WorldWideScience

Sample records for wild anastrepha obliqua

  1. Influence of quantities of brewer yeast on the performance of Anastrepha obliqua wild females (Diptera, Tephritidae

    Directory of Open Access Journals (Sweden)

    Cresoni-Pereira Carla

    2001-01-01

    Full Text Available Using artificial solid diets, experiments were performed with Anastrepha obliqua (Macquart, 1835 wild females in order to verify the influence of different quantities of brewer yeast on the performance and compensation behavior to unbalanced diets ingestion. The observed parameters were egg production, ingestion, diet efficiency and survival in the reproductive phase. Results indicated that there was no compensatory ingestion to different quantities of yeast and that the diet with 12.5g of yeast provided the best performance. The absence of compensatory ingestion is discussed based on the yeast phagostimulation and on the costs involved in solid diets ingestion. The relation between the analyzed parameters and the protein quantities in the diet were discussed.

  2. Influence of quantities of brewer yeast on the performance of Anastrepha obliqua wild females (Diptera, Tephritidae)

    Energy Technology Data Exchange (ETDEWEB)

    Cresoni-Pereira, Carla; Zucoloto, Fernando Sergio [Universidade de Sao Paulo (USP), Ribeirao Preto, SP (Brazil). Faculdade de Filosofia, Ciencias e Letras. Dept. de Biologia

    2001-11-15

    Using artificial solid diets, experiments were performed with Anastrepha obliqua (Macquart, 1835) wild females in order to verify the influence of different quantities of brewer yeast on the performance and compensation behavior to unbalanced diets ingestion. The observed parameters were egg production, ingestion, diet efficiency and survival in the reproductive phase. Results indicated that there was no compensatory ingestion to different quantities of yeast and that the diet with 12.5g of yeast provided the best performance. The absence of compensatory ingestion is discussed based on the yeast phagostimulation and on the costs involved in solid diets ingestion. The relation between the analyzed parameters and the protein quantities in the diet were discussed. (author)

  3. Anastrepha ludens and Anastrepha serpentina (Diptera: Tephritidae) do not infest Psidium guajava (Myrtaceae), but Anastrepha obliqua occasionally shares this resource with Anastrepha striata in nature.

    Science.gov (United States)

    Birke, Andrea; Aluja, Martin

    2011-08-01

    This study examined whether economically important fruit fly species Anastrepha ludens (Loew), Anastrepha serpentina (Wiedemann), and Anastrepha obliqua (Macquart) (Diptera: Tephritidae) may opportunistically exploit guavas, Psidium guajava L. (Myrtaceae), growing near preferred natural hosts. We collected 3,459 kg of guavas and 895 kg of other known host species [sour orange, Citrus aurantium L.; grapefruit, Citrus paradisi Macfadyen; mango, Mangifera indica L.; white sapote, Casimiroa edulis La Llave and Lex.; sapote, Pouteria sapota (Jacq.); sapodilla, Manilkara zapota L.; and wild plum, Spondias purpurea L. and Spondias mombin L.] along an altitudinal gradient over a 4-yr period (2006-2009). Plants were growing in sympatry in 23 localities where the guavas are usually infested in the state of Veracruz, M6xico. The guava samples yielded 20,341 Anastrepha spp. pupae in total (overall mean, 5.88 pupae per kg of fruit). Confirming previous reports, Anastrepha fraterculus (Wiedemann) and Anastrepha striata (Schiner) were found heavily infesting guavas in Veracruz. Importantly, although we did not find evidence that A. ludens and A. serpentina are able to attack this valuable commodity, we document for the first time in the agriculturally important state of Veracruz that P. guajava is an alternative natural host plant of A. obliqua. We recovered two fruit in the mango-growing locality of la Vibora, Tlalixcoyan, that harbored larvae of A. striata and A. obliqua. This finding has important practical implications for management of A. obliqua. Over the entire altitudinal gradient, when individual fruit infestation was examined, a dynamic pattern of species dominance was unveiled with guavas growing below 800 m above sea level mainly attacked by A. striata and a progressive replacement with increasing altitude by A. fraterculus. Interestingly, most individual fruit examined (97%) harbored a single species of fruit fly, a finding that may be taken as evidence of

  4. Irradiation of Ceratitis capitata, Anastrepha fraterculus and Anastrepha obliqua larvae (Diptera: Tephritidae) on an artificial diet; Irradiacao de larvas de Ceratitis capitata, Anastrepha fraterculus e Anastrepha obliqua (Diptera: Tephritidae) em dieta artificial

    Energy Technology Data Exchange (ETDEWEB)

    Raga, A.; Sato, M.E.; Suplicy Filho, N.; Potenza, M.R. [Instituto Biologico, Sao Paulo, SP (Brazil); Yamazaki, M.C.R. [Instituto de Pesquisas Energeticas e Nucleares (IPEN), Sao Paulo, SP (Brazil)

    1992-01-01

    The aim of the experiment was to establish gamma radiation dose levels sufficient to prevent the emergence of adults, and thus to serve as parameters for disinfestation of hosts of the fruit-flies Ceratitis capitata, Anastrepha fraterculus, and Anastrepha obliqua. Four-, 5,6-, and 7-day-old larvae of the 3 species were tested. Pupation was unaffected by 40 Gy for C. capitata, and by 100 Gy for A. fraterculus and A. obliqua. Gamma radiation doses necessary to prevent development of adults from larvae were 30 Gy, 20 Gy and 20 Gy for C. capitata, A. obliqua respectively. (author). 10 refs, 6 tabs.

  5. Phylogeography of Anastrepha obliqua inferred with mtDNA sequencing.

    Science.gov (United States)

    Ruiz-Arce, Raul; Barr, Norman B; Owen, Christopher L; Thomas, Donald B; McPheron, Bruce A

    2012-12-01

    Anastrepha obliqua (Macquart) (Diptera: Tephritidae), the West Indian fruit fly, is a frugivorous pest that occasionally finds its way to commercial growing areas outside its native distribution. It inhabits areas in Mexico, Central and South America, and the Caribbean with occasional infestations having occurred in the southern tier states (California, Florida, and Texas) of the United States. This fly is associated with many plant species and is a major pest of mango and plum. We examine the genetic diversity of the West Indian fruit fly based on mitochondrial COI and ND6 DNA sequences. Our analysis of 349 individuals from 54 geographic collections from Mexico, Central America, the Caribbean, and South America detected 61 haplotypes that are structured into three phylogenetic clades. The distribution of these clades among populations is associated with geography. Six populations are identified in this analysis: Mesoamerica, Central America, Caribbean, western Mexico, Andean South America, and eastern Brazil. In addition, substantial differences exist among these genetic types that warrants further taxonomic review.

  6. Nonhost status of commercial Persea americana 'Hass' to Anastrepha ludens, Anastrepha obliqua, Anastrepha serpentina, and Anastrepha striata (Diptera: Tephritidae) in Mexico.

    Science.gov (United States)

    Aluja, Martín; Díaz-Fleischer, Francisco; Arredondo, José

    2004-04-01

    The objective of this study was to determine the host status in Mexico of commercially cultivated and marketed avocado, Persea americana (Mill.), 'Hass' to Anastrepha ludens (Loew), Anastrepha obliqua (Macquart), Anastrepha serpentina (Wiedemann), and Anastrepha striata (Schiner) (Diptera: Tephritidae). Experiments in Michoacán, Mexico, were carried out in six orchards located at three altitudes above sea level during two times (August-October 2001 and April-June 2002). They included choice ('Hass' avocado plus natural host) and no-choice foraging behavior tests on trees under field cages; no-choice, forced infestation trials on caged, fruit-bearing branches in the field, and with individual fruit under laboratory conditions; infestation trials using 'Hass' avocados left unprotected over 1 and 7 d on the ground of orchards; studies to ascertain depth of oviposition and determine egg hatchability; and experiments to determine susceptibility by using time elapsed since removal of fruit from tree as the experimental variable. We trapped adult Anastrepha (n = 7,936) in all orchards and dissected fruit (n = 7,695) from orchards and packing houses (n = 1,620) in search of eggs or larvae. Most (96.7%) A. ludens, A. obliqua, A. striata, and A. serpentina adults were captured in low-elevation orchards. No eggs or larvae were detected in any of the fruit from foraging behavior studies or dissected fruit from orchards or packing houses. Of 5,200 mature, intact fruit on trees in the field forcibly exposed to no-choice female oviposition activity (five females/fruit), we only found four fruit infested by A. ludens but no adults emerged. 'Hass' avocados only became marginally susceptible to attack by A. ludens (but not A. obliqua, A. serpentina, and A. striata) 24 h after being removed from the tree. Fruit placed on the ground in orchards (n = 3,600) were occasionally infested by Neosilba batesi (Curran) (Diptera: Lonchaeidae), a decomposer, but not Anastrepha spp. Based on our

  7. Phylogeography of West Indian fruit fly, Anastrepha obliqua, inferred with mtDNA sequencing

    Science.gov (United States)

    Anastrepha obliqua (Macquart) (Diptera: Tephritidae), the West Indian fruit fly, is a frugivorous pest that occasionally finds its way to commercial growing areas outside its native distribution. It inhabits areas in Mexico, Central and South America, and the Caribbean, with occasional infestations...

  8. Influence of male nutritional conditions on the performance and alimentary selection of wild females of Anastrepha obliqua (Macquart)(Diptera, Tephritidae)

    Energy Technology Data Exchange (ETDEWEB)

    Cresoni-Pereira, Carla; Zucoloto, Fernando Sergio [Universidade Federal de Sao Paulo (USP), Ribeirao Preto, SP (Brazil). Fac. de Filosofia, Ciencias e Letras. Dept. de Biologia], e-mail: cresoni@usp.br, e-mail: zucoloto@ffclrp.usp.br

    2006-04-15

    The behavior of A. obliqua females is regulated by endogenous and exogenous factors and among these the presence of males. Experiments were carried out to investigate whether the presence of males and their nutritional condition may affect the behavior of self-selection feeding and the performance of A. obliqua females. Females were sorted in groups containing yeast-deprived females and males, and non-yeast deprived females and males. The females were maintained apart from the males by a transparent plastic screen. Several yeast and sucrose combinations were offered to the females in a single diet block or in separate blocks. Ingestion, egg production, longevity and diet efficiency were determined. The non-yeast-deprived males positively influenced the females performance when the latter were fed with yeast and sucrose in distinct diet blocks. Performance was better in the groups without males and with yeast-deprived males where the females could not select the nutrient proportions (yeast and sucrose in a single diet block). (author)

  9. Effect of Resin Ducts and Sap Content on Infestation and Development of Immature Stages of Anastrepha obliqua and Anastrepha ludens (Diptera: Tephritidae) in Four Mango (Sapindales: Anacardiaceae) Cultivars.

    Science.gov (United States)

    Guillén, Larissa; Adaime, Ricardo; Birke, Andrea; Velázquez, Olinda; Angeles, Guillermo; Ortega, Fernando; Ruíz, Eliel; Aluja, Martín

    2017-04-01

    We determined the influence of resin ducts, sap content, and fruit physicochemical features of four mango cultivars (Criollo, Manila, Ataulfo, and Tommy Atkins) on their susceptibility to the attack of the two most pestiferous fruit fly species infesting mangoes in Mexico: Anastrepha ludens (Loew) and Anastrepha obliqua (Macquart). We performed three studies: 1) analysis of resin ducts in mango fruit exocarp to determine the density and area occupied by resin ducts in each mango cultivar, 2) assessment of mango physicochemical features including fruit sap content, and 3) a forced infestation trial under field conditions using enclosed fruit-bearing branches to expose mangoes to gravid A. ludens or A. obliqua females. Infestation rates, development time from egg to prepupae and pupae, pupal weight, and percent of adult emergence, were assessed. 'Ataulfo' and 'Tommy Atkins' cultivars exhibited the highest resin duct density and sap content, the lowest infestation rate, and had a negative effect on immature development and pupal weight. In sharp contrast, 'Manila' and 'Criollo' cultivars, with the lowest resin duct density and sap content, were highly susceptible to A. ludens and A. obliqua attack. We conclude that sap content and the number, size, and distribution of resin ducts as well as firmness in mango fruit exocarp are all involved in the resistance of mango to A. ludens and A. obliqua attack. © The Authors 2017. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  10. Susceptibility of 15 mango (Sapindales: Anacardiaceae) cultivars to the attack by Anastrepha ludens and Anastrepha obliqua (Diptera:Tephritidae) and the role of underdeveloped fruit as pest reservoirs: management implications

    Science.gov (United States)

    We evaluated the susceptibility of 15 mango cultivars to the attack of Anastrepha ludens and A. obliqua, the main Tephritid pests of this crop in Mexico. In a field experiment, bagged, fruit-bearing branches were exposed to gravid females of both fly species. Infestation rates, developmental time,...

  11. Influence of Pupation Substrate on Mass Production and Fitness of Adult Anastrepha obliqua Macquart (Diptera: Tephritidae) for Sterile Insect Technique Application.

    Science.gov (United States)

    Aceituno-Medina, Marysol; Rivera-Ciprian, José Pedro; Hernández, Emilio

    2017-10-16

    Tephritid mass-rearing systems require an artificial substrate for pupation. Pupation substrate characteristics influence the quality of insects produced. Coconut fiber, as an alternative to the conventional pupation substrate vermiculite, was evaluated for Anastrepha obliqua Macquart (Diptera: Tephritidae) pupation behavior (pupation patterns, distribution, respiration rate, and pupal weight) and adult fitness (adult eclosion time, flight ability, and male mating competitiveness). Pupation percentage at 24 h, pupal weight, and flight ability were not significantly affected by substrate type. Adult eclosion levels of 50% were reached at 29.7 and 41.6 h for coconut fiber and vermiculite, respectively. Pupae distribution patterns differed between substrates because the larval aggregation level was reduced during the pupation process in coconut fiber. The pupae aggregation was three times greater in vermiculite than in coconut fiber. A higher respiratory rate in the last days of pupation and adult eclosion were recorded in the insects maintained in coconut fiber. Coconut fiber suitability as a pupation substrate for quality mass production of pupae and its implications for sterile insect technique are discussed. © The Authors 2017. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For permissions, please email: journals.permissions@oup.com.

  12. Selección de Cepas de Hongos Entomopatógenos para el Manejo de Anastrepha obliqua (Macquart, 1835 (Diptera: Tephritidae en Colombia Selection of Strains of Entomopathogenic Fungi for Management of Anastrepha obliqua (Macquart, 1835 (Diptera: Tephritidae in Colombia

    Directory of Open Access Journals (Sweden)

    Armando Osorio-Fajardo

    2011-12-01

    Full Text Available Se evaluaron 15 cepas de los hongos entomopatógenos Beauveria bassiana y Metarhizium anisopliae sobre adultos de un día de edad de la mosca de la fruta Anastrepha obliqua. El trabajo se realizó con el fin de seleccionar las cepas más virulentas al insecto y estudiar el efecto sobre los adultos jóvenes cuando el hongo era aplicado antes de la emergencia. Mediante un screening con una concentración de 1x10(7 conidias/mL se seleccionaron las tres cepas más virulentas, siendo dos de ellas de Beauveria y una de Metarhizium, las cuales causaron mortalidades del 77%, 71% y 66%. Valores de CL50 de 2,38x10(6, 1,81x10(6 y 9,94x10(6 conidias/mL, respectivamente, fueron determinados para cada una de estas cepas y un TL50 respectivo de 48,12; 56 y 42,75 horas. No se encontraron diferencias significativas en la mortalidad entre hembras y machos. La aspersión de la CL90 de las cepas seleccionadas sobre el medio de pupación de la mosca de la fruta produjo 34-48% de mortalidad durante las 120 horas de evaluación. Los hongos entomopatógenos pueden ser utilizados fácilmente para el control biológico de A. obliqua aplicándolos de manera dirigida a los adultos jóvenes bajo la copa de los árboles, en programas de manejo integrado de plagas.Fifteen strains from entomopathogenic Beauveria bassiana and Metarhizium anisopliae fungi were evaluated on one day-old adults of Anastrepha obliqua fruit fly. Tested were carried out for selecting the most virulent strains and the effectiveness of their use on young adult when the entomopathogen were applied before emergence were studied too. A screening with a 1x10(7 conidia/mL concentration was used for selecting the three most pathogenic isolates, two from Beauveria and one from Metarhizium, having 77, 71 and 66% mortality. The LC50 for these isolates were 2.38x10(6, 1.81x10(6 and 9.94x10(6 conidia/mL, respectively, and a respective LT50 were 48.12, 56 and 42.75 hours. No significant differences were found

  13. Fitness of Mass-Reared Males of Anastrepha obliqua (Diptera: Tephritidae) Resulting From Mating Competition Tests in Field Cages.

    Science.gov (United States)

    Hernández, Emilio; Liedo, Pablo; Toledo, Jorge; Montoya, Pablo; Perales, Hugo; Ruiz-Montoya, Lorena

    2017-10-11

    The sterile insect technique uses males that have been mass-reared in a controlled environment. The insects, once released in the field, must compete to mate. However, the mass-rearing condition supposes a loss of fitness that will be noticeable by wild females. To compare the fitness of wild males and mass-reared males, three competition settings were established. In setting 1, wild males, mass-reared males and wild females were released in field cages. In setting 2, wild females and wild males were released without competition, and in setting 3, mass-reared males and mass-reared females were also released without competition. Male fitness was based on their mating success, fecundity, weight and longevity. The fitness of the females was measured based on weight and several demographic parameters. The highest percentage of mating was between wild males and wild females between 0800 and 0900 h in the competition condition, while the mass-reared males started one hour later. The successful wild males weighed more and showed longer mating times, greater longevity and a higher number of matings than the mass-reared males. Although the mass-reared males showed the lowest percentage of matings, their fecundity when mating with wild females indicated a high fitness. Since the survival and fecundity of wild females that mated with mass-reared males decreased to become similar to those of mass-reared females that mated with mass-reared males, females seem to be influenced by the type of male (wild or mass-reared). © The Authors 2017. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For permissions, please email: journals.permissions@oup.com.

  14. Visibility and Persistence of Marker Dyes and Effect on the Quality and Mating Competitiveness of Mass-Reared Flies (Diptera: Tephritidae): Anastrepha obliqua and Bisexual and Genetic Sexing (Tapachula-7) Strains of A. ludens.

    Science.gov (United States)

    Arredondo, José; Ruiz, Lia; López, Gladis; Díaz-Fleischer, Francisco

    2017-08-01

    Fluorescent dyes are commonly used in the sterile insect technique (SIT) for marking insects for a proper identification after recapture. However, the quality of the mark must be balanced against insect performance, because dyes can negatively affect some parameters of insect performance and reduce their effectiveness in control with the SIT. We determined the visibility and persistence and the effect of dyes on the quality of Anastrepha obliqua (Macquart) and Anastrepha ludens (Loew) (bisexual and genetic sexing strains) by testing four concentrations of a dye (Day-Glo) from 0 to 2.5 g dye/kg of pupae. Visibility and persistence of the mark were positively affected by dose and negatively affected by the length of time the samples were kept in a solution of 75% alcohol. However, upon dissection, even the lowest dose of dye was visible under a fluorescence microscope. Between dyed and undyed pupae (control), no significant differences were observed in rates of emergence, fliers and flight ability, and survival in two tests, with water and without food and without water and food, at any of the concentrations tested. Furthermore, no significant difference in mating competitiveness was detected between control pupae and those dyed at 1.0 and 2.5 g dye/kg pupae. We discuss our results with the possibility of reducing the dose of dye in these three flies, because the heads are large enough to capture sufficient particles to permit identification with the current methods of detection. © The Authors 2017. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  15. The Effect of Ginger Oil on the Sexual Performance of Anastrepha Males (Diptera: Tephritidae)

    National Research Council Canada - National Science Library

    Salvador Flores; J. Pedro Rivera; Emilio Hernandez; Pablo Montoya

    2011-01-01

    .... In this study, we evaluated the effect of ginger oil treatment on the sexual performance of males of 3 Anastrepha fruit fly species of economic importance (A. ludens (Loew), A. obliqua (Macquart), and A. serpentina (Wiedemann...

  16. Diversity of Anastrepha spp. (Diptera: Tephritidae) and associated braconid parasitoids from native and exotic hosts in southeastern Bahia, Brazil.

    Science.gov (United States)

    Silva, Janisete G; Dutra, Vivian S; Santos, Mirian S; Silva, Nívea M O; Vidal, Daniela B; Nink, Ricardo A; Guimarães, Jorge A; Araujo, Elton L

    2010-10-01

    We documented fruit fly-host associations and infestation rates over 5 yr in the state of Bahia, Brazil, by systematically collecting native and introduced fruits in backyard and commercial orchards, experimental stations, and patches of native vegetation. Fruit were collected in multiple sites in the southern and southernmost regions of Bahia. A total of 942.22 kg from 27 fruit species in 15 plant families was collected throughout this study. Of these, 15 plant species from six families were infested by Anastrepha species. A total of 11,614 fruit flies was reared from the fruit (5,178 females and 6,436 males). No specimens of Ceratitis capitata (Wiedemann) were recovered. Eleven Anastrepha species were recovered from the collected fruit: Anastrepha antunesi Lima (0.04%), Anastrepha distincta Greene (0.1%), Anastrepha fraterculus (Wiedemann) (53.5%), Anastrepha leptozona Hendel (4.5%), Anastrepha manihoti Lima (0.1%), Anastrepha montei Lima (1.0%), Anastrepha obliqua (Macquart) (33.0%), Anastrepha pickeli Lima (2.0%), Anastrepha serpentina (Wiedemann) (1.0%), Anastrepha sororcula Zucchi (3.0%), and Anastrepha zenildae Zucchi (1.8%). We recovered 1,265 parasitoids (Hymenoptera: Braconidae) from Anastrepha pupae. Three species of braconids were found to parasitize larvae of nine Anastrepha species. The most common parasitoid species recovered was Doryctobracon areolatus (Szépligeti) (81.7%), followed by Utetes anastrephae (Viereck) (12.2%) and Asobara anastrephae (Muesebeck) (6.1%). We report A. fraterculus infesting Malay apple Syzygium malaccense (L.) Merr. & L. M. Perry and A. fraterculus, A. sororcula, and A. zenildae infesting araza Eugenia stipitata McVaugh for the first time in Brazil.

  17. Parasitóides (Hymenoptera: Braconidae de Anastrepha Schiner (Diptera: Tephritidae no estado do Acre Parasitoids (Hymenoptera: Braconidae of Anastrepha Schiner (Diptera: Tephritidae in the state of Acre, Brazil

    Directory of Open Access Journals (Sweden)

    Marcílio José Thomazini

    2009-03-01

    Full Text Available Este trabalho relata a primeira ocorrência de parasitóides em moscas-das-frutas do gênero Anastrepha Schiner no estado do Acre. No município de Bujari foram encontrados os braconídeos Opius bellus Gahan (72,5%, Doryctobracon areolatus (Szépligeti (26,8% e Utetes anastrephae (Viereck (0,7% associados a A. obliqua (Macquart em frutos de taperebá (Spondias mombin L., com parasitismo de 29,5%. No município de Rio Branco, em frutos de goiaba (Psidium guajava L., ocorreu somente D. areolatus em A. obliqua com parasitismo de 2,7%.This paper records the first parasitoids occurrence on Anastrepha Schiner fruit flies in the state of Acre, Brazil. In the Bujari County there occurred the braconids Opius bellus Gahan (72.5%, Doryctobracon areolatus (Szépligeti (26.8% e Utetes anastrephae (Viereck (0.7% associated with A. obliqua (Macquart in tapereba fruits (Spondias mombin L., with parasitism of 29.5%. In guajava fruits (Psidium guajava L. at Rio Branco County, only D. areolatus on A. obliqua occurred, with parasitism of 2.7%.

  18. Species of Anastrepha (Diptera: Tephritidae) captured in a guava orchard (Psidium guajava L., Myrtaceae) in Boa Vista, Roraima, Brazil.

    Science.gov (United States)

    Marsaro Júnior, A L; Deus, E G; Ronchi-Teles, B; Adaime, R; Silva Júnior, R J

    2013-11-01

    The guava fruit (Psidium guajava) is among the most strongly affected by fruit flies in Brazil. In the Brazilian Amazon, 11 species of Anastrepha have been reported in guava orchards to date. This work aimed to identify the species of Anastrepha present in a guava orchard in the municipality of Boa Vista, determine the species infesting the fruits, and identify any parasitoids present. Two McPhail traps with food bait were installed and weekly collections were made between January and December 2008. Fruits were also collected systematically during this period, with a view to determining the association between host plant and tephritid species. Nine species of Anastrepha were identified, in addition to one specimen belonging to a probable new species. Anastrepha striata Schiner, Anastrepha sororcula Zucchi, Anastrepha obliqua (Macquart), and Anastrepha fraterculus (Wiedemann) were the dominant species in the orchard, accounting for 84.8% of all captured individuals. All females collected directly from fruits were A. striata. Doryctobracon areolatus (Szépligeti) was the only parasitoid species obtained. In this work, Anastrepha ethalea (Walker) is reported for the first time in the state of Roraima.

  19. Ocorrência do fungo entomopatogênico Isaria javanica (Frieder. & Bally Samson & Hywell-Jones (Fungi, Sordariomycetes em lagartas de Lonomia obliqua Walker (Lepidoptera, Saturniidae, Hemileucinae Occurrence of the entomopathogenic fungus Isaria javanica (Frieder. & Bally Samson & Hywell-Jones (Fungi, Sordariomycetes infecting Lonomia obliqua Walker (Lepidoptera, Saturniidae, Hemileucinae caterpillars

    Directory of Open Access Journals (Sweden)

    Alexandre Specht

    2009-01-01

    Full Text Available Este fungo foi isolado pela primeira vez de lagartas de L. obliqua de uma agregação em plátano (Platanus acerifolia (Aiton Wild - Platanaceae, em Bento Gonçalves, RS, Brasil. Após isolamento, purificação e caracterização, realizou-se um teste de patogenicidade com lagartas sadias de L. obliqua para corroborar, sua infectividade pelo postulado de Koch. Constatou-se correspondência morfológica e molecular entre o inóculo e o reisolado, comprovando sua patogenicidade a L. obliqua.It is recorded for the first time the occurrence of the entomopathogenic fungus Isaria javanica (Frieder. & Bally Samson & Hywell-Jones (Fungi: Sordariomycetes infecting Lonomia obliqua Walker (Lepidoptera: Saturniidae: Hemileucinae caterpillars. This fungus was isolated from L. obliqua individuals collected from Platanus acerifolia (Aiton Wild- Platanaceae in Rio Grande do Sul state, Brazil. After isolation, purification and characterization, fungal conidia were inoculated on healthy L. obliqua caterpillars and from dead caterpillars the fungal isolates were again obtained. New isolates and the original isolate did not differ when compared by morphological and molecular tests.

  20. Solar sterilization of abscised fruit: a cultural practice to reduce infestations of Anastrepha obliqua around orchards

    Science.gov (United States)

    Abscised mangoes, Mangifera indica L., of several varieties were stored under varying conditions of insolation, including no sun (stored in a laboratory), shade (stored under the shade of a mango tree), full sun (stored in direct view of the sun), and covered in a black plastic bag and stored in dir...

  1. Faunistic analysis of Anastrepha spp. (Diptera: Tephritidae) on a guava orchard under organic management in the municipality of Una, Bahia, Brazil

    Energy Technology Data Exchange (ETDEWEB)

    Dutra, Vivian S.; Santos, Mirian S; Souza Filho, Zilton A.; Silva, Janisete G. [Universidade Estadual de Santa Cruz (UESC), Ilheus, BA (Brazil). Dept. de Ciencias Biologicas; Araujo, Elton L. [Universidade Federal Rural do Semi-Arido, Mossoro, RN (Brazil). Dept. de Ciencias Vegetais

    2009-01-15

    We carried out a study to characterize fruit fly populations on an organic guava orchard (Psidium guajava cv. Paluma) in the municipality of Una, southern region of the state of Bahia, Brazil, using faunistic analysis of the adult fruit f y specimens captured in McPhail traps from January 2004 through March 2007. A total of 22,673 specimens of Anastrepha (15,306 females and 7,367 males) were captured. Thirteen species of Anastrepha were recorded. A. fraterculus and A. obliqua were the more frequent and dominant species, accounting for 90.1% of all females captured in the traps. A. fraterculus was the predominant species (more frequent, constant and dominant). The high value of the Simpson index (0.62) and the low values of Shannon-Wiener (0.83) and equitability (0.49) indices indicated the dominance and high frequency of A. fraterculus and A. obliqua on the guava orchard despite the presence of other fruit species as potential hosts of fruit flies. (author)

  2. Biochemical and biological properties of Lonomia obliqua bristle extract

    Directory of Open Access Journals (Sweden)

    A. M. Chudzinski-Tavassi

    2006-04-01

    Full Text Available Lonomia obliqua caterpillar is frequently seen in accidents with humans especially in the south of Brazil. Patients develop a hemorrhagic syndrome that can be treated with specific antilonomic serum. A consumptive coagulopathy was found to be the main cause of bleeding complications observed in patients after contact with L. obliqua. Studies revealed that L. obliqua caterpillar bristle extract (LOCBE displays a procoagulant activity that leads to intravascular thrombin formation, resulting in a special form of disseminated intravascular coagulation (DIC. Fibrinolysis seems to be secondary to the fibrin production, since no direct fibrinolytic activity was found in LOCBE. Two procoagulant toxins, a factor X activator (Losac and a prothrombin activator (Lopap, were isolated from LOCBE and characterized. Infusion of Lopap into experimental animals triggered a condition similar to that observed in human envenomation.

  3. A review on plant Cordia obliqua Willd. (Clammy cherry).

    Science.gov (United States)

    Gupta, Richa; Gupta, Ghanshyam Das

    2015-01-01

    Cordia obliqua Willd. plant (Common name-Clammy Cherry) belongs to family Boraginaceae. It is a medium-sized deciduous tree and very vigorous in growth. According to traditional system, it possesses anthelmintic, purgative, diuretic, expectorant, antipyretic, hepatoprotective and analgesic action. The fruits are edible and used as pickle. The gum obtained from mucilage is used for pasting sheets of paper and as matrix forming material in tablet formulations. Phytochemical investigations show the presence of alkaloids, flavonoids, phenolics, tannins and reducing sugar. Evaluation of pharmacological activities confirmed C. obliqua plant as antimicrobial, hypotensive, respiratory stimulant, diuretic and anti-inflammatory drug. A number of traditional activities of this plant still need scientific approval which will increase its medicinal potential. This review presents the Pharmacognostic properties, phytochemical constituents, traditional uses and biological activities reported for the plant and it will be helpful to explore the knowledge about Cordia obliqua Willd. for the researchers.

  4. Capture of Anastrepha suspensa and sterile male Ceratitis capitata (Diptera: Tephritidae) in multilure traps versus phase 4 traps

    Science.gov (United States)

    Field trials were conducted in south Florida to compare capture of wild Caribbean fruit flies, Anastrepha suspensa (Loew), and sterile male Mediterranean fruit flies, Ceratitis capitata (Wiedemann), in Multilure traps, which are McPhail-type traps that use an aqueous solution to retain attracted fli...

  5. Eucalyptus obliqua seedling growth in organic vs. mineral soil horizons

    Science.gov (United States)

    Barry, Karen M.; Janos, David P.; Nichols, Scott; Bowman, David M. J. S.

    2015-01-01

    Eucalyptus obliqua, the most widespread timber tree in Tasmania, is a pioneer after fire which can eliminate the organic layer of forest soil, exposing the underlying mineral soil. We compared seedling growth, mycorrhiza formation, and mineral nutrient limitation in organic layer vs. mineral soil. We grew E. obliqua seedlings separately in pots of organic layer and mineral soil in a glasshouse. Additional treatments of organic soil only, involved fully crossed methyl-bromide fumigation and fertilization. Fertilization comprised chelated iron for 121 days after transplant (DAT) followed by soluble phosphorus. At 357 DAT, whole plant dry weight was three times greater in ambient organic than in mineral soil. In organic soil, fumigation halved ectomycorrhiza abundance and reduced seedling growth at 149 DAT, but by 357 DAT when negative effects of fumigation on seedling growth had disappeared, neither fumigation nor fertilization affected mycorrhiza abundance. Iron fertilization diminished seedling growth, but subsequent phosphorus fertilization improved it. E. obliqua seedlings grow much better in organic layer soil than in mineral soil, although phosphorus remains limiting. The prevalent forestry practice of burning to mineral soil after timber harvest exposes a poor growth medium likely only partially compensated by fire-induced mineral soil alterations. PMID:25750650

  6. Eucalyptus obliqua seedling growth in organic versus mineral soil horizons

    Directory of Open Access Journals (Sweden)

    Karen eBarry

    2015-02-01

    Full Text Available Eucalyptus obliqua, the most widespread timber tree in Tasmania, is a pioneer after fire which can eliminate the organic layer of forest soil, exposing the underlying mineral soil. We compared seedling growth, mycorrhiza formation, and mineral nutrient limitation in organic layer versus mineral soil. We grew E. obliqua seedlings separately in pots of organic layer and mineral soil in a glasshouse. Additional treatments of organic soil only, involved fully crossed methyl-bromide fumigation and fertilization. Fertilization comprised chelated iron for 121 days after transplant (DAT followed by soluble phosphorus. At 357 DAT, whole plant dry weight was three times greater in ambient organic than in mineral soil. In organic soil, fumigation halved ectomycorrhiza abundance and reduced seedling growth at 149 DAT, but by 357 DAT when negative effects of fumigation on seedling growth had disappeared, neither fumigation nor fertilization affected mycorrhiza abundance. Iron fertilization diminished seedling growth, but subsequent phosphorus fertilization improved it. E. obliqua seedlings grow much better in organic layer soil than in mineral soil, although phosphorus remains limiting. The prevalent forestry practice of burning to mineral soil after timber harvest exposes a poor growth medium likely only partially compensated by fire-induced mineral soil alterations.

  7. Eucalyptus obliqua seedling growth in organic vs. mineral soil horizons.

    Science.gov (United States)

    Barry, Karen M; Janos, David P; Nichols, Scott; Bowman, David M J S

    2015-01-01

    Eucalyptus obliqua, the most widespread timber tree in Tasmania, is a pioneer after fire which can eliminate the organic layer of forest soil, exposing the underlying mineral soil. We compared seedling growth, mycorrhiza formation, and mineral nutrient limitation in organic layer vs. mineral soil. We grew E. obliqua seedlings separately in pots of organic layer and mineral soil in a glasshouse. Additional treatments of organic soil only, involved fully crossed methyl-bromide fumigation and fertilization. Fertilization comprised chelated iron for 121 days after transplant (DAT) followed by soluble phosphorus. At 357 DAT, whole plant dry weight was three times greater in ambient organic than in mineral soil. In organic soil, fumigation halved ectomycorrhiza abundance and reduced seedling growth at 149 DAT, but by 357 DAT when negative effects of fumigation on seedling growth had disappeared, neither fumigation nor fertilization affected mycorrhiza abundance. Iron fertilization diminished seedling growth, but subsequent phosphorus fertilization improved it. E. obliqua seedlings grow much better in organic layer soil than in mineral soil, although phosphorus remains limiting. The prevalent forestry practice of burning to mineral soil after timber harvest exposes a poor growth medium likely only partially compensated by fire-induced mineral soil alterations.

  8. Native and introduced host plants of Anastrepha fraterculus and Ceratitis capitata (Diptera: Tephritidae) in northwestern Argentina.

    Science.gov (United States)

    Ovruski, Sergio; Schliserman, Pablo; Aluja, Martín

    2003-08-01

    Wild or commercially grown, native and exotic fruit were collected in 30 localities in the Tucumán province (NW Argentina) from January 1990 to December 1995 to determine their status as hosts of Anastrepha fraterculus (Wiedemann) and/or Ceratitis capitata (Wiedemann), the only two fruit fly species of economic and quarantine importance in Argentina. A total of 84,094 fruit (3,466.1 kg) representing 33 species (7 native and 26 exotic) in 15 plant families were sampled. We determined the following 17 host plant associations: Annona cherimola Miller (Annonaceae), Citrus paradisi Macfadyn (Rutaceae), Diospyros kaki L. (Ebenaceae), Eugenia uniflora L., Psidium guajava L., Myrcianthes pungens (Berg) Legrand (Myrtaceae), Ficus carica L. (Moraceae), Juglans australis Grisebach (Juglandaceae), Mangifera indica L. (Anacardiaceae), Eriobotrya japonica (Thunb.) Lindl., Prunus armeniaca L., P. domestica L., and P. persica (L.) Batsch (Rosaceae) were infested by both A. fraterculus and C. capitata. Citrus aurantium L., Citrus reticulata Blanco, Citrus sinensis (L.) Osbeck (Rutaceae), and Passiflora caerulea L. (Passifloraceae) were only infested by Ceratitis capitata. Out of a total of 99,627 adults that emerged from pupae, 69,180 (approximately 69.5%) were Anastrepha fraterculus, 30,138 (approximately 30.2%) were C. capitata, and 309 (approximately 0.3%) were an unidentified Anastrepha species. Anastrepha fraterculus predominated in native plant species while C. capitata did so in introduced species. Infestation rates (number of larvae/kg of fruit) varied sharply from year to year and between host plant species (overall there was a significant negative correlation between fruit size and infestation level). We provide information on fruiting phenology of all the reported hosts and discuss our findings in light of their practical (e.g., management of A. fraterculus and C. capitata in citrus groves) implications.

  9. Volatiles emitted from tea plants infested by Ectropis obliqua larvae are attractive to conspecific moths.

    Science.gov (United States)

    Sun, Xiao-Ling; Wang, Guo-Chang; Gao, Yu; Zhang, Xin-Zhong; Xin, Zhao-Jun; Chen, Zong-Mao

    2014-10-01

    Herbivore-induced plant volatiles have been reported to play a role in the host-searching behavior of herbivores. However, next to nothing is known about the effect of volatiles emitted from tea plants infested by Ectropis obliqua larvae on the behavior of conspecific adults. Here, we found that tea plants infested by E. obliqua caterpillars for 24 h were more attractive to both virgin male and female E. obliqua adults than were intact, uninfested tea plants; moreover, mated female E. obliqua moths were more attracted by infested tea plants and preferentially oviposited on these plants, whereas male moths were repelled by infested plants once they had mated. Volatile analysis revealed that the herbivore infestation dramatically increased the emission of volatiles. Among these volatiles, 17 compounds elicited antennal responses from both male and female virginal moths. Using a Y-tube olfactometer, we found that 3 of the 17 chemicals, benzyl alcohol, (Z)-3-hexenyl hexanoate, and (Z)-3-hexenal, were attractive, but two compounds, linalool and benzyl nitril, were repellent to virgin male and female moths. One chemical, (Z)-3-hexenyl acetate, was attractive only to virgin males. Mated females were attracted by three compounds, (Z)-3-hexenyl hexanoate, (Z)-3-hexenyl acetate, and (Z)-3-hexenal; whereas mated males were repelled by (Z)-3-hexenol. The findings provide new insights into the interaction between tea plants and the herbivores, and may help scientists develop new measures with which to control E. obliqua.

  10. Mechanisms of acute kidney injury induced by experimental Lonomia obliqua envenomation.

    Science.gov (United States)

    Berger, Markus; Santi, Lucélia; Beys-da-Silva, Walter O; Oliveira, Fabrício Marcus Silva; Caliari, Marcelo Vidigal; Yates, John R; Vieira, Maria Aparecida Ribeiro; Guimarães, Jorge Almeida

    2015-03-01

    Lonomia obliqua caterpillar envenomation causes acute kidney injury (AKI), which can be responsible for its deadly actions. This study evaluates the possible mechanisms involved in the pathogenesis of renal dysfunction. To characterize L. obliqua venom effects, we subcutaneously injected rats and examined renal functional, morphological and biochemical parameters at several time points. We also performed discovery-based proteomic analysis to measure protein expression to identify molecular pathways of renal disease. L. obliqua envenomation causes acute tubular necrosis, which is associated with renal inflammation; formation of hematic casts, resulting from intravascular hemolysis; increase in vascular permeability and fibrosis. The dilation of Bowman's space and glomerular tuft is related to fluid leakage and intra-glomerular fibrin deposition, respectively, since tissue factor procoagulant activity increases in the kidney. Systemic hypotension also contributes to these alterations and to the sudden loss of basic renal functions, including filtration and excretion capacities, urinary concentration and maintenance of fluid homeostasis. In addition, envenomed kidneys increase the expression of proteins involved in cell stress, inflammation, tissue injury, heme-induced oxidative stress, coagulation and complement system activation. Finally, the localization of the venom in renal tissue agrees with morphological and functional alterations, suggesting also a direct nephrotoxic activity. In conclusion, the mechanisms of L. obliqua-induced AKI are complex involving mainly glomerular and tubular functional impairment and vascular alterations. These results are important to understand the mechanisms of renal injury and may suggest more efficient ways to prevent or attenuate the pathology of Lonomia's envenomation.

  11. Dopaol 2-keto- and 2,3-diketo-glycosides from Chelone obliqua (Scrophulariaceae)

    DEFF Research Database (Denmark)

    Franzyk, Henrik; Olsen, Carl Erik; Jensen, Søren Rosendal

    2004-01-01

    Two unique 2-(3,4-dihydroxyphenyl)ethyl glycosides, namely, dopaol beta-D-2-ketoglucopyranoside and dopaol beta-D-2,3-diketoglucopyranoside, were isolated from Chelone obliqua together with the iridoid glucoside catalpol, dopaol beta-D-glucopyranoside, descaffeoylverbascoside, and verbascoside. G...

  12. Dopaol 2-keto- and 2,3-diketoglycosides from Chelone obliqua

    DEFF Research Database (Denmark)

    Franzyk, Henrik; Olsen, Carl Erik; Jensen, Søren Rosendal

    2004-01-01

    Two unique 2-(3,4-dihydroxyphenyl)ethyl glycosides, namely, dopaol beta-D-2-ketoglucopyranoside and dopaol beta-D-2,3-diketoglucopyranoside, were isolated from Chelone obliqua together with the iridoid glucoside catalpol, dopaol beta-D-glucopyranoside, descaffeoylverbascoside, and verbascoside. G...

  13. Mechanisms of Acute Kidney Injury Induced by Experimental Lonomia obliqua Envenomation

    Science.gov (United States)

    Berger, Markus; Santi, Lucélia; Beys-da-Silva, Walter O.; Oliveira, Fabrício Marcus Silva; Caliari, Marcelo Vidigal; Yates, John R.; Ribeiro, Maria Aparecida; Guimarães, Jorge Almeida

    2015-01-01

    Background Lonomia obliqua caterpillar envenomation causes acute kidney injury (AKI), which can be responsible for its deadly actions. This study evaluates the possible mechanisms involved in the pathogenesis of renal dysfunction. Methods To characterize L. obliqua venom effects we subcutaneously injected rats and examined renal functional, morphological and biochemical parameters at several time points. We also performed discovery based proteomic analysis to measure protein expression to identify molecular pathways of renal disease. Results L. obliqua envenomation causes acute tubular necrosis, which is associated with renal inflammation; formation of hematic casts, resulting from intravascular hemolysis; increase in vascular permeability and fibrosis. The dilation of Bowman’s space and glomerular tuft is related to fluid leakage and intra-glomerular fibrin deposition, respectively, since tissue factor procoagulant activity increases in the kidney. Systemic hypotension also contributes to these alterations and to the sudden loss of basic renal functions, including filtration and excretion capacities, urinary concentration and maintenance of fluid homeostasis. In addition, envenomed kidneys increases expression of proteins involved in cell stress, inflammation, tissue injury, heme-induced oxidative stress, coagulation and complement system activation. Finally, the localization of the venom in renal tissue agrees with morphological and functional alterations, suggesting also a direct nephrotoxic activity. Conclusions Mechanisms of L. obliqua-induced AKI are complex involving mainly glomerular and tubular functional impairment and vascular alterations. These results are important to understand the mechanisms of renal injury and may suggest more efficient ways to prevent or attenuate the pathology of Lonomia’s envenomation. PMID:24798088

  14. A revision of the Anastrepha robusta species group (Diptera: Tephritidae)

    Science.gov (United States)

    The Anastrepha robusta species group is revised to include the following 29 species: A. amaryllis Tigrero (Ecuador), A. amazonensis, n. sp. (Brazil: Amazonas), A. bella, n. sp. (Panamá), A. binodosa Stone (Colombia, Brazil: Amazonas, Pará), A. concava Greene (Costa Rica to Ecuador and Brazil: Amazon...

  15. Host status of grapefruit and Valencia oranges for Anastrepha serpentina and Anastrepha ludens (Diptera: Tephritidae).

    Science.gov (United States)

    Mangan, Robert L; Thomas, Donald B; Moreno, Aleena M Tarshis

    2011-04-01

    Anastrepha serpentina (Wiedemann) (Diptera: Tephritidae) is sporadically captured in the Rio Grande Valley of Texas. Although its preferred hosts are in the Sapotaceae family, several varieties of Citrus, including grapefruit and oranges are listed as alternate hosts. Although Mexican fruit fly, Anastrepha ludens (Loew), is known to be a major pest of Citrus, doubt exists as to the status of Citrus as a breeding host for A. serpentina. To evaluate the host status of commercial Citrus for A. serpentina we compared oviposition and development with that of A. ludens under laboratory conditions with 'Rio Red' grapefruit (Citrus paradisi MacFayden) and 'Valencia' oranges [Citrus sinensis (L.) Osbeck] in different stages of maturity. Both fly species oviposited in early season fruit in which the eggs and larvae died in the fruit albedo. Survival of either species to the adult stage occurred in later season grapefruit. In oranges, no A. serpentina larvae survived compared with 150 A. ludens surviving to adults. Survival on both Citrus species was much lower for A. serpentina, only approximately 5% of eggs eclosed into larvae in grapefruit compared with approximatley 50% for A. ludens. In oranges approximately 16% of A. serpentina eggs eclosed compared with approximately 76% for A. ludens. In grapefruit, only one fourth as many A. serpentina larvae survived to the adult stage compared with A. ludens. Additional experiments were performed in a greenhouse on small, caged trees of la coma (Sideroxylon celastrinum H.B.K.), a Texas species of Sapotaceae. The A. serpentina females readily oviposited into these berries and normal adults emerged. The present low incidence of the adults, coupled with the high mortality during development of the larvae, suggests that Texas citrus is unlikely to support a breeding population of A. serpentina.

  16. Regurgitant derived from the tea geometrid Ectropis obliqua suppresses wound-induced polyphenol oxidases activity in tea plants.

    Science.gov (United States)

    Yang, Zi-Wei; Duan, Xiao-Na; Jin, Shan; Li, Xi-Wang; Chen, Zong-Mao; Ren, Bing-Zhong; Sun, Xiao-Ling

    2013-06-01

    Polyphenol oxidases (PPOs) have been reported to play an important role in protecting plants from attack by herbivores. However, little is known about their role in tea. Here, we investigated the effect of PPOs on interactions between tea plants and the tea geometrid Ectropis obliqua, one of the most important insect pests of tea. Jasmonic acid (JA) treatment resulted in increases in PPO activity, and the effect of JA was dose dependent. Ectropis obliqua caterpillars grew and developed more slowly on JA-treated tea plants than on control plants, and larval weight gains depended on the JA dosage. Artificial diet complemented with PPOs reduced the growth and survival rate of E. obliqua caterpillars, and there was a negative relationship between PPO level and larval growth and survival. Unlike mechanical wounding, which is an effective inducer of tea plant PPO activity, wounding plus the herbivore regurgitant or herbivore infestation suppressed the wound-induced PPO activities, especially at 4 days after treatment. These results suggest that PPOs are an important anti-herbivore factor in tea plants, defending them against E. obliqua larvae, and that E. obliqua larvae have evolved to elude the tea plant's defense by inhibiting the production of PPOs.

  17. Ammonium Acetate and Ammonium Bicarbonate in Traps for Anastrepha Fruit Flies

    Science.gov (United States)

    Fruit flies in the genus Anastrepha, especially the reproductive age females, are attracted to protein baits. Synthetic lures based on the principal components of protein degradation, especially ammonia along with acetic acid, were tested against three of the most economically important Anastrepha s...

  18. Identification and Expression Patterns of Putative Diversified Carboxylesterases in the Tea Geometrid Ectropis obliqua Prout

    Directory of Open Access Journals (Sweden)

    Liang Sun

    2017-12-01

    Full Text Available Carboxylesterases (CXEs belong to a family of metabolic enzymes. Some CXEs act as odorant-degrading enzymes (ODEs, which are reportedly highly expressed in insect olfactory organs and participate in the rapid deactivation of ester pheromone components and plant volatiles. The tea geometrid Ectropis obliqua Prout produces sex pheromones consisting of non-ester functional compounds but relies heavily on acetic ester plant volatiles to search for host plants and locate oviposition sites. However, studies characterizing putative candidate ODEs in this important tea plant pest are still relatively scarce. In the present study, we identified 35 candidate EoblCXE genes from E. obliqua chemosensory organs based on previously obtained transcriptomic data. The deduced amino acid sequences possessed the typical characteristics of the insect CXE family, including oxyanion hole residues, the Ser-Glu-His catalytic triad, and the Ser active included in the conserved pentapeptide characteristic of esterases, Gly-X-Ser-X-Gly. Phylogenetic analyses revealed that the EoblCXEs were diverse, belonging to several different insect esterase clades. Tissue- and sex-related expression patterns were studied via reverse-transcription and quantitative real-time polymerase chain reaction analyses (RT- and qRT-PCR. The results showed that 35 EoblCXE genes presented a diversified expression profile; among these, 12 EoblCXEs appeared to be antenna-biased, two EoblCXEs were non-chemosensory organ-biased, 12 EoblCXEs were ubiquitous, and nine EoblCXEs showed heterogeneous expression levels among different tissues. Intriguingly, two EoblCXE genes, EoblCXE7 and EoblCXE13, were not only strongly localized to antennal sensilla tuned to odorants, such as the sensilla trichodea (Str I and II and sensilla basiconica (Sba, but were also expressed in the putative gustatory sensilla styloconica (Sst, indicating that these two CXEs might play multiple physiological roles in the E. obliqua

  19. A new species of Anastrepha (Diptera: Tephritidae) from Colombia, Costa Rica and Panama

    Science.gov (United States)

    Anastrepha woodi, new species, is described and illustrated based on specimens from Colombia and Costa Rica. It is compared with A. loewi Stone, the most similar species, which is also redescribed....

  20. Electrophysiological and behavioural responses of the tea geometrid Ectropis obliqua (Lepidoptera: Geometridae) to volatiles from a non-host plant, rosemary, Rosmarinus officinalis (Lamiaceae).

    Science.gov (United States)

    Zhang, Zhengqun; Bian, Lei; Sun, Xiaoling; Luo, Zongxiu; Xin, Zhaojun; Luo, Fengjian; Chen, Zongmao

    2015-01-01

    A plant-based 'push-pull' strategy for Ectropis obliqua (Prout) (Lepidoptera: Geometridae) is being developed using semiochemicals in the volatiles of Rosmarinus officinalis (Lamiaceae). The aim of this study was to identify and quantify the bioactive components within R. officinalis by gas chromatography-electroantennographic detection (GC-EAD) and gas chromatography-mass spectrometry (GC-MS), and to test the antennal and behavioural responses of E. obliqua to these chemicals. The emission dynamics of bioactive chemicals was also monitored. GC-EAD experiments indicated that E. obliqua antennae responded to the following volatile compounds from R. officinalis: myrcene, α-terpinene, γ-terpinene, linalool, cis-verbenol, camphor, α-terpineol and verbenone, which were the minor constituents. Based on the dose-dependent antennal and behavioural responses of E. obliqua to these bioactive compounds, myrcene, γ-terpinene, linalool, cis-verbenol, camphor and verbenone were found to play a key role in repelling the moths, and the mixture that included all eight compounds was significantly more effective. The maximum emissions of these semiochemicals occurred at nightfall. The specifically bioactive compounds in R. officinalis volatiles are responsible for repelling E. obliqua adults. Results indicate that R. officinalis should be considered as a potential behaviour-modifying stimulus for 'push' components when developing 'push-pull' strategies for control of E. obliqua using semiochemicals. © 2014 Society of Chemical Industry.

  1. Effect of the gene transformer of Anastrepha on the somatic sexual development of Drosophila.

    Science.gov (United States)

    Ruiz, María-Fernanda; Sánchez, Lucas

    2010-01-01

    The gene transformer (tra) is the key regulatory memory device for sex determination in tephritid insects. The present manuscript addressed the question about the functional conservation of the tephritid Anastrepha Transformer protein to direct somatic sexual development in Drosophila (Drosophilidae). The transformer cDNA of Anastrepha encoding the putative full-length Tra protein was cloned in pUAST and introduced into Drosophila melanogaster. To express this protein, the GAL4-UAS system was used. The Anastrepha Tra protein induced the female-specific splicing of both dsx and fru pre-mRNAs in Drosophila XY male flies, so that these became transformed into females, though this transformation was incomplete (the sexually dimorphic foreleg basitarsus and the external terminalia were monitored). It was found that the degree of female transformation directly depended on the dose of Anastrepha tra and Drosophila transformer-2 (tra-2) genes, and that the Anastrepha Tra-Drosophila Tra2 complex is not as efficient as the Drosophila Tra-Tra2 complex at inducing the female-specific splicing of Drosophila dsx pre-mRNA. This can explain why the Anastrepha Tra protein cannot fully substitute for the endogenous Drosophila Tra protein.

  2. Precocious sexual signalling and mating in Anastrepha fraterculus (Diptera: Tephritidae) sterile males achieved through juvenile hormone treatment and protein supplements

    Science.gov (United States)

    Sexual maturation of Anastrepha fraterculus is a long process. Methoprene (a mimic of juvenile hormone) considerably reduces the time for sexual maturation in males. However, in other Anastrepha species, this effect depends on protein intake at the adult stage. Here, we evaluated the mating competit...

  3. Male Sexual Behavior and Pheromone Emission Is Enhanced by Exposure to Guava Fruit Volatiles in Anastrepha fraterculus.

    Directory of Open Access Journals (Sweden)

    Guillermo E Bachmann

    Full Text Available Plant chemicals can affect reproductive strategies of tephritid fruit flies by influencing sex pheromone communication and increasing male mating competitiveness.We explored whether exposure of Anastrepha fraterculus males to guava fruit volatiles and to a synthetic blend of volatile compounds released by this fruit affects the sexual performance of wild and laboratory flies. By means of bioassays and pheromone collection we investigated the mechanism underlying this phenomenon.Guava volatile exposure enhanced male mating success and positively affected male calling behavior and pheromone release in laboratory and wild males. Changes in male behavior appear to be particularly important during the initial phase of the sexual activity period, when most of the mating pairs are formed. Exposure of laboratory males to a subset of guava fruit volatiles enhanced mating success, showing that the response to the fruit might be mimicked artificially.Volatiles of guava seem to influence male mating success through an enhancement of chemical and physical signals related to the communication between sexes. This finding has important implications for the management of this pest species through the Sterile Insect Technique. We discuss the possibility of using artificial blends to improve the sexual competitiveness of sterile males.

  4. Morphological characterization of the reproductive system of irradiated Anastrepha fraterculus

    Energy Technology Data Exchange (ETDEWEB)

    Bartolucci, Andrea, E-mail: andreabartolucci@iscamen.com.a [Instituto de Sanidad y Calidad Agropecuaria de Mendoza (ISCAMEN), Mendoza (Argentina); Vera, M. Teresa [Consejo Nacional de Investigaciones Cientificas y Tecnicas (CONICET), (Argentina); Yusef, Veronica [Comision Nacional de Energia Atomica (Argentina). Centro Atomico Ezeiza; Oviedo, Andrea [Estacion Experimental Agroindustrial Obispo Colombres (EEAOC), Tucuman (Argentina)

    2006-07-01

    Field identification of released sterile insects is a major issue for eradication and suppression programs. Irradiated flies are normally identified by the presence of a fluorescent dye. When a fly lacks fluorescent dye, determination of gonadal state is necessary to identified between sterile or fertile flies. This is particularly relevant when population levels have decreased. Animal and identification is required to be as unequivocal as possible. Here we describe the reproductive system of irradiated Anastrepha fraterculus of different ages and we compare it with that of fertile flies in order to provide a diagnosis tool. Fertile and irradiated A. fraterculus were dissected from the day of emergence and until 15 days of age. Gross morphology was described and the gonads were measured. Germ cells were visualized in the testis. The reproductive systems of both males and females contained the same structures as other Anastrepha species. From day 1 to day 3, there were no detectable differences between irradiated and fertile males. The growing region encompassed half the testis total length and there was no free sperm in the seminal vesicle. On day 4 the presence of free sperm was seen in the seminal vesicle. At this stage irradiated males started differentiating from fertile ones: the growing region reduced in size and totally disappeared by day 11; sperm bundle zones occupied most of the testis; spermatids lost their triangular shape and sperm remained in the seminal vesicle without moving into the apical region. Testis length and width of irradiated males did not differ from fertile males. In females, the maturation of the ovaries involved a change in size that was more pronounced in the length of the ovary. This became noticeable at day 3. At this stage, the formation of yolk and the basal follicle began in fertile females and the oocyte had the same size as the trophocytes. From this point, the oocyte started growing. After day 8, the maturing oocyte reached

  5. Electroantennogram and behavioral responses of Anastrepha suspensa (Diptera: Tephritidae) to putrescine and ammonium bicarbonate lures

    Science.gov (United States)

    At present, the most effective synthetic lures for pest Anastrepha fruit flies are multi-component blends that include an ammonia-emitting substrate and the diamine synergist, putrescine (1,4-diaminobutane). Both chemicals are regarded as protein-feeding cues which result in female-biased attractio...

  6. Development of transgenic strains for the biological control of the Mexican fruit fly, Anastrepha ludens

    Science.gov (United States)

    The Mexican fruit fly, Anastrepha ludens, is a highly significant agricultural pest species that has been genetically transformed with a piggyBac¬-based transposon vector system using independent vector and transposase helper plasmids. Estimated germ-line transformation frequencies were approximate...

  7. Monitoring and application of reduced-risk pesticides for managing Anastrepha suspensa (Diptera: Tephritidae)

    Science.gov (United States)

    Tropical guava, Psidium guajava, is an important fruit crop that is rich in several nutrients including vitamin C. In the U. S. it is commonly cultivated in southern Florida, Texas and California. Caribbean fruit fly, Anastrepha suspensa Loew, is a key pest of tropical guava, causing significant yie...

  8. Quantifying individual fruit fly consumption with Anastrepha suspensa (Diptera: Tephritidae).

    Science.gov (United States)

    Nigg, H N; Schumann, R A; Yang, J J; Yang, L K; Simpson, S E; Etxeberria, E; Burns, R E; Harris, D L; Fraser, S

    2004-12-01

    We needed a technique to compare the consumption of baits by individual Carribbean fruit fly, Anastrepha suspensa (Loew). By improving consumption and determining individual dose, we could lower pesticide concentration while retaining bait/pesticide efficacy and potentially reduce the environmental impact of fruit fly bait/pesticide eradication methods. We report here a precise dye-based technique for the quantification of consumption by individual adult A. suspensa fruit flies. Fluorescein, measured at 491 nm, and cresol red, measured at 573 nm, were efficiently extracted with 0.1 M NaOH and quantified with a spectrophotometer. The lower limit for this method with 0.1% dye concentration is 300 nl consumed by an individual fly. Dye movement to the hindgut and possible defecation occurred in approximately 4 h; maximum ingestion occurred in approximately 1 h. Maximum experimental time is limited to 4 h. Flies preferred feeding upside down compared with right side up when given a choice; consumption was equal when flies were given no choice of feeding position. Thus, maximum bait/pesticide efficacy might be achieved with an upside-down presentation. Regurgitation led to a 100% overestimation of actual consumption with the J-tube presentation of food. Our individual fly consumption technique will be useful in comparing consumption in phagostimulant studies, estimating dose in oral toxicity tests, differentiating behavioral and physiological resistance in toxicant studies, ultimately leading to improved bait/pesticide methods and reduced environmental impact of area wide fruit fly eradication programs. This technique could be applied to studies of tephritid consumption, to the consumption of other insects, and to regurgitation studies.

  9. Effect of continuous rearing on courtship acoustics of five braconid parasitoids, candidates for augmentative biological control of Anastrepha species

    Science.gov (United States)

    The courtship acoustics of five species of parasitoid wasps (Hymenoptera: Braconidae), potential candidates for augmentative biological control of Anastrepha species (Diptera: Tephritidae), were compared between recently colonized individuals and those continuously reared 70-148 generations. During...

  10. Evaluation of mass trapping and bait stations to control Anastrepha (Diptera: Tephritidae) fruit flies in mango orchards of Chiapas, Mexico

    National Research Council Canada - National Science Library

    Salvador Flores; Enoc Gómez; Sergio Campos; Fredy Gálvez; Jorge Toledo; Pablo Liedo; Rui Pereira; Pablo Montoya

    2017-01-01

    ...) and Anastrepha ludens (Loew) (Diptera: Tephritidae) in mango orchards in Chiapas, Mexico. Among the bait stations evaluated, we found that a wide-mouth 2 L plastic bottle baited with Cera Trap...

  11. The gene transformer-2 of Anastrepha fruit flies (Diptera, Tephritidae) and its evolution in insects.

    Science.gov (United States)

    Sarno, Francesca; Ruiz, María F; Eirín-López, José M; Perondini, André L P; Selivon, Denise; Sánchez, Lucas

    2010-05-13

    In the tephritids Ceratitis, Bactrocera and Anastrepha, the gene transformer provides the memory device for sex determination via its auto-regulation; only in females is functional Tra protein produced. To date, the isolation and characterisation of the gene transformer-2 in the tephritids has only been undertaken in Ceratitis, and it has been shown that its function is required for the female-specific splicing of doublesex and transformer pre-mRNA. It therefore participates in transformer auto-regulatory function. In this work, the characterisation of this gene in eleven tephritid species belonging to the less extensively analysed genus Anastrepha was undertaken in order to throw light on the evolution of transformer-2. The gene transformer-2 produces a protein of 249 amino acids in both sexes, which shows the features of the SR protein family. No significant partially spliced mRNA isoform specific to the male germ line was detected, unlike in Drosophila. It is transcribed in both sexes during development and in adult life, in both the soma and germ line. The injection of Anastrepha transformer-2 dsRNA into Anastrepha embryos caused a change in the splicing pattern of the endogenous transformer and doublesex pre-mRNA of XX females from the female to the male mode. Consequently, these XX females were transformed into pseudomales. The comparison of the eleven Anastrepha Transformer-2 proteins among themselves, and with the Transformer-2 proteins of other insects, suggests the existence of negative selection acting at the protein level to maintain Transformer-2 structural features. These results indicate that transformer-2 is required for sex determination in Anastrepha through its participation in the female-specific splicing of transformer and doublesex pre-mRNAs. It is therefore needed for the auto-regulation of the gene transformer. Thus, the transformer/transfomer-2 > doublesex elements at the bottom of the cascade, and their relationships, probably represent

  12. Estudo de proteínas obtidas de hemolinfa de Lonomia obliqua com ação antiviral

    OpenAIRE

    Katia Nardelli Greco

    2009-01-01

    Diversos trabalhos têm demonstrado a presença de peptídeos bioativos em hemolinfa de insetos e seu potencial uso como agentes terapêuticos. Este trabalho buscou identificar e isolar proteínas da hemolinfa de Lonomia obliqua com ação antiviral. A adição de hemolinfa antes da infecção reduziu o título de poliovírus de 1,5x107 TCID50/mL no cultivo controle para 4x105 TCID50/mL e em aproximadamente 100 vezes o título do sarampo. Após cromatografia de gel filtração, foram obtidos 3 pools de prote...

  13. Physicochemical Evidence on Sublethal Neonicotinoid Imidacloprid Interacting with an Odorant-Binding Protein from the Tea Geometrid Moth, Ectropis obliqua.

    Science.gov (United States)

    Li, Hongliang; Zhao, Lei; Fu, Xiaobin; Song, Xinmi; Wu, Fan; Tang, Mingzhu; Cui, Hongchun; Yu, Jizhong

    2017-04-26

    Nowadays the excessive usage of neonicotinoid insecticides always results in residues in Chinese tea fields. It is not clear whether the insecticide residue at the sublethal level influences the physiological processes of tea pests. Here, we provide evidence of interaction between the neonicotinoid imidacloprid and a general odorant-binding protein, EoblGOBP2, from the tea geometrid moth, Ectropis obliqua. The interacting process was demonstrated through multiple fluorescence spectra, UV absorption spectra, circular dichroism (CD) spectra, molecular docking, etc. The binding mode was determined to be static (from 300 to 310 K) and dynamic quenching (from 290 to 300 K). The binding distance was calculated to be 6.9 nm on the basis of FRET theory. According to the thermodynamic analysis, the process was mainly driven by enthalpy (ΔH neonicotinoid insecticide at sublethal level may still affect the olfactory cognition of the tea geometrid moth to volatile compounds from tea leaves.

  14. Estudo imonoquimico do veneno da largata lonomia obliqua e desenvolvimento de um ELISA ("enzyme-linked immunosorbent assay") para detecção do veneno

    OpenAIRE

    Luciene Alves Moreira Marques

    1999-01-01

    Resumo: O envenenamento humano por lagartas de mariposas saturnídeas L. obliqua, leva a distúrbios hemostáticos, sendo o óbito, em geral, decorrente de insuficiência renal aguda ou de hemorragia maciça em órgãos nobres. Pouco se sabe sobre a composição bioquímica e imunológica do veneno destas lagartas. Esta dissertação descreve um estudo imunológico do veneno desta espécie, incluindo o desenvolvimento de um "Enzyme-Linked Immunosorbent Assay" (ELISA) para detecção do veneno de L. obliqua. As...

  15. Sexual Competitiveness of Anastrepha ludens (Diptera: Tephritidae) Males Exposed to Citrus aurantium and Citrus paradisi Essential Oils.

    Science.gov (United States)

    Morató, Santiago; Shelly, Todd; Rull, Juan; Aluja, Martin

    2015-04-01

    Males of the Mediterranean fruit fly (Ceratitis capitata (Wiedemann)) display increased mating competitiveness following exposure to the odor of certain host and nonhost plants, and this phenomenon has been used in the sterile insect technique to boost the mating success of released, sterile males. Here, we aimed to establish whether males of the Mexican fruit fly (Anastrepha ludens (Loew)) gain a mating advantage when exposed to the aroma of two preferred hosts, grapefruit (Citrus paradisi Macfadyen) and bitter orange (Citrus aurantium L.). Under seminatural conditions, we observed that, in trials using wildish males (from a young laboratory colony started with wild flies) exclusively, exposure to the aroma of bitter orange had no effect on male mating success but exposure to the odor grapefruit oil increased male mating success significantly. In a separate test involving both exposed and nonexposed wildish and mass-reared, sterile males, although wildish males were clearly more competitive than sterile males, exposure to grapefruit oil had no detectable effect on either male type. Exposure to oils had no effect on copulation duration in any of the experiments. We discuss the possibility that the positive effect of grapefruit essential oils on wildish male competitiveness may have been linked to exposure of females to grapefruit as a larval food, which may have imprinted them with grapefruit odors during pupal eclosion and biased their response as adults to odors of their maternal host. © The Authors 2015. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  16. Discovery of a new antiviral protein isolated Lonomia obliqua analysed by bioinformatics and real-time approaches.

    Science.gov (United States)

    Carmo, Ana Carolina Viegas; Yamasaki, Lilian Hiromi Tomanari; Figueiredo, Cristina Adelaide; da Silva Giovanni, Dalton Nogueira; de Oliveira, Maria Isabel; Dos Santos, Fabiana Cristina Pereira; Curti, Suely Pires; Rahal, Paula; Mendonça, Ronaldo Zucatelli

    2015-12-01

    This study presents a new recombinant protein that acts as a powerful antiviral (rAVLO-recombinant Antiviral protein of Lonomia obliqua). It was able to reduce the replication by 10(6) fold for herpes virus and by 10(4) fold for rubella virus. RT-PCR of viral RNA rAVLO treated infected cells also showed similar rate of inhibition in replication. The analysis of this protein by bioinformatics suggests that this protein is globular, secreted with a signal peptide and has the ability to bind to MHC class I. It was found that there are several protein binding sites with various HLA and a prevalence of α-helices in the N-terminal region (overall classified as a α/β protein type). BLAST similarity sequence search for corresponding cDNA did not reveal a similar sequence in Genbank, suggesting that it is from a novel protein family. In this study we have observed that this recombinant protein and hemolymph has a potent antiviral action. This protein was produced in a baculovirus/Sf-9 system. Therefore, these analyses suggest that this novel polypeptide is a candidate as a broad spectrum antiviral.

  17. A review of hymenopterous parasitoid guilds attacking Anastrepha spp. and Ceratitis capitata (Diptera: Tephritidae) in Argentina

    Energy Technology Data Exchange (ETDEWEB)

    Ovruski, Sergio M.; Orono, Luis E.; Nunez-Campero, Segundo; Schliserman, Pablo; Albornoz-Medina, Patricia; Bezdjian, Laura P.; Nieuwenhove, Guido A. Van; Martin, Cristina B. [Consejo Nacional de Investigaciones Cientificas y Tecnicas (CONICET), Tucuman (Argentina). Planta Piloto de Procesos Industriales Microbiologicos y Biotecnologia. Div. Control Biologico de Plagas

    2006-07-01

    This study provides detailed information on the diversity, abundance, guilds, host plant and host fly ranges, distribution, and taxonomic status of hymenopterous parasitoid species associated with Ceratitis capitata (Wiedemann) and Anastrepha spp. (A. fraterculus (Wiedemann) and A. schultzi Blanchard) in Argentina. Moreover, the article also argues future needs regarding the use of some parasitoid species as an alternative tool in fruit fly management programs of the National Fruit Fly Control and Eradication Program (PROCEM-Argentina). Data used for this work were obtained from numerous old and recent published articles on fruit fly parasitoids in Argentina. (author)

  18. Patrones de infestación por insectos xilófagos en renovales de Nothofagus obliqua Mirb. y Nothofagus dombeyi (Mirb. Oerst. (Fagales: Nothofagaceae Infestation patterns of xylophagous insects in second growth stands of Nothofagus obliqua Mirb. and Nothofagus dombeyi (Mirb. Oerst. (Fagales: Nothofagaceae

    Directory of Open Access Journals (Sweden)

    LORENA H. SUÁREZ

    2005-03-01

    Full Text Available Evaluamos los patrones de infestación por insectos xilófagos en renovales de Nothofagus obliqua y Nothofagus dombeyi en las provincias de Valdivia, Osorno y Llanquihue (Chile. Realizamos los análisis a dos escalas: en primer lugar se consideraron las variables diámetro a la altura del pecho (DAP y clase de copa del árbol hospedante (CC como predictores de daño por xilófagos a nivel del árbol. En segundo lugar se consideraron las variables densidad arbórea total, densidad de hospedante, número y cobertura de especies (estas últimas agrupadas en los estratos arbóreo, arbustivo, de herbáceas y de epífitas, y su asociación con el porcentaje de infestación a nivel de rodal. El área de estudio presentó una infestación promedio de 9,35 % en N. obliqua y 15,89 % en N. dombeyi. A nivel individual tanto el DAP como la CC se relacionan positivamente con la presencia de daño, sin embargo el DAP resultó mejor predictor tanto para N. obliqua como para N. dombeyi, aumentando la probabilidad de encontrar un árbol dañado con el aumento del DAP. A nivel de rodal se encontró que las variables estudiadas no se relacionan con la infestación en N. obliqua, mientras que en N. dombeyi renovales con mayor número de especies en el estrato arbustivo y/o con mayor densidad de rodal y hospedante presentaron menores niveles de infestaciónInfestation patterns of xylophagous insects were evaluated in second growth stands of Nothofagus obliqua and Nothofagus dombeyi in Valdivia, Osorno and Llanquihue provinces of Chile. The analysis addressed two scales. First, at the individual level, diameter at breast height (DBH and canopy class (CC of the host tree were used as predictor traits of xylophagous damage. Second, at the stand level, variables such as total tree density, host density, species richness and cover (arboreal, shrubby, herbaceous and epiphytic strata and their asociation with infestation average were considered. The infestation mean was 9

  19. Effect of cryopreservation on the pre-hatching behavior in the Mexican fruit fly Anastrepha ludens Loew (Diptera, Tephritidae)

    Science.gov (United States)

    In a sampling of untreated embryos of Mexican fruit fly, Anastrepha ludens, the cumulative hatch percentage was 84.77±7.8% of which ~70% of the larvae eclosed through the posterior pole of the egg. This is due to an unusual and seemingly energy demanding act of flipping of the fully developed pre-ha...

  20. Incipient speciation revealed in Anastrepha fraterculus (Diptera; Tephritidae) by studies on mating compatibility, sex pheromones, hybridisation and cytology

    Science.gov (United States)

    It is suggested that the nominal species Anastrepha fraterculus is a species complex and previous studies showed high levels of pre-zygotic isolation between two laboratory strains from Argentina and Peru. To further analyze this observation, experiments were carried out on the same populations and...

  1. Large scale artificial rearing of Anastrepha sp.1 aff. fraterculus (Diptera: Tephritidae in Brazil

    Directory of Open Access Journals (Sweden)

    Julio Marcos Melges Walder

    2014-08-01

    Full Text Available Some species of the genus Anastrepha (Diptera: Tephritidae are successfully managed by matching the sterile insect technique with parasitoid releases. Such strategies used in integrated pest management can be implemented only where insect mass-rearing programs are feasible. In this study, we show the process of domestication, rearing technology and quality control data obtained from 54 generations of Anastrepha sp.1 aff. fraterculus (Wiedemann, 1830 kept under fully artificial conditions. Eggs were collected by an artificial oviposition panel consisting of one side of the cage made of blue voile fabric externally covered with a thin layer of silicon rubber. They were then air-bubbled in water at 25 ºC for 48 h before seeding. Larvae were reared on the regular laboratory artificial diet with 66 % of agar reduction turning over a semi-liquid diet, which reduced costs and improved insect quality. The adult and larval diets were composed of local ingredients including hydrolyzed yeast. When large-scale production of this fly is contemplated, the critical stage is larval development. This system of artificial rearing for A. fraterculus sp.1 developed in Brazil, allows for the production of a large number of insects of excellent quality using local ingredients and less agar in diet composition than the original medium used for this species. By reducing the interval of egg collection, the system might be optimized in terms of insect yield and, therefore, meet the demands of A. fraterculus sp.1 with regard to integrated pest management purposes.

  2. [Fruit flies (Diptera: Tephritidae) and their parasitoids (Hymenoptera: Braconidae) associated to host plants in the southern region of Bahia State].

    Science.gov (United States)

    Bittencourt, M A L; da Silva, A C M; Silva, V E S; Bomfim, Z V; Guimarães, J A; de Souza Filho, M F; Araujo, E L

    2011-01-01

    The association among Anastrepha species, braconid parasitoids and host fruits in southern Bahia is recorded. Doryctobracon areolatus (Szépligeti) was associated with A. serpentina (Wied.) in Pouteria caimito, A. bahiensis Lima in Helicostylis tomentosa, A. sororcula Zucchi in Eugenia uniflora, and A. obliqua (Macquart) in Spondias purpurea. Anatrepha obliqua was unique in fruits of Averrhoa carambola, but associated with D. areolatus, Asobara anastrephae (Muesebeck) and Utetes anastrephae (Viereck). In Achras sapota, A. serpentina was associated with A. anastrephae and D. areolatus, while in Psidium guajava, A. fraterculus (Wied.) and A. sororcula were associated with D. areolatus and U. anastrephae.

  3. 7 CFR 305.31 - Irradiation treatment of imported regulated articles for certain plant pests.

    Science.gov (United States)

    2010-01-01

    ... fruit fly 70 Anastrepha obliqua West Indian fruit fly 70 Anastrepha serpentina Sapote fruit fly 100 Anastrepha suspensa Caribbean fruit fly 70 Aspidiotus destructor Coconut scale 150 Bactrocera jarvisi Jarvis fruit fly 100 Bactrocera tryoni Queensland fruit fly 100 Brevipalpus chilensis False red spider mite 300...

  4. Co-Infestation and Spatial Distribution of Bactrocera carambolae and Anastrepha spp. (Diptera: Tephritidae) in Common Guava in the Eastern Amazon.

    Science.gov (United States)

    Deus, E G; Godoy, W A C; Sousa, M S M; Lopes, G N; Jesus-Barros, C R; Silva, J G; Adaime, R

    2016-01-01

    Field infestation and spatial distribution of introduced Bactrocera carambolae Drew and Hancock and native species of Anastrepha in common guavas [Psidium guajava (L.)] were investigated in the eastern Amazon. Fruit sampling was carried out in the municipalities of Calçoene and Oiapoque in the state of Amapá, Brazil. The frequency distribution of larvae in fruit was fitted to the negative binomial distribution. Anastrepha striata was more abundant in both sampled areas in comparison to Anastrepha fraterculus (Wiedemann) and B. carambolae The frequency distribution analysis of adults revealed an aggregated pattern for B. carambolae as well as for A. fraterculus and Anastrepha striata Schiner, described by the negative binomial distribution. Although the populations of Anastrepha spp. may have suffered some impact due to the presence of B. carambolae, the results are still not robust enough to indicate effective reduction in the abundance of Anastrepha spp. caused by B. carambolae in a general sense. The high degree of aggregation observed for both species suggests interspecific co-occurrence with the simultaneous presence of both species in the analysed fruit. Moreover, a significant fraction of uninfested guavas also indicated absence of competitive displacement. © The Author 2016. Published by Oxford University Press on behalf of the Entomological Society of America.

  5. Controle químico de Anastrepha fraterculus (Wied. (Diptera: Tephritidae em laboratório Chemical control of Anastrepha fraterculus (Wied. (Diptera: Tephritidae in laboratory

    Directory of Open Access Journals (Sweden)

    Priscila Lang Scoz

    2004-12-01

    Full Text Available O efeito de quatro novos grupos químicos de inseticidas incluindo avermectina (benzoato de emamectina, éter piretróide (etofemprox, neoniconitnóide (imidacloprid, thiacloprid e thiamethoxan e naturalyte (spinosad foram avaliados em laboratório (25 ± 3ºC, umidade relativa de 70 ± 10% e fotofase de 12 horas, visando ao controle de adultos e ovos/larvas de Anastrepha fraterculus comparando-os com os fosforados fenthion e thrichlorphon. O benzoato de emamectina não foi eficiente no controle de adultos de A. fraterculus via contato e ingestão. O etofenprox, imidacloprid, spinosad e thiamethoxan foram eficientes no controle de adultos de A. fraterculus via contato e ingestão, proporcionando maior mortalidade via ingestão. Os novos inseticidas não provocaram mortalidade significativa de ovos/larvas de A. fraterculus localizados no interior de maçãs, enquanto que os fosforados fenthion e thrichlorphon resultaram em 100% de mortalidade das fases imaturas e adultos. Os novos inseticidas apresentam potencial para uso nas iscas tóxicas, substituindo os fosforados para o controle de adultos.The South American Fruit Fly, Anastrepha fraterculus is one of the most important pest of temperate fruit crops. The effect of four new inseticide groups to replace organophosphate compounds for A. fraterculus control was evaluated under laboratory conditions (25 ± 3ºC, relative humity of 70 ± 10% and 12:12 L:D. Emamectin benzoate, etofenprox, imidacloprid, spinosad, thiacloprid and thiamethoxan were evaluated to control adults by contact and ingestion and against eggs/larvae inside apple fruits compared with fenthion and thrichlorphon. Emamectin benzoate was not efficient to control adults of A. fraterculus by contact and ingestion. Etofenprox, imidacloprid, spinosad and thiamethoxan were efficient to control adults by contact and ingestion being more toxic by ingestion. No new insecticide controlled eggs/larvae inside apple fruit while organophosphate

  6. Update of host plant list of Anastrepha fraterculus and Ceratitis capitata in Argentina

    Energy Technology Data Exchange (ETDEWEB)

    Orono, Luis E.; Albornoz-Medina, Patricia; Nunez-Campero, Segundo; Nieuwenhove, Guido A. van; Bezdjian, Laura P.; Martin, Cristina B.; Schliserman, Pablo; Ovruski, Sergio M. [Consejo Nacional de Investigaciones Cientificas y Tecnicas (CONICET), Tucuman (Argentina). Planta Piloto de Procesos Industriales Microbiologicos y Biotecnologia. Div. Control Biologico de Plagas

    2006-07-01

    The study displays a complete picture of the host range of the two economically important fruit fly species in Argentina, the native Anastrepha fraterculus (Wiedemann) (South American Fruit Fly) and the exotic Ceratitis capitata (Wiedemann) (Mediterranean Fruit Fly or Medfly). This work provides information on the fruit type of each plant species, associated tephritid species, habitat where the fruit was collected, geographical location of each fruit collection area (latitude, longitude, and altitude), phyto geographic regions where each area is located, as well as a general description of the landscape characteristics of those habitats where the fruit samples with fly larvae were collected. A complete, detailed bibliographic review was made in order to provide all the relevant information needed for host use in natural setting. (author)

  7. New species and host plants of Anastrepha (Diptera: Tephritidae) primarily from Peru and Bolivia.

    Science.gov (United States)

    Norrbom, Allen L; Rodriguez, Erick J; Steck, Gary J; Sutton, Bruce A; Nolazco, Norma

    2015-11-16

    Twenty-eight new species of Anastrepha are described and illustrated: A. acca (Bolivia, Peru), A. adami (Peru), A. amplidentata (Bolivia, Peru), A. annonae (Peru), A. breviapex (Peru), A. caballeroi (Peru), A. camba (Bolivia, Peru), A. cicra (Bolivia, Peru), A. disjuncta (Peru), A. durantae (Peru), A. echaratiensis (Peru), A. eminens (Peru), A. ericki (Peru), A. gonzalezi (Bolivia, Peru), A. guevarai (Peru), A. gusi (Peru), A. kimi (Colombia, Peru), A. korytkowskii (Bolivia, Peru), A. latilanceola (Bolivia, Peru), A. melanoptera (Peru), A. mollyae (Bolivia, Peru), A. perezi (Peru), A. psidivora (Peru), A. robynae (Peru), A. rondoniensis (Brazil, Peru), A. tunariensis (Bolivia, Peru), A. villosa (Bolivia), and A. zacharyi (Peru). The following host plant records are reported: A. amplidentata from Spondias mombin L. (Anacardiaceae); A. caballeroi from Quararibea malacocalyx A. Robyns & S. Nilsson (Malvaceae); A. annonae from Annona mucosa Jacq. and Annona sp. (Annonaceae); A. durantae from Duranta peruviana Moldenke (Verbenaceae); and A. psidivora from Psidium guajava L. (Myrtaceae).

  8. The gene transformer of anastrepha fruit flies (Diptera, tephritidae and its evolution in insects.

    Directory of Open Access Journals (Sweden)

    María Fernanda Ruiz

    Full Text Available In the tephritids Ceratitis capitata and Bactrocera oleae, the gene transformer acts as the memory device for sex determination, via an auto-regulatory function; and functional Tra protein is produced only in females. This paper investigates the evolution of the gene tra, which was characterised in twelve tephritid species belonging to the less extensively analysed genus Anastrepha. Our study provided the following major conclusions. Firstly, the memory device mechanism used by this gene in sex determination in tephritids likely existed in the common ancestor of the Ceratitis, Bactrocera and Anastrepha phylogenetic lineages. This mechanism would represent the ancestral state with respect to the extant cascade seen in the more evolved Drosophila lineage. Secondly, Transformer2-specific binding intronic splicing silencer sites were found in the splicing regulatory region of transformer but not in doublesex pre-mRNAs in these tephritids. Thus, these sites probably provide the discriminating feature for the putative dual splicing activity of the Tra-Tra2 complex in tephritids. It acts as a splicing activator in dsx pre-mRNA splicing (its binding to the female-specific exon promotes the inclusion of this exon into the mature mRNA, and as a splicing inhibitor in tra pre-mRNA splicing (its binding to the male-specific exons prevents the inclusion of these exons into the mature mRNA. Further, a highly conserved region was found in the specific amino-terminal region of the tephritid Tra protein that might be involved in Tra auto-regulatory function and hence in its repressive splicing behaviour. Finally, the Tra proteins conserved the SR dipeptides, which are essential for Tra functionality.

  9. Distribución natural de Nothofagus alpina y Nothofagus obliqua (nothofagaceae en Argentina, dos especies de primera importancia forestal de los bosques templados norpatagónicos Natural distribution of Nothofagus alpina and Nothofagus obliqua (Nothofagaceae in Argentina, two productively important tree species of the North Patagonian temperate forests

    Directory of Open Access Journals (Sweden)

    Yamila Sabatier

    2011-06-01

    Full Text Available Conocer la distribución natural de cualquier especie es esencial para poder planificar su conservación o uso. El Raulí [Nothofagus alpina (Poepp. & Endl. Oerst. = Nothofagus nervosa (Phil. Dim. et Mil.] y el Roble Pellín [Nothofagus obliqua (Mirb. Oerst. ssp. obliqua] son dos especies forestales de primera importancia en los bosques norpatagónicos, y objetos de un programa de domesticación en curso. En base al cruce de capas de información digital de estudios previos verificada por informantes locales calificados, por controles de campo y por interpretación sobre pantalla de imágenes provistas libremente por Google Earth, se mapeó la distribución natural de ambas especies en Argentina. La presencia del Raulí se registra sobre una superficie de 79.636 ha, mientras que sobre 33.859 ha se desarrollan bosques con presencia de Roble Pellín. La mayor parte de estas superficies se encuentran protegidas por el sistema de Parques Nacionales (97 % del área ocupada con Raulí y 83 % de la ocupada con Roble Pellín, sin embargo varios bosques relevantes para la conservación se hallan bajo jurisdicción de la Provincia de Neuquén, lo cual debería ser considerado al momento de planear una estrategia de conservación para ambas especies.Knowing the natural range of any species is essential to plan its conservation or use. The South-American beeches Raulí [Nothofagus alpina (Poepp. & Endl. Oerst. = Nothofagus nervosa (Phil. Dim. et Mil.] and Roble Pellín [Nothofagus obliqua (Mirb. Oerst. ssp. obliqua] are two important forest tree species of the North Patagonian forests, and the object of a current domestication program. Natural distribution of both beeches in Argentina was mapped based on digital information of previous works which was verified by local qualified informants, ground control check and visual interpretation of images freely provided by Google Earth. Raulí is present over a surface of 79,636 ha, while 33,859 ha are occupied by

  10. Comportamento sexual de Anastrepha sororcula Zucchi (Diptera, Tephritidae em laboratório Sexual behavior of Anastrepha sororcula Zucchi (Diptera, Tephritidae in laboratory

    Directory of Open Access Journals (Sweden)

    Michelli C. N. Facholi-Bendassolli

    2006-09-01

    Full Text Available Anastrepha sororcula Zucchi, 1979, é uma das espécies de mosca-das-frutas mais disseminadas no País, sendo considerada a praga-chave que causa os maiores danos à produção de goiaba (Psidium guajava L., 1758 no Brasil. Em vista da importância desta espécie no complexo de pragas naturais da fruticultura brasileira e, em face à escassez de dados sobre sua biologia e comportamento, este trabalho teve por objetivo obter informações sobre a idade de maturação sexual de A. sororcula em laboratório e descrever seu comportamento reprodutivo. Os machos atingiram a maturidade sexual entre 7 e 18 dias após a emergência, com a maioria dos indivíduos tornando-se sexualmente maduros entre 10 e 13 dias de idade. Exibiram comportamento de sinalização às fêmeas, caracterizado pela distensão da região pleural do abdome, formando uma pequena bolsa de cada lado e, eversão de uma diminuta bolsa membranosa de cutícula retal que circunda a área anal. Durante este processo, os machos realizaram rápidos movimentos de vibração das asas, produzindo sinais audíveis. Uma gotícula foi liberada da região anal durante os movimentos de vibração alar. Após a atração das fêmeas, os machos realizaram uma série de movimentos elaborados de cortejo. As fêmeas alcançaram a maturação sexual entre 14 e 24 dias da emergência, com a maioria tornando-se sexualmente madura aos 19 dias de idade. A exibição diária das atividades sexuais foi confinada quase que exclusivamente ao período das 16:00-17:30h. A. sororcula apresentou um acentuado padrão de protandria.Anastrepha sororcula Zucchi, 1979, is a fruit fly species that can be considered a key pest to the production of guava (Psidium guajava L., 1758, fruit tree which has a wide distribution in Brazil. In view of the importance of this species as a natural pest of Brazilian horticulture and, considering the lack of data about its biology and behavior, the aim of this paper is to obtain

  11. Effect of cold storage on larval and adult Anastrepha ludens (Diptera: Tephritidae) viability in commercially ripe, artificially infested Persea americana 'Hass'.

    Science.gov (United States)

    Aluja, M; Díaz-Fleischer, F; Arredondo, J; Valle-Mora, J; Rull, J

    2010-12-01

    Commercially ripe 'Hass' avocados, Persea americana Mill, artificially exposed to wild Anastrepha ludens (Loew) (Diptera: Tephritidae) females 24 h after harvest were placed in a cold storage facility to determine the effect of low temperature on larval survival and adult viability. Fruit were left for 3, 6, 9, and 12 d in a cold room at 5 degrees C followed by a 20-25-d period at ambient temperature to allow for larval development and pupation. Hass avocados and grapefruit, Citrus paradisi Macfadyen, maintained at ambient temperature served as controls. Overall, only 0.23% of the Hass avocados and 19.30% of the grapefruit were infested. The number of infested fruit increased with decreasing exposure time to cold. Puparia from cold-treated Hass avocados were significantly smaller than those stemming from cold-treated grapefruit. Hass avocados exposed for 12 d to 5 degrees C yielded no puparia, and those exposed for 6 and 9 d yielded 22 and two puparia, respectively, but no adults. Although Hass avocados exposed to cold temperature for 3 d yielded adults that reached sexual maturity (N = 16), females laid inviable eggs. Grapefruit exposed to cold for 12 d yielded normal-sized puparia (but no adults), whereas those exposed over 9 d yielded females able to lay viable eggs. We conclude that exposing fruit to cold storage after packing and during transport represents an effective risk-mitigating procedure in the highly improbable event that a gravid A. ludens female might lay eggs in a commercially ripe Hass avocado that had been left unprotected in a packinghouse.

  12. Wild harvest

    NARCIS (Netherlands)

    Cruz-Garcia, G.S.; Struik, P.C.; Johnson, D.E.

    2016-01-01

    Rice fields provide not only a staple food but are also bio-diverse and multi-functional ecosystems. Wild food plants are important elements of biodiversity in rice fields and are critical components to the subsistence of poor farmers. The spatial and seasonal distribution of wild food plants

  13. Wild Yam

    Science.gov (United States)

    ... laboratory into various steroids, such as estrogen and dehydroepiandrosterone (DHEA). The root and the bulb of the plant ... wild yam and diosgenin promoted as a “natural DHEA.” This is because in the laboratory DHEA is ...

  14. Olfactory response of Anastrepha striata (Diptera: Tephritidae) to guava and sweet orange volatiles.

    Science.gov (United States)

    Diaz-Santiz, Edvin; Rojas, Julio C; Cruz-López, Leopoldo; Hernández, Emilio; Malo, Edi A

    2016-10-01

    The behavioral responses of virgin and mated female Anastrepha striata Schiner (Diptera: Tephritidae) to guava (Psidium guajava L.) or sweet orange (Citrus sinensis L.) were evaluated separately using multilure traps in two-choice tests in field cages. The results showed that flies were more attracted to guava and sweet orange volatiles than to control (unbaited trap). The physiological state (virgin or mated) of females did not affect their attraction to the fruit volatiles. Combined analysis of gas chromatography coupled with electroantennography (GC-EAD) of volatile extracts of both fruits showed that 1 and 6 compounds from orange and guava, respectively elicited repeatable antennal responses from mated females. The EAD active compounds in guava volatile extracts were identified by gas chromatography-mass spectrometry (GC-MS) as ethyl butyrate, (Z)-3-hexenol, hexanol, ethyl hexanoate, hexyl acetate, and ethyl octanoate. Linalool was identified as the only antennal active compound in sweet orange extracts. In field cage tests, there were no significant differences between the number of mated flies captured by the traps baited with guava extracts and the number caught by traps baited with the 6-component blend that was formulated according to the relative proportions in the guava extracts. Similar results occurred when synthetic linalool was evaluated against orange extracts. From a practical point of view, the compounds identified in this study could be used for monitoring A. striata populations. © 2015 Institute of Zoology, Chinese Academy of Sciences.

  15. Phylogeographic Structure in Anastrepha ludens (Diptera: Tephritidae) Populations Inferred With mtDNA Sequencing.

    Science.gov (United States)

    Ruiz-Arce, Raul; Owen, Christopher L; Thomas, Donald B; Barr, Norman B; McPheron, Bruce A

    2015-06-01

    Anastrepha ludens (Loew) (Diptera: Tephritidae), the Mexican fruit fly, is a major pest of citrus and mango. It has a wide distribution in Mexico and Central America, with infestations occurring in Texas, California, and Florida with origins believed to have been centered in northeastern Mexico. This research evaluates the utility of a sequence-based approach for two mitochondrial (COI and ND6) gene regions. We use these markers to examine genetic diversity, estimate population structure, and identify diagnostic information for A. ludens populations. We analyzed 543 individuals from 67 geographic collections and found one predominant haplotype occurring in the majority of specimens. We observed 68 haplotypes in all and see differences among haplotypes belonging to northern and southern collections. Mexico haplotypes differ by few bases possibly as a result of a recent bottleneck event. In contrast to the hypothesis suggesting northeastern Mexico as the origin of this species, we see that specimens from two southern collections show high genetic variability delineating three mitochondrial groups. These data suggest that Central America is the origin for A. ludens. We show that COI and ND6 are useful for phylogeographic studies of A. ludens. Published by Oxford University Press on behalf of Entomological Society of America 2015. This work is written by US Government employees and is in the public domain in the US.

  16. Contribución al Estudio de las Moscas Anastrephas en Colombia.

    Directory of Open Access Journals (Sweden)

    González Mendoza Rafael

    1952-11-01

    Full Text Available 1. Colombia tiene amplias posibilidades de desarrollar una industria frutícola floreciente dadas las excepcionales condiciones de ubicación geográfica, diversidad de climas y de suelos. 2. La deficiente producción frutera actual es el resultado de una reunión de factores adversos, entre los que resalta el desconocimiento de los problemas científicos que afectan a dicha industria. En este aspecto, los problemas fitosanitarios, abandonados y faltos de investigación, ocupan lugar preponderante. 3. Las moscas Anastrephas constituyen la plaga más importante de la fruticultura nacional, y por esta razón, un estudio sobre estos insectos es un tema de importancia. 4. Las principales "moscas de las frutas" pertenecen dentro de la familia Trypetidae, a los géneros: Dacus, Rhaglethis, Ceratitis, Dactrocera y Anastrepha. 5. Los nombres comunes con que se conocen las moscas Anastrephas varían de un país a otro y se relacionan particularmente con el lugar de origen de las distintas especies o la fruta determinada como preterida por la mosca en una localidad. En Colombia la denominación vernácula más difundida es la de "gusano de las frutas". También se nombra el insecto como "mosca o gusano del mango" o "gusano de la guayaba". 6. Los nombres científicos de las moscas distinguen a una, gran cantidad de especies. En Colombia, varios autores han reportado la existencia de las especies A.fraterculus, A. ludens, A. mombinpracoptans, A. pikeli y A. serpentina. Todas estas especies inciden en las regiones colombianas comprendidas entre 0 y 2000 metros de altura, es decir, en casi todas las regiones agrícolas importantes (frutales, café, cacao de temperaturas entre 14° y 30° C. 7. Las moscas Anastrephas están confinadas casi exclusivamente al continente americano entre las latitudes 27° N. y 35° S. Particularmente, la especie A. fraterculus, una de las más difundidas en Colombia, fué determinada por Wiedemann (1830

  17. Adult population dynamics of the bolivian fruit flies Anastrepha sp. (Diptera: Tephritidae at Municipality Coroico, Department of The La Paz, Bolivia

    Directory of Open Access Journals (Sweden)

    Gonzáles Manuel

    2011-08-01

    Full Text Available The investigation was carried out in Paco (1603 msnm communities, it Marca (1511 msnm and Capellania (1720 msnm, of the Municipality of Coroico, department of La Paz, Bolivia. In orchards frutícolas semicomerciales, they settled 15 traps distributed McPhail in a similar way among areas, five for community, sampling" "points. The censuses were carried out with an interval of 15 days, they were identified and they quantified the mature flies of the fruit. For the captures of the individuals, they settled the traps McPhail, using the attractive (Buminal one and as conserving borax. The traps were distributed in representative parcels, having as main cultivations, orange, mandarin, grapefruit, guava and avocado. The identification taxonómica of the captured species was carried out in the laboratory of the National Program of Control of Flies of the fruit (PROMOSCA, clerk of the National Service of Agricultural Sanity and Alimentary (SENASAG Inocuidad. 1210 mature flies of the fruit were captures, those that grouped for species, sex, capture dates and community, corresponding to the seven carried out censuses. The species of Anastrepha fraterculus (Wiedeman were identified, Anastrepha striata Schiner, Anastrepha serpentine (Wiedeman, Anastrepha sp, Ceratitis capitata (Wiedemann, Blepharoneura sp Loew, Hexaresta sp Hering, Hexachaeta sp Loew, Tomoplagia sp Coquillett, Tetreuaresta sp Hendel, being that of more presence Anastrepha fraterculus (Wiedeman with 818 and Ceratitis capitata (Wiedemann, with 354. The temperature and presence of spices put up frutícolas of flies of the fruit in maturation state explain the observed fluctuations.

  18. Examination of the ligand-binding and enzymatic properties of a bilin-binding protein from the poisonous caterpillar Lonomia obliqua.

    Directory of Open Access Journals (Sweden)

    Ana B G Veiga

    Full Text Available The bilin-binding proteins (BBP from lepidopteran insects are members of the lipocalin family of proteins and play a special role in pigmentation through the binding of biliverdin IXγ. Lopap, a BBP-like protein from the venom of the toxic caterpillar Lonomia obliqua has been reported to act as a serine protease that activates the coagulation proenzyme prothrombin. Here we show that BBPLo, a variant of lopap from the same organism binds biliverdin IXγ, forming a complex that is spectrally identical with previously described BBP proteins. Although BBPLo is nearly identical in sequence to lopap, no prothrombinase activity was detected in our recombinant preparations using reconstituted systems containing coagulation factors Xa and Va, as well as anionic phospholipids. In addition to biliverdin, BBPLo was found to form a 1:1 complex with heme prompting us to examine whether the unusual biliverdin IXγ ligand of BBPs forms as a result of oxidation of bound heme in situ rather than by a conventional heme oxygenase. Using ascorbate or a NADPH(+-ferredoxin reductase-ferredoxin system as a source of reducing equivalents, spectral changes are seen that suggest an initial reduction of heme to the Fe(II state and formation of an oxyferrous complex. The complex then disappears and a product identified as a 5-coordinate carbonyl complex of verdoheme, an intermediate in the biosynthesis of biliverdin, is formed. However, further reaction to form biliverdin was not observed, making it unlikely that biliverdin IXγ is formed by this pathway.

  19. Wild immunology.

    Science.gov (United States)

    Pedersen, Amy B; Babayan, Simon A

    2011-03-01

    In wild populations, individuals are regularly exposed to a wide range of pathogens. In this context, organisms must elicit and regulate effective immune responses to protect their health while avoiding immunopathology. However, most of our knowledge about the function and dynamics of immune responses comes from laboratory studies performed on inbred mice in highly controlled environments with limited exposure to infection. Natural populations, on the other hand, exhibit wide genetic and environmental diversity. We argue that now is the time for immunology to be taken into the wild. The goal of 'wild immunology' is to link immune phenotype with host fitness in natural environments. To achieve this requires relevant measures of immune responsiveness that are both applicable to the host-parasite interaction under study and robustly associated with measures of host and parasite fitness. Bringing immunology to nonmodel organisms and linking that knowledge host fitness, and ultimately population dynamics, will face difficult challenges, both technical (lack of reagents and annotated genomes) and statistical (variation among individuals and populations). However, the affordability of new genomic technologies will help immunologists, ecologists and evolutionary biologists work together to translate and test our current knowledge of immune mechanisms in natural systems. From this approach, ecologists will gain new insight into mechanisms relevant to host health and fitness, while immunologists will be given a measure of the real-world health impacts of the immune factors they study. Thus, wild immunology can be the missing link between laboratory-based immunology and human, wildlife and domesticated animal health. © 2011 Blackwell Publishing Ltd.

  20. Fruit flies (Diptera: Tephritidae associated to native fruit of Spondias spp. (Anacardiaceae and Ximenia americana L. (Olacaceae and their parasitoids in the State of Piaui, Brazil

    Directory of Open Access Journals (Sweden)

    Almerinda Amélia Rodrigues Araújo

    2014-09-01

    Full Text Available This work aims to identify the species of fruit flies and their parasitoids associated to native fruit of Spondias spp. (caja S. mombin L., umbu-caja Spondias sp., umbu S. tuberosa Arr. Câm. and wild plum Ximenia americana L., in the State of Piaui, Brazil. Samples (63 of fruits were collected from November 2009 to July 2010, totalizing 4,495 fruits and 46,906 kg. It was possible to obtain 10,617 puparia, from which 4,497 tephritids and 1,118 braconid parasitoids emerged. Regarding Spondias spp., the highest occurrence was Anastrepha obliqua (Macquart, with 100% for umbu and umbu-caja. Caja presented an average of 99.52% of A. obliqua, 0.46% of Anastrepha fraterculus (Wied. and 0.97% of Ceratitis capitata (Wied.. Wild plum percentages were 97.83% for A. alveata Stone and 2.17% for A. fraterculus. Infestation rates were 429.2, 178.4, 158.9 and 43.3 puparia/kg in umbu-caja, caja, wild plum and umbu, respectively. Pupal viability was 77.8%, 69.3%, 52.5% and 41.1% to umbu, wild plum, umbu-caja and caja, respectively. By analyzing the sample parasitoids, the percentage was 21.39% for the Doryctobracon areolatus (Szépligeti species and 78.61% for Opius bellus Gahan. For the first time, it was recorded in Brazil X. americana as a host to A. alveata, as well as D. aleolatus and O. bellus as parasitoids of A. obliqua and A. alveata in Piaui.

  1. The Effects of a Modified Hot Water Treatment on Anastrepha ludens (Diptera: Tephritidae)-Infested Mango.

    Science.gov (United States)

    Hernández, Emilio; Aceituno-Medina, Marysol; Toledo, Jorge; Bravo, Bigail; Caro-Corrales, José; Montoya, Pablo; Mangan, Robert

    2017-04-01

    The Mexican fruit fly, Anastrepha ludens (Loew), is a quarantine pest in mango (Mangifera indica L.) that can be controlled by using a hot water treatment (HWT). This treatment is normally followed by a 30-min hydrocooling (HYC) process that reduces the negative effects that the treatment has on fruit quality. However, if hot water-treated fruits are immediately immersed in water at 21 °C, the survival rate of third-instar A. ludens may be increased. The current approved treatment protocol states that if HYC is used, then treated fruit should undergo an additional 10-min HWT or on platform for 30 min before HYC. We aimed to determine the efficacy of HWT without an additional 10-min treatment before being subjected to HYC, while taking into consideration that the most important conditions are the temperature of the fruit core throughout treatment and the type of infestation, either oviposition or inoculation. Two experimental tests were conducted. Our first aim was to determine the effectiveness of HWT followed by HYC using three varieties and different size classes of mangoes ('Ataulfo' 200-375 and 401-570 g; 'Tommy Atkins' 401-500 and 501-700 g; 'Kent' 401-500 g). The four treatment combinations used to test HWT and immediate HYC at 21 °C were 1) HWT, 2) HWT/HYC, 3) HWT + 10 min/HYC, and 4) HWT/30 min on platform/HYC; an independent experiment was used for each variety. The second aim was to validate the HWT/HYC combination by performing confirmatory tests in commercial packing houses. The results showed that as long as the mango core temperature reached 45 °C during the HWT, it was not necessary to add the 10-min treatment to the HWT before HYC at 21 °C was applied. To ensure that the larvae are subjected to the HWT treatment for sufficient time to be lethal, the temperature of the fruit core throughout the treatment must be recorded. © The Authors 2017. Published by Oxford University Press on behalf of Entomological Society of

  2. Flutuação populacional de adultos de Anastrepha fraterculus (Wied. em cultivo protegido e convencional de videira Anastrepha fraterculus (Wied. adult seasonal fluctuation in plastic covering and conventional grapevine cultivation

    Directory of Open Access Journals (Sweden)

    Geraldo Chavarria

    2009-09-01

    Full Text Available A mosca-das-frutas sul-americana, Anastrepha fraterculus (Wiedemann, 1830 (Diptera: Tephritidae, é considerada praga-chave das fruteiras de clima temperado na região Sul do Brasil. No entanto, poucas informações encontram-se disponíveis quando a espécie está associada à cultura da videira. Neste trabalho, foi avaliado o efeito da cobertura plástica sobre a população de adultos de A. fraterculus durante o ciclo de cultivo da videira cv. Moscato Giallo. O experimento foi conduzido nos ciclos de 2005/06 e 2006/07, em vinhedo comercial localizado em Flores da Cunha-RS (latitude 29° 06' sul, longitude 51° 20' oeste e altitude de 541 m, coberto com plástico impermeável tipo ráfia (160 µm de 12 fileiras com 35 m, deixando-se cinco fileiras sem cobertura (controle. Os adultos foram monitorados nas duas áreas com armadilhas McPhail, utilizando-se como atrativo de proteína hidrolisada (BioAnastrepha® a 5%, no período de outubro a abril, nos dois ciclos. O pico populacional da espécie, nos dois ciclos, foi observado no período de maturação da uva. Não foram registradas diferenças significativas nas capturas entre as áreas, concluindo-se que a cobertura plástica não afeta a mobilidade e a flutuação populacional de A. fraterculus em cultivo protegido de videira.The South American Fruit Fly Anastrepha fraterculus (Wiedemann, 1830 (Diptera: Tephritidae is one of the most important pests of temperate fruits in Southern Brazil. Little information regarded to pest damage is available when this insect is associated with vineyards. In this work was evaluated the plastic cover effect on seasonal fluctuation of A. fraterculus adults in vineyards of cv. Moscato Giallo. The experiment was conducted on 2005/06 and 2006/07 seasons in a vineyard located in Flores da Cunha, RS (latitude 29° 06' South, longitude 51° 20' West and altitude 541 m, covered with an impermeable plastic cloth (2.65 m x 160 µm, in 12 rows with 35 m, with five rows

  3. Mineralización del nitrógeno, carbono y actividad enzimática del suelo en un bosque de Nothofagus obliqua (Mirb Oerst y una plantación de Pinus radiata D. Don. del centro-sur de Chile Nitrogen and carbon mineralization and enzyme activity in soils of Nothofagus obliqua (Mirb Oerst stands and Pinus radiata D. Don plantation in south-central Chile

    Directory of Open Access Journals (Sweden)

    YESSICA RIVAS

    2009-03-01

    Full Text Available En Chile, el establecimiento de plantaciones comerciales de rápido crecimiento ha sido sostenido en las últimas décadas mediante la sustitución de bosques nativos y conversión de suelos agrícolas. Pinus radiata D. Don es la principal especie productiva, debido a su crecimiento acelerado y adaptabilidad al clima y los suelos. En el presente estudio se plantea que la actividad biológica del suelo es variable a través del año, en respuesta a variaciones de precipitación, temperatura y contenido de humedad de suelo y que el cambio de uso de suelo desde un bosque templado de Nothofagus obliqua (Mirb Oerst a una plantación con coniferas exóticas, modifica la química del suelo y consecuentemente los procesos de N-min, C-min y la actividad biológica del suelo. Esta hipótesis fue examinada en un bosque de N. obliqua y una plantación de P. radiata del centro-sur de Chile (40°07' S, 72° O. Se evaluó mensualmente la tasa mineralización de nitrógeno (N-min, cabono (C-min y la actividad enzimática potencial del suelo (ureasa, proteasa e hidrólisis de la fluoresceína diacetato entre septiembre 2003 y mayo 2005. Los resultados demuestran que los niveles de las variables de actividad biológica del suelo fueron significativamente diferentes entre las parcelas de bosque y plantación (Lambda de Wilk = 0,022; F 5,80 = 733; P In Chile, commercial forests plantations have increased during the last decades due in part to replacement of native forests and conversion of agricultural soils. Pinus radiata D. Don has been the main tree planted, due to its rapid growth and adaptability. In the present study we proposed that biological activity varies along the year due to changes of precipitation, temperature and soil water content and mainly because the conversion of native forest to exotic P. radiata plantations alters the soil chemistry, N and C mineralization and the potential enzymatic activity in these soils. This hypothesis was examined in a

  4. Establishment of a colony of Anastrepha ludens (Diptera: Tephritidae) under relaxed mass-rearing conditions in Mexico

    Energy Technology Data Exchange (ETDEWEB)

    Orozco-Davila, Dina; Hernandez, Refugio; Solis, Eduardo; Quintero, J. Luis; Dominguez, Julio, E-mail: dorozco1@prodigy.net.m [United States Department of Agriculture, Gainesville, FL (United States). Agricultural Research Service. Center for Medical, Agricultural, and Veterinary Entomology; Sigma Space Corporation, MD(United States); Programa Moscamed Moscafrut-Desarrollo de Metodos, Chiapas (Mexico)

    2006-07-01

    Several studies have suggested that maintaining a line of insects under laboratory conditions reduces their biological attributes. With this principle in mind, the mass production of Anastrepha ludens originating from a colony raised under relaxed rearing conditions was evaluated over a period of three years. The results of the evaluation indicated that insects kept under these conditions reached their larval maturity in 10 days, and attained a greater weight, which has a direct influence on pupal quality. In adult cages having a fly density of 70,000 individuals, there was a lower level of stress which favored fecundity. Fertility was apparently not affected by the cage density. These results suggest that keeping a production line under relaxed conditions optimizes insect production and promotes higher quality. (author)

  5. Characterisation of the chemical profiles of Brazilian and Andean morphotypes belonging to the Anastrepha fraterculus complex (Diptera, Tephritidae).

    Science.gov (United States)

    Vaníčková, Lucie; Břízová, Radka; Pompeiano, Antonio; Ferreira, Luana Lima; de Aquino, Nathaly Costa; Tavares, Raphael de Farias; Rodriguez, Laura D; Mendonça, Adriana de Lima; Canal, Nelson Augusto; do Nascimento, Ruth Rufino

    2015-01-01

    Fruit fly sexual behaviour is directly influenced by chemical and non-chemical cues that play important roles in reproductive isolation. The chemical profiles of pheromones and cuticular hydrocarbons (CHs) of eight fruit fly populations of the Andean, Brazilian-1 and Brazilian-3 morphotypes of the Anastrepha fraterculus cryptic species complex originating from Colombia (four populations) and Brazil (four populations) were analysed using two-dimensional gas chromatography with mass spectrometric detection. The resulting chemical diversity data were studied using principal component analyses. Andean morphotypes could be discriminated from the Brazilian-1 and Brazilian-3 morphotypes by means of male-borne pheromones and/or male and female CH profiles. The Brazilian-1 and Brazilian-3 morphotypes were found to be monophyletic. The use of chemical profiles as species- and sex-specific signatures for cryptic species separations is discussed.

  6. Nuclear ribosomal internal transcribed spacer 1 (ITS1) variation in the Anastrepha fraterculus cryptic species complex (Diptera, Tephritidae) of the Andean region

    Science.gov (United States)

    Sutton, Bruce D.; Steck, Gary J.; Norrbom, Allen L.; Rodriguez, Erick J.; Srivastava, Pratibha; Alvarado, Norma Nolazco; Colque, Fredy; Landa, Erick Yábar; Sánchez, Juan José Lagrava; Quisberth, Elizabeth; Peñaranda, Emilio Arévalo; Clavijo, P. A. Rodriguez; Alvarez-Baca, Jeniffer K.; Zapata, Tito Guevara; Ponce, Patricio

    2015-01-01

    Abstract The nuclear ribosomal internal transcribed spacer 1 (ITS1) was sequenced for Anastrepha fraterculus (Wiedemann, 1830) originating from 85 collections from the northern and central Andean countries of South America including Argentina (Tucumán), Bolivia, Perú, Ecuador, Colombia, and Venezuela. The ITS1 regions of additional specimens (17 collections) from Central America (México, Guatemala, Costa Rica, and Panamá), Brazil, Caribbean Colombia, and coastal Venezuela were sequenced and together with published sequences (Paraguay) provided context for interpretation. A total of six ITS1 sequence variants were recognized in the Andean region comprising four groups. Type I predominates in the southernmost range of Anastrepha fraterculus. Type II predominates in its northernmost range. In the central and northern Andes, the geographic distributions overlap and interdigitate with a strong elevational effect. A discussion of relationships between observed ITS1 types and morphometric types is included. PMID:26798259

  7. Sterility and Sexual Competitiveness of Tapachula-7 Anastrepha ludens Males Irradiated at Different Doses

    National Research Council Canada - National Science Library

    Orozco-Dávila, Dina; Adriano-Anaya, Maria de Lourdes; Quintero-Fong, Luis; Salvador-Figueroa, Miguel

    2015-01-01

    .... Under laboratory and field conditions, we evaluated the effects of gamma irradiation at doses of 0, 20, 40, 60 and 80 Gy on the sexual competitiveness of males, the induction of sterility in wild...

  8. Sterility and Sexual Competitiveness of Tapachula-7 Anastrepha ludens Males Irradiated at Different Doses: e0135759

    National Research Council Canada - National Science Library

    Orozco-Davila, Dina; Adriano-Anaya, Maria deLourdes; Quintero-Fong, Luis; Salvador-Figueroa, Miguel

    2015-01-01

    .... Under laboratory and field conditions, we evaluated the effects of gamma irradiation at doses of 0, 20, 40, 60 and 80 Gy on the sexual competitiveness of males, the induction of sterility in wild...

  9. Wilde?s worlds: Sir William Wilde in Victorian Ireland

    OpenAIRE

    McGeachie, J.

    2016-01-01

    Introduction Other contributors to this collection have evoked the disparate worlds inhabited by Sir William Wilde. Aims To provide an overall assessment of his career. Materials and methods Looking at the historical conditions that made possible such a career spanning such disparate worlds. Deploying methodologies developed by historians of medicine and sociologists of science, the article brings together Wilde the nineteenth century clinician and Dublin man of science, the Wilde of the Cens...

  10. Flutuação populacional de Anastrepha fraterculus (Wiedemann e Ceratitis capitata (Wiedemann (Diptera, Tephritidae em pomares de pessegueiro em Porto Alegre, Rio Grande do Sul Population fluctuation of Anastrepha fraterculus (Wiedemann and Ceratitis capitata (Wiedemann (Diptera, Tephritidae in peach orchards in Porto Alegre, Rio Grande do Sul

    Directory of Open Access Journals (Sweden)

    Flávio Roberto Mello Garcia

    1998-01-01

    Full Text Available This paper presents the study of population fluctuation of Anastrepha fraterculus (Wiedemann, 1824 and Ceratitis capitata (Wiedemann, 1830 in peach orchards in Porto Alegre city. The peak for A. fraterculus was in November and December and for C. capitata in December and January. There was no significant difference among the population levels in the cultivars Fla 13-72, Premier and Marli.

  11. Asymmetry of frontal bristles and postocular setae in species and hybrids of the Anastrepha fraterculus complex (Diptera, Tephritidae

    Directory of Open Access Journals (Sweden)

    João Maria G.A. Souza

    2007-01-01

    Full Text Available Asymmetry of the frontal bristles and postocular setae was studied in samples from natural populations and laboratory colonies of Anastrepha sp. 1 aff. fraterculus, of A. sp. 2 aff. fraterculus, and in F1 hybrids obtained from laboratory reciprocal crosses. Natural populations were sampled in a zone of sympatry and in two geographically distant regions with different climatic conditions. Asymmetry was scored as the differences between the number of bristles and of setae on the right and left sides of the head, males and females analyzed independently. The two traits exhibited variability according to the model of fluctuating asymmetry (FA. No significant differences among samples were found in the FA of frontal bristles. A significant FA was observed for the postocular setae of A. sp. 1 males from a southern population (Vacaria, RS as compared to the asymmetry exhibited by males and females of some other samples. No significant differences in FA were observed among the interspecific hybrids and the laboratory samples of both parental species. The higher FA found in the males from Vacaria was attributed to climatic conditions prevailing in that region. The absence of a higher FA in hybrids may be related to the relatively recent evolutionary history of the two species.

  12. Genetic diversity and population structure of Anastrepha striata (Diptera: Tephritidae) in three natural regions of southwestern Colombia using mitochondrial sequences.

    Science.gov (United States)

    Gallo-Franco, Jenny Johana; Velasco-Cuervo, Sandra Marcela; Aguirre-Ramirez, Elkin; González Obando, Ranulfo; Carrejo, Nancy Soraya; Toro-Perea, Nelson

    2017-02-01

    Anastrepha striata is widely distributed across the Americas and is a pest of economically important crops, especially crops of the Myrtaceae family. Insect population structures can be influenced by the presence of physical barriers or characteristics associated with habitat differences. This study evaluated the effect of the Western Andes on the population structure of A. striata. Individuals were collected from Psidium guajava fruits from three natural regions of southwestern Colombia (Pacific Coast, mountainous region and the inter-Andean valley of the Cauca River). Based on a 1318 bp concatenated of the genes Cytochrome Oxidase subunit I (COI) and NADH dehydrogenase subunit 6 (ND6), 14 haplotypes with few changes among them (between 1 and 3) were found. There was only one dominant haplotype in all three regions. No genetic structure associated with the three eco-geographical regions of the study was found. Moreover, the Western Andes are not an effective barrier for the genetic isolation of the populations from the Pacific Coast compared with the inter-Andean valley populations. This genetic homogeneity could be partially due to anthropogenic intervention, which acts as a dispersal agent of infested fruits. Another hypothesis to explain the lack of structure would be the relatively recent arrival of A. striata to the region, as indicated by an analysis of the demographic history, which reveals a process of population expansion. This study represents the first attempt to understand the population genetics of A. striata in Colombia and could contribute to the integral management of this pest.

  13. Effects of microwave-assisted hot water treatments designed against Mexican fruit fly (Anastrepha ludens) on grapefruit (Citrus paradisi) quality.

    Science.gov (United States)

    Soto-Reyes, Nohemi; Lopez-Malo, Aurelio; Rojas-Laguna, Roberto; Gómez-Salazar, Julián Andrés; Sosa-Morales, María Elena

    2017-12-18

    Hot water treatment (HWT) against Anastrepha ludens were developed achieving 48°C in the core of grapefruits and holding it for 6 min. After heating, the grapefruits were hydro-cooled and stored at 23°C and analyzed for 16 days. The effect of microwave-assisted hot water treatment (MW-HWT) on grapefruit quality was analyzed and compared with the quality of fruits treated with HWT and control fruits (without treatment). The physico-chemical properties and chemical composition of essential oil were analyzed. MW-HWT was equivalent to HWT according to accumulated heat calculations, with the advantage of being shorter. Treatments significantly affected the weight, color, maturity index, juice content, firmness, titratable acidity, pH and ascorbic acid content of the grapefruits (P 0.05). The major components identified in the essential oil were D-limonene and β-myrcene, compounds responsible of the scent of the grapefruits. Microwave-assisted hot water treatment (MW-HWT) was shorter (130 min) and had a lesser effect on the quality of the grapefruit when compared to fruits under HWT (188 min duration). Thus, this treatment could be considered as an alternative method against the Mexican fruit fly in grapefruit. This article is protected by copyright. All rights reserved.

  14. Comparison of aggregation and feeding responses by normal and irradiated fruit flies, Ceratitis capitata and Anastrepha suspensa (Diptera: Tephritidae)

    Energy Technology Data Exchange (ETDEWEB)

    Galun, R.; Gothilf, S.; Blondheim, S.; Sharp, J.L.; Mazor, M.; Lachman, A.

    1985-12-01

    Olfactory, aggregatory, and feeding responses of normal (untreated) laboratory stocks of Mediterranean fruit fly (medfly), Ceratitis capitata (Wiedemann), and of Caribbean fruit fly (caribfly), Anastrepha suspensa (Loew), were compared to those of flies irradiated (10 krad in air) 2 days before eclosion. Females of both species consumed greater quantities of protein hydrolysate solutions, entered protein hydrolysate-baited olfactory traps, and aggregated on agar plates containing protein hydrolysate in greater numbers than males of the same age and condition. However, male medflies consumed more sucrose than did females of the same age and condition. In the medfly, irradiation resulted in reduced olfactory response, reduced total food intake by flies of both sexes, and a significant reduction in aggregation on and intake of protein hydrolysate by females and of sugar consumption by males. In the irradiated caribfly, there was a significant reduction in olfactory response of females to yeast hydrolysate. In both sexes, aggregation on and consumption of yeast hydrolysate were reduced. Effects of irradiation on feeding behavior are discussed in relation to the biology of the flies and their control by the sterile insect release method.

  15. Alcohol dehydrogenase activities and ethanol tolerance in Anastrepha (Diptera, Tephritidae fruit-fly species and their hybrids

    Directory of Open Access Journals (Sweden)

    Eneas Carvalho

    2009-01-01

    Full Text Available The ADH (alcohol dehydrogenase system is one of the earliest known models of molecular evolution, and is still the most studied in Drosophila. Herein, we studied this model in the genus Anastrepha (Diptera, Tephritidae. Due to the remarkable advantages it presents, it is possible to cross species with different Adh genotypes and with different phenotype traits related to ethanol tolerance. The two species studied here each have a different number of Adh gene copies, whereby crosses generate polymorphisms in gene number and in composition of the genetic background. We measured certain traits related to ethanol metabolism and tolerance. ADH specific enzyme activity presented gene by environment interactions, and the larval protein content showed an additive pattern of inheritance, whilst ADH enzyme activity per larva presented a complex behavior that may be explained by epistatic effects. Regression models suggest that there are heritable factors acting on ethanol tolerance, which may be related to enzymatic activity of the ADHs and to larval mass, although a pronounced environmental effect on ethanol tolerance was also observed. By using these data, we speculated on the mechanisms of ethanol tolerance and its inheritance as well as of associated traits.

  16. Fungi that cause rot in bunches of grape identified in adult fruit flies (Anastrepha fraterculus (Diptera: Tephritidae

    Directory of Open Access Journals (Sweden)

    Ruben Machota Jr

    2013-06-01

    Full Text Available Anastrepha fraterculus (Wiedemann is the main species of frugivorous insect that damages berries of table grape (Vitis vinifera L. in Southern Brazil. This study was conducted to isolate and identify the fungi associated with bunch rot present in the body of adults of A. fraterculus collected in a commercial vineyard. From January to February 2011, adults of A. fraterculus were collected from a commercial vineyard of green grapes using adapted McPhail traps. In laboratory, flies bodies were divided into four parts (head, legs, wings, and ovipositor in Petri dishes with PDA medium to evaluate microorganisms associated. Six adult females of A. fraterculus collected in the field were also analyzed in a scanning electron microscope (SEM to identify spores of fungi. Phytopathogenic microorganisms were found in all sectioned parts. Fungal spores were recorded adhered to the body of adult females of A. fraterculus. The main species of fungi found in the body parts of A. fraterculus were Cladosporium spp. (20.2% of the obtained colonies, Botrytis cinerea Pers. (12.9%, Colletotrichum spp. (10.1%, Penicillium spp. (10.1%, Fusarium spp. (7.7%, followed by Rhizopus spp., Trichoderma spp. and Aspergillus spp., suggesting that the insect can serve as a mechanical vector of spores increasing damage in the vineyards.

  17. Percepção química e visual de Anastrepha fraterculus (Diptera, Tephritidae em laboratório Chemical and visual perception of Anastrepha fraterculus (Diptera, Tephritidae in laboratory

    Directory of Open Access Journals (Sweden)

    Patrícia L. F. Gregorio

    2010-06-01

    Full Text Available A mosca-das-frutas-sul-americana, Anastrepha fraterculus (Wiedemann, 1830, é uma das principais pragas da fruticultura no Brasil. Durante a alimentação, as larvas fazem galerias nos frutos, alterando o sabor e prejudicando a produção e comercialização dos mesmos. O presente trabalho teve como objetivo estudar fatores envolvidos na escolha do hospedeiro por A. fraterculus. Foram avaliadas as respostas eletroantenográficas de machos e fêmeas a extratos etanólicos de frutos verdes e maduros de pessegueiro - Prunus persica, cultivar Chimarrita (Rosaceae, pitangueira - Eugenia uniflora (Myrtaceae, guabirobeira - Campomanesia xanthocarpa (Myrtaceae e araçazeiro - Psidium cattleianum (Myrtaceae. Foram também observadas as influências da cor (amarela, verde e vermelha e da composição do substrato de oviposição (polpas de araçá, guabiroba, pitanga e pêssego na fecundidade da espécie. As respostas eletroantenográficas de fêmeas foram significativamente distintas para os extratos de guabiroba verde e madura, araçá maduro e pitanga verde. Em antenas de machos, as maiores despolarizações médias foram registradas em resposta aos extratos de guabiroba verde e madura, araçá verde e maduro e pitanga verde. As respostas eletrofisiológicas geradas não diferiram estatisticamente entre os sexos, para todos os tratamentos. A cor do substrato não afetou a oviposição. As fêmeas ovipositaram mais nos substratos contendo polpa de pêssego e de guabiroba, quando comparados aos respectivos controles.The South American fruit fly Anastrepha fraterculus (Wiedemann, 1830 is one of the greatest threats to the fruit growing industry in Brazil. During the feeding process, the larvae build galleries within the fruit, altering the flavor and damaging its production and commercialization. The present work had as its objective to study the factors involved in the choice of the host by A. fraterculus. Electroantennographic responses of the males and

  18. Viabilidad de huevos y modelo de jaula para la cría artificial masiva de Anastrepha fraterculus (Diptera: Tephritidae Viability of eggs and screen cage model for mass artificial rearing of Anastrepha fraterculus (Diptera: Tephritidae

    Directory of Open Access Journals (Sweden)

    Juliana García

    2011-12-01

    Full Text Available El objetivo del presente trabajo fue determinar la viabilidad de huevos y el modelo de jaula apropiada para la cría artificial masiva de Anastrepha fraterculus (Wiedemann. Los resultados muestran que el periodo de máxima oviposición ocurre durante los primeros 10 días en jaulas modelo Mediana, lo cual permite obtener el volumen de huevos necesario para alimentar el pie de cría de A. fraterculus en una cría masiva. Considerando que se encontró relación positiva entre el volumen de huevos ovipositados y el porcentaje de eclosión de huevos, en un periodo de 21 días de colecta, este periodo coincide además con los valores de eclosión más altos. Entre los modelos de jaulas evaluadas: Mediana, Grande y Mission; el modelo Mediana mostró los mejores resultados al evaluar el número de ía con un valor promedio de 11,4. La jaula que mostró menores resultados fue el modelo Mission, con un valor promedio de 4,6 huevos/hembra/día. Las jaulas grandes mostraron valores menores a las jaulas Medianas, pero las diferencias fueron no significativas. Los buenos valores registrados en las jaulas Medianas posiblemente se deban a la estructura de la jaula, que presentó la cara interna dividida en muchos compartimientos, lo cual mejora la distribución de las moscas adultas y previene la mortalidad temprana por hacinamiento en la base o en el techo de la jaula.The aim of this study was to determine the viability of eggs and cage model suitable for artificial mass rearing of Anastrepha fraterculus (Wiedemann. The results show that the period of maximum oviposition occurs during the first 10 days in Medium cages which allows to obtain the necessary volume of eggs to feed the foot of rearing of A. fraterculus in a mass rearing. Considering that a positive relationship was found between the volume of eggs oviposited and the hatchability percentage in a period of 21 days of collection, this period coincides with the highest values of hatching. Among the

  19. Effect of cryopreservation on the pre-hatching behavior in the Mexican fruit fly Anastrepha ludens Loew (Diptera, Tephritidae).

    Science.gov (United States)

    Rajamohan, Arun; Rinehart, Joseph P; Leopold, Roger A

    2017-12-19

    In a sampling of untreated embryos of the economically important fruit pest species, Anastrepha ludens, the cumulative hatch percentage in the lab was noted to be ∼85%. Approximately 70% of the larvae had eclosed through the posterior pole of the egg. This process is effected by the act of Pole Reversal (PR) of the fully developed pre-hatch larva from the wider anterior to the narrower posterior pole of the egg. Investigation of the effects of cryopreservation and various pretreatments prior to cryostorage on the PR behavior was prompted by the observation of significantly lower proportion of cryopreserved embryos exhibiting the PR behavior. Pretreatments (dechorionation and permeabilization) followed by vitrification resulted in delayed hatching, reflecting a slower embryonic development rate of ∼10 h. A smaller proportion of the treated embryos either eclosed from the anterior end of the egg or did not eclose at all despite complete development and prehatch gnawing activity. In the untreated controls, 24.0% of the embryos eclosed from the anterior pole. After permeabilization and cryopreservation, 83% and 55% (adjusted hatch) of the embryos were noted to hatch this way, respectively. An analysis of the hatch count after the treatments shows that factors contributing to the embryos' inability to properly invert polarity is not solely due to cryopreservation but also due to the pretreatment procedures including dechorionation and permeabilization. In fact, the permeabilization pre-treatment contributed the highest to this phenomenon lending support to the view that chemical toxicity rather than physical effects of cryopreservation play a major role in post-cryopreservation effects. Published by Elsevier Inc.

  20. Viabilidad de huevos y modelo de jaula para la cría artificial masiva de Anastrepha fraterculus (Diptera: Tephritidae

    Directory of Open Access Journals (Sweden)

    JULIANA GARCÍA

    2011-01-01

    Full Text Available El objetivo del presente trabajo fue determinar la viabilidad de huevos y el modelo de jaula apropiada para la cría artificial masiva de Anastrepha fraterculus (Wiedemann. Los resultados muestran que el periodo de máxima oviposición ocurre durante los primeros 10 días en jaulas modelo Mediana, lo cual permite obtener el volumen de huevos necesario para alimentar el pie de cría de A. fraterculus en una cría masiva. Considerando que se encontró relación positiva entre el volumen de huevos ovipositados y el porcentaje de eclosión de huevos, en un periodo de 21 días de colecta, este periodo coincide además con los valores de eclosión más altos. Entre los modelos de jaulas evaluadas: Mediana, Grande y Mission; el modelo Mediana mostró los mejores resultados al evaluar el número de huevos/hembra/día con un valor promedio de 11,4. La jaula que mostró menores resultados fue el modelo Mission, con un valor promedio de 4,6 huevos/hembra/día. Las jaulas grandes mostraron valores menores a las jaulas Medianas, pero las diferencias fueron no significativas. Los buenos valores registrados en las jaulas Medianas posiblemente se deban a la estructura de la jaula, que presentó la cara interna dividida en muchos compartimientos, lo cual mejora la distribución de las moscas adultas y previene la mortalidad temprana por hacinamiento en la base o en el techo de la jaula.

  1. Fatores climáticos na dinâmica populacional de Anastrepha spp. (diptera: tephritidae e de Scymnus spp. (coleoptera: coccinellidae em um pomar experimental de goiaba (Psidium guajava L.

    Directory of Open Access Journals (Sweden)

    Ricardo Aparecido Calore

    2013-03-01

    Full Text Available Este trabalho objetivou caracterizar a dinâmica populacional de Anastrepha spp. e de Scymnus spp. em pomar experimental semiorgânico de goiaba (Psidium guajava L., em Pindorama-SP, na Agência Paulista de Tecnologia dos Agronegócios (APTA e correlacioná-la com fatores meteorológicos. Para o levantamento da dinâmica populacional, os espécimes foram monitorados com armadilhas adesivas amarelas (25 cm x 9,5 cm, trocadas a cada 15 dias, no período de um ano (entre junho de 2009 e junho de 2010. Os insetos foram avaliados e quantificados no Laboratório de Seletividade Ecológica da UNESP-FCAV em Jaboticabal-SP. Observou-se a ocorrência de Anastrepha spp. e Scymnus spp. durante todo o período de amostragem. Com base nos resultados obtidos e nas condições de desenvolvimento do presente trabalho, foram possíveis as seguintes conclusões: a Ocorre aumento na densidade populacional de Anastrepha spp. com o aumento das temperaturas mínima, média e máxima; b Os picos populacionais de Anastrepha spp. ocorrem de janeiro a março e coincidem com o período de disponibilidade de frutos maduros no pomar de goiaba; c Constatam-se as maiores ocorrências do predador Scymnus spp. no período de setembro a dezembro, e as menores ocorrências, em fevereiro e março; d As precipitações não interferem na dinâmica populacional de Anastrepha spp. e de Scymnus spp..

  2. Geostatistics and Geographic Information System to Analyze the Spatial Distribution of the Diversity of Anastrepha Species (Diptera: Tephritidae): the Effect of Forest Fragments in an Urban Area.

    Science.gov (United States)

    Garcia, A G; Araujo, M R; Uramoto, K; Walder, J M M; Zucchi, R A

    2017-12-08

    Fruit flies are among the most damaging insect pests of commercial fruit in Brazil. It is important to understand the landscape elements that may favor these flies. In the present study, spatial data from surveys of species of Anastrepha Schiner (Diptera: Tephritidae) in an urban area with forest fragments were analyzed, using geostatistics and Geographic Information System (GIS) to map the diversity of insects and evaluate how the forest fragments drive the spatial patterns. The results indicated a high diversity of species associated with large fragments, and a trend toward lower diversity in the more urbanized area, as the fragment sizes decreased. We concluded that the diversity of Anastrepha species is directly and positively related to large and continuous forest fragments in urbanized areas, and that combining geostatistics and GIS is a promising method for use in insect-pest management and sampling involving fruit flies. © The Authors 2017. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  3. Capture of Anastrepha sororcula (Diptera: Tephritidae in McPhail and Jackson traps with food attractant and virgin adults

    Directory of Open Access Journals (Sweden)

    Christiane dos Santos Felix

    2009-02-01

    Full Text Available This stady evaluated the capture of A. sororcula in the traps baited with the conspecific virgin adults and food attractant in two orchards. The first was the orchard of the Universidade Federal da Grande Dourados (OUFGD and the second, the orchard of the Sindicato Rural de Dourados (OSRD. The capture of A. sororcula in McPhail and Jackson traps was carried out using the corn hydrolysed protein (CHP, control (no flies, virgin males (5, 10 and 15, five virgin females and five virgin couples. The average number of the flies caught in the traps with the corn hydrolysed protein was signifícantly higher than all the other treatments. There was no significant capture of A. sororcula females in the traps baited with the conspecific virgin males, females or the couples.As moscas-das-frutas constituem um grupo de pragas responsáveis por grandes prejuízos econômicos à fruticultura mundial. Anastrepha sororcula Zucchi, é a principal espécie de tefritídeo que ataca a goiaba em Mato Grosso do Sul. O objetivo desta pesquisa foi avaliar a captura de adultos de A. sororcula em armadilhas com atrativo alimentar e adultos virgens, em dois ambientes. Os bioensaios iniciaram-se com a criação de A. sororcula no Laboratório de Insetos Frugívoros da Universidade Federal da Grande Dourados (UFGD. As pesquisas de campo foram desenvolvidas nos pomares da UFGD e do Sindicato Rural de Dourados (SRD-MS. A captura de adultos de A. sororcula em armadilhas McPhail e Jackson foi avaliada para os tratamentos: proteína hidrolisada de milho, testemunha (sem moscas, machos virgens (5, 10 e 15, 5 fêmeas virgens e 5 casais. O número médio de indivíduos capturados nas armadilhas com proteína foi significativamente maior que nos demais tratamentos. O número médio de adultos de A. sororcula, capturado com o tratamento proteína no SRD foi significativamente superior ao do pomar da UFGD. Não ocorreu captura significativa de fêmeas de A. sororcula nas armadilhas com

  4. Wild blijft je bezighouden

    NARCIS (Netherlands)

    Wijk, van C.A.P.; Harmont, van J.

    2010-01-01

    Wild kan zorgen voor fikse productie- en kwaliteitschade én een hoop ergernis. Als de schade al te verhalen is, dan houdt de afhandeling van een schadeclaim veel rompslomp in. Neem daarom tijdig voorzorgsmaatregelen. Maar hoe je het ook wendt of keert, wild blijft je bezighouden.

  5. Genetics and biology of Anastrepha fraterculus: research supporting the use of the sterile insect technique (SIT) to control this pest in Argentina.

    Science.gov (United States)

    Cladera, Jorge L; Vilardi, Juan C; Juri, Marianela; Paulin, Laura E; Giardini, M Cecilia; Gómez Cendra, Paula V; Segura, Diego F; Lanzavecchia, Silvia B

    2014-01-01

    Two species of true fruit flies (taxonomic family Tephritidae) are considered pests of fruit and vegetable production in Argentina: the cosmopolitan Mediterranean fruit fly (Ceratitis capitata Wiedemann) and the new world South American fruit fly (Anastrepha fraterculus Wiedemann). The distribution of these two species in Argentina overlaps north of the capital, Buenos Aires. Regarding the control of these two pests, the varied geographical fruit producing regions in Argentina are in different fly control situations. One part is under a programme using the sterile insect technique (SIT) for the eradication of C. capitata, because A. fraterculus is not present in this area. The application of the SIT to control C. capitata north of the present line with the possibility of A. fraterculus occupying the niche left vacant by C. capitata becomes a cause of much concern. Only initial steps have been taken to investigate the genetics and biology of A. fraterculus. Consequently, only fragmentary information has been recorded in the literature regarding the use of SIT to control this species. For these reasons, the research to develop a SIT protocol to control A. fraterculus is greatly needed. In recent years, research groups have been building a network in Argentina in order to address particular aspects of the development of the SIT for Anastrepha fraterculus. The problems being addressed by these groups include improvement of artificial diets, facilitation of insect mass rearing, radiation doses and conditions for insect sterilisation, basic knowledge supporting the development of males-only strains, reduction of male maturation time to facilitate releases, identification and isolation of chemical communication signals, and a good deal of population genetic studies. This paper is the product of a concerted effort to gather all this knowledge scattered in numerous and often hard-to-access reports and papers and summarize their basic conclusions in a single publication.

  6. Wild reindeer of Yakutia

    Directory of Open Access Journals (Sweden)

    V.M. Safronov

    1996-01-01

    Full Text Available Three major herds of wild reindeer (Rangifer tarandus tarandus L., totaling over 200,000 animals, occur in the tundra and taiga of northern Yakutia. These herds have been expanding since the late 1950s and now occupy most of their historic range. In addition, several thousand wild reindeer occupy the New Siberian Islands and adjacent coastal mainland tundra, and there are about 60,000 largely sedentary forest reindeer in mountainous areas of the southern two-thirds of the province. Wild reindeer are commercially hunted throughout the mainland, and the production of wild meat is an important part of the economy of the province and of individual reindeer enterprises which produce both wild and domestic meat.

  7. Demographic analysis of mass-reared Anastrepha fraterculus (Diptera: Tephritidae in Tucumán, Argentina Análisis demográfico de la cría masiva de Anastrepha fraterculus (Diptera: Tephritidae en Tucumán, Argentina

    Directory of Open Access Journals (Sweden)

    Héctor E. Jaldo

    2007-06-01

    Full Text Available The life cycle of a lab-adapted mass reared strain of Anastrepha fraterculus at 24°C constant temperature was 41 days, including the preoviposition period. Mortality rates of 8%, 22%, 22%, 5%, and 43% were recorded for eggs, larvae, pupae, adults (preoviposition stage and adults (reproductive stage, respectively. The intrinsic rate of increase was 0.065, the net fecundity rate was 120.4, and the gross fecundity rate was 328.4. In a stable population, 22% would be eggs, 53% larvae, 18% pupae, 4% preoviposition adults, and 3% reproductive adults.El ciclo de vida de Anastrepha fraterculus en cría masiva a temperatura constante de 24°C fue de 41 días, incluyendo el período de preoviposición. Las mortalidades para huevo, larva, pupa, adultos en preoviposición y adultos reproductivos fueron de 8%, 22%, 22%, 5% y 43%, respectivamente. La tasa intrínseca de incremento natural fue de 0,065, la tasa de fertilidad neta fue de 120,4, y la tasa de fertilidad bruta fue de 328,4. En una población estable 22% debería ser huevos, 53% larvas, 18% pupas, 4% adultos en preoviposición y 3% adultos en etapa reproductiva.

  8. Himenópteros parasitóides de larvas de Anastrepha spp. em frutos de carambola (Averrhoa carambola L. na região de Divinópolis, Minas Gerais, Brasil Himenopterous parasitoids of Anastrepha spp. larvae, in star fruit (Averrhoa carambola L. In divinópolis region, Minas Gerais, Brasil

    Directory of Open Access Journals (Sweden)

    Cláudio Gonçalves Silva

    2003-12-01

    Full Text Available Este trabalho foi conduzido com o objetivo de conhecer os parasitóides de moscas-da-fruta na região de Divinópolis-MG. As pupas foram obtidas pelo método de flutuação, sendo individualizadas em cápsulas de gelatina até a emergência das moscas adultas ou de seus parasitóides. A prevalência total de parasitismo foi de 14,8%. Trichopria anastrepha foi a espécie mais comum, com 44,5%.The objective of this work was to identify the parasitoids of fruit flies in Divinópolis-MG region. The pupae were obtained by the flotation method. They were individually placed in gelatin capsules until the emergency of the adult flies or their parasitoids. The overall prevalence of parasitism was 14,8%. Trichopria anastrepha was the most common specie with a frequency of 44,5%.

  9. Cytogenetic Analysis of the South American Fruit Fly Anastrepha fraterculus (Diptera:Tephritidae Species Complex: Construction of Detailed Photographic Polytene Chromosome Maps of the Argentinian Af. sp.1 Member.

    Directory of Open Access Journals (Sweden)

    Angeliki Gariou-Papalexiou

    Full Text Available Genetic and cytogenetic studies constitute a significant basis for understanding the biology of insect pests and the design and the construction of genetic tools for biological control strategies. Anastrepha fraterculus is an important pest of the Tephritidae family. It is distributed from southern Texas through eastern Mexico, Central America and South America causing significant crop damage and economic losses. Currently it is considered as a species complex; until now seven members have been described based on multidisciplinary approaches. Here we report the cytogenetic analysis of an Argentinian population characterized as Af. sp.1 member of the Anastrepha fraterculus species complex. The mitotic karyotype and the first detailed photographic maps of the salivary gland polytene chromosomes are presented. The mitotic metaphase complement consists of six (6 pairs of chromosomes, including one pair of heteromorphic sex chromosomes, with the male being the heterogametic sex. The analysis of the salivary gland polytene complement shows a total number of five long chromosomes that correspond to the five autosomes of the mitotic karyotype and a heterochromatic network corresponding to the sex chromosomes. Comparison of the polytene chromosome maps between this species and Anastrepha ludens shows significant similarity. The polytene maps presented here are suitable for cytogenetic studies that could shed light on the species limits within this species complex and support the development of genetic tools for sterile insect technique (SIT applications.

  10. Wild and Scenic Rivers

    Data.gov (United States)

    Earth Data Analysis Center, University of New Mexico — This map layer portrays the linear federally-owned land features (i.e., national parkways, wild and scenic rivers, etc.) of the United States, Puerto Rico, and the...

  11. Wild Poliovirus List

    Science.gov (United States)

    ... Polio + Prevention The Virus Vaccine-Derived Polioviruses The Vaccines IPV OPV The Communities History of Polio Polio Now This Week Wild poliovirus list Public Health Emergency status Circulating vaccine-derived poliovirus Surveillance Indicators The Global Polio Laboratory ...

  12. Into the urban wild

    DEFF Research Database (Denmark)

    Mollee, Eefke Maria; Pouliot, Mariéve; McDonald, Morag A.

    2017-01-01

    In sub-Saharan Africa, many people depend on natural resources for their livelihoods. While urbanisation causes landscape changes, little is known of how this process affects the use of wild plant resources by urban populations. This study contributes to addressing this knowledge gap by exploring...... the prevalence and determinants of urban collectors of wild plants in Kampala, Uganda. During February to August 2015, 93 structured interviews were conducted in inner, outer, and peri-urban areas of the city. The findings in this study show that urban wild plants are used by almost half (47%) of the respondents......, mainly for medicinal purposes but also as a complement to diets. The findings further indicate that residents with lower income, of younger age (urban areas are more likely to be urban collectors. Seasonality appears to be of greater importance...

  13. Effects of gamma radiation on the sterility and behavioral quality of the caribbean fruit fly, Anastrepha suspensa (Loew (Diptera:Tephritidae Efeitos da radiação gama na esterilização e comportamento da mosca-do-caribe, Anastrepha suspensa (Low (Diptera:Tephritidae

    Directory of Open Access Journals (Sweden)

    J.M.M. Walder

    1993-09-01

    Full Text Available Pupae of Anastrepha suspensa (Loew were irradiated 2 days before adult eclosión in an air atmosphere with 15, 20, 25, 30, 50 and 70 Gy of gamma radiation (Co-60. The radiation effects on sterility and other parameters of quality and behavior of males and females of caribfly were established. Males became fully sterile with a dose of 50 Gy and females laid no eggs when exposed to 25 Gy. Radiation had no significant effect on adult eclosion, sex ratio, flight ability and irritability, but female mortality was affected significantly by radiation, showing higher survival rates in low dosage treatments. The mating behavior of the males was reduced significantly by increasing the radiation doses.Pupas de Anastrepha suspensa (Loew foram irradiadas dois dias antes da emergência dos adultos em atmosfera de ar com as doses de 15, 20, 25, 30, 50 e 70 Gy de radiação gama (Co-60. Foram avaliados os efeitos da radiação sobre a esterilidade e outros parâmetros de qualidade e comportamento de machos e fêmeas de mosca-do-caribe. Machos tornaram-se totalmente estéreis com uma dose de 50 Gy e as fêmeas não ovipositaram quando expostas a 25 Gy. A radiação não teve efeito significativo sobre a taxa de emergência de adultos, na razão sexual, na habilidade de vôo e na irritabilidade desses insetos. Somente a mortalidade das fêmeas foi afetada significativamente pela radiação, causando unia maior sobrevivência nas dosagens mais baixas. A atividade de acasalamento dos machos foi reduzida significativamente com o incremento da dosagem de radiação.

  14. Wild grapevine management

    Science.gov (United States)

    H. Clay Smith

    1989-01-01

    Wild grapevines are a problem for forest managers in many areas of the central hardwood forests. The vines grow on a wide range of soil and site conditions but usually are more concentrated on good sites (northern red oak site index 70 and above), on the faster growing more valuable timber. Presently there is more interest and concern in controlling grapevine for the...

  15. Comparison of Anastrepha ludens (Diptera: Tephritidae) Bisexual and Genetic Sexing (Tapachula-7) Strains: Effect of Hypoxia, Fly Density, Chilling Period, and Food Type on Fly Quality.

    Science.gov (United States)

    Arredondo, José; Ruiz, Lía; Hernández, Emilio; Montoya, Pablo; Díaz-Fleischer, Francisco

    2016-04-01

    The use of genetic sexing strain (GSS) insects in the sterile insect technique (SIT) makes necessary the revision of quality parameters of some stressful steps used during the packing process for aerial release because of possible differences in tolerance between fly strains. Here, we determined the effect of three periods of hypoxia (12, 24, and 36 h at pupal stage), three cage densities (1.0, 1.3, and 1.5 flies/cm2), two different foods (protein/sugar (1/24) and Mubarqui), and three chilling times (20 min [control], 90, and 180 min) on the quality parameters of flies of two Anastrepha ludens (Loew) strains (bisexual and GSS Tapachula-7). In general, the response to stressful conditions of both fly strains was qualitatively equivalent but quantitatively different, as flies of both strains responded equally to the stressful factors; however, flies of Tapachula-7 exhibited lower quality parameters than the control flies. Thus, hypoxia affected the flying ability but not the emergence or longevity of flies. The food type affected the adult weight; protein/sugar produced heavier flies that also survived longer and had a greater mating propensity. Flies under the lowest density were better fliers that those at the other two densities. Increasing chilling time reduced flight ability but not longevity or mating propensity. The implications of these findings for the use of A. ludens GSS in SIT programs are discussed herein.

  16. Mixture-amount design and response surface modeling to assess the effects of flavonoids and phenolic acids on developmental performance of Anastrepha ludens.

    Science.gov (United States)

    Pascacio-Villafán, Carlos; Lapointe, Stephen; Williams, Trevor; Sivinski, John; Niedz, Randall; Aluja, Martín

    2014-03-01

    Host plant resistance to insect attack and expansion of insect pests to novel hosts may to be modulated by phenolic compounds in host plants. Many studies have evaluated the role of phenolics in host plant resistance and the effect of phenolics on herbivore performance, but few studies have tested the joint effect of several compounds. Here, we used mixture-amount experimental design and response surface modeling to study the effects of a variety of phenolic compounds on the development and survival of Mexican fruit fly (Anastrepha ludens [Loew]), a notorious polyphagous pest of fruit crops that is likely to expand its distribution range under climate change scenarios. (+)- Catechin, phloridzin, rutin, chlorogenic acid, and p-coumaric acid were added individually or in mixtures at different concentrations to a laboratory diet used to rear individuals of A. ludens. No effect was observed with any mixture or concentration on percent pupation, pupal weight, adult emergence, or survival from neonate larvae to adults. Larval weight, larval and pupal developmental time, and the prevalence of adult deformities were affected by particular mixtures and concentrations of the compounds tested. We suggest that some combinations/concentrations of phenolic compounds could contribute to the management of A. ludens. We also highlight the importance of testing mixtures of plant secondary compounds when exploring their effects upon insect herbivore performance, and we show that mixture-amount design is a useful tool for this type of experiments.

  17. Quarantine cold treatments for Ceratitis capitata and Anastrepha fraterculus (Diptera: Tephritidae) for citrus in Argentina: conclusions after 10 years of research

    Energy Technology Data Exchange (ETDEWEB)

    Willink, Eduardo; Gastaminza, Gerardo; Salvatore, Analia; Gramajo, M. Cecilia; Acenolaza, Mariana; Avila, Rosana; Favre, Paola, E-mail: ewillink@eeaoc.org.a [Estacion Experimental Agroindustrial Obispo Colombres (EEAOC), Tucuman (Argentina)

    2006-07-01

    Argentina has quarantine restrictions in some markets due to the presence of two quarantine fruit fly pests: Ceratitis capitata and Anastrepha fraterculus. One alternative is the use of cold quarantine treatments during transport of the commodities. Since 1996, the Estacion Experimental Agroindustrial Obispo Colombres (EEAOC), Tucuman, Argentina, has developed different cold quarantine treatments for citrus. In the present work we present all the data the EEAOC generated in the last ten years in order to facilitate the development of such cold treatments. Fruit flies were obtained from the colonies reared at EEAOC. Four citrus species were analyzed: lemon, grapefruit, orange and tangerines. Different varieties were analyzed for each fruit species. Sensitivity trials aiming at determine the most tolerant stage as well as to asses if there is any influence of varieties on cold tolerance were performed. Finally we compared the tolerance to cold between the two species. Sensitivity trials showed that mature larvae (L3) are the most tolerant stage for both fruit fly species. There was no effect of the varieties and the two fruit fly species were equally sensible to cold. Our results provide strong evidence in favor of concluding that any cold treatment developed for C. capitata is effective for A. fraterculus. (author)

  18. OCORRÊNCIA E ÍNDICE DE INFESTAÇÃO DE Anastrepha spp. (DIP., TEPHRITIADE EM Pouteria gardneriana Radlk. E Pouteria ramiflora (Mart. Radlk. (SAPOTACEAE, NOS CERRADOS DE GOIÁS OCCURENCE AND INFESTATION INDEXES OF Anastrepha spp. (DIP., TEPHIRITIDAE IN Pouteria gardneriana RADLK AND Pouteria ramjflora (MART. RADLK. (SAPOTACEAE IN “CERRADOS” OF THE STATE OF GOIÁS, BRAZIL

    Directory of Open Access Journals (Sweden)

    Nelson Augusto Canal Daza

    2007-09-01

    Full Text Available

    Dentre as frutíferas nativas dos cerrados goianos destacam-se as do gênero Pouteria, com ampla distribuição nas regiões tropicais e subtropicais de todo o mundo, sendo a P. ramiflora (curriola a mais comum. Pouteria gardneriana (guapeva ocorre geralmente nos solos mais úmidos, sempre agrupada na faixa de separação cerrados-veredas. Dos 25 municípios do Estado de Goiás amostrados, em nove foi registrada a ocorrência dessas duas espécies de Pouteria, cujos frutos são bastante suscetíveis ao ataque de moscas-das-frutas. Dos frutos de guapeva e curriola, emergiram adultos de Anastrepha (99,82% e apenas alguns exemplares de Ceratitis capitata (0,18%. As espécies coletadas em P. gardneriana foram: Anastrepha bistrigata, A. fraterculus, A. leptozona, A. serpentina, A. zenildae, A. zernyi e C. capitata. De P. ramiflora foram obtidas: A. fraterculus, A. leptozona, A. serpentina e A. zernyi. Dos pupários de Anastrepha

  19. Wild ideas in food

    DEFF Research Database (Denmark)

    Münke, Christopher; Halloran, Afton Marina Szasz; Vantomme, Paul

    2015-01-01

    Foraging for all manner of wild plants, animals and fungi and their products makes up part of the traditional diets of approximately 300 million worldwide (Bharucha and Pretty, 2010). Furthermore, their relevance in the global food supply is often underestimated, as policies and statistics...... at national and regional levels tend to neglect their importance for food sovereignty and food culture (Bharucha and Pretty, 2010). Foraged plants often grow spontaneously and many exist independent of human interaction (Heywood, 1999)...

  20. Antibiotic resistance in wild birds

    National Research Council Canada - National Science Library

    Bonnedahl, Jonas; Järhult, Josef D

    2014-01-01

    .... Antibiotic-resistant bacteria have been isolated from a multitude of wild bird species. Several studies strongly indicate transmission of resistant bacteria from human rest products to wild birds...

  1. Going WILD for Drupal

    Energy Technology Data Exchange (ETDEWEB)

    Abbott, Jennifer; Sandberg, Tami

    2014-06-01

    The Wind-Wildlife Impacts Literature Database (WILD), formerly known as the Avian Literature Database, was created in 1997. The goal of the database was to begin tracking the research that detailed the potential impact of wind energy development on birds. The Avian Literature Database was originally housed on a proprietary platform called Livelink ECM from Open- Text and maintained by in-house technical staff. The initial set of records was added by library staff. A vital part of the newly launched Drupal-based WILD database is the Bibliography module. Many of the resources included in the database have digital object identifiers (DOI). The bibliographic information for any item that has a DOI can be imported into the database using this module. This greatly reduces the amount of manual data entry required to add records to the database. The content available in WILD is international in scope, which can be easily discerned by looking at the tags available in the browse menu.

  2. Parasitic infections in wild ruminants and wild boar

    Directory of Open Access Journals (Sweden)

    Ilić Tamara

    2011-01-01

    Full Text Available Wild ruminants and wild boar belong to the order Artiodactyla, the suborders Ruminantia and Nonruminantia and are classified as wild animals for big game hunting, whose breeding presents a very important branch of the hunting economy. Diseases caused by protozoa are rarely found in wild ruminants in nature. Causes of coccidiosis, cryptosporidiosis, toxoplasmosis, sarcocystiosis, giardiasis, babesiosis, and theileriosis have been diagnosed in deer. The most significant helminthoses in wild ruminants are fasciosis, dicrocoeliasis, paramphistomosis, fascioloidosis, cysticercosis, anoplocephalidosis, coenurosis, echinococcosis, pulmonary strongyloidiasis, parasitic gastroenteritis, strongyloidiasis and trichuriasis, with certain differences in the extent of prevalence of infection with certain species. The most frequent ectoparasitoses in wild deer and doe are diseases caused by ticks, mites, scabies mites, and hypoderma. The most represented endoparasitoses in wild boar throughout the world are coccidiosis, balantidiasis, metastrongyloidiasis, verminous gastritis, ascariasis, macracanthorhynchosis, trichinelosis, trichuriasis, cystecercosis, echinococcosis, and less frequently, there are also fasciolosis and dicrocoeliasis. The predominant ectoparasitoses in wild boar are ticks and scabies mites. Knowledge of the etiology and epizootiology of parasitic infections in wild ruminants and wild boar is of extreme importance for the process of promoting the health protection system for animals and humans, in particular when taking into account the biological and ecological hazard posed by zoonotic infections.

  3. ANÁLISE FAUNÍSTICA E FLUTUAÇÃO POPULACIONAL DE MOSCAS-DAS-FRUTAS (DIPTERA: TEPHRITIDAE EM BELMONTE, BAHIA

    Directory of Open Access Journals (Sweden)

    MÍRIAN DA SILVA SANTOS

    2011-01-01

    Full Text Available This study was carried out in a mixed orchard in the municipality of Belmonte, in the southernmost region of Bahia and it aimed at characterizing the fruit fly (Diptera: Tephritidae population using faunistic analysis and studying its population fluctuation. The study was conducted from August 2007 to August 2009. Fruit fly captures were carried out using McPhail traps baited with protein hydrolisate at 5%. Weekly, the captured insects found in traps were transferred to plastic vials, one vial per trap, filled with 70% ethanol and taken to the laboratory for identification. A total of 9,709 fruit flies was captured, out of which 9,477 specimens were Anastrepha (5,908 females and 3,569 males and 232 specimens were Ceratitis capitata (Wiedemann (201 females and 31 males. Nine species of Anastrepha were recorded: Anastrepha bahiensis (Lima (2.59%, Anastrepha distincta (Greene (2.71%, Anastrepha fraterculus (Wiedemann (59.37%, Anastrepha leptozona (Hendel (0.02%, Anastrepha manihoti (Lima (0.02%, Anastrepha obliqua (Macquart (2.98%, Anastrepha serpentina (Wiedemann (0.07%, Anastrepha sororcula Zucchi (29.14%, Anastrepha zenildae Zucchi (0.22%, and C. capitata (2.88%. Anastrepha fraterculus and A. sororcula were the dominant species and only A. fraterculus was constant on the orchard. The values of the Simpson (0.51 and of Shannon (01.35 indices were intermediate and the modified Hill index was 0.49, indicating a medium diversity. The high est capturevalues of Anastrepha spp. occurred from July to December 2008, with a population peak in September.

  4. Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830 (Diptera: Tephritidae

    Directory of Open Access Journals (Sweden)

    IJ. Bechara

    Full Text Available The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae. We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3' as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

  5. Flutuação populacional de Anastrepha fraterculus (Wiedemann, 1830 (Diptera, Tephritidae na Região Oeste de Santa Catarina, Brasil Population fluctuation of Anastrepha fraterculus (Wiedemann, 1830 (Diptera, Tephritidae in the Western Region of Santa Catarina State, Brazil

    Directory of Open Access Journals (Sweden)

    Flávio Roberto Mello Garcia

    2003-01-01

    Full Text Available Fruit flies are the major pests in fruit orchards and require a frequent insecticide aplication control, which increases production cost and chemical residues in fruits. Adults of Anastrepha fraterculus were sampled from twelve peach, plum, orange, tangerine and acid lime orchards in four counties in the Western Region of Santa Catarina. Modified McPhail plastic traps, baited with glucose 10%, were used to collect the flies from October 1998 to September 2000. Trap monitoring, bait replacement and fruit flies sorting by species and sex were done weekly. A total of 4,164 specimens of A. fraterculus was collected and highest population was registered in the county of Chapecó (64,8% of all sampled flies. Adults were collected all year long, with the highest population peaks occurring from December and January, although the fluctuation was different for each fruit species due to their particular phenology and in different years. Positive correlation among temperature, atmospheric humidity and population levels of adults of A. fraterculus was observed. According to the degree days obtained for each year, 4851.9, 4632.9 and 4983.7, respectively in 1998, 1999 and 2000, it was established that A. fraterculus could present an average of 11.2 generations a year.

  6. Wild McEliece Incognito

    DEFF Research Database (Denmark)

    Bernstein, Daniel J.; Lange, Tanja; Peters, Christiane

    2011-01-01

    The wild McEliece cryptosystem uses wild Goppa codes over nite elds to achieve smaller public key sizes compared to the original McEliece cryptosystem at the same level of security against all attacks known. However, the cryptosystem drops one of the condence-inspiring shields built into the orig...

  7. The Wilde analyst.

    Science.gov (United States)

    Miller, Joel

    2013-03-01

    Oscar Wilde (1854-1900) took on the challenge of teaching us how to live artfully. From the dynamic successes and tragedies of his own life Oscar knew that everything worthy of existence is worthy of art, including its ugliness and suffering. Oscar observed much about human nature, especially his own, in an era when convention was not challenged, knowledge was taught and appearances were everything. For him, "The supreme vice is shallowness."(1) Society and psychoanalysis can still be honored and shaken by his words. The paradoxical and complex nature of Oscar's insights was as good as any coming from a thoughtful psychoanalyst. After the first two attempts to write about Oscar fell flat, it became clear that I must engage with him and try to match the unsparing commitment to explore his unconscious and interior life. In the process of creating the array of sketches of my psychoanalytic encounters with Oscar, I also found the words to describe what drew me to the field some 20 years ago-the art of psychoanalysis.

  8. SUSCETIBILIDADE DE GENÓTIPOS DE MACIEIRA A Anastrepha fraterculus (DIPTERA: TEPHRITIDAE EM DIFERENTES CONDIÇÕES DE INFESTAÇÃO

    Directory of Open Access Journals (Sweden)

    JANAÍNA PEREIRA DOS SANTOS

    2015-03-01

    Full Text Available RESUMO O estudo objetivou registrar as injúrias de Anastrepha fraterculus (Diptera: Tephritidae, em dois estádios de desenvolvimento dos frutos das macieiras M-11/00 e ‘Catarina’, submetidos a três condições de infestação a campo, na safra de 2011/2012. O experimento foi conduzido em pomar mantido sob manejo orgânico, na Estação Experimental da Epagri de Caçador-SC. O número médio de moscas foi avaliado semanalmente, com quatro armadilhas do tipo McPhail. Frutos imaturos e maduros da seleção M-11/00 e da cultivar Catarina foram submetidos às condições de infestação artificial, controlada e natural. No início da frutificação, após o raleio, em cada genótipo, 500 frutos foram aleatoriamente ensacados com embalagens de tecido não texturizado (TNT. Os frutos submetidos à infestação artificial foram envoltos, individualmente, por uma gaiola contendo duas fêmeas acasaladas de A. fraterculus, que permaneceram por três dias para oviposição. Na infestação controlada, no mesmo dia da instalação das gaiolas, frutos protegidos tiveram as embalagens retiradas para que ficassem por três dias expostos. Frutos não ensacados foram utilizados para avaliar a infestação natural. Em cada estádio de desenvolvimento, foram registrados os valores dos atributos físico-químicos dos frutos. O número médio de A. fraterculus durante a safra foi de 3,08 moscas/armadilha/ semana. Na seleção M-11/00, em todas as condições de infestação, o número médio de larvas e pupários foi maior em frutos maduros. Na cv. Catarina, estes números não diferiram entre as condições de infestação nem entre os estádios de desenvolvimento. Pupários de A. fraterculus não foram observados em frutos de ‘Catarina’, e nesta cultivar constatou-se maior acidez e menor relação sólidos solúveis/acidez.

  9. FRUIT FLIES AND THEIR PARASITOIDS IN THE FRUIT GROWING REGION OF LIVRAMENTO DE NOSSA SENHORA, BAHIA, WITH RECORDS OF UNPRECEDENTED INTERACTIONS

    Directory of Open Access Journals (Sweden)

    SUZANY AGUIAR LEITE

    2017-10-01

    Full Text Available ABSTRACT Several fruit fly species (Diptera: Tephritidae and Lonchaeidae assume the status of primary pests in fruit trees grown in Brazil, causing direct production losses. The aims of the study were to know aspects of diversity of fruit flies and their parasitoids in the fruit growing region of Livramento de Nossa Senhora, Bahia. Fruit samples were collected from 19 plant species during November/2011 and June/2014. Infestation rates were calculated in pupae.kg-1 of fruit and pupae.fruit-1. The results indicate the occurrence of Anastrepha obliqua (Macquart, Ceratitis capitata (Wiedemann and Neosilba pendula (Bezzi. Plant species Anacardium occidentale, Averrhoa carambola, Carica papaya, Eugenia uniflora, Malpighia emarginata, Mangifera indica var. “Haden”, “Rosa” and “Tommy Atkins”, Opuntia ficus indica, Pereskia bahiensis, Psidium guajava, Spondias lutea, Spondias purpurea and Spondias tuberosa are hosts of fruit flies in the region. Unprecedented bitrophic relationships between P. bahiensis and C. capitata and Anastrepha sp. and between Opuntia ficus indica and C. capitata and A. obliqua were recorded. Unprecedented tritrophic relationship for the state of Bahia Averrhoa carambola and C. capitata and parasitoid of the Pteromalidae Family were also recorded. Tritrophic associations between M. indica var. “Tommy Atkins” and S. purpurea and A. obliqua and Doryctobracon areolatus; and between S. purpurea and A. obliqua and Utetes anastrephae were observed.

  10. Fruit flies (Diptera, Tephritidae and their parasitoids on cultivated and wild hosts in the Cerrado-Pantanal ecotone in Mato Grosso do Sul, Brazil

    Directory of Open Access Journals (Sweden)

    Tiago Ledesma Taira

    2013-09-01

    Full Text Available Fruit flies (Diptera, Tephritidae and their parasitoids on cultivated and wild hosts in the Cerrado-Pantanal ecotone in Mato Grosso do Sul, Brazil. Information on frugivorous flies in cultivated or wild host plants and their parasitoids in the Cerrado-Pantanal ecotone in Aquidauana, Mato Grosso do Sul is presented and discussed. Fruit fly samples were collected weekly in specific fruit trees, and McPhail® traps were installed in the same trees for a period of two years. The fruit flies infested ripe and unripe fruits of Averrhoa carambola L., Schoepfia sp., Psidium guajava L. and Pouteria torta (Mart. Radlk and mature fruits of Anacardium occidentale L. and Inga laurina (Sw. Willd. Nineteen fruit fly species were obtained with the combination of sampling methods (collecting fruits and trapping, nine of them obtained with both methods, five found only in fruits and five only in traps. This is the first record of Anastrepha striata Schiner in a species of Sapotaceae, as well as for A. castanea Norrbom and A. daciformes Bezzi in Schoepfia sp. (Olacaceae, and for A. distincta Greene in fruits of P. guajava in the state of Mato Grosso do Sul. Fruit collections simultaneously associated with capture of fruit flies by McPhail traps in the same host plants are essential to understand the diversity of fruit flies and their relationship with hosts and parasitoids. Species of Braconidae and Pteromalidae were recovered, where Doryctobracon areolatus (Szépligeti was the most abundant parasitoid in larvae of tephritids infesting both cultivated and wild host fruits.

  11. SISTEMA DE CROMOSSOMOS SEXUAIS MÚLTIPLOS X1X1X2X2/X1X2Y NA MOSCA-DAS-FRUTAS Anastrepha sororcula (DIPTERA: TEPHRITIDAE

    Directory of Open Access Journals (Sweden)

    Inês Regina de Araújo Moura Cunha

    2014-08-01

    Full Text Available Sistemas de cromossomos sexuais simples estão difundidos entre os Tephritidae do gênero Anastrepha. Espécies deste gênero apresentam enorme importância pelo impacto que causam em frutíferas cultivadas, sobretudo no nordeste do Brasil. Análises citogenéticas desenvolvidas em Anastrepha sororcula, através da análise da estrutura cariotípica e bandamento C revelaram a presença de um sistema de cromossomos sexuais múltiplos do tipo X1X1X2X2/X1X2Y nesta espécie. Enquanto as fêmeas apresentam um cariótipo homomórfico com 2n=12, os machos possuem 2n=11, onde se destaca um grande cromossomo Y despareado. O nível de divergência cariotípica da espécie A. sororcula do nordeste, com a presença de um sistema de cromossomos sexuais múltiplos, em relação às regiões central e sudeste do Brasil, podem indicar a ocorrência de impedimentos reprodutivos entre os exemplares das duas áreas e que possivelmente, como outros exemplos que existem neste gênero, A. sororcula constitua um complexo de espécies ainda não inteiramente definido. Palavras-chave: Alossomos, peste agrícola, citogenética de insetos, heterocromatina. DOI: http://dx.doi.org/10.18561/2179-5746/biotaamazonia.v4n2p1-4

  12. Wild dogma II: The role and implications of wild dogma for wild dog management in Australia

    Directory of Open Access Journals (Sweden)

    Benjamin L. ALLEN, Richard M. ENGEMAN, Lee R. ALLEN

    2011-12-01

    Full Text Available The studies of Allen (2011 and Allen et al. (2011 recently examined the methodology underpinning claims that dingoes provide net benefits to biodiversity by suppressing foxes and cats. They found most studies to have design flaws and/or observational methods that preclude valid interpretations from the data, describing most of the current literature as ‘wild dogma’. In this short supplement, we briefly highlight the roles and implications of wild dogma for wild dog management in Australia. We discuss nomenclature, and the influence that unreliable science can have on policy and practice changes related to apex predator management [Current Zoology 57 (6: 737–740, 2011].

  13. MOSCAS-DAS-FRUTAS (DIPTERA: TEPHRITIDAE EM POMARES DA ÁREA URBANA NO NORTE DE MINAS GERAIS

    Directory of Open Access Journals (Sweden)

    CLARICE DINIZ ALVARENGA

    2010-01-01

    Full Text Available The aim this work was know the species of fruit fly and host plants in orchards in the urban area in the north of Minas Gerais. Were selected 10 orchards with wide variety of fruit species, which were distributed in equidistant way in the urban area of Janaúba, MG. Weekly, were collected systematically fruit flies through trap type McPhail and ripe fruit and in ripening one, on those orchards. Were collected 7.016 tephritid obtained from trap (5.226 and fruit (1.790, from which 1.044 belonged to genus Anastrepha and 5.972 were Ceratitis capitata. The specimens number of C. capitata (85.1% was around six times superior to Anastrepha spp. (14.9%, demonstrating the preference of this species for urban orchards. Eight species of Anastrepha occur in urban orchards of Janaúba, MG. Ceratitis capitata was found infesting 10 species of host fruits, being the main S. purpurea and guava. In fruits were collected three species of Anastrepha (A. obliqua, A. sororcula and A. zenildae which were associated with five species of fruit (Malpighia glabra L, Psidium guayava L, S. dulcis, S. purpurea and S. tuberosa. The predominant species of Anastrepha was A. obliqua, and S. tuberosa and S. purpurea being the main hosts of this species in the urban area of Janaúba, MG.

  14. Laboratory Animal Management: Wild Birds.

    Science.gov (United States)

    National Academy of Sciences - National Research Council, Washington, DC. Inst. of Lab. Animal Resources.

    This is a report on the care and use of wild birds in captivity as research animals. Chapters are presented on procurement and identification, housing, nutrition, health of birds and personnel, reproduction in confinement, and surgical procedures. Also included are addresses of federal, state, and provencial regulatory agencies concerned with wild…

  15. Wild Vietnamese relatives of blueberries

    Science.gov (United States)

    rom 25 October to 14 November 2015, wild relatives of cultivated blueberry, Vaccinium corymbosum, were collected during a Vietnamese-US cooperative expedition in Northern Vietnam. The exploration involved representatives of the Plant Resources Center, Vietnam Academy of Agricultural Sciences, in Han...

  16. TB in Wild Asian Elephants

    Centers for Disease Control (CDC) Podcasts

    2017-05-10

    Dr. Susan Mikota, co-founder of Elephant Care International, discusses TB in wild Asian elephants.  Created: 5/10/2017 by National Center for Emerging and Zoonotic Infectious Diseases (NCEZID).   Date Released: 5/10/2017.

  17. Wild Accessions and Mutant Resources

    DEFF Research Database (Denmark)

    Kawaguchi, Masayoshi; Sandal, Niels Nørgaard

    2014-01-01

    Lotus japonicus, Lotus burttii, and Lotus filicaulis are species of Lotus genus that are utilized for molecular genetic analysis such as the construction of a linkage map and QTL analysis. Among them, a number of mutants have been isolated from two wild accessions: L. japonicus Gifu B-129 and Miy...

  18. Bioactivities and Health Benefits of Wild Fruits

    Directory of Open Access Journals (Sweden)

    Ya Li

    2016-08-01

    Full Text Available Wild fruits are exotic or underutilized. Wild fruits contain many bioactive compounds, such as anthocyanins and flavonoids. Many studies have shown that wild fruits possess various bioactivities and health benefits, such as free radical scavenging, antioxidant, anti-inflammatory, antimicrobial, and anticancer activity. Therefore, wild fruits have the potential to be developed into functional foods or pharmaceuticals to prevent and treat several chronic diseases. In the present article, we review current knowledge about the bioactivities and health benefits of wild fruits, which is valuable for the exploitation and utilization of wild fruits.

  19. New records of fruit flies (Diptera: Tephritidae), wild hosts and parasitoids (Hymenoptera: Braconidae) in the Brazilian Amazon

    Energy Technology Data Exchange (ETDEWEB)

    Jesus, Cristiane R. de; Oliveira, Manoela N. de; Silva, Ricardo A. da [EMBRAPA Amapa, Macapa, AP (Brazil); Pereira, Julia D.B. [Universidade Federal do Amapa, Macapa, AP (Brazil); Souza Filho, Miguel F. [Instituto Biologico, Campinas, SP (Brazil); Costa Neto, Salustiano V. da [Instituto de Pesquisas Cientificas e Tecnologicas do Amapa, Macapa, AP (Brazil); Marinho, Claudia F.; Zucchi, Roberto A. [Escola Superior de Agricultura Luiz de Queiroz (ESALQ/USP), Piracicaba, SP (Brazil). Dept. de Entomologia, Fitopatologia e Zoologia Agricola

    2008-11-15

    Anastrepha anomala Stone was obtained from Parahancornia amapa (Huber) Ducke (Apocynaceae) fruits, and Anastrepha hastata Stone from Cheiloclinium cognatum (Miers.) (Hippocrateaceae) in the State of Amapa, Brazil. Two braconids, Doryctobracon sp. and Opius bellus Gahan, were reared from the latter fruit fl y species. This is the fi rst record of P. amapa as a fruit fl y host. C. cognatum is the fi rst host known to A. hastata. Both braconids are also the fi rst records of parasitoids for this species. (author)

  20. The wild tapered block bootstrap

    DEFF Research Database (Denmark)

    Hounyo, Ulrich

    -based method in terms of asymptotic accuracy of variance estimation and distribution approximation. For stationary time series, the asymptotic validity, and the favorable bias properties of the new bootstrap method are shown in two important cases: smooth functions of means, and M-estimators. The first......In this paper, a new resampling procedure, called the wild tapered block bootstrap, is introduced as a means of calculating standard errors of estimators and constructing confidence regions for parameters based on dependent heterogeneous data. The method consists in tapering each overlapping block...... of the series first, the applying the standard wild bootstrap for independent and heteroscedastic distrbuted observations to overlapping tapered blocks in an appropriate way. Its perserves the favorable bias and mean squared error properties of the tapered block bootstrap, which is the state-of-the-art block...

  1. WILD PIG ATTACKS ON HUMANS

    Energy Technology Data Exchange (ETDEWEB)

    Mayer, J.

    2013-04-12

    Attacks on humans by wild pigs (Sus scrofa) have been documented since ancient times. However, studies characterizing these incidents are lacking. In an effort to better understand this phenomenon, information was collected from 412 wild pig attacks on humans. Similar to studies of large predator attacks on humans, data came from a variety of sources. The various attacks compiled occurred in seven zoogeographic realms. Most attacks occurred within the species native range, and specifically in rural areas. The occurrence was highest during the winter months and daylight hours. Most happened under non-hunting circumstances and appeared to be unprovoked. Wounded animals were the chief cause of these attacks in hunting situations. The animals involved were typically solitary, male and large in size. The fate of the wild pigs involved in these attacks varied depending upon the circumstances, however, most escaped uninjured. Most human victims were adult males traveling on foot and alone. The most frequent outcome for these victims was physical contact/mauling. The severity of resulting injuries ranged from minor to fatal. Most of the mauled victims had injuries to only one part of their bodies, with legs/feet being the most frequent body part injured. Injuries were primarily in the form of lacerations and punctures. Fatalities were typically due to blood loss. In some cases, serious infections or toxemia resulted from the injuries. Other species (i.e., pets and livestock) were also accompanying some of the humans during these attacks. The fates of these animals varied from escaping uninjured to being killed. Frequency data on both non-hunting and hunting incidents of wild pig attacks on humans at the Savannah River Site, South Carolina, showed quantitatively that such incidents are rare.

  2. Minnesota Wild and Scenic River Districts

    Data.gov (United States)

    Minnesota Department of Natural Resources — District boundaries for wild, scenic, and recreational rivers designated under the Minnesota State Wild and Scenic Rivers Act. Includes portions of the Minnesota...

  3. AHP 35: Review: TIBET WILD

    Directory of Open Access Journals (Sweden)

    William V Bleisch

    2015-02-01

    Full Text Available Es sieht ein Mondenshcatten Als mein Gefrährte mit, Und aug den wei en Matten Such ich des Wildes Tritt….. Wilhelm Müller, Gute Nacht George Schaller's remarkable career spans nearly six decades of work resulting in field studies of wildlife in the most remote regions, including pioneering investigations on four continents. More than half of that time was spent involved with studies of the wildlife of the Tibetan Plateau and neighboring regions. Following each new phase of his career, from his work on mountain gorillas in Rwanda, tigers in India, lions on the Serengeti, wild sheep in the Himalayas, and Tibetan antelope and other wildlife on the Tibetan steppes, he has made the time to publish a book on each of his expeditions – or more exactly, two (see full list in Appendix. One is always a scholarly monograph full of data, tables, and maps, the other a popular account for the general public. These paired volumes are usually published within one year of each other, and there have been six such pairings so far. For example, Schaller's classic the Mountain Monarchs: Wild Sheep and Goats of the Himalaya was published in 1978; in 1980, he published Stones of Silence: Journeys in the Himalaya; in 1997 he published the popular Tibet's Hidden Wilderness: Wildlife and Nomads of the Chang Tang Reserve; and the next year, 1998, saw the appearance of his scholarly monograph Wildlife of the Tibetan Steppe. ...

  4. Wheel running in the wild.

    Science.gov (United States)

    Meijer, Johanna H; Robbers, Yuri

    2014-07-07

    The importance of exercise for health and neurogenesis is becoming increasingly clear. Wheel running is often used in the laboratory for triggering enhanced activity levels, despite the common objection that this behaviour is an artefact of captivity and merely signifies neurosis or stereotypy. If wheel running is indeed caused by captive housing, wild mice are not expected to use a running wheel in nature. This however, to our knowledge, has never been tested. Here, we show that when running wheels are placed in nature, they are frequently used by wild mice, also when no extrinsic reward is provided. Bout lengths of running wheel behaviour in the wild match those for captive mice. This finding falsifies one criterion for stereotypic behaviour, and suggests that running wheel activity is an elective behaviour. In a time when lifestyle in general and lack of exercise in particular are a major cause of disease in the modern world, research into physical activity is of utmost importance. Our findings may help alleviate the main concern regarding the use of running wheels in research on exercise.

  5. Evolutionary Biology Needs Wild Microbiomes.

    Science.gov (United States)

    Hird, Sarah M

    2017-01-01

    The microbiome is a vital component to the evolution of a host and much of what we know about the microbiome derives from studies on humans and captive animals. But captivity alters the microbiome and mammals have unique biological adaptations that affect their microbiomes (e.g., milk). Birds represent over 30% of known tetrapod diversity and possess their own suite of adaptations relevant to the microbiome. In a previous study, we showed that 59 species of birds displayed immense variation in their microbiomes and host (bird) taxonomy and ecology were most correlated with the gut microbiome. In this Frontiers Focused Review, I put those results in a broader context by discussing how collecting and analyzing wild microbiomes contributes to the main goals of evolutionary biology and the specific ways that birds are unique microbial hosts. Finally, I outline some of the methodological considerations for adding microbiome sampling to the research of wild animals and urge researchers to do so. To truly understand the evolution of a host, we need to understand the millions of microorganisms that inhabit it as well: evolutionary biology needs wild microbiomes.

  6. Grapefruit as a host for the West Indian fruit fly (Diptera: Tephritidae).

    Science.gov (United States)

    Mangan, Robert L; Thomas, Donald B; Moreno, Aleena Tarshis; Robacker, David

    2011-02-01

    The most common hosts for the West Indian fruit fly, Anastrepha obliqua (Macquart) (Diptera: Tephritidae) are fruit in the family Anacardiaceae (mango [Mangifera L.] and mombin [Spondias L.] species). However, similar to many of the tropical fruit flies of major economic importance, this species attacks several other families of crop fruit, including Annonaceae (cherimoya, Annona cherimola Mill.), Myrtaceae (guava, Psidium L.), Oxalidaceae (carambola, Averrhoa carambola L.), Passifloraceae (granadilla, Passiflora quadrangularis Mill.), and Sapotaceae [mamey sapote, Pouteria sapota (Jacq.) H. E. Moore & Steam]. In the family Rutaceae the economically important genus Citrus has been reported and until recently considered a host for this fruit fly. In this study, we reviewed the taxonomy of A. obliqua, tested specific chemicals that may inhibit oviposition, compared egg-to-adult survival of A. obliqua on preferred hosts and on grapefruit (Citrus X paradisi Macfad.), and measured fruit tissue-specific developmental rates of A. obliqua and the known citrus breeding Mexican fruit fly, Anastrepha ludens (Loew) (Diptera: Tephritidae), from egg to pupae. Our literature review shows much confusion concerning the taxonomy of this and related Anastrepha species, including synonymies and confusion with other species. The deterrent effect of the highest concentration of flavonoids for oviposition, although significant, was not absolute. Experiments carried out under laboratory conditions showed 15-40 times greater survival of A. ludens (whose preferred hosts include Rutaceae) on grapefruit compared with A. obliqua for both tree attached and harvested fruit. Experiments of survival of developing stages over time showed that the two species oviposit into different tissues in the fruit, and mortality is much higher for the West Indian fruit fly in the flavedo and albedo of the fruit compared with the Mexican fruit fly.

  7. Tame-wild dichotomy for derived categories

    OpenAIRE

    Bekkert, Viktor I.; Drozd, Yuriy A.

    2003-01-01

    We prove that every finite dimensional algebra over an algebraically closed field is either derived tame or derived wild. The proof is based on the technique of matrix problems (boxes and reduction algorithm). It implies, in particular, that any degeneration of a derived wild algebra is derived wild; respectively, any deformation of a derived tame algebra is derived tame.

  8. Toxoplasmosis in wild and domestic animals

    Science.gov (United States)

    Toxoplasma gondii is widely distributed in wild and domestic animals. The present chapter reviews toxoplasmosis in wild and domestic animals. Coverage in wild animal species is limited to confirmed cases of toxoplasmosis, cases with parasite isolation, cases with parasite detection by PCR, and exper...

  9. Spatiotemporal trends in Canadian domestic wild boar production and habitat predict wild pig distribution

    DEFF Research Database (Denmark)

    Michel, Nicole; Laforge, Michel; van Beest, Floris

    2017-01-01

    eradication of wild pigs is rarely feasible after establishment over large areas, effective management will depend on strengthening regulations and enforcement of containment practices for Canadian domestic wild boar farms. Initiation of coordinated provincial and federal efforts to implement population...... wild boar and test the propagule pressure hypothesis to improve predictive ability of an existing habitat-based model of wild pigs. We reviewed spatiotemporal patterns in domestic wild boar production across ten Canadian provinces during 1991–2011 and evaluated the ability of wild boar farm...... distribution to improve predictive models of wild pig occurrence using a resource selection probability function for wild pigs in Saskatchewan. Domestic wild boar production in Canada increased from 1991 to 2001 followed by sharp declines in all provinces. The distribution of domestic wild boar farms in 2006...

  10. Hsp90 depletion goes wild.

    Science.gov (United States)

    Siegal, Mark L; Masel, Joanna

    2012-02-27

    Hsp90 reveals phenotypic variation in the laboratory, but is Hsp90 depletion important in the wild? Recent work from Chen and Wagner in BMC Evolutionary Biology has discovered a naturally occurring Drosophila allele that downregulates Hsp90, creating sensitivity to cryptic genetic variation. Laboratory studies suggest that the exact magnitude of Hsp90 downregulation is important. Extreme Hsp90 depletion might reactivate transposable elements and/or induce aneuploidy, in addition to revealing cryptic genetic variation. See research article http://wwww.biomedcentral.com/1471-2148/12/25.

  11. WILD HONEY INTOXICATION: CASE REPORT

    Directory of Open Access Journals (Sweden)

    Munire Babayigit

    2013-09-01

    Full Text Available Wild honey intoxication (WHI is a rare disease that results from consuming honey produced by Rhododendron polen feeded bees. WHI develops due to grayanotoxin (GT that it contains. WHI might present with mild symptoms of gastrointestinal, cardiovascular and neurological systems or might also present in a life threatining form with AV block and cardiovascular collaps. In this report we aimed to present clinical presentation and treatment of a case of WHI. [J Contemp Med 2013; 3(3.000: 197-199

  12. Chilled packing systems for fruit flies (Diptera: Tephritidae) in the sterile insect technique

    Energy Technology Data Exchange (ETDEWEB)

    Hernandez, Emilio; Escobar, Arseny; Bravo, Bigail; Montoya, Pablo [Instituto Interamericano de Cooperacion para la Agricultura (IICA), Chiapas (Mexico); Secretaria de Agricultura, Ganaderia, Desarrollo Rural, Pesca y Alimentacion (SAGARPA), Mexico, D.F. (Mexico). Programa Moscafrut

    2010-07-15

    We evaluated three packing systems (PARC boxes, 'GT' screen towers and 'MX' screen towers) for the emergence and sexual maturation of sterile fruit flies, at three adult fl y densities (1, 1.2 and 1.3 fly/cm 2) and three food types. At the lowest density, results showed no significant differences in the longevity and flight ability of adult Anastrepha ludens (Loew) and Anastrepha obliqua Macquart among the three packing systems. Higher densities resulted in a decrease in these parameters. In the evaluation of the three food types, no significant differences were found either on longevity or flight ability of A. ludens. However, the greatest longevity for both sexes A. obliqua was obtained with commercial powdered Mb and the mix of sugar, protein and corn starch on paper (SPCP) food types. The highest value for flight ability in A. obliqua males was obtained with powdered Mb and SPCP food types, and for females with Mb powdered food. Our data indicated that GT and MX screen tower packing systems are an alternative to the PARC boxes, since they were suitable for adult fl y sexual maturation without any harm to their longevity or flight ability. The tested foods were equivalent in both fruit fl y species, with the exception of the agar type for A. obliqua, which yielded the lowest biological parameters evaluated. Our results contribute to the application of new methods for the packing and release of sterile flies in large-scale programs. (author)

  13. Vocal communication of wild parrots

    Science.gov (United States)

    Bradbury, Jack

    2004-05-01

    Field studies of four sympatric parrot species in Costa Rica are revealing several possible functions for the well-known ability of parrots to mimic new sounds throughout life. Despite earlier suggestions that this might facilitate exchanges of environmental information, all data so far suggest that vocal mimicry in the wild is associated with mediation of the fission/fusion of groups of parrots and/or of conflicts between mated pairs. Recent results using array recording and interactive playback will be summarized, and several technical problems created by the mechanisms of parrot vocal signal production discussed. [Research supported by NSF Grant IBN-022927 and by continued encouragement and logistics provided by the staff of the Area Conservacion Guanacaste (Costa Rica).

  14. RESTRAINING OF WILD ANIMALS WITH CHEMICAL SUBSTANCES

    Directory of Open Access Journals (Sweden)

    Vedad Škapur

    2015-06-01

    Full Text Available Animal restrainment technique is one of the most complex procedures in the veterinary practice. Restraining of wild, zoo and exotic animals is completly different from restraining of domestic animals. The restraining and anesthesia processes of the wild animals are often conducted by using a dart gun and blow pipe with the automatic syringes and gas guns, and with application of different chemical preparation/drugs. Key words: restraning, wild, zoo, exotic, animals

  15. Species of fruit flies (Tephritidae obtained of McPhail trap in the Bahia State, Brazil/ Espécies de moscas-das-frutas (Tephritidae obtidas em armadilhas McPhail no Estado da Bahia, Brasil

    Directory of Open Access Journals (Sweden)

    Miguel Francisco de Souza Filho

    2006-07-01

    Full Text Available The objective of this study was to provide knowledge on the species of fruit flies in commercial orchards in counties of the southern and extreme southern regions of the State of Bahia, Brazil. Flies were captured weekly by McPhail traps, using a hydrolyzed corn protein at 5%, as attractant. A total of 257 female was collected, and the species were identified as: Anastrepha fraterculus (77.4%, A. sororcula (4.7%, A. obliqua (2.7%, A. zenildae (0.8%, A. distincta (0.4%, A. consobrina (0.4%, Anastrepha sp.1 (5.1% and Ceratitis capitata (8.5%.O objetivo deste trabalho foi conhecer as espécies de moscas-das-frutas que ocorrem em pomares comerciais em alguns municípios da região sul e extremo-sul do estado da Bahia, Brasil. As moscas-dasfrutas foram capturadas, semanalmente, utilizando-se armadilhas McPhail, tendo como atrativo proteína hidrolisada de milho a 5%. Foi obtido um total de 257 espécimes fêmeas, pertencentes às espécies: Anastrepha fraterculus (77,4%, A. sororcula (4,7%, A. obliqua (2,7%, A. zenildae (0,8%, A. distincta (0,4%, A. consobrina (0,4%, Anastrepha sp.1 (5,1% e Ceratitis capitata (8,5%.

  16. Last of the Wild Project, Version 1, 2002 (LWP-1): Last of the Wild Dataset (Geographic)

    Data.gov (United States)

    National Aeronautics and Space Administration — The Last of the Wild Dataset of the Last of the Wild Project, Version 1, 2002 (LWP-1) is derived from the LWP-1 Human Footprint Dataset. The gridded data are...

  17. Last of the Wild Project, Version 1, 2002 (LWP-1): Last of the Wild Dataset (IGHP)

    Data.gov (United States)

    National Aeronautics and Space Administration — The Last of the Wild Dataset of the Last of the Wild Project, Version 1, 2002 (LWP-1) is derived from the LWP-1 Human Footprint Dataset. The gridded data are...

  18. Last of the Wild Project, Version 2, 2005 (LWP-2): Last of the Wild Dataset (IGHP)

    Data.gov (United States)

    National Aeronautics and Space Administration — The Last of the Wild Dataset of the Last of the Wild Project, Version 2, 2005 (LWP-2) is derived from the LWP-2 Human Footprint Dataset. The gridded data are...

  19. Last of the Wild Project, Version 2, 2005 (LWP-2): Last of the Wild Dataset (Geographic)

    Data.gov (United States)

    National Aeronautics and Space Administration — The Last of the Wild Dataset of the Last of the Wild Project, Version 2, 2005 (LWP-2) is derived from the LWP-2 Human Footprint Dataset. The gridded data are...

  20. Care for the Wild in the Anthropocene

    NARCIS (Netherlands)

    Swart, Jacobus

    2016-01-01

    Animal ethical approaches often focus on certain individual animal features and capabilities for attributing moral standing to them. These features are usually considered from a moral point of view as not differing for wild, semi-wild, and domesticated animals. However, several authors have argued

  1. Market tntegration between farmed and wild fish

    DEFF Research Database (Denmark)

    Bronnmann, Julia; Ankamah-Yeboah, Isaac; Nielsen, Max

    2016-01-01

    Following decade-long growth in worldwide farming of pangasius and tilapia, imports to Germany, a main European market, have been reduced since 2010. One reason for this might be supply growth of wild species at the total German whitefish market, if market integration exists between farmed and wild...

  2. The nomenclature of the African wild ass

    NARCIS (Netherlands)

    Groves, C.P.; Smeenk, C.

    2007-01-01

    The 19th-century reports on the occurrence and identity of wild asses in North-East Africa are reviewed, as well as the names applied in various publications by Fitzinger and von Heuglin, respectively. The first published name for the African wild ass, Asinus africanus Fitzinger, 1858, is a nomen

  3. Sampling wild species to conserve genetic diversity

    Science.gov (United States)

    Sampling seed from natural populations of crop wild relatives requires choice of the locations to sample from and the amount of seed to sample. While this may seem like a simple choice, in fact careful planning of a collector’s sampling strategy is needed to ensure that a crop wild collection will ...

  4. Lead Poisoning in Wild Birds

    Science.gov (United States)

    Lahner, Lesanna L.; Franson, J. Christian

    2009-01-01

    Lead in its various forms has been used for thousands of years, originally in cooking utensils and glazes and more recently in many industrial and commercial applications. However, lead is a potent, potentially deadly toxin that damages many organs in the body and can affect all animals, including humans. By the mid 1990s, lead had been removed from many products in the United States, such as paint and fuel, but it is still commonly used in ammunition for hunting upland game birds, small mammals, and large game animals, as well as in fishing tackle. Wild birds, such as mourning doves, bald eagles, California condors, and loons, can die from the ingestion of one lead shot, bullet fragment, or sinker. According to a recent study on loon mortality, nearly half of adult loons found sick or dead during the breeding season in New England were diagnosed with confirmed or suspected lead poisoning from ingestion of lead fishing weights. Recent regulations in some states have restricted the use of lead ammunition on certain upland game hunting areas, as well as lead fishing tackle in areas frequented by common loons and trumpeter swans. A variety of alternatives to lead are available for use in hunting, shooting sports, and fishing activities.

  5. Conservation of wild reindeer in Kamchatka

    Directory of Open Access Journals (Sweden)

    Vladimir I. Mosolov

    2000-04-01

    Full Text Available The wild reindeer of Kamchatka were never numerous and probably did not exceed 15 000 in number because of the restricted amount of winter and summer range, and the characteristically deep snow of the peninsula. Before I960, biologists believed there was one population with three major wintering areas. The inaccessibility of the interior of the peninsula provided natural protection for wild reindeer and other wildlife. After I960, the road system was expanded for the benefit of the logging and mining industries, and poorly regulated commercial hunting of wild reindeer expanded. The wild reindeer population declined rapidly, and became fragmented into 3 herds by the early 1970s. The herds in southern and northeastern Kamchatka were reduced to a few hundred animals, but the herd in eastern Kamchatka that was largely protected by the federal Kronotskii Biosphere Reserve recovered. Poorly regulated hunting and competition with domestic reindeer continue to be the major conservation issues facing wild reindeer in Kamchatka.

  6. ANÁLISE FAUNÍSTICA DE ESPÉCIES DE MOSCA-DAS-FRUTAS (DIP., TEPHRITIDAE EM MINAS GERAIS

    Directory of Open Access Journals (Sweden)

    N.A. CANAL

    1998-01-01

    Full Text Available Em seis locais de quatro municípios (Janaúba, Jaíba, Nova Porteirinha e Itacarambí do norte do Estado de Minas Gerais, foram coletados 29.454 espécimes de mosca-das-frutas, pertencentes a Ceratitis capitata e a 20 espécies de Anastrepha. O levantamento foi feito entre janeiro de 94 e dezembro de 96, utilizando armadilhas plásticas tipo McPhail. Ceratitis capitata foi a espécie predominante em áreas urbanas. As espécies de Anastrepha predominaram em áreas rurais. A. obliqua, A. zenildae e Anastrepha n. sp.3 foram as espécies predominantes do gênero, entretanto, essa predominância variou de local para local em função da disponibilidade de hospedeiros. As comunidades apresentaram índices de diversidade baixos e quocientes de similaridade entre 73 e 100%.A total of 29,454 specimens of fruit fly were trapped in six sites of four counties (Janaúba, Jaíba, Nova Porteirinha and Itacarambí of the north of the State of Minas Gerais, Brazil. The specimens were collected using McPhail plastic traps from January 1994 to December 1996. The trapped fruit flies belonged to Ceratitis capitata and to 20 species of Anastrepha. Ceratitis capitata was the predominant species in the urban areas and Anastrepha species were predominant in the field areas. A. obliqua, A. zenildae and Anastrepha n. sp.3 were the predominant species of the genera, whereas the predominant species differed among localities, according to host availability. The diversity indexes were low and the coefficient of similarity varied from 73 to 100%.

  7. Linkage disequilibrium in wild mice.

    Directory of Open Access Journals (Sweden)

    Cathy C Laurie

    2007-08-01

    Full Text Available Crosses between laboratory strains of mice provide a powerful way of detecting quantitative trait loci for complex traits related to human disease. Hundreds of these loci have been detected, but only a small number of the underlying causative genes have been identified. The main difficulty is the extensive linkage disequilibrium (LD in intercross progeny and the slow process of fine-scale mapping by traditional methods. Recently, new approaches have been introduced, such as association studies with inbred lines and multigenerational crosses. These approaches are very useful for interval reduction, but generally do not provide single-gene resolution because of strong LD extending over one to several megabases. Here, we investigate the genetic structure of a natural population of mice in Arizona to determine its suitability for fine-scale LD mapping and association studies. There are three main findings: (1 Arizona mice have a high level of genetic variation, which includes a large fraction of the sequence variation present in classical strains of laboratory mice; (2 they show clear evidence of local inbreeding but appear to lack stable population structure across the study area; and (3 LD decays with distance at a rate similar to human populations, which is considerably more rapid than in laboratory populations of mice. Strong associations in Arizona mice are limited primarily to markers less than 100 kb apart, which provides the possibility of fine-scale association mapping at the level of one or a few genes. Although other considerations, such as sample size requirements and marker discovery, are serious issues in the implementation of association studies, the genetic variation and LD results indicate that wild mice could provide a useful tool for identifying genes that cause variation in complex traits.

  8. Sir William Wilde: an enlightened editor.

    Science.gov (United States)

    O'Doherty, M

    2016-05-01

    This paper examines Sir William Wilde's peculiar genius as editor, his contribution to the Irish Journal of Medical Science in ensuring its endurance and making it a treasure-house of the history of medicine in Ireland.

  9. Eelworms in wild hoofed mammals of Ukraine

    Directory of Open Access Journals (Sweden)

    Y. Dovgyi

    2011-08-01

    Full Text Available Strongylata, Rhabditata and Ascaridata eelworms were found in wild hoofs (roe deers and wild boars in Ukraine. Strongylata are presented by Globocephalus sp., Dictyocaulus viviparous (Bloch, D. еckerti Skrjabin, Muellerius sp., Cystocaulus sp., Protostrongylus sp., Haemonchus contortus Rundolphi, Marshallagia marshalli (Ransom, Nematodirus oiratianus Rajevskaja, Trichostrongylus axei (Cobbold, Bunostomum phlebotomum (Railliet, Oesophagostomum venulosus (Rudolphi, O. dentatm (Rudolphi and Chabertia ovina (Raill.. The helmints Strongyloides papillosus Wedl, S. ransomi Scwartz et Al. and Ascaris suum (Goeze were identified for Rhabditata and Ascaridata.

  10. Observational Learning in Wild and Captive Dolphins

    OpenAIRE

    Yeater, Deirdre B.; Stan A. Kuczaj II

    2010-01-01

    Many non-human species imitate the behavior of others, and dolphins seem particularly adept at this form of observational learning. Evidence for observational learning in wild dolphins is rare, given the difficulty of observing individual wild animals in sufficient detail to eliminate other possible explanations of purported imitation. Consequently, much of the evidence supporting observational learning in dolphins has involved animals in captive settings. This research suggests that dolphins...

  11. Parasitic infections of wild rabbits and hares

    Directory of Open Access Journals (Sweden)

    Ilić Tamara

    2014-01-01

    Full Text Available The paper presents the most important parasitic infections of wild rabbits and hares, which harmful effect in this animal population is manifested as a gradual weakening of the immune system, reduction in fertility, weight loss and constant exhaustion. Order of Lagomorpha (hares or lagomorphs belongs to superorder of higher mammals which includes the family of rabbits (Leporidae which are represented in Europe as well as the family of whistleblowers (Ochotonidae which live only in North America and Northern regions of Asia. The most important representatives of Leporidae family are European hare (Lepus europeus and wild rabbit (Oryctolagus cuniculus. The most important endoparasitosis of hares and wild rabbits are: coccidiosis, encephalitozoonosis (nosemosis, toxoplasmosis, sarcocystosis, giardiasis, cryptosporidiosis, protostrongylosis, trichostrngylodosis, passalurosis, anoplocephalidosis, cysticercosis and fasciolosis. The most frequent ectoparasites of rabbits and wild hares are fleas, lice and ticks. Reduction in hare population, which is noticed in whole Europe including Serbia, is caused by changed living conditions, quantitatively and qualitatively insufficient nutrition, increased use of herbicides as well as various infectious diseases and the diseases of parasitic etiology. Since wild rabbits and hares pose a threat to health of domestic rabbits and people, knowledge of parasitic fauna of these wild animals is of extreme epizootiological and epidemiological importance.

  12. Experimental challenges of wild Manila clams with Perkinsus species isolated from naturally infected wild Manila clams.

    Science.gov (United States)

    Waki, Tsukasa; Shimokawa, Jun; Watanabe, Shinji; Yoshinaga, Tomoyoshi; Ogawa, Kazuo

    2012-09-15

    Manila clams, Ruditapes philippinarum, are widely harvested in the coastal waters in Japan. However, there have been significant decreases in the populations of Manila clams since the 1980s. It is thought that infection with the protozoan Perkinsus species has contributed to these decreases. A previous study demonstrated that high infection levels of a pure strain of Perkinsus olseni (ATCC PRA-181) were lethal to hatchery-raised small Manila clams, however, the pathogenicity of wild strain Perkinsus species to wild Manila clam is unclear. To address this, we challenged large (30-40 mm in shell length) and small (3-15 mm in shell length) wild Manila clams with Perkinsus species isolated from naturally infected wild Manila clams. We report high mortalities among the small clams, but not among the large ones. This is the first report to confirm the pathogenicity of wild isolate of Perkinsus species to wild Manila clams. Copyright © 2012 Elsevier Inc. All rights reserved.

  13. Oscar Wilde and the brain cell.

    Science.gov (United States)

    Cohn, Elisha

    2013-01-01

    This chapter considers Oscar Wilde's interest in the brain cell as an aesthetic object. Offering an account of Wilde's career that analyzes his early interest in physiology and philosophy, this chapter argues that Wilde's uniquely aesthetic take on the brain suggests that he rejects an account of the self as autonomous or self-determining. For many late Victorians brain science threatened both the freedom of human action and the legitimacy of beauty because it had the potential to invalidate conscious experience. But writers whose work Wilde knew, like John Ruskin, W. K. Clifford, and John Tyndall, avoided the despair of materialism by using aesthetic terms in their own discussions of life's invisible materials. Wilde's art collaborates with the contemporary sciences. His depictions of the cell direct the senses to a new field of being that emphasizes the molecular life all humans have in common, in which individual responsibility and activity matter less than the necessity of beauty. © 2013 Elsevier B.V. All rights reserved.

  14. Market conduct and performance of wild and semi-wild food plants ...

    African Journals Online (AJOL)

    This study assessed the market conduct and performance of wild and semi-wild food plants (WSWFPs) traded in Bunyoro-Kitara Kingdom, Uganda. A rapid market survey (RMS) was conducted in 17 local markets in Kibanda County. Market prices and weekly volumes of traded WSWFPs were compared with some of the ...

  15. Market conduct and performance of wild and semi-wild food plants ...

    African Journals Online (AJOL)

    Prof. Jacob Agea

    2013-06-12

    Jun 12, 2013 ... 5School of Environment, Natural Resources and Geography, Bangor University, Bangor-Gwynedd, ... This study assessed the market conduct and performance of wild and semi-wild food plants (WSWFPs) traded in ... Traded products were primarily delivered to markets on foot and using bicycles. Currently ...

  16. Haemoglobin polymorphism in wild and cultured African catfish ...

    African Journals Online (AJOL)

    The result shows that both wild and cultured C. gariepinus had AA, BB and CC genotypes in the males and females. However, BD genotype was observed only in the female wild C. gariepinus. The percentage AA and BB genotypes of wild male C. gariepinus was 6.6% each. Wild females had AA, BB, CC and BD genotype ...

  17. Rabies and African wild dogs in Kenya.

    Science.gov (United States)

    Kat, P W; Alexander, K A; Smith, J S; Munson, L

    1995-11-22

    Three packs of African wild dogs (Lycaon pictus) ranging to the north of the Masai Mara National Reserve in southwestern Kenya were monitored from 1988 to 1990. During a six week period (August 2-September 14, 1989), 21 of 23 members of one of these packs died. Histological examination of two brain samples revealed eosinophilic intracytoplasmic inclusions (Negri bodies), supporting a diagnosis of rabies viral encephalitis. An additional brain sample tested positive for rabies with a fluorescent antibody test. Nucleotide sequence of the rabies viral N and G genes from isolates of four African wild dogs (including an individual from Tanzania) indicated that infection was with a viral variant common among domestic dogs in Kenya and Tanzania. A hypothesis linking African wild dog rabies deaths to researcher handling is evaluated and considered implausible.

  18. True Numerical Cognition in the Wild.

    Science.gov (United States)

    Piantadosi, Steven T; Cantlon, Jessica F

    2017-04-01

    Cognitive and neural research over the past few decades has produced sophisticated models of the representations and algorithms underlying numerical reasoning in humans and other animals. These models make precise predictions for how humans and other animals should behave when faced with quantitative decisions, yet primarily have been tested only in laboratory tasks. We used data from wild baboons' troop movements recently reported by Strandburg-Peshkin, Farine, Couzin, and Crofoot (2015) to compare a variety of models of quantitative decision making. We found that the decisions made by these naturally behaving wild animals rely specifically on numerical representations that have key homologies with the psychophysics of human number representations. These findings provide important new data on the types of problems human numerical cognition was designed to solve and constitute the first robust evidence of true numerical reasoning in wild animals.

  19. Ombre di ombre. Wilde cita Balzac II

    Directory of Open Access Journals (Sweden)

    Susi Pietri

    2010-12-01

    Full Text Available Oscar Wilde, “reader of Balzac” in Balzac in English and in The Decay of Lying, as well as in other essays and imagined conversations, tests an especially transgressive practice of quotation, rewriting and rereading both Balzac’s self-readings and the readings of Balzac made by other writers, such as Charles Baudelaire, Théophile Gautier and Algernon Charles Swinburne. In this way, Oscar Wilde transforms the manipulation of quotations into a new aesthetic invention. Indeed, by inserting themes and characters taken from the Comédie humaine in his own essays and dialogues, Wilde follows a complex strategy to take possession of Balzac’s inheritance and explores the performative power of the “mask”, the systematic use of critical paradoxes, the poetics of “plagiarism” and of “living plagiarism” as “reverse quotation” of Art by Life and vice versa.

  20. How fast was wild wheat domesticated?

    Science.gov (United States)

    Tanno, Ken-Ichi; Willcox, George

    2006-03-31

    Prehistoric cultivation of wild wheat in the Fertile Crescent led to the selection of mutants with indehiscent (nonshattering) ears, which evolved into modern domestic wheat. Previous estimates suggested that this transformation was rapid, but our analyses of archaeological plant remains demonstrate that indehiscent domesticates were slow to appear, emerging approximately 9500 years before the present, and that dehiscent (shattering) forms were still common in cultivated fields approximately 7500 years before the present. Slow domestication implies that after cultivation began, wild cereals may have remained unchanged for a long period, supporting claims that agriculture originated in the Near East approximately 10,500 years before the present.

  1. Consequences of recurrent gene flow from crops to wild relatives.

    OpenAIRE

    Haygood, Ralph; Ives, Anthony R; Andow, David A

    2003-01-01

    Concern about gene flow from crops to wild relatives has become widespread with the increasing cultivation of transgenic crops. Possible consequences of such gene flow include genetic assimilation, wherein crop genes replace wild ones, and demographic swamping, wherein hybrids are less fertile than their wild parents, and wild populations shrink. Using mathematical models of a wild population recurrently receiving pollen from a genetically fixed crop, we find that the conditions for genetic a...

  2. Cordia dichotomoa Forst. f Syn. C. obliqua Willd. (English: Sebesten ...

    Indian Academy of Sciences (India)

    ropes, cordage and paper pulp. The fruit is an astringent and is used in affections o.f urinary passages, diseases o.llllngs and spleen. The decoction of bark is used infevers. The kernels are used in treating ring-worm. The leaves are used in treating ulcers and headache. The plant is used as an antidote to snake-bite.

  3. EU experimental study on wild boar trichinellosis

    NARCIS (Netherlands)

    Knapen F van; Franchimont JH; Garate T; Henriksen SA; Martinez-Fernandez A; Pfeiffer G; Ring C; Soule C; Voigt WP; LPM; diverse veterinaire instituten in Spanje; Denemarken; Duitsland en Frankrijk

    1995-01-01

    Sinds januari 1994 is de EEG-richtlijn 92/45 EEC van kracht waarin de controle van vlees van wilde dieren (inclusief zwijnen) op afwezigheid van Trichinella spiralis is geregeld. Er wordt gebruik gemaakt van laboratoriummethoden die geschikt zijn voor onderzoek van vlees van varkens. In een

  4. Zoopharmacognosy-Self-Medication in Wild Animals

    Indian Academy of Sciences (India)

    Home; Journals; Resonance – Journal of Science Education; Volume 13; Issue 3. Zoopharmacognosy - Self-Medication in Wild Animals. Rajasekar Raman Sripathi Kandula. General Article Volume 13 Issue 3 March 2008 pp 245-253. Fulltext. Click here to view fulltext PDF. Permanent link:

  5. Who Speaks for Wolf? Not Project WILD.

    Science.gov (United States)

    Horwood, Bert

    Project WILD, a Canadian elementary school curriculum supplement about wildlife and the environment, is seriously flawed in that it presents a human-centered view of the world while purporting to be unbiased. This anthropocentric perspective, in which humans are alienated from the environment and in control of nature by technological means, is in…

  6. DETERMINANTS OF VISITORS' PREFERENCE FOR WILD ANIMAL ...

    African Journals Online (AJOL)

    Omotesho

    this increasingly important sector. This study examined the determinants of visitors' preference for wild animal species in Kwara State, Nigeria. It determined the animal species preference in the state and highlighted the desired animal characteristics that endeared animals to zoo visitors.A structured questionnaire was used ...

  7. Boundaries of the wolf and the wild

    NARCIS (Netherlands)

    Arts, Koen; Fischer, Anke; Wal, van der René

    2016-01-01

    Animal reintroduction and rewilding are two widely appealing and frequently connected forms of ecological restoration. However, the critical assumption that animal reintroduction automatically helps to restore formerly wild places is under-theorized. To fill this void, we identified three common

  8. aqueous solutions by caladium bicolor (wild

    African Journals Online (AJOL)

    The biomaterial is cellulosic and therefore biodegradable and environment friendly. Kinetics describes the ... The study of kinetics in wastewater treatment is significant as it provides available insights ... metals in aqueous effluent using Caladium bicolor (wild cocoyam) biomass. Secondly, to present a modeling equation to ...

  9. The wild animal as a research animal

    NARCIS (Netherlands)

    Swart, JAA

    2004-01-01

    Most discussions on animal experimentation refer to domesticated animals and regulations are tailored to this class of animals. However, wild animals are also used for research, e. g., in biological field research that is often directed to fundamental ecological-evolutionary questions or to

  10. aqueous solutions by caladium bicolor (wild

    African Journals Online (AJOL)

    maximum sorption was found to be 75.11 mg/g and 25.30 mg/g for Pb2+ and Cdº ... be used to predict the rate of pollutant removal from aqueous solutions in the ... The adsorbent used in the present study is C. bicolor (wild cocoyam) biomass.

  11. "Wild Beasts" Roam the Art Room

    Science.gov (United States)

    Thompson, Virginia P.

    2012-01-01

    Fauvism is a style of painting based on the use of intensely vivid colors that were not natural to the faces, landscapes and objects being painted. It was how artists expressed themselves during the first decade of the 20th century, and lasted only a short time. The artists were called "les Fauves," which means "the wild beasts." In this article,…

  12. Wild and domesticated mushroom consumption in Nigeria ...

    African Journals Online (AJOL)

    Research on mushroom and mushroom products is dynamic with global increasing interest. The natural habitat of mushrooms being the wild, it is imperative to cultivate mushroom domestically in order to make it available to the populace. The aim of this research was to assess the perception of consumers to consumption of ...

  13. and wild cherry (Prunus avium L.)

    African Journals Online (AJOL)

    user

    2011-02-28

    Feb 28, 2011 ... refrige-rator at 3°C. In addition, an improved German seed source (SS) collected from Mittelgebirge (Polle) seed orchard in 1999 was kindly donated for the study by the. Lower Saxony Forest Genetics Resources Research. Institute (NFV) in Germany. In total, six SSs were used for wild cherry in this study.

  14. Global conservation priorities for crop wild relatives

    NARCIS (Netherlands)

    Castañeda-Álvarez, Nora P.; Khoury, Colin K.; Achicanoy, Harold A.; Bernau, Vivian; Dempewolf, Hannes; Eastwood, Ruth J.; Guarino, Luigi; Harker, Ruth H.; Jarvis, Andy; Maxted, Nigel; Müller, Jonas V.; Ramirez-Villegas, Julian; Sosa, Chrystian C.; Struik, Paul C.; Vincent, Holly; Toll, Jane

    2016-01-01

    The wild relatives of domesticated crops possess genetic diversity useful for developing more productive, nutritious and resilient crop varieties. However, their conservation status and availability for utilization are a concern, and have not been quantified globally. Here, we model the global

  15. Wild genius - domestic fool? Spatial learning abilities of wild and domestic guinea pigs

    Directory of Open Access Journals (Sweden)

    Sachser Norbert

    2010-03-01

    Full Text Available Abstract Background Domestic animals and their wild relatives differ in a wide variety of aspects. The process of domestication of the domestic guinea pig (Cavia aperea f. porcellus, starting at least 4500 years ago, led to changes in the anatomy, physiology, and behaviour compared with their wild relative, the wild cavy, Cavia aperea. Although domestic guinea pigs are widely used as a laboratory animal, learning and memory capabilities are often disregarded as being very scarce. Even less is known about learning and memory of wild cavies. In this regard, one striking domestic trait is a reduction in relative brain size, which in the domesticated form of the guinea pig amounts to 13%. However, the common belief, that such a reduction of brain size in the course of domestication of different species is accomplished by less learning capabilities is not at all very well established in the literature. Indeed, domestic animals might also even outperform their wild conspecifics taking advantage of their adaptation to a man-made environment. In our study we compared the spatial learning abilities of wild and domestic guinea pigs. We expected that the two forms are different regarding their learning performance possibly related to the process of domestication. Therefore wild cavies as well as domestic guinea pigs of both sexes, aged 35 to 45 days, were tested in the Morris water maze to investigate their ability of spatial learning. Results Both, wild cavies and domestic guinea pigs were able to learn the task, proving the water maze to be a suitable test also for wild cavies. Regarding the speed of learning, male as well as female domestic guinea pigs outperformed their wild conspecifics significantly. Interestingly, only domestic guinea pigs showed a significant spatial association of the platform position, while other effective search strategies were used by wild cavies. Conclusion The results demonstrate that domestic guinea pigs do not at all

  16. Consumer beliefs regarding farmed versus wild fish.

    Science.gov (United States)

    Claret, Anna; Guerrero, Luis; Ginés, Rafael; Grau, Amàlia; Hernández, M Dolores; Aguirre, Enaitz; Peleteiro, José Benito; Fernández-Pato, Carlos; Rodríguez-Rodríguez, Carmen

    2014-08-01

    Aquaculture is a food-producing activity, alternative to traditional extractive fishing, which still acts as a reference for most consumers. The main objective of the present paper was to study which consumer beliefs, regarding farmed versus wild fish, hinder the potential development of the aquaculture sector. To achieve this purpose the study was organized into two complementary steps: a qualitative approach (focus groups) aimed at assessing consumer perception about wild and farmed fish and to identify the salient beliefs that differentiate them; and a quantitative approach (survey by means of a questionnaire) to validate the results obtained in the focus group discussions over a representative sample of participants (n = 919). Results showed that participants perceive clear differences between farmed and wild fish. Although no significant differences between both kinds of fish were detected on safety, in general farmed fish was perceived to be less affected by marine pollution, heavy metals and parasites. In the contrary, wild fish was considered to have healthier feeding, to contain fewer antibiotics and to be fresher, healthier, less handled and more natural. Beliefs related to quality were in favour of wild fish, while those related to availability and price were in favour of farmed fish. Significant differences were observed in the perception of both kinds of fish depending on the consumers' objective knowledge about fish, on the level of education, age and gender and on the three segments of consumers identified: "Traditional/Conservative", "Connoisseur", "Open to aquaculture". The results provided could play an important role when planning and designing efficient marketing strategies for promoting farmed fish by adapting the information provided to the perception of each segment of consumers identified by the present study. Copyright © 2014 Elsevier Ltd. All rights reserved.

  17. Hymenopteran parasitoids associated with frugivorous larvae in a Brazilian caatinga-cerrado ecotone.

    Science.gov (United States)

    De Souza, A R; Lopes-Mielezrski, G N; Lopes, E N; Querino, R B; Corsato, C D A; Giustolin, T A; Zucchi, R A

    2012-04-01

    The purpose of this study was to investigate native species of parasitoids of frugivorous larvae and their associations with host plants in commercial guava orchards and in typical native dry forests of a caatinga-cerrado ecotone in the State of Minas Gerais, Brazil. Nine species of parasitoids were associated with larvae of Anastrepha (Tephritidae) and Neosilba (Lonchaeidae) in fruit of Psidium guajava L. (Myrtaceae), Ziziphus joazeiro Mart. (Rhamnaceae), Spondias tuberosa Arruda (Anacardiaceae), Spondias dulcis Forst. (Anacardiaceae), Syzygium cumini (L.) Skeels (Myrtaceae), and Randia armata (Sw.) DC. (Rubiaceae). Doryctobracon areolatus was the most abundant species, obtained from puparia of Anastrepha zenildae, An. sororcula, An. fraterculus, An. obliqua, and An. turpiniae. This is the first report of Asobara obliqua in Brazil and of As. anastrephae and Tropideucoila weldi in dry forests of Minas Gerais State. The number of species of parasitoids was higher in areas with greater diversity of cultivated species and lower pesticide use. The forest fragments adjacent to the orchards served as shelter for parasitoids of frugivorous larvae.

  18. Chemical composition of oils from wild almond (Prunus scoparia and wild pistachio (Pistacia atlantica

    Directory of Open Access Journals (Sweden)

    Jafari Mohammadi, S. A.

    2013-03-01

    Full Text Available The aim of this study was to determine the fatty acids, sterols and triacylglycerol compositions as well as the amount of tocopherols, total phenols and pigments wild almond and cold pressed wild pistachio oils. Triacylglycerols, tocopherols and pigments were analyzed with HPLC, fatty acids and sterols with gas chromatography, and total phenols photometrically. The main fatty acids in both samples were oleic, linoleic and palmitic acids. The most predominant TAG species are SLL + PLO (21.83% in wild pistachio oil and OOO (47.27% in wild almond oil. Pheophytin a was the major pigment in wild pistachio oil. There were no pigments detected in wild almond oil. Total phenols were 57.6 mg kg-1 oil for wild pistachio and 45.3 mg kg-1 oil for wild almond oil.El objetivo de este estudio fue determinar la composición en ácidos grasos, esteroles, triglicéridos, así como tocoferoles, fenoles totales y pigmentos de aceites de almendras y pistachos silvestres prensados en frío. Triglicéridos (TAG, tocoferoles y pigmentos se analizaron mediante HPLC, los ácidos grasos y esteroles mediante cromatografía de gases, y los fenoles totales espectrofotométricamente. Los principales ácidos grasos de ambas especies fueron los ácidos oleico, linoleico y palmítico. Las especies de TAG predominantes son SLL + OLP (21,83% en el pistacho silvestre y OOO (47,27% en almendras silvestre. Feofitina a es un pigmento importante en los aceites de pistacho silvestre. No se detectó pigmentos en los aceites de almendras silvestres. Los fenoles totales fueron 57,6 mg kg-1 y 45,3 mg kg-1 en los aceites de pistacho silvestre y de almendra silvestre respectivamente.

  19. Evaluating Ambient Displays in the Wild

    DEFF Research Database (Denmark)

    Messeter, Jörn; Molenaar, Daryn

    A prominent issue for evaluating ambient displays has been the conflict between the relative intrusiveness of evaluation methods and the intention to keep the display at the periphery of the user’s attention. There is a general lack of research discussing the difficulties of evaluating ambient...... displays in the wild, and in particular social aspects of use has received little attention. This paper presents a case study of an ambient light display designed for a public setting. Based on results from a non-intrusive in situ evaluation, we argue that viewing ambient displays as features of a broader...... social setting may aid our understanding of issues regarding the evaluation of ambient displays in the wild....

  20. Sleeping distance in wild wolf packs

    Science.gov (United States)

    Knick, S.T.; Mech, L.D.

    1980-01-01

    Sleeping distances were observed among members of 13 wild wolf (Canis lupus) packs and 11 pairs in northeastern Minnesota to determine if the distances correlated with pack size and composition. The study utilized aerial radio-tracking and observation during winter. Pack size and number of adults per pack were inversely related to pack average sleeping distance and variability. No correlation between sleeping distance and microclimate was observed. Possible relationships between social bonding and our results are discussed.

  1. La seconda visione. Wilde cita Balzac I

    Directory of Open Access Journals (Sweden)

    Susi Pietri

    2010-06-01

    Full Text Available Oscar Wilde, “lettore di Balzac” in Balzac in English, The Decay of Lying, e in diversi altri saggi e conversazioni immaginarie, sperimenta una pratica particolarmente trasgressiva della citazione, riscrivendo e rileggendo auto-letture dello stesso Balzac e letture balzachiane di altri scrittori, come Charles Baudelaire, Théophile Gautier e Algernon Charles Swinburne, fino a trasformare la manipolazione delle citazioni in reinvenzione estetica. L’inserzione di temi e personaggi della Comédie humaine nelle proprie opere saggistiche e dialogiche risponde a una complessa strategia di “riappropriazione” dell’eredità balzachiana, attraverso l’esplorazione del potere performativo della “maschera”, l’uso sistematico di paradossi critici, la poetica del “plagio” e del “plagio vivente” in quanto “citazione a rovescio” dell’Arte da parte della Vita e viceversa. Oscar Wilde, “reader of Balzac” in Balzac in English and in The Decay of Lying, as well as in other essays and imagined conversations, tests an especially transgressive practice of quotation, rewriting and rereading both Balzac’s self-readings and the readings of Balzac made by other writers, such as Charles Baudelaire, Théophile Gautier and Algernon Charles Swinburne. In this way, Oscar Wilde transforms the manipulation of quotations into a new aesthetic invention. Indeed, by inserting themes and characters taken from the Comédie humaine in his own essays and dialogues, Wilde follows a complex strategy to take possession of Balzac’s inheritance and explores the performative power of the “mask”, the systematic use of critical paradoxes, the poetics of “plagiarism” and of “living plagiarism” as “reverse quotation” of Art by Life and vice versa.

  2. Dental eruption in East African wild chimpanzees.

    Science.gov (United States)

    Machanda, Zarin; Brazeau, Nick F; Bernard, Andrew B; Donovan, Ronan M; Papakyrikos, Amanda M; Wrangham, Richard; Smith, Tanya M

    2015-05-01

    Knowledge of chimpanzee development has played an essential role in our understanding of the evolution of human ontogeny. However, recent studies of wild ape dentitions have cast doubt on the use of developmental standards derived from captive individuals. Others have called into question the use of deceased wild individuals to infer normative development. We conducted a high resolution photographic study of living known-age subadults in the Kanyawara community (Kibale National Park, Uganda) to generate a comprehensive three year record of dental eruption (including tooth emergence ages). These non-invasive data allow comparisons of captive and wild chimpanzees, establish accurate developmental standards for relatively healthy wild individuals, and facilitate direct assessments of primate-wide associations between dental development and life history. Emergence ages in the Kanyawara chimpanzees are very similar to living Gombe chimpanzees, and are broadly comparable to deceased Taï Forest chimpanzees. Early-emerging teeth such as the deciduous dentition and first molar (M1) appear during a time of maternal dependence, and are almost indistinguishable from captive chimpanzee emergence ages, while later forming teeth in the Kanyawara population emerge in the latter half of captive age ranges or beyond. Five juveniles whose lower M1s emerged by or before 3.3 years of age continued to nurse for a year or more beyond M1 emergence, and their mothers showed considerable variation in reproductive rates. The third molars of two adolescent females emerged several months to several years prior to the birth of their first offspring. Given that broad primate-wide relationships between molar emergence and life history do not necessarily hold within this population of chimpanzees, particularly for variables that are reported to be coincident with molar emergence, we suggest that further study is required in order to predict life history variables in hominins or hominoids

  3. Observation of dystocia in wild elk

    Science.gov (United States)

    Chad P. Lehman; Lowell E. Schmitz; Mark A. Rumble; Jackie J. Kragel; Joshua J. Millspaugh

    2012-01-01

    On the basis of reports in the literature, incidence of dystocia in wild elk (Cervus elaphus) across the west is rare. In 2011, one of 34 (3%) pregnant cow elk in our study experienced dystocia during birth. Our visual observations indicated that it took approximately 4 days for a radio-collared cow elk to succumb to dystocia in our study. Little is known about...

  4. Population genetics and disease ecology of European wild boar

    NARCIS (Netherlands)

    Goedbloed, D.J.

    2013-01-01

    Welke factoren beïnvloeden de frequentie van de ziekten in wilde populaties? Het promotieonderzoek van Daniel Goedbloed beoordeelde de invloed van demografische, genetische en omgevingsfactoren op de frequentie van twee infectieziekten in Noordwest-Europese wilde zwijnen populaties.

  5. Facultative parthenogenesis discovered in wild vertebrates

    Science.gov (United States)

    Booth, Warren; Smith, Charles F.; Eskridge, Pamela H.; Hoss, Shannon K.; Mendelson, Joseph R.; Schuett, Gordon W.

    2012-01-01

    Facultative parthenogenesis (FP)—asexual reproduction by bisexual species—has been documented in a variety of multi-cellular organisms but only recently in snakes, varanid lizards, birds and sharks. Unlike the approximately 80 taxa of unisexual reptiles, amphibians and fishes that exist in nature, FP has yet to be documented in the wild. Based on captive documentation, it appears that FP is widespread in squamate reptiles (snakes, lizards and amphisbaenians), and its occurrence in nature seems inevitable, yet the task of detecting FP in wild individuals has been deemed formidable. Here we show, using microsatellite DNA genotyping and litter characteristics, the first cases of FP in wild-collected pregnant females and their offspring of two closely related species of North American pitviper snakes—the copperhead (Agkistrodon contortrix) and cottonmouth (Agkistrodon piscivorus). Our findings support the view that non-hybrid origins of parthenogenesis, such as FP, are more common in squamates than previously thought. With this confirmation, FP can no longer be viewed as a rare curiosity outside the mainstream of vertebrate evolution. Future research on FP in squamate reptiles related to proximate control of induction, reproductive competence of parthenogens and population genetics modelling is warranted. PMID:22977071

  6. Variable Nitrogen Fixation in Wild Populus.

    Directory of Open Access Journals (Sweden)

    Sharon L Doty

    Full Text Available The microbiome of plants is diverse, and like that of animals, is important for overall health and nutrient acquisition. In legumes and actinorhizal plants, a portion of essential nitrogen (N is obtained through symbiosis with nodule-inhabiting, N2-fixing microorganisms. However, a variety of non-nodulating plant species can also thrive in natural, low-N settings. Some of these species may rely on endophytes, microorganisms that live within plants, to fix N2 gas into usable forms. Here we report the first direct evidence of N2 fixation in the early successional wild tree, Populus trichocarpa, a non-leguminous tree, from its native riparian habitat. In order to measure N2 fixation, surface-sterilized cuttings of wild poplar were assayed using both 15N2 incorporation and the commonly used acetylene reduction assay. The 15N label was incorporated at high levels in a subset of cuttings, suggesting a high level of N-fixation. Similarly, acetylene was reduced to ethylene in some samples. The microbiota of the cuttings was highly variable, both in numbers of cultured bacteria and in genetic diversity. Our results indicated that associative N2-fixation occurred within wild poplar and that a non-uniformity in the distribution of endophytic bacteria may explain the variability in N-fixation activity. These results point to the need for molecular studies to decipher the required microbial consortia and conditions for effective endophytic N2-fixation in trees.

  7. Mycobacterium spp. in wild game in Slovenia.

    Science.gov (United States)

    Pate, Mateja; Zajc, Urška; Kušar, Darja; Žele, Diana; Vengušt, Gorazd; Pirš, Tina; Ocepek, Matjaž

    2016-02-01

    Wildlife species are an important reservoir of mycobacterial infections that may jeopardise efforts to control and eradicate bovine tuberculosis (bTB), caused by Mycobacterium bovis. Slovenia is officially free of bTB, but no data on the presence of mycobacteria in wild animals has been reported. In this study, samples of liver and lymph nodes were examined from 306 apparently healthy free-range wild animals of 13 species in Slovenia belonging to the families Cervidae, Suidae, Canidae, Mustelidae and Bovidae. Mycobacteria were isolated from 36/306 (11.8%) animals (red deer, roe deer, fallow deer, wild boar and jackal) and identified by PCR, commercial diagnostic kits and sequencing. Non-tuberculous mycobacteria identified in five species were Mycobacterium peregrinum, M. avium subsp. hominissuis, M. intracellulare, M. confluentis, M. fortuitum, M. terrae, M. avium subsp. avium, M. celatum, M. engbaekii, M. neoaurum, M. nonchromogenicum and M. vaccae. Copyright © 2015 Elsevier Ltd. All rights reserved.

  8. CHARACTERIZATION OF WILD PIG VEHICLE COLLISIONS

    Energy Technology Data Exchange (ETDEWEB)

    Mayer, J; Paul E. Johns, P

    2007-05-23

    Wild pig (Sus scrofa) collisions with vehicles are known to occur in the United States, but only minimal information describing these accidents has been reported. In an effort to better characterize these accidents, data were collected from 179 wild pig-vehicle collisions from a location in west central South Carolina. Data included accident parameters pertaining to the animals involved, time, location, and human impacts. The age structure of the animals involved was significantly older than that found in the population. Most collisions involved single animals; however, up to seven animals were involved in individual accidents. As the number of animals per collision increased, the age and body mass of the individuals involved decreased. The percentage of males was significantly higher in the single-animal accidents. Annual attrition due to vehicle collisions averaged 0.8 percent of the population. Wild pig-vehicle collisions occurred year-round and throughout the 24-hour daily time period. Most accidents were at night. The presence of lateral barriers was significantly more frequent at the collision locations. Human injuries were infrequent but potentially serious. The mean vehicle damage estimate was $1,173.

  9. Global conservation priorities for crop wild relatives.

    Science.gov (United States)

    Castañeda-Álvarez, Nora P; Khoury, Colin K; Achicanoy, Harold A; Bernau, Vivian; Dempewolf, Hannes; Eastwood, Ruth J; Guarino, Luigi; Harker, Ruth H; Jarvis, Andy; Maxted, Nigel; Müller, Jonas V; Ramirez-Villegas, Julian; Sosa, Chrystian C; Struik, Paul C; Vincent, Holly; Toll, Jane

    2016-03-21

    The wild relatives of domesticated crops possess genetic diversity useful for developing more productive, nutritious and resilient crop varieties. However, their conservation status and availability for utilization are a concern, and have not been quantified globally. Here, we model the global distribution of 1,076 taxa related to 81 crops, using occurrence information collected from biodiversity, herbarium and gene bank databases. We compare the potential geographic and ecological diversity encompassed in these distributions with that currently accessible in gene banks, as a means to estimate the comprehensiveness of the conservation of genetic diversity. Our results indicate that the diversity of crop wild relatives is poorly represented in gene banks. For 313 (29.1% of total) taxa associated with 63 crops, no germplasm accessions exist, and a further 257 (23.9%) are represented by fewer than ten accessions. Over 70% of taxa are identified as high priority for further collecting in order to improve their representation in gene banks, and over 95% are insufficiently represented in regard to the full range of geographic and ecological variation in their native distributions. The most critical collecting gaps occur in the Mediterranean and the Near East, western and southern Europe, Southeast and East Asia, and South America. We conclude that a systematic effort is needed to improve the conservation and availability of crop wild relatives for use in plant breeding.

  10. Toxoplasma gondii in small neotropical wild felids

    Directory of Open Access Journals (Sweden)

    William Alberto Cañon-Franco

    2013-02-01

    Full Text Available In the last decade, studies on wildlife worldwide have discovered key epidemiological aspects of the sylvatic cycle of Toxoplasma gondii. However, despite the known role of wild felines as definitive hosts in the transmission and maintenance of this parasite, few studies have focused on the involvement of these animals. Brazil exhibits the largest number of wild felid species in the Americas, all of which have a critical conservation status. However, serological detections, epidemiological studies and some molecular characterizations of T. gondii have primarily used Neotropical felid populations that are maintained in captivity, which does not reflect the disease behavior in free-living conditions. A systematic review of the worldwide scientific literature was conducted focusing on toxoplasmosis in small Neotropical felids. This review covered a number of aspects, including the state of scientific research, parasite transmission in the wild, the genetic characteristics of isolates, the relationship between these genetic characteristics and the pathogenicity of the parasite, and the risk factors linked to conflicts with humans. The present review shows the relevance of studying these felid populations based on their frequent interactions with humans in peri-urban areas and the need for further comprehensive studies to establish the real significance of T. gondii in public and animal health in tropical and temperate regions.

  11. Identification of novel insertion–deletion markers for Dongxiang wild ...

    Indian Academy of Sciences (India)

    Common wild rice (Oryza rufipogon Griff.) is considered to be the ancestor of cultivated rice (Oryza sativa L.) (Ishii et al. 2011). During the domestication process from wild rice to cultivated rice, many genes of the wild rice were fil- tered either by drift or naturally and human selection or both, resulting in a significant reduction ...

  12. The importance of wild meat in the Global South

    DEFF Research Database (Denmark)

    Nielsen, Martin R.; Meilby, Henrik; Smith-Hall, Carsten

    2018-01-01

    across Latin America, Asia, and Africa, we show that 39% of the sampled households, by extrapolation representing ~ 150 million households in the Global South, ‘harvest’ wild meat. On average, wild meat makes up 2% of households’ income of which own consumption accounts for 89%. Reliance on wild meat...

  13. Project WILD Aquatic K-12 Curriculum and Activity Guide

    Science.gov (United States)

    Council for Environmental Education, 2011

    2011-01-01

    The "Project WILD Aquatic K-12 Curriculum and Activity Guide" emphasizes aquatic wildlife and aquatic ecosystems. It is organized in topic units and is based on the Project WILD conceptual framework. Because these activities are designed for integration into existing courses of study, instructors may use one or many Project WILD Aquatic activities…

  14. Estimation of in situ mating systems in wild sorghum (Sorghum ...

    Indian Academy of Sciences (India)

    The high outcrossing rates of wild/weedy sorghum populations in Ethiopia indicate a high potential for crop genes (including transgenes) to spread within the wild pool. Therefore, effective risk management strategies may be needed if the introgression of transgenes or other crop genes from improved cultivars into wild or ...

  15. Wild Food Summit: Anishinaabe Relearning Traditional Gathering Practices

    Science.gov (United States)

    Sorensen, Barbara Ellen

    2011-01-01

    Wild Food Summits is a program initiated by Steve Dahlberg, the White Earth Tribal & Community College Extension director. Dahlberg began Wild Food Summits to teach people about identifying and gathering wild greens, mushrooms, and other edible plant life. The whole community comes together to cook and eat the foods. The tribal college has…

  16. Last of the Wild Project, Version 1, 2002 (LWP-1): Top One Percent Wild Areas Dataset (Geographic)

    Data.gov (United States)

    National Aeronautics and Space Administration — The Top One Percent Wild Areas Dataset of the Last of the Wild Project, Version 1, 2002 (LWP-1) is derived from the LWP-1 Human Footprint Dataset. The gridded data...

  17. Last of the Wild Project, Version 1, 2002 (LWP-1): Top One Percent Wild Areas Dataset (IGHP)

    Data.gov (United States)

    National Aeronautics and Space Administration — The Top One Percent Wild Areas Dataset of the Last of the Wild Project, Version 1, 2002 (LWP-1) is derived from the LWP-1 Human Footprint Dataset. The gridded data...

  18. Diversidade de moscas frugívoras (Diptera, Tephritoidea em áreas de matas decídua e ciliar no Pantanal sul-mato-grossense, Brasil Diversity of frugivorous flies (Diptera, Tephritoidea in areas of decidual and riparian forests in South Pantanal, Brazil

    Directory of Open Access Journals (Sweden)

    Edima Ramos Minzão

    2008-09-01

    Full Text Available O conhecimento da diversidade de espécies de moscas nos ecossistemas é importante para subsidiar na escolha de métodos ecologicamente corretos para o controle de tefritóideos (Tephritidae e Lonchaeidae pragas. O objetivo deste trabalho foi avaliar a diversidade de tefritóideos e seus padrões populacionais em áreas de matas decídua e ciliar. As moscas foram capturadas em armadilhas McPhail com atrativo alimentar em duas reservas florestais do município de Corumbá-MS, de agosto de 2003 a agosto de 2004. Treze espécies pertencentes a cinco gêneros e duas famílias foram registradas. No Sítio Pingo de Amor (mata decídua [MD], foram coletadas: Anastrepha dissimilis, A. fraterculus, A. obliqua, A. rheediae, A. sororcula, A. undosa e Ceratitis capitata (Tephritidae e de Lonchaeidae foram capturadas: Dasiops sp.1, Dasiops sp.2, Lonchaea sp.1, Lonchaea sp.2, Neosilba sp.1 e Neosilba sp.2. No Canal do Tamengo (mata ciliar [MC], foram obtidas todas as espécies mencionadas acima, exceto: A. dissimilis, A. rheediae, A. undosa, Dasiops sp.2 and Neosilba sp.2. O índice de diversidade de Shannon-Weaver (H', foi: 2,01 na MD e 1,51 na MC. Anastrepha obliqua foi caracterizada como muito abundante em ambas as reservas florestais. Na mata decídua A. sororcula foi constante e predominante e, Neosilba sp.1, muito abundante. Em ambos os ambientes A. obliqua, Lonchaea sp.2 e Neosilba sp.1 foram muito freqüentes e, A. obliqua e Neosilba sp.1 foram dominantes.The knowledge of fly species diversity and population patterns in the ecosystems is important to subsidy the choice of ecologically correct methods for control of tephritoid pests. The aim of this paper is to evaluate the diversity of tephritoids and their population patterns in a decidual and a riparian forest. Flies were caught in McPhail traps with food bait in two natural forest reserves at the Municipality of Corumbá-MS, from August 2003 to August 2004. Thirteen species belonging to five

  19. Drought Tolerance in Modern and Wild Wheat

    Science.gov (United States)

    Budak, Hikmet; Kantar, Melda; Yucebilgili Kurtoglu, Kuaybe

    2013-01-01

    The genus Triticum includes bread (Triticum aestivum) and durum wheat (Triticum durum) and constitutes a major source for human food consumption. Drought is currently the leading threat on world's food supply, limiting crop yield, and is complicated since drought tolerance is a quantitative trait with a complex phenotype affected by the plant's developmental stage. Drought tolerance is crucial to stabilize and increase food production since domestication has limited the genetic diversity of crops including wild wheat, leading to cultivated species, adapted to artificial environments, and lost tolerance to drought stress. Improvement for drought tolerance can be achieved by the introduction of drought-grelated genes and QTLs to modern wheat cultivars. Therefore, identification of candidate molecules or loci involved in drought tolerance is necessary, which is undertaken by “omics” studies and QTL mapping. In this sense, wild counterparts of modern varieties, specifically wild emmer wheat (T. dicoccoides), which are highly tolerant to drought, hold a great potential. Prior to their introgression to modern wheat cultivars, drought related candidate genes are first characterized at the molecular level, and their function is confirmed via transgenic studies. After integration of the tolerance loci, specific environment targeted field trials are performed coupled with extensive analysis of morphological and physiological characteristics of developed cultivars, to assess their performance under drought conditions and their possible contributions to yield in certain regions. This paper focuses on recent advances on drought related gene/QTL identification, studies on drought related molecular pathways, and current efforts on improvement of wheat cultivars for drought tolerance. PMID:23766697

  20. Drought Tolerance in Modern and Wild Wheat

    Directory of Open Access Journals (Sweden)

    Hikmet Budak

    2013-01-01

    Full Text Available The genus Triticum includes bread (Triticum aestivum and durum wheat (Triticum durum and constitutes a major source for human food consumption. Drought is currently the leading threat on world's food supply, limiting crop yield, and is complicated since drought tolerance is a quantitative trait with a complex phenotype affected by the plant's developmental stage. Drought tolerance is crucial to stabilize and increase food production since domestication has limited the genetic diversity of crops including wild wheat, leading to cultivated species, adapted to artificial environments, and lost tolerance to drought stress. Improvement for drought tolerance can be achieved by the introduction of drought-grelated genes and QTLs to modern wheat cultivars. Therefore, identification of candidate molecules or loci involved in drought tolerance is necessary, which is undertaken by “omics” studies and QTL mapping. In this sense, wild counterparts of modern varieties, specifically wild emmer wheat (T. dicoccoides, which are highly tolerant to drought, hold a great potential. Prior to their introgression to modern wheat cultivars, drought related candidate genes are first characterized at the molecular level, and their function is confirmed via transgenic studies. After integration of the tolerance loci, specific environment targeted field trials are performed coupled with extensive analysis of morphological and physiological characteristics of developed cultivars, to assess their performance under drought conditions and their possible contributions to yield in certain regions. This paper focuses on recent advances on drought related gene/QTL identification, studies on drought related molecular pathways, and current efforts on improvement of wheat cultivars for drought tolerance.

  1. The fecal viral flora of wild rodents.

    Directory of Open Access Journals (Sweden)

    Tung G Phan

    2011-09-01

    Full Text Available The frequent interactions of rodents with humans make them a common source of zoonotic infections. To obtain an initial unbiased measure of the viral diversity in the enteric tract of wild rodents we sequenced partially purified, randomly amplified viral RNA and DNA in the feces of 105 wild rodents (mouse, vole, and rat collected in California and Virginia. We identified in decreasing frequency sequences related to the mammalian viruses families Circoviridae, Picobirnaviridae, Picornaviridae, Astroviridae, Parvoviridae, Papillomaviridae, Adenoviridae, and Coronaviridae. Seventeen small circular DNA genomes containing one or two replicase genes distantly related to the Circoviridae representing several potentially new viral families were characterized. In the Picornaviridae family two new candidate genera as well as a close genetic relative of the human pathogen Aichi virus were characterized. Fragments of the first mouse sapelovirus and picobirnaviruses were identified and the first murine astrovirus genome was characterized. A mouse papillomavirus genome and fragments of a novel adenovirus and adenovirus-associated virus were also sequenced. The next largest fraction of the rodent fecal virome was related to insect viruses of the Densoviridae, Iridoviridae, Polydnaviridae, Dicistroviriade, Bromoviridae, and Virgaviridae families followed by plant virus-related sequences in the Nanoviridae, Geminiviridae, Phycodnaviridae, Secoviridae, Partitiviridae, Tymoviridae, Alphaflexiviridae, and Tombusviridae families reflecting the largely insect and plant rodent diet. Phylogenetic analyses of full and partial viral genomes therefore revealed many previously unreported viral species, genera, and families. The close genetic similarities noted between some rodent and human viruses might reflect past zoonoses. This study increases our understanding of the viral diversity in wild rodents and highlights the large number of still uncharacterized viruses in

  2. Cyclical nursing patterns in wild orangutans

    Science.gov (United States)

    Smith, Tanya M.; Austin, Christine; Hinde, Katie; Vogel, Erin R.; Arora, Manish

    2017-01-01

    Nursing behavior is notoriously difficult to study in arboreal primates, particularly when offspring suckle inconspicuously in nests. Orangutans have the most prolonged nursing period of any mammal, with the cessation of suckling (weaning) estimated to occur at 6 to 8 years of age in the wild. Milk consumption is hypothesized to be relatively constant over this period, but direct evidence is limited. We previously demonstrated that trace element analysis of bioavailable elements from milk, such as barium, provides accurate estimates of early-life diet transitions and developmental stress when coupled with growth lines in the teeth of humans and nonhuman primates. We provide the first detailed nursing histories of wild, unprovisioned orangutans (Pongo abelii and Pongo pygmaeus) using chemical and histological analyses. Laser ablation inductively coupled plasma mass spectrometry was used to determine barium distributions across the teeth of four wild-shot individuals aged from postnatal biological rhythms. Barium levels rose during the first year of life in all individuals and began to decline shortly after, consistent with behavioral observations of intensive nursing followed by solid food supplementation. Subsequent barium levels show large sustained fluctuations on an approximately annual basis. These patterns appear to be due to cycles of varying milk consumption, continuing until death in an 8.8-year-old Sumatran individual. A female Bornean orangutan ceased suckling at 8.1 years of age. These individuals exceed the maximum weaning age reported for any nonhuman primate. Orangutan nursing may reflect cycles of infant demand that relate to fluctuating resource availability. PMID:28560319

  3. Analysis of Powdery Mildew Resistance in Wild Melon MLO Mutants

    Directory of Open Access Journals (Sweden)

    Cheng Hong

    2015-11-01

    Full Text Available Wild species have a potential value in crop breeding. Explore MLO gene which related with powdery mildew natural resistance is very important for improving the quality of melon. Resistance to powdery mildew was examined in cultivar and wild species by leaf inoculation. The wild germplasms showed resistance to powdery mildew Race1. Cloning and sequence analysis of the CmMLO2 gene identified an 85 bp difference between the wild and cultivated species. The CmMLO2 gene was expressed in the wild germplasm after fluorescence-labeled Agrobacterium-mediated transformation. A positive transgenic plant showed successful invasion by powdery mildew Race1. These results suggested that the wild species might have failed to encode the MLO protein, thereby resulting in the MLO-negative regulation of powdery mildew, which in turn resulted in the broad-spectrum resistance of the wild species to powdery mildew.

  4. Lead in wild blackberries from suburban roadsides

    Energy Technology Data Exchange (ETDEWEB)

    Farmer, J.G.

    1979-01-01

    A mean lead content of 0.79 mg kg/sup -1/ was found for wild blackberries from roadside hedgerows in a suburban area of Glasgow. This represents a five-fold enhancement in lead content relative to blackberries from non-roadside environments and can be attributed to the emission of lead-containing compounds from car exhaust. Washing typically removed less than or equal to 0.1 mg kg/sup -1/. However, M.A.F.F. (1975) recommended limits for lead in fresh food (1 mg kg/sup -1/) and canned fruits and preserves (2 mg kg/sup -1/) were not, in general, exceeded.

  5. Sanguepazzo (Wild blood) : Motion picture (2008)

    OpenAIRE

    Lauri Lucente, Gloria; Buhagiar, Celaine

    2009-01-01

    Giovanna's father: Bologna, Italy, Pre-war scenario. Michele Casali's only teenage daughter, Giovanna Casali, poses a problem to him. Driven by jealousy, she has just killed her best friend. After a painful trial, Giovanna is sent to to a psychiatric hospital due to her ¨non compus mentis¨ state Wild blood: Valenti and Ferida - executed by partisans. Idolised by the public, a famous and infamous couple on and off screen. Stars of the Fascist endorsed 'white telephone' cinema, their privat...

  6. Human Infection in Wild Mountain Gorillas

    Centers for Disease Control (CDC) Podcasts

    2011-04-25

    This podcast discusses a study about the transmission of Human Metapneumovirus Infection to wild mountain gorillas in Rwanda in 2009, published in the April 2011 issue of Emerging Infectious Diseases. Dr. Ian Lipkin, Director of the Center for Infection and Immunity and Dr. Gustavo Palacios, investigator in the Center of Infection & Immunity share details of this study.  Created: 4/25/2011 by National Center for Emerging Zoonotic and Infectious Diseases (NCEZID).   Date Released: 5/2/2011.

  7. Component analysis of cultivated ginseng, cultivated wild ginseng, and natural wild ginseng by structural parts using HPLC method

    Directory of Open Access Journals (Sweden)

    Young-Ju,Han

    2007-02-01

    Full Text Available Objectives : The aim of this experiments is to provide an objective differentiation of ginseng, Korean and Chinese cultivated wild ginseng, and natural wild ginseng through components analysis of different parts of ginseng. Methods : Comparative analyses of ginsenoside-, ginsenoside-, and ginsenosides and from the root, stem, and leaves of ginseng, Korean and Chinese cultivated wild ginseng, and natural wild ginseng were conducted using HPLC. Results : 1. For content comparison of leaves, ginseng showed highest content of ginsenoside than other samples. Natural wild ginseng showed relatively high content of ginsenosides and than other samples. 2. For content comparison of the stem, ginseng and 10 years old Chinese cultivated wild ginseng didn't contain ginsenoside . Natural wild ginseng showed higher content of ginsenosides and than other samples. 3. For content comparison of the root, ginsenoside was found only in 5 and 10 years old Korean cultivated wild ginseng. 4. Distribution of contents by the parts of ginseng was similar in ginseng and Chinese cultivated wild ginseng. Conclusions : Above experiment data can be an important indicator for the identification of ginseng, Korean and Chinese cultivated wild ginseng, and natural wild ginseng.

  8. Measuring circulating antioxidants in wild birds.

    Science.gov (United States)

    Cohen, Alan; Klasing, Kirk; Ricklefs, Robert

    2007-05-01

    Antioxidants protect against free radical damage, which is associated with various age-related pathologies. Antioxidants are also an important buffer against the respiratory burst of the immune system. This protection presumably has costs and therefore might underlie important life-history trade-offs. Studying such trade-offs in a comparative context requires field-applicable methods for assessing antioxidant capacity in wild animals. Here, we present modifications to a simple spectrophotometric assay (the TEAC or TAS assay) that can be applied to miniscule amounts of blood plasma to determine circulating antioxidant capacity. Additionally, uric acid, the most abundant circulating antioxidant, should be measured independently. Uric acid in birds is derived from amino acid catabolism, perhaps incidentally to its antioxidant function. The assay was validated in experimental studies on chickens showing effects of diet on antioxidant capacity, and in field measurements on 92 species of birds, which demonstrate substantial species differences in constitutive antioxidant capacity. Furthermore, most wild birds demonstrate a dramatic change in antioxidant capacity due to stress. These results show that this technique detects variation appropriate for both interspecific and intraspecific studies, and that antioxidants and uric acid change in response to conditions of interest to field ecologists, such as diet and stress.

  9. Farming and the fate of wild nature.

    Science.gov (United States)

    Green, Rhys E; Cornell, Stephen J; Scharlemann, Jörn P W; Balmford, Andrew

    2005-01-28

    World food demand is expected to more than double by 2050. Decisions about how to meet this challenge will have profound effects on wild species and habitats. We show that farming is already the greatest extinction threat to birds (the best known taxon), and its adverse impacts look set to increase, especially in developing countries. Two competing solutions have been proposed: wildlife-friendly farming (which boosts densities of wild populations on farmland but may decrease agricultural yields) and land sparing (which minimizes demand for farmland by increasing yield). We present a model that identifies how to resolve the trade-off between these approaches. This shows that the best type of farming for species persistence depends on the demand for agricultural products and on how the population densities of different species on farmland change with agricultural yield. Empirical data on such density-yield functions are sparse, but evidence from a range of taxa in developing countries suggests that high-yield farming may allow more species to persist.

  10. Dietary values of wild and semi-wild edible plants in Southern Ethiopia

    African Journals Online (AJOL)

    The wild edibles constituted good amounts of nutrients essential in human diet. Green leafy vegetables (GLVs) gave 1.5-5.8% ether extractives and total mineral composition of 12.5%-25.6%; Ca being highest (1100 - 3419 mg %) and exceptionally high for Justicia ladanoides (6177 mg %). Fe, Mg, Mn and Zn ranged from ...

  11. ESPÉCIES E FLUTUAÇÃO POPULACIONAL DE MOSCAS-DAS-FRUTAS EM UM POMAR COMERCIAL DE MANGUEIRA, NO LITORAL DO ESTADO DO CEARÁ

    Directory of Open Access Journals (Sweden)

    Joseph Jonathan Dantas de Oliveira

    2009-01-01

    Full Text Available The objective of this research was to know the species and the population fluctuation of fruit flies (Diptera: Tephritidae in a commercial mango (Mangifera indica L. orchard in the coast of Ceará State. The study was developed from July of 2005 to July of 2007, in the municipality of Beberibe (CE. The capture of the fruit flies was performed using McPhail traps with 5% corn protein hydrolyzed solution as attractant. Weekly, the captured insects were sorted, the fruit flies were maintained in 70% alcohol solution and subsequently identified. The population fluctuation was estimated using the FTD (Fly/Trap/Day index. During the research, six fruit flies species were captured: Anastrepha obliqua (Macquart (63%, A. zenildae Zucchi (7%, A. sororcula Zucchi (5%, A. fraterculus (Wied. (2%, A. distincta Greene (2% and Ceratitis capitata (Wied. (21%. The Anastrepha spp. and C. capitata population peaked was between April and July, in both years of study.

  12. Does empathy predict altruism in the wild?

    Science.gov (United States)

    Bethlehem, Richard A I; Allison, Carrie; van Andel, Emma M; Coles, Alexander I; Neil, Kimberley; Baron-Cohen, Simon

    2017-12-01

    Why do people act altruistically? One theory is that empathy is a driver of morality. Experimental studies of this are often confined to laboratory settings, which often lack ecological validity. In the present study we investigated whether empathy traits predict if people will act altruistically in a real-world setting, "in the wild". We staged a situation in public that was designed to elicit helping, and subsequently measured empathic traits in those who either stopped to help or walked past and did not help. Results show that a higher number of empathic traits are a significant and positive predictor for altruistic behavior in a real-life situation. This supports the theory that the act of doing good is correlated with empathy.

  13. North Spain (Burgos wild mammals ectoparasites

    Directory of Open Access Journals (Sweden)

    Domínguez G.

    2004-09-01

    Full Text Available Twenty-seven species of arthropods were collected from 105 wild mammals, six wolves Canis lupus (Linnaeus, 1758 included. A total of 87 animals (82,8 % harboured some ectoparasites. Ticks were found in 60 % of the samples, fleas in 51.4 %, chewing-lice in 3.8 %, and others (Mesostigmata and hippoboscids in 3.8 %. Moreover, 42.5 % were single infestation and 57.5 % mixed. Some of the species were new records for a host in spanish country such as Trichodectes canis (De Géer, 1778, Ixodes trianguliceps (Birula, 1895, Ceralophyllus (Monopsyllus S. sciurorum (Schrank, 1803 and Paraceras melis melis (Walker, 1856 on several mammals. Two species were new records for Spain: Chaetopsylla matina (Jordan, 1925 and Archaeopsylla erinacei erinacei (Bouché, 1835.

  14. Rare wild Orchids at CERN Meyrin

    CERN Multimedia

    2005-01-01

    There are several "Floral Nature Reserve - Late Mowing" zones at CERN Meyrin. The blossoms of a rare and a not so rare type of wild orchid are currently in flower. The rare one is the bee orchid (Ophrys Apifera) which is a protected perennial. They are very unusual and in some years can appear in great numbers and then sometimes only reappear after a decade. They live in a symbiotic relationship with a soil-dwelling fungus. Its name stems from the fact that its brown, furry lip resembles and smells like a female bee, a mimicry used to attract drones to aid in pollination. The much more distributed species is the pyramidal orchid (Anacamptis Pyramidalis), which due to its size and its bright pink colour is already visible when you pass by in your car. Photos were taken on the late mowing zone adjacent to route Einstein opposite building 57 on 4 June 2005.

  15. Rare wild Orchids at CERN Meyrin

    CERN Multimedia

    2005-01-01

    There are several "Floral Nature Reserve - Late Mowing" zones at CERN Meyrin. The blossoms of a rare and a not so rare type of wild orchid are currently in flower. The rare one is the bee orchid (Ophrys Apifera) which is a protected perennial. They are very unusual and in some years can appear in great numbers and then sometimes only reappear after a decade. They live in a symbiotic relationship with a soil-dwelling fungus. Its name stems from the fact that its brown, furry lip resembles and smells like a female bee, a mimicry used to attract drones to aid in pollination. The much more distributed species is the pyramidal orchid (Anacamptis Pyramidalis), which due to its size and its bright pink colour is already visible when you pass by in your car.

  16. Roadkill of wild mammals on RS-135

    Directory of Open Access Journals (Sweden)

    Carla Grasiele Zanin Hegel

    2012-06-01

    Full Text Available Among environmental impacts, fragmentation of habitat for agriculture and livestock has led to a distortion of the natural environment and increased rates of wildlife killed on roads. Weekly surveys of road-killed mammals were made along highway RS-135 (km 8-34 between May 2008 and May 2010. For each case, we recorded the species and location along the road. We collected 95 mammals belonging to 16 species and 12 families, with a frequency of 0.025 roadkills per kilometer. The most abundant species were Cerdocyon thous (22.11%, Nasua nasua (10.52%, Pseudalopex gymnocercus (9.47% and Cavia aperea (7.37%, which together comprised 49.5% of the cases. This study contributed with information on roadkill of wild mammals in RS-135 of Rio Grande do Sul.

  17. In search of the 'Wild Contemporary'

    DEFF Research Database (Denmark)

    Jensen, Ole B.

    . The paper opens this up by presenting a few contemporary urban projects from the architectural company BIG. Representing the ‘wild contemporary' projects coming out of BIG are interesting examples of ‘utopian pragmatism' resisting seeing for example ‘sustainability' as loss of opportunities or lack......Contemporary global challenges to the distribution and organization of mobilities require new ways of envisioning and imagining to bring forward the discussion about new policies. This paper explores the imaginary visioning by using earlier utopian thoughts and visions as ‘prisms......' for the contemporary mobility debate in order to get closer to new imaginaries of technologies, complex systems and cultural change. The paper set out to identify key thoughts of utopian and critical urbanism (Harvey, Lefebvre, Friedman, Sandercock) and bridges those to contemporary critical scenario thinking (Dennis...

  18. Biodiversity of wild fruit species of Serbia

    Directory of Open Access Journals (Sweden)

    Bošnjaković Dušica

    2012-01-01

    Full Text Available Several field collecting trips in the 2009-2011 period confirmed that forest fruit species are an inexhaustible genofond of extremely important varieties that yield fruit of excellent quality and high nutritive value, with wide range of applications, including nutritional, medicinal and food production. The aim of this work was to develop long term interactive and integrated strategy for selection of wild fruit species through different breeding methods, as well as popularization of selected products and their integration into intensive fruit growing. The most important morphological, ecological, and biological characteristics were studied and presented for Cornus mas, Sambucus nigra, Morus sp. and Rosa sp. For each studied fruit species, advanced selections for cultivar release has been reported.

  19. Oscar Wilde and the scarlet woman.

    Science.gov (United States)

    Hanson, E

    1997-01-01

    In the late nineteenth century, England was embroiled in a political debate over the importation of Roman Catholic rituals into the Anglican Church, not to mention the re-establishment of the Roman Church itself in Great Britain. Victorian anti-Catholic rhetoric draws upon the figure of the Whore of Babylon to depict the Roman Catholic Church as the Scarlet Woman, a femme fatale who perverts Christianity and seduces Englishmen with elaborate rituals and lascivious whisperings in the confessional. In writing Salomé, Oscar Wilde played ironically on the hysterical eroticism of the No Popery movement by mining the paradox of biblical sensuality. He invested his play with a biblical wealth of archaic metaphors and gestures that took their cues from The Song of Songs and The Book of Revelation. He became the ecclesiastical dandy that evangelicals feared most, a poet enamored of the Scarlet Woman, a would-be convert who exposed the scandal of Christianity as art.

  20. ENVIRONMENTAL CONTAMINANTS IN WILD BOARS FROM CALABRIA

    Directory of Open Access Journals (Sweden)

    F. Naccari

    2011-01-01

    Full Text Available The aim of this study was to determine heavy metals (Cd, Cu, Pb and Zn organochlorine pesticides (POCs and polychlorinated biphenyl (PCBs in some samples (heart, kidney, liver, lung, muscle tissue and spleen of wild boars (utilized as “bioindicator” from various areas from Calabria. Quantitative determination of POCs and PCBs were carried out using GC-ECD and confirmed with GC-MS. The concentrations of heavy metals were determined by a Varian Atomic Absorption Spectroscopy instrument. Our data have shown low residual levels of OCs, heavy metals and the absence of PCBs in all samples analyzed and therefore the boar meat products are not dangerous for the consumer. Moreover, results obtained deserve particular attention not only for their significance but especially because they were recorded in Calabria, a region a low risk of environmental pollution due to the shortage of industries and the traditional agricultural activity.

  1. Multidrug resistant yeasts in synanthropic wild birds

    Directory of Open Access Journals (Sweden)

    Somanath Sushela

    2010-03-01

    Full Text Available Abstract Background The aim of this study was to investigate the presence of multidrug resistant yeasts in the faeces of synanthropic wild birds from the Bangsar suburb of Kuala Lumpur. Methods Species characterisations of yeast isolates and determinations of antimycotic susceptibility profiles were undertaken using the commercial characterization kit, Integral System Yeasts Plus (Liofilchem, Italy. Results Fourteen species of yeasts were detected in the bird faecal samples.Candida albicans was present in 28.89% of bird faecal samples, Candida krusei (13.33%, Candida tropicalis (4.44%, Candida glabrata (4.44%, Candida parapsilosis (2.22%, Candida lambica (2.22%, Candida stellatoidea (2.22%, Candida rugosa (2.22% and Candida lusitaniae (2.22%. Amongst the non-candidal yeast isolates, Cryptococcus laurentii was present in 6.67% of bird faecal samples, Cryptococcus uniguttulatus (4.44%, Saccharomyces cerevisiae (4.44%, Trichosporon pullulans (2.22%, Trichosporon pullulans/Cryptococcus albidus (8.89% and Rhodotorula rubra/Rhodotorula glutinis (4.44%. Of the isolated yeasts, 18.1% (or 26/144 were found to be resistant to all 11 antimycotic agents they were tested against i.e. Nystatin, Amphotericin B, Flucytosine, Econazole, Ketoconazole, Clotrimazole, Miconazole, Itraconazole, Voriconazole, Fluconazole 16 and Fluconazole 64. 45.8% (or 66/144 of the bird faecal yeast isolates were resistant to four or more of the 11 antimycotic agents they were tested against. Conclusions This finding is of public health significance as these synanthropic wild birds may be reservoirs for transmission of drug resistant yeast infections to humans.

  2. Search for Mycobacterium leprae in wild mammals

    Directory of Open Access Journals (Sweden)

    Sílvia Cristina Barboza Pedrini

    Full Text Available Leprosy is still a worldwide public health problem. Brazil and India show the highest prevalence rates of the disease. Natural infection of armadillos Dasypus novemcinctus with Mycobacterium leprae has been reported in some regions of the United States. Identification of bacilli is difficult, particularly due to its inability to grow in vitro. The use of molecular tools represents a fast and sensitive alternative method for diagnosis of mycobacteriosis. In the present study, the diagnostic methods used were bacilloscopy, histopathology, microbiology, and PCR using specific primers for M. leprae repetitive sequences. PCR were performed using genomic DNA extracted from 138 samples of liver, spleen, lymph nodes, and skin of 44 D. novemcinctus, Euphractus sexcinctus, Cabassous unicinctus, and C. tatouay armadillos from the Middle Western region of the state of São Paulo and from the experimental station of Embrapa Pantanal, located in Pantanal da Nhecolândia of Mato Grosso do Sul state. Also, the molecular analysis of 19 samples from internal organs of other road killed species of wild animals, such as Nasua nasua (ring-tailed coati, Procyon cancrivoros (hand-skinned, Cerdocyon thous (dog-pity-bush, Cavia aperea (restless cavy, Didelphis albiventris (skunk, Sphigurrus spinosus (hedgehog, and Gallictis vittata (ferret showed PCR negative data. None of the 157 analyzed samples had shown natural mycobacterial infection. Only the armadillo inoculated with material collected from untreated multibacillary leprosy patient presented PCR positive and its genomic sequencing revealed 100% identity with M. leprae. According to these preliminary studies, based on the used methodology, it is possible to conclude that wild mammals seem not to play an important role in the epidemiology of leprosy in the Middle Western region of the São Paulo state and in the Pantanal of Mato Grosso do Sul state.

  3. Locomotor and postural development of wild chimpanzees.

    Science.gov (United States)

    Sarringhaus, L A; MacLatchy, L M; Mitani, J C

    2014-01-01

    Chimpanzees are our closest living relatives and their positional repertoire likely includes elements shared with our common ancestor. Currently, limitations exist in our ability to correlate locomotor anatomy with behavioral function in the wild. Here we provide a detailed description of developmental changes in chimpanzee locomotion and posture. Fieldwork was conducted on wild chimpanzees at Ngogo, Kibale National Park, Uganda. The large size of the Ngogo chimpanzee community permitted cross-sectional analysis of locomotor and postural changes across many individuals. Chimpanzee positional behavior proceeds developmentally through a number of distinct stages, each characterized by its own loading regime. Infants principally used their upper limbs while moving; the loading environment changed to more hindlimb dominated locomotion as infants aged. Infants displayed more diversity in their forms of positional behavior than members of any other age-sex class, engaging in behaviors not habitually exhibited by adults. While the most common locomotor mode for infants was torso-orthograde suspensory locomotion, a large shift toward quadrupedal locomotion during infancy occurred at three years of age, when rates of this behavior increased. Overall, the most dramatic transition in positional behavior occurred during juvenility (at approximately five years), with the advent of complete independent locomotion. Juveniles decreased the amount of time they spent clinging and in torso-orthograde suspensory locomotion and increased their time spent sitting and walking and running quadrupedally compared with younger individuals. Juvenility marked the age at which quadrupedal walking became the most frequent locomotor behavior, but quadrupedal walking did not encompass the majority of locomotor time until individuals reached adolescence. Relative to all younger individuals, adolescent chimpanzees (10-13 years) experienced a further increase in the amount of time they walked

  4. Personality in wild bonobos (Pan paniscus).

    Science.gov (United States)

    Garai, Cintia; Weiss, Alexander; Arnaud, Coline; Furuichi, Takeshi

    2016-11-01

    To understand the evolution of personality structure requires examining personality dimensions in multiple species using a common set of traits. Little research has been conducted on personality in wild populations of nonhuman primates. Using behavioral observations and questionnaire ratings, we examined factors influencing personality in 16 wild bonobos (Pan paniscus) at Wamba, Luo Scientific Reserve, Democratic Republic of the Congo. We extracted five factors from 31 of the items from the Hominoid Personality Questionnaire (HPQ) and three factors from observed behaviors. The HPQ factors were labeled Unemotionality Q , Friendliness Q , Aggressiveness Q , Irritability Q , and Activity Q . The behavioral factors were labeled Grooming B , Playfulness B , and Introversion B . We established the convergent and divergent validity of these factors by obtaining correlations between the HPQ and behavioral factors. We tested for sex differences and found that males were significantly higher on Introversion B and significantly lower in Irritability Q . We then tested for age differences and found that Friendliness Q was lower and Aggressiveness Q was higher in older individuals. Finally, we found that, among males, hierarchical rank was associated with higher Aggressiveness Q . These findings contrast with findings in chimpanzees in ways consistent with known species differences. For one, consistent with the more egalitarian structure of bonobo society, we did not identify a clear Dominance factor. Also, the results related to sex differences were consistent with previous findings that reveal closer bonds between female bonobos than female chimpanzees. These findings highlight the importance of studying personality in closely related species and the need to consider species' socioecology when studying personality. Am. J. Primatol. 78:1178-1189, 2016. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

  5. DNA recovery from wild chimpanzee tools.

    Directory of Open Access Journals (Sweden)

    Fiona A Stewart

    Full Text Available Most of our knowledge of wild chimpanzee behaviour stems from fewer than 10 long-term field sites. This bias limits studies to a potentially unrepresentative set of communities known to show great behavioural diversity on small geographic scales. Here, we introduce a new genetic approach to bridge the gap between behavioural material evidence in unhabituated chimpanzees and genetic advances in the field of primatology. The use of DNA analyses has revolutionised archaeological and primatological fields, whereby extraction of DNA from non-invasively collected samples allows researchers to reconstruct behaviour without ever directly observing individuals. We used commercially available forensic DNA kits to show that termite-fishing by wild chimpanzees (Pan troglodytes schweinfurthii leaves behind detectable chimpanzee DNA evidence on tools. We then quantified the recovered DNA, compared the yield to that from faecal samples, and performed an initial assessment of mitochondrial and microsatellite markers to identify individuals. From 49 termite-fishing tools from the Issa Valley research site in western Tanzania, we recovered an average of 52 pg/μl chimpanzee DNA, compared to 376.2 pg/μl in faecal DNA extracts. Mitochondrial DNA haplotypes could be assigned to 41 of 49 tools (84%. Twenty-six tool DNA extracts yielded >25 pg/μl DNA and were selected for microsatellite analyses; genotypes were determined with confidence for 18 tools. These tools were used by a minimum of 11 individuals across the study period and termite mounds. These results demonstrate the utility of bio-molecular techniques and a primate archaeology approach in non-invasive monitoring and behavioural reconstruction of unhabituated primate populations.

  6. Exploration and Selection of the Wild Olive Genotypes

    OpenAIRE

    , H. Ismaili; , C. Cantini; , G. Ianni; , I. Lloshi

    2016-01-01

    Exploration on wild olive diversity carried out during the period 20002011, recorded a number of 27 wild forms. Morphological marker based analysis were performed for olive identity characterization, to determine their localization, usage limits as well as to build in-situ & ex-situ collection of 27 wild olive forms. Morphological description (Rezgen) was done for each olive genotype, in total of 49 characters; of tree, leaf, inflorescence, fruit and endocarp were measured during the ...

  7. Have somatic parameters of wild Equidae in captivity been changing?

    OpenAIRE

    NOVOTNÁ, Adéla

    2015-01-01

    Behavioral, physiological, and morphological changes commonly occurred to animals under domestication distinguish domestic animals from their wild ancestors. Similar changes on some wild animals kept in captivity (zoological gardens) can also be observed. This diploma thesis concerns these morphological changes on a skeleton of Equidae. For several species and subspecies of this family some osteometric data received from those kept in captivity are compared to those from the wild. A more deta...

  8. DEMAND FOR WILD BLUEBERRIES AT FARM AND PROCESSOR LEVELS

    OpenAIRE

    Cheng, Hsiang-Tai; Peavey, Stephanie R.; Kezis, Alan S.

    2000-01-01

    The wild blueberry crop harvested in Maine and eastern Canada has increased considerably in recent years. The purpose of this study is to understand the recent trends in demand for wild blueberries with particular attention to the effects of production and the marketing of wild and cultivated blueberries. A price response model was developed to analyze farm-gate price and the processor price, using annual data from 1978 through 1997. Key explanatory variables in the model include quantity of ...

  9. The Effect of Cultivated Wild Ginseng Extract on Preadipocyte Proliferation

    Directory of Open Access Journals (Sweden)

    Byoung-Woo Kim

    2007-12-01

    Full Text Available Objectives : The purpose of this study is to investigate the effects of cultivated wild ginseng extract on primary cultured preadipocyte and adipocytes. Methods : Diminish preadipocyte proliferation does primary role to reduce obesity. So, preadipocytes and adipocytes were performed on cell cultures with using Sprague-Dawley rats and treated with 0.01-1mg/㎖ cultivated wild ginseng extract. Result : At all concentrations, cultivated wild ginseng extract wasn't show the suppress proliferation of preadipocytes significantly and failed to show effects on decomposition of adipocytes except high dosage. Conclusion : Based on these findings, cultivated wild ginseng is not a suitable choice for the treatment of localized obesity.

  10. Moscas-das-frutas (Diptera: Tephritidae em um pomar de goiabeira, no semiárido brasileiro

    Directory of Open Access Journals (Sweden)

    Elton Lucio Araujo

    2013-06-01

    Full Text Available As moscas-das-frutas (Diptera: Tephritidae são pragas-chave na cultura da goiabeira Psidium guajava L., com predominância de diferentes espécies de acordo com a região produtora no Brasil. Os objetivos do presente trabalho foram conhecer a diversidade e analisar parâmetros faunísticos das moscas-das-frutas obtidas em um pomar de goiabeira, no município de Cruzeta, Rio Grande do Norte, situado no semiárido brasileiro. As moscas-das-frutas foram coletadas semanalmente, com auxílio de armadilhas McPhail, tendo como atrativo proteína hidrolisada a 5% v/v. Foram registradas cinco espécies no pomar estudado: Ceratitis capitata (Wied., Anastrepha zenildae Zucchi, Anastrepha sororcula Zucchi, Anastrepha obliqua (Macquart e Anastrepha dissimilis Stone. Ceratitis capitata foi a espécie mais frequente, constante e dominante, considerada como uma praga invasiva, potencial em pomares de goiabeira no semiárido brasileiro.

  11. The Immunology of Wild Rodents: Current Status and Future Prospects

    Directory of Open Access Journals (Sweden)

    Mark Viney

    2017-11-01

    Full Text Available Wild animals’ immune responses contribute to their evolutionary fitness. These responses are moulded by selection to be appropriate to the actual antigenic environment in which the animals live, but without imposing an excessive energetic demand which compromises other component of fitness. But, exactly what these responses are, and how they compare with those of laboratory animals, has been little studied. Here, we review the very small number of published studies of immune responses of wild rodents, finding general agreement that their humoral (antibody responses are highly elevated when compared with those of laboratory animals, and that wild rodents’ cellular immune system reveals extensive antigenic exposure. In contrast, proliferative and cytokine responses of ex vivo-stimulated immune cells of wild rodents are typically depressed compared with those of laboratory animals. Collectively, these responses are appropriate to wild animals’ lives, because the elevated responses reflect the cumulative exposure to infection, while the depressed proliferative and cytokine responses are indicative of effective immune homeostasis that minimizes immunopathology. A more comprehensive understanding of the immune ecology of wild animals requires (i understanding the antigenic load to which wild animals are exposed, and identification of any key antigens that mould the immune repertoire, (ii identifying immunoregulatory processes of wild animals and the events that induce them, and (iii understanding the actual resource state of wild animals, and the immunological consequences that flow from this. Together, by extending studies of wild rodents, particularly addressing these questions (while drawing on our immunological understanding of laboratory animals, we will be better able to understand how rodents’ immune responses contribute to their fitness in the wild.

  12. Flesh quality differentiation of wild and cultured Nile tilapia ...

    African Journals Online (AJOL)

    Variation in chemical composition and carcass traits among different wild and cultured Nile tilapia, Oreochromis niloticus populations were analyzed to study and compare the differences among different wild (Manzalah lake, Nile river and Edku lake) and cultured Nile tilapia populations. Data of body composition of different ...

  13. Bioactive Diterpenes and Sesquiterpenes from the Rhizomes of Wild ...

    African Journals Online (AJOL)

    Wild ginger (Siphonochilus aethiopicus (Schweinf) B.L Burtt) is used in traditional medicines in the West and South of Africa. In the present study, the crude hexane extract of wild ginger was evaluated for in vitro bioactivity. The components isolated from the plant for the first time are: epi-curzerenone, furanodienone ...

  14. Prevalence of echinococcosis in dogs and wild carnivores in ...

    African Journals Online (AJOL)

    A prevalence study on echinococcosis in dogs and wild carnivores was conducted in northen Tanzania. Copro-antigen ELISA was used to screen 442 dog faecal samples from Magu, Bariadi and Ngorongoro districts, together with 88 wild carnivore samples from Serengeti National Park. Overall prevalence of E. granulosus ...

  15. SURVEY OF WILD PLANT SEEDS AND THEIR VALUE IN ...

    African Journals Online (AJOL)

    A gap in knowledge exist on the traditional medicinal use of wild plant seeds in Nigeria. The study involved oral ... SURVEY OF WILD PLANT SEEDS AND THEIR VALUE IN TRADITONAL HERBAL MEDICINE IN OSUN STATE, NIGERIA. INTRODUCTION ..... as seeds should be encouraged to ensure sustainability in the.

  16. Economic Valuation of Wild Animal Species in Odeda Local ...

    African Journals Online (AJOL)

    A study on economic values of wild animal species was conducted to investigate the species of animals commonly hunted and the respondents' willingness to pay (WTP) for conservation of the wild animals. The study was conducted at Odeda Local government area of Ogun state, Nigeria. Two hundred (200) structured ...

  17. Genetic diversity among varieties and wild species accessions of ...

    African Journals Online (AJOL)

    Genetic diversity among varieties and wild species accessions of pea (Pisum sativum L.) based on SSR markers. ... African Journal of Biotechnology ... To assess the genetic relations inPisum genus and to examine putative duplicate accessions, 20 pea varieties (Pisum sativum L.) with 57 accessions from wild Pisum ...

  18. wild vertebrate pests activities on agricultural crops at gashaka ...

    African Journals Online (AJOL)

    A survey was conducted among 57 farmers at three different ranges in Gashaka Gumti National Park to identify wild vertebrate pests that raided and destroyed agricultural crops. The results showed that 16 wild fauna species were identified as crop pests. Six of them, Ceropithecus aethiops, Papio anubis, Heliosciurus ...

  19. Wild vertebrate pests activities on agricultural crops at Gashaka ...

    African Journals Online (AJOL)

    A survey was conducted among 57 farmers at three different ranges in Gashaka Gumti National Park to identify wild vertebrate pests that raided and destroyed agricultural crops. The results showed that 16 wild fauna species were identified as crop pests. Six of them, Ceropithecus aethiops, Papio anubis, Heliosciurus ...

  20. Genomewide Evolutionary Rates in Laboratory and Wild Yeast

    OpenAIRE

    Ronald, James; Tang, Hua; Brem, Rachel B.

    2006-01-01

    As wild organisms adapt to the laboratory environment, they become less relevant as biological models. It has been suggested that a commonly used S. cerevisiae strain has rapidly accumulated mutations in the lab. We report a low-to-intermediate rate of protein evolution in this strain relative to wild isolates.

  1. Genetic diversity and molecular discrimination of wild tea plants from ...

    African Journals Online (AJOL)

    To efficiently assess and discriminate wild tea germplasms, inter-simple sequence repeats (ISSR) were used to determine genetic relationships among 40 wild tea plants. A total of 275 bands were generated with 15 ISSR primers, of which 274 (99.6%) were polymorphic. The mean genetic similarity coefficient, the mean ...

  2. Antibacterial activity of some wild medicinal plants collected from ...

    African Journals Online (AJOL)

    Traditional medicine has a key role in health care worldwide. Obtaining scientific information about the efficacy and safety of the wild plants grown in western Mediterranean coast of Egypt is one of our research goals. In this study, 10 wild plants namely Mesembryanthemum crystallinum, Blackiella aellen, Arthrocnemon ...

  3. Salmonella spp. dynamics in wild blueberry, Vaccinium angustifolium Aiton

    Science.gov (United States)

    A six-year field study was conducted in the two major wild, or lowbush, blueberry growing regions in Maine, Midcoast and Downeast. This study used data from two cropping cycles (four years) to model the dynamics of Salmonella spp. prevalence in wild blueberry fields (Vaccinium angustifolium Aiton). ...

  4. Horticultural value of wild genetic resources: introduction to the workshop

    Science.gov (United States)

    Wild plant genetic resources are increasingly becoming valuable for breeding, genomics, and ornamental horticulture programs. Wild relatives of horticultural species may offer desirable traits that are not available in cultivated varieties, but “wilds” often also have traits that are highly undesir...

  5. Wild carnivores (Mammalia) as hosts for ticks (Ixodida) in Panama

    NARCIS (Netherlands)

    Bermudez, S.E.; Esser, H.J.; Miranda, R.; Moreno, R.S.

    2015-01-01

    This study reports ticks collected from wild carnivores from different habitat types in Panama. We examined 94 individual wild carnivores and we found 87 parasitized by ticks: seven coyotes, six crab-eating foxes, 54 coatis, four raccoons, five ocelots, two pumas, two gray foxes, two skunks, and one

  6. [Arbuscular mycorrhiza of cultivated and wild Pinellia ternata].

    Science.gov (United States)

    Cheng, Litao; Guo, Qiaosheng; Liu, Zuoyi

    2010-02-01

    To study the arbuscular mycorrhiza and arbuscular mycorrhizal fungi associated with cultivated and wild Pinellia ternata in Guizhou province. Wild and cultivated P. ternata roots were observed through staining and microscopic examination, the arbuscular mycorrhizal fungi spores were isolated through wet thieving according to Gerdemann & Nicolson (1963), the spores were identified following the description of Schenck & Pérez (1988), and some previous publications. The typical arbuscular mycorrhiza (AM) structure was showed according to a research of wild and cultivated P. ternata. In the survey of AM fungi species in the rhizosphere of wild and cultivated P. ternata, 3 genera and 21 species were found, 3 genera and 7 species were identified. 5 species of them belong to Glomus, 1 species belongs to Scutellospora, 1 species belongs to Gigaspora, including Glomus mosseae, G. intraradices, G. melanosporum, G. deserticola, G. aggregatum, Scutellospora castanea, Gigaspora albida, and one of them was a new record, i.e., Scutellospora castanea which was the dominant species in Bijie. The diversity of AM fungi between wild and cultivated Pinellia ternata was showed on this survey, the fungi associated with wild ones are different form the cultivated ones, such as Gigaspora albida only occurs in cultivated ones, Glomus melanosporum only occurs in wild ones, while Glomus mosseae and Glomus intraradices occur in both wild and cultivated ones, and there were specialization species in Bijie, all these can provide new though for solving degradation problem of cultivated Pinellia ternata.

  7. Nutritional value and cholesterol-lowering effect of wild lettuce ...

    African Journals Online (AJOL)

    The nutritive value and cholesterol-lowering effect of wild lettuce (Launaea taxaracifolia) leaf when fed as a source of protein was assessed by using male albino rats (Rattus norvegicus) as an index of evaluation. The rats were fed on both methionine supplemented and unsupplemented wild lettuce leaf diets and elicited ...

  8. Exploring and mapping genetic variation in wild barley

    NARCIS (Netherlands)

    Vanhala, T.

    2004-01-01

    Wild barley represents an important genetic resource for cultivated barley, which has a narrowed gene pool due to intensive breeding. Therefore, it is imperative to study the genetics of different traits in wild barley, if it is to be used for cultivar improvement. This thesis describes studies of

  9. Inter Simple Sequence Repeat (ISSR) analysis of wild and cultivated ...

    African Journals Online (AJOL)

    Inter Simple Sequence Repeat (ISSR) analysis of wild and cultivated rice species from Ethiopia. ... African Journal of Biotechnology ... The genetic diversity of three wild rice populations of Ethiopia along with three cultivated rice populations were studied using Inter simple sequence repeats (ISSRs) as a molecular marker.

  10. How does supplementary feeding affect endoparasite infection in wild boar?

    DEFF Research Database (Denmark)

    Oja, Ragne; Velstrom, Kaisa; Moks, Epp

    2017-01-01

    was associated with both wild boar and feeding site density, whereas the presence of Eimeria sp. oocysts in faecal samples was only associated with wild boar density. Helminth eggs were found more often from the soil of active and abandoned feeding sites than from control areas. This could reflect parasitic...

  11. Genetic diversity and molecular discrimination of wild tea plants from ...

    African Journals Online (AJOL)

    DR TONUKARI NYEROVWO

    2012-07-03

    Jul 3, 2012 ... To efficiently assess and discriminate wild tea germplasms, inter-simple sequence repeats (ISSR) were used to determine genetic relationships among 40 wild tea plants. A total of 275 bands were generated with 15 ISSR primers, of which 274 (99.6%) were polymorphic. The mean genetic similarity ...

  12. Wild edible plants: sustainable use and management by indigenous ...

    African Journals Online (AJOL)

    Wild edible plants are valuable resources in rural livelihoods for supplementing the staple food, ensuring food security, dietary diversification and sustained income. This study aimed to identify and document indigenous uses and management of wild edible plants being used by the Afar and Oromo communities in and the ...

  13. Potential role for wild vegetables in household food security: a ...

    African Journals Online (AJOL)

    The value of wild edible vegetables in food security has not been given sufficient attention in South Africa. Consequently, there are no formal interventions that seek to encourage people to use traditional vegetables as sources of essential nutrients. Studies on the role of wild leafy vegetables in food security could provide ...

  14. Astonishing the wild pigs highlights of technology

    CERN Document Server

    Trueb, Lucien F; Stuber, Fred A

    2015-01-01

    A hydraulic machine for astonishing wild pigs was one of the many technological highlights the author encountered in the course of his career as a research scientist and science writer. Writing a book about them, never taking more (or less) than two printed pages for each of 146 subjects was a very special challenge. The book covers fundamentally important achievements of technology that directly impacted mankind or even profoundly changed it. Many of those highlights are quite new, at least one of them (power generation by nuclear fusion) is not available yet. But particularly ingenious things dating way back were also included, as they are the base of our technical civilization Good examples are ceramics as well as copper, bronze and iron; whole periods of history have been named for the latter three. The analog computer of Antikythera used for stellar navigation was made some 2100 years ago, gunpowder was used in China as early as 1044 A.D., the astronomical clock in the Strasburg cathedral was built in th...

  15. The Caribbean and the Wild Coast

    Directory of Open Access Journals (Sweden)

    Marian Goslinga

    1992-07-01

    Full Text Available [First paragraph] Suriname: a bibliography, 1980-1989. Jo DERKX & IRENE ROLFES. Leiden, the Netherlands: Department of Caribbean Studies, KITLV/Royal Institute of Linguistics and Anthropology, 1990. x + 297 pp. (Paper NLG 25.00 La Caraïbe politique et internationale: bibliographie politologique avec références économiques et socio-culturelles. MICHEL L. MARTIN. Paris: L'Harmattan, 1990. xvii + 287 pp. Suriname. ROSEMARIJN HOEFTE. Oxford and Santa Barbara CA: Clio Press, 1990. xxx + 229 pp. (Cloth US$ 45.00 Although in North American academie circles interest in Suriname (or the Wild Coast, as the area was originally called has always been marginal, the same cannot be said for the Dutch, for whom the former colony continues to hold an enduring fascination. Not only have the Dutch studied the country's historical beginnings assiduously, but Suriname's controversial relationship with the former mother country assures it a definite place in contemporary social and political thought.

  16. Pancreatitis in wild zinc-poisoned waterfowl

    Science.gov (United States)

    Sileo, Louis; Beyer, W. Nelson; Mateo, Rafael

    2003-01-01

    Four waterfowl were collected in the TriState Mining District (Oklahoma, Kansas and Missouri, USA), an area known to be contaminated with lead, cadmium and zinc (Zn). They were part of a larger group of 20 waterfowl collected to determine the exposure of birds to metal contamination at the site. The four waterfowl (three Branta canadensis, one Anas platyrhynchos) had mild to severe degenerative abnormalities of the exocrine pancreas, as well as tissue (pancreas, liver) concentrations of Zn that were considered toxic. The mildest condition was characterized by generalized atrophy of exocrine cells that exhibited cytoplasmic vacuoles and a relative lack of zymogen. The most severe condition was characterized by acini with distended lumens and hyperplastic exocrine tissue that completely lacked zymogen; these acini were widely separated by immature fibrous tissue. Because the lesions were nearly identical to the lesions reported in chickens and captive waterfowl that had been poisoned with ingested Zn, and because the concentrations of Zn in the pancreas and liver of the four birds were consistent with the concentrations measured in Zn-poisoned birds, we concluded that these waterfowl were poisoned by Zn. This may be the first reported case of zinc poisoning in free-ranging wild birds poisoned by environmental Zn.

  17. Functional flexibility in wild bonobo vocal behaviour

    Directory of Open Access Journals (Sweden)

    Zanna Clay

    2015-08-01

    Full Text Available A shared principle in the evolution of language and the development of speech is the emergence of functional flexibility, the capacity of vocal signals to express a range of emotional states independently of context and biological function. Functional flexibility has recently been demonstrated in the vocalisations of pre-linguistic human infants, which has been contrasted to the functionally fixed vocal behaviour of non-human primates. Here, we revisited the presumed chasm in functional flexibility between human and non-human primate vocal behaviour, with a study on our closest living primate relatives, the bonobo (Pan paniscus. We found that wild bonobos use a specific call type (the “peep” across a range of contexts that cover the full valence range (positive-neutral-negative in much of their daily activities, including feeding, travel, rest, aggression, alarm, nesting and grooming. Peeps were produced in functionally flexible ways in some contexts, but not others. Crucially, calls did not vary acoustically between neutral and positive contexts, suggesting that recipients take pragmatic information into account to make inferences about call meaning. In comparison, peeps during negative contexts were acoustically distinct. Our data suggest that the capacity for functional flexibility has evolutionary roots that predate the evolution of human speech. We interpret this evidence as an example of an evolutionary early transition away from fixed vocal signalling towards functional flexibility.

  18. Wild and semi-wild leafy vegetables used by the Maale and Ari ethnic communities in southern Ethiopia

    NARCIS (Netherlands)

    Kidane, Berhane; Maesen, van der L.J.G.; Asfaw, Zemede; Sosef, M.S.M.; Andel, van Tinde

    2015-01-01

    We studied wild and semi-wild leafy vegetables used by the Maale and Ari ethnic communities in southern Ethiopia. Quantitative and qualitative ethnobotanical methods, including individual and focus group (n = 18) discussions, field observations, and individual interviews (n = 144), were used in

  19. Wild food in Europe: a synthesis of knowledge and data of terrestrial wild food as an ecosystem service

    NARCIS (Netherlands)

    Schulp, C.J.E.; Thuiller, W.; Verburg, P.H.

    2014-01-01

    Wild food is an iconic ecosystem service that receives little attention in quantifying, valuating and mapping studies, due to the perceived low importance or due to lack of data. Here, we synthesize available data on the importance of wild food as ecosystem service, its spatial distribution and

  20. Blood Parasites of Semi-Domesticated and Wild Birds in Kaduna ...

    African Journals Online (AJOL)

    Wild birds interact with poultry with likelihood of exchange of blood parasites between the wild bird and poultry highlighting the need to understand wild bird parasites so as to reduce cross infection at the wild bird-poultry interface. There is paucity of data on blood parasites of wild birds in Kaduna State, Nigeria. This study ...

  1. Familial Hepatitis E Outbreak Linked to Wild Boar Meat Consumption.

    Science.gov (United States)

    Rivero-Juarez, A; Frias, M; Martinez-Peinado, A; Risalde, M A; Rodriguez-Cano, D; Camacho, A; García-Bocanegra, I; Cuenca-Lopez, F; Gomez-Villamandos, J C; Rivero, A

    2017-11-01

    An HIV-infected patient was diagnosed with acute hepatitis E infection in our hospital. An epidemiological inquiry was performed to collect demographic, food and animal exposure variables in order to identify the potential route of transmission. The patient reported that his family traditionally hunted wild boar for food. All family members were analysed for hepatitis E virus infection. Additionally, route of transmission by wild boar meat consumption and prevalence of HEV infection among wild boar from the same hunting area were investigated. In all-family members (n = 8), HEV-RNA was amplified. Two wild boar meat slices consumed was analysed, showing the presence of HEV. The virus isolated was consistent with genotype 3, revealing 100% homology between family members and meat. Additionally, we tested nine wild boar hunted in the same hunting area. All of them were RNA-HEV positive, isolating the same HEV genotype 3 viral strain. We demonstrated by phylogenetic analysis zoonotic transmission of HEV by wild boar meat consumption. The prevalence of HEV infection among wild boar found in our study suggests that this species is an important route of transmission to human. © 2017 Blackwell Verlag GmbH.

  2. Meat from wild boar (Sus scrofa L.): a review.

    Science.gov (United States)

    Sales, James; Kotrba, Radim

    2013-06-01

    Wild boar is a species that is utilised for food and sport hunting throughout the world. Recent increases in natural populations and the potential of farming wild boars have stimulated interest in this species as a meat producer. Compared to domestic pigs, wild boars present a higher degree of carcass fatness and larger loin areas, more slow-twitch oxidative (I) and fast-twitch oxidative glycolytic (IIA) and less fast-twitch glycolytic (IIB) muscle fibres, and darker, less tender and leaner meat. Differences in diets might contribute to differences in cooked meat flavour and fatty acid composition between wild boars and domestic pigs. Higher α-tocopherol concentrations in wild boar might extend its meat shelf-life. Mechanical massaging of muscles, vacuum package ageing and addition of marinates have been attempted to tenderise wild boar meat. Further research on hunting protocols for wild boar, and value-added products from its meat, are needed. Copyright © 2013 Elsevier Ltd. All rights reserved.

  3. Estimate of herpetofauna depredation by a population of wild pigs

    Science.gov (United States)

    Jolley, D.B.; Ditchkoff, S.S.; Sparklin, B.D.; Hanson, L.B.; Mitchell, M.S.; Grand, J.B.

    2010-01-01

    Herpetofauna populations are decreasing worldwide, and the range of wild pigs (Sus scrofa) is expanding. Depredation of threatened reptile and amphibian populations by wild pigs could be substantial. By understanding depredation characteristics and rates, more resources can be directed toward controlling populations of wild pigs coincident with threatened or endangered herpetofauna populations. From April 2005 to March 2006 we used firearms to collect wild pigs (n = 68) and examined stomach content for reptiles and amphibians. We found 64 individual reptiles and amphibians, composed of 5 different species, that were consumed by wild pigs during an estimated 254 hours of foraging. Primarily arboreal species (e.g., Anolis carolinensis) became more vulnerable to depredation when temperatures were low and they sought thermal shelter. Other species (e.g., Scaphiopus holbrookii) that exhibit mass terrestrial migrations during the breeding season also faced increased vulnerability to depredation by wild pigs. Results suggest that wild pigs are opportunistic consumers that can exploit and potentially have a negative impact on species with particular life-history characteristics. ?? 2009 American Society of Mammalogists.

  4. Evidence of Aujeszky's disease in wild boar in Serbia.

    Science.gov (United States)

    Milicevic, V; Radojicic, S; Valcic, M; Ivovic, V; Radosavljevic, V

    2016-06-30

    Aujeszky's disease is a viral disease of suids caused by Suid Herpesvirus 1. The disease has worldwide distribution with significant economic impact. In Serbia, there is neither an Aujeszky's disease eradication nor national vaccination programme of domestic pigs. Since clinical symptoms of Aujeszky's disease are not specific, it is important to establish a link between clinical signs and presence of ADV active infection in wild boars. The aim of this study was to investigate the possibility of active infection within wild boar showing signs of ADV and also to examine relationship between isolates from domestic pigs and wild boar. Having in mind that virus has not been previously isolated from wild boars in Serbia, we report the first isolation of Suid Herpesvirus 1 from this species in Serbia. Tissue and serum samples from 40 wild boars from eastern Serbia were examined for evidence of Aujeszky's disease (AD). Suid Herpesvirus 1 (SHV1), the cause of AD was isolated on PK15 cell line from three tissue samples, inducing cytopathic effect (CPE) with syncytia forming, and viral genome was detected by polymerase chain reaction (PCR) in eight samples. Genetic analysis of us4, us9 and ul49.5 partial sequences showed high homology between ADV isolates from wild boars and between isolates from wild boars and domestic animals. Neutralizing antibodies were not detected by virus neutralisation test (VNT) in sera from four out of eight PCR positive wild boars suggesting recent infection in those animals. This is the first demonstration of Aujeszky's disease virus (ADV) in the wild boar population in Serbia although seroconversion has been detected previously.

  5. A Genetic Study of Wild Populations and Evolution A Genetic Study of Wild Populations and Evolution

    Directory of Open Access Journals (Sweden)

    Hovanitz William

    1944-06-01

    Full Text Available The determination of the scientific basis of heredity within the last two decades and the verification of the principal conclusions in many different plants and animals has made possible the application of analytical methods in the study of variations in wild populations. As with the physical and chemical sciences, genetics has been enabled to make use of mathematics to compound (often theoretically out of simple units, the genes, the complexity known as an organism, much in the same way as a chemist compounds molecules with atoms and the physicist compounds atoms with protons and electrons. The determination of the scientific basis of heredity within the last two decades and the verification of the principal conclusions in many different plants and animals has made possible the application of analytical methods in the study of variations in wild populations. As with the physical and chemical sciences, genetics has been enabled to make use of mathematics to compound (often theoretically out of simple units, the genes, the complexity known as an organism, much in the same way as a chemist compounds molecules with atoms and the physicist compounds atoms with protons and electrons.

  6. Ethnobotanical review of wild edible plants of Slovakia

    OpenAIRE

    Łukasz Łuczaj

    2012-01-01

    This paper is an ethnobotanical review of wild edible plants gathered for consumption from the 19th century to the present day, within the present borders of Slovakia. Twenty-four sources (mainly ethnographic) documenting the culinary use of wild plants were analysed. The use of 106 species (over 3% of the Slovak flora) has been recorded. Nowadays most of them are no longer used, or used rarely, apart from a few species of wild fruits. The most frequently used plants include the fruits of Rub...

  7. Wild Manihot Species Do Not Possess C4 Photosynthesis

    Science.gov (United States)

    CALATAYUD, P.‐A.; BARÓN, C. H.; VELÁSQUEZ, H.; ARROYAVE, J. A.; LAMAZE, T.

    2002-01-01

    Cultivated cassava (Manihot esculenta) has a higher rate of photosynthesis than is usual for C3 plants and photosynthesis is not light saturated. For these reasons it has been suggested that cultivated cassava could be derived from wild species possessing C4 photosynthesis. The natural abundance of 13C and activities of phosphoenolpyruvate carboxylase and phosphoglycolate phosphatase were measured in leaves of 20 wild cassava species to test this hypothesis. All the species studied, including M. flabellifolia the potential wild progenitor of cultivated cassava, clearly exhibited C3 not C4 characteristics. PMID:12096814

  8. Sperm traits in farmed and wild Atlantic salmon Salmo salar.

    Science.gov (United States)

    Camarillo-Sepulveda, N; Hamoutene, D; Lush, L; Burt, K; Volkoff, H; Fleming, I A

    2016-02-01

    Differences in sperm metabolism and morphology between wild and non-local farmed Atlantic salmon Salmo salar were assessed by measuring metabolic enzyme activities and length of sperm flagella. No differences were observed between wild and farmed S. salar sperm with regards to cell counts or any of the biochemical variables assessed. Flagella of sperm cells were significantly longer in wild than farmed S. salar; however, this did not result in higher energy levels or different fertilization rates. © 2015 The Fisheries Society of the British Isles.

  9. Anti-cancer and anti-oxidant efficacies of wild ginseng and cultivated wild ginseng of Korea and China

    Directory of Open Access Journals (Sweden)

    Young-Min,Ahn

    2007-02-01

    Full Text Available Objectives : The aim of this study was to verify anti-cancer and anti-oxidant efficacies of Korean wild ginseng and cultivated wild ginseng of Korea and China. Methods : For the measurement of anti-oxidation, SOD-like activity was evaluated using xanthine oxidase reduction method under in vitro environment. Subcutaneous and abdominal cancer were induced using CT-26 human colon cancer cells for the measurement of growth inhibition of cancer cells and differences in survival rate. Results : 1. Measurement of anti-oxidant activity of ginseng, Chinese and Korean cultivated wild ginseng, and natural wild ginseng samples showed concentration dependent anti-oxidant activity in HX/XOD system. Anti-oxidant activity showed drastic increase at 1mg/ml in all samples. 2. For the evaluation of growth inhibition of cancer cells after hypodermic implantation of CT-26 cancer cells in the peritoneal cavity of mice, Chinese and Korean cultivated wild ginseng and natural wild ginseng groups showed significant inhibition of tumor growth from the 12th day compared to the control group. Similar inhibitory effects were also shown on the 15th and 18th days. But there was no significant difference between the experiment groups. 3. For the observation of increase in survival rate of the natural wild ginseng group, CT-26 cancer cells were implanted in the peritoneal cavity of mice.

  10. Nutritive value of green or yellow foxtail, wild oats, wild buckwheat or redroot pigweed seed as determined with the rat.

    Science.gov (United States)

    Harrold, R L; Craig, D L; Nalewaja, J D; North, B B

    1980-07-01

    Pure green foxtail (Setaria viridis Beauv.), yellow foxtail (Setaria lutescens Hubb.), wild oats (Avena fatua L.), wild buckwehat (Polygonum convolvulus L.) and redroot pigweed (Amaranthus retroflexus L.) seeds were fed to growing male rats in two experiments. In the first experiment, green or yellow foxtail and wild oats seeds were found to be first-limiting in the amino acid lysine. Green or yellow foxtail seed supplemented with lysine produced satisfactory rat growth. Digestible energy (DE) values of lysine-supplemented diets were: 3.478, 3.068 and 2.696 kcal/g dry matter (DM) for green foxtail, yellow foxtail and wild oats, respectively. Protein digestibility values were 77.1, 68.6 and 54.2 for the respective diets. Wild oats were accepted poorly by the rats, even after lysine supplementation. In the second experiment, rats required approximately 7 days to adapt to voluntary consumption of an amino acid-supplemented wild buckwheat diet. Moderate weight gain of weanling male rats was obtained because of high consumption of the wild buckwheat diet, which had 2.206 kcal DE/g DM and 52.5% crude protein digestibility. In contrast, initial high acceptability of the redroot pigweed diet quickly declined. Digestibility values for the redroot pigweed diet were 2.884 kcal DE/g DM and 54.6% rude protein digestibility. The relationship between digestibility values obtained with rats and those obtained with swine is discussed.

  11. Sublethal consequences of urban life for wild vertebrates

    National Research Council Canada - National Science Library

    Gallagher, Austin J; Peiman, Kathryn S; de Bruijn, Robert; Cooke, Steven J; Birnie-Gauvin, Kim

    2016-01-01

    ... — while others have not. Here we present a review of the sublethal consequences of life in the city for wild vertebrates, and demonstrate that urban animals face an almost completely different set of physiological...

  12. Hard boundaries influence African wild dogs' diet and prey selection

    National Research Council Canada - National Science Library

    Davies‐Mostert, Harriet T; Mills, Michael G. L; Macdonald, David W; Dickman, Christopher

    2013-01-01

    Human‐mediated changes in habitat structure may disturb predator–prey relationships. We investigated the influence of perimeter fences on the diet of a reintroduced population of African wild dogs L ycaon pictus T emminck 1820 in a 316...

  13. Wind River: A Wild and Scenic River Analysis: Preliminary draft

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — The Wind River meets the criteria for inclusion in the National Wild and Scenic Rivers System. Subject to valid existing rights, the minerals in Federal lands which...

  14. Hybrids between wild and cultivated carrots in Danish carrot fields

    DEFF Research Database (Denmark)

    Hauser, Thure Pavlo; Bjørn, G. K.

    2001-01-01

    seeds. Pollen and seed dispersal from fields into wild carrot populations is probably rather frequent in Denmark. A closer inspection of the morphology of flowering plants indicate that some of these (2-60%) are bolters of pure cultivar origin, as indicated primarily by orange root colour. The remainder...... is probably first or advanced generation hybrids between wild and cultivated plants, as indicated by their white roots and combinations of morphological characters from either plant type. Some of these hybrids are imported to Denmark together with the sowing seed, as indicated by significantly different......It is well known that wild carrots may pollute the seed crops of cultivated carrots, but whether cultivated carrots can also disperse pollen and seed, and thereby introduce genes into wild carrot populations, is only little described. In Denmark, there is no commercial seed production of carrots...

  15. Death of a wild wolf from canine parvovirus enteritis

    Science.gov (United States)

    Mech, L.D.; Kurtz, H.J.; Goyal, S.

    1997-01-01

    A 9-mo-old female wolf (Canis lupus) in the Superior National Forest of Minnesota (USA) died from a canine parvovirus (CPV) infection. This is the first direct evidence that this infection effects free-ranging wild wolves.

  16. 30,000-Year-Old Wild Flax Fibers

    National Research Council Canada - National Science Library

    Eliso Kvavadze; Ofer Bar-Yosef; Anna Belfer-Cohen; Elisabetta Boaretto; Nino Jakeli; Zinovi Matskevich; Tengiz Meshveliani

    2009-01-01

    A unique finding of wild flax fibers from a series of Upper Paleolithic layers at Dzudzuana Cave, located in the foothills of the Caucasus, Georgia, indicates that prehistoric hunter-gatherers were...

  17. Impediments, opportunities and strategies to enhance trade of wild ...

    African Journals Online (AJOL)

    Prof. Jacob Agea

    Full Length Research Paper. Impediments ... wild food plants (WSWFPs) in Bunyoro-Kitara Kingdom, Uganda. Semi-structured ... perishability, market dues, inaccurate consumers' perceptions, seasonal shortfalls and unreliable supply ...

  18. Salmon 2100: the future of wild Pacific salmon

    National Research Council Canada - National Science Library

    Lackey, R.T; Lach, D.H; Duncan, S.L

    2006-01-01

    Realistic options to restore and sustain wild salmon runs in California, Oregon, Washington, Idaho and southern British Columbia are identified by 36 salmon scientists, resource managers, and policy experts...

  19. SALMON 2100: THE FUTURE OF WILD PACIFIC SALMON

    Science.gov (United States)

    Many experts have concluded that wild salmon recovery efforts in western North America (especially California, Oregon, Washington, Idaho, and southern British Columbia), as earnest, expensive, and socially disruptive as they currently are, do not appear likely to sustain biologic...

  20. Federal Measures Against the Abuse of Wild Animals

    Science.gov (United States)

    Reed, Nathaniel P.

    1974-01-01

    Describes the appalling conditions associated with many zoos and with the trafficking of exotic pets, and discusses recent federal and international measures designed to reduce the abuse of wild animals. (JR)

  1. Microflora diversity on the phyloplane of wild Okra ( Corchorus ...

    African Journals Online (AJOL)

    ) as a staple vegetable. Population dynamics, richness and frequency of occurrence of microflora isolates on healthy green leaves of wild okra were estimated within two weeks at weekly intervals using the dilution technique. This study was ...

  2. Creating a sanctuary for wild Steelhead Trout through hatchery operations

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — The Deschutes River basin in north-central Oregon supports a wild population of threatened summer steelhead (Oncorhynchus mykiss). The basin has seen large increases...

  3. Tracking and Stalking the Wild: A Course Description.

    Science.gov (United States)

    Kowalewski, David

    2002-01-01

    Introduces an undergraduate course offered to junior and senior students on tracking and stalking in the wild. Finds and identifies fresh tracks of species selected by students as the ultimate goal of the course. (YDS)

  4. Wild Cultures: A Comparison between Chimpanzee and Human Cultures

    Directory of Open Access Journals (Sweden)

    Diana Rocío Carvajal Contreras

    2013-07-01

    Full Text Available Review of Wild Cultures: A Comparison between Chimpanzee and Human Cultures. Christophe Boesch. 2012. Cambridge University Press. Pp. 276, 68 b & w illustrations, 11 tables. £60 (hardback. ISBN 9781109025370.

  5. War 2010: The Emergence of the Wild Card Scenario

    National Research Council Canada - National Science Library

    Rosello, Victor

    1997-01-01

    This research paper explores the possibility of using prophecy-based predictions to create worst case scenarios or 'wild cards,' when examined within the context of current trends and indicators of world threats...

  6. Multi-surface Interaction in the WILD Room

    DEFF Research Database (Denmark)

    Beaudouin-Lafon, Michel; Chapuis, Olivier; Eagan, James R.

    2012-01-01

    The WILD (wall-sized interaction with large datasets) room serves as a testbed for exploring the next generation of interactive systems by distributing interaction across diverse computing devices, enabling multiple users to easily and seamlessly create, share, and manipulate digital content....... The featured Web extra is a video of Michel Beaudouin-Lafon and his colleagues demonstrating how the WILD (wall-sized interaction with large datasets) room lets users view, explore, manipulate large amounts of digital content....

  7. Worldwide Occurrence of Feline Hemoplasma Infections in Wild Felid Species▿

    Science.gov (United States)

    Willi, Barbara; Filoni, Claudia; Catão-Dias, José L.; Cattori, Valentino; Meli, Marina L.; Vargas, Astrid; Martínez, Fernando; Roelke, Melody E.; Ryser-Degiorgis, Marie-Pierre; Leutenegger, Christian M.; Lutz, Hans; Hofmann-Lehmann, Regina

    2007-01-01

    While hemoplasma infections in domestic cats are well studied, almost no information is available on their occurrence in wild felids. The aims of the present study were to investigate wild felid species as possible reservoirs of feline hemoplasmas and the molecular characterization of the hemoplasma isolates. Blood samples from the following 257 wild felids were analyzed: 35 Iberian lynxes from Spain, 36 Eurasian lynxes from Switzerland, 31 European wildcats from France, 45 lions from Tanzania, and 110 Brazilian wild felids, including 12 wild felid species kept in zoos and one free-ranging ocelot. Using real-time PCR, feline hemoplasmas were detected in samples of the following species: Iberian lynx, Eurasian lynx, European wildcat, lion, puma, oncilla, Geoffroy's cat, margay, and ocelot. “Candidatus Mycoplasma haemominutum” was the most common feline hemoplasma in Iberian lynxes, Eurasian lynxes, Serengeti lions, and Brazilian wild felids, whereas “Candidatus Mycoplasma turicensis” was the most prevalent in European wildcats; hemoplasma coinfections were frequently observed. Hemoplasma infection was associated with species and free-ranging status of the felids in all animals and with feline leukemia virus provirus-positive status in European wildcats. Phylogenetic analyses of the 16S rRNA and the partial RNase P gene revealed that most hemoplasma isolates exhibit high sequence identities to domestic cat-derived isolates, although some isolates form different subclusters within the phylogenetic tree. In conclusion, 9 out of 15 wild felid species from three different continents were found to be infected with feline hemoplasmas. The effect of feline hemoplasma infections on wild felid populations needs to be further investigated. PMID:17301277

  8. Worldwide occurrence of feline hemoplasma infections in wild felid species.

    Science.gov (United States)

    Willi, Barbara; Filoni, Claudia; Catão-Dias, José L; Cattori, Valentino; Meli, Marina L; Vargas, Astrid; Martínez, Fernando; Roelke, Melody E; Ryser-Degiorgis, Marie-Pierre; Leutenegger, Christian M; Lutz, Hans; Hofmann-Lehmann, Regina

    2007-04-01

    While hemoplasma infections in domestic cats are well studied, almost no information is available on their occurrence in wild felids. The aims of the present study were to investigate wild felid species as possible reservoirs of feline hemoplasmas and the molecular characterization of the hemoplasma isolates. Blood samples from the following 257 wild felids were analyzed: 35 Iberian lynxes from Spain, 36 Eurasian lynxes from Switzerland, 31 European wildcats from France, 45 lions from Tanzania, and 110 Brazilian wild felids, including 12 wild felid species kept in zoos and one free-ranging ocelot. Using real-time PCR, feline hemoplasmas were detected in samples of the following species: Iberian lynx, Eurasian lynx, European wildcat, lion, puma, oncilla, Geoffroy's cat, margay, and ocelot. "Candidatus Mycoplasma haemominutum" was the most common feline hemoplasma in Iberian lynxes, Eurasian lynxes, Serengeti lions, and Brazilian wild felids, whereas "Candidatus Mycoplasma turicensis" was the most prevalent in European wildcats; hemoplasma coinfections were frequently observed. Hemoplasma infection was associated with species and free-ranging status of the felids in all animals and with feline leukemia virus provirus-positive status in European wildcats. Phylogenetic analyses of the 16S rRNA and the partial RNase P gene revealed that most hemoplasma isolates exhibit high sequence identities to domestic cat-derived isolates, although some isolates form different subclusters within the phylogenetic tree. In conclusion, 9 out of 15 wild felid species from three different continents were found to be infected with feline hemoplasmas. The effect of feline hemoplasma infections on wild felid populations needs to be further investigated.

  9. Were Polish wild boars exposed to Schmallenberg virus?

    Directory of Open Access Journals (Sweden)

    Kęsik-Maliszewska Julia

    2017-06-01

    Full Text Available Introduction: A novel to Europe Schmallenberg virus (SBV causes clinical disease manifested by reproduction disorders in farm ruminants. In free-living ruminants, SBV antibodies as well as the virus were detected. Recent studies also revealed SBV antibodies in wild boars. The study investigates SBV antibodies occurring in wild boars in Poland at the peak of recent virus epidemics in the country.

  10. Androgen receptor and monoamine oxidase polymorphism in wild bonobos

    OpenAIRE

    Garai, Cintia; Furuichi, Takeshi; Kawamoto, Yoshi; Ryu, Heungjin; Inoue-Murayama, Miho

    2014-01-01

    Androgen receptor gene (AR), monoamine oxidase A gene (MAOA) and monoamine oxidase B gene (MAOB) have been found to have associations with behavioral traits, such as aggressiveness, and disorders in humans. However, the extent to which similar genetic effects might influence the behavior of wild apes is unclear. We examined the loci AR glutamine repeat (ARQ), AR glycine repeat (ARG), MAOA intron 2 dinucleotide repeat (MAin2) and MAOB intron 2 dinucleotide repeat (MBin2) in 32 wild bonobos, Pa...

  11. Marked seasonal variation in the wild mouse gut microbiota

    OpenAIRE

    Maurice, CF; Cl Knowles, S; Ladau, J.; Pollard, KS; Fenton, A.; Pedersen, AB; Turnbaugh, PJ

    2015-01-01

    Recent studies have provided an unprecedented view of the microbial communities colonizing captive mice; yet the host and environmental factors that shape the rodent gut microbiota in their natural habitat remain largely unexplored. Here, we present results from a 2-year 16 S ribosomal RNA gene sequencing-based survey of wild wood mice (Apodemus sylvaticus) in two nearby woodlands. Similar to other mammals, wild mice were colonized by 10 bacterial phyla and dominated by the Firmicutes, Bacter...

  12. Phytonutrient, Antioxidant and Mineral Composition of Some Wild ...

    African Journals Online (AJOL)

    The values for total carotenoid ranged from 172.77 ìg/100 g (in C. millenii) to 1380.17 ìg/100 g (in C. albidum). The wild fruits are sources of phytonutrients, antioxidants such as vitamin C, total carotenoids and some minerals. Planting of the wild fruit trees or the incorporation in farming systems should thus be encouraged to ...

  13. Mink farms predict Aleutian disease exposure in wild American mink.

    Science.gov (United States)

    Nituch, Larissa A; Bowman, Jeff; Beauclerc, Kaela B; Schulte-Hostedde, Albrecht I

    2011-01-01

    Infectious diseases can often be of conservation importance for wildlife. Spillover, when infectious disease is transmitted from a reservoir population to sympatric wildlife, is a particular threat. American mink (Neovison vison) populations across Canada appear to be declining, but factors thus far explored have not fully explained this population trend. Recent research has shown, however, that domestic mink are escaping from mink farms and hybridizing with wild mink. Domestic mink may also be spreading Aleutian disease (AD), a highly pathogenic parvovirus prevalent in mink farms, to wild mink populations. AD could reduce fitness in wild mink by reducing both the productivity of adult females and survivorship of juveniles and adults. To assess the seroprevalence and geographic distribution of AD infection in free-ranging mink in relation to the presence of mink farms, we conducted both a large-scale serological survey, across the province of Ontario, and a smaller-scale survey, at the interface between a mink farm and wild mink. Antibodies to AD were detected in 29% of mink (60 of 208 mink sampled); however, seroprevalence was significantly higher in areas closer to mink farms than in areas farther from farms, at both large and small spatial scales. Our results indicate that mink farms act as sources of AD transmission to the wild. As such, it is likely that wild mink across North America may be experiencing increased exposure to AD, via disease transmission from mink farms, which may be affecting wild mink demographics across their range. In light of declining mink populations, high AD seroprevalence within some mink farms, and the large number of mink farms situated across North America, improved biosecurity measures on farms are warranted to prevent continued disease transmission at the interface between mink farms and wild mink populations.

  14. Epidemiological Profile of Wild Rabies in Brazil (2002-2012).

    Science.gov (United States)

    Rocha, S M; de Oliveira, S V; Heinemann, M B; Gonçalves, V S P

    2017-04-01

    Rabies is one of the most important zoonosis in the world with high impact on public health. Studies report the presence of Lyssavirus in reservoirs of the wild cycle, highlighting the role of wild canines, marmosets, and vampire and non-vampire bats as potential vectors of the disease to domestic animals and human beings. Therefore, the reintroduction of rabies in urban environments from reservoirs of the wild cycle is a matter of concern. This study describes the profile of rabies cases documented in Brazil from 2002 to 2012, with emphasis on the wild transmission cycle of the disease. We carried out a descriptive study using records with information on the time of infection, persons with infection and location of confirmed cases of rabies in humans and animals, as well as data on anti-rabies treatments obtained from the Information System of Notifiable Diseases (Sinan) database. Within the study period, 82 cases of rabies transmitted by wild animals to humans were reported, predominantly in rural areas of the northern and north-eastern regions. Of the cases in humans, 72% did not receive post-exposure prophylaxis. Among wild mammals, vampire bats were the most frequent vectors of the disease. In the north-east region, 460 terrestrial wild mammals were reported with confirmed rabies. Over the study period, 1703 bats were reported to carry the rabies virus. In the south-east region, the most frequently reported carriers of the virus were non-vampire bats. The midwest and northern regions presented a lower number of records of rabies cases among terrestrial wild mammals. However, the high number of rabies cases among bovines reflects the role of the vampire bat as a maintainer of the rabies virus in the rural cycle. The present results are key to adjust the planning of rabies control in Brazil to the current epidemiological trends. © 2015 Blackwell Verlag GmbH.

  15. Mink farms predict Aleutian disease exposure in wild American mink.

    Directory of Open Access Journals (Sweden)

    Larissa A Nituch

    Full Text Available BACKGROUND: Infectious diseases can often be of conservation importance for wildlife. Spillover, when infectious disease is transmitted from a reservoir population to sympatric wildlife, is a particular threat. American mink (Neovison vison populations across Canada appear to be declining, but factors thus far explored have not fully explained this population trend. Recent research has shown, however, that domestic mink are escaping from mink farms and hybridizing with wild mink. Domestic mink may also be spreading Aleutian disease (AD, a highly pathogenic parvovirus prevalent in mink farms, to wild mink populations. AD could reduce fitness in wild mink by reducing both the productivity of adult females and survivorship of juveniles and adults. METHODS: To assess the seroprevalence and geographic distribution of AD infection in free-ranging mink in relation to the presence of mink farms, we conducted both a large-scale serological survey, across the province of Ontario, and a smaller-scale survey, at the interface between a mink farm and wild mink. CONCLUSIONS/SIGNIFICANCE: Antibodies to AD were detected in 29% of mink (60 of 208 mink sampled; however, seroprevalence was significantly higher in areas closer to mink farms than in areas farther from farms, at both large and small spatial scales. Our results indicate that mink farms act as sources of AD transmission to the wild. As such, it is likely that wild mink across North America may be experiencing increased exposure to AD, via disease transmission from mink farms, which may be affecting wild mink demographics across their range. In light of declining mink populations, high AD seroprevalence within some mink farms, and the large number of mink farms situated across North America, improved biosecurity measures on farms are warranted to prevent continued disease transmission at the interface between mink farms and wild mink populations.

  16. Organochlorines in wild mink (Mustela vison) from Norway

    Energy Technology Data Exchange (ETDEWEB)

    Skaare, J.U.; Polder, A.; Brevik, E.M.; Kveseth, N.J.

    Levels of PCBs, DDE, and HCB have been determined in wild mink caught in the Norwegian counties of Sogn and Fjordane, Rogaland, and Hedmark. No significant differences were founds in organochlorine levels in wild mink from these counties, and the average level, based on fat weight, in abdominal adipose tissue was about 1 ppm DDE, 0.1 ppm HCB and for PCB ranging from 1 to 15 ppm.

  17. Identification of Potential Wild Herbal as parts of Landscape Elements

    Science.gov (United States)

    Sulistyantara, Bambang; Mentari, Nio

    2017-10-01

    Many landscape plants can grow on their own without cultivated by humans. They are type of plants that can be found anywhere, so they can be categorized as wild plants. The economic value of wild plants are easy to obtain and their maintenance costs are low. Because wild plants not widely known even a just a few of people that aware of their existence, it is necessary to do a study to learn the potential of the wild plants to be used as an element of landscape. This research aims to identify the species that have potential to be used in landscape design, to describe the benefits of the their implementation as a landscape element, and to recommend the wild plants that have functional value and visual. This research used a scoring method based on the functional and visual criteria, and questionnaires were conducted to 50 students of Landscape Architecture IPB who have completed Landscape Plants courses. Based on the research, there are 150 species of wild plants that found in the study site, and 60 of them are recommended as landscape elements. Then all of the species were arranged as a recommendations book so they can be used as alternative landscape plants.

  18. The control of classical swine fever in wild boar

    Directory of Open Access Journals (Sweden)

    Volker eMoennig

    2015-11-01

    Full Text Available Classical swine fever (CSF is a viral disease with severe economic consequences for domestic pigs. Natural hosts for the CSF virus (CSFV are members of the family Suidae, i.e. Eurasian wild boar (sus scrofa are also susceptible. CSF in wild boar poses a serious threat to domestic pigs. CSFV is an enveloped RNA virus belonging to the pestivirus genus of the Flaviviridae family. Transmission of the infection is usually by direct contact or by feeding of contaminated meat products. In recent decades CSF has been successfully eradicated from Australia, North America, and the European Union. In areas with dense wild boar populations CSF tends to become endemic whereas it is often self-limiting in small, less dense populations. In recent decades eradication strategies of CSF in wild boar have been improved considerably. The reduction of the number of susceptible animals to a threshold level where the basic reproductive number is R0<1 is the major goal of all control efforts. Depending on the epidemiological situation, hunting measures combined with strict hygiene may be effective in areas with a relatively low density of wild boar. Oral immunization was shown to be highly effective in endemic situations in areas with a high density of wild boar.

  19. Seed coating with a neonicotinoid insecticide negatively affects wild bees.

    Science.gov (United States)

    Rundlöf, Maj; Andersson, Georg K S; Bommarco, Riccardo; Fries, Ingemar; Hederström, Veronica; Herbertsson, Lina; Jonsson, Ove; Klatt, Björn K; Pedersen, Thorsten R; Yourstone, Johanna; Smith, Henrik G

    2015-05-07

    Understanding the effects of neonicotinoid insecticides on bees is vital because of reported declines in bee diversity and distribution and the crucial role bees have as pollinators in ecosystems and agriculture. Neonicotinoids are suspected to pose an unacceptable risk to bees, partly because of their systemic uptake in plants, and the European Union has therefore introduced a moratorium on three neonicotinoids as seed coatings in flowering crops that attract bees. The moratorium has been criticized for being based on weak evidence, particularly because effects have mostly been measured on bees that have been artificially fed neonicotinoids. Thus, the key question is how neonicotinoids influence bees, and wild bees in particular, in real-world agricultural landscapes. Here we show that a commonly used insecticide seed coating in a flowering crop can have serious consequences for wild bees. In a study with replicated and matched landscapes, we found that seed coating with Elado, an insecticide containing a combination of the neonicotinoid clothianidin and the non-systemic pyrethroid β-cyfluthrin, applied to oilseed rape seeds, reduced wild bee density, solitary bee nesting, and bumblebee colony growth and reproduction under field conditions. Hence, such insecticidal use can pose a substantial risk to wild bees in agricultural landscapes, and the contribution of pesticides to the global decline of wild bees may have been underestimated. The lack of a significant response in honeybee colonies suggests that reported pesticide effects on honeybees cannot always be extrapolated to wild bees.

  20. Epizootiological-epidemiological importance of parasitic infections in wild canids

    Directory of Open Access Journals (Sweden)

    Ilić Tamara

    2012-01-01

    Full Text Available The family of wild canids belongs to the order Carnivora and comprises 16 genuses that are distributed in most countries all over the world. The most important endoparasitic diseases of wild canids are toxocariasis, uncinariasis, capillariasis, trichinellosis, echinococcosis, cestodiasis, opisthorchiasis, and alariasis. Ectoparasites that most often exist as parasites in wild canids are mites, fleas, ticks and scabies.Wild canids have a large epizootiological-epidemiological significance since they are hosts to parasites that cause certain vector diseases, the most important of which are leishmaniasis, ehrilichiosis, babesiasis, borreliosis, dirofilariasis, bartonellosis, and hepatozoonosis. The increased frequency of interaction between domestic and wild canids steps up the risk of the appearance, spread, and maintaining of the disease in domestic dog populations. Observed from the aspect of the biological and ecological risk, that can be caused by zoonotic infections, the knowledge of the etiology and epizootiology of parasistic infections of wild canids is of particular importance for the region of the Republic of Serbia. [Projekat Ministarstva nauke Republike Srbije, br. TR31084: Praćenje zdravstvenog stanja divljači i uvođenje novih biotehnoloških postupaka u detekciji zaraznih i zoonoznih agenasa - analiza rizika za zdravlje ljudi, domaćih i divljih životinja i kontaminaciju životne sredine i br. 173001: Primena EIIP/ISM bioinformatičke platforme u otkrivanju novih terapeutskih targeta i potencijalnih terapeutskih molekula

  1. Reproductive success in wild and hatchery male coho salmon.

    Science.gov (United States)

    Neff, Bryan D; Garner, Shawn R; Fleming, Ian A; Gross, Mart R

    2015-08-01

    Salmon produced by hatcheries have lower fitness in the wild than naturally produced salmon, but the factors underlying this difference remain an active area of research. We used genetic parentage analysis of alevins produced by experimentally mixed groups of wild and hatchery coho salmon (Oncorhynchus kisutch) to quantify male paternity in spawning hierarchies. We identify factors influencing paternity and revise previously published behavioural estimates of reproductive success for wild and hatchery males. We observed a strong effect of hierarchy size and hierarchy position on paternity: in two-male hierarchies, the first male sired 63% (±29%; s.d.) of the alevins and the second male 37% (±29%); in three-male hierarchies, the first male sired 64% (±26%), the second male 24% (±20%) and the third male 12% (±10%). As previously documented, hatchery males hold inferior positions in spawning hierarchies, but we also discovered that hatchery males had only 55-84% the paternity of wild males when occupying the same position within a spawning hierarchy. This paternity difference may result from inferior performance of hatchery males during sperm competition, female mate choice for wild males, or differential offspring survival. Regardless of its cause, the combination of inferior hierarchical position and inferior success at a position resulted in hatchery males having only half (51%) the reproductive success of wild males.

  2. Índice de infestação e diversidade de moscas-das-frutas em hospedeiros exóticos e nativos no pólo de fruticultura de Anagé, BA Index of infestation and diversity of fruit-flies in exotic hosts native to the fruitculture area in Anagé, Bahia, Brazil

    Directory of Open Access Journals (Sweden)

    Ricardo Falcão de Sá

    2008-01-01

    Full Text Available As moscas-das-frutas (Diptera: Tephritidae são os principais entraves às exportações de manga nos pólos de fruticultura da Região Sudoeste da Bahia. O presente trabalho teve como objetivo estudar índices de infestação e a diversidade de moscas-das-frutas no pólo de fruticultura de Anagé, BA, visando obter subsídios para o manejo integrado dessas pragas na mangueira, na região. Os estudos foram realizados em 2004 e 2005, nos municípios de Anagé, Belo Campo e Caraíbas, BA, procedendo-se à coleta de frutos de 21 espécies vegetais, nativas e exóticas, e identificação das espécies de moscas associadas. Estimaram-se os índices de infestação em pupários/kg de fruto e pupários/fruto. Os maiores índices de infestação, em pupários/kg de fruto, ocorreram em serigüela (Spondias purpurea L. com 61,3, juá (Ziziphus joazeiro L., 38,3 e umbu (Spondias tuberosa L., 33,1, considerados hospedeiros primários de Anastrepha fraterculus (Wiedemann e A. obliqua (Macquart. As maiores infestações em pupários/fruto ocorreram em serigüela (0,9; umbu (0,7 e cajarana (Spondias sp. (0,2. Com base no monitoramento larval, registra-se, para as condições do pólo de fruticultura de Anagé, a ocorrência das espécies Anastrepha fraterculus, A. obliqua, A. dissimilis, A. amita, A. distincta, A. sororcula, A. zenildae e Ceratitis capitata. Registram-se, pela primeira vez, as seguintes associações bitróficas: juá com A. fraterculus, A. obliqua, A. dissimilis e A. distincta; e umbu com A. amita e A. sororcula.Fruit-flies (Diptera: Tephritidae are the main hindrance for mango exportation in the fruitculture areas of the Southwestern Region of Bahia. The purpose of the present work was to study the indexes of infestation and diversity of fruit-flies in the fruitculture area of Anagé, BA, in order to obtain subsidies to the integrated management of these pests in mango, in this region. Studies were carried out in 2004 and 2005 in the

  3. Biodiversidade de moscas-das-frutas (Diptera, Tephritoidea em matas nativas e pomares domésticos de dois municípios do Estado do Tocantins, Brasil Biodiversity of fruit flies (Diptera, Tephritoidea in native forests and orchards in two counties of the State of Tocantins, Brazil

    Directory of Open Access Journals (Sweden)

    Darcy A. do Bomfim

    2007-01-01

    Full Text Available Este trabalho apresenta análise faunística comparativa das espécies de moscas-das-frutas capturadas em armadilhas McPhail (junho a dezembro de 2002 com proteína hidrolisada de milho a 5%. Foram comparadas a riqueza de espécies e a estrutura populacional entre ambientes de mata e pomar dos municípios de Palmas e Porto Nacional, TO. Foram capturados 1.748 indivíduos de espécies de três gêneros de Tephritidae: Tomoplagia Coquillett, 1910, Anastrepha Schiner, 1868 e Ceratitis MacLeay, 1829. De Lonchaeidae foram capturadas espécies de três gêneros: Lonchaea Fallén, 1820, Neosilba McAlpine, 1962 e Dasiops Rondani, 1856. Ceratitis capitata (Wiedemann, 1824. Dezenove espécies de Anastrepha foram coletadas, sendo a maioria dos indivíduos (69,1% de A. obliqua (Macquart, 1835. Não houve diferença significativa (P This paper presents comparative and faunistic analysis of the species of fruit flies captured in McPhail traps (from June to December 2002 baited with 5% corn protein hydrolyzed. Species richness and the patterns of population are compared between forest and orchard environments and between the counties of Palmas and Porto Nacional. A total of 1,748 individuals of Tephritidae belonging to species of three genera were collected: Tomoplagia Coquillett, 1910, Anastrepha Schiner, 1868 and Ceratitis MacLeay, 1829. Species of three genera of Lonchaeidae were also captured: Lonchaea Fallén, 1820, Neosilba McAlpine, 1962 and Dasiops Rondani, 1856. Ceratitis capitata (Wiedemann, 1824 and nineteen species of the genus Anastrepha were collected. Most of the collected individuals (69.1% belonged to A. obliqua (Macquart, 1935. The average numbers of tephritid individuals in Palmas and native forests were significantly lower than Porto Nacional and orchards, respectively. According to the Shannon diversity index (H' and test t used for comparing the fruit flies fauna among the environments, it was verified that only one comparison showed

  4. Abundant microsatellite diversity and oil content in wild Arachis species.

    Directory of Open Access Journals (Sweden)

    Li Huang

    Full Text Available The peanut (Arachis hypogaea is an important oil crop. Breeding for high oil content is becoming increasingly important. Wild Arachis species have been reported to harbor genes for many valuable traits that may enable the improvement of cultivated Arachis hypogaea, such as resistance to pests and disease. However, only limited information is available on variation in oil content. In the present study, a collection of 72 wild Arachis accessions representing 19 species and 3 cultivated peanut accessions were genotyped using 136 genome-wide SSR markers and phenotyped for oil content over three growing seasons. The wild Arachis accessions showed abundant diversity across the 19 species. A. duranensis exhibited the highest diversity, with a Shannon-Weaver diversity index of 0.35. A total of 129 unique alleles were detected in the species studied. A. rigonii exhibited the largest number of unique alleles (75, indicating that this species is highly differentiated. AMOVA and genetic distance analyses confirmed the genetic differentiation between the wild Arachis species. The majority of SSR alleles were detected exclusively in the wild species and not in A. hypogaea, indicating that directional selection or the hitchhiking effect has played an important role in the domestication of the cultivated peanut. The 75 accessions were grouped into three clusters based on population structure and phylogenic analysis, consistent with their taxonomic sections, species and genome types. A. villosa and A. batizocoi were grouped with A. hypogaea, suggesting the close relationship between these two diploid wild species and the cultivated peanut. Considerable phenotypic variation in oil content was observed among different sections and species. Nine alleles were identified as associated with oil content based on association analysis, of these, three alleles were associated with higher oil content but were absent in the cultivated peanut. The results demonstrated that

  5. Molecular Characterization of Enterocytozoon bieneusi in Wild Carnivores in Spain.

    Science.gov (United States)

    Santín, Mónica; Calero-Bernal, Rafael; Carmena, David; Mateo, Marta; Balseiro, Ana; Barral, Marta; Lima Barbero, José Francisco; Habela, Miguel Ángel

    2017-12-12

    Microsporidia comprises a diverse group of obligate intracellular parasites that infect a broad range of invertebrates and vertebrates. Among Microsporidia, Enterocytozoon bieneusi is the most frequently detected species in humans and animals worldwide bringing into question the possible role of animal reservoirs in the epidemiology of this pathogen. Although E. bieneusi is an emerging zoonotic pathogen able to infect many domestic and wild mammals that could act as reservoir of infection for humans and other animals, only few studies have documented its occurrence in wild carnivores. To determine the occurrence of E. bieneusi in wild carnivores, we examined 190 wild carnivores collected from different locations in Spain. Twenty-five fecal samples (13.2%) from three host species (European badger, beech marten, and red fox) were E. bieneusi-positive by PCR. Nucleotide sequence analysis of the ITS region revealed a high degree of genetic diversity with a total of eight distinct genotypes including four known (PtEbIX, S5, S9, and WildBoar3) and four novel (EbCar1-EbCar4) genotypes identified. Phylogenetic analysis showed that the four novel genotypes (EbCar1-EbCar4), S5, S9, and WildBoar3 clustered within the previously designated zoonotic Group 1. Our results demonstrate that human-pathogenic genotypes are present in wild carnivores, corroborating their potential role as a source of human infection and environmental contamination. © 2017 The Author(s) Journal of Eukaryotic Microbiology © 2017 International Society of Protistologists.

  6. Novel Sources of Witchweed (Striga) Resistance from Wild Sorghum Accessions.

    Science.gov (United States)

    Mbuvi, Dorothy A; Masiga, Clet W; Kuria, Eric; Masanga, Joel; Wamalwa, Mark; Mohamed, Abdallah; Odeny, Damaris A; Hamza, Nada; Timko, Michael P; Runo, Steven

    2017-01-01

    Sorghum is a major food staple in sub-Saharan Africa (SSA), but its production is constrained by the parasitic plant Striga that attaches to the roots of many cereals crops and causes severe stunting and loss of yield. Away from cultivated farmland, wild sorghum accessions grow as weedy plants and have shown remarkable immunity to Striga. We sought to determine the extent of the resistance to Striga in wild sorghum plants. Our screening strategy involved controlled laboratory assays of rhizotrons, where we artificially infected sorghum with Striga, as well as field experiments at three sites, where we grew sorghum with a natural Striga infestation. We tested the resistance response of seven accessions of wild sorghum of the aethiopicum, drummondii, and arundinaceum races against N13, which is a cultivated Striga resistant landrace. The susceptible control was farmer-preferred variety, Ochuti. From the laboratory experiments, we found three wild sorghum accessions (WSA-1, WSE-1, and WSA-2) that had significantly higher resistance than N13. These accessions had the lowest Striga biomass and the fewest and smallest Striga attached to them. Further microscopic and histological analysis of attached Striga haustorium showed that wild sorghum accessions hindered the ingression of Striga haustorium into the host endodermis. In one of the resistant accessions (WSE-1), host and parasite interaction led to the accumulation of large amounts of secondary metabolites that formed a dark coloration at the interphase. Field experiments confirmed the laboratory screening experiments in that these same accessions were found to have resistance against Striga. In the field, wild sorghum had low Area under the Striga Number Progressive curve (AUSNPC), which measures emergence of Striga from a host over time. We concluded that wild sorghum accessions are an important reservoir for Striga resistance that could be used to expand the genetic basis of cultivated sorghum for resistance to the

  7. Collection and trade of wild-harvested orchids in Nepal.

    Science.gov (United States)

    Subedi, Abishkar; Kunwar, Bimal; Choi, Young; Dai, Yuntao; van Andel, Tinde; Chaudhary, Ram P; de Boer, Hugo J; Gravendeel, Barbara

    2013-08-31

    Wild orchids are illegally harvested and traded in Nepal for use in local traditional medicine, horticulture, and international trade. This study aims to: 1) identify the diversity of species of wild orchids in trade in Nepal; 2) study the chain of commercialization from collector to client and/or export; 3) map traditional knowledge and medicinal use of orchids; and 4) integrate the collected data to propose a more sustainable approach to orchid conservation in Nepal. Trade, species diversity, and traditional use of wild-harvested orchids were documented during field surveys of markets and through interviews. Trade volumes and approximate income were estimated based on surveys and current market prices. Orchid material samples were identified to species level using a combination of morphology and DNA barcoding. Orchid trade is a long tradition, and illegal export to China, India and Hong Kong is rife. Estimates show that 9.4 tons of wild orchids were illegally traded from the study sites during 2008/2009. A total of 60 species of wild orchids were reported to be used in traditional medicinal practices to cure at least 38 different ailments, including energizers, aphrodisiacs and treatments of burnt skin, fractured or dislocated bones, headaches, fever and wounds. DNA barcoding successfully identified orchid material to species level that remained sterile after culturing. Collection of wild orchids was found to be widespread in Nepal, but illegal trade is threatening many species in the wild. Establishment of small-scale sustainable orchid breeding enterprises could be a valuable alternative for the production of medicinal orchids for local communities. Critically endangered species should be placed on CITES Appendix I to provide extra protection to those species. DNA barcoding is an effective method for species identification and monitoring of illegal cross-border trade.

  8. Diversity and seasonality of fruit flies (Diptera: Tephritidae and Lonchaeidae and their parasitoids (Hymenoptera: Braconidae and Figitidae in orchards of guava, loquat and peach

    Directory of Open Access Journals (Sweden)

    MF. Souza-Filho

    Full Text Available This work was carried out in orchards of guava progenies, and loquat and peach cultivars, in Monte Alegre do Sul, SP, Brazil, in 2002 and 2003. Guavas and loquats were bagged and unbagged bi-weekly and weekly, respectively, for assessment of the infestation period. Peach was only bagged weekly. The assays started when the fruits were at the beginning of development, but still green. Ripe fruits were taken to the laboratory and placed individually into plastic cups. McPhail plastic traps containing torula yeast were hung from January 2002 to January 2004 to assess the fruit fly population in each orchard, but only the Ceratitis capitata population is here discussed. Five tephritid species were reared from the fruits: Anastrepha bistrigata Bezzi, A. fraterculus (Wiedemann, A. obliqua (Macquart, A. sororcula Zucchi, and C. capitata, in addition to six lonchaeid species: Neosilba certa (Walker, N. glaberrima (Wiedemann, N. pendula (Bezzi, N. zadolicha McAlpine and Steyskal, Neosilba sp. 4, and Neosilba sp. 10 (both species are in the process of being described by P. C. Strikis, as well as some unidentified Neosilba species. Ten parasitoid species were obtained from fruit fly puparia, of which five were braconids: Asobara anastrephae (Muesebeck, Doryctobracon areolatus (Szépligeti, D. brasiliensis (Szépligeti, Opius bellus Gahan, and Utetes anastrephae (Viereck, and five figitids: Aganaspis pelleranoi (Brèthes, Dicerataspis grenadensis Ashmead, Lopheucoila anastrephae (Rhower, Leptopilina boulardi (Barbotin, Carlton and Kelner-Pillaut, and Trybliographa infuscata Diaz, Gallardo and Uchôa. Ceratitis capitata showed a seasonal behavior with population density peaking at the second semester of each year. Anastrepha and Neosilba species remained in the orchards throughout both years.

  9. Diversity and seasonality of fruit flies (Diptera: Tephritidae and Lonchaeidae) and their parasitoids (Hymenoptera: Braconidae and Figitidae) in orchards of guava, loquat and peach

    Energy Technology Data Exchange (ETDEWEB)

    Souza-Filho, M.F.; Raga, A. [Instituto Biologico, Campinas, SP (Brazil)], e-mail: miguelf@biologico.sp.gov.br; Azevedo-Filho, J.A. [Agencia Paulista de Tecnologia dos Agronegocios (APTA), Monte Alegre do Sul, SP (Brazil). Polo Regional do Leste Paulista; Strikis, P.C. [Universidade Estadual de Campinas (UNICAMP), SP (Brazil). Inst. de Biologia. Dept. de Parasitologia; Guimaraes, J.A. [EMBRAPA Agroindustria Tropical, Fortaleza, CE (Brazil); Zucchi, R.A. [Escola Superior de Agricultura Luiz de Queiroz (ESALQ/USP), Piracicaba, SP (Brazil). Dept. de Entomologia, Fitopatologia e Zoologia Agricola

    2009-02-15

    This work was carried out in orchards of guava progenies, and loquat and peach cultivars, in Monte Alegre do Sul, SP, Brazil, in 2002 and 2003. Guavas and loquats were bagged and unbagged bi-weekly and weekly, respectively, for assessment of the infestation period. Peach was only bagged weekly. The assays started when the fruits were at the beginning of development, but still green. Ripe fruits were taken to the laboratory and placed individually into plastic cups. McPhail plastic traps containing torula yeast were hung from January 2002 to January 2004 to assess the fruit fly population in each orchard, but only the Ceratitis capitata population is here discussed. Five tephritid species were reared from the fruits: Anastrepha bistrigata Bezzi, A. fraterculus (Wiedemann), A. obliqua (Macquart), A. sororcula Zucchi, and C. capitata, in addition to six lonchaeid species: Neosilba certa (Walker), N. glaberrima (Wiedemann), N. pendula (Bezzi), N. zadolicha McAlpine and Steyskal, Neosilba sp. 4, and Neosilba sp. 10 (both species are in the process of being described by P. C. Strikis), as well as some unidentified Neosilba species. Ten parasitoid species were obtained from fruit fly puparia, of which five were braconids: Asobara anastrephae (Muesebeck), Doryctobracon areolatus (Szepligeti), D. brasiliensis (Szepligeti), Opius bellus Gahan, and Utetes anastrephae (Viereck), and five figitids: Aganaspis pelleranoi (Brethes), Dicerataspis grenadensis Ashmead, Lopheucoila anastrephae (Rhower), Leptopilina boulardi (Barbotin, Carlton and Kelner-Pillaut), and Trybliographa infuscata Diaz, Gallardo and Uchoa. Ceratitis capitata showed a seasonal behavior with population density peaking at the second semester of each year. Anastrepha and Neosilba species remained in the orchards throughout both years. (author)

  10. Relações interespecíficas entre parasitoides nativos de moscas-das-frutas e o braconídeo exótico Diachasmimorpha longicaudata em frutos de 'umbu-cajá' Interespecific relations between native parasitoids of fruit flies and exotic braconid Diachasmimorpha longicaudata in fruits of 'umbu-cajá'

    Directory of Open Access Journals (Sweden)

    Zuzinaide Vidal Bomfim

    2010-02-01

    Full Text Available Espécies de vespas parasitoides (Hymenoptera: Braconidae são importantes agentes de controle biológico de moscas-das-frutas (Diptera: Tephritidae. Este trabalho teve por objetivo conhecer os efeitos da liberação e as relações de competitividade interespecífica do parasitoide exótico Diachasmimorpha longicaudata Ashmead sobre o complexo de parasitoides nativos de moscas-das-frutas associado a frutos de 'umbu-cajá' (Spondias spp. na região do Recôncavo Baiano. Entre os meses de abril e julho de 2006, 8.955 frutos (192,93kg foram coletados antes e após (24 e 48 horas a liberação de 9.600 fêmeas de D. longicaudata em campo. Obteve-se um total de 8.724 pupários de Tephritidae, dos quais emergiram 3.963 adultos de Anastrepha obliqua (Macquart e 1.115 parasitoides. A maior frequência relativa foi de Doryctobracon areolatus (Szépligeti, seguida por Asobara Anastrephae (Muesebeck e Utetes Anastrephae (Viereck. Após 24 e 48 horas da liberação do parasitoide exótico D. longicaudata em campo, constatou-se que o índice de parasitismo total aumentou de 15,86 para 20,4 e 45,19%, respectivamente. Assim, observou-se que a liberação da espécie exótica D. longicaudata não apresenta efeitos negativos na ocorrência dos parasitoides nativos e contribui para complementar o controle biológico natural de A. obliqua em frutos de 'umbu-cajá', nas condições deste estudo.Wasps parasitoid species (Hymenoptera: Braconidae are fruit flies (Diptera: Tephritidae biological control important agents. This study aimed to know the effects of the release and interspecific competitive relationships of the exotic parasitoid Diachasmimorpha longicaudata Ashmead (Hymenoptera: Braconidae on the native parasitoid complex of fruit flies in Spondias spp. in the region of Recôncavo Baiano. From April to July of 2006, 8.955 fruits (192.93kg were collected before and after (24 and 48 hours release of 9.600 females of D. longicaudata. Exactly 8.724 Tephritidae

  11. Wild inside: Urban wild boar select natural, not anthropogenic food resources.

    Science.gov (United States)

    Stillfried, Milena; Gras, Pierre; Busch, Matthias; Börner, Konstantin; Kramer-Schadt, Stephanie; Ortmann, Sylvia

    2017-01-01

    Most wildlife species are urban avoiders, but some became urban utilizers and dwellers successfully living in cities. Often, they are assumed to be attracted into urban areas by easily accessible and highly energetic anthropogenic food sources. We macroscopically analysed stomachs of 247 wild boar (Sus scrofa, hereafter WB) from urban areas of Berlin and from the surrounding rural areas. From the stomach contents we determined as predictors of food quality modulus of fineness (MOF,), percentage of acid insoluble ash (AIA) and macronutrients such as amount of energy and percentage of protein, fat, fibre and starch. We run linear mixed models to test: (1) differences in the proportion of landscape variables, (2) differences of nutrients consumed in urban vs. rural WB and (3) the impact of landscape variables on gathered nutrients. We found only few cases of anthropogenic food in the qualitative macroscopic analysis. We categorized the WB into five stomach content categories but found no significant difference in the frequency of those categories between urban and rural WB. The amount of energy was higher in stomachs of urban WB than in rural WB. The analysis of landscape variables revealed that the energy of urban WB increased with increasing percentage of sealing, while an increased human density resulted in poor food quality for urban and rural WB. Although the percentage of protein decreased in areas with a high percentage of coniferous forests, the food quality increased. High percentage of grassland decreased the percentage of consumed fat and starch and increased the percentage of fibre, while a high percentage of agricultural areas increased the percentage of consumed starch. Anthropogenic food such as garbage might serve as fallback food when access to natural resources is limited. We infer that urban WB forage abundant, natural resources in urban areas. Urban WB might use anthropogenic resources (e.g. garbage) if those are easier to exploit and more abundant

  12. Wild inside: Urban wild boar select natural, not anthropogenic food resources.

    Directory of Open Access Journals (Sweden)

    Milena Stillfried

    Full Text Available Most wildlife species are urban avoiders, but some became urban utilizers and dwellers successfully living in cities. Often, they are assumed to be attracted into urban areas by easily accessible and highly energetic anthropogenic food sources. We macroscopically analysed stomachs of 247 wild boar (Sus scrofa, hereafter WB from urban areas of Berlin and from the surrounding rural areas. From the stomach contents we determined as predictors of food quality modulus of fineness (MOF,, percentage of acid insoluble ash (AIA and macronutrients such as amount of energy and percentage of protein, fat, fibre and starch. We run linear mixed models to test: (1 differences in the proportion of landscape variables, (2 differences of nutrients consumed in urban vs. rural WB and (3 the impact of landscape variables on gathered nutrients. We found only few cases of anthropogenic food in the qualitative macroscopic analysis. We categorized the WB into five stomach content categories but found no significant difference in the frequency of those categories between urban and rural WB. The amount of energy was higher in stomachs of urban WB than in rural WB. The analysis of landscape variables revealed that the energy of urban WB increased with increasing percentage of sealing, while an increased human density resulted in poor food quality for urban and rural WB. Although the percentage of protein decreased in areas with a high percentage of coniferous forests, the food quality increased. High percentage of grassland decreased the percentage of consumed fat and starch and increased the percentage of fibre, while a high percentage of agricultural areas increased the percentage of consumed starch. Anthropogenic food such as garbage might serve as fallback food when access to natural resources is limited. We infer that urban WB forage abundant, natural resources in urban areas. Urban WB might use anthropogenic resources (e.g. garbage if those are easier to exploit and

  13. Mangifera sylvatica (Wild Mango): A new cocoa butter alternative

    Science.gov (United States)

    Akhter, Sayma; McDonald, Morag A.; Marriott, Ray

    2016-01-01

    Cocoa butter is the pure butter extracted from cocoa beans and is a major ingredient in the chocolate industry. Global production of cocoa is in decline due to crop failure, diseases and ageing plantations, leading to price fluctuations and the necessity for the industry to find high quality cocoa butter alternatives. This study explored the potential of a wild mango (Mangifera sylvatica), an underutilised fruit in south-east Asia, as a new Cocoa Butter Alternative (CBA). Analyses showed that wild mango butter has a light coloured fat with a similar fatty acid profile (palmitic, stearic and oleic acid) and triglyceride profile (POP, SOS and POS) to cocoa butter. Thermal and physical properties are also similar to cocoa butter. Additionally, wild mango butter comprises 65% SOS (1, 3-distearoyl-2-oleoyl-glycerol) which indicates potential to become a Cocoa Butter Improver (an enhancement of CBA). It is concluded that these attractive properties of wild mango could be prompted by a coalition of policy makers, foresters, food industries and horticulturists to promote more widespread cultivation of this wild fruit species to realise the market opportunity. PMID:27555345

  14. Genetic variation in domestic reindeer and wild caribou in Alaska

    Science.gov (United States)

    Cronin, M.; Renecker, L.; Pierson, Barbara J.; Patton, J.C.

    1995-01-01

    Reindeer were introduced into Alaska 100 years ago and have been maintained as semidomestic livestock. They have had contact with wild caribou herds, including deliberate cross-breeding and mixing in the wild. Reindeer have considerable potential as a domestic animal for meat or velvet antler production, and wild caribou are important to subsistence and sport hunters. Our objective was to quantify the genetic relationships of reindeer and caribou in Alaska. We identified allelic variation among five herds of wild caribou and three herds of reindeer with DNA sequencing and restriction enzymes for three loci: a DQA locus of the major histocompatibility complex (Rata-DQA1), k-casein and the D-loop of mitochondrial DNA. These loci are of interest because of their potential influence on domestic animal performance and the fitness of wild populations. There is considerable genetic variation in reindeer and caribou for all three loci, including five, three and six alleles for DQA, k-casein and D-loop respectively. Most alleles occur in both reindeer and caribou, which may be the result of recent common ancestry or genetic introgression in either direction. However, allele frequencies differ considerably between reindeer and caribou, which suggests that gene flow has been limited.

  15. Anaplasmataceae agents among wild mammals and ectoparasites in Brazil.

    Science.gov (United States)

    DE Sousa, K C M; Calchi, A C; Herrera, H M; Dumler, J S; Barros-Battesti, D M; Machado, R Z; André, M R

    2017-11-06

    Anaplasmataceae agents comprise obligate intracellular bacteria that can cause disease in humans and animals. Between August 2013 and March 2015, 31 Nasua nasua (coati), 78 Cerdocyon thous (crab-eating fox), seven Leopardus pardalis (ocelot), 110 wild rodents, 30 marsupials, and 42 dogs were sampled in the Pantanal wetland, Brazil. In addition, ectoparasites found parasitizing the animals were collected and identified. The present work aimed to investigate the occurrence of Anaplasmataceae agents in wild mammals, domestic dogs and ectoparasites, by molecular and serological techniques. Overall, 14 (17·9%) C. thous, seven (16·6%) dogs and one (3·2%) N. nasua were seroreactive to Ehrlichia canis. Nine dogs, two C. thous, one N. nasua, eight wild rodents, five marsupials, eight Amblyomma sculptum, four Amblyomma parvum, 13 A. sculptum nymphal pools, two Amblyomma larvae pools and one Polygenis (Polygenis) bohlsi bohlsi flea pool were positive for Ehrlichia spp. closely related to E. canis. Seven N. nasua, two dogs, one C. thous, one L. pardalis, four wild rodents, three marsupials, 15 A. sculptum, two Amblyomma ovale, two A. parvum and one Amblyomma spp. larval pools were positive for Anaplasma spp. closely related to A. phagocytophilum or A. bovis. The present study provided evidence that wild animals from Brazilian Pantanal are exposed to Anaplasmataceae agents.

  16. Genome diversity in wild grasses under environmental stress

    Science.gov (United States)

    Fitzgerald, Timothy L.; Shapter, Frances M.; McDonald, Stuart; Waters, Daniel L. E.; Chivers, Ian H.; Drenth, Andre; Nevo, Eviatar; Henry, Robert J.

    2011-01-01

    Patterns of diversity distribution in the Isa defense locus in wild-barley populations suggest adaptive selection at this locus. The extent to which environmental selection may act at additional nuclear-encoded defense loci and within the whole chloroplast genome has now been examined by analyses in two grass species. Analysis of genetic diversity in wild barley (Hordeum spontaneum) defense genes revealed much greater variation in biotic stress-related genes than abiotic stress-related genes. Genetic diversity at the Isa defense locus in wild populations of weeping ricegrass [Microlaena stipoides (Labill.) R. Br.], a very distant wild-rice relative, was more diverse in samples from relatively hotter and drier environments, a phenomenon that reflects observations in wild barley populations. Whole-chloroplast genome sequences of bulked weeping ricegrass individuals sourced from contrasting environments showed higher levels of diversity in the drier environment in both coding and noncoding portions of the genome. Increased genetic diversity may be important in allowing plant populations to adapt to greater environmental variation in warmer and drier climatic conditions. PMID:22173638

  17. Natural infection by endoparasites among free-living wild animals.

    Science.gov (United States)

    Holsback, Luciane; Cardoso, Mauro José Lahm; Fagnani, Rafael; Patelli, Thaís Helena Constantino

    2013-01-01

    The objective of this study was to investigate the frequency of occurrence and variety of intestinal parasites among free-living wild animals. Fecal samples from wild mammals and birds at rehabilitation centers in the states of Mato Grosso do Sul and São Paulo were analyzed by sedimentation and flotation-centrifugation methods. Parasite eggs, oocysts, cysts and/or trophozoites were found in 71% of the samples. Cryptosporidium sp. oocysts were detected in fecal samples from oncillas (Leopardus tigrinus) and scaly-headed parrots (Pionus maximiliani). Giardia cysts were identified in the feces of a gray brocket (Mazama gouazoubira). Among the most common parasites found, there were eggs from Toxocara cati, Toxascaris leonina and Ancylostoma tubaeforme, and from Cestoda. Several Enterobius sp. eggs were found in the feces of red howler monkeys (Alouatta seniculus). It can be concluded from this study that despite the small number of samples, the diversity of parasites found was noteworthy. Additional information about parasite endofauna in wild animals is needed, since their presence might suggest that there could be proximity to and interactions with domestic animals and/or humans. In addition, further studies on parasites from free-living wild animals are of prime importance for understanding the intensity of anthropic changes in wild environments.

  18. Ethnobotanical review of wild edible plants of Slovakia

    Directory of Open Access Journals (Sweden)

    Łukasz Łuczaj

    2012-11-01

    Full Text Available This paper is an ethnobotanical review of wild edible plants gathered for consumption from the 19th century to the present day, within the present borders of Slovakia. Twenty-four sources (mainly ethnographic documenting the culinary use of wild plants were analysed. The use of 106 species (over 3% of the Slovak flora has been recorded. Nowadays most of them are no longer used, or used rarely, apart from a few species of wild fruits. The most frequently used plants include the fruits of Rubus idaeus, Fragaria spp., Rubus subgenus Rubus, Vaccinium myrtillus, V. vitis-idaea, Fagus sylvatica, Corylus avellana, Prunus spinosa, Pyrus spp., Malus spp., Crataegus spp. and the leaves of Urtica dioica, Rumex acetosa, Chenopodiaceae species, Cardamine amara, Glechoma spp., Taraxacum spp. and Oxalis acetosella. The most commonly used wild food taxa are nearly identical to those used in Poland, and the same negative association of wild vegetables with famine exists in Slovakia, resulting in their near complete disappearance from the present-day diet.

  19. Emerging fungal pathogen Ophidiomyces ophiodiicola in wild European snakes

    Science.gov (United States)

    Franklinos, Lydia H. V.; Lorch, Jeffrey M.; Bohuski, Elizabeth A.; Rodriguez-Ramos Fernandez, Julia; Wright, Owen; Fitzpatrick, Liam; Petrovan, Silviu; Durrant, Chris; Linton, Chris; Baláž, Vojtech; Cunningham, Andrew A; Lawson, Becki

    2017-01-01

    Snake fungal disease (SFD) is an emerging disease of conservation concern in eastern North America. Ophidiomyces ophiodiicola, the causative agent of SFD, has been isolated from over 30 species of wild snakes from six families in North America. Whilst O. ophiodiicola has been isolated from captive snakes outside North America, the pathogen has not been reported from wild snakes elsewhere. We screened 33 carcasses and 303 moulted skins from wild snakes collected from 2010–2016 in Great Britain and the Czech Republic for the presence of macroscopic skin lesions and O. ophiodiicola. The fungus was detected using real-time PCR in 26 (8.6%) specimens across the period of collection. Follow up culture and histopathologic analyses confirmed that both O. ophiodiicola and SFD occur in wild European snakes. Although skin lesions were mild in most cases, in some snakes they were severe and were considered likely to have contributed to mortality. Culture characterisations demonstrated that European isolates grew more slowly than those from the United States, and phylogenetic analyses indicated that isolates from European wild snakes reside in a clade distinct from the North American isolates examined. These genetic and phenotypic differences indicate that the European isolates represent novel strains of O. ophiodiicola. Further work is required to understand the individual and population level impact of this pathogen in Europe.

  20. Mangifera sylvatica (Wild Mango): A new cocoa butter alternative

    Science.gov (United States)

    Akhter, Sayma; McDonald, Morag A.; Marriott, Ray

    2016-08-01

    Cocoa butter is the pure butter extracted from cocoa beans and is a major ingredient in the chocolate industry. Global production of cocoa is in decline due to crop failure, diseases and ageing plantations, leading to price fluctuations and the necessity for the industry to find high quality cocoa butter alternatives. This study explored the potential of a wild mango (Mangifera sylvatica), an underutilised fruit in south-east Asia, as a new Cocoa Butter Alternative (CBA). Analyses showed that wild mango butter has a light coloured fat with a similar fatty acid profile (palmitic, stearic and oleic acid) and triglyceride profile (POP, SOS and POS) to cocoa butter. Thermal and physical properties are also similar to cocoa butter. Additionally, wild mango butter comprises 65% SOS (1, 3-distearoyl-2-oleoyl-glycerol) which indicates potential to become a Cocoa Butter Improver (an enhancement of CBA). It is concluded that these attractive properties of wild mango could be prompted by a coalition of policy makers, foresters, food industries and horticulturists to promote more widespread cultivation of this wild fruit species to realise the market opportunity.

  1. How much does it cost to look like a pig in a wild boar group?

    DEFF Research Database (Denmark)

    Batocchio, Daniele; Iacolina, Laura; Canu, Antonio

    2017-01-01

    carried out acamera trap study to assess whether phenotypically anomalous colouration in wild boar, i.e. potentiallyintrogressed with domestic pigs, affected the hierarchical structure of wild boar social groups. Chromat-ically anomalous wild boars (CAWs) were detected in 32 out of 531 wild boar videos...

  2. Lack of polymorphism at MC1R wild-type allele and evidence of domestic allele introgression across European wild boar populations

    DEFF Research Database (Denmark)

    Canu, Antonio; Vilaça, Sibelle T.; Iacolina, Laura

    2016-01-01

    Domestication promotes the emergence of novel phenotypic and behavioural traits in domesticated animals compared to their wild ancestors. We analysed variation at the melanocortin receptor I (MC1R) and nuclear receptor subfamily 6, group A, member 1 (NR6A1) genes in European wild boar populations...... of hybridization between wild and domestic forms. Most of the wild boars (94%) were homozygous for the European wild-type (E+) MC1R allele. We did not observe any synonymous substitution in the European E+ allele, confirming its monomorphism even in areas known to be hotspots of wild boar genetic diversity....... The remaining wild boars (6%) showed genetic introgression of three different European domestic alleles. No Asian MC1R allele was found in our sample. Furthermore, domestic NR6A1 alleles were observed in 6% of wild boars. Considering jointly the two loci analyzed, 11% of boars, sampled all over Europe, showed...

  3. [Wild animals and law and ethics in France].

    Science.gov (United States)

    Nouët, Jean-Claude

    2013-01-01

    Legal systems applying to wild animals are very different depending on whether the animals are in captivity or under human control, or whether they are in the wild. Animals in captivity, like domesticated animals, are covered by protective measures for the welfare of the individual animal, but wild animals are not considered as individuals but only as members of a species, their numbers being controlled by humans and determined by human interests. In the light of contemporary scientific knowledge, such legal approaches are now inappropriate and can no longer be accepted for ethical reasons. The legal systems need to develop and must include a definition of the animal as an individual and as a sentient being.

  4. First TBEV serological screening in Flemish wild boar

    Directory of Open Access Journals (Sweden)

    Sophie Roelandt

    2016-04-01

    Full Text Available In the frame of a Flemish wildlife surveillance in 2013, a serological screening was performed on sera from wild boar (Sus scrofa; n=238 in order to detect tick-borne encephalitis virus (TBEV-specific antibodies. Neutralising antibodies were titrated with a seroneutralisation test (SNT, using two cut-off titres (1/10–1/15. Seven wild boars were found TBEV-seropositive and showed moderate (>1/15 to high (>1/125 SNT-titres; three individuals had borderline results (1/10–1/15. This study demonstrated the presence of TBEV-specific antibodies in wild boar and highlighted potential TBEV-foci in Flanders. Additional surveillance including direct virus testing is now recommended.

  5. First TBEV serological screening in Flemish wild boar

    Science.gov (United States)

    Roelandt, Sophie; Suin, Vanessa; Van der Stede, Yves; Lamoral, Sophie; Marche, Sylvie; Tignon, Marylène; Saiz, Juan Carlos; Escribano-Romero, Estela; Casaer, Jim; Brochier, Bernard; Van Gucht, Steven; Roels, Stefan; Vervaeke, Muriel

    2016-01-01

    In the frame of a Flemish wildlife surveillance in 2013, a serological screening was performed on sera from wild boar (Sus scrofa; n=238) in order to detect tick-borne encephalitis virus (TBEV)-specific antibodies. Neutralising antibodies were titrated with a seroneutralisation test (SNT), using two cut-off titres (1/10–1/15). Seven wild boars were found TBEV-seropositive and showed moderate (>1/15) to high (>1/125) SNT-titres; three individuals had borderline results (1/10–1/15). This study demonstrated the presence of TBEV-specific antibodies in wild boar and highlighted potential TBEV-foci in Flanders. Additional surveillance including direct virus testing is now recommended. PMID:27087689

  6. Antioxidant capacity and mineral contents of edible wild Australian mushrooms.

    Science.gov (United States)

    Zeng, X; Suwandi, J; Fuller, J; Doronila, A; Ng, K

    2012-08-01

    Five selected edible wild Australian mushrooms, Morchella elata, Suillus luteus, Pleurotus eryngii, Cyttaria gunnii, and Flammulina velutipes, were evaluated for their antioxidant capacity and mineral contents. The antioxidant capacities of the methanolic extracts of the dried caps of the mushrooms were determined using a number of different chemical reactions in evaluating multi-mechanistic antioxidant activities. These included the Trolox equivalent antioxidant capacity, ferric ion reducing antioxidant power, and ferrous ion chelating activity. Mineral contents of the dried caps of the mushrooms were also determined by inductively coupled plasma-optical emission spectroscopy. The results indicated that these edible wild mushrooms have a high antioxidant capacity and all, except C. gunnii, have a high level of several essential micro-nutrients such as copper, magnesium, and zinc. It can be concluded that these edible wild mushrooms are good sources of nutritional antioxidants and a number of mineral elements.

  7. Consumer perception versus scientific evidence of farmed and wild fish

    DEFF Research Database (Denmark)

    Verbeke, Wim; Sioen, Isabelle; Brunsø, Karen

    2007-01-01

    The increasing number of marketable fish being supplied from aquaculture is a response to the increasing demand for healthy food and is filling the gap left by depleting natural fish stocks. Little is known about the awareness and perception of the consumer in terms of farmed fish versus fish from...... capture fisheries. The consumer's subjective point of view is of overriding importance for the production system and product acceptance as well as for future market success. In this paper consumer perception in Belgium is explored and compared against scientific evidence of farmed versus wild fish....... Primary data were collected through a consumer survey (April 2003) and focus group discussions (May 2004) with Belgian consumers. The majority of the consumer sample reported no perceived differences between farmed versus wild fish. However, mean perception scores were slightly in favour of wild fish...

  8. Natural Parasitism in Fruit Fly (Diptera: Tephritidae) Populations in Disturbed Areas Adjacent to Commercial Mango Orchards in Chiapas and Veracruz, Mexico.

    Science.gov (United States)

    Montoya, Pablo; Ayala, Amanda; López, Patricia; Cancino, Jorge; Cabrera, Héctor; Cruz, Jassmin; Martinez, Ana Mabel; Figueroa, Isaac; Liedo, Pablo

    2016-04-01

    To determine the natural parasitism in fruit fly populations in disturbed areas adjacent to commercial mango orchards in the states of Chiapas and Veracruz, Mexico, we recorded over one year the fruit fly-host associations, fly infestation, and parasitism rates in backyard orchards and patches of native vegetation. We also investigated the relationship between fruit size, level of larval infestation, and percent of parasitism, and attempted to determine the presence of superparasitism. The most recurrent species in trap catches was Anastrepha obliqua (Macquart), followed by Anastrepha ludens (Loew), in both study zones. The fruit infestation rates were higher in Chiapas than in Veracruz, with A. obliqua again being the most conspicuous species emerging from collected fruits. The diversity of parasitoids species attacking fruit fly larvae was greater in Chiapas, with a predominance of Doryctobracon areolatus (Szépligeti) in both sites, although the exotic Diachasmimorpha longicaudata (Ashmead) was well established in Chiapas. Fruit size was positively correlated with the number of larvae per fruit, but this relationship was not observed in the level of parasitism. The number of oviposition scars was not related to the number of immature parasitoids inside the pupa of D. areolatus emerging from plum fruits. Mass releases of Di. longicaudata seem not to affect the presence or prevalence of the native species. Our findings open new research scenarios on the role and impact of native parasitoid species attacking Anastrepha flies that can contribute to the development of sound strategies for using these species in projects for augmentative biological control. © The Authors 2016. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  9. WildSense: Monitoring Interactions among Wild Deer in Harsh Outdoor Environments Using a Delay-Tolerant WSN

    Directory of Open Access Journals (Sweden)

    Junho Ahn

    2016-01-01

    Full Text Available Biologists and ecologists often monitor the spread of disease among deer in the wild by using tracking systems that record their movement patterns, locations, and interaction behavior. The existing commercial systems for monitoring wild deer utilize collars with GPS sensors, deployed on captured and rereleased deer. The GPS sensors record location data every few hours, enabling researchers to approximate the interaction behavior of tracked deer with their GPS locations. However, the coarse granularity of periodically recorded GPS location data provides only limited precision for determining deer interaction behavior. We have designed a novel system to monitor wild deer interaction behavior more precisely in harsh wilderness environments. Our system combines the functionalities of both GPS and RF-radio sensors with low-cost and minimal-resource motes. We designed and built our system to be able to operate robustly for a period of up to several months for continual tracking and monitoring of the locations and interaction behaviors of wild deer in harsh environments. We successfully deployed six deer collars on six wild deer that were captured and rereleased in the Soapstone Prairie Natural Area of northern Colorado over a one-month period. In this paper, we describe how we designed and built this system and evaluate its successful operation in a wilderness area.

  10. Designing Autonomy: Opportunities for New Wildness in the Anthropocene.

    Science.gov (United States)

    Cantrell, Bradley; Martin, Laura J; Ellis, Erle C

    2017-03-01

    Maintaining wild places increasingly involves intensive human interventions. Several recent projects use semi-automated mediating technologies to enact conservation and restoration actions, including re-seeding and invasive species eradication. Could a deep-learning system sustain the autonomy of nonhuman ecological processes at designated sites without direct human interventions? We explore here the prospects for automated curation of wild places, as well as the technical and ethical questions that such co-creation poses for ecologists, conservationists, and designers. Our goal is to foster innovative approaches to creating and maintaining the autonomy of evolving ecological systems. Copyright © 2016 Elsevier Ltd. All rights reserved.

  11. Intestinal protozoa in wild boars (Sus scrofa) in western Iran.

    Science.gov (United States)

    Solaymani-Mohammadi, S; Rezaian, M; Hooshyar, H; Mowlavi, G R; Babaei, Z; Anwar, M A

    2004-10-01

    A total of 12 gastrointestinal tracts of wild boars (Sus scrofa) from western Iran (Luristan) were examined for protozoan infection between September 2000 and November 2001. Of 12 boars examined, 67% harbored one or more species of the following protozoa: Balantidium coli (25%), Tritrichomonas suis (25%), Blastocystis sp. (25%), Entamoeba polecki (17%), Entamoeba suis (8%), Iodamoeba butschlii (17%), and Chilomastix mesnili (8%). Four of these protozoan species also are reported in humans, and persons living in rural areas where wild boars are abundant should take precaution to avoid infection.

  12. WILD PIGS: BIOLOGY, DAMAGE, CONTROL TECHINQUES AND MANAGEMENT

    Energy Technology Data Exchange (ETDEWEB)

    Mayer, John; Brisbin, I. Lehr

    2009-12-31

    The existence of problems with wild pigs (Sus scrofa) is nothing new to the Western Hemisphere. Damage by these introduced animals was reported as far back as 1505 by the early Spanish colonies in the Caribbean, where wild pigs were killing the colonists cattle. Droves of these animals also ravaged cultivated crops of maize and sugarcane on islands in the West Indies during this same time period. These wild pigs reportedly were very aggressive and often attacked Spanish soldiers hunting rebellious Indians or escaped slaves on these islands, especially when these animals were cornered. The documentation of such impacts by introduced populations of this species in the United States has subsequently increased in recent years, and continued up through the present (Towne and Wentworth. 1950, Wood and Barrett 1979, Mayer and Brisbin 1991, Dickson et al. 2001). In spite of a fairly constant history in this country since the early 1900s, wild pigs have had a dramatic recent increase in both distribution and numbers in the United States. Between 1989 and 2009, the number of states reporting the presence of introduced wild pigs went from 19 up to as many as 44. This increase, in part natural, but largely manmade, has caused an increased workload and cost for land and resource managers in areas where these new populations are found. This is the direct result of the damage that these introduced animals do. The cost of both these impacts and control efforts has been estimated to exceed a billion dollars annually (Pimentel 2007). The complexity of this problem has been further complicated by the widespread appeal and economic potential of these animals as a big game species (Tisdell 1982, Degner 1989). Wild pigs are a controversial problem that is not going away and will likely only get worse with time. Not only do they cause damage, but wild pigs are also survivors. They reproduce at a rate faster than any other mammal of comparable size, native or introduced; they can eat just

  13. Nootropic activity of extracts from wild and cultivated Alfredia cernua.

    Science.gov (United States)

    Mustafin, R N; Shilova, I V; Suslov, N I; Kuvacheva, N V; Amelchenko, V P

    2011-01-01

    Antihypoxic and nootropic activities of extracts from aerial parts of wild and cultivated Alfredia cernua (L.) Cass. were studied on the models of pressure chamber hypoxia, open field test, and passive avoidance conditioning. The extracts of Alfredia cernua promoted retention of the orientation reflex and passive avoidance conditioned response and normalized orientation and exploratory activities disordered as a result of hypoxic injury. The efficiency of the extracts was superior to that of piracetam by the effect on retention of passive avoidance response throughout the greater part of the experiment. Nootropic activity of cultivated Alfredia cernua was not inferior to that of the wild plant.

  14. Abalone farm discharges the withering syndrome pathogen into the wild

    Science.gov (United States)

    Lafferty, Kevin D.; Ben-Horin, Tal

    2014-01-01

    An intracellular bacterium Candidatus Xenohaliotis californiensis, also called Withering-Syndrome Rickettsia-Like Organism (WS-RLO), is the cause of mass mortalities that are the chief reason for endangerment of black abalone (Haliotis cracherodii). Using a real-time PCR assay, we found that a shore-based abalone farm (AF) in Santa Barbara, CA, USA discharged WS-RLO DNA into the ocean. Several other shore-based AFs discharge effluent into critical habitat for black abalone in California and this might affect the recovery of wild black abalone. Existing regulatory frameworks exist that could help protect wild species from pathogens released from shore-based aquaculture.

  15. NUTRITIONAL AND ANTINUTRITIONAL EVALUATION OF WILD YAM (Dioscorea spp.

    Directory of Open Access Journals (Sweden)

    Veerabahu Ramasamy Mohan

    2011-05-01

    The wild yam tubers consumed by the tribes Kanikkars / Palliyars of South- Eastern slopes of Western Ghats, Tamil Nadu (Dioscorea alata, D. bulbifera var vera, D. esculenta, D. oppositifolia var dukhumensis, D.oppositifolia var. oppositifolia, D. pentaphylla var. pentaphylla, D. spicata, D. tomentosa and D. wallichi were evaluated for its nutritional quality. From the present investigation, it is observed that most of the wild edible yams were found to be a good source of protein, lipid, crude fibre, starch, vitamins and minerals. Antinutritional substances like total free phenolics, tannins, hydrogen cyanide, total oxalate, amylase and trypsin inhibitor activities were quantified. Â

  16. Characterisation of phenolic compounds in wild fruits from Northeastern Portugal

    OpenAIRE

    Guimarães, Rafaela; Barros, Lillian; Dueñas, Montserrat; Carvalho, Ana Maria de; Queiroz, Maria João R. P.; Santos-Buelga, Celestino; Isabel C.F.R. Ferreira

    2013-01-01

    This study aimed to analyse the phenolic composition of wild fruits of Arbutus unedo (strawberry-tree), Prunus spinosa (blackthorn), Rosa canina and Rosa micrantha (wild roses). Analyses were performed by HPLC-DAD-ESI/MS. Prunus spinosa fruits presented the highest concentration in phenolic acids (29.78 mg/100 g dry weight), being 3-O-caffeoylquinic acid the most abundant one, and flavone/ols (57.48 mg/100 g), among which quercetin3-O-rutinoside (15.63 mg/100 g) was the majority compound. (+)...

  17. Gene flow and genetic diversity in cultivated and wild cacao (Theobroma cacao) in Bolivia.

    Science.gov (United States)

    Chumacero de Schawe, Claudia; Durka, Walter; Tscharntke, Teja; Hensen, Isabell; Kessler, Michael

    2013-11-01

    The role of pollen flow within and between cultivated and wild tropical crop species is little known. To study the pollen flow of cacao, we estimated the degree of self-pollination and pollen dispersal distances as well as gene flow between wild and cultivated cacao (Theobroma cacao L.). We studied pollen flow and genetic diversity of cultivated and wild cacao populations by genotyping 143 wild and 86 cultivated mature plants and 374 seedlings raised from 19 wild and 25 cultivated trees at nine microsatellite loci. A principal component analysis distinguished wild and cultivated cacao trees, supporting the notion that Bolivia harbors truly wild cacao populations. Cultivated cacao had a higher level of genetic diversity than wild cacao, presumably reflecting the varied origin of cultivated plants. Both cacao types had high outcrossing rates, but the paternity analysis revealed 7-14% self-pollination in wild and cultivated cacao. Despite the tiny size of the pollinators, pollen was transported distances up to 3 km; wild cacao showed longer distances (mean = 922 m) than cultivated cacao (826 m). Our data revealed that 16-20% of pollination events occurred between cultivated and wild populations. We found evidence of self-pollination in both wild and cultivated cacao. Pollination distances are larger than those typically reported in tropical understory tree species. The relatively high pollen exchange from cultivated to wild cacao compromises genetic identity of wild populations, calling for the protection of extensive natural forest tracts to protect wild cacao in Bolivia.

  18. Wild dreams in Physics at the end of the millennium

    DEFF Research Database (Denmark)

    Bohr, Henrik; Nielsen, H.B.

    1999-01-01

    The main text is supposed to be very introductory and the wild theory chapters to be explained for lay-men with many pedagogical figures but with all the mathematical eqautions relegated to appendices, each corresponding to a particular chapter. In that way we make the main text available for a v...

  19. Ecto and Gastrointestinal Parasites of Captured Wild Pigeons in ...

    African Journals Online (AJOL)

    This study was conducted to assess the prevalence of ecto and gastrointestinal parasites of captured wild pigeons in Benin - City, Nigeria. Fifty-six adult pigeons (Columba livia) comprising of thirty-one males and twenty-five females were examined. Gastrointestinal helminth parasites were found in 33 (58.9%) of the ...

  20. Digestive morphophysiology of the giraffe and other wild ruminants

    DEFF Research Database (Denmark)

    Sauer, Cathrine

    exception was the relatively smaller parotid salivary glands found in giraffes compared to other ‘moose-type’ ruminants. Differences in rumen papillation pattern and fecal particle size between wild and captive giraffes indicate that adjustments should be made to the captive feeding programs. A feeding...

  1. 50 CFR 12.34 - Return to the wild.

    Science.gov (United States)

    2010-10-01

    ... 50 Wildlife and Fisheries 1 2010-10-01 2010-10-01 false Return to the wild. 12.34 Section 12.34 Wildlife and Fisheries UNITED STATES FISH AND WILDLIFE SERVICE, DEPARTMENT OF THE INTERIOR TAKING... with the permission of the landowner. (c) Any live member of an exotic species of wildlife (including...

  2. Saraca asoca (Roxb.) de Wilde Syn. Saraca indica L. (English ...

    Indian Academy of Sciences (India)

    Saraca asoca (Roxb.) de Wilde Syn. Saraca indica L. (English: Ashoka; Hindi: Asok) ofCaesalpilliaceae is a medium sized extremely ornamental evergreen tree with numerous spreading and drooping branches, compound leaves and orange-yellow flowers in clusters. Fruits are black, leathery pods with compressed seeds.

  3. Strong reciprocity is not uncommon in the "wild".

    Science.gov (United States)

    Runciman, W G

    2012-02-01

    Guala is right to draw attention to the difficulty of extrapolating from the experimental evidence for weak or strong reciprocity to what is observed in the "wild." However, there may be more strong reciprocity in real-world communities than he allows for, as strikingly illustrated in the example of the Mafia.

  4. Genetic diversity of intensive cultured and wild tiger shrimp Penaeus ...

    African Journals Online (AJOL)

    Mahdi

    2011-02-25

    Feb 25, 2011 ... Brood stock showed lower genetic diversity value than wild population. However, with an observed heterozygosity (Hobs) below expectations it would be necessary to introduce cross breeding among hatcheries to reduce the risk of inbreeding depression. Microsatellite markers analysis was able to ...

  5. Distemper outbreak and its effect on African wild dog conservation.

    NARCIS (Netherlands)

    M.W.G. van de Bildt (Marco); T. Kuiken (Thijs); A.M. Visee; S. Lema; A.R. Fitzjohn; A.D.M.E. Osterhaus (Albert)

    2002-01-01

    textabstractIn December 2000, an infectious disease spread through a captive breeding group of African wild dogs (Lycaon pictus) in Tanzania, killing 49 of 52 animals within 2 months. The causative agent was identified as Canine distemper virus (CDV) by means of histologic examination, virus

  6. African wild dogs test the 'survival of the fittest' paradigm.

    Science.gov (United States)

    Pole, Alistair; Gordon, Iain J; Gorman, Martyn L

    2003-08-07

    Charles Darwin first used the term 'survival of the fittest' in the 5th edition of The origin of species. A literal interpretation implies that predators will selectively prey upon the weakest members of a population. We demonstrate that this is true for African wild dogs hunting impala.

  7. Wind-Wildlife Impacts Literature Database (WILD)(Fact Sheet)

    Energy Technology Data Exchange (ETDEWEB)

    2015-01-01

    The Wind-Wildlife Impacts Literature Database (WILD), developed and maintained by the National Wind Technology Center (NWTC) at the National Renewable Energy Laboratory (NREL), is comprised of over 1,000 citations pertaining to the effects of land-based wind, offshore wind, marine and hydrokinetic, power lines, and communication and television towers on wildlife.

  8. Antioxidant characterization of some Sicilian edible wild greens.

    Science.gov (United States)

    Salvatore, Sara; Pellegrini, Nicoletta; Brenna, Oreste V; Del Rio, Daniele; Frasca, Graziella; Brighenti, Furio; Tumino, Rosario

    2005-11-30

    Epidemiological studies have demonstrated that many antioxidants and the total antioxidant capacity (TAC) of the diet may protect against cancers and cardiovascular disease. Common fruits and vegetables are good sources of antioxidants, although in some Mediterranean areas traditional wild greens are responsible for a significant percentage of total dietary antioxidant intake. In the European Prospective Investigation into Cancer and Nutrition cohort of Ragusa (Sicily), a high number of subjects were found to frequently eat wild greens, including Sinapis incana and Sinapis nigra, Diplotaxis erucoides, Cichorium intybus, Asparagus acutifolius, and Borrago officinalis. On the basis of these observations, detailed characterization of single antioxidant components (i.e., polyphenols, carotenoids, chlorophylls, and ascorbic acid) and the TAC of these edible wild traditional plants was performed. The wild plants examined were found to be very rich in antioxidants, such as flavonoids and carotenoids, with high TAC values, suggesting that the importance of these vegetables, not only in the traditional but even in the contemporary diet, needs to be emphasized.

  9. Wild Justice: Honor and Fairness among Beasts at Play

    Science.gov (United States)

    Bekoff, Marc; Pierce, Jessica

    2009-01-01

    This essay challenges science's traditional taboo against anthropomorphizing animals or considering their behavior as indicative of feelings similar to human emotions. In their new book "Wild Justice: The Moral Lives of Animals," the authors argue that anthropomorphism is alive and well, as it should be. Here they describe some…

  10. Observations of terrestrial locomotion in wild Polypterus senegalus ...

    African Journals Online (AJOL)

    Polypterids, the most basal actinopterygians, are a group of fish long-considered living fossils and holding a key position for understanding fish and tetrapod evolution. Knowledge of the natural history of Polypterus is limited, their having been studied in little detail since the early 1900s. The locomotory habits of wild ...

  11. Helminths of Wild Predatory Mammals (Mammalia, Carnivora of Ukraine. Trematodes

    Directory of Open Access Journals (Sweden)

    Korol E. N.

    2016-08-01

    Full Text Available The paper summarises information on 11 species of trematodes parasitic in 9 species of wild carnivorans of Ukraine. The largest number of trematode species (9 was found in the red fox (Vulpes vulpes. Alaria alata (Diplostomidae appeared to be the most common trematode parasite in the studied group; it was found in 4 host species from 9 administrative regions and Crimea.

  12. Karyotype analysis in octoploid and decaploid wild strawberries, Fragaria (Rosaceae)

    Science.gov (United States)

    The 20 wild species of strawberries in the genus Fragaria (Rosaceae), have a euploid series including diploid (2n = 2x = 14) through decaploid (2n = 10x = 70) members. Karyotyping has not been thoroughly examined. The objective of this research was to determine the chromosomal morphology and karyoty...

  13. Exploiting wild relatives of S. lycopersicum for quality traits

    NARCIS (Netherlands)

    Víquez Zamora, A.M.

    2015-01-01

    Exploiting wild relatives of S. lycopersicum for quality traits Ana Marcela Víquez Zamora Tomatoes are consumed worldwide and became a model for crop plant research. A part of the research aims at expanding genetic diversity in tomato; this can be done by incorporating

  14. Inter Simple Sequence Repeat (ISSR) analysis of wild and cultivated ...

    African Journals Online (AJOL)

    ONOS

    2010-08-09

    Aug 9, 2010 ... ed through interspecific hybridization of Asian and African rice, formed a cluster with Asian rice. Generally cultivated and wild species clearly observed to have separated groups in both UPGMA and neighbor joining analysis. The two methods showed almost the same tree topology with similar groupings ...

  15. A comparative study of antibacterial activities of wild and cultivated ...

    African Journals Online (AJOL)

    Farmers generally collect fresh plant materials from the wild for ethnoveterinary uses. They are encouraged to harvest with caution and dry or cultivate important materials in order to protect the biodiversity. These recommendations are not validated scientifically. The microplate method for minimum inhibitory concentration ...

  16. The GRIN-Taxonomy crop wild relative inventory

    Science.gov (United States)

    In order to provide an informational tool for assessing and prioritizing germplasm needs for ex situ conservation in the U.S. National Plant Germplasm System (NPGS), the USDA Agricultural Research Service in 2008 initiated a project to identify wild relatives (CWR) of major and minor crops. Each cro...

  17. An inventory of crop wild relatives of the United States

    Science.gov (United States)

    The use of crop wild relatives (CWR) in breeding is likely to continue to intensify as utilization techniques improve and crop adaptation to climate change becomes more pressing. Significant gaps remain in the conservation of these genetic resources, constraining availability for research. As a fi...

  18. Nitrogen fixation and chemical composition of wild annual legumes ...

    African Journals Online (AJOL)

    yakoub@AHMED

    řixing (acetylene reducing) species were Medicago intertexta and Melilotus indicus. The structure oř nodules řrom most oř the wild herb legumes showed the characteristic řeatures oř indeterminate nodules (with an apical meristematic tissue).

  19. Determinants of visitors' preference for wild animal spieces (A case ...

    African Journals Online (AJOL)

    The enormous potentials of tourism in recreation, community and economic development can be maximised through focusing on visitors' preference in ensuring the sustainability of this increasingly important sector. This study examined the determinants of visitors' preference for wild animal species in Kwara State, Nigeria.

  20. Circadian chronotypes among wild-captured west Andean octodontids

    Directory of Open Access Journals (Sweden)

    ADRIÁN OCAMPO-GARCÉS

    2006-01-01

    Full Text Available Rest activity pattern was studied in wild-captured males of Octodon degus (n=9, Octodon bridgesi (n=3, and Spalacopus cyanus (n=6 (Rodentia: Octodontidae. Ten-minute resolution actograms were constructed from data obtained by an automated acquisition system. After two months of habituation to a stable light-dark schedule, recordings were performed in isolation chambers under a 12: 12 Light Dark schedule. A free-running period (constant darkness was recorded for O. bridgesi and S. cyanus. O. degus displayed a crepuscular pattern of rest activity rhythm. Entrained O. bridgesi and S. cyanus displayed nocturnal preference, with rest anticipating light phase and without crepuscular activity bouts. Under constant darkness, active phase occurred at subjective night in O. bridgesi and S. cyanus. Wild-captured O. bridgesi and S. cyanus possess a circadian driven nocturnal preference, while wild O. degus displays a crepuscular profile. Diurnal active phase preference of wild S. cyanus colonies observed in the field could not be explained solely by photic entrainment, since social and/or masking processes appear to be operative. The genus Octodon includes species with diverse chronotypes. We propose that crepuscular diurnal pattern observed in O. degus is a recent acquisition among the octodontid lineage

  1. Crop wild relatives of the brinjal eggplant (Solanum melongena)

    NARCIS (Netherlands)

    Syfert, Mindy M.; Castañeda-Álvarez, Nora P.; Khoury, Colin K.; Särkinen, Tiina; Sosa, Chrystian C.; Achicanoy, Harold A.; Bernau, Vivian; Prohens, Jaime; Daunay, Marie Christine; Knapp, Sandra

    2016-01-01

    PREMISE OF THE STUDY: Crop wild relatives (CWR) provide important traits for plant breeding, including pest, pathogen, and abiotic stress resistance. Therefore, their conservation and future availability are essential for food security. Despite this need, the world's genebanks are currently

  2. Effect of Dietary Inclussion of Antibiotics and Wild Sunflower ...

    African Journals Online (AJOL)

    The effect of addition of penicillin, streptomycin and wild sunflower leaf in layer diet on the performance of hens was investigated. Forty (40) Shaver Brown layers at twenty four weeks of age were involved in a completely randomized design experiment. They were randomly allocated to give dietary treatments.

  3. Knemidocoptic Mange in Wild Golden Eagles, California, USA

    Centers for Disease Control (CDC) Podcasts

    2014-09-21

    Dr. Mike Miller reads an abridged version of the article, Knemidocoptic Mange in Wild Golden Eagles, California, USA .  Created: 9/21/2014 by National Center for Emerging and Zoonotic Infectious Diseases (NCEZID).   Date Released: 10/15/2014.

  4. Wild Black-lip Pearl Oyster (Pinctada margaritifera) Spat Collection ...

    African Journals Online (AJOL)

    Abstract—Pearl farming is a growing aquaculture activity in Tanzania but requires sufficient young pearl oysters to make it feasible. Collection of spat in the wild is the most viable way of doing this and was tested to establish whether it would yield sufficient juvenile pearl oysters to support an industry. A total of.

  5. Do wild great tits avoid exposure to light at night?

    NARCIS (Netherlands)

    Jong, De Maaike; Ouyang, Jenny Q.; Grunsven, van Roy H.A.; Visser, Marcel E.; Spoelstra, Kamiel

    2016-01-01

    Studies of wild populations have provided important insights into the effects of artificial light at night on organisms, populations and ecosystems. However, in most studies the exact amount of light at night individuals are exposed to remains unknown. Individuals can potentially control their

  6. Do wild great tits avoid exposure to light at night?

    NARCIS (Netherlands)

    De Jong, M.; Ouyang, Jenny; van Grunsven, Roy H. A.; Visser, M.E.; Spoelstra, K.

    2016-01-01

    Studies of wild populations have provided important insights into the effects of artificial light at night on organisms, populations and ecosystems. However, in most studies the exact amount of light at night individuals are exposed to remains unknown. Individuals can potentially control their

  7. WILD ANIMALS AS RESERVOIRS OF MYIASIS-PRODUCING FLIES ...

    African Journals Online (AJOL)

    Wild reservoirs of the Tumbu fly Cordylobia anthropophaga are mainly rodents; those of. Lund's fly Cordylobia rodhaini are small antelopes and the giant rat. Both species are commonly found and are important pests of humans, dogs and several other domestic animals. There are seven species of equine bot flies ...

  8. Microsatellite analysis of the genetic relationships between wild and ...

    Indian Academy of Sciences (India)

    the large-scale artificial culture of giant grouper has been. ∗For correspondence. E-mail: lsszy@mail.sysu.edu.cn. Qing Wang and Xiang Wang contributed equally to this work. successfully established in China and other Asian countries, alleviating the fishing pressure on wild populations to some extent (Tupper and Sheriff ...

  9. Cellulase production by wild strains of Aspergillus niger, Penicillium ...

    African Journals Online (AJOL)

    Waste cellulosic materials (corncob, sawdust and sugarcane pulp) and crystalline cellulose induced cellulase production in wild strains of Aspergillus niger, Penicillium chrysogenum and Trichoderma harzianum isolated from a wood-waste dump in Lagos, Nigeria. Cellulose-supplemented media gave the maximum ...

  10. Variability pattern within 65 accessions of African wild vigna - Vigna ...

    African Journals Online (AJOL)

    Variability pattern within 65 accessions of African wild vigna - Vigna ambacensis Baker. MA Adebayo, CO Aremu. Abstract. No Abstract. Nigerian Journal of Genetics Vol. 19 2005: pp. 1-8. Full Text: EMAIL FULL TEXT EMAIL FULL TEXT · DOWNLOAD FULL TEXT DOWNLOAD FULL TEXT.

  11. Prevalence and Intensity of Gastrointestinal Parasites in Wild ...

    African Journals Online (AJOL)

    The objective of the study was to screen for gastrointestinal parasite infections from sixty five wild-trapped Pabio anubis (olive baboons) and sixty four Cercopithecus aaethiops (African green monkeys) from various locations in Kenya and at the Institute of Primate Research (IPR), Nairobi, in March 2008 to June 2009 to ...

  12. Genetic analysis of wild apple resources in Shandong province ...

    African Journals Online (AJOL)

    Wild apple resources are important and they develop gradually in apple industry and genetic diversity. In this study ... This study indicates that the results obtained based on the dendrograms constructed using unweighted pair-group using arithmetic average (UPGMA) cluster analysis were significantly correlated. The ISSR ...

  13. Characterization and expression of dehydrins in wild Egyptian pea ...

    African Journals Online (AJOL)

    Characterization and expression of dehydrins in wild Egyptian pea (Pisum sativum L.) Ashraf Haider Haider. Abstract. Pea genotypes exhibited significant genetic variation in drought tolerance. Polymerase chain reaction (PCR) screening for dehydrins in different pea genotypes indicated the amplification of at least six ...

  14. Ligninolytic enzyme activities in mycelium of some wild and ...

    African Journals Online (AJOL)

    STORAGESEVER

    2008-12-03

    Dec 3, 2008 ... and commercial mushrooms. Erbil Kalmış. 1, İhsan Yaşa2, Fatih Kalyoncu3*, ... ligninolytic enzyme production. Key words: Basidiomycetes, enzymatic activity, lignocellulose. INTRODUCTION ... In this study, we used mycelia that belong to 19 mushroom species. (six commercial and 13 wild) to determine ...

  15. Wild Birds and the Urban Ecology of Ticks

    Centers for Disease Control (CDC) Podcasts

    2012-12-21

    Dr. Sarah Hamer, Assistant Professor and Veterinary Ecologist with the College of Veterinary Medicine at Texas A&M University, discusses her investigation of ticks on wild birds in urban Chicago.  Created: 12/21/2012 by National Center for Emerging and Zoonotic Infectious Diseases (NCEZID).   Date Released: 12/27/2012.

  16. Viral metagenomic analysis of feces of wild small carnivores.

    Science.gov (United States)

    Bodewes, Rogier; Ruiz-Gonzalez, Aritz; Schapendonk, Claudia M E; van den Brand, Judith M A; Osterhaus, Albert D M E; Smits, Saskia L

    2014-05-15

    Recent studies have clearly demonstrated the enormous virus diversity that exists among wild animals. This exemplifies the required expansion of our knowledge of the virus diversity present in wildlife, as well as the potential transmission of these viruses to domestic animals or humans. In the present study we evaluated the viral diversity of fecal samples (n = 42) collected from 10 different species of wild small carnivores inhabiting the northern part of Spain using random PCR in combination with next-generation sequencing. Samples were collected from American mink (Neovison vison), European mink (Mustela lutreola), European polecat (Mustela putorius), European pine marten (Martes martes), stone marten (Martes foina), Eurasian otter (Lutra lutra) and Eurasian badger (Meles meles) of the family of Mustelidae; common genet (Genetta genetta) of the family of Viverridae; red fox (Vulpes vulpes) of the family of Canidae and European wild cat (Felis silvestris) of the family of Felidae. A number of sequences of possible novel viruses or virus variants were detected, including a theilovirus, phleboviruses, an amdovirus, a kobuvirus and picobirnaviruses. Using random PCR in combination with next generation sequencing, sequences of various novel viruses or virus variants were detected in fecal samples collected from Spanish carnivores. Detected novel viruses highlight the viral diversity that is present in fecal material of wild carnivores.

  17. Systematics, diversity, genetics, and evolution of wild and cultivated potatoes

    Science.gov (United States)

    Cultivated potato, Solanum tuberosum L., is the third most important food crop and is grown and consumed worldwide. Indigenous primitive cultivated (landrace) potatoes, and wild potatoes, all classified as Solanum section Petota, are widely used for potato improvement. Members of section Petota are ...

  18. Cellulolytic activities of wild type fungi isolated from decayed wood ...

    African Journals Online (AJOL)

    Prof. Ogunji

    Damaso, M. C. T., Terzi, S. D., Farias, X. A., de Oliveria, C. P., Fraga, M. E. and Couri, S. (2012). Selection of cellulolytic fungi isolated from diverse substrates. Braz. Arch. Biol. Technol.55 (4): 513 – 520. Doolotkeldieva, T. D. and Bobusheva, S. T. (2011). Screening of wild type fungal isolates for cellulolytic activity. Microbiol.

  19. Measuring forest and wild product contributions to household welfare

    DEFF Research Database (Denmark)

    Bakkegaard, Riyong Kim; Hogarth, Nicholas J.; Bong, Indah Waty

    2017-01-01

    Systematic comparisons of human dependence on forests and environmental resources have been challenging, as a result of heterogeneous methodologies. Specialized Forestry Modules have been developed, with the goal of filling current information gaps concerning the economic importance of forest and......' detailed and systematic approach can help ensure that contributions of forest and wild products are not underestimated in national figures....

  20. Proximate nutrient composition of some wild edible medicinal plants ...

    African Journals Online (AJOL)

    There are high levels of malnutrition especially among children in Africa. In Uganda, this is compounded by widespread food insecurity. There are various wild edible plant species in Uganda. However, little research has been carried out to document and validate the claims associated with their use. A study was, therefore, ...

  1. Preliminary analyses and amino acid profile of wild sunflower ...

    African Journals Online (AJOL)

    Tithonia diversifolia (wild sunflower) leaves were harvested, sundried and milled to obtain Tithonia diversifolia leaf meal (TDLM). Samples of the TDLM were analysed for proximate composition, amino acid profile and certain antinutrients. Analysis revealed a composition of 20.6% CP, 18.9% CF, 4.0% EE, 42.5% CHO and ...

  2. Radiocesium uptake mechanisms in wild and culture mushrooms

    Energy Technology Data Exchange (ETDEWEB)

    Sugiyama, Hideo; Terada, Hiroshi (Institute of Public Health, Tokyo (Japan)); Isomura, Kimio; Tsukada, Hirofumi; Shibata, Hisashi

    1993-12-01

    Concentrations of [sup 137]Cs and stable Cs in wild mushrooms, cultivated mushrooms and those substrates were measured by gamma-ray spectrometry and neutron activation analysis. The average concentration of [sup 137]Cs in 80 wild mushrooms in Japan was 87.5 Bq/kg (wet wt.), and concentration of [sup 137]Cs in mycorrhizal mushrooms was higher than that of saprophytic mushrooms. High concentrations of [sup 137]Cs were found in Pleurotus ostreatus (Fr.) Kummer Y-1, saprophytic mushrooms, cultivated in culture substrates containing high [sup 137]Cs. Clear correlations with 5% level of significance were found between wild mushroom-to-substrate ratios (wet/dry) of [sup 137]Cs concentration and those of stable Cs. Cultivated P. ostreatus-to-culture substrate ratios (wet/wet) of [sup 137]Cs concentration were stable in the order of 10[sup 0] when the culture substrate was containing 10 000 Bq/kg (wet wt.) of [sup 137]Cs or 1 000 mg/kg (wet wt.) of stable Cs. The ratios of [sup 137]Cs concentration in cultivated mushrooms were about equal to those in wild mushrooms. Higher concentration of [sup 137]Cs in culture substrate after sampling P. ostreatus was observed at the upper layer where mycelium density was high. (author).

  3. 76 FR 55107 - Wild Horse and Burro Advisory Board; Meeting

    Science.gov (United States)

    2011-09-06

    ..., Virginia 22202. The hotel phone number for reservations is 703-418-1234 and the fax number is 703-418-1233... telecommunications device for the deaf (TDD) may call the Federal Information Relay Service (FIRS) at 1-800-877-8339... Service on matters pertaining to the management and protection of wild, free-roaming horses and burros on...

  4. Isolation and characterization of ten microsatellite loci for wild Citrus ...

    Indian Academy of Sciences (India)

    Swingle, F. venosa (Champ. ex Benth.) Huang, F. margarita (Lour.) Swingle, F. japonica (Thunb.) Swingle and F. bawangica Huang (Zhang et al. 2008). Despite this taxonomic revision, a considerable amount of variation in fruit size within some wild populations still exists. Further comprehensive field and molecular studies.

  5. Towards a Sustainable Wild Poliovirus Containment Strategy in ...

    African Journals Online (AJOL)

    Esem

    storing Wild Polio Virus (WPV) or potential infectious materials as a last step in contributing to sub-regional efforts in attaining a polio free status and the eradication ... entered into a computer database. Physical follow up visits by the NTF were made to some laboratories indentified on the inventory list as potentially storing.

  6. Impediments, opportunities and strategies to enhance trade of wild ...

    African Journals Online (AJOL)

    This study examined the impediments, opportunities and strategies to enhance trade of wild and semiwild food plants (WSWFPs) in Bunyoro-Kitara Kingdom, Uganda. Semi-structured questionnaire was administered face-to-face to sixty six (66) traders of WSWFPs in the formal markets: five (5) mobile hawkers and eleven ...

  7. Assessing the genetic diversity of cultivars and wild soybeans using ...

    African Journals Online (AJOL)

    USER

    2010-08-02

    Aug 2, 2010 ... soybean accessions of cultivars, landraces and wild soybeans collected in the Shanxi Agricultural. University using 40 simple .... PCR analysis. PCR was carried out in a 20 µl volume that contained template DNA. (50 - 100 ng), 1×PCR buffer (including MgCl2), 0.2 mmol dNTPs,. 0.2 µmol SSR primers and ...

  8. Fatty acids profiles of some Spanish wild vegetables.

    Science.gov (United States)

    Morales, P; Ferreira, I C F R; Carvalho, A M; Sánchez-Mata, M C; Cámara, M; Tardío, J

    2012-06-01

    Polyunsaturated fatty acids play an important role in human nutrition, being associated with several health benefits. The analyzed vegetables, in spite of its low fat content, lower than 2%, present a high proportion of polyunsaturated fatty acids of n-3, n-6 and n-9 series, such as α-linolenic, linoleic and oleic acids, respectively. Wild edible plants contain in general a good balance of n-6 and n-3 fatty acids. The present study tries to contribute to the preservation and valorization of traditional food resources, studying the fatty acids profile of 20 wild vegetables by gas-liquid chromatography with flame ionization detection. Results show that species in which leaves are predominant in their edible parts have in general the highest polyunsaturated fatty acid/saturated fatty acid ratios: Rumex pulcher (5.44), Cichorium intybus (5.14) and Papaver rhoeas (5.00). Due to the low n-6/n-3 ratios of the majority of the samples, they can be considered interesting sources of n-3 fatty acids, especially those with higher total fat amount, such as Bryonia dioica, Chondrilla juncea or Montia fontana, with the highest contents of α-linolenic acid (67.78, 56.27 and 47.65%, respectively). The wild asparaguses of Asparagus acutifolius and Tamus communis stand out for their linoleic acid content (42.29 and 42.45%, respectively). All these features reinforce the interest of including wild plants in diet, as an alternative to the variety of vegetables normally used.

  9. 78 FR 46599 - Wild Horse and Burro Advisory Board Meeting

    Science.gov (United States)

    2013-08-01

    ... and likely to influence the BLM's decisions on the management and protection of wild horses and burros. Before including your address, phone number, email address, or other personal identifying information in your comment, you should be aware that your entire comment--including your personal identifying...

  10. Proliferation and rooting of wild cherry: The influence of cytokinin ...

    African Journals Online (AJOL)

    Determination of the most optimal type and concentration of plant growth regulators as medium constituents is one of the most important aspects of successful micro propagation, among other in vitro factors. With the aim of optimization of in vitro multiplication of wild cherry, the effect of the following cytokinins was studied: ...

  11. Wild native trees in tropical homegardens of Southeast Mexico

    NARCIS (Netherlands)

    Rooduijn, Bastiaan; Bongers, Frans; Wal, van der Hans

    2018-01-01

    Tropical homegardens (THGs) are a model system for rural development that may reconcile food production with social resilience and biodiversity conservation, particularly in rapidly changing landscapes. This study quantified the sink function of THGs for wild native trees in relation to tree cover

  12. Thermoluminescence (TL) analysis for otoliths of the wild carps ...

    African Journals Online (AJOL)

    TL characteristics of otoliths from the wild carps (cyprinoid) living in the Baiyangdian Lake, Hebei Province and Miyun Reservoir, Beijing City was first studied, and ... contaminated water, and this could be regarded as an important typomorphic biomineral for monitoring the contaminative degree and environment change of ...

  13. Schone consumptie aal door groeiverdunning van kleine wilde aal

    NARCIS (Netherlands)

    Kotterman, M.J.J.; Bierman, S.M.

    2013-01-01

    Dit rapport beschrijft hoe kleine wilde aal, gevangen in de gesloten gebieden, kan uitgroeien tot grote aal die aan de consumptie-normen voldoet. Door groei van een aal onder schone omstandigheden neemt de biomassa toe, maar de hoeveelheid verontreiniging in de aal niet of nauwelijks. Het

  14. Antioxidant activity of selected wild Canadian prairie fruits.

    Science.gov (United States)

    Klensporf-Pawlik, Dorota; Przybylski, Roman

    2015-01-01

    Canadian prairies are a habitat for unique wild plants. The main object of the present study was to investigate phytochemicals content and antioxidant activity in seven wild Canadian prairie fruits. The presence of total phenolics, flavonoids, anthocyanins and antioxidant activity were identified in the extracts according to standard procedure. Wild rose had the highest amounts of total phenolics and total flavonoids, whereas elderberry exhibited the highest amount of anthocyanins. All extracts showed good scavenging activities towards DPPH radicals. The results showed a good linear relationship between oxygen radical absorbance capacity and total phenolics indicating that radicals are scavenged at a greater rate as the total phenolics content increases. Additionally, all extracts when applied at concentration of 800 ppm, showed ability to inhibit oxidation of canola oil. In SOT test the best results were obtained when extract of American mountain ash was used. In general, wild rose followed by American mountain ash demonstrated the highest antioxidant activity among assessed Canadian prairie fruits. From the results it can be concluded that prairie fruit extracts are a rich source of phenolic compounds and poses a high antioxidant activity, confirmed by assessment with different type of radicals employed.

  15. Effect of nitrogen fertilization application and maturity of wild ...

    African Journals Online (AJOL)

    N) fertilizer application (0, 125 and 250kg N/ha) and stage of maturity on chemical composition and degradation characteristics of wild sunflower forage meal in West African Dwarf sheep. Nitrogen (0,125 and 250 kg N/ha) as NPK was applied ...

  16. A global assessment of salmon aquaculture impacts on wild salmonids.

    Directory of Open Access Journals (Sweden)

    Jennifer S Ford

    2008-02-01

    Full Text Available Since the late 1980s, wild salmon catch and abundance have declined dramatically in the North Atlantic and in much of the northeastern Pacific south of Alaska. In these areas, there has been a concomitant increase in the production of farmed salmon. Previous studies have shown negative impacts on wild salmonids, but these results have been difficult to translate into predictions of change in wild population survival and abundance. We compared marine survival of salmonids in areas with salmon farming to adjacent areas without farms in Scotland, Ireland, Atlantic Canada, and Pacific Canada to estimate changes in marine survival concurrent with the growth of salmon aquaculture. Through a meta-analysis of existing data, we show a reduction in survival or abundance of Atlantic salmon; sea trout; and pink, chum, and coho salmon in association with increased production of farmed salmon. In many cases, these reductions in survival or abundance are greater than 50%. Meta-analytic estimates of the mean effect are significant and negative, suggesting that salmon farming has reduced survival of wild salmon and trout in many populations and countries.

  17. Ducks as Sentinels for Avian Influenza in Wild Birds

    Science.gov (United States)

    Baumer, Anette; Revilla-Fernández, Sandra; Beer, Martin; Wodak, Eveline; Fink, Maria; Greber, Norbert; Harder, Timm C.; Wilking, Hendrik; Brunhart, Iris; Matthes, Doris; Kraatz, Ulf; Strunk, Peter; Fiedler, Wolfgang; Fereidouni, Sasan R.; Staubach, Christoph; Conraths, Franz J.; Griot, Chris; Mettenleiter, Thomas C.; Stärk, Katharina D.C.

    2009-01-01

    To determine the effectiveness of ducks as sentinels for avian influenza virus (AIV) infection, we placed mallards in contact with wild birds at resting sites in Germany, Austria, and Switzerland. Infections of sentinel birds with different AIV subtypes confirmed the value of such surveillance for AIV monitoring. PMID:19861060

  18. Microsatellite analysis of the genetic relationships between wild and ...

    Indian Academy of Sciences (India)

    In the present study, we isolated 11 microsatellite DNA markers, and analysed the genetic diversity and differentiation between cultured stocks and wild populations of the giant grouper originating from the South China Sea. A total of 390 alleles at 11 microsatellite loci were detected in 130 individuals from five different ...

  19. The genetic diversity of wild rescuegrass is associated with ...

    Indian Academy of Sciences (India)

    suggesting an extremely low variability and a common origin of the current commercial cultivars. The novel germplasm collection of wild rescuegrass opens the way to improve the performance of this crop in humid temperate regions and to extend its cultivation to new cli- mates such as water deficit environments. Journal of ...

  20. VIEWIT uses on the wild and scenic upper Missouri River

    Science.gov (United States)

    Dwight K. Araki

    1979-01-01

    This paper discusses a computer application approach to mapping the scenic boundaries on the Upper Missouri Wild and Scenic River. The approach taken in this effort was the computer program VIEWIT. VIEWIT, for seen area analysis, was developed over an eight-year period prior to 1968, by Elliot L. Amidon and Gary H. Elsner. This is the first attempt by the BLW to...

  1. Java EE 7 development with WildFly

    CERN Document Server

    Ćmil, Michał; Marchioni, Francesco

    2014-01-01

    If you are a Java developer who wants to learn about Java EE, this is the book for you. It's also ideal for developers who already have experience with the Java EE platform but would like to learn more about the new Java EE 7 features by analyzing fully functional sample applications using the new application server WildFly.

  2. Isolation of dermatophytes in wild felids from screening centers

    Science.gov (United States)

    Albano, Ana Paula N.; da Silva Nascente, Patrícia; Meirelles Leite, Alice T.; Xavier, Melissa O.; Santin, Rosema; Mattei, Antonella Souza; Humberg, Roberta M.P.; Coimbra, Marco Antonio A.; Minello, Luiz Fernando; Meireles, Mario C.A.

    2013-01-01

    The aim of this study was detect the presence of dermatophyte fungi on wild felids from screening centers. Samples were taken from 30 animals, assembled in two groups: “free-ranging” and “transitory captivity”. The dermatophytes (Trichophyton genus), isolated from two felids (6.6%), both of the group “free-ranging”. PMID:24159301

  3. Introgression of Crop Alleles into Wild or Weedy Populations

    NARCIS (Netherlands)

    Ellstrand, N.C.; Meirmans, P.; Rong, J.; Bartsch, D.; Ghosh, A.; de Jong, T.J.; Haccou, P.; Lu, B-R.; Snow, A.A.; Stewart, C.N.; Strasburg, J.L.; van Tienderen, P.H.; Vrieling, K; Hooftman, D.A.P.

    2013-01-01

    The evolutionary significance of introgression has been discussed for decades. Questions about potential impacts of transgene flow into wild and weedy populations brought renewed attention to the introgression of crop alleles into those populations. In the past two decades, the field has advanced

  4. Antigenic characterization of mycobacteria from South American wild seals.

    Science.gov (United States)

    Alito, A; Romano, M I; Bigi, F; Zumárraga, M; Cataldi, A

    1999-08-31

    Tuberculosis-producing mycobacteria have been previously described in marine mammals (Cousins et al., 1990, 1993; Romano et al., 1995; Bernardelli et al., 1996). The strains belonged to the M. tuberculosis complex (M. tuberculosis, M. bovis, M. microti and M. africanum), but showed genetic and biochemical differences. The antigenic composition of mycobacteria isolated from wild seals was analyzed by Western blots, using antibodies against some selected antigens. The antigenic content was compared with that of M. bovis, M. tuberculosis and M. microti isolates. The lack of Hsp65 protein in supernatants suggested a low degree of cell lysis in the three-week cultures used. SOD, P27 lipoprotein, MPB64 and antigen 85 were observed in all the strains studied. The wild seal strains, as well as M. tuberculosis, did not produce MPB70 and MPB83. Only very weak bands of P36 antigen were observed in culture supernatants from wild seal mycobacteria. Summarizing, the antigenic composition of mycobacterial strains from wild seals is different from M. bovis strains.

  5. Physicochemical characteristics of castor oil from local wild castor ...

    African Journals Online (AJOL)

    Physicochemical characteristics of castor oil from seeds of the local wild castor plant (Ricinus communis) found in Ghana were determined to evaluate its suitability for exploitation for industrial purposes. The castor seeds were found to be rich in oil, containing 57 per cent castor oil of which 37 per cent was easily expressed ...

  6. Towards a Sustainable Wild Poliovirus Containment Strategy in ...

    African Journals Online (AJOL)

    Objective: The main objective of the survey and inventory of laboratories was to identify laboratories storing Wild Polio Virus (WPV) or potential infectious materials as a last step in contributing to sub-regional efforts in attaining a polio free status and the eradication of poliomyelitis in Zambia. Methods: An adapted WHO ...

  7. Multi-species wild herbivore systems vs. domestic single species ...

    African Journals Online (AJOL)

    Multi-species wild herbivore systems vs. domestic single species systems: a comparison of net animal productivity. PS Goodman. Abstract. Reports the results of a study conducted to compare the short and medium term net annual harvested animal production for six areas situated in the semi-arid bushveld of north eastern ...

  8. Innate resistance to myxomatosis in wild rabbits in England*

    Science.gov (United States)

    Ross, J.; Sanders, M. F.

    1977-01-01

    Wild rabbits (Oryctolagus cuniculus) from one study area in England have been used over a period of 11 years to investigate the possible appearance of innate resistance to myxomatosis. Rabbits of 4-6 weeks old were captured alive, retained in the laboratory until at least 4 months old, and then infected with a type of myxoma virus which kills 90-95% of laboratory rabbits. Observations were made of symptoms, mortality rate and survival times. In the first 4 years of the study (1966-9), mortality rates were not significantly different from those of laboratory rabbits, although survival times of wild rabbits were appreciably longer. In 1970, the mortality rate amongst wild rabbits was 59%, in 1974 it was 17%, and in 1976 it was 20%, thus showing that a considerable degree of inherited resistance to myxomatosis has developed. The types of myxoma virus most commonly isolated from wild rabbits in Great Britain in recent years have been those which cause 70-95% mortality in laboratory rabbits. Therefore, if the degree of innate resistance demonstrated is widespread in Great Britain, there are serious implications regarding the size of the rabbit population, because myxomatosis has been an important factor in holding rabbit numbers at a relatively low level. PMID:270526

  9. Innate resistance to myxomatosis in wild rabbits in England.

    Science.gov (United States)

    Ross, J; Sanders, M F

    1977-12-01

    Wild rabbits (Oryctolagus cuniculus) from one study area in England have been used over a period of 11 years to investigate the possible appearance of innate resistance to myxomatosis. Rabbits of 4-6 weeks old were captured alive, retained in the laboratory until at least 4 months old, and then infected with a type of myxoma virus which kills 90-95% of laboratory rabbits. Observations were made of symptoms, mortality rate and survival times.In the first 4 years of the study (1966-9), mortality rates were not significantly different from those of laboratory rabbits, although survival times of wild rabbits were appreciably longer. In 1970, the mortality rate amongst wild rabbits was 59%, in 1974 it was 17%, and in 1976 it was 20%, thus showing that a considerable degree of inherited resistance to myxomatosis has developed.The types of myxoma virus most commonly isolated from wild rabbits in Great Britain in recent years have been those which cause 70-95% mortality in laboratory rabbits. Therefore, if the degree of innate resistance demonstrated is widespread in Great Britain, there are serious implications regarding the size of the rabbit population, because myxomatosis has been an important factor in holding rabbit numbers at a relatively low level.

  10. Introduction of wild MAP species into the field culture

    Directory of Open Access Journals (Sweden)

    Dušková, Elena

    2016-07-01

    Full Text Available Althea officinalis L., Dracocephalum moldavica L., Gentiana lutea L., Rhodiola rosea L., and Valeriana officinalis L. are the species of wild medicinal plants which are not very commonly grown in field culture. The methods and practical experiences of their multiplication and growing in a field nursery in Olomouc (the Czech Republic are explained and shown in the manuscript.

  11. Digital Necrobacillosis in Norwegian Wild Tundra Reindeer (Rangifer tarandus tarandus)

    DEFF Research Database (Denmark)

    Handeland, K.; Boye, Mette; Bergsjø, B.

    2010-01-01

    Outbreaks of digital necrobacillosis in Norwegian wild tundra reindeer (Rangifer tarandus tarandus) are described. The outbreaks occurred in late summer and autumn 2007 and 2008, subsequent to periods with an unusually high number of days with precipitation and high air temperature. Lesions were...

  12. The significance of gathering wild orchid tubers for orphan ...

    African Journals Online (AJOL)

    We investigated the role of gathering and selling the edible tubers of wild orchids by children orphaned by AIDS as one of their livelihood strategies, through a household survey administered to 152 households in three villages in the Southern Highlands of Tanzania during 2006 and 2007. Additionally, several household ...

  13. Parasites of Clarias gariepinus obtained from culture and wild ...

    African Journals Online (AJOL)

    Seventy-nine parasites were recovered from the wild affecting the same body areas, except that Ergasillus sp. and Argulus sp. respectively affected the fills and fins more. No significant difference was recorded in the level of parasitic infection among the two groups (P>0.05) and amongst the host males and female fish hosts ...

  14. Comparison of proximate and fatty acid compositions of wild brown ...

    African Journals Online (AJOL)

    The purpose of this study was to compare the fatty acid and proximate composition of two commercially exploited trout species (wild brown trout (WBT) and farmed rainbow trout (FRT)). The mean crude lipid content in FRT (4.3%) was significantly higher than that in WBT (2.7%). Total saturated fatty acid concentration ...

  15. Tocopherols composition of Portuguese wild mushrooms with antioxidant capacity

    OpenAIRE

    Sandrina A. Heleno; Barros, Lillian; Sousa, Maria João; Martins, Anabela; Isabel C. F. R. Ferreira

    2010-01-01

    The antioxidant composition and properties of 18 Portuguese wild mushrooms (Clitocybe alexandri, Cortinarius glaucopus, Fistulina hepatica, Hydnum repandum, Hygrophoropsis aurantiaca, Hypholoma capnoides, Laccaria amethystina, Laccaria laccata, Lactarius aurantiacus, Lactarius salmonicolor, Lepista inversa, Lepista sordida, Mycena rosea, Russula delica, Russula vesca, Suillus collinitus, Suillus mediterraneensis, Tricholoma sulphureum) were evaluated, in order to contribute to the...

  16. Exploration of wild relatives of tomato for enhanced stress tolerance

    NARCIS (Netherlands)

    Junming Li,

    2010-01-01

    Among the different abiotic and biotic stresses, Botrytis cinerea, Phytophthora infestans and high salt concentrations are world-wide the most destructive. Several wild relatives of tomato were identified as source for tolerance to these stresses. Three introgression line (IL) populations derived

  17. Microgeographic Edaphic Differentiation in Hordein Polymorphisms of Wild Barley

    DEFF Research Database (Denmark)

    Nevo, E.; Beiles, A.; Storch, N.

    1983-01-01

    Genetic diversity in the storage protein hordein encoded by two loci, Horl and Hor2, was analyzed electrophoretically in seeds from 123 individual plants of wild barley, Hordeum spontaneum, the progenitor of cultivated barley. The test was conducted in two topographically different 100 meter tran...

  18. Impediments, opportunities and strategies to enhance trade of wild ...

    African Journals Online (AJOL)

    Prof. Jacob Agea

    High seasonality hence unreliable quantities for market leading to fluctuation in prices. 70.4 (1.3). Unorganized markets (WSWFPs ... No restriction to sell WSWFPs unlike wild meat. 15.5 (4.6) in setting the prices, and the non .... area eat bush meat on a weekly basis, its trade goes on undercover. Strategies to improve the ...

  19. Seroprevalence of Toxoplasma gondii antibodies in wild birds in Taiwan.

    Science.gov (United States)

    Chen, Ju-Chi; Tsai, Yu-Jen; Wu, Ying-Ling

    2015-10-01

    Toxoplasma gondii is a zoonotic protozoon which is well known for infecting humans and wild animals. In the present study, antibodies to T. gondii were evaluated in 394 wild birds, belonging to 37 species, from 15 different administrative regions in Taiwan. Using modified agglutination test (MAT), the overall seroprevalence of infection was 23.35% (CI 95% = 19.17%-27.53%). Antibodies were detected in birds of prey (25.73%, CI 95% = 19.76%-31.70%), birds living in freshwater or marine systems (34.29%, CI 95% = 18.56%-50.01%) and ground-feeding birds (18.12%, CI 95% = 11.94%-24.31%). Adult birds showed higher seroprevalence than that in juvenile birds, and the presence of clinical abnormalities was associated with T. gondii seropositivity. The results showed that this pathogen has spread widely in Taiwan. This suggests the zoonotic potential of the disease, with transmission from urban to rural regions, and from terrestrial to aquatic systems. The pathogenicity of T. gondii infection in wild birds in Taiwan needs further investigation. This is the first study of the seroprevalence of T. gondii in wild birds in Taiwan. Copyright © 2015 Elsevier Ltd. All rights reserved.

  20. FACTS, FANTASIES, AND FORECASTS: THE FUTURE OF WILD PACIFIC SALMON

    Science.gov (United States)

    Throughout the far western contiguous United States (California, Oregon, Washington, and Idaho), many wild salmon stocks have declined and some have disappeared. The decline has taken place over the past 150 years, but there have been decades when the numbers increased. Overall...

  1. Mycelial growth and antibacterial metabolite production by wild ...

    African Journals Online (AJOL)

    Russula sp. and Pycnoporus cinnabarinus (wild mushrooms) were subjected to laboratory cultivation by spore germination and tissue culturing on Sabouraud dextrose agar plates. Subsequently, the growth and production of metabolite(s) were monitored in submerged fermentation for 7days using agar diffusion method.

  2. Fatty and amino acids composition of selected wild edible ...

    African Journals Online (AJOL)

    For thousands of years, mushrooms have long been used for their health promoting properties. The aim of this study was to determine the fatty acids and amino acids contents in priority wild mushrooms: Termitomyces microcarpus, Termitomyces sp. (Bunyanaka), Termitomyces globulus, Termitomyces eurrhizus and ...

  3. Cultivation of three types of indigenous wild edible mushrooms ...

    African Journals Online (AJOL)

    The periods for spawn running, pinhead and fruit body formation, number of flushes, yield and biological efficiency of the three Tanzanian wild edible mushrooms, Coprinus cinereus, Pleurotus flabellatus and Volvariella volvocea, grown on composted sisal decortications residue were studied. Results revealed that the ...

  4. wild and domesticated mushroom consumption in nigeria abstract

    African Journals Online (AJOL)

    USER

    Research on mushroom and mushroom products is dynamic with global increasing interest. The natural habitat of mushrooms being the wild, it is imperative to cultivate mushroom domestically in order to make it available to the populace. The aim of this research was to assess the perception of consumers to consumption of ...

  5. Economics of wild salmon ecosystems: Bristol Bay, Alaska

    Science.gov (United States)

    John W. Duffield; Christopher J. Neher; David A. Patterson; Oliver S. Goldsmith

    2007-01-01

    This paper provides an estimate of the economic value of wild salmon ecosystems in the major watershed of Bristol Bay, Alaska. The analysis utilizes both regional economic and social benefit-cost accounting frameworks. Key sectors analyzed include subsistence, commercial fishing, sport fishing, hunting, and nonconsumptive wildlife viewing and tourism. The mixed cash-...

  6. Comparative transcriptomics of wild North American Vitis species

    Science.gov (United States)

    The cultivated grapevine (Vitis vinifera) is one of the world’s most important fruit crops. While grapes are now cultivated across the world, biotic and abiotic stresses often limit the production of grapes. Compared with the cultivated grape, wild grapevine species possess adaptive traits for str...

  7. From research to action: enhancing crop yield through wild pollinators

    NARCIS (Netherlands)

    Garibaldi, A.; Carvalheiro, L.G.; Leonhardt, S.D.; Aizen, M.A.; Blaauw, B.R.; Isaacs, R.; Kuhlman, M.; Kleijn, D.; Klein, A.M.; Kremen, C.; Morandin, L.; Scheper, J.A.; Winfree, R.

    2014-01-01

    Recent evidence highlights the value of wild-insect species richness and abundance for crop pollination worldwide. Yet, deliberate physical importation of single species (eg European honey bees) into crop fields for pollination remains the mainstream management approach, and implementation of

  8. Understanding The Use Of Stolen Webmail Credentials In The Wild

    OpenAIRE

    Onaolapo, J.; Stringhini, G.; Mariconti, E.

    2016-01-01

    Parsed metadata of the accesses to stolen accounts presented in the paper "What Happens After You Are Pwnd: Understanding The Use Of Stolen Webmail Credentials In The Wild" published at the ACM Internet Measurement Conference (IMC) in 2016. The data is stored as a Python pickle dictionary.

  9. Concurrent pregnancy and lactation in wild giraffes ( Giraffa ...

    African Journals Online (AJOL)

    Lactation boosts reproductive costs by depleting maternal condition and delaying subsequent conception. However, some evidence suggests that giraffes (Giraffa camelopardalis) have evolved a mechanism to minimise the time allocated to suckling-induced suppression of ovulation. Here, we show for the first time that wild ...

  10. Summer Flowering Cover Crops Support Wild Bees in Vineyards.

    Science.gov (United States)

    Wilson, Houston; Wong, Jessica S; Thorp, Robbin W; Miles, Albie F; Daane, Kent M; Altieri, Miguel A

    2017-12-30

    Agricultural expansion and intensification negatively affect pollinator populations and has led to reductions in pollination services across multiple cropping systems. As a result, growers and researchers have utilized the restoration of local and landscape habitat diversity to support pollinators, and wild bees in particular. Although a majority of studies to date have focussed on effects in pollinator-dependent crops such as almond, tomato, sunflower, and watermelon, supporting wild bees in self-pollinated crops, such as grapes, can contribute to broader conservation goals as well as provide other indirect benefits to growers. This study evaluates the influence of summer flowering cover crops and landscape diversity on the abundance and diversity of vineyard bee populations. We showed that diversity and abundance of wild bees were increased on the flowering cover crop, but were unaffected by changes in landscape diversity. These findings indicate that summer flowering cover crops can be used to support wild bees and this could be a useful strategy for grape growers interested in pollinator conservation as part of a broader farmscape sustainability agenda. © The Author(s) 2017. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  11. Engineering a wild fast-growing Mycoplasma bacterium to generate ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    2018-01-12

    Jan 12, 2018 ... To develop a fast growing CCPP vaccine for cheaper production and long term protection, cutting edge synthetic biotechnology tools will be used to delete harmful and nonessential genes from a fast growing bacterium isolated from wild goats. These genes will be replaced by CCPP protective vaccine ...

  12. Utilization of sunflower crop wild relatives for cultivated sunflower improvement

    Science.gov (United States)

    Sunflower (Helianthus annuus L.) is one of the few crops native to the U.S. The current USDA-ARS-NPGS crop wild relatives sunflower collection is the largest extant collection in the world, containing 2,519 accessions comprised of 53 species; 39 perennial and 14 annual. To fully utilize gene bank co...

  13. Short communications : Are wild African lungfish obligate air ...

    African Journals Online (AJOL)

    Laboratory studies have resulted in classification of the marbled African lungfish, Protopterus aethiopicus, as an obligate air-breather. However, there have been no investigations of the extent of dependence on aerial respiration by this species in the wild. We used radio telemetry to obtain quantitative information on the ...

  14. Wild edible mushrooms in the Blue Mountains: resource and issues.

    Science.gov (United States)

    Catherine G. Parks; Craig L. Schmitt

    1997-01-01

    This paper reviews the wild mushroom resource of the Blue Mountains of northeastern Oregon and southeastern Washington and summarizes issues and concerns for regulation, monitoring, and management. Existing biological information on the major available commercial mushrooms in the area, with emphasis on morels, is presented. Brief descriptions of the most commonly...

  15. 50 CFR 16.11 - Importation of live wild mammals.

    Science.gov (United States)

    2010-10-01

    ... 50 Wildlife and Fisheries 1 2010-10-01 2010-10-01 false Importation of live wild mammals. 16.11... mammals. (a) The importation, transportation, or acquisition is prohibited of live specimens of: (1) Any... mammals under the terms and conditions set forth in § 16.22. (b) Upon the filing of a written declaration...

  16. Free-radical scavenging capacity and antimicrobial activity of wild ...

    African Journals Online (AJOL)

    Free-radical scavenging capacity and antimicrobial activity of wild edible mushroom from Turkey. ... concentration of both RF ethanol extract and the standards the higher the inhibition effect. ... The ethanol extract of R. flava inhibited the growth of Gram-positive bacteria better than Gram-negative bacteria and yeast.

  17. Assessing the genetic diversity of cultivars and wild soybeans using ...

    African Journals Online (AJOL)

    Increasing the diversity of the soybean germplasm base could introduce new genes affecting agronomic traits. In this study, we demonstrated the differences of genetic diversity level among 40 soybean accessions of cultivars, landraces and wild soybeans collected in the Shanxi Agricultural University using 40 simple ...

  18. Antioxidant property of wild and farmed sea bream ( Sparus aurata ...

    African Journals Online (AJOL)

    1,1-diphenyl-2-picrylhydrazyl (DPPH) radicals and hydroxyl radicalscavenging activity (RSA) as well as the reducing power activity of different extracts increased linearly with increasing concentration. DPPH scavenging activity was more effective with farmed fish extracts. Extracts of oven cooked wild and grilled farmed fish ...

  19. Base catalyzed transesterification of wild apricot kernel oil for ...

    African Journals Online (AJOL)

    Prunus armeniaca L. grows wildly and is also cultivated at higher altitudes in temperate regions of Pakistan. Its kernel is a rich source of oil but its biodiesel production properties have not yet been exploited. During the present investigation, some quality parameters of kernel oil like acid value, free fatty acid content (as oleic ...

  20. Viral metagenomic analysis of feces of wild small carnivores

    NARCIS (Netherlands)

    R. Bodewes (Rogier); A. Ruiz-Gonzalez (Aritz); C.M.E. Schapendonk (Claudia); J.M.A. van den Brand (Judith); A.D.M.E. Osterhaus (Albert); S.L. Smits (Saskia)

    2014-01-01

    textabstractBackground: Recent studies have clearly demonstrated the enormous virus diversity that exists among wild animals. This exemplifies the required expansion of our knowledge of the virus diversity present in wildlife, as well as the potential transmission of these viruses to domestic

  1. Ligninolytic enzyme activities in mycelium of some wild and ...

    African Journals Online (AJOL)

    Lignin is probably one of the most recalcitrant compounds synthesized by plants. This compound is degraded by few microorganisms. White-rot fungi have been extensively studied due to its powerful ligninolytic enzymes. In this study, ligninolytic enzyme activities of different fungal species (six commercial and 13 wild) were ...

  2. Persuasive Pamesa: Not Running Wild with the CISG

    DEFF Research Database (Denmark)

    Lookofsky, Joseph

    2010-01-01

    The focus of this contribution is the potential for "expansionist" lawmaking by national courts when they interpret private international legislation, in casu the United Nations Convention on Contracts for the International Sale of Goods (CISG). After surveying a number of concrete examples, both...... real and hypothetical, the author concludes that most national course are not "running wild" with the CISG....

  3. Mineralogy and Petrology of Comet Wild 2 Nucleus Samples

    Energy Technology Data Exchange (ETDEWEB)

    Zolensky, M E; Zega, T J; Yano, H; Wirick, S; Westphal, A J; Weisberg, M K; Weber, I; Warren, J L; Velbel, M A; Tsuchiyama, A; Tsou, P; Toppani, A; Tomioka, N; Tomeoka, K; Teslich, N; Taheri, M; Susini, J; Stroud, R; Stephan, T; Stadermann, F J; Snead, C J; Simon, S B; Siminovici, A; See, T H; Robert, F; Rietmeijer, F M; Rao, W; Perronnet, M C; Papanastassiou, D A; Okudaira, K; Ohsumi, K; Ohnishi, I; Nakanura-Messenger, K; Nakamura, T; Mostefaoui, S; Mikouchi, T; Meibom, A; Matrajt, G; Marcus, M A; Leroux, H; Lemelle, L; Le, L; Lanzirotti, A; Langenhorst, F; Krot, A N; Keller, L P; Kearsley, A T; Joswiak, D; Jacob, D; Ishii, H; Harvey, R; Hagiya, K; Grossman, L; Graham, G A; Gounelle, M; Gillet, P; Genge, M J; Flynn, G; Ferrior, T; Fallon, S; Ebel, D S; Dai, Z R; Cordier, P; Chi, M; Butterworth, A L; Brownlee, D E; Bridges, J C; Brennan, S; Brearley, A; Bradley, J P; Bleuet, P; Bland, P A; Bastien, R

    2006-10-11

    The bulk of the Wild 2 samples appear to be weakly-constructed mixtures of nanometerscale grains with occasional much larger (>1{micro}m) ferromagnesian silicates, Fe-Ni sulfides, Fe-Ni metal and accessory phases. The very wide range of olivine and low-Ca pyroxene compositions in Wild 2 require a wide range of formation conditions, probably reflecting different formation locations in the protoplanetary disk. The restricted compositional ranges of Fe-Ni sulfides, the wide range for silicates, and absence of hydrous phases indicate that Wild 2 experienced little or no aqueous alteration. Less abundant Wild 2 materials include a refractory particle, whose presence appears to require large-scale radial transport in the early protoplanetary disk. The nature of cometary solids is of fundamental importance to our understanding of the early solar nebula and protoplanetary history. Until now we have had to study comets from afar using spectroscopy, or settle for analyses of interplanetary dust particles (IDPs) of uncertain provenance. We report here mineralogical and petrographic analyses of particles derived directly from Comet Wild 2. All of the Wild 2 particles we have thus far examined have been modified in various ways by the capture process. All particles that may have been loose aggregates, ''traveling sand piles'', disaggregated into individual components with the larger, denser components penetrating more deeply into the aerogel. Individual grains experienced a wide range of heating effects that range from excellent preservation to melting (Fig. 1); such behavior was expected (1, 2 ,3). What is remarkable is the extreme variability of these modifications and the fact that severely modified and unmodified materials can be found within a micrometer of each other, requiring tremendous local temperature gradients. Fortunately, we have an internal gauge of impact collection heating. Fe-Ni sulfides are ubiquitous in the Wild 2 samples, are very

  4. Disinfestation of mangoes by irradiation; Desinfestacion de mango por irradiacion

    Energy Technology Data Exchange (ETDEWEB)

    Bustos R, M.E

    1992-05-15

    The mango is a fruit-bearing very important in the mexican economy. Mexico is between the first positions of the world like country producing with an average export volume of 40,000 annual tons in the last years. For this reason it was decided to make this investigation, which was developed according to the investigation protocols proposed by the Agricultural Research Service of the USA (ARS - US DOA). The objective is to account with the technical and scientific necessary bases to propose to the US DOA the regulation of the irradiation process like quarantine treatment for Mexican export mango. The goals are: to determine in the laboratory the minimum dose (Dmin.) to inhibit the emergency of adults of the species of the fruit flies of more importance for Mexico. To confirm the least radiation dose Dmin. for quarantine treatment based on the safety value Probit-9. To evaluate the mango quality irradiated to 2 and 2.5 times the Dmin. proposal for quarantine treatment. According to information provided by the General Direction of Vegetable Sanity, it was determined that the fly species of the fruit of more economic importance for Mexico are of the genus Anastrepha ludens, Anastrepha serpentina, Anastrepha obliqua and Ceratitis capitata. (Author)

  5. Fruit flies (Diptera: Tephritidae and their hosts in the municipality of Quixeré, state of Ceará, Brazil

    Directory of Open Access Journals (Sweden)

    Marcia Mayara de Sousa

    2017-07-01

    Full Text Available The state of Ceará is one of the main producers and exporters of tropical fruits in Brazil. However, the farmers have some problems related with the fruit flies (Diptera: Tephritidae, because these tefritids cause damages to the fruits and the simple presence of some species makes difficult the export of fruits in natura. In the state of Ceará, information about fruit flies and their hosts in fruit producing regions are scarce, such as in the region of Baixo Jaguaribe. This region is located in the Brazilian semiarid and is composed of ten municipalities, among them the municipality of Quixeré. Therefore, the objective of this study was to know the species of fruit flies, their hosts and respective infestation index, in different places of the municipality of Quixeré. For this, fruits were randomly collected in different fruit trees (native and exotic, in the rural and urban area of Quixeré. The collected fruits were transported to the laboratory, where they were counted, weighed and stored in plastic trays on a layer of vermiculite. After seven days, the vermiculite was sieved and the pupae obtained were stored in plastic containers until the emergence of adults. Fruits of 21 species were sampled and only five were infested by fruit flies. The species obtained were Ceratitis capitata (Wiedemann, Anastrepha zenildae Zucchi, Anastrepha sororcula Zucchi and Anastrepha obliqua (Macquart. Guava Psidium guajava L. was the fruit that presented the highest rates of infestation.

  6. Population genetics of foxtail millet and its wild ancestor

    Directory of Open Access Journals (Sweden)

    Wang Yongfang

    2010-10-01

    Full Text Available Abstract Background Foxtail millet (Setaria italica (L. P. Beauv., one of the most ancient domesticated crops, is becoming a model system for studying biofuel crops and comparative genomics in the grasses. However, knowledge on the level of genetic diversity and linkage disequilibrium (LD is very limited in this crop and its wild ancestor, green foxtail (Setaria viridis (L. P. Beauv.. Such information would help us to understand the domestication process of cultivated species and will allow further research in these species, including association mapping and identification of agricultural significant genes involved in domestication. Results In this study, we surveyed DNA sequence for nine loci across 50 accessions of cultivated foxtail millet and 34 of its wild progenitor. We found a low level of genetic diversity in wild green foxtail (θ = 0.0059, θ means Watterson's estimator of θ. Despite of a 55% loss of its wild diversity, foxtail millet still harbored a considerable level of diversity (θ = 0.0027 when compared to rice and sorghum (θ = 0.0024 and 0.0034, respectively. The level of LD in the domesticated foxtail millet extends to 1 kb, while it decayed rapidly to a negligible level within 150 bp in wild green foxtail. Using coalescent simulation, we estimated the bottleneck severity at k = 0.6095 when ρ/θ = 1. These results indicated that the domestication bottleneck of foxtail millet was more severe than that of maize but slightly less pronounced than that of rice. Conclusions The results in this study establish a general framework for the domestication history of foxtail millet. The low level of genetic diversity and the increased level of LD in foxtail millet are mainly caused by a population bottleneck, although gene flow from foxtail millet to green foxtail is another factor that may have shaped the pattern of genetic diversity of these two related gene pools. The knowledge provided in this study will benefit future population

  7. Phenotypic plasticity of labile traits in the wild

    Directory of Open Access Journals (Sweden)

    Jon E. BROMMER

    2013-08-01

    Full Text Available Individual-based studies allow quantification of phenotypic plasticity in behavioural, life-history and other labile traits. The study of phenotypic plasticity in the wild can shed new light on the ultimate objectives (1 whether plasticity itself can evolve or is constrained by its genetic architecture, and (2 whether plasticity is associated to other traits, including fitness (selection. I describe the main statistical approach for how repeated records of individuals and a description of the environment (E allow quantification of variation in plasticity across individuals (IxE and genotypes (GxE in wild populations. Based on a literature review of life-history and behavioural studies on plasticity in the wild, I discuss the present state of the two objectives listed above. Few studies have quantified GxE of labile traits in wild populations, and it is likely that power to detect statistically significant GxE is lacking. Apart from the issue of whether it is heritable, plasticity tends to correlate with average trait expression (not fully supported by the few genetic estimates available and may thus be evolutionary constrained in this way. Individual-specific estimates of plasticity tend to be related to other traits of the individual (including fitness, but these analyses may be anti-conservative because they predominantly concern stats-on-stats. Despite the increased interest in plasticity in wild populations, the putative lack of power to detect GxE in such populations hinders achieving general insights. I discuss possible steps to invigorate the field by moving away from simply testing for presence of GxE to analyses that ‘scale up’ to population level proce­sses and by the development of new behavioural theory to identify quantitative genetic parameters which can be estimated [Current Zoology 58 (4: 485–505, 2013].

  8. Wild Western Lowland Gorillas Signal Selectively Using Odor

    Science.gov (United States)

    Klailova, Michelle; Lee, Phyllis C.

    2014-01-01

    Mammals communicate socially through visual, auditory and chemical signals. The chemical sense is the oldest sense and is shared by all organisms including bacteria. Despite mounting evidence for social chemo-signaling in humans, the extent to which it modulates behavior is debated and can benefit from comparative models of closely related hominoids. The use of odor cues in wild ape social communication has been only rarely explored. Apart from one study on wild chimpanzee sniffing, our understanding is limited to anecdotes. We present the first study of wild gorilla chemo-communication and the first analysis of olfactory signaling in relation to arousal levels and odor strength in wild apes. If gorilla scent is used as a signaling mechanism instead of only a sign of arousal or stress, odor emission should be context specific and capable of variation as a function of the relationships between the emitter and perceiver(s). Measured through a human pungency scale, we determined the factors that predicted extreme levels of silverback odor for one wild western lowland gorilla (Gorilla gorilla gorilla) group silverback. Extreme silverback odor was predicted by the presence and intensity of inter-unit interactions, silverback anger, distress and long-calling auditory rates, and the absence of close proximity between the silverback and mother of the youngest infant. Odor strength also varied according to the focal silverback's strategic responses during high intensity inter-unit interactions. Silverbacks appear to use odor as a modifiable form of communication; where odor acts as a highly flexible, context dependent signaling mechanism to group members and extra-group units. The importance of olfaction to ape social communication may be especially pertinent in Central African forests where limited visibility may necessitate increased reliance on other senses. PMID:25006973

  9. Epidemiological Surveillance of Lymphocryptovirus Infection in Wild Bonobos

    Science.gov (United States)

    Yoshida, Tomoyuki; Takemoto, Hiroyuki; Sakamaki, Tetsuya; Tokuyama, Nahoko; Hart, John; Hart, Terese; Dupain, Jef; Cobden, Amy; Mulavwa, Mbangi; Kawamoto, Yoshi; Kaneko, Akihisa; Enomoto, Yuki; Sato, Eiji; Kooriyama, Takanori; Miyabe-Nishiwaki, Takako; Suzuki, Juri; Saito, Akatsuki; Okamoto, Munehiro; Tomonaga, Masaki; Matsuzawa, Tetsuro; Furuichi, Takeshi; Akari, Hirofumi

    2016-01-01

    Lymphocryptovirus (LCV) is one of the major gena in the herpesvirus family and is widely disseminated among primates. LCVs of human and rhesus macaques are shown to be causative agents of a number of malignant diseases including lymphoma and carcinoma. Bonobos (Pan paniscus) are highly endangered and the least studied species of the great apes. Considering the potential pathogenicity of the LCV that might threaten the fate of wild bonobos, population-based epidemiological information in terms of LCV prevalence in different location of Bonobo’s habitats will help propose improved conservation strategies for the bonobos. However, such data are not available yet because it is very difficult to collect blood samples in the wild and thus virtually impossible to conduct sero-epidemiological study on the wild ape. In order to overcome this issue, we focused on evaluating anti-LCV IgA in the feces of bonobos, which are available in a non-invasive manner. Preliminary study showed that anti-LCV IgA but not IgG was efficiently and reproducibly detected in the feces of captive chimpanzees. It is noteworthy that the fecal IgA-positive individuals were seropositive for both anti-LCV IgG and IgA and that the IgA antibodies in both sera and feces were also detectable by Western blotting assay. These results indicate that the detection of fecal anti-LCV IgA is likely a reliable and feasible for epidemiological surveillance of LCV prevalence in the great apes. We then applied this method and found that 31% of wild bonobos tested were positive for anti-LCV IgA antibody in the feces. Notably, the positivity rates varied extensively among their sampled populations. In conclusion, our results in this study demonstrate that LCV is highly disseminated among wild bonobos while the prevalence is remarkably diverse in their population-dependent manner. PMID:27570523

  10. Epidemiological surveillance of lymphocryptovirus infection in wild bonobos

    Directory of Open Access Journals (Sweden)

    Tomoyuki Yoshida

    2016-08-01

    Full Text Available Lymphocryptovirus (LCV is one of the major gena in the herpesvirus family and is widely disseminated among primates. LCVs of human and rhesus macaques are shown to be causative agents of a number of malignant diseases including lymphoma and carcinoma. Bonobos (Pan paniscus are highly endangered and the least studied species of the great apes. Considering the potential pathogenicity of the LCV that might threaten the fate of wild bonobos, population-based epidemiological information in terms of LCV prevalence in different location of Bonobo’s habitats will help propose improved conservation strategies for the bonobos. However, such data are not available yet because it is very difficult to collect blood samples in the wild and thus virtually impossible to conduct sero-epidemiological study on the wild ape. In order to overcome this issue, we focused on evaluating anti-LCV IgA in the feces of bonobos, which are available in a noninvasive manner. Preliminary study showed that anti-LCV IgA but not IgG was efficiently and reproducibly detected in the feces of captive chimpanzees. It is noteworthy that the fecal IgA-positive individuals were seropositive for both anti-LCV IgG and IgA and that the IgA antibodies in both sera and feces were also detectable by Western blotting assay. These results indicate that the detection of fecal anti-LCV IgA is likely a reliable and feasible for epidemiological surveillance of LCV prevalence in the great apes. We then applied this method and found that 31% of wild bonobos tested were positive for anti-LCV IgA antibody in the feces. Notably, the positivity rates varied extensively among their sampled populations. In conclusion, our results in this study demonstrate that LCV is highly disseminated among wild bonobos while the prevalence is remarkably diverse in their population-dependent manner.

  11. Wilde'i suvenäitus Tartu kuurordis = Wilde's summer exhibition at the Tartu resort / Indrek Grigor

    Index Scriptorium Estoniae

    Grigor, Indrek, 1981-

    2015-01-01

    Kunstniketrio Kristiina Hansen, Sigrid Viir ja Johannes Säre ühisnäitus "Bussijaamas lõdisev Kim Wilde ümiseb..." Tartu Kunstimaja monumentaalgaleriis. Tõmmatakse paralleele eelmisel aastal Haapsalu Linnagaleriis toimunud samade autorite näitusega "Pjotr Iljitš Tšaikovski kohtub päikesetõusul..."

  12. Gathering an edible wild plant: food or medicine? A case study on wild edibles and functional foods in Granada, Spain

    Directory of Open Access Journals (Sweden)

    Guillermo Benítez

    2017-08-01

    Full Text Available A study on wild edible resources has been performed in the western part of Granada Province (Spain using ethnobotanical methods. We document and analyze knowledge concerning wild edible plants and mushrooms and their folk medicinal uses in the study area. Several botanical features and use characteristics have been analyzed for the species included, with special attention to their medicinal uses, highlighting a large number of edible-medicinal species. Local importance of the medicinal uses for these resources has been confirmed. Up to 135 species are gathered from the wild in the study area, from which 46 can be considered folk functional foods. In addition, 45 crop plants with uncommon edible or medicinal uses are included, 29 of these being considered functional foods as well. Therefore, a total of 75 plant species are used as edible medicines which serve to treat 36 different conditions. The local concept of food and medicine regarding wild plant resources seems not to be well established. Studies on the pharmacological properties of these foods are needed in order to establish their real or potential benefits for the treated affections.

  13. Eating from the wild: diversity of wild edible plants used by Tibetans in Shangri-la region, Yunnan, China.

    Science.gov (United States)

    Ju, Yan; Zhuo, Jingxian; Liu, Bo; Long, Chunlin

    2013-04-19

    Locally harvested wild edible plants (WEPs) provide food as well as cash income for indigenous people and are of great importance in ensuring global food security. Some also play a significant role in maintaining the productivity and stability of traditional agro-ecosystems. Shangri-la region of Yunnan Province, SW China, is regarded as a biodiversity hotspot. People living there have accumulated traditional knowledge about plants. However, with economic development, WEPs are threatened and the associated traditional knowledge is in danger of being lost. Therefore, ethnobotanical surveys were conducted throughout this area to investigate and document the wild edible plants traditionally used by local Tibetan people. Twenty-nine villages were selected to carry out the field investigations. Information was collected using direct observation, semi-structured interviews, individual discussions, key informant interviews, focus group discussions, questionnaires and participatory rural appraisal (PRA). Information about 168 wild edible plant species in 116 genera of 62 families was recorded and specimens were collected. Most species were edible greens (80 species) or fruits (78). These WEPs are sources for local people, especially those living in remote rural areas, to obtain mineral elements and vitamins. More than half of the species (70%) have multiple use(s) besides food value. Some are crop wild relatives that could be used for crop improvement. Several also have potential values for further commercial exploitation. However, the utilization of WEPs and related knowledge are eroding rapidly, especially in the areas with convenient transportation and booming tourism. Wild food plants species are abundant and diverse in Shangri-la region. They provide food and nutrients to local people and could also be a source of cash income. However, both WEPs and their associated indigenous knowledge are facing various threats. Thus, conservation and sustainable utilization of these

  14. Characterisation of wild rabbit commercial game farms in Spain

    Directory of Open Access Journals (Sweden)

    Pedro González-Redondo

    2014-03-01

    Full Text Available The aim of this research is to characterise the wild rabbit (Oryctolagus cuniculus commercial game farms in Spain using variables related to structure, management and marketing. To this end, a structured survey was administered in 2009 to 21 privately-owned farms. This subsector was an average age of 13. The average size of the breeding stock of the farms was 431 does and 64 bucks. Eighty-five percent of the farms kept all or part of the breeding stock in cages and 38.1% used artificial insemination. All the farms carried out breeder self-replacement, 4.8% by buying wild rabbits from other farms, whereas 38.1% captured wild rabbits for this purpose. Nineteen percent of the wild rabbit game farms also produced other game species, mainly red-legged partridge (Alectoris rufa, pheasant (Phasianus colchicus and quail (Coturnix coturnix. Fourteen percent of the farms supplied wild rabbits to be used as prey to be released in programmes for the conservation of endangered predators, and 38.1% supplied breeding rabbits to be used by other farms to replace culled animals. Eighty-six percent of the farms offered the service of transporting the animals from the farm to the hunting grounds to their clients, and 14.3% advised customers on how to successfully release and restock hunting grounds. Seventy-six percent of the farms marketed their products throughout Spain, and 38.1% exported wild rabbits to neighbouring countries, mainly Portugal and France. Forty-three percent of the farms advertised themselves in hunting magazines, 19.1% promoted themselves by attending livestock and game fairs, and 38.1% had their own websites. In conclusion, this alternative rabbit production system constitutes a well-established subsector in Spain, despite being only 2 decades old. It also seems that it has not yet reached its development maturity. It shows wide diversity in terms of farm size and structure, as well as marketing and promotional activities.

  15. Endometrial polyp in an African wild dog (Lycaon pictus).

    Science.gov (United States)

    Cho, H S; Park, N Y

    2006-11-01

    An 8-year-old female African wild dog (Lycaon pictus) from a zoo in Gyeonggi province, Republic of Korea presented with a 3.0 x 2.0 x 2.5 cm in size, smooth-surfaced, solitary pedunculated mass protruding into the uterine lumen. Microscopically, the mass was covered with epithelium, contained endometrial gland tissue, and was dilated in the vascularised stroma. Within the mass, there was extensive diffuse haemorrhage with several blood vessels apparently plugged with fibrin. At the base of the mass, the spaces lined with epithelium near the attachment of the stalk were interpreted to be glandular structures. There were segments of cuboidal epithelium found on the surface of the mass, which was similar to the lining the uterus. A diagnosis of an endometrial polyp was made based on the gross and histology findings. This is the first case report of a spontaneous endometrial polyp in an African wild dog.

  16. Traffic noise reduces foraging efficiency in wild owls

    Science.gov (United States)

    Senzaki, Masayuki; Yamaura, Yuichi; Francis, Clinton D.; Nakamura, Futoshi

    2016-08-01

    Anthropogenic noise has been increasing globally. Laboratory experiments suggest that noise disrupts foraging behavior across a range of species, but to reveal the full impacts of noise, we must examine the impacts of noise on foraging behavior among species in the wild. Owls are widespread nocturnal top predators and use prey rustling sounds for localizing prey when hunting. We conducted field experiments to examine the effect of traffic noise on owls’ ability to detect prey. Results suggest that foraging efficiency declines with increasing traffic noise levels due to acoustic masking and/or distraction and aversion to traffic noise. Moreover, we estimate that effects of traffic noise on owls’ ability to detect prey reach >120 m from a road, which is larger than the distance estimated from captive studies with bats. Our study provides the first evidence that noise reduces foraging efficiency in wild animals, and highlights the possible pervasive impacts of noise.

  17. Trends in Medicinal Uses of Edible Wild Vertebrates in Brazil

    Directory of Open Access Journals (Sweden)

    Rômulo Romeu Nóbrega Alves

    2017-01-01

    Full Text Available The use of food medicines is a widespread practice worldwide. In Brazil, such use is often associated with wild animals, mostly focusing on vertebrate species. Here we assessed taxonomic and ecological trends in traditional uses of wild edible vertebrates in the country, through an extensive ethnobiological database analysis. Our results showed that at least 165 health conditions are reportedly treated by edible vertebrate species (n=204, mostly fishes and mammals. However, reptiles stand out presenting a higher plasticity in the treatment of multiple health conditions. Considering the 20 disease categories recorded, treatment prescriptions were similar within continental (i.e., terrestrial and freshwater and also within coastal and marine habitats, which may reflect locally related trends in occurrence and use of the medicinal fauna. The comprehension of the multiplicity and trends in the therapeutic uses of Brazilian vertebrates is of particular interest from a conservation perspective, as several threatened species were recorded.

  18. Occurrence of Trichinella spp. in wild animals in northwestern Libya

    Directory of Open Access Journals (Sweden)

    M.M. Hosni

    2013-07-01

    Full Text Available The present study determined the occurrence of Trichinella spp. in captured and some perished wildlife animals which included 70 hedgehogs, 19 red foxes, 13 common jackals and 8 crested porcupines in northwestern Libya. Muscle samples of these animals were examined by trichinoscopy. Trichinella larvae were detected only in 4 (5.7% of the hedgehogs (Erinaceus algirus and 2 (10.5% of the red foxes (Vulpes vulpes. Larvae were found in the muscles of the diaphragm, abdomen, tongue, forelimb, hindlimb and intercostal muscles. Examination of tissue sections revealed the presence of numerous cysts within the muscle fibers containing one or more coiled or elongated larvae. Inflammatory cell infiltration was observed around the cysts especially at their poles. Results indicated the importance of wild animals as reservoirs of Trichinella larvae and their role in the transmission of the disease to other wild and domestic animals as well as humans.

  19. Occurrence of Trichinella spp. in wild animals in northwestern Libya

    Science.gov (United States)

    Hosni, M.M.; Maghrbi, A.A. El; Ganghish, K.S.

    2013-01-01

    The present study determined the occurrence of Trichinella spp. in captured and some perished wildlife animals which included 70 hedgehogs, 19 red foxes, 13 common jackals and 8 crested porcupines in northwestern Libya. Muscle samples of these animals were examined by trichinoscopy. Trichinella larvae were detected only in 4 (5.7%) of the hedgehogs (Erinaceus algirus) and 2 (10.5%) of the red foxes (Vulpes vulpes). Larvae were found in the muscles of the diaphragm, abdomen, tongue, forelimb, hindlimb and intercostal muscles. Examination of tissue sections revealed the presence of numerous cysts within the muscle fibers containing one or more coiled or elongated larvae. Inflammatory cell infiltration was observed around the cysts especially at their poles. Results indicated the importance of wild animals as reservoirs of Trichinella larvae and their role in the transmission of the disease to other wild and domestic animals as well as humans. PMID:26623318

  20. Four pillars of radio astronomy Mills, Christiansen, Wild, Bracewell

    CERN Document Server

    Frater, R H; Wendt, H W

    2017-01-01

    This is the story of Bernie Mills, Chris Christiansen, Paul Wild and Ron Bracewell, members of a team of radio astronomers that would lead Australia, and the world, into this new field of research. Each of the four is remembered for his remarkable work: Mills for the development the cross type instrument that now bears his name; Christiansen for the application of rotational synthesis techniques; Wild for the masterful joining of observations and theory to elicit the nature of the solar atmosphere; Bracewell for his contribution to imaging theory. As well, these Four Pillars are remembered for creating a remarkable environment for scientific discovery and for influencing the careers of future generations. Their pursuit of basic science helped pave the way for technological developments in areas ranging from Wi-Fi to sonar to medical imaging to air navigation, and for underpinning the foundations of modern cosmology and astrophysics.

  1. The Diversity of Wild Banana Species (Genus Musa in Java

    Directory of Open Access Journals (Sweden)

    Lulut Dwi Sulistyaningsih

    2016-03-01

    Full Text Available The diversity of wild banana species (genus Musa, listed in Flora of Java has been revised. The present taxonomic study is based on morphological characteristics observed in the herbarium specimens deposited at the Herbarium Bogoriense (BO, living collections in the Bogor Botanical Garden, the Cibodas Botanical Garden, and during the explorations done at Mt. Salak, West Java. Eight species of Musa (Musa acuminata, M. balbisiana, M. coccinea, M. ornata, M. salaccensis, M. sanguinea, M. textilis and M. velutina and seven infraspecific taxa of M. acuminata are recognized in Java, of which two infraspecific taxa are endemic. West Java is the center of distribution for the wild banana species in Java. Taxonomic descriptions including an identification key are presented.

  2. Wild food plants of popular use in Sicily

    Directory of Open Access Journals (Sweden)

    Venza Francesca

    2007-03-01

    Full Text Available Abstract In the present work the authors report the result of their food ethnobotanical researches, which have been carried out in Sicily during the last thirty years. Data concerning 188 wild species used in the traditional Sicilian cuisine are reported. The authors underline those species that are partially or completely unknown for their culinary use and they illustrate other species that local inhabitants suggested in the prevention or treatment of symptomatologies caused by a refined diet, poor in vegetables. These data want to contribute to avoid the loss of traditional knowledge on uses and recipes concerning wild food botanicals, and to encourage further studies for those species that have not yet been sufficiently researched in their food chemical and nutritional profile. These studies may also suggest new applications for a few botanicals in medico-nutritional fields. The work includes also a short review of the seaweeds and mushrooms traditionally gathered and consumed in Sicily.

  3. A triterpenoid from wild bitter gourd inhibits breast cancer cells

    Science.gov (United States)

    Bai, Li-Yuan; Chiu, Chang-Fang; Chu, Po-Chen; Lin, Wei-Yu; Chiu, Shih-Jiuan; Weng, Jing-Ru

    2016-03-01

    The antitumor activity of 3β,7β,25-trihydroxycucurbita-5,23(E)-dien-19-al (TCD), a triterpenoid isolated from wild bitter gourd, in breast cancer cells was investigated. TCD suppressed the proliferation of MCF-7 and MDA-MB-231 breast cancer cells with IC50 values at 72 h of 19 and 23 μM, respectively, via a PPARγ-independent manner. TCD induced cell apoptosis accompanied with pleiotrophic biological modulations including down-regulation of Akt-NF-κB signaling, up-regulation of p38 mitogen-activated protein kinase and p53, increased reactive oxygen species generation, inhibition of histone deacetylases protein expression, and cytoprotective autophagy. Together, these findings provided the translational value of TCD and wild bitter gourd as an antitumor agent for patients with breast cancer.

  4. Image-based red cell counting for wild animals blood.

    Science.gov (United States)

    Mauricio, Claudio R M; Schneider, Fabio K; Dos Santos, Leonilda Correia

    2010-01-01

    An image-based red blood cell (RBC) automatic counting system is presented for wild animals blood analysis. Images with 2048×1536-pixel resolution acquired on an optical microscope using Neubauer chambers are used to evaluate RBC counting for three animal species (Leopardus pardalis, Cebus apella and Nasua nasua) and the error found using the proposed method is similar to that obtained for inter observer visual counting method, i.e., around 10%. Smaller errors (e.g., 3%) can be obtained in regions with less grid artifacts. These promising results allow the use of the proposed method either as a complete automatic counting tool in laboratories for wild animal's blood analysis or as a first counting stage in a semi-automatic counting tool.

  5. Wild food plants of popular use in Sicily

    Science.gov (United States)

    Lentini, Francesca; Venza, Francesca

    2007-01-01

    In the present work the authors report the result of their food ethnobotanical researches, which have been carried out in Sicily during the last thirty years. Data concerning 188 wild species used in the traditional Sicilian cuisine are reported. The authors underline those species that are partially or completely unknown for their culinary use and they illustrate other species that local inhabitants suggested in the prevention or treatment of symptomatologies caused by a refined diet, poor in vegetables. These data want to contribute to avoid the loss of traditional knowledge on uses and recipes concerning wild food botanicals, and to encourage further studies for those species that have not yet been sufficiently researched in their food chemical and nutritional profile. These studies may also suggest new applications for a few botanicals in medico-nutritional fields. The work includes also a short review of the seaweeds and mushrooms traditionally gathered and consumed in Sicily. PMID:17397527

  6. Wild Collection and Cultivation of Native Species in Iceland

    OpenAIRE

    Whitney, Cory; Gebauer, Jens; Anderson, Molly

    2014-01-01

    Based on an MSc thesis submitted to the joint Master program between University of Kassel and University of Goettingen and later published: WHITNEY C.W., GEBAUER J. & ANDERSON M. 2012. A Survey of Wild Collection and Cultivation of Indigenous Species in Iceland. Human Ecology. This paper outlines a survey of Icelanders who use local plants. Some of the species (e.g. Angelica spp. and Betula spp.) were very important. However, great potential exists for a more diverse harvest and for sust...

  7. Ecology and Neurophysiology of Sleep in Two Wild Sloth Species

    Science.gov (United States)

    Voirin, Bryson; Scriba, Madeleine F.; Martinez-Gonzalez, Dolores; Vyssotski, Alexei L.; Wikelski, Martin; Rattenborg, Niels C.

    2014-01-01

    Study Objectives: Interspecific variation in sleep measured in captivity correlates with various physiological and environmental factors, including estimates of predation risk in the wild. However, it remains unclear whether prior comparative studies have been confounded by the captive recording environment. Herein we examine the effect of predation pressure on sleep in sloths living in the wild. Design: Comparison of two closely related sloth species, one exposed to predation and one free from predation. Setting: Panamanian mainland rainforest (predators present) and island mangrove (predators absent). Participants: Mainland (Bradypus variegatus, five males and four females) and island (Bradypus pygmaeus, six males) sloths. Interventions: None. Measurements and Results: Electroencephalographic (EEG) and electromyographic (EMG) activity was recorded using a miniature data logger. Although both species spent between 9 and 10 h per day sleeping, the mainland sloths showed a preference for sleeping at night, whereas island sloths showed no preference for sleeping during the day or night. Standardized EEG activity during nonrapid eye movement (NREM) sleep showed lower low-frequency power, and increased spindle and higher frequency power in island sloths when compared to mainland sloths. Conclusions: In sloths sleeping in the wild, predation pressure influenced the timing of sleep, but not the amount of time spent asleep. The preference for sleeping at night in mainland sloths may be a strategy to avoid detection by nocturnal cats. The pronounced differences in the NREM sleep EEG spectrum remain unexplained, but might be related to genetic or environmental factors. Citation: Voirin B; Scriba MF; Martinez-Gonzalez D; Vyssotski AL; Wikelski M; Rattenborg NC. Ecology and neurophysiology of sleep in two wild sloth species. SLEEP 2014;37(4):753-761. PMID:24899764

  8. Isoflurane anaesthesia in an African wild dog, Lycaon pictus.

    Science.gov (United States)

    Stegmann, G F

    2000-12-01

    Anaesthesia was required in a captive female African wild dog (Lycaon pictus) for surgical wound treatment. After it was immobilised with a medetomidine-ketamine combination, bradycardia, hypothermia, systolic hypertension and metabolic acidosis were observed. Surgical anaesthesia was maintained with a 1% end-tidal isoflurane concentration. A decrease in the arterial blood pressure, rectal temperature and pH occurred during maintenance of anaesthesia.

  9. Distemper outbreak and its effect on African wild dog conservation.

    Science.gov (United States)

    van de Bildt, Marco W G; Kuiken, Thijs; Visee, Aart M; Lema, Sangito; Fitzjohn, Tony R; Osterhaus, Albert D M E

    2002-02-01

    In December 2000, an infectious disease spread through a captive breeding group of African wild dogs (Lycaon pictus) in Tanzania, killing 49 of 52 animals within 2 months. The causative agent was identified as Canine distemper virus (CDV) by means of histologic examination, virus isolation, reverse transcriptase-polymerase chain reaction analysis, and nucleotide sequencing. This report emphasizes the importance of adequate protection against infectious diseases for the successful outcome of captive breeding programs of endangered species.

  10. Sex Differences in Wild Chimpanzee Behavior Emerge during Infancy

    OpenAIRE

    Lonsdorf, Elizabeth V.; Catherine Markham, A.; Heintz, Matthew R.; Anderson, Karen?E.; Ciuk, David J.; Jane Goodall; Murray, Carson M.

    2014-01-01

    The role of biological and social influences on sex differences in human child development is a persistent topic of discussion and debate. Given their many similarities to humans, chimpanzees are an important study species for understanding the biological and evolutionary roots of sex differences in human development. In this study, we present the most detailed analyses of wild chimpanzee infant development to date, encompassing data from 40 infants from the long-term study of chimpanzees at ...

  11. Wild Sardinia: Ethnographic Provocations. Research Report and Reply to Critics

    Directory of Open Access Journals (Sweden)

    Tracey Heatherington

    2015-06-01

    Full Text Available The author of Wild Sardinia: Indigeneity and the Global Dreamtimes of Environmentalism (University of Washington Press 2010 offers a summary of research and reply to critics. The work is contextualized in the context of contemporary debates in anthropology and environmental studies.\\ The article discusses misunderstandings that might arise from reading across languages and disciplinary traditions, in order to broaden the scope of meaningful debate.

  12. Tuberculosis in wild birds: implications for captive birds

    Science.gov (United States)

    Converse, K. A.; Dein, F. J.

    1990-01-01

    The geographic distribution of avian tuberculosis is widespread but the lack of visible epizootics makes assessment of its impact on wild birds difficult. Generally a low prevalence, widely-scattered, individual animal disease, avian tuberculosis is caused by the same agent in wild and domestic birds. Thus there exists the potential for disease transfer between these two groups in situations that result in direct contact such as wild animals newly captured or transferred from rehabilitation centers, and wild and captive animals intermingling in exhibit areas. During the past 7 yr, tuberculosis caused by Mycobacterium avium, was diagnosed in 64 birds submitted to the National Wildlife Health Research Center from 16 states; avian tuberculosis was the primary diagnosis in 52 of the 64 birds, while the remaining 12 isolates were incidental findings. Twenty-eight of these birds were picked up during epizootics caused by other disease agents including avian cholera, botulism type C, and lead, organophosphorus compound, and cyanide poisoning. Twelve birds were found incidental to birds collected during disease monitoring programs and research projects, and 10 birds were collected by hunters or found sick and euthanatized. Tuberculosis lesions occurred (in order of decreasing frequency) in the liver, intestine, spleen, lung, and air sacs. Several unusual morphological presentations were observed in the gizzard, shoulder joint, jugular vein, face, nares and bill, ureter and bone marrow. Infected birds were collected during all 12 mo of the yr from a variety of species in the Anseriformes, Podicipediformes, Gruiformes, and Falconiformes. Nine of the 46 known age birds were immature indicating that lesions can develop during the first year.

  13. Neosomes of tungid fleas on wild and domestic animals

    OpenAIRE

    Linardi, Pedro Marcos; de Avelar, Daniel Moreira

    2014-01-01

    Tunga is the most specialized genus among the Siphonaptera because adult females penetrate into the skin of their hosts and, after mating and fertilization, undergo hypertrophy, forming an enlarged structure known as the neosome. In humans and other warm-blooded animals, neosomes cause tungiasis, which arises due to the action of opportunistic agents. Although its effects on humans and domestic animals are well described in the literature, little is known about the impact of tungiasis on wild...

  14. Blood pressure responses of wild giraffes studied by radio telemetry.

    Science.gov (United States)

    Van Citters, R L; Kemper, W S; Franklin, D L

    1966-04-15

    Blood pressure was telemetered from transducers chronically implanted in the carotid arteries of two adult, wild, male giraffes captured and released near Kiboko, Kenya. Cerebral perfusion pressure ranged from 280/180 mm-Hg while the animal was lying with its head on the ground to 125/75 mm-Hg when it was standing erect; it varied between these levels during spontaneous activity such as walking, grazing, and running.

  15. Exploration of wild relatives of tomato for enhanced stress tolerance

    OpenAIRE

    Junming Li

    2010-01-01

    Among the different abiotic and biotic stresses, Botrytis cinerea, Phytophthora infestans and high salt concentrations are world-wide the most destructive. Several wild relatives of tomato were identified as source for tolerance to these stresses. Three introgression line (IL) populations derived from S. habrochaites LA1777, S. pennellii LA716 and S. lycopersicoides LA2951 were employed to identify quantitative trait loci (QTL). For B. cinerea resistance twenty four QTLs were identified in S....

  16. Mangifera sylvatica (Wild Mango): A new cocoa butter alternative

    OpenAIRE

    Sayma Akhter; Morag A. McDonald; Ray Marriott

    2016-01-01

    Cocoa butter is the pure butter extracted from cocoa beans and is a major ingredient in the chocolate industry. Global production of cocoa is in decline due to crop failure, diseases and ageing plantations, leading to price fluctuations and the necessity for the industry to find high quality cocoa butter alternatives. This study explored the potential of a wild mango (Mangifera sylvatica), an underutilised fruit in south-east Asia, as a new Cocoa Butter Alternative (CBA). Analyses showed that...

  17. Adaptive plasticity in wild field cricket's acoustic signaling.

    Directory of Open Access Journals (Sweden)

    Susan M Bertram

    Full Text Available Phenotypic plasticity can be adaptive when phenotypes are closely matched to changes in the environment. In crickets, rhythmic fluctuations in the biotic and abiotic environment regularly result in diel rhythms in density of sexually active individuals. Given that density strongly influences the intensity of sexual selection, we asked whether crickets exhibit plasticity in signaling behavior that aligns with these rhythmic fluctuations in the socio-sexual environment. We quantified the acoustic mate signaling behavior of wild-caught males of two cricket species, Gryllus veletis and G. pennsylvanicus. Crickets exhibited phenotypically plastic mate signaling behavior, with most males signaling more often and more attractively during the times of day when mating activity is highest in the wild. Most male G. pennsylvanicus chirped more often and louder, with shorter interpulse durations, pulse periods, chirp durations, and interchirp durations, and at slightly higher carrier frequencies during the time of the day that mating activity is highest in the wild. Similarly, most male G. veletis chirped more often, with more pulses per chirp, longer interpulse durations, pulse periods, and chirp durations, shorter interchirp durations, and at lower carrier frequencies during the time of peak mating activity in the wild. Among-male variation in signaling plasticity was high, with some males signaling in an apparently maladaptive manner. Body size explained some of the among-male variation in G. pennsylvanicus plasticity but not G. veletis plasticity. Overall, our findings suggest that crickets exhibit phenotypically plastic mate attraction signals that closely match the fluctuating socio-sexual context they experience.

  18. External decontamination of wild leeches with hypochloric acid

    OpenAIRE

    Tuncer Serdar; Ongen Betigul; Gurler Nezahat; Kuvat Samet; Nazik Hasan; Aydin Atakan; Hocaoglu Emre; Kesim Sinan

    2004-01-01

    Abstract Background Medicinal leech, Hirudo medicinalis, has been used in plastic and reconstructive surgery, to relieve venous congestion and to improve the microrevascularization of flaps. In many countries, wild leeches are still provided from local markets and utilised with antibiotic prophylaxies. In this research, results of identification of bacteria in the transport fluid is reported, oral and intestinal floras and the antibiograms of the identified microorganisms are investigated. Al...

  19. Pentastomids of wild snakes in the Australian tropics ☆

    OpenAIRE

    Kelehear, Crystal; Spratt, David M.; O’Meally, Denis; Shine, Richard

    2013-01-01

    Pentastomids are endoparasites of the respiratory system of vertebrates, maturing primarily in carnivorous reptiles. Adult and larval pentastomids can cause severe pathology resulting in the death of their intermediate and definitive hosts. The study of pentastomids is a neglected field, impaired by risk of zoonoses, difficulties in species identification, and life cycle complexities. We surveyed wild snakes in the tropics of Australia to clarify which host species possess these parasites, an...

  20. Complete mitochondrial genome of a wild Siberian tiger.

    Science.gov (United States)

    Sun, Yujiao; Lu, Taofeng; Sun, Zhaohui; Guan, Weijun; Liu, Zhensheng; Teng, Liwei; Wang, Shuo; Ma, Yuehui

    2015-01-01

    In this study, the complete mitochondrial genome of Siberian tiger (Panthera tigris altaica) was sequenced, using muscle tissue obtained from a male wild tiger. The total length of the mitochondrial genome is 16,996 bp. The genome structure of this tiger is in accordance with other Siberian tigers and it contains 12S rRNA gene, 16S rRNA gene, 22 tRNA genes, 13 protein-coding genes, and 1 control region.