI and insulin resistance measured by the homeostasis model assessment of insulin resistance index. Body composition was determined by dual-energy X-ray absorptiometry. Main outcome measures were the biomarkers C-reactive protein (CRP), plasminogen activator inhibitor-1 (PAI-1), and von Willebrand factor antigen. Normal weight insulin-resistant PCOS women were characterized by abdominal obesity and elevated levels of plasma PAI-1. Overweight/obese insulin-resistant PCOS women had increased levels of both PAI-1 and CRP. Of the three Rotterdam criteria, only hyperandrogenemia was significantly associated with the hemostatic risk marker of long-term cardiovascular disease risk. Surrogate risk markers for cardiovascular disease are elevated in women with PCOS, especially insulin-resistant and overweight/obese women. © 2015 Nordic Federation of Societies of Obstetrics and Gynecology.

The anti-oxidative transcription factor Nuclear factor E2 related factor-2 (Nrf2) counteracts TGF-β1 mediated growth inhibition of pancreatic ductal epithelial cells -Nrf2 as determinant of pro-tumorigenic functions of TGF-β1

International Nuclear Information System (INIS)

Genrich, Geeske; Kruppa, Marcus; Lenk, Lennart; Helm, Ole; Broich, Anna; Freitag-Wolf, Sandra; Röcken, Christoph; Sipos, Bence; Schäfer, Heiner; Sebens, Susanne

2016-01-01

Nuclear factor E2 related factor-2 (Nrf2) is an oxidative stress inducible transcription factor being essential in regulating cell homeostasis. Thus, acute induction of Nrf2 in epithelial cells exposed to inflammation confers protection from oxidative cell damage and mutagenesis supporting an anti-tumorigenic role for Nrf2. However, pancreatic ductal adenocarcinoma (PDAC) is characterized by persistent Nrf2 activity conferring therapy resistance which points to a pro-tumorigenic role of Nrf2. A similar dichotomous role in tumorigenesis is described for the Transforming Growth Factor-beta 1 (TGF-β1). The present study therefore aimed at elucidating whether the switch of Nrf2 function towards a tumor promoting one relates to the modulation of TGF-β1 induced cell responses and whether this might occur early in PDAC development. In situ analysis comprised immunohistochemical stainings of activated (phosphorylated) Nrf2 and Ki67 in pancreatic tissues containing normal ducts and pancreatic intraepithelial neoplasia (PanINs). In vitro, Nrf2 levels in benign (H6c7-pBp), premalignant (H6c7-kras) and malignant (Colo357) pancreatic ductal epithelial cells were modulated by Nrf2 specific siRNA or Nrf2 overexpression. Then, the effect of Nrf2 alone and in combination with TGF-β1 on cell growth and survival was investigated by cell counting, Ki67 staining and apoptosis assays. The underlying cell signaling was investigated by western blotting. Statistical analysis was performed by Shapiro-Wilk test for normal distribution. Parametric data were analyzed by one-way ANOVA, while non-parametric data were analyzed by Kruskal-Wallis one-way ANOVA on ranks. Significantly elevated expression of activated Nrf2 and Ki67 could be detected in PanINs but not in normal pancreatic ductal epithelium. While the effect of Nrf2 on basal cell growth of H6c7-pBp, H6c7-kras and Colo357 cells was minor, it clearly attenuated the growth inhibiting effects of TGF-β1 in all cell lines. This enhanced

Transcriptional regulation of Hb-α and Hb-β through nuclear factor E2-related factor-2 (Nrf2) activation in human vaginal cells: A novel mechanism of cellular adaptability to oxidative stress.

Science.gov (United States)

Saha, Debarchana; Koli, Swanand; Reddy, Kudumula Venkata Rami

2017-06-01

Hemoglobin (Hb), a major protein involved in transport of oxygen (O 2 ), is expressed by erythroid lineages. Until recently, it was not known whether non-erythroid cells express Hb. The objective was to evaluate the expression and functional significance of Hb-α and Hb-β in human primary vaginal epithelial cells (hPVECs) and decipher downstream signaling. RT-PCR, qRT-PCR, flow cytometry, Western blot, immunofluorescence were used to evaluate the expression of Hb-α, Hb-β, and nuclear factor E2-related factor-2(Nrf2) after hydrogen peroxide (H 2 O 2 ) induction. Electrophoretic mobility shift assay (EMSA) and chromatin immunoprecipitation (ChIP) assay were used to determine the binding efficiency of Nrf2 on the Hb-α promoter. Stimulation of hPVECs and human vaginal epithelial cell line, VK2/E6E7 with H 2 O 2 augmented the expression of Hb-α, Hb-β, Nrf2, heme oxygenase-1 (HO-1), and reactive oxygen species (ROS). Treatment of these cells with Nrf2 inhibitor, trigonelline (Trig) inhibited Hb-α and Hb-β expressions. Hb-α and Hb-β overexpression downregulated H 2 O 2 -induced ROS. The presence of Nrf2 binding domain was demonstrated within Hb-α promoter. The results revealed for the first time that Hb-α and Hb-β were induced by oxidative stress through the activation of Nrf2. Overexpression of Hb-α and Hb-β ameliorated H 2 O 2 -induced oxidative stress, indicating one of the possible mechanism(s) to protect hPVECS from oxidative stress. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Evolutionary history of the most speciose mammals: molecular phylogeny of muroid rodents.

OpenAIRE

Michaux, Johan; Reyes, A.; Catzeflis, F.

2001-01-01

Phylogenetic relationships between 32 species of rodents representing 14 subfamilies of Muridae and four subfamilies of Dipodidae were studied using sequences of the nuclear protein-coding genes Lecithin Cholesterol Acyl Transferase (LCAT) and von Willebrand Factor (vWF). An examination of some evolutionary properties of each data matrix indicates that the two genes are rather complementary, with lower rates of nonsynonymous substitutions for LCAT. Both markers exhibit a wide range of GC3 per...

A high-throughput screening assay for eukaryotic elongation factor 2 kinase inhibitors

Directory of Open Access Journals (Sweden)

Ting Xiao

2016-10-01

Full Text Available Eukaryotic elongation factor 2 kinase (eEF2K inhibitors may aid in the development of new therapeutic agents to combat cancer. Purified human eEF2K was obtained from an Escherichia coli expression system and a luminescence-based high-throughput screening (HTS assay was developed using MH-1 peptide as the substrate. The luminescent readouts correlated with the amount of adenosine triphosphate remaining in the kinase reaction. This method was applied to a large-scale screening campaign against a diverse compound library and subsequent confirmation studies. Nine initial hits showing inhibitory activities on eEF2K were identified from 56,000 synthetic compounds during the HTS campaign, of which, five were chosen to test their effects in cancer cell lines.

Placental Growth Factor Contributes to Liver Inflammation, Angiogenesis, Fibrosis in Mice by Promoting Hepatic Macrophage Recruitment and Activation

Directory of Open Access Journals (Sweden)

Xi Li

2017-07-01

Full Text Available Placental growth factor (PlGF, a member of the vascular endothelial growth factor (VEGF family, mediates wound healing and inflammatory responses, exerting an effect on liver fibrosis and angiogenesis; however, the precise mechanism remains unclear. The aims of this study are to identify the role of PlGF in liver inflammation and fibrosis induced by bile duct ligation (BDL in mice and to reveal the underlying molecular mechanism. PlGF small interfering RNA (siRNA or non-targeting control siRNA was injected by tail vein starting 2 days after BDL. Liver inflammation, fibrosis, angiogenesis, macrophage infiltration, and hepatic stellate cells (HSCs activation were examined. Our results showed that PlGF was highly expressed in fibrotic livers and mainly distributed in activated HSCs and macrophages. Furthermore, PlGF silencing strongly reduced the severity of liver inflammation and fibrosis, and inhibited the activation of HSCs. Remarkably, PlGF silencing also attenuated BDL-induced hepatic angiogenesis, as evidenced by attenuated liver endothelial cell markers CD31 and von Willebrand factor immunostaining and genes or protein expression. Interestingly, these pathological ameliorations by PlGF silencing were due to a marked reduction in the numbers of intrahepatic F4/80+, CD68+, and Ly6C+ cell populations, which were reflected by a lower expression of these macrophage marker molecules in fibrotic livers. In addition, knockdown of PlGF by siRNA inhibited macrophages activation and substantially suppressed the expression of pro-inflammatory cytokines and chemokines in fibrotic livers. Mechanistically, evaluation of cultured RAW 264.7 cells revealed that VEGF receptor 1 (VEGFR1 mainly involved in mediating the role of PlGF in macrophages recruitment and activation, since using VEGFR1 neutralizing antibody blocking PlGF/VEGFR1 signaling axis significantly inhibited macrophages migration and inflammatory responses. Together, these findings indicate

Regulation of Brain-Derived Neurotrophic Factor and Growth Factor Signaling Pathways by Tyrosine Phosphatase Shp2 in the Retina: A Brief Review

Directory of Open Access Journals (Sweden)

Mojdeh Abbasi

2018-03-01

Full Text Available SH2 domain-containing tyrosine phosphatase-2 (PTPN11 or Shp2 is a ubiquitously expressed protein that plays a key regulatory role in cell proliferation, differentiation and growth factor (GF signaling. This enzyme is well expressed in various retinal neurons and has emerged as an important player in regulating survival signaling networks in the neuronal tissues. The non-receptor phosphatase can translocate to lipid rafts in the membrane and has been implicated to regulate several signaling modules including PI3K/Akt, JAK-STAT and Mitogen Activated Protein Kinase (MAPK pathways in a wide range of biochemical processes in healthy and diseased states. This review focuses on the roles of Shp2 phosphatase in regulating brain-derived neurotrophic factor (BDNF neurotrophin signaling pathways and discusses its cross-talk with various GF and downstream signaling pathways in the retina.

A New V2G Control Strategy for Load Factor Improvement Using Smoothing Technique

Directory of Open Access Journals (Sweden)

CHANHOM, P.

2017-08-01

Full Text Available This paper proposes a new vehicle-to-grid (V2G control strategy for improving the load factor in the power network. To operate the proposed strategy, the available storage capacity of the PEVs’ batteries is considered as a battery energy storage system (BESS for charging and discharging an amount of power corresponding to the V2G power command. Due to the remarkable advantages of the technique so-called simple moving average, it is selected for applying in the proposed V2G control strategy. In this research, for investigating the load factor improvement, the essential data including the daily-load profiles with 7-day and 14-day periods are used for the 3 studied cases. These 3 studied cases present the power network with variation of the PEVs locations for describing the PEVs usage and charging or discharging behavior. The performance of the proposed strategy is simulated and verified by the MATPOWER software. The simulation results show that the load factors of the 3 studied cases are improved. Moreover, the encouragement of energy arbitrage for the PEVs owners is also discussed in this paper.

Light meson form factors at high Q2 from lattice QCD

Science.gov (United States)

Koponen, Jonna; Zimermmane-Santos, André; Davies, Christine; Lepage, G. Peter; Lytle, Andrew

2018-03-01

Measurements and theoretical calculations of meson form factors are essential for our understanding of internal hadron structure and QCD, the dynamics that bind the quarks in hadrons. The pion electromagnetic form factor has been measured at small space-like momentum transfer |q2| theory is applicable. This leaves a gap in the intermediate Q2 where the form factors are not known. As a part of their 12 GeV upgrade Jefferson Lab will measure pion and kaon form factors in this intermediate region, up to Q2 of 6 GeV2. This is then an ideal opportunity for lattice QCD to make an accurate prediction ahead of the experimental results. Lattice QCD provides a from-first-principles approach to calculate form factors, and the challenge here is to control the statistical and systematic uncertainties as errors grow when going to higher Q2 values. Here we report on a calculation that tests the method using an ηs meson, a 'heavy pion' made of strange quarks, and also present preliminary results for kaon and pion form factors. We use the nf = 2 + 1 + 1 ensembles made by the MILC collaboration and Highly Improved Staggered Quarks, which allows us to obtain high statistics. The HISQ action is also designed to have small dicretisation errors. Using several light quark masses and lattice spacings allows us to control the chiral and continuum extrapolation and keep systematic errors in check. Warning, no authors found for 2018EPJWC.17506016.

Specification of jaw identity by the Hand2 transcription factor

Science.gov (United States)

Funato, Noriko; Kokubo, Hiroki; Nakamura, Masataka; Yanagisawa, Hiromi; Saga, Yumiko

2016-01-01

Acquisition of the lower jaw (mandible) was evolutionarily important for jawed vertebrates. In humans, syndromic craniofacial malformations often accompany jaw anomalies. The basic helix-loop-helix transcription factor Hand2, which is conserved among jawed vertebrates, is expressed in the neural crest in the mandibular process but not in the maxillary process of the first branchial arch. Here, we provide evidence that Hand2 is sufficient for upper jaw (maxilla)-to-mandible transformation by regulating the expression of homeobox transcription factors in mice. Altered Hand2 expression in the neural crest transformed the maxillae into mandibles with duplicated Meckel’s cartilage, which resulted in an absence of the secondary palate. In Hand2-overexpressing mutants, non-Hox homeobox transcription factors were dysregulated. These results suggest that Hand2 regulates mandibular development through downstream genes of Hand2 and is therefore a major determinant of jaw identity. Hand2 may have influenced the evolutionary acquisition of the mandible and secondary palate. PMID:27329940

Traffic air pollution and oxidized LDL.

Directory of Open Access Journals (Sweden)

Lotte Jacobs

Full Text Available BACKGROUND: Epidemiologic studies indirectly suggest that air pollution accelerates atherosclerosis. We hypothesized that individual exposure to particulate matter (PM derived from fossil fuel would correlate with plasma concentrations of oxidized low-density lipoprotein (LDL, taken as a marker of atherosclerosis. We tested this hypothesis in patients with diabetes, who are at high risk for atherosclerosis. METHODOLOGY/PRINCIPAL FINDINGS: In a cross-sectional study of non-smoking adult outpatients with diabetes we assessed individual chronic exposure to PM by measuring the area occupied by carbon in airway macrophages, collected by sputum induction and by determining the distance from the patient's residence to a major road, through geocoding. These exposure indices were regressed against plasma concentrations of oxidized LDL, von Willebrand factor and plasminogen activator inhibitor 1 (PAI-1. We could assess the carbon load of airway macrophages in 79 subjects (58 percent. Each doubling in the distance of residence from major roads was associated with a 0.027 µm(2 decrease (95% confidence interval (CI: -0.048 to -0.0051 in the carbon load of airway macrophages. Independently from other covariates, we found that each increase of 0.25 µm(2 [interquartile range (IQR] in carbon load was associated with an increase of 7.3 U/L (95% CI: 1.3 to 13.3 in plasma oxidized LDL. Each doubling in distance of residence from major roads was associated with a decrease of -2.9 U/L (95% CI: -5.2 to -0.72 in oxidized LDL. Neither the carbon load of macrophages nor the distance from residence to major roads, were associated with plasma von Willebrand factor or PAI-1. CONCLUSIONS: The observed positive association, in a susceptible group of the general population, between plasma oxidized LDL levels and either the carbon load of airway macrophages or the proximity of the subject's residence to busy roads suggests a proatherogenic effect of traffic air pollution.

Predicting type 2 diabetes using genetic and environmental risk factors in a multi-ethnic Malaysian cohort.

Science.gov (United States)

Abdullah, N; Abdul Murad, N A; Mohd Haniff, E A; Syafruddin, S E; Attia, J; Oldmeadow, C; Kamaruddin, M A; Abd Jalal, N; Ismail, N; Ishak, M; Jamal, R; Scott, R J; Holliday, E G

2017-08-01

Malaysia has a high and rising prevalence of type 2 diabetes (T2D). While environmental (non-genetic) risk factors for the disease are well established, the role of genetic variations and gene-environment interactions remain understudied in this population. This study aimed to estimate the relative contributions of environmental and genetic risk factors to T2D in Malaysia and also to assess evidence for gene-environment interactions that may explain additional risk variation. This was a case-control study including 1604 Malays, 1654 Chinese and 1728 Indians from the Malaysian Cohort Project. The proportion of T2D risk variance explained by known genetic and environmental factors was assessed by fitting multivariable logistic regression models and evaluating McFadden's pseudo R 2 and the area under the receiver-operating characteristic curve (AUC). Models with and without the genetic risk score (GRS) were compared using the log likelihood ratio Chi-squared test and AUCs. Multiplicative interaction between genetic and environmental risk factors was assessed via logistic regression within and across ancestral groups. Interactions were assessed for the GRS and its 62 constituent variants. The models including environmental risk factors only had pseudo R 2 values of 16.5-28.3% and AUC of 0.75-0.83. Incorporating a genetic score aggregating 62 T2D-associated risk variants significantly increased the model fit (likelihood ratio P-value of 2.50 × 10 -4 -4.83 × 10 -12 ) and increased the pseudo R 2 by about 1-2% and AUC by 1-3%. None of the gene-environment interactions reached significance after multiple testing adjustment, either for the GRS or individual variants. For individual variants, 33 out of 310 tested associations showed nominal statistical significance with 0.001 variation in Malaysian population groups. If gene-environment interactions involving common genetic variants exist, they are likely of small effect, requiring substantially larger samples for

Effect of Puumala hantavirus infection on Human Umbilical Vein Endothelial Cell hemostatic function: platelet interactions, increased tissue factor expression and fibrinolysis regulator release

Directory of Open Access Journals (Sweden)

Marco Goeijenbier

2015-03-01

Full Text Available Puumala virus (PUUV infection causes over 5000 cases of hemorrhagic fever in Europe annually and can influence the hemostatic balance extensively. Infection might lead to hemorrhage, while a recent study showed an increased risk of myocardial infarction during or shortly after PUUV infection. The mechanism by which this hantavirus influences the coagulation system remains unknown. Therefore we aimed to elucidate mechanisms explaining alterations seen in primary and secondary hemostasis during PUUV infection. By using low passage PUUV isolates to infect primary human umbilical vein endothelial cells (HUVECs we were able to show alterations in the regulation of primary- and secondary hemostasis and in the release of fibrinolysis regulators. Our main finding was an activation of secondary hemostasis due to increased tissue factor expression leading to increased thrombin generation in a functional assay. Furthermore, we showed that during infection platelets adhered to HUVECs and subsequently specifically to PUUV virus particles. Infection of HUVECs with PUUV did not result in increased von Willebrand factor while they produced more plasminogen activator inhibitor type-1 (PAI-1 compared to controls. The PAI-1 produced in this model formed complexes with vitronectin. This is the first report that reveals a potential mechanism behind the pro-coagulant changes in PUUV patients, which could be the result of increased thrombin generation due to an increased tissue factor expression on endothelial cells during infection. Furthermore, we provide insight into the contribution of endothelial cell responses regarding hemostasis in PUUV pathogenesis.

Body Mass Index: A Risk Factor for Retinopathy in Type 2 Diabetic Patients

Directory of Open Access Journals (Sweden)

Snježana Kaštelan

2013-01-01

Full Text Available The aim of the study was to investigate whether body mass index (BMI independently or in correlation with other risk factors is associated with diabetic retinopathy (DR progression. The study included 545 patients with type 2 diabetes. According to DR status, they were divided into three groups: group 1 (no retinopathy; n=296, group 2 (mild/moderate nonproliferative DR; n=118, and group 3 (severe/very severe NPDR or proliferative DR; n=131. Patients without DR were younger than those with signs of retinopathy at time of diabetes onset whilst diabetes duration was longer in groups with severe NPDR and PDR. DR progression was correlated with diabetes duration, BMI, HbA1c, hypertension, and cholesterol. Statistical analyses showed that the progression of retinopathy increased significantly with higher BMI (gr. 1: 26.50 ± 2.70, gr. 2: 28.11 ± 3.00, gr. 3: 28.69 ± 2.50; P<0.01. We observed a significant deterioration of HbA1c and a significant increase in cholesterol and hypertension with an increase in BMI. Correlation between BMI and triglycerides was not significant. Thus, BMI in correlation with HbA1c cholesterol and hypertension appears to be associated with the progression of DR in type 2 diabetes and may serve as a predictive factor for the development of this important cause of visual loss in developed countries.

Vasohibin 2 promotes human luminal breast cancer angiogenesis in a non-paracrine manner via transcriptional activation of fibroblast growth factor 2.

Science.gov (United States)

Tu, Min; Lu, Cheng; Lv, Nan; Wei, Jishu; Lu, Zipeng; Xi, Chunhua; Chen, Jianmin; Guo, Feng; Jiang, Kuirong; Li, Qiang; Wu, Junli; Song, Guoxin; Wang, Shui; Gao, Wentao; Miao, Yi

2016-12-28

Vasohibin 2 (VASH2) is an angiogenic factor and cancer-related protein that acts via paracrine mechanisms. Here, we investigated the angiogenic function and mechanism of action of VASH2 in 200 human breast cancer tissues by performing immunohistochemical staining, western blot, indirect sandwich enzyme-linked immunosorbent assay (ELISA), and a semi-quantitative sandwich-based antibody array. Breast cancer cells stably overexpressing VASH2 or with knocked-down VASH2 were established and used for in vivo and in vitro models. In human luminal tissue, but not in HER2-positive or basal-like breast cancer tissues, VASH2 was positively correlated with CD31-positive microvascular density, induced angiogenesis in xenograft tumors, and promoted human umbilical vein endothelial cell tube formation in vitro. VASH2 expression was absent in the concentrated conditioned medium collected from knocked-down VASH2 and VASH2-overexpressing luminal breast cancer cells. Further, VASH2 regulated the expression of fibroblast growth factor 2 (FGF2) in human luminal breast cancer cells, and the pro-angiogenic effect induced by VASH2 overexpression was blocked by FGF2 neutralization in vitro. Additionally, dual luciferase reporter assay and Chromatin immunoprecipitation analysis results showed that FGF2 promoter was transcriptionally activated by VASH2 via histone modifications. In conclusion, VASH2 expression is positively correlated with FGF2 expression and promotes angiogenesis in human luminal breast cancer by transcriptional activation of fibroblast growth factor 2 through non-paracrine mechanisms. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

Regulation of cell proliferation by the E2F transcription factors

DEFF Research Database (Denmark)

Helin, K

1998-01-01

Experimental data generated in the past year have further emphasized the essential role for the E2F transcription factors in the regulation of cell proliferation. Genetic studies have shown that E2F activity is required for normal development in fruitflies, and the generation of E2F-1(-/-) mice h......Fs in the proteasomes. Novel target genes for the E2F transcription factors have been identified that link the E2Fs directly to the initiation of DNA replication.......Experimental data generated in the past year have further emphasized the essential role for the E2F transcription factors in the regulation of cell proliferation. Genetic studies have shown that E2F activity is required for normal development in fruitflies, and the generation of E2F-1(-/-) mice has...... demonstrated that individual members of the E2F transcription factor family are likely to have distinct roles in mammalian development and homeostasis. Additional mechanisms regulating the activity of the E2F transcription factors have been reported, including subcellular localization and proteolysis of the E2...

N1421K mutation in the glycoprotein Ib binding domain impairs ristocetin- and botrocetin-mediated binding of von Willebrand factor to platelets

DEFF Research Database (Denmark)

Lanke, E.; Kristoffersson, A.C.; Isaksson, C.

2008-01-01

, moderately decreased plasma factor VIII (FVIII) and VWF levels, and disproportionately low-plasma VWF:RCo levels. The patients were found to be heterozygous for the novel N1421K mutation, caused by a 4263C > G transversion in exon 28 of the VWF gene coding for the A1 domain. Botrocetin- and ristocetin-mediated...... binding of plasma VWF to GPIb were reduced in the patients. In vitro mutagenesis and expression in COS-7 cells confirmed the impairment of the mutant in botrocetin- and ristocetin-mediated VWF binding to GPIb. VWF collagen binding capacity was unaffected in plasma from the heterozygous individuals as well...

In silico particle margination in blood flow

OpenAIRE

Müller, Kathrin

2015-01-01

A profound knowledge of margination, the migration of blood components to the vessel wall in blood flow, is required in order to understand the genesis of various diseases, as e.g., cardiovascular diseases or bleeding disorders. Margination of particles is a pre-condition for potential adhesion. Adhesion to the vessel wall is required for platelets, the protein von Willebrand factor (VWF), but also for drug and imaging agent carriers in order to perform their particular tasks. In the haemosta...

Molecular genetics of hemophilia A: Clinical perspectives

African Journals Online (AJOL)

Azza A.G. Tantawy

Evaluation of an individual with a suspected bleeding disorder includes: platelet count .... information for genetic counseling of at-risk family members. It is indicated for ... Patients with blood group O and a low von Willebrand antigen level have a ..... [4] Husain N. Carrier analysis for hemophilia A: ideal versus acceptable.

Tissue localization of human trefoil factors 1, 2, and 3

DEFF Research Database (Denmark)

Madsen, Jens; Nielsen, Ole; Tornøe, Ida

2007-01-01

Trefoil factors (TTFs) are small, compact proteins coexpressed with mucins in the gastrointestinal tract. Three trefoil factors are known in mammals: TFF1, TFF2, and TFF3. They are implicated to play diverse roles in maintenance and repair of the gastrointestinal channel. We compared the expression...... pattern of the three trefoil factors analyzing mRNA from a panel of 20 human tissues by conventional reverse transcriptase (RT) PCR and, in addition, by real-time PCR. These findings were supported by immunohistochemical analysis of paraffin-embedded human tissues using rabbit polyclonal antibodies raised...... against these factors. TFF1 showed highest expression in the stomach and colon, whereas TFF2 and TFF3 showed highest expression in stomach and colon, respectively. All three TFFs were found in the ducts of pancreas. Whereas TFF2 was found to be restricted to these two tissues, the structurally more...

Physics program for a 2 GeV, 100% duty factor electron accelerator

International Nuclear Information System (INIS)

Laget, J.M.

1983-11-01

Electron beams are a powerful tool. In electron scattering the possibility of varying independently the energy transfer, the momentum transfer and the polarization of the virtual photon makes it possible to study systematically the different parts of the nuclear dynamics. The use of real or virtual photon beams is a very efficient way to look for very excited states and to study their form factors and their shapes. It is also possible to reach very high momentum transfers and to get rid of the multiple scattering of the probe (which always occurs for hadronic projectiles). This is the best way to study mechanisms which occur at short distances, and which lead to strongly correlated particles in the final state. But the corresponding experiments are also difficult, since they require the detection of several particles in coincidence, and correspond to small transition rates. An energy of 2 GeV and a duty factor close to 100% allow to achieve this goal. The high duty factor makes it possible to perform easily the coincidence experiment: they are the only way to disentangle the various reaction channels, and to single out the mechanisms which are sensitive to short range effects. The energy is high enough to make possible the separation between the longitudinal and the transverse part of the cross section, and to study the spatial behavior of the nuclear transitions at distance as small as .2 fm over the energy range where the Δ-resonance is created. This is the transition domain between two extreme pictures of the nuclear matter

Induction of Epstein-Barr Virus Oncoprotein LMP1 by Transcription Factors AP-2 and Early B Cell Factor

Science.gov (United States)

Noda, Chieko; Narita, Yohei; Watanabe, Takahiro; Yoshida, Masahiro; Ashio, Keiji; Sato, Yoshitaka; Goshima, Fumi; Kanda, Teru; Yoshiyama, Hironori; Tsurumi, Tatsuya; Kimura, Hiroshi

2016-01-01

ABSTRACT Latent membrane protein 1 (LMP1) is a major oncogene essential for primary B cell transformation by Epstein-Barr virus (EBV). Previous studies suggested that some transcription factors, such as PU.1, RBP-Jκ, NF-κB, and STAT, are involved in this expression, but the underlying mechanism is unclear. Here, we identified binding sites for PAX5, AP-2, and EBF in the proximal LMP1 promoter (ED-L1p). We first confirmed the significance of PU.1 and POU domain transcription factor binding for activation of the promoter in latency III. We then focused on the transcription factors AP-2 and early B cell factor (EBF). Interestingly, among the three AP-2-binding sites in the LMP1 promoter, two motifs were also bound by EBF. Overexpression, knockdown, and mutagenesis in the context of the viral genome indicated that AP-2 plays an important role in LMP1 expression in latency II in epithelial cells. In latency III B cells, on the other hand, the B cell-specific transcription factor EBF binds to the ED-L1p and activates LMP1 transcription from the promoter. IMPORTANCE Epstein-Barr virus (EBV) latent membrane protein 1 (LMP1) is crucial for B cell transformation and oncogenesis of other EBV-related malignancies, such as nasopharyngeal carcinoma and T/NK lymphoma. Its expression is largely dependent on the cell type or condition, and some transcription factors have been implicated in its regulation. However, these previous reports evaluated the significance of specific factors mostly by reporter assay. In this study, we prepared point-mutated EBV at the binding sites of such transcription factors and confirmed the importance of AP-2, EBF, PU.1, and POU domain factors. Our results will provide insight into the transcriptional regulation of the major oncogene LMP1. PMID:26819314

Studies of the g factors of the ground 4A2 and the first excited 2E state of Cr 3+ ions in emerald

Science.gov (United States)

Wei, Qun; Guo, Li-Xin; Yang, Zi-Yuan; Wei, Bing

2011-09-01

By using complete diagonalization method, the zero-field splitting and g factors of the ground 4A2 and the first excited 2E states of Cr 3+ ions in emerald are calculated. The theoretical results are in good agreement with the experimental data. The dependencies of the g factors on the crystal field parameters, including Dq, v, and v', have been studied. It is shown that, the g factors of the ground state varied with the crystal field parameters approximately in a linear way, but the g factors of the first excited state varied nonlinearly with these parameters.

Determination of the Pion Charge Form Factor at Q2=1.60 and 2.45 (GeV/c)2

International Nuclear Information System (INIS)

Horn, T.; Beise, E. J.; Breuer, H.; Chang, C. C.; King, P. M.; Liu, J.; Roos, P. G.; Aniol, K.; Margaziotis, D. J.; Arrington, J.; Holt, R. J.; Potterveld, D.; Reimer, P.; Zheng, X.; Barrett, B.; Sarty, A.; Blok, H. P.; Tvaskis, V.; Boeglin, W.; Markowitz, P.

2006-01-01

The 1 H(e,e ' π + )n cross section was measured at four-momentum transfers of Q 2 =1.60 and 2.45 GeV 2 at an invariant mass of the photon nucleon system of W=2.22 GeV. The charged pion form factor (F π ) was extracted from the data by comparing the separated longitudinal pion electroproduction cross section to a Regge model prediction in which F π is a free parameter. The results indicate that the pion form factor deviates from the charge-radius constrained monopole form at these values of Q 2 by one sigma, but is still far from its perturbative quantum chromodynamics prediction

Endogenous Vascular Endothelial Growth Factor-A (VEGF-A) Maintains Endothelial Cell Homeostasis by Regulating VEGF Receptor-2 Transcription*

Science.gov (United States)

E, Guangqi; Cao, Ying; Bhattacharya, Santanu; Dutta, Shamit; Wang, Enfeng; Mukhopadhyay, Debabrata

2012-01-01

Vascular endothelial growth factor A (VEGF-A) is one of the most important factors controlling angiogenesis. Although the functions of exogenous VEGF-A have been widely studied, the roles of endogenous VEGF-A remain unclear. Here we focused on the mechanistic functions of endogenous VEGF-A in endothelial cells. We found that it is complexed with VEGF receptor 2 (VEGFR-2) and maintains a basal expression level for VEGFR-2 and its downstream signaling activation. Endogenous VEGF-A also controls expression of key endothelial specific genes including VEGFR-2, Tie-2, and vascular endothelial cadherin. Of importance, endogenous VEGF-A differs from exogenous VEGF-A by regulating VEGFR-2 transcription through mediation of FoxC2 binding to the FOX:ETS motif, and the complex formed by endogenous VEGF-A with VEGFR-2 is localized within the EEA1 (early endosome antigen 1) endosomal compartment. Taken together, our results emphasize the importance of endogenous VEGF-A in endothelial cells by regulating key vascular proteins and maintaining the endothelial homeostasis. PMID:22167188

Exposure to nerve growth factor worsens nephrotoxic effect induced by Cyclosporine A in HK-2 cells.