WorldWideScience

Sample records for wild-type gene encoding

  1. DNA vaccines encoding proteins from wild-type and attenuated canine distemper virus protect equally well against wild-type virus challenge.

    Science.gov (United States)

    Nielsen, Line; Jensen, Trine Hammer; Kristensen, Birte; Jensen, Tove Dannemann; Karlskov-Mortensen, Peter; Lund, Morten; Aasted, Bent; Blixenkrone-Møller, Merete

    2012-10-01

    Immunity induced by DNA vaccines containing the hemagglutinin (H) and nucleoprotein (N) genes of wild-type and attenuated canine distemper virus (CDV) was investigated in mink (Mustela vison), a highly susceptible natural host of CDV. All DNA-immunized mink seroconverted, and significant levels of virus-neutralizing (VN) antibodies were present on the day of challenge with wild-type CDV. The DNA vaccines also primed the cell-mediated memory responses, as indicated by an early increase in the number of interferon-gamma (IFN-γ)-producing lymphocytes after challenge. Importantly, the wild-type and attenuated CDV DNA vaccines had a long-term protective effect against wild-type CDV challenge. The vaccine-induced immunity induced by the H and N genes from wild-type CDV and those from attenuated CDV was comparable. Because these two DNA vaccines were shown to protect equally well against wild-type virus challenge, it is suggested that the genetic/antigenic heterogeneity between vaccine strains and contemporary wild-type strains are unlikely to cause vaccine failure.

  2. Synthesis of a wild-type and three mutant Cucurbita maxima trypsin inhibitor-encoding genes by a single-strand approach.

    Science.gov (United States)

    Botes, D P; Qobose, M D; Corfield, V A

    1991-09-15

    A single-strand approach to gene assembly, based on a modification of an in vitro complementary oligodeoxyribonucleotide template-directed ligation of the desired sequence to a linearized vector [Chen et al., Nucleic Acids Res. 18 (1990) 871-878], is described. The gene coding for the wild-type Cucurbita maxima trypsin inhibitor of 29 amino acid residues [Bode et al., FEBS Lett. 242 (1989) 285-292], as well as three mutant forms of the gene, in which two of the three disulfide bonds have been replaced singly or as a pair, have been synthesized in a single synthesis run with minimal manual intervention. Subsequent to ligation to pUC9 and in vivo gapped duplex repair by Escherichia coli, their sequences have been verified.

  3. Spatial encoding in spinal sensorimotor circuits differs in different wild type mice strains

    Directory of Open Access Journals (Sweden)

    Schouenborg Jens

    2008-05-01

    Full Text Available Abstract Background Previous studies in the rat have shown that the spatial organisation of the receptive fields of nociceptive withdrawal reflex (NWR system are functionally adapted through experience dependent mechanisms, termed somatosensory imprinting, during postnatal development. Here we wanted to clarify 1 if mice exhibit a similar spatial encoding of sensory input to NWR as previously found in the rat and 2 if mice strains with a poor learning capacity in various behavioural tests, associated with deficient long term potention, also exhibit poor adaptation of NWR. The organisation of the NWR system in two adult wild type mouse strains with normal long term potentiation (LTP in hippocampus and two adult wild type mouse strains exhibiting deficiencies in corresponding LTP were used and compared to previous results in the rat. Receptive fields of reflexes in single hindlimb muscles were mapped with CO2 laser heat pulses. Results While the spatial organisation of the nociceptive receptive fields in mice with normal LTP were very similar to those in rats, the LTP impaired strains exhibited receptive fields of NWRs with aberrant sensitivity distributions. However, no difference was found in NWR thresholds or onset C-fibre latencies suggesting that the mechanisms determining general reflex sensitivity and somatosensory imprinting are different. Conclusion Our results thus confirm that sensory encoding in mice and rat NWR is similar, provided that mice strains with a good learning capability are studied and raise the possibility that LTP like mechanisms are involved in somatosensory imprinting.

  4. Screening and Expression of a Silicon Transporter Gene (Lsi1) in Wild-Type Indica Rice Cultivars

    Science.gov (United States)

    Abiri, Rambod; Kalhori, Nahid; Atabaki, Narges

    2017-01-01

    Silicon (Si) is one of the most prevalent elements in the soil. It is beneficial for plant growth and development, and it contributes to plant defense against different stresses. The Lsi1 gene encodes a Si transporter that was identified in a mutant Japonica rice variety. This gene was not identified in fourteen Malaysian rice varieties during screening. Then, a mutant version of Lsi1 was substituted for the native version in the three most common Malaysian rice varieties, MR219, MR220, and MR276, to evaluate the function of the transgene. Real-time PCR was used to explore the differential expression of Lsi1 in the three transgenic rice varieties. Silicon concentrations in the roots and leaves of transgenic plants were significantly higher than in wild-type plants. Transgenic varieties showed significant increases in the activities of the enzymes SOD, POD, APX, and CAT; photosynthesis; and chlorophyll content; however, the highest chlorophyll A and B levels were observed in transgenic MR276. Transgenic varieties have shown a stronger root and leaf structure, as well as hairier roots, compared to the wild-type plants. This suggests that Lsi1 plays a key role in rice, increasing the absorption and accumulation of Si, then alters antioxidant activities, and improves morphological properties. PMID:28191468

  5. Screening and Expression of a Silicon Transporter Gene (Lsi1 in Wild-Type Indica Rice Cultivars

    Directory of Open Access Journals (Sweden)

    Mahbod Sahebi

    2017-01-01

    Full Text Available Silicon (Si is one of the most prevalent elements in the soil. It is beneficial for plant growth and development, and it contributes to plant defense against different stresses. The Lsi1 gene encodes a Si transporter that was identified in a mutant Japonica rice variety. This gene was not identified in fourteen Malaysian rice varieties during screening. Then, a mutant version of Lsi1 was substituted for the native version in the three most common Malaysian rice varieties, MR219, MR220, and MR276, to evaluate the function of the transgene. Real-time PCR was used to explore the differential expression of Lsi1 in the three transgenic rice varieties. Silicon concentrations in the roots and leaves of transgenic plants were significantly higher than in wild-type plants. Transgenic varieties showed significant increases in the activities of the enzymes SOD, POD, APX, and CAT; photosynthesis; and chlorophyll content; however, the highest chlorophyll A and B levels were observed in transgenic MR276. Transgenic varieties have shown a stronger root and leaf structure, as well as hairier roots, compared to the wild-type plants. This suggests that Lsi1 plays a key role in rice, increasing the absorption and accumulation of Si, then alters antioxidant activities, and improves morphological properties.

  6. Screening and Expression of a Silicon Transporter Gene (Lsi1) in Wild-Type Indica Rice Cultivars.

    Science.gov (United States)

    Sahebi, Mahbod; Hanafi, Mohamed M; Rafii, M Y; Azizi, Parisa; Abiri, Rambod; Kalhori, Nahid; Atabaki, Narges

    2017-01-01

    Silicon (Si) is one of the most prevalent elements in the soil. It is beneficial for plant growth and development, and it contributes to plant defense against different stresses. The Lsi1 gene encodes a Si transporter that was identified in a mutant Japonica rice variety. This gene was not identified in fourteen Malaysian rice varieties during screening. Then, a mutant version of Lsi1 was substituted for the native version in the three most common Malaysian rice varieties, MR219, MR220, and MR276, to evaluate the function of the transgene. Real-time PCR was used to explore the differential expression of Lsi1 in the three transgenic rice varieties. Silicon concentrations in the roots and leaves of transgenic plants were significantly higher than in wild-type plants. Transgenic varieties showed significant increases in the activities of the enzymes SOD, POD, APX, and CAT; photosynthesis; and chlorophyll content; however, the highest chlorophyll A and B levels were observed in transgenic MR276. Transgenic varieties have shown a stronger root and leaf structure, as well as hairier roots, compared to the wild-type plants. This suggests that Lsi1 plays a key role in rice, increasing the absorption and accumulation of Si, then alters antioxidant activities, and improves morphological properties.

  7. Gene expression profiling in wild-type and metallothionein mutant fibroblast cell lines

    Directory of Open Access Journals (Sweden)

    ÁNGELA D ARMENDÁRIZ

    2006-01-01

    Full Text Available The role of metallothioneins (MT in copper homeostasis is of great interest, as it appears to be partially responsible for the regulation of intracellular copper levels during adaptation to extracellular excess of the metal. To further investigate a possible role of MTs in copper metabolism, a genomics approach was utilized to evaluate the role of MT on gene expression. Microarray analysis was used to examine the effects of copper overload in fibroblast cells from normal and MT I and II double knock-out mice (MT-/-. As a first step, we compared genes that were significantly upregulated in wild-type and MT-/- cells exposed to copper. Even though wild-type and mutant cells are undistinguishable in terms of their morphological features and rates of growth, our results show that MT-/- cells do not respond with induction of typical markers of cellular stress under copper excess conditions, as observed in the wild-type cell line, suggesting that the transcription initiation rate or the mRNA stability of stress genes is affected when there is an alteration in the copper store capacity. The functional classification of other up-regulated genes in both cell lines indicates that a large proportion (>80% belong to two major categories: 1 metabolism; and 2 cellular physiological processes, suggesting that at the transcriptional level copper overload induces the expression of genes associated with diverse molecular functions. These results open the possibility to understand how copper homeostasis is being coordinated with other metabolic pathways.

  8. Mutant INS-gene induced diabetes of youth: proinsulin cysteine residues impose dominant-negative inhibition on wild-type proinsulin transport.

    Directory of Open Access Journals (Sweden)

    Ming Liu

    2010-10-01

    Full Text Available Recently, a syndrome of Mutant INS-gene-induced Diabetes of Youth (MIDY, derived from one of 26 distinct mutations has been identified as a cause of insulin-deficient diabetes, resulting from expression of a misfolded mutant proinsulin protein in the endoplasmic reticulum (ER of insulin-producing pancreatic beta cells. Genetic deletion of one, two, or even three alleles encoding insulin in mice does not necessarily lead to diabetes. Yet MIDY patients are INS-gene heterozygotes; inheritance of even one MIDY allele, causes diabetes. Although a favored explanation for the onset of diabetes is that insurmountable ER stress and ER stress response from the mutant proinsulin causes a net loss of beta cells, in this report we present three surprising and interlinked discoveries. First, in the presence of MIDY mutants, an increased fraction of wild-type proinsulin becomes recruited into nonnative disulfide-linked protein complexes. Second, regardless of whether MIDY mutations result in the loss, or creation, of an extra unpaired cysteine within proinsulin, Cys residues in the mutant protein are nevertheless essential in causing intracellular entrapment of co-expressed wild-type proinsulin, blocking insulin production. Third, while each of the MIDY mutants induces ER stress and ER stress response; ER stress and ER stress response alone appear insufficient to account for blockade of wild-type proinsulin. While there is general agreement that ultimately, as diabetes progresses, a significant loss of beta cell mass occurs, the early events described herein precede cell death and loss of beta cell mass. We conclude that the molecular pathogenesis of MIDY is initiated by perturbation of the disulfide-coupled folding pathway of wild-type proinsulin.

  9. Complementation of the amylose-free starch mutant of potato (Solanum tuberosum.) by the gene encoding granule-bound starch synthase

    NARCIS (Netherlands)

    van der Leij, E.R.; Visser, R.G.E.; OOSTERHAVEN, K; VANDERKOP, DAM; Jacobsen, E.; Feenstra, W.

    1991-01-01

    Agrobacterium rhizogenes-mediated introduction of the wild-type allele of the gene encoding granule-bound starch synthase (GBSS) into the amylose-free starch mutant amf of potato leads to restoration of GBSS activity and amylose synthesis, which demonstrates that Amf is the structural gene for GBSS.

  10. A speculated ribozyme site in the herpes simplex virus type 1 latency-associated transcript gene is not essential for a wild-type reactivation phenotype

    Science.gov (United States)

    Carpenter, Dale; Singh, Sukhpreet; Osorio, Nelson; Hsiang, Chinhui; Jiang, Xianzhi; Jin, Ling; Jones, Clinton; Wechsler, Steven L

    2010-01-01

    During herpes simplex virus-1 (HSV-1) latency in sensory neurons, LAT (latency-associated transcript) is the only abundantly expressed viral gene. LAT plays an important role in the HSV-1 latency-reactivation cycle, because LAT deletion mutants have a significantly decreased reactivation phenotype. Based solely on sequence analysis, it was speculated that LAT encodes a ribozyme that plays an important role in how LAT enhances the virus’ reactivation phenotype. Because LAT ribozyme activity has never been reported, we decided to test the converse hypothesis, namely, that this region of LAT does not encode a ribozyme function important for LAT’s ability to enhance the reactivation phenotype. We constructed a viral mutant (LAT-Rz) in which the speculated ribozyme consensus sequence was altered such that no ribozyme was encoded. We report here that LAT-Rz had a wild-type reactivation phenotype in mice, confirming the hypothesis that the speculated LAT ribozyme is not a dominant factor in stimulating the latency-reactivation cycle in mice. PMID:18982533

  11. Tumour gene expression predicts response to cetuximab in patients with KRAS wild-type metastatic colorectal cancer.

    Science.gov (United States)

    Baker, J B; Dutta, D; Watson, D; Maddala, T; Munneke, B M; Shak, S; Rowinsky, E K; Xu, L-A; Harbison, C T; Clark, E A; Mauro, D J; Khambata-Ford, S

    2011-02-01

    Although it is accepted that metastatic colorectal cancers (mCRCs) that carry activating mutations in KRAS are unresponsive to anti-epidermal growth factor receptor (EGFR) monoclonal antibodies, a significant fraction of KRAS wild-type (wt) mCRCs are also unresponsive to anti-EGFR therapy. Genes encoding EGFR ligands amphiregulin (AREG) and epiregulin (EREG) are promising gene expression-based markers but have not been incorporated into a test to dichotomise KRAS wt mCRC patients with respect to sensitivity to anti-EGFR treatment. We used RT-PCR to test 110 candidate gene expression markers in primary tumours from 144 KRAS wt mCRC patients who received monotherapy with the anti-EGFR antibody cetuximab. Results were correlated with multiple clinical endpoints: disease control, objective response, and progression-free survival (PFS). Expression of many of the tested candidate genes, including EREG and AREG, strongly associate with all clinical endpoints. Using multivariate analysis with two-layer five-fold cross-validation, we constructed a four-gene predictive classifier. Strikingly, patients below the classifier cutpoint had PFS and disease control rates similar to those of patients with KRAS mutant mCRC. Gene expression appears to identify KRAS wt mCRC patients who receive little benefit from cetuximab. It will be important to test this model in an independent validation study.

  12. Increased enzyme production under liquid culture conditions in the industrial fungus Aspergillus oryzae by disruption of the genes encoding cell wall α-1,3-glucan synthase.

    Science.gov (United States)

    Miyazawa, Ken; Yoshimi, Akira; Zhang, Silai; Sano, Motoaki; Nakayama, Mayumi; Gomi, Katsuya; Abe, Keietsu

    2016-09-01

    Under liquid culture conditions, the hyphae of filamentous fungi aggregate to form pellets, which reduces cell density and fermentation productivity. Previously, we found that loss of α-1,3-glucan in the cell wall of the fungus Aspergillus nidulans increased hyphal dispersion. Therefore, here we constructed a mutant of the industrial fungus A. oryzae in which the three genes encoding α-1,3-glucan synthase were disrupted (tripleΔ). Although the hyphae of the tripleΔ mutant were not fully dispersed, the mutant strain did form smaller pellets than the wild-type strain. We next examined enzyme productivity under liquid culture conditions by transforming the cutinase-encoding gene cutL1 into A. oryzae wild-type and the tripleΔ mutant (i.e. wild-type-cutL1, tripleΔ-cutL1). A. oryzae tripleΔ-cutL1 formed smaller hyphal pellets and showed both greater biomass and increased CutL1 productivity compared with wild-type-cutL1, which might be attributable to a decrease in the number of tripleΔ-cutL1 cells under anaerobic conditions.

  13. The Riemerella anatipestifer AS87_01735 Gene Encodes Nicotinamidase PncA, an Important Virulence Factor.

    Science.gov (United States)

    Wang, Xiaolan; Liu, Beibei; Dou, Yafeng; Fan, Hongjie; Wang, Shaohui; Li, Tao; Ding, Chan; Yu, Shengqing

    2016-10-01

    Riemerella anatipestifer is a major bacterial pathogen that causes septicemic and exudative diseases in domestic ducks. In our previous study, we found that deletion of the AS87_01735 gene significantly decreased the bacterial virulence of R. anatipestifer strain Yb2 (mutant RA625). The AS87_01735 gene was predicted to encode a nicotinamidase (PncA), a key enzyme that catalyzes the conversion of nicotinamide to nicotinic acid, which is an important reaction in the NAD(+) salvage pathway. In this study, the AS87_01735 gene was expressed and identified as the PncA-encoding gene, using an enzymatic assay. Western blot analysis demonstrated that R. anatipestifer PncA was localized to the cytoplasm. The mutant strain RA625 (named Yb2ΔpncA in this study) showed a similar growth rate but decreased NAD(+) quantities in both the exponential and stationary phases in tryptic soy broth culture, compared with the wild-type strain Yb2. In addition, Yb2ΔpncA-infected ducks showed much lower bacterial loads in their blood, and no visible histological changes were observed in the heart, liver, and spleen. Furthermore, Yb2ΔpncA immunization of ducks conferred effective protection against challenge with the virulent wild-type strain Yb2. Our results suggest that the R. anatipestifer AS87_01735 gene encodes PncA, which is an important virulence factor, and that the Yb2ΔpncA mutant can be used as a novel live vaccine candidate. Riemerella anatipestifer is reported worldwide as a cause of septicemic and exudative diseases of domestic ducks. The pncA gene encodes a nicotinamidase (PncA), a key enzyme that catalyzes the conversion of nicotinamide to nicotinic acid, which is an important reaction in the NAD(+) salvage pathway. In this study, we identified and characterized the pncA-homologous gene AS87_01735 in R. anatipestifer strain Yb2. R. anatipestifer PncA is a cytoplasmic protein that possesses similar PncA activity, compared with other organisms. Generation of the pncA mutant Yb

  14. Typing of Panton-Valentine Leukocidin-Encoding Phages and lukSF-PV Gene Sequence Variation in Staphylococcus aureus from China.

    Science.gov (United States)

    Zhao, Huanqiang; Hu, Fupin; Jin, Shu; Xu, Xiaogang; Zou, Yuhan; Ding, Baixing; He, Chunyan; Gong, Fang; Liu, Qingzhong

    2016-01-01

    Panton-Valentine leukocidin (PVL, encoded by lukSF-PV genes), a bi-component and pore-forming toxin, is carried by different staphylococcal bacteriophages. The prevalence of PVL in Staphylococcus aureus has been reported around the globe. However, the data on PVL-encoding phage types, lukSF-PV gene variation and chromosomal phage insertion sites for PVL-positive S. aureus are limited, especially in China. In order to obtain a more complete understanding of the molecular epidemiology of PVL-positive S. aureus, an integrated and modified PCR-based scheme was applied to detect the PVL-encoding phage types. Phage insertion locus and the lukSF-PV variant were determined by PCR and sequencing. Meanwhile, the genetic background was characterized by staphylococcal cassette chromosome mec (SCCmec) typing, staphylococcal protein A (spa) gene polymorphisms typing, pulsed-field gel electrophoresis (PFGE) typing, accessory gene regulator (agr) locus typing and multilocus sequence typing (MLST). Seventy eight (78/1175, 6.6%) isolates possessed the lukSF-PV genes and 59.0% (46/78) of PVL-positive strains belonged to CC59 lineage. Eight known different PVL-encoding phage types were detected, and Φ7247PVL/ΦST5967PVL (n = 13) and ΦPVL (n = 12) were the most prevalent among them. While 25 (25/78, 32.1%) isolates, belonging to ST30, and ST59 clones, were unable to be typed by the modified PCR-based scheme. Single nucleotide polymorphisms (SNPs) were identified at five locations in the lukSF-PV genes, two of which were non-synonymous. Maximum-likelihood tree analysis of attachment sites sequences detected six SNP profiles for attR and eight for attL, respectively. In conclusion, the PVL-positive S. aureus mainly harbored Φ7247PVL/ΦST5967PVL and ΦPVL in the regions studied. lukSF-PV gene sequences, PVL-encoding phages, and phage insertion locus generally varied with lineages. Moreover, PVL-positive clones that have emerged worldwide likely carry distinct phages.

  15. Typing of Panton-Valentine Leukocidin-encoding Phages and lukSF-PV Gene Sequence Variation in Staphylococcus aureus from China

    Directory of Open Access Journals (Sweden)

    Huanqiang Zhao

    2016-08-01

    Full Text Available Panton-Valentine leucocidin (PVL, encoded by lukSF-PV genes, a bi-component and pore-forming toxin, is carried by different staphylococcal bacteriophages. The prevalence of PVL in Staphylococcus aureus (S. aureus have been reported around the globe. However, the data on PVL-encoding phage types, lukSF-PV gene variation and chromosomal phage insertion sites for PVL-positive S. aureus are limited, especially in China. In order to obtain a more complete understanding of the molecular epidemiology of PVL-positive S. aureus, an integrated and modified PCR-based scheme was applied to detect the PVL-encoding phage types. Phage insertion locus and the lukSF-PV variant were determined by PCR and sequencing. Meanwhile, the genetic background was characterized by staphylococcal cassette chromosome mec (SCCmec typing, staphylococcal protein A (spa gene polymorphisms typing, pulsed-field gel electrophoresis (PFGE typing, accessory gene regulator (agr locus typing and multilocus sequence typing (MLST. Seventy eight (78/1175, 6.6% isolates possessed the lukSF-PV genes and 59.0% (46/78 of PVL-positive strains belonged to CC59 lineage. Eight known different PVL-encoding phage types were detected, and Φ7247PVL/ΦST5967PVL (n=13 and ΦPVL (n=12 were the most prevalent among them. While 25 (25/78, 32.1% isolates, belonging to ST30 and ST59 clones, were unable to be typed by the modified PCR-based scheme. Single nucleotide polymorphisms (SNPs were identified at five locations in the lukSF-PV genes, two of which were non-synonymous. Maximum-likelihood tree analysis of attachment sites sequences detected six SNP profiles for attR and eight for attL, respectively. In conclusion, the PVL-positive S. aureus mainly harbored Φ7247PVL/ΦST5967PVL and ΦPVL in the regions studied. lukSF-PV gene sequences, PVL-encoding phages and phage insertion locus generally varied with lineages. Moreover, PVL-positive clones that have emerged worldwide likely carry distinct phages.

  16. Molecular cloning and expression of the gene encoding the kinetoplast-associated type II DNA topoisomerase of Crithidia fasciculata.

    Science.gov (United States)

    Pasion, S G; Hines, J C; Aebersold, R; Ray, D S

    1992-01-01

    A type II DNA topoisomerase, topoIImt, was shown previously to be associated with the kinetoplast DNA of the trypanosomatid Crithidia fasciculata. The gene encoding this kinetoplast-associated topoisomerase has been cloned by immunological screening of a Crithidia genomic expression library with monoclonal antibodies raised against the purified enzyme. The gene CfaTOP2 is a single copy gene and is expressed as a 4.8-kb polyadenylated transcript. The nucleotide sequence of CfaTOP2 has been determined and encodes a predicted polypeptide of 1239 amino acids with a molecular mass of 138,445. The identification of the cloned gene is supported by immunoblot analysis of the beta-galactosidase-CfaTOP2 fusion protein expressed in Escherichia coli and by analysis of tryptic peptide sequences derived from purified topoIImt. CfaTOP2 shares significant homology with nuclear type II DNA topoisomerases of other eukaryotes suggesting that in Crithidia both nuclear and mitochondrial forms of topoisomerase II are encoded by the same gene.

  17. Identification of the gene encoding the 65-kilodalton DNA-binding protein of herpes simplex virus type 1

    International Nuclear Information System (INIS)

    Parris, D.S.; Cross, A.; Orr, A.; Frame, M.C.; Murphy, M.; McGeoch, D.J.; Marsden, H.S.; Haarr, L.

    1988-01-01

    Hybrid arrest of in vitro translation was used to localize the region of the herpes simplex virus type 1 genome encoding the 65-kilodalton DNA-binding protein (65K DBP ) to between genome coordinates 0.592 and 0.649. Knowledge of the DNA sequence of this region allowed us to identify three open reading frames as likely candidates for the gene encoding 65K DBP . Two independent approaches were used to determine which of these three open reading frames encoded the protein. For the first approach a monoclonal antibody, MAb 6898, which reacted specifically with 65K DBP , was isolated. This antibody was used, with the techniques of hybrid arrest of in vitro translation and in vitro translation of selected mRNA, to identify the gene encoding 65K DBP . The second approach involved preparation of antisera directed against oligopeptides corresponding to regions of the predicted amino acid sequence of this gene. These antisera reacted specifically with 65K DBP , thus confirming the gene assignment

  18. Impact of recombination on polymorphism of genes encoding Kunitz-type protease inhibitors in the genus Solanum.

    Science.gov (United States)

    Speranskaya, Anna S; Krinitsina, Anastasia A; Kudryavtseva, Anna V; Poltronieri, Palmiro; Santino, Angelo; Oparina, Nina Y; Dmitriev, Alexey A; Belenikin, Maxim S; Guseva, Marina A; Shevelev, Alexei B

    2012-08-01

    The group of Kunitz-type protease inhibitors (KPI) from potato is encoded by a polymorphic family of multiple allelic and non-allelic genes. The previous explanations of the KPI variability were based on the hypothesis of random mutagenesis as a key factor of KPI polymorphism. KPI-A genes from the genomes of Solanum tuberosum cv. Istrinskii and the wild species Solanum palustre were amplified by PCR with subsequent cloning in plasmids. True KPI sequences were derived from comparison of the cloned copies. "Hot spots" of recombination in KPI genes were independently identified by DnaSP 4.0 and TOPALi v2.5 software. The KPI-A sequence from potato cv. Istrinskii was found to be 100% identical to the gene from Solanum nigrum. This fact illustrates a high degree of similarity of KPI genes in the genus Solanum. Pairwise comparison of KPI A and B genes unambiguously showed a non-uniform extent of polymorphism at different nt positions. Moreover, the occurrence of substitutions was not random along the strand. Taken together, these facts contradict the traditional hypothesis of random mutagenesis as a principal source of KPI gene polymorphism. The experimentally found mosaic structure of KPI genes in both plants studied is consistent with the hypothesis suggesting recombination of ancestral genes. The same mechanism was proposed earlier for other resistance-conferring genes in the nightshade family (Solanaceae). Based on the data obtained, we searched for potential motifs of site-specific binding with plant DNA recombinases. During this work, we analyzed the sequencing data reported by the Potato Genome Sequencing Consortium (PGSC), 2011 and found considerable inconsistence of their data concerning the number, location, and orientation of KPI genes of groups A and B. The key role of recombination rather than random point mutagenesis in KPI polymorphism was demonstrated for the first time. Copyright © 2012 Elsevier Masson SAS. All rights reserved.

  19. Expression-based clustering of CAZyme-encoding genes of Aspergillus niger.

    Science.gov (United States)

    Gruben, Birgit S; Mäkelä, Miia R; Kowalczyk, Joanna E; Zhou, Miaomiao; Benoit-Gelber, Isabelle; De Vries, Ronald P

    2017-11-23

    The Aspergillus niger genome contains a large repertoire of genes encoding carbohydrate active enzymes (CAZymes) that are targeted to plant polysaccharide degradation enabling A. niger to grow on a wide range of plant biomass substrates. Which genes need to be activated in certain environmental conditions depends on the composition of the available substrate. Previous studies have demonstrated the involvement of a number of transcriptional regulators in plant biomass degradation and have identified sets of target genes for each regulator. In this study, a broad transcriptional analysis was performed of the A. niger genes encoding (putative) plant polysaccharide degrading enzymes. Microarray data focusing on the initial response of A. niger to the presence of plant biomass related carbon sources were analyzed of a wild-type strain N402 that was grown on a large range of carbon sources and of the regulatory mutant strains ΔxlnR, ΔaraR, ΔamyR, ΔrhaR and ΔgalX that were grown on their specific inducing compounds. The cluster analysis of the expression data revealed several groups of co-regulated genes, which goes beyond the traditionally described co-regulated gene sets. Additional putative target genes of the selected regulators were identified, based on their expression profile. Notably, in several cases the expression profile puts questions on the function assignment of uncharacterized genes that was based on homology searches, highlighting the need for more extensive biochemical studies into the substrate specificity of enzymes encoded by these non-characterized genes. The data also revealed sets of genes that were upregulated in the regulatory mutants, suggesting interaction between the regulatory systems and a therefore even more complex overall regulatory network than has been reported so far. Expression profiling on a large number of substrates provides better insight in the complex regulatory systems that drive the conversion of plant biomass by fungi. In

  20. The fixABCX genes in Rhodospirillum rubrum encode a putative membrane complex participating in electron transfer to nitrogenase.

    Science.gov (United States)

    Edgren, Tomas; Nordlund, Stefan

    2004-04-01

    In our efforts to identify the components participating in electron transport to nitrogenase in Rhodospirillum rubrum, we used mini-Tn5 mutagenesis followed by metronidazole selection. One of the mutants isolated, SNT-1, exhibited a decreased growth rate and about 25% of the in vivo nitrogenase activity compared to the wild-type values. The in vitro nitrogenase activity was essentially wild type, indicating that the mutation affects electron transport to nitrogenase. Sequencing showed that the Tn5 insertion is located in a region with a high level of similarity to fixC, and extended sequencing revealed additional putative fix genes, in the order fixABCX. Complementation of SNT-1 with the whole fix gene cluster in trans restored wild-type nitrogenase activity and growth. Using Western blotting, we demonstrated that expression of fixA and fixB occurs only under conditions under which nitrogenase also is expressed. SNT-1 was further shown to produce larger amounts of both ribulose 1,5-bisphosphate carboxylase/oxygenase and polyhydroxy alkanoates than the wild type, indicating that the redox status is affected in this mutant. Using Western blotting, we found that FixA and FixB are soluble proteins, whereas FixC most likely is a transmembrane protein. We propose that the fixABCX genes encode a membrane protein complex that plays a central role in electron transfer to nitrogenase in R. rubrum. Furthermore, we suggest that FixC is the link between nitrogen fixation and the proton motive force generated in the photosynthetic reactions.

  1. Genetic and phylogenetic characterization of the type II cyclobutane pyrimidine dimer photolyases encoded by Leporipoxviruses

    International Nuclear Information System (INIS)

    Bennett, C. James; Webb, Melissa; Willer, David O.; Evans, David H.

    2003-01-01

    Shope fibroma virus and myxoma virus encode proteins predicted to be Type II photolyases. These are enzymes that catalyze light-dependent repair of cyclobutane pyrimidine dimers (CPDs). When the Shope fibroma virus S127L gene was expressed in an Escherichia coli strain lacking functional CPD repair pathways, the expressed gene protected the bacteria from 70-75% of the ultraviolet (UV) light-induced cytotoxic DNA damage. This proportion suggests that Leporipoxvirus photolyases can only repair CPDs, which typically comprise ∼70% of the damage caused by short wavelength UV light. To test whether these enzymes can protect virus genomes from UV, we exposed virus suspensions to UV-C light followed by graded exposure to filtered visible light. Viruses encoding a deletion of the putative photolyase gene were unable to photoreactivate UV damage while this treatment again eliminated 70-90% of the lethal photoproducts in wild-type viruses. Western blotting detected photolyase protein in extracts prepared from purified virions and it can be deduced that the poxvirion interior must be fluid enough to permit diffusion of this ∼50-kDa DNA-binding protein to the sites where it catalyzes photoreactivation. Photolyase promoters are difficult to categorize using bioinformatics methods, as they do not obviously resemble any of the known poxvirus promoter motifs. By fusing the SFV promoter to DNA encoding a luciferase open reading frame, the photolyase promoter was found to exhibit very weak late promoter activity. These data show that the genomes of Leporipoxviruses, similar to that of fowlpox virus, encode catalytically active photolyases. Phylogenetic studies also confirmed the monophyletic origin of poxviruses and suggest an ancient origin for these genes and perhaps poxviruses

  2. The pmr gene, encoding a Ca2+-ATPase, is required for calcium and manganese homeostasis and normal development of hyphae and conidia in Neurospora crassa.

    Science.gov (United States)

    Bowman, Barry J; Abreu, Stephen; Johl, Jessica K; Bowman, Emma Jean

    2012-11-01

    The pmr gene is predicted to encode a Ca(2+)-ATPase in the secretory pathway. We examined two strains of Neurospora crassa that lacked PMR: the Δpmr strain, in which pmr was completely deleted, and pmr(RIP), in which the gene was extensively mutated. Both strains had identical, complex phenotypes. Compared to the wild type, these strains required high concentrations of calcium or manganese for optimal growth and had highly branched, slow-growing hyphae. They conidiated poorly, and the shape and size of the conidia were abnormal. Calcium accumulated in the Δpmr strains to only 20% of the wild-type level. High concentrations of MnCl(2) (1 to 5 mM) in growth medium partially suppressed the morphological defects but did not alter the defect in calcium accumulation. The Δpmr Δnca-2 double mutant (nca-2 encodes a Ca(2+)-ATPase in the plasma membrane) accumulated 8-fold more calcium than the wild type, and the morphology of the hyphae was more similar to that of wild-type hyphae. Previous experiments failed to show a function for nca-1, which encodes a SERCA-type Ca(2+)-ATPase in the endoplasmic reticulum (B. J. Bowman, S. Abreu, E. Margolles-Clark, M. Draskovic, and E. J. Bowman, Eukaryot. Cell 10:654-661, 2011). The pmr(RIP) Δnca-1 double mutant accumulated small amounts of calcium, like the Δpmr strain, but exhibited even more extreme morphological defects. Thus, PMR can apparently replace NCA-1 in the endoplasmic reticulum, but NCA-1 cannot replace PMR. The morphological defects in the Δpmr strain are likely caused, in part, by insufficient concentrations of calcium and manganese in the Golgi compartment; however, PMR is also needed to accumulate normal levels of calcium in the whole cell.

  3. Transcriptional regulatory program in wild-type and retinoblastoma gene-deficient mouse embryonic fibroblasts during adipocyte differentiation

    DEFF Research Database (Denmark)

    Hakim-Weber, Robab; Krogsdam, Anne-M; Jørgensen, Claus

    2011-01-01

    Although many molecular regulators of adipogenesis have been identified a comprehensive catalogue of components is still missing. Recent studies showed that the retinoblastoma protein (pRb) was expressed in the cell cycle and late cellular differentiation phase during adipogenesis. To investigate...... this dual role of pRb in the early and late stages of adipogenesis we used microarrays to perform a comprehensive systems-level analysis of the common transcriptional program of the classic 3T3-L1 preadipocyte cell line, wild-type mouse embryonic fibroblasts (MEFs), and retinoblastoma gene-deficient MEFs...... of experimental data and computational analyses pinpointed a feedback-loop between Pparg and Foxo1.To analyze the effects of the retinoblastoma protein at the transcriptional level we chose a perturbated system (Rb-/- MEFs) for comparison to the transcriptional program of wild-type MEFs. Gene ontology analysis...

  4. Involvement of SPI-2-encoded SpiC in flagellum synthesis in Salmonella enterica serovar Typhimurium

    Directory of Open Access Journals (Sweden)

    Sugita Asami

    2009-08-01

    Full Text Available Abstract Background SpiC encoded within Salmonella pathogenicity island 2 on the Salmonella enterica serovar Typhimurium chromosome is required for survival within macrophages and systemic infection in mice. Additionally, SpiC contributes to Salmonella-induced activation of the signal transduction pathways in macrophages by affecting the expression of FliC, a component of flagella filaments. Here, we show the contribution of SpiC in flagellum synthesis. Results Quantitative RT-PCR shows that the expression levels of the class 3 fliD and motA genes that encode for the flagella cap and motor torque proteins, respectively, were lower for a spiC mutant strain than for the wild-type Salmonella. Further, this mutant had lower expression levels of the class 2 genes including the fliA gene encoding the flagellar-specific alternative sigma factor. We also found differences in flagella assembly between the wild-type strain and the spiC mutant. Many flagella filaments were observed on the bacterial surface of the wild-type strain, whereas the spiC mutant had only few flagella. The absence of spiC led to reduced expression of the FlhD protein, which functions as the master regulator in flagella gene expression, although no significant difference at the transcription level of the flhDC operon was observed between the wild-type strain and the spiC mutant. Conclusion The data show that SpiC is involved in flagella assembly by affecting the post-transcription expression of flhDC.

  5. Rapid duplication and loss of nbs-encoding genes in eurosids II

    International Nuclear Information System (INIS)

    Si, W.; Gu, L.; Yang, S.; Zhang, X.; Memon, S.

    2015-01-01

    Eurosids basically evolved from the core Eudicots Rosids. The Rosids consist of two large assemblages, Eurosids I (Fabids) and Eurosids II (Malvids), which belong to the largest group of Angiosperms, comprising of >40,000 and ∼ 15,000 species, respectively. Although the evolutionary patterns of the largest class of disease resistance genes consisting of a nucleotide binding site (NBS) and leucine-rich repeats (LRRs) have been studied in many species, systemic research of NBS-encoding genes has not been performed in different orders of Eurosids II. Here, five Eurosids II species, Gossypium raimondii, Theobroma cacao, Carica papaya, Citrus clementina, and Arabidopsis thaliana, distributing in three orders, were used to gain insights into the evolutionary patterns of the NBS-encoding genes. Our data showed that frequent copy number variations of NBS-encoding genes were found among these species. Phylogenetic tree analysis and the numbers of the NBS-encoding genes in the common ancestor of these species showed that species-specific NBS clades, including multi-copy and single copy numbers are dominant among these genes. However, not a single clade was found with only five copies, which come from all of the five species, respectively, suggesting rapid turn-over with birth and death of the NBS-encoding genes among Eurosids II species. In addition, a strong positive correlation was observed between the Toll/interleukin receptor (TIR)) type NBS-encoding genes and species-specific genes, indicating rapid gene loss and duplication. Whereas, non- TIR type NBS-encoding genes in these five species showed two distinct evolutionary patterns. (author)

  6. Investigation of the role of genes encoding zinc exporters zntA, zitB, and fieF during Salmonella typhimurium infection

    DEFF Research Database (Denmark)

    Huang, Kaisong; Wang, Dan; Frederiksen, Rikki F.

    2018-01-01

    The transition metal zinc is involved in crucial biological processes in all living organisms and is essential for survival of Salmonella in the host. However, little is known about the role of genes encoding zinc efflux transporters during Salmonella infection. In this study, we constructed...... deletion mutants for genes encoding zinc exporters (zntA, zitB, and fieF) in the wild-type (WT) strain Salmonella enterica serovar Typhimurium (S. Typhimurium) 4/74. The mutants 4/74ΔzntA and 4/74ΔzntA/zitB exhibited a dramatic growth delay and abrogated growth ability, respectively, in Luria Bertani...... medium supplemented with 0.25 mM ZnCl2 or 1.5 mM CuSO4 compared to the WT strain. In order to investigate the role of genes encoding zinc exporters on survival of S. Typhimurium inside cells, amoeba and macrophage infection models were used. No significant differences in uptake or survival were detected...

  7. ngs (Notochord Granular Surface) Gene Encodes a Novel Type of Intermediate Filament Family Protein Essential for Notochord Maintenance in Zebrafish*

    Science.gov (United States)

    Tong, Xiangjun; Xia, Zhidan; Zu, Yao; Telfer, Helena; Hu, Jing; Yu, Jingyi; Liu, Huan; Zhang, Quan; Sodmergen; Lin, Shuo; Zhang, Bo

    2013-01-01

    The notochord is an important organ involved in embryonic patterning and locomotion. In zebrafish, the mature notochord consists of a single stack of fully differentiated, large vacuolated cells called chordocytes, surrounded by a single layer of less differentiated notochordal epithelial cells called chordoblasts. Through genetic analysis of zebrafish lines carrying pseudo-typed retroviral insertions, a mutant exhibiting a defective notochord with a granular appearance was isolated, and the corresponding gene was identified as ngs (notochord granular surface), which was specifically expressed in the notochord. In the mutants, the notochord started to degenerate from 32 hours post-fertilization, and the chordocytes were then gradually replaced by smaller cells derived from chordoblasts. The granular notochord phenotype was alleviated by anesthetizing the mutant embryos with tricaine to prevent muscle contraction and locomotion. Phylogenetic analysis showed that ngs encodes a new type of intermediate filament (IF) family protein, which we named chordostatin based on its function. Under the transmission electron microcopy, bundles of 10-nm-thick IF-like filaments were enriched in the chordocytes of wild-type zebrafish embryos, whereas the chordocytes in ngs mutants lacked IF-like structures. Furthermore, chordostatin-enhanced GFP (EGFP) fusion protein assembled into a filamentous network specifically in chordocytes. Taken together, our work demonstrates that ngs encodes a novel type of IF protein and functions to maintain notochord integrity for larval development and locomotion. Our work sheds light on the mechanisms of notochord structural maintenance, as well as the evolution and biological function of IF family proteins. PMID:23132861

  8. ngs (notochord granular surface) gene encodes a novel type of intermediate filament family protein essential for notochord maintenance in zebrafish.

    Science.gov (United States)

    Tong, Xiangjun; Xia, Zhidan; Zu, Yao; Telfer, Helena; Hu, Jing; Yu, Jingyi; Liu, Huan; Zhang, Quan; Sodmergen; Lin, Shuo; Zhang, Bo

    2013-01-25

    The notochord is an important organ involved in embryonic patterning and locomotion. In zebrafish, the mature notochord consists of a single stack of fully differentiated, large vacuolated cells called chordocytes, surrounded by a single layer of less differentiated notochordal epithelial cells called chordoblasts. Through genetic analysis of zebrafish lines carrying pseudo-typed retroviral insertions, a mutant exhibiting a defective notochord with a granular appearance was isolated, and the corresponding gene was identified as ngs (notochord granular surface), which was specifically expressed in the notochord. In the mutants, the notochord started to degenerate from 32 hours post-fertilization, and the chordocytes were then gradually replaced by smaller cells derived from chordoblasts. The granular notochord phenotype was alleviated by anesthetizing the mutant embryos with tricaine to prevent muscle contraction and locomotion. Phylogenetic analysis showed that ngs encodes a new type of intermediate filament (IF) family protein, which we named chordostatin based on its function. Under the transmission electron microcopy, bundles of 10-nm-thick IF-like filaments were enriched in the chordocytes of wild-type zebrafish embryos, whereas the chordocytes in ngs mutants lacked IF-like structures. Furthermore, chordostatin-enhanced GFP (EGFP) fusion protein assembled into a filamentous network specifically in chordocytes. Taken together, our work demonstrates that ngs encodes a novel type of IF protein and functions to maintain notochord integrity for larval development and locomotion. Our work sheds light on the mechanisms of notochord structural maintenance, as well as the evolution and biological function of IF family proteins.

  9. Overexpression of wild-type aspartokinase increases L-lysine production in the thermotolerant methylotrophic bacterium Bacillus methanolicus.

    Science.gov (United States)

    Jakobsen, Oyvind M; Brautaset, Trygve; Degnes, Kristin F; Heggeset, Tonje M B; Balzer, Simone; Flickinger, Michael C; Valla, Svein; Ellingsen, Trond E

    2009-02-01

    Aspartokinase (AK) controls the carbon flow into the aspartate pathway for the biosynthesis of the amino acids l-methionine, l-threonine, l-isoleucine, and l-lysine. We report here the cloning of four genes (asd, encoding aspartate semialdehyde dehydrogenase; dapA, encoding dihydrodipicolinate synthase; dapG, encoding AKI; and yclM, encoding AKIII) of the aspartate pathway in Bacillus methanolicus MGA3. Together with the known AKII gene lysC, dapG and yclM form a set of three AK genes in this organism. Overexpression of dapG, lysC, and yclM increased l-lysine production in wild-type B. methanolicus strain MGA3 2-, 10-, and 60-fold (corresponding to 11 g/liter), respectively, without negatively affecting the specific growth rate. The production levels of l-methionine (less than 0.5 g/liter) and l-threonine (less than 0.1 g/liter) were low in all recombinant strains. The AK proteins were purified, and biochemical analyses demonstrated that they have similar V(max) values (between 47 and 58 micromol/min/mg protein) and K(m) values for l-aspartate (between 1.9 and 5.0 mM). AKI and AKII were allosterically inhibited by meso-diaminopimelate (50% inhibitory concentration [IC(50)], 0.1 mM) and by l-lysine (IC(50), 0.3 mM), respectively. AKIII was inhibited by l-threonine (IC(50), 4 mM) and by l-lysine (IC(50), 5 mM), and this enzyme was synergistically inhibited in the presence of both of these amino acids at low concentrations. The correlation between the impact on l-lysine production in vivo and the biochemical properties in vitro of the individual AK proteins is discussed. This is the first example of improving l-lysine production by metabolic engineering of B. methanolicus and also the first documentation of considerably increasing l-lysine production by overexpression of a wild-type AK.

  10. UV-sensitivity and repair of UV-damage in Salmonella of wild type

    International Nuclear Information System (INIS)

    Kondratiev, Y.S.; Brukhansky, G.V.; Andreeva, I.V.; Skavronskaya, A.G.

    1977-01-01

    The UV-sensitivity of wild type Salmonella strains has been compared to that of wild type E.coli and its UV-sensitive mutants. Many wild type Salmonella strains are 4-5 times more sensitive than wild type E.coli and their inactivation curve is similar to that for E.coli with a mutation in the polA gene. Alkaline sucrose gradient centrifugation has shown a deficiency of these strains in normal excision repair of UV-damaged DNA. This deficiency is not a Salmonella genus feature because one strain as resistant as wild type E.coli was found. This resistant strain showed normal excision repair in alkaline sucrose gradient centrifugation experiments. The possible influence of plasmids and mutations in repair genes on the ability of Salmonella to repair UV-damaged DNA is discussed. (orig.) [de

  11. UV-sensitivity and repair of UV-damage in Salmonella of wild type

    Energy Technology Data Exchange (ETDEWEB)

    Kondratiev, Y S; Brukhansky, G V; Andreeva, I V; Skavronskaya, A G [Akademiya Meditsinskikh Nauk SSSR, Moscow. Inst. Ehpidemiologii i Mikrobiologii

    1977-12-01

    The UV-sensitivity of wild type Salmonella strains has been compared to that of wild type E.coli and its UV-sensitive mutants. Many wild type Salmonella strains are 4-5 times more sensitive than wild type E.coli and their inactivation curve is similar to that for E.coli with a mutation in the polA gene. Alkaline sucrose gradient centrifugation has shown a deficiency of these strains in normal excision repair of UV-damaged DNA. This deficiency is not a Salmonella genus feature because one strain as resistant as wild type E.coli was found. This resistant strain showed normal excision repair in alkaline sucrose gradient centrifugation experiments. The possible influence of plasmids and mutations in repair genes on the ability of Salmonella to repair UV-damaged DNA is discussed.

  12. [Cloning, mutagenesis and symbiotic phenotype of three lipid transfer protein encoding genes from Mesorhizobium huakuii 7653R].

    Science.gov (United States)

    Li, Yanan; Zeng, Xiaobo; Zhou, Xuejuan; Li, Youguo

    2016-12-04

    Lipid transfer protein superfamily is involved in lipid transport and metabolism. This study aimed to construct mutants of three lipid transfer protein encoding genes in Mesorhizobium huakuii 7653R, and to study the phenotypes and function of mutations during symbiosis with Astragalus sinicus. We used bioinformatics to predict structure characteristics and biological functions of lipid transfer proteins, and conducted semi-quantitative and fluorescent quantitative real-time PCR to analyze the expression levels of target genes in free-living and symbiotic conditions. Using pK19mob insertion mutagenesis to construct mutants, we carried out pot plant experiments to observe symbiotic phenotypes. MCHK-5577, MCHK-2172 and MCHK-2779 genes encoding proteins belonged to START/RHO alpha_C/PITP/Bet_v1/CoxG/CalC (SRPBCC) superfamily, involved in lipid transport or metabolism, and were identical to M. loti at 95% level. Gene relative transcription level of the three genes all increased compared to free-living condition. We obtained three mutants. Compared with wild-type 7653R, above-ground biomass of plants and nodulenitrogenase activity induced by the three mutants significantly decreased. Results indicated that lipid transfer protein encoding genes of Mesorhizobium huakuii 7653R may play important roles in symbiotic nitrogen fixation, and the mutations significantly affected the symbiotic phenotypes. The present work provided a basis to study further symbiotic function mechanism associated with lipid transfer proteins from rhizobia.

  13. Identification of Gene Resistance to Avian InfluenzaVirus (Mx Gene among Wild Waterbirds

    Directory of Open Access Journals (Sweden)

    Dewi Elfidasari

    2013-04-01

    Full Text Available The Mx gene is an antiviral gene used to determine the resistance or the susceptibility to different types of viruses, including the Avian Influenza (AI virus subtype H5N1. The AI virus subtype H5N1 infection in chickens causes Mx gene polymorphism. The Mx+ gene shows resistant to the AIvirus subtype H5N1, whereas the Mx-gene shows signs of susceptible. The objective of thisresearch was to detect the Mxgene in wild aquatic birds using the Polymerase Chain Reaction Restriction Fragment Length Polymorphism (PCR-RFLP method with the primer pairs F2 and NE-R2/R and the RsaI restriction enzyme. DNA samples were obtained from eight species of wild waterbirds with positive and negative exposure to the AI virus subtype H5N1. DNA amplification results showed that the Mxgene in wild aquatic birds is found in a 100 bp fragment, which is the same as the Mx gene found in chickens. However, unlike chickens, the Mxgene in wild aquatic birds did not show any polymorphism. This study proves that Mx- based resistance to AI virus subtype H5N1 in different in wild birds than in chickens.

  14. Engineering of red cells of Arabidopsis thaliana and comparative genome-wide gene expression analysis of red cells versus wild-type cells.

    Science.gov (United States)

    Shi, Ming-Zhu; Xie, De-Yu

    2011-04-01

    We report metabolic engineering of Arabidopsis red cells and genome-wide gene expression analysis associated with anthocyanin biosynthesis and other metabolic pathways between red cells and wild-type (WT) cells. Red cells of A. thaliana were engineered for the first time from the leaves of production of anthocyanin pigment 1-Dominant (pap1-D). These red cells produced seven anthocyanin molecules including a new one that was characterized by LC-MS analysis. Wild-type cells established as a control did not produce anthocyanins. A genome-wide microarray analysis revealed that nearly 66 and 65% of genes in the genome were expressed in the red cells and wild-type cells, respectively. In comparison with the WT cells, 3.2% of expressed genes in the red cells were differentially expressed. The expression levels of 14 genes involved in the biosynthetic pathway of anthocyanin were significantly higher in the red cells than in the WT cells. Microarray and RT-PCR analyses demonstrated that the TTG1-GL3/TT8-PAP1 complex regulated the biosynthesis of anthocyanins. Furthermore, most of the genes with significant differential expression levels in the red cells versus the WT cells were characterized with diverse biochemical functions, many of which were mapped to different metabolic pathways (e.g., ribosomal protein biosynthesis, photosynthesis, glycolysis, glyoxylate metabolism, and plant secondary metabolisms) or organelles (e.g., chloroplast). We suggest that the difference in gene expression profiles between the two cell lines likely results from cell types, the overexpression of PAP1, and the high metabolic flux toward anthocyanins.

  15. Electrotransformation and expression of cellulase genes in wild-type Lactobacillus reuteri.

    Science.gov (United States)

    Li, Wang; Yang, Ming-Ming; Zhang, Guang-Qin; He, Wan-Ling; Li, Yuan-Xiao; Chen, Yu-Lin

    2012-01-01

    Two cellulase genes, Cel15 and Cel73, were amplified from Bacillus subtilis genome DNA in a previous study. Two integrative vectors, pLEM4153 and pLEM4154, containing the genes Cel15 and Cel73, respectively, were constructed and successfully electroporated into the wild-type Lactobacillus reuteri which was isolated from chick guts through an optimized procedure. Two recombinant L. reuteri were selected from a Man, Rogosa, and Sharp (MRS) plate with 10 µg/ml erythromycin, and named L. reuteri XNY-Cel15 and L. reuteri XNY-Cel73, respectively. To verify the transcription and expression of the two cellulase genes in the recombinant L. reuteri strains, the mRNA relative quantity (RQ) and the cellulase activity were determined. The mRNA RQ of Cel15 in L. reuteri XNY-Cel15 is 1,8849.5, and that of Cel73 in L. reuteri XNY-Cel73 is 1,388, and the cellulase activity of the modified MRS broth cultured with L. reuteri XNY-Cel15 was 0.158 U/ml, whereas that with L. reuteri XNY-Cel73 was 0.15 U/ml. Copyright © 2012 S. Karger AG, Basel.

  16. Hepcidin regulation in wild-type and Hfe knockout mice in response to alcohol consumption: evidence for an alcohol-induced hypoxic response.

    Science.gov (United States)

    Heritage, Mandy L; Murphy, Therese L; Bridle, Kim R; Anderson, Gregory J; Crawford, Darrell H G; Fletcher, Linda M

    2009-08-01

    Expression of Hamp1, the gene encoding the iron regulatory peptide hepcidin, is inappropriately low in HFE-associated hereditary hemochromatosis and Hfe knockout mice (Hfe(-/-)). Since chronic alcohol consumption is also associated with disturbances in iron metabolism, we investigated the effects of alcohol consumption on hepcidin mRNA expression in Hfe(-/-) mice. Hfe(-/-) and C57BL/6 (wild-type) mice were pair-fed either an alcohol liquid diet or control diet for up to 8 weeks. The mRNA levels of hepcidin and ferroportin were measured at the mRNA level by RT-PCR and protein expression of hypoxia inducible factor-1 alpha (HIF-1alpha) was measured by western blot. Hamp1 mRNA expression was significantly decreased and duodenal ferroportin expression was increased in alcohol-fed wild-type mice at 8 weeks. Time course experiments showed that the decrease in hepcidin mRNA was not immediate, but was significant by 4 weeks. Consistent with the genetic defect, Hamp1 mRNA was decreased and duodenal ferroportin mRNA expression was increased in Hfe(-/-) mice fed on the control diet compared with wild-type animals and alcohol further exacerbated these effects. HIF-1alpha protein levels were elevated in alcohol-fed wild-type animals compared with controls. Alcohol may decrease Hamp1 gene expression independently of the HFE pathway possibly via alcohol-induced hypoxia.

  17. The you gene encodes an EGF-CUB protein essential for Hedgehog signaling in zebrafish.

    Directory of Open Access Journals (Sweden)

    Ian G Woods

    2005-03-01

    Full Text Available Hedgehog signaling is required for many aspects of development in vertebrates and invertebrates. Misregulation of the Hedgehog pathway causes developmental abnormalities and has been implicated in certain types of cancer. Large-scale genetic screens in zebrafish have identified a group of mutations, termed you-class mutations, that share common defects in somite shape and in most cases disrupt Hedgehog signaling. These mutant embryos exhibit U-shaped somites characteristic of defects in slow muscle development. In addition, Hedgehog pathway mutations disrupt spinal cord patterning. We report the positional cloning of you, one of the original you-class mutations, and show that it is required for Hedgehog signaling in the development of slow muscle and in the specification of ventral fates in the spinal cord. The you gene encodes a novel protein with conserved EGF and CUB domains and a secretory pathway signal sequence. Epistasis experiments support an extracellular role for You upstream of the Hedgehog response mechanism. Analysis of chimeras indicates that you mutant cells can appropriately respond to Hedgehog signaling in a wild-type environment. Additional chimera analysis indicates that wild-type you gene function is not required in axial Hedgehog-producing cells, suggesting that You is essential for transport or stability of Hedgehog signals in the extracellular environment. Our positional cloning and functional studies demonstrate that You is a novel extracellular component of the Hedgehog pathway in vertebrates.

  18. Genome-wide comparative analysis of NBS-encoding genes between Brassica species and Arabidopsis thaliana.

    Science.gov (United States)

    Yu, Jingyin; Tehrim, Sadia; Zhang, Fengqi; Tong, Chaobo; Huang, Junyan; Cheng, Xiaohui; Dong, Caihua; Zhou, Yanqiu; Qin, Rui; Hua, Wei; Liu, Shengyi

    2014-01-03

    Plant disease resistance (R) genes with the nucleotide binding site (NBS) play an important role in offering resistance to pathogens. The availability of complete genome sequences of Brassica oleracea and Brassica rapa provides an important opportunity for researchers to identify and characterize NBS-encoding R genes in Brassica species and to compare with analogues in Arabidopsis thaliana based on a comparative genomics approach. However, little is known about the evolutionary fate of NBS-encoding genes in the Brassica lineage after split from A. thaliana. Here we present genome-wide analysis of NBS-encoding genes in B. oleracea, B. rapa and A. thaliana. Through the employment of HMM search and manual curation, we identified 157, 206 and 167 NBS-encoding genes in B. oleracea, B. rapa and A. thaliana genomes, respectively. Phylogenetic analysis among 3 species classified NBS-encoding genes into 6 subgroups. Tandem duplication and whole genome triplication (WGT) analyses revealed that after WGT of the Brassica ancestor, NBS-encoding homologous gene pairs on triplicated regions in Brassica ancestor were deleted or lost quickly, but NBS-encoding genes in Brassica species experienced species-specific gene amplification by tandem duplication after divergence of B. rapa and B. oleracea. Expression profiling of NBS-encoding orthologous gene pairs indicated the differential expression pattern of retained orthologous gene copies in B. oleracea and B. rapa. Furthermore, evolutionary analysis of CNL type NBS-encoding orthologous gene pairs among 3 species suggested that orthologous genes in B. rapa species have undergone stronger negative selection than those in B .oleracea species. But for TNL type, there are no significant differences in the orthologous gene pairs between the two species. This study is first identification and characterization of NBS-encoding genes in B. rapa and B. oleracea based on whole genome sequences. Through tandem duplication and whole genome

  19. Extreme expansion of NBS-encoding genes in Rosaceae.

    Science.gov (United States)

    Jia, YanXiao; Yuan, Yang; Zhang, Yanchun; Yang, Sihai; Zhang, Xiaohui

    2015-05-03

    Nucleotide binding site leucine-rich repeats (NBS-LRR) genes encode a large class of disease resistance (R) proteins in plants. Extensive studies have been carried out to identify and investigate NBS-encoding gene families in many important plant species. However, no comprehensive research into NBS-encoding genes in the Rosaceae has been performed. In this study, five whole-genome sequenced Rosaceae species, including apple, pear, peach, mei, and strawberry, were analyzed to investigate the evolutionary pattern of NBS-encoding genes and to compare them to those of three Cucurbitaceae species, cucumber, melon, and watermelon. Considerable differences in the copy number of NBS-encoding genes were observed between Cucurbitaceae and Rosaceae species. In Rosaceae species, a large number and a high proportion of NBS-encoding genes were observed in peach (437, 1.52%), mei (475, 1.51%), strawberry (346, 1.05%) and pear (617, 1.44%), and apple contained a whopping 1303 (2.05%) NBS-encoding genes, which might be the highest number of R-genes in all of these reported diploid plant. However, no more than 100 NBS-encoding genes were identified in Cucurbitaceae. Many more species-specific gene families were classified and detected with the signature of positive selection in Rosaceae species, especially in the apple genome. Taken together, our findings indicate that NBS-encoding genes in Rosaceae, especially in apple, have undergone extreme expansion and rapid adaptive evolution. Useful information was provided for further research on the evolutionary mode of disease resistance genes in Rosaceae crops.

  20. Transcriptome and Gene Ontology (GO) Enrichment Analysis Reveals Genes Involved in Biotin Metabolism That Affect L-Lysine Production in Corynebacterium glutamicum.

    Science.gov (United States)

    Kim, Hong-Il; Kim, Jong-Hyeon; Park, Young-Jin

    2016-03-09

    Corynebacterium glutamicum is widely used for amino acid production. In the present study, 543 genes showed a significant change in their mRNA expression levels in L-lysine-producing C. glutamicum ATCC21300 than that in the wild-type C. glutamicum ATCC13032. Among these 543 differentially expressed genes (DEGs), 28 genes were up- or downregulated. In addition, 454 DEGs were functionally enriched and categorized based on BLAST sequence homologies and gene ontology (GO) annotations using the Blast2GO software. Interestingly, NCgl0071 (bioB, encoding biotin synthase) was expressed at levels ~20-fold higher in the L-lysine-producing ATCC21300 strain than that in the wild-type ATCC13032 strain. Five other genes involved in biotin metabolism or transport--NCgl2515 (bioA, encoding adenosylmethionine-8-amino-7-oxononanoate aminotransferase), NCgl2516 (bioD, encoding dithiobiotin synthetase), NCgl1883, NCgl1884, and NCgl1885--were also expressed at significantly higher levels in the L-lysine-producing ATCC21300 strain than that in the wild-type ATCC13032 strain, which we determined using both next-generation RNA sequencing and quantitative real-time PCR analysis. When we disrupted the bioB gene in C. glutamicum ATCC21300, L-lysine production decreased by approximately 76%, and the three genes involved in biotin transport (NCgl1883, NCgl1884, and NCgl1885) were significantly downregulated. These results will be helpful to improve our understanding of C. glutamicum for industrial amino acid production.

  1. Characterization of Bombyx mori nucleopolyhedrovirus orf68 gene that encodes a novel structural protein of budded virus.

    Science.gov (United States)

    Iwanaga, Masashi; Kurihara, Masaaki; Kobayashi, Masahiko; Kang, WonKyung

    2002-05-25

    All lepidopteran baculovirus genomes sequenced to date encode a homolog of the Bombyx mori nucleopolyhedrovirus (BmNPV) orf68 gene, suggesting that it performs an important role in the virus life cycle. In this article we describe the characterization of BmNPV orf68 gene. Northern and Western analyses demonstrated that orf68 gene was expressed as a late gene and encoded a structural protein of budded virus (BV). Immunohistochemical analysis by confocal microscopy showed that ORF68 protein was localized mainly in the nucleus of infected cells. To examine the function of orf68 gene, we constructed orf68 deletion mutant (BmD68) and characterized it in BmN cells and larvae of B. mori. BV production was delayed in BmD68-infected cells. The larval bioassays also demonstrated that deletion of orf68 did not reduce the infectivity, but mutant virus took 70 h longer to kill the host than wild-type BmNPV. In addition, dot-blot analysis showed viral DNA accumulated more slowly in mutant infected cells. Further examination suggested that BmD68 was less efficient in entry and budding from cells, although it seemed to possess normal attachment ability. These results suggest that ORF68 is a BV-associated protein involved in secondary infection from cell-to-cell. (c) 2002 Elsevier Science (USA).

  2. Disruption of the Candida albicans TPS1 Gene Encoding Trehalose-6-Phosphate Synthase Impairs Formation of Hyphae and Decreases Infectivity†

    Science.gov (United States)

    Zaragoza, Oscar; Blazquez, Miguel A.; Gancedo, Carlos

    1998-01-01

    The TPS1 gene from Candida albicans, which encodes trehalose-6-phosphate synthase, has been cloned by functional complementation of a tps1 mutant from Saccharomyces cerevisiae. In contrast with the wild-type strain, the double tps1/tps1 disruptant did not accumulate trehalose at stationary phase or after heat shock. Growth of the tps1/tps1 disruptant at 30°C was indistinguishable from that of the wild type. However, at 42°C it did not grow on glucose or fructose but grew normally on galactose or glycerol. At 37°C, the yeast-hypha transition in the mutant in glucose-calf serum medium did not occur. During growth at 42°C, the mutant did not form hyphae in galactose or in glycerol. Some of the growth defects observed may be traced to an unbalanced sugar metabolism that reduces the cellular content of ATP. Mice inoculated with 106 CFU of the tps1/tps1 mutant did not show visible symptoms of infection 16 days after inoculation, while those similarly inoculated with wild-type cells were dead 12 days after inoculation. PMID:9683476

  3. The presence of two S-layer-protein-encoding genes is conserved among species related to Lactobacillus acidophilus

    NARCIS (Netherlands)

    Boot, H.J.; Kolen, C.P.A.M.; Pot, B.; Kersters, K.; Pouwels, P.H.

    1996-01-01

    Previously we have shown that the type strain of Lactobacillus acidophilus possesses two S-protein-encoding genes, one of which is silent, on a chromosomal segment of 6 kb. The S-protein-encoding gene in the expression site can be exchanged for the silent S-protein-encoding gene by inversion of this

  4. The Aspergillus uvsH gene encodes a product homologous to yeast RAD18 and Neurospora UVS-2.

    Science.gov (United States)

    Yoon, J H; Lee, B J; Kang, H S

    1995-07-28

    The uvsH DNA repair gene of Aspergillus nidulans has been cloned by complementation of the uvsH77 mutation with a cosmid library containing genomic DNA inserts from a wild-type strain. Methylmethane sulfonate (MMS)-resistant transformants were obtained on medium containing 0.01% MMS, to which uvsH mutants exhibit high sensitivity. Retransformation of uvsH77 mutants with the rescued cosmids from the MMS-resistant transformants resulted in restoration of both UV and MMS resistance to wild-type levels. Nucleotide sequence analysis of the genomic DNA and cDNA of the uvsH gene shows that it has an open reading frame (ORF) of 1329 bp, interrupted by two introns of 51 and 61 bp. A 2.4 kb transcript of the uvsH gene was detected by Northern blot analysis. Primer extension analysis revealed that transcription starts at 31 bp upstream from the translation initiation codon. This gene encodes a predicted polypeptide of 443 amino acids, which has two unique zinc finger motifs. The proposed polypeptide displays 39% identity to the Neurospora crassa UVS-2 protein and 24% identity to the Saccharomyces cerevisiae RAD18 protein. The sequence similarity is particularly high in three domains. One zinc finger (RING finger) motif is located in the first domain close to the N-terminus. The other zinc finger motif is in the second domain. In the third domain, the mutation sites in both the uvsH77 and uvsH304 alleles were identified.(ABSTRACT TRUNCATED AT 250 WORDS)

  5. Type 3 Fimbriae Encoded on Plasmids Are Expressed from a Unique Promoter without Affecting Host Motility, Facilitating an Exceptional Phenotype That Enhances Conjugal Plasmid Transfer

    DEFF Research Database (Denmark)

    Madsen, Jonas Stenlokke; Riber, Leise; Kot, Witold

    2016-01-01

    Horizontal gene transfer (HGT), the transmission of genetic material to a recipient that is not the progeny of the donor, is fundamental in bacterial evolution. HGT is often mediated by mobile genetic elements such as conjugative plasmids, which may be in conflict with the chromosomal elements...... of the genome because they are independent replicons that may petition their own evolutionary strategy. Here we study differences between type 3 fimbriae encoded on wild type plasmids and in chromosomes. Using known and newly characterized plasmids we show that the expression of type 3 fimbriae encoded...... on plasmids is systematically different, as MrkH, a c-di-GMP dependent transcriptional activator is not needed for strong expression of the fimbriae. MrkH is required for expression of type 3 fimbriae of the Klebsiella pneumoniae chromosome, wherefrom the fimbriae operon (mrkABCDF) of plasmids is believed...

  6. A comparative transcriptome analysis of a wild purple potato and its red mutant provides insight into the mechanism of anthocyanin transformation.

    Directory of Open Access Journals (Sweden)

    Fang Liu

    Full Text Available In this study, a red mutant was obtained through in vitro regeneration of a wild purple potato. High-performance liquid chromatography and Mass spectrometry analysis revealed that pelargonidin-3-O-glucoside and petunidin-3-O-glucoside were main anthocyanins in the mutant and wild type tubers, respectively. In order to thoroughly understand the mechanism of anthocyanin transformation in two materials, a comparative transcriptome analysis of the mutant and wild type was carried out through high-throughput RNA sequencing, and 295 differentially expressed genes (DEGs were obtained. Real-time qRT-PCR validation of DEGs was consistent with the transcriptome date. The DEGs mainly influenced biological and metabolic pathways, including phenylpropanoid biosynthesis and translation, and biosynthesis of flavone and flavonol. In anthocyanin biosynthetic pathway, the analysis of structural genes expressions showed that three genes, one encoding phenylalanine ammonia-lyase, one encoding 4-coumarate-CoA ligase and one encoding flavonoid 3',5'-hydroxylasem were significantly down-regulated in the mutant; one gene encoding phenylalanine ammonia-lyase was significantly up-regulated. Moreover, the transcription factors, such as bZIP family, MYB family, LOB family, MADS family, zf-HD family and C2H2 family, were significantly regulated in anthocyanin transformation. Response proteins of hormone, such as gibberellin, abscisic acid and brassinosteroid, were also significantly regulated in anthocyanin transformation. The information contributes to discovering the candidate genes in anthocyanin transformation, which can serve as a comprehensive resource for molecular mechanism research of anthocyanin transformation in potatoes.

  7. Gene ercA, encoding a putative iron-containing alcohol dehydrogenase, is involved in regulation of ethanol utilization in Pseudomonas aeruginosa.

    Science.gov (United States)

    Hempel, Niels; Görisch, Helmut; Mern, Demissew S

    2013-09-01

    Several two-component regulatory systems are known to be involved in the signal transduction pathway of the ethanol oxidation system in Pseudomonas aeruginosa ATCC 17933. These sensor kinases and response regulators are organized in a hierarchical manner. In addition, a cytoplasmic putative iron-containing alcohol dehydrogenase (Fe-ADH) encoded by ercA (PA1991) has been identified to play an essential role in this regulatory network. The gene ercA (PA1991) is located next to ercS, which encodes a sensor kinase. Inactivation of ercA (PA1991) by insertion of a kanamycin resistance cassette created mutant NH1. NH1 showed poor growth on various alcohols. On ethanol, NH1 grew only with an extremely extended lag phase. During the induction period on ethanol, transcription of structural genes exa and pqqABCDEH, encoding components of initial ethanol oxidation in P. aeruginosa, was drastically reduced in NH1, which indicates the regulatory function of ercA (PA1991). However, transcription in the extremely delayed logarithmic growth phase was comparable to that in the wild type. To date, the involvement of an Fe-ADH in signal transduction processes has not been reported.

  8. Promoter for the late gene encoding Vp5 of herpes simplex virus type 1 is recognized by cell extracts derived from uninfected cells

    International Nuclear Information System (INIS)

    Chisholm, G.E.; Summers, W.C.

    1986-01-01

    The ability of whole-cell extracts from unidentified HeLa cells to recognize the promoter for the herpes simplex virus type 1 late gene encoding the major capsid protein Vp5 was investigated by using both in vitro transcriptional and S1 nuclease protection analysis. This gene promoter was recognized by the cell extracts and produced abundant amounts of transcript in the absence of any other virus-encoded factors. This transcript was shown to arise, in vitro, from specific initiation at or very near the physiological mRNA start site. Thus, it appears that cell extracts from uninfected HeLa cells can efficiently recognize both early- and late-gene promoters

  9. Linkage of the gene that encodes the alpha 1 chain of type V collagen (COL5A1) to type II Ehlers-Danlos syndrome (EDS II).

    Science.gov (United States)

    Loughlin, J; Irven, C; Hardwick, L J; Butcher, S; Walsh, S; Wordsworth, P; Sykes, B

    1995-09-01

    Ehlers-Danlos syndrome (EDS) is a group of heritable disorders of connective tissue with skin, ligaments and blood vessels being the main sites affected. The commonest variant (EDS II) exhibits an autosomal dominant mode of inheritance and is characterized by joint hypermobility, cigarette paper scars, lax skin and excessive bruising. As yet no gene has been linked to EDS II, nor has linkage been established to a specific region of the genome. However, several candidate genes encoding proteins of the extracellular matrix have been excluded. Using an intragenic simple sequence repeat polymorphism, we report linkage of the COL5A1 gene, which encodes the alpha 1(V) chain of type V collagen, to EDS II. A maximum LOD score (Zmax) for linkage of 8.3 at theta = 0.00 was generated for a single large pedigree.

  10. Construction of adiponectin-encoding plasmid DNA and gene therapy of non-obese type 2 diabetes mellitus.

    Science.gov (United States)

    Nan, Mei Hua; Park, Jeong-Sook; Myung, Chang-Seon

    2010-01-01

    Adiponectin (ADN), an insulin-sensitizing adipokine, stimulates glucose uptake, inhibits gluconeogenesis, and plays an important role in improving insulin sensitivity. Since blood levels of ADN are low in type 2 diabetes mellitus (DM), this study was designed to investigate the therapeutic effectiveness of increasing the ADN level through injection of plasmid DNA encoding ADN in type 2 DM. A non-obese type 2 DM mouse model was established via combined administration of streptozotocin with nicotinamide and exhibited significantly higher plasma glucose concentration and insulin resistance compared with normal controls according to oral glucose tolerance and insulin challenge tests. Plasmid DNA encoding mouse ADN from differentiated NIH3T3 adipocytes was constructed in pVAX1 (pVAX/ADN). Transfection of pVAX/ADN into various cell lines including HeLa, HT22, HEK293, HepG2, and SK-Hep1 cells, increased ADN mRNA expression levels in a dose-dependent manner. The administration of pVAX/ADN into non-obese type 2 DM mice via tail vein significantly increased the blood level of ADN and decreased the plasma glucose concentration. Moreover, the parameters related to insulin resistance (HOMA-IR) and insulin sensitivity (QUICKI) were significantly improved. These results suggest that ADN gene therapy could be a clinically effective tool for the treatment of type 2 DM.

  11. Agrobacterium-mediated transformation of grapefruit with the wild-type and mutant RNA-dependent RNA polymerase genes of Citrus tristeza virus

    Science.gov (United States)

    Citrus paradisi Macf. cv. Duncan was transformed with constructs coding for the wild-type and mutant RNA-dependent RNA polymerase (RdRp) of Citrus tristeza virus (CTV) for exploring replicase-mediated pathogen-derived resistance (RM-PDR). The RdRp gene was amplified from CTV genome and used to gener...

  12. Sex-Specific Diurnal Immobility Induced by Forced Swim Test in Wild Type and Clock Gene Deficient Mice

    Directory of Open Access Journals (Sweden)

    Ningyue Li

    2015-03-01

    Full Text Available Objective: The link between alterations in circadian rhythms and depression are well established, but the underlying mechanisms are far less elucidated. We investigated the circadian characteristics of immobility behavior in wild type (WT mice and mice with mutations in core Clock genes. Methods: All mice were tested with forced swim test (FST at 4 h intervals. Results: These experiments revealed significant diurnal rhythms associated with immobility behavior in both male and female WT mice with sex-different circadian properties. In addition, male mice showed significantly less immobility during the night phase in comparison to female mice. Female Per1Brdm1 mice also showed significant rhythmicity. However, the timing of rhythmicity was very different from that observed in female wild type mice. Male Per1Brdm1 mice showed a pattern of rhythmicity similar to that of wild type mice. Furthermore, female Per1Brdm1 mice showed higher duration of immobility in comparison to male Per1Brdm1 mice in both daytime and early night phases. Neither Per2Brdm1 nor ClockΔ19 mice showed significant rhythmicity, but both female Per2Brdm1 and ClockΔ19 mice had lower levels of immobility, compared to males. Conclusions: This study highlights the differences in the circadian characteristics of immobility induced by FST in WT, ClockΔ19, Per1, and Per2 deficient mice.

  13. Genetic Characterization of the Hemagglutinin Genes of Wild-Type Measles Virus Circulating in China, 1993–2009

    Science.gov (United States)

    Zhu, Zhen; Liu, Chunyu; Mao, Naiying; Ji, Yixin; Wang, Huiling; Jiang, Xiaohong; Li, Chongshan; Tang, Wei; Feng, Daxing; Wang, Changyin; Zheng, Lei; Lei, Yue; Ling, Hua; Zhao, Chunfang; Ma, Yan; He, Jilan; Wang, Yan; Li, Ping; Guan, Ronghui; Zhou, Shujie; Zhou, Jianhui; Wang, Shuang; Zhang, Hong; Zheng, Huanying; Liu, Leng; Ma, Hemuti; Guan, Jing; Lu, Peishan; Feng, Yan; Zhang, Yanjun; Zhou, Shunde; Xiong, Ying; Ba, Zhuoma; Chen, Hui; Yang, Xiuhui; Bo, Fang; Ma, Yujie; Liang, Yong; Lei, Yake; Gu, Suyi; Liu, Wei; Chen, Meng; Featherstone, David; Jee, Youngmee; Bellini, William J.; Rota, Paul A.; Xu, Wenbo

    2013-01-01

    Background China experienced several large measles outbreaks in the past two decades, and a series of enhanced control measures were implemented to achieve the goal of measles elimination. Molecular epidemiologic surveillance of wild-type measles viruses (MeV) provides valuable information about the viral transmission patterns. Since 1993, virologic surveillnace has confirmed that a single endemic genotype H1 viruses have been predominantly circulating in China. A component of molecular surveillance is to monitor the genetic characteristics of the hemagglutinin (H) gene of MeV, the major target for virus neutralizing antibodies. Principal Findings Analysis of the sequences of the complete H gene from 56 representative wild-type MeV strains circulating in China during 1993–2009 showed that the H gene sequences were clustered into 2 groups, cluster 1 and cluster 2. Cluster1 strains were the most frequently detected cluster and had a widespread distribution in China after 2000. The predicted amino acid sequences of the H protein were relatively conserved at most of the functionally significant amino acid positions. However, most of the genotype H1 cluster1 viruses had an amino acid substitution (Ser240Asn), which removed a predicted N-linked glycosylation site. In addition, the substitution of Pro397Leu in the hemagglutinin noose epitope (HNE) was identified in 23 of 56 strains. The evolutionary rate of the H gene of the genotype H1 viruses was estimated to be approximately 0.76×10−3 substitutions per site per year, and the ratio of dN to dS (dN/dS) was measles in China. PMID:24073194

  14. Characterization of the cydAB-Encoded Cytochrome bd Oxidase from Mycobacterium smegmatis

    Science.gov (United States)

    Kana, Bavesh D.; Weinstein, Edward A.; Avarbock, David; Dawes, Stephanie S.; Rubin, Harvey; Mizrahi, Valerie

    2001-01-01

    The cydAB genes from Mycobacterium smegmatis have been cloned and characterized. The cydA and cydB genes encode the two subunits of a cytochrome bd oxidase belonging to the widely distributed family of quinol oxidases found in prokaryotes. The cydD and cydC genes located immediately downstream of cydB encode a putative ATP-binding cassette-type transporter. At room temperature, reduced minus oxidized difference spectra of membranes purified from wild-type M. smegmatis displayed spectral features that are characteristic of the γ-proteobacterial type cytochrome bd oxidase. Inactivation of cydA or cydB by insertion of a kanamycin resistance marker resulted in loss of d-heme absorbance at 631 nm. The d-heme could be restored by transformation of the M. smegmatis cyd mutants with a replicating plasmid carrying the highly homologous cydABDC gene cluster from Mycobacterium tuberculosis. Inactivation of cydA had no effect on the ability of M. smegmatis to exit from stationary phase at 37 or 42°C. The growth rate of the cydA mutant was tested under oxystatic conditions. Although no discernible growth defect was observed under moderately aerobic conditions (9.2 to 37.5 × 102 Pa of pO2 or 5 to 21% air saturation), the mutant displayed a significant growth disadvantage when cocultured with the wild type under extreme microaerophilia (0.8 to 1.7 × 102 Pa of pO2 or 0.5 to 1% air saturation). These observations were in accordance with the two- to threefold increase in cydAB gene expression observed upon reduction of the pO2 of the growth medium from 21 to 0.5% air saturation and with the concomitant increase in d-heme absorbance in spectra of membranes isolated from wild-type M. smegmatis cultured at 1% air saturation. Finally, the cydA mutant displayed a competitive growth disadvantage in the presence of the terminal oxidase inhibitor, cyanide, when cocultured with wild type at 21% air saturation in an oxystat. In conjunction with these findings, our results suggest that

  15. Cloning and Sequence Analysis of Vibrio halioticoli Genes Encoding Three Types of Polyguluronate Lyase.

    Science.gov (United States)

    Sugimura; Sawabe; Ezura

    2000-01-01

    The alginate lyase-coding genes of Vibrio halioticoli IAM 14596(T), which was isolated from the gut of the abalone Haliotis discus hannai, were cloned using plasmid vector pUC 18, and expressed in Escherichia coli. Three alginate lyase-positive clones, pVHB, pVHC, and pVHE, were obtained, and all clones expressed the enzyme activity specific for polyguluronate. Three genes, alyVG1, alyVG2, and alyVG3, encoding polyguluronate lyase were sequenced: alyVG1 from pVHB was composed of a 1056-bp open reading frame (ORF) encoding 352 amino acid residues; alyVG2 gene from pVHC was composed of a 993-bp ORF encoding 331 amino acid residues; and alyVG3 gene from pVHE was composed of a 705-bp ORF encoding 235 amino acid residues. Comparison of nucleotide and deduced amino acid sequences among AlyVG1, AlyVG2, and AlyVG3 revealed low homologies. The identity value between AlyVG1 and AlyVG2 was 18.7%, and that between AlyVG2 and AlyVG3 was 17.0%. A higher identity value (26.0%) was observed between AlyVG1 and AlyVG3. Sequence comparison among known polyguluronate lyases including AlyVG1, AlyVG2, and AlyVG3 also did not reveal an identical region in these sequences. However, AlyVG1 showed the highest identity value (36.2%) and the highest similarity (73.3%) to AlyA from Klebsiella pneumoniae. A consensus region comprising nine amino acid (YFKAGXYXQ) in the carboxy-terminal region previously reported by Mallisard and colleagues was observed only in AlyVG1 and AlyVG2.

  16. Spreading of genes encoding enterotoxins, haemolysins, adhesin and biofilm among methicillin resistant Staphylococcus aureus strains with staphylococcal cassette chromosome mec type IIIA isolated from burn patients.

    Science.gov (United States)

    Motallebi, Mitra; Jabalameli, Fereshteh; Asadollahi, Kheirollah; Taherikalani, Morovat; Emaneini, Mohammad

    2016-08-01

    The emergence of antibiotic-resistant Staphylococcus aureus in particular methicillin-resistant S. aureus (MRSA) is an important concern in burn medical centers either in Iran or worldwide. A total of 128 S. aureus isolates were collected from wound infection of burn patients during June 2013 to June 2014. Multiplex-polymerase chain reaction (MPCR) assay was performed for the characterization of the staphylococcal cassette chromosome mec (SCCmec). Genes encoding virulence factors and biofilm were targeted by PCR. Of 128 S. aureus isolates, 77 (60.1%) isolates were MRSA. Fifty four (70.1%) isolates were identified as SCCmec type IIIA. The most frequently detected toxin genes among MRSA isolates with SCCmec type IIIA were sea (64.1%) and hla (51.8%). The rate of coexistence of sea with hla and sea with hla and hlb was 37% and12.9%, respectively. The sec, eta, tst, pvl, hla and hlb genes were not detected in any of the MRSA isolates. The most prevalent genes encoding biofilm was eno, found in 61.1% of isolates, followed by fib and icaA found in 48.1% and 38.8% of the isolates, respectively. The rate of coexistence of fib + eno + icaA + icaD and fib + eno was 20.3% and 9.2%, respectively. The ebps gene was not detected in any of the isolates. In conclusion, our study indicated that the sea, hla, fib and icaA were most frequent genes encoding virulence factors among MRSA with SCCmec type IIIA isolated from burn wound infection. Moreover, the results of this study shows that the rate of coexistence of genes encoding different virulence factor were high. Copyright © 2016 Elsevier Ltd. All rights reserved.

  17. Sequence-Based Appraisal of the Genes Encoding Neck and Carbohydrate Recognition Domain of Conglutinin in Blackbuck (Antilope cervicapra and Goat (Capra hircus

    Directory of Open Access Journals (Sweden)

    Sasmita Barik

    2014-01-01

    Full Text Available Conglutinin, a collagenous C-type lectin, acts as soluble pattern recognition receptor (PRR in recognition of pathogens. In the present study, genes encoding neck and carbohydrate recognition domain (NCRD of conglutinin in goat and blackbuck were amplified, cloned, and sequenced. The obtained 488 bp ORFs encoding NCRD were submitted to NCBI with accession numbers KC505182 and KC505183. Both nucleotide and predicted amino acid sequences were analysed with sequences of other ruminants retrieved from NCBI GenBank using DNAstar and Megalign5.2 software. Sequence analysis revealed maximum similarity of blackbuck sequence with wild ruminants like nilgai and buffalo, whereas goat sequence displayed maximum similarity with sheep sequence at both nucleotide and amino acid level. Phylogenetic analysis further indicated clear divergence of wild ruminants from the domestic ruminants in separate clusters. The predicted secondary structures of NCRD protein in goat and blackbuck using SWISSMODEL ProtParam online software were found to possess 6 beta-sheets and 3 alpha-helices which are identical to the result obtained in case of sheep, cattle, buffalo, and nilgai. However, quaternary structure in goat, sheep, and cattle was found to differ from that of buffalo, nilgai, and blackbuck, suggesting a probable variation in the efficiency of antimicrobial activity among wild and domestic ruminants.

  18. Whole-Genome Sequencing of Sordaria macrospora Mutants Identifies Developmental Genes.

    Science.gov (United States)

    Nowrousian, Minou; Teichert, Ines; Masloff, Sandra; Kück, Ulrich

    2012-02-01

    The study of mutants to elucidate gene functions has a long and successful history; however, to discover causative mutations in mutants that were generated by random mutagenesis often takes years of laboratory work and requires previously generated genetic and/or physical markers, or resources like DNA libraries for complementation. Here, we present an alternative method to identify defective genes in developmental mutants of the filamentous fungus Sordaria macrospora through Illumina/Solexa whole-genome sequencing. We sequenced pooled DNA from progeny of crosses of three mutants and the wild type and were able to pinpoint the causative mutations in the mutant strains through bioinformatics analysis. One mutant is a spore color mutant, and the mutated gene encodes a melanin biosynthesis enzyme. The causative mutation is a G to A change in the first base of an intron, leading to a splice defect. The second mutant carries an allelic mutation in the pro41 gene encoding a protein essential for sexual development. In the mutant, we detected a complex pattern of deletion/rearrangements at the pro41 locus. In the third mutant, a point mutation in the stop codon of a transcription factor-encoding gene leads to the production of immature fruiting bodies. For all mutants, transformation with a wild type-copy of the affected gene restored the wild-type phenotype. Our data demonstrate that whole-genome sequencing of mutant strains is a rapid method to identify developmental genes in an organism that can be genetically crossed and where a reference genome sequence is available, even without prior mapping information.

  19. Genome wide re-sequencing of newly developed Rice Lines from common wild rice (Oryza rufipogon Griff.) for the identification of NBS-LRR genes.

    Science.gov (United States)

    Liu, Wen; Ghouri, Fozia; Yu, Hang; Li, Xiang; Yu, Shuhong; Shahid, Muhammad Qasim; Liu, Xiangdong

    2017-01-01

    Common wild rice (Oryza rufipogon Griff.) is an important germplasm for rice breeding, which contains many resistance genes. Re-sequencing provides an unprecedented opportunity to explore the abundant useful genes at whole genome level. Here, we identified the nucleotide-binding site leucine-rich repeat (NBS-LRR) encoding genes by re-sequencing of two wild rice lines (i.e. Huaye 1 and Huaye 2) that were developed from common wild rice. We obtained 128 to 147 million reads with approximately 32.5-fold coverage depth, and uniquely covered more than 89.6% (> = 1 fold) of reference genomes. Two wild rice lines showed high SNP (single-nucleotide polymorphisms) variation rate in 12 chromosomes against the reference genomes of Nipponbare (japonica cultivar) and 93-11 (indica cultivar). InDels (insertion/deletion polymorphisms) count-length distribution exhibited normal distribution in the two lines, and most of the InDels were ranged from -5 to 5 bp. With reference to the Nipponbare genome sequence, we detected a total of 1,209,308 SNPs, 161,117 InDels and 4,192 SVs (structural variations) in Huaye 1, and 1,387,959 SNPs, 180,226 InDels and 5,305 SVs in Huaye 2. A total of 44.9% and 46.9% genes exhibited sequence variations in two wild rice lines compared to the Nipponbare and 93-11 reference genomes, respectively. Analysis of NBS-LRR mutant candidate genes showed that they were mainly distributed on chromosome 11, and NBS domain was more conserved than LRR domain in both wild rice lines. NBS genes depicted higher levels of genetic diversity in Huaye 1 than that found in Huaye 2. Furthermore, protein-protein interaction analysis showed that NBS genes mostly interacted with the cytochrome C protein (Os05g0420600, Os01g0885000 and BGIOSGA038922), while some NBS genes interacted with heat shock protein, DNA-binding activity, Phosphoinositide 3-kinase and a coiled coil region. We explored abundant NBS-LRR encoding genes in two common wild rice lines through genome wide re

  20. Overexpression of Genes Encoding Glycolytic Enzymes in Corynebacterium glutamicum Enhances Glucose Metabolism and Alanine Production under Oxygen Deprivation Conditions

    Science.gov (United States)

    Yamamoto, Shogo; Gunji, Wataru; Suzuki, Hiroaki; Toda, Hiroshi; Suda, Masako; Jojima, Toru; Inui, Masayuki

    2012-01-01

    We previously reported that Corynebacterium glutamicum strain ΔldhAΔppc+alaD+gapA, overexpressing glyceraldehyde-3-phosphate dehydrogenase-encoding gapA, shows significantly improved glucose consumption and alanine formation under oxygen deprivation conditions (T. Jojima, M. Fujii, E. Mori, M. Inui, and H. Yukawa, Appl. Microbiol. Biotechnol. 87:159–165, 2010). In this study, we employ stepwise overexpression and chromosomal integration of a total of four genes encoding glycolytic enzymes (herein referred to as glycolytic genes) to demonstrate further successive improvements in C. glutamicum glucose metabolism under oxygen deprivation. In addition to gapA, overexpressing pyruvate kinase-encoding pyk and phosphofructokinase-encoding pfk enabled strain GLY2/pCRD500 to realize respective 13% and 20% improved rates of glucose consumption and alanine formation compared to GLY1/pCRD500. Subsequent overexpression of glucose-6-phosphate isomerase-encoding gpi in strain GLY3/pCRD500 further improved its glucose metabolism. Notably, both alanine productivity and yield increased after each overexpression step. After 48 h of incubation, GLY3/pCRD500 produced 2,430 mM alanine at a yield of 91.8%. This was 6.4-fold higher productivity than that of the wild-type strain. Intracellular metabolite analysis showed that gapA overexpression led to a decreased concentration of metabolites upstream of glyceraldehyde-3-phosphate dehydrogenase, suggesting that the overexpression resolved a bottleneck in glycolysis. Changing ratios of the extracellular metabolites by overexpression of glycolytic genes resulted in reduction of the intracellular NADH/NAD+ ratio, which also plays an important role on the improvement of glucose consumption. Enhanced alanine dehydrogenase activity using a high-copy-number plasmid further accelerated the overall alanine productivity. Increase in glycolytic enzyme activities is a promising approach to make drastic progress in growth-arrested bioprocesses. PMID

  1. Pathological Roles of Wild-Type Cu, Zn-Superoxide Dismutase in Amyotrophic Lateral Sclerosis

    Directory of Open Access Journals (Sweden)

    Yoshiaki Furukawa

    2012-01-01

    Full Text Available Dominant mutations in a Cu, Zn-superoxide dismutase (SOD1 gene cause a familial form of amyotrophic lateral sclerosis (ALS. While it remains controversial how SOD1 mutations lead to onset and progression of the disease, many in vitro and in vivo studies have supported a gain-of-toxicity mechanism where pathogenic mutations contribute to destabilizing a native structure of SOD1 and thus facilitate misfolding and aggregation. Indeed, abnormal accumulation of SOD1-positive inclusions in spinal motor neurons is a pathological hallmark in SOD1-related familial ALS. Furthermore, similarities in clinical phenotypes and neuropathology of ALS cases with and without mutations in sod1 gene have implied a disease mechanism involving SOD1 common to all ALS cases. Although pathogenic roles of wild-type SOD1 in sporadic ALS remain controversial, recent developments of novel SOD1 antibodies have made it possible to characterize wild-type SOD1 under pathological conditions of ALS. Here, I have briefly reviewed recent progress on biochemical and immunohistochemical characterization of wild-type SOD1 in sporadic ALS cases and discussed possible involvement of wild-type SOD1 in a pathomechanism of ALS.

  2. Stress tolerances of nullmutants of function-unknown genes encoding menadione stress-responsive proteins in Aspergillus nidulans.

    Science.gov (United States)

    Leiter, Éva; Bálint, Mihály; Miskei, Márton; Orosz, Erzsébet; Szabó, Zsuzsa; Pócsi, István

    2016-07-01

    A group of menadione stress-responsive function-unkown genes of Aspergillus nidulans (Locus IDs ANID_03987.1, ANID_06058.1, ANID_10219.1, and ANID_10260.1) was deleted and phenotypically characterized. Importantly, comparative and phylogenetic analyses of the tested A. nidulans genes and their orthologs shed light only on the presence of a TANGO2 domain with NRDE protein motif in the translated ANID_06058.1 gene but did not reveal any recognizable protein-encoding domains in other protein sequences. The gene deletion strains were subjected to oxidative, osmotic, and metal ion stress and, surprisingly, only the ΔANID_10219.1 mutant showed an increased sensitivity to 0.12 mmol l(-1) menadione sodium bisulfite. The gene deletions affected the stress sensitivities (tolerances) irregularly, for example, some strains grew more slowly when exposed to various oxidants and/or osmotic stress generating agents, meanwhile the ΔANID_10260.1 mutant possessed a wild-type tolerance to all stressors tested. Our results are in line with earlier studies demonstrating that the deletions of stress-responsive genes do not confer necessarily any stress-sensitivity phenotypes, which can be attributed to compensatory mechanisms based on other elements of the stress response system with overlapping functions. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  3. Functional characterization of the gene FoOCH1 encoding a putative α-1,6-mannosyltransferase in Fusarium oxysporum f. sp. cubense.

    Science.gov (United States)

    Li, Min-Hui; Xie, Xiao-Ling; Lin, Xian-Feng; Shi, Jin-Xiu; Ding, Zhao-Jian; Ling, Jin-Feng; Xi, Ping-Gen; Zhou, Jia-Nuan; Leng, Yueqiang; Zhong, Shaobin; Jiang, Zi-De

    2014-04-01

    Fusarium oxysporum f. sp. cubense (FOC) is the causal agent of banana Fusarium wilt and has become one of the most destructive pathogens threatening the banana production worldwide. However, few genes related to morphogenesis and pathogenicity of this fungal pathogen have been functionally characterized. In this study, we identified and characterized the disrupted gene in a T-DNA insertional mutant (L953) of FOC with significantly reduced virulence on banana plants. The gene disrupted by T-DNA insertion in L953 harbors an open reading frame, which encodes a protein with homology to α-1,6-mannosyltransferase (OCH1) in fungi. The deletion mutants (ΔFoOCH1) of the OCH1 orthologue (FoOCH1) in FOC were impaired in fungal growth, exhibited brighter staining with fluorescein isothiocyanate (FITC)-Concanavalin A, had less cell wall proteins and secreted more proteins into liquid media than the wild type. Furthermore, the mutation or deletion of FoOCH1 led to loss of ability to penetrate cellophane membrane and decline in hyphal attachment and colonization as well as virulence to the banana host. The mutant phenotypes were fully restored by complementation with the wild type FoOCH1 gene. Our data provide a first evidence for the critical role of FoOCH1 in maintenance of cell wall integrity and virulence of F. oxysporum f. sp. cubense. Copyright © 2014 Elsevier Inc. All rights reserved.

  4. New recombinant bacterium comprises a heterologous gene encoding glycerol dehydrogenase and/or an up-regulated native gene encoding glycerol dehydrogenase, useful for producing ethanol

    DEFF Research Database (Denmark)

    2010-01-01

    dehydrogenase encoding region of the bacterium, or is inserted into a phosphotransacetylase encoding region of the bacterium, or is inserted into an acetate kinase encoding region of the bacterium. It is operably linked to an inducible, a regulated or a constitutive promoter. The up-regulated glycerol......TECHNOLOGY FOCUS - BIOTECHNOLOGY - Preparation (claimed): Producing recombinant bacterium having enhanced ethanol production characteristics when cultivated in growth medium comprising glycerol comprises: (a) transforming a parental bacterium by (i) the insertion of a heterologous gene encoding...... glycerol dehydrogenase; and/or (ii) up-regulating a native gene encoding glycerol dehydrogenase; and (b) obtaining the recombinant bacterium. Preferred Bacterium: In the recombinant bacterium above, the inserted heterologous gene and/or the up-regulated native gene is encoding a glycerol dehydrogenase...

  5. A Caenorhabditis elegans wild type defies the temperature-size rule owing to a single nucleotide polymorphism in tra-3.

    Directory of Open Access Journals (Sweden)

    Jan E Kammenga

    2007-03-01

    Full Text Available Ectotherms rely for their body heat on surrounding temperatures. A key question in biology is why most ectotherms mature at a larger size at lower temperatures, a phenomenon known as the temperature-size rule. Since temperature affects virtually all processes in a living organism, current theories to explain this phenomenon are diverse and complex and assert often from opposing assumptions. Although widely studied, the molecular genetic control of the temperature-size rule is unknown. We found that the Caenorhabditis elegans wild-type N2 complied with the temperature-size rule, whereas wild-type CB4856 defied it. Using a candidate gene approach based on an N2 x CB4856 recombinant inbred panel in combination with mutant analysis, complementation, and transgenic studies, we show that a single nucleotide polymorphism in tra-3 leads to mutation F96L in the encoded calpain-like protease. This mutation attenuates the ability of CB4856 to grow larger at low temperature. Homology modelling predicts that F96L reduces TRA-3 activity by destabilizing the DII-A domain. The data show that size adaptation of ectotherms to temperature changes may be less complex than previously thought because a subtle wild-type polymorphism modulates the temperature responsiveness of body size. These findings provide a novel step toward the molecular understanding of the temperature-size rule, which has puzzled biologists for decades.

  6. [Expression of mutation type GJA8 gene and wild type GJA8 gene of a congenital inherited nuclear cataract family in eukaryotic cells].

    Science.gov (United States)

    Zheng, Jian-qiu; Liu, Ping; Wang, Jian-wen; Liu, Jian-ju

    2010-04-20

    To clone the sequence of mutation type GJA8 gene (mGJA8) and wild type GJA8 gene (wGJA8) of a congenital inherited nuclear cataract family and study their expression in eukaryotic cell lines in vitro. The mGJA8 and wGJA8 were amplified from this family's DNA and healthy people's DNA by PCR respectively. The mGJA8 and wGJA8 were recombined with plasmid pEGFP-N1 respectively. The accuracy of pEGFP-N1-GJA8 was confirmed by restriction enzyme digestion and DNA sequencing. Finally pEGFP-N1- mGJA8 and pEGFP-N1- wGJA8 and GFP protein were transfected into COS7 cells by lipofectin. The expression of pEGFP-N1-GJA8 and GFP fusion protein were to observe under fluorescence microscope, and to detect by Western-blotting and immunohistochemical staining. The mGJA8 and wGJA8 were cloned successfully. With restricting enzyme digestion analysis and DNA sequencing, recombinant plasmid pEGFP-N1-mGJA8 and pEGFP-N1-wGJA8 were constructed correctly and their GFP fusions were expressed in transfected COS7 cells. The expression of pEGFP-N1-mGJA8 and pEGFP-N1-wGJA8 fusion protein were observed under fluorescence microscope, and detected by Western-blotting and immunohistochemical staining successfully. The mGJA8 gene and wGJA8 gene are cloned successfully, and pEGFP-N1-mGJA8 and pEGFP-N1-mGJA8 fusion protein can be expressed in COS7 cells, which establish the foundation for further studying the mechanism of this congenital inherited nuclear cataract family.

  7. LABA1, a Domestication Gene Associated with Long, Barbed Awns in Wild Rice.

    Science.gov (United States)

    Hua, Lei; Wang, Diane R; Tan, Lubin; Fu, Yongcai; Liu, Fengxia; Xiao, Langtao; Zhu, Zuofeng; Fu, Qiang; Sun, Xianyou; Gu, Ping; Cai, Hongwei; McCouch, Susan R; Sun, Chuanqing

    2015-07-01

    Common wild rice (Oryza rufipogon), the wild relative of Asian cultivated rice (Oryza sativa), flaunts long, barbed awns, which are necessary for efficient propagation and dissemination of seeds. By contrast, O. sativa cultivars have been selected to be awnless or to harbor short, barbless awns, which facilitate seed processing and storage. The transition from long, barbed awns to short, barbless awns was a crucial event in rice domestication. Here, we show that the presence of long, barbed awns in wild rice is controlled by a major gene on chromosome 4, LONG AND BARBED AWN1 (LABA1), which encodes a cytokinin-activating enzyme. A frame-shift deletion in LABA1 of cultivated rice reduces the cytokinin concentration in awn primordia, disrupting barb formation and awn elongation. Sequencing analysis demonstrated low nucleotide diversity and a selective sweep encompassing an ∼800-kb region around the derived laba1 allele in cultivated rice. Haplotype analysis revealed that the laba1 allele originated in the japonica subspecies and moved into the indica gene pool via introgression, suggesting that humans selected for this locus in early rice domestication. Identification of LABA1 provides new insights into rice domestication and also sheds light on the molecular mechanism underlying awn development. © 2015 American Society of Plant Biologists. All rights reserved.

  8. Prednisolone-induced differential gene expression in mouse liver carrying wild type or a dimerization-defective glucocorticoid receptor

    Directory of Open Access Journals (Sweden)

    Dokter Wim

    2010-06-01

    Full Text Available Abstract Background Glucocorticoids (GCs control expression of a large number of genes via binding to the GC receptor (GR. Transcription may be regulated either by binding of the GR dimer to DNA regulatory elements or by protein-protein interactions of GR monomers with other transcription factors. Although the type of regulation for a number of individual target genes is known, the relative contribution of both mechanisms to the regulation of the entire transcriptional program remains elusive. To study the importance of GR dimerization in the regulation of gene expression, we performed gene expression profiling of livers of prednisolone-treated wild type (WT and mice that have lost the ability to form GR dimers (GRdim. Results The GR target genes identified in WT mice were predominantly related to glucose metabolism, the cell cycle, apoptosis and inflammation. In GRdim mice, the level of prednisolone-induced gene expression was significantly reduced compared to WT, but not completely absent. Interestingly, for a set of genes, involved in cell cycle and apoptosis processes and strongly related to Foxo3a and p53, induction by prednisolone was completely abolished in GRdim mice. In contrast, glucose metabolism-related genes were still modestly upregulated in GRdim mice upon prednisolone treatment. Finally, we identified several novel GC-inducible genes from which Fam107a, a putative histone acetyltransferase complex interacting protein, was most strongly dependent on GR dimerization. Conclusions This study on prednisolone-induced effects in livers of WT and GRdim mice identified a number of interesting candidate genes and pathways regulated by GR dimers and sheds new light onto the complex transcriptional regulation of liver function by GCs.

  9. Overproduction of lactimidomycin by cross-overexpression of genes encoding Streptomyces antibiotic regulatory proteins.

    Science.gov (United States)

    Zhang, Bo; Yang, Dong; Yan, Yijun; Pan, Guohui; Xiang, Wensheng; Shen, Ben

    2016-03-01

    The glutarimide-containing polyketides represent a fascinating class of natural products that exhibit a multitude of biological activities. We have recently cloned and sequenced the biosynthetic gene clusters for three members of the glutarimide-containing polyketides-iso-migrastatin (iso-MGS) from Streptomyces platensis NRRL 18993, lactimidomycin (LTM) from Streptomyces amphibiosporus ATCC 53964, and cycloheximide (CHX) from Streptomyces sp. YIM56141. Comparative analysis of the three clusters identified mgsA and chxA, from the mgs and chx gene clusters, respectively, that were predicted to encode the PimR-like Streptomyces antibiotic regulatory proteins (SARPs) but failed to reveal any regulatory gene from the ltm gene cluster. Overexpression of mgsA or chxA in S. platensis NRRL 18993, Streptomyces sp. YIM56141 or SB11024, and a recombinant strain of Streptomyces coelicolor M145 carrying the intact mgs gene cluster has no significant effect on iso-MGS or CHX production, suggesting that MgsA or ChxA regulation may not be rate-limiting for iso-MGS and CHX production in these producers. In contrast, overexpression of mgsA or chxA in S. amphibiosporus ATCC 53964 resulted in a significant increase in LTM production, with LTM titer reaching 106 mg/L, which is five-fold higher than that of the wild-type strain. These results support MgsA and ChxA as members of the SARP family of positive regulators for the iso-MGS and CHX biosynthetic machinery and demonstrate the feasibility to improve glutarimide-containing polyketide production in Streptomyces strains by exploiting common regulators.

  10. Detection of β-lactamase encoding genes in feces, soil and water from a Brazilian pig farm.

    Science.gov (United States)

    Furlan, João Pedro Rueda; Stehling, Eliana Guedes

    2018-01-10

    β-lactam antibiotics are widely used for the treatment of different types of infections worldwide and the resistance to these antibiotics has grown sharply, which is of great concern. Resistance to β-lactams in gram-negative bacteria is mainly due to the production of β-lactamases, which are classified according to their functional activities. The aim of this study was to verify the presence of β-lactamases encoding genes in feces, soil, and water from a Brazilian pig farm. Different β-lactamases encoding genes were found, including bla CTX-M-Gp1 , bla CTX-M-Gp9 , bla SHV , bla OXA-1-like , bla GES , and bla VEB . The bla SHV and bla CTX-M-Gp1 genes have been detected in all types of samples, indicating the spread of β-lactam resistant bacteria among farm pigs and the environment around them. These results indicate that β-lactamase encoding genes belonging to the cloxacillinase, ESBL, and carbapenemase and they have high potential to spread in different sources, due to the fact that genes are closely related to mobile genetic elements, especially plasmids.

  11. The SBP-Box Gene VpSBP11 from Chinese Wild Vitis Is Involved in Floral Transition and Affects Leaf Development.

    Science.gov (United States)

    Hou, Hongmin; Yan, Xiaoxiao; Sha, Ting; Yan, Qin; Wang, Xiping

    2017-07-13

    Flowering occurs in angiosperms during a major developmental transition from vegetative growth to the reproductive phase. Squamosa promoter binding protein (SBP)-box genes have been found to play critical roles in regulating flower and fruit development, but their roles in grapevine have remained unclear. To better understand the functions of the grape SBP-box genes in both vegetative and reproductive growth phases, a full-length complementary DNA (cDNA) sequence of the putative SBP-box transcription factor gene, VpSBP11 , was obtained from Chinese wild grapevine Vitis pseudoreticulata Wen Tsai Wang (W. T. Wang) clone 'Baihe-35-1'. VpSBP11 encoded a putative polypeptide of 170 amino acids with a highly conserved SBP-domain with two zinc-binding sites of the Cx2C-x3-H-x11-C-x6-H (C2HCH) type and a nuclear localization signal. We confirmed that the VpSBP11 protein was targeted to the nucleus and possessed transcriptional activation activity by subcellular localization and trans -activation assay. Over-expression of VpSBP11 in Arabidopsis thaliana was shown to activate the FUL gene, and subsequently the AP1 and LFY genes, all of which were floral meristem identity genes, and to cause earlier flowering than in wild type (WT) plants. The pattern of vegetative growth was also different between the transgenic and WT plants. For example, in the VpSBP11 over-expressing transgenic plants, the number of rosette leaves was less than that of WT; the petiole was significantly elongated; and the rosette and cauline leaves curled upwards or downwards. These results were consistent with VpSBP11 acting as a transcription factor during the transition from the vegetative stage to the reproductive stage.

  12. Cloning, characterization, expression analysis and inhibition studies of a novel gene encoding Bowman-Birk type protease inhibitor from rice bean

    Science.gov (United States)

    This paper presents the first study describing the isolation, cloning and characterization of a full length gene encoding Bowman-Birk protease inhibitor (RbTI) from rice bean (Vigna umbellata). A full-length protease inhibitor gene with complete open reading frame of 327bp encoding 109 amino acids w...

  13. Nuclear-Cytoplasmic Conflict in Pea (Pisum sativum L.) Is Associated with Nuclear and Plastidic Candidate Genes Encoding Acetyl-CoA Carboxylase Subunits

    Science.gov (United States)

    Bogdanova, Vera S.; Zaytseva, Olga O.; Mglinets, Anatoliy V.; Shatskaya, Natalia V.; Kosterin, Oleg E.; Vasiliev, Gennadiy V.

    2015-01-01

    In crosses of wild and cultivated peas (Pisum sativum L.), nuclear-cytoplasmic incompatibility frequently occurs manifested as decreased pollen fertility, male gametophyte lethality, sporophyte lethality. High-throughput sequencing of plastid genomes of one cultivated and four wild pea accessions differing in cross-compatibility was performed. Candidate genes for involvement in the nuclear-plastid conflict were searched in the reconstructed plastid genomes. In the annotated Medicago truncatula genome, nuclear candidate genes were searched in the portion syntenic to the pea chromosome region known to harbor a locus involved in the conflict. In the plastid genomes, a substantial variability of the accD locus represented by nucleotide substitutions and indels was found to correspond to the pattern of cross-compatibility among the accessions analyzed. Amino acid substitutions in the polypeptides encoded by the alleles of a nuclear locus, designated as Bccp3, with a complementary function to accD, fitted the compatibility pattern. The accD locus in the plastid genome encoding beta subunit of the carboxyltransferase of acetyl-coA carboxylase and the nuclear locus Bccp3 encoding biotin carboxyl carrier protein of the same multi-subunit enzyme were nominated as candidate genes for main contribution to nuclear-cytoplasmic incompatibility in peas. Existence of another nuclear locus involved in the accD-mediated conflict is hypothesized. PMID:25789472

  14. Nuclear-cytoplasmic conflict in pea (Pisum sativum L. is associated with nuclear and plastidic candidate genes encoding acetyl-CoA carboxylase subunits.

    Directory of Open Access Journals (Sweden)

    Vera S Bogdanova

    Full Text Available In crosses of wild and cultivated peas (Pisum sativum L., nuclear-cytoplasmic incompatibility frequently occurs manifested as decreased pollen fertility, male gametophyte lethality, sporophyte lethality. High-throughput sequencing of plastid genomes of one cultivated and four wild pea accessions differing in cross-compatibility was performed. Candidate genes for involvement in the nuclear-plastid conflict were searched in the reconstructed plastid genomes. In the annotated Medicago truncatula genome, nuclear candidate genes were searched in the portion syntenic to the pea chromosome region known to harbor a locus involved in the conflict. In the plastid genomes, a substantial variability of the accD locus represented by nucleotide substitutions and indels was found to correspond to the pattern of cross-compatibility among the accessions analyzed. Amino acid substitutions in the polypeptides encoded by the alleles of a nuclear locus, designated as Bccp3, with a complementary function to accD, fitted the compatibility pattern. The accD locus in the plastid genome encoding beta subunit of the carboxyltransferase of acetyl-coA carboxylase and the nuclear locus Bccp3 encoding biotin carboxyl carrier protein of the same multi-subunit enzyme were nominated as candidate genes for main contribution to nuclear-cytoplasmic incompatibility in peas. Existence of another nuclear locus involved in the accD-mediated conflict is hypothesized.

  15. Genes Encoding Aluminum-Activated Malate Transporter II and their Association with Fruit Acidity in Apple

    Directory of Open Access Journals (Sweden)

    Baiquan Ma

    2015-11-01

    Full Text Available A gene encoding aluminum-activated malate transporter (ALMT was previously reported as a candidate for the locus controlling acidity in apple ( × Borkh.. In this study, we found that apple genes can be divided into three families and the gene belongs to the family. Duplication of genes in apple is related to the polyploid origin of the apple genome. Divergence in expression has occurred between the gene and its homologs in the family and only the gene is significantly associated with malic acid content. The locus consists of two alleles, and . resides in the tonoplast and its ectopic expression in yeast was found to increase the influx of malic acid into yeast cells significantly, suggesting it may function as a vacuolar malate channel. In contrast, encodes a truncated protein because of a single nucleotide substitution of G with A in the last exon. As this truncated protein resides within the cell membrane, it is deemed to be nonfunctional as a vacuolar malate channel. The frequency of the genotype is very low in apple cultivars but is high in wild relatives, which suggests that apple domestication may be accompanied by selection for the gene. In addition, variations in the malic acid content of mature fruits were also observed between accessions with the same genotype in the locus. This suggests that the gene is not the only genetic determinant of fruit acidity in apple.

  16. Mutation of a Rice Gene Encoding a Phenylalanine Biosynthetic Enzyme Results in Accumulation of Phenylalanine and Tryptophan[W

    Science.gov (United States)

    Yamada, Tetsuya; Matsuda, Fumio; Kasai, Koji; Fukuoka, Shuichi; Kitamura, Keisuke; Tozawa, Yuzuru; Miyagawa, Hisashi; Wakasa, Kyo

    2008-01-01

    Two distinct biosynthetic pathways for Phe in plants have been proposed: conversion of prephenate to Phe via phenylpyruvate or arogenate. The reactions catalyzed by prephenate dehydratase (PDT) and arogenate dehydratase (ADT) contribute to these respective pathways. The Mtr1 mutant of rice (Oryza sativa) manifests accumulation of Phe, Trp, and several phenylpropanoids, suggesting a link between the synthesis of Phe and Trp. Here, we show that the Mtr1 mutant gene (mtr1-D) encodes a form of rice PDT with a point mutation in the putative allosteric regulatory region of the protein. Transformed callus lines expressing mtr1-D exhibited all the characteristics of Mtr1 callus tissue. Biochemical analysis revealed that rice PDT possesses both PDT and ADT activities, with a preference for arogenate as substrate, suggesting that it functions primarily as an ADT. The wild-type enzyme is feedback regulated by Phe, whereas the mutant enzyme showed a reduced feedback sensitivity, resulting in Phe accumulation. In addition, these observations indicate that rice PDT is critical for regulating the size of the Phe pool in plant cells. Feeding external Phe to wild-type callus tissue and seedlings resulted in Trp accumulation, demonstrating a connection between Phe accumulation and Trp pool size. PMID:18487352

  17. Bacillus caldolyticus prs gene encoding phosphoribosyldiphosphate synthase

    DEFF Research Database (Denmark)

    Krath, Britta N.; Hove-Jensen, Bjarne

    1996-01-01

    The prs gene, encoding phosphoribosyl-diphosphate (PRPP) synthase, as well as the flanking DNA sequences were cloned and sequenced from the Gram-positive thermophile, Bacillus caldolyticus. Comparison with the homologous sequences from the mesophile, Bacillus subtilis, revealed a gene (gca......D) encoding N-acetylglucosamine-l-phosphate uridyltransferase upstream of prs, and a gene homologous to ctc downstream of prs. cDNA synthesis with a B. caldolyticus gcaD-prs-ctc-specified mRNA as template, followed by amplification utilising the polymerase chain reaction indicated that the three genes are co......-transcribed. Comparison of amino acid sequences revealed a high similarity among PRPP synthases across a wide phylogenetic range. An E. coli strain harbouring the B. caldolyticus prs gene in a multicopy plasmid produced PRPP synthase activity 33-fold over the activity of a haploid B. caldolyticus strain. B. caldolyticus...

  18. LABA1, a Domestication Gene Associated with Long, Barbed Awns in Wild Rice[OPEN

    Science.gov (United States)

    Hua, Lei; Wang, Diane R.; Tan, Lubin; Fu, Yongcai; Liu, Fengxia; Xiao, Langtao; Zhu, Zuofeng; Fu, Qiang; Sun, Xianyou; Gu, Ping; Cai, Hongwei; McCouch, Susan R.; Sun, Chuanqing

    2015-01-01

    Common wild rice (Oryza rufipogon), the wild relative of Asian cultivated rice (Oryza sativa), flaunts long, barbed awns, which are necessary for efficient propagation and dissemination of seeds. By contrast, O. sativa cultivars have been selected to be awnless or to harbor short, barbless awns, which facilitate seed processing and storage. The transition from long, barbed awns to short, barbless awns was a crucial event in rice domestication. Here, we show that the presence of long, barbed awns in wild rice is controlled by a major gene on chromosome 4, LONG AND BARBED AWN1 (LABA1), which encodes a cytokinin-activating enzyme. A frame-shift deletion in LABA1 of cultivated rice reduces the cytokinin concentration in awn primordia, disrupting barb formation and awn elongation. Sequencing analysis demonstrated low nucleotide diversity and a selective sweep encompassing an ∼800-kb region around the derived laba1 allele in cultivated rice. Haplotype analysis revealed that the laba1 allele originated in the japonica subspecies and moved into the indica gene pool via introgression, suggesting that humans selected for this locus in early rice domestication. Identification of LABA1 provides new insights into rice domestication and also sheds light on the molecular mechanism underlying awn development. PMID:26082172

  19. Mutation of CDH23, encoding a new member of the cadherin gene family, causes Usher syndrome type 1D.

    Science.gov (United States)

    Bolz, H; von Brederlow, B; Ramírez, A; Bryda, E C; Kutsche, K; Nothwang, H G; Seeliger, M; del C-Salcedó Cabrera, M; Vila, M C; Molina, O P; Gal, A; Kubisch, C

    2001-01-01

    Usher syndrome type I (USH1) is an autosomal recessive disorder characterized by congenital sensorineural hearing loss, vestibular dysfunction and visual impairment due to early onset retinitis pigmentosa (RP). So far, six loci (USH1A-USH1F) have been mapped, but only two USH1 genes have been identified: MYO7A for USH1B and the gene encoding harmonin for USH1C. We identified a Cuban pedigree linked to the locus for Usher syndrome type 1D (MIM 601067) within the q2 region of chromosome 10). Affected individuals present with congenital deafness and a highly variable degree of retinal degeneration. Using a positional candidate approach, we identified a new member of the cadherin gene superfamily, CDH23. It encodes a protein of 3,354 amino acids with a single transmembrane domain and 27 cadherin repeats. In the Cuban family, we detected two different mutations: a severe course of the retinal disease was observed in individuals homozygous for what is probably a truncating splice-site mutation (c.4488G-->C), whereas mild RP is present in individuals carrying the homozygous missense mutation R1746Q. A variable expression of the retinal phenotype was seen in patients with a combination of both mutations. In addition, we identified two mutations, Delta M1281 and IVS51+5G-->A, in a German USH1 patient. Our data show that different mutations in CDH23 result in USH1D with a variable retinal phenotype. In an accompanying paper, it is shown that mutations in the mouse ortholog cause disorganization of inner ear stereocilia and deafness in the waltzer mouse.

  20. Identifying the Integrated Neural Networks Involved in Capsaicin-Induced Pain Using fMRI in Awake TRPV1 Knockout and Wild-Type Rats

    Directory of Open Access Journals (Sweden)

    Jason Richard Yee

    2015-02-01

    Full Text Available In the present study, we used functional MRI in awake rats to investigate the pain response that accompanies intradermal injection of capsaicin into the hindpaw. To this end, we used BOLD imaging together with a 3D segmented, annotated rat atlas and computational analysis to identify the integrated neural circuits involved in capsaicin-induced pain. The specificity of the pain response to capsaicin was tested in a transgenic model that contains a biallelic deletion of the gene encoding for the transient receptor potential cation channel subfamily V member 1 (TRPV1. Capsaicin is an exogenous ligand for the TRPV1 receptor, and in wild-type rats, activated the putative pain neural circuit. In addition, capsaicin-treated wild-type rats exhibited activation in brain regions comprising the Papez circuit and habenular system, systems that play important roles in the integration of emotional information, and learning and memory of aversive information, respectively. As expected, capsaicin administration to TRPV1-KO rats failed to elicit the robust BOLD activation pattern observed in wild-type controls. However, the intradermal injection of formalin elicited a significant activation of the putative pain pathway as represented by such areas as the anterior cingulate, somatosensory cortex, parabrachial nucleus, and periaqueductal gray. Notably, comparison of neural responses to capsaicin in wild-type versus knock-out rats uncovered evidence that capsaicin may function in an antinociceptive capacity independent of TRPV1 signaling. Our data suggest that neuroimaging of pain in awake, conscious animals has the potential to inform the neurobiological basis of full and integrated perceptions of pain.

  1. Genetic and functional analysis of the gene encoding GAP-43 in schizophrenia.

    Science.gov (United States)

    Shen, Yu-Chih; Tsai, Ho-Min; Cheng, Min-Chih; Hsu, Shih-Hsin; Chen, Shih-Fen; Chen, Chia-Hsiang

    2012-02-01

    In earlier reports, growth-associated protein 43 (GAP-43) has been shown to be critical for initial establishment or reorganization of synaptic connections, a process thought to be disrupted in schizophrenia. Additionally, abnormal GAP-43 expression in different brain regions has been linked to this disorder in postmortem brain studies. In this study, we investigated the involvement of the gene encoding GAP-43 in the susceptibility to schizophrenia. We searched for genetic variants in the promoter region and 3 exons (including both UTR ends) of the GAP-43 gene using direct sequencing in a sample of patients with schizophrenia (n=586) and non-psychotic controls (n=576), both being Han Chinese from Taiwan, and conducted an association and functional study. We identified 11 common polymorphisms in the GAP-43 gene. SNP and haplotype-based analyses displayed no associations with schizophrenia. Additionally, we identified 4 rare variants in 5 out of 586 patients, including 1 variant located at the promoter region (c.-258-4722G>T) and 1 synonymous (V110V) and 2 missense (G150R and P188L) variants located at exon 2. No rare variants were found in the control subjects. The results of the reporter gene assay demonstrated that the regulatory activity of construct containing c.-258-4722T was significantly lower as compared to the wild type construct (c.-258-4722G; panalysis also demonstrated the functional relevance of other rare variants. Our study lends support to the hypothesis of multiple rare mutations in schizophrenia, and it provides genetic clues that indicate the involvement of GAP-43 in this disorder. Copyright © 2011 Elsevier B.V. All rights reserved.

  2. No evidence for functional inactivation of wild-type p53 protein by MDM2 overexpression in gastric carcinogenesis

    NARCIS (Netherlands)

    Blok, P.; Craanen, M. E.; Dekker, W.; Offerhaus, G. J.; Tytgat, G. N.

    1998-01-01

    Inactivation of wild-type p53 during gastric carcinogenesis is usually caused by mutations within exons 5-8 of the p53 gene leading to mutated, usually immunohistochemically detectable p53 proteins. However, functional inactivation of wild-type p53, mimicking mutational inactivation, may also result

  3. Genetic association analysis of 13 nuclear-encoded mitochondrial candidate genes with type II diabetes mellitus: The DAMAGE study

    DEFF Research Database (Denmark)

    Reiling, Erwin; van Vliet-Ostaptchouk, Jana V; van 't Riet, Esther

    2009-01-01

    ). After a meta-analysis, only one SNP in SIRT4 (rs2522138) remained significant (P=0.01). Extending the second stage with samples from the Danish Steno Study (n=1220 participants) resulted in a common odds ratio (OR) of 0.92 (0.85-1.00), P=0.06. Moreover, in a large meta-analysis of three genome......Mitochondria play an important role in many processes, like glucose metabolism, fatty acid oxidation and ATP synthesis. In this study, we aimed to identify association of common polymorphisms in nuclear-encoded genes involved in mitochondrial protein synthesis and biogenesis with type II diabetes...

  4. DNA binding properties of dioxin receptors in wild-type and mutant mouse hepatoma cells

    International Nuclear Information System (INIS)

    Cuthill, S.; Poellinger, L.

    1988-01-01

    The current model of action of 2,3,7,8-tetrachlorodibenzo-p-dioxin (dioxin) entails stimulation of target gene transcription via the formation of dioxin-receptor complexes and subsequent accumulation of the complexes within the cell nucleus. Here, the authors have analyzed the DNA binding properties of the dioxin receptor in wild-type mouse hepatoma (Hepa 1c1c7) cells and a class of nonresponsive mutant cells which fail to accumulate dioxin-receptor complexes within the nucleus in vivo. In vitro, both the wild-type and mutant [ 3 H]dioxin-receptor complexes exhibited low affinity for DNA-cellulose (5-8% and around 4% retention, respectively) in the absence of prior biochemical manipulations. However, following chromatography on heparin-Sepharose, the wild-type but not the mutant dioxin receptor was transformed to a species with an increased affinity for DNA (40-50% retention on DNA-cellulose). The gross molecular structure of the mutant, non DNA binding dioxin receptor did not appear to be altered as compared to that of the wild-type receptor. These results imply that the primary deficiency in the mutant dioxin receptor form may reside at the DNA binding level and that, in analogy to steroid hormone receptors, DNA binding of the receptor may be an essential step in the regulation of target gene transcription by dioxin

  5. The Aspergillus fumigatus siderophore biosynthetic gene sidA, encoding L-ornithine N5-oxygenase, is required for virulence.

    Science.gov (United States)

    Hissen, Anna H T; Wan, Adrian N C; Warwas, Mark L; Pinto, Linda J; Moore, Margo M

    2005-09-01

    Aspergillus fumigatus is the leading cause of invasive mold infection and is a serious problem in immunocompromised populations worldwide. We have previously shown that survival of A. fumigatus in serum may be related to secretion of siderophores. In this study, we identified and characterized the sidA gene of A. fumigatus, which encodes l-ornithine N(5)-oxygenase, the first committed step in hydroxamate siderophore biosynthesis. A. fumigatus sidA codes for a protein of 501 amino acids with significant homology to other fungal l-ornithine N(5)-oxygenases. A stable DeltasidA strain was created by deletion of A. fumigatus sidA. This strain was unable to synthesize the siderophores N',N",N'''-triacetylfusarinine C (TAF) and ferricrocin. Growth of the DeltasidA strain was the same as that of the wild type in rich media; however, the DeltasidA strain was unable to grow in low-iron defined media or media containing 10% human serum unless supplemented with TAF or ferricrocin. No significant differences in ferric reduction activities were observed between the parental strain and the DeltasidA strain, indicating that blocking siderophore secretion did not result in upregulation of this pathway. Unlike the parental strain, the DeltasidA strain was unable to remove iron from human transferrin. A rescued strain (DeltasidA + sidA) was constructed; it produced siderophores and had the same growth as the wild type on iron-limited media. Unlike the wild-type and rescued strains, the DeltasidA strain was avirulent in a mouse model of invasive aspergillosis, indicating that sidA is necessary for A. fumigatus virulence.

  6. Comparison of clastogen-induced gene expression profiles in wild-type and DNA repair-deficient Rad54/Rad54B cells

    Directory of Open Access Journals (Sweden)

    van Benthem Jan

    2010-01-01

    Full Text Available Abstract Background Previously we found that Rad54/Rad54B cells are more sensitive towards mitomycin C (MMC as compared to wild-type (WT cells. This difference in sensitivity was absent upon exposure to other clastogens like bleomycin (BLM and γ-radiation. In order to get further insight into possible underlying mechanisms, gene expression changes in WT and Rad54/Rad54B MEFs (mouse embryonic fibroblasts after exposure to the clastogens MMC and BLM were investigated. Exposures of these cells to mutagens (N-ac-AAF and ENU and vehicle were taken as controls. Results Most exposures resulted in an induction of DNA damage signaling and apoptosis genes and a reduced expression of cell division genes in cells of both genotypes. As expected, responses to N-ac-AAF were very similar in both genotypes. ENU exposure did not lead to significant gene expression changes in cells of both genotypes, presumably due to its short half-life. Gene expression responses to clastogens, however, showed a genotype-dependent effect for BLM and MMC. MMC treated Rad54/Rad54B MEFs showed no induction of p53-signaling, DNA damage response and apoptosis as seen for all the other treatments. Conclusion These data support our finding that different types of clastogens exist and that responses to these types depend on the DNA repair status of the cells.

  7. The AtNFXL1 gene functions as a signaling component of the type A trichothecene-dependent response

    Science.gov (United States)

    Asano, Tomoya; Yasuda, Michiko; Nakashita, Hideo; Kimura, Makoto; Yamaguchi1, Kazuo

    2008-01-01

    Phytopathogenic Fusarium species produce the trichothecene family of phytotoxins, which function as a virulence factor during infection of plants. Trichothecenes are classifiable into four major groups by their chemical structures. Recently, the AtNFXL1 gene was reported as a type A trichothecene T-2 toxin-inducible gene. The AtNFXL1 gene encodes a putative transcription factor with similarity to the human transcription repressor NF-X1. The atnfxl1 mutant exhibited hypersensitivity phenotype to T-2 toxin but not to type B deoxynivalenol (DON) in comparison with wild type when Arabidopsis thaliana grew on agar medium containing trichothecenes. The absence or presence of a carbonyl group at the C8 position distinguishes type A and type B. Growth defect by another type A trichothecene diacetoxyscirpenol (DAS), was weakly enhanced in the atnfxl1 mutant. Diacetoxyscirpenol is distinguishable from T-2 toxin only by the absence of an isovaleryl group at the C8 position. Correspondingly, the AtNFXL1 promoter activity was apparently induced in T-2 toxin-treated and DAS-treated plants. In contrast, DON failed to induce the AtNFXL1 promoter activity. Consequently, the AtNFXL1 gene functions as a signaling component of the type A trichothecene-dependent response in Arabidopsis. In addition, the C8 position of trichothecenes might be closely related to the function of AtNFXL1 gene. PMID:19704430

  8. Distribution of non-LEE-encoded type 3 secretion system dependent effectors in enteropathogenic Escherichia coli

    Directory of Open Access Journals (Sweden)

    Fábia A. Salvador

    2014-09-01

    Full Text Available Enteropathogenic Escherichia coli (EPEC are important human gastroenteritis agents. The prevalence of six non-LEE genes encoding type 3 translocated effectors was investigated. The nleC, cif and nleB genes were more prevalent in typical than in atypical EPEC, although a higher diversity of genes combinations was observed in atypical EPEC.

  9. Analysis of Powdery Mildew Resistance in Wild Melon MLO Mutants

    Directory of Open Access Journals (Sweden)

    Cheng Hong

    2015-11-01

    Full Text Available Wild species have a potential value in crop breeding. Explore MLO gene which related with powdery mildew natural resistance is very important for improving the quality of melon. Resistance to powdery mildew was examined in cultivar and wild species by leaf inoculation. The wild germplasms showed resistance to powdery mildew Race1. Cloning and sequence analysis of the CmMLO2 gene identified an 85 bp difference between the wild and cultivated species. The CmMLO2 gene was expressed in the wild germplasm after fluorescence-labeled Agrobacterium-mediated transformation. A positive transgenic plant showed successful invasion by powdery mildew Race1. These results suggested that the wild species might have failed to encode the MLO protein, thereby resulting in the MLO-negative regulation of powdery mildew, which in turn resulted in the broad-spectrum resistance of the wild species to powdery mildew.

  10. A deep auto-encoder model for gene expression prediction.

    Science.gov (United States)

    Xie, Rui; Wen, Jia; Quitadamo, Andrew; Cheng, Jianlin; Shi, Xinghua

    2017-11-17

    Gene expression is a key intermediate level that genotypes lead to a particular trait. Gene expression is affected by various factors including genotypes of genetic variants. With an aim of delineating the genetic impact on gene expression, we build a deep auto-encoder model to assess how good genetic variants will contribute to gene expression changes. This new deep learning model is a regression-based predictive model based on the MultiLayer Perceptron and Stacked Denoising Auto-encoder (MLP-SAE). The model is trained using a stacked denoising auto-encoder for feature selection and a multilayer perceptron framework for backpropagation. We further improve the model by introducing dropout to prevent overfitting and improve performance. To demonstrate the usage of this model, we apply MLP-SAE to a real genomic datasets with genotypes and gene expression profiles measured in yeast. Our results show that the MLP-SAE model with dropout outperforms other models including Lasso, Random Forests and the MLP-SAE model without dropout. Using the MLP-SAE model with dropout, we show that gene expression quantifications predicted by the model solely based on genotypes, align well with true gene expression patterns. We provide a deep auto-encoder model for predicting gene expression from SNP genotypes. This study demonstrates that deep learning is appropriate for tackling another genomic problem, i.e., building predictive models to understand genotypes' contribution to gene expression. With the emerging availability of richer genomic data, we anticipate that deep learning models play a bigger role in modeling and interpreting genomics.

  11. A Root-Preferential DFR-Like Gene Encoding Dihydrokaempferol Reductase Involved in Anthocyanin Biosynthesis of Purple-Fleshed Sweet Potato.

    Science.gov (United States)

    Liu, Xiaoqiang; Xiang, Min; Fan, Yufang; Yang, Chunxian; Zeng, Lingjiang; Zhang, Qitang; Chen, Min; Liao, Zhihua

    2017-01-01

    Purple-fleshed sweet potato is good for health due to rich anthocyanins in tubers. Although the anthocyanin biosynthetic pathway is well understood in up-ground organs of plants, the knowledge on anthocyanin biosynthesis in underground tubers is limited. In the present study, we isolated and functionally characterized a root-preferential gene encoding dihydrokaempferol reductase ( IbDHKR ) from purple-fleshed sweet potato. IbDHKR showed highly similarity with the reported dihydroflavonol reductases in other plant species at the sequence levels and the NADPH-binding motif and the substrate-binding domain were also found in IbDHKR. The tissue profile showed that IbDHKR was expressed in all the tested organs, but with much higher level in tuber roots. The expression level of IbDHKR was consistent with the anthocyanin content in sweet potato organs, suggesting that tuber roots were the main organs to synthesize anthocyanins. The recombinant 44 kD IbDHKR was purified and fed by three different dihydroflavonol substrates including dihydrokaempferol (DHK), dihydroquerctin, and dihydromyrecetin. The substrate feeding assay indicated that only DHK could be accepted as substrate by IbDHKR, which was reduced to leucopelargonidin confirmed by LC-MS. Finally, IbDHKR was overexpressed in transgenic tobacco. The IbDHKR-overexpression tobacco corolla was more highly pigmented and contained higher level of anthocyanins than the wild-type tobacco corolla. In summary, IbDHKR was a root-preferential gene involved in anthocyanin biosynthesis and its encoding protein, specifically catalyzing DHK reduction to yield leucopelargonidin, was a candidate gene for engineering anthocyanin biosynthetic pathway.

  12. Transfection of wild type ADVP53 gene into human brain tumor cell lines has a radiosensitizing effect independent of apoptosis

    International Nuclear Information System (INIS)

    Geng, L.; Walter, S; Vaughan, A.T.M.

    1997-01-01

    Purpose: Despite attempts with a variety of therapeutic approaches there has been little impact on the survival of patients with Glioblastoma multiforme, with median survivals reported of approximately 12 months. In this study a replication restricted adenovirus vector is used to transfer the wild type p53 gene into two cell lines derived from a human astrocytoma U87MG or glioblastoma T98G, to determine its ability to act as a radiosensitizer in conjunction with conventional radiotherapy. Methods: An adenovirus vector containing the human wild type p53 (Advp53) gene was used in addition to a control vector containing the β-galactosidase (Advγgal) reporter gene. To achieve cellular incorporation both vectors were incubated with cells for 30 minutes - washed and returned to culture. The successful incorporation of each vector was determined by either a p53 assay using either a western blotting or flow cytometry techniques, or specific staining for β-galactosidase activity. The presence of each vector was assayed until the constructs were eliminated from the cell. To determine the effects of these vectors on cell survival sufficient vector was added to produce a measurable reduction in clonogenic survival and this value was used in subsequent irradiation experiments. To determine the ability of wild type p53 to induce apoptosis the cells were examined from 1 to 5 days after irradiation by H and E staining for the characteristic morphology indicating an apoptotic process. Results: Both the Advp53 and Advβgal vectors were successfully incorporated into each cell line. Expression of each gene was reduced to approximately half by 5 days and virtually eliminated by 15 days after transfection in both lines. At the doses used the wild type Advp53 adenovirus was toxic to both cell lines giving surviving fractions between 39-74%. When this toxicity was taken into account the presence of the Advp53 gene had a radiosensitizing effect in each cell line. To determine the

  13. Cloning and sequencing of a gene encoding a 21-kilodalton outer membrane protein from Bordetella avium and expression of the gene in Salmonella typhimurium.

    Science.gov (United States)

    Gentry-Weeks, C R; Hultsch, A L; Kelly, S M; Keith, J M; Curtiss, R

    1992-01-01

    Asd+ vector pYA292, and the construct was introduced into the avirulent delta cya delta crp delta asd S. typhimurium chi 3987 for oral immunization of birds. The gene encoding the 21-kDa protein was expressed equivalently in B. avium 197, delta asd E. coli chi 6097, and S. typhimurium chi 3987 and was localized primarily in the cytoplasmic membrane and outer membrane. In preliminary studies on oral inoculation of turkey poults with S. typhimurium chi 3987 expressing the gene encoding the B. avium 21-kDa protein, it was determined that a single dose of the recombinant Salmonella vaccine failed to elicit serum antibodies against the 21-kDa protein and challenge with wild-type B. avium 197 resulted in colonization of the trachea and thymus with B. avium 197. Images PMID:1447140

  14. The Schizosaccharomyces pombe mam1 gene encodes an ABC transporter mediating secretion of M-factor

    DEFF Research Database (Denmark)

    Christensen, P U; Davey, William John; Nielsen, O

    1997-01-01

    In the fission yeast Schizosaccharomyces pombe, cells of opposite mating type communicate via diffusible peptide pheromones prior to mating. We have cloned the S. pombe mam1 gene, which encodes a 1336-amino acid protein belonging to the ATP-binding cassette (ABC) superfamily. The mam1 gene is onl...

  15. Pulmonary hypertension in wild type mice and animals with genetic deficit in KCa2.3 and KCa3.1 channels.

    Directory of Open Access Journals (Sweden)

    Christine Wandall-Frostholm

    Full Text Available In vascular biology, endothelial KCa2.3 and KCa3.1 channels contribute to arterial blood pressure regulation by producing membrane hyperpolarization and smooth muscle relaxation. The role of KCa2.3 and KCa3.1 channels in the pulmonary circulation is not fully established. Using mice with genetically encoded deficit of KCa2.3 and KCa3.1 channels, this study investigated the effect of loss of the channels in hypoxia-induced pulmonary hypertension.Male wild type and KCa3.1-/-/KCa2.3T/T(+DOX mice were exposed to chronic hypoxia for four weeks to induce pulmonary hypertension. The degree of pulmonary hypertension was evaluated by right ventricular pressure and assessment of right ventricular hypertrophy. Segments of pulmonary arteries were mounted in a wire myograph for functional studies and morphometric studies were performed on lung sections. Chronic hypoxia induced pulmonary hypertension, right ventricular hypertrophy, increased lung weight, and increased hematocrit levels in either genotype. The KCa3.1-/-/KCa2.3T/T(+DOX mice developed structural alterations in the heart with increased right ventricular wall thickness as well as in pulmonary vessels with increased lumen size in partially- and fully-muscularized vessels and decreased wall area, not seen in wild type mice. Exposure to chronic hypoxia up-regulated the gene expression of the KCa2.3 channel by twofold in wild type mice and increased by 2.5-fold the relaxation evoked by the KCa2.3 and KCa3.1 channel activator NS309, whereas the acetylcholine-induced relaxation - sensitive to the combination of KCa2.3 and KCa3.1 channel blockers, apamin and charybdotoxin - was reduced by 2.5-fold in chronic hypoxic mice of either genotype.Despite the deficits of the KCa2.3 and KCa3.1 channels failed to change hypoxia-induced pulmonary hypertension, the up-regulation of KCa2.3-gene expression and increased NS309-induced relaxation in wild-type mice point to a novel mechanism to counteract pulmonary

  16. Antibody production of wild-type and enzyme V279F variants of PAF-AH as a risk factor for Cardiovascular disease

    Science.gov (United States)

    Ramadhani, Anggia N.; Puspitarini, Sapti; Sari, Anissa N.; Widodo

    2017-11-01

    Coronary artery disease (CAD) has emerged as a leading cause of death in Indonesia nowadays. WHO data in 2012 revealed that 37% of the Indonesian population died from this disease. CAD occurs because of endothelial dysfunction in the arteries. Lipoprotein-associated phospholipase A2 (Lp-PLA2), also known as platelet-activating factor acetylhydrolase (PAF-AH), is a phospholipase A2 enzyme, encoded by the PLA2G7 gene. This protein is predicted to be involved in inflammatory phospholipid metabolism so it can be used as a biomarker of CAD in the early phase. Thus, the purpose of this research is to discover the difference in antibody production between wild-type and mutant V279F. The PAF-AH enzyme was isolated from mice lymphocyte cells in order to develop this enzyme as a biomarker of cardiovascular disease. PAF-AH migrates at 55kDa according to SDS-PAGE analysis. Flow cytometry analysis showed that mutant PAF-AH (V279F) is more antigenic than wild-type PAF-AH. The missense mutation of V279F PAF-AH means this enzyme cannot catabolize the acetyl group at the sn-2 position of PAF.

  17. Cloning and analysis of the genes encoding the type IIS restriction-modification system HphI from Haemophilus parahaemolyticus.

    Science.gov (United States)

    Lubys, A; Lubienè, J; Kulakauskas, S; Stankevicius, K; Timinskas, A; Janulaitis, A

    1996-07-15

    The genomic region encoding the type IIS restriction-modification (R-M) system HphI (enzymes recognizing the asymmetric sequence 5'-GGTGA-3'/5'-TCACC-3') from Haemophilus parahaemolyticus were cloned into Escherichia coli and sequenced. Sequence analysis of the R-M HphI system revealed three adjacent genes aligned in the same orientation: a cytosine 5 methyltransferase (gene hphIMC), an adenine N6 methyltransferase (hphIMA) and the HphI restriction endonuclease (gene hphIR). Either methyltransferase is capable of protecting plasmid DNA in vivo against the action of the cognate restriction endonuclease. hphIMA methylation renders plasmid DNA resistant to R.Hindill at overlapping sites, suggesting that the adenine methyltransferase modifies the 3'-terminal A residue on the GGTGA strand. Strong homology was found between the N-terminal part of the m6A methyltransferasease and an unidentified reading frame interrupted by an incomplete gaIE gene of Neisseria meningitidis. The HphI R-M genes are flanked by a copy of a 56 bp direct nucleotide repeat on each side. Similar sequences have also been identified in the non-coding regions of H.influenzae Rd DNA. Possible involvement of the repeat sequences in the mobility of the HphI R-M system is discussed.

  18. A plastome mutation affects processing of both chloroplast and nuclear DNA-encoded plastid proteins.

    Science.gov (United States)

    Johnson, E M; Schnabelrauch, L S; Sears, B B

    1991-01-01

    Immunoblotting of a chloroplast mutant (pm7) of Oenothera showed that three proteins, cytochrome f and the 23 kDa and 16 kDa subunits of the oxygen-evolving subcomplex of photosystem II, were larger than the corresponding mature proteins of the wild type and, thus, appear to be improperly processed in pm7. The mutant is also chlorotic and has little or no internal membrane development in the plastids. The improperly processed proteins, and other proteins that are completely missing, represent products of both the plastid and nuclear genomes. To test for linkage of these defects, a green revertant of pm7 was isolated from cultures in which the mutant plastids were maintained in a nuclear background homozygous for the plastome mutator (pm) gene. In this revertant, all proteins analyzed co-reverted to the wild-type condition, indicating that a single mutation in a plastome gene is responsible for the complex phenotype of pm7. These results suggest that the defect in pm7 lies in a gene that affects a processing protease encoded in the chloroplast genome.

  19. Identifying pathogenicity genes in the rubber tree anthracnose fungus Colletotrichum gloeosporioides through random insertional mutagenesis.

    Science.gov (United States)

    Cai, Zhiying; Li, Guohua; Lin, Chunhua; Shi, Tao; Zhai, Ligang; Chen, Yipeng; Huang, Guixiu

    2013-07-19

    To gain more insight into the molecular mechanisms of Colletotrichum gloeosporioides pathogenesis, Agrobacterium tumefaciens-mediated transformation (ATMT) was used to identify mutants of C. gloeosporioides impaired in pathogenicity. An ATMT library of 4128 C. gloeosporioides transformants was generated. Transformants were screened for defects in pathogenicity with a detached copper brown leaf assay. 32 mutants showing reproducible pathogenicity defects were obtained. Southern blot analysis showed 60.4% of the transformants had single-site T-DNA integrations. 16 Genomic sequences flanking T-DNA were recovered from mutants by thermal asymmetric interlaced PCR, and were used to isolate the tagged genes from the genome sequence of wild-type C. gloeosporioides by Basic Local Alignment Search Tool searches against the local genome database of the wild-type C. gloeosporioides. One potential pathogenicity genes encoded calcium-translocating P-type ATPase. Six potential pathogenicity genes had no known homologs in filamentous fungi and were likely to be novel fungal virulence factors. Two putative genes encoded Glycosyltransferase family 28 domain-containing protein and Mov34/MPN/PAD-1 family protein, respectively. Five potential pathogenicity genes had putative function matched with putative protein of other Colletotrichum species. Two known C. gloeosporioides pathogenicity genes were also identified, the encoding Glomerella cingulata hard-surface induced protein and C. gloeosporioides regulatory subunit of protein kinase A gene involved in cAMP-dependent PKA signal transduction pathway. Copyright © 2013 Elsevier GmbH. All rights reserved.

  20. Rice gene SDL/RNRS1, encoding the small subunit of ribonucleotide reductase, is required for chlorophyll synthesis and plant growth development.

    Science.gov (United States)

    Qin, Ran; Zeng, Dongdong; Liang, Rong; Yang, Chengcong; Akhter, Delara; Alamin, Md; Jin, Xiaoli; Shi, Chunhai

    2017-09-05

    A new mutant named sdl (stripe and drooping leaf) was characterized from indica cultivar Zhenong 34 by ethylmethane sulfonate (EMS) mutagenesis. The mutant sdl exhibited development defects including stripe and drooping leaf, dwarfism and deformed floral organs. The gene SDL was found allelic to RNRS1 by map-based cloning, which was homologous to Arabidopsis TSO2 encoding the small subunit of ribonucleotide reductase. The gDNA sequencing results of sdl in mutant showed that there was a repetitive sequence insertion of 138-bp at the 475 th bp in the exon. The redundant sequence was conserved in SDL homologous proteins, which contained the active site (tyrosine), as well as two amino acids glutamate and histidine involved in the binding of iron. There were fewer chloroplasts and grana lamellas in sdl leaf compared with those of wild-type. Additionally, the stripe leaves of sdl seedlings were highly sensitive to temperature, since the chlorophyll content was increased with the temperature rising. The drooping leaf of sdl might be resulted from the disappearance of vascular bundles and mesophyll cells in both leaf midrib and lateral veins. Fittingly to the phenotypes of mutant sdl, the expression levels of genes associated with photosynthesis and chlorophyll synthesis were found to be down- or up-regulated at different temperatures in mutant sdl. Also, the transcriptional levels of genes related to plant height and floral organ formation showed obvious differences between wild-type and sdl. The "SDL/RNRS1" was, hence, required for the chlorophyll biosynthesis and also played pleiotropic roles in the regulation of plant development. Copyright © 2017. Published by Elsevier B.V.

  1. A Herpes Simplex Virus Type 1 Mutant Expressing a Baculovirus Inhibitor of Apoptosis Gene in Place of Latency-Associated Transcript Has a Wild-Type Reactivation Phenotype in the Mouse

    Science.gov (United States)

    Jin, Ling; Perng, Guey-Chuen; Mott, Kevin R.; Osorio, Nelson; Naito, Julia; Brick, David J.; Carpenter, Dale; Jones, Clinton; Wechsler, Steven L.

    2005-01-01

    The latency-associated transcript (LAT) is essential for the wild-type herpes simplex virus type 1 (HSV-1) high-reactivation phenotype since LAT− mutants have a low-reactivation phenotype. We previously reported that LAT can decrease apoptosis and proposed that this activity is involved in LAT's ability to enhance the HSV-1 reactivation phenotype. The first 20% of the primary 8.3-kb LAT transcript is sufficient for enhancing the reactivation phenotype and for decreasing apoptosis, supporting this proposal. For this study, we constructed an HSV-1 LAT− mutant that expresses the baculovirus antiapoptosis gene product cpIAP under control of the LAT promoter and in place of the LAT region mentioned above. Mice were ocularly infected with this mutant, designated dLAT-cpIAP, and the reactivation phenotype was determined using the trigeminal ganglion explant model. dLAT-cpIAP had a reactivation phenotype similar to that of wild-type virus and significantly higher than that of (i) the LAT− mutant dLAT2903; (ii) dLAT1.5, a control virus containing the same LAT deletion as dLAT-cpIAP, but with no insertion of foreign DNA, thereby controlling for potential readthrough transcription past the cpIAP insert; and (iii) dLAT-EGFP, a control virus identical to dLAT-cpIAP except that it contained the enhanced green fluorescent protein open reading frame (ORF) in place of the cpIAP ORF, thereby controlling for expression of a random foreign gene instead of the cpIAP gene. These results show that an antiapoptosis gene with no sequence similarity to LAT can efficiently substitute for the LAT function involved in enhancing the in vitro-induced HSV-1 reactivation phenotype in the mouse. PMID:16160155

  2. Cloning of human genes encoding novel G protein-coupled receptors

    Energy Technology Data Exchange (ETDEWEB)

    Marchese, A.; Docherty, J.M.; Heiber, M. [Univ. of Toronto, (Canada)] [and others

    1994-10-01

    We report the isolation and characterization of several novel human genes encoding G protein-coupled receptors. Each of the receptors contained the familiar seven transmembrane topography and most closely resembled peptide binding receptors. Gene GPR1 encoded a receptor protein that is intronless in the coding region and that shared identity (43% in the transmembrane regions) with the opioid receptors. Northern blot analysis revealed that GPR1 transcripts were expressed in the human hippocampus, and the gene was localized to chromosome 15q21.6. Gene GPR2 encoded a protein that most closely resembled an interleukin-8 receptor (51% in the transmembrane regions), and this gene, not expressed in the six brain regions examined, was localized to chromosome 17q2.1-q21.3. A third gene, GPR3, showed identity (56% in the transmembrane regions) with a previously characterized cDNA clone from rat and was localized to chromosome 1p35-p36.1. 31 refs., 5 figs., 1 tab.

  3. Crop-to-wild gene flow and its fitness consequences for a wild fruit tree: Towards a comprehensive conservation strategy of the wild apple in Europe.

    Science.gov (United States)

    Feurtey, Alice; Cornille, Amandine; Shykoff, Jacqui A; Snirc, Alodie; Giraud, Tatiana

    2017-02-01

    Crop-to-wild gene flow can reduce the fitness and genetic integrity of wild species. Malus sylvestris , the European crab-apple fruit tree in particular, is threatened by the disappearance of its habitat and by gene flow from its domesticated relative , Malus domestica . With the aims of evaluating threats for M. sylvestris and of formulating recommendations for its conservation, we studied here, using microsatellite markers and growth experiments: (i) hybridization rates in seeds and trees from a French forest and in seeds used for replanting crab apples in agrosystems and in forests, (ii) the impact of the level of M. domestica ancestry on individual tree fitness and (iii) pollen dispersal abilities in relation to crop-to-wild gene flow. We found substantial contemporary crop-to-wild gene flow in crab-apple tree populations and superior fitness of hybrids compared to wild seeds and seedlings. Using paternity analyses, we showed that pollen dispersal could occur up to 4 km and decreased with tree density. The seed network furnishing the wild apple reintroduction agroforestry programmes was found to suffer from poor genetic diversity, introgressions and species misidentification. Overall, our findings indicate supported threats for the European wild apple steering us to provide precise recommendations for its conservation.

  4. Research on the ultrafast fluorescence property of thylakoid membranes of the wild-type and mutant rice

    Science.gov (United States)

    Ren, Zhao-Yu; Xu, Xiao-Ming; Wang, Shui-Cai; Xin, Yue-Yong; He, Jun-Fang; Hou, Xun

    2003-10-01

    A high yielding rice variety mutant (Oryza sativa L., Zhenhui 249) with low chlorophyll b (Chl b) has been discovered in natural fields. It has a quality character controlled by a pair of recessive genes (nuclear gene). The partial loss of Chl b in content affects the efficiency of light harvest in a light harvest complex (LHC), thus producing the difference of the exciting energy transfer and the efficiency of photochemistry conversion between the mutant and wild-type rice in photosynthetic unit. The efficiency of utilizing light energy is higher in the mutant than that in the wild-type rice relatively. For further discussion of the above-mentioned difference and learning about the mechanism of the increase in the photochemical efficiency of the mutant, the pico-second resolution fluorescence spectrum measurement with delay-frame-scanning single photon counting technique is adopted. Thylakoid membranes of the mutant and the wild-type rice are excited by an Ar+ laser with a pulse width of 120 ps, repetition rate of 4 MHz and wavelength of 514 nm. Compared with the time and spectrum property of exciting fluorescence, conclusions of those ultrafast dynamic experiments are: 1) The speeds of the exciting energy transferred in photo-system I are faster than that in photo-system II in both samples. 2) The speeds of the exciting energy transfer of mutant sample are faster than those of the wild-type. This might be one of the major reasons why the efficiency of photosynthesis is higher in mutant than that in the wild-type rice.

  5. Sequence variation in the alpha-toxin encoding plc gene of Clostridium perfringens strains isolated from diseased and healthy chickens

    DEFF Research Database (Denmark)

    Abildgaard, L; Engberg, RM; Pedersen, Karl

    2009-01-01

    The aim of the present study was to analyse the genetic diversity of the alpha-toxin encoding plc gene and the variation in a-toxin production of Clostridium perfringens type A strains isolated from presumably healthy chickens and chickens suffering from either necrotic enteritis (NE) or cholangio......-hepatitis. The a-toxin encoding plc genes from 60 different pulsed-field gel electrophoresis (PFGE) types (strains) of C perfringens were sequenced and translated in silico to amino acid sequences and the a-toxin production was investigated in batch cultures of 45 of the strains using an enzyme...

  6. The effect of UVB on flavonoid biosynthesis in wild type and mutant petunia and arabidopsis

    International Nuclear Information System (INIS)

    Ryan, K.G.; Swinny, E.E.; Markham, K.R.; Winefield, C.

    2000-01-01

    Full text: Flavonoids may protect plants against damage by UVB radiation. Flavonoid composition and mRNA expression were determined following growth of plants under natural light, and under natural light with low UVB and with enhanced UVB. In wild-type Arabidopsis and Petunia, UVB induced an increase in total levels of flavonols and this was due to an up-regulation of, several genes coding for key enzymes in the phenylpropanoid pathway. In addition, UVB induced a higher rate of production of the di-hydroxylated si flavonol, quercetin glycoside than of the mono-hydroxylated equivalent, of kaempferol glycoside. Thus the ratio of quercetin to kaempferol increased with UVB treatment in wild type plants, and this suggests that the flavonoid r 3'hydroxylase (F3'H) enzyme, which converts dihydrokaempferol to dihydroquercetin, may play a key role in plant protection from UVB. Mutant plants of both species lacking this F3'H gene were grown under similar UV conditions. Leaves of the mutant Arabidopsis plant (tt7) did not contain quercetin, even under the enhanced UVB treatment. Under the low UVB treatment the total amount of flavonol was similar to the wild-type (Ler), but with increasing UVB, total flavonol (i.e. kaempferol) levels were significantly higher than in similarly treated wild type plants. In the Petunia F3'H mutant, low levels of quercetin were found even in the low UVB treatment, which indicates this variety may be producing some quercetin via an alternative pathway. Under UVB radiation, total flavonoids increased to levels significantly higher than in similarly treated wild type plants, and most of this material was kaempferol. These observations suggest that quercetin is the preferred protective flavonol in wild type plants, due perhaps to enhanced antioxidant or free radical scavenging activity. In mutant plants lacking the F3'H enzyme, the response is to produce a larger amount of a less effective photoprotectant

  7. Herpes simplex virus type 1 gene UL14: phenotype of a null mutant and identification of the encoded protein.

    Science.gov (United States)

    Cunningham, C; Davison, A J; MacLean, A R; Taus, N S; Baines, J D

    2000-01-01

    Herpes simplex virus type 1 (HSV-1) gene UL14 is located between divergently transcribed genes UL13 and UL15 and overlaps the promoters for both of these genes. UL14 also exhibits a substantial overlap of its coding region with that of UL13. It is one of the few HSV-1 genes for which a phenotype and protein product have not been described. Using mass spectrometric and immunological approaches, we demonstrated that the UL14 protein is a minor component of the virion tegument of 32 kDa which is expressed late in infection. In infected cells, the UL14 protein was detected in the nucleus at discrete sites within electron-dense nuclear bodies and in the cytoplasm initially in a diffuse distribution and then at discrete sites. Some of the UL14 protein was phosphorylated. A mutant with a 4-bp deletion in the central region of UL14 failed to produce the UL14 protein and generated small plaques. The mutant exhibited an extended growth cycle at low multiplicity of infection and appeared to be compromised in efficient transit of virus particles from the infected cell. In mice injected intracranially, the 50% lethal dose of the mutant was reduced more than 30,000-fold. Recovery of the mutant from the latently infected sacral ganglia of mice injected peripherally was significantly less than that of wild-type virus, suggesting a marked defect in the establishment of, or reactivation from, latent infection.

  8. Ectopic expression of ubiquitin-conjugating enzyme gene from wild rice, OgUBC1, confers resistance against UV-B radiation and Botrytis infection in Arabidopsis thaliana

    International Nuclear Information System (INIS)

    Jeon, En Hee; Pak, Jung Hun; Kim, Mi Jin; Kim, Hye Jeong; Shin, Sang Hyun; Lee, Jai Heon; Kim, Doh Hoon; Oh, Ju Sung; Oh, Boung-Jun; Jung, Ho Won; Chung, Young Soo

    2012-01-01

    Highlights: ► We isolated a novel E2 ubiquitin-conjugating enzyme from leaves of wild rice plants. ► The OgUBC1 was highly expressed in leaves treated with SA and UV-B radiation. ► The recombinant OgUBC1 has an enzymatic activity of E2 in vitro. ► The OgUBC1 could protect disruption of plant cells by UV-B radiation. ► OgUBC1 confers disease resistance and UV-B tolerance in transgenic Arabidopsis plants. -- Abstract: A previously unidentified gene encoding ubiquitin-conjugating enzyme was isolated from leaves of wild rice plant treated with wounding and microbe-associated molecular patterns. The OgUBC1 gene was composed of 148 amino acids and contained a typical active site and 21 ubiquitin thioester intermediate interaction residues and 4 E3 interaction residues. Both exogenous application of salicylic acid and UV-B irradiation triggered expression of OgUBC1 in leaves of wild rice. Recombinant OgUBC1 proteins bound to ubiquitins in vitro, proposing that the protein might act as E2 enzyme in planta. Heterologous expression of the OgUBC1 in Arabidopsis thaliana protected plants from cellular damage caused by an excess of UV-B radiation. A stable expression of chalcone synthase gene was detected in leaves of OgUBC1-expressing Arabidopsis, resulting in producing higher amounts of anthocyanin than those in wild-type Col-0 plants. Additionally, both pathogenesis-related gene1 and 5 were transcribed in the transgenic Arabidopsis in the absence of pathogen infection. The OgUBC1-expressing plants were resistant to the infection of Botrytis cinerea. Taken together, we suggested that the OgUBC1 is involved in ubiquitination process important for cellular response against biotic and abiotic stresses in plants.

  9. Ectopic expression of ubiquitin-conjugating enzyme gene from wild rice, OgUBC1, confers resistance against UV-B radiation and Botrytis infection in Arabidopsis thaliana

    Energy Technology Data Exchange (ETDEWEB)

    Jeon, En Hee; Pak, Jung Hun; Kim, Mi Jin; Kim, Hye Jeong [Department of Genetic Engineering, Dong-A University, Busan 604-714 (Korea, Republic of); Shin, Sang Hyun [National Crop Experiment Station, Rural Development Administration, Suwon 441-100 (Korea, Republic of); Lee, Jai Heon; Kim, Doh Hoon; Oh, Ju Sung [Department of Genetic Engineering, Dong-A University, Busan 604-714 (Korea, Republic of); Oh, Boung-Jun [BioControl Center, Jeonnam 516-942 (Korea, Republic of); Jung, Ho Won, E-mail: hwjung@dau.ac.kr [Department of Genetic Engineering, Dong-A University, Busan 604-714 (Korea, Republic of); Chung, Young Soo, E-mail: chungys@dau.ac.kr [Department of Genetic Engineering, Dong-A University, Busan 604-714 (Korea, Republic of)

    2012-10-19

    Highlights: Black-Right-Pointing-Pointer We isolated a novel E2 ubiquitin-conjugating enzyme from leaves of wild rice plants. Black-Right-Pointing-Pointer The OgUBC1 was highly expressed in leaves treated with SA and UV-B radiation. Black-Right-Pointing-Pointer The recombinant OgUBC1 has an enzymatic activity of E2 in vitro. Black-Right-Pointing-Pointer The OgUBC1 could protect disruption of plant cells by UV-B radiation. Black-Right-Pointing-Pointer OgUBC1 confers disease resistance and UV-B tolerance in transgenic Arabidopsis plants. -- Abstract: A previously unidentified gene encoding ubiquitin-conjugating enzyme was isolated from leaves of wild rice plant treated with wounding and microbe-associated molecular patterns. The OgUBC1 gene was composed of 148 amino acids and contained a typical active site and 21 ubiquitin thioester intermediate interaction residues and 4 E3 interaction residues. Both exogenous application of salicylic acid and UV-B irradiation triggered expression of OgUBC1 in leaves of wild rice. Recombinant OgUBC1 proteins bound to ubiquitins in vitro, proposing that the protein might act as E2 enzyme in planta. Heterologous expression of the OgUBC1 in Arabidopsis thaliana protected plants from cellular damage caused by an excess of UV-B radiation. A stable expression of chalcone synthase gene was detected in leaves of OgUBC1-expressing Arabidopsis, resulting in producing higher amounts of anthocyanin than those in wild-type Col-0 plants. Additionally, both pathogenesis-related gene1 and 5 were transcribed in the transgenic Arabidopsis in the absence of pathogen infection. The OgUBC1-expressing plants were resistant to the infection of Botrytis cinerea. Taken together, we suggested that the OgUBC1 is involved in ubiquitination process important for cellular response against biotic and abiotic stresses in plants.

  10. Compositional and Functional Differences in the Human Gut Microbiome Correlate with Clinical Outcome following Infection with Wild-Type Salmonella enterica Serovar Typhi.

    Science.gov (United States)

    Zhang, Yan; Brady, Arthur; Jones, Cheron; Song, Yang; Darton, Thomas C; Jones, Claire; Blohmke, Christoph J; Pollard, Andrew J; Magder, Laurence S; Fasano, Alessio; Sztein, Marcelo B; Fraser, Claire M

    2018-05-08

    Insights into disease susceptibility as well as the efficacy of vaccines against typhoid and other enteric pathogens may be informed by better understanding the relationship between the effector immune response and the gut microbiota. In the present study, we characterized the composition (16S rRNA gene profiling) and function (RNA sequencing [RNA-seq]) of the gut microbiota following immunization and subsequent exposure to wild-type Salmonella enterica serovar Typhi in a human challenge model to further investigate the central hypothesis that clinical outcomes may be linked to the gut microbiota. Metatranscriptome analysis of longitudinal stool samples collected from study subjects revealed two stable patterns of gene expression for the human gut microbiota, dominated by transcripts from either Methanobrevibacter or a diverse representation of genera in the Firmicutes phylum. Immunization with one of two live oral attenuated vaccines against S.  Typhi had minimal effects on the composition or function of the gut microbiota. It was observed that subjects harboring the methanogen-dominated transcriptome community at baseline displayed a lower risk of developing symptoms of typhoid following challenge with wild-type S.  Typhi. Furthermore, genes encoding antioxidant proteins, metal homeostasis and transport proteins, and heat shock proteins were expressed at a higher level at baseline or after challenge with S.  Typhi in subjects who did not develop symptoms of typhoid. These data suggest that functional differences relating to redox potential and ion homeostasis in the gut microbiota may impact clinical outcomes following exposure to wild-type S.  Typhi. IMPORTANCE S.  Typhi is a significant cause of systemic febrile morbidity in settings with poor sanitation and limited access to clean water. It has been demonstrated that the human gut microbiota can influence mucosal immune responses, but there is little information available on the impact of the human gut

  11. Chemical and serologic definition of two unique D region-encoded molecules in the wild-derived mouse strain B10.GAA37.

    Science.gov (United States)

    Lillehoj, E P; Walsh, W D; Potter, T; Lee, D R; Coligan, J E; Hansen, T H

    1984-12-01

    Detailed serologic and biochemical characterization of D region products of the wild-derived mouse strain B10.GAA37 (Dw16) were performed and compared with previous studies of the D region products of the H-2d,b, and q haplotypes. Serologic analysis revealed that the antigens encoded by the Dw16 region express a unique combination of specificities defined by monoclonal antibodies (mAb) with established activity for the Ld and Dd molecules. Two out of five anti-Ld-reactive mAb reacted with B10.GAA37 cells, whereas one of three anti-Dd mAb showed B10.GAA37 reactivity. Sequential immunoprecipitation of B10.GAA37 antigens demonstrated the existence of at least two antigenically distinct molecules (designated Dw16 and Lw16) encoded by genes associated with the Dw16 region. Peptide map comparisons of the Dw16 and Lw16 molecules defined multiple differences in their primary protein structure, suggesting they are products of separate genes. Structural comparisons of the Lw16 and Dw16 molecules with the Ld and Dd molecules implied a) that the Dw16 and Dd regions did not result from a recent evolutionary divergence of a common primordial haplotype, and b) that the Lw16 and Dw16 molecules are more structurally homologous to each other than the Ld and Dd molecules are. Comparison of these findings with our previous studies of antigens encoded by the D regions suggest that each of these haplotypes has unique properties in terms of the number of gene products expressed and/or the structural relatedness of products of the same region.

  12. Genotyping assay for differentiation of wild-type and vaccine viruses in subjects immunized with live attenuated influenza vaccine.

    Directory of Open Access Journals (Sweden)

    Victoria Matyushenko

    Full Text Available Live attenuated influenza vaccines (LAIVs are considered as safe and effective tool to control influenza in different age groups, especially in young children. An important part of the LAIV safety evaluation is the detection of vaccine virus replication in the nasopharynx of the vaccinees, with special attention to a potential virus transmission to the unvaccinated close contacts. Conducting LAIV clinical trials in some geographical regions with year-round circulation of influenza viruses warrants the development of robust and reliable tools for differentiating vaccine viruses from wild-type influenza viruses in nasal pharyngeal wash (NPW specimens of vaccinated subjects. Here we report the development of genotyping assay for the detection of wild-type and vaccine-type influenza virus genes in NPW specimens of young children immunized with Russian-backbone seasonal trivalent LAIV using Sanger sequencing from newly designed universal primers. The new primer set allowed amplification and sequencing of short fragments of viral genes in NPW specimens and appeared to be more sensitive than conventional real-time RT-PCR protocols routinely used for the detection and typing/subtyping of influenza virus in humans. Furthermore, the new assay is capable of defining the origin of wild-type influenza virus through BLAST search with the generated sequences of viral genes fragments.

  13. Differential gene expression in porcine SK6 cells infected with wild-type and SAP domain-mutant foot-and-mouth disease virus.

    Science.gov (United States)

    Ni, Zixin; Yang, Fan; Cao, Weijun; Zhang, Xiangle; Jin, Ye; Mao, Ruoqing; Du, Xiaoli; Li, Weiwei; Guo, Jianhong; Liu, Xiangtao; Zhu, Zixiang; Zheng, Haixue

    2016-06-01

    Foot-and-mouth disease virus (FMDV) is the causative agent of a highly contagious disease in livestock. The viral proteinase L(pro) of FMDV is involved in pathogenicity, and mutation of the L(pro) SAP domain reduces FMDV pathogenicity in pigs. To determine the gene expression profiles associated with decreased pathogenicity in porcine cells, we performed transcriptome analysis using next-generation sequencing technology and compared differentially expressed genes in SK6 cells infected with FMDV containing L(pro) with either a wild-type or mutated version of the SAP domain. This analysis yielded 1,853 genes that exhibited a ≥ 2-fold change in expression and was validated by real-time quantitative PCR detection of several differentially expressed genes. Many of the differentially expressed genes correlated with antiviral responses corresponded to genes associated with transcription factors, immune regulation, cytokine production, inflammatory response, and apoptosis. Alterations in gene expression profiles may be responsible for the variations in pathogenicity observed between the two FMDV variants. Our results provided genes of interest for the further study of antiviral pathways and pathogenic mechanisms related to FMDV L(pro).

  14. Genome-wide identification of structural variants in genes encoding drug targets

    DEFF Research Database (Denmark)

    Rasmussen, Henrik Berg; Dahmcke, Christina Mackeprang

    2012-01-01

    The objective of the present study was to identify structural variants of drug target-encoding genes on a genome-wide scale. We also aimed at identifying drugs that are potentially amenable for individualization of treatments based on knowledge about structural variation in the genes encoding...

  15. The Arabidopsis thaliana REDUCED EPIDERMAL FLUORESCENCE1 gene encodes an aldehyde dehydrogenase involved in ferulic acid and sinapic acid biosynthesis.

    Science.gov (United States)

    Nair, Ramesh B; Bastress, Kristen L; Ruegger, Max O; Denault, Jeff W; Chapple, Clint

    2004-02-01

    Recent research has significantly advanced our understanding of the phenylpropanoid pathway but has left in doubt the pathway by which sinapic acid is synthesized in plants. The reduced epidermal fluorescence1 (ref1) mutant of Arabidopsis thaliana accumulates only 10 to 30% of the sinapate esters found in wild-type plants. Positional cloning of the REF1 gene revealed that it encodes an aldehyde dehydrogenase, a member of a large class of NADP(+)-dependent enzymes that catalyze the oxidation of aldehydes to their corresponding carboxylic acids. Consistent with this finding, extracts of ref1 leaves exhibit low sinapaldehyde dehydrogenase activity. These data indicate that REF1 encodes a sinapaldehyde dehydrogenase required for sinapic acid and sinapate ester biosynthesis. When expressed in Escherichia coli, REF1 was found to exhibit both sinapaldehyde and coniferaldehyde dehydrogenase activity, and further phenotypic analysis of ref1 mutant plants showed that they contain less cell wall-esterified ferulic acid. These findings suggest that both ferulic acid and sinapic acid are derived, at least in part, through oxidation of coniferaldehyde and sinapaldehyde. This route is directly opposite to the traditional representation of phenylpropanoid metabolism in which hydroxycinnamic acids are instead precursors of their corresponding aldehydes.

  16. Differential induction of Toll-like receptors & type 1 interferons by Sabin attenuated & wild type 1 polioviruses in human neuronal cells.

    Science.gov (United States)

    Mohanty, Madhu C; Deshpande, Jagadish M

    2013-01-01

    Polioviruses are the causative agent of paralytic poliomyelitis. Attenuated polioviruses (Sabin oral poliovirus vaccine strains) do not replicate efficiently in neurons as compared to the wild type polioviruses and therefore do not cause disease. This study was aimed to investigate the differential host immune response to wild type 1 poliovirus (wild PV) and Sabin attenuated type 1 poliovirus (Sabin PV) in cultured human neuronal cells. By using flow cytometry and real time PCR methods we examined host innate immune responses and compared the role of toll like receptors (TLRs) and cytoplasmic RNA helicases in cultured human neuronal cells (SK-N-SH) infected with Sabin PV and wild PV. Human neuronal cells expressed very low levels of TLRs constitutively. Sabin PV infection induced significantly higher expression of TLR3, TLR7 and melanoma differentiation-associated protein-5 (MDA-5) m-RNA in neuronal cells at the beginning of infection (up to 4 h) as compared to wild PV. Further, Sabin PV also induced the expression of interferon α/β at early time point of infection. The induced expression of IFN α/β gene by Sabin PV in neuronal cells could be suppressed by inhibiting TLR7. Neuronal cell innate immune response to Sabin and wild polioviruses differ significantly for TLR3, TLR7, MDA5 and type 1 interferons. Effects of TLR7 activation and interferon production and Sabin virus replication in neuronal cells need to be actively investigated in future studies.

  17. Minor Threonine Dehydratase Encoded Within the Threonine Synthetic Region of Bacillus subtilis1

    Science.gov (United States)

    Vapnek, Daniel; Greer, Sheldon

    1971-01-01

    Challenging auxotrophs on metabolites that are precursors of a biosynthetic step involving a mutated enzyme has revealed a new class of suppressor mutations which act by derepressing a minor enzyme activity not normally detected in the wild-type strain. These indirect, partial suppressor mutations which allow isoleucine auxotrophs to grow on homoserine or threonine have been analyzed to determine their effect on enzymes involved in the biosynthesis of these amino acids. It has been found that one class of these suppressor mutations (sprA) leads to the derepression of homoserine kinase, homoserine dehydrogenase, and a minor threonine dehydratase that is not sufficiently active to be detected in the wild-type strain. The gene encoding this second threonine dehydratase activity has been found to be located between the structural genes for homoserine kinase and homoserine dehydrogenase. The results of these experiments indicate that plating of auxotrophs on precursors of a biosynthetic step involving mutated enzymes could prove to be a valuable method for the detection of regulatory mutants as well as a possible tool in studying the evolution of biochemical pathways. PMID:4997544

  18. Antimicrobial resistance and virulence genes in enterococci from wild game meat in Spain.

    Science.gov (United States)

    Guerrero-Ramos, Emilia; Cordero, Jorge; Molina-González, Diana; Poeta, Patrícia; Igrejas, Gilberto; Alonso-Calleja, Carlos; Capita, Rosa

    2016-02-01

    A total of 55 enterococci (45 Enterococcus faecium, 7 Enterococcus faecalis, and three Enterococcus durans) isolated from the meat of wild game animals (roe deer, boar, rabbit, pheasant, and pigeon) in North-Western Spain were tested for susceptibility to 14 antimicrobials by the disc diffusion method. All strains showed a multi-resistant phenotype (resistance to between three and 10 antimicrobials). The strains exhibited high percentages of resistance to erythromycin (89.1%), tetracycline (67.3%), ciprofloxacin (92.7%), nitrofurantoin (67.3%), and quinupristin-dalfopristin (81.8%). The lowest values (9.1%) were observed for high-level resistance to gentamicin, kanamycin, and streptomycin. The average number of resistances per strain was 5.8 for E. faecium isolates, 7.9 for E. faecalis, and 5.7 for E. durans. Genes encoding antimicrobial resistance and virulence were studied by polymerase chain reaction. A total of 15 (57.7%) of the 26 vancomycin-resistant isolates harboured the vanA gene. Other resistance genes detected included vanB, erm(B) and/or erm(C), tet(L) and/or tet(M), acc(6')-aph(2″), and aph(3')-IIIa in strains resistant to vancomycin, erythromycin, tetracycline, gentamicin, and kanamycin, respectively. Specific genes of the Tn5397 transposon were detected in 54.8% of the tet(M)-positive enterococci. Nine virulence factors (gelE, agg, ace, cpd, frs, esp, hyl, efaAfs and efaAfm) were studied. All virulence genes, with the exception of the frs gene, were found to be present in the enterococcal isolates. At least one virulence gene was detected in 20.0% of E. faecium, 71.4% of E. faecalis and 33.3% of E. durans isolates, with ace and cpd being the most frequently detected genes (6 isolates each). This suggests that wild game meat might play a role in the spreading through the food chain of enterococci with antimicrobial resistance and virulence determinants to humans. Copyright © 2015 Elsevier Ltd. All rights reserved.

  19. Exploratory biomarker analysis for treatment response in KRAS wild type metastatic colorectal cancer patients who received cetuximab plus irinotecan

    International Nuclear Information System (INIS)

    Kim, Seung Tae; Ahn, Tae Jin; Lee, Eunjin; Do, In-Gu; Lee, Su Jin; Park, Se Hoon; Park, Joon Oh; Park, Young Suk; Lim, Ho Yeong; Kang, Won Ki; Kim, Suk Hyeong; Lee, Jeeyun; Kim, Hee Cheol

    2015-01-01

    More than half of the patients selected based on KRAS mutation status fail to respond to the treatment with cetuximab in metastatic colorectal cancer (mCRC). We designed a study to identify additional biomarkers that could act as indicators for cetuximab treatment in mCRC. We investigated 58 tumor samples from wild type KRAS CRC patients treated with cetuximab plus irinotecan (CI). We conducted the genotyping for mutations in either BRAF or PIK3CA and profiled comprehensively the expression of 522 kinase genes. BRAF mutation was detected in 5.1 % (3/58) of patients. All 50 patients showed wild type PIK3CA. Gene expression patterns that categorized patients with or without the disease control to CI were compared by supervised classification analysis. PSKH1, TLK2 and PHKG2 were overexpressed significantly in patients with the disease control to IC. The higher expression value of PSKH1 (r = 0.462, p < 0.001) and TLK2 (r = 0.361, p = 0.005) had the significant correlation to prolonged PFS. The result of this work demonstrated that expression nature of kinase genes such as PSKH1, TLK2 and PHKG2 may be informative to predict the efficacy of CI in wild type KRAS CRC. Mutations in either BRAF or PIK3CA were rare subsets in wild type KRAS CRC

  20. GABA metabolism pathway genes, UGA1 and GAD1, regulate replicative lifespan in Saccharomycescerevisiae

    Energy Technology Data Exchange (ETDEWEB)

    Kamei, Yuka; Tamura, Takayuki [Department of Bioscience, Faculty of Bioscience, Nagahama Institute of Bio-Science and Technology, 1266 Tamura, Nagahama, Shiga 526-0829 (Japan); Yoshida, Ryo [Department of Biotechnology, Graduate School of Engineering, Osaka University, 2-1 Yamadaoka, Suita, Osaka 565-0871 (Japan); Ohta, Shinji [Department of Bioscience, Faculty of Bioscience, Nagahama Institute of Bio-Science and Technology, 1266 Tamura, Nagahama, Shiga 526-0829 (Japan); Fukusaki, Eiichiro [Department of Biotechnology, Graduate School of Engineering, Osaka University, 2-1 Yamadaoka, Suita, Osaka 565-0871 (Japan); Mukai, Yukio, E-mail: y_mukai@nagahama-i-bio.ac.jp [Department of Bioscience, Faculty of Bioscience, Nagahama Institute of Bio-Science and Technology, 1266 Tamura, Nagahama, Shiga 526-0829 (Japan)

    2011-04-01

    Highlights: {yields}We demonstrate that two genes in the yeast GABA metabolism pathway affect aging. {yields} Deletion of the UGA1 or GAD1 genes extends replicative lifespan. {yields} Addition of GABA to wild-type cultures has no effect on lifespan. {yields} Intracellular GABA levels do not differ in longevity mutants and wild-type cells. {yields} Levels of tricarboxylic acid cycle intermediates positively correlate with lifespan. -- Abstract: Many of the genes involved in aging have been identified in organisms ranging from yeast to human. Our previous study showed that deletion of the UGA3 gene-which encodes a zinc-finger transcription factor necessary for {gamma}-aminobutyric acid (GABA)-dependent induction of the UGA1 (GABA aminotransferase), UGA2 (succinate semialdehyde dehydrogenase), and UGA4 (GABA permease) genes-extends replicative lifespan in the budding yeast Saccharomycescerevisiae. Here, we found that deletion of UGA1 lengthened the lifespan, as did deletion of UGA3; in contrast, strains with UGA2 or UGA4 deletions exhibited no lifespan extension. The {Delta}uga1 strain cannot deaminate GABA to succinate semialdehyde. Deletion of GAD1, which encodes the glutamate decarboxylase that converts glutamate into GABA, also increased lifespan. Therefore, two genes in the GABA metabolism pathway, UGA1 and GAD1, were identified as aging genes. Unexpectedly, intracellular GABA levels in mutant cells (except for {Delta}uga2 cells) did not differ from those in wild-type cells. Addition of GABA to culture media, which induces transcription of the UGA structural genes, had no effect on replicative lifespan of wild-type cells. Multivariate analysis of {sup 1}H nuclear magnetic resonance spectra for the whole-cell metabolite levels demonstrated a separation between long-lived and normal-lived strains. Gas chromatography-mass spectrometry analysis of identified metabolites showed that levels of tricarboxylic acid cycle intermediates positively correlated with lifespan

  1. GABA metabolism pathway genes, UGA1 and GAD1, regulate replicative lifespan in Saccharomycescerevisiae

    International Nuclear Information System (INIS)

    Kamei, Yuka; Tamura, Takayuki; Yoshida, Ryo; Ohta, Shinji; Fukusaki, Eiichiro; Mukai, Yukio

    2011-01-01

    Highlights: →We demonstrate that two genes in the yeast GABA metabolism pathway affect aging. → Deletion of the UGA1 or GAD1 genes extends replicative lifespan. → Addition of GABA to wild-type cultures has no effect on lifespan. → Intracellular GABA levels do not differ in longevity mutants and wild-type cells. → Levels of tricarboxylic acid cycle intermediates positively correlate with lifespan. -- Abstract: Many of the genes involved in aging have been identified in organisms ranging from yeast to human. Our previous study showed that deletion of the UGA3 gene-which encodes a zinc-finger transcription factor necessary for γ-aminobutyric acid (GABA)-dependent induction of the UGA1 (GABA aminotransferase), UGA2 (succinate semialdehyde dehydrogenase), and UGA4 (GABA permease) genes-extends replicative lifespan in the budding yeast Saccharomycescerevisiae. Here, we found that deletion of UGA1 lengthened the lifespan, as did deletion of UGA3; in contrast, strains with UGA2 or UGA4 deletions exhibited no lifespan extension. The Δuga1 strain cannot deaminate GABA to succinate semialdehyde. Deletion of GAD1, which encodes the glutamate decarboxylase that converts glutamate into GABA, also increased lifespan. Therefore, two genes in the GABA metabolism pathway, UGA1 and GAD1, were identified as aging genes. Unexpectedly, intracellular GABA levels in mutant cells (except for Δuga2 cells) did not differ from those in wild-type cells. Addition of GABA to culture media, which induces transcription of the UGA structural genes, had no effect on replicative lifespan of wild-type cells. Multivariate analysis of 1 H nuclear magnetic resonance spectra for the whole-cell metabolite levels demonstrated a separation between long-lived and normal-lived strains. Gas chromatography-mass spectrometry analysis of identified metabolites showed that levels of tricarboxylic acid cycle intermediates positively correlated with lifespan extension. These results strongly suggest

  2. The pbrB gene encodes a laccase required for DHN-melanin synthesis in conidia of Talaromyces (Penicillium) marneffei.

    Science.gov (United States)

    Sapmak, Ariya; Boyce, Kylie J; Andrianopoulos, Alex; Vanittanakom, Nongnuch

    2015-01-01

    Talaromyces marneffei (Basionym: Penicillium marneffei) is a significant opportunistic fungal pathogen in patients infected with human immunodeficiency virus in Southeast Asia. T. marneffei cells have been shown to become melanized in vivo. Melanins are pigment biopolymers which act as a non-specific protectant against various stressors and which play an important role during virulence in fungi. The synthesis of the two most commonly found melanins in fungi, the eumelanin DOPA-melanin and the allomelanin DHN-melanin, requires the action of laccase enzymes. The T. marneffei genome encodes a number of laccases and this study describes the characterization of one of these, pbrB, during growth and development. A strain carrying a PbrB-GFP fusion shows that pbrB is expressed at high levels during asexual development (conidiation) but not in cells growing vegetatively. The pbrB gene is required for the synthesis of DHN-melanin in conidia and when deleted results in brown pigmented conidia, in contrast to the green conidia of the wild type.

  3. Expression of paralogous SEP-, FUL-, AG- and STK-like MADS-box genes in wild-type and peloric Phalaenopsis flowers.

    Directory of Open Access Journals (Sweden)

    Roberta eAcri-Nunes-Miranda

    2014-03-01

    Full Text Available The diverse flowers of Orchidaceae are the result of several major morphological transitions, among them the most studied is the differentiation of the inner median tepal into the labellum, a perianth organ key in pollinator attraction. Type A peloria lacking stamens and with ectopic labella in place of inner lateral tepals are useful for testing models on the genes specifying these organs by comparing their patterns of expression between wild-type and peloric flowers. Previous studies focused on DEFICIENS and GLOBOSA-like MADS-box genes because of their conserved role in perianth and stamen development. The ‘orchid code’ model summarizes this work and shows in Orchidaceae there are four paralogous lineages of DEFICIENS/AP3-like genes differentially expressed in each floral whorl. Experimental tests of this model showed the conserved, higher expression of genes from two specific DEF-like gene lineages is associated with labellum development. The present study tests whether eight MADS-box candidate SEP-, FUL-, AG- and STK-like genes have been specifically duplicated in the Orchidaceae and are also differentially expressed in association with the distinct flower organs of Phalaenopsis hyb. Athens. The gene trees indicate orchid-specific duplications. In a way analogous to what is observed in labellum-specific DEF-like genes, a two-fold increase in the expression of SEP3-like gene PhaMADS7 was measured in the labellum-like inner lateral tepals of peloric flowers. The overlap between SEP3-like and DEF-like genes suggests both are associated with labellum specification and similar positional cues determine their domains of expression. In contrast, the uniform messenger levels of FUL-like genes suggest they are involved in the development of all organs and their expression in the ovary suggests cell differentiation starts before pollination. As previously reported AG-like and STK-like are exclusively expressed in gynostemium and ovary, however no

  4. Cloning and characterization of the gene encoding IMP dehydrogenase from Arabidopsis thaliana.

    Science.gov (United States)

    Collart, F R; Osipiuk, J; Trent, J; Olsen, G J; Huberman, E

    1996-10-03

    We have cloned and characterized the gene encoding inosine monophosphate dehydrogenase (IMPDH) from Arabidopsis thaliana (At). The transcription unit of the At gene spans approximately 1900 bp and specifies a protein of 503 amino acids with a calculated relative molecular mass (M(r)) of 54,190. The gene is comprised of a minimum of four introns and five exons with all donor and acceptor splice sequences conforming to previously proposed consensus sequences. The deduced IMPDH amino-acid sequence from At shows a remarkable similarity to other eukaryotic IMPDH sequences, with a 48% identity to human Type II enzyme. Allowing for conservative substitutions, the enzyme is 69% similar to human Type II IMPDH. The putative active-site sequence of At IMPDH conforms to the IMP dehydrogenase/guanosine monophosphate reductase motif and contains an essential active-site cysteine residue.

  5. [Abnormal floral meristem development in transgenic tomato plants do not depend on the expression of genes encoding defense-related PR-proteins and antimicrobial peptides].

    Science.gov (United States)

    Khaliluev, M R; Chaban, I A; Kononenko, N V; Baranova, E N; Dolgov, S V; Kharchenko, P N; Poliakov, V Iu

    2014-01-01

    In this study, the morphological and cytoembryological analyses of the tomato plants transformed with the genes encoding chitin-binding proteins (ac and RS-intron-Shir) from Amaranthus caudatus L. andA. retroflexus L., respectively, as well as the gene amp2 encoding hevein-like antimicrobial peptides from Stellaria media L., have been performed. The transgenic lines were adapted to soil and grown the greenhouse. The analysis of putative transgenic tomato plants revealed several lines that did not differ phenotypically from the wild type plants and three lines with disruption in differentiation of the inflorescence shoot and the flower, as well as the fruit formation (modified plants of each line were transformed with a single gene as noted before). Abnormalities in the development of the generative organs were maintained for at least six vegetative generations. These transgenic plants were shown to be defective in the mail gametophyte formation, fertilization, and, consequently, led to parthenocarpic fruits. The detailed analysis of growing ovules in the abnormal transgenic plants showed that the replacement tissue was formed and proliferated instead of unfertilized embryo sac. The structure of the replacement tissue differed from both embryonic and endosperm tissue of the normal ovule. The formation of the replacement tissue occurred due to continuing proliferation of the endothelial cells that lost their ability for differentiation. The final step in the development of the replacement tissue was its death, which resulted in the cell lysis. The expression of the genes used was confirmed by RT-PCR in all three lines with abnormal phenotype, as well as in several lines that did not phenotypically differ from the untransformed control. This suggests that abnormalities in the organs of the generative sphere in the transgenic plants do not depend on the expression of the foreign genes that were introduced in the tomato genome. Here, we argue that agrobacterial

  6. Wild type measles virus attenuation independent of type I IFN

    Directory of Open Access Journals (Sweden)

    Horvat Branka

    2008-02-01

    Full Text Available Abstract Background Measles virus attenuation has been historically performed by adaptation to cell culture. The current dogma is that attenuated virus strains induce more type I IFN and are more resistant to IFN-induced protection than wild type (wt. Results The adaptation of a measles virus isolate (G954-PBL by 13 passages in Vero cells induced a strong attenuation of this strain in vivo. The adapted virus (G954-V13 differs from its parental strain by only 5 amino acids (4 in P/V/C and 1 in the M gene. While a vaccine strain, Edmonston Zagreb, could replicate equally well in various primate cells, both G954 strains exhibited restriction to the specific cell type used initially for their propagation. Surprisingly, we observed that both G954 strains induced type I IFN, the wt strain inducing even more than the attenuated ones, particularly in human plasmacytoid Dendritic Cells. Type I IFN-induced protection from the infection of both G954 strains depended on the cell type analyzed, being less efficient in the cells used to grow the viral strain. Conclusion Thus, mutations in M and P/V/C proteins can critically affect MV pathogenicity, cellular tropism and lead to virus attenuation without interfering with the α/β IFN system.

  7. HFE gene mutations and Wilson's disease in Sardinia.

    Science.gov (United States)

    Sorbello, Orazio; Sini, Margherita; Civolani, Alberto; Demelia, Luigi

    2010-03-01

    Hypocaeruloplasminaemia can lead to tissue iron storage in Wilson's disease and the possibility of iron overload in long-term overtreated patients should be considered. The HFE gene encodes a protein that is intimately involved in intestinal iron absorption. The aim of this study was to determine the prevalence of the HFE gene mutation, its role in iron metabolism of Wilson's disease patients and the interplay of therapy in copper and iron homeostasis. The records of 32 patients with Wilson's disease were reviewed for iron and copper indices, HFE gene mutations and liver biopsy. Twenty-six patients were negative for HFE gene mutations and did not present significant alterations of iron metabolism. The HFE mutation was significantly associated with increased hepatic iron content (PHFE gene wild-type. The HFE gene mutations may be an addictional factor in iron overload in Wilson's disease. Our results showed that an adjustment of dosage of drugs could prevent further iron overload induced by overtreatment only in patients HFE wild-type. 2009. Published by Elsevier Ltd.

  8. The correlation between the use of personal protective equipment and level wild-type p53 of dental technicians in Surabaya

    Directory of Open Access Journals (Sweden)

    Puspa Dila Rohmaniar

    2017-03-01

    Full Text Available Background: Exposure of metals among dental technicians that come from the working environment can lead to the formation reactive oxygen species (ROS. ROS can cause mutations in the p53 gene (p53. The mutation is transversion mutation GuanineThymine. p53 mutations can lead to low expression of the wild-type p53 protein (p53. Wild-type p53 involved in many biological processes such as regulation of genes involved in cell cycle, cell growth after DNA damage, and apoptosis. However, exposure to metals among dental technicians can be prevented through the use of personal protective equipment (PPE during work. Purpose: The purpose of this study was to analyze the correlation between the use of personal protective equipment to wild-type p53 protein levels among dental technicians in Surabaya. Method: This study was observational analytic with cross sectional approach. 40 samples were taken by random sampling. Data were retrieved through interviews and observations. Wild-type p53 was analyzed from saliva with indirect ELISA method. Analysis of data used Kolmogorov Smirnov normality test and a Pearson correlation test. Value significance was p<0.05 (95% confidence level. Result: There was a significant association between the use of personal protective equipment with wild-type p53 levels with p=0.002 Conclusion: The use PPE properly is positively correlated with the wild-type p53 protein levels of dental technicians in Surabaya.

  9. Transgenic modification of potato pectic polysaccharides also affects type and level of cell wall xyloglucan

    NARCIS (Netherlands)

    Huang, Jie Hong; Jiang, Rui; Kortstee, Anne; Dees, Dianka C.T.; Trindade, Luisa M.; Gruppen, Harry; Schols, Henk A.

    2017-01-01

    BACKGROUND: Genes encoding pectic enzymes were introduced into wild-type potato Karnico. Cell wall materials were extracted from Karnico and transgenic lines expressing β-galactosidase (β-Gal-14) or rhamnogalacturonan lyase (RGL-18). Pectic polysaccharides from the β-Gal-14 transgenic line exhibited

  10. Defects in rhizobial cyclic glucan and lipopolysaccharide synthesis alter legume gene expression during nodule development

    DEFF Research Database (Denmark)

    D'Antuono, Alejandra L; Ott, Thomas; Krusell, Lene

    2008-01-01

    cDNA array technology was used to compare transcriptome profiles of Lotus japonicus roots inoculated with a Mesorhizobium loti wild-type and two mutant strains affected in cyclic beta(1-2) glucan synthesis (cgs) and in lipopolysaccharide synthesis (lpsbeta2). Expression of genes associated...... with the development of a fully functional nodule was significantly affected in plants inoculated with the cgs mutant. Array results also revealed that induction of marker genes for nodule development was delayed when plants were inoculated with the lpsbeta2 mutant. Quantitative real-time reverse......-transcriptase polymerase chain reaction was used to quantify gene expression of a subset of genes involved in plant defense response, redox metabolism, or genes that encode for nodulins. The majority of the genes analyzed in this study were more highly expressed in roots inoculated with the wild type compared with those...

  11. Transcriptome analysis of trichothecene-induced gene expression in barley.

    Science.gov (United States)

    Boddu, Jayanand; Cho, Seungho; Muehlbauer, Gary J

    2007-11-01

    Fusarium head blight, caused primarily by Fusarium graminearum, is a major disease problem on barley (Hordeum vulgare L.). Trichothecene mycotoxins produced by the fungus during infection increase the aggressiveness of the fungus and promote infection in wheat (Triticum aestivum L.). Loss-of-function mutations in the TRI5 gene in F. graminearum result in the inability to synthesize trichothecenes and in reduced virulence on wheat. We examined the impact of pathogen-derived trichothecenes on virulence and the transcriptional differences in barley spikes infected with a trichothecene-producing wild-type strain and a loss-of-function tri5 trichothecene nonproducing mutant. Disease severity, fungal biomass, and floret necrosis and bleaching were reduced in spikes inoculated with the tri5 mutant strain compared with the wild-type strain, indicating that the inability to synthesize trichothecenes results in reduced virulence in barley. We detected 63 transcripts that were induced during trichothecene accumulation, including genes encoding putative trichothecene detoxification and transport proteins, ubiquitination-related proteins, programmed cell death-related proteins, transcription factors, and cytochrome P450s. We also detected 414 gene transcripts that were designated as basal defense response genes largely independent of trichothecene accumulation. Our results show that barley exhibits a specific response to trichothecene accumulation that can be separated from the basal defense response. We propose that barley responds to trichothecene accumulation by inducing at least two general responses. One response is the induction of genes encoding trichothecene detoxification and transport activities that may reduce the impact of trichothecenes. The other response is to induce genes encoding proteins associated with ubiquitination and cell death which may promote successful establishment of the disease.

  12. Identification of new developmentally regulated genes involved in Streptomyces coelicolor sporulation.

    Science.gov (United States)

    Salerno, Paola; Persson, Jessica; Bucca, Giselda; Laing, Emma; Ausmees, Nora; Smith, Colin P; Flärdh, Klas

    2013-12-05

    The sporulation of aerial hyphae of Streptomyces coelicolor is a complex developmental process. Only a limited number of the genes involved in this intriguing morphological differentiation programme are known, including some key regulatory genes. The aim of this study was to expand our knowledge of the gene repertoire involved in S. coelicolor sporulation. We report a DNA microarray-based investigation of developmentally controlled gene expression in S. coelicolor. By comparing global transcription patterns of the wild-type parent and two mutants lacking key regulators of aerial hyphal sporulation, we found a total of 114 genes that had significantly different expression in at least one of the two mutants compared to the wild-type during sporulation. A whiA mutant showed the largest effects on gene expression, while only a few genes were specifically affected by whiH mutation. Seven new sporulation loci were investigated in more detail with respect to expression patterns and mutant phenotypes. These included SCO7449-7451 that affect spore pigment biogenesis; SCO1773-1774 that encode an L-alanine dehydrogenase and a regulator-like protein and are required for maturation of spores; SCO3857 that encodes a protein highly similar to a nosiheptide resistance regulator and affects spore maturation; and four additional loci (SCO4421, SCO4157, SCO0934, SCO1195) that show developmental regulation but no overt mutant phenotype. Furthermore, we describe a new promoter-probe vector that takes advantage of the red fluorescent protein mCherry as a reporter of cell type-specific promoter activity. Aerial hyphal sporulation in S. coelicolor is a technically challenging process for global transcriptomic investigations since it occurs only as a small fraction of the colony biomass and is not highly synchronized. Here we show that by comparing a wild-type to mutants lacking regulators that are specifically affecting processes in aerial hypha, it is possible to identify previously

  13. Characterization of nifB, nifS, and nifU genes in the cyanobacterium Anabaena variabilis: NifB is required for the vanadium-dependent nitrogenase.

    OpenAIRE

    Lyons, E M; Thiel, T

    1995-01-01

    Anabaena variabilis ATCC 29413 is a heterotrophic, nitrogen-fixing cyanobacterium containing both a Mo-dependent nitrogenase encoded by the nif genes and V-dependent nitrogenase encoded by the vnf genes. The nifB, nifS, and nifU genes of A. variabilis were cloned, mapped, and partially sequenced. The fdxN gene was between nifB and nifS. Growth and acetylene reduction assays using wild-type and mutant strains indicated that the nifB product (NifB) was required for nitrogen fixation not only by...

  14. Differential induction of Toll-like receptors & type 1 interferons by Sabin attenuated & wild type 1 polioviruses in human neuronal cells

    Directory of Open Access Journals (Sweden)

    Madhu C Mohanty

    2013-01-01

    Full Text Available Background & objectives: Polioviruses are the causative agent of paralytic poliomyelitis. Attenuated polioviruses (Sabin oral poliovirus vaccine strains do not replicate efficiently in neurons as compared to the wild type polioviruses and therefore do not cause disease. This study was aimed to investigate the differential host immune response to wild type 1 poliovirus (wild PV and Sabin attenuated type 1 poliovirus (Sabin PV in cultured human neuronal cells. Methods: By using flow cytometry and real time PCR methods we examined host innate immune responses and compared the role of toll like receptors (TLRs and cytoplasmic RNA helicases in cultured human neuronal cells (SK-N-SH infected with Sabin PV and wild PV. Results: Human neuronal cells expressed very low levels of TLRs constitutively. Sabin PV infection induced significantly higher expression of TLR3, TLR7 and melanoma differentiation-associated protein-5 (MDA-5 m-RNA in neuronal cells at the beginning of infection (up to 4 h as compared to wild PV. Further, Sabin PV also induced the expression of interferon α/β at early time point of infection. The induced expression of IFN α/β gene by Sabin PV in neuronal cells could be suppressed by inhibiting TLR7. Interpretation & conclusions: Neuronal cell innate immune response to Sabin and wild polioviruses differ significantly for TLR3, TLR7, MDA5 and type 1 interferons. Effects of TLR7 activation and interferon production and Sabin virus replication in neuronal cells need to be actively investigated in future studies.

  15. Motif analysis unveils the possible co-regulation of chloroplast genes and nuclear genes encoding chloroplast proteins.

    Science.gov (United States)

    Wang, Ying; Ding, Jun; Daniell, Henry; Hu, Haiyan; Li, Xiaoman

    2012-09-01

    Chloroplasts play critical roles in land plant cells. Despite their importance and the availability of at least 200 sequenced chloroplast genomes, the number of known DNA regulatory sequences in chloroplast genomes are limited. In this paper, we designed computational methods to systematically study putative DNA regulatory sequences in intergenic regions near chloroplast genes in seven plant species and in promoter sequences of nuclear genes in Arabidopsis and rice. We found that -35/-10 elements alone cannot explain the transcriptional regulation of chloroplast genes. We also concluded that there are unlikely motifs shared by intergenic sequences of most of chloroplast genes, indicating that these genes are regulated differently. Finally and surprisingly, we found five conserved motifs, each of which occurs in no more than six chloroplast intergenic sequences, are significantly shared by promoters of nuclear-genes encoding chloroplast proteins. By integrating information from gene function annotation, protein subcellular localization analyses, protein-protein interaction data, and gene expression data, we further showed support of the functionality of these conserved motifs. Our study implies the existence of unknown nuclear-encoded transcription factors that regulate both chloroplast genes and nuclear genes encoding chloroplast protein, which sheds light on the understanding of the transcriptional regulation of chloroplast genes.

  16. Expression of paralogous SEP-, FUL-, AG- and STK-like MADS-box genes in wild-type and peloric Phalaenopsis flowers.

    Science.gov (United States)

    Acri-Nunes-Miranda, Roberta; Mondragón-Palomino, Mariana

    2014-01-01

    The diverse flowers of Orchidaceae are the result of several major morphological transitions, among them the most studied is the differentiation of the inner median tepal into the labellum, a perianth organ key in pollinator attraction. Type A peloria lacking stamens and with ectopic labella in place of inner lateral tepals are useful for testing models on the genes specifying these organs by comparing their patterns of expression between wild-type and peloric flowers. Previous studies focused on DEFICIENS- and GLOBOSA-like MADS-box genes because of their conserved role in perianth and stamen development. The "orchid code" model summarizes this work and shows in Orchidaceae there are four paralogous lineages of DEFICIENS/AP3-like genes differentially expressed in each floral whorl. Experimental tests of this model showed the conserved, higher expression of genes from two specific DEF-like gene lineages is associated with labellum development. The present study tests whether eight MADS-box candidate SEP-, FUL-, AG-, and STK-like genes have been specifically duplicated in the Orchidaceae and are also differentially expressed in association with the distinct flower organs of Phalaenopsis hyb. "Athens." The gene trees indicate orchid-specific duplications. In a way analogous to what is observed in labellum-specific DEF-like genes, a two-fold increase in the expression of SEP3-like gene PhaMADS7 was measured in the labellum-like inner lateral tepals of peloric flowers. The overlap between SEP3-like and DEF-like genes suggests both are associated with labellum specification and similar positional cues determine their domains of expression. In contrast, the uniform messenger levels of FUL-like genes suggest they are involved in the development of all organs and their expression in the ovary suggests cell differentiation starts before pollination. As previously reported AG-like and STK-like genes are exclusively expressed in gynostemium and ovary, however no evidence for

  17. A comparison of brain gene expression levels in domesticated and wild animals.

    Directory of Open Access Journals (Sweden)

    Frank W Albert

    2012-09-01

    Full Text Available Domestication has led to similar changes in morphology and behavior in several animal species, raising the question whether similarities between different domestication events also exist at the molecular level. We used mRNA sequencing to analyze genome-wide gene expression patterns in brain frontal cortex in three pairs of domesticated and wild species (dogs and wolves, pigs and wild boars, and domesticated and wild rabbits. We compared the expression differences with those between domesticated guinea pigs and a distant wild relative (Cavia aperea as well as between two lines of rats selected for tameness or aggression towards humans. There were few gene expression differences between domesticated and wild dogs, pigs, and rabbits (30-75 genes (less than 1% of expressed genes were differentially expressed, while guinea pigs and C. aperea differed more strongly. Almost no overlap was found between the genes with differential expression in the different domestication events. In addition, joint analyses of all domesticated and wild samples provided only suggestive evidence for the existence of a small group of genes that changed their expression in a similar fashion in different domesticated species. The most extreme of these shared expression changes include up-regulation in domesticates of SOX6 and PROM1, two modulators of brain development. There was almost no overlap between gene expression in domesticated animals and the tame and aggressive rats. However, two of the genes with the strongest expression differences between the rats (DLL3 and DHDH were located in a genomic region associated with tameness and aggression, suggesting a role in influencing tameness. In summary, the majority of brain gene expression changes in domesticated animals are specific to the given domestication event, suggesting that the causative variants of behavioral domestication traits may likewise be different.

  18. Gene flow among wild and domesticated almond species: insights from chloroplast and nuclear markers

    Science.gov (United States)

    Delplancke, Malou; Alvarez, Nadir; Espíndola, Anahí; Joly, Hélène; Benoit, Laure; Brouck, Elise; Arrigo, Nils

    2012-01-01

    Hybridization has played a central role in the evolutionary history of domesticated plants. Notably, several breeding programs relying on gene introgression from the wild compartment have been performed in fruit tree species within the genus Prunus but few studies investigated spontaneous gene flow among wild and domesticated Prunus species. Consequently, a comprehensive understanding of genetic relationships and levels of gene flow between domesticated and wild Prunus species is needed. Combining nuclear and chloroplastic microsatellites, we investigated the gene flow and hybridization among two key almond tree species, the cultivated Prunus dulcis and one of the most widespread wild relative Prunus orientalis in the Fertile Crescent. We detected high genetic diversity levels in both species along with substantial and symmetric gene flow between the domesticated P. dulcis and the wild P. orientalis. These results were discussed in light of the cultivated species diversity, by outlining the frequent spontaneous genetic contributions of wild species to the domesticated compartment. In addition, crop-to-wild gene flow suggests that ad hoc transgene containment strategies would be required if genetically modified cultivars were introduced in the northwestern Mediterranean. PMID:25568053

  19. Bioinformatics analysis and detection of gelatinase encoded gene in Lysinibacillussphaericus

    Science.gov (United States)

    Repin, Rul Aisyah Mat; Mutalib, Sahilah Abdul; Shahimi, Safiyyah; Khalid, Rozida Mohd.; Ayob, Mohd. Khan; Bakar, Mohd. Faizal Abu; Isa, Mohd Noor Mat

    2016-11-01

    In this study, we performed bioinformatics analysis toward genome sequence of Lysinibacillussphaericus (L. sphaericus) to determine gene encoded for gelatinase. L. sphaericus was isolated from soil and gelatinase species-specific bacterium to porcine and bovine gelatin. This bacterium offers the possibility of enzymes production which is specific to both species of meat, respectively. The main focus of this research is to identify the gelatinase encoded gene within the bacteria of L. Sphaericus using bioinformatics analysis of partially sequence genome. From the research study, three candidate gene were identified which was, gelatinase candidate gene 1 (P1), NODE_71_length_93919_cov_158.931839_21 which containing 1563 base pair (bp) in size with 520 amino acids sequence; Secondly, gelatinase candidate gene 2 (P2), NODE_23_length_52851_cov_190.061386_17 which containing 1776 bp in size with 591 amino acids sequence; and Thirdly, gelatinase candidate gene 3 (P3), NODE_106_length_32943_cov_169.147919_8 containing 1701 bp in size with 566 amino acids sequence. Three pairs of oligonucleotide primers were designed and namely as, F1, R1, F2, R2, F3 and R3 were targeted short sequences of cDNA by PCR. The amplicons were reliably results in 1563 bp in size for candidate gene P1 and 1701 bp in size for candidate gene P3. Therefore, the results of bioinformatics analysis of L. Sphaericus resulting in gene encoded gelatinase were identified.

  20. The capacity of Listeria monocytogenes mutants with in-frame deletions in putative ATP-binding cassette transporters to form biofilms and comparison with the wild type

    Directory of Open Access Journals (Sweden)

    Marina Ceruso

    2014-02-01

    Full Text Available Listeria monocytogenes (Lm is a food-borne pathogen responsible for human listeriosis, an invasive infection with high mortality rates. Lm has developed efficient strategies for survival under stress conditions such as starvation and wide variations in temperature, pH, and osmolarity. Therefore, Lm can survive in food under multiple stress conditions. Detailed studies to determine the mode of action of this pathogen for survival under stress conditions are important to control Lm in food. It has been shown that genes encoding for ATP-binding cassette (ABC transporters are induced in Lm in food, in particular under stress conditions. Previous studies showed that these genes are involved in sensitivity to nisin, acids, and salt. The aim of this study was to determine the involvement of some ABC transporters in biofilm formation. Therefore, deletion mutants of ABC transporter genes (LMOf2365_1875 and LMOf2365_1877 were created in Lm F2365, and then were compared to the wild type for their capacity to form biofilms. Lm strain F2365 was chosen as reference since the genome is fully sequenced and furthermore this strain is particularly involved in food-borne outbreaks of listeriosis. Our results showed that DLMOf2365_1875 had an increased capacity to form biofilms compared to the wild type, indicating that LMOf2365_1875 negatively regulates biofilm formation. A deeper knowledge on the ability to form biofilms in these mutants may help in the development of intervention strategies to control Lm in food and in the environment.

  1. Deletion of the Sm1 encoding motif in the lsm gene results in distinct changes in the transcriptome and enhanced swarming activity of Haloferax cells.

    Science.gov (United States)

    Maier, Lisa-Katharina; Benz, Juliane; Fischer, Susan; Alstetter, Martina; Jaschinski, Katharina; Hilker, Rolf; Becker, Anke; Allers, Thorsten; Soppa, Jörg; Marchfelder, Anita

    2015-10-01

    Members of the Sm protein family are important for the cellular RNA metabolism in all three domains of life. The family includes archaeal and eukaryotic Lsm proteins, eukaryotic Sm proteins and archaeal and bacterial Hfq proteins. While several studies concerning the bacterial and eukaryotic family members have been published, little is known about the archaeal Lsm proteins. Although structures for several archaeal Lsm proteins have been solved already more than ten years ago, we still do not know much about their biological function, however one can confidently propose that the archaeal Lsm proteins will also be involved in RNA metabolism. Therefore, we investigated this protein in the halophilic archaeon Haloferax volcanii. The Haloferax genome encodes a single Lsm protein, the lsm gene overlaps and is co-transcribed with the gene for the ribosomal L37.eR protein. Here, we show that the reading frame of the lsm gene contains a promoter which regulates expression of the overlapping rpl37R gene. This rpl37R specific promoter ensures high expression of the rpl37R gene in exponential growth phase. To investigate the biological function of the Lsm protein we generated a lsm deletion mutant that had the coding sequence for the Sm1 motif removed but still contained the internal promoter for the downstream rpl37R gene. The transcriptome of this deletion mutant was compared to the wild type transcriptome, revealing that several genes are down-regulated and many genes are up-regulated in the deletion strain. Northern blot analyses confirmed down-regulation of two genes. In addition, the deletion strain showed a gain of function in swarming, in congruence with the up-regulation of transcripts encoding proteins required for motility. Copyright © 2015 The Authors. Published by Elsevier B.V. All rights reserved.

  2. O6-methylguanine-DNA methyltransferase in wild-type and ada mutants of Escherichia coli

    International Nuclear Information System (INIS)

    Mitra, S.; Pal, B.C.; Foote, R.S.

    1982-01-01

    O 6 -Methylguanine-DNA methyltransferase is induced in Escherichia coli during growth in low levels of N-methyl-N'-nitro-N-nitrosoguanidine. We have developed a sensitive assay for quantitating low levels of this activity with a synthetic DNA substrate containing 3 H-labeled O 6 -methylguanine as the only modified base. Although both wild-type and adaptation-deficient (ada) mutants of E. coli contained low but comparable numbers (from 13 to 60) of the enzyme molecules per cell, adaptation treatment caused a significant increase of the enzyme in the wild type but not in the ada mutants, suggesting that the ada mutation is in a regulatory locus and not in the structural gene for the methyltransferase

  3. Fine mapping and characterization of BPH27, a brown planthopper resistance gene from wild rice (Oryza rufipogon Griff.).

    Science.gov (United States)

    Huang, D; Qiu, Y; Zhang, Y; Huang, F; Meng, J; Wei, S; Li, R; Chen, B

    2013-01-01

    The brown planthopper (Nilaparvata lugens Stål; BPH) is one of the most serious rice pests worldwide. Growing resistant varieties is the most effective way to manage this insect, and wild rice species are a valuable source of resistance genes for developing resistant cultivars. BPH27 derived from an accession of Guangxi wild rice, Oryza rufipogon Griff. (Accession no. 2183, hereafter named GX2183), was primarily mapped to a 17-cM region on the long arm of the chromosome four. In this study, fine mapping of BPH27 was conducted using two BC(1)F(2) populations derived from introgression lines of GX2183. Insect resistance was evaluated in the BC(1)F(2) populations with 6,010 individual offsprings, and 346 resistance extremes were obtained and employed for fine mapping of BPH27. High-resolution linkage analysis defined the BPH27 locus to an 86.3-kb region in Nipponbare. Regarding the sequence information of rice cultivars, Nipponbare and 93-11, all predicted open reading frames (ORFs) in the fine-mapping region have been annotated as 11 types of proteins, and three ORFs encode disease-related proteins. Moreover, the average BPH numbers showed significant differences in 96-120 h after release in comparisons between the preliminary near-isogenic lines (pre-NILs, lines harboring resistance genes) and BaiR54. BPH growth and development were inhibited and survival rates were lower in the pre-NIL plants compared with the recurrent parent BaiR54. The pre-NIL exhibited 50.7% reductions in population growth rates (PGR) compared to BaiR54. The new development in fine mapping of BPH27 will facilitate the efforts to clone this important resistant gene and to use it in BPH-resistance rice breeding.

  4. [High gene conversion frequency between genes encoding 2-deoxyglucose-6-phosphate phosphatase in 3 Saccharomyces species].

    Science.gov (United States)

    Piscopo, Sara-Pier; Drouin, Guy

    2014-05-01

    Gene conversions are nonreciprocal sequence exchanges between genes. They are relatively common in Saccharomyces cerevisiae, but few studies have investigated the evolutionary fate of gene conversions or their functional impacts. Here, we analyze the evolution and impact of gene conversions between the two genes encoding 2-deoxyglucose-6-phosphate phosphatase in S. cerevisiae, Saccharomyces paradoxus and Saccharomyces mikatae. Our results demonstrate that the last half of these genes are subject to gene conversions among these three species. The greater similarity and the greater percentage of GC nucleotides in the converted regions, as well as the absence of long regions of adjacent common converted sites, suggest that these gene conversions are frequent and occur independently in all three species. The high frequency of these conversions probably result from the fact that they have little impact on the protein sequences encoded by these genes.

  5. RNAi-based silencing of genes encoding the vacuolar- ATPase ...

    African Journals Online (AJOL)

    RNAi-based silencing of genes encoding the vacuolar- ATPase subunits a and c in pink bollworm (Pectinophora gossypiella). Ahmed M. A. Mohammed. Abstract. RNA interference is a post- transcriptional gene regulation mechanism that is predominantly found in eukaryotic organisms. RNAi demonstrated a successful ...

  6. Genetic variants in nuclear-encoded mitochondrial genes influence AIDS progression.

    Directory of Open Access Journals (Sweden)

    Sher L Hendrickson

    2010-09-01

    Full Text Available The human mitochondrial genome includes only 13 coding genes while nuclear-encoded genes account for 99% of proteins responsible for mitochondrial morphology, redox regulation, and energetics. Mitochondrial pathogenesis occurs in HIV patients and genetically, mitochondrial DNA haplogroups with presumed functional differences have been associated with differential AIDS progression.Here we explore whether single nucleotide polymorphisms (SNPs within 904 of the estimated 1,500 genes that specify nuclear-encoded mitochondrial proteins (NEMPs influence AIDS progression among HIV-1 infected patients. We examined NEMPs for association with the rate of AIDS progression using genotypes generated by an Affymetrix 6.0 genotyping array of 1,455 European American patients from five US AIDS cohorts. Successfully genotyped SNPs gave 50% or better haplotype coverage for 679 of known NEMP genes. With a Bonferroni adjustment for the number of genes and tests examined, multiple SNPs within two NEMP genes showed significant association with AIDS progression: acyl-CoA synthetase medium-chain family member 4 (ACSM4 on chromosome 12 and peroxisomal D3,D2-enoyl-CoA isomerase (PECI on chromosome 6.Our previous studies on mitochondrial DNA showed that European haplogroups with presumed functional differences were associated with AIDS progression and HAART mediated adverse events. The modest influences of nuclear-encoded mitochondrial genes found in the current study add support to the idea that mitochondrial function plays a role in AIDS pathogenesis.

  7. Gene flow and genetic diversity in cultivated and wild cacao (Theobroma cacao) in Bolivia.

    Science.gov (United States)

    Chumacero de Schawe, Claudia; Durka, Walter; Tscharntke, Teja; Hensen, Isabell; Kessler, Michael

    2013-11-01

    The role of pollen flow within and between cultivated and wild tropical crop species is little known. To study the pollen flow of cacao, we estimated the degree of self-pollination and pollen dispersal distances as well as gene flow between wild and cultivated cacao (Theobroma cacao L.). We studied pollen flow and genetic diversity of cultivated and wild cacao populations by genotyping 143 wild and 86 cultivated mature plants and 374 seedlings raised from 19 wild and 25 cultivated trees at nine microsatellite loci. A principal component analysis distinguished wild and cultivated cacao trees, supporting the notion that Bolivia harbors truly wild cacao populations. Cultivated cacao had a higher level of genetic diversity than wild cacao, presumably reflecting the varied origin of cultivated plants. Both cacao types had high outcrossing rates, but the paternity analysis revealed 7-14% self-pollination in wild and cultivated cacao. Despite the tiny size of the pollinators, pollen was transported distances up to 3 km; wild cacao showed longer distances (mean = 922 m) than cultivated cacao (826 m). Our data revealed that 16-20% of pollination events occurred between cultivated and wild populations. We found evidence of self-pollination in both wild and cultivated cacao. Pollination distances are larger than those typically reported in tropical understory tree species. The relatively high pollen exchange from cultivated to wild cacao compromises genetic identity of wild populations, calling for the protection of extensive natural forest tracts to protect wild cacao in Bolivia.

  8. Differential effects of silver nanoparticles on DNA damage and DNA repair gene expression in Ogg1-deficient and wild type mice.

    Science.gov (United States)

    Nallanthighal, Sameera; Chan, Cadia; Murray, Thomas M; Mosier, Aaron P; Cady, Nathaniel C; Reliene, Ramune

    2017-10-01

    Due to extensive use in consumer goods, it is important to understand the genotoxicity of silver nanoparticles (AgNPs) and identify susceptible populations. 8-Oxoguanine DNA glycosylase 1 (OGG1) excises 8-oxo-7,8-dihydro-2-deoxyguanine (8-oxoG), a pro-mutagenic lesion induced by oxidative stress. To understand whether defects in OGG1 is a possible genetic factor increasing an individual's susceptibly to AgNPs, we determined DNA damage, genome rearrangements, and expression of DNA repair genes in Ogg1-deficient and wild type mice exposed orally to 4 mg/kg of citrate-coated AgNPs over a period of 7 d. DNA damage was examined at 3 and 7 d of exposure and 7 and 14 d post-exposure. AgNPs induced 8-oxoG, double strand breaks (DSBs), chromosomal damage, and DNA deletions in both genotypes. However, 8-oxoG was induced earlier in Ogg1-deficient mice and 8-oxoG levels were higher after 7-d treatment and persisted longer after exposure termination. AgNPs downregulated DNA glycosylases Ogg1, Neil1, and Neil2 in wild type mice, but upregulated Myh, Neil1, and Neil2 glycosylases in Ogg1-deficient mice. Neil1 and Neil2 can repair 8-oxoG. Thus, AgNP-mediated downregulation of DNA glycosylases in wild type mice may contribute to genotoxicity, while upregulation thereof in Ogg1-deficient mice could serve as an adaptive response to AgNP-induced DNA damage. However, our data show that Ogg1 is indispensable for the efficient repair of AgNP-induced damage. In summary, citrate-coated AgNPs are genotoxic in both genotypes and Ogg1 deficiency exacerbates the effect. These data suggest that humans with genetic polymorphisms and mutations in OGG1 may have increased susceptibility to AgNP-mediated DNA damage.

  9. Molecular evolution of the Paramyxoviridae and Rhabdoviridae multiple-protein-encoding P gene.

    Science.gov (United States)

    Jordan, I K; Sutter, B A; McClure, M A

    2000-01-01

    Presented here is an analysis of the molecular evolutionary dynamics of the P gene among 76 representative sequences of the Paramyxoviridae and Rhabdoviridae RNA virus families. In a number of Paramyxoviridae taxa, as well as in vesicular stomatitis viruses of the Rhabdoviridae, the P gene encodes multiple proteins from a single genomic RNA sequence. These products include the phosphoprotein (P), as well as the C and V proteins. The complexity of the P gene makes it an intriguing locus to study from an evolutionary perspective. Amino acid sequence alignments of the proteins encoded at the P and N loci were used in independent phylogenetic reconstructions of the Paramyxoviridae and Rhabdoviridae families. P-gene-coding capacities were mapped onto the Paramyxoviridae phylogeny, and the most parsimonious path of multiple-coding-capacity evolution was determined. Levels of amino acid variation for Paramyxoviridae and Rhabdoviridae P-gene-encoded products were also analyzed. Proteins encoded in overlapping reading frames from the same nucleotides have different levels of amino acid variation. The nucleotide architecture that underlies the amino acid variation was determined in order to evaluate the role of selection in the evolution of the P gene overlapping reading frames. In every case, the evolution of one of the proteins encoded in the overlapping reading frames has been constrained by negative selection while the other has evolved more rapidly. The integrity of the overlapping reading frame that represents a derived state is generally maintained at the expense of the ancestral reading frame encoded by the same nucleotides. The evolution of such multicoding sequences is likely a response by RNA viruses to selective pressure to maximize genomic information content while maintaining small genome size. The ability to evolve such a complex genomic strategy is intimately related to the dynamics of the viral quasispecies, which allow enhanced exploration of the adaptive

  10. Over-expression of zmarg encoding an arginase improves grain production in maize

    International Nuclear Information System (INIS)

    Hong, D.; Tian, Y.; Meng, X.; Zhang, P.

    2016-01-01

    Arginase, as one of the three key enzymes in nitrogen catabolism, the physiological role of Arg catabolism in cereal crops has not been fully clarified. Studies have shown that arginase-encoding genes play a key role in providing nitrogen to developing seedlings in many plant species.Yield is a primary trait in many crop breeding programs, which can be increased by modification of genes related to photosynthesis, nitrogen assimilation, carbon distribution, plant architecture, and transcriptional networks controlling plant development. In the present study, a maize arginase gene ZmARG was cloned and introduced into maize inbred lines by Agrobacterium tumefaciens- mediated transformation. Putative transgenic plants were confirmed by PCR, Southern blotting RT-PCR analysis. The expression of the ZmARG gene increased arginase activity in several tissues in transgenic lines. Transgenic maize plants had significantly higher ear weight and 100-seed weight as compared with wild-type control. Our results suggested that ZmARG was a potential target gene for crop yield improvement. (author)

  11. glpx Gene in Mycobacterium tuberculosis Is Required for In Vitro Gluconeogenic Growth and In Vivo Survival.

    Directory of Open Access Journals (Sweden)

    Hiten J Gutka

    Full Text Available Several enzymes involved in central carbon metabolism and gluconeogenesis play a critical role in survival and pathogenesis of Mycobacterium tuberculosis (Mtb. The only known functional fructose 1,6-bisphosphatase (FBPase in Mtb is encoded by the glpX gene and belongs to the Class II sub-family of FBPase. We describe herein the generation of a ΔglpX strain using homologous recombination. Although the growth profile of ΔglpX is comparable to that of wild type Mtb when grown on the standard enrichment media, its growth is dysgonic with individual gluconeogenic substrates such as oleic acid, glycerol and acetate. In mice lung CFU titers of ΔglpX were 2-3 log10 lower than the wild-type Mtb strain. The results indicate that glpX gene encodes a functional FBPase and is essential for both in vitro and in vivo growth and survival of Mtb. Loss of glpX results in significant reduction of FBPase activity but not complete abolition. These findings verify that the glpX encoded FBPase II in Mtb can be a potential target for drug discovery.

  12. Comparison of genome engineering using the CRISPR-Cas9 system in C. glabrata wild-type and lig4 strains.

    Science.gov (United States)

    Cen, Yuke; Timmermans, Bea; Souffriau, Ben; Thevelein, Johan M; Van Dijck, Patrick

    2017-10-01

    Candida glabrata is reported as the second most prevalent human opportunistic fungal pathogen in North America and is threatening patients all over the world. Its incidence is rising, while it has developed resistance to the most widely used antifungal drugs, necessitating new approaches based on better insight into the biology of the organism. Despite its close phylogenetic relationship with Saccharomyces cerevisiae, generating precise genomic alterations in this species is problematic. Previously we have shown that deletion of LIG4, which encodes an enzyme involved in Non-Homologous End Joining (NHEJ), strongly enhances the probability of obtaining correctly modified transformants. In this work we used the Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) and CRISPR associated protein 9 (Cas9) system to genetically engineer the C. glabrata genome, targeting the genes ADE2, MET15 and SOK2, located on different chromosomes. We used the CRISPR-Cas9 technology to replace the open reading frame (ORF) by the SAT1 selective marker or introduced a premature stop codon in ADE2 and MET15, as they are easily scored by their adenine or methionine auxotrophy, respectively. The SOK2 gene was modified by insertion of a triple HA-tag sequence and the transformants were verified in a western blot. The CRISPR-Cas9 mediated targeting efficiency varies depending on the gene targeted and the genetic modification performed. We show that CRISPR-Cas9 mediated genome editing is more efficient than the conventional method in the wild-type strain, moreover it has the big advantage being marker-free. In previous work, we showed that the targeting efficiency is highly increased in the lig4Δ strain using the conventional way to delete genes in C. glabrata. Using the CRISPR-Cas9 system in this strain, the percentage of correct transformants is consistently higher compared to the wild-type strain. This indicates that using the lig4 mutant as such is already a strong

  13. A highly divergent gene cluster in honey bees encodes a novel silk family.

    Science.gov (United States)

    Sutherland, Tara D; Campbell, Peter M; Weisman, Sarah; Trueman, Holly E; Sriskantha, Alagacone; Wanjura, Wolfgang J; Haritos, Victoria S

    2006-11-01

    The pupal cocoon of the domesticated silk moth Bombyx mori is the best known and most extensively studied insect silk. It is not widely known that Apis mellifera larvae also produce silk. We have used a combination of genomic and proteomic techniques to identify four honey bee fiber genes (AmelFibroin1-4) and two silk-associated genes (AmelSA1 and 2). The four fiber genes are small, comprise a single exon each, and are clustered on a short genomic region where the open reading frames are GC-rich amid low GC intergenic regions. The genes encode similar proteins that are highly helical and predicted to form unusually tight coiled coils. Despite the similarity in size, structure, and composition of the encoded proteins, the genes have low primary sequence identity. We propose that the four fiber genes have arisen from gene duplication events but have subsequently diverged significantly. The silk-associated genes encode proteins likely to act as a glue (AmelSA1) and involved in silk processing (AmelSA2). Although the silks of honey bees and silkmoths both originate in larval labial glands, the silk proteins are completely different in their primary, secondary, and tertiary structures as well as the genomic arrangement of the genes encoding them. This implies independent evolutionary origins for these functionally related proteins.

  14. Expression of wild-type and mutant medium-chain acyl-CoA dehydrogenase (MCAD) cDNA in eucaryotic cells

    DEFF Research Database (Denmark)

    Jensen, T G; Andresen, B S; Bross, P

    1992-01-01

    An effective EBV-based expression system for eucaryotic cells has been developed and used for the study of the mitochondrial enzyme medium-chain acyl-CoA dehydrogenase (MCAD). 1325 bp of PCR-generated MCAD cDNA, containing the entire coding region, was placed between the SV40 early promoter...... and polyadenylation signals in the EBV-based vector. Both wild-type MCAD cDNA and cDNA containing the prevalent disease-causing mutation A to G at position 985 of the MCAD cDNA were tested. In transfected COS-7 cells, the steady state amount of mutant MCAD protein was consistently lower than the amount of wild......-type human enzyme. The enzyme activity in extracts from cells harbouring the wild-type MCAD cDNA was dramatically higher than in the controls (harbouring the vector without the MCAD gene) while only a slightly higher activity was measured with the mutant MCAD. The mutant MCAD present behaves like wild...

  15. Interleukin-1 receptor type I gene-deficient mice are less susceptible to Staphylococcus epidermidis biomaterial-associated infection than are wild-type mice

    NARCIS (Netherlands)

    Boelens, J. J.; van der Poll, T.; Zaat, S. A.; Murk, J. L.; Weening, J. J.; Dankert, J.

    2000-01-01

    Elevated concentrations of interleukin-1 (IL-1) were found in tissue surrounding biomaterials infected with Staphylococcus epidermidis. To determine the role of IL-1 in biomaterial-associated infection (BAI), IL-1 receptor type I-deficient (IL-1R(-/-)) and wild-type mice received subcutaneous

  16. Many Saccharomyces cerevisiae Cell Wall Protein Encoding Genes Are Coregulated by Mss11, but Cellular Adhesion Phenotypes Appear Only Flo Protein Dependent.

    Science.gov (United States)

    Bester, Michael C; Jacobson, Dan; Bauer, Florian F

    2012-01-01

    The outer cell wall of the yeast Saccharomyces cerevisiae serves as the interface with the surrounding environment and directly affects cell-cell and cell-surface interactions. Many of these interactions are facilitated by specific adhesins that belong to the Flo protein family. Flo mannoproteins have been implicated in phenotypes such as flocculation, substrate adhesion, biofilm formation, and pseudohyphal growth. Genetic data strongly suggest that individual Flo proteins are responsible for many specific cellular adhesion phenotypes. However, it remains unclear whether such phenotypes are determined solely by the nature of the expressed FLO genes or rather as the result of a combination of FLO gene expression and other cell wall properties and cell wall proteins. Mss11 has been shown to be a central element of FLO1 and FLO11 gene regulation and acts together with the cAMP-PKA-dependent transcription factor Flo8. Here we use genome-wide transcription analysis to identify genes that are directly or indirectly regulated by Mss11. Interestingly, many of these genes encode cell wall mannoproteins, in particular, members of the TIR and DAN families. To examine whether these genes play a role in the adhesion properties associated with Mss11 expression, we assessed deletion mutants of these genes in wild-type and flo11Δ genetic backgrounds. This analysis shows that only FLO genes, in particular FLO1/10/11, appear to significantly impact on such phenotypes. Thus adhesion-related phenotypes are primarily dependent on the balance of FLO gene expression.

  17. Computational fitness landscape for all gene-order permutations of an RNA virus.

    Directory of Open Access Journals (Sweden)

    Kwang-il Lim

    2009-02-01

    Full Text Available How does the growth of a virus depend on the linear arrangement of genes in its genome? Answering this question may enhance our basic understanding of virus evolution and advance applications of viruses as live attenuated vaccines, gene-therapy vectors, or anti-tumor therapeutics. We used a mathematical model for vesicular stomatitis virus (VSV, a prototype RNA virus that encodes five genes (N-P-M-G-L, to simulate the intracellular growth of all 120 possible gene-order variants. Simulated yields of virus infection varied by 6,000-fold and were found to be most sensitive to gene-order permutations that increased levels of the L gene transcript or reduced levels of the N gene transcript, the lowest and highest expressed genes of the wild-type virus, respectively. Effects of gene order on virus growth also depended upon the host-cell environment, reflecting different resources for protein synthesis and different cell susceptibilities to infection. Moreover, by computationally deleting intergenic attenuations, which define a key mechanism of transcriptional regulation in VSV, the variation in growth associated with the 120 gene-order variants was drastically narrowed from 6,000- to 20-fold, and many variants produced higher progeny yields than wild-type. These results suggest that regulation by intergenic attenuation preceded or co-evolved with the fixation of the wild type gene order in the evolution of VSV. In summary, our models have begun to reveal how gene functions, gene regulation, and genomic organization of viruses interact with their host environments to define processes of viral growth and evolution.

  18. A novel homozygous no-stop mutation in G6PC gene from a Chinese patient with glycogen storage disease type Ia.

    Science.gov (United States)

    Gu, Lei-Lei; Li, Xin-Hua; Han, Yue; Zhang, Dong-Hua; Gong, Qi-Ming; Zhang, Xin-Xin

    2014-02-25

    Glycogen storage disease type Ia (GSD-Ia) is an autosomal recessive genetic disorder resulting in hypoglycemia, hepatomegaly and growth retardation. It is caused by mutations in the G6PC gene encoding Glucose-6-phosphatase. To date, over 80 mutations have been identified in the G6PC gene. Here we reported a novel mutation found in a Chinese patient with abnormal transaminases, hypoglycemia, hepatomegaly and short stature. Direct sequencing of the coding region and splicing-sites in the G6PC gene revealed a novel no-stop mutation, p.*358Yext*43, leading to a 43 amino-acid extension of G6Pase. The expression level of mutant G6Pase transcripts was only 7.8% relative to wild-type transcripts. This mutation was not found in 120 chromosomes from 60 unrelated healthy control subjects using direct sequencing, and was further confirmed by digestion with Rsa I restriction endonuclease. In conclusion, we revealed a novel no-stop mutation in this study which expands the spectrum of mutations in the G6PC gene. The molecular genetic analysis was indispensable to the diagnosis of GSD-Ia for the patient. Copyright © 2013 Elsevier B.V. All rights reserved.

  19. Genetic analysis of the porcine group B rotavirus NSP2 gene from wild-type Brazilian strains

    Directory of Open Access Journals (Sweden)

    K.C. Médici

    2010-01-01

    Full Text Available Group B rotaviruses (RV-B were first identified in piglet feces, being later associated with diarrhea in humans, cattle, lambs, and rats. In human beings, the virus was only described in China, India, and Bangladesh, especially infecting adults. Only a few studies concerning molecular analysis of the RV-B NSP2 gene have been conducted, and porcine RV-B has not been characterized. In the present study, three porcine wild-type RV-B strains from piglet stool samples collected from Brazilian pig herds were used for analysis. PAGE results were inconclusive for those samples, but specific amplicons of the RV-B NSP2 gene (segment 8 were obtained in a semi-nested PCR assay. The three porcine RV-B strains showed the highest nucleotide identity with the human WH1 strain and the alignments with other published sequences resulted in three groups of strains divided according to host species. The group of human strains showed 92.4 to 99.7% nucleotide identity while the porcine strains of the Brazilian RV-B group showed 90.4 to 91.8% identity to each other. The identity of the Brazilian porcine RV-B strains with outer sequences consisting of group A and C rotaviruses was only 35.3 to 38.8%. A dendrogram was also constructed to group the strains into clusters according to host species: human, rat, and a distinct third cluster consisting exclusively of the Brazilian porcine RV-B strains. This is the first study of the porcine RV-B NSP2 gene that contributes to the partial characterization of this virus and demonstrates the relationship among RV-B strains from different host species.

  20. Two Genes Encoding Uracil Phosphoribosyltransferase Are Present in Bacillus subtilis

    DEFF Research Database (Denmark)

    Martinussen, Jan; Glaser, Philippe; Andersen, Paal S.

    1995-01-01

    Uracil phosphoribosyltransferase (UPRTase) catalyzes the key reaction in the salvage of uracil in many microorganisms. Surprisingly, two genes encoding UPRTase activity were cloned from Bacillus subtilis by complementation of an Escherichia coli mutant. The genes were sequenced, and the putative...

  1. Virulence properties of methicillin-susceptible Staphylococcus aureus food isolates encoding Panton-Valentine Leukocidin gene.

    Science.gov (United States)

    Sudagidan, Mert; Aydin, Ali

    2010-04-15

    In this study, three Panton-Valentine Leukocidin gene carrying methicillin-susceptible Staphylococcus aureus (MSSA) strains (M1-AAG42B, PY30C-b and YF1B-b) were isolated from different food samples in Kesan-Edirne, Turkey. These strains were characterized on the basis of MLST type, spa type, virulence factor gene contents, antibiotic susceptibilities against 21 antibiotics and biofilm formation. The genetic relatedness of the strains was determined by PFGE. In addition, the complete gene sequences of lukS-PV and lukF-PV were also investigated. All strains were found to be susceptible to tested antibiotics and they were mecA negative. Three strains showed the same PFGE band pattern, ST152 clonal type and t355 spa type. In the detection of virulence factor genes, sea, seb, sec, sed, see, seg, seh, sei, sej, sek, sel, sem, sen, seo, sep, seq, seu, eta, etb, set1, geh and tst genes were not detected. All strains showed the positive results for alpha- and beta-haemolysin genes (hla and hlb), protease encoding genes (sspA, sspB and aur), lukE and lukD leukocidin genes (lukED). The strains were found to be non-biofilm formers. By this study, the virulence properties of the strains were described and this is one of the first reports regarding PVL-positive MSSA strains from food. (c) 2010 Elsevier B.V. All rights reserved.

  2. Escherichia coli rpiA gene encoding ribose phosphate isomerase A

    DEFF Research Database (Denmark)

    Hove-Jensen, Bjarne; Maigaard, Marianne

    1993-01-01

    The rpiA gene encoding ribose phosphate isomerase A was cloned from phage 1A2(471) of the Kohara gene library. Subcloning, restriction, and complementation analyses revealed an 1,800-bp SspI-generated DNA fragment that contained the entire control and coding sequences. This DNA fragment was seque......The rpiA gene encoding ribose phosphate isomerase A was cloned from phage 1A2(471) of the Kohara gene library. Subcloning, restriction, and complementation analyses revealed an 1,800-bp SspI-generated DNA fragment that contained the entire control and coding sequences. This DNA fragment...

  3. Effects of deoxycycline induced lentivirus encoding FasL gene on ...

    African Journals Online (AJOL)

    Abstract. Fas/Fas ligand (FasL)-mediated apoptosis plays a critical role in deletion of activated T cells. This study aimed to construct the lentivirus encoding FasL gene induced by deoxycycline and evaluate its effects on apoptosis of Th1 cells. A plasmid expression system encoding FasL was constructed through utilizing the ...

  4. Impact of the Disruption of ASN3-Encoding Asparagine Synthetase on Arabidopsis Development

    Directory of Open Access Journals (Sweden)

    Laure Gaufichon

    2016-02-01

    Full Text Available The aim of this study was to investigate the role of ASN3-encoded asparagine synthetase (AS, EC 6.3.5.4 during vegetative growth, seed development and germination of Arabidopsis thaliana. Phenotypic analysis of knockout (asn3-1 and knockdown (asn3-2 T-DNA insertion mutants for the ASN3 gene (At5g10240 demonstrated wild-type contents of asparagine synthetase protein, chlorophyll and ammonium in green leaves at 35 days after sowing. In situ hybridization localized ASN3 mRNA to phloem companion cells of vasculature. Young siliques of the asn3-1 knockout line showed a decrease in asparagine but an increase in glutamate. The seeds of asn3-1 and asn3-2 displayed a wild-type nitrogen status expressed as total nitrogen content, indicating that the repression of ASN3 expression had only a limited effect on mature seeds. An analysis of amino acid labeling of seeds imbibed with (15N ammonium for 24 h revealed that asn3-1 seeds contained 20% less total asparagine while 15N-labeled asparagine ((2-15Nasparagine, (4-15Nasparagine and (2,4-15Nasparagine increased by 12% compared to wild-type seeds. The data indicate a fine regulation of asparagine synthesis and hydrolysis in Arabidopsis seeds.

  5. The Arabidopsis histone chaperone FACT is required for stress-induced expression of anthocyanin biosynthetic genes.

    Science.gov (United States)

    Pfab, Alexander; Breindl, Matthias; Grasser, Klaus D

    2018-03-01

    The histone chaperone FACT is involved in the expression of genes encoding anthocyanin biosynthetic enzymes also upon induction by moderate high-light and therefore contributes to the stress-induced plant pigmentation. The histone chaperone FACT consists of the SSRP1 and SPT16 proteins and associates with transcribing RNAPII (RNAPII) along the transcribed region of genes. FACT can promote transcriptional elongation by destabilising nucleosomes in the path of RNA polymerase II, thereby facilitating efficient transcription of chromatin templates. Transcript profiling of Arabidopsis plants depleted in SSRP1 or SPT16 demonstrates that only a small subset of genes is differentially expressed relative to wild type. The majority of these genes is either up- or down-regulated in both the ssrp1 and spt16 plants. Among the down-regulated genes, those encoding enzymes of the biosynthetic pathway of the plant secondary metabolites termed anthocyanins (but not regulators of the pathway) are overrepresented. Upon exposure to moderate high-light stress several of these genes are up-regulated to a lesser extent in ssrp1/spt16 compared to wild type plants, and accordingly the mutant plants accumulate lower amounts of anthocyanin pigments. Moreover, the expression of SSRP1 and SPT16 is induced under these conditions. Therefore, our findings indicate that FACT is a novel factor required for the accumulation of anthocyanins in response to light-induction.

  6. Cloning and knockout of formate hydrogen lyase and H{sub 2}-uptake hydrogenase genes in Enterobacter aerogenes for enhanced hydrogen production

    Energy Technology Data Exchange (ETDEWEB)

    Zhao, Hongxin; Ma, Kun; Lu, Yuan; Zhang, Chong; Wang, Liyan; Xing, Xin-Hui [Institute of Biochemical Engineering, Department of Chemical Engineering, Tsinghua University, Tsinghua Yuan, Beijing 100084 (China)

    2009-01-15

    A 5431-bp DNA fragment partially encoding the formate hydrogen lyase (FHL) gene cluster hycABCDE was isolated and identified from Enterobacter aerogenes IAM1183 chromosomal DNA. All the five putative gene products showed a high degree of homology to the reported bacterial FHL proteins. The gene hycA, encoding the FHL repressor protein, and hybO, encoding the small subunit of the uptake hydrogenase, were targeted for genetic knockout for improving the hydrogen production. The pYM-Red recombination system was adopted to form insertional mutations in the E. aerogenes genome, thereby creating mutant strains of IAM1183-A ({delta} hycA), IAM1183-O ({delta} hybO), and IAM1183-AO ({delta} hycA/ {delta} hybO double knockout). The hydrogen production experiments with these mutants showed that the maximum specific hydrogen productivities of IAM1183-A, IAM1183-O, and IAM1183-AO were 2879.466 {+-} 38.59, 2747.203 {+-} 13.25 and 3372.019 {+-} 4.39 (ml h{sup -1} g{sup -1}dry cell weight), respectively, higher than that of the wild strain (2321.861 {+-} 15.34 ml h{sup -1} g{sup -1}dry cell weight). The total H{sub 2} yields by the three mutants IAM1183-A, IAM1183-O and IAM1183-AO were 0.73, 0.78, and 0.83 mol-H{sub 2}/mol glucose, respectively, while the wild-type IAM1183 was only 0.65 mol-H{sub 2}/mol glucose. The metabolites of the mutants including acetate, ethanol, 2,3-butanediol and succinate were all increased compared with that of the wild type, implying the changed metabolic flux by the mutation. In the fermentor cultivation with IAM1183 {delta} hycA/ {delta} hybO, the total hydrogen volume after 16 h cultivation reached 4.4 L, while that for the wild type was only 2.9 L. (author)

  7. Exogenous wild type p53 gene affects radiosensitivity of human lung adenocarcinoma cell line under hypoxia

    International Nuclear Information System (INIS)

    Wang Jianhua; Wang Feng; Liu Yongping; Zhang Yaping; Ni Yan; Li Shirong

    2008-01-01

    Objective: To evaluate the effect of exogenous wild type p53 (wtp53) gene on radiosensitivity of human lung adenocarcinoma cell line under hypoxia. Methods: Human lung adenocarcinoma cell line A549 was transfected with adenovirus carrying recombinant exogenous wtp53. Four irradiation groups were studied: normal cell (Group A), wtp53 transfected cell (Group B), normal cell under hypoxia (Group C) and wtp53 transfected cell under hypoxia(Group D). Cells were irradiated with 9 MeV electron beams. Cellular survival fraction was analyzed. Multi-target single-hit model was used to plot the survival curve. D 0 , D q , oxygen enhancement ratio (OER), sensitizing enhancement ratio (SER) and other parameters were used to evaluate the effects of wtp53 gene on radiosensitivity of A549. The cell apoptotic rate of each group was examined by flow cytometry. Results: OER was 1.75 and 0.81 before and after wtp53 transfection. SER was 1.77 in oxic circumstance and 3.84 under hypoxia. The cell apoptotic rate of Group A and B was lower than Group C and D (F=7.92, P=0.048), with Group A lower than B and Group C lower than D (F=82.50, P=0.001). But Group B and D were similar(t=2.04, P=0.111). Conclusions: Hypoxia can increase the radiation resistance of lung adenocarcinoma cell line A549. The wtp53 can promote apoptosis and improve tumor radiosensitivity, especially under hypoxia. (authors)

  8. Arabidopsis VARIEGATED 3 encodes a chloroplasttargeted, zinc-finger protein required for chloroplast and palisade cell development

    DEFF Research Database (Denmark)

    Næsted, Henrik; Holm, A.; Jenkins, T.

    2004-01-01

    The stable, recessive Arabidopsis variegated 3 (var3) mutant exhibits a variegated phenotype due to somatic areas lacking or containing developmentally retarded chloroplasts and greatly reduced numbers of palisade cells. The VAR3 gene, isolated by transposon tagging, encodes the 85.9 kDa VAR3...... that pigment profiles are qualitatively similar in wild type and var3, although var3 accumulates lower levels of chlorophylls and carotenoids. These results indicate that VAR3 is a part of a protein complex required for normal chloroplast and palisade cell development....

  9. Genetic variability and evolutionary implications of RNA silencing suppressor genes in RNA1 of sweet potato chlorotic stunt virus isolates infecting sweetpotato and related wild species.

    Directory of Open Access Journals (Sweden)

    Arthur K Tugume

    Full Text Available BACKGROUND: The bipartite single-stranded RNA genome of Sweet potato chlorotic stunt virus (SPCSV, genus Crinivirus; Closteroviridae encodes a Class 1 RNase III (RNase3, a putative hydrophobic protein (p7 and a 22-kDa protein (p22 from genes located in RNA1. RNase3 and p22 suppress RNA silencing, the basal antiviral defence mechanism in plants. RNase3 is sufficient to render sweetpotato (Ipomoea batatas virus-susceptible and predisposes it to development of severe diseases following infection with unrelated virus. The incidence, strains and gene content of SPCSV infecting wild plant species have not been studied. METHODOLOGY/PRINCIPAL FINDINGS: Thirty SPCSV isolates were characterized from 10 wild Ipomoea species, Hewittia sublobata or Lepistemon owariensis (family Convolvulaceae in Uganda and compared with 34 local SPCSV isolates infecting sweetpotatoes. All isolates belonged to the East African (EA strain of SPCSV and contained RNase3 and p7, but p22 was not detected in six isolates. The three genes showed only limited genetic variability and the proteins were under purifying selection. SPCSV isolates lacking p22 synergized with Sweet potato feathery mottle virus (SPFMV, genus potyvirus; Potyviridae and caused severe symptoms in co-infected sweetpotato plants. One SPCSV isolate enhanced accumulation of SPFMV, but no severe symptoms developed. A new whitefly-transmitted virus (KML33b encoding an RNase3 homolog (<56% identity to SPCSV RNase3 able to suppresses sense-mediated RNA silencing was detected in I. sinensis. CONCLUSIONS/SIGNIFICANCE: SPCSV isolates infecting wild species and sweetpotato in Uganda were genetically undifferentiated, suggesting inter-species transmission of SPCSV. Most isolates in Uganda contained p22, unlike SPCSV isolates characterized from other countries and continents. Enhanced accumulation of SPFMV and increased disease severity were found to be uncoupled phenotypic outcomes of RNase3-mediated viral synergism in

  10. Transfer of engineered genes from crop to wild plants

    DEFF Research Database (Denmark)

    Bagger Jørgensen, Rikke; Hauser, T.P.; Mikkelsen, T.R.

    1996-01-01

    The escape of engineered genes - genes inserted using recombinant DNA techniques - from cultivated plants to wild or weedy relatives has raised concern about possible risks to the environment or to health. The media have added considerably to public concern by suggesting that such gene escape...... is a new and rather unexpected phenomenon. However, transfer of engineered genes between plants is not at-all surprising, because it is mediated by exactly the same mechanisms as those responsible for transferring endogenous plant genes: it takes place by sexual crosses, with pollen as the carrier...

  11. Mating-Type Genes and MAT Switching in Saccharomyces cerevisiae

    Science.gov (United States)

    Haber, James E.

    2012-01-01

    Mating type in Saccharomyces cerevisiae is determined by two nonhomologous alleles, MATa and MATα. These sequences encode regulators of the two different haploid mating types and of the diploids formed by their conjugation. Analysis of the MATa1, MATα1, and MATα2 alleles provided one of the earliest models of cell-type specification by transcriptional activators and repressors. Remarkably, homothallic yeast cells can switch their mating type as often as every generation by a highly choreographed, site-specific homologous recombination event that replaces one MAT allele with different DNA sequences encoding the opposite MAT allele. This replacement process involves the participation of two intact but unexpressed copies of mating-type information at the heterochromatic loci, HMLα and HMRa, which are located at opposite ends of the same chromosome-encoding MAT. The study of MAT switching has yielded important insights into the control of cell lineage, the silencing of gene expression, the formation of heterochromatin, and the regulation of accessibility of the donor sequences. Real-time analysis of MAT switching has provided the most detailed description of the molecular events that occur during the homologous recombinational repair of a programmed double-strand chromosome break. PMID:22555442

  12. Purification, gene cloning, gene expression, and mutants of Dps from the obligate anaerobe Porphyromonas gingivalis.

    Science.gov (United States)

    Ueshima, Junichi; Shoji, Mikio; Ratnayake, Dinath B; Abe, Kihachiro; Yoshida, Shinichi; Yamamoto, Kenji; Nakayama, Koji

    2003-03-01

    The periodontopathogen Porphyromonas gingivalis is an obligate anaerobe that is devoid of catalase but exhibits a relatively high degree of resistance to peroxide stress. In the present study, we demonstrate that P. gingivalis contains a Dps homologue that plays an important role in the protection of cells from peroxide stress. The Dps protein isolated from P. gingivalis displayed a ferritin-like spherical polymer consisting of 19-kDa subunits. Molecular cloning and sequencing of the gene encoding this protein revealed that it had a high similarity in nucleotide and amino acid sequences to Dps proteins from other species. The expression of Dps was significantly increased by exposure of P. gingivalis to atmospheric oxygen in an OxyR-dependent manner, indicating that it is regulated by the reactive oxygen species-regulating gene oxyR. The Dps-deficient mutants, including the dps single mutant and the ftn dps double mutant, showed no viability loss upon exposure to atmospheric oxygen for 6 h. In contrast to the wild type, however, these mutants exhibited the high susceptibility to hydrogen peroxide, thereby disrupting the viability. On the other hand, no significant difference in sensitivity to mitomycin C and metronidazole was observed between the wild type and the mutants. Furthermore, the dps single mutant, compared with the wild type, showed a lower viability in infected human umbilical vein endothelial cells.

  13. Craniofacial Statistical Deformation Models of Wild-type mice and Crouzon mice

    DEFF Research Database (Denmark)

    Ólafsdóttir, Hildur; Darvann, Tron Andre; Ersbøll, Bjarne Kjær

    2007-01-01

    Crouzon syndrome is characterised by the premature fusion of cranial sutures and synchondroses leading to craniofacial growth disturbances. The gene causing the syndrome was discovered approximately a decade ago and recently the first mouse model of the syndrome was generated. In this study, a set...... of Micro CT scannings of the heads of wild-type (normal) mice and Crouzon mice were investigated. Statistical deformation models were built to assess the anatomical differences between the groups, as well as the within-group anatomical variation. Following the approach by Rueckert et al. we built an atlas...

  14. Asian wild rice is a hybrid swarm with extensive gene flow and feralization from domesticated rice.

    Science.gov (United States)

    Wang, Hongru; Vieira, Filipe G; Crawford, Jacob E; Chu, Chengcai; Nielsen, Rasmus

    2017-06-01

    The domestication history of rice remains controversial, with multiple studies reaching different conclusions regarding its origin(s). These studies have generally assumed that populations of living wild rice, O. rufipogon , are descendants of the ancestral population that gave rise to domesticated rice, but relatively little attention has been paid to the origins and history of wild rice itself. Here, we investigate the genetic ancestry of wild rice by analyzing a diverse panel of rice genomes consisting of 203 domesticated and 435 wild rice accessions. We show that most modern wild rice is heavily admixed with domesticated rice through both pollen- and seed-mediated gene flow. In fact, much presumed wild rice may simply represent different stages of feralized domesticated rice. In line with this hypothesis, many presumed wild rice varieties show remnants of the effects of selective sweeps in previously identified domestication genes, as well as evidence of recent selection in flowering genes possibly associated with the feralization process. Furthermore, there is a distinct geographical pattern of gene flow from aus , indica , and japonica varieties into colocated wild rice. We also show that admixture from aus and indica is more recent than gene flow from japonica , possibly consistent with an earlier spread of japonica varieties. We argue that wild rice populations should be considered a hybrid swarm, connected to domesticated rice by continuous and extensive gene flow. © 2017 Wang et al.; Published by Cold Spring Harbor Laboratory Press.

  15. Characterization of Urtica dioica agglutinin isolectins and the encoding gene family.

    Science.gov (United States)

    Does, M P; Ng, D K; Dekker, H L; Peumans, W J; Houterman, P M; Van Damme, E J; Cornelissen, B J

    1999-01-01

    Urtica dioica agglutinin (UDA) has previously been found in roots and rhizomes of stinging nettles as a mixture of UDA-isolectins. Protein and cDNA sequencing have shown that mature UDA is composed of two hevein domains and is processed from a precursor protein. The precursor contains a signal peptide, two in-tandem hevein domains, a hinge region and a carboxyl-terminal chitinase domain. Genomic fragments encoding precursors for UDA-isolectins have been amplified by five independent polymerase chain reactions on genomic DNA from stinging nettle ecotype Weerselo. One amplified gene was completely sequenced. As compared to the published cDNA sequence, the genomic sequence contains, besides two basepair substitutions, two introns located at the same positions as in other plant chitinases. By partial sequence analysis of 40 amplified genes, 16 different genes were identified which encode seven putative UDA-isolectins. The deduced amino acid sequences share 78.9-98.9% identity. In extracts of roots and rhizomes of stinging nettle ecotype Weerselo six out of these seven isolectins were detected by mass spectrometry. One of them is an acidic form, which has not been identified before. Our results demonstrate that UDA is encoded by a large gene family.

  16. Synergistic and Antagonistic Interplay between Myostatin Gene Expression and Physical Activity Levels on Gene Expression Patterns in Triceps Brachii Muscles of C57/BL6 Mice

    Science.gov (United States)

    Caetano-Anollés, Kelsey; Mishra, Sanjibita; Rodriguez-Zas, Sandra L.

    2015-01-01

    Levels of myostatin expression and physical activity have both been associated with transcriptome dysregulation and skeletal muscle hypertrophy. The transcriptome of triceps brachii muscles from male C57/BL6 mice corresponding to two genotypes (wild-type and myostatin-reduced) under two conditions (high and low physical activity) was characterized using RNA-Seq. Synergistic and antagonistic interaction and ortholog modes of action of myostatin genotype and activity level on genes and gene pathways in this skeletal muscle were uncovered; 1,836, 238, and 399 genes exhibited significant (FDR-adjusted P-value myostatin-reduced relative to active and inactive wild-type, (ii) inactive myostatin-reduced and active wild-type, and (iii) inactive myostatin-reduced and inactive wild-type. Several remarkable genes and gene pathways were identified. The expression profile of nascent polypeptide-associated complex alpha subunit (Naca) supports a synergistic interaction between activity level and myostatin genotype, while Gremlin 2 (Grem2) displayed an antagonistic interaction. Comparison between activity levels revealed expression changes in genes encoding for structural proteins important for muscle function (including troponin, tropomyosin and myoglobin) and for fatty acid metabolism (some linked to diabetes and obesity, DNA-repair, stem cell renewal, and various forms of cancer). Conversely, comparison between genotype groups revealed changes in genes associated with G1-to-S-phase transition of the cell cycle of myoblasts and the expression of Grem2 proteins that modulate the cleavage of the myostatin propeptide. A number of myostatin-feedback regulated gene products that are primarily regulatory were uncovered, including microRNA impacting central functions and Piezo proteins that make cationic current-controlling mechanosensitive ion channels. These important findings extend hypotheses of myostatin and physical activity master regulation of genes and gene pathways

  17. Escherichia coli yjjPB genes encode a succinate transporter important for succinate production.

    Science.gov (United States)

    Fukui, Keita; Nanatani, Kei; Hara, Yoshihiko; Yamakami, Suguru; Yahagi, Daiki; Chinen, Akito; Tokura, Mitsunori; Abe, Keietsu

    2017-09-01

    Under anaerobic conditions, Escherichia coli produces succinate from glucose via the reductive tricarboxylic acid cycle. To date, however, no genes encoding succinate exporters have been established in E. coli. Therefore, we attempted to identify genes encoding succinate exporters by screening an E. coli MG1655 genome library. We identified the yjjPB genes as candidates encoding a succinate transporter, which enhanced succinate production in Pantoea ananatis under aerobic conditions. A complementation assay conducted in Corynebacterium glutamicum strain AJ110655ΔsucE1 demonstrated that both YjjP and YjjB are required for the restoration of succinate production. Furthermore, deletion of yjjPB decreased succinate production in E. coli by 70% under anaerobic conditions. Taken together, these results suggest that YjjPB constitutes a succinate transporter in E. coli and that the products of both genes are required for succinate export.

  18. Cloning, expression and characterisation of a novel gene encoding ...

    African Journals Online (AJOL)

    微软用户

    2012-01-12

    Jan 12, 2012 ... ... characterisation of a novel gene encoding a chemosensory protein from Bemisia ... The genomic DNA sequence comparisons revealed a 1490 bp intron ... have several conserved sequence motifs, including the. N-terminal ...

  19. Identification of cis-elements for ethylene and circadian regulation of the Solanum melongena gene encoding cysteine proteinase.

    Science.gov (United States)

    Rawat, Reetika; Xu, Zeng-Fu; Yao, Kwok-Ming; Chye, Mee-Len

    2005-03-01

    We have previously shown that the expression of SmCP which encodes Solanum melongena cysteine proteinase is ethylene-inducible and is under circadian control. To understand the regulation of SmCP, a 1.34-kb SmCP 5'-flanking region and its deletion derivatives were analyzed for cis-elements using GUS and luc fusions and by in vitro binding assays. Analysis of transgenic tobacco transformed with SmCP promoter-GUS constructs confirmed that the promoter region -415/+54 containing Ethylene Responsive Element ERE(-355/-348) conferred threefold ethylene-induction of GUS expression, while -827/+54 which also contains ERE(-683/-676), produced fivefold induction. Using gel mobility shift assays, we demonstrated that each ERE binds nuclear proteins from both ethephon-treated and untreated 5-week-old seedlings, suggesting that different transcriptions factors bind each ERE under varying physiological conditions. Binding was also observed in extracts from senescent, but not young, fruits. The variation in binding at the EREs in fruits and seedlings imply that organ-specific factors may participate in binding. Analysis of transgenic tobacco expressing various SmCP promoter-luc constructs containing wild-type or mutant Evening Elements (EEs) confirmed that both conserved EEs at -795/-787 and -785/-777 are important in circadian control. We confirmed the binding of total nuclear proteins to EEs in gel mobility shift assays and in DNase I footprinting. Our results suggest that multiple proteins bind the EEs which are conserved in plants other than Arabidopsis and that functional EEs and EREs are present in the 5'-flanking region of a gene encoding cysteine proteinase.

  20. Novel insertion mutation of ABCB1 gene in an ivermectin-sensitive Border Collie

    OpenAIRE

    Han, Jae-Ik; Son, Hyoung-Won; Park, Seung-Cheol; Na, Ki-Jeong

    2010-01-01

    P-glycoprotein (P-gp) is encoded by the ABCB1 gene and acts as an efflux pump for xenobiotics. In the Border Collie, a nonsense mutation caused by a 4-base pair deletion in the ABCB1 gene is associated with a premature stop to P-gp synthesis. In this study, we examined the full-length coding sequence of the ABCB1 gene in an ivermectin-sensitive Border Collie that lacked the aforementioned deletion mutation. The sequence was compared to the corresponding sequences of a wild-type Beagle and sev...

  1. The frequency of genes encoding three putative group B streptococcal virulence factors among invasive and colonizing isolates

    Directory of Open Access Journals (Sweden)

    Borchardt Stephanie M

    2006-07-01

    Full Text Available Abstract Background Group B Streptococcus (GBS causes severe infections in very young infants and invasive disease in pregnant women and adults with underlying medical conditions. GBS pathogenicity varies between and within serotypes, with considerable variation in genetic content between strains. Three proteins, Rib encoded by rib, and alpha and beta C proteins encoded by bca and bac, respectively, have been suggested as potential vaccine candidates for GBS. It is not known, however, whether these genes occur more frequently in invasive versus colonizing GBS strains. Methods We screened 162 invasive and 338 colonizing GBS strains from different collections using dot blot hybridization to assess the frequency of bca, bac and rib. All strains were defined by serotyping for capsular type, and frequency differences were tested using the Chi square test. Results Genes encoding the beta C protein (bac and Rib (rib occurred at similar frequencies among invasive and colonizing isolates, bac (20% vs. 23%, and rib (28% vs. 20%, while the alpha (bca C protein was more frequently found in colonizing strains (46% vs, invasive (29%. Invasive strains were associated with specific serotype/gene combinations. Conclusion Novel virulence factors must be identified to better understand GBS disease.

  2. Staphylococcus aureus nasal carriage in Ukraine: antibacterial resistance and virulence factor encoding genes.

    Science.gov (United States)

    Netsvyetayeva, Irina; Fraczek, Mariusz; Piskorska, Katarzyna; Golas, Marlena; Sikora, Magdalena; Mlynarczyk, Andrzej; Swoboda-Kopec, Ewa; Marusza, Wojciech; Palmieri, Beniamino; Iannitti, Tommaso

    2014-03-05

    The number of studies regarding the incidence of multidrug resistant strains and distribution of genes encoding virulence factors, which have colonized the post-Soviet states, is considerably limited. The aim of the study was (1) to assess the Staphylococcus (S.) aureus nasal carriage rate, including Methicillin Resistant S. aureus (MRSA) strains in adult Ukrainian population, (2) to determine antibiotic resistant pattern and (3) the occurrence of Panton Valentine Leukocidine (PVL)-, Fibronectin-Binding Protein A (FnBPA)- and Exfoliative Toxin (ET)-encoding genes. Nasal samples for S. aureus culture were obtained from 245 adults. The susceptibility pattern for several classes of antibiotics was determined by disk diffusion method according to the European Committee on Antimicrobial Susceptibility Testing (EUCAST) guidelines. The virulence factor encoding genes, mecA, lukS-lukF, eta, etb, etd, fnbA, were detected by Polymerase Chain Reaction (PCR). The S. aureus nasal carriage rate was 40%. The prevalence of nasal MRSA carriage in adults was 3.7%. LukS-lukF genes were detected in over 58% of the strains. ET-encoding genes were detected in over 39% of the strains and the most prevalent was etd. The fnbA gene was detected in over 59% of the strains. All MRSA isolates tested were positive for the mecA gene. LukS-lukF genes and the etd gene were commonly co-present in MRSA, while lukS-lukF genes and the fnbA gene were commonly co-present in Methicillin Sensitive S. aureus (MSSA) isolates. No significant difference was detected between the occurrence of lukS-lukF genes (P > 0.05) and the etd gene (P > 0.05) when comparing MRSA and MSSA. The occurrence of the fnbA gene was significantly more frequent in MSSA strains (P aureus is a common cause of infection. The prevalence of S. aureus nasal carriage in our cohort of patients from Ukraine was 40.4%. We found that 9.1% of the strains were classified as MRSA and all MRSA isolates tested positive for the mecA gene

  3. The mitochondrial gene encoding ribosomal protein S12 has been translocated to the nuclear genome in Oenothera.

    Science.gov (United States)

    Grohmann, L; Brennicke, A; Schuster, W

    1992-01-01

    The Oenothera mitochondrial genome contains only a gene fragment for ribosomal protein S12 (rps12), while other plants encode a functional gene in the mitochondrion. The complete Oenothera rps12 gene is located in the nucleus. The transit sequence necessary to target this protein to the mitochondrion is encoded by a 5'-extension of the open reading frame. Comparison of the amino acid sequence encoded by the nuclear gene with the polypeptides encoded by edited mitochondrial cDNA and genomic sequences of other plants suggests that gene transfer between mitochondrion and nucleus started from edited mitochondrial RNA molecules. Mechanisms and requirements of gene transfer and activation are discussed. Images PMID:1454526

  4. Expression of genes encoding multi-transmembrane proteins in specific primate taste cell populations.

    Directory of Open Access Journals (Sweden)

    Bryan D Moyer

    Full Text Available BACKGROUND: Using fungiform (FG and circumvallate (CV taste buds isolated by laser capture microdissection and analyzed using gene arrays, we previously constructed a comprehensive database of gene expression in primates, which revealed over 2,300 taste bud-associated genes. Bioinformatics analyses identified hundreds of genes predicted to encode multi-transmembrane domain proteins with no previous association with taste function. A first step in elucidating the roles these gene products play in gustation is to identify the specific taste cell types in which they are expressed. METHODOLOGY/PRINCIPAL FINDINGS: Using double label in situ hybridization analyses, we identified seven new genes expressed in specific taste cell types, including sweet, bitter, and umami cells (TRPM5-positive, sour cells (PKD2L1-positive, as well as other taste cell populations. Transmembrane protein 44 (TMEM44, a protein with seven predicted transmembrane domains with no homology to GPCRs, is expressed in a TRPM5-negative and PKD2L1-negative population that is enriched in the bottom portion of taste buds and may represent developmentally immature taste cells. Calcium homeostasis modulator 1 (CALHM1, a component of a novel calcium channel, along with family members CALHM2 and CALHM3; multiple C2 domains; transmembrane 1 (MCTP1, a calcium-binding transmembrane protein; and anoctamin 7 (ANO7, a member of the recently identified calcium-gated chloride channel family, are all expressed in TRPM5 cells. These proteins may modulate and effect calcium signalling stemming from sweet, bitter, and umami receptor activation. Synaptic vesicle glycoprotein 2B (SV2B, a regulator of synaptic vesicle exocytosis, is expressed in PKD2L1 cells, suggesting that this taste cell population transmits tastant information to gustatory afferent nerve fibers via exocytic neurotransmitter release. CONCLUSIONS/SIGNIFICANCE: Identification of genes encoding multi-transmembrane domain proteins

  5. Regulation of the subunit composition of plastidic glutamine synthetase of the wild-type and of the phytochrome-deficient aurea mutant of tomato by blue/UV-A- or by UV-B-light

    International Nuclear Information System (INIS)

    Migge, A.; Carrayol, E.; Hirel, B.; Lohmann, M.; Meya, G.; Becker, T.W.

    1998-01-01

    The photomorphogenetic aurea mutant of tomato severely deficient in spectrophotometrically active phytochromes was used to study the light-regulation of the single-copy nuclear gene encoding plastidic glutamine synthetase (GS-2; EC 6.1.3.2). The de-etiolation of dark-grown aurea mutant seedling cotyledons showed an obligatory dependency on blue light. A limited red light-responsiveness of etiolated aurea cotyledons is, however, retained as seen by the stimulation of both the GS-2 transcript and protein level in the cotyledons of aurea seedlings during growth in red light. The subunits of the octameric GS-2 enzyme were represented by polypeptides with similar electrophoretic mobilities (polypeptides a) in etiolated wild-type or aurea mutant cotyledons. GS-2 proteins with similar apparent molecular masses were also seen in the cotyledons of red light-grown aurea mutant seedlings. In contrast, GS-2 polypeptides with different apparent molecular masses (polypeptides a and b) were detected in the cotyledons of wild-type seedlings grown in red light. This difference indicates that the (post-translational) modification of tomato GS-2 subunit composition is mediated by the photoreceptor phytochrome. The illumination of etiolated wild-type or aurea cotyledons with UV-A- or UV-B-light light resulted in an increase in both the GS-2 transcript and protein level. Following illumination of etiolated wild-type seedlings with UV-A-light, the relative proportion of the GS-2 polypeptides a and b was similar than upon irradiation with blue light but different than after exposure to UV-B- or red light. This result suggests the involvement of a blue/ UV-A-light-specific photoreceptor in the regulation of tomato GS-2 subunit composition. (author)

  6. The pyrH gene of Lactococcus lactis subsp. cremoris encoding UMP kinase is transcribed as part of an operon including the frr1 gene encoding ribosomal recycling factor

    DEFF Research Database (Denmark)

    Wadskov-Hansen, Steen Lüders; Martinussen, Jan; Hammer, Karin

    2000-01-01

    establishing the ability of the encoded protein to synthesize UDP. The pyrH gene in L. lactis is flanked downstream by frr1 encoding ribosomal recycling factor 1 and upstream by an open reading frame, orfA, of unknown function. The three genes were shown to constitute an operon transcribed in the direction orf......A-pyrH-frr1 from a promoter immediately in front of orfA. This operon belongs to an evolutionary highly conserved gene cluster, since the organization of pyrH on the chromosomal level in L. lactis shows a high resemblance to that found in Bacillus subtilis as well as in Escherichia coli and several other...

  7. An evolutionarily conserved gene family encodes proton-selective ion channels.

    Science.gov (United States)

    Tu, Yu-Hsiang; Cooper, Alexander J; Teng, Bochuan; Chang, Rui B; Artiga, Daniel J; Turner, Heather N; Mulhall, Eric M; Ye, Wenlei; Smith, Andrew D; Liman, Emily R

    2018-03-02

    Ion channels form the basis for cellular electrical signaling. Despite the scores of genetically identified ion channels selective for other monatomic ions, only one type of proton-selective ion channel has been found in eukaryotic cells. By comparative transcriptome analysis of mouse taste receptor cells, we identified Otopetrin1 (OTOP1), a protein required for development of gravity-sensing otoconia in the vestibular system, as forming a proton-selective ion channel. We found that murine OTOP1 is enriched in acid-detecting taste receptor cells and is required for their zinc-sensitive proton conductance. Two related murine genes, Otop2 and Otop3 , and a Drosophila ortholog also encode proton channels. Evolutionary conservation of the gene family and its widespread tissue distribution suggest a broad role for proton channels in physiology and pathophysiology. Copyright © 2018 The Authors, some rights reserved; exclusive licensee American Association for the Advancement of Science. No claim to original U.S. Government Works.

  8. An emerging role for misfolded wild-type SOD1 in sporadic ALS pathogenesis

    Directory of Open Access Journals (Sweden)

    Melissa S Rotunno

    2013-12-01

    Full Text Available Amyotrophic lateral sclerosis (ALS is a fatal neurodegenerative disorder that targets motor neurons, leading to paralysis and death within a few years of disease onset. While several genes have been linked to the inheritable, or familial, form of ALS, much less is known about the cause(s of sporadic ALS, which accounts for approximately 90% of ALS cases. Due to the clinical similarities between familial and sporadic ALS, it is plausible that both forms of the disease converge on a common pathway and, therefore, involve common factors. Recent evidence suggests the Cu,Zn-superoxide dismutase (SOD1 protein to be one such factor that is common to both sporadic and familial ALS. In 1993, mutations were uncovered in SOD1 that represent the first known genetic cause of familial ALS. While the exact mechanism of mutant-SOD1 toxicity is still not known today, most evidence points to a gain of toxic function that stems, at least in part, from the propensity of this protein to misfold. In the wild-type SOD1 protein, non-genetic perturbations such as metal depletion, disruption of the quaternary structure, and oxidation, can also induce SOD1 to misfold. In fact, these aforementioned post-translational modifications cause wild-type SOD1 to adopt a toxic conformation that is similar to familial ALS-linked SOD1 variants. These observations, together with the detection of misfolded wild-type SOD1 within human post-mortem sporadic ALS samples, have been used to support the controversial hypothesis that misfolded forms of wild-type SOD1 contribute to sporadic ALS pathogenesis. In this review, we present data from the literature that both support and contradict this hypothesis. We also discuss SOD1 as a potential therapeutic target for both familial and sporadic ALS.

  9. A Major Facilitator Superfamily protein encoded by TcMucK gene is not required for cuticle pigmentation, growth and development in Tribolium castaneum.

    Science.gov (United States)

    Mun, Seulgi; Noh, Mi Young; Osanai-Futahashi, Mizuko; Muthukrishnan, Subbaratnam; Kramer, Karl J; Arakane, Yasuyuki

    2014-06-01

    Insect cuticle pigmentation and sclerotization (tanning) are vital physiological processes for insect growth, development and survival. We have previously identified several colorless precursor molecules as well as enzymes involved in their biosynthesis and processing to yield the mature intensely colored body cuticle pigments. A recent study indicated that the Bombyx mori (silkmoth) gene, BmMucK, which encodes a protein orthologous to a Culex pipiens quiquefasciatus (Southern house mosquito) cis,cis, muconate transporter, is a member of the "Major Facilitator Superfamily" (MFS) of transporter proteins and is associated with the appearance of pigmented body segments of naturally occurring body color mutants of B. mori. While RNA interference of the BmMucK gene failed to result in any observable phenotype, RNAi using a dsRNA for an orthologous gene from the red flour beetle, Tribolium castaneum, was reported to result in molting defects and darkening of the cuticle and some body parts, leading to the suggestion that orthologs of MucK genes may differ in their functions among insects. To verify the role and essentiality of the ortholog of this gene in development and body pigmentation function in T. castaneum we obtained cDNAs for the orthologous gene (TcMucK) from RNA isolated from the GA-1 wild-type strain of T. castaneum. The sequence of a 1524 nucleotides-long cDNA for TcMucK which encodes the putatively full-length protein, was assembled from two overlapping RT-PCR fragments and the expression profile of this gene during development was analyzed by real-time PCR. This cDNA encodes a 55.8 kDa protein consisting of 507 amino acid residues and includes 11 putative transmembrane segments. Transcripts of TcMucK were detected throughout all of the developmental stages analyzed. The function of this gene was explored by injection of two different double-stranded RNAs targeting different regions of the TcMucK gene (dsTcMucKs) into young larvae to down

  10. Genetical and functional investigation of fliC genes encoding flagellar serotype H4 in wildtype strains of Escherichia coli and in a laboratory E. coli K-12 strain expressing flagellar antigen type H48

    Directory of Open Access Journals (Sweden)

    Schaudinn Christoph

    2005-01-01

    Full Text Available Abstract Background Serotyping of O-(lipopolysaccharide and H-(flagellar antigens is a wideley used method for identification of pathogenic strains and clones of Escherichia coli. At present, 176 O- and 53 H-antigens are described for E. coli which occur in different combinations in the strains. The flagellar antigen H4 is widely present in E. coli strains of different O-serotypes and pathotypes and we have investigated the genetic relationship between H4 encoding fliC genes by PCR, nucleotide sequencing and expression studies. Results The complete nucleotide sequence of fliC genes present in E. coli reference strains U9-41 (O2:K1:H4 and P12b (O15:H17 was determined and both were found 99.3% (1043 of 1050 nucleotides identical in their coding sequence. A PCR/RFLP protocol was developed for typing of fliC-H4 strains and 88 E. coli strains reacting with H4 antiserum were investigated. Nucleotide sequencing of complete fliC genes of six E. coli strains which were selected based on serum agglutination titers, fliC-PCR genotyping and reference data revealed 96.6 to 100% identity on the amino acid level. The functional expression of flagellin encoded by fliC-H4 from strain U9-41 and from our strain P12b which is an H4 expressing variant type was investigated in the E. coli K-12 strain JM109 which encodes flagellar type H48. The fliC recombinant plasmid carrying JM109 strains reacted with both H4 and H48 specific antisera whereas JM109 reacted only with the H48 antiserum. By immunoelectron microscopy, we could show that the flagella made by the fliC-H4 recombinant plasmid carrying strain are constituted of H48 and H4 flagellins which are co-assembled into functional flagella. Conclusion The flagellar serotype H4 is encoded by closely related fliC genes present in serologically different types of E. coli strainswhich were isolated at different time periods and geographical locations. Our expression studies show for the first time, that flagellins of

  11. Comparison of the proteomes of three yeast wild type strains: CEN.PK2, FY1679 and W303

    DEFF Research Database (Denmark)

    Rogowska-Wrzesinska, A.; Mose Larsen, P.; Blomberg, A.

    2001-01-01

    Yeast deletion strains created during gene function analysis projects very often show drastic phenotypic differences depending on the genetic background used. These results indicate the existence of important molecular differences between the CEN.PK2, FY1679 and W303 wild type strains...

  12. Evaluation of MIC Strip Isavuconazole test for susceptibility testing of wild-type and non-wild-type Aspergillus fumigatus isolates

    DEFF Research Database (Denmark)

    Arendrup, Maiken Cavling; Verweij, Paul; Nielsen, Henrik Vedel

    2017-01-01

    We evaluated the MIC Strip Isavuconazole test against EUCAST E.Def 9.3 by using 40 wild-type and 39 CYP51A mutant Aspergillus fumigatus strains. The strip full inhibition endpoint (FIE) and 80% growth inhibition endpoint were determined by two independent readers, reader 1 (R1) and R2. The essent......We evaluated the MIC Strip Isavuconazole test against EUCAST E.Def 9.3 by using 40 wild-type and 39 CYP51A mutant Aspergillus fumigatus strains. The strip full inhibition endpoint (FIE) and 80% growth inhibition endpoint were determined by two independent readers, reader 1 (R1) and R2...

  13. Transforming a NEP1 toxin gene into two Fusarium spp. to enhance mycoherbicide activity on Orobanche--failure and success.

    Science.gov (United States)

    Meir, Sagit; Amsellem, Ziva; Al-Ahmad, Hani; Safran, Einat; Gressel, Jonathan

    2009-05-01

    The NEP1 gene encoding a fungal toxin that successfully conferred hypervirulence when transformed into Colletotrichum coccodes (Wallr.) Hughes attacking Abutilon theophrasti (L.) Medic. was tested to ascertain if it would enhance pathogenicity of Fusarium species to Orobanche aegyptiaca Pers. parasitising crops. None of the Fusarium oxysporum (#CNCM I-1622) NEP1 transformants was hypervirulent. NEP1 transformants of a new but unnamed Fusarium sp. (#CNCM I-1621--previously identified as F. arthrosporioides) killed Orobanche more rapidly than the wild type. Transformed lines of both species were NEP1 PCR positive, as was the wild type of F. oxysporum #CNCM I-1622 and five other formae speciales of F. oxysporum. All six wild-type formae speciales of F. oxysporum tested excrete minute amounts of immunologically and bioassay-detectable NEP1-like protein. NEP1 expression of most F. oxysporum transformants was suppressed, suggesting that the native gene and the transgene silence each other. The sequence of the putative NEP1 gene in Fusarium oxysporum #CNCM I-1622 differs from the sequence in the toxin-overproducing strain of F. oxysporum f. sp. erythroxyli in four or five amino acids in the first exon. Wild-type Fusarium sp. #CNCM I-1621 does not contain a NEP1-like gene, explaining why it seemed amenable to transformation with high expression, and its virulence was probably enhanced by not cosuppressing the endogenous gene as occurred with Fusarium oxysporum #CNCM I-1622.

  14. Iron-dependent gene expression in Actinomyces oris

    Directory of Open Access Journals (Sweden)

    Matthew P. Mulé

    2015-12-01

    Results: When A. oris was grown under iron-limiting conditions, the genes encoding iron/siderophore transporters fetA and sidD showed increased expression. One of these genes (sidD was mutated, and the sidD::Km strain exhibited a 50% reduction in growth in late log and stationary phase cells in media that contained iron. This growth defect was restored when the sidD gene was provided in a complemented strain. We were able to isolate the AmdR-encoding gene in seven clinical isolates of Actinomyces. When these protein sequences were aligned to the laboratory strain, there was a high degree of sequence similarity. Conclusions: The growth of the sidD::Km mutant in iron-replete medium mirrored the growth of the wild-type strain grown in iron-limiting medium, suggesting that the sidD::Km mutant was compromised in iron uptake. The known iron regulator AmdR is well conserved in clinical isolates of A. oris. This work provides additional insight into iron metabolism in this important oral microbe.

  15. Bacteriophage-encoded shiga toxin gene in atypical bacterial host

    Directory of Open Access Journals (Sweden)

    Casas Veronica

    2011-07-01

    Full Text Available Abstract Background Contamination from fecal bacteria in recreational waters is a major health concern since bacteria capable of causing human disease can be found in animal feces. The Dog Beach area of Ocean Beach in San Diego, California is a beach prone to closures due to high levels of fecal indicator bacteria (FIB. A potential source of these FIB could be the canine feces left behind by owners who do not clean up after their pets. We tested this hypothesis by screening the DNA isolated from canine feces for the bacteriophage-encoded stx gene normally found in the virulent strains of the fecal bacterium Escherichia coli. Results Twenty canine fecal samples were collected, processed for total and bacterial fraction DNA, and screened by PCR for the stx gene. The stx gene was detected in the total and bacterial fraction DNA of one fecal sample. Bacterial isolates were then cultivated from the stx-positive fecal sample. Eighty nine of these canine fecal bacterial isolates were screened by PCR for the stx gene. The stx gene was detected in five of these isolates. Sequencing and phylogenetic analyses of 16S rRNA gene PCR products from the canine fecal bacterial isolates indicated that they were Enterococcus and not E. coli. Conclusions The bacteriophage-encoded stx gene was found in multiple species of bacteria cultivated from canine fecal samples gathered at the shoreline of the Dog Beach area of Ocean Beach in San Diego, California. The canine fecal bacteria carrying the stx gene were not the typical E. coli host and were instead identified through phylogenetic analyses as Enterococcus. This suggests a large degree of horizontal gene transfer of exotoxin genes in recreational waters.

  16. Somatic loss of function mutations in neurofibromin 1 and MYC associated factor X genes identified by exome-wide sequencing in a wild-type GIST case

    International Nuclear Information System (INIS)

    Belinsky, Martin G.; Rink, Lori; Cai, Kathy Q.; Capuzzi, Stephen J.; Hoang, Yen; Chien, Jeremy; Godwin, Andrew K.; Mehren, Margaret von

    2015-01-01

    Approximately 10–15 % of gastrointestinal stromal tumors (GISTs) lack gain of function mutations in the KIT and platelet-derived growth factor receptor alpha (PDGFRA) genes. An alternate mechanism of oncogenesis through loss of function of the succinate-dehydrogenase (SDH) enzyme complex has been identified for a subset of these “wild type” GISTs. Paired tumor and normal DNA from an SDH-intact wild-type GIST case was subjected to whole exome sequencing to identify the pathogenic mechanism(s) in this tumor. Selected findings were further investigated in panels of GIST tumors through Sanger DNA sequencing, quantitative real-time PCR, and immunohistochemical approaches. A hemizygous frameshift mutation (p.His2261Leufs*4), in the neurofibromin 1 (NF1) gene was identified in the patient’s GIST; however, no germline NF1 mutation was found. A somatic frameshift mutation (p.Lys54Argfs*31) in the MYC associated factor X (MAX) gene was also identified. Immunohistochemical analysis for MAX on a large panel of GISTs identified loss of MAX expression in the MAX-mutated GIST and in a subset of mainly KIT-mutated tumors. This study suggests that inactivating NF1 mutations outside the context of neurofibromatosis may be the oncogenic mechanism for a subset of sporadic GIST. In addition, loss of function mutation of the MAX gene was identified for the first time in GIST, and a broader role for MAX in GIST progression was suggested. The online version of this article (doi:10.1186/s12885-015-1872-y) contains supplementary material, which is available to authorized users

  17. [Therapeutic effect of a novel recombinant vaccine encoding chicken collagen type II procollagen gene on collagen-induced arthritis in rat].

    Science.gov (United States)

    Song, Xin-qiang; Luo, Yuan; Wang, Dan; Liu, Shu-guang; Liu, Jin-feng; Yuan, Fang; Xue, Hong; Liu, Nan; Liang, Fei; Sun, Yu-ying; Xi, Yong-zhi

    2006-08-08

    To investigate the therapeutic effect of gene vaccine encoding chicken collagen type II (CC II) on collagen-induced arthritis (CIA) comprehensively. Three groups (CIA) were given a single intravenous injection of plasmid pcDNA-CCOL2A1 (20 microg/kg, 200 microg/kg, 400 microg/kg) respectively and one group (CIA) was injected 200 microg/kg pcDNA3.1 as a control. The effect of gene vaccine (pcDNA-CCOL2A1) was evaluated according to the arthritis score, radiological and histological examinations. The severity of arthritis of CIA rats which were administered 200 microg/kg pcDNA-CCOL2A1 was significantly reduced from the fifth day. According to the radiological and histological examinations, the articular cartilage as well as subchondral bone trabeculae are similar to those of the normal groups, so the bone and articular cartilage structure were protected after treatment with 200 microg/kg pcDNA-CCOL2A1 with a little synovial hyperplasia. The therapeutic effect of 200 microg/kg pcDNA-CCOL2A1 group has significant difference in comparison with that of the pcDNA3.1 group (P 0.05). The new gene vaccine pcDNA-CCOL2A1 has significant therapeutic effect on CIA rats, and the treatment may therefore be an effective strategy for RA patient clinically.

  18. Identification and characterization of a gene encoding a putative ...

    Indian Academy of Sciences (India)

    2012-10-30

    Oct 30, 2012 ... Genetic Improvement of Oil Crops, Ministry of Agriculture, Wuhan 430062, China. 2Institute of ... Its encoding gene is an essential candidate for oil crops to .... higher level in leaves than in other organs (Kim and Huang. 2004) ...

  19. Gene set of nuclear-encoded mitochondrial regulators is enriched for common inherited variation in obesity.

    Directory of Open Access Journals (Sweden)

    Nadja Knoll

    Full Text Available There are hints of an altered mitochondrial function in obesity. Nuclear-encoded genes are relevant for mitochondrial function (3 gene sets of known relevant pathways: (1 16 nuclear regulators of mitochondrial genes, (2 91 genes for oxidative phosphorylation and (3 966 nuclear-encoded mitochondrial genes. Gene set enrichment analysis (GSEA showed no association with type 2 diabetes mellitus in these gene sets. Here we performed a GSEA for the same gene sets for obesity. Genome wide association study (GWAS data from a case-control approach on 453 extremely obese children and adolescents and 435 lean adult controls were used for GSEA. For independent confirmation, we analyzed 705 obesity GWAS trios (extremely obese child and both biological parents and a population-based GWAS sample (KORA F4, n = 1,743. A meta-analysis was performed on all three samples. In each sample, the distribution of significance levels between the respective gene set and those of all genes was compared using the leading-edge-fraction-comparison test (cut-offs between the 50(th and 95(th percentile of the set of all gene-wise corrected p-values as implemented in the MAGENTA software. In the case-control sample, significant enrichment of associations with obesity was observed above the 50(th percentile for the set of the 16 nuclear regulators of mitochondrial genes (p(GSEA,50 = 0.0103. This finding was not confirmed in the trios (p(GSEA,50 = 0.5991, but in KORA (p(GSEA,50 = 0.0398. The meta-analysis again indicated a trend for enrichment (p(MAGENTA,50 = 0.1052, p(MAGENTA,75 = 0.0251. The GSEA revealed that weak association signals for obesity might be enriched in the gene set of 16 nuclear regulators of mitochondrial genes.

  20. Naturally occurring mutations in the human 5-lipoxygenase gene promoter that modify transcription factor binding and reporter gene transcription.

    Science.gov (United States)

    In, K H; Asano, K; Beier, D; Grobholz, J; Finn, P W; Silverman, E K; Silverman, E S; Collins, T; Fischer, A R; Keith, T P; Serino, K; Kim, S W; De Sanctis, G T; Yandava, C; Pillari, A; Rubin, P; Kemp, J; Israel, E; Busse, W; Ledford, D; Murray, J J; Segal, A; Tinkleman, D; Drazen, J M

    1997-03-01

    Five lipoxygenase (5-LO) is the first committed enzyme in the metabolic pathway leading to the synthesis of the leukotrienes. We examined genomic DNA isolated from 25 normal subjects and 31 patients with asthma (6 of whom had aspirin-sensitive asthma) for mutations in the known transcription factor binding regions and the protein encoding region of the 5-LO gene. A family of mutations in the G + C-rich transcription factor binding region was identified consisting of the deletion of one, deletion of two, or addition of one zinc finger (Sp1/Egr-1) binding sites in the region 176 to 147 bp upstream from the ATG translation start site where there are normally 5 Sp1 binding motifs in tandem. Reporter gene activity directed by any of the mutant forms of the transcription factor binding region was significantly (P < 0.05) less effective than the activity driven by the wild type transcription factor binding region. Electrophoretic mobility shift assays (EMSAs) demonstrated the capacity of wild type and mutant transcription factor binding regions to bind nuclear extracts from human umbilical vein endothelial cells (HUVECs). These data are consistent with a family of mutations in the 5-LO gene that can modify reporter gene transcription possibly through differences in Sp1 and Egr-1 transactivation.

  1. Sabin and wild type polioviruses from children who presented with ...

    African Journals Online (AJOL)

    Conclusion: This study further confirms the presence of Sabin and wild-type poliovirus among children in Nigeria. The isolation of Sabin strain of poliovirus is advantageous to the polio eradication program as it is capable of inducing natural immunity in susceptible hosts. Transmission of wild-type poliovirus among children ...

  2. Identification of enzymes and quantification of metabolic fluxes in the wild type and in a recombinant Aspergillus oryzae strain

    DEFF Research Database (Denmark)

    Pedersen, Henrik; Carlsen, Morten; Nielsen, Jens Bredal

    1999-01-01

    Two alpha-amylase-producing strains of Aspergillus oryzae, a wild-type strain and a recombinant containing additional copies of the alpha-amylase gene, were characterized,vith respect to enzyme activities, localization of enzymes to the mitochondria or cytosol, macromolecular composition...

  3. Screening of the Enterocin-Encoding Genes and Antimicrobial Activity in Enterococcus Species.

    Science.gov (United States)

    Ogaki, Mayara Baptistucci; Rocha, Katia Real; Terra, MÁrcia Regina; Furlaneto, MÁrcia Cristina; Maia, Luciana Furlaneto

    2016-06-28

    In the current study, a total of 135 enterococci strains from different sources were screened for the presence of the enterocin-encoding genes entA, entP, entB, entL50A, and entL50B. The enterocin genes were present at different frequencies, with entA occurring the most frequently, followed by entP and entB; entL50A and L50B were not detected. The occurrence of single enterocin genes was higher than the occurrence of multiple enterocin gene combinations. The 80 isolates that harbor at least one enterocin-encoding gene (denoted "Gene(+) strains") were screened for antimicrobial activity. A total of 82.5% of the Gene(+) strains inhibited at least one of the indicator strains, and the isolates harboring multiple enterocin-encoding genes inhibited a larger number of indicator strains than isolates harboring a single gene. The indicator strains that exhibited growth inhibition included Listeria innocua strain CLIP 12612 (ATCC BAA-680), Listeria monocytogenes strain CDC 4555, Enterococcus faecalis ATCC 29212, Staphylococcus aureus ATCC 25923, S. aureus ATCC 29213, S. aureus ATCC 6538, Salmonella enteritidis ATCC 13076, Salmonella typhimurium strain UK-1 (ATCC 68169), and Escherichia coli BAC 49LT ETEC. Inhibition due to either bacteriophage lysis or cytolysin activity was excluded. The growth inhibition of antilisterial Gene+ strains was further tested under different culture conditions. Among the culture media formulations, the MRS agar medium supplemented with 2% (w/v) yeast extract was the best solidified medium for enterocin production. Our findings extend the current knowledge of enterocin-producing enterococci, which may have potential applications as biopreservatives in the food industry due to their capability of controlling food spoilage pathogens.

  4. Three synonymous genes encode calmodulin in a reptile, the Japanese tortoise, Clemmys japonica

    Directory of Open Access Journals (Sweden)

    Kouji Shimoda

    2002-01-01

    Full Text Available Three distinct calmodulin (CaM-encoding cDNAs were isolated from a reptile, the Japanese tortoise (Clemmys japonica, based on degenerative primer PCR. Because of synonymous codon usages, the deduced amino acid (aa sequences were exactly the same in all three genes and identical to the aa sequence of vertebrate CaM. The three cDNAs, referred to as CaM-A, -B, and -C, seemed to belong to the same type as CaMI, CaMII, and CaMIII, respectively, based on their sequence identity with those of the mammalian cDNAs and the glutamate codon biases. Northern blot analysis detected CaM-A and -B as bands corresponding to 1.8 kb, with the most abundant levels in the brain and testis, while CaM-C was detected most abundantly in the brain as bands of 1.4 and 2.0 kb. Our results indicate that, in the tortoise, CaM protein is encoded by at least three non-allelic genes, and that the ‘multigene-one protein' principle of CaM synthesis is applicable to all classes of vertebrates, from fishes to mammals.

  5. Global gene expression profiles of MT knockout and wild-type mice in the condition of doxorubicin-induced cardiomyopathy.

    Science.gov (United States)

    Shuai, Yi; Guo, Jun; Dong, Yansheng; Zhong, Weijian; Xiao, Ping; Zhou, Tong; Zhang, Lishi; Peng, Shuangqing

    2011-01-15

    Increasing evidence from in vivo and in vitro studies has indicated that MT exerts protective effects against DOX-induced cardiotoxicity; however the underlying precise mechanisms still remain an enigma. Therefore, the present study was designed using MT knockout mice in concert with genomic approaches to explore the possible molecular and cellular mechanisms in terms of the genetic network changes. MT-I/II null (MT⁻/⁻) mice and corresponding wild-type mice (MT+/+) were administrated with a single dose of DOX (15 mg/kg, i.p.) or equal volume of saline. Animals were sacrificed on the 4th day after DOX administration and samples were collected for further analyses. Global gene expression profiles of cardiac mRNA from two genotype mice revealed that 381 characteristically MT-responsive genes were identified between MT+/+ mice and MT⁻/⁻ mice in response to DOX, including fos, ucp3, car3, atf3, map3k6, etc. Functional analysis implied MAPK signaling pathway, p53 signaling pathway, Jak-STAT signaling pathway, PPAR signaling pathway, Wnt signaling pathway, etc. might be involved to mediate the protection of DOX cardiomyopathy by MT. Results from the present study not only validated the previously reported possible mechanisms of MT protection against DOX toxicity, but also provided new clues into the molecular mechanisms involved in this process. Copyright © 2010 Elsevier Ireland Ltd. All rights reserved.

  6. Candida albicans AGE3, the ortholog of the S. cerevisiae ARF-GAP-encoding gene GCS1, is required for hyphal growth and drug resistance.

    Directory of Open Access Journals (Sweden)

    Thomas Lettner

    Full Text Available BACKGROUND: Hyphal growth and multidrug resistance of C. albicans are important features for virulence and antifungal therapy of this pathogenic fungus. METHODOLOGY/PRINCIPAL FINDINGS: Here we show by phenotypic complementation analysis that the C. albicans gene AGE3 is the functional ortholog of the yeast ARF-GAP-encoding gene GCS1. The finding that the gene is required for efficient endocytosis points to an important functional role of Age3p in endosomal compartments. Most C. albicans age3Delta mutant cells which grew as cell clusters under yeast growth conditions showed defects in filamentation under different hyphal growth conditions and were almost completely disabled for invasive filamentous growth. Under hyphal growth conditions only a fraction of age3Delta cells shows a wild-type-like polarization pattern of the actin cytoskeleton and lipid rafts. Moreover, age3Delta cells were highly susceptible to several unrelated toxic compounds including antifungal azole drugs. Irrespective of the AGE3 genotype, C-terminal fusions of GFP to the drug efflux pumps Cdr1p and Mdr1p were predominantly localized in the plasma membrane. Moreover, the plasma membranes of wild-type and age3Delta mutant cells contained similar amounts of Cdr1p, Cdr2p and Mdr1p. CONCLUSIONS/SIGNIFICANCE: The results indicate that the defect in sustaining filament elongation is probably caused by the failure of age3Delta cells to polarize the actin cytoskeleton and possibly of inefficient endocytosis. The high susceptibility of age3Delta cells to azoles is not caused by inefficient transport of efflux pumps to the cell membrane. A possible role of a vacuolar defect of age3Delta cells in drug susceptibility is proposed and discussed. In conclusion, our study shows that the ARF-GAP Age3p is required for hyphal growth which is an important virulence factor of C. albicans and essential for detoxification of azole drugs which are routinely used for antifungal therapy. Thus, it

  7. Type II heat-labile enterotoxins from 50 diverse Escherichia coli isolates belong almost exclusively to the LT-IIc family and may be prophage encoded.

    Directory of Open Access Journals (Sweden)

    Michael G Jobling

    Full Text Available Some enterotoxigenic Escherichia coli (ETEC produce a type II heat-labile enterotoxin (LT-II that activates adenylate cyclase in susceptible cells but is not neutralized by antisera against cholera toxin or type I heat-labile enterotoxin (LT-I. LT-I variants encoded by plasmids in ETEC from humans and pigs have amino acid sequences that are ≥ 95% identical. In contrast, LT-II toxins are chromosomally encoded and are much more diverse. Early studies characterized LT-IIa and LT-IIb variants, but a novel LT-IIc was reported recently. Here we characterized the LT-II encoding loci from 48 additional ETEC isolates. Two encoded LT-IIa, none encoded LT-IIb, and 46 encoded highly related variants of LT-IIc. Phylogenetic analysis indicated that the predicted LT-IIc toxins encoded by these loci could be assigned to 6 subgroups. The loci corresponding to individual toxins within each subgroup had DNA sequences that were more than 99% identical. The LT-IIc subgroups appear to have arisen by multiple recombinational events between progenitor loci encoding LT-IIc1- and LT-IIc3-like variants. All loci from representative isolates encoding the LT-IIa, LT-IIb, and each subgroup of LT-IIc enterotoxins are preceded by highly-related genes that are between 80 and 93% identical to predicted phage lysozyme genes. DNA sequences immediately following the B genes differ considerably between toxin subgroups, but all are most closely related to genomic sequences found in predicted prophages. Together these data suggest that the LT-II loci are inserted into lambdoid type prophages that may or may not be infectious. These findings raise the possibility that production of LT-II enterotoxins by ETEC may be determined by phage conversion and may be activated by induction of prophage, in a manner similar to control of production of Shiga-like toxins by converting phages in isolates of enterohemmorhagic E. coli.

  8. Arabidopsis VARIEGATED 3 encodes a chloroplast-targeted, zinc-finger protein required for chloroplast and palisade cell development

    DEFF Research Database (Denmark)

    Næsted, Henrik; Holm, Agnethe; Jenkins, Tom

    2004-01-01

    The stable, recessive Arabidopsis variegated 3 (var3) mutant exhibits a variegated phenotype due to somatic areas lacking or containing developmentally retarded chloroplasts and greatly reduced numbers of palisade cells. The VAR3 gene, isolated by transposon tagging, encodes the 85.9 kDa VAR3...... that pigment profiles are qualitatively similar in wild type and var3, although var3 accumulates lower levels of chlorophylls and carotenoids. These results indicate that VAR3 is a part of a protein complex required for normal chloroplast and palisade cell development....

  9. Transcriptional modulation of genes encoding nitrate reductase in ...

    African Journals Online (AJOL)

    The free aluminum (Al) content in soil can reach levels that are toxic to plants, and this has frequently limited increased productivity of cultures. Four genes encoding nitrate reductase (NR) were identified, named ZmNR1–4. With the aim of evaluating NR activity and the transcriptional modulation of the ZmNR1, ZmNR2, ...

  10. Clostridium difficile and Clostridium perfringens from wild carnivore species in Brazil.

    Science.gov (United States)

    Silva, Rodrigo Otávio Silveira; D'Elia, Mirella Lauria; Tostes Teixeira, Erika Procópio; Pereira, Pedro Lúcio Lithg; de Magalhães Soares, Danielle Ferreira; Cavalcanti, Álvaro Roberto; Kocuvan, Aleksander; Rupnik, Maja; Santos, André Luiz Quagliatto; Junior, Carlos Augusto Oliveira; Lobato, Francisco Carlos Faria

    2014-08-01

    Despite some case reports, the importance of Clostridium perfringens and Clostridium difficile for wild carnivores remains unclear. Thus, the objective of this study was to identify C. perfringens and C. difficile strains in stool samples from wild carnivore species in Brazil. A total of 34 stool samples were collected and subjected to C. perfringens and C. difficile isolation. Suggestive colonies of C. perfringens were then analyzed for genes encoding the major C. perfringens toxins (alpha, beta, epsilon and iota) and the beta-2 toxin (cpb2), enterotoxin (cpe) and NetB (netb) genes. C. difficile strains were analyzed by multiplex-PCR for toxins A (tcdA) and B (tcdB) and a binary toxin gene (cdtB) and also submitted to a PCR ribotyping. Unthawed aliquots of samples positive for C. difficile isolation were subjected to the detection of A/B toxins by a cytotoxicity assay (CTA). C. perfringens was isolated from 26 samples (76.5%), all of which were genotyped as type A. The netb gene was not detected, whereas the cpb2 and cpe genes were found in nine and three C. perfringens strains, respectively. C. difficile was isolated from two (5.9%) samples. A non-toxigenic strain was recovered from a non-diarrheic maned wolf (Chrysocyon brachyurus). Conversely, a toxigenic strain was found in the sample of a diarrheic ocelot (Leopardus pardallis); an unthawed stool sample was also positive for A/B toxins by CTA, indicating a diagnosis of C. difficile-associated diarrhea in this animal. The present work suggests that wild carnivore species could carry C. difficile strains and that they could be susceptible to C. difficile infection. Copyright © 2014 Elsevier Ltd. All rights reserved.

  11. Mass Spectrometry Analysis of Wild-Type and Knock-in Q140/Q140 Huntington's Disease Mouse Brains Reveals Changes in Glycerophospholipids Including Alterations in Phosphatidic Acid and Lyso-Phosphatidic Acid.

    Science.gov (United States)

    Vodicka, Petr; Mo, Shunyan; Tousley, Adelaide; Green, Karin M; Sapp, Ellen; Iuliano, Maria; Sadri-Vakili, Ghazaleh; Shaffer, Scott A; Aronin, Neil; DiFiglia, Marian; Kegel-Gleason, Kimberly B

    2015-01-01

    Huntington's disease (HD) is a neurodegenerative disease caused by a CAG expansion in the HD gene, which encodes the protein Huntingtin. Huntingtin associates with membranes and can interact directly with glycerophospholipids in membranes. We analyzed glycerophospholipid profiles from brains of 11 month old wild-type (WT) and Q140/Q140 HD knock-in mice to assess potential changes in glycerophospholipid metabolism. Polar lipids from cerebellum, cortex, and striatum were extracted and analyzed by liquid chromatography and negative ion electrospray tandem mass spectrometry analysis (LC-MS/MS). Gene products involved in polar lipid metabolism were studied using western blotting, immuno-electron microscopy and qPCR. Significant changes in numerous species of glycerophosphate (phosphatidic acid, PA) were found in striatum, cerebellum and cortex from Q140/Q140 HD mice compared to WT mice at 11 months. Changes in specific species could also be detected for other glycerophospholipids. Increases in species of lyso-PA (LPA) were measured in striatum of Q140/Q140 HD mice compared to WT. Protein levels for c-terminal binding protein 1 (CtBP1), a regulator of PA biosynthesis, were reduced in striatal synaptosomes from HD mice compared to wild-type at 6 and 12 months. Immunoreactivity for CtBP1 was detected on membranes of synaptic vesicles in striatal axon terminals in the globus pallidus. These novel results identify a potential site of molecular pathology caused by mutant Huntingtin that may impart early changes in HD.

  12. Genetic Transformation of Artemisia carvifolia Buch with rol Genes Enhances Artemisinin Accumulation.

    Directory of Open Access Journals (Sweden)

    Erum Dilshad

    Full Text Available The potent antimalarial drug artemisinin has a high cost, since its only viable source to date is Artemisia annua (0.01-0.8% DW. There is therefore an urgent need to design new strategies to increase its production or to find alternative sources. In the current study, Artemisia carvifolia Buch was selected with the aim of detecting artemisinin and then enhancing the production of the target compound and its derivatives. These metabolites were determined by LC-MS in the shoots of A. carvifolia wild type plants at the following concentrations: artemisinin (8μg/g, artesunate (2.24μg/g, dihydroartemisinin (13.6μg/g and artemether (12.8μg/g. Genetic transformation of A. carvifolia was carried out with Agrobacterium tumefaciens GV3101 harboring the rol B and rol C genes. Artemisinin content increased 3-7-fold in transgenics bearing the rol B gene, and 2.3-6-fold in those with the rol C gene. A similar pattern was observed for artemisinin analogues. The dynamics of artemisinin content in transgenics and wild type A.carvifolia was also correlated with the expression of genes involved in its biosynthesis. Real time qPCR analysis revealed the differential expression of genes involved in artemisinin biosynthesis, i.e. those encoding amorpha-4, 11 diene synthase (ADS, cytochrome P450 (CYP71AV1, and aldehyde dehydrogenase 1 (ALDH1, with a relatively higher transcript level found in transgenics than in the wild type plant. Also, the gene related to trichome development and sesquiterpenoid biosynthesis (TFAR1 showed an altered expression in the transgenics compared to wild type A.carvifolia, which was in accordance with the trichome density of the respective plants. The trichome index was significantly higher in the rol B and rol C gene-expressing transgenics with an increased production of artemisinin, thereby demonstrating that the rol genes are effective inducers of plant secondary metabolism.

  13. Molecular comparison of the structural proteins encoding gene clusters of two related Lactobacillus delbrueckii bacteriophages.

    Science.gov (United States)

    Vasala, A; Dupont, L; Baumann, M; Ritzenthaler, P; Alatossava, T

    1993-01-01

    Virulent phage LL-H and temperate phage mv4 are two related bacteriophages of Lactobacillus delbrueckii. The gene clusters encoding structural proteins of these two phages have been sequenced and further analyzed. Six open reading frames (ORF-1 to ORF-6) were detected. Protein sequencing and Western immunoblotting experiments confirmed that ORF-3 (g34) encoded the main capsid protein Gp34. The presence of a putative late promoter in front of the phage LL-H g34 gene was suggested by primer extension experiments. Comparative sequence analysis between phage LL-H and phage mv4 revealed striking similarities in the structure and organization of this gene cluster, suggesting that the genes encoding phage structural proteins belong to a highly conservative module. Images PMID:8497043

  14. Reduced Neuronal Transcription of Escargot, the Drosophila Gene Encoding a Snail-Type Transcription Factor, Promotes Longevity

    Science.gov (United States)

    Symonenko, Alexander V.; Roshina, Natalia V.; Krementsova, Anna V.; Pasyukova, Elena G.

    2018-01-01

    In recent years, several genes involved in complex neuron specification networks have been shown to control life span. However, information on these genes is scattered, and studies to discover new neuronal genes and gene cascades contributing to life span control are needed, especially because of the recognized role of the nervous system in governing homeostasis, aging, and longevity. Previously, we demonstrated that several genes that encode RNA polymerase II transcription factors and that are involved in the development of the nervous system affect life span in Drosophila melanogaster. Among other genes, escargot (esg) was demonstrated to be causally associated with an increase in the life span of male flies. Here, we present new data on the role of esg in life span control. We show that esg affects the life spans of both mated and unmated males and females to varying degrees. By analyzing the survival and locomotion of the esg mutants, we demonstrate that esg is involved in the control of aging. We show that increased longevity is caused by decreased esg transcription. In particular, we demonstrate that esg knockdown in the nervous system increased life span, directly establishing the involvement of the neuronal esg function in life span control. Our data invite attention to the mechanisms regulating the esg transcription rate, which is changed by insertions of DNA fragments of different sizes downstream of the structural part of the gene, indicating the direction of further research. Our data agree with the previously made suggestion that alterations in gene expression during development might affect adult lifespan, due to epigenetic patterns inherited in cell lineages or predetermined during the development of the structural and functional properties of the nervous system. PMID:29760717

  15. A conserved gene family encodes transmembrane proteins with fibronectin, immunoglobulin and leucine-rich repeat domains (FIGLER

    Directory of Open Access Journals (Sweden)

    Haga Christopher L

    2007-09-01

    Full Text Available Abstract Background In mouse the cytokine interleukin-7 (IL-7 is required for generation of B lymphocytes, but human IL-7 does not appear to have this function. A bioinformatics approach was therefore used to identify IL-7 receptor related genes in the hope of identifying the elusive human cytokine. Results Our database search identified a family of nine gene candidates, which we have provisionally named fibronectin immunoglobulin leucine-rich repeat (FIGLER. The FIGLER 1–9 genes are predicted to encode type I transmembrane glycoproteins with 6–12 leucine-rich repeats (LRR, a C2 type Ig domain, a fibronectin type III domain, a hydrophobic transmembrane domain, and a cytoplasmic domain containing one to four tyrosine residues. Members of this multichromosomal gene family possess 20–47% overall amino acid identity and are differentially expressed in cell lines and primary hematopoietic lineage cells. Genes for FIGLER homologs were identified in macaque, orangutan, chimpanzee, mouse, rat, dog, chicken, toad, and puffer fish databases. The non-human FIGLER homologs share 38–99% overall amino acid identity with their human counterpart. Conclusion The extracellular domain structure and absence of recognizable cytoplasmic signaling motifs in members of the highly conserved FIGLER gene family suggest a trophic or cell adhesion function for these molecules.

  16. Establishment of new transmissible and drug-sensitive human immunodeficiency virus type 1 wild types due to transmission of nucleoside analogue-resistant virus.

    Science.gov (United States)

    de Ronde, A; van Dooren, M; van Der Hoek, L; Bouwhuis, D; de Rooij, E; van Gemen, B; de Boer, R; Goudsmit, J

    2001-01-01

    Sequence analysis of human immunodeficiency virus type 1 (HIV-1) from 74 persons with acute infections identified eight strains with mutations in the reverse transcriptase (RT) gene at positions 41, 67, 68, 70, 215, and 219 associated with resistance to the nucleoside analogue zidovudine (AZT). Follow-up of the fate of these resistant HIV-1 strains in four newly infected individuals revealed that they were readily replaced by sensitive strains. The RT of the resistant viruses changed at amino acid 215 from tyrosine (Y) to aspartic acid (D) or serine (S), with asparagine (N) as a transient intermediate, indicating the establishment of new wild types. When we introduced these mutations and the original threonine (T)-containing wild type into infectious molecular clones and assessed their competitive advantage in vitro, the order of fitness was in accord with the in vivo observations: 215Y types with D, S, or N residues at position 215 may be warranted in order to estimate the threat to long-term efficacy of regimens including nucleoside analogues.

  17. PfsR is a key regulator of iron homeostasis in Synechocystis PCC 6803.

    Directory of Open Access Journals (Sweden)

    Dan Cheng

    Full Text Available Iron is an essential cofactor in numerous cellular processes. The iron deficiency in the oceans affects the primary productivity of phytoplankton including cyanobacteria. In this study, we examined the function of PfsR, a TetR family transcriptional regulator, in iron homeostasis of the cyanobacterium Synechocystis PCC 6803. Compared with the wild type, the pfsR deletion mutant displayed stronger tolerance to iron limitation and accumulated significantly more chlorophyll a, carotenoid, and phycocyanin under iron-limiting conditions. The mutant also maintained more photosystem I and photosystem II complexes than the wild type after iron deprivation. In addition, the activities of photosystem I and photosystem II were much higher in pfsR deletion mutant than in wild-type cells under iron-limiting conditions. The transcripts of pfsR were enhanced by iron limitation and inactivation of the gene affected pronouncedly expression of fut genes (encoding a ferric iron transporter, feoB (encoding a ferrous iron transporter, bfr genes (encoding bacterioferritins, ho genes (encoding heme oxygenases, isiA (encoding a chlorophyll-binding protein, and furA (encoding a ferric uptake regulator. The iron quota in pfsR deletion mutant cells was higher than in wild-type cells both before and after exposure to iron limitation. Electrophoretic mobility shift assays showed that PfsR bound to its own promoter and thereby auto-regulated its own expression. These data suggest that PfsR is a critical regulator of iron homeostasis.

  18. Cross-species microarray hybridization to identify developmentally regulated genes in the filamentous fungus Sordaria macrospora.

    Science.gov (United States)

    Nowrousian, Minou; Ringelberg, Carol; Dunlap, Jay C; Loros, Jennifer J; Kück, Ulrich

    2005-04-01

    The filamentous fungus Sordaria macrospora forms complex three-dimensional fruiting bodies that protect the developing ascospores and ensure their proper discharge. Several regulatory genes essential for fruiting body development were previously isolated by complementation of the sterile mutants pro1, pro11 and pro22. To establish the genetic relationships between these genes and to identify downstream targets, we have conducted cross-species microarray hybridizations using cDNA arrays derived from the closely related fungus Neurospora crassa and RNA probes prepared from wild-type S. macrospora and the three developmental mutants. Of the 1,420 genes which gave a signal with the probes from all the strains used, 172 (12%) were regulated differently in at least one of the three mutants compared to the wild type, and 17 (1.2%) were regulated differently in all three mutant strains. Microarray data were verified by Northern analysis or quantitative real time PCR. Among the genes that are up- or down-regulated in the mutant strains are genes encoding the pheromone precursors, enzymes involved in melanin biosynthesis and a lectin-like protein. Analysis of gene expression in double mutants revealed a complex network of interaction between the pro gene products.

  19. Identification of herpes simplex virus type 1 proteins encoded within the first 1.5 kb of the latency-associated transcript.

    Science.gov (United States)

    Henderson, Gail; Jaber, Tareq; Carpenter, Dale; Wechsler, Steven L; Jones, Clinton

    2009-09-01

    Expression of the first 1.5 kb of the latency-associated transcript (LAT) that is encoded by herpes simplex virus type 1 (HSV-1) is sufficient for wild-type (wt) levels of reactivation from latency in small animal models. Peptide-specific immunoglobulin G (IgG) was generated against open reading frames (ORFs) that are located within the first 1.5 kb of LAT coding sequences. Cells stably transfected with LAT or trigeminal ganglionic neurons of mice infected with a LAT expressing virus appeared to express the L2 or L8 ORF. Only L2 ORF expression was readily detected in trigeminal ganglionic neurons of latently infected mice.

  20. Analysis of viral protein-2 encoding gene of avian encephalomyelitis virus from field specimens in Central Java region, Indonesia

    Directory of Open Access Journals (Sweden)

    Aris Haryanto

    2016-01-01

    Full Text Available Aim: Avian encephalomyelitis (AE is a viral disease which can infect various types of poultry, especially chicken. In Indonesia, the incidence of AE infection in chicken has been reported since 2009, the AE incidence tends to increase from year to year. The objective of this study was to analyze viral protein 2 (VP-2 encoding gene of AE virus (AEV from various species of birds in field specimen by reverse transcription polymerase chain reaction (RT-PCR amplification using specific nucleotides primer for confirmation of AE diagnosis. Materials and Methods: A total of 13 AEV samples are isolated from various species of poultry which are serologically diagnosed infected by AEV from some areas in central Java, Indonesia. Research stage consists of virus samples collection from field specimens, extraction of AEV RNA, amplification of VP-2 protein encoding gene by RT-PCR, separation of RT-PCR product by agarose gel electrophoresis, DNA sequencing and data analysis. Results: Amplification products of the VP-2 encoding gene of AEV by RT-PCR methods of various types of poultry from field specimens showed a positive results on sample code 499/4/12 which generated DNA fragment in the size of 619 bp. Sensitivity test of RT-PCR amplification showed that the minimum concentration of RNA template is 127.75 ng/μl. The multiple alignments of DNA sequencing product indicated that positive sample with code 499/4/12 has 92% nucleotide homology compared with AEV with accession number AV1775/07 and 85% nucleotide homology with accession number ZCHP2/0912695 from Genbank database. Analysis of VP-2 gene sequence showed that it found 46 nucleotides difference between isolate 499/4/12 compared with accession number AV1775/07 and 93 nucleotides different with accession number ZCHP2/0912695. Conclusions: Analyses of the VP-2 encoding gene of AEV with RT-PCR method from 13 samples from field specimen generated the DNA fragment in the size of 619 bp from one sample with

  1. Deleting multiple lytic genes enhances biomass yield and production of recombinant proteins by Bacillus subtilis.

    Science.gov (United States)

    Wang, Yi; Chen, Zhenmin; Zhao, Ruili; Jin, Tingting; Zhang, Xiaoming; Chen, Xiangdong

    2014-08-31

    Bacillus subtilis is widely used in agriculture and industrial biotechnology; however, cell autolysis significantly decreases its yield in liquid cultures. Numerous factors mediate the lysis of B. subtilis, such as cannibalism factors, prophages, and peptidoglycan (PG) hydrolases. The aim of this work was to use molecular genetic techniques to develop a new strategy to prevent cell lysis and enhance biomass as well as the production of recombinant proteins. Five genes or genetic elements representing three different functional categories were studied as follows: lytC encoding PG hydrolases, the prophage genes xpf and yqxG-yqxH-cwlA (yGlA), and skfA and sdpC that encode cannibalism factors. Cell lysis was reduced and biomass was enhanced by deleting individually skfA, sdpC, xpf, and lytC. We constructed the multiple deletion mutant LM2531 (skfA sdpC lytC xpf) and found that after 4 h of culture, its biomass yield was significantly increased compared with that of prototypical B. subtilis 168 (wild-type) strain and that 15% and 92% of the cells were lysed in cultures of LM2531 and wild-type, respectively. Moreover, two expression vectors were constructed for producing recombinant proteins (β-galactosidase and nattokinase) under the control of the P43 promoter. Cultures of LM2531 and wild-type transformants produced 13741 U/ml and 7991 U/ml of intracellular β-galactosidase, respectively (1.72-fold increase). Further, the level of secreted nattokinase produced by strain LM2531 increased by 2.6-fold compared with wild-type (5226 IU/ml vs. 2028 IU/ml, respectively). Our novel, systematic multigene deletion approach designed to inhibit cell lysis significantly increased the biomass yield and the production of recombinant proteins by B. subtilis. These findings show promise for guiding efforts to manipulate the genomes of other B. subtilis strains that are used for industrial purposes.

  2. Clinical and pathological associations with p53 tumour-suppressor gene mutations and expression of p21WAF1/Cip1 in colorectal carcinoma

    NARCIS (Netherlands)

    Slebos, R. J.; Baas, I. O.; Clement, M.; Polak, M.; Mulder, J. W.; van den Berg, F. M.; Hamilton, S. R.; Offerhaus, G. J.

    1996-01-01

    Inactivation of the p53 tumour-suppressor gene is common in a wide variety of human neoplasms. In the majority of cases, single point mutations in the protein-encoding sequence of p53 lead to positive immunohistochemistry (IHC) for the p53 protein, and are accompanied by loss of the wild-type

  3. A plasmid-encoded nicotinamidase (PncA) is essential for infectivity of Borrelia burgdorferi in a mammalian host.

    Science.gov (United States)

    Purser, Joye E; Lawrenz, Matthew B; Caimano, Melissa J; Howell, Jerrilyn K; Radolf, Justin D; Norris, Steven J

    2003-05-01

    Borrelia burgdorferi, a spirochaete that causes Lyme borreliosis, contains 21 linear and circular plasmids thought to be important for survival in mammals or ticks. Our results demonstrate that the gene BBE22 encoding a nicotinamidase is capable of replacing the requirement for the 25 kb linear plasmid lp25 during mammalian infection. Transformation of B. burgdorferi lacking lp25 with a shuttle vector containing the lp25 gene BBE22 (pBBE22) restored infectivity in mice to a level comparable to that of wild-type Borrelia. This complementation also restored the growth and host adaptation of lp25-B. burgdorferi in dialysis membrane chambers (DMCs) implanted in rats. A single Cys to Ala conversion at the putative active site of BBE22 abrogated the ability of pBBE22 to re-establish infectivity or growth in DMCs. Additional Salmonella typhimurium complementation studies and enzymatic analysis demonstrated that the BBE22 gene product has nicotinamidase activity and is most probably required for the biosynthesis of NAD. These results indicate that some plasmid-encoded products fulfil physiological functions required in the enzootic cycle of pathogenic Borrelia.

  4. RNAi-based silencing of genes encoding the vacuolar- ATPase ...

    African Journals Online (AJOL)

    2016-11-09

    Nov 9, 2016 ... Spodoptera exigua larval development by silencing chitin synthase gene with RNA interference. Bull. Entomol. Res. 98:613-619. Dow JAT (1999). The Multifunctional Drosophila melanogaster V-. ATPase is encoded by a multigene family. J. Bioenerg. Biomembr. 31:75-83. Fire A, Xu SQ, Montgomery MK, ...

  5. Functional characterization of MAT1-1-specific mating-type genes in the homothallic ascomycete Sordaria macrospora provides new insights into essential and nonessential sexual regulators.

    Science.gov (United States)

    Klix, V; Nowrousian, M; Ringelberg, C; Loros, J J; Dunlap, J C; Pöggeler, S

    2010-06-01

    Mating-type genes in fungi encode regulators of mating and sexual development. Heterothallic ascomycete species require different sets of mating-type genes to control nonself-recognition and mating of compatible partners of different mating types. Homothallic (self-fertile) species also carry mating-type genes in their genome that are essential for sexual development. To analyze the molecular basis of homothallism and the role of mating-type genes during fruiting-body development, we deleted each of the three genes, SmtA-1 (MAT1-1-1), SmtA-2 (MAT1-1-2), and SmtA-3 (MAT1-1-3), contained in the MAT1-1 part of the mating-type locus of the homothallic ascomycete species Sordaria macrospora. Phenotypic analysis of deletion mutants revealed that the PPF domain protein-encoding gene SmtA-2 is essential for sexual reproduction, whereas the alpha domain protein-encoding genes SmtA-1 and SmtA-3 play no role in fruiting-body development. By means of cross-species microarray analysis using Neurospora crassa oligonucleotide microarrays hybridized with S. macrospora targets and quantitative real-time PCR, we identified genes expressed under the control of SmtA-1 and SmtA-2. Both genes are involved in the regulation of gene expression, including that of pheromone genes.

  6. Identification of genes encoding the type IX secretion system and secreted proteins in Flavobacterium columnare IA-S-4

    Science.gov (United States)

    Flavobacterium columnare, a member of the phylum Bacteroidetes, causes columnaris disease in wild and aquaculture-reared freshwater fish. The mechanisms responsible for columnaris disease are not known. Many members of the phylum Bacteroidetes use type IX secretion systems (T9SSs) to secrete enzymes...

  7. Novel insertion mutation of ABCB1 gene in an ivermectin-sensitive Border Collie.

    Science.gov (United States)

    Han, Jae-Ik; Son, Hyoung-Won; Park, Seung-Cheol; Na, Ki-Jeong

    2010-12-01

    P-glycoprotein (P-gp) is encoded by the ABCB1 gene and acts as an efflux pump for xenobiotics. In the Border Collie, a nonsense mutation caused by a 4-base pair deletion in the ABCB1 gene is associated with a premature stop to P-gp synthesis. In this study, we examined the full-length coding sequence of the ABCB1 gene in an ivermectin-sensitive Border Collie that lacked the aforementioned deletion mutation. The sequence was compared to the corresponding sequences of a wild-type Beagle and seven ivermectin-tolerant family members of the Border Collie. When compared to the wild-type Beagle sequence, that of the ivermectin-sensitive Border Collie was found to have one insertion mutation and eight single nucleotide polymorphisms (SNPs) in the coding sequence of the ABCB1 gene. While the eight SNPs were also found in the family members' sequences, the insertion mutation was found only in the ivermectin-sensitive dog. These results suggest the possibility that the SNPs are species-specific features of the ABCB1 gene in Border Collies, and that the insertion mutation may be related to ivermectin intolerance.

  8. Role of wild-type p53 in apoptotic and non-apoptotic cell death induced by X-irradiation and heat treatment in p53-mutated mouse M10 cells

    International Nuclear Information System (INIS)

    Ito, Atsushi; Nakano, Hisako; Shinohara, Kunio

    2010-01-01

    The sensitizing effects of wild-type p53 on X-ray-induced cell death and on heat-induced apoptosis in M10, a radiosensitive and Trp53 (mouse p53 gene)-mutated lymphoma cell line which dies through necrosis by X-irradiation, were investigated using three M10 derived transfectants with wild-type TP53 (human p53 gene). Cell death was determined by colony formation and/or dye exclusion test, and apoptosis was detected as the changes in nuclear morphology by Giemsa staining. Expression of wild-type p53 protein increased radiosensitivity of cell death as determined by both clonogenic and dye exclusion assays. This increase in radiosensitivity was attributable largely to apoptosis induction in addition to a small enhancement of necrosis. Interestingly neither pathway to cell death was accompanied by caspase-3 activation. On the other hand, heat-induced caspase-3 dependent apoptotic cell death without transfection was further increased by the transfection of wild-type p53. In conclusion, the introduction of wild-type p53 enhanced apoptotic cell death by X-rays or heat via different mechanisms that do or do not activate caspase-3, respectively. In addition, p53 also enhanced the X-ray-induced necrosis in M10 cells. (author)

  9. Mutations in the Arabidopsis Lst8 and Raptor genes encoding partners of the TOR complex, or inhibition of TOR activity decrease abscisic acid (ABA) synthesis.

    Science.gov (United States)

    Kravchenko, Alena; Citerne, Sylvie; Jéhanno, Isabelle; Bersimbaev, Rakhmetkazhi I; Veit, Bruce; Meyer, Christian; Leprince, Anne-Sophie

    2015-11-27

    The Target of Rapamycin (TOR) kinase regulates essential processes in plant growth and development by modulation of metabolism and translation in response to environmental signals. In this study, we show that abscisic acid (ABA) metabolism is also regulated by the TOR kinase. Indeed ABA hormone level strongly decreases in Lst8-1 and Raptor3g mutant lines as well as in wild-type (WT) Arabidopsis plants treated with AZD-8055, a TOR inhibitor. However the growth and germination of these lines are more sensitive to exogenous ABA. The diminished ABA hormone accumulation is correlated with lower transcript levels of ZEP, NCED3 and AAO3 biosynthetic enzymes, and higher transcript amount of the CYP707A2 gene encoding a key-enzyme in abscisic acid catabolism. These results suggest that the TOR signaling pathway is implicated in the regulation of ABA accumulation in Arabidopsis. Copyright © 2015 Elsevier Inc. All rights reserved.

  10. Identification and Analysis of the Chloroplast rpoC1 Gene Differentially Expressed in Wild Ginseng

    Directory of Open Access Journals (Sweden)

    Lee Kwang-Ho

    2012-06-01

    Full Text Available Panax ginseng is a well-known herbal medicine in traditional Asian medicine, and wild ginseng is widely accepted to be more active than cultivated ginseng in chemoprevention. However, little has actually been reported on the difference between wild ginseng and cultivated ginseng. Thus, to identify and analyze those differences, we used suppressive subtraction hybridization (SSH sequences with microarrays, realtime polymerase chain reaction (PCR, and reverse transcription PCRs (RT-PCRs. One of the clones isolated in this research was the chloroplast rpoC1 gene, a β subunit of RNA polymerase. Real-time RT-PCR results showed that the expression of the rpoC1 gene was significantly upregulated in wild ginseng as compared to cultivated ginseng, so, we conclude that the rpoC1 gene may be one of the important markers of wild ginseng.

  11. Identification and characterization of the genes encoding the core histones and histone variants of Neurospora crassa.

    OpenAIRE

    Hays, Shan M; Swanson, Johanna; Selker, Eric U

    2002-01-01

    We have identified and characterized the complete complement of genes encoding the core histones of Neurospora crassa. In addition to the previously identified pair of genes that encode histones H3 and H4 (hH3 and hH4-1), we identified a second histone H4 gene (hH4-2), a divergently transcribed pair of genes that encode H2A and H2B (hH2A and hH2B), a homolog of the F/Z family of H2A variants (hH2Az), a homolog of the H3 variant CSE4 from Saccharomyces cerevisiae (hH3v), and a highly diverged ...

  12. Identification of Genes Encoding the Folate- and Thiamine-Binding Membrane Proteins in Firmicutes

    NARCIS (Netherlands)

    Eudes, Aymerick; Erkens, Guus B.; Slotboom, Dirk J.; Rodionov, Dmitry A.; Naponelli, Valeria; Hanson, Andrew D.

    Genes encoding high-affinity folate- and thiamine-binding proteins (FolT, ThiT) were identified in the Lactobacillus casei genome, expressed in Lactococcus lactis, and functionally characterized. Similar genes occur in many Firmicutes, sometimes next to folate or thiamine salvage genes. Most thiT

  13. Environmental cycle of antibiotic resistance encoded genes: A systematic review

    Directory of Open Access Journals (Sweden)

    R. ghanbari

    2017-12-01

    Full Text Available Antibiotic-resistant bacteria and genes enter the environment in different ways. The release of these factors into the environment has increased concerns related to public health. The aim of the study was to evaluate the antibiotic resistance genes (ARGs in the environmental resources. In this systematic review, the data were extracted from valid sources of information including ScienceDirect, PubMed, Google Scholar and SID. Evaluation and selection of articles were conducted on the basis of the PRISMA checklist. A total of 39 articles were included in the study, which were chosen from a total of 1249 papers. The inclusion criterion was the identification of genes encoding antibiotic resistance against the eight important groups of antibiotics determined by using the PCR technique in the environmental sources including municipal and hospital wastewater treatment plants, animal and agricultural wastes, effluents from treatment plants, natural waters, sediments, and drinking waters. In this study, 113 genes encoding antibiotic resistance to eight groups of antibiotics (beta-lactams, aminoglycosides, tetracyclines, macrolides, sulfonamides, chloramphenicol, glycopeptides and quinolones were identified in various environments. Antibiotic resistance genes were found in all the investigated environments. The investigation of microorganisms carrying these genes shows that most of the bacteria especially gram-negative bacteria are effective in the acquisition and the dissemination of these pollutants in the environment. Discharging the raw wastewaters and effluents from wastewater treatments acts as major routes in the dissemination of ARGs into environment sources and can pose hazards to public health.

  14. Fungicidal activity of peptides encoded by immunoglobulin genes

    OpenAIRE

    Polonelli, Luciano; Ciociola, Tecla; Sperind?, Martina; Giovati, Laura; D?Adda, Tiziana; Galati, Serena; Travassos, Luiz R.; Magliani, Walter; Conti, Stefania

    2017-01-01

    Evidence from previous works disclosed the antimicrobial, antiviral, anti-tumour and/or immunomodulatory activity exerted, through different mechanisms of action, by peptides expressed in the complementarity-determining regions or even in the constant region of antibodies, independently from their specificity and isotype. Presently, we report the selection, from available databases, of peptide sequences encoded by immunoglobulin genes for the evaluation of their potential biological activitie...

  15. The type VI secretion system encoded in SPI-6 plays a role in gastrointestinal colonization and systemic spread of Salmonella enterica serovar Typhimurium in the chicken.

    Directory of Open Access Journals (Sweden)

    David Pezoa

    Full Text Available The role of the Salmonella Pathogenicity Islands (SPIs in pathogenesis of Salmonella enterica Typhimurium infection in the chicken is poorly studied, while many studies have been completed in murine models. The Type VI Secretion System (T6SS is a recently described protein secretion system in Gram-negative bacteria. The genus Salmonella contains five phylogenetically distinct T6SS encoded in differentially distributed genomic islands. S. Typhimurium harbors a T6SS encoded in SPI-6 (T6SSSPI-6, which contributes to the ability of Salmonella to colonize mice. On the other hand, serotype Gallinarum harbors a T6SS encoded in SPI-19 (T6SSSPI-19 that is required for colonization of chicks. In this work, we investigated the role of T6SSSPI-6 in infection of chicks by S. Typhimurium. Oral infection of White Leghorn chicks showed that a ΔT6SSSPI-6 mutant had reduced colonization of the gut and internal organs, compared with the wild-type strain. Transfer of the intact T6SSSPI-6 gene cluster into the T6SS mutant restored bacterial colonization. In addition, our results showed that transfer of T6SSSPI-19 from S. Gallinarum to the ΔT6SSSPI-6 mutant of S. Typhimurium not only complemented the colonization defect but also resulted in a transient increase in the colonization of the cecum and ileum of chicks at days 1 and 3 post-infection. Our data indicates that T6SSSPI-6 contributes to chicken colonization and suggests that both T6SSSPI-6 and T6SSSPI-19 perform similar functions in vivo despite belonging to different phylogenetic families.

  16. The plastid-localized pfkB-type carbohydrate kinases FRUCTOKINASE-LIKE 1 and 2 are essential for growth and development of Arabidopsis thaliana

    Directory of Open Access Journals (Sweden)

    Gilkerson Jonathan

    2012-07-01

    Full Text Available Abstract Background Transcription of plastid-encoded genes requires two different DNA-dependent RNA polymerases, a nuclear-encoded polymerase (NEP and plastid-encoded polymerase (PEP. Recent studies identified two related pfkB-type carbohydrate kinases, named FRUCTOKINASE-LIKE PROTEIN (FLN1 and FLN2, as components of the thylakoid bound PEP complex in both Arabidopsis thaliana and Sinapis alba (mustard. Additional work demonstrated that RNAi-mediated reduction in FLN expression specifically diminished transcription of PEP-dependent genes. Results Here, we report the characterization of Arabidopsis FLN knockout alleles to examine the contribution of each gene in plant growth, chloroplast development, and in mediating PEP-dependent transcription. We show that fln plants have severe phenotypes with fln1 resulting in an albino phenotype that is seedling lethal without a source of exogenous carbon. In contrast, fln2 plants display chlorosis prior to leaf expansion, but exhibit slow greening, remain autotrophic, can grow to maturity, and set viable seed. fln1 fln2 double mutant analysis reveals haplo-insufficiency, and fln1 fln2 plants have a similar, but more severe phenotype than either single mutant. Normal plastid development in both light and dark requires the FLNs, but surprisingly skotomorphogenesis is unaffected in fln seedlings. Seedlings genetically fln1-1 with dexamethasone-inducible FLN1-HA expression at germination are phenotypically indistinguishable from wild-type. Induction of FLN-HA after 24 hours of germination cannot rescue the mutant phenotype, indicating that the effects of loss of FLN are not always reversible. Examination of chloroplast gene expression in fln1-1 and fln2-1 by qRT-PCR reveals that transcripts of PEP-dependent genes were specifically reduced compared to NEP-dependent genes in both single mutants. Conclusions Our results demonstrate that each FLN protein contributes to wild type growth, and acting additively are

  17. EUI1, encoding a putative cytochrome P450 monooxygenase, regulates internode elongation by modulating gibberellin responses in rice.

    Science.gov (United States)

    Luo, Anding; Qian, Qian; Yin, Hengfu; Liu, Xiaoqiang; Yin, Changxi; Lan, Ying; Tang, Jiuyou; Tang, Zuoshun; Cao, Shouyun; Wang, Xiujie; Xia, Kai; Fu, Xiangdong; Luo, Da; Chu, Chengcai

    2006-02-01

    Elongation of rice internodes is one of the most important agronomic traits, which determines the plant height and underlies the grain yield. It has been shown that the elongation of internodes is under genetic control, and various factors are implicated in the process. Here, we report a detailed characterization of an elongated uppermost internode1 (eui1) mutant, which has been used in hybrid rice breeding. In the eui1-2 mutant, the cell lengths in the uppermost internodes are significantly longer than that of wild type and thus give rise to the elongated uppermost internode. It was found that the level of active gibberellin was elevated in the mutant, whereas its growth in response to gibberellin is similar to that of the wild type, suggesting that the higher level accumulation of gibberellin in the eui1 mutant causes the abnormal elongation of the uppermost internode. Consistently, the expression levels of several genes which encode gibberellin biosynthesis enzymes were altered. We cloned the EUI1 gene, which encodes a putative cytochrome P450 monooxygenase, by map-based cloning and found that EUI1 was weakly expressed in most tissues, but preferentially in young panicles. To confirm its function, transgenic experiments with different constructs of EUI1 were conducted. Overexpression of EUI1 gave rise to the gibberellin-deficient-like phenotypes, which could be partially reversed by supplementation with gibberellin. Furthermore, apart from the alteration of expression levels of the gibberellin biosynthesis genes, accumulation of SLR1 protein was found in the overexpressing transgenic plants, indicating that the expression level of EUI1 is implicated in both gibberellin-mediated SLR1 destruction and a feedback regulation in gibberellin biosynthesis. Therefore, we proposed that EUI1 plays a negative role in gibberellin-mediated regulation of cell elongation in the uppermost internode of rice.

  18. Expression analysis of the Theileria parva subtelomere-encoded variable secreted protein gene family.

    Directory of Open Access Journals (Sweden)

    Jacqueline Schmuckli-Maurer

    Full Text Available The intracellular protozoan parasite Theileria parva transforms bovine lymphocytes inducing uncontrolled proliferation. Proteins released from the parasite are assumed to contribute to phenotypic changes of the host cell and parasite persistence. With 85 members, genes encoding subtelomeric variable secreted proteins (SVSPs form the largest gene family in T. parva. The majority of SVSPs contain predicted signal peptides, suggesting secretion into the host cell cytoplasm.We analysed SVSP expression in T. parva-transformed cell lines established in vitro by infection of T or B lymphocytes with cloned T. parva parasites. Microarray and quantitative real-time PCR analysis revealed mRNA expression for a wide range of SVSP genes. The pattern of mRNA expression was largely defined by the parasite genotype and not by host background or cell type, and found to be relatively stable in vitro over a period of two months. Interestingly, immunofluorescence analysis carried out on cell lines established from a cloned parasite showed that expression of a single SVSP encoded by TP03_0882 is limited to only a small percentage of parasites. Epitope-tagged TP03_0882 expressed in mammalian cells was found to translocate into the nucleus, a process that could be attributed to two different nuclear localisation signals.Our analysis reveals a complex pattern of Theileria SVSP mRNA expression, which depends on the parasite genotype. Whereas in cell lines established from a cloned parasite transcripts can be found corresponding to a wide range of SVSP genes, only a minority of parasites appear to express a particular SVSP protein. The fact that a number of SVSPs contain functional nuclear localisation signals suggests that proteins released from the parasite could contribute to phenotypic changes of the host cell. This initial characterisation will facilitate future studies on the regulation of SVSP gene expression and the potential biological role of these enigmatic

  19. Labeled Azospirillum brasilense wild type and excretion-ammonium strains in association with barley roots.

    Science.gov (United States)

    Santos, Adrian Richard Schenberger; Etto, Rafael Mazer; Furmam, Rafaela Wiegand; Freitas, Denis Leandro de; Santos, Karina Freire d'Eça Nogueira; Souza, Emanuel Maltempi de; Pedrosa, Fábio de Oliveira; Ayub, Ricardo Antônio; Steffens, Maria Berenice Reynaud; Galvão, Carolina Weigert

    2017-09-01

    Soil bacteria colonization in plants is a complex process, which involves interaction between many bacterial characters and plant responses. In this work, we labeled Azospirillum brasilense FP2 (wild type) and HM053 (excretion-ammonium) strains by insertion of the reporter gene gusA-kanamycin into the dinitrogenase reductase coding gene, nifH, and evaluated bacteria colonization in barley (Hordeum vulgare). In addition, we determined inoculation effect based on growth promotion parameters. We report an uncommon endophytic behavior of A. brasilense Sp7 derivative inside the root hair cells of barley and highlight the promising use of A. brasilense HM053 as plant growth-promoting bacterium. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

  20. Cloning of an epoxide hydrolase encoding gene from Rhodotorula mucilaginosa and functional expresion in Yarrowia lipolytica

    CSIR Research Space (South Africa)

    Labuschagne, M

    2007-01-01

    Full Text Available , were used to amplify the genomic EH-encoding gene from Rhodotorula mucilaginosa. The 2347 bp genomic sequence revealed a 1979 bp ORF containing nine introns. The cDNA sequence revealed an 1185 bp EH-encoding gene that translates into a 394 amino acid...

  1. Functional Characterization of MAT1-1-Specific Mating-Type Genes in the Homothallic Ascomycete Sordaria macrospora Provides New Insights into Essential and Nonessential Sexual Regulators▿†

    Science.gov (United States)

    Klix, V.; Nowrousian, M.; Ringelberg, C.; Loros, J. J.; Dunlap, J. C.; Pöggeler, S.

    2010-01-01

    Mating-type genes in fungi encode regulators of mating and sexual development. Heterothallic ascomycete species require different sets of mating-type genes to control nonself-recognition and mating of compatible partners of different mating types. Homothallic (self-fertile) species also carry mating-type genes in their genome that are essential for sexual development. To analyze the molecular basis of homothallism and the role of mating-type genes during fruiting-body development, we deleted each of the three genes, SmtA-1 (MAT1-1-1), SmtA-2 (MAT1-1-2), and SmtA-3 (MAT1-1-3), contained in the MAT1-1 part of the mating-type locus of the homothallic ascomycete species Sordaria macrospora. Phenotypic analysis of deletion mutants revealed that the PPF domain protein-encoding gene SmtA-2 is essential for sexual reproduction, whereas the α domain protein-encoding genes SmtA-1 and SmtA-3 play no role in fruiting-body development. By means of cross-species microarray analysis using Neurospora crassa oligonucleotide microarrays hybridized with S. macrospora targets and quantitative real-time PCR, we identified genes expressed under the control of SmtA-1 and SmtA-2. Both genes are involved in the regulation of gene expression, including that of pheromone genes. PMID:20435701

  2. Comparative Study of Nonautolytic Mutant and Wild-Type Strains of Coprinopsis cinerea Supports an Important Role of Glucanases in Fruiting Body Autolysis.

    Science.gov (United States)

    Liu, Zhonghua; Niu, Xin; Wang, Jun; Zhang, Wenming; Yang, Mingmei; Liu, Cuicui; Xiong, Yuanjing; Zhao, Yan; Pei, Siyu; Qin, Qin; Zhang, Yu; Yu, Yuan; Yuan, Sheng

    2015-11-04

    Autolysis of Coprinopsis cinerea fruiting bodies affects its commercial value. In this study, a mutant of C. cinerea that exhibits pileus expansion without pileus autolysis was obtained using ultraviolet mutagenesis. This suggests that pileus expansion and pileus autolysis involve different enzymes or proteins. Among the detected hydrolytic enzymes, only β-1,3-glucanase activity increased with expansion and autolysis of pilei in the wild-type strain, but the increase was abolished in the mutant. This suggests that β-1,3-glucanases plays a major role in the autolysis. Although there are 43 possible β-1,3-glucoside hydrolases genes, only 4 known genes, which have products that are thought to act synergistically to degrade the β-1,3-glucan backbone of cell walls during fruiting body autolysis, and an unreported gene were upregulated during pileus expansion and autolysis in the wild-type stain but were suppressed in the mutant. This suggests that expression of these β-1,3-glucanases is potentially controlled by a single regulatory mechanism.

  3. Co-expression of an Erwinia chrysanthemi pectate lyase-encoding gene (pelE) and an E. carotovora polygalacturonase-encoding gene (peh1) in Saccharomyces cerevisiae.

    Science.gov (United States)

    Laing, E; Pretorius, I S

    1993-05-01

    A pectate lyase (PL)-encoding gene (pelE) from Erwinia chrysanthemi and a polygalacturonase (PG)-encoding gene (peh1) from E. carotovora were each inserted between a novel yeast expression-secretion cassette and a yeast gene terminator, and cloned separately into a yeast-centromeric shuttle vector (YCp50), generating recombinant plasmids pAMS12 and pAMS13. Transcription initiation signals present in the expression-secretion cassette were derived from the yeast alcohol dehydrogenase gene promoter (ADC1P), whereas the transcription termination signals were derived from the yeast tryptophan synthase gene terminator (TRP5T). Secretion of PL and PG was directed by the signal sequence of the yeast mating pheromone alpha-factor (MF alpha 1s). A pectinase cassette comprising ADC1P-MF alpha 1s-pelE-TRP5T and ADC1P-MF alpha 1s-peh1-TRP5T was subcloned into YCp50, generating plasmid pAMS14. Subsequently, the dominant selectable Geneticin G418-resistance (GtR) marker, APH1, inserted between the yeast uridine diphosphoglucose 4-epimerase gene promoter (GAL10P) and yeast orotidine-5'-phosphate carboxylase gene terminator (URA3T), was cloned into pAMS14, resulting in plasmid pAMS15. Plasmids pAMS12, pAMS13 and pAMS14 were transformed into a laboratory strain of Saccharomyces cerevisiae, whereas pAMS15 was stably introduced into two commercial wine yeast strains. DNA-DNA and DNA-RNA hybridization analyses revealed the presence of these plasmids, and the pelE and peh1 transcripts in the yeast transformants, respectively. A polypectate agarose assay indicated the extracellular production of biologically active PL and PG by the S. cerevisiae transformants and confirmed that co-expression of the pelE and peh1 genes synergistically enhanced pectate degradation.

  4. Comparative Study on Growth Performance of Transgenic (Over-Expressed OsNHX1 and Wild-Type Nipponbare under Different Salinity Regimes

    Directory of Open Access Journals (Sweden)

    Nurul Kahrani ISHAK

    2015-11-01

    Full Text Available Transgenic Nipponbare which over-expressed a Na+/H+ antiporter gene OsNHX1 was used to compare its growth performance, water status and photosynthetic efficiency with its wild type under varying salinity regimes. Chlorophyll content, quantum yield and photosynthetic rate were measured to assess the impact of salinity stress on photosynthetic efficiency for transgenic and wild-type Nipponbare. Effects of salinity on water status and gas exchange to both lines were studied by measuring water use efficiency, instantaneous transpiration rate and stomatal conductance. Dry shoot weight and leaf area were determined after three months of growth to assess the impacts of salinity on the growth of those two lines. Our study showed that both lines were affected by salinity stress, however, the transgenic line showed higher photosynthetic efficiency, better utilization of water, and better growth due to low transpiration rate and stomatal conductance. Reduction of photosynthetic efficiency exhibited by the wild-type Nipponbare was correlated to its poor growth under salinity stress.

  5. Nucleotide sequence of the Agrobacterium tumefaciens octopine Ti plasmid-encoded tmr gene

    NARCIS (Netherlands)

    Heidekamp, F.; Dirkse, W.G.; Hille, J.; Ormondt, H. van

    1983-01-01

    The nucleotide sequence of the tmr gene, encoded by the octopine Ti plasmid from Agrobacterium tumefaciens (pTiAch5), was determined. The T-DNA, which encompasses this gene, is involved in tumor formation and maintenance, and probably mediates the cytokinin-independent growth of transformed plant

  6. [Divergence of paralogous growth-hormone-encoding genes and their promoters in Salmonidae].

    Science.gov (United States)

    Kamenskaya, D N; Pankova, M V; Atopkin, D M; Brykov, V A

    2017-01-01

    In many fish species, including salmonids, the growth-hormone is encoded by two duplicated paralogous genes, gh1 and gh2. Both genes were already in place at the time of divergence of species in this group. A comparison of the entire sequence of these genes of salmonids has shown that their conserved regions are associated with exons, while their most variable regions correspond to introns. Introns C and D include putative regulatory elements (sites Pit-1, CRE, and ERE), that are also conserved. In chars, the degree of polymorphism of gh2 gene is 2-3 times as large as that in gh1 gene. However, a comparison across all Salmonidae species would not extent this observation to other species. In both these chars' genes, the promoters are conserved mainly because they correspond to putative regulatory sequences (TATA box, binding sites for the pituitary transcription factor Pit-1 (F1-F4), CRE, GRE and RAR/RXR elements). The promoter of gh2 gene has a greater degree of polymorphism compared with gh1 gene promoter in all investigated species of salmonids. The observed differences in the rates of accumulation of changes in growth hormone encoding paralogs could be explained by differences in the intensity of selection.

  7. Relationships between protein-encoding gene abundance and corresponding process are commonly assumed yet rarely observed

    Science.gov (United States)

    Rocca, Jennifer D.; Hall, Edward K.; Lennon, Jay T.; Evans, Sarah E.; Waldrop, Mark P.; Cotner, James B.; Nemergut, Diana R.; Graham, Emily B.; Wallenstein, Matthew D.

    2015-01-01

    For any enzyme-catalyzed reaction to occur, the corresponding protein-encoding genes and transcripts are necessary prerequisites. Thus, a positive relationship between the abundance of gene or transcripts and corresponding process rates is often assumed. To test this assumption, we conducted a meta-analysis of the relationships between gene and/or transcript abundances and corresponding process rates. We identified 415 studies that quantified the abundance of genes or transcripts for enzymes involved in carbon or nitrogen cycling. However, in only 59 of these manuscripts did the authors report both gene or transcript abundance and rates of the appropriate process. We found that within studies there was a significant but weak positive relationship between gene abundance and the corresponding process. Correlations were not strengthened by accounting for habitat type, differences among genes or reaction products versus reactants, suggesting that other ecological and methodological factors may affect the strength of this relationship. Our findings highlight the need for fundamental research on the factors that control transcription, translation and enzyme function in natural systems to better link genomic and transcriptomic data to ecosystem processes.

  8. Concerning RNA-guided gene drives for the alteration of wild populations.

    Science.gov (United States)

    Esvelt, Kevin M; Smidler, Andrea L; Catteruccia, Flaminia; Church, George M

    2014-07-17

    Gene drives may be capable of addressing ecological problems by altering entire populations of wild organisms, but their use has remained largely theoretical due to technical constraints. Here we consider the potential for RNA-guided gene drives based on the CRISPR nuclease Cas9 to serve as a general method for spreading altered traits through wild populations over many generations. We detail likely capabilities, discuss limitations, and provide novel precautionary strategies to control the spread of gene drives and reverse genomic changes. The ability to edit populations of sexual species would offer substantial benefits to humanity and the environment. For example, RNA-guided gene drives could potentially prevent the spread of disease, support agriculture by reversing pesticide and herbicide resistance in insects and weeds, and control damaging invasive species. However, the possibility of unwanted ecological effects and near-certainty of spread across political borders demand careful assessment of each potential application. We call for thoughtful, inclusive, and well-informed public discussions to explore the responsible use of this currently theoretical technology.

  9. Fructose 6-phosphate phosphoketolase activity in wild-type strains of Lactobacillus, isolated from the intestinal tract of pigs.

    Science.gov (United States)

    Bolado-Martínez, E; Acedo-Félix, E; Peregrino-Uriarte, A B; Yepiz-Plascencia, G

    2012-01-01

    Phosphoketolases are key enzymes of the phosphoketolase pathway of heterofermentative lactic acid bacteria, which include lactobacilli. In heterofermentative lactobacilli xylulose 5-phosphate phosphoketolase (X5PPK) is the main enzyme of the phosphoketolase pathway. However, activity of fructose 6-phosphate phosphoketolase (F6PPK) has always been considered absent in lactic acid bacteria. In this study, the F6PPK activity was detected in 24 porcine wild-type strains of Lactobacillus reuteri and Lactobacillus mucosae, but not in the Lactobacillus salivarius or in L. reuteri ATCC strains. The activity of F6PPK increased after treatment of the culture at low-pH and diminished after porcine bile-salts stress conditions in wild-type strains of L. reuteri. Colorimetric quantification at 505 nm allowed to differentiate between microbial strains with low activity and without the activity of F6PPK. Additionally, activity of F6PPK and the X5PPK gene expression levels were evaluated by real time PCR, under stress and nonstress conditions, in 3 L. reuteri strains. Although an exact correlation, between enzyme activity and gene expression was not obtained, it remains possible that the xpk gene codes for a phosphoketolase with dual substrate, at least in the analyzed strains of L. reuteri.

  10. The carB gene encoding the large subunit of carbamoylphosphate synthetase from Lactococcus lactis is transcribed monocistronically

    DEFF Research Database (Denmark)

    Martinussen, Jan; Hammer, Karin

    1998-01-01

    The biosynthesis of carbamoylphosphate is catalysed by the heterodimeric enzyme carbamoylphosphate synthetase (CPSase). The genes encoding the two subunits in procaryotes are normally transcribed as an operon, whereas in Lactococcus lactis, the gene encoding the large subunit (carB) is shown...

  11. Mathematical model of the SOS response regulation in wild-type Escherichia coli

    International Nuclear Information System (INIS)

    Aksenov, S.V.

    1997-01-01

    Regulation of the SOS response in Escherichia coli, which is a set of inducible cellular reactions introduced after DNA damage, is due to specific interaction of LexA and RecA proteins. LexA protein is a common repressor of the genes of the SOS system, and RecA protein, once transiently activated by the so-called SOS-inducing signal, promotes LexA protein destruction. We have described the SOS regulation by means of differential equations with regard to LexA and RecA concentrations elsewhere. The 'input' function for model equations is the level of the SOS-inducing signal against time. Here we present a means for calculating the concentration of single-stranded DNA (SOS-inducing signal) as a function of time in wild-type cells after ultraviolet irradiation. With model equations one can simulate kinetic curves of SOS regulatory proteins after DNA damage to survey the SOS response kinetics. Simulation of LexA protein kinetics agrees with experimental data. We compare simulated LexA kinetic curves in wild-type and uνr - mutant bacteria, which is useful in investigating the way uνrABC-dependent excision repair modulates the SOS response kinetics. Possible applications of the model to investigating various aspects of the SOS induction are discussed

  12. Codon Optimization Significantly Improves the Expression Level of α-Amylase Gene from Bacillus licheniformis in Pichia pastoris

    Directory of Open Access Journals (Sweden)

    Jian-Rong Wang

    2015-01-01

    Full Text Available α-Amylase as an important industrial enzyme has been widely used in starch processing, detergent, and paper industries. To improve expression efficiency of recombinant α-amylase from Bacillus licheniformis (B. licheniformis, the α-amylase gene from B. licheniformis was optimized according to the codon usage of Pichia pastoris (P. pastoris and expressed in P. pastoris. Totally, the codons encoding 305 amino acids were optimized in which a total of 328 nucleotides were changed and the G+C content was increased from 47.6 to 49.2%. The recombinants were cultured in 96-deep-well microplates and screened by a new plate assay method. Compared with the wild-type gene, the optimized gene is expressed at a significantly higher level in P. pastoris after methanol induction for 168 h in 5- and 50-L bioreactor with the maximum activity of 8100 and 11000 U/mL, which was 2.31- and 2.62-fold higher than that by wild-type gene. The improved expression level makes the enzyme a good candidate for α-amylase production in industrial use.

  13. A single Danio rerio hars gene encodes both cytoplasmic and mitochondrial histidyl-tRNA synthetases.

    Directory of Open Access Journals (Sweden)

    Ashley L Waldron

    Full Text Available Histidyl tRNA Synthetase (HARS is a member of the aminoacyl tRNA synthetase (ARS family of enzymes. This family of 20 enzymes is responsible for attaching specific amino acids to their cognate tRNA molecules, a critical step in protein synthesis. However, recent work highlighting a growing number of associations between ARS genes and diverse human diseases raises the possibility of new and unexpected functions in this ancient enzyme family. For example, mutations in HARS have been linked to two different neurological disorders, Usher Syndrome Type IIIB and Charcot Marie Tooth peripheral neuropathy. These connections raise the possibility of previously undiscovered roles for HARS in metazoan development, with alterations in these functions leading to complex diseases. In an attempt to establish Danio rerio as a model for studying HARS functions in human disease, we characterized the Danio rerio hars gene and compared it to that of human HARS. Using a combination of bioinformatics, molecular biology, and cellular approaches, we found that while the human genome encodes separate genes for cytoplasmic and mitochondrial HARS protein, the Danio rerio genome encodes a single hars gene which undergoes alternative splicing to produce the respective cytoplasmic and mitochondrial versions of Hars. Nevertheless, while the HARS genes of humans and Danio differ significantly at the genomic level, we found that they are still highly conserved at the amino acid level, underscoring the potential utility of Danio rerio as a model organism for investigating HARS function and its link to human diseases in vivo.

  14. Overexpression of PaFT gene in the wild orchid Phalaenopsis amabilis (L.) Blume

    Science.gov (United States)

    Semiarti, Endang; Mercuriani, Ixora S.; Rizal, Rinaldi; Slamet, Agus; Utami, Bekti S.; Bestari, Ida A.; Aziz-Purwantoro, Moeljopawiro, S.; Jang, Soenghoe; Machida, Y.; Machida, C.

    2015-09-01

    To shorten vegetative stage and induce transition from vegetative to reproductive stage in orchids, we overexpressed Phalaenopsis amabilis Flowering LocusT (PaFT) gene under the control of Ubiquitin promoter into protocorm of Indonesian Wild Orchid Phalaenopsis amabilis (L.) Blume. The dynamic expression of vegetative gene Phalaenopsis Homeobox1 (POH1) and flowering time gene PaFT has been analyzed. Accumulation of mRNA was detected in shoot and leaves of both transgenic and non transgenic plants by using Reverse transcriptase-PCR (RT-PCR) with specific gene primers for POH1 and PaFT in 24 months old plants. To analyze the POH1 and PaFT genes, three pairs of degenerate primers PaFT degF1R1, F2R2 and F3R3 that amplified 531 bp PaFT cDNA were used. We detected 700 bp PaFTcDNA from leaves and shoots of transgenic plants, but not in NT plants. POH1 mRNA was detected in plants. PaFT protein consists of Phospatidyl Ethanolamine-Binding Protein (PEBP) in interval base 73-483 and CETS family protein at base 7-519, which are important motif for transmembrane protein. We inserted Ubipro::PaFT/pGAS101 into P. amabilis protocorm using Agrobacterium. Analysis of transgenic plants showed that PaFTmRNA was accumulated in leaves of 12 months after sowing, although it is not detected in non transgeic plants. Compare to the wild type (NT plants), ectopic expression of PaFT shows alter phenotype as follows: 31% normal, 19% with short-wavy leaves, 5% form rosette leaves and 45% produced multishoots. Analysis of protein profiles of trasgenic plants showed that a putative PaFT protein (MW 19,7 kDa) was produced in 1eaves and shoots.This means that at 12 months, POH1 gene expression gradually decreased/negatively regulated, the expression of PaFT gene was activated, although there is no flower initiation yet. Some environmental factors might play a role to induce inflorescens. This experiment is in progress.

  15. Repetitive DNA and Plant Domestication: Variation in Copy Number and Proximity to Genes of LTR-Retrotransposons among Wild and Cultivated Sunflower (Helianthus annuus) Genotypes.

    Science.gov (United States)

    Mascagni, Flavia; Barghini, Elena; Giordani, Tommaso; Rieseberg, Loren H; Cavallini, Andrea; Natali, Lucia

    2015-11-24

    The sunflower (Helianthus annuus) genome contains a very large proportion of transposable elements, especially long terminal repeat retrotransposons. However, knowledge on the retrotransposon-related variability within this species is still limited. We used next-generation sequencing (NGS) technologies to perform a quantitative and qualitative survey of intraspecific variation of the retrotransposon fraction of the genome across 15 genotypes--7 wild accessions and 8 cultivars--of H. annuus. By mapping the Illumina reads of the 15 genotypes onto a library of sunflower long terminal repeat retrotransposons, we observed considerable variability in redundancy among genotypes, at both superfamily and family levels. In another analysis, we mapped Illumina paired reads to two sets of sequences, that is, long terminal repeat retrotransposons and protein-encoding sequences, and evaluated the extent of retrotransposon proximity to genes in the sunflower genome by counting the number of paired reads in which one read mapped to a retrotransposon and the other to a gene. Large variability among genotypes was also ascertained for retrotransposon proximity to genes. Both long terminal repeat retrotransposon redundancy and proximity to genes varied among retrotransposon families and also between cultivated and wild genotypes. Such differences are discussed in relation to the possible role of long terminal repeat retrotransposons in the domestication of sunflower. © The Author(s) 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  16. Functional analysis of atfA gene to stress response in pathogenic thermal dimorphic fungus Penicillium marneffei.

    Directory of Open Access Journals (Sweden)

    Panjaphorn Nimmanee

    Full Text Available Penicillium marneffei, the pathogenic thermal dimorphic fungus is a causative agent of a fatal systemic disease, penicilliosis marneffei, in immunocompromised patients especially HIV patients. For growth and survival, this fungus has to adapt to environmental stresses outside and inside host cells and this adaptation requires stress signaling pathways and regulation of gene expression under various kinds of stresses. In this report, P. marneffei activating transcription factor (atfA gene encoding bZip-type transcription factor was characterized. To determine functions of this gene, atfA isogenic mutant strain was constructed using the modified split marker recombination method. The phenotypes and susceptibility to varieties of stresses including osmotic, oxidative, heat, UV, cell wall and cell membrane stresses of the mutant strain were compared with the wild type and the atfA complemented strains. Results demonstrated that the mRNA expression level of P. marneffei atfA gene increased under heat stress at 42°C. The atfA mutant was more sensitive to sodium dodecyl sulphate, amphotericin B and tert-butyl hydroperoxide than the wild type and complemented strains but not hydrogen peroxide, menadione, NaCl, sorbitol, calcofluor white, itraconazole, UV stresses and heat stress at 39°C. In addition, recovery of atfA mutant conidia after mouse and human macrophage infections was significantly decreased compared to those of wild type and complemented strains. These results indicated that the atfA gene was required by P. marneffei under specific stress conditions and might be necessary for fighting against host immune cells during the initiation of infection.

  17. Comparative Global Gene Expression Profiles of Wild-Type Yersinia pestis CO92 and Its Braun Lipoprotein Mutant at Flea and Human Body Temperatures

    Directory of Open Access Journals (Sweden)

    Cristi L. Galindo

    2010-01-01

    Full Text Available Braun/murein lipoprotein (Lpp is involved in inflammatory responses and septic shock. We previously characterized a Δlpp mutant of Yersinia pestis CO92 and found that this mutant was defective in surviving in macrophages and was attenuated in a mouse inhalation model of plague when compared to the highly virulent wild-type (WT bacterium. We performed global transcriptional profiling of WT Y. pestis and its Δlpp mutant using microarrays. The organisms were cultured at 26 and 37 degrees Celsius to simulate the flea vector and mammalian host environments, respectively. Our data revealed vastly different effects of lpp mutation on the transcriptomes of Y. pestis grown at 37 versus 26C. While the absence of Lpp resulted mainly in the downregulation of metabolic genes at 26C, the Y. pestis Δlpp mutant cultured at 37C exhibited profound alterations in stress response and virulence genes, compared to WT bacteria. We investigated one of the stress-related genes (htrA downregulated in the Δlpp mutant relative to WT Y. pestis. Indeed, complementation of the Δlpp mutant with the htrA gene restored intracellular survival of the Y. pestis Δlpp mutant. Our results support a role for Lpp in Y. pestis adaptation to the host environment, possibly via transcriptional activation of htrA.

  18. Early Transcriptional Responses of Bovine Chorioallantoic Membrane Explants to Wild Type, ΔvirB2 or ΔbtpB Brucella abortus Infection

    Science.gov (United States)

    Mol, Juliana P. S.; Costa, Erica A.; Carvalho, Alex F.; Sun, Yao-Hui; Tsolis, Reneé M.; Paixão, Tatiane A.; Santos, Renato L.

    2014-01-01

    The pathogenesis of the Brucella-induced inflammatory response in the bovine placenta is not completely understood. In this study we evaluated the role of the B. abortus Type IV secretion system and the anti-inflammatory factor BtpB in early interactions with bovine placental tissues. Transcription profiles of chorioallantoic membrane (CAM) explants inoculated with wild type (strain 2308), ΔvirB2 or ΔbtpB Brucella abortus were compared by microarray analysis at 4 hours post infection. Transcripts with significant variation (>2 fold change; Pabortus resulted in slightly more genes with decreased than increased transcription levels. Conversely, infection of trophoblastic cells with the ΔvirB2 or the ΔbtpB mutant strains, that lack a functional T4SS or that has impaired inhibition of TLR signaling, respectively, induced more upregulated than downregulated genes. Wild type Brucella abortus impaired transcription of host genes related to immune response when compared to ΔvirB and ΔbtpB mutants. Our findings suggest that proinflammatory genes are negatively modulated in bovine trophoblastic cells at early stages of infection. The virB operon and btpB are directly or indirectly related to modulation of these host genes. These results shed light on the early interactions between B. abortus and placental tissue that ultimately culminate in inflammatory pathology and abortion. PMID:25259715

  19. Effect of the deletion of qmoABC and the promoter distal gene encoding a hypothetical protein on sulfate-reduction in Desulfovibrio vulgaris Hildenborough

    Energy Technology Data Exchange (ETDEWEB)

    Zane, Grant M.; Yen, Huei-chi Bill; Wall, Judy D.

    2010-03-18

    The pathway of electrons required for the reduction of sulfate in sulfate-reducing bacteria (SRB) is not yet fully characterized. In order to determine the role of a transmembrane protein complex suggested to be involved in this process, a deletion of Desulfovibrio vulgaris Hildenborough was created by marker exchange mutagenesis that eliminated four genes putatively encoding the QmoABC complex and a hypothetical protein (DVU0851). The Qmo complex (quinone-interacting membrane-bound oxidoreductase) is proposed to be responsible for transporting electrons to the dissimilatory adenosine-5?phosphosulfate (APS) reductase in SRB. In support of the predicted role of this complex, the deletion mutant was unable to grow using sulfate as its sole electron acceptor with a range of electron donors. To explore a possible role for the hypothetical protein in sulfate reduction, a second mutant was constructed that had lost only the gene that codes for DVU0851. The second constructed mutant grew with sulfate as the sole electron acceptor; however, there was a lag that was not present with the wild-type or complemented strain. Neither deletion strain was significantly impaired for growth with sulfite or thiosulfate as terminal electron acceptor. Complementation of the D(qmoABC-DVU0851) mutant with all four genes or only the qmoABC genes restored its ability to grow by sulfate respiration. These results confirmed the prediction that the Qmo complex is in the electron pathway for sulfate-reduction and revealed that no other transmembrane complex could compensate when Qmo was lacking.

  20. Shewanella putrefaciens mtrB encodes an outer membrane protein required for Fe(III) and Mn(IV) reduction.

    Science.gov (United States)

    Beliaev, A S; Saffarini, D A

    1998-12-01

    Iron and manganese oxides or oxyhydroxides are abundant transition metals, and in aquatic environments they serve as terminal electron acceptors for a large number of bacterial species. The molecular mechanisms of anaerobic metal reduction, however, are not understood. Shewanella putrefaciens is a facultative anaerobe that uses Fe(III) and Mn(IV) as terminal electron acceptors during anaerobic respiration. Transposon mutagenesis was used to generate mutants of S. putrefaciens, and one such mutant, SR-21, was analyzed in detail. Growth and enzyme assays indicated that the mutation in SR-21 resulted in loss of Fe(III) and Mn(IV) reduction but did not affect its ability to reduce other electron acceptors used by the wild type. This deficiency was due to Tn5 inactivation of an open reading frame (ORF) designated mtrB. mtrB encodes a protein of 679 amino acids and contains a signal sequence characteristic of secreted proteins. Analysis of membrane fractions of the mutant, SR-21, and wild-type cells indicated that MtrB is located on the outer membrane of S. putrefaciens. A 5.2-kb DNA fragment that contains mtrB was isolated and completely sequenced. A second ORF, designated mtrA, was found directly upstream of mtrB. The two ORFs appear to be arranged in an operon. mtrA encodes a putative 10-heme c-type cytochrome of 333 amino acids. The N-terminal sequence of MtrA contains a potential signal sequence for secretion across the cell membrane. The amino acid sequence of MtrA exhibited 34% identity to NrfB from Escherichia coli, which is involved in formate-dependent nitrite reduction. To our knowledge, this is the first report of genes encoding proteins involved in metal reduction.

  1. Overexpression of cotton RAV1 gene in Arabidopsis confers transgenic plants high salinity and drought sensitivity.

    Science.gov (United States)

    Li, Xiao-Jie; Li, Mo; Zhou, Ying; Hu, Shan; Hu, Rong; Chen, Yun; Li, Xue-Bao

    2015-01-01

    RAV (related to ABI3/VP1) protein containing an AP2 domain in the N-terminal region and a B3 domain in the C-terminal region, which belongs to AP2 transcription factor family, is unique in higher plants. In this study, a gene (GhRAV1) encoding a RAV protein of 357 amino acids was identified in cotton (Gossypium hirsutum). Transient expression analysis of the eGFP:GhRAV1 fusion genes in tobacco (Nicotiana tabacum) epidermal cells revealed that GhRAV1 protein was localized in the cell nucleus. Quantitative RT-PCR analysis indicated that expression of GhRAV1 in cotton is induced by abscisic acid (ABA), NaCl and polyethylene glycol (PEG). Overexpression of GhRAV1 in Arabidopsis resulted in plant sensitive to ABA, NaCl and PEG. With abscisic acid (ABA) treatment, seed germination and green seedling rates of the GhRAV1 transgenic plants were remarkably lower than those of wild type. In the presence of NaCl, the seed germination and seedling growth of the GhRAV1 transgenic lines were inhibited greater than those of wild type. And chlorophyll content and maximum photochemical efficiency of the transgenic plants were significantly lower than those of wild type. Under drought stress, the GhRAV1 transgenic plants displayed more severe wilting than wild type. Furthermore, expressions of the stress-related genes were altered in the GhRAV1 transgenic Arabidopsis plants under high salinity and drought stresses. Collectively, our data suggested that GhRAV1 may be involved in response to high salinity and drought stresses through regulating expressions of the stress-related genes during cotton development.

  2. Cloning and Characterization of upp, a Gene Encoding Uracil Phosphoribosyltransferase from Lactococcus lactis

    DEFF Research Database (Denmark)

    Martinussen, Jan; Hammer, Karin

    1994-01-01

    Uracil phosphoribosyltransferase catalyzes the key reaction in the salvage of uracil in many microorganisms. The gene encoding uracil phosphoribosyltransferase (upp) was cloned from Lactococcus lactis subsp. cremoris MG1363 by complementation of an Escherichia coli mutant. The gene was sequenced...

  3. Horse cDNA clones encoding two MHC class I genes

    Energy Technology Data Exchange (ETDEWEB)

    Barbis, D.P.; Maher, J.K.; Stanek, J.; Klaunberg, B.A.; Antczak, D.F.

    1994-12-31

    Two full-length clones encoding MHC class I genes were isolated by screening a horse cDNA library, using a probe encoding in human HLA-A2.2Y allele. The library was made in the pcDNA1 vector (Invitrogen, San Diego, CA), using mRNA from peripheral blood lymphocytes obtained from a Thoroughbred stallion (No. 0834) homozygous for a common horse MHC haplotype (ELA-A2, -B2, -D2; Antczak et al. 1984; Donaldson et al. 1988). The clones were sequenced, using SP6 and T7 universal primers and horse-specific oligonucleotides designed to extend previously determined sequences.

  4. Comparative metabolic profiling of mce1 operon mutant vs wild-type Mycobacterium tuberculosis strains.

    Science.gov (United States)

    Queiroz, Adriano; Medina-Cleghorn, Daniel; Marjanovic, Olivera; Nomura, Daniel K; Riley, Lee W

    2015-11-01

    Mycobacterium tuberculosis disrupted in a 13-gene operon (mce1) accumulates free mycolic acids (FM) in its cell wall and causes accelerated death in mice. Here, to more comprehensively analyze differences in their cell wall lipid composition, we used an untargeted metabolomics approach to compare the lipid profiles of wild-type and mce1 operon mutant strains. By liquid chromatography-mass spectrometry, we identified >400 distinct lipids significantly altered in the mce1 mutant compared to wild type. These lipids included decreased levels of saccharolipids and glycerophospholipids, and increased levels of alpha-, methoxy- and keto mycolic acids (MA), and hydroxyphthioceranic acid. The mutant showed reduced expression of mmpL8, mmpL10, stf0, pks2 and papA2 genes involved in transport and metabolism of lipids recognized to induce proinflammatory response; these lipids were found to be decreased in the mutant. In contrast, the transcripts of mmpL3, fasI, kasA, kasB, acpM and RV3451 involved in MA transport and metabolism increased; MA inhibits inflammatory response in macrophages. Since the mce1 operon is known to be regulated in intracellular M. tuberculosis, we speculate that the differences we observed in cell wall lipid metabolism and composition may affect host response to M. tuberculosis infection and determine the clinical outcome of such an infection. © FEMS 2015. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  5. Association of single nucleotide polymorphisms in the gene encoding GLUT1 and diabetic nephropathy in Brazilian patients with type 1 diabetes mellitus.

    Science.gov (United States)

    Marques, T; Patente, T A; Monteiro, M B; Cavaleiro, A M; Queiroz, M S; Nery, M; de Azevedo, M J; Canani, L H; Parisi, M C; Moura-Neto, A; Passarelli, M; Giannella-Neto, D; Machado, U F; Corrêa-Giannella, M L

    2015-04-15

    Mesangial cells subject to high extracellular glucose concentrations, as occur in hyperglycaemic states, are unable to down regulate glucose influx, resulting in intracellular activation of deleterious biochemical pathways. A high expression of GLUT1 participates in the development of diabetic glomerulopathy. Variants in the gene encoding GLUT1 (SLC2A1) have been associated to this diabetic complication. The aim of this study was to test whether polymorphisms in SLC2A1 confer susceptibility to diabetic nephropathy (DN) in Brazilian type 1 diabetes patients. Four polymorphisms (rs3820589, rs1385129, rs841847 and rs841848) were genotyped in a Brazilian cohort comprised of 452 patients. A prospective analysis was performed in 155 patients. Mean duration of follow-up was 5.6 ± 2.4 years and the incidence of renal events was 18.0%. The rs3820589 presented an inverse association with the prevalence of incipient DN (OR: 0.36, 95% CI: 0.16 - 0.80, p=0.01) and with progression to renal events (HR: 0.20; 95% CI: 0.03 - 0.70; p=0.009). AGGT and AGAC haplotypes were associated with the prevalence of incipient DN and the AGAC haplotype was also associated with the prevalence of established/advanced DN. In conclusion, rs3820589 in the SLC2A1 gene modulates the risk to DN in Brazilian patients with inadequate type 1 diabetes control. Copyright © 2015 Elsevier B.V. All rights reserved.

  6. Altered phenotypic expression of immunoglobulin heavy-chain variable-region (VH) genes in Alicia rabbits probably reflects a small deletion in the VH genes closest to the joining region.

    Science.gov (United States)

    Allegrucci, M; Newman, B A; Young-Cooper, G O; Alexander, C B; Meier, D; Kelus, A S; Mage, R G

    1990-07-01

    Rabbits of the Alicia strain have a mutation (ali) that segregates with the immunoglobulin heavy-chain (lgh) locus and has a cis effect upon the expression of heavy-chain variable-region (VH) genes encoding the a2 allotype. In heterozygous a1/ali or a3/ali rabbits, serum immunoglobulins are almost entirely the products of the normal a1 or a3 allele and only traces of a2 immunoglobulin are detectable. Adult homozygous ali/ali rabbits likewise have normal immunoglobulin levels resulting from increased production of a-negative immunoglobulins and some residual ability to produce the a2 allotype. By contrast, the majority of the immunoglobulins of wild-type a2 rabbits are a2-positive and only a small percentage are a-negative. Genomic DNAs from homozygous mutant and wild-type animals were indistinguishable by Southern analyses using a variety of restriction enzyme digests and lgh probes. However, when digests with infrequently cutting enzymes were analyzed by transverse alternating-field electrophoresis, the ali DNA fragments were 10-15 kilobases smaller than the wild type. These fragments hybridized to probes both for VH and for a region of DNA a few kilobases downstream of the VH genes nearest the joining region. We suggest that this relatively small deletion affects a segment containing 3' VH genes with important regulatory functions, the loss of which leads to the ali phenotype. These results, and the fact that the 3' VH genes rearrange early in B-cell development, indicate that the 3' end of the VH locus probably plays a key role in regulation of VH gene expression.

  7. Cellulolytic (cel) genes of Clostridium thermocellum F7 and the proteins encoded by them

    International Nuclear Information System (INIS)

    Piruzyan, E.S.; Mogutov, M.A.; Velikodvorskaya, G.A.; Pushkarskaya, T.A.

    1988-01-01

    This study is concerned with genes cell, ce12, and ce13 encoding the endoglucanase of the cellulolytic complex of the anaerobic thermophilic Clostridium thermocellum F7 bacteria, these genes having been closed by us earlier. The authors present the characteristics of proteins synthesized by the cel genes in the minicell system of the strain Escherichia coli K-12 X925. The molecular weights of the proteins encoded by genes cell, ce12, and ce13 are 30,000, 45,000, and 50,000 dalton, respectively. The study of the homology of the cloned section of the C. thermocellum DNA containing the endoglucanase genes, using Southern's blot-hybridization method, did not reveal their physical linkage in the genome. The authors detected a plasmid with a size of about 30 kb in the cells of the C. thermocellum F7 strain investigated

  8. Genotype-Phenotype Associations of the CD-Associated Single Nucleotide Polymorphism within the Gene Locus Encoding Protein Tyrosine Phosphatase Non-Receptor Type 22 in Patients of the Swiss IBD Cohort.

    Directory of Open Access Journals (Sweden)

    Marianne R Spalinger

    Full Text Available Protein tyrosine phosphatase non-receptor type 22 (PTPN22 plays an important role in immune cell function and intestinal homeostasis. The single nucleotide polymorphism (SNP rs2476601 within the PTPN22 gene locus results in aberrant function of PTPN22 protein and protects from Crohn's disease (CD. Here, we investigated associations of PTPN22 SNP rs2476601 in inflammatory bowel disease (IBD patients in the Swiss IBD Cohort Study (SIBDCS.2'028 SIBDCS patients (1173 CD and 855 ulcerative colitis (UC patients were included. The clinical characteristics were analysed for an association with the presence of the PTPN22 SNP rs2476601 genotypes 'homozygous variant' (AA, 'heterozygous' (GA and 'homozygous wild-type' (GG.13 patients (0.6% were homozygous variant (AA for the PTPN22 polymorphism, 269 (13.3% heterozygous variant (GA and 1'746 (86.1% homozygous wild-type (GG. In CD, AA and GA genotypes were associated with less use of steroids and antibiotics, and reduced prevalence of vitamin D and calcium deficiency. In UC the AA and GA genotype was associated with increased use of azathioprine and anti-TNF antibodies, but significantly less patients with the PTPN22 variant featured malabsorption syndrome (p = 0.026.Our study for the first time addressed how presence of SNP rs2476601 within the PTPN22 gene affects clinical characteristics in IBD-patients. Several factors that correlate with more severe disease were found to be less common in CD patients carrying the A-allele, pointing towards a protective role for this variant in affected CD patients. In UC patients however, we found the opposite trend, suggesting a disease-promoting effect of the A-allele.

  9. The Expression of Genes Encoding Secreted Proteins in Medicago truncatula A17 Inoculated Roots

    Directory of Open Access Journals (Sweden)

    LUCIA KUSUMAWATI

    2013-09-01

    Full Text Available Subtilisin-like serine protease (MtSBT, serine carboxypeptidase (MtSCP, MtN5, non-specific lipid transfer protein (MtnsLTP, early nodulin2-like protein (MtENOD2-like, FAD-binding domain containing protein (MtFAD-BP1, and rhicadhesin receptor protein (MtRHRE1 were among 34 proteins found in the supernatant of M. truncatula 2HA and sickle cell suspension cultures. This study investigated the expression of genes encoding those proteins in roots and developing nodules. Two methods were used: quantitative real time RT-PCR and gene expression analysis (with promoter:GUS fusion in roots. Those proteins are predicted as secreted proteins which is indirectly supported by the findings that promoter:GUS fusions of six of the seven genes encoding secreted proteins were strongly expressed in the vascular bundle of transgenic hairy roots. All six genes have expressed in 14-day old nodule. The expression levels of the selected seven genes were quantified in Sinorhizobium-inoculated and control plants using quantitative real time RT-PCR. In conclusion, among seven genes encoding secreted proteins analyzed, the expression level of only one gene, MtN5, was up-regulated significantly in inoculated root segments compared to controls. The expression of MtSBT1, MtSCP1, MtnsLTP, MtFAD-BP1, MtRHRE1 and MtN5 were higher in root tip than in other tissues examined.

  10. Genotype-dependent participation of coat color gene loci in the behavioral traits of laboratory mice.

    Science.gov (United States)

    Yamamuro, Yutaka; Shiraishi, Aya

    2011-10-01

    To evaluate if loci responsible for coat color phenotypes contribute to behavioral characteristics, we specified novel gene loci associated with social exploratory behavior and examined the effects of the frequency of each allele at distinct loci on behavioral expression. We used the F2 generation, which arose from the mating of F1 mice obtained by interbreeding DBA/2 and ICR mice. Phenotypic analysis indicated that the agouti and albino loci affect behavioral traits. A genotype-based analysis revealed that novel exploratory activity was suppressed in a manner dependent on the frequency of the dominant wild-type allele at the agouti, but not albino, locus. The allele-dependent suppression was restricted to colored mice and was not seen in albino mice. The present results suggest that the agouti locus contributes to a particular behavioral trait in the presence of a wild-type allele at the albino locus, which encodes a structural gene for tyrosinase. Copyright © 2011 Elsevier B.V. All rights reserved.

  11. Activation Of Wild-Type Hras Suppresses The Earliest Stages Of Pancreatic Cancer

    Directory of Open Access Journals (Sweden)

    Jamie Weyandt

    2015-08-01

    Conclusions: Loss of wild-type Hras promotes the earliest stages of pancreatic tumorigenesis, and moreover results in more rapid progression of the disease. As such, mechanisms leading to activation of wild-type Ras proteins, including but not limited to redox-dependent reactions, may influence the development of pancreatic cancer.

  12. Preselection of EGFR mutations in non-small-cell lung cancer patients by immunohistochemistry: comparison with DNA-sequencing, EGFR wild-type expression, gene copy number gain and clinicopathological data.

    Science.gov (United States)

    Gaber, Rania; Watermann, Iris; Kugler, Christian; Vollmer, Ekkehard; Perner, Sven; Reck, Martin; Goldmann, Torsten

    2017-01-01

    Targeting epidermal growth factor receptor (EGFR) in patients with non-small-cell lung cancer (NSCLC) having EGFR mutations is associated with an improved overall survival. The aim of this study is to verify, if EGFR mutations detected by immunohistochemistry (IHC) is a convincing way to preselect patients for DNA-sequencing and to figure out, the statistical association between EGFR mutation, wild-type EGFR overexpression, gene copy number gain, which are the main factors inducing EGFR tumorigenic activity and the clinicopathological data. Two hundred sixteen tumor tissue samples of primarily chemotherapeutic naïve NSCLC patients were analyzed for EGFR mutations E746-A750del and L858R and correlated with DNA-sequencing. Two hundred six of which were assessed by IHC, using 6B6 and 43B2 specific antibodies followed by DNA-sequencing of positive cases and 10 already genotyped tumor tissues were also included to investigate debugging accuracy of IHC. In addition, EGFR wild-type overexpression was IHC evaluated and EGFR gene copy number determination was performed by fluorescence in situ hybridization (FISH). Forty-one÷206 (19.9%) cases were positive for mutated EGFR by IHC. Eight of them had EGFR mutations of exons 18-21 by DNA-sequencing. Hit rate of 10 already genotyped NSCLC mutated cases was 90% by IHC. Positive association was found between EGFR mutations determined by IHC and both EGFR overexpression and increased gene copy number (p=0.002 and p<0.001, respectively). Additionally, positive association was detected between EGFR mutations, high tumor grade and clinical stage (p<0.001). IHC staining with mutation specific antibodies was demonstrated as a possible useful screening test to preselect patients for DNA-sequencing.

  13. Functional Analysis of the Trichoderma harzianum nox1 Gene, Encoding an NADPH Oxidase, Relates Production of Reactive Oxygen Species to Specific Biocontrol Activity against Pythium ultimum▿†

    Science.gov (United States)

    Montero-Barrientos, M.; Hermosa, R.; Cardoza, R. E.; Gutiérrez, S.; Monte, E.

    2011-01-01

    The synthesis of reactive oxygen species (ROS) is one of the first events following pathogenic interactions in eukaryotic cells, and NADPH oxidases are involved in the formation of such ROS. The nox1 gene of Trichoderma harzianum was cloned, and its role in antagonism against phytopathogens was analyzed in nox1-overexpressed transformants. The increased levels of nox1 expression in these transformants were accompanied by an increase in ROS production during their direct confrontation with Pythium ultimum. The transformants displayed an increased hydrolytic pattern, as determined by comparing protease, cellulase, and chitinase activities with those for the wild type. In confrontation assays against P. ultimum the nox1-overexpressed transformants were more effective than the wild type, but not in assays against Botrytis cinerea or Rhizoctonia solani. A transcriptomic analysis using a Trichoderma high-density oligonucleotide (HDO) microarray also showed that, compared to gene expression for the interaction of wild-type T. harzianum and P. ultimum, genes related to protease, cellulase, and chitinase activities were differentially upregulated in the interaction of a nox1-overexpressed transformant with this pathogen. Our results show that nox1 is involved in T. harzianum ROS production and antagonism against P. ultimum. PMID:21421791

  14. Genome analysis and identification of gelatinase encoded gene in Enterobacter aerogenes

    Science.gov (United States)

    Shahimi, Safiyyah; Mutalib, Sahilah Abdul; Khalid, Rozida Abdul; Repin, Rul Aisyah Mat; Lamri, Mohd Fadly; Bakar, Mohd Faizal Abu; Isa, Mohd Noor Mat

    2016-11-01

    In this study, bioinformatic analysis towards genome sequence of E. aerogenes was done to determine gene encoded for gelatinase. Enterobacter aerogenes was isolated from hot spring water and gelatinase species-specific bacterium to porcine and fish gelatin. This bacterium offers the possibility of enzymes production which is specific to both species gelatine, respectively. Enterobacter aerogenes was partially genome sequenced resulting in 5.0 mega basepair (Mbp) total size of sequence. From pre-process pipeline, 87.6 Mbp of total reads, 68.8 Mbp of total high quality reads and 78.58 percent of high quality percentage was determined. Genome assembly produced 120 contigs with 67.5% of contigs over 1 kilo base pair (kbp), 124856 bp of N50 contig length and 55.17 % of GC base content percentage. About 4705 protein gene was identified from protein prediction analysis. Two candidate genes selected have highest similarity identity percentage against gelatinase enzyme available in Swiss-Prot and NCBI online database. They were NODE_9_length_26866_cov_148.013245_12 containing 1029 base pair (bp) sequence with 342 amino acid sequence and NODE_24_length_155103_cov_177.082458_62 which containing 717 bp sequence with 238 amino acid sequence, respectively. Thus, two paired of primers (forward and reverse) were designed, based on the open reading frame (ORF) of selected genes. Genome analysis of E. aerogenes resulting genes encoded gelatinase were identified.

  15. Roothairless5, which functions in maize (Zea mays L.) root hair initiation and elongation encodes a monocot-specific NADPH oxidase.

    Science.gov (United States)

    Nestler, Josefine; Liu, Sanzhen; Wen, Tsui-Jung; Paschold, Anja; Marcon, Caroline; Tang, Ho Man; Li, Delin; Li, Li; Meeley, Robert B; Sakai, Hajime; Bruce, Wesley; Schnable, Patrick S; Hochholdinger, Frank

    2014-09-01

    Root hairs are instrumental for nutrient uptake in monocot cereals. The maize (Zea mays L.) roothairless5 (rth5) mutant displays defects in root hair initiation and elongation manifested by a reduced density and length of root hairs. Map-based cloning revealed that the rth5 gene encodes a monocot-specific NADPH oxidase. RNA-Seq, in situ hybridization and qRT-PCR experiments demonstrated that the rth5 gene displays preferential expression in root hairs but also accumulates to low levels in other tissues. Immunolocalization detected RTH5 proteins in the epidermis of the elongation and differentiation zone of primary roots. Because superoxide and hydrogen peroxide levels are reduced in the tips of growing rth5 mutant root hairs as compared with wild-type, and Reactive oxygen species (ROS) is known to be involved in tip growth, we hypothesize that the RTH5 protein is responsible for establishing the high levels of ROS in the tips of growing root hairs required for elongation. Consistent with this hypothesis, a comparative RNA-Seq analysis of 6-day-old rth5 versus wild-type primary roots revealed significant over-representation of only two gene ontology (GO) classes related to the biological functions (i.e. oxidation/reduction and carbohydrate metabolism) among 893 differentially expressed genes (FDR <5%). Within these two classes the subgroups 'response to oxidative stress' and 'cellulose biosynthesis' were most prominently represented. © 2014 The Authors The Plant Journal © 2014 John Wiley & Sons Ltd.

  16. Cloning and characterization of largemouth bass ( Micropterus salmoides) myostatin encoding gene and its promoter

    Science.gov (United States)

    Li, Shengjie; Bai, Junjie; Wang, Lin

    2008-08-01

    Myostatin or GDF-8, a member of the transforming growth factor-β (TGF-β) superfamily, has been demonstrated to be a negative regulator of skeletal muscle mass in mammals. In the present study, we obtained a 5.64 kb sequence of myostatin encoding gene and its promoter from largemouth bass ( Micropterus salmoides). The myostatin encoding gene consisted of three exons (488 bp, 371 bp and 1779 bp, respectively) and two introns (390 bp and 855 bp, respectively). The intron-exon boundaries were conservative in comparison with those of mammalian myostatin encoding genes, whereas the size of introns was smaller than that of mammals. Sequence analysis of 1.569 kb of the largemouth bass myostatin gene promoter region revealed that it contained two TATA boxes, one CAAT box and nine putative E-boxes. Putative muscle growth response elements for myocyte enhancer factor 2 (MEF2), serum response factor (SRF), activator protein 1 (AP1), etc., and muscle-specific Mt binding site (MTBF) were also detected. Some of the transcription factor binding sites were conserved among five teleost species. This information will be useful for studying the transcriptional regulation of myostatin in fish.

  17. Relating genes to function: identifying enriched transcription factors using the ENCODE ChIP-Seq significance tool.

    Science.gov (United States)

    Auerbach, Raymond K; Chen, Bin; Butte, Atul J

    2013-08-01

    Biological analysis has shifted from identifying genes and transcripts to mapping these genes and transcripts to biological functions. The ENCODE Project has generated hundreds of ChIP-Seq experiments spanning multiple transcription factors and cell lines for public use, but tools for a biomedical scientist to analyze these data are either non-existent or tailored to narrow biological questions. We present the ENCODE ChIP-Seq Significance Tool, a flexible web application leveraging public ENCODE data to identify enriched transcription factors in a gene or transcript list for comparative analyses. The ENCODE ChIP-Seq Significance Tool is written in JavaScript on the client side and has been tested on Google Chrome, Apple Safari and Mozilla Firefox browsers. Server-side scripts are written in PHP and leverage R and a MySQL database. The tool is available at http://encodeqt.stanford.edu. abutte@stanford.edu Supplementary material is available at Bioinformatics online.

  18. Evidence that the mitochondrial leucyl tRNA synthetase (LARS2) gene represents a novel type 2 diabetes susceptibility gene

    NARCIS (Netherlands)

    L.M. 't Hart (Leen); H.A.P. Pols (Huib); T. Hansen (Torben); I. Rietveld (Ingrid); J.M. Dekker (Jacqueline); J.A. Maassen (Johannes); M.G.A.A.M. Nijpels (Giel); G.M.C. Janssen (George); P.P. Arp (Pascal); R.J. Heine (Robert); A.G. Uitterlinden (André); T. Jorgensen (Torben); C.M. van Duijn (Cornelia); K. Borch-Johnsen; O. Pedersen (Oluf)

    2005-01-01

    textabstractPreviously, we have shown that a mutation in the mitochondrial DNA-encoded tRNA(Leu(UUR)) gene is associated with type 2 diabetes. One of the consequences of this mutation is a reduced aminoacylation of tRNA(Leu(UUR)). In this study, we have examined whether variants in the leucyl tRNA

  19. Mitochondrial genome sequence of the Tibetan wild ass (Equus kiang).

    Science.gov (United States)

    Luo, Yongjun; Chen, Yu; Liu, Fuyu; Jiang, Chunhua; Gao, Yuqi

    2011-02-01

    The Tibetan wild ass, or kiang (Equus kiang) is endemic to the cold and hypoxic (4000-7000 m above sea level) climates of the montane and alpine grasslands of the Tibetan Plateau. We report here the complete nucleotide sequence of the E. kiang mitochondrial genome. Our results show that E. kiang mitochondrial DNA is 16,634 bp long, and predicted to encode all the 37 genes that are typical for vertebrates.

  20. Cloning and characterization of the gsk gene encoding guanosine kinase of Escherichia coli

    DEFF Research Database (Denmark)

    Harlow, Kenneth W.; Nygaard, Per; Hove-Jensen, Bjarne

    1995-01-01

    The Escherichia coli gsk gene encoding guanosine kinase was cloned from the Kohara gene library by complementation of the E. coli gsk-1 mutant allele. The cloned DNA fragment was sequenced and shown to encode a putative polypeptide of 433 amino acids with a molecular mass of 48,113 Da. Minicell...

  1. Systematic mutagenesis of genes encoding predicted autotransported proteins of Burkholderia pseudomallei identifies factors mediating virulence in mice, net intracellular replication and a novel protein conferring serum resistance.

    Directory of Open Access Journals (Sweden)

    Natalie R Lazar Adler

    Full Text Available Burkholderia pseudomallei is the causative agent of the severe tropical disease melioidosis, which commonly presents as sepsis. The B. pseudomallei K96243 genome encodes eleven predicted autotransporters, a diverse family of secreted and outer membrane proteins often associated with virulence. In a systematic study of these autotransporters, we constructed insertion mutants in each gene predicted to encode an autotransporter and assessed them for three pathogenesis-associated phenotypes: virulence in the BALB/c intra-peritoneal mouse melioidosis model, net intracellular replication in J774.2 murine macrophage-like cells and survival in 45% (v/v normal human serum. From the complete repertoire of eleven autotransporter mutants, we identified eight mutants which exhibited an increase in median lethal dose of 1 to 2-log10 compared to the isogenic parent strain (bcaA, boaA, boaB, bpaA, bpaC, bpaE, bpaF and bimA. Four mutants, all demonstrating attenuation for virulence, exhibited reduced net intracellular replication in J774.2 macrophage-like cells (bimA, boaB, bpaC and bpaE. A single mutant (bpaC was identified that exhibited significantly reduced serum survival compared to wild-type. The bpaC mutant, which demonstrated attenuation for virulence and net intracellular replication, was sensitive to complement-mediated killing via the classical and/or lectin pathway. Serum resistance was rescued by in trans complementation. Subsequently, we expressed recombinant proteins of the passenger domain of four predicted autotransporters representing each of the phenotypic groups identified: those attenuated for virulence (BcaA, those attenuated for virulence and net intracellular replication (BpaE, the BpaC mutant with defects in virulence, net intracellular replication and serum resistance and those displaying wild-type phenotypes (BatA. Only BcaA and BpaE elicited a strong IFN-γ response in a restimulation assay using whole blood from seropositive donors

  2. Wild Carrot Differentiation in Europe and Selection at DcAOX1 Gene?

    Directory of Open Access Journals (Sweden)

    Tânia Nobre

    Full Text Available By definition, the domestication process leads to an overall reduction of crop genetic diversity. This lead to the current search of genomic regions in wild crop relatives (CWR, an important task for modern carrot breeding. Nowadays massive sequencing possibilities can allow for discovery of novel genetic resources in wild populations, but this quest could be aided by the use of a surrogate gene (to first identify and prioritize novel wild populations for increased sequencing effort. Alternative oxidase (AOX gene family seems to be linked to all kinds of abiotic and biotic stress reactions in various organisms and thus have the potential to be used in the identification of CWR hotspots of environment-adapted diversity. High variability of DcAOX1 was found in populations of wild carrot sampled across a West-European environmental gradient. Even though no direct relation was found with the analyzed climatic conditions or with physical distance, population differentiation exists and results mainly from the polymorphisms associated with DcAOX1 exon 1 and intron 1. The relatively high number of amino acid changes and the identification of several unusually variable positions (through a likelihood ratio test, suggests that DcAOX1 gene might be under positive selection. However, if positive selection is considered, it only acts on some specific populations (i.e. is in the form of adaptive differences in different population locations given the observed high genetic diversity. We were able to identify two populations with higher levels of differentiation which are promising as hot spots of specific functional diversity.

  3. Isolation of Clostridium difficile and Detection of A and B Toxins Encoding Genes

    Directory of Open Access Journals (Sweden)

    Abbas Ali Imani Fooladi

    2014-02-01

    Full Text Available Background: Clostridium difficile is the most important anaerobic, gram positive, spore forming bacillus which is known as a prevalent factor leading to antibiotic associated diarrheas and is the causative agent of pseudomembrane colitis. The role of this bacterium along with the over use of antibiotics have been proved to result in colitis. The major virulence factors of these bacteria are the A and B toxins. Objectives: The purpose of this study was to isolate C. difficile from stool samples and detect A and B toxins encoding genes, in order toserve as a routine method for clinical diagnosis. Materials and Methods: Recognition of A and B toxins encoding genes by uniplex and multiplex PCR using two pairs of primers from 136 accumulated stool samples. Results: Results of the present study showed that out of 136 stool samples, three C. difficile were isolated and these strains contained A and B toxins encoding genes. Conclusions: It was concluded that although detection of C. difficile from stool samples based on PCR (polymerase chain reaction is expensive, yet this method is more sensitive and less time-consuming than culture methods and can be used as a clinical laboratory test.

  4. Alteration of gene expression profile in Niemann-Pick type C mice correlates with tissue damage and oxidative stress.

    Directory of Open Access Journals (Sweden)

    Mary C Vázquez

    Full Text Available BACKGROUND: Niemann-Pick type C disease (NPC is a neurovisceral lipid storage disorder mainly characterized by unesterified cholesterol accumulation in lysosomal/late endosomal compartments, although there is also an important storage for several other kind of lipids. The main tissues affected by the disease are the liver and the cerebellum. Oxidative stress has been described in various NPC cells and tissues, such as liver and cerebellum. Although considerable alterations occur in the liver, the pathological mechanisms involved in hepatocyte damage and death have not been clearly defined. Here, we assessed hepatic tissue integrity, biochemical and oxidative stress parameters of wild-type control (Npc1(+/+; WT and homozygous-mutant (Npc1(-/-; NPC mice. In addition, the mRNA abundance of genes encoding proteins associated with oxidative stress, copper metabolism, fibrosis, inflammation and cholesterol metabolism were analyzed in livers and cerebella of WT and NPC mice. METHODOLOGY/PRINCIPAL FINDINGS: We analyzed various oxidative stress parameters in the liver and hepatic and cerebellum gene expression in 7-week-old NPC1-deficient mice compared with control animals. We found signs of inflammation and fibrosis in NPC livers upon histological examination. These signs were correlated with increased levels of carbonylated proteins, diminished total glutathione content and significantly increased total copper levels in liver tissue. Finally, we analyzed liver and cerebellum gene expression patterns by qPCR and microarray assays. We found a correlation between fibrotic tissue and differential expression of hepatic as well as cerebellar genes associated with oxidative stress, fibrosis and inflammation in NPC mice. CONCLUSIONS/SIGNIFICANCE: In NPC mice, liver disease is characterized by an increase in fibrosis and in markers associated with oxidative stress. NPC is also correlated with altered gene expression, mainly of genes involved in oxidative stress

  5. Bioinformatics Study of m.9053G>A Mutation at the Gene in Relation to Type 2 Diabetes Mellitus and Cataract Diseases

    Directory of Open Access Journals (Sweden)

    *Iman Permana Maksum

    2017-09-01

    Full Text Available The mitochondrial disease often associated with various illnesses in relation to the activity of cells metabolites and the synthesis of adenosine triphosphate (ATP, including alteration in the mitochondrial DNA. The mutation of m.9053G>A at the ATP6 gene was found in patients with type 2 diabetes mellitus (DM type 2 and cataract. Therefore, this mutation is predicted to be clinical features of the 2 diseases. ATP6 gene encodes protein subunit of ATPase6, a part of ATP synthase, which is important in the electron transfer and proton translocation in intracellular respiration system. This study aims to investigate the mutation effect of m.9053G>A at the ATP6 gene (S167N to the structure and function of ATPase6 using bioinformatics method. The structure of ATPase6 was constructed using homology modeling method. The crystal structure of bovine’s ATP synthase (Protein Data Bank ID 5FIL was used as a template because of high sequence similarity (77% and coverage (96% of the input sequence. The effect of mutation was investigated at the proton translocation channel of ATPase6. It is predicted that the channel was disrupted due to changes in electrostatic potential from serine to asparagine. Furthermore, molecular docking suggests that water binding on the proton translocation channel in the S167N mutant was different from the wild type. The result of this study is hoped to be useful in the development of a new genetic marker for DM type 2 and cataract.

  6. Gene interaction at seed-awning loci in the genetic background of wild rice.

    Science.gov (United States)

    Ikemoto, Mai; Otsuka, Mitsuharu; Thanh, Pham Thien; Phan, Phuong Dang Thai; Ishikawa, Ryo; Ishii, Takashige

    2017-09-12

    Seed awning is one of the important traits for successful propagation in wild rice. During the domestication of rice by ancient humans, plants with awnless seeds may have been selected because long awns hindered collection and handling activities. To investigate domestication of awnless rice, QTL analysis for seed awning was first carried out using backcross recombinant inbred lines between Oryza sativa Nipponbare (recurrent parent) and O. rufipogon W630 (donor parent). Two strong QTLs were detected in the same regions as known major seed-awning loci, An-1 and RAE2. Subsequent causal mutation surveying and fine mapping confirmed that O. rufipogon W630 has functional alleles at both loci. The gene effects and interactions at these loci were examined using two backcross populations with reciprocal genetic backgrounds of O. sativa Nipponbare and O. rufipogon W630. As awn length in wild rice varied among seeds even in the same plant, awn length was measured based on spikelet position. In the genetic background of cultivated rice, the wild alleles at An-1 and RAE2 had awning effects, and plants having both wild homozygous alleles produced awns whose length was about 70% of those of the wild parent. On the other hand, in the genetic background of wild rice, the substitution of cultivated alleles at An-1 and RAE2 contributed little to awn length reduction. These results indicate that the domestication process of awnless seeds was complicated because many genes are involved in awn formation in wild rice.

  7. Identification and Characterization of an Autolysin-Encoding Gene of Streptococcus mutans

    OpenAIRE

    Shibata, Yukie; Kawada, Miki; Nakano, Yoshio; Toyoshima, Kuniaki; Yamashita, Yoshihisa

    2005-01-01

    We identified a gene (atlA) encoding autolytic activity from Streptococcus mutans Xc. The AtlA protein predicted to be encoded by atlA is composed of 979 amino acids with a molecular weight of 107,279 and has a conserved β-1,4-N-acetylmuramidase (lysozyme) domain in the C-terminal portion. Sodium dodecyl sulfate extracts of strain Xc showed two major bacteriolytic bands with molecular masses of 107 and 79 kDa, both of which were absent from a mutant with inactivated atlA. Western blot analysi...

  8. Recombinant vectors construction for cellobiohydrolase encoding gene constitutive expression

    Directory of Open Access Journals (Sweden)

    Leontina GURGU

    2012-12-01

    Full Text Available Cellobiohydrolases (EC 3.2.1.91 are important exo enzymes involved in cellulose hydrolysis alongside endoglucanases (EC 3.2.1.4 and β-glucosidases (EC 3.2.1.21. Heterologous cellobiohydrolase gene expression under constitutive promoter control using Saccharomyces cerevisiae as host system is of great importance for a successful SSF process. From this point of view, the main objective of the work was to use Yeplac181 expression vector as a recipient for cellobiohdrolase - cbhB encoding gene expression under the control of the actin promoter, in Saccharomyces cerevisiae. Two hybridvectors, YEplac-Actp and YEplac-Actp-CbhB, were generated usingEscherichia coli XLI Blue for the cloning experiments. Constitutive cbhB gene expression was checked by proteine gel electrophoresis (SDS-PAGE after insertion of these constructs into Saccharomyces cerevisiae.

  9. Analysis of the structural genes encoding M-factor in the fission yeast Schizosaccharomyces pombe: identification of a third gene, mfm3

    DEFF Research Database (Denmark)

    Kjaerulff, S; Davey, William John; Nielsen, O

    1994-01-01

    We previously identified two genes, mfm1 and mfm2, with the potential to encode the M-factor mating pheromone of the fission yeast Schizosaccharomyces pombe (J. Davey, EMBO J. 11:951-960, 1992), but further analysis revealed that a mutant strain lacking both genes still produced active M-factor. ......We previously identified two genes, mfm1 and mfm2, with the potential to encode the M-factor mating pheromone of the fission yeast Schizosaccharomyces pombe (J. Davey, EMBO J. 11:951-960, 1992), but further analysis revealed that a mutant strain lacking both genes still produced active M...... that is not rescued by addition of exogenous M-factor. A mutational analysis reveals that all three mfm genes contribute to the production of M-factor. Their transcription is limited to M cells and requires the mat1-Mc and ste11 gene products. Each gene is induced when the cells are starved of nitrogen and further...

  10. Herpes simplex virus type 1 (HSV-1)-derived recombinant vectors for gene transfer and gene therapy.

    Science.gov (United States)

    Marconi, Peggy; Fraefel, Cornel; Epstein, Alberto L

    2015-01-01

    Herpes simplex virus type 1 (HSV-1 ) is a human pathogen whose lifestyle is based on a long-term dual interaction with the infected host, being able to establish both lytic and latent infections. The virus genome is a 153-kilobase pair (kbp) double-stranded DNA molecule encoding more than 80 genes. The interest of HSV-1 as gene transfer vector stems from its ability to infect many different cell types, both quiescent and proliferating cells, the very high packaging capacity of the virus capsid, the outstanding neurotropic adaptations that this virus has evolved, and the fact that it never integrates into the cellular chromosomes, thus avoiding the risk of insertional mutagenesis. Two types of vectors can be derived from HSV-1, recombinant vectors and amplicon vectors, and different methodologies have been developed to prepare large stocks of each type of vector. This chapter summarizes the approach most commonly used to prepare recombinant HSV-1 vectors through homologous recombination, either in eukaryotic cells or in bacteria.

  11. The Kynurenine 3-Monooxygenase Encoding Gene, BcKMO, Is Involved in the Growth, Development, and Pathogenicity of Botrytis cinerea

    Directory of Open Access Journals (Sweden)

    Kang Zhang

    2018-05-01

    Full Text Available A pathogenic mutant, BCG183, was obtained by screening the T-DNA insertion library of Botrytis cinerea. A novel pathogenicity-related gene BcKMO, which encodes kynurenine 3-monooxygenase (KMO, was isolated and identified via thermal asymmetric interlaced PCR, bioinformatics analyses, and KMO activity measurement. The mutant BCG183 grew slowly, did not produce conidia and sclerotia, had slender hyphae, and presented enhanced pathogenicity. The phenotype and pathogenicity of the BcKMO-complementing mutant (BCG183/BcKMO were similar to those of the wild-type (WT strain. The activities of polymethylgalacturonase, polygalacturonase, and toxins were significantly higher, whereas acid production was significantly decreased in the mutant BCG183, when compared with those in the WT and BCG183/BcKMO. Moreover, the sensitivity of mutant BCG183 to NaCl and KCl was remarkably increased, whereas that to fluconazole, Congo Red, menadione, H2O2, and SQ22536 and U0126 [cAMP-dependent protein kinase (cAMP and mitogen-activated protein kinase (MAPK signaling pathways inhibitors, respectively] were significantly decreased compared with the other strains. Furthermore, the key genes involved in the cAMP and MAPK signaling pathways, Pka1, Pka2, PkaR, Bcg2, Bcg3, bmp1, and bmp3, were significantly upregulated or downregulated in the mutant BCG183. BcKMO expression levels were also upregulated or downregulated in the RNAi mutants of the key genes involved in the cAMP and MAPK signaling pathways. These findings indicated that BcKMO positively regulates growth and development, but negatively regulates pathogenicity of B. cinerea. Furthermore, BcKMO was found to be involved in controlling cell wall degrading enzymes activity, toxins activity, acid production, and cell wall integrity, and participate in cAMP and MAPK signaling pathways of B. cinerea.

  12. The Kynurenine 3-Monooxygenase Encoding Gene, BcKMO, Is Involved in the Growth, Development, and Pathogenicity of Botrytis cinerea.

    Science.gov (United States)

    Zhang, Kang; Yuan, Xuemei; Zang, Jinping; Wang, Min; Zhao, Fuxin; Li, Peifen; Cao, Hongzhe; Han, Jianmin; Xing, Jihong; Dong, Jingao

    2018-01-01

    A pathogenic mutant, BCG183, was obtained by screening the T-DNA insertion library of Botrytis cinerea . A novel pathogenicity-related gene BcKMO , which encodes kynurenine 3-monooxygenase (KMO), was isolated and identified via thermal asymmetric interlaced PCR, bioinformatics analyses, and KMO activity measurement. The mutant BCG183 grew slowly, did not produce conidia and sclerotia, had slender hyphae, and presented enhanced pathogenicity. The phenotype and pathogenicity of the BcKMO -complementing mutant (BCG183/ BcKMO ) were similar to those of the wild-type (WT) strain. The activities of polymethylgalacturonase, polygalacturonase, and toxins were significantly higher, whereas acid production was significantly decreased in the mutant BCG183, when compared with those in the WT and BCG183/ BcKMO . Moreover, the sensitivity of mutant BCG183 to NaCl and KCl was remarkably increased, whereas that to fluconazole, Congo Red, menadione, H 2 O 2 , and SQ22536 and U0126 [cAMP-dependent protein kinase (cAMP) and mitogen-activated protein kinase (MAPK) signaling pathways inhibitors, respectively] were significantly decreased compared with the other strains. Furthermore, the key genes involved in the cAMP and MAPK signaling pathways, Pka1 , Pka2 , PkaR , Bcg2 , Bcg3 , bmp1 , and bmp3, were significantly upregulated or downregulated in the mutant BCG183. BcKMO expression levels were also upregulated or downregulated in the RNAi mutants of the key genes involved in the cAMP and MAPK signaling pathways. These findings indicated that BcKMO positively regulates growth and development, but negatively regulates pathogenicity of B. cinerea . Furthermore, BcKMO was found to be involved in controlling cell wall degrading enzymes activity, toxins activity, acid production, and cell wall integrity, and participate in cAMP and MAPK signaling pathways of B. cinerea .

  13. Optimized Mitochondrial Targeting of Proteins Encoded by Modified mRNAs Rescues Cells Harboring Mutations in mtATP6

    Directory of Open Access Journals (Sweden)

    Randall Marcelo Chin

    2018-03-01

    Full Text Available Summary: Mitochondrial disease may be caused by mutations in the protein-coding genes of the mitochondrial genome. A promising strategy for treating such diseases is allotopic expression—the translation of wild-type copies of these proteins in the cytosol, with subsequent translocation into the mitochondria, resulting in rescue of mitochondrial function. In this paper, we develop an automated, quantitative, and unbiased screening platform to evaluate protein localization and mitochondrial morphology. This platform was used to compare 31 mitochondrial targeting sequences and 15 3′ UTRs in their ability to localize up to 9 allotopically expressed proteins to the mitochondria and their subsequent impact on mitochondrial morphology. Taking these two factors together, we synthesized chemically modified mRNAs that encode for an optimized allotopic expression construct for mtATP6. These mRNAs were able to functionally rescue a cell line harboring the 8993T > G point mutation in the mtATP6 gene. : Allotopic expression of proteins normally encoded by mtDNA is a promising therapy for mitochondrial disease. Chin et al. use an unbiased and high-content imaging-based screening platform to optimize allotopic expression. Modified mRNAs encoding for the optimized allotopic expression constructs rescued the respiration and growth of mtATP6-deficient cells. Keywords: mitochondria, mitochondrial disease, mRNA, modified mRNA, ATP6, allotopic expression, rare disease, gene therapy, screening, high content imaging

  14. Protists and the Wild, Wild West of Gene Expression: New Frontiers, Lawlessness, and Misfits.

    Science.gov (United States)

    Smith, David Roy; Keeling, Patrick J

    2016-09-08

    The DNA double helix has been called one of life's most elegant structures, largely because of its universality, simplicity, and symmetry. The expression of information encoded within DNA, however, can be far from simple or symmetric and is sometimes surprisingly variable, convoluted, and wantonly inefficient. Although exceptions to the rules exist in certain model systems, the true extent to which life has stretched the limits of gene expression is made clear by nonmodel systems, particularly protists (microbial eukaryotes). The nuclear and organelle genomes of protists are subject to the most tangled forms of gene expression yet identified. The complicated and extravagant picture of the underlying genetics of eukaryotic microbial life changes how we think about the flow of genetic information and the evolutionary processes shaping it. Here, we discuss the origins, diversity, and growing interest in noncanonical protist gene expression and its relationship to genomic architecture.

  15. Gene knockout of the KCNJ8-encoded Kir6.1 K(ATP) channel imparts fatal susceptibility to endotoxemia.

    Science.gov (United States)

    Kane, Garvan C; Lam, Chen-Fuh; O'Cochlain, Fearghas; Hodgson, Denice M; Reyes, Santiago; Liu, Xiao-Ke; Miki, Takashi; Seino, Susumu; Katusic, Zvonimir S; Terzic, Andre

    2006-11-01

    Sepsis, the systemic inflammatory response to infection, imposes a high demand for bodily adaptation, with the cardiovascular response a key determinant of outcome. The homeostatic elements that secure cardiac tolerance in the setting of the sepsis syndrome are poorly understood. Here, in a model of acute septic shock induced by endotoxin challenge with Escherichia coli lipopolysaccharide (LPS), knockout of the KCNJ8 gene encoding the vascular Kir6.1 K(ATP) channel pore predisposed to an early and profound survival disadvantage. The exaggerated susceptibility provoked by disruption of this stress-responsive sensor of cellular metabolism was linked to progressive deterioration in cardiac activity, ischemic myocardial damage, and contractile dysfunction. Deletion of KCNJ8 blunted the responsiveness of coronary vessels to cytokine- or metabolic-mediated vasodilation necessary to support myocardial perfusion in the wild-type (WT), creating a deficit in adaptive response in the Kir6.1 knockout. Application of a K(ATP) channel opener drug improved survival in the endotoxic WT but had no effect in the Kir6.1 knockout. Restoration of the dilatory capacity of coronary vessels was required to rescue the Kir6.1 knockout phenotype and reverse survival disadvantage in lethal endotoxemia. Thus, the Kir6.1-containing K(ATP) channel, by coupling vasoreactivity with metabolic demand, provides a vital feedback element for cardiovascular tolerance in endotoxic shock.

  16. Selecting one of several mating types through gene segment joining and deletion in Tetrahymena thermophila.

    Directory of Open Access Journals (Sweden)

    Marcella D Cervantes

    Full Text Available The unicellular eukaryote Tetrahymena thermophila has seven mating types. Cells can mate only when they recognize cells of a different mating type as non-self. As a ciliate, Tetrahymena separates its germline and soma into two nuclei. During growth the somatic nucleus is responsible for all gene transcription while the germline nucleus remains silent. During mating, a new somatic nucleus is differentiated from a germline nucleus and mating type is decided by a stochastic process. We report here that the somatic mating type locus contains a pair of genes arranged head-to-head. Each gene encodes a mating type-specific segment and a transmembrane domain that is shared by all mating types. Somatic gene knockouts showed both genes are required for efficient non-self recognition and successful mating, as assessed by pair formation and progeny production. The germline mating type locus consists of a tandem array of incomplete gene pairs representing each potential mating type. During mating, a complete new gene pair is assembled at the somatic mating type locus; the incomplete genes of one gene pair are completed by joining to gene segments at each end of germline array. All other germline gene pairs are deleted in the process. These programmed DNA rearrangements make this a fascinating system of mating type determination.

  17. Evolutionary genomics of plant genes encoding N-terminal-TM-C2 domain proteins and the similar FAM62 genes and synaptotagmin genes of metazoans

    Directory of Open Access Journals (Sweden)

    Craxton Molly

    2007-07-01

    Full Text Available Abstract Background Synaptotagmin genes are found in animal genomes and are known to function in the nervous system. Genes with a similar domain architecture as well as sequence similarity to synaptotagmin C2 domains have also been found in plant genomes. The plant genes share an additional region of sequence similarity with a group of animal genes named FAM62. FAM62 genes also have a similar domain architecture. Little is known about the functions of the plant genes and animal FAM62 genes. Indeed, many members of the large and diverse Syt gene family await functional characterization. Understanding the evolutionary relationships among these genes will help to realize the full implications of functional studies and lead to improved genome annotation. Results I collected and compared plant Syt-like sequences from the primary nucleotide sequence databases at NCBI. The collection comprises six groups of plant genes conserved in embryophytes: NTMC2Type1 to NTMC2Type6. I collected and compared metazoan FAM62 sequences and identified some similar sequences from other eukaryotic lineages. I found evidence of RNA editing and alternative splicing. I compared the intron patterns of Syt genes. I also compared Rabphilin and Doc2 genes. Conclusion Genes encoding proteins with N-terminal-transmembrane-C2 domain architectures resembling synaptotagmins, are widespread in eukaryotes. A collection of these genes is presented here. The collection provides a resource for studies of intron evolution. I have classified the collection into homologous gene families according to distinctive patterns of sequence conservation and intron position. The evolutionary histories of these gene families are traceable through the appearance of family members in different eukaryotic lineages. Assuming an intron-rich eukaryotic ancestor, the conserved intron patterns distinctive of individual gene families, indicate independent origins of Syt, FAM62 and NTMC2 genes. Resemblances

  18. Detailed analysis of putative genes encoding small proteins in legume genomes

    Directory of Open Access Journals (Sweden)

    Gabriel eGuillén

    2013-06-01

    Full Text Available Diverse plant genome sequencing projects coupled with powerful bioinformatics tools have facilitated massive data analysis to construct specialized databases classified according to cellular function. However, there are still a considerable number of genes encoding proteins whose function has not yet been characterized. Included in this category are small proteins (SPs, 30-150 amino acids encoded by short open reading frames (sORFs. SPs play important roles in plant physiology, growth, and development. Unfortunately, protocols focused on the genome-wide identification and characterization of sORFs are scarce or remain poorly implemented. As a result, these genes are underrepresented in many genome annotations. In this work, we exploited publicly available genome sequences of Phaseolus vulgaris, Medicago truncatula, Glycine max and Lotus japonicus to analyze the abundance of annotated SPs in plant legumes. Our strategy to uncover bona fide sORFs at the genome level was centered in bioinformatics analysis of characteristics such as evidence of expression (transcription, presence of known protein regions or domains, and identification of orthologous genes in the genomes explored. We collected 6170, 10461, 30521, and 23599 putative sORFs from P. vulgaris, G. max, M. truncatula, and L. japonicus genomes, respectively. Expressed sequence tags (ESTs available in the DFCI Gene Index database provided evidence that ~one-third of the predicted legume sORFs are expressed. Most potential SPs have a counterpart in a different plant species and counterpart regions or domains in larger proteins. Potential functional sORFs were also classified according to a reduced set of GO categories, and the expression of 13 of them during P. vulgaris nodule ontogeny was confirmed by qPCR. This analysis provides a collection of sORFs that potentially encode for meaningful SPs, and offers the possibility of their further functional evaluation.

  19. Deletion analysis of Streptococcus pneumoniae late competence genes distinguishes virulence determinants that are dependent or independent of competence induction.

    Science.gov (United States)

    Zhu, Luchang; Lin, Jingjun; Kuang, Zhizhou; Vidal, Jorge E; Lau, Gee W

    2015-07-01

    The competence regulon of Streptococcus pneumoniae (pneumococcus) is crucial for genetic transformation. During competence development, the alternative sigma factor ComX is activated, which in turn, initiates transcription of 80 'late' competence genes. Interestingly, only 16 late genes are essential for genetic transformation. We hypothesized that these late genes that are dispensable for competence are beneficial to pneumococcal fitness during infection. These late genes were systematically deleted, and the resulting mutants were examined for their fitness during mouse models of bacteremia and acute pneumonia. Among these, 14 late genes were important for fitness in mice. Significantly, deletion of some late genes attenuated pneumococcal fitness to the same level in both wild-type and ComX-null genetic backgrounds, suggesting that the constitutive baseline expression of these genes was important for bacterial fitness. In contrast, some mutants were attenuated only in the wild-type genetic background but not in the ComX-null background, suggesting that specific expression of these genes during competence state contributed to pneumococcal fitness. Increased virulence during competence state was partially caused by the induction of allolytic enzymes that enhanced pneumolysin release. These results distinguish the role of basal expression versus competence induction in virulence functions encoded by ComX-regulated late competence genes. © 2015 John Wiley & Sons Ltd.

  20. Ti plasmid-encoded genes responsible for catabolism of the crown gall opine mannopine by Agrobacterium tumefaciens are homologs of the T-region genes responsible for synthesis of this opine by the plant tumor.

    Science.gov (United States)

    Kim, K S; Farrand, S K

    1996-06-01

    Agrobacterium tumefaciens NT1 harboring pSaB4, which contains the 14-kb BamHI fragment 4 from the octopine/mannityl opine-type Ti plasmid pTi15955, grew well with agropine (AGR) but slowly with mannopine (MOP) as the sole carbon source. When a second plasmid encoding a dedicated transport system for MOP was introduced, these cells grew well with both AGR and MOP. Transposon insertion mutagenesis and subcloning identified a 5.7-kb region of BamHI fragment 4 that encodes functions required for the degradation of MOP. DNA sequence analysis revealed seven putative genes in this region: mocD (moc for mannityl opine catabolism) and mocE, oriented from right to left, and mocRCBAS, oriented from left to right. Significant identities exist at the nucleotide and derived amino acid sequence levels between these moc genes and the mas genes that are responsible for opine biosynthesis in crown gall tumors. MocD is a homolog of Mas2, the anabolic conjugase encoded by mas2'. MocE and MocC are related to the amino half and the carboxyl half, respectively, of Mas1 (MOP reductase), the second enzyme for MOP biosynthesis. These results indicate that the moc and mas genes evolved from a common origin. MocR and MocS are related to each other and to a putative repressor for the AGR degradation system encoded by the rhizogenic plasmid pRiA4. MocB and MocA are homologs of 6-phosphogluconate dehydratase and glucose-6-phosphate dehydrogenase, respectively. Mutations in mocD and mocE, but not mocC, are suppressed by functions encoded by the chromosome or the 450-kb megaplasmid present in many Agrobacterium isolates. We propose that moc genes derived from genes located elsewhere in the bacterial genome and that the tumor-expressed mas genes evolved from the bacterial moc genes.

  1. Bioinformatics Analysis of NBS-LRR Encoding Resistance Genes in Setaria italica.

    Science.gov (United States)

    Zhao, Yan; Weng, Qiaoyun; Song, Jinhui; Ma, Hailian; Yuan, Jincheng; Dong, Zhiping; Liu, Yinghui

    2016-06-01

    In plants, resistance (R) genes are involved in pathogen recognition and subsequent activation of innate immune responses. The nucleotide-binding site-leucine-rich repeat (NBS-LRR) genes family forms the largest R-gene family among plant genomes and play an important role in plant disease resistance. In this paper, comprehensive analysis of NBS-encoding genes is performed in the whole Setaria italica genome. A total of 96 NBS-LRR genes are identified, and comprehensive overview of the NBS-LRR genes is undertaken, including phylogenetic analysis, chromosome locations, conserved motifs of proteins, and gene expression. Based on the domain, these genes are divided into two groups and distributed in all Setaria italica chromosomes. Most NBS-LRR genes are located at the distal tip of the long arms of the chromosomes. Setaria italica NBS-LRR proteins share at least one nucleotide-biding domain and one leucine-rich repeat domain. Our results also show the duplication of NBS-LRR genes in Setaria italica is related to their gene structure.

  2. Gene replacement in Penicillium roqueforti.

    Science.gov (United States)

    Goarin, Anne; Silar, Philippe; Malagnac, Fabienne

    2015-05-01

    Most cheese-making filamentous fungi lack suitable molecular tools to improve their biotechnology potential. Penicillium roqueforti, a species of high industrial importance, would benefit from functional data yielded by molecular genetic approaches. This work provides the first example of gene replacement by homologous recombination in P. roqueforti, demonstrating that knockout experiments can be performed in this fungus. To do so, we improved the existing transformation method to integrate transgenes into P. roqueforti genome. In the meantime, we cloned the PrNiaD gene, which encodes a NADPH-dependent nitrate reductase that reduces nitrate to nitrite. Then, we performed a deletion of the PrNiaD gene from P. roqueforti strain AGO. The ΔPrNiaD mutant strain is more resistant to chlorate-containing medium than the wild-type strain, but did not grow on nitrate-containing medium. Because genomic data are now available, we believe that generating selective deletions of candidate genes will be a key step to open the way for a comprehensive exploration of gene function in P. roqueforti.

  3. Identification of chitinolytic bacteria isolated from shrimp pond sediment and characterization of their chitinase encoding gene

    Science.gov (United States)

    Triwijayani, A. U.; Puspita, I. D.; Murwantoko; Ustadi

    2018-03-01

    Chitinolytic bacteria are a group of bacteria owning enzymes that able to hydrolyze chitin. Previously, we isolated chitinolytic bacteria from shrimp pond sediment in Bantul, Yogyakarta, and obtained five isolates showing high chitinolytic index named as isolate PT1, PT2, PT5, PT6 and PB2. The aims of this study were to identify chitinolytic bacteria isolated from shrimp pond sediment and to characterize the chitinase encoding gene from each isolate. The molecular technique was performed by amplification of 16S rDNA, amplification of chitinase encoding gene and sequence analysis. Two chitinolytic bacteria of PT1 and PT2 were similar to Aeromonas bivalvium strain D15, PT5 to Pseudomonas stutzeri strain BD-2.2.1, PT6 to Serratia marcescens strain FZSF02 and PB2 to Streptomyces misionensis strain OsiRt-1. The comparison of chitinase encoding gene between three isolates with those in Gen Bank shows that PT1 had similar sequences with the chi1 gene in Aeromonas sp. 17m, PT2 with chi1 gene in A. caviae (CB101) and PT6 with chiB gene in S. Marcescens (BJL200).

  4. [A novel gene (Aa-accA ) encoding acetyl-CoA carboxyltransferase alpha-subunit of Alkalimonas amylolytica N10 enhances salt and alkali tolerance of Escherichia coli and tobacco BY-2 cells].

    Science.gov (United States)

    Xian, Mingjie; Zhai, Lei; Zhong, Naiqin; Ma, Yiwei; Xue, Yanfen; Ma, Yanhe

    2013-08-04

    Acetyl-CoA carboxylase (ACC) catalyzes the first step of fatty acid synthesis. In most bacteria, ACC is composed of four subunits encoded by accA, accB, accC, and accD. Of them, accA encodes acetyl-CoA carboxyltransferase alpha-subunit. Our prior work on proteomics of Alkalimonas amylolytica N10 showed that the expression of the Aa-accA has a remarkable response to salt and alkali stress. This research aimed to find out the Aa-accA gene contributing to salt and alkali tolerance. The Aa-accA was amplified by PCR from A. amylolytica N10 and expressed in E. coli K12 host. The effects of Aa-accA expression on the growth of transgenic strains were examined under different NaCl concentration and pH conditions. Transgenic tobacco BY-2 cells harboring Aa-accA were also generated via Agrobacterium-mediated transformation. The viability of BY-2 cells was determined with FDA staining method after salt and alkali shock. The Aa-accA gene product has 318 amino acids and is homologous to the carboxyl transferase domain of acyl-CoA carboxylases. It showed 76% identity with AccA (acetyl-CoA carboxylase carboxyltransferase subunit alpha) from E. coli. Compared to the wild-type strains, transgenic E. coli K12 strain containing Aa-accA showed remarkable growth superiority when grown in increased NaCl concentrations and pH levels. The final cell density of the transgenic strains was 2.6 and 3.5 times higher than that of the control type when they were cultivated in LB medium containing 6% (W/V) NaCl and at pH 9, respectively. Complementary expression of Aa-accA in an accA-depletion E. coli can recover the tolerance of K12 delta accA to salt and alkali stresses to some extent. Similar to the transgenic E. coli, transgenic tobacco BY-2 cells showed higher percentages of viability compared to the wild BY-2 cells under the salt or alkali stress condition. We found that Aa-accA from A. amylolytica N10 overexpression enhances the tolerance of both transgenic E. coli and tobacco BY-2 cells to

  5. Impact of agricultural management on bacterial laccase-encoding genes with possible implications for soil carbon storage in semi-arid Mediterranean olive farming

    Directory of Open Access Journals (Sweden)

    Beatriz Moreno

    2016-07-01

    Full Text Available Background: In this work, we aimed to gain insights into the contribution of soil bacteria to carbon sequestration in Mediterranean habitats. In particular, we aimed to use bacterial laccase-encoding genes as molecular markers for soil organic C cycling. Using rainfed olive farming as an experimental model, we determined the stability and accumulation levels of humic substances and applied these data to bacterial laccase-encoding gene expression and diversity in soils under four different agricultural management systems (bare soils under tillage/no tillage and vegetation cover under chemical/mechanical management. Materials and Methods: Humic C (> 104 Da was subjected to isoelectric focusing. The GC-MS method was used to analyze aromatic hydrocarbons. Real-Time PCR quantification and denaturing gradient gel electrophoresis (DGGE for functional bacterial laccase-like multicopper oxidase (LMCO-encoding genes and transcripts were also carried out. Results: Soils under spontaneous vegetation, eliminated in springtime using mechanical methods for more than 30 years, showed the highest humic acid levels as well as the largest bacterial population rich in laccase genes and transcripts. The structure of the bacterial community based on LMCO genes also pointed to phylogenetic differences between these soils due to the impact of different management systems. Soils where herbicides were used to eliminate spontaneous vegetation once a year and those where pre-emergence herbicides resulted in bare soils clustered together for DNA-based DGGE analysis, which indicated a certain amount of microbial selection due to the application of herbicides. When LMCO-encoding gene expression was studied, soils where cover vegetation was managed either with herbicides or with mechanical methods showed less than 10% similarity, suggesting that the type of weed management strategy used can impact weed community composition and consequently laccase substrates derived from

  6. Medicago truncatula contains a second gene encoding a plastid located glutamine synthetase exclusively expressed in developing seeds

    Directory of Open Access Journals (Sweden)

    Seabra Ana R

    2010-08-01

    Full Text Available Abstract Background Nitrogen is a crucial nutrient that is both essential and rate limiting for plant growth and seed production. Glutamine synthetase (GS, occupies a central position in nitrogen assimilation and recycling, justifying the extensive number of studies that have been dedicated to this enzyme from several plant sources. All plants species studied to date have been reported as containing a single, nuclear gene encoding a plastid located GS isoenzyme per haploid genome. This study reports the existence of a second nuclear gene encoding a plastid located GS in Medicago truncatula. Results This study characterizes a new, second gene encoding a plastid located glutamine synthetase (GS2 in M. truncatula. The gene encodes a functional GS isoenzyme with unique kinetic properties, which is exclusively expressed in developing seeds. Based on molecular data and the assumption of a molecular clock, it is estimated that the gene arose from a duplication event that occurred about 10 My ago, after legume speciation and that duplicated sequences are also present in closely related species of the Vicioide subclade. Expression analysis by RT-PCR and western blot indicate that the gene is exclusively expressed in developing seeds and its expression is related to seed filling, suggesting a specific function of the enzyme associated to legume seed metabolism. Interestingly, the gene was found to be subjected to alternative splicing over the first intron, leading to the formation of two transcripts with similar open reading frames but varying 5' UTR lengths, due to retention of the first intron. To our knowledge, this is the first report of alternative splicing on a plant GS gene. Conclusions This study shows that Medicago truncatula contains an additional GS gene encoding a plastid located isoenzyme, which is functional and exclusively expressed during seed development. Legumes produce protein-rich seeds requiring high amounts of nitrogen, we postulate

  7. The Networks of Genes Encoding Palmitoylated Proteins in Axonal and Synaptic Compartments Are Affected in PPT1 Overexpressing Neuronal-Like Cells

    Directory of Open Access Journals (Sweden)

    Francesco Pezzini

    2017-08-01

    Full Text Available CLN1 disease (OMIM #256730 is an early childhood ceroid-lipofuscinosis associated with mutated CLN1, whose product Palmitoyl-Protein Thioesterase 1 (PPT1 is a lysosomal enzyme involved in the removal of palmitate residues from S-acylated proteins. In neurons, PPT1 expression is also linked to synaptic compartments. The aim of this study was to unravel molecular signatures connected to CLN1. We utilized SH-SY5Y neuroblastoma cells overexpressing wild type CLN1 (SH-p.wtCLN1 and five selected CLN1 patients’ mutations. The cellular distribution of wtPPT1 was consistent with regular processing of endogenous protein, partially detected inside Lysosomal Associated Membrane Protein 2 (LAMP2 positive vesicles, while the mutants displayed more diffuse cytoplasmic pattern. Transcriptomic profiling revealed 802 differentially expressed genes (DEGs in SH-p.wtCLN1 (as compared to empty-vector transfected cells, whereas the number of DEGs detected in the two mutants (p.L222P and p.M57Nfs*45 was significantly lower. Bioinformatic scrutiny linked DEGs with neurite formation and neuronal transmission. Specifically, neuritogenesis and proliferation of neuronal processes were predicted to be hampered in the wtCLN1 overexpressing cell line, and these findings were corroborated by morphological investigations. Palmitoylation survey identified 113 palmitoylated protein-encoding genes in SH-p.wtCLN1, including 25 ones simultaneously assigned to axonal growth and synaptic compartments. A remarkable decrease in the expression of palmitoylated proteins, functionally related to axonal elongation (GAP43, CRMP1 and NEFM and of the synaptic marker SNAP25, specifically in SH-p.wtCLN1 cells was confirmed by immunoblotting. Subsequent, bioinformatic network survey of DEGs assigned to the synaptic annotations linked 81 DEGs, including 23 ones encoding for palmitoylated proteins. Results obtained in this experimental setting outlined two affected functional modules (connected to

  8. Renal-Retinal Ciliopathy Gene Sdccag8 Regulates DNA Damage Response Signaling

    DEFF Research Database (Denmark)

    Airik, Rannar; Slaats, Gisela G; Guo, Zhi

    2014-01-01

    Nephronophthisis-related ciliopathies (NPHP-RCs) are developmental and degenerative kidney diseases that are frequently associated with extrarenal pathologies such as retinal degeneration, obesity, and intellectual disability. We recently identified mutations in a gene encoding the centrosomal...... protein SDCCAG8 as causing NPHP type 10 in humans. To study the role of Sdccag8 in disease pathogenesis, we generated a Sdccag8 gene-trap mouse line. Homozygous Sdccag8(gt/gt) mice lacked the wild-type Sdccag8 transcript and protein, and recapitulated the human phenotypes of NPHP and retinal degeneration....... These mice exhibited early onset retinal degeneration that was associated with rhodopsin mislocalization in the photoreceptors and reduced cone cell numbers, and led to progressive loss of vision. By contrast, renal histologic changes occurred later, and no global ciliary defects were observed in the kidneys...

  9. Regulation of gene expression by photosynthetic signals triggered through modified CO2 availability

    Directory of Open Access Journals (Sweden)

    Wormuth Dennis

    2006-08-01

    Full Text Available Abstract Background To coordinate metabolite fluxes and energy availability, plants adjust metabolism and gene expression to environmental changes through employment of interacting signalling pathways. Results Comparing the response of Arabidopsis wild-type plants with that of the mutants adg1, pgr1 and vtc1 upon altered CO2-availability, the regulatory role of the cellular energy status, photosynthetic electron transport, the redox state and concentration of ascorbate and glutathione and the assimilatory force was analyzed in relation to the transcript abundance of stress-responsive nuclear encoded genes and psaA and psbA encoding the reaction centre proteins of photosystem I and II, respectively. Transcript abundance of Bap1, Stp1, psaA and psaB was coupled with seven metabolic parameters. Especially for psaA and psaB, the complex analysis demonstrated that the assumed PQ-dependent redox control is subordinate to signals linked to the relative availability of 3-PGA and DHAP, which define the assimilatory force. For the transcripts of sAPx and Csd2 high correlations with the calculated redox state of NADPH were observed in pgr1, but not in wild-type, suggesting that in wild-type plants signals depending on thylakoid acidification overlay a predominant redox-signal. Strongest correlation with the redox state of ascorbate was observed for 2CPA, whose transcript abundance regulation however was almost insensitive to the ascorbate content demonstrating dominance of redox regulation over metabolite sensing. Conclusion In the mutants, signalling pathways are partially uncoupled, demonstrating dominance of metabolic control of photoreaction centre expression over sensing the redox state of the PQ-pool. The balance between the cellular redox poise and the energy signature regulates sAPx and Csd2 transcript abundance, while 2CPA expression is primarily redox-controlled.

  10. Genome-wide analysis of wild-type Epstein-Barr virus genomes derived from healthy individuals of the 1,000 Genomes Project.

    Science.gov (United States)

    Santpere, Gabriel; Darre, Fleur; Blanco, Soledad; Alcami, Antonio; Villoslada, Pablo; Mar Albà, M; Navarro, Arcadi

    2014-04-01

    Most people in the world (∼90%) are infected by the Epstein-Barr virus (EBV), which establishes itself permanently in B cells. Infection by EBV is related to a number of diseases including infectious mononucleosis, multiple sclerosis, and different types of cancer. So far, only seven complete EBV strains have been described, all of them coming from donors presenting EBV-related diseases. To perform a detailed comparative genomic analysis of EBV including, for the first time, EBV strains derived from healthy individuals, we reconstructed EBV sequences infecting lymphoblastoid cell lines (LCLs) from the 1000 Genomes Project. As strain B95-8 was used to transform B cells to obtain LCLs, it is always present, but a specific deletion in its genome sets it apart from natural EBV strains. After studying hundreds of individuals, we determined the presence of natural EBV in at least 10 of them and obtained a set of variants specific to wild-type EBV. By mapping the natural EBV reads into the EBV reference genome (NC007605), we constructed nearly complete wild-type viral genomes from three individuals. Adding them to the five disease-derived EBV genomic sequences available in the literature, we performed an in-depth comparative genomic analysis. We found that latency genes harbor more nucleotide diversity than lytic genes and that six out of nine latency-related genes, as well as other genes involved in viral attachment and entry into host cells, packaging, and the capsid, present the molecular signature of accelerated protein evolution rates, suggesting rapid host-parasite coevolution.

  11. The porcine lymphotropic herpesvirus 1 encodes functional regulators of gene expression

    International Nuclear Information System (INIS)

    Lindner, I.; Ehlers, B.; Noack, S.; Dural, G.; Yasmum, N.; Bauer, C.; Goltz, M.

    2007-01-01

    The porcine lymphotropic herpesviruses (PLHV) are discussed as possible risk factors in xenotransplantation because of the high prevalence of PLHV-1, PLHV-2 and PLHV-3 in pig populations world-wide and the fact that PLHV-1 has been found to be associated with porcine post-transplant lymphoproliferative disease. To provide structural and functional knowledge on the PLHV immediate-early (IE) transactivator genes, the central regions of the PLHV genomes were characterized by genome walking, sequence and splicing analysis. Three spliced genes were identified (ORF50, ORFA6/BZLF1 h , ORF57) encoding putative IE transactivators, homologous to (i) ORF50 and BRLF1/Rta (ii) K8/K-bZIP and BZLF1/Zta and (iii) ORF57 and BMLF1 of HHV-8 and EBV, respectively. Expressed as myc-tag or HA-tag fusion proteins, they were located to the cellular nucleus. In reporter gene assays, several PLHV-promoters were mainly activated by PLHV-1 ORF50, to a lower level by PLHV-1 ORFA6/BZLF1 h and not by PLHV-1 ORF57. However, the ORF57-encoded protein acted synergistically on ORF50-mediated activation

  12. Natural variation in the VELVET gene bcvel1 affects virulence and light-dependent differentiation in Botrytis cinerea.

    Directory of Open Access Journals (Sweden)

    Julia Schumacher

    Full Text Available Botrytis cinerea is an aggressive plant pathogen causing gray mold disease on various plant species. In this study, we identified the genetic origin for significantly differing phenotypes of the two sequenced B. cinerea isolates, B05.10 and T4, with regard to light-dependent differentiation, oxalic acid (OA formation and virulence. By conducting a map-based cloning approach we identified a single nucleotide polymorphism (SNP in an open reading frame encoding a VELVET gene (bcvel1. The SNP in isolate T4 results in a truncated protein that is predominantly found in the cytosol in contrast to the full-length protein of isolate B05.10 that accumulates in the nuclei. Deletion of the full-length gene in B05.10 resulted in the T4 phenotype, namely light-independent conidiation, loss of sclerotial development and oxalic acid production, and reduced virulence on several host plants. These findings indicate that the identified SNP represents a loss-of-function mutation of bcvel1. In accordance, the expression of the B05.10 copy in T4 rescued the wild-type/B05.10 phenotype. BcVEL1 is crucial for full virulence as deletion mutants are significantly hampered in killing and decomposing plant tissues. However, the production of the two best known secondary metabolites, the phytotoxins botcinic acid and botrydial, are not affected by the deletion of bcvel1 indicating that other factors are responsible for reduced virulence. Genome-wide expression analyses of B05.10- and Δbcvel1-infected plant material revealed a number of genes differentially expressed in the mutant: while several protease- encoding genes are under-expressed in Δbcvel1 compared to the wild type, the group of over-expressed genes is enriched for genes encoding sugar, amino acid and ammonium transporters and glycoside hydrolases reflecting the response of Δbcvel1 mutants to nutrient starvation conditions.

  13. Natural variation in the VELVET gene bcvel1 affects virulence and light-dependent differentiation in Botrytis cinerea.

    Science.gov (United States)

    Schumacher, Julia; Pradier, Jean-Marc; Simon, Adeline; Traeger, Stefanie; Moraga, Javier; Collado, Isidro González; Viaud, Muriel; Tudzynski, Bettina

    2012-01-01

    Botrytis cinerea is an aggressive plant pathogen causing gray mold disease on various plant species. In this study, we identified the genetic origin for significantly differing phenotypes of the two sequenced B. cinerea isolates, B05.10 and T4, with regard to light-dependent differentiation, oxalic acid (OA) formation and virulence. By conducting a map-based cloning approach we identified a single nucleotide polymorphism (SNP) in an open reading frame encoding a VELVET gene (bcvel1). The SNP in isolate T4 results in a truncated protein that is predominantly found in the cytosol in contrast to the full-length protein of isolate B05.10 that accumulates in the nuclei. Deletion of the full-length gene in B05.10 resulted in the T4 phenotype, namely light-independent conidiation, loss of sclerotial development and oxalic acid production, and reduced virulence on several host plants. These findings indicate that the identified SNP represents a loss-of-function mutation of bcvel1. In accordance, the expression of the B05.10 copy in T4 rescued the wild-type/B05.10 phenotype. BcVEL1 is crucial for full virulence as deletion mutants are significantly hampered in killing and decomposing plant tissues. However, the production of the two best known secondary metabolites, the phytotoxins botcinic acid and botrydial, are not affected by the deletion of bcvel1 indicating that other factors are responsible for reduced virulence. Genome-wide expression analyses of B05.10- and Δbcvel1-infected plant material revealed a number of genes differentially expressed in the mutant: while several protease- encoding genes are under-expressed in Δbcvel1 compared to the wild type, the group of over-expressed genes is enriched for genes encoding sugar, amino acid and ammonium transporters and glycoside hydrolases reflecting the response of Δbcvel1 mutants to nutrient starvation conditions.

  14. Food-grade host/vector expression system for Lactobacillus casei based on complementation of plasmid-associated phospho-beta-galactosidase gene lacG.

    Science.gov (United States)

    Takala, T M; Saris, P E J; Tynkkynen, S S H

    2003-01-01

    A new food-grade host/vector system for Lactobacillus casei based on lactose selection was constructed. The wild-type non-starter host Lb. casei strain E utilizes lactose via a plasmid-encoded phosphotransferase system. For food-grade cloning, a stable lactose-deficient mutant was constructed by deleting a 141-bp fragment from the phospho-beta-galactosidase gene lacG via gene replacement. The deletion resulted in an inactive phospho-beta-galactosidase enzyme with an internal in-frame deletion of 47 amino acids. A complementation plasmid was constructed containing a replicon from Lactococcus lactis, the lacG gene from Lb. casei, and the constitutive promoter of pepR for lacG expression from Lb. rhamnosus. The expression of the lacG gene from the resulting food-grade plasmid pLEB600 restored the ability of the lactose-negative mutant strain to grow on lactose to the wild-type level. The vector pLEB600 was used for expression of the proline iminopeptidase gene pepI from Lb. helveticus in Lb. casei. The results show that the food-grade expression system reported in this paper can be used for expression of foreign genes in Lb. casei.

  15. Identification and comparative profiling of miRNAs in an early flowering mutant of trifoliate orange and its wild type by genome-wide deep sequencing.

    Directory of Open Access Journals (Sweden)

    Lei-Ming Sun

    Full Text Available MicroRNAs (miRNAs are a new class of small, endogenous RNAs that play a regulatory role in various biological and metabolic processes by negatively affecting gene expression at the post-transcriptional level. While the number of known Arabidopsis and rice miRNAs is continuously increasing, information regarding miRNAs from woody plants such as citrus remains limited. Solexa sequencing was performed at different developmental stages on both an early flowering mutant of trifoliate orange (precocious trifoliate orange, Poncirus trifoliata L. Raf. and its wild-type in this study, resulting in the obtainment of 141 known miRNAs belonging to 99 families and 75 novel miRNAs in four libraries. A total of 317 potential target genes were predicted based on the 51 novel miRNAs families, GO and KEGG annotation revealed that high ranked miRNA-target genes are those implicated in diverse cellular processes in plants, including development, transcription, protein degradation and cross adaptation. To characterize those miRNAs expressed at the juvenile and adult development stages of the mutant and its wild-type, further analysis on the expression profiles of several miRNAs through real-time PCR was performed. The results revealed that most miRNAs were down-regulated at adult stage compared with juvenile stage for both the mutant and its wild-type. These results indicate that both conserved and novel miRNAs may play important roles in citrus growth and development, stress responses and other physiological processes.

  16. Over-expression of a novel JAZ family gene from Glycine soja, increases salt and alkali stress tolerance.

    Science.gov (United States)

    Zhu, Dan; Cai, Hua; Luo, Xiao; Bai, Xi; Deyholos, Michael K; Chen, Qin; Chen, Chao; Ji, Wei; Zhu, Yanming

    2012-09-21

    Salt and alkali stress are two of the main environmental factors limiting crop production. Recent discoveries show that the JAZ family encodes plant-specific genes involved in jasmonate signaling. However, there is only limited information about this gene family in abiotic stress response, and in wild soybean (Glycine soja), which is a species noted for its tolerance to alkali and salinity. Here, we isolated and characterized a novel JAZ family gene, GsJAZ2, from G. soja. Transcript abundance of GsJAZ2 increased following exposure to salt, alkali, cold and drought. Over-expression of GsJAZ2 in Arabidopsis resulted in enhanced plant tolerance to salt and alkali stress. The expression levels of some alkali stress response and stress-inducible marker genes were significantly higher in the GsJAZ2 overexpression lines as compared to wild-type plants. Subcellular localization studies using a GFP fusion protein showed that GsJAZ2 was localized to the nucleus. These results suggest that the newly isolated wild soybean GsJAZ2 is a positive regulator of plant salt and alkali stress tolerance. Crown Copyright © 2012. Published by Elsevier Inc. All rights reserved.

  17. A recessive contiguous gene deletion causing infantile hyperinsulinism, enteropathy and deafness identifies the Usher type 1C gene.

    Science.gov (United States)

    Bitner-Glindzicz, M; Lindley, K J; Rutland, P; Blaydon, D; Smith, V V; Milla, P J; Hussain, K; Furth-Lavi, J; Cosgrove, K E; Shepherd, R M; Barnes, P D; O'Brien, R E; Farndon, P A; Sowden, J; Liu, X Z; Scanlan, M J; Malcolm, S; Dunne, M J; Aynsley-Green, A; Glaser, B

    2000-09-01

    Usher syndrome type 1 describes the association of profound, congenital sensorineural deafness, vestibular hypofunction and childhood onset retinitis pigmentosa. It is an autosomal recessive condition and is subdivided on the basis of linkage analysis into types 1A through 1E. Usher type 1C maps to the region containing the genes ABCC8 and KCNJ11 (encoding components of ATP-sensitive K + (KATP) channels), which may be mutated in patients with hyperinsulinism. We identified three individuals from two consanguineous families with severe hyperinsulinism, profound congenital sensorineural deafness, enteropathy and renal tubular dysfunction. The molecular basis of the disorder is a homozygous 122-kb deletion of 11p14-15, which includes part of ABCC8 and overlaps with the locus for Usher syndrome type 1C and DFNB18. The centromeric boundary of this deletion includes part of a gene shown to be mutated in families with type 1C Usher syndrome, and is hence assigned the name USH1C. The pattern of expression of the USH1C protein is consistent with the clinical features exhibited by individuals with the contiguous gene deletion and with isolated Usher type 1C.

  18. Cloning, characterization, and expression of the dapE gene of Escherichia coli.

    Science.gov (United States)

    Bouvier, J; Richaud, C; Higgins, W; Bögler, O; Stragier, P

    1992-08-01

    The dapE gene of Escherichia coli encodes N-succinyl-L-diaminopimelic acid desuccinylase, an enzyme that catalyzes the synthesis of LL-diaminopimelic acid, one of the last steps in the diaminopimelic acid-lysine pathway. The dapE gene region was previously purified from a lambda bacteriophage transducing the neighboring purC gene (J. Parker, J. Bacteriol. 157:712-717, 1984). Various subcloning steps led to the identification of a 2.3-kb fragment that complemented several dapE mutants and allowed more than 400-fold overexpression of N-succinyl-L-diaminopimelic acid desuccinylase. Sequencing of this fragment revealed the presence of two closely linked open reading frames. The second one encodes a 375-residue, 41,129-M(r) polypeptide that was identified as N-succinyl-L-diaminopimelic acid desuccinylase. The first one encodes a 118-residue polypeptide that is not required for diaminopimelic acid biosynthesis, as judged by the wild-type phenotype of a strain in which this gene was disrupted. Expression of the dapE gene was studied by monitoring amylomaltase activity in strains in which the malPQ operon was under the control of various fragments located upstream of the dapE gene. The major promoter governing dapE transcription was found to be located in the adjacent orf118 gene, while a minor promoter allowed the transcription of both orf118 and dapE. Neither of these two promoters is regulated by the lysine concentration in the growth medium.

  19. Changes in polyphenol and sugar concentrations in wild type and genetically modified Nicotiana langsdorffii Weinmann in response to water and heat stress.

    Science.gov (United States)

    Ancillotti, Claudia; Bogani, Patrizia; Biricolti, Stefano; Calistri, Elisa; Checchini, Leonardo; Ciofi, Lorenzo; Gonnelli, Cristina; Del Bubba, Massimo

    2015-12-01

    In this study wild type Nicotiana langsdorffii plants were genetically transformed by the insertion of the rat gene (gr) encoding the glucocorticoid receptor or the rolC gene and exposed to water and heat stress. Water stress was induced for 15 days by adding 20% PEG 6000 in the growth medium, whereas the heat treatment was performed at 50 °C for 2 h, after that a re-growing capability study was carried out. The plant response to stress was investigated by determining electrolyte leakage, dry weight biomass production and water content. These data were evaluated in relation to antiradical activity and concentrations of total polyphenols, selected phenolic compounds and some soluble sugars, as biochemical indicators of metabolic changes due to gene insertion and/or stress treatments. As regards the water stress, the measured physiological parameters evidenced an increasing stress level in the order rolC < gr < WT plants (e.g. about 100% and 50% electrolyte leakage increase in WT and gr samples, respectively) and complied with the biochemical pattern, which consisted in a general decrease of antiradical activity and phenolics, together with an increase in sugars. As regard heat stress, electrolyte leakage data were only in partial agreement with the re-growing capability study. In fact, according to this latter evaluation, gr was the genotype less affected by the heat shock. In this regard, sugars and especially phenolic compounds are informative of the long-term effects due to heat shock treatment. Copyright © 2015 Elsevier Masson SAS. All rights reserved.

  20. Biological activity and safety of adenoviral vector-expressed wild-type p53 after intratumoral injection in melanoma and breast cancer patients with p53-overexpressing tumors

    NARCIS (Netherlands)

    Dummer, R; Bergh, J; Karlsson, Y; Horovitz, JA; Mulder, NH; Huinin, DT; Burg, G; Hofbauer, G; Osanto, S

    p53 mutations are common genetic alterations in human cancer. Gene transfer of a wild-type (wt) p53 gene reverses the loss of normal p53 function in vitro and in vivo. A phase I dose escalation study of single intratumoral (i.t.) injection of a replication-defective adenoviral expression vector

  1. Identification of the Gene Encoding Isoprimeverose-producing Oligoxyloglucan Hydrolase in Aspergillus oryzae*

    Science.gov (United States)

    Matsuzawa, Tomohiko; Mitsuishi, Yasushi; Kameyama, Akihiko

    2016-01-01

    Aspergillus oryzae produces a unique β-glucosidase, isoprimeverose-producing oligoxyloglucan hydrolase (IPase), that recognizes and releases isoprimeverose (α-d-xylopyranose-(1→6)-d-glucopyranose) units from the non-reducing ends of oligoxyloglucans. A gene encoding A. oryzae IPase, termed ipeA, was identified and expressed in Pichia pastoris. With the exception of cellobiose, IpeA hydrolyzes a variety of oligoxyloglucans and is a member of the glycoside hydrolase family 3. Xylopyranosyl branching at the non-reducing ends was vital for IPase activity, and galactosylation at a α-1,6-linked xylopyranosyl side chain completely abolished IpeA activity. Hepta-oligoxyloglucan saccharide (Xyl3Glc4) substrate was preferred over tri- (Xyl1Glc2) and tetra- (Xyl2Glc2) oligoxyloglucan saccharides substrates. IpeA transferred isoprimeverose units to other saccharides, indicating transglycosylation activity. The ipeA gene was expressed in xylose and xyloglucan media and was strongly induced in the presence of xyloglucan endo-xyloglucanase-hydrolyzed products. This is the first study to report the identification of a gene encoding IPase in eukaryotes. PMID:26755723

  2. Cloning of gene-encoded stem bromelain on system coming from Pichia pastoris as therapeutic protein candidate

    Science.gov (United States)

    Yusuf, Y.; Hidayati, W.

    2018-01-01

    The process of identifying bacterial recombination using PCR, and restriction, and then sequencing process was done after identifying the bacteria. This research aimed to get a yeast cell of Pichia pastoris which has an encoder gene of stem bromelain enzyme. The production of recombinant stem bromelain enzymes using yeast cells of P. pastoris can produce pure bromelain rod enzymes and have the same conformation with the enzyme’s conformation in pineapple plants. This recombinant stem bromelain enzyme can be used as a therapeutic protein in inflammatory, cancer and degenerative diseases. This study was an early stage of a step series to obtain bromelain rod protein derived from pineapple made with genetic engineering techniques. This research was started by isolating the RNA of pineapple stem which was continued with constructing cDNA using reserve transcriptase-PCR technique (RT-PCR), doing the amplification of bromelain enzyme encoder gene with PCR technique using a specific premiere couple which was designed. The process was continued by cloning into bacterium cells of Escherichia coli. A vector which brought the encoder gene of stem bromelain enzyme was inserted into the yeast cell of P. pastoris and was continued by identifying the yeast cell of P. pastoris which brought the encoder gene of stem bromelain enzyme. The research has not found enzyme gene of stem bromelain in yeast cell of P. pastoris yet. The next step is repeating the process by buying new reagent; RNase inhibitor, and buying liquid nitrogen.

  3. Mutations in pncA, a gene encoding pyrazinamidase/nicotinamidase, cause resistance to the antituberculous drug pyrazinamide in tubercle bacillus.

    Science.gov (United States)

    Scorpio, A; Zhang, Y

    1996-06-01

    Naturally pyrazinamide (PZA)-resistant Mycobacterium bovis and acquired PZA-resistant M. tuberculosis strains lose pyrazinamidase (PZase). To investigate the molecular mechanism of PZA resistance, we have cloned the gene (pncA) encoding M. tuberculosis PZase. Mutations in pncA were identified in both types of PZA-resistant strains, and transformation of these strains with a functional pncA gene restored PZase activity and PZA susceptibility. These findings, besides providing the basis for understanding how PZA works, should have implications for rapid detection of PZA-resistant clinical isolates of M. tuberculosis and also for rapid differentiation of M. bovis from M. tuberculosis strains.

  4. Expression analysis of two gene subfamilies encoding the plasma membrane H+-ATPase in Nicotiana plumbaginifolia reveals the major transport functions of this enzyme.

    Science.gov (United States)

    Moriau, L; Michelet, B; Bogaerts, P; Lambert, L; Michel, A; Oufattole, M; Boutry, M

    1999-07-01

    The plasma membrane H+-ATPase couples ATP hydrolysis to proton transport, thereby establishing the driving force for solute transport across the plasma membrane. In Nicotiana plumbaginifolia, this enzyme is encoded by at least nine pma (plasma membrane H+-ATPase) genes. Four of these are classified into two gene subfamilies, pma1-2-3 and pma4, which are the most highly expressed in plant species. We have isolated genomic clones for pma2 and pma4. Mapping of their transcript 5' end revealed the presence of a long leader that contained small open reading frames, regulatory features typical of other pma genes. The gusA reporter gene was then used to determine the expression of pma2, pma3 and pma4 in N. tabacum. These data, together with those obtained previously for pma1, led to the following conclusions. (i) The four pma-gusA genes were all expressed in root, stem, leaf and flower organs, but each in a cell-type specific manner. Expression in these organs was confirmed at the protein level, using subfamily-specific antibodies. (ii) pma4-gusA was expressed in many cell types and notably in root hair and epidermis, in companion cells, and in guard cells, indicating that in N. plumbaginifolia the same H+-ATPase isoform might be involved in mineral nutrition, phloem loading and control of stomata aperture. (iii) The second gene subfamily is composed, in N. plumbaginifolia, of a single gene (pma4) with a wide expression pattern and, in Arabidopsis thaliana, of three genes (aha1, aha2, aha3), at least two of them having a more restrictive expression pattern. (iv) Some cell types expressed pma2 and pma4 at the same time, which encode H+-ATPases with different enzymatic properties.

  5. The KL24 gene cluster and a genomic island encoding a Wzy polymerase contribute genes needed for synthesis of the K24 capsular polysaccharide by the multiply antibiotic resistant Acinetobacter baumannii isolate RCH51.

    Science.gov (United States)

    Kenyon, Johanna J; Kasimova, Anastasiya A; Shneider, Mikhail M; Shashkov, Alexander S; Arbatsky, Nikolay P; Popova, Anastasiya V; Miroshnikov, Konstantin A; Hall, Ruth M; Knirel, Yuriy A

    2017-03-01

    The whole-genome sequence of the multiply antibiotic resistant Acinetobacter baumannii isolate RCH51 belonging to sequence type ST103 (Institut Pasteur scheme) revealed that the set of genes at the capsule locus, KL24, includes four genes predicted to direct the synthesis of 3-acetamido-3,6-dideoxy-d-galactose (d-Fuc3NAc), and this sugar was found in the capsular polysaccharide (CPS). One of these genes, fdtE, encodes a novel bifunctional protein with an N-terminal FdtA 3,4-ketoisomerase domain and a C-terminal acetyltransferase domain. KL24 lacks a gene encoding a Wzy polymerase to link the oligosaccharide K units to form the CPS found associated with isolate RCH51, and a wzy gene was found in a small genomic island (GI) near the cpn60 gene. This GI is in precisely the same location as another GI carrying wzy and atr genes recently found in several A. baumannii isolates, but it does not otherwise resemble it. The CPS isolated from RCH51, studied by sugar analysis and 1D and 2D 1H and 13C NMR spectroscopy, revealed that the K unit has a branched pentasaccharide structure made up of Gal, GalNAc and GlcNAc residues with d-Fuc3NAc as a side branch, and the K units are linked via a β-d-GlcpNAc-(1→3)-β-d-Galp linkage formed by the Wzy encoded by the GI. The functions of the glycosyltransferases encoded by KL24 were assigned to formation of specific bonds. A correspondence between the order of the genes in KL24 and other KL and the order of the linkages they form was noted, and this may be useful in future predictions of glycosyltransferase specificities.

  6. Diversity of beetle genes encoding novel plant cell wall degrading enzymes.

    Directory of Open Access Journals (Sweden)

    Yannick Pauchet

    Full Text Available Plant cell walls are a heterogeneous mixture of polysaccharides and proteins that require a range of different enzymes to degrade them. Plant cell walls are also the primary source of cellulose, the most abundant and useful biopolymer on the planet. Plant cell wall degrading enzymes (PCWDEs are therefore important in a wide range of biotechnological processes from the production of biofuels and food to waste processing. However, despite the fact that the last common ancestor of all deuterostomes was inferred to be able to digest, or even synthesize, cellulose using endogenous genes, all model insects whose complete genomes have been sequenced lack genes encoding such enzymes. To establish if the apparent "disappearance" of PCWDEs from insects is simply a sampling problem, we used 454 mediated pyrosequencing to scan the gut transcriptomes of beetles that feed on a variety of plant derived diets. By sequencing the transcriptome of five beetles, and surveying publicly available ESTs, we describe 167 new beetle PCWDEs belonging to eight different enzyme families. This survey proves that these enzymes are not only present in non-model insects but that the multigene families that encode them are apparently undergoing complex birth-death dynamics. This reinforces the observation that insects themselves, and not just their microbial symbionts, are a rich source of PCWDEs. Further it emphasises that the apparent absence of genes encoding PCWDEs from model organisms is indeed simply a sampling artefact. Given the huge diversity of beetles alive today, and the diversity of their lifestyles and diets, we predict that beetle guts will emerge as an important new source of enzymes for use in biotechnology.

  7. Prevalence of genes encoding extracellular virulence factors among meticillin-resistant Staphylococcus aureus isolates from the University Hospital, Olomouc, Czech Republic.

    Science.gov (United States)

    Sauer, P; Síla, J; Stosová, T; Vecerová, R; Hejnar, P; Vágnerová, I; Kolár, M; Raclavsky, V; Petrzelová, J; Lovecková, Y; Koukalová, D

    2008-04-01

    A rather fast and complicated progression of an infection caused by some strains of Staphylococcus aureus could be associated with the expression and co-action of virulence factor complexes in these strains. This study screened the antibiotic susceptibility and prevalence of virulence markers in isolates of meticillin-resistant S. aureus (MRSA) obtained from patients hospitalized at the University Hospital in Olomouc, Czech Republic. A total of 100 isolates was screened for 13 genes encoding extracellular virulence determinants (tst, pvl, eta, etb, sea, seb, sec, sed, see, seg, seh, sei and sej) and for their distribution in sample types. Eighty-nine isolates were positive for at least one of the genes. Genes for etb, pvl, see and seh were not detected in any of the MRSA isolates. No statistically significant differences in the occurrence of the determinants studied among sample types were found.

  8. Effects of TCDD on the expression of nuclear encoded mitochondrial genes

    International Nuclear Information System (INIS)

    Forgacs, Agnes L.; Burgoon, Lyle D.; Lynn, Scott G.; LaPres, John J.; Zacharewski, Timothy

    2010-01-01

    Generation of mitochondrial reactive oxygen species (ROS) can be perturbed following exposure to environmental chemicals such as 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD). Reports indicate that the aryl hydrocarbon receptor (AhR) mediates TCDD-induced sustained hepatic oxidative stress by decreasing hepatic ATP levels and through hyperpolarization of the inner mitochondrial membrane. To further elucidate the effects of TCDD on the mitochondria, high-throughput quantitative real-time PCR (HTP-QRTPCR) was used to evaluate the expression of 90 nuclear genes encoding mitochondrial proteins involved in electron transport, oxidative phosphorylation, uncoupling, and associated chaperones. HTP-QRTPCR analysis of time course (30 μg/kg TCDD at 2, 4, 8, 12, 18, 24, 72, and 168 h) liver samples obtained from orally gavaged immature, ovariectomized C57BL/6 mice identified 54 differentially expressed genes (|fold change| > 1.5 and P-value < 0.1). Of these, 8 exhibited a sigmoidal or exponential dose-response profile (0.03 to 300 μg/kg TCDD) at 4, 24 or 72 h. Dose-responsive genes encoded proteins associated with electron transport chain (ETC) complexes I (NADH dehydrogenase), III (cytochrome c reductase), IV (cytochrome c oxidase), and V (ATP synthase) and could be generally categorized as having proton gradient, ATP synthesis, and chaperone activities. In contrast, transcript levels of ETC complex II, succinate dehydrogenase, remained unchanged. Putative dioxin response elements were computationally found in the promoter regions of all 8 dose-responsive genes. This high-throughput approach suggests that TCDD alters the expression of genes associated with mitochondrial function which may contribute to TCDD-elicited mitochondrial toxicity.

  9. Alterations in gene expression in mutant amyloid precursor protein transgenic mice lacking Niemann-Pick type C1 protein.

    Directory of Open Access Journals (Sweden)

    Mahua Maulik

    Full Text Available Niemann-Pick type C (NPC disease, a rare autosomal recessive disorder caused mostly by mutation in NPC1 gene, is pathologically characterized by the accumulation of free cholesterol in brain and other tissues. This is accompanied by gliosis and loss of neurons in selected brain regions, including the cerebellum. Recent studies have shown that NPC disease exhibits intriguing parallels with Alzheimer's disease, including the presence of neurofibrillary tangles and increased levels of amyloid precursor protein (APP-derived β-amyloid (Aβ peptides in vulnerable brain neurons. To evaluate the role of Aβ in NPC disease, we determined the gene expression profile in selected brain regions of our recently developed bigenic ANPC mice, generated by crossing APP transgenic (Tg mice with heterozygous Npc1-deficient mice. The ANPC mice exhibited exacerbated neuronal and glial pathology compared to other genotypes [i.e., APP-Tg, double heterozygous (Dhet, Npc1-null and wild-type mice]. Analysis of expression profiles of 86 selected genes using real-time RT-PCR arrays showed a wide-spectrum of alterations in the four genotypes compared to wild-type controls. The changes observed in APP-Tg and Dhet mice are limited to only few genes involved mostly in the regulation of cholesterol metabolism, whereas Npc1-null and ANPC mice showed alterations in the expression profiles of a number of genes regulating cholesterol homeostasis, APP metabolism, vesicular trafficking and cell death mechanism in both hippocampus and cerebellum compared to wild-type mice. Intriguingly, ANPC and Npc1-null mice, with some exceptions, exhibited similar changes, although more genes were differentially expressed in the affected cerebellum than the relatively spared hippocampus. The altered gene profiles were found to match with the corresponding protein levels. These results suggest that lack of Npc1 protein can alter the expression profile of selected transcripts as well as proteins, and

  10. Genomic polymorphism, recombination, and linkage disequilibrium in human major histocompatibility complex-encoded antigen-processing genes.

    Science.gov (United States)

    van Endert, P M; Lopez, M T; Patel, S D; Monaco, J J; McDevitt, H O

    1992-01-01

    Recently, two subunits of a large cytosolic protease and two putative peptide transporter proteins were found to be encoded by genes within the class II region of the major histocompatibility complex (MHC). These genes have been suggested to be involved in the processing of antigenic proteins for presentation by MHC class I molecules. Because of the high degree of polymorphism in MHC genes, and previous evidence for both functional and polypeptide sequence polymorphism in the proteins encoded by the antigen-processing genes, we tested DNA from 27 consanguineous human cell lines for genomic polymorphism by restriction fragment length polymorphism (RFLP) analysis. These studies demonstrate a strong linkage disequilibrium between TAP1 and LMP2 RFLPs. Moreover, RFLPs, as well as a polymorphic stop codon in the telomeric TAP2 gene, appear to be in linkage disequilibrium with HLA-DR alleles and RFLPs in the HLA-DO gene. A high rate of recombination, however, seems to occur in the center of the complex, between the TAP1 and TAP2 genes. Images PMID:1360671

  11. Trichoderma reesei xylanase 5 is defective in the reference strain QM6a but functional alleles are present in other wild-type strains.

    Science.gov (United States)

    Ramoni, Jonas; Marchetti-Deschmann, Martina; Seidl-Seiboth, Verena; Seiboth, Bernhard

    2017-05-01

    Trichoderma reesei is a paradigm for the regulation and industrial production of plant cell wall-degrading enzymes. Among these, five xylanases, including the glycoside hydrolase (GH) family 11 XYN1 and XYN2, the GH10 XYN3, and the GH30 XYN4 and XYN6, were described. By genome mining and transcriptome analysis, a further putative xylanase, encoded by xyn5, was identified. Analysis of xyn5 from the genome-sequenced reference strain T. reesei QM6a shows that it encodes a non-functional, truncated form of XYN5. However, non-truncated orthologues are present in other genome sequenced Trichoderma spp., and sequencing of xyn5 in other T. reesei wild-type isolates shows that they harbor a putative functional xyn5 allele. In silico analysis and 3D modeling revealed that the encoded XYN5 has significant structural similarities to xylanases of the GH11 family, including a GH-typical substrate binding groove and a carboxylate pair in the active site. The xyn5 of wild-type strain TUCIM1282 was recombinantly expressed in a T. reesei strain with a (hemi)cellulase-free background and the corresponding protein purified to apparent homogeneity. The pH and temperature optima and the kinetic parameters of the purified XYN5 were pH 4, 50 °C, and V max  = 2646 nkat/mg with a K m of 9.68 mg/ml. This functional xyn5 allele was used to replace the mutated version which led to an overall increase of the xylanolytic activity. These findings are of particular importance as GH11 xylanases are of high biotechnological relevance, and T. reesei is one of the main industrial producers of such lignocellulose-degrading enzymes.

  12. Combinational deletion of three membrane protein-encoding genes highly attenuates yersinia pestis while retaining immunogenicity in a mouse model of pneumonic plague.

    Science.gov (United States)

    Tiner, Bethany L; Sha, Jian; Kirtley, Michelle L; Erova, Tatiana E; Popov, Vsevolod L; Baze, Wallace B; van Lier, Christina J; Ponnusamy, Duraisamy; Andersson, Jourdan A; Motin, Vladimir L; Chauhan, Sadhana; Chopra, Ashok K

    2015-04-01

    Previously, we showed that deletion of genes encoding Braun lipoprotein (Lpp) and MsbB attenuated Yersinia pestis CO92 in mouse and rat models of bubonic and pneumonic plague. While Lpp activates Toll-like receptor 2, the MsbB acyltransferase modifies lipopolysaccharide. Here, we deleted the ail gene (encoding the attachment-invasion locus) from wild-type (WT) strain CO92 or its lpp single and Δlpp ΔmsbB double mutants. While the Δail single mutant was minimally attenuated compared to the WT bacterium in a mouse model of pneumonic plague, the Δlpp Δail double mutant and the Δlpp ΔmsbB Δail triple mutant were increasingly attenuated, with the latter being unable to kill mice at a 50% lethal dose (LD50) equivalent to 6,800 LD50s of WT CO92. The mutant-infected animals developed balanced TH1- and TH2-based immune responses based on antibody isotyping. The triple mutant was cleared from mouse organs rapidly, with concurrent decreases in the production of various cytokines and histopathological lesions. When surviving animals infected with increasing doses of the triple mutant were subsequently challenged on day 24 with the bioluminescent WT CO92 strain (20 to 28 LD50s), 40 to 70% of the mice survived, with efficient clearing of the invading pathogen, as visualized in real time by in vivo imaging. The rapid clearance of the triple mutant, compared to that of WT CO92, from animals was related to the decreased adherence and invasion of human-derived HeLa and A549 alveolar epithelial cells and to its inability to survive intracellularly in these cells as well as in MH-S murine alveolar and primary human macrophages. An early burst of cytokine production in macrophages elicited by the triple mutant compared to WT CO92 and the mutant's sensitivity to the bactericidal effect of human serum would further augment bacterial clearance. Together, deletion of the ail gene from the Δlpp ΔmsbB double mutant severely attenuated Y. pestis CO92 to evoke pneumonic plague in a

  13. The promoter of the glucoamylase-encoding gene of Aspergillus niger functions in Ustilago maydis

    Energy Technology Data Exchange (ETDEWEB)

    Smith, T.L. (Dept. of Agriculture, Madison, WI (United States) Univ. of Wisconsin, Madison (United States)); Gaskell, J.; Cullen, D. (Dept. of Agriculture, Madison, WI (United States)); Berka, R.M.; Yang, M.; Henner, D.J. (Genentech Inc., San Francisco, CA (United States))

    1990-01-01

    Promoter sequences from the Aspergillus niger glucoamylase-encoding gene (glaA) were linked to the bacterial hygromycin (Hy) phosphotransferase-encoding gene (hph) and this chimeric marker was used to select Hy-resistant (Hy[sup R]) Ustilago maydis transformants. This is an example of an Ascomycete promoter functioning in a Basidiomycete. Hy[sup R] transformants varied with respect to copy number of integrated vector, mitotic stability, and tolerance to Hy. Only 216 bp of glaA promoter sequence is required for expression in U. maydis but this promoter is not induced by starch as it is in Aspergillus spp. The transcription start points are the same in U. maydis and A. niger.

  14. Comparative behaviour of lab.-cultured and wild-type Dacus oleae flies in the field

    International Nuclear Information System (INIS)

    Prokopy, R.J.; Haniotakis, G.E.; Economopoulos, A.P.

    1975-01-01

    Under field conditions, the authors compared the responses of lab.-type (ca. 85 generations under artificial conditions) and wild-type Dacus oleae flies to host plant colour and odour, host fruit colour and shape, small rectangles of different colours and shades, and McPhail-type traps of different colours baited with different odours. Except for the lab.-type flies being relatively more attracted toward red fruit models and small red rectangles and relatively less attracted toward yellow fruit models and small yellow rectangles than the wild type, the qualitative nature of the responses of the two fly types toward the various experimental treatments was essentially the same. Quantitatively, however, consistently smaller percentages of the released lab.-type than the released wild-type flies were recaptured, suggesting that the mobility, flight pattern, or vigour of the two types of flies may be different. (author)

  15. Gastric Medullary Carcinoma with Sporadic Mismatch Repair Deficiency and a TP53 R273C Mutation: An Unusual Case with Wild-Type BRAF

    Directory of Open Access Journals (Sweden)

    Brett M. Lowenthal

    2017-01-01

    Full Text Available Medullary carcinoma has long been recognized as a subtype of colorectal cancer associated with microsatellite instability and Lynch syndrome. Gastric medullary carcinoma is a very rare neoplasm. We report a 67-year-old male who presented with a solitary gastric mass. Total gastrectomy revealed a well-demarcated, poorly differentiated carcinoma with an organoid growth pattern, pushing borders, and abundant peritumoral lymphocytic response. The prior cytology was cellular with immunohistochemical panel consistent with upper gastrointestinal/pancreaticobiliary origin. Overall, the histopathologic findings were consistent with gastric medullary carcinoma. A mismatch repair panel revealed a mismatch repair protein deficient tumor with loss of MLH1 and PMS2 expression. BRAF V600E immunostain (VE1 and BRAF molecular testing were negative, indicating a wild-type gene. Tumor sequencing of MLH1 demonstrated a wild-type gene, while our molecular panel identified TP53 c.817C>T (p.R273C mutation. These findings were compatible with a sporadic tumor. Given that morphologically identical medullary tumors often occur in Lynch syndrome, it is possible that mismatch repair loss is an early event in sporadic tumors with p53 mutation being a late event. Despite having wild-type BRAF, this tumor is sporadic and unrelated to Lynch syndrome. This case report demonstrates that coordinate ancillary studies are needed to resolve sporadic versus hereditary rare tumors.

  16. [Analysis of SOX10 gene mutation in a family affected with Waardenburg syndrome type II].

    Science.gov (United States)

    Zheng, Lei; Yan, Yousheng; Chen, Xue; Zhang, Chuan; Zhang, Qinghua; Feng, Xuan; Hao, Shen

    2018-02-10

    OBJECTIVE To detect potential mutation of SOX10 gene in a pedigree affected with Warrdenburg syndrome type II. METHODS Genomic DNA was extracted from peripheral blood samples of the proband and his family members. Exons and flanking sequences of MITF, PAX3, SOX10, SNAI2, END3 and ENDRB genes were analyzed by chip capturing and high throughput sequencing. Suspected mutations were verified with Sanger sequencing. RESULTS A c.127C>T (p.R43X) mutation of the SOX10 gene was detected in the proband, for which both parents showed a wild-type genotype. CONCLUSION The c.127C>T (p.R43X) mutation of SOX10 gene probably underlies the ocular symptoms and hearing loss of the proband.

  17. Structure and Composition of Protein Bodies from Wild-Type and High-Lysine Barley Endosperm

    DEFF Research Database (Denmark)

    Ingversen, J.

    1975-01-01

    Protein bodies were isolated from 13 and 28 day old endosperms of barley mutant 1508 and its wild type, Bomi barley. The fine structure of the isolated protein bodies was determined by electron microscopy, and the proteins present in the preparations characterized by amino-acid analysis and SDS......-polyacrylamidegel electrophoresis. Sections through pellets of isolated protein bodies from both the mutant and the wild type revealed protein body structures corresponding with those observed in sections through the intact starchy endosperms. The majority of the wild-type protein bodies was homogeneous spheres accompanied...... that the wild-type protein bodies contained large amounts of prolamines (the storage protein group which is soluble in 55 % isopropanol) and some glutelins (the storage proteins soluble in dilute alkali), whereas the mutant protein bodies have glutelin as the major component and little prolamines...

  18. Spontaneous human squamous cell carcinomas are killed by a human cytotoxic T lymphocyte clone recognizing a wild-type p53-derived peptide

    DEFF Research Database (Denmark)

    Röpke, M; Hald, J; Guldberg, Per

    1996-01-01

    p53 genes, in a L9V/HLA-A2 specific and restricted fashion. Thus, the normal tolerance against endogenously processed p53 protein-derived self-epitopes can be broken by peptide-specific in vitro priming. p53 protein-derived wild-type peptides might thus represent tumor associated target molecules...

  19. AIB1 gene amplification and the instability of polyQ encoding sequence in breast cancer cell lines

    Directory of Open Access Journals (Sweden)

    Clarke Robert

    2006-05-01

    Full Text Available Abstract Background The poly Q polymorphism in AIB1 (amplified in breast cancer gene is usually assessed by fragment length analysis which does not reveal the actual sequence variation. The purpose of this study is to investigate the sequence variation of poly Q encoding region in breast cancer cell lines at single molecule level, and to determine if the sequence variation is related to AIB1 gene amplification. Methods The polymorphic poly Q encoding region of AIB1 gene was investigated at the single molecule level by PCR cloning/sequencing. The amplification of AIB1 gene in various breast cancer cell lines were studied by real-time quantitative PCR. Results Significant amplifications (5–23 folds of AIB1 gene were found in 2 out of 9 (22% ER positive cell lines (in BT-474 and MCF-7 but not in BT-20, ZR-75-1, T47D, BT483, MDA-MB-361, MDA-MB-468 and MDA-MB-330. The AIB1 gene was not amplified in any of the ER negative cell lines. Different passages of MCF-7 cell lines and their derivatives maintained the feature of AIB1 amplification. When the cells were selected for hormone independence (LCC1 and resistance to 4-hydroxy tamoxifen (4-OH TAM (LCC2 and R27, ICI 182,780 (LCC9 or 4-OH TAM, KEO and LY 117018 (LY-2, AIB1 copy number decreased but still remained highly amplified. Sequencing analysis of poly Q encoding region of AIB1 gene did not reveal specific patterns that could be correlated with AIB1 gene amplification. However, about 72% of the breast cancer cell lines had at least one under represented (3CAA(CAG9(CAACAG3(CAACAGCAG2CAA of the original cell line, a number of altered poly Q encoding sequences were found in the derivatives of MCF-7 cell lines. Conclusion These data suggest that poly Q encoding region of AIB1 gene is somatic unstable in breast cancer cell lines. The instability and the sequence characteristics, however, do not appear to be associated with the level of the gene amplification.

  20. Characterization of Genes Encoding Key Enzymes Involved in Anthocyanin Metabolism of Kiwifruit during Storage Period.

    Science.gov (United States)

    Li, Boqiang; Xia, Yongxiu; Wang, Yuying; Qin, Guozheng; Tian, Shiping

    2017-01-01

    'Hongyang' is a red fleshed kiwifruit with high anthocyanin content. In this study, we mainly investigated effects of different temperatures (25 and 0°C) on anthocyanin biosynthesis in harvested kiwifruit, and characterized the genes encoding key enzymes involved in anthocyanin metabolism, as well as evaluated the mode of the action, by which low temperature regulates anthocyanin accumulation in 'Hongyang' kiwifruit during storage period. The results showed that low temperature could effectively enhance the anthocyanin accumulation of kiwifruit in the end of storage period (90 days), which related to the increase in mRNA levels of ANS1, ANS2, DRF1, DRF2 , and UGFT2 . Moreover, the transcript abundance of MYBA1-1 and MYB5-1 , the genes encoding an important component of MYB-bHLH-WD40 (MBW) complex, was up-regulated, possibly contributing to the induction of specific anthocyanin biosynthesis genes under the low temperature. To further investigate the roles of AcMYB5-1/5-2/A1-1 in regulation of anthocyanin biosynthesis, genes encoding the three transcription factors were transiently transformed in Nicotiana benthamiana leaves. Overexpression of AcMYB5-1/5-2/A1-1 activated the gene expression of NtANS and NtDFR in tobacco. Our results suggested that low temperature storage could stimulate the anthocyanin accumulation in harvested kiwifruit via regulating several structural and regulatory genes involved in anthocyanin biosynthesis.

  1. Bovine Herpes Virus 1 (BHV-1) and Herpes Simplex Virus Type 1 (HSV-1) Promote Survival of Latently Infected Sensory Neurons, in Part by Inhibiting Apoptosis

    Science.gov (United States)

    Jones, Clinton

    2013-01-01

    α-Herpesvirinae subfamily members, including herpes simplex virus type 1 (HSV-1) and bovine herpes virus 1 (BHV-1), initiate infection in mucosal surfaces. BHV-1 and HSV-1 enter sensory neurons by cell-cell spread where a burst of viral gene expression occurs. When compared to non-neuronal cells, viral gene expression is quickly extinguished in sensory neurons resulting in neuronal survival and latency. The HSV-1 latency associated transcript (LAT), which is abundantly expressed in latently infected neurons, inhibits apoptosis, viral transcription, and productive infection, and directly or indirectly enhances reactivation from latency in small animal models. Three anti-apoptosis genes can be substituted for LAT, which will restore wild type levels of reactivation from latency to a LAT null mutant virus. Two small non-coding RNAs encoded by LAT possess anti-apoptosis functions in transfected cells. The BHV-1 latency related RNA (LR-RNA), like LAT, is abundantly expressed during latency. The LR-RNA encodes a protein (ORF2) and two microRNAs that are expressed in certain latently infected neurons. Wild-type expression of LR gene products is required for stress-induced reactivation from latency in cattle. ORF2 has anti-apoptosis functions and interacts with certain cellular transcription factors that stimulate viral transcription and productive infection. ORF2 is predicted to promote survival of infected neurons by inhibiting apoptosis and sequestering cellular transcription factors which stimulate productive infection. In addition, the LR encoded microRNAs inhibit viral transcription and apoptosis. In summary, the ability of BHV-1 and HSV-1 to interfere with apoptosis and productive infection in sensory neurons is crucial for the life-long latency-reactivation cycle in their respective hosts. PMID:25278776

  2. Porphyrin Interactions with Wild Type and Mutant Mouse Ferrochelatase

    Energy Technology Data Exchange (ETDEWEB)

    Ferreira, Gloria C.; Franco, Ricardo; Lu, Yi; Ma, Jian-Guo; Shelnutt, John A.

    1999-05-19

    Ferrochelatase (EC 4.99.1.1), the terminal enzyme of the heme biosynthetic pathway, catalyzes Fe2+ chelation into protoporphyrin IX. Resonance Raman and W-visible absorbance spectroscopes of wild type and engineered variants of murine ferrochelatase were used to examine the proposed structural mechanism for iron insertion into protoporphyrin by ferrochelatase. The recombinant variants (i.e., H207N and E287Q) are enzymes in which the conserved amino acids histidine-207 and glutamate-287 of murine ferrochelatase were substituted with asparagine and glutamine, respectively. Both of these residues are at the active site of the enzyme as deduced from the Bacillus subtilis ferrochelatase three-dimensional structure. Addition of free base or metalated porphyrins to wild type ferrochelatase and H207N variant yields a quasi 1:1 complex, possibly a monomeric protein-bound species. In contrast, the addition of porphyrin (either free base or metalated) to E287Q is sub-stoichiometric, as this variant retains bound porphyrin in the active site during isolation and purification. The specificity of porphyrin binding is confirmed by the narrowing of the structure-sensitive resonance Raman lines and the vinyl vibrational mode. Resonance Raman spectra of free base and metalated porphyrins bound to the wild type ferrochelatase indicate a nonplanar distortion of the porphyrin macrocycle, although the magnitude of the distortion cannot be determined without first defining the specific type of deformation. Significantly, the extent of the nonplanar distortion varies in the case of H207N- and E287Q-bound porphyrins. In fact, resonance Raman spectral decomposition indicates a homogeneous ruffled distortion for the nickel protoporphyrin bound to the wild type ferrochelatase, whereas both a planar and ruffled conformations are present for the H207N-bound porphyrin. Perhaps more revealing is the unusual resonance , 3 Raman spectrum of the endogenous E287Q-bound porphyrin, which has

  3. A plasmid-encoded UmuD homologue regulates expression of Pseudomonas aeruginosa SOS genes.

    Science.gov (United States)

    Díaz-Magaña, Amada; Alva-Murillo, Nayeli; Chávez-Moctezuma, Martha P; López-Meza, Joel E; Ramírez-Díaz, Martha I; Cervantes, Carlos

    2015-07-01

    The Pseudomonas aeruginosa plasmid pUM505 contains the umuDC operon that encodes proteins similar to error-prone repair DNA polymerase V. The umuC gene appears to be truncated and its product is probably not functional. The umuD gene, renamed umuDpR, possesses an SOS box overlapped with a Sigma factor 70 type promoter; accordingly, transcriptional fusions revealed that the umuDpR gene promoter is activated by mitomycin C. The predicted sequence of the UmuDpR protein displays 23 % identity with the Ps. aeruginosa SOS-response LexA repressor. The umuDpR gene caused increased MMC sensitivity when transferred to the Ps. aeruginosa PAO1 strain. As expected, PAO1-derived knockout lexA-  mutant PW6037 showed resistance to MMC; however, when the umuDpR gene was transferred to PW6037, MMC resistance level was reduced. These data suggested that UmuDpR represses the expression of SOS genes, as LexA does. To test whether UmuDpR exerts regulatory functions, expression of PAO1 SOS genes was evaluated by reverse transcription quantitative PCR assays in the lexA-  mutant with or without the pUC_umuD recombinant plasmid. Expression of lexA, imuA and recA genes increased 3.4-5.3 times in the lexA-  mutant, relative to transcription of the corresponding genes in the lexA+ strain, but decreased significantly in the lexA- /umuDpR transformant. These results confirmed that the UmuDpR protein is a repressor of Ps. aeruginosa SOS genes controlled by LexA. Electrophoretic mobility shift assays, however, did not show binding of UmuDpR to 5' regions of SOS genes, suggesting an indirect mechanism of regulation.

  4. Selenium Pretreatment Alleviated LPS-Induced Immunological Stress Via Upregulation of Several Selenoprotein Encoding Genes in Murine RAW264.7 Cells.

    Science.gov (United States)

    Wang, Longqiong; Jing, Jinzhong; Yan, Hui; Tang, Jiayong; Jia, Gang; Liu, Guangmang; Chen, Xiaoling; Tian, Gang; Cai, Jingyi; Shang, Haiying; Zhao, Hua

    2018-04-18

    This study was conducted to profile selenoprotein encoding genes in mouse RAW264.7 cells upon lipopolysaccharide (LPS) challenge and integrate their roles into immunological regulation in response to selenium (Se) pretreatment. LPS was used to develop immunological stress in macrophages. Cells were pretreated with different levels of Se (0, 0.5, 1.0, 1.5, 2.0 μmol Se/L) for 2 h, followed by LPS (100 ng/mL) stimulation for another 3 h. The mRNA expression of 24 selenoprotein encoding genes and 9 inflammation-related genes were investigated. The results showed that LPS (100 ng/mL) effectively induced immunological stress in RAW264.7 cells with induced inflammation cytokines, IL-6 and TNF-α, mRNA expression, and cellular secretion. LPS increased (P immunological stress in RAW264.7 cells accompanied with the global downregulation of selenoprotein encoding genes and Se pretreatment alleviated immunological stress via upregulation of a subset of selenoprotein encoding genes.

  5. Identification of novel Clostridium perfringens type E strains that carry an iota toxin plasmid with a functional enterotoxin gene.

    Directory of Open Access Journals (Sweden)

    Kazuaki Miyamoto

    Full Text Available Clostridium perfringens enterotoxin (CPE is a major virulence factor for human gastrointestinal diseases, such as food poisoning and antibiotic associated diarrhea. The CPE-encoding gene (cpe can be chromosomal or plasmid-borne. Recent development of conventional PCR cpe-genotyping assays makes it possible to identify cpe location (chromosomal or plasmid in type A isolates. Initial studies for developing cpe genotyping assays indicated that all cpe-positive strains isolated from sickened patients were typable by cpe-genotypes, but surveys of C. perfringens environmental strains or strains from feces of healthy people suggested that this assay might not be useful for some cpe-carrying type A isolates. In the current study, a pulsed-field gel electrophoresis Southern blot assay showed that four cpe-genotype untypable isolates carried their cpe gene on a plasmid of ∼65 kb. Complete sequence analysis of the ∼65 kb variant cpe-carrying plasmid revealed no intact IS elements and a disrupted cytosine methyltransferase (dcm gene. More importantly, this plasmid contains a conjugative transfer region, a variant cpe gene and variant iota toxin genes. The toxin genes encoded by this plasmid are expressed based upon the results of RT-PCR assays. The ∼65 kb plasmid is closely related to the pCPF4969 cpe plasmid of type A isolates. MLST analyses indicated these isolates belong to a unique cluster of C. perfringens. Overall, these isolates carrying a variant functional cpe gene and iota toxin genes represent unique type E strains.

  6. Characterization of the Aspergillus niger prtT, a unique regulator of extracellular protease encoding genes

    NARCIS (Netherlands)

    Punt, P.J.; Schuren, F.H.J.; Lehmbeck, J.; Christensen, T.; Hjort, C.; Hondel, C.A.M.J.J. van den

    2008-01-01

    Expression of several Aspergillus niger genes encoding major secreted, but not vacuolar, protease genes including the major acid protease gene pepA, was shown to be affected in the previously isolated A. niger protease mutant, AB1.13 [Mattern, I.E., van Noort, J.M., van den Berg, P., Archer, D.A.,

  7. The gene for a lectin-like protein is transcriptionally activated during sexual development, but is not essential for fruiting body formation in the filamentous fungus Sordaria macrospora

    Directory of Open Access Journals (Sweden)

    Cebula Patricia

    2005-11-01

    Full Text Available Abstract Background The filamentous fungus Sordaria macrospora forms complex three-dimensional fruiting bodies called perithecia that protect the developing ascospores and ensure their proper discharge. In previous microarray analyses, several genes have been identified that are downregulated in sterile mutants compared to the wild type. Among these genes was tap1 (transcript associated with perithecial development, a gene encoding a putative lectin homolog. Results Analysis of tap1 transcript levels in the wild type under conditions allowing only vegetative growth compared to conditions that lead to fruiting body development showed that tap1 is not only downregulated in developmental mutants but is also upregulated in the wild type during fruiting body development. We have cloned and sequenced a 3.2 kb fragment of genomic DNA containing the tap1 open reading frame and adjoining sequences. The genomic region comprising tap1 is syntenic to its homologous region in the closely related filamentous fungus Neurospora crassa. To determine whether tap1 is involved in fruiting body development in S. macrospora, a knockout construct was generated in which the tap1 open reading frame was replaced by the hygromycin B resistance gene hph under the control of fungal regulatory regions. Transformation of the S. macrospora wild type with this construct resulted in a tap1 deletion strain where tap1 had been replaced by the hph cassette. The knockout strain displayed no phenotypic differences under conditions of vegetative growth and sexual development when compared to the wild type. Double mutants carrying the Δtap1 allele in several developmental mutant backgrounds were phenotypically similar to the corresponding developmental mutant strains. Conclusion The tap1 transcript is strongly upregulated during sexual development in S. macrospora; however, analysis of a tap1 knockout strain shows that tap1 is not essential for fruiting body formation in S. macrospora.

  8. The gene for a lectin-like protein is transcriptionally activated during sexual development, but is not essential for fruiting body formation in the filamentous fungus Sordaria macrospora.

    Science.gov (United States)

    Nowrousian, Minou; Cebula, Patricia

    2005-11-03

    The filamentous fungus Sordaria macrospora forms complex three-dimensional fruiting bodies called perithecia that protect the developing ascospores and ensure their proper discharge. In previous microarray analyses, several genes have been identified that are downregulated in sterile mutants compared to the wild type. Among these genes was tap1 (transcript associated with perithecial development), a gene encoding a putative lectin homolog. Analysis of tap1 transcript levels in the wild type under conditions allowing only vegetative growth compared to conditions that lead to fruiting body development showed that tap1 is not only downregulated in developmental mutants but is also upregulated in the wild type during fruiting body development. We have cloned and sequenced a 3.2 kb fragment of genomic DNA containing the tap1 open reading frame and adjoining sequences. The genomic region comprising tap1 is syntenic to its homologous region in the closely related filamentous fungus Neurospora crassa. To determine whether tap1 is involved in fruiting body development in S. macrospora, a knockout construct was generated in which the tap1 open reading frame was replaced by the hygromycin B resistance gene hph under the control of fungal regulatory regions. Transformation of the S. macrospora wild type with this construct resulted in a tap1 deletion strain where tap1 had been replaced by the hph cassette. The knockout strain displayed no phenotypic differences under conditions of vegetative growth and sexual development when compared to the wild type. Double mutants carrying the Deltatap1 allele in several developmental mutant backgrounds were phenotypically similar to the corresponding developmental mutant strains. The tap1 transcript is strongly upregulated during sexual development in S. macrospora; however, analysis of a tap1 knockout strain shows that tap1 is not essential for fruiting body formation in S. macrospora.

  9. Characterization of the biocontrol activity of pseudomonas fluorescens strain X reveals novel genes regulated by glucose.

    Directory of Open Access Journals (Sweden)

    Gerasimos F Kremmydas

    Full Text Available Pseudomonas fluorescens strain X, a bacterial isolate from the rhizosphere of bean seedlings, has the ability to suppress damping-off caused by the oomycete Pythium ultimum. To determine the genes controlling the biocontrol activity of strain X, transposon mutagenesis, sequencing and complementation was performed. Results indicate that, biocontrol ability of this isolate is attributed to gcd gene encoding glucose dehydrogenase, genes encoding its co-enzyme pyrroloquinoline quinone (PQQ, and two genes (sup5 and sup6 which seem to be organized in a putative operon. This operon (named supX consists of five genes, one of which encodes a non-ribosomal peptide synthase. A unique binding site for a GntR-type transcriptional factor is localized upstream of the supX putative operon. Synteny comparison of the genes in supX revealed that they are common in the genus Pseudomonas, but with a low degree of similarity. supX shows high similarity only to the mangotoxin operon of Ps. syringae pv. syringae UMAF0158. Quantitative real-time PCR analysis indicated that transcription of supX is strongly reduced in the gcd and PQQ-minus mutants of Ps. fluorescens strain X. On the contrary, transcription of supX in the wild type is enhanced by glucose and transcription levels that appear to be higher during the stationary phase. Gcd, which uses PQQ as a cofactor, catalyses the oxidation of glucose to gluconic acid, which controls the activity of the GntR family of transcriptional factors. The genes in the supX putative operon have not been implicated before in the biocontrol of plant pathogens by pseudomonads. They are involved in the biosynthesis of an antimicrobial compound by Ps. fluorescens strain X and their transcription is controlled by glucose, possibly through the activity of a GntR-type transcriptional factor binding upstream of this putative operon.

  10. Evolution of the C-Type Lectin-Like Receptor Genes of the DECTIN-1 Cluster in the NK Gene Complex

    Directory of Open Access Journals (Sweden)

    Susanne Sattler

    2012-01-01

    Full Text Available Pattern recognition receptors are crucial in initiating and shaping innate and adaptive immune responses and often belong to families of structurally and evolutionarily related proteins. The human C-type lectin-like receptors encoded in the DECTIN-1 cluster within the NK gene complex contain prominent receptors with pattern recognition function, such as DECTIN-1 and LOX-1. All members of this cluster share significant homology and are considered to have arisen from subsequent gene duplications. Recent developments in sequencing and the availability of comprehensive sequence data comprising many species showed that the receptors of the DECTIN-1 cluster are not only homologous to each other but also highly conserved between species. Even in Caenorhabditis elegans, genes displaying homology to the mammalian C-type lectin-like receptors have been detected. In this paper, we conduct a comprehensive phylogenetic survey and give an up-to-date overview of the currently available data on the evolutionary emergence of the DECTIN-1 cluster genes.

  11. Family with sequence similarity 83, member B is a predictor of poor prognosis and a potential therapeutic target for lung adenocarcinoma expressing wild-type epidermal growth factor receptor.

    Science.gov (United States)

    Yamaura, Takumi; Ezaki, Junji; Okabe, Naoyuki; Takagi, Hironori; Ozaki, Yuki; Inoue, Takuya; Watanabe, Yuzuru; Fukuhara, Mitsuro; Muto, Satoshi; Matsumura, Yuki; Hasegawa, Takeo; Hoshino, Mika; Osugi, Jun; Shio, Yutaka; Waguri, Satoshi; Tamura, Hirosumi; Imai, Jun-Ichi; Ito, Emi; Yanagisawa, Yuka; Honma, Reiko; Watanabe, Shinya; Suzuki, Hiroyuki

    2018-02-01

    Lung adenocarcinoma (ADC) patients with tumors that harbor no targetable driver gene mutation, such as epidermal growth factor receptor ( EGFR ) gene mutations, have unfavorable prognosis, and thus, novel therapeutic targets are required. Family with sequence similarity 83, member B ( FAM83B ) is a biomarker for squamous cell lung cancer. FAM83B has also recently been shown to serve an important role in the EGFR signaling pathway. In the present study, the molecular and clinical impact of FAM83B in lung ADC was investigated. Matched tumor and adjacent normal tissue samples were obtained from 216 patients who underwent complete lung resection for primary lung ADC and were examined for FAM83B expression using cDNA microarray analysis. The associations between FAM83B expression and clinicopathological parameters, including patient survival, were examined. FAM83B was highly expressed in tumors from males, smokers and in tumors with wild-type EGFR . Multivariate analyses further confirmed that wild-type EGFR tumors were significantly positively associated with FAM83B expression. In survival analysis, FAM83B expression was associated with poor outcomes in disease-free survival and overall survival, particularly when stratified against tumors with wild-type EGFR . Furthermore, FAM83B knockdown was performed to investigate its phenotypic effect on lung ADC cell lines. Gene silencing by FAM83B RNA interference induced growth suppression in the HLC-1 and H1975 lung ADC cell lines. FAM83B may be involved in lung ADC tumor proliferation and can be a predictor of poor survival. FAM83B is also a potential novel therapeutic target for ADC with wild-type EGFR .

  12. Multiple genes encode the major surface glycoprotein of Pneumocystis carinii

    DEFF Research Database (Denmark)

    Kovacs, J A; Powell, F; Edman, J C

    1993-01-01

    hydrophobic region at the carboxyl terminus. The presence of multiple related msg genes encoding the major surface glycoprotein of P. carinii suggests that antigenic variation is a possible mechanism for evading host defenses. Further characterization of this family of genes should allow the development......The major surface antigen of Pneumocystis carinii, a life-threatening opportunistic pathogen in human immunodeficiency virus-infected patients, is an abundant glycoprotein that functions in host-organism interactions. A monoclonal antibody to this antigen is protective in animals, and thus...... blot studies using chromosomal or restricted DNA, the major surface glycoproteins are the products of a multicopy family of genes. The predicted protein has an M(r) of approximately 123,000, is relatively rich in cysteine residues (5.5%) that are very strongly conserved, and contains a well conserved...

  13. Molecular Evolution of a Type 1 Wild-Vaccine Poliovirus Recombinant during Widespread Circulation in China

    Science.gov (United States)

    Liu, Hong-Mei; Zheng, Du-Ping; Zhang, Li-Bi; Oberste, M. Steven; Pallansch, Mark A.; Kew, Olen M.

    2000-01-01

    Type 1 wild-vaccine recombinant polioviruses were isolated from poliomyelitis patients in China from 1991 to 1993. We compared the sequences of 34 recombinant isolates over the 1,353-nucleotide (nt) genomic interval (nt 2480 to 3832) encoding the major capsid protein, VP1, and the protease, 2A. All recombinants had a 367-nt block of sequence (nt 3271 to 3637) derived from the Sabin 1 oral poliovirus vaccine strain spanning the 3′-terminal sequences of VP1 (115 nt) and the 5′ half of 2A (252 nt). The remaining VP1 sequences were closely (up to 99.5%) related to those of a major genotype of wild type 1 poliovirus endemic to China up to 1994. In contrast, the non-vaccine-derived sequences at the 3′ half of 2A were more distantly related (polioviruses from China. The vaccine-derived sequences of the earliest (April 1991) isolates completely matched those of Sabin 1. Later isolates diverged from the early isolates primarily by accumulation of synonymous base substitutions (at a rate of ∼3.7 × 10−2 substitutions per synonymous site per year) over the entire VP1-2A interval. Distinct evolutionary lineages were found in different Chinese provinces. From the combined epidemiologic and evolutionary analyses, we propose that the recombinant virus arose during mixed infection of a single individual in northern China in early 1991 and that its progeny spread by multiple independent chains of transmission into some of the most populous areas of China within a year of the initiating infection. PMID:11070012

  14. Prediction of Wild-type Enzyme Characteristics

    DEFF Research Database (Denmark)

    Geertz-Hansen, Henrik Marcus

    of biotechnology, including enzyme discovery and characterization. This work presents two articles on sequence-based discovery and functional annotation of enzymes in environmental samples, and two articles on analysis and prediction of enzyme thermostability and cofactor requirements. The first article presents...... a sequence-based approach to discovery of proteolytic enzymes in metagenomes obtained from the Polar oceans. We show that microorganisms living in these extreme environments of constant low temperature harbour genes encoding novel proteolytic enzymes with potential industrial relevance. The second article...... presents a web server for the processing and annotation of functional metagenomics sequencing data, tailored to meet the requirements of non-bioinformaticians. The third article presents analyses of the molecular determinants of enzyme thermostability, and a feature-based prediction method of the melting...

  15. The Bacillus subtilis yaaH Gene Is Transcribed by SigE RNA Polymerase during Sporulation, and Its Product Is Involved in Germination of Spores

    Science.gov (United States)

    Kodama, Takeko; Takamatsu, Hiromu; Asai, Kei; Kobayashi, Kazuo; Ogasawara, Naotake; Watabe, Kazuhito

    1999-01-01

    The expression of 21 novel genes located in the region from dnaA to abrB of the Bacillus subtilis chromosome was analyzed. One of the genes, yaaH, had a predicted promoter sequence conserved among SigE-dependent genes. Northern blot analysis revealed that yaaH mRNA was first detected from 2 h after the cessation of logarithmic growth (T2) of sporulation in wild-type cells and in spoIIIG (SigG−) and spoIVCB (SigK−) mutants but not in spoIIAC (SigF−) and spoIIGAB (SigE−) mutants. The transcription start point was determined by primer extension analysis; the −10 and −35 regions are very similar to the consensus sequences recognized by SigE-containing RNA polymerase. A YaaH-His tag fusion encoded by a plasmid with a predicted promoter for the yaaH gene was produced from T2 of sporulation in a B. subtilis transformant and extracted from mature spores, indicating that the yaaH gene product is a spore protein. Inactivation of the yaaH gene by insertion of an erythromycin resistance gene did not affect vegetative growth or spore resistance to heat, chloroform, and lysozyme. The germination of yaaH mutant spores in a mixture of l-asparagine, d-glucose, d-fructose, and potassium chloride was almost the same as that of wild-type spores, but the mutant spores were defective in l-alanine-stimulated germination. These results suggest that yaaH is a novel gene encoding a spore protein produced in the mother cell compartment from T2 of sporulation and that it is required for the l-alanine-stimulated germination pathway. PMID:10419957

  16. Read-through transcript from NM23-H1 into the neighboring NM23-H2 gene encodes a novel protein, NM23-LV

    NARCIS (Netherlands)

    Valentijn, Linda J.; Koster, Jan; Versteeg, Rogier

    2006-01-01

    NM23-H1 and NM23-H2 are neighboring genes on chromosome 17q. They encode nucleoside diphosphate kinases that have additional roles in signal transduction, transcription, and apoptosis. NM23-H1 expression is a strong marker for prognosis and metastatic behavior in many tumor types. A new

  17. Physiological and molecular characterization of Si uptake in wild rice species.

    Science.gov (United States)

    Mitani-Ueno, Namiki; Ogai, Hisao; Yamaji, Naoki; Ma, Jian Feng

    2014-07-01

    Cultivated rice (Oryza sativa) accumulates high concentration of silicon (Si), which is required for its high and sustainable production. High Si accumulation in cultivated rice is achieved by a high expression of both influx (Lsi1) and efflux (Lsi2) Si transporters in roots. Herein, we physiologically investigated Si uptake, isolated and functionally characterized Si transporters in six wild rice species with different genome types. Si uptake by the roots was lower in Oryza rufipogon, Oryza barthii (AA genome), Oryza australiensis (EE genome) and Oryza punctata (BB genome), but similar in Oryza glumaepatula and Oryza meridionalis (AA genome) compared with the cultivated rice (cv. Nipponbare). However, all wild rice species and the cultivated rice showed similar concentration of Si in the shoots when grown in a field. All species with AA genome showed the same amino acid sequence of both Lsi1 and Lsi2 as O. sativa, whereas species with EE and BB genome showed several nucleotide differences in both Lsi1 and Lsi2. However, proteins encoded by these genes also showed transport activity for Si in Xenopus oocyte. The mRNA expression of Lsi1 in all wild rice species was lower than that in the cultivated rice, whereas the expression of Lsi2 was lower in O. rufipogon and O. barthii but similar in other species. Similar cellular localization of Lsi1 and Lsi2 was observed in all wild rice as the cultivated rice. These results indicate that superior Si uptake, the important trait for rice growth, is basically conserved in wild and cultivated rice species. © 2013 Scandinavian Plant Physiology Society.

  18. Studies on the Nucleotide Sequence, Transcription and Deletion Analysis of the BmNPV Protein Kinase Gene.

    Science.gov (United States)

    Zhang, Chuan-Xi; Hu, Cui; Wu, Xiang-Fu

    1998-01-01

    The coding region of BmvPK-1 gene of Bombyx mori NPV (Strain ZJ8) is 828 nt long and encodes a 276 aa polypeptide with predicted molecular mass of 32 kD. Dot blot analysis showed its mRNA to be gene is first detectable at 18 h p.i. and reaching the highest transcriptional level at 48 h p.i. The result suggested that BmvPK-1 gene is a late or very late gene. The most conserved 365 bp of the BmvPK-1 gene was deleted in a transfer vector (pUCPK-lac), and a report gene (lacZ) was inserted in the deleted position. Cotransfection of BmN cells with pUCPK-lac DNA and BmNPV DNA resulted in the recombinant virus which expressed detectable product of lacZ gene. But the virus with the deleted BmvPK-1 gene could not be isolated from the wild BmNPV by plaque purification method. The result showed that the BmvPK-1 gene deleted virus can multiply only with the help of the product of this gene from the wild type virus, and the gene is necessary for the virus to finish its life cycle in the cultured cells.

  19. Placental triglyceride accumulation in maternal type 1 diabetes is associated with increased lipase gene expression

    DEFF Research Database (Denmark)

    Lindegaard, Marie Louise Skakkebæk; Damm, Peter; Mathiesen, Elisabeth R

    2006-01-01

    Maternal diabetes can cause fetal macrosomia and increased risk of obesity, diabetes, and cardiovascular disease in adulthood of the offspring. Although increased transplacental lipid transport could be involved, the impact of maternal type 1 diabetes on molecular mechanisms for lipid transport...... in placenta is largely unknown. To examine whether maternal type 1 diabetes affects placental lipid metabolism, we measured lipids and mRNA expression of lipase-encoding genes in placentas from women with type 1 diabetes (n = 27) and a control group (n = 21). The placental triglyceride (TG) concentration....... These results suggest that maternal type 1 diabetes is associated with TG accumulation and increased EL and HSL gene expression in placenta and that optimal metabolic control reduces these effects....

  20. Identification of an ICP27-responsive element in the coding region of a herpes simplex virus type 1 late gene.

    Science.gov (United States)

    Sedlackova, Lenka; Perkins, Keith D; Meyer, Julia; Strain, Anna K; Goldman, Oksana; Rice, Stephen A

    2010-03-01

    During productive herpes simplex virus type 1 (HSV-1) infection, a subset of viral delayed-early (DE) and late (L) genes require the immediate-early (IE) protein ICP27 for their expression. However, the cis-acting regulatory sequences in DE and L genes that mediate their specific induction by ICP27 are unknown. One viral L gene that is highly dependent on ICP27 is that encoding glycoprotein C (gC). We previously demonstrated that this gene is posttranscriptionally transactivated by ICP27 in a plasmid cotransfection assay. Based on our past results, we hypothesized that the gC gene possesses a cis-acting inhibitory sequence and that ICP27 overcomes the effects of this sequence to enable efficient gC expression. To test this model, we systematically deleted sequences from the body of the gC gene and tested the resulting constructs for expression. In so doing, we identified a 258-bp "silencing element" (SE) in the 5' portion of the gC coding region. When present, the SE inhibits gC mRNA accumulation from a transiently transfected gC gene, unless ICP27 is present. Moreover, the SE can be transferred to another HSV-1 gene, where it inhibits mRNA accumulation in the absence of ICP27 and confers high-level expression in the presence of ICP27. Thus, for the first time, an ICP27-responsive sequence has been identified in a physiologically relevant ICP27 target gene. To see if the SE functions during viral infection, we engineered HSV-1 recombinants that lack the SE, either in a wild-type (WT) or ICP27-null genetic background. In an ICP27-null background, deletion of the SE led to ICP27-independent expression of the gC gene, demonstrating that the SE functions during viral infection. Surprisingly, the ICP27-independent gC expression seen with the mutant occurred even in the absence of viral DNA synthesis, indicating that the SE helps to regulate the tight DNA replication-dependent expression of gC.

  1. A mutation in the gene encoding mitochondrial Mg²+ channel MRS2 results in demyelination in the rat.

    Directory of Open Access Journals (Sweden)

    Takashi Kuramoto

    2011-01-01

    Full Text Available The rat demyelination (dmy mutation serves as a unique model system to investigate the maintenance of myelin, because it provokes severe myelin breakdown in the central nervous system (CNS after normal postnatal completion of myelination. Here, we report the molecular characterization of this mutation and discuss the possible pathomechanisms underlying demyelination. By positional cloning, we found that a G-to-A transition, 177 bp downstream of exon 3 of the Mrs2 (MRS2 magnesium homeostasis factor (Saccharomyces cerevisiae gene, generated a novel splice acceptor site which resulted in functional inactivation of the mutant allele. Transgenic rescue with wild-type Mrs2-cDNA validated our findings. Mrs2 encodes an essential component of the major Mg²+ influx system in mitochondria of yeast as well as human cells. We showed that the dmy/dmy rats have major mitochondrial deficits with a markedly elevated lactic acid concentration in the cerebrospinal fluid, a 60% reduction in ATP, and increased numbers of mitochondria in the swollen cytoplasm of oligodendrocytes. MRS2-GFP recombinant BAC transgenic rats showed that MRS2 was dominantly expressed in neurons rather than oligodendrocytes and was ultrastructurally observed in the inner membrane of mitochondria. Our observations led to the conclusion that dmy/dmy rats suffer from a mitochondrial disease and that the maintenance of myelin has a different mechanism from its initial production. They also established that Mg²+ homeostasis in CNS mitochondria is essential for the maintenance of myelin.

  2. WRKY domain-encoding genes of a crop legume chickpea (Cicer arietinum): comparative analysis with Medicago truncatula WRKY family and characterization of group-III gene(s).

    Science.gov (United States)

    Kumar, Kamal; Srivastava, Vikas; Purayannur, Savithri; Kaladhar, V Chandra; Cheruvu, Purnima Jaiswal; Verma, Praveen Kumar

    2016-06-01

    The WRKY genes have been identified as important transcriptional modulators predominantly during the environmental stresses, but they also play critical role at various stages of plant life cycle. We report the identification of WRKY domain (WD)-encoding genes from galegoid clade legumes chickpea (Cicer arietinum L.) and barrel medic (Medicago truncatula). In total, 78 and 98 WD-encoding genes were found in chickpea and barrel medic, respectively. Comparative analysis suggests the presence of both conserved and unique WRKYs, and expansion of WRKY family in M. truncatula primarily by tandem duplication. Exclusively found in galegoid legumes, CaWRKY16 and its orthologues encode for a novel protein having a transmembrane and partial Exo70 domains flanking a group-III WD. Genomic region of galegoids, having CaWRKY16, is more dynamic when compared with millettioids. In onion cells, fused CaWRKY16-EYFP showed punctate fluorescent signals in cytoplasm. The chickpea WRKY group-III genes were further characterized for their transcript level modulation during pathogenic stress and treatments of abscisic acid, jasmonic acid, and salicylic acid (SA) by real-time PCR. Differential regulation of genes was observed during Ascochyta rabiei infection and SA treatment. Characterization of A. rabiei and SA inducible gene CaWRKY50 showed that it localizes to plant nucleus, binds to W-box, and have a C-terminal transactivation domain. Overexpression of CaWRKY50 in tobacco plants resulted in early flowering and senescence. The in-depth comparative account presented here for two legume WRKY genes will be of great utility in hastening functional characterization of crop legume WRKYs and will also help in characterization of Exo70Js. © The Author 2016. Published by Oxford University Press on behalf of Kazusa DNA Research Institute.

  3. Gene therapy restores auditory and vestibular function in a mouse model of Usher syndrome type 1c.

    Science.gov (United States)

    Pan, Bifeng; Askew, Charles; Galvin, Alice; Heman-Ackah, Selena; Asai, Yukako; Indzhykulian, Artur A; Jodelka, Francine M; Hastings, Michelle L; Lentz, Jennifer J; Vandenberghe, Luk H; Holt, Jeffrey R; Géléoc, Gwenaëlle S

    2017-03-01

    Because there are currently no biological treatments for hearing loss, we sought to advance gene therapy approaches to treat genetic deafness. We focused on Usher syndrome, a devastating genetic disorder that causes blindness, balance disorders and profound deafness, and studied a knock-in mouse model, Ush1c c.216G>A, for Usher syndrome type IC (USH1C). As restoration of complex auditory and balance function is likely to require gene delivery systems that target auditory and vestibular sensory cells with high efficiency, we delivered wild-type Ush1c into the inner ear of Ush1c c.216G>A mice using a synthetic adeno-associated viral vector, Anc80L65, shown to transduce 80-90% of sensory hair cells. We demonstrate recovery of gene and protein expression, restoration of sensory cell function, rescue of complex auditory function and recovery of hearing and balance behavior to near wild-type levels. The data represent unprecedented recovery of inner ear function and suggest that biological therapies to treat deafness may be suitable for translation to humans with genetic inner ear disorders.

  4. Evidence that the mitochondrial leucyl tRNA synthetase (LARS2) gene represents a novel type 2 diabetes susceptibility gene

    DEFF Research Database (Denmark)

    hart, Leen M; Hansen, Torben; Rietveld, Ingrid

    2005-01-01

    Previously, we have shown that a mutation in the mitochondrial DNA-encoded tRNA(Leu(UUR)) gene is associated with type 2 diabetes. One of the consequences of this mutation is a reduced aminoacylation of tRNA(Leu(UUR)). In this study, we have examined whether variants in the leucyl tRNA synthetase...... gene (LARS2), involved in aminoacylation of tRNA(Leu(UUR)), associate with type 2 diabetes. Direct sequencing of LARS2 cDNA from 25 type 2 diabetic subjects revealed eight single nucleotide polymorphisms. Two of the variants were examined in 7,836 subjects from four independent populations...... in the Netherlands and Denmark. A -109 g/a variant was not associated with type 2 diabetes. Allele frequencies for the other variant, H324Q, were 3.5% in type 2 diabetic and 2.7% in control subjects, respectively. The common odds ratio across all four studies was 1.40 (95% CI 1.12-1.76), P = 0.004. There were...

  5. Epigenetic control of virulence gene expression in Pseudomonas aeruginosa by a LysR-type transcription regulator.

    Directory of Open Access Journals (Sweden)

    Keith H Turner

    2009-12-01

    Full Text Available Phenotypic variation within an isogenic bacterial population is thought to ensure the survival of a subset of cells in adverse conditions. The opportunistic pathogen Pseudomonas aeruginosa variably expresses several phenotypes, including antibiotic resistance, biofilm formation, and the production of CupA fimbriae. Here we describe a previously unidentified bistable switch in P. aeruginosa. This switch controls the expression of a diverse set of genes, including aprA, which encodes the secreted virulence factor alkaline protease. We present evidence that bistable expression of PA2432, herein named bexR (bistable expression regulator, which encodes a LysR-type transcription regulator, controls this switch. In particular, using DNA microarrays, quantitative RT-PCR analysis, chromatin immunoprecipitation, and reporter gene fusions, we identify genes directly under the control of BexR and show that these genes are bistably expressed. Furthermore, we show that bexR is itself bistably expressed and positively autoregulated. Finally, using single-cell analyses of a GFP reporter fusion, we present evidence that positive autoregulation of bexR is necessary for bistable expression of the BexR regulon. Our findings suggest that a positive feedback loop involving a LysR-type transcription regulator serves as the basis for an epigenetic switch that controls virulence gene expression in P. aeruginosa.

  6. Identification of two small RNAs within the first 1.5-kb of the herpes simplex virus type 1-encoded latency-associated transcript.

    Science.gov (United States)

    Peng, Weiping; Vitvitskaia, Olga; Carpenter, Dale; Wechsler, Steven L; Jones, Clinton

    2008-01-01

    The herpes simplex virus type 1 (HSV-1) latency-associated transcript (LAT) is abundantly expressed in latently infected neurons. In the rabbit or mouse ocular models of infection, expression of the first 1.5 kb of LAT coding sequences is sufficient for and necessary for wild-type levels of spontaneous reactivation from latency. The antiapoptosis functions of LAT, which maps to the same 1.5 kb of LAT, are important for the latency-reactivation cycle because replacement of LAT with other antiapoptosis genes (the baculovirus IAP gene or the bovine herpesvirus type 1 latency-related gene) restores wild-type levels of reactivation to a LAT null mutant. A recent study identified a micro-RNA within LAT that can inhibit apoptosis (Gupta et al, Nature 442: 82-85). In this study, the authors analyzed the first 1.5 kb of LAT for additional small RNAs that may have regulatory functions. Two LAT-specific small RNAs were detected in productively infected human neuroblastoma cells within the first 1.5 kb of LAT, in a region that is important for inhibiting apoptosis. Although these small RNAs possess extensive secondary structure and a stem-loop structure, bands migrating near 23 bases were not detected suggesting these small RNAs are not true micro-RNAs. Both of the small LAT-specific RNAs have the potential to base pair with the ICP4 mRNA. These two small LAT RNAs may play a role in the latency-reactivation cycle by reducing apoptosis and/or by reducing ICP4 RNA expression.

  7. Expression, purification, crystallization and preliminary X-ray analysis of wild-type and of an active-site mutant of glyceraldehyde-3-phosphate dehydrogenase from Campylobacter jejuni

    International Nuclear Information System (INIS)

    Tourigny, David S.; Elliott, Paul R.; Edgell, Louise J.; Hudson, Gregg M.; Moody, Peter C. E.

    2010-01-01

    The cloning, expression, purification, crystallization and preliminary X-ray analysis of wild-type and of an active-site mutant of C. jejuni glyceraldehyde-3-phosphate dehydrogenase is reported. The genome of the enteric pathogen Campylobacter jejuni encodes a single glyceraldehyde-3-phosphate dehydrogenase that can utilize either NADP + or NAD + as coenzymes for the oxidative phosphorylation of glyceraldehyde-3-phosphate to 1,3-diphosphoglycerate. Here, the cloning, expression, purification, crystallization and preliminary X-ray analysis of both the wild type and an active-site mutant of the enzyme are presented. Preliminary X-ray analysis revealed that in both cases the crystals diffracted to beyond 1.9 Å resolution. The space group is shown to be I4 1 22, with unit-cell parameters a = 90.75, b = 90.75, c = 225.48 Å, α = 90.46, β = 90.46, γ = 222.79°; each asymmetric unit contains only one subunit of the tetrameric enzyme

  8. Genes regulation encoding ADP/ATP carrier in yeasts Saccharomyces cerevisiae and Candida parapsilosis

    International Nuclear Information System (INIS)

    Nebohacova, M.

    2000-01-01

    Genes encoding a mitochondrial ADP/ATP carrier (AAC) in yeast Saccharomyces cerevisiae and Candida parapsilosis were investigated. AAC2 is coding for the major AAC isoform in S. cerevisiae. We suggest that AAC2 is a member of a syn-expression group of genes encoding oxidative phosphorylation proteins. Within our previous studies on the regulation of the AAC2 transcription an UAS (-393/-268) was identified that is essential for the expression of this gene. Two functional regulatory cis-elements are located within this UAS -binding sites for an ABFl factor and for HAP2/3/4/5 heteromeric complex. We examined relative contributions and mutual interactions of the ABFl and HAP2/3/4/5 factors in the activation of transcription from the UAS of the AAC2 gene. The whole UAS was dissected into smaller sub-fragments and tested for (i) the ability to form DNA-protein complexes with cellular proteins in vitro, (ii) the ability to confer heterologous expression using AAC3 gene lacking its own promoter, and (iii) the expression of AAC3-lacZ fusion instead of intact AAC3 gene. The obtained results demonstrated that: a) The whole UAS as well as sub-fragment containing only ABF1-binding site are able to form DNA-protein complexes with cellular proteins in oxygen- and heme- dependent manner. The experiments with antibody against the ABF1 showed that the ABF1 factor is one of the proteins binding to AAC2 promoter. We have been unsuccessful to prove the binding of cellular proteins to the HAP2/3/4/5-binding site. However, the presence of HAP2/3/4/5-binding site is necessary to drive a binding of cellular proteins to the ABF1-binding site in carbon source-dependent manner. b) The presence of both ABF1- and HAP2/3/4/5-binding sites and original spacing between them is necessary to confer the growth of Aaac2 mutant strain on non- fermentable carbon source when put in front of AAC3 gene introduced on centromeric vector to Aaac2 mutant strain. c) For the activation of AAC3-lacZ expression on

  9. aes, the gene encoding the esterase B in Escherichia coli, is a powerful phylogenetic marker of the species

    Directory of Open Access Journals (Sweden)

    Tuffery Pierre

    2009-12-01

    Full Text Available Abstract Background Previous studies have established a correlation between electrophoretic polymorphism of esterase B, and virulence and phylogeny of Escherichia coli. Strains belonging to the phylogenetic group B2 are more frequently implicated in extraintestinal infections and include esterase B2 variants, whereas phylogenetic groups A, B1 and D contain less virulent strains and include esterase B1 variants. We investigated esterase B as a marker of phylogeny and/or virulence, in a thorough analysis of the esterase B-encoding gene. Results We identified the gene encoding esterase B as the acetyl-esterase gene (aes using gene disruption. The analysis of aes nucleotide sequences in a panel of 78 reference strains, including the E. coli reference (ECOR strains, demonstrated that the gene is under purifying selection. The phylogenetic tree reconstructed from aes sequences showed a strong correlation with the species phylogenetic history, based on multi-locus sequence typing using six housekeeping genes. The unambiguous distinction between variants B1 and B2 by electrophoresis was consistent with Aes amino-acid sequence analysis and protein modelling, which showed that substituted amino acids in the two esterase B variants occurred mostly at different sites on the protein surface. Studies in an experimental mouse model of septicaemia using mutant strains did not reveal a direct link between aes and extraintestinal virulence. Moreover, we did not find any genes in the chromosomal region of aes to be associated with virulence. Conclusion Our findings suggest that aes does not play a direct role in the virulence of E. coli extraintestinal infection. However, this gene acts as a powerful marker of phylogeny, illustrating the extensive divergence of B2 phylogenetic group strains from the rest of the species.

  10. Characterization of a second physiologically relevant lactose permease gene (lacpB) in Aspergillus nidulans.

    Science.gov (United States)

    Fekete, Erzsébet; Orosz, Anita; Kulcsár, László; Kavalecz, Napsugár; Flipphi, Michel; Karaffa, Levente

    2016-05-01

    In Aspergillus nidulans, uptake rather than hydrolysis is the rate-limiting step of lactose catabolism. Deletion of the lactose permease A-encoding gene (lacpA) reduces the growth rate on lactose, while its overexpression enables faster growth than wild-type strains are capable of. We have identified a second physiologically relevant lactose transporter, LacpB. Glycerol-grown mycelia from mutants deleted for lacpB appear to take up only minute amounts of lactose during the first 60 h after a medium transfer, while mycelia of double lacpA/lacpB-deletant strains are unable to produce new biomass from lactose. Although transcription of both lacp genes was strongly induced by lactose, their inducer profiles differ markedly. lacpA but not lacpB expression was high in d-galactose cultures. However, lacpB responded strongly also to β-linked glucopyranose dimers cellobiose and sophorose, while these inducers of the cellulolytic system did not provoke any lacpA response. Nevertheless, lacpB transcript was induced to higher levels on cellobiose in strains that lack the lacpA gene than in a wild-type background. Indeed, cellobiose uptake was faster and biomass formation accelerated in lacpA deletants. In contrast, in lacpB knockout strains, growth rate and cellobiose uptake were considerably reduced relative to wild-type, indicating that the cellulose and lactose catabolic systems employ common elements. Nevertheless, our permease mutants still grew on cellobiose, which suggests that its uptake in A. nidulans prominently involves hitherto unknown transport systems.

  11. A Mutation in the Bacillus subtilis rsbU Gene That Limits RNA Synthesis during Sporulation.

    Science.gov (United States)

    Rothstein, David M; Lazinski, David; Osburne, Marcia S; Sonenshein, Abraham L

    2017-07-15

    Mutants of Bacillis subtilis that are temperature sensitive for RNA synthesis during sporulation were isolated after selection with a 32 P suicide agent. Whole-genome sequencing revealed that two of the mutants carried an identical lesion in the rsbU gene, which encodes a phosphatase that indirectly activates SigB, the stress-responsive RNA polymerase sigma factor. The mutation appeared to cause RsbU to be hyperactive, because the mutants were more resistant than the parent strain to ethanol stress. In support of this hypothesis, pseudorevertants that regained wild-type levels of sporulation at high temperature had secondary mutations that prevented expression of the mutant rsbU gene. The properties of these RsbU mutants support the idea that activation of SigB diminishes the bacterium's ability to sporulate. IMPORTANCE Most bacterial species encode multiple RNA polymerase promoter recognition subunits (sigma factors). Each sigma factor directs RNA polymerase to different sets of genes; each gene set typically encodes proteins important for responses to specific environmental conditions, such as changes in temperature, salt concentration, and nutrient availability. A selection for mutants of Bacillus subtilis that are temperature sensitive for RNA synthesis during sporulation unexpectedly yielded strains with a point mutation in rsbU , a gene that encodes a protein that normally activates sigma factor B (SigB) under conditions of salt stress. The mutation appears to cause RsbU, and therefore SigB, to be active inappropriately, thereby inhibiting, directly or indirectly, the ability of the cells to transcribe sporulation genes. Copyright © 2017 American Society for Microbiology.

  12. Human case of bacteremia caused by Streptococcus canis sequence type 9 harboring the scm gene.

    Science.gov (United States)

    Taniyama, Daisuke; Abe, Yoshihiko; Sakai, Tetsuya; Kikuchi, Takahide; Takahashi, Takashi

    2017-01-01

    Streptococcus canis (Sc) is a zoonotic pathogen that is transferred mainly from companion animals to humans. One of the major virulence factors in Sc is the M-like protein encoded by the scm gene, which is involved in anti-phagocytic activities, as well as the recruitment of plasminogen to the bacterial surface in cooperation with enolase, and the consequent enhancement of bacterial transmigration and survival. This is the first reported human case of uncomplicated bacteremia following a dog bite, caused by Streptococcus canis harboring the scm gene. The similarity of the 16S rRNA from the infecting species to that of the Sc type strain, as well as the amplification of the species-specific cfg gene, encoding a co-hemolysin, was used to confirm the species identity. Furthermore, the isolate was confirmed as sequence type 9. The partial scm gene sequence harbored by the isolate was closely related to those of other two Sc strains. While this isolate did not possess the erm (A), erm (B), or mef (A), macrolide/lincosamide resistance genes, it was not susceptible to azithromycin: its susceptibility was intermediate. Even though human Sc bacteremia is rare, clinicians should be aware of this microorganism, as well as Pasteurella sp., Prevotella sp., and Capnocytophaga sp., when examining and treating patients with fever who maintain close contact with companion animals.

  13. Proximal Region of the Gene Encoding Cytadherence-Related Protein Permits Molecular Typing of Mycoplasma genitalium Clinical Strains by PCR-Restriction Fragment Length Polymorphism

    Science.gov (United States)

    Musatovova, Oxana; Herrera, Caleb; Baseman, Joel B.

    2006-01-01

    Restriction fragment length polymorphism (RFLP) analysis of the PCR-amplified proximal region of the gene encoding cytadherence accessory protein P110 (MG192) revealed DNA sequence divergences among 54 Mycoplasma genitalium clinical strains isolated from the genitourinary tracts of women attending a sexually transmitted disease-related health clinic, plus one from the respiratory tract and one from synovial fluid. Seven of 56 (12.5%) strains exhibited RFLPs following digestion of the proximal region with restriction endonuclease MboI or RsaI, or both. No sequence variability was detected in the distal portion of the gene. PMID:16455921

  14. A young root-specific gene (ArMY2) from horseradish encoding a MYR II myrosinase with kinetic preference for the root-specific glucosinolate gluconasturtiin.

    Science.gov (United States)

    Loebers, Andreas; Müller-Uri, Frieder; Kreis, Wolfgang

    2014-03-01

    The pungent taste of horseradish is caused by isothiocyanates which are released from glucosinolates by myrosinases. These enzymes are encoded by genes belonging to one of two subfamilies, termed MYR I and MYR II, respectively. A MYR II-type myrosinase gene was identified for the first time in horseradish. The gene termed ArMY2 was only expressed in young roots. A full-length cDNA encoding a myrosinase termed ArMy2 was isolated and heterologously expressed in Pichia pastoris. The recombinant His-tagged enzyme was characterized biochemically. Substrate affinity was 5 times higher towards gluconasturtiin than towards sinigrin. Gluconasturtiin was found to be the most abundant glucosinolate in young horseradish roots while sinigrin dominated in storage roots and leaves. This indicates that a specialized glucosinolate-myrosinase defense system might be active in young roots. Copyright © 2013 Elsevier Ltd. All rights reserved.

  15. Mutagenesis in sequence encoding of human factor VII for gene therapy of hemophilia

    Directory of Open Access Journals (Sweden)

    B Kazemi

    2009-12-01

    Full Text Available "nBackground: Current treatment of hemophilia which is one of the most common bleeding disorders, involves replacement therapy using concentrates of FVIII and FIX .However, these concentrates have been associated with viral infections and thromboembolic complications and development of antibodies. "nThe use of recombinant human factor VII (rhFVII is effective  for the treatment of patients with  hemophilia A or B, who develop antibodies ( referred as inhibitors against  replacement therapy , because it induces coagulation independent of FVIII and FIX. However, its short half-life and high cost have limited its use. One potential solution to this problem may be the use of FVIIa gene transfer, which would attain continuing therapeutic levels of expression from a single injection. The aim of this study was to engineer a novel hFVII (human FVII gene containing a cleavage site for the intracellular protease and furin, by PCR mutagenesis "nMethods: The sequence encoding light and heavy chains of hFVII, were amplified by using hFVII/pTZ57R and specific primers, separately. The PCR products were cloned in pTZ57R vector. "nResults and discussion: Cloning was confirmed by restriction analysis or PCR amplification using specific primers and plasmid universal primers. Mutagenesis of sequence encoding light and heavy chain was confirmed by restriction enzyme. "nConclusion: In the present study, it was provided recombinant plasmids based on mutant form of DNA encoding light and heavy chains.  Joining mutant form of DNA encoding light chain with mutant heavy chain led to a new variant of hFVII. This variant can be activated by furin and an increase in the proportion of activated form of FVII. This mutant form of hFVII may be used for gene therapy of hemophilia.

  16. Chicken genome analysis reveals novel genes encoding biotin-binding proteins related to avidin family

    Directory of Open Access Journals (Sweden)

    Nordlund Henri R

    2005-03-01

    Full Text Available Abstract Background A chicken egg contains several biotin-binding proteins (BBPs, whose complete DNA and amino acid sequences are not known. In order to identify and characterise these genes and proteins we studied chicken cDNAs and genes available in the NCBI database and chicken genome database using the reported N-terminal amino acid sequences of chicken egg-yolk BBPs as search strings. Results Two separate hits showing significant homology for these N-terminal sequences were discovered. For one of these hits, the chromosomal location in the immediate proximity of the avidin gene family was found. Both of these hits encode proteins having high sequence similarity with avidin suggesting that chicken BBPs are paralogous to avidin family. In particular, almost all residues corresponding to biotin binding in avidin are conserved in these putative BBP proteins. One of the found DNA sequences, however, seems to encode a carboxy-terminal extension not present in avidin. Conclusion We describe here the predicted properties of the putative BBP genes and proteins. Our present observations link BBP genes together with avidin gene family and shed more light on the genetic arrangement and variability of this family. In addition, comparative modelling revealed the potential structural elements important for the functional and structural properties of the putative BBP proteins.

  17. Single-base resolution maps of cultivated and wild rice methylomes and regulatory roles of DNA methylation in plant gene expression

    Directory of Open Access Journals (Sweden)

    Li Xin

    2012-07-01

    Full Text Available Abstract Background DNA methylation plays important biological roles in plants and animals. To examine the rice genomic methylation landscape and assess its functional significance, we generated single-base resolution DNA methylome maps for Asian cultivated rice Oryza sativa ssp. japonica, indica and their wild relatives, Oryza rufipogon and Oryza nivara. Results The overall methylation level of rice genomes is four times higher than that of Arabidopsis. Consistent with the results reported for Arabidopsis, methylation in promoters represses gene expression while gene-body methylation generally appears to be positively associated with gene expression. Interestingly, we discovered that methylation in gene transcriptional termination regions (TTRs can significantly repress gene expression, and the effect is even stronger than that of promoter methylation. Through integrated analysis of genomic, DNA methylomic and transcriptomic differences between cultivated and wild rice, we found that primary DNA sequence divergence is the major determinant of methylational differences at the whole genome level, but DNA methylational difference alone can only account for limited gene expression variation between the cultivated and wild rice. Furthermore, we identified a number of genes with significant difference in methylation level between the wild and cultivated rice. Conclusions The single-base resolution methylomes of rice obtained in this study have not only broadened our understanding of the mechanism and function of DNA methylation in plant genomes, but also provided valuable data for future studies of rice epigenetics and the epigenetic differentiation between wild and cultivated rice.

  18. Role of fruA and csgA genes in gene expression during development of Myxococcus xanthus. Analysis by two-dimensional gel electrophoresis.

    Science.gov (United States)

    Horiuchi, Takayuki; Taoka, Masato; Isobe, Toshiaki; Komano, Teruya; Inouye, Sumiko

    2002-07-26

    Two genes, fruA and csgA, encoding a putative transcription factor and C-factor, respectively, are essential for fruiting body formation of Myxococcus xanthus. To investigate the role of fruA and csgA genes in developmental gene expression, developing cells as well as vegetative cells of M. xanthus wild-type, fruA::Tc, and csgA731 strains were pulse-labeled with [(35)S]methionine, and the whole cell proteins were analyzed using two-dimensional immobilized pH gradient/SDS-PAGE. Differences in protein synthesis patterns among more than 700 protein spots were detected during development of the three strains. Fourteen proteins showing distinctly different expression patterns in mutant cells were analyzed in more detail. Five of the 14 proteins were identified as elongation factor Tu (EF-Tu), Dru, DofA, FruA, and protein S by immunoblot analysis and mass spectroscopy. A gene encoding DofA was cloned and sequenced. Although both fruA and csgA genes regulate early development of M. xanthus, they were found to differently regulate expression of several developmental genes. The production of six proteins, including DofA and protein S, was dependent on fruA, whereas the production of two proteins was dependent on csgA, and one protein was dependent on both fruA and csgA. To explain the present findings, a new model was presented in which different levels of FruA phosphorylation may distinctively regulate the expression of two groups of developmental genes.

  19. Porcine E. coli: virulence-associated genes, resistance genes and adhesion and probiotic activity tested by a new screening method.

    Science.gov (United States)

    Schierack, Peter; Rödiger, Stefan; Kuhl, Christoph; Hiemann, Rico; Roggenbuck, Dirk; Li, Ganwu; Weinreich, Jörg; Berger, Enrico; Nolan, Lisa K; Nicholson, Bryon; Römer, Antje; Frömmel, Ulrike; Wieler, Lothar H; Schröder, Christian

    2013-01-01

    We established an automated screening method to characterize adhesion of Escherichia coli to intestinal porcine epithelial cells (IPEC-J2) and their probiotic activity against infection by enteropathogenic E. coli (EPEC). 104 intestinal E. coli isolates from domestic pigs were tested by PCR for the occurrence of virulence-associated genes, genes coding for resistances to antimicrobial agents and metals, and for phylogenetic origin by PCR. Adhesion rates and probiotic activity were examined for correlation with the presence of these genes. Finally, data were compared with those from 93 E. coli isolates from wild boars. Isolates from domestic pigs carried a broad variety of all tested genes and showed great diversity in gene patterns. Adhesions varied with a maximum of 18.3 or 24.2 mean bacteria adherence per epithelial cell after 2 or 6 hours respectively. Most isolates from domestic pigs and wild boars showed low adherence, with no correlation between adhesion/probiotic activity and E. coli genes or gene clusters. The gene sfa/foc, encoding for a subunit of F1C fimbriae did show a positive correlative association with adherence and probiotic activity; however E. coli isolates from wild boars with the sfa/foc gene showed less adhesion and probiotic activity than E. coli with the sfa/foc gene isolated from domestic pigs after 6 hour incubation. In conclusion, screening porcine E. coli for virulence associated genes genes, adhesion to intestinal epithelial cells, and probiotic activity revealed a single important adhesion factor, several probiotic candidates, and showed important differences between E. coli of domestic pigs and wild boars.

  20. Porcine E. coli: virulence-associated genes, resistance genes and adhesion and probiotic activity tested by a new screening method.

    Directory of Open Access Journals (Sweden)

    Peter Schierack

    Full Text Available We established an automated screening method to characterize adhesion of Escherichia coli to intestinal porcine epithelial cells (IPEC-J2 and their probiotic activity against infection by enteropathogenic E. coli (EPEC. 104 intestinal E. coli isolates from domestic pigs were tested by PCR for the occurrence of virulence-associated genes, genes coding for resistances to antimicrobial agents and metals, and for phylogenetic origin by PCR. Adhesion rates and probiotic activity were examined for correlation with the presence of these genes. Finally, data were compared with those from 93 E. coli isolates from wild boars. Isolates from domestic pigs carried a broad variety of all tested genes and showed great diversity in gene patterns. Adhesions varied with a maximum of 18.3 or 24.2 mean bacteria adherence per epithelial cell after 2 or 6 hours respectively. Most isolates from domestic pigs and wild boars showed low adherence, with no correlation between adhesion/probiotic activity and E. coli genes or gene clusters. The gene sfa/foc, encoding for a subunit of F1C fimbriae did show a positive correlative association with adherence and probiotic activity; however E. coli isolates from wild boars with the sfa/foc gene showed less adhesion and probiotic activity than E. coli with the sfa/foc gene isolated from domestic pigs after 6 hour incubation. In conclusion, screening porcine E. coli for virulence associated genes genes, adhesion to intestinal epithelial cells, and probiotic activity revealed a single important adhesion factor, several probiotic candidates, and showed important differences between E. coli of domestic pigs and wild boars.

  1. WRKY transcription factor genes in wild rice Oryza nivara.

    Science.gov (United States)

    Xu, Hengjian; Watanabe, Kenneth A; Zhang, Liyuan; Shen, Qingxi J

    2016-08-01

    The WRKY transcription factor family is one of the largest gene families involved in plant development and stress response. Although many WRKY genes have been studied in cultivated rice (Oryza sativa), the WRKY genes in the wild rice species Oryza nivara, the direct progenitor of O. sativa, have not been studied. O. nivara shows abundant genetic diversity and elite drought and disease resistance features. Herein, a total of 97 O. nivara WRKY (OnWRKY) genes were identified. RNA-sequencing demonstrates that OnWRKY genes were generally expressed at higher levels in the roots of 30-day-old plants. Bioinformatic analyses suggest that most of OnWRKY genes could be induced by salicylic acid, abscisic acid, and drought. Abundant potential MAPK phosphorylation sites in OnWRKYs suggest that activities of most OnWRKYs can be regulated by phosphorylation. Phylogenetic analyses of OnWRKYs support a novel hypothesis that ancient group IIc OnWRKYs were the original ancestors of only some group IIc and group III WRKYs. The analyses also offer strong support that group IIc OnWRKYs containing the HVE sequence in their zinc finger motifs were derived from group Ia WRKYs. This study provides a solid foundation for the study of the evolution and functions of WRKY genes in O. nivara. © The Author 2016. Published by Oxford University Press on behalf of Kazusa DNA Research Institute.

  2. The rgg0182 gene encodes a transcriptional regulator required for the full Streptococcus thermophilus LMG18311 thermal adaptation.

    Science.gov (United States)

    Henry, Romain; Bruneau, Emmanuelle; Gardan, Rozenn; Bertin, Stéphane; Fleuchot, Betty; Decaris, Bernard; Leblond-Bourget, Nathalie

    2011-10-07

    Streptococcus thermophilus is an important starter strain for the production of yogurt and cheeses. The analysis of sequenced genomes of four strains of S. thermophilus indicates that they contain several genes of the rgg familly potentially encoding transcriptional regulators. Some of the Rgg proteins are known to be involved in bacterial stress adaptation. In this study, we demonstrated that Streptococcus thermophilus thermal stress adaptation required the rgg0182 gene which transcription depends on the culture medium and the growth temperature. This gene encoded a protein showing similarity with members of the Rgg family transcriptional regulator. Our data confirmed that Rgg0182 is a transcriptional regulator controlling the expression of its neighboring genes as well as chaperones and proteases encoding genes. Therefore, analysis of a Δrgg0182 mutant revealed that this protein played a role in the heat shock adaptation of Streptococcus thermophilus LMG18311. These data showed the importance of the Rgg0182 transcriptional regulator on the survival of S. thermophilus during dairy processes and more specifically during changes in temperature.

  3. The rgg0182 gene encodes a transcriptional regulator required for the full Streptococcus thermophilus LMG18311 thermal adaptation

    Directory of Open Access Journals (Sweden)

    Bertin Stéphane

    2011-10-01

    Full Text Available Abstract Background Streptococcus thermophilus is an important starter strain for the production of yogurt and cheeses. The analysis of sequenced genomes of four strains of S. thermophilus indicates that they contain several genes of the rgg familly potentially encoding transcriptional regulators. Some of the Rgg proteins are known to be involved in bacterial stress adaptation. Results In this study, we demonstrated that Streptococcus thermophilus thermal stress adaptation required the rgg0182 gene which transcription depends on the culture medium and the growth temperature. This gene encoded a protein showing similarity with members of the Rgg family transcriptional regulator. Our data confirmed that Rgg0182 is a transcriptional regulator controlling the expression of its neighboring genes as well as chaperones and proteases encoding genes. Therefore, analysis of a Δrgg0182 mutant revealed that this protein played a role in the heat shock adaptation of Streptococcus thermophilus LMG18311. Conclusions These data showed the importance of the Rgg0182 transcriptional regulator on the survival of S. thermophilus during dairy processes and more specifically during changes in temperature.

  4. A Ten-Week Biochemistry Lab Project Studying Wild-Type and Mutant Bacterial Alkaline Phosphatase

    Science.gov (United States)

    Witherow, D. Scott

    2016-01-01

    This work describes a 10-week laboratory project studying wild-type and mutant bacterial alkaline phosphatase, in which students purify, quantitate, and perform kinetic assays on wild-type and selected mutants of the enzyme. Students also perform plasmid DNA purification, digestion, and gel analysis. In addition to simply learning important…

  5. Word form Encoding in Chinese Word Naming and Word Typing

    Science.gov (United States)

    Chen, Jenn-Yeu; Li, Cheng-Yi

    2011-01-01

    The process of word form encoding was investigated in primed word naming and word typing with Chinese monosyllabic words. The target words shared or did not share the onset consonants with the prime words. The stimulus onset asynchrony (SOA) was 100 ms or 300 ms. Typing required the participants to enter the phonetic letters of the target word,…

  6. Bacterial competition reveals differential regulation of the pks genes by Bacillus subtilis.

    Science.gov (United States)

    Vargas-Bautista, Carol; Rahlwes, Kathryn; Straight, Paul

    2014-02-01

    Bacillus subtilis is adaptable to many environments in part due to its ability to produce a broad range of bioactive compounds. One such compound, bacillaene, is a linear polyketide/nonribosomal peptide. The pks genes encode the enzymatic megacomplex that synthesizes bacillaene. The majority of pks genes appear to be organized as a giant operon (>74 kb from pksC-pksR). In previous work (P. D. Straight, M. A. Fischbach, C. T. Walsh, D. Z. Rudner, and R. Kolter, Proc. Natl. Acad. Sci. U. S. A. 104:305-310, 2007, doi:10.1073/pnas.0609073103), a deletion of the pks operon in B. subtilis was found to induce prodiginine production by Streptomyces coelicolor. Here, colonies of wild-type B. subtilis formed a spreading population that induced prodiginine production from Streptomyces lividans, suggesting differential regulation of pks genes and, as a result, bacillaene. While the parent colony showed widespread induction of pks expression among cells in the population, we found the spreading cells uniformly and transiently repressed the expression of the pks genes. To identify regulators that control pks genes, we first determined the pattern of pks gene expression in liquid culture. We next identified mutations in regulatory genes that disrupted the wild-type pattern of pks gene expression. We found that expression of the pks genes requires the master regulator of development, Spo0A, through its repression of AbrB and the stationary-phase regulator, CodY. Deletions of degU, comA, and scoC had moderate effects, disrupting the timing and level of pks gene expression. The observed patterns of expression suggest that complex regulation of bacillaene and other antibiotics optimizes competitive fitness for B. subtilis.

  7. Expression of chicken parvovirus VP2 in chicken embryo fibroblasts requires codon optimization for production of naked DNA and vectored meleagrid herpesvirus type 1 vaccines.

    Science.gov (United States)

    Spatz, Stephen J; Volkening, Jeremy D; Mullis, Robert; Li, Fenglan; Mercado, John; Zsak, Laszlo

    2013-10-01

    Meleagrid herpesvirus type 1 (MeHV-1) is an ideal vector for the expression of antigens from pathogenic avian organisms in order to generate vaccines. Chicken parvovirus (ChPV) is a widespread infectious virus that causes serious disease in chickens. It is one of the etiological agents largely suspected in causing Runting Stunting Syndrome (RSS) in chickens. Initial attempts to express the wild-type gene encoding the capsid protein VP2 of ChPV by insertion into the thymidine kinase gene of MeHV-1 were unsuccessful. However, transient expression of a codon-optimized synthetic VP2 gene cloned into the bicistronic vector pIRES2-Ds-Red2, could be demonstrated by immunocytochemical staining of transfected chicken embryo fibroblasts (CEFs). Red fluorescence could also be detected in these transfected cells since the red fluorescent protein gene is downstream from the internal ribosome entry site (IRES). Strikingly, fluorescence could not be demonstrated in cells transiently transfected with the bicistronic vector containing the wild-type or non-codon-optimized VP2 gene. Immunocytochemical staining of these cells also failed to demonstrate expression of wild-type VP2, indicating that the lack of expression was at the RNA level and the VP2 protein was not toxic to CEFs. Chickens vaccinated with a DNA vaccine consisting of the bicistronic vector containing the codon-optimized VP2 elicited a humoral immune response as measured by a VP2-specific ELISA. This VP2 codon-optimized bicistronic cassette was rescued into the MeHV-1 genome generating a vectored vaccine against ChPV disease.

  8. MitoRes: a resource of nuclear-encoded mitochondrial genes and their products in Metazoa.

    Science.gov (United States)

    Catalano, Domenico; Licciulli, Flavio; Turi, Antonio; Grillo, Giorgio; Saccone, Cecilia; D'Elia, Domenica

    2006-01-24

    Mitochondria are sub-cellular organelles that have a central role in energy production and in other metabolic pathways of all eukaryotic respiring cells. In the last few years, with more and more genomes being sequenced, a huge amount of data has been generated providing an unprecedented opportunity to use the comparative analysis approach in studies of evolution and functional genomics with the aim of shedding light on molecular mechanisms regulating mitochondrial biogenesis and metabolism. In this context, the problem of the optimal extraction of representative datasets of genomic and proteomic data assumes a crucial importance. Specialised resources for nuclear-encoded mitochondria-related proteins already exist; however, no mitochondrial database is currently available with the same features of MitoRes, which is an update of the MitoNuc database extensively modified in its structure, data sources and graphical interface. It contains data on nuclear-encoded mitochondria-related products for any metazoan species for which this type of data is available and also provides comprehensive sequence datasets (gene, transcript and protein) as well as useful tools for their extraction and export. MitoRes http://www2.ba.itb.cnr.it/MitoRes/ consolidates information from publicly external sources and automatically annotates them into a relational database. Additionally, it also clusters proteins on the basis of their sequence similarity and interconnects them with genomic data. The search engine and sequence management tools allow the query/retrieval of the database content and the extraction and export of sequences (gene, transcript, protein) and related sub-sequences (intron, exon, UTR, CDS, signal peptide and gene flanking regions) ready to be used for in silico analysis. The tool we describe here has been developed to support lab scientists and bioinformaticians alike in the characterization of molecular features and evolution of mitochondrial targeting sequences. The

  9. The euryhaline yeast Debaryomyces hansenii has two catalase genes encoding enzymes with differential activity profile.

    Science.gov (United States)

    Segal-Kischinevzky, Claudia; Rodarte-Murguía, Beatriz; Valdés-López, Victor; Mendoza-Hernández, Guillermo; González, Alicia; Alba-Lois, Luisa

    2011-03-01

    Debaryomyces hansenii is a spoilage yeast able to grow in a variety of ecological niches, from seawater to dairy products. Results presented in this article show that (i) D. hansenii has an inherent resistance to H2O2 which could be attributed to the fact that this yeast has a basal catalase activity which is several-fold higher than that observed in Saccharomyces cerevisiae under the same culture conditions, (ii) D. hansenii has two genes (DhCTA1 and DhCTT1) encoding two catalase isozymes with a differential enzymatic activity profile which is not strictly correlated with a differential expression profile of the encoding genes.

  10. The dnaN gene codes for the beta subunit of DNA polymerase III holoenzyme of escherichia coli.

    Science.gov (United States)

    Burgers, P M; Kornberg, A; Sakakibara, Y

    1981-09-01

    An Escherichia coli mutant, dnaN59, stops DNA synthesis promptly upon a shift to a high temperature; the wild-type dnaN gene carried in a transducing phage encodes a polypeptide of about 41,000 daltons [Sakakibara, Y. & Mizukami, T. (1980) Mol. Gen. Genet. 178, 541-553; Yuasa, S. & Sakakibara, Y. (1980) Mol. Gen. Genet. 180, 267-273]. We now find that the product of dnaN gene is the beta subunit of DNA polymerase III holoenzyme, the principal DNA synthetic multipolypeptide complex in E. coli. The conclusion is based on the following observations: (i) Extracts from dnaN59 cells were defective in phage phi X174 and G4 DNA synthesis after the mutant cells had been exposed to the increased temperature. (ii) The enzymatic defect was overcome by addition of purified beta subunit but not by other subunits of DNA polymerase III holoenzyme or by other replication proteins required for phi X174 DNA synthesis. (iii) Partially purified beta subunit from the dnaN mutant, unlike that from the wild type, was inactive in reconstituting the holoenzyme when mixed with the other purified subunits. (iv) Increased dosage of the dnaN gene provided by a plasmid carrying the gene raised cellular levels of the beta subunit 5- to 6-fold.

  11. A novel method, digital genome scanning detects KRAS gene amplification in gastric cancers: involvement of overexpressed wild-type KRAS in downstream signaling and cancer cell growth

    Directory of Open Access Journals (Sweden)

    Yanagihara Kazuyoshi

    2009-06-01

    Full Text Available Abstract Background Gastric cancer is the third most common malignancy affecting the general population worldwide. Aberrant activation of KRAS is a key factor in the development of many types of tumor, however, oncogenic mutations of KRAS are infrequent in gastric cancer. We have developed a novel quantitative method of analysis of DNA copy number, termed digital genome scanning (DGS, which is based on the enumeration of short restriction fragments, and does not involve PCR or hybridization. In the current study, we used DGS to survey copy-number alterations in gastric cancer cells. Methods DGS of gastric cancer cell lines was performed using the sequences of 5000 to 15000 restriction fragments. We screened 20 gastric cancer cell lines and 86 primary gastric tumors for KRAS amplification by quantitative PCR, and investigated KRAS amplification at the DNA, mRNA and protein levels by mutational analysis, real-time PCR, immunoblot analysis, GTP-RAS pull-down assay and immunohistochemical analysis. The effect of KRAS knock-down on the activation of p44/42 MAP kinase and AKT and on cell growth were examined by immunoblot and colorimetric assay, respectively. Results DGS analysis of the HSC45 gastric cancer cell line revealed the amplification of a 500-kb region on chromosome 12p12.1, which contains the KRAS gene locus. Amplification of the KRAS locus was detected in 15% (3/20 of gastric cancer cell lines (8–18-fold amplification and 4.7% (4/86 of primary gastric tumors (8–50-fold amplification. KRAS mutations were identified in two of the three cell lines in which KRAS was amplified, but were not detected in any of the primary tumors. Overexpression of KRAS protein correlated directly with increased KRAS copy number. The level of GTP-bound KRAS was elevated following serum stimulation in cells with amplified wild-type KRAS, but not in cells with amplified mutant KRAS. Knock-down of KRAS in gastric cancer cells that carried amplified wild-type

  12. A novel method, digital genome scanning detects KRAS gene amplification in gastric cancers: involvement of overexpressed wild-type KRAS in downstream signaling and cancer cell growth

    International Nuclear Information System (INIS)

    Mita, Hiroaki; Yanagihara, Kazuyoshi; Fujita, Masahiro; Hosokawa, Masao; Kusano, Masanobu; Sabau, Sorin Vasile; Tatsumi, Haruyuki; Imai, Kohzoh; Shinomura, Yasuhisa; Tokino, Takashi; Toyota, Minoru; Aoki, Fumio; Akashi, Hirofumi; Maruyama, Reo; Sasaki, Yasushi; Suzuki, Hiromu; Idogawa, Masashi; Kashima, Lisa

    2009-01-01

    Gastric cancer is the third most common malignancy affecting the general population worldwide. Aberrant activation of KRAS is a key factor in the development of many types of tumor, however, oncogenic mutations of KRAS are infrequent in gastric cancer. We have developed a novel quantitative method of analysis of DNA copy number, termed digital genome scanning (DGS), which is based on the enumeration of short restriction fragments, and does not involve PCR or hybridization. In the current study, we used DGS to survey copy-number alterations in gastric cancer cells. DGS of gastric cancer cell lines was performed using the sequences of 5000 to 15000 restriction fragments. We screened 20 gastric cancer cell lines and 86 primary gastric tumors for KRAS amplification by quantitative PCR, and investigated KRAS amplification at the DNA, mRNA and protein levels by mutational analysis, real-time PCR, immunoblot analysis, GTP-RAS pull-down assay and immunohistochemical analysis. The effect of KRAS knock-down on the activation of p44/42 MAP kinase and AKT and on cell growth were examined by immunoblot and colorimetric assay, respectively. DGS analysis of the HSC45 gastric cancer cell line revealed the amplification of a 500-kb region on chromosome 12p12.1, which contains the KRAS gene locus. Amplification of the KRAS locus was detected in 15% (3/20) of gastric cancer cell lines (8–18-fold amplification) and 4.7% (4/86) of primary gastric tumors (8–50-fold amplification). KRAS mutations were identified in two of the three cell lines in which KRAS was amplified, but were not detected in any of the primary tumors. Overexpression of KRAS protein correlated directly with increased KRAS copy number. The level of GTP-bound KRAS was elevated following serum stimulation in cells with amplified wild-type KRAS, but not in cells with amplified mutant KRAS. Knock-down of KRAS in gastric cancer cells that carried amplified wild-type KRAS resulted in the inhibition of cell growth and

  13. Draft Genome Sequence of the Nitrogen-Fixing Rhizobium sullae Type Strain IS123T Focusing on the Key Genes for Symbiosis with its Host Hedysarum coronarium L.

    Directory of Open Access Journals (Sweden)

    Gaurav Sablok

    2017-07-01

    Full Text Available The prominent feature of rhizobia is their molecular dialogue with plant hosts. Such interaction is enabled by the presence of a series of symbiotic genes encoding for the synthesis and export of signals triggering organogenetic and physiological responses in the plant. The genome of the Rhizobium sullae type strain IS123T nodulating the legume Hedysarum coronarium, was sequenced and resulted in 317 scaffolds for a total assembled size of 7,889,576 bp. Its features were compared with those of genomes from rhizobia representing an increasing gradient of taxonomical distance, from a conspecific isolate (Rhizobium sullae WSM1592, to two congeneric cases (Rhizobium leguminosarum bv. viciae and Rhizobium etli and up to different genera within the legume-nodulating taxa. The host plant is of agricultural importance, but, unlike the majority of other domesticated plant species, it is able to survive quite well in the wild. Data showed that that the type strain of R. sullae, isolated from a wild host specimen, is endowed with a richer array of symbiotic genes in comparison to other strains, species or genera of rhizobia that were rescued from domesticated plant ecotypes. The analysis revealed that the bacterium by itself is incapable of surviving in the extreme conditions that its host plant can tolerate. When exposed to drought or alkaline condition, the bacterium depends on its host to survive. Data are consistent with the view of the plant phenotype as the primary factor enabling symbiotic nitrogen fixing bacteria to survive in otherwise limiting environments.

  14. Using Patient-Specific Induced Pluripotent Stem Cells and Wild-Type Mice to Develop a Gene Augmentation-Based Strategy to Treat CLN3-Associated Retinal Degeneration.

    Science.gov (United States)

    Wiley, Luke A; Burnight, Erin R; Drack, Arlene V; Banach, Bailey B; Ochoa, Dalyz; Cranston, Cathryn M; Madumba, Robert A; East, Jade S; Mullins, Robert F; Stone, Edwin M; Tucker, Budd A

    2016-10-01

    Juvenile neuronal ceroid lipofuscinosis (JNCL) is a childhood neurodegenerative disease with early-onset, severe central vision loss. Affected children develop seizures and CNS degeneration accompanied by severe motor and cognitive deficits. There is no cure for JNCL, and patients usually die during the second or third decade of life. In this study, independent lines of induced pluripotent stem cells (iPSCs) were generated from two patients with molecularly confirmed mutations in CLN3, the gene mutated in JNCL. Clinical-grade adeno-associated adenovirus serotype 2 (AAV2) carrying the full-length coding sequence of human CLN3 was generated in a U.S. Food and Drug Administration-registered cGMP facility. AAV2-CLN3 was efficacious in restoring full-length CLN3 transcript and protein in patient-specific fibroblasts and iPSC-derived retinal neurons. When injected into the subretinal space of wild-type mice, purified AAV2-CLN3 did not show any evidence of retinal toxicity. This study provides proof-of-principle for initiation of a clinical trial using AAV-mediated gene augmentation for the treatment of children with CLN3-associated retinal degeneration.

  15. OVER-EXPRESSION OF GENE ENCODING FATTY ACID METABOLIC ENZYMES IN FISH

    Directory of Open Access Journals (Sweden)

    Alimuddin Alimuddin

    2008-12-01

    Full Text Available Eicosapentaenoic acid (EPA, 20:5n-3 and docosahexaenoic acid (DHA, 22:6n-3 have important nutritional benefits in humans. EPA and DHA are mainly derived from fish, but the decline in the stocks of major marine capture fishes could result in these fatty acids being consumed less. Farmed fish could serve as promising sources of EPA and DHA, but they need these fatty acids in their diets. Generation of fish strains that are capable of synthesizing enough amounts of EPA/DHA from the conversion of α-linolenic acid (LNA, 18:3n-3 rich oils can supply a new EPA/DHA source. This may be achieved by over-expression of genes encoding enzymes involved in HUFA biosynthesis. In aquaculture, the successful of this technique would open the possibility to reduce the enrichment of live food with fish oils for marine fish larvae, and to completely substitute fish oils with plant oils without reducing the quality of flesh in terms of EPA and DHA contents. Here, three genes, i.e. Δ6-desaturase-like (OmΔ6FAD, Δ5-desaturase-like (OmΔ5FAD and elongase-like (MELO encoding EPA/DHA metabolic enzymes derived from masu salmon (Oncorhynchus masou were individually transferred into zebrafish (Danio rerio as a model to increase its ability for synthesizing EPA and DHA. Fatty acid analysis showed that EPA content in whole body of the second transgenic fish generation over-expressing OmΔ6FAD gene was 1.4 fold and that of DHA was 2.1 fold higher (P<0.05 than those in non-transgenic fish. The EPA content in whole body of transgenic fish over-expressing OmΔ5FAD gene was 1.21-fold, and that of DHA was 1.24-fold higher (P<0.05 than those in nontransgenic fish. The same patterns were obtained in transgenic fish over-expressing MELO gene. EPA content was increased by 1.30-fold and DHA content by 1.33-fold higher (P<0.05 than those in non-transgenic fish. The results of studies demonstrated that fatty acid content of fish can be enhanced by over

  16. High Myopia Caused by a Mutation in LEPREL1, Encoding Prolyl 3-Hydroxylase 2

    Science.gov (United States)

    Mordechai, Shikma; Gradstein, Libe; Pasanen, Annika; Ofir, Rivka; El Amour, Khalil; Levy, Jaime; Belfair, Nadav; Lifshitz, Tova; Joshua, Sara; Narkis, Ginat; Elbedour, Khalil; Myllyharju, Johanna; Birk, Ohad S.

    2011-01-01

    Autosomal-recessive high-grade axial myopia was diagnosed in Bedouin Israeli consanguineous kindred. Some affected individuals also had variable expressivity of early-onset cataracts, peripheral vitreo-retinal degeneration, and secondary sight loss due to severe retinal detachments. Through genome-wide linkage analysis, the disease-associated gene was mapped to ∼1.7 Mb on chromosome 3q28 (the maximum LOD score was 11.5 at θ = 0 for marker D3S1314). Sequencing of the entire coding regions and intron-exon boundaries of the six genes within the defined locus identified a single mutation (c.1523G>T) in exon 10 of LEPREL1, encoding prolyl 3-hydroxylase 2 (P3H2), a 2-oxoglutarate-dependent dioxygenase that hydroxylates collagens. The mutation affects a glycine that is conserved within P3H isozymes. Analysis of wild-type and p.Gly508Val (c.1523G>T) mutant recombinant P3H2 polypeptides expressed in insect cells showed that the mutation led to complete inactivation of P3H2. PMID:21885030

  17. IL6 gene promoter polymorphisms and type 2 diabetes

    DEFF Research Database (Denmark)

    Huth, Cornelia; Heid, Iris M; Vollmert, Caren

    2006-01-01

    Several lines of evidence indicate a causal role of the cytokine interleukin (IL)-6 in the development of type 2 diabetes in humans. Two common polymorphisms in the promoter of the IL-6 encoding gene IL6, -174G>C (rs1800795) and -573G>C (rs1800796), have been investigated for association with type...... 2 diabetes in numerous studies but with results that have been largely equivocal. To clarify the relationship between the two IL6 variants and type 2 diabetes, we analyzed individual data on >20,000 participants from 21 published and unpublished studies. Collected data represent eight different...... countries, making this the largest association analysis for type 2 diabetes reported to date. The GC and CC genotypes of IL6 -174G>C were associated with a decreased risk of type 2 diabetes (odds ratio 0.91, P = 0.037), corresponding to a risk modification of nearly 9%. No evidence for association was found...

  18. Atm heterozygous mice are more sensitive to radiation-induced cataracts than are their wild-type counterparts

    Science.gov (United States)

    Worgul, Basil V.; Smilenov, Lubomir; Brenner, David J.; Junk, Anna; Zhou, Wei; Hall, Eric J.

    2002-01-01

    It is important to know whether the human population includes genetically predisposed radiosensitive subsets. In vitro studies have shown that cells from individuals homozygous for ataxia telangiectasia (A-T) are much more radiosensitive than cells from unaffected individuals. Although cells heterozygous for the ATM gene (ATM(+/-)) may be slightly more radiosensitive in vitro, it remained to be determined whether the greater susceptibility of ATM(+/-) cells translates into an increased sensitivity for late effects in vivo, though there is a suggestion that radiotherapy patients that are heterozygous for the ATM gene may be more at risk of developing late normal tissue damage. We chose cataractogenesis in the lens as a means to assay for the effects of ATM deficiency in a late-responding tissue. One eye of wild-type, Atm heterozygous and homozygous knockout mice was exposed to 0.5-, 1.0-, 2.0-, or 4.0-Gy x rays. The animals were followed weekly for cataract development by conventional slit-lamp biomicroscopy. Cataract development in the animals of all three groups was strongly dependent on dose. The lenses of homozygous mice were the first to opacify at any given dose. Most important in the present context is that cataracts appeared earlier in the heterozygous versus wild-type animals. The data suggest that ATM heterozygotes in the human population may also be radiosensitive. This may influence the choice of individuals destined to be exposed to higher than normal doses of radiation, such as astronauts, and may also suggest that radiotherapy patients who are ATM heterozygotes could be predisposed to increased late normal tissue damage.

  19. A novel blast resistance gene, Pi54rh cloned from wild species of rice, Oryza rhizomatis confers broad spectrum resistance to Magnaporthe oryzae.

    Science.gov (United States)

    Das, Alok; Soubam, D; Singh, P K; Thakur, S; Singh, N K; Sharma, T R

    2012-06-01

    The dominant rice blast resistance gene, Pi54 confers resistance to Magnaporthe oryzae in different parts of India. In our effort to identify more effective forms of this gene, we isolated an orthologue of Pi54 named as Pi54rh from the blast-resistant wild species of rice, Oryza rhizomatis, using allele mining approach and validated by complementation. The Pi54rh belongs to CC-NBS-LRR family of disease resistance genes with a unique Zinc finger (C(3)H type) domain. The 1,447 bp Pi54rh transcript comprises of 101 bp 5'-UTR, 1,083 bp coding region and 263 bp 3'-UTR, driven by pathogen inducible promoter. We showed the extracellular localization of Pi54rh protein and the presence of glycosylation, myristoylation and phosphorylation sites which implicates its role in signal transduction process. This is in contrast to other blast resistance genes that are predicted to be intracellular NBS-LRR-type resistance proteins. The Pi54rh was found to express constitutively at basal level in the leaves, but upregulates 3.8-fold at 96 h post-inoculation with the pathogen. Functional validation of cloned Pi54rh gene using complementation test showed high degree of resistance to seven isolates of M. oryzae collected from different geographical locations of India. In this study, for the first time, we demonstrated that a rice blast resistance gene Pi54rh cloned from wild species of rice provides broad spectrum resistance to M. oryzae hence can be used in rice improvement breeding programme.

  20. Construction of a multicontrol sterility system for a maize male-sterile line and hybrid seed production based on the ZmMs7 gene encoding a PHD-finger transcription factor.

    Science.gov (United States)

    Zhang, Danfeng; Wu, Suowei; An, Xueli; Xie, Ke; Dong, Zhenying; Zhou, Yan; Xu, Liwen; Fang, Wen; Liu, Shensi; Liu, Shuangshuang; Zhu, Taotao; Li, Jinping; Rao, Liqun; Zhao, Jiuran; Wan, Xiangyuan

    2018-02-01

    Although hundreds of genetic male sterility (GMS) mutants have been identified in maize, few are commercially used due to a lack of effective methods to produce large quantities of pure male-sterile seeds. Here, we develop a multicontrol sterility (MCS) system based on the maize male sterility 7 (ms7) mutant and its wild-type Zea mays Male sterility 7 (ZmMs7) gene via a transgenic strategy, leading to the utilization of GMS in hybrid seed production. ZmMs7 is isolated by a map-based cloning approach and encodes a PHD-finger transcription factor orthologous to rice PTC1 and Arabidopsis MS1. The MCS transgenic maintainer lines are developed based on the ms7-6007 mutant transformed with MCS constructs containing the (i) ZmMs7 gene to restore fertility, (ii) α-amylase gene ZmAA and/or (iii) DNA adenine methylase gene Dam to devitalize transgenic pollen, (iv) red fluorescence protein gene DsRed2 or mCherry to mark transgenic seeds and (v) herbicide-resistant gene Bar for transgenic seed selection. Self-pollination of the MCS transgenic maintainer line produces transgenic red fluorescent seeds and nontransgenic normal colour seeds at a 1:1 ratio. Among them, all the fluorescent seeds are male fertile, but the seeds with a normal colour are male sterile. Cross-pollination of the transgenic plants to male-sterile plants propagates male-sterile seeds with high purity. Moreover, the transgene transmission rate through pollen of transgenic plants harbouring two pollen-disrupted genes is lower than that containing one pollen-disrupted gene. The MCS system has great potential to enhance the efficiency of maize male-sterile line propagation and commercial hybrid seed production. © 2017 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

  1. NFκB-mediated activation of the cellular FUT3, 5 and 6 gene cluster by herpes simplex virus type 1.

    Science.gov (United States)

    Nordén, Rickard; Samuelsson, Ebba; Nyström, Kristina

    2017-11-01

    Herpes simplex virus type 1 has the ability to induce expression of a human gene cluster located on chromosome 19 upon infection. This gene cluster contains three fucosyltransferases (encoded by FUT3, FUT5 and FUT6) with the ability to add a fucose to an N-acetylglucosamine residue. Little is known regarding the transcriptional activation of these three genes in human cells. Intriguingly, herpes simplex virus type 1 activates all three genes simultaneously during infection, a situation not observed in uninfected tissue, pointing towards a virus specific mechanism for transcriptional activation. The aim of this study was to define the underlying mechanism for the herpes simplex virus type 1 activation of FUT3, FUT5 and FUT6 transcription. The transcriptional activation of the FUT-gene cluster on chromosome 19 in fibroblasts was specific, not involving adjacent genes. Moreover, inhibition of NFκB signaling through panepoxydone treatment significantly decreased the induction of FUT3, FUT5 and FUT6 transcriptional activation, as did siRNA targeting of p65, in herpes simplex virus type 1 infected fibroblasts. NFκB and p65 signaling appears to play an important role in the regulation of FUT3, FUT5 and FUT6 transcriptional activation by herpes simplex virus type 1 although additional, unidentified, viral factors might account for part of the mechanism as direct interferon mediated stimulation of NFκB was not sufficient to induce the fucosyltransferase encoding gene cluster in uninfected cells. © The Author 2017. Published by Oxford University Press. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  2. Characterisation of the Aspergillus nidulans frA1 mutant: hexose phosphorylation and apparent lack of involvement of hexokinase in glucose repression.

    NARCIS (Netherlands)

    Ruijter, G.J.G.; Panneman, H.; Broeck, van den H.C.; Bennett, J.M.; Visser, J.

    1996-01-01

    Hexose phosphorylation was studied in Aspergillus nidulans wild-type and in a fructose non-utilising mutant (frA). The data indicate the presence of at least one hexokinase and one glucokinase in wild-type A. nidulans, while the frA1 mutant lacks hexokinase activity. The A. nidulans gene encoding

  3. Harnessing Genetic Diversity of Wild Gene Pools to Enhance Wheat Crop Production and Sustainability: Challenges and Opportunities

    Directory of Open Access Journals (Sweden)

    Carla Ceoloni

    2017-12-01

    Full Text Available Wild species are extremely rich resources of useful genes not available in the cultivated gene pool. For species providing staple food to mankind, such as the cultivated Triticum species, including hexaploid bread wheat (Triticum aestivum, 6x and tetraploid durum wheat (T. durum, 4x, widening the genetic base is a priority and primary target to cope with the many challenges that the crop has to face. These include recent climate changes, as well as actual and projected demographic growth, contrasting with reduction of arable land and water reserves. All of these environmental and societal modifications pose major constraints to the required production increase in the wheat crop. A sustainable approach to address this task implies resorting to non-conventional breeding strategies, such as “chromosome engineering”. This is based on cytogenetic methodologies, which ultimately allow for the incorporation into wheat chromosomes of targeted, and ideally small, chromosomal segments from the genome of wild relatives, containing the gene(s of interest. Chromosome engineering has been successfully applied to introduce into wheat genes/QTL for resistance to biotic and abiotic stresses, quality attributes, and even yield-related traits. In recent years, a substantial upsurge in effective alien gene exploitation for wheat improvement has come from modern technologies, including use of molecular markers, molecular cytogenetic techniques, and sequencing, which have greatly expanded our knowledge and ability to finely manipulate wheat and alien genomes. Examples will be provided of various types of stable introgressions, including pyramiding of different alien genes/QTL, into the background of bread and durum wheat genotypes, representing valuable materials for both species to respond to the needed novelty in current and future breeding programs. Challenging contexts, such as that inherent to the 4x nature of durum wheat when compared to 6x bread wheat, or

  4. Transcription factor VdCmr1 is required for pigment production, protection from UV irradiation, and regulates expression of melanin biosynthetic genes in Verticillium dahliae.

    Science.gov (United States)

    Wang, Yonglin; Hu, Xiaoping; Fang, Yulin; Anchieta, Amy; Goldman, Polly H; Hernandez, Gustavo; Klosterman, Steven J

    2018-04-01

    Verticillium dahliae is a soilborne fungus that causes vascular wilt diseases on numerous plant species worldwide. The production of darkly melanized microsclerotia is crucial in the disease cycle of V. dahliae, as these structures allow for long-term survival in soil. Previously, transcriptomic and genomic analysis identified a cluster of genes in V. dahliae that encodes some dihydroxynaphthalene (DHN) melanin biosynthetic pathway homologues found in related fungi. In this study, we explored the roles of cluster-specific transcription factor VdCmr1, as well as two other genes within the cluster encoding a polyketide synthase (VdPKS1) and a laccase (VdLac1), enzymes at initial and endpoint steps in DHN melanin production. The results revealed that VdCmr1 and VdPKS1 are required for melanin production, but neither is required for microsclerotia production. None of the three genes were required for pathogenesis on tobacco and lettuce. Exposure of ΔVdCmr1 and wild-type strains to UV irradiation, or to high temperature (40 °C), revealed an approx. 50 % reduction of survival in the ΔVdCmr1 strain, relative to the wild-type strain, in response to either condition. Expression profiles revealed that expression of some melanin biosynthetic genes are in part dependent on VdCmr1. Combined data indicate VdCmr1 is a key regulator of melanin biosynthesis, and that via regulation of melanogenesis, VdCmr1 affects survival of V. dahliae in response to abiotic threats. We conclude with a model showing regulation of VdCmr1 by a high osmolarity glycerol response (Hog)-type MAP kinase pathway.

  5. Cell cloning-based transcriptome analysis in Rett patients: relevance to the pathogenesis of Rett syndrome of new human MeCP2 target genes.

    Science.gov (United States)

    Nectoux, J; Fichou, Y; Rosas-Vargas, H; Cagnard, N; Bahi-Buisson, N; Nusbaum, P; Letourneur, F; Chelly, J; Bienvenu, T

    2010-07-01

    More than 90% of Rett syndrome (RTT) patients have heterozygous mutations in the X-linked methyl-CpG binding protein 2 (MECP2) gene that encodes the methyl-CpG-binding protein 2, a transcriptional modulator. Because MECP2 is subjected to X chromosome inactivation (XCI), girls with RTT either express the wild-type or mutant allele in each individual cell. To test the consequences of MECP2 mutations resulting from a genome-wide transcriptional dysregulation and to identify its target genes in a system that circumvents the functional mosaicism resulting from XCI, we carried out gene expression profiling of clonal populations derived from fibroblast primary cultures expressing exclusively either the wild-type or the mutant MECP2 allele. Clonal cultures were obtained from skin biopsy of three RTT patients carrying either a non-sense or a frameshift MECP2 mutation. For each patient, gene expression profiles of wild-type and mutant clones were compared by oligonucleotide expression microarray analysis. Firstly, clustering analysis classified the RTT patients according to their genetic background and MECP2 mutation. Secondly, expression profiling by microarray analysis and quantitative RT-PCR indicated four up-regulated genes and five down-regulated genes significantly dysregulated in all our statistical analysis, including excellent potential candidate genes for the understanding of the pathophysiology of this neurodevelopmental disease. Thirdly, chromatin immunoprecipitation analysis confirmed MeCP2 binding to respective CpG islands in three out of four up-regulated candidate genes and sequencing of bisulphite-converted DNA indicated that MeCP2 preferentially binds to methylated-DNA sequences. Most importantly, the finding that at least two of these genes (BMCC1 and RNF182) were shown to be involved in cell survival and/or apoptosis may suggest that impaired MeCP2 function could alter the survival of neurons thus compromising brain function without inducing cell death.

  6. The Pseudomonas aeruginosa pirA gene encodes a second receptor for ferrienterobactin and synthetic catecholate analogues.

    Science.gov (United States)

    Ghysels, Bart; Ochsner, Urs; Möllman, Ute; Heinisch, Lothar; Vasil, Michael; Cornelis, Pierre; Matthijs, Sandra

    2005-05-15

    Actively secreted iron chelating agents termed siderophores play an important role in the virulence and rhizosphere competence of fluorescent pseudomonads, including Pseudomonas aeruginosa which secretes a high affinity siderophore, pyoverdine, and the low affinity siderophore, pyochelin. Uptake of the iron-siderophore complexes is an active process that requires specific outer membrane located receptors, which are dependent of the inner membrane-associated protein TonB and two other inner membrane proteins, ExbB and ExbC. P. aeruginosa is also capable of using a remarkable variety of heterologous siderophores as sources of iron, apparently by expressing their cognate receptors. Illustrative of this feature are the 32 (of which 28 putative) siderophore receptor genes observed in the P. aeruginosa PAO1 genome. However, except for a few (pyoverdine, pyochelin, enterobactin), the vast majority of P. aeruginosa siderophore receptor genes still remain to be characterized. Ten synthetic iron chelators of catecholate type stimulated growth of a pyoverdine/pyochelin deficient P. aeruginosa PAO1 mutant under condition of severe iron limitation. Null mutants of the 32 putative TonB-dependent siderophore receptor encoding genes engineered in the same genetic background were screened for obvious deficiencies in uptake of the synthetic siderophores, but none showed decreased growth stimulation in the presence of the different siderophores. However, a double knock-out mutant of ferrienterobactin receptor encoding gene pfeA (PA 2688) and pirA (PA0931) failed to be stimulated by 4 of the tested synthetic catecholate siderophores whose chemical structures resemble enterobactin. Ferric-enterobactin also failed to stimulate growth of the double pfeA-pirA mutant although, like its synthetic analogues, it stimulated growth of the corresponding single mutants. Hence, we confirmed that pirA represents a second P. aeruginosa ferric-enterobactin receptor. The example of these two

  7. Silencing of the PiAvr3a effector-encoding gene from Phytophthora infestans by transcriptional fusion to a short interspersed element.

    Science.gov (United States)

    Vetukuri, Ramesh R; Tian, Zhendong; Avrova, Anna O; Savenkov, Eugene I; Dixelius, Christina; Whisson, Stephen C

    2011-12-01

    Phytophthora infestans is the notorious oomycete causing late blight of potato and tomato. A large proportion of the P. infestans genome is composed of transposable elements, the activity of which may be controlled by RNA silencing. Accumulation of small RNAs is one of the hallmarks of RNA silencing. Here we demonstrate the presence of small RNAs corresponding to the sequence of a short interspersed retrotransposable element (SINE) suggesting that small RNAs might be involved in silencing of SINEs in P. infestans. This notion was exploited to develop novel tools for gene silencing in P. infestans by engineering transcriptional fusions of the PiAvr3a gene, encoding an RXLR avirulence effector, to the infSINEm retroelement. Transgenic P. infestans lines expressing either 5'-infSINEm::PiAvr3a-3' or 5'-PiAvr3a::SINEm-3' chimeric transcripts initially exhibited partial silencing of PiAvr3a. Over time, PiAvr3a either recovered wild type transcript levels in some lines, or became fully silenced in others. Introduction of an inverted repeat construct was also successful in yielding P. infestans transgenic lines silenced for PiAvr3a. In contrast, constructs expressing antisense or aberrant RNA transcripts failed to initiate silencing of PiAvr3a. Lines exhibiting the most effective silencing of PiAvr3a were either weakly or non-pathogenic on susceptible potato cv. Bintje. This study expands the repertoire of reverse genetics tools available for P. infestans research, and provides insights into a possible mode of variation in effector expression through spread of silencing from adjacent retroelements. Crown Copyright © 2011. Published by Elsevier Ltd. All rights reserved.

  8. Coevolution between Nuclear-Encoded DNA Replication, Recombination, and Repair Genes and Plastid Genome Complexity.

    Science.gov (United States)

    Zhang, Jin; Ruhlman, Tracey A; Sabir, Jamal S M; Blazier, John Chris; Weng, Mao-Lun; Park, Seongjun; Jansen, Robert K

    2016-02-17

    Disruption of DNA replication, recombination, and repair (DNA-RRR) systems has been hypothesized to cause highly elevated nucleotide substitution rates and genome rearrangements in the plastids of angiosperms, but this theory remains untested. To investigate nuclear-plastid genome (plastome) coevolution in Geraniaceae, four different measures of plastome complexity (rearrangements, repeats, nucleotide insertions/deletions, and substitution rates) were evaluated along with substitution rates of 12 nuclear-encoded, plastid-targeted DNA-RRR genes from 27 Geraniales species. Significant correlations were detected for nonsynonymous (dN) but not synonymous (dS) substitution rates for three DNA-RRR genes (uvrB/C, why1, and gyrA) supporting a role for these genes in accelerated plastid genome evolution in Geraniaceae. Furthermore, correlation between dN of uvrB/C and plastome complexity suggests the presence of nucleotide excision repair system in plastids. Significant correlations were also detected between plastome complexity and 13 of the 90 nuclear-encoded organelle-targeted genes investigated. Comparisons revealed significant acceleration of dN in plastid-targeted genes of Geraniales relative to Brassicales suggesting this correlation may be an artifact of elevated rates in this gene set in Geraniaceae. Correlation between dN of plastid-targeted DNA-RRR genes and plastome complexity supports the hypothesis that the aberrant patterns in angiosperm plastome evolution could be caused by dysfunction in DNA-RRR systems. © The Author 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  9. Expression and Functional Analysis of WRKY Transcription Factors in Chinese Wild Hazel, Corylus heterophylla Fisch.

    Science.gov (United States)

    Zhao, Tian-Tian; Zhang, Jin; Liang, Li-Song; Ma, Qing-Hua; Chen, Xin; Zong, Jian-Wei; Wang, Gui-Xi

    2015-01-01

    Plant WRKY transcription factors are known to regulate various biotic and abiotic stress responses. In this study we identified a total of 30 putative WRKY unigenes in a transcriptome dataset of the Chinese wild Hazel, Corylus heterophylla, a species that is noted for its cold tolerance. Thirteen full-length of these ChWRKY genes were cloned and found to encode complete protein sequences, and they were divided into three groups, based on the number of WRKY domains and the pattern of zinc finger structures. Representatives of each of the groups, Unigene25835 (group I), Unigene37641 (group II) and Unigene20441 (group III), were transiently expressed as fusion proteins with yellow fluorescent fusion protein in Nicotiana benthamiana, where they were observed to accumulate in the nucleus, in accordance with their predicted roles as transcriptional activators. An analysis of the expression patterns of all 30 WRKY genes revealed differences in transcript abundance profiles following exposure to cold, drought and high salinity conditions. Among the stress-inducible genes, 23 were up-regulated by all three abiotic stresses and the WRKY genes collectively exhibited four different patterns of expression in flower buds during the overwintering period from November to April. The organ/tissue related expression analysis showed that 18 WRKY genes were highly expressed in stem but only 2 (Unigene9262 and Unigene43101) were greatest in male anthotaxies. The expression of Unigene37641, a member of the group II WRKY genes, was substantially up-regulated by cold, drought and salinity treatments, and its overexpression in Arabidopsis thaliana resulted in better seedling growth, compared with wild type plants, under cold treatment conditions. The transgenic lines also had exhibited higher soluble protein content, superoxide dismutase and peroxidase activiety and lower levels of malondialdehyde, which collectively suggets that Unigene37641 expression promotes cold tolerance.

  10. Discovering functions of unannotated genes from a transcriptome survey of wild fungal isolates.

    Science.gov (United States)

    Ellison, Christopher E; Kowbel, David; Glass, N Louise; Taylor, John W; Brem, Rachel B

    2014-04-01

    Most fungal genomes are poorly annotated, and many fungal traits of industrial and biomedical relevance are not well suited to classical genetic screens. Assigning genes to phenotypes on a genomic scale thus remains an urgent need in the field. We developed an approach to infer gene function from expression profiles of wild fungal isolates, and we applied our strategy to the filamentous fungus Neurospora crassa. Using transcriptome measurements in 70 strains from two well-defined clades of this microbe, we first identified 2,247 cases in which the expression of an unannotated gene rose and fell across N. crassa strains in parallel with the expression of well-characterized genes. We then used image analysis of hyphal morphologies, quantitative growth assays, and expression profiling to test the functions of four genes predicted from our population analyses. The results revealed two factors that influenced regulation of metabolism of nonpreferred carbon and nitrogen sources, a gene that governed hyphal architecture, and a gene that mediated amino acid starvation resistance. These findings validate the power of our population-transcriptomic approach for inference of novel gene function, and we suggest that this strategy will be of broad utility for genome-scale annotation in many fungal systems. IMPORTANCE Some fungal species cause deadly infections in humans or crop plants, and other fungi are workhorses of industrial chemistry, including the production of biofuels. Advances in medical and industrial mycology require an understanding of the genes that control fungal traits. We developed a method to infer functions of uncharacterized genes by observing correlated expression of their mRNAs with those of known genes across wild fungal isolates. We applied this strategy to a filamentous fungus and predicted functions for thousands of unknown genes. In four cases, we experimentally validated the predictions from our method, discovering novel genes involved in the

  11. Sieve element occlusion (SEO) genes encode structural phloem proteins involved in wound sealing of the phloem.

    Science.gov (United States)

    Ernst, Antonia M; Jekat, Stephan B; Zielonka, Sascia; Müller, Boje; Neumann, Ulla; Rüping, Boris; Twyman, Richard M; Krzyzanek, Vladislav; Prüfer, Dirk; Noll, Gundula A

    2012-07-10

    The sieve element occlusion (SEO) gene family originally was delimited to genes encoding structural components of forisomes, which are specialized crystalloid phloem proteins found solely in the Fabaceae. More recently, SEO genes discovered in various non-Fabaceae plants were proposed to encode the common phloem proteins (P-proteins) that plug sieve plates after wounding. We carried out a comprehensive characterization of two tobacco (Nicotiana tabacum) SEO genes (NtSEO). Reporter genes controlled by the NtSEO promoters were expressed specifically in immature sieve elements, and GFP-SEO fusion proteins formed parietal agglomerates in intact sieve elements as well as sieve plate plugs after wounding. NtSEO proteins with and without fluorescent protein tags formed agglomerates similar in structure to native P-protein bodies when transiently coexpressed in Nicotiana benthamiana, and the analysis of these protein complexes by electron microscopy revealed ultrastructural features resembling those of native P-proteins. NtSEO-RNA interference lines were essentially devoid of P-protein structures and lost photoassimilates more rapidly after injury than control plants, thus confirming the role of P-proteins in sieve tube sealing. We therefore provide direct evidence that SEO genes in tobacco encode P-protein subunits that affect translocation. We also found that peptides recently identified in fascicular phloem P-protein plugs from squash (Cucurbita maxima) represent cucurbit members of the SEO family. Our results therefore suggest a common evolutionary origin for P-proteins found in the sieve elements of all dicotyledonous plants and demonstrate the exceptional status of extrafascicular P-proteins in cucurbits.

  12. Evidence for the bacterial origin of genes encoding fermentation enzymes of the amitochondriate protozoan parasite Entamoeba histolytica.

    Science.gov (United States)

    Rosenthal, B; Mai, Z; Caplivski, D; Ghosh, S; de la Vega, H; Graf, T; Samuelson, J

    1997-06-01

    Entamoeba histolytica is an amitochondriate protozoan parasite with numerous bacterium-like fermentation enzymes including the pyruvate:ferredoxin oxidoreductase (POR), ferredoxin (FD), and alcohol dehydrogenase E (ADHE). The goal of this study was to determine whether the genes encoding these cytosolic E. histolytica fermentation enzymes might derive from a bacterium by horizontal transfer, as has previously been suggested for E. histolytica genes encoding heat shock protein 60, nicotinamide nucleotide transhydrogenase, and superoxide dismutase. In this study, the E. histolytica por gene and the adhE gene of a second amitochondriate protozoan parasite, Giardia lamblia, were sequenced, and their phylogenetic positions were estimated in relation to POR, ADHE, and FD cloned from eukaryotic and eubacterial organisms. The E. histolytica por gene encodes a 1,620-amino-acid peptide that contained conserved iron-sulfur- and thiamine pyrophosphate-binding sites. The predicted E. histolytica POR showed fewer positional identities to the POR of G. lamblia (34%) than to the POR of the enterobacterium Klebsiella pneumoniae (49%), the cyanobacterium Anabaena sp. (44%), and the protozoan Trichomonas vaginalis (46%), which targets its POR to anaerobic organelles called hydrogenosomes. Maximum-likelihood, neighbor-joining, and parsimony analyses also suggested as less likely E. histolytica POR sharing more recent common ancestry with G. lamblia POR than with POR of bacteria and the T. vaginalis hydrogenosome. The G. lamblia adhE encodes an 888-amino-acid fusion peptide with an aldehyde dehydrogenase at its amino half and an iron-dependent (class 3) ADH at its carboxy half. The predicted G. lamblia ADHE showed extensive positional identities to ADHE of Escherichia coli (49%), Clostridium acetobutylicum (44%), and E. histolytica (43%) and lesser identities to the class 3 ADH of eubacteria and yeast (19 to 36%). Phylogenetic analyses inferred a closer relationship of the E

  13. Cephem Potentiation by Inactivation of Nonessential Genes Involved in Cell Wall Biogenesis of beta-Lactamase-Producing Escherichia coli

    DEFF Research Database (Denmark)

    Baker, Kristin R.; Sigurdardottir, Helga Høeg; Jana, Bimal

    2017-01-01

    Reversal of antimicrobial resistance is an appealing and largely unexplored strategy in drug discovery. The objective of this study was to identify potential targets for “helper” drugs reversing cephem resistance in Escherichia coli strains producing β-lactamases. A CMY-2-encoding plasmid...... was transferred by conjugation to seven isogenic deletion mutants exhibiting cephem hypersusceptibility. The effect of each mutation was evaluated by comparing the MICs in the wild type and the mutant harboring the same plasmid. Mutation of two genes encoding proteins involved in cell wall biosynthesis, dap...... for all three drugs. Individual deletion of dapF and mrcB in a clinical isolate of CTX-M-15-producing E. coli sequence type 131 (ST131) resulted in partial reversal of ceftazidime and cefepime resistance but did not reduce MICs below susceptibility breakpoints. Growth curve analysis indicated no fitness...

  14. Transposable elements generate population-specific insertional patterns and allelic variation in genes of wild emmer wheat (Triticum turgidum ssp. dicoccoides).

    Science.gov (United States)

    Domb, Katherine; Keidar, Danielle; Yaakov, Beery; Khasdan, Vadim; Kashkush, Khalil

    2017-10-27

    Natural populations of the tetraploid wild emmer wheat (genome AABB) were previously shown to demonstrate eco-geographically structured genetic and epigenetic diversity. Transposable elements (TEs) might make up a significant part of the genetic and epigenetic variation between individuals and populations because they comprise over 80% of the wild emmer wheat genome. In this study, we performed detailed analyses to assess the dynamics of transposable elements in 50 accessions of wild emmer wheat collected from 5 geographically isolated sites. The analyses included: the copy number variation of TEs among accessions in the five populations, population-unique insertional patterns, and the impact of population-unique/specific TE insertions on structure and expression of genes. We assessed the copy numbers of 12 TE families using real-time quantitative PCR, and found significant copy number variation (CNV) in the 50 wild emmer wheat accessions, in a population-specific manner. In some cases, the CNV difference reached up to 6-fold. However, the CNV was TE-specific, namely some TE families showed higher copy numbers in one or more populations, and other TE families showed lower copy numbers in the same population(s). Furthermore, we assessed the insertional patterns of 6 TE families using transposon display (TD), and observed significant population-specific insertional patterns. The polymorphism levels of TE-insertional patterns reached 92% among all wild emmer wheat accessions, in some cases. In addition, we observed population-specific/unique TE insertions, some of which were located within or close to protein-coding genes, creating allelic variations in a population-specific manner. We also showed that those genes are differentially expressed in wild emmer wheat. For the first time, this study shows that TEs proliferate in wild emmer wheat in a population-specific manner, creating new alleles of genes, which contribute to the divergent evolution of homeologous genes

  15. Pharmacologic Treatment Assigned for Niemann Pick Type C1 Disease Partly Changes Behavioral Traits in Wild-Type Mice.

    Science.gov (United States)

    Schlegel, Victoria; Thieme, Markus; Holzmann, Carsten; Witt, Martin; Grittner, Ulrike; Rolfs, Arndt; Wree, Andreas

    2016-11-09

    Niemann-Pick Type C1 (NPC1) is an autosomal recessive inherited disorder characterized by accumulation of cholesterol and glycosphingolipids. Previously, we demonstrated that BALB/c-npc1 nih Npc1 -/- mice treated with miglustat, cyclodextrin and allopregnanolone generally performed better than untreated Npc1 -/- animals. Unexpectedly, they also seemed to accomplish motor tests better than their sham-treated wild-type littermates. However, combination-treated mutant mice displayed worse cognition performance compared to sham-treated ones. To evaluate effects of these drugs in healthy BALB/c mice, we here analyzed pharmacologic effects on motor and cognitive behavior of wild-type mice. For combination treatment mice were injected with allopregnanolone/cyclodextrin weekly, starting at P7. Miglustat injections were performed daily from P10 till P23. Starting at P23, miglustat was embedded in the chow. Other mice were treated with miglustat only, or sham-treated. The battery of behavioral tests consisted of accelerod, Morris water maze, elevated plus maze, open field and hot-plate tests. Motor capabilities and spontaneous motor behavior were unaltered in both drug-treated groups. Miglustat-treated wild-type mice displayed impaired spatial learning compared to sham- and combination-treated mice. Both combination- and miglustat-treated mice showed enhanced anxiety in the elevated plus maze compared to sham-treated mice. Additionally, combination treatment as well as miglustat alone significantly reduced brain weight, whereas only combination treatment reduced body weight significantly. Our results suggest that allopregnanolone/cyclodextrin ameliorate most side effects of miglustat in wild-type mice.

  16. Pharmacologic Treatment Assigned for Niemann Pick Type C1 Disease Partly Changes Behavioral Traits in Wild-Type Mice

    Directory of Open Access Journals (Sweden)

    Victoria Schlegel

    2016-11-01

    Full Text Available Niemann-Pick Type C1 (NPC1 is an autosomal recessive inherited disorder characterized by accumulation of cholesterol and glycosphingolipids. Previously, we demonstrated that BALB/c-npc1nihNpc1−/− mice treated with miglustat, cyclodextrin and allopregnanolone generally performed better than untreated Npc1−/− animals. Unexpectedly, they also seemed to accomplish motor tests better than their sham-treated wild-type littermates. However, combination-treated mutant mice displayed worse cognition performance compared to sham-treated ones. To evaluate effects of these drugs in healthy BALB/c mice, we here analyzed pharmacologic effects on motor and cognitive behavior of wild-type mice. For combination treatment mice were injected with allopregnanolone/cyclodextrin weekly, starting at P7. Miglustat injections were performed daily from P10 till P23. Starting at P23, miglustat was embedded in the chow. Other mice were treated with miglustat only, or sham-treated. The battery of behavioral tests consisted of accelerod, Morris water maze, elevated plus maze, open field and hot-plate tests. Motor capabilities and spontaneous motor behavior were unaltered in both drug-treated groups. Miglustat-treated wild-type mice displayed impaired spatial learning compared to sham- and combination-treated mice. Both combination- and miglustat-treated mice showed enhanced anxiety in the elevated plus maze compared to sham-treated mice. Additionally, combination treatment as well as miglustat alone significantly reduced brain weight, whereas only combination treatment reduced body weight significantly. Our results suggest that allopregnanolone/cyclodextrin ameliorate most side effects of miglustat in wild-type mice.

  17. Characterization of a pathogen induced thaumatin-like protein gene AdTLP from Arachis diogoi, a wild peanut.

    Directory of Open Access Journals (Sweden)

    Naveen Kumar Singh

    Full Text Available Peanut (Arachis hypogaea L is one of the widely cultivated and leading oilseed crops of the world and its yields are greatly affected by various biotic and abiotic stresses. Arachis diogoi, a wild relative of peanut, is an important source of genes for resistance against various stresses that affect peanut. In our previous study a thaumatin-like protein gene was found to be upregulated in a differential expression reverse transcription PCR (DDRT-PCR study using the conidial spray of the late leaf spot pathogen, Phaeoisariopsis personata. In the present study, the corresponding full length cDNA was cloned using RACE-PCR and has been designated as AdTLP. It carried an open reading frame of 726 bp potentially capable of encoding a polypeptide of 241 amino acids with 16 conserved cysteine residues. The semi-quantitative RT-PCR analysis showed that the transcript level of AdTLP increased upon treatment with the late leaf spot pathogen of peanut, P. personata and various hormone treatments indicating its involvement in both, biotic and abiotic stresses. The antifungal activity of the purified recombinant protein was checked against different fungal pathogens, which showed enhanced anti-fungal activity compared to many other reported TLP proteins. The recombinant AdTLP-GFP fusion protein was found to be predominantly localized to extracellular spaces. Transgenic tobacco plants ectopically expressing AdTLP showed enhanced resistance to fungal pathogen, Rhizoctonia solani. The seedling assays showed enhanced tolerance of AdTLP transgenic plants against salt and oxidative stress. The transcript analysis of various defense related genes highlighted constitutively higher level expression of PR1a, PI-I and PI-II genes in transgenic plants. These results suggest that the AdTLP is a good candidate gene for enhancing stress resistance in crop plants.

  18. Cloning and characterization of an epoxide hydrolase-encoding gene from Rhodotorula glutinis

    NARCIS (Netherlands)

    Visser, H.; Vreugdenhil, S.; Bont, de J.A.M.; Verdoes, J.C.

    2000-01-01

    We cloned and characterized the epoxide hydrolase gene, EPH1, from Rhodotorula glutinis. The EPH1 open reading frame of 1230 bp was interrupted by nine introns and encoded a polypeptide of 409 amino acids with a calculated molecular mass of 46.3 kDa. The amino acid sequence was similar to that of

  19. Phasevarion mediated epigenetic gene regulation in Helicobacter pylori.

    Directory of Open Access Journals (Sweden)

    Yogitha N Srikhanta

    Full Text Available Many host-adapted bacterial pathogens contain DNA methyltransferases (mod genes that are subject to phase-variable expression (high-frequency reversible ON/OFF switching of gene expression. In Haemophilus influenzae and pathogenic Neisseria, the random switching of the modA gene, associated with a phase-variable type III restriction modification (R-M system, controls expression of a phase-variable regulon of genes (a "phasevarion", via differential methylation of the genome in the modA ON and OFF states. Phase-variable type III R-M systems are also found in Helicobacter pylori, suggesting that phasevarions may also exist in this key human pathogen. Phylogenetic studies on the phase-variable type III modH gene revealed that there are 17 distinct alleles in H. pylori, which differ only in their DNA recognition domain. One of the most commonly found alleles was modH5 (16% of isolates. Microarray analysis comparing the wild-type P12modH5 ON strain to a P12ΔmodH5 mutant revealed that six genes were either up- or down-regulated, and some were virulence-associated. These included flaA, which encodes a flagella protein important in motility and hopG, an outer membrane protein essential for colonization and associated with gastric cancer. This study provides the first evidence of this epigenetic mechanism of gene expression in H. pylori. Characterisation of H. pylori modH phasevarions to define stable immunological targets will be essential for vaccine development and may also contribute to understanding H. pylori pathogenesis.

  20. Ataxin1L is a regulator of HSC function highlighting the utility of cross-tissue comparisons for gene discovery.

    Directory of Open Access Journals (Sweden)

    Juliette J Kahle

    2013-03-01

    Full Text Available Hematopoietic stem cells (HSCs are rare quiescent cells that continuously replenish the cellular components of the peripheral blood. Observing that the ataxia-associated gene Ataxin-1-like (Atxn1L was highly expressed in HSCs, we examined its role in HSC function through in vitro and in vivo assays. Mice lacking Atxn1L had greater numbers of HSCs that regenerated the blood more quickly than their wild-type counterparts. Molecular analyses indicated Atxn1L null HSCs had gene expression changes that regulate a program consistent with their higher level of proliferation, suggesting that Atxn1L is a novel regulator of HSC quiescence. To determine if additional brain-associated genes were candidates for hematologic regulation, we examined genes encoding proteins from autism- and ataxia-associated protein-protein interaction networks for their representation in hematopoietic cell populations. The interactomes were found to be highly enriched for proteins encoded by genes specifically expressed in HSCs relative to their differentiated progeny. Our data suggest a heretofore unappreciated similarity between regulatory modules in the brain and HSCs, offering a new strategy for novel gene discovery in both systems.

  1. Molecular cloning and chromosome mapping of the human gene encoding protein phosphotyrosyl phosphatase 1B

    International Nuclear Information System (INIS)

    Brown-Shimer, S.; Johnson, K.A.; Bruskin, A.; Green, N.R.; Hill, D.E.; Lawrence, J.B.; Johnson, C.

    1990-01-01

    The inactivation of growth suppressor genes appears to play a major role in the malignant process. To assess whether protein phosphotyrosyl phosphatases function as growth suppressors, the authors have isolated a cDNA clone encoding human protein phosphotyrosyl phosphatase 1B for structural and functional characterization. The translation product deduced from the 1,305-nucleotide open reading frame predicts a protein containing 435 amino acids and having a molecular mass of 49,966 Da. The amino-terminal 321 amino acids deduced from the cDNA sequence are identical to the empirically determined sequence of protein phosphotyrosyl phosphatase 1B. A genomic clone has been isolated and used in an in situ hybridization to banded metaphase chromosomes to determine that the gene encoding protein phosphotyrosyl phosphatase 1B maps as a single-copy gene to the long arm of chromosome 20 in the region q13.1-q13.2

  2. [Functional activity of the modA, gene in Methylobacterium dichloromethanicum DM4].

    Science.gov (United States)

    Firsova, Y E; Trotsenko, Y A

    2014-01-01

    The putative METDI2644 (modA2) gene of Methylobacterium dichloromethanicum DM4, present in the 126-kbp chromosomal fragment associated with dichloromethane (DCM) degradation was investigated. While this gene is presumed to encode the periplasmic substrate-binding subunit of the molybdate ABC transporter, its conceptual translation also exhibits similarity to the proteins containing the ostA conservative domain and responsible for resistance of gram-negative bacteria to organic solvents. Reverse transcription polymerase chain reaction (RT-PCR) revealed the RNA transcripts of this gene in the cells grown on either DCM or methanol. The mobilizable suicide vector pK18mob was used to obtain a knockout mutant with the METDI2644 gene inactivated by insertion of the gentamycin cassette. The mutant pregrown on methanol exhibited lower growth rate on DCM than the wild-type strain DM4. The difference was not alleviated by addition of sodium molybdate. Our results suggest that the METDI2644 gene product plays a role in cell adaptation to DCM degradation.

  3. Topological and organizational properties of the products of house-keeping and tissue-specific genes in protein-protein interaction networks.

    Science.gov (United States)

    Lin, Wen-Hsien; Liu, Wei-Chung; Hwang, Ming-Jing

    2009-03-11

    Human cells of various tissue types differ greatly in morphology despite having the same set of genetic information. Some genes are expressed in all cell types to perform house-keeping functions, while some are selectively expressed to perform tissue-specific functions. In this study, we wished to elucidate how proteins encoded by human house-keeping genes and tissue-specific genes are organized in human protein-protein interaction networks. We constructed protein-protein interaction networks for different tissue types using two gene expression datasets and one protein-protein interaction database. We then calculated three network indices of topological importance, the degree, closeness, and betweenness centralities, to measure the network position of proteins encoded by house-keeping and tissue-specific genes, and quantified their local connectivity structure. Compared to a random selection of proteins, house-keeping gene-encoded proteins tended to have a greater number of directly interacting neighbors and occupy network positions in several shortest paths of interaction between protein pairs, whereas tissue-specific gene-encoded proteins did not. In addition, house-keeping gene-encoded proteins tended to connect with other house-keeping gene-encoded proteins in all tissue types, whereas tissue-specific gene-encoded proteins also tended to connect with other tissue-specific gene-encoded proteins, but only in approximately half of the tissue types examined. Our analysis showed that house-keeping gene-encoded proteins tend to occupy important network positions, while those encoded by tissue-specific genes do not. The biological implications of our findings were discussed and we proposed a hypothesis regarding how cells organize their protein tools in protein-protein interaction networks. Our results led us to speculate that house-keeping gene-encoded proteins might form a core in human protein-protein interaction networks, while clusters of tissue-specific gene-encoded

  4. Identification of novel miRNAs and miRNA dependent developmental shifts of gene expression in Arabidopsis thaliana.

    Directory of Open Access Journals (Sweden)

    Shuhua Zhan

    Full Text Available microRNAs (miRNAs are small, endogenous RNAs of 20 approximately 25 nucleotides, processed from stem-loop regions of longer RNA precursors. Plant miRNAs act as negative regulators of target mRNAs predominately by slicing target transcripts, and a number of miRNAs play important roles in development. We analyzed a number of published datasets from Arabidopsis thaliana to characterize novel miRNAs, novel miRNA targets, and miRNA-regulated developmental changes in gene expression. These data include microarray profiling data and small RNA (sRNA deep sequencing data derived from miRNA biogenesis/transport mutants, microarray profiling data of mRNAs in a developmental series, and computational predictions of conserved genomic stem-loop structures. Our conservative analyses identified five novel mature miRNAs and seven miRNA targets, including one novel target gene. Two complementary miRNAs that target distinct mRNAs were encoded by one gene. We found that genes targeted by known miRNAs, and genes up-regulated or down-regulated in miRNA mutant inflorescences, are highly expressed in the wild type inflorescence. In addition, transcripts upregulated within the mutant inflorescences were abundant in wild type leaves and shoot meristems and low in pollen and seed. Downregulated transcripts were abundant in wild type pollen and seed and low in shoot meristems, roots and leaves. Thus, disrupting miRNA function causes the inflorescence transcriptome to resemble the leaf and meristem and to differ from pollen and seed. Applications of our computational approach to other species and the use of more liberal criteria than reported here will further expand the number of identified miRNAs and miRNA targets. Our findings suggest that miRNAs have a global role in promoting vegetative to reproductive transitions in A. thaliana.

  5. A Novel Complementation Assay for Quick and Specific Screen of Genes Encoding Glycerol-3-Phosphate Acyltransferases

    Directory of Open Access Journals (Sweden)

    Jie Lei

    2018-03-01

    Full Text Available The initial step in glycerolipid biosynthesis, especially in diverse allopolyploid crop species, is poorly understood, mainly due to the lack of an effective and convenient method for functional characterization of genes encoding glycerol-3-phosphate acyltransferases (GPATs catalyzing this reaction. Here we present a novel complementation assay for quick and specific characterization of GPAT-encoding genes. Its key design involves rational construction of yeast conditional lethal gat1Δgat2Δ double mutant bearing the heterologous Arabidopsis AtGPAT1 gene whose leaky expression under repressed conditions does not support any non-specific growth, thereby circumventing the false positive problem encountered with the system based on the gat1Δgat2Δ mutant harboring the native episomal GAT1 gene whose leaky expression appears to be sufficient for generating enough GPAT activities for the non-specific restoration of the mutant growth. A complementation assay developed based on this novel mutant enables quick phenotypic screen of GPAT sequences. A high degree of specificity of our assay was exemplified by its ability to differentiate effectively GPAT-encoding genes from those of other fatty acyltransferases and lipid-related sequences. Using this assay, we show that Arabidopsis AtGPAT1, AtGPAT5, and AtGPAT7 can complement the phosphatidate biosynthetic defect in the double mutants. Collectively, our assay provides a powerful tool for rapid screening, validation and optimization of GPAT sequences, aiding future engineering of the initial step of the triacylglycerol biosynthesis in oilseeds.

  6. A single nucleotide polymorphism within the acetyl-coenzyme A carboxylase beta gene is associated with proteinuria in patients with type 2 diabetes

    DEFF Research Database (Denmark)

    Maeda, Shiro; Kobayashi, Masa-aki; Araki, Shin-ichi

    2010-01-01

    It has been suggested that genetic susceptibility plays an important role in the pathogenesis of diabetic nephropathy. A large-scale genotyping analysis of gene-based single nucleotide polymorphisms (SNPs) in Japanese patients with type 2 diabetes identified the gene encoding acetyl-coenzyme A ca...

  7. A Run-Length Encoding Approach for Path Analysis of C. elegans Search Behavior

    Directory of Open Access Journals (Sweden)

    Li Huang

    2016-01-01

    Full Text Available The nematode Caenorhabditis elegans explores the environment using a combination of different movement patterns, which include straight movement, reversal, and turns. We propose to quantify C. elegans movement behavior using a computer vision approach based on run-length encoding of step-length data. In this approach, the path of C. elegans is encoded as a string of characters, where each character represents a path segment of a specific type of movement. With these encoded string data, we perform k-means cluster analysis to distinguish movement behaviors resulting from different genotypes and food availability. We found that shallow and sharp turns are the most critical factors in distinguishing the differences among the movement behaviors. To validate our approach, we examined the movement behavior of tph-1 mutants that lack an enzyme responsible for serotonin biosynthesis. A k-means cluster analysis with the path string-encoded data showed that tph-1 movement behavior on food is similar to that of wild-type animals off food. We suggest that this run-length encoding approach is applicable to trajectory data in animal or human mobility data.

  8. Isolation and characterization of the gene encoding the starch debranching enzyme limit dextrinase from germinating barley

    DEFF Research Database (Denmark)

    Kristensen, Michael; Lok, Finn; Planchot, Véronique

    1999-01-01

    with a value of 105 kDa estimated by SDS;;PAGE, The coding sequence is interrupted by 26 introns varying in length from 93 bp to 825 bp. The 27 exons vary in length from 53 bp to 197 bp. Southern blot analysis shows that the limit dextrinase gene is present as a single copy in the barley genome. Gene......The gene encoding the starch debranching enzyme limit dextrinase, LD, from barley (Hordeum vulgare), was isolated from a genomic phage library using a barley cDNA clone as probe. The gene encodes a protein of 904 amino acid residues with a calculated molecular mass of 98.6 kDa. This is in agreement...... expression is high during germination and the steady state transcription level reaches a maximum at day 5 of germination. The deduced amino acid sequence corresponds to the protein sequence of limit dextrinase purified from germinating malt, as determined by automated N-terminal sequencing of tryptic...

  9. The impact of H63D HFE gene carriage on hemoglobin and iron status in children.

    Science.gov (United States)

    Barbara, Kaczorowska-Hac; Marcin, Luszczyk; Jedrzej, Antosiewicz; Wieslaw, Ziolkowski; Elzbieta, Adamkiewicz-Drozynska; Malgorzata, Mysliwiec; Ewa, Milosz; Jacek, Kaczor Jan

    2016-12-01

    The molecular mechanism that regulates iron homeostasis is based on a network of signals, which reflect on the iron requirements of the body. Hereditary hemochromatosis is a heterogenic metabolic syndrome which is due to unchecked transfer of iron into the bloodstream and its toxic effects on parenchymatous organs. It is caused by the mutation of genes that encode proteins that help hepcidin to monitor serum iron. These proteins include the human hemochromatosis protein -HFE, transferrin-receptor 2, hemojuvelin in rare instances, and ferroportin. HFE-related hemochromatosis is the most frequent form of the disease. Interestingly, the low penetrance of polymorphic HFE genes results in rare clinical presentation of the disease, predominantly in middle-aged males. Taking into account the wide dispersion of HFE mutation in our population and also its unknown role in heterozygotes, we analyzed the impact of H63D HFE carriage in the developmental age, with respect to gender, on the iron status and hemoglobin concentration of carriers in comparison to those of wild-type HFE gene (12.7 ± 3.07 years, 42 boys and 41 girls). H63D carriers presented higher blood iron, transferrin saturation, and ferritin concentration than wild-type probands (p HFE heterozygotes.

  10. Over-expression of a novel JAZ family gene from Glycine soja, increases salt and alkali stress tolerance

    International Nuclear Information System (INIS)

    Zhu, Dan; Cai, Hua; Luo, Xiao; Bai, Xi; Deyholos, Michael K.; Chen, Qin; Chen, Chao; Ji, Wei; Zhu, Yanming

    2012-01-01

    Highlights: ► We isolated and characterized a novel JAZ family gene, GsJAZ2, from Glycine soja. ► Overexpression of GsJAZ2 enhanced plant tolerance to salt and alkali stress. ► The transcriptions of stress marker genes were higher in GsJAZ2 overexpression lines. ► GsJAZ2 was localized to nucleus. -- Abstract: Salt and alkali stress are two of the main environmental factors limiting crop production. Recent discoveries show that the JAZ family encodes plant-specific genes involved in jasmonate signaling. However, there is only limited information about this gene family in abiotic stress response, and in wild soybean (Glycine soja), which is a species noted for its tolerance to alkali and salinity. Here, we isolated and characterized a novel JAZ family gene, GsJAZ2, from G. soja. Transcript abundance of GsJAZ2 increased following exposure to salt, alkali, cold and drought. Over-expression of GsJAZ2 in Arabidopsis resulted in enhanced plant tolerance to salt and alkali stress. The expression levels of some alkali stress response and stress-inducible marker genes were significantly higher in the GsJAZ2 overexpression lines as compared to wild-type plants. Subcellular localization studies using a GFP fusion protein showed that GsJAZ2 was localized to the nucleus. These results suggest that the newly isolated wild soybean GsJAZ2 is a positive regulator of plant salt and alkali stress tolerance.

  11. The pat1 protein kinase controls transcription of the mating-type genes in fission yeast

    DEFF Research Database (Denmark)

    Nielsen, O; Egel, R; Nielsen, Olaf

    1990-01-01

    . This differentiation process is characterized by a transcriptional induction of the mating-type genes. Conjugation can also be induced in pat1-ts mutants by a shift to a semi-permissive temperature. The pat1 gene encodes a protein kinase, which also functions further downstream in the developmental pathway controlling...... of the mating-type genes in the zygote leads to complete loss of pat1 protein kinase activity causing entry into meiosis. Thus, pat1 can promote its own inactivation. We suggest a model according to which a stepwise inactivation of pat1 leads to sequential derepression of the processes of conjugation......The developmental programme of fission yeast brings about a transition from mitotic cell division to the dormant state of ascospores. In response to nitrogen starvation, two cells of opposite mating type conjugate to form a diploid zygote, which then undergoes meiosis and sporulation...

  12. Draft genome sequence of Cicer reticulatum L., the wild progenitor of chickpea provides a resource for agronomic trait improvement.

    Science.gov (United States)

    Gupta, Sonal; Nawaz, Kashif; Parween, Sabiha; Roy, Riti; Sahu, Kamlesh; Kumar Pole, Anil; Khandal, Hitaishi; Srivastava, Rishi; Kumar Parida, Swarup; Chattopadhyay, Debasis

    2017-02-01

    Cicer reticulatum L. is the wild progenitor of the fourth most important legume crop chickpea (C. arietinum L.). We assembled short-read sequences into 416 Mb draft genome of C. reticulatum and anchored 78% (327 Mb) of this assembly to eight linkage groups. Genome annotation predicted 25,680 protein-coding genes covering more than 90% of predicted gene space. The genome assembly shared a substantial synteny and conservation of gene orders with the genome of the model legume Medicago truncatula. Resistance gene homologs of wild and domesticated chickpeas showed high sequence homology and conserved synteny. Comparison of gene sequences and nucleotide diversity using 66 wild and domesticated chickpea accessions suggested that the desi type chickpea was genetically closer to the wild species than the kabuli type. Comparative analyses predicted gene flow between the wild and the cultivated species during domestication. Molecular diversity and population genetic structure determination using 15,096 genome-wide single nucleotide polymorphisms revealed an admixed domestication pattern among cultivated (desi and kabuli) and wild chickpea accessions belonging to three population groups reflecting significant influence of parentage or geographical origin for their cultivar-specific population classification. The assembly and the polymorphic sequence resources presented here would facilitate the study of chickpea domestication and targeted use of wild Cicer germplasms for agronomic trait improvement in chickpea. © The Author 2016. Published by Oxford University Press on behalf of Kazusa DNA Research Institute.

  13. Estimating immunoregulatory gene networks in human herpesvirus type 6-infected T cells

    International Nuclear Information System (INIS)

    Takaku, Tomoiku; Ohyashiki, Junko H.; Zhang, Yu; Ohyashiki, Kazuma

    2005-01-01

    The immune response to viral infection involves complex network of dynamic gene and protein interactions. We present here the dynamic gene network of the host immune response during human herpesvirus type 6 (HHV-6) infection in an adult T-cell leukemia cell line. Using a pathway-focused oligonucleotide DNA microarray, we found a possible association between chemokine genes regulating Th1/Th2 balance and genes regulating T-cell proliferation during HHV-6B infection. Gene network analysis using an integrated comprehensive workbench, VoyaGene, revealed that a gene encoding a TEC-family kinase, ITK, might be a putative modulator in the host immune response against HHV-6B infection. We conclude that Th2-dominated inflammatory reaction in host cells may play an important role in HHV-6B-infected T cells, thereby suggesting the possibility that ITK might be a therapeutic target in diseases related to dysregulation of Th1/Th2 balance. This study describes a novel approach to find genes related with the complex host-virus interaction using microarray data employing the Bayesian statistical framework

  14. Bacterial Competition Reveals Differential Regulation of the pks Genes by Bacillus subtilis

    Science.gov (United States)

    Vargas-Bautista, Carol; Rahlwes, Kathryn

    2014-01-01

    Bacillus subtilis is adaptable to many environments in part due to its ability to produce a broad range of bioactive compounds. One such compound, bacillaene, is a linear polyketide/nonribosomal peptide. The pks genes encode the enzymatic megacomplex that synthesizes bacillaene. The majority of pks genes appear to be organized as a giant operon (>74 kb from pksC-pksR). In previous work (P. D. Straight, M. A. Fischbach, C. T. Walsh, D. Z. Rudner, and R. Kolter, Proc. Natl. Acad. Sci. U. S. A. 104:305–310, 2007, doi:10.1073/pnas.0609073103), a deletion of the pks operon in B. subtilis was found to induce prodiginine production by Streptomyces coelicolor. Here, colonies of wild-type B. subtilis formed a spreading population that induced prodiginine production from Streptomyces lividans, suggesting differential regulation of pks genes and, as a result, bacillaene. While the parent colony showed widespread induction of pks expression among cells in the population, we found the spreading cells uniformly and transiently repressed the expression of the pks genes. To identify regulators that control pks genes, we first determined the pattern of pks gene expression in liquid culture. We next identified mutations in regulatory genes that disrupted the wild-type pattern of pks gene expression. We found that expression of the pks genes requires the master regulator of development, Spo0A, through its repression of AbrB and the stationary-phase regulator, CodY. Deletions of degU, comA, and scoC had moderate effects, disrupting the timing and level of pks gene expression. The observed patterns of expression suggest that complex regulation of bacillaene and other antibiotics optimizes competitive fitness for B. subtilis. PMID:24187085

  15. Organization of Genes Required for the Oxidation of Methanol to Formaldehyde in Three Type II Methylotrophs

    Science.gov (United States)

    Bastien, C.; Machlin, S.; Zhang, Y.; Donaldson, K.; Hanson, R. S.

    1989-01-01

    Restriction maps of genes required for the synthesis of active methanol dehydrogenase in Methylobacterium organophilum XX and Methylobacterium sp. strain AM1 have been completed and compared. In these two species of pink-pigmented, type II methylotrophs, 15 genes were identified that were required for the expression of methanol dehydrogenase activity. None of these genes were required for the synthesis of the prosthetic group of methanol dehydrogenase, pyrroloquinoline quinone. The structural gene required for the synthesis of cytochrome cL, an electron acceptor uniquely required for methanol dehydrogenase, and the genes encoding small basic peptides that copurified with methanol dehydrogenases were closely linked to the methanol dehydrogenase structural genes. A cloned 22-kilobase DNA insert from Methylsporovibrio methanica 81Z, an obligate type II methanotroph, complemented mutants that contained lesions in four genes closely linked to the methanol dehydrogenase structural genes. The methanol dehydrogenase and cytochrome cL structural genes were found to be transcribed independently in M. organophilum XX. Only two of the genes required for methanol dehydrogenase synthesis in this bacterium were found to be cotranscribed. PMID:16348074

  16. Mobile gene silencing in Arabidopsis is regulated by hydrogen peroxide

    Directory of Open Access Journals (Sweden)

    Dacheng Liang

    2014-12-01

    Full Text Available In plants and nematodes, RNAi can spread from cells from which it is initiated to other cells in the organism. The underlying mechanism controlling the mobility of RNAi signals is not known, especially in the case of plants. A genetic screen designed to recover plants impaired in the movement but not the production or effectiveness of the RNAi signal identified RCI3, which encodes a hydrogen peroxide (H2O2-producing type III peroxidase, as a key regulator of silencing mobility in Arabidopsis thaliana. Silencing initiated in the roots of rci3 plants failed to spread into leaf tissue or floral tissue. Application of exogenous H2O2 reinstated the spread in rci3 plants and accelerated it in wild-type plants. The addition of catalase or MnO2, which breaks down H2O2, slowed the spread of silencing in wild-type plants. We propose that endogenous H2O2, under the control of peroxidases, regulates the spread of gene silencing by altering plasmodesmata permeability through remodelling of local cell wall structure, and may play a role in regulating systemic viral defence.

  17. Cell-Type-Specific Transcriptome Analysis in the Drosophila Mushroom Body Reveals Memory-Related Changes in Gene Expression.

    Science.gov (United States)

    Crocker, Amanda; Guan, Xiao-Juan; Murphy, Coleen T; Murthy, Mala

    2016-05-17

    Learning and memory formation in Drosophila rely on a network of neurons in the mushroom bodies (MBs). Whereas numerous studies have delineated roles for individual cell types within this network in aspects of learning or memory, whether or not these cells can also be distinguished by the genes they express remains unresolved. In addition, the changes in gene expression that accompany long-term memory formation within the MBs have not yet been studied by neuron type. Here, we address both issues by performing RNA sequencing on single cell types (harvested via patch pipets) within the MB. We discover that the expression of genes that encode cell surface receptors is sufficient to identify cell types and that a subset of these genes, required for sensory transduction in peripheral sensory neurons, is not only expressed within individual neurons of the MB in the central brain, but is also critical for memory formation. Copyright © 2016 The Author(s). Published by Elsevier Inc. All rights reserved.

  18. TDP-43 or FUS-induced misfolded human wild-type SOD1 can propagate intercellularly in a prion-like fashion.

    Science.gov (United States)

    Pokrishevsky, Edward; Grad, Leslie I; Cashman, Neil R

    2016-03-01

    Amyotrophic lateral sclerosis (ALS), which appears to spread through the neuroaxis in a spatiotemporally restricted manner, is linked to heritable mutations in genes encoding SOD1, TDP-43, FUS, C9ORF72, or can occur sporadically without recognized genetic mutations. Misfolded human wild-type (HuWt) SOD1 has been detected in both familial and sporadic ALS patients, despite mutations in SOD1 accounting for only 2% of total cases. We previously showed that accumulation of pathological TDP-43 or FUS coexist with misfolded HuWtSOD1 in patient motor neurons, and can trigger its misfolding in cultured cells. Here, we used immunocytochemistry and immunoprecipitation to demonstrate that TDP-43 or FUS-induced misfolded HuWtSOD1 can propagate from cell-to-cell via conditioned media, and seed cytotoxic misfolding of endogenous HuWtSOD1 in the recipient cells in a prion-like fashion. Knockdown of SOD1 using siRNA in recipient cells, or incubation of conditioned media with misfolded SOD1-specific antibodies, inhibits intercellular transmission, indicating that HuWtSOD1 is an obligate seed and substrate of propagated misfolding. In this system, intercellular spread of SOD1 misfolding is not accompanied by transmission of TDP-43 or FUS pathology. Our findings argue that pathological TDP-43 and FUS may exert motor neuron pathology in ALS through the initiation of propagated misfolding of SOD1.

  19. KONSTRUKSI MUTAN PROTEIN FOSFATASE ptc2D Saccharomyces cerevisiae DENGAN METODE PENGGANTIAN GEN TARGET DENGAN POLYMERASE CHAIN REACTION (PCR

    Directory of Open Access Journals (Sweden)

    Hermansyah

    2011-05-01

    Full Text Available Yeast Saccharomyces cerevisiae is an excellent model to studi genes function of eukarotic cells such as study of gene encoding protein phosphatase PTC2. Novel phenotypic caused by mutated gene is an important step to study function of gene. In this study constructed mutant of PTC2 gene encoding protein phosphatase. Method that used in this construction was replacement of target gene (PTC2 with auxotroph marker Candida albicans HIS3 by Polymer Chain Reaction (PCR or called by PCR-mediated disruption. Mutant colonies which grew in selective medium SC without histidine were confirmed by PCR amplification. By using 1% Agarose gel electrophoresis the result showed that size of ptc2D::CgHIS3 transformant was 3.52 kb while wild type strain was 2.9 kb, indicated that ptc2D::CgHIS3 has integrated on chromosome V replacing PTC2 wild type.

  20. Genetic relationships and epidemiological links between wild type 1 poliovirus isolates in Pakistan and Afghanistan.

    Science.gov (United States)

    Angez, Mehar; Shaukat, Shahzad; Alam, Muhammad M; Sharif, Salmaan; Khurshid, Adnan; Zaidi, Syed Sohail Zahoor

    2012-02-22

    Efforts have been made to eliminate wild poliovirus transmission since 1988 when the World Health Organization began its global eradication campaign. Since then, the incidence of polio has decreased significantly. However, serotype 1 and serotype 3 still circulate endemically in Pakistan and Afghanistan. Both countries constitute a single epidemiologic block representing one of the three remaining major global reservoirs of poliovirus transmission. In this study we used genetic sequence data to investigate transmission links among viruses from diverse locations during 2005-2007. In order to find the origins and routes of wild type 1 poliovirus circulation, polioviruses were isolated from faecal samples of Acute Flaccid Paralysis (AFP) patients. We used viral cultures, two intratypic differentiation methods PCR, ELISA to characterize as vaccine or wild type 1 and nucleic acid sequencing of entire VP1 region of poliovirus genome to determine the genetic relatedness. One hundred eleven wild type 1 poliovirus isolates were subjected to nucleotide sequencing for genetic variation study. Considering the 15% divergence of the sequences from Sabin 1, Phylogenetic analysis by MEGA software revealed that active inter and intra country transmission of many genetically distinct strains of wild poliovirus type 1 belonged to genotype SOAS which is indigenous in this region. By grouping wild type 1 polioviruses according to nucleotide sequence homology, three distinct clusters A, B and C were obtained with multiple chains of transmission together with some silent circulations represented by orphan lineages. Our results emphasize that there was a persistent transmission of wild type 1 polioviruses in Pakistan and Afghanistan during 2005-2007. The epidemiologic information provided by the sequence data can contribute to the formulation of better strategies for poliomyelitis control to those critical areas, associated with high risk population groups which include migrants

  1. Genetic relationships and epidemiological links between wild type 1 poliovirus isolates in Pakistan and Afghanistan

    Directory of Open Access Journals (Sweden)

    Angez Mehar

    2012-02-01

    Full Text Available Abstract Background/Aim Efforts have been made to eliminate wild poliovirus transmission since 1988 when the World Health Organization began its global eradication campaign. Since then, the incidence of polio has decreased significantly. However, serotype 1 and serotype 3 still circulate endemically in Pakistan and Afghanistan. Both countries constitute a single epidemiologic block representing one of the three remaining major global reservoirs of poliovirus transmission. In this study we used genetic sequence data to investigate transmission links among viruses from diverse locations during 2005-2007. Methods In order to find the origins and routes of wild type 1 poliovirus circulation, polioviruses were isolated from faecal samples of Acute Flaccid Paralysis (AFP patients. We used viral cultures, two intratypic differentiation methods PCR, ELISA to characterize as vaccine or wild type 1 and nucleic acid sequencing of entire VP1 region of poliovirus genome to determine the genetic relatedness. Results One hundred eleven wild type 1 poliovirus isolates were subjected to nucleotide sequencing for genetic variation study. Considering the 15% divergence of the sequences from Sabin 1, Phylogenetic analysis by MEGA software revealed that active inter and intra country transmission of many genetically distinct strains of wild poliovirus type 1 belonged to genotype SOAS which is indigenous in this region. By grouping wild type 1 polioviruses according to nucleotide sequence homology, three distinct clusters A, B and C were obtained with multiple chains of transmission together with some silent circulations represented by orphan lineages. Conclusion Our results emphasize that there was a persistent transmission of wild type1 polioviruses in Pakistan and Afghanistan during 2005-2007. The epidemiologic information provided by the sequence data can contribute to the formulation of better strategies for poliomyelitis control to those critical areas

  2. Piper betle induces phase I & II genes through Nrf2/ARE signaling pathway in mouse embryonic fibroblasts derived from wild type and Nrf2 knockout cells.

    Science.gov (United States)

    Wan Hasan, Wan Nuraini; Kwak, Mi-Kyoung; Makpol, Suzana; Wan Ngah, Wan Zurinah; Mohd Yusof, Yasmin Anum

    2014-02-23

    Nuclear factor-erythroid 2 p45 related factor 2 (Nrf2) is a primary transcription factor, protecting cells from oxidative stress by regulating a number of antioxidants and phase II detoxifying enzymes. Dietary components such as sulforaphane in broccoli and quercetin in onions have been shown to be inducers of Nrf2. Piper betle (PB) grows well in tropical climate and the leaves are used in a number of traditional remedies for the treatment of stomach ailments and infections among Asians. The aim of this study was to elucidate the effect of Piper betle (PB) leaves extract in Nrf2 signaling pathway by using 2 types of cells; mouse embryonic fibroblasts (MEFs) derived from wild-type (WT) and Nrf2 knockout (N0) mice. WT and N0 cells were treated with 5 and 10 μg/ml of PB for 10 and 12-h for the determination of nuclear translocation of Nrf2 protein. Luciferase reporter gene activity was performed to evaluate the antioxidant response element (ARE)-induction by PB. Real-time PCR and Western blot were conducted on both WT and N0 cells after PB treatment for the determination of antioxidant enzymes [superoxide dismutase (SOD1) and heme-oxygenase (HO-1)], phase I oxidoreductase enzymes [ quinone oxidoreductase (NQO1)] and phase II detoxifying enzyme [glutathione S-transferase (GST)]. Nuclear translocation of Nrf2 by PB in WT cells was better after 10 h incubation compared to 12 h. Real time PCR and Western blot analysis showed increased expressions of Nrf2, NQO1 and GSTA1 genes with corresponding increases in glutathione, NQO1 and HO-1 proteins in WT cells. Reporter gene ARE was stimulated by PB as shown by ARE/luciferase assay. Interestingly, PB induced SOD1 gene and protein expressions in N0 cells but not in WT cells. The results of this study confirmed that PB activated Nrf2-ARE signaling pathway which subsequently induced some phase I oxidoreductase, phase II detoxifying and antioxidant genes expression via ARE reporter gene involved in the Nrf2 pathway with the

  3. Comparative differential gene expression analysis of nucleus-encoded proteins for Rafflesia cantleyi against Arabidopsis thaliana

    Science.gov (United States)

    Ng, Siuk-Mun; Lee, Xin-Wei; Wan, Kiew-Lian; Firdaus-Raih, Mohd

    2015-09-01

    Regulation of functional nucleus-encoded proteins targeting the plastidial functions was comparatively studied for a plant parasite, Rafflesia cantleyi versus a photosynthetic plant, Arabidopsis thaliana. This study involved two species of different feeding modes and different developmental stages. A total of 30 nucleus-encoded proteins were found to be differentially-regulated during two stages in the parasite; whereas 17 nucleus-encoded proteins were differentially-expressed during two developmental stages in Arabidopsis thaliana. One notable finding observed for the two plants was the identification of genes involved in the regulation of photosynthesis-related processes where these processes, as expected, seem to be present only in the autotroph.

  4. Herbicide resistance-endowing ACCase gene mutations in hexaploid wild oat (Avena fatua): insights into resistance evolution in a hexaploid species

    Science.gov (United States)

    Yu, Q; Ahmad-Hamdani, M S; Han, H; Christoffers, M J; Powles, S B

    2013-01-01

    Many herbicide-resistant weed species are polyploids, but far too little about the evolution of resistance mutations in polyploids is understood. Hexaploid wild oat (Avena fatua) is a global crop weed and many populations have evolved herbicide resistance. We studied plastidic acetyl-coenzyme A carboxylase (ACCase)-inhibiting herbicide resistance in hexaploid wild oat and revealed that resistant individuals can express one, two or three different plastidic ACCase gene resistance mutations (Ile-1781-Leu, Asp-2078-Gly and Cys-2088-Arg). Using ACCase resistance mutations as molecular markers, combined with genetic, molecular and biochemical approaches, we found in individual resistant wild-oat plants that (1) up to three unlinked ACCase gene loci assort independently following Mendelian laws for disomic inheritance, (2) all three of these homoeologous ACCase genes were transcribed, with each able to carry its own mutation and (3) in a hexaploid background, each individual ACCase resistance mutation confers relatively low-level herbicide resistance, in contrast to high-level resistance conferred by the same mutations in unrelated diploid weed species of the Poaceae (grass) family. Low resistance conferred by individual ACCase resistance mutations is likely due to a dilution effect by susceptible ACCase expressed by homoeologs in hexaploid wild oat and/or differential expression of homoeologous ACCase gene copies. Thus, polyploidy in hexaploid wild oat may slow resistance evolution. Evidence of coexisting non-target-site resistance mechanisms among wild-oat populations was also revealed. In all, these results demonstrate that herbicide resistance and its evolution can be more complex in hexaploid wild oat than in unrelated diploid grass weeds. Our data provide a starting point for the daunting task of understanding resistance evolution in polyploids. PMID:23047200

  5. Silencing of the major family of NBS-LRR-encoding genes in lettuce results in the loss of multiple resistance specificities.

    Science.gov (United States)

    Wroblewski, Tadeusz; Piskurewicz, Urszula; Tomczak, Anna; Ochoa, Oswaldo; Michelmore, Richard W

    2007-09-01

    The RGC2 gene cluster in lettuce (Lactuca sativa) is one of the largest known families of genes encoding nucleotide binding site-leucine-rich repeat (NBS-LRR) proteins. One of its members, RGC2B, encodes Dm3 which determines resistance to downy mildew caused by the oomycete Bremia lactucae carrying the cognate avirulence gene, Avr3. We developed an efficient strategy for analysis of this large family of low expressed genes using post-transcriptional gene silencing (PTGS). We transformed lettuce cv. Diana (carrying Dm3) using chimeric gene constructs designed to simultaneously silence RGC2B and the GUS reporter gene via the production of interfering hairpin RNA (ihpRNA). Transient assays of GUS expression in leaves accurately predicted silencing of both genes and were subsequently used to assay silencing in transgenic T(1) plants and their offspring. Levels of mRNA were reduced not only for RGC2B but also for all seven diverse RGC2 family members tested. We then used the same strategy to show that the resistance specificity encoded by the genetically defined Dm18 locus in lettuce cv. Mariska is the result of two resistance specificities, only one of which was silenced by ihpRNA derived from RGC2B. Analysis of progeny from crosses between transgenic, silenced tester stocks and lettuce accessions carrying other resistance genes previously mapped to the RGC2 locus indicated that two additional resistance specificities to B. lactucae, Dm14 and Dm16, as well as resistance to lettuce root aphid (Pemphigus bursarius L.), Ra, are encoded by RGC2 family members.

  6. Humoral and cell-mediated immune responses in DNA immunized mink challenged with wild-type canine distemper virus.

    Science.gov (United States)

    Nielsen, Line; Søgaard, Mette; Karlskov-Mortensen, Peter; Jensen, Trine Hammer; Jensen, Tove Dannemann; Aasted, Bent; Blixenkrone-Møller, Merete

    2009-07-30

    The aim of the study was to investigate the different phases of the immune response after DNA immunization with the hemagglutinin and nucleoprotein genes from canine distemper virus (CDV). Although attenuated live CDV vaccines have effectively reduced the incidence of disease, canine distemper is still a problem worldwide. The broad host range of CDV creates a constant viral reservoir among wildlife animals. Our results demonstrated early humoral and cell-mediated immune responses (IFN-gamma) in DNA vaccinated mink compared to mock-vaccinated mink after challenge with a Danish wild-type CDV. The DNA vaccine-induced immunity protected the natural host against disease development.

  7. The in vitro redundant enzymes PurN and PurT are both essential for systemic infection of mice in Salmonella enterica serovar Typhimurium

    DEFF Research Database (Denmark)

    Jelsbak, Lotte; Mortensen, Mie Ina Bjerregaard; Kilstrup, Mogens

    2016-01-01

    the third step in the purine synthesis. Surprisingly the results of the current study demonstrated that single gene deletions of each of the genes encoding these enzymes caused attenuation (competitive infection index fast as the wild type...

  8. Alteration of cell wall polysaccharides through transgenic expression of UDP-Glc 4-epimerase-encoding genes in potato tubers.

    Science.gov (United States)

    Huang, Jie-Hong; Kortstee, Anne; Dees, Dianka C T; Trindade, Luisa M; Schols, Henk A; Gruppen, Harry

    2016-08-01

    Uridine diphosphate (UDP)-glucose 4-epimerase (UGE) catalyzes the conversion of UDP-glucose to UDP-galactose. Cell wall materials from the cv. Kardal (wild-type, background) and two UGE transgenic lines (UGE 45-1 and UGE 51-16) were isolated and fractionated. The galactose (Gal) content (mg/100g tuber) from UGE 45-1 transgenic line was 38% higher than that of wild-type, and resulted in longer pectin side chains. The Gal content present in UGE 51-16 was 17% lower than that of wild-type, although most pectin populations maintained the same level of Gal. Both UGE transgenic lines showed unexpectedly a decrease in acetylation and an increase in methyl-esterification of pectin. Both UGE transgenic lines showed similar proportions of homogalacturonan and rhamnogalacturonan I within pectin backbone as the wild-type, except for the calcium-bound pectin fraction exhibiting relatively less rhamnogalacturonan I. Next to pectin modification, xyloglucan populations from both transgenic lines were altered resulting in different XSGG and XXGG proportion in comparison to wild-type. Copyright © 2016 Elsevier Ltd. All rights reserved.

  9. The pectin lyase-encoding gene (pnl) family from Glomerella cingulata: characterization of pnlA and its expression in yeast.

    Science.gov (United States)

    Templeton, M D; Sharrock, K R; Bowen, J K; Crowhurst, R N; Rikkerink, E H

    1994-05-03

    Oligodeoxyribonucleotide primers were designed from conserved amino acid (aa) sequences between pectin lyase D (PNLD) from Aspergillus niger and pectate lyases A and E (PELA/E) from Erwinia chrysanthemi. The polymerase chain reaction (PCR) was used with these primers to amplify genomic DNA from the plant pathogenic fungus Glomerella cingulata. Three different 220-bp fragments with homology to PNL-encoding genes from A. niger, and a 320-bp fragment with homology to PEL-encoding genes from Nicotiana tabacum and E. carotovora were cloned. One of the 220-bp PCR products (designated pnlA) was used as a probe to isolate a PNL-encoding gene from a lambda genomic DNA library prepared from G. cingulata. Nucleotide (nt) sequence data revealed that this gene has seven exons and codes for a putative 380-aa protein. The nt sequence of a cDNA clone, prepared using PCR, confirmed the presence of the six introns. The positions of the introns were different from the sites of the five introns present in the three PNL-encoding genes previously sequenced from A. niger. PNLA was synthesised in yeast by cloning the cDNA into the expression vector, pEMBLYex-4, and enzymatically active protein was secreted into the culture medium. Significantly higher expression was achieved when the context of the start codon, CACCATG, was mutated to CAAAATG, a consensus sequence commonly found in highly expressed yeast genes. The produced protein had an isoelectric point (pI) of 9.4, the same as that for the G. cingulata pnlA product.(ABSTRACT TRUNCATED AT 250 WORDS)

  10. Coamplification in tumors of KRAS2, type 2 inositol 1,4,5 triphosphate receptor gene, and a novel human gene, KRAG

    Energy Technology Data Exchange (ETDEWEB)

    Heighway, J.; Betticher, D.C.; Altermatt, H.J. [Univ. Hospital of Berne (Switzerland)] [and others

    1996-07-01

    Analysis of a region of DNA, coamplified in tumors with KRAS2, resulted in the identification of the human homologue of the mouse KRAG gene. The gene was widely expressed in range of cell lines, tumors, and normal tissue and demonstrated a high degree of alternate splicing. A human KRAG cDNA sequence, with a structure similar to that encoded by the amplified gene in mouse Y1 adrenal carcinoma cells, was isolated by RT-PCR. The predicted amino acid similarity between the two sequences was 91%, and hydrophobicity plots suggested a structure closely resembling that of transmembrane 4 superfamily members. Identification of a PCR-based restriction fragment length polymorphism allele-specific splicing differences in tumors. Northern analysis of mRNA derived from a range of tissues suggested high level expression in muscle and confirmed alternate splicing. To facilitate the analysis of exon junctions, a YAC clone encoding the genomic sequence was identified. This allowed the localization of KRAG to human chromosome 12p11.2. Isolation of one end of this nonchimeric clone demonstrated a perfect match with a 247-bp sequence within the 3{prime} untranslated region of the type 2 1,4,5-inositol triphosphate receptor gene. Multiplex PCR confirmed the inclusion of both genes. Multiplex PCR confirmed the inclusion of both genes in the KRAS2 amplicon in human malignancy, suggesting that either may contribute to the malignant phenotypes. 35 refs., 6 figs., 1 tab.

  11. Phenotypic silencing of cytoplasmic genes using sequence-specific double-stranded short interfering RNA and its application in the reverse genetics of wild type negative-strand RNA viruses

    Directory of Open Access Journals (Sweden)

    Barik Sailen

    2001-12-01

    Full Text Available Abstract Background Post-transcriptional gene silencing (PTGS by short interfering RNA has opened up new directions in the phenotypic mutation of cellular genes. However, its efficacy on non-nuclear genes and its effect on the interferon pathway remain unexplored. Since directed mutation of RNA genomes is not possible through conventional mutagenesis, we have tested sequence-specific 21-nucleotide long double-stranded RNAs (dsRNAs for their ability to silence cytoplasmic RNA genomes. Results Short dsRNAs were generated against specific mRNAs of respiratory syncytial virus, a nonsegmented negative-stranded RNA virus with a cytoplasmic life cycle. At nanomolar concentrations, the dsRNAs specifically abrogated expression of the corresponding viral proteins, and produced the expected mutant phenotype ex vivo. The dsRNAs did not induce an interferon response, and did not inhibit cellular gene expression. The ablation of the viral proteins correlated with the loss of the specific mRNAs. In contrast, viral genomic and antigenomic RNA, which are encapsidated, were not directly affected. Conclusions Synthetic inhibitory dsRNAs are effective in specific silencing of RNA genomes that are exclusively cytoplasmic and transcribed by RNA-dependent RNA polymerases. RNA-directed RNA gene silencing does not require cloning, expression, and mutagenesis of viral cDNA, and thus, will allow the generation of phenotypic null mutants of specific RNA viral genes under normal infection conditions and at any point in the infection cycle. This will, for the first time, permit functional genomic studies, attenuated infections, reverse genetic analysis, and studies of host-virus signaling pathways using a wild type RNA virus, unencumbered by any superinfecting virus.

  12. Practical Programming with Higher-Order Encodings and Dependent Types

    DEFF Research Database (Denmark)

    Poswolsky, Adam; Schürmann, Carsten

    2008-01-01

    , tedious, and error-prone. In this paper, we describe the underlying calculus of Delphin. Delphin is a fully implemented functional-programming language supporting reasoning over higher-order encodings and dependent types, while maintaining the benefits of HOAS. More specifically, just as representations...... for instantiation from those that will remain uninstantiated, utilizing a variation of Miller and Tiu’s ∇-quantifier [1]....

  13. Heterogeneous genetic diversity pattern in Plasmodium vivax genes encoding merozoite surface proteins (MSP) -7E, -7F and -7L.

    Science.gov (United States)

    Garzón-Ospina, Diego; Forero-Rodríguez, Johanna; Patarroyo, Manuel A

    2014-12-13

    The msp-7 gene has become differentially expanded in the Plasmodium genus; Plasmodium vivax has the highest copy number of this gene, several of which encode antigenic proteins in merozoites. DNA sequences from thirty-six Colombian clinical isolates from P. vivax (pv) msp-7E, -7F and -7L genes were analysed for characterizing and studying the genetic diversity of these pvmsp-7 members which are expressed during the intra-erythrocyte stage; natural selection signals producing the variation pattern so observed were evaluated. The pvmsp-7E gene was highly polymorphic compared to pvmsp-7F and pvmsp-7L which were seen to have limited genetic diversity; pvmsp-7E polymorphism was seen to have been maintained by different types of positive selection. Even though these copies seemed to be species-specific duplications, a search in the Plasmodium cynomolgi genome (P. vivax sister taxon) showed that both species shared the whole msp-7 repertoire. This led to exploring the long-term effect of natural selection by comparing the orthologous sequences which led to finding signatures for lineage-specific positive selection. The results confirmed that the P. vivax msp-7 family has a heterogeneous genetic diversity pattern; some members are highly conserved whilst others are highly diverse. The results suggested that the 3'-end of these genes encode MSP-7 proteins' functional region whilst the central region of pvmsp-7E has evolved rapidly. The lineage-specific positive selection signals found suggested that mutations occurring in msp-7s genes during host switch may have succeeded in adapting the ancestral P. vivax parasite population to humans.

  14. Identification and characterization of genes encoding polycyclic aromatic hydrocarbon dioxygenase and polycyclic aromatic hydrocarbon dihydrodiol dehydrogenase in Pseudomonas putida OUS82.

    OpenAIRE

    Takizawa, N; Kaida, N; Torigoe, S; Moritani, T; Sawada, T; Satoh, S; Kiyohara, H

    1994-01-01

    Naphthalene and phenanthrene are transformed by enzymes encoded by the pah gene cluster of Pseudomonas putida OUS82. The pahA and pahB genes, which encode the first and second enzymes, dioxygenase and cis-dihydrodiol dehydrogenase, respectively, were identified and sequenced. The DNA sequences showed that pahA and pahB were clustered and that pahA consisted of four cistrons, pahAa, pahAb, pahAc, and pahAd, which encode ferredoxin reductase, ferredoxin, and two subunits of the iron-sulfur prot...

  15. Rearing in seawater mesocosms improves the spawning performance of growth hormone transgenic and wild-type coho salmon.

    Directory of Open Access Journals (Sweden)

    Rosalind A Leggatt

    Full Text Available Growth hormone (GH transgenes can significantly accelerate growth rates in fish and cause associated alterations to their physiology and behaviour. Concern exists regarding potential environmental risks of GH transgenic fish, should they enter natural ecosystems. In particular, whether they can reproduce and generate viable offspring under natural conditions is poorly understood. In previous studies, GH transgenic salmon grown under contained culture conditions had lower spawning behaviour and reproductive success relative to wild-type fish reared in nature. However, wild-type salmon cultured in equal conditions also had limited reproductive success. As such, whether decreased reproductive success of GH transgenic salmon is due to the action of the transgene or to secondary effects of culture (or a combination has not been fully ascertained. Hence, salmon were reared in large (350,000 L, semi-natural, seawater tanks (termed mesocosms designed to minimize effects of standard laboratory culture conditions, and the reproductive success of wild-type and GH transgenic coho salmon from mesocosms were compared with that of wild-type fish from nature. Mesocosm rearing partially restored spawning behaviour and success of wild-type fish relative to culture rearing, but remained lower overall than those reared in nature. GH transgenic salmon reared in the mesocosm had similar spawning behaviour and success as wild-type fish reared in the mesocosm when in full competition and without competition, but had lower success in male-only competition experiments. There was evidence of genotype×environmental interactions on spawning success, so that spawning success of transgenic fish, should they escape to natural systems in early life, cannot be predicted with low uncertainty. Under the present conditions, we found no evidence to support enhanced mating capabilities of GH transgenic coho salmon compared to wild-type salmon. However, it is clear that GH transgenic

  16. Sustained miRNA-mediated Knockdown of Mutant AAT With Simultaneous Augmentation of Wild-type AAT Has Minimal Effect on Global Liver miRNA Profiles

    OpenAIRE

    2013-01-01

    α-1 antitrypsin (AAT) deficiency can exhibit two pathologic states: a lung disease that is primarily due to the loss of AAT's antiprotease function, and a liver disease resulting from a toxic gain-of-function of the PiZ-AAT (Z-AAT) mutant protein. We have developed several recombinant adeno-associated virus (rAAV) vectors that incorporate microRNA (miRNA) sequences targeting the AAT gene while also driving the expression of miRNA-resistant wild-type AAT-PiM (M-AAT) gene, thus achieving concom...

  17. Edwardsiella ictaluri Encodes an Acid Activated Urease that is Required for Intracellular Replication in Channel Catfish Ictalurus punctatus Macrophages

    Science.gov (United States)

    Genomic analysis indicated that Edwardsiella ictaluri encodes a putative ureasepathogenicity island containing 9 open reading frames, including urea and ammonium transporters. In vitro studies with the wild-type E. ictaluri and a ureG::kan urease mutant strain indicated that E. ictaluri is significa...

  18. Ascorbate oxidase-dependent changes in the redox state of the apoplast modulate gene transcript accumulation leading to modified hormone signaling and orchestration of defense processes in tobacco.

    Science.gov (United States)

    Pignocchi, Cristina; Kiddle, Guy; Hernández, Iker; Foster, Simon J; Asensi, Amparo; Taybi, Tahar; Barnes, Jeremy; Foyer, Christine H

    2006-06-01

    The role of the redox state of the apoplast in hormone responses, signaling cascades, and gene expression was studied in transgenic tobacco (Nicotiana tabacum) plants with modified cell wall-localized ascorbate oxidase (AO). High AO activity specifically decreased the ascorbic acid (AA) content of the apoplast and altered plant growth responses triggered by hormones. Auxin stimulated shoot growth only when the apoplastic AA pool was reduced in wild-type or AO antisense lines. Oxidation of apoplastic AA in AO sense lines was associated with loss of the auxin response, higher mitogen-activated protein kinase activities, and susceptibility to a virulent strain of the pathogen Pseudomonas syringae. The total leaf glutathione pool, the ratio of reduced glutathione to glutathione disulfide, and glutathione reductase activities were similar in the leaves of all lines. However, AO sense leaves exhibited significantly lower dehydroascorbate reductase and ascorbate peroxidase activities than wild-type and antisense leaves. The abundance of mRNAs encoding antioxidant enzymes was similar in all lines. However, the day/night rhythms in the abundance of transcripts encoding the three catalase isoforms were changed in response to the AA content of the apoplast. Other transcripts influenced by AO included photorespiratory genes and a plasma membrane Ca(2+) channel-associated gene. We conclude that the redox state of the apoplast modulates plant growth and defense responses by regulating signal transduction cascades and gene expression patterns. Hence, AO activity, which modulates the redox state of the apoplastic AA pool, strongly influences the responses of plant cells to external and internal stimuli.

  19. Lactobacillus plantarum gene clusters encoding putative cell-surface protein complexes for carbohydrate utilization are conserved in specific gram-positive bacteria

    Directory of Open Access Journals (Sweden)

    Muscariello Lidia

    2006-05-01

    Full Text Available Abstract Background Genomes of gram-positive bacteria encode many putative cell-surface proteins, of which the majority has no known function. From the rapidly increasing number of available genome sequences it has become apparent that many cell-surface proteins are conserved, and frequently encoded in gene clusters or operons, suggesting common functions, and interactions of multiple components. Results A novel gene cluster encoding exclusively cell-surface proteins was identified, which is conserved in a subgroup of gram-positive bacteria. Each gene cluster generally has one copy of four new gene families called cscA, cscB, cscC and cscD. Clusters encoding these cell-surface proteins were found only in complete genomes of Lactobacillus plantarum, Lactobacillus sakei, Enterococcus faecalis, Listeria innocua, Listeria monocytogenes, Lactococcus lactis ssp lactis and Bacillus cereus and in incomplete genomes of L. lactis ssp cremoris, Lactobacillus casei, Enterococcus faecium, Pediococcus pentosaceus, Lactobacillius brevis, Oenococcus oeni, Leuconostoc mesenteroides, and Bacillus thuringiensis. These genes are neither present in the genomes of streptococci, staphylococci and clostridia, nor in the Lactobacillus acidophilus group, suggesting a niche-specific distribution, possibly relating to association with plants. All encoded proteins have a signal peptide for secretion by the Sec-dependent pathway, while some have cell-surface anchors, novel WxL domains, and putative domains for sugar binding and degradation. Transcriptome analysis in L. plantarum shows that the cscA-D genes are co-expressed, supporting their operon organization. Many gene clusters are significantly up-regulated in a glucose-grown, ccpA-mutant derivative of L. plantarum, suggesting catabolite control. This is supported by the presence of predicted CRE-sites upstream or inside the up-regulated cscA-D gene clusters. Conclusion We propose that the CscA, CscB, CscC and Csc

  20. Characterization of the beta-carotene hydroxylase gene DSM2 conferring drought and oxidative stress resistance by increasing xanthophylls and abscisic acid synthesis in rice.

    Science.gov (United States)

    Du, Hao; Wang, Nili; Cui, Fei; Li, Xianghua; Xiao, Jinghua; Xiong, Lizhong

    2010-11-01

    Drought is a major limiting factor for crop production. To identify critical genes for drought resistance in rice (Oryza sativa), we screened T-DNA mutants and identified a drought-hypersensitive mutant, dsm2. The mutant phenotype was caused by a T-DNA insertion in a gene encoding a putative β-carotene hydroxylase (BCH). BCH is predicted for the biosynthesis of zeaxanthin, a carotenoid precursor of abscisic acid (ABA). The amounts of zeaxanthin and ABA were significantly reduced in two allelic dsm2 mutants after drought stress compared with the wild type. Under drought stress conditions, the mutant leaves lost water faster than the wild type and the photosynthesis rate, biomass, and grain yield were significantly reduced, whereas malondialdehyde level and stomata aperture were increased in the mutant. The mutant is also hypersensitive to oxidative stresses. The mutant had significantly lower maximal efficiency of photosystem II photochemistry and nonphotochemical quenching capacity than the wild type, indicating photoinhibition in photosystem II and decreased capacity for eliminating excess energy by thermal dissipation. Overexpression of DSM2 in rice resulted in significantly increased resistance to drought and oxidative stresses and increases of the xanthophylls and nonphotochemical quenching. Some stress-related ABA-responsive genes were up-regulated in the overexpression line. DSM2 is a chloroplast protein, and the response of DSM2 to environmental stimuli is distinctive from the other two BCH members in rice. We conclude that the DSM2 gene significantly contributes to control of the xanthophyll cycle and ABA synthesis, both of which play critical roles in the establishment of drought resistance in rice.

  1. Inherited differences in crossing over and gene conversion frequencies between wild strains of Sordaria fimicola from "Evolution Canyon".

    Science.gov (United States)

    Saleem, M; Lamb, B C; Nevo, E

    2001-12-01

    Recombination generates new combinations of existing genetic variation and therefore may be important in adaptation and evolution. We investigated whether there was natural genetic variation for recombination frequencies and whether any such variation was environment related and possibly adaptive. Crossing over and gene conversion frequencies often differed significantly in a consistent direction between wild strains of the fungus Sordaria fimicola isolated from a harsher or a milder microscale environment in "Evolution Canyon," Israel. First- and second-generation descendants from selfing the original strains from the harsher, more variable, south-facing slope had higher frequencies of crossing over in locus-centromere intervals and of gene conversion than those from the lusher north-facing slopes. There were some significant differences between strains within slopes, but these were less marked than between slopes. Such inherited variation could provide a basis for natural selection for optimum recombination frequencies in each environment. There were no significant differences in meiotic hybrid DNA correction frequencies between strains from the different slopes. The conversion analysis was made using only conversions to wild type, because estimations of conversion to mutant were affected by a high frequency of spontaneous mutation. There was no polarized segregation of chromosomes at meiosis I or of chromatids at meiosis II.

  2. Bcmimp1, a Botrytis cinerea gene transiently expressed in planta, encodes a mitochondrial protein

    Directory of Open Access Journals (Sweden)

    David eBenito-Pescador

    2016-02-01

    Full Text Available Botrytis cinerea is a widespread necrotrophic fungus which infects more than 200 plant species. In an attempt to characterize the physiological status of the fungus in planta and to identify genetic factors contributing to its ability to infect the host cells, a differential gene expression analysis during the interaction B. cinerea-tomato was carried out. Gene Bcmimp1 codes for a mRNA detected by differential display in the course of this analysis. During the interaction with the host, it shows a transient expression pattern with maximal expression levels during the colonization and maceration of the infected tissues. Bioinformatic analysis suggested that BCMIMP1 is an integral membrane protein located in the mitochondrial inner membrane. Co-localization experiments with a BCMIMP1-GFP fusion protein confirmed that the protein is targeted to the mitochondria. ΔBcmimp1 mutants do not show obvious phenotypic differences during saprophytic growth and their infection ability was unaltered as compared to the wild-type. Interestingly, the mutants produced increased levels of ROS, likely as a consequence of disturbed mitochondrial function. Although Bcmimp1 expression is enhanced in planta it cannot be considered a pathogenicity factor.

  3. KCNMA1 encoded cardiac BK channels afford protection against ischemia-reperfusion injury.

    Directory of Open Access Journals (Sweden)

    Ewa Soltysinska

    Full Text Available Mitochondrial potassium channels have been implicated in myocardial protection mediated through pre-/postconditioning. Compounds that open the Ca2+- and voltage-activated potassium channel of big-conductance (BK have a pre-conditioning-like effect on survival of cardiomyocytes after ischemia/reperfusion injury. Recently, mitochondrial BK channels (mitoBKs in cardiomyocytes were implicated as infarct-limiting factors that derive directly from the KCNMA1 gene encoding for canonical BKs usually present at the plasma membrane of cells. However, some studies challenged these cardio-protective roles of mitoBKs. Herein, we present electrophysiological evidence for paxilline- and NS11021-sensitive BK-mediated currents of 190 pS conductance in mitoplasts from wild-type but not BK-/- cardiomyocytes. Transmission electron microscopy of BK-/- ventricular muscles fibres showed normal ultra-structures and matrix dimension, but oxidative phosphorylation capacities at normoxia and upon re-oxygenation after anoxia were significantly attenuated in BK-/- permeabilized cardiomyocytes. In the absence of BK, post-anoxic reactive oxygen species (ROS production from cardiomyocyte mitochondria was elevated indicating that mitoBK fine-tune the oxidative state at hypoxia and re-oxygenation. Because ROS and the capacity of the myocardium for oxidative metabolism are important determinants of cellular survival, we tested BK-/- hearts for their response in an ex-vivo model of ischemia/reperfusion (I/R injury. Infarct areas, coronary flow and heart rates were not different between wild-type and BK-/- hearts upon I/R injury in the absence of ischemic pre-conditioning (IP, but differed upon IP. While the area of infarction comprised 28±3% of the area at risk in wild-type, it was increased to 58±5% in BK-/- hearts suggesting that BK mediates the beneficial effects of IP. These findings suggest that cardiac BK channels are important for proper oxidative energy supply of

  4. Fungal-specific transcription factor AbPf2 activates pathogenicity in Alternaria brassicicola

    Energy Technology Data Exchange (ETDEWEB)

    Cho, Yangrae; Ohm, Robin A. [US Department of Energy Joint Genome Institute, 2800 Mitchell Drive, Walnut Creek, CA, 94598, USA; Grigoriev, Igor V. [US Department of Energy Joint Genome Institute, 2800 Mitchell Drive, Walnut Creek, CA, 94598, USA; Srivastava, Akhil [Plant and Environmental Protection Sciences, University of Hawaii at Manoa, 3190 Maile Way, St John 317, Honolulu, HI, 96822, USA

    2013-05-24

    Alternaria brassicicola is a successful saprophyte and necrotrophic plant pathogen. To identify molecular determinants of pathogenicity, we created non-pathogenic mutants of a transcription factor-encoding gene, AbPf2. The frequency and timing of germination and appressorium formation on host plants were similar between the non-pathogenic abpf2 mutants and wild-type A. brassicicola. The mutants were also similar in vitro to wild-type A. brassicicola in terms of vegetative growth, conidium production, and responses to a phytoalexin, reactive oxygen species and osmolites. The hyphae of the mutants grew slowly but did not cause disease symptoms on the surface of host plants. Transcripts of the AbPf2 gene increased exponentially soon after wild-type conidia contacted their host plants . A small amount of AbPf2 protein, as monitored using GFP fusions, was present in young, mature conidia. The protein level decreased during saprophytic growth, but increased and was located primarily in fungal nuclei during pathogenesis. Levels of the proteins and transcripts sharply decreased following colonization of host tissues beyond the initial infection site. When expression of the transcription factor was induced in the wild-type during early pathogenesis, 106 fungal genes were also induced in the wild-type but not in the abpf2 mutants. Notably, 33 of the 106 genes encoded secreted proteins, including eight putative effector proteins. Plants inoculated with abpf2 mutants expressed higher levels of genes associated with photosynthesis, the pentose phosphate pathway and primary metabolism, but lower levels of defense-related genes. Our results suggest that AbPf2 is an important regulator of pathogenesis, but does not affect other cellular processes in A. brassicicola.

  5. The wild type as concept and in experimental practice: A history of its role in classical genetics and evolutionary theory.

    Science.gov (United States)

    Holmes, Tarquin

    2017-06-01

    Wild types in genetics are specialised strains of laboratory experimental organism which principally serve as standards against which variation is measured. As selectively inbred lineages highly isolated from ancestral wild populations, there appears to be little wild or typical about them. I will nonetheless argue that they have historically been successfully used as stand-ins for nature, allowing knowledge produced in the laboratory to be extrapolated to the natural world. In this paper, I will explore the 19th century origins of the wild type concept, the theoretical and experimental innovations which allowed concepts and organisms to move from wild nature to laboratory domestication c. 1900 (resulting in the production of standardised lab strains), and the conflict among early geneticists between interactionist and atomist accounts of wild type, which would eventually lead to the conceptual disintegration of wild types and the triumph of genocentrism and population genetics. I conclude by discussing how the strategy of using wild type strains to represent nature in the lab has nonetheless survived the downfall of the wild type concept and continues to provide, significant limitations acknowledged, an epistemically productive means of investigating heredity and evolutionary variation. Copyright © 2017 Elsevier Ltd. All rights reserved.

  6. ABNORMAL TYPE-III COLLAGEN PRODUCED BY AN EXON-17-SKIPPING MUTATION OF THE COL3A1 GENE IN EHLERS-DANLOS SYNDROME TYPE-IV IS NOT INCORPORATED INTO THE EXTRACELLULAR-MATRIX

    NARCIS (Netherlands)

    CHIODO, AA; SILLENCE, DO; COLE, WG; BATEMAN, JF

    1995-01-01

    A novel heterozygous mutation of the COL3Al gene that encodes the alpha 1(III) chains of type III collagen was identified in a family with the: acrogeric form of Ehlers-Danlos syndrome type IV (EDS-IV). Cultured dermal fibroblasts produced normal and shortened alpha 1(III) chains. The triple helix

  7. Functional analysis of three type-2 DGAT homologue genes for triacylglycerol production in the green microalga Chlamydomonas reinhardtii.

    Science.gov (United States)

    La Russa, M; Bogen, C; Uhmeyer, A; Doebbe, A; Filippone, E; Kruse, O; Mussgnug, J H

    2012-11-30

    Photosynthetic organisms like plants and algae can use sunlight to produce lipids as important metabolic compounds. Plant-derived triacylglycerols (TAGs) are valuable for human and animal nutrition because of their high energy content and are becoming increasingly important for the production of renewable biofuels. Acyl-CoA:diacylglycerol acyltransferases (DGATs) have been demonstrated to play an important role in the accumulation of TAG compounds in higher plants. DGAT homologue genes have been identified in the genome of the green alga Chlamydomonas reinhardtii, however their function in vivo is still unknown. In this work, the three most promising type-2 DGAT candidate genes potentially involved in TAG lipid accumulation (CrDGAT2a, b and c) were investigated by constructing overexpression strains. For each of the genes, three strains were identified which showed enhanced mRNA levels of between 1.7 and 29.1 times that of the wild type (wt). Total lipid contents, neutral lipids and fatty acid profiles were determined and showed that an enhanced mRNA expression level of the investigated DGAT genes did not boost the intracellular TAG accumulation or resulted in alterations of the fatty acid profiles compared to wild type during standard growth condition or during nitrogen or sulfur stress conditions. We conclude that biotechnological efforts to enhance cellular TAG amount in microalgae need further insights into the complex network of lipid biosynthesis to identify potential bottlenecks of neutral lipid production. Copyright © 2012 Elsevier B.V. All rights reserved.

  8. Cloning and expression of cell wall acid invertase gene fragment ...

    African Journals Online (AJOL)

    A fragment of invertase gene containing catalytic sites of cysteine was cloned from poinsettia (Euphorbia pulcherrima wild.) by using the polymerase chain reaction (PCR) method. The length of the fragment was 521 bp, encoding 173 amino acids and containing a part of open reading frames, but no intron. It had a high ...

  9. Evidence for Chlamydiaceae and Parachlamydiaceae in a wild boar (Sus scrofa population in Italy

    Directory of Open Access Journals (Sweden)

    Antonietta Di Francesco

    2013-03-01

    Full Text Available Conjunctival swabs from 44 free-living wild boars culled during a demographic control programme applied in a Regional Park located in the Northern Italy were examined by 16S rRNA encoding gene nested PCR. In total, 22 (50% wild boars were PCR positive. Sequencing of the amplicons identified Chlamydia suis and Chlamydia pecorum in 12 and 5 samples, respectively. For one sample found PCR positive, the nucleotide sequence could not be determined. Four conjunctival samples showed ≥ 92% sequence similarities to 16S rRNA sequences from Chlamydia-like organisms, as did large intestine, uterus, and vaginal swabs from the same four animals. Amoeba DNA was found in one Chlamydia-like organism positive conjunctival swab. To our knowledge, this is the first detection of members of the Parachlamydiaceae family in wild boars, confirming a large animal host range for Chlamydia-like organisms.

  10. Fusarium spp. Associated with Field-Grown Grain of Near-Isogenic Low Lignin and Wild-Type Sorghum

    Science.gov (United States)

    Fusarium spp. associated with field-grown grain of near-isogenic low lignin and wild-type sorghum. Deanna Funnell-Harris and Jeff Pedersen, USDA-ARS, Lincoln, NE Previous studies indicated that low lignin brown midrib (bmr) sorghum may be more resistant to Fusarium spp. than wild-type and that phen...

  11. Transplacental and oral transmission of wild-type bluetongue virus serotype 8 in cattle after experimental infection

    NARCIS (Netherlands)

    Backx, A.; Heutink, C.G.; Rooij, van E.M.A.; Rijn, van P.A.

    2009-01-01

    Potential vertical transmission of wild-type bluetongue virus serotype 8 (BTV-8) in cattle was explored in this experiment. We demonstrated transplacental transmission of wild-type BTV-8 in one calf and oral infection with BTV-8 in another calf. Following the experimental BTV-8 infection of seven

  12. Genome-wide analysis of Dongxiang wild rice (Oryza rufipogon Griff.) to investigate lost/acquired genes during rice domestication.

    Science.gov (United States)

    Zhang, Fantao; Xu, Tao; Mao, Linyong; Yan, Shuangyong; Chen, Xiwen; Wu, Zhenfeng; Chen, Rui; Luo, Xiangdong; Xie, Jiankun; Gao, Shan

    2016-04-26

    It is widely accepted that cultivated rice (Oryza sativa L.) was domesticated from common wild rice (Oryza rufipogon Griff.). Compared to other studies which concentrate on rice origin, this study is to genetically elucidate the substantially phenotypic and physiological changes from wild rice to cultivated rice at the whole genome level. Instead of comparing two assembled genomes, this study directly compared the Dongxiang wild rice (DXWR) Illumina sequencing reads with the Nipponbare (O. sativa) complete genome without assembly of the DXWR genome. Based on the results from the comparative genomics analysis, structural variations (SVs) between DXWR and Nipponbare were determined to locate deleted genes which could have been acquired by Nipponbare during rice domestication. To overcome the limit of the SV detection, the DXWR transcriptome was also sequenced and compared with the Nipponbare transcriptome to discover the genes which could have been lost in DXWR during domestication. Both 1591 Nipponbare-acquired genes and 206 DXWR-lost transcripts were further analyzed using annotations from multiple sources. The NGS data are available in the NCBI SRA database with ID SRP070627. These results help better understanding the domestication from wild rice to cultivated rice at the whole genome level and provide a genomic data resource for rice genetic research or breeding. One finding confirmed transposable elements contribute greatly to the genome evolution from wild rice to cultivated rice. Another finding suggested the photophosphorylation and oxidative phosphorylation system in cultivated rice could have adapted to environmental changes simultaneously during domestication.

  13. Common variants of the BRCA1 wild-type allele modify the risk of breast cancer in BRCA1 mutation carriers.

    OpenAIRE

    Cox, D. G.; Simard, J.; Sinnett, D.; Hamdi, Y.; Soucy, P.; Ouimet, M.; Barjhoux, L.; Verny-Pierre, C.; McGuffog, L.; Healey, S.; Szabo, C.; Greene, M. H.; Mai, P. L.; Andrulis, I. L.; Thomassen, M.

    2011-01-01

    Mutations in the BRCA1 gene substantially increase a woman's lifetime risk of breast cancer. However, there is great variation in this increase in risk with several genetic and non-genetic modifiers identified. The BRCA1 protein plays a central role in DNA repair, a mechanism that is particularly instrumental in safeguarding cells against tumorigenesis. We hypothesized that polymorphisms that alter the expression and/or function of BRCA1 carried on the wild-type (non-mutated) copy of the BRCA...

  14. p53 functions as a cell cycle control protein in osteosarcomas.

    OpenAIRE

    Diller, L; Kassel, J; Nelson, C E; Gryka, M A; Litwak, G; Gebhardt, M; Bressac, B; Ozturk, M; Baker, S J; Vogelstein, B

    1990-01-01

    Mutations in the p53 gene have been associated with a wide range of human tumors, including osteosarcomas. Although it has been shown that wild-type p53 can block the ability of E1a and ras to cotransform primary rodent cells, it is poorly understood why inactivation of the p53 gene is important for tumor formation. We show that overexpression of the gene encoding wild-type p53 blocks the growth of osteosarcoma cells. The growth arrest was determined to be due to an inability of the transfect...

  15. Discovery of a Potent Class of PI3Kα Inhibitors with Unique Binding Mode via Encoded Library Technology (ELT).

    Science.gov (United States)

    Yang, Hongfang; Medeiros, Patricia F; Raha, Kaushik; Elkins, Patricia; Lind, Kenneth E; Lehr, Ruth; Adams, Nicholas D; Burgess, Joelle L; Schmidt, Stanley J; Knight, Steven D; Auger, Kurt R; Schaber, Michael D; Franklin, G Joseph; Ding, Yun; DeLorey, Jennifer L; Centrella, Paolo A; Mataruse, Sibongile; Skinner, Steven R; Clark, Matthew A; Cuozzo, John W; Evindar, Ghotas

    2015-05-14

    In the search of PI3K p110α wild type and H1047R mutant selective small molecule leads, an encoded library technology (ELT) campaign against the desired target proteins was performed which led to the discovery of a selective chemotype for PI3K isoforms from a three-cycle DNA encoded library. An X-ray crystal structure of a representative inhibitor from this chemotype demonstrated a unique binding mode in the p110α protein.

  16. Fine Mapping and Candidate Gene Analysis of the Leaf-Color Gene ygl-1 in Maize.

    Directory of Open Access Journals (Sweden)

    Haiying Guan

    Full Text Available A novel yellow-green leaf mutant yellow-green leaf-1 (ygl-1 was isolated in self-pollinated progenies from the cross of maize inbred lines Ye478 and Yuanwu02. The mutant spontaneously showed yellow-green character throughout the lifespan. Meanwhile, the mutant reduced contents of chlorophyll and Car, arrested chloroplast development and lowered the capacity of photosynthesis compared with the wild-type Lx7226. Genetic analysis revealed that the mutant phenotype was controlled by a recessive nuclear gene. The ygl-1 locus was initially mapped to an interval of about 0.86 Mb in bin 1.01 on the short arm of chromosome 1 using 231 yellow-green leaf individuals of an F2 segregating population from ygl-1/Lx7226. Utilizing four new polymorphic SSR markers, the ygl-1 locus was narrowed down to a region of about 48 kb using 2930 and 2247 individuals of F2 and F3 mapping populations, respectively. Among the three predicted genes annotated within this 48 kb region, GRMZM2G007441, which was predicted to encode a cpSRP43 protein, had a 1-bp nucleotide deletion in the coding region of ygl-1 resulting in a frame shift mutation. Semi-quantitative RT-PCR analysis revealed that YGL-1 was constitutively expressed in all tested tissues and its expression level was not significantly affected in the ygl-1 mutant from early to mature stages, while light intensity regulated its expression both in the ygl-1 mutant and wild type seedlings. Furthermore, the mRNA levels of some genes involved in chloroplast development were affected in the six-week old ygl-1 plants. These findings suggested that YGL-1 plays an important role in chloroplast development of maize.

  17. Composition and expression of genes encoding carbohydrate-active enzymes in the straw-degrading mushroom Volvariella volvacea.

    Directory of Open Access Journals (Sweden)

    Bingzhi Chen

    Full Text Available Volvariella volvacea is one of a few commercial cultivated mushrooms mainly using straw as carbon source. In this study, the genome of V. volcacea was sequenced and assembled. A total of 285 genes encoding carbohydrate-active enzymes (CAZymes in V. volvacea were identified and annotated. Among 15 fungi with sequenced genomes, V. volvacea ranks seventh in the number of genes encoding CAZymes. In addition, the composition of glycoside hydrolases in V. volcacea is dramatically different from other basidiomycetes: it is particularly rich in members of the glycoside hydrolase families GH10 (hemicellulose degradation and GH43 (hemicellulose and pectin degradation, and the lyase families PL1, PL3 and PL4 (pectin degradation but lacks families GH5b, GH11, GH26, GH62, GH93, GH115, GH105, GH9, GH53, GH32, GH74 and CE12. Analysis of genome-wide gene expression profiles of 3 strains using 3'-tag digital gene expression (DGE reveals that 239 CAZyme genes were expressed even in potato destrose broth medium. Our data also showed that the formation of a heterokaryotic strain could dramatically increase the expression of a number of genes which were poorly expressed in its parental homokaryotic strains.

  18. The Obesity-Associated FTO Gene Encodes a 2-Oxoglutarate–Dependent Nucleic Acid Demethylase

    Science.gov (United States)

    Gerken, Thomas; Girard, Christophe A.; Tung, Yi-Chun Loraine; Webby, Celia J.; Saudek, Vladimir; Hewitson, Kirsty S.; Yeo, Giles S. H.; McDonough, Michael A.; Cunliffe, Sharon; McNeill, Luke A.; Galvanovskis, Juris; Rorsman, Patrik; Robins, Peter; Prieur, Xavier; Coll, Anthony P.; Ma, Marcella; Jovanovic, Zorica; Farooqi, I. Sadaf; Sedgwick, Barbara; Barroso, Inês; Lindahl, Tomas; Ponting, Chris P.; Ashcroft, Frances M.; O'Rahilly, Stephen; Schofield, Christopher J.

    2009-01-01

    Variants in the FTO (fat mass and obesity associated) gene are associated with increased body mass index in humans. Here, we show by bioinformatics analysis that FTO shares sequence motifs with Fe(II)- and 2-oxoglutarate–dependent oxygenases. We find that recombinant murine Fto catalyzes the Fe(II)- and 2OG-dependent demethylation of 3-methylthymine in single-stranded DNA, with concomitant production of succinate, formaldehyde, and carbon dioxide. Consistent with a potential role in nucleic acid demethylation, Fto localizes to the nucleus in transfected cells. Studies of wild-type mice indicate that Fto messenger RNA (mRNA) is most abundant in the brain, particularly in hypothalamic nuclei governing energy balance, and that Fto mRNA levels in the arcuate nucleus are regulated by feeding and fasting. Studies can now be directed toward determining the physiologically relevant FTO substrate and how nucleic acid methylation status is linked to increased fat mass. PMID:17991826

  19. Extensive overproduction of the AdhE protein by rng mutations depends on mutations in the cra gene or in the Cra-box of the adhE promoter.

    Science.gov (United States)

    Kaga, Naoko; Umitsuki, Genryou; Clark, David P; Nagai, Kazuo; Wachi, Masaaki

    2002-07-05

    Escherichia coli RNase G encoded by the rng gene is involved in degradation of adhE mRNA. Overproduction of the AdhE protein by rng mutants was found to depend on the genetic background of strains derived from DC272 (adhC81) or MC1061. We found that DC272 carried a point mutation in the Cra-binding site of the adhE promoter. The Cra protein encoded by the cra gene is known to act as a repressor of adhE. P1-phage-mediated transduction and lacZ fusion analysis with the mutant adhE promoter confirmed that this mutation is responsible for overproduction. On the other hand, Southern hybridization revealed that MC1061 had a 0.85-kb deletion of the cra gene. Overproduction of AdhE in the MC1061 background was reversed to the wild-type levels by introduction of a plasmid carrying the cra(+) gene. These results indicated that expression of the adhE gene was regulated transcriptionally by Cra and posttranscriptionally by RNase G. (c) 2002 Elsevier Science (USA).

  20. Duplication and Loss of Function of Genes Encoding RNA Polymerase III Subunit C4 Causes Hybrid Incompatibility in Rice

    Directory of Open Access Journals (Sweden)

    Giao Ngoc Nguyen

    2017-08-01

    Full Text Available Reproductive barriers are commonly observed in both animals and plants, in which they maintain species integrity and contribute to speciation. This report shows that a combination of loss-of-function alleles at two duplicated loci, DUPLICATED GAMETOPHYTIC STERILITY 1 (DGS1 on chromosome 4 and DGS2 on chromosome 7, causes pollen sterility in hybrid progeny derived from an interspecific cross between cultivated rice, Oryza sativa, and an Asian annual wild rice, O. nivara. Male gametes carrying the DGS1 allele from O. nivara (DGS1-nivaras and the DGS2 allele from O. sativa (DGS2-T65s were sterile, but female gametes carrying the same genotype were fertile. We isolated the causal gene, which encodes a protein homologous to DNA-dependent RNA polymerase (RNAP III subunit C4 (RPC4. RPC4 facilitates the transcription of 5S rRNAs and tRNAs. The loss-of-function alleles at DGS1-nivaras and DGS2-T65s were caused by weak or nonexpression of RPC4 and an absence of RPC4, respectively. Phylogenetic analysis demonstrated that gene duplication of RPC4 at DGS1 and DGS2 was a recent event that occurred after divergence of the ancestral population of Oryza from other Poaceae or during diversification of AA-genome species.

  1. A combination of independent transcriptional regulators shapes bacterial virulence gene expression during infection.

    Directory of Open Access Journals (Sweden)

    Samuel A Shelburne

    2010-03-01

    Full Text Available Transcriptional regulatory networks are fundamental to how microbes alter gene expression in response to environmental stimuli, thereby playing a critical role in bacterial pathogenesis. However, understanding how bacterial transcriptional regulatory networks function during host-pathogen interaction is limited. Recent studies in group A Streptococcus (GAS suggested that the transcriptional regulator catabolite control protein A (CcpA influences many of the same genes as the control of virulence (CovRS two-component gene regulatory system. To provide new information about the CcpA and CovRS networks, we compared the CcpA and CovR transcriptomes in a serotype M1 GAS strain. The transcript levels of several of the same genes encoding virulence factors and proteins involved in basic metabolic processes were affected in both DeltaccpA and DeltacovR isogenic mutant strains. Recombinant CcpA and CovR bound with high-affinity to the promoter regions of several co-regulated genes, including those encoding proteins involved in carbohydrate and amino acid metabolism. Compared to the wild-type parental strain, DeltaccpA and DeltacovRDeltaccpA isogenic mutant strains were significantly less virulent in a mouse myositis model. Inactivation of CcpA and CovR alone and in combination led to significant alterations in the transcript levels of several key GAS virulence factor encoding genes during infection. Importantly, the transcript level alterations in the DeltaccpA and DeltacovRDeltaccpA isogenic mutant strains observed during infection were distinct from those occurring during growth in laboratory medium. These data provide new knowledge regarding the molecular mechanisms by which pathogenic bacteria respond to environmental signals to regulate virulence factor production and basic metabolic processes during infection.

  2. Identification of a truncated nucleoprotein in avian metapneumovirus-infected cells encoded by a second AUG, in-frame to the full-length gene

    Science.gov (United States)

    Alvarez, Rene; Seal, Bruce S

    2005-01-01

    Background Avian metapneumoviruses (aMPV) cause an upper respiratory disease with low mortality, but high morbidity primarily in commercial turkeys. There are three types of aMPV (A, B, C) of which the C type is found only in the United States. Viruses related to aMPV include human, bovine, ovine, and caprine respiratory syncytial viruses and pneumonia virus of mice, as well as the recently identified human metapneumovirus (hMPV). The aMPV and hMPV have become the type viruses of a new genus within the Metapneumovirus. The aMPV nucleoprotein (N) amino acid sequences of serotypes A, B, and C were aligned for comparative analysis. Based on predicted antigenicity of consensus protein sequences, five aMPV-specific N peptides were synthesized for development of peptide-antigens and antisera. Results The presence of two aMPV nucleoprotein (N) gene encoded polypeptides was detected in aMPV/C/US/Co and aMPV/A/UK/3b infected Vero cells. Nucleoprotein 1 (N1) encoded from the first open reading frame (ORF) was predicted to be 394 amino acids in length for aMPV/C/US/Co and 391 amino acids in length for aMPV/A/UK/3b with approximate molecular weights of 43.3 kilodaltons and 42.7 kilodaltons, respectively. Nucleoprotein 2 (N2) was hypothesized to be encoded by a second downstream ORF in-frame with ORF1 and encoded a protein predicted to contain 328 amino acids for aMPV/C/US/Co or 259 amino acids for aMPV/A/UK/3b with approximate molecular weights of 36 kilodaltons and 28.3 kilodaltons, respectively. Peptide antibodies to the N-terminal and C-terminal portions of the aMPV N protein confirmed presence of these products in both aMPV/C/US/Co- and aMPV/A/UK/3b-infected Vero cells. N1 and N2 for aMPV/C/US/Co ORFs were molecularly cloned and expressed in Vero cells utilizing eukaryotic expression vectors to confirm identity of the aMPV encoded proteins. Conclusion This is the first reported identification of potential, accessory in-frame N2 ORF gene products among members of the

  3. Identification of a truncated nucleoprotein in avian metapneumovirus-infected cells encoded by a second AUG, in-frame to the full-length gene

    Directory of Open Access Journals (Sweden)

    Alvarez Rene

    2005-04-01

    Full Text Available Abstract Background Avian metapneumoviruses (aMPV cause an upper respiratory disease with low mortality, but high morbidity primarily in commercial turkeys. There are three types of aMPV (A, B, C of which the C type is found only in the United States. Viruses related to aMPV include human, bovine, ovine, and caprine respiratory syncytial viruses and pneumonia virus of mice, as well as the recently identified human metapneumovirus (hMPV. The aMPV and hMPV have become the type viruses of a new genus within the Metapneumovirus. The aMPV nucleoprotein (N amino acid sequences of serotypes A, B, and C were aligned for comparative analysis. Based on predicted antigenicity of consensus protein sequences, five aMPV-specific N peptides were synthesized for development of peptide-antigens and antisera. Results The presence of two aMPV nucleoprotein (N gene encoded polypeptides was detected in aMPV/C/US/Co and aMPV/A/UK/3b infected Vero cells. Nucleoprotein 1 (N1 encoded from the first open reading frame (ORF was predicted to be 394 amino acids in length for aMPV/C/US/Co and 391 amino acids in length for aMPV/A/UK/3b with approximate molecular weights of 43.3 kilodaltons and 42.7 kilodaltons, respectively. Nucleoprotein 2 (N2 was hypothesized to be encoded by a second downstream ORF in-frame with ORF1 and encoded a protein predicted to contain 328 amino acids for aMPV/C/US/Co or 259 amino acids for aMPV/A/UK/3b with approximate molecular weights of 36 kilodaltons and 28.3 kilodaltons, respectively. Peptide antibodies to the N-terminal and C-terminal portions of the aMPV N protein confirmed presence of these products in both aMPV/C/US/Co- and aMPV/A/UK/3b-infected Vero cells. N1 and N2 for aMPV/C/US/Co ORFs were molecularly cloned and expressed in Vero cells utilizing eukaryotic expression vectors to confirm identity of the aMPV encoded proteins. Conclusion This is the first reported identification of potential, accessory in-frame N2 ORF gene products among

  4. Correlation of gene expression and contaminat concentrations in wild largescale suckers: a field-based study

    Science.gov (United States)

    Christiansen, Helena E.; Mehinto, Alvine C.; Yu, Fahong; Perry, Russell W.; Denslow, Nancy D.; Maule, Alec G.; Mesa, Matthew G.

    2014-01-01

    Toxic compounds such as organochlorine pesticides (OCs), polychlorinated biphenyls (PCBs), and polybrominated diphenyl ether flame retardants (PBDEs) have been detected in fish, birds, and aquatic mammals that live in the Columbia River or use food resources from within the river. We developed a custom microarray for largescale suckers (Catostomus macrocheilus) and used it to investigate the molecular effects of contaminant exposure on wild fish in the Columbia River. Using Significance Analysis of Microarrays (SAM) we identified 72 probes representing 69 unique genes with expression patterns that correlated with hepatic tissue levels of OCs, PCBs, or PBDEs. These genes were involved in many biological processes previously shown to respond to contaminant exposure, including drug and lipid metabolism, apoptosis, cellular transport, oxidative stress, and cellular chaperone function. The relation between gene expression and contaminant concentration suggests that these genes may respond to environmental contaminant exposure and are promising candidates for further field and laboratory studies to develop biomarkers for monitoring exposure of wild fish to contaminant mixtures found in the Columbia River Basin. The array developed in this study could also be a useful tool for studies involving endangered sucker species and other sucker species used in contaminant research.

  5. Map-based Cloning and Characterization of the BPH18 Gene from Wild Rice Conferring Resistance to Brown Planthopper (BPH) Insect Pest.

    Science.gov (United States)

    Ji, Hyeonso; Kim, Sung-Ryul; Kim, Yul-Ho; Suh, Jung-Pil; Park, Hyang-Mi; Sreenivasulu, Nese; Misra, Gopal; Kim, Suk-Man; Hechanova, Sherry Lou; Kim, Hakbum; Lee, Gang-Seob; Yoon, Ung-Han; Kim, Tae-Ho; Lim, Hyemin; Suh, Suk-Chul; Yang, Jungil; An, Gynheung; Jena, Kshirod K

    2016-09-29

    Brown planthopper (BPH) is a phloem sap-sucking insect pest of rice which causes severe yield loss. We cloned the BPH18 gene from the BPH-resistant introgression line derived from the wild rice species Oryza australiensis. Map-based cloning and complementation test revealed that the BPH18 encodes CC-NBS-NBS-LRR protein. BPH18 has two NBS domains, unlike the typical NBS-LRR proteins. The BPH18 promoter::GUS transgenic plants exhibited strong GUS expression in the vascular bundles of the leaf sheath, especially in phloem cells where the BPH attacks. The BPH18 proteins were widely localized to the endo-membranes in a cell, including the endoplasmic reticulum, Golgi apparatus, trans-Golgi network, and prevacuolar compartments, suggesting that BPH18 may recognize the BPH invasion at endo-membranes in phloem cells. Whole genome sequencing of the near-isogenic lines (NILs), NIL-BPH18 and NIL-BPH26, revealed that BPH18 located at the same locus of BPH26. However, these two genes have remarkable sequence differences and the independent NILs showed differential BPH resistance with different expression patterns of plant defense-related genes, indicating that BPH18 and BPH26 are functionally different alleles. These findings would facilitate elucidation of the molecular mechanism of BPH resistance and the identified novel alleles to fast track breeding BPH resistant rice cultivars.

  6. Molecular control of copper homeostasis in filamentous fungi: increased expression of a metallothionein gene during aging of Podospora anserina.

    Science.gov (United States)

    Averbeck, N B; Borghouts, C; Hamann, A; Specke, V; Osiewacz, H D

    2001-01-01

    The lifespan of the ascomycete Podospora anserina was previously demonstrated to be significantly increased in a copper-uptake mutant, suggesting that copper is a potential stressor involved in degenerative processes. In order to determine whether changes in copper stress occur in the cells during normal aging of cultures, we cloned and characterized a gene coding for a component of the molecular machinery involved in the control of copper homeostasis. This gene, PaMt1, is a single-copy gene that encodes a metallothionein of 26 amino acids. The coding sequence of PaMt1 is interrupted by a single intron. The deduced amino acid sequence shows a high degree of sequence identity to metallothioneins of the filamentous ascomycete Neurospora crassa and the basidiomycete Agaricus bisporus, and to the N-terminal portion of mammalian metallothioneins. Levels of PaMt1 transcript increase in response to elevated amounts of copper in the growth medium and during aging of wild-type cultures. In contrast, in the long-lived mutant grisea, transcript levels first increase but then decrease again. The ability of wild-type cultures to respond to exogenous copper stress via the induction of PaMt1 transcription is not affected as they grow older.

  7. CORTICAL ENCODING OF SIGNALS IN NOISE: EFFECTS OF STIMULUS TYPE AND RECORDING PARADIGM

    Science.gov (United States)

    Billings, Curtis J.; Bennett, Keri O.; Molis, Michelle R.; Leek, Marjorie R.

    2010-01-01

    Objectives Perception-in-noise deficits have been demonstrated across many populations and listening conditions. Many factors contribute to successful perception of auditory stimuli in noise, including neural encoding in the central auditory system. Physiological measures such as cortical auditory evoked potentials can provide a view of neural encoding at the level of the cortex that may inform our understanding of listeners’ abilities to perceive signals in the presence of background noise. In order to understand signal-in-noise neural encoding better, we set out to determine the effect of signal type, noise type, and evoking paradigm on the P1-N1-P2 complex. Design Tones and speech stimuli were presented to nine individuals in quiet, and in three background noise types: continuous speech spectrum noise, interrupted speech spectrum noise, and four-talker babble at a signal-to-noise ratio of −3 dB. In separate sessions, cortical auditory evoked potentials were evoked by a passive homogenous paradigm (single repeating stimulus) and an active oddball paradigm. Results The results for the N1 component indicated significant effects of signal type, noise type, and evoking paradigm. While components P1 and P2 also had significant main effects of these variables, only P2 demonstrated significant interactions among these variables. Conclusions Signal type, noise type, and evoking paradigm all must be carefully considered when interpreting signal-in-noise evoked potentials. Furthermore, these data confirm the possible usefulness of CAEPs as an aid to understanding perception-in-noise deficits. PMID:20890206

  8. An Investigation of the Relationship between PPP1R3 Gene Polymorphism and Type 2 Diabetes

    Directory of Open Access Journals (Sweden)

    Soyar Sari

    2017-07-01

    Full Text Available Background and Objectives: PPP1R3 is one of the genes confirmed to be associated with type 2 diabetes. This gene is located on the long arm of chromosome 7 and encodes protein phosphatase 1 (PP1, which has serine/threonine phosphatase activity. There is a polymorphic region in the 3'UTR region of this gene, which creates ARE1 and ARE2 alleles. The aim of this study was to determine the relationship between PPP1R3 gene polymorphism and type 2 diabetes. Methods: In this case-control study, 100 patients with type 2 diabetes and 100 healthy individuals, were randomly selected from the study population. PPP1R3 gene polymorphism was analyzed using PCR-RFLP method. Comparison of variables between healthy and patient groups, was performed by t-test, allele frequency by counting, and calculation of their ratio by chi-square test, and the population was confirmed to be in Hardy-Weinberg equilibrium. Distribution of genotypes and alleles was compared between healthy and patient groups. Results: In this study, there was no significant difference between the frequency of genotypes and frequency of alleles in subjects with type 2 diabetes and healthy control subjects. Conclusion: The findings of this study indicated that polymorphisms in the 3'UTR region of PPP1R3 gene is not associated with type 2 diabetes.

  9. Modulation of expression of genes encoding nuclear proteins following exposure to JANUS neutrons or γ-rays

    International Nuclear Information System (INIS)

    Woloschak, G.E.; Chang-Liu, Chin-Mei

    1994-01-01

    Previous work has shown that exposure of cells to ionizing radiations causes modulation of a variety of genes, including those encoding c-fos, interleukin-1, tumor necrosis factor, cytoskeletal elements, and many more. The experiments reported herein were designed to examine the effects of either JANUS neutron or γ-ray exposure on expression of genes encoding nucleus-associated proteins (H4-histone, c-jun, c-myc, Rb, and p53). Cycling Syrian hamster embryo cells were irradiated with varying doses and dose rates of either JANUS fission-spectrum neutrons or γ-rays; after incubation of the cell cultures for 1 h following radiation exposure, mRNA was harvested and analyzed by Northern blot. Results revealed induction of transcripts for c-jun, H4-histone, and Rb following γ-ray but not following neutron exposure. Interestingly, expression of c-myc was repressed following γ-ray but not following neutron exposure. Radiations at different doses and dose rates were compared for each of the genes studied

  10. The ARG1-LIKE2 gene of Arabidopsis functions in a gravity signal transduction pathway that is genetically distinct from the PGM pathway

    Science.gov (United States)

    Guan, Changhui; Rosen, Elizabeth S.; Boonsirichai, Kanokporn; Poff, Kenneth L.; Masson, Patrick H.

    2003-01-01

    The arl2 mutants of Arabidopsis display altered root and hypocotyl gravitropism, whereas their inflorescence stems are fully gravitropic. Interestingly, mutant roots respond like the wild type to phytohormones and an inhibitor of polar auxin transport. Also, their cap columella cells accumulate starch similarly to wild-type cells, and mutant hypocotyls display strong phototropic responses to lateral light stimulation. The ARL2 gene encodes a DnaJ-like protein similar to ARG1, another protein previously implicated in gravity signal transduction in Arabidopsis seedlings. ARL2 is expressed at low levels in all organs of seedlings and plants. arl2-1 arg1-2 double mutant roots display kinetics of gravitropism similar to those of single mutants. However, double mutants carrying both arl2-1 and pgm-1 (a mutation in the starch-biosynthetic gene PHOSPHOGLUCOMUTASE) at the homozygous state display a more pronounced root gravitropic defect than the single mutants. On the other hand, seedlings with a null mutation in ARL1, a paralog of ARG1 and ARL2, behave similarly to the wild type in gravitropism and other related assays. Taken together, the results suggest that ARG1 and ARL2 function in the same gravity signal transduction pathway in the hypocotyl and root of Arabidopsis seedlings, distinct from the pathway involving PGM.

  11. Properties of virion transactivator proteins encoded by primate cytomegaloviruses

    Directory of Open Access Journals (Sweden)

    Barry Peter A

    2009-05-01

    Full Text Available Abstract Background Human cytomegalovirus (HCMV is a betaherpesvirus that causes severe disease in situations where the immune system is immature or compromised. HCMV immediate early (IE gene expression is stimulated by the virion phosphoprotein pp71, encoded by open reading frame (ORF UL82, and this transactivation activity is important for the efficient initiation of viral replication. It is currently recognized that pp71 acts to overcome cellular intrinsic defences that otherwise block viral IE gene expression, and that interactions of pp71 with the cell proteins Daxx and ATRX are important for this function. A further property of pp71 is the ability to enable prolonged gene expression from quiescent herpes simplex virus type 1 (HSV-1 genomes. Non-human primate cytomegaloviruses encode homologs of pp71, but there is currently no published information that addresses their effects on gene expression and modes of action. Results The UL82 homolog encoded by simian cytomegalovirus (SCMV, strain Colburn, was identified and cloned. This ORF, named S82, was cloned into an HSV-1 vector, as were those from baboon, rhesus monkey and chimpanzee cytomegaloviruses. The use of an HSV-1 vector enabled expression of the UL82 homologs in a range of cell types, and permitted investigation of their abilities to direct prolonged gene expression from quiescent genomes. The results show that all UL82 homologs activate gene expression, and that neither host cell type nor promoter target sequence has major effects on these activities. Surprisingly, the UL82 proteins specified by non-human primate cytomegaloviruses, unlike pp71, did not direct long term expression from quiescent HSV-1 genomes. In addition, significant differences were observed in the intranuclear localization of the UL82 homologs, and in their effects on Daxx. Strikingly, S82 mediated the release of Daxx from nuclear domain 10 substructures much more rapidly than pp71 or the other proteins tested. All

  12. Effects of regionally applied heating on the respiration of wild type ...

    African Journals Online (AJOL)

    Nocturnal dark respiration (Rn) in wild type and transgenic soybean plants ... Illinois, USA under ambient and elevated CO2 conditions was examined in this study. ... Experimental plants were transferred to a controlled growth chamber at V4 ...

  13. CHARACTERIZATION OF 0.58 kb DNA STILBENE SYNTHASE ENCODING GENE FRAGMENT FROM MELINJO PLANT (Gnetum gnemon

    Directory of Open Access Journals (Sweden)

    Tri Joko Raharjo

    2011-12-01

    Full Text Available Resveratrol is a potent anticancer agent resulted as the main product of enzymatic reaction between common precursor in plants and Stilbene Synthase enzyme, which is expressed by sts gene. Characterization of internal fragment of Stilbene Synthase (STS encoding gene from melinjo plant (Gnetum gnemon L. has been carried out as part of a larger work to obtain a full length of Stilbene Synthase encoding gene of the plant. RT-PCR (Reverse Transcriptase Polymerase Chain Reaction was performed using two degenerated primers to amplify the gene fragment. Ten published STS conserved amino acid sequences from various plant species from genebank were utilized to construct a pair of GGF2 (5' GTTCCACCTGCGAAGCAGCC 3' and GGR2 (5' CTGGATCGCACATCC TGGTG 3' primers. Both designed primers were predicted to be in the position of 334-354 and 897-916 kb of the gene respectively. Total RNA isolated from melinjo leaves was used as template for the RT-PCR amplification process using two-step technique. A collection of 0.58 DNA fragments was generated from RT-PCR amplification and met the expected results. The obtained DNA fragments were subsequently isolated, refined and sequenced. A nucleotide sequence analysis was accomplished by comparing it to the existed sts genes available in genebank. Homology analysis of the DNA fragments with Arachis hypogaea L00952 sts gene showed high similarity level. Taken together, the results are evidence that the amplified fragment obtained in this study is part of melinjo sts gene

  14. Increased production of free fatty acids in Aspergillus oryzae by disruption of a predicted acyl-CoA synthetase gene.

    Science.gov (United States)

    Tamano, Koichi; Bruno, Kenneth S; Koike, Hideaki; Ishii, Tomoko; Miura, Ai; Umemura, Myco; Culley, David E; Baker, Scott E; Machida, Masayuki

    2015-04-01

    Fatty acids are attractive molecules as source materials for the production of biodiesel fuel. Previously, we attained a 2.4-fold increase in fatty acid production by increasing the expression of fatty acid synthesis-related genes in Aspergillus oryzae. In this study, we achieved an additional increase in the production of fatty acids by disrupting a predicted acyl-CoA synthetase gene in A. oryzae. The A. oryzae genome is predicted to encode six acyl-CoA synthetase genes and disruption of AO090011000642, one of the six genes, resulted in a 9.2-fold higher accumulation (corresponding to an increased production of 0.23 mmol/g dry cell weight) of intracellular fatty acid in comparison to the wild-type strain. Furthermore, by introducing a niaD marker from Aspergillus nidulans to the disruptant, as well as changing the concentration of nitrogen in the culture medium from 10 to 350 mM, fatty acid productivity reached 0.54 mmol/g dry cell weight. Analysis of the relative composition of the major intracellular free fatty acids caused by disruption of AO090011000642 in comparison to the wild-type strain showed an increase in stearic acid (7 to 26 %), decrease in linoleic acid (50 to 27 %), and no significant changes in palmitic or oleic acid (each around 20-25 %).

  15. De novo Transcriptome Assembly of Common Wild Rice (Oryza rufipogon Griff.) and Discovery of Drought-Response Genes in Root Tissue Based on Transcriptomic Data.

    Science.gov (United States)

    Tian, Xin-Jie; Long, Yan; Wang, Jiao; Zhang, Jing-Wen; Wang, Yan-Yan; Li, Wei-Min; Peng, Yu-Fa; Yuan, Qian-Hua; Pei, Xin-Wu

    2015-01-01

    The perennial O. rufipogon (common wild rice), which is considered to be the ancestor of Asian cultivated rice species, contains many useful genetic resources, including drought resistance genes. However, few studies have identified the drought resistance and tissue-specific genes in common wild rice. In this study, transcriptome sequencing libraries were constructed, including drought-treated roots (DR) and control leaves (CL) and roots (CR). Using Illumina sequencing technology, we generated 16.75 million bases of high-quality sequence data for common wild rice and conducted de novo assembly and annotation of genes without prior genome information. These reads were assembled into 119,332 unigenes with an average length of 715 bp. A total of 88,813 distinct sequences (74.42% of unigenes) significantly matched known genes in the NCBI NT database. Differentially expressed gene (DEG) analysis showed that 3617 genes were up-regulated and 4171 genes were down-regulated in the CR library compared with the CL library. Among the DEGs, 535 genes were expressed in roots but not in shoots. A similar comparison between the DR and CR libraries showed that 1393 genes were up-regulated and 315 genes were down-regulated in the DR library compared with the CR library. Finally, 37 genes that were specifically expressed in roots were screened after comparing the DEGs identified in the above-described analyses. This study provides a transcriptome sequence resource for common wild rice plants and establishes a digital gene expression profile of wild rice plants under drought conditions using the assembled transcriptome data as a reference. Several tissue-specific and drought-stress-related candidate genes were identified, representing a fully characterized transcriptome and providing a valuable resource for genetic and genomic studies in plants.

  16. MT-PCR panel detection of canine parvovirus (CPV-2): Vaccine and wild-type CPV-2 can be difficult to differentiate in canine diagnostic fecal samples.

    Science.gov (United States)

    Meggiolaro, Maira N; Ly, Anna; Rysnik-Steck, Benjamin; Silva, Carolina; Zhang, Joshua; Higgins, Damien P; Muscatello, Gary; Norris, Jacqueline M; Krockenberger, Mark; Šlapeta, Jan

    2017-06-01

    Canine parvovirus (CPV-2) remains an important cause of devastating enteritis in young dogs. It can be successfully prevented with live attenuated CPV-2 vaccines when given at the appropriate age and in the absence of maternal antibody interference. Rapid diagnosis of parvoviral enteritis in young dogs is essential to ensuring suitable barrier nursing protocols within veterinary hospitals. The current diagnostic trend is to use multiplexed PCR panels to detect an array of pathogens commonly responsible for diarrhea in dogs. The multiplexed PCR assays do not distinguish wild from vaccine CPV-2. They are highly sensitive and detect even a low level of virus shedding, such as those caused by the CPV-2 vaccine. The aim of this study was to identify the CPV-2 subtypes detected in diagnostic specimens and rule out occult shedding of CPV-2 vaccine strains. For a total of 21 samples that tested positive for CPV-2 in a small animal fecal pathogens diagnostic multiplexed tandem PCR (MT-PCR) panel during 2014-2016 we partially characterized the VP2 gene of CPV-2. Vaccine CPV-2 strain, wild type CPV-2a subtypes and vaccine-like CPV-2b subtypes were detected. High copy number was indicative of wild-type CPV-2a presence, but presence of vaccine-like CPV-2b had a variable copy number in fecal samples. A yardstick approach to a copy number or C t -value to discriminate vaccine strain from a wild type virus of CPV-2 can be, in some cases, potentially misleading. Therefore, discriminating vaccine strain from a wild type subtype of CPV-2 remains ambitious. Copyright © 2017 Elsevier Ltd. All rights reserved.

  17. A case of pseudohypoaldosteronism type 1 with a mutation in the mineralocorticoid receptor gene

    Directory of Open Access Journals (Sweden)

    Se Eun Lee

    2011-02-01

    Full Text Available Pseudohypoaldosteronism type 1 (PHA1 is a rare form of mineralocorticoid resistance characterized in newborns by salt wasting with dehydration, hyperkalemia and failure to thrive. This disease is heterogeneous in etiology and includes autosomal dominant PHA1 owing to mutations of the NR3C2 gene encoding the mineralocorticoid receptor, autosomal recessive PHA1 due to mutations of the epithelial sodium channel (ENaC gene, and secondary PHA1 associated with urinary tract diseases. Amongst these diseases, autosomal dominant PHA1 shows has manifestations restricted to renal tubules including a mild salt loss during infancy and that shows a gradual improvement with advancing age. Here, we report a neonatal case of PHA1 with a NR3C2 gene mutation (a heterozygous c.2146_2147insG in exon 5, in which the patient showed failure to thrive, hyponatremia, hyperkalemia, and elevated plasma renin and aldosterone levels. This is the first case of pseudohypoaldosteronism type 1 confirmed by genetic analysis in Korea.

  18. Ectopic Expression of the Wild Grape WRKY Transcription Factor VqWRKY52 in Arabidopsis thaliana Enhances Resistance to the Biotrophic Pathogen Powdery Mildew But Not to the Necrotrophic Pathogen Botrytis cinerea.

    Science.gov (United States)

    Wang, Xianhang; Guo, Rongrong; Tu, Mingxing; Wang, Dejun; Guo, Chunlei; Wan, Ran; Li, Zhi; Wang, Xiping

    2017-01-01

    WRKY transcription factors are known to play important roles in plant responses to biotic stresses. We previously showed that the expression of the WRKY gene, VqWRKY52 , from Chinese wild Vitis quinquangularis was strongly induced 24 h post inoculation with powdery mildew. In this study, we analyzed the expression levels of VqWRKY52 following treatment with the defense related hormones salicylic acid (SA) and methyl jasmonate, revealing that VqWRKY52 was strongly induced by SA but not JA. We characterized the VqWRKY52 gene, which encodes a WRKY III gene family member, and found that ectopic expression in Arabidopsis thaliana enhanced resistance to powdery mildew and Pseudomonas syringae pv. tomato DC3000, but increased susceptibility to Botrytis cinerea , compared with wild type (WT) plants. The transgenic A. thaliana lines displayed strong cell death induced by the biotrophic powdery mildew pathogen, the hemibiotrophic P. syringe pathogen and the necrotrophic pathogen B. cinerea . In addition, the relative expression levels of various defense-related genes were compared between the transgenic A. thaliana lines and WT plants following the infection by different pathogens. Collectively, the results indicated that VqWRKY52 plays essential roles in the SA dependent signal transduction pathway and that it can enhance the hypersensitive response cell death triggered by microbial pathogens.

  19. Comparative analysis of the protein compositions between wild type and body color mutant of helicoverpa armigera adult

    International Nuclear Information System (INIS)

    He Lihua; Chen Jin'e; Liu Yan; Wang Yongqiang; Liu Peigang; Meng Zhiqi

    2012-01-01

    To gain an in-depth understanding of the fineness and regulation mechanism of body color mutant of Helicoverpa armigera Hbner, the protein composition differences between adult of dominant mutant, recessive mutant and wild type were studied using the SDS-PAGE combined with MALDI-TOF-TOF/MS and bioinformatics analysis. The results indicated that the protein composition of the dominant mutant and wild type had little difference. However, there were obvious differences between the recessive mutant and wild-type. Three specific stripe were chosen for mass spectrometry and bioinformatics analysis, and two types of proteins related to energy metabolism and cytoskeleton were identified. These findings suggested that the two types of proteins may be associated with occurrence and regulation of body color mutant traits of H. armigera. (authors)

  20. Wild-type MIC distributions for aminoglycoside and cyclic polypeptide antibiotics used for treatment of Mycobacterium tuberculosis infections.

    Science.gov (United States)

    Juréen, P; Angeby, K; Sturegård, E; Chryssanthou, E; Giske, C G; Werngren, J; Nordvall, M; Johansson, A; Kahlmeter, G; Hoffner, S; Schön, T

    2010-05-01

    The aminoglycosides and cyclic polypeptides are essential drugs in the treatment of multidrug-resistant tuberculosis, underscoring the need for accurate and reproducible drug susceptibility testing (DST). The epidemiological cutoff value (ECOFF) separating wild-type susceptible strains from non-wild-type strains is an important but rarely used tool for indicating susceptibility breakpoints against Mycobacterium tuberculosis. In this study, we established wild-type MIC distributions on Middlebrook 7H10 medium for amikacin, kanamycin, streptomycin, capreomycin, and viomycin using 90 consecutive clinical isolates and 21 resistant strains. Overall, the MIC variation between and within runs did not exceed +/-1 MIC dilution step, and validation of MIC values in Bactec 960 MGIT demonstrated good agreement. Tentative ECOFFs defining the wild type were established for all investigated drugs, including amikacin and viomycin, which currently lack susceptibility breakpoints for 7H10. Five out of seven amikacin- and kanamycin-resistant isolates were classified as susceptible to capreomycin according to the current critical concentration (10 mg/liter) but were non-wild type according to the ECOFF (4 mg/liter), suggesting that the critical concentration may be too high. All amikacin- and kanamycin-resistant isolates were clearly below the ECOFF for viomycin, and two of them were below the ECOFF for streptomycin, indicating that these two drugs may be considered for treatment of amikacin-resistant strains. Pharmacodynamic indices (peak serum concentration [Cmax]/MIC) were more favorable for amikacin and viomycin compared to kanamycin and capreomycin. In conclusion, our data emphasize the importance of establishing wild-type MIC distributions for improving the quality of drug susceptibility testing against Mycobacterium tuberculosis.