WorldWideScience

Sample records for wheat yellow rust

  1. Wheat Rust Toolbox Related to New Initiatives on Yellow Rust

    DEFF Research Database (Denmark)

    Hansen, Jens Grønbech; Lassen, Poul

    ://www.fao.org/agriculture/crops/rust/stem/rust-report/en/). The Wheat rust toolbox is one of several International research platforms hosted by Aarhus University, and it uses the same ICT framework and databases as EuroWheat (www.eurowheat.org) and EuroBlight (www.EuroBlight.net). The Wheat Rust Toolbox will also serve the Global Rust Reference Centre (GRRC) as well...... – 2009), and as soon as possible this will be expanded to cover all global yellow rust data available via the GRRC. The presentation will focus on experiences from the previous work on global databases and web based information systems, as well as propose ideas how the toolbox can be helpful regarding...

  2. Sources of resistance to yellow rust and stem rust in wheat-alien introgressions

    OpenAIRE

    Rahmatov, Mahbubjon

    2013-01-01

    Wheat is the staple food and the main source of caloric intake in most developing countries, and thereby an important source in order to maintain food security for the growing populations in those countries. Stem rust Puccinia graminis f. sp. tritici, and yellow rust P. striiformis f. sp. tritici of wheat continues to cause severe damage locally and globally, thereby contributing to food insecurity. In this paper biology and taxonomy of stem rust and yellow rust, breeding for resistance, util...

  3. Protein modeling of yellow rust disease in wheat

    International Nuclear Information System (INIS)

    Aziz, S.E.; Bano, R.; Zayed, M.E.; Elshikh, M.S.; Khan, M.H.; Chaudhry, Z.

    2017-01-01

    Wheat production in Pakistan is affected by yellow rust disease caused by a fungus Puccinia striiformis. There is a need to broaden the genetic basis of wheat by identifying new resistance genes. The present study was aimed to identify an alternate resistance gene for yellow rust disease in wheat caused by Puccinia striiformis. Genome sequence was compared with databases and similar gene was identified for disease resistance in rye plant. Structural analysis of RGA1 gene (resistance gene in wheat) was carried out using different bioinformatics tools and an alternative gene having same structure was identified on the basis of structural and sequence homology. Rye plant is the proposed plant for the alternate new resistance gene. The result of pairwise alignment of RGA1 gene in wheat and gene of rye plant is 94.2% with accession DQ494535 .The secondary structures of both the genes was compared and found similar to each other. These comparisons between the wheat resistance gene and gene from rye plant depict structural similarities between the two genes. Results of RGA1 gene's structural analysis in wheat is as follow: Helices: 59, Extended sheets: 30, Turns: 12, Coils: 13 and for alternate resistance genes in Rye is as follow: Helices: 52, Extended sheets: 30, Turns: 14, Coils: 17. As structures are similar, the alternate identified gene could be used for resistance in wheat. (author)

  4. Resistance Potential of Bread Wheat Genotypes Against Yellow Rust Disease Under Egyptian Climate.

    Science.gov (United States)

    Mahmoud, Amer F; Hassan, Mohamed I; Amein, Karam A

    2015-12-01

    Yellow rust (stripe rust), caused by Puccinia striiformis f. sp. tritici, is one of the most destructive foliar diseases of wheat in Egypt and worldwide. In order to identify wheat genotypes resistant to yellow rust and develop molecular markers associated with the resistance, fifty F8 recombinant inbred lines (RILs) derived from a cross between resistant and susceptible bread wheat landraces were obtained. Artificial infection of Puccinia striiformis was performed under greenhouse conditions during two growing seasons and relative resistance index (RRI) was calculated. Two Egyptian bread wheat cultivars i.e. Giza-168 (resistant) and Sakha-69 (susceptible) were also evaluated. RRI values of two-year trial showed that 10 RILs responded with RRI value >6 2 rust. However, further molecular analyses would be performed to confirm markers associated with the resistance and suitable for marker-assisted selection. Resistant RILs identified in the study could be efficiently used to improve the resistance to yellow rust in wheat.

  5. New Spectral Index for Detecting Wheat Yellow Rust Using Sentinel-2 Multispectral Imagery

    Directory of Open Access Journals (Sweden)

    Qiong Zheng

    2018-03-01

    Full Text Available Yellow rust is one of the most destructive diseases for winter wheat and has led to a significant decrease in winter wheat quality and yield. Identifying and monitoring yellow rust is of great importance for guiding agricultural production over large areas. Compared with traditional crop disease discrimination methods, remote sensing technology has proven to be a useful tool for accomplishing such a task at large scale. This study explores the potential of the Sentinel-2 Multispectral Instrument (MSI, a newly launched satellite with refined spatial resolution and three red-edge bands, for discriminating between yellow rust infection severities (i.e., healthy, slight, and severe in winter wheat. The corresponding simulative multispectral bands for the Sentinel-2 sensor were calculated by the sensor’s relative spectral response (RSR function based on the in situ hyperspectral data acquired at the canopy level. Three Sentinel-2 spectral bands, including B4 (Red, B5 (Re1, and B7 (Re3, were found to be sensitive bands using the random forest (RF method. A new multispectral index, the Red Edge Disease Stress Index (REDSI, which consists of these sensitive bands, was proposed to detect yellow rust infection at different severity levels. The overall identification accuracy for REDSI was 84.1% and the kappa coefficient was 0.76. Moreover, REDSI performed better than other commonly used disease spectral indexes for yellow rust discrimination at the canopy scale. The optimal threshold method was adopted for mapping yellow rust infection at regional scales based on realistic Sentinel-2 multispectral image data to further assess REDSI’s ability for yellow rust detection. The overall accuracy was 85.2% and kappa coefficient was 0.67, which was found through validation against a set of field survey data. This study suggests that the Sentinel-2 MSI has the potential for yellow rust discrimination, and the newly proposed REDSI has great robustness and

  6. New Spectral Index for Detecting Wheat Yellow Rust Using Sentinel-2 Multispectral Imagery.

    Science.gov (United States)

    Zheng, Qiong; Huang, Wenjiang; Cui, Ximin; Shi, Yue; Liu, Linyi

    2018-03-15

    Yellow rust is one of the most destructive diseases for winter wheat and has led to a significant decrease in winter wheat quality and yield. Identifying and monitoring yellow rust is of great importance for guiding agricultural production over large areas. Compared with traditional crop disease discrimination methods, remote sensing technology has proven to be a useful tool for accomplishing such a task at large scale. This study explores the potential of the Sentinel-2 Multispectral Instrument (MSI), a newly launched satellite with refined spatial resolution and three red-edge bands, for discriminating between yellow rust infection severities (i.e., healthy, slight, and severe) in winter wheat. The corresponding simulative multispectral bands for the Sentinel-2 sensor were calculated by the sensor's relative spectral response (RSR) function based on the in situ hyperspectral data acquired at the canopy level. Three Sentinel-2 spectral bands, including B4 (Red), B5 (Re1), and B7 (Re3), were found to be sensitive bands using the random forest (RF) method. A new multispectral index, the Red Edge Disease Stress Index (REDSI), which consists of these sensitive bands, was proposed to detect yellow rust infection at different severity levels. The overall identification accuracy for REDSI was 84.1% and the kappa coefficient was 0.76. Moreover, REDSI performed better than other commonly used disease spectral indexes for yellow rust discrimination at the canopy scale. The optimal threshold method was adopted for mapping yellow rust infection at regional scales based on realistic Sentinel-2 multispectral image data to further assess REDSI's ability for yellow rust detection. The overall accuracy was 85.2% and kappa coefficient was 0.67, which was found through validation against a set of field survey data. This study suggests that the Sentinel-2 MSI has the potential for yellow rust discrimination, and the newly proposed REDSI has great robustness and generalized ability

  7. Survey the Effect of Mycorrhiza and Azospirillum of Wheat Cultivars Resistance in Yellow Rust

    Directory of Open Access Journals (Sweden)

    M. Jiriaie

    2017-01-01

    Full Text Available Introduction: Wheat is one of the major agricultural crops with respect to human nutrition. It is cultivated over a wide range of environments, because of wide adaptation to diverse environmental conditions. In Iran, 6.2 million hectares are under wheat cultivation, of which 33% is irrigated and 67% is rain-fed, the irrigated wheat growing areas (2 million hectares are located mostly in southern, central and east of Iran Production of crops is under the influence of plant genetic structure, environmental conditions and their interactions. Biotic and abiotic stresses are considered to lower production. Among the biotic stress, the fungal disease is the main factor limiting production of crop plants in hot and humid regions. Stripe rust was not a serious economic concern to the wheat industry for most of the 1990’s due to the use of resistant varieties. However, by 2003 it had developed into a significant issue, particularly as new path types evolved. Even in the dry years of 2003 and 2004, stripe rust cost growers significant income. Provide country's need for wheat as a strategic product, meanwhile, production is free from chemical fungicide is a high but achievable goal. So in order to achieve fertilizer and fungicide resources that in addition to having no adverse effects on consumers and the environment, has been economically able to provide nutrition need of crop plant, is very important. Materials and Methods: With this approach, to survey the effect of Mycorrhiza and Azospirillum in resistance to yellow rust in wheat cultivars, an experiment was conducted at the research station of the Shahid Chamran University of Ahvaz, Iran in 2012-13. The experimental design was factorial based on a randomized complete block design with three replications. The treatments include of Mycorrhiza fungi in three levels (without application of Mycorrhiza strain and using strain Glomus intraradices and Glomus mosseae, Azospirillum lipoferum bacterium in two

  8. Prediction of yield losses in wheat (triticum aestivum l.) caused by yellow rust in relation to epidemiological factors in Faisalabad

    International Nuclear Information System (INIS)

    Ahmad, S.; Afzal, M.; Noorka, I.R.; Iqbal, Z.; Akhtar, N.; Iiftikhar, Y.; Kamran, M.

    2010-01-01

    Thirty six genotypes were screened against yellow rust to check their level of susceptibility or resistance. Among 36 genotypes screened against yellow rust, 18 were susceptible, 6 were moderately susceptible to susceptible, 7 were moderately resistant to moderately susceptible and 5 genotypes remained resistant. Yield losses were predicted in wheat on the basis of varying level of yellow rust severities. It was observed that susceptible genotypes showed higher yield losses as compared to resistant genotypes. Maximum severity of 90% of yellow rust resulted in 54% to 55% calculated and predicted losses, respectively. While 40, 50, 60 and 70% disease severity of yellow rust caused 35-34%, 38-37%, 42-40% and 46-47% calculated and predicted losses, respectively. However, the decline in losses was observed as the genotypes changed their reaction from susceptible to moderate susceptible. Similarly, losses were diminished as the varieties/lines showed moderate resistant reaction from moderate susceptible. Minimum temperature and relative humidity remained positively correlated while the maximum temperature showed negative correlation with stripe rust severity. With the increase of minimum temperature and relative humidity a rise up in stripe rust infection was seen while as the maximum temperature increased stripe rust infection decreased on different genotypes. It may be concluded from the study that environmental factors played major role in the spread of the disease which result in yield losses. (author)

  9. Yellow Rust Resistance in Advanced Lines and Commercial ...

    African Journals Online (AJOL)

    The objective of this study was to characterize seedling yellow rust resistance in 21 advanced bread wheat lines and 20 cultivars from Ethiopia. Yellow rust infection types (ITs) produced on test wheat lines and cultivars from nine yellow rust races were compared with ITs produced on standard differential lines that differed ...

  10. Identification and characterization of resistance to yellow rust and powdery mildew in wild emmer wheat and their transfer to bread wheat

    NARCIS (Netherlands)

    Silfhout, van C.H.

    1989-01-01

    In wild emmer wheat three different kinds of genes for resistance to yellow rust were found, namely genes causing overall resistance, genes causing adult-plant resistance and genes which induce resistance detectable at higher temperatures. At least eleven different and probably novel major

  11. Gene effects and combining ability in some bread wheat genotypes to yellow rust disease.

    Science.gov (United States)

    Razavi, A R; Taeb, M; Afshari, F; Khavari, S; Abbaspoor, M

    2009-01-15

    Ten wheat lines were studied to determine gene effects and combining ability in some bread wheat genotypes to yellow rust disease. Ten parental lines and F1 were evaluated in a randomized complete block design with three replications in Agricultural and Natural Resources Research Center, Mashhad, Iran. Two races (134E134A+ and 4E0A+) were used for this study. Latent Period (LP) and Infection Type (IT) were measured in the field and greenhouse. Results showed significant differences between races in their pathogenicity and between genotypes in their resistance to the pathogen. Diallel cross carried out between the parents and progenies and thereafter were analyzed by the method of Griffing and Haymans. The General Combining Ability (GCA) and Special Combining Ability (SCA) for all traits were significant and showed additive variance was more important. Test for validity of diallel hypothesis proved epistasis effect for all traits. P1, P2 and F1 showed significant difference between all traits in generations mean analysis. Average degree of dominance ranged from partial to over dominance for resistance or susceptibility. Dominance, additive and epistatic types of gene action were responsible for the genetic control of the traits. However, except for additive-additive component, non-additive effect of genes could not be fixed by self-fertilization.

  12. 29-34 Yellow Rust Resistance in Advanced Lines and Commercial ...

    African Journals Online (AJOL)

    rust pathogen. The objective of this study was to characterize seedling yellow rust resistance in 21 advanced bread wheat lines and 20 cultivars from Ethiopia. Yellow rust infection types (ITs) produced on test wheat lines and cultivars from nine yellow rust races were compared with ITs produced on standard differential lines ...

  13. Identification and evaluation of resistance to powdery mildew and yellow rust in a wheat mapping population.

    Directory of Open Access Journals (Sweden)

    Lijun Yang

    Full Text Available Deployment of cultivars with genetic resistance is an effective approach to control the diseases of powdery mildew (PM and yellow rust (YR. Chinese wheat cultivar XK0106 exhibits high levels of resistance to both diseases, while cultivar E07901 has partial, adult plant resistance (APR. The aim of this study was to map resistance loci derived from the two cultivars and analyze their effects against PM and YR in a range of environments. A doubled haploid population (388 lines was used to develop a framework map consisting of 117 SSR markers, while a much higher density map using the 90K Illumina iSelect SNP array was produced with a subset of 80 randomly selected lines. Seedling resistance was characterized against a range of PM and YR isolates, while field scores in multiple environments were used to characterize APR. Composite interval mapping (CIM of seedling PM scores identified two QTLs (QPm.haas-6A and QPm.haas-2A, the former being located at the Pm21 locus. These QTLs were also significant in field scores, as were Qpm.haas-3A and QPm.haas-5A. QYr.haas-1B-1 and QYr.haas-2A were identified in field scores of YR and were located at the Yr24/26 and Yr17 chromosomal regions respectively. A second 1B QTL, QYr.haas-1B-2 was also identified. QPm.haas-2A and QYr.haas-1B-2 are likely to be new QTLs that have not been previously identified. Effects of the QTLs were further investigated in multiple environments through the testing of selected lines predicted to contain various QTL combinations. Significant additive interactions between the PM QTLs highlighted the ability to pyramid these loci to provide higher level of resistance. Interactions between the YR QTLs gave insights into the pathogen populations in the different locations as well as showing genetic interactions between these loci.

  14. Grain yield losses in yellow-rusted durum wheat estimated using digital and conventional parameters under field conditions

    Directory of Open Access Journals (Sweden)

    Omar Vergara-Diaz

    2015-06-01

    Full Text Available The biotrophic fungus Puccinia striiformis f. sp. tritici is the causal agent of the yellow rust in wheat. Between the years 2010–2013 a new strain of this pathogen (Warrior/Ambition, against which the present cultivated wheat varieties have no resistance, appeared and spread rapidly. It threatens cereal production in most of Europe. The search for sources of resistance to this strain is proposed as the most efficient and safe solution to ensure high grain production. This will be helped by the development of high performance and low cost techniques for field phenotyping. In this study we analyzed vegetation indices in the Red, Green, Blue (RGB images of crop canopies under field conditions. We evaluated their accuracy in predicting grain yield and assessing disease severity in comparison to other field measurements including the Normalized Difference Vegetation Index (NDVI, leaf chlorophyll content, stomatal conductance, and canopy temperature. We also discuss yield components and agronomic parameters in relation to grain yield and disease severity. RGB-based indices proved to be accurate predictors of grain yield and grain yield losses associated with yellow rust (R2 = 0.581 and R2 = 0.536, respectively, far surpassing the predictive ability of NDVI (R2 = 0.118 and R2 = 0.128, respectively. In comparison to potential yield, we found the presence of disease to be correlated with reductions in the number of grains per spike, grains per square meter, kernel weight and harvest index. Grain yield losses in the presence of yellow rust were also greater in later heading varieties. The combination of RGB-based indices and days to heading together explained 70.9% of the variability in grain yield and 62.7% of the yield losses.

  15. Molecular and genetic study of wheat rusts | Le Maitre | African ...

    African Journals Online (AJOL)

    Puccinia triticina, Puccinia graminis and Puccinia striiformis cause leaf, stem and yellow rust, respectively. Wheat rusts can cause losses as high as 70%. The rusts ability to evolve fungicide resistance has resulted in the use of resistant cultivars as the primary method of control. Breeding resistant cultivars is a long process ...

  16. Evaluation of wavelet spectral features in pathological detection and discrimination of yellow rust and powdery mildew in winter wheat with hyperspectral reflectance data

    Science.gov (United States)

    Shi, Yue; Huang, Wenjiang; Zhou, Xianfeng

    2017-04-01

    Hyperspectral absorption features are important indicators of characterizing plant biophysical variables for the automatic diagnosis of crop diseases. Continuous wavelet analysis has proven to be an advanced hyperspectral analysis technique for extracting absorption features; however, specific wavelet features (WFs) and their relationship with pathological characteristics induced by different infestations have rarely been summarized. The aim of this research is to determine the most sensitive WFs for identifying specific pathological lesions from yellow rust and powdery mildew in winter wheat, based on 314 hyperspectral samples measured in field experiments in China in 2002, 2003, 2005, and 2012. The resultant WFs could be used as proxies to capture the major spectral absorption features caused by infestation of yellow rust or powdery mildew. Multivariate regression analysis based on these WFs outperformed conventional spectral features in disease detection; meanwhile, a Fisher discrimination model exhibited considerable potential for generating separable clusters for each infestation. Optimal classification returned an overall accuracy of 91.9% with a Kappa of 0.89. This paper also emphasizes the WFs and their relationship with pathological characteristics in order to provide a foundation for the further application of this approach in monitoring winter wheat diseases at the regional scale.

  17. Reaction of Rust on Some Bread Wheat Varieties in Çukurova Region

    OpenAIRE

    AY, Hasan

    2013-01-01

    This study was conducted with 126 varieties of wheat between 2009-2010 years in Adana. There has not been artificially inoculated yellow, leaf and stem rusts. Races of rust in natural were evaluated in both years. Between 2009-2010 this study was conducted in Adana, with 126 varieties of bread wheat. In both years, only the natural environment leaf rust races inoculated for assessments reactions of bread wheat. According to results, 49 bread wheat varieties were found resistant, 6 bread wheat...

  18. Genetic analysis of rust resistance genes in global wheat cultivars: an overview

    International Nuclear Information System (INIS)

    Aktar-Uz-Zaman, Md; Tuhina-Khatun, Mst; Hanafi, Mohamed Musa; Sahebi, Mahbod

    2017-01-01

    Rust is the most devastating fungal disease in wheat. Three rust diseases, namely, leaf or brown rust caused by Puccinia triticina Eriks, stem or black rust caused by Puccinia graminis f. sp. tritici West, and stripe or yellow rust caused by Puccinia striiformis f. Tritici Eriks, are the most economically significant and common diseases among global wheat cultivars. Growing cultivars resistant to rust is the most sustainable, cost-effective and environmentally friendly approach for controlling rust diseases. To date, more than 187 rust resistance genes (80 leaf rust, 58 stem rust and 49 stripe rust) have been derived from diverse wheat or durum wheat cultivars and the related wild species using different molecular methods. This review provides a detailed discussion of the different aspects of rust resistance genes, their primitive sources, their distribution in global wheat cultivars and the importance of durable resistant varieties for controlling rust diseases. This information will serve as a foundation for plant breeders and geneticists to develop durable rust-resistant wheat varieties through marker-assisted breeding or gene pyramiding

  19. A change in temperature modulates defence to yellow (stripe) rust in wheat line UC1041 independently of resistance gene Yr36.

    Science.gov (United States)

    Bryant, Ruth R M; McGrann, Graham R D; Mitchell, Alice R; Schoonbeek, Henk-Jan; Boyd, Lesley A; Uauy, Cristobal; Dorling, Steve; Ridout, Christopher J

    2014-01-08

    Rust diseases are of major importance in wheat production worldwide. With the constant evolution of new rust strains and their adaptation to higher temperatures, consistent and durable disease resistance is a key challenge. Environmental conditions affect resistance gene performance, but the basis for this is poorly understood. Here we show that a change in day temperature affects wheat resistance to Puccinia striiformis f. sp tritici (Pst), the causal agent of yellow (or stripe) rust. Using adult plants of near-isogenic lines UC1041 +/- Yr36, there was no significant difference between Pst percentage uredia coverage in plants grown at day temperatures of 18°C or 25°C in adult UC1041 + Yr36 plants. However, when plants were transferred to the lower day temperature at the time of Pst inoculation, infection increased up to two fold. Interestingly, this response was independent of Yr36, which has previously been reported as a temperature-responsive resistance gene as Pst development in adult UC1041 -Yr36 plants was similarly affected by the plants experiencing a temperature reduction. In addition, UC1041 -Yr36 plants grown at the lower temperature then transferred to the higher temperature were effectively resistant and a temperature change in either direction was shown to affect Pst development up to 8 days prior to inoculation. Results for seedlings were similar, but more variable compared to adult plants. Enhanced resistance to Pst was observed in seedlings of UC1041 and the cultivar Shamrock when transferred to the higher temperature. Resistance was not affected in seedlings of cultivar Solstice by a temperature change in either direction. Yr36 is effective at 18°C, refining the lower range of temperature at which resistance against Pst is conferred compared to previous studies. Results reveal previously uncharacterised defence temperature sensitivity in the UC1041 background which is caused by a change in temperature and independently of Yr36. This novel

  20. Studies on stem and leaf rust resistance in wheat

    International Nuclear Information System (INIS)

    Knott, D.R.

    1983-01-01

    Stem and leaf rust resistance was successfully transferred from Agropyron to wheat by radiation-induced translocations. Mutation induction subsequently proved to be useful in separating an undesired gene for yellow pigment from the resistance. The homoeologous pairing mutant obtained by Sears was also used successfully in obtaining transfers through crossing-over between wheat and Agropyron chromosomes. Another experimental series succeeded in accumulating minor genes for rust resistance, after eliminating major genes for specific resistance. The resistance is polygenic and widely effective although not general. It is recessively inherited, and hoped to be more durable than major gene resistance used so far in the Canadian prairies. An attempt to induce mutations for leaf rust resistance in a small-scale experiment with leading Canadian wheat varieties Manitou and Neepawa using gamma rays and EMS has not been successful. (author)

  1. Development of RAPD based markers for wheat rust resistance ...

    African Journals Online (AJOL)

    Rust diseases are the major cause of low yield of wheat in Pakistan. Wheat breeders all over the world as well as in Pakistan are deriving rust resistance genes from alien species like Triticum ventricosum and introducing them in common wheat (Triticum aestivum). One such example is the introgression of rust resistance ...

  2. Evidence for Increased Aggressiveness in a Recent Widespread Strain of Puccinia striiformis f. sp. tritici Causing Stripe Rust of Wheat

    DEFF Research Database (Denmark)

    Milus, Eugene A; Kristensen, Kristian; Hovmøller, Mogens S

    2009-01-01

    Stripe rust (yellow rust) of wheat, caused by Puccinia striiformis f. sp. tritici, has become more severe in eastern United States, Australia, and elsewhere since 2000. Recent research has shown that this coincided with a global spread of two closely related strains that were similar based on vir...... that wheat rust fungi can adapt to warmer temperatures and cause severe disease in previously unfavorable environments......Stripe rust (yellow rust) of wheat, caused by Puccinia striiformis f. sp. tritici, has become more severe in eastern United States, Australia, and elsewhere since 2000. Recent research has shown that this coincided with a global spread of two closely related strains that were similar based...... regimes for latent period, lesion length, lesion width, lesion area, and spore production on adult plants of a susceptible wheat cultivar with no known genes for resistance to stripe rust. "New" isolates (since 2000) were significantly more aggressive than "old" isolates (before 2000) for all variables...

  3. development of wheat germplasm for stem rust resistance in eastern ...

    African Journals Online (AJOL)

    ACSS

    Wheat (Triticum aestivum) rust outbreak is the primary production constraint in Eastern Africa. Ethiopia, Kenya and Uganda are hot spots for the epidemic of rusts, due to higher rates of evolution of new pathogen races, especially of the virulent stem rust (Puccinia graminis) race, Ug99. The objective of this study was to ...

  4. Development of wheat germplasm for stem rust resistance in eastern ...

    African Journals Online (AJOL)

    Wheat (Triticum aestivum) rust outbreak is the primary production constraint in Eastern Africa. Ethiopia, Kenya and Uganda are hot spots for the epidemic of rusts, due to higher rates of evolution of new pathogen races, especially of the virulent stem rust (Puccinia graminis) race, Ug99. The objective of this study was to ...

  5. Rust resistance evaluation of advanced wheat (triticum aestivum l.) genotypes using pcr-based dna markers

    International Nuclear Information System (INIS)

    Rahman, S.U.; Younis, M.; Iqbal, M.Z.; Nawaz, M.

    2014-01-01

    The most effective and environmental friendly approach for the control of wheat rust disease is the use of resistant genotypes. The present study was conducted to explore rust resistance potential of 85 elite wheat genotypes (36 varieties and 49 advanced lines) using various types of DNA markers like STS, SCAR and SSR. DNA markers linked with different genes conferring resistance to rusts (Leaf rust=Lr, Yellow rust=Yr and Stem rust=Sr) were employed in this study. A total of 18 genes, consisting of eleven Lr (lr1, lr10, lr19, lr21, lr28, lr34, lr39, lr46, lr47, lr51 and lr52), four Yr (yr5, yr18, yr26 and yr29) and three Sr genes (sr2, sr29, and sr36) were studied through linked DNA markers. Maximum number of Lr genes was found in 17 advanced lines and 9 varieties, Yr genes in 26 advanced lines and 20 wheat varieties, and Sr genes in 43 advanced lines and 27 varieties. Minimum number of Lr genes was found in advanced line D-97 and variety Kohinoor-83, Yr genes in wheat variety Bwp-97 and Sr genes in 6 advanced lines and 8 varieties. Molecular data revealed that genotypes having same origin, from a specified area showed resistance for similar type of genes. In this study, an average similarity of 84% was recorded among wheat genotypes. Out of 18 loci, 15 were found to be polymorphic. (author)

  6. Molecular and genetic study of wheat rusts | Le Maitre | African ...

    African Journals Online (AJOL)

    Microsatellite markers were used to differentiate P. triticina and P. striiformis pathotypes. Amplified fragment length polymorphisms (AFLP) were used to differentiate stem rust P. graminis pathotypes. Phylogenetic trees were created for leaf and stem rust pathotypes. Field isolates of leaf, stem and yellow rust were collected ...

  7. Determination of rust resistance genes in pakistani bread wheats

    International Nuclear Information System (INIS)

    Qamar, M.; Ahmad, S.D.; Rabbani, M.A.; Shinwari, Z.K.

    2014-01-01

    Stripe and leaf rusts are the major constraints to bread wheat production in Pakistan. Molecular markers were used to investigate the presence of leaf rust and stripe rust resistance gene cluster Lr34/Yr18 and stem rust resistance gene Sr2 in 52 Pakistani bread wheat cultivars/lines. PCR amplification of DNA fragments using DNA marker csLV-34 showed that 13 of the studied cultivars/lines, namely 03FJ26, NR 337, NR 339, NR 347, NR 350, Manthar, Margalla 99, Iqbal 2000, Saleem 2000, Wafaq 2001, Marwat 2001, Pirsabak 2004 and Fareed 2006 carry leaf rust and stripe rust resistance genes Lr34/Yr18. Stem rust resistance gene Sr2 was observed in 36 Pakistani spring wheat cultivars/lines using stm560.3tgag marker. The slow rusting gene Sr2 needs to be combined with additional stem rust resistance genes to establish durable resistance against Ug99 in modern wheat cultivars. Low frequency of Lr34/Yr18 was found in Pakistani wheats. This gene cluster needs to be incorporated into Pakistani wheats for durable rust resistance. (author)

  8. stem rust seedling resistance genes in ethiopian wheat cultivars

    African Journals Online (AJOL)

    Prof. Adipala Ekwamu

    Stem rust caused by Puccinia graminis f. sp. tritici is one of the major biotic limiting factors for wheat production in Ethiopia. Host plant resistance is the best option to manage stem rust from its economic and environmental points of view. Wheat cultivars are released for production without carrying race specific tests against ...

  9. Reação de cultivares de trigo à ferrugem da folha e mancha amarela e responsividade a fungicidas Reaction of wheat cultivars to leaf rust and yellow spot and responsiveness to fungicides

    Directory of Open Access Journals (Sweden)

    Nédio Rodrigo Tormen

    2013-02-01

    Full Text Available Com o objetivo de avaliar a reação de cultivares de trigo à ferrugem da folha, causada por Puccinia triticina, e mancha amarela, causada por Drechslera tritici-repentis, e sua responsividade ao controle químico com fungicidas, foi conduzido experimento de campo durante os invernos de 2009 e 2010, Itaara-RS. As cultivares avaliadas foram 'FCEP 51', 'FCEP 52', 'CD 114', 'FCEP Campo Real', 'FCEP Cristalino', 'FCEP Nova Era', 'OR Marfim', 'OR Abalone', 'OR Safira' e 'OR Pampeano'; na safra 2010, a cultivar 'CD 114' foi substituída pela OR Quartzo. Os tratamentos avaliados foram: P1 - testemunha sem aplicação de fungicida; P2 - fempropimorfe (560g ha-1 de i.a.; P3 - azoxistrobina + ciproconazol (60+24g ha-1 de i.a.; e P4 - piraclostrobina + metconazol (60+97,5g ha-1 de i.a.. Após a segunda aplicação, efetuaram-se avaliações semanais de severidade das doenças, cujos dados foram utilizados para o cálculo da Área Abaixo da Curva de Progresso da Doença (AACPD. Também foram determinados a produtividade e o peso do hectolitro. No que se refere à suscetibilidade às doenças, as cultivares estudadas apresentaram respostas distintas de um ano para o outro. Para ferrugem, o comportamento mostrou-se similar em ambos os anos, enquanto que, para mancha amarela, houve variação. Quanto à resposta ao controle químico, ocorreram variações de acordo com o patógeno e com o grau de suscetibilidade das cultivares. O uso integrado de resistência genética e controle químico mostrou-se mais efetivo para ferrugem da folha.Aiming to evaluate the susceptibility of wheat cultivars to leaf rust and yellow spot and their responsiveness to chemical fungicides, two field trials were carried out, during 2009 and 2010 winter's. The cultivars evaluated were: 'FCEP 51', 'FCEP 52', 'CD114', 'FCEP Campo Real', 'FCEP Cristalino', 'FCEP Nova Era', 'OR Marfim', 'OR Abalone', 'OR Safira' and 'OR Pampeano'. In 2010, the 'CD 114' cultivar was replaced by Quartzo

  10. Remapping of the stripe rust resistance gene Yr10 in common wheat.

    Science.gov (United States)

    Yuan, Cuiling; Wu, Jingzheng; Yan, Baiqiang; Hao, Qunqun; Zhang, Chaozhong; Lyu, Bo; Ni, Fei; Caplan, Allan; Wu, Jiajie; Fu, Daolin

    2018-02-23

    Yr10 is an important gene to control wheat stripe rust, and the search for Yr10 needs to be continued. Wheat stripe rust or yellow rust is a devastating fungal disease caused by Puccinia striiformis f. sp. tritici (Pst). Host disease resistance offers a primary source for controlling wheat stripe rust. The stripe rust resistance gene Yr10 confers the race-specific resistance to most tested Pst races in China including CYR29. Early studies proposed that Yr10 was a nucleotide-binding site, leucine-rich repeat gene archived as GenBank accession AF149112 (hereafter designated the Yr10 candidate gene or Yr10 CG ). In this study, we revealed that 15 Chinese wheat cultivars positive for Yr10 CG are susceptible to CYR29. We then expressed the Yr10 CG cDNA in the common wheat 'Bobwhite'. The Yr10 CG -cDNA positive transgenic plants were also susceptible to CYR29. Thus, it is highly unlikely that Yr10 CG corresponds to the Yr10 resistance gene. Using the Yr10 donor 'Moro' and the Pst-susceptible wheat 'Huixianhong', we generated two F 3 populations that displayed a single Mendelian segregation on the Yr10 gene, and used them to remap the Yr10 gene. Six markers were placed in the Yr10 region, with the Yr10 CG gene now mapping about 1.2-cM proximal to the Yr10 locus and the Xsdauw79 marker is completely linked to the Yr10 locus. Apparently, the Yr10 gene has not yet been identified. Fine mapping and positional cloning of Yr10 is important for gene pyramiding for stripe rust resistance in wheat.

  11. Characterization of stem rust resistance gene Sr2 in Indian wheat ...

    African Journals Online (AJOL)

    Stem rust or black rust is one of the most important diseases of wheat worldwide. In India, central, peninsular and southern hill zones are particularly prone to stem rust where favourable environmental conditions exist. The recent emergence of wheat stem rust race Ug99 (TTKSK) and related strains threatens global wheat ...

  12. Stem rust seedling resistance genes in Ethiopian wheat cultivars ...

    African Journals Online (AJOL)

    Thirty durum wheat (19 commercial cultivars and 11 breeding lines) and 30 bread wheat (20 commercial cultivars and 10 breeding lines) were tested for gene postulation. Stem rust infection types produced on wheat cultivars and breeding lines by ten Pgt races was compared with infection types produced on 40 near ...

  13. Sources of stem rust resistance in Ethiopian tetraploid wheat ...

    African Journals Online (AJOL)

    Stem or black rust of wheat caused by the fungus Puccinia graminis f. sp. tritici Ericks and Henn (Pgt) is an important disease on wheat worldwide. Pgt is an obligate biotroph, heteroceous in its life cycle and heterothallic in mating type. Seedlings of 41 emmer (Triticum dicoccum), 56 durum (T. durum) wheat accessions were ...

  14. Leaf and stripe rust resistance among Ethiopian grown wheat ...

    African Journals Online (AJOL)

    The result indicated that 20 varieties and lines harbor resistance to the leaf rust and 26 to the stripe rust pathotypes showing infection types <2+. Twelve bread wheat varieties and lines (Et-13 A2, HAR 1407 [Tusie], HAR 1775 [Tura], HAR 1920, HAR 2192, HAR 2534, HAR 2536, HAR 2561, HAR 2563 and three durum lines ...

  15. Wheat rusts in the United States in 2016

    Science.gov (United States)

    In 2016, wheat stripe rust caused by Puccinia striiformis f. sp. graminis was widespread throughout the United States. Cool temperatures and abundant rainfall in the southern Great Plains allowed stripe rust to become widely established and spread throughout the Great Plains and eastern United State...

  16. Inheritance and bulked segregant analysis of leaf rust and stem rust resistance genes in eight durum wheat genotypes

    Science.gov (United States)

    Leaf rust, caused by Puccinia triticina (Pt) and stem rust caused by Puccinia graminis f. sp. tritici (Pgt) are important diseases of durum wheat. This study determined the inheritance and genomic locations of leaf rust resistance (Lr) genes to Pt-race BBBQJ and stem rust resistance (Sr) genes to Pg...

  17. Induced resistance and gene expression in wheat against leaf rust ...

    African Journals Online (AJOL)

    uvp

    2013-05-15

    May 15, 2013 ... 2Department of Soil, Crop and Climate Sciences, University of the Free State, P.O Box ... Key words: Wheat leaf rust, induced resistance, priming, gene ..... transformation: susceptibility of transgenic Nicotiana sylvestris plants.

  18. Molecular Characterization of wheat stem rust races in Kenya

    Science.gov (United States)

    Stem or black rust caused by Puccinia graminis f. sp. tritici (Pgt) Erikss. & Henning causes severe losses to wheat (Triticum aestivum L.), historically threatening global wheat production. Characterizing prevalent isolates of Pgt would enhance the knowledge of population dynamics and evolution of t...

  19. Lr67/Yr46 confers adult plant resistance to stem rust and powdery mildew in wheat.

    Science.gov (United States)

    Herrera-Foessel, Sybil A; Singh, Ravi P; Lillemo, Morten; Huerta-Espino, Julio; Bhavani, Sridhar; Singh, Sukhwinder; Lan, Caixia; Calvo-Salazar, Violeta; Lagudah, Evans S

    2014-04-01

    We demonstrate that Lr67/Yr46 has pleiotropic effect on stem rust and powdery mildew resistance and is associated with leaf tip necrosis. Genes are designated as Sr55, Pm46 and Ltn3 , respectively. Wheat (Triticum aestivum) accession RL6077, known to carry the pleiotropic slow rusting leaf and yellow rust resistance genes Lr67/Yr46 in Thatcher background, displayed significantly lower stem rust (P. graminis tritici; Pgt) and powdery mildew (Blumeria graminis tritici; Bgt) severities in Kenya and in Norway, respectively, compared to its recurrent parent Thatcher. We investigated the resistance of RL6077 to stem rust and powdery mildew using Avocet × RL6077 F6 recombinant inbred lines (RILs) derived from two photoperiod-insensitive F3 families segregating for Lr67/Yr46. Greenhouse seedling tests were conducted with Mexican Pgt race RTR. Field evaluations were conducted under artificially initiated stem rust epidemics with Pgt races RTR and TTKST (Ug99 + Sr24) at Ciudad Obregon (Mexico) and Njoro (Kenya) during 2010-2011; and under natural powdery mildew epiphytotic in Norway at Ås and Hamar during 2011 and 2012. In Mexico, a mean reduction of 41 % on stem rust severity was obtained for RILs carrying Lr67/Yr46, compared to RILs that lacked the gene, whereas in Kenya the difference was smaller (16 %) but significant. In Norway, leaf tip necrosis was associated with Lr67/Yr46 and RILs carrying Lr67/Yr46 showed a 20 % reduction in mean powdery mildew severity at both sites across the 2 years of evaluation. Our study demonstrates that Lr67/Yr46 confers partial resistance to stem rust and powdery mildew and is associated with leaf tip necrosis. The corresponding pleiotropic, or tightly linked, genes, designated as Sr55, Pm46, and Ltn3, can be utilized to provide broad-spectrum durable disease resistance in wheat.

  20. Rust fungi on some poaceous weeds of wheat crops in Pakistan

    OpenAIRE

    NAJAM-UL-SEHAR AFSHAN*; ABDUL REHMAN NIAZI

    2013-01-01

    The article enlists common poaceous weeds found in wheat crop sand their specific parasitic rust fungi. In this study, four (04) plant taxa of Poaceae infected with rust fungi are collected from different wheat crops grown in different areas of Pakistan. The rust fungi are isolated, characterized and identified. All these host plants are known weeds of wheat crop in Pakistan. This work would help to identify and enlist the potential rust fungi on weeds of wheat crop that could be utilized to ...

  1. Inheritance and Bulked Segregant Analysis of Leaf Rust and Stem Rust Resistance in Durum Wheat Genotypes.

    Science.gov (United States)

    Aoun, Meriem; Kolmer, James A; Rouse, Matthew N; Chao, Shiaoman; Bulbula, Worku Denbel; Elias, Elias M; Acevedo, Maricelis

    2017-12-01

    Leaf rust, caused by Puccinia triticina, and stem rust, caused by P. graminis f. sp. tritici, are important diseases of durum wheat. This study determined the inheritance and genomic locations of leaf rust resistance (Lr) genes to P. triticina race BBBQJ and stem rust resistance (Sr) genes to P. graminis f. sp. tritici race TTKSK in durum accessions. Eight leaf-rust-resistant genotypes were used to develop biparental populations. Accessions PI 192051 and PI 534304 were also resistant to P. graminis f. sp. tritici race TTKSK. The resulting progenies were phenotyped for leaf rust and stem rust response at seedling stage. The Lr and Sr genes were mapped in five populations using single-nucleotide polymorphisms and bulked segregant analysis. Five leaf-rust-resistant genotypes carried single dominant Lr genes whereas, in the remaining accessions, there was deviation from the expected segregation ratio of a single dominant Lr gene. Seven genotypes carried Lr genes different from those previously characterized in durum. The single dominant Lr genes in PI 209274, PI 244061, PI387263, and PI 313096 were mapped to chromosome arms 6BS, 2BS, 6BL, and 6BS, respectively. The Sr gene in PI 534304 mapped to 6AL and is most likely Sr13, while the Sr gene in PI 192051 could be uncharacterized in durum.

  2. Prehaustorial and posthaustorial resistance to wheat leaf rust in diploid wheat

    NARCIS (Netherlands)

    Anker, C.C.

    2001-01-01

    In modern wheat cultivars, resistance to wheat leaf rust, Puccinia triticina , is either based on hypersensitivity resistance or on partial resistance. Hypersensitivity resistance in wheat is monogenic, often complete and posthaustorial: it is induced after the

  3. Wheat Rust Information Resources - Integrated tools and data for improved decision making

    DEFF Research Database (Denmark)

    Hodson, David; Hansen, Jens Grønbech; Lassen, Poul

    giving access to an unprecedented set of data for rust surveys, alternate hosts (barberry), rust pathotypes, trap nurseries and resistant cultivars. Standardized protocols for data collection have permitted the development of a comprehensive data management system, named the Wheat Rust Toolbox....... Integration of the CIMMYT Wheat Atlas and the Genetic Resources Information System (GRIS) databases provides a rich resource on wheat cultivars and their resistance to important rust races. Data access is facilitated via dedicated web portals such as Rust Tracker (www.rusttracker.org) and the Global Rust...

  4. Induced mutations for resistance to leaf rust in wheat

    International Nuclear Information System (INIS)

    Borojevic, K.

    1983-01-01

    Problems related to the induction of mutations for disease resistance were investigated under several aspects, using the wheat/leaf rust system. Previously selected mutant lines, tested in M 11 and M 13 , were found to differ with regard to infection type and disease severity from the original varieties. To verify the induced-mutation origin, these mutants were examined further using test crosses with carriers of known genes for leaf rust resistance and electrophoresis. A separate experiment to induce mutations for leaf rust resistance in the wheat varieties Sava, Aurora and Siete Cerros, using gamma rays, fast neutrons and EMS, yielded mutants with different disease reaction in the varieties Sava and Aurora at a frequency of about 1x10 - 3 per M 1 plant progenies. (author)

  5. Identification of leaf rust resistant gene Lr10 in Pakistani wheat ...

    African Journals Online (AJOL)

    Leaf (brown) rust is the major disease of wheat in Pakistan and other countries. The disease is more effectively controlled when several rust resistance genes are pyramided into a single line. Molecular survey was conducted to screen 25 Pakistan wheat germplasm for the presence of leaf rust resistance gene Lr10 using ...

  6. Genetic characterization of stem rust resistance in a global spring wheat germplasm collection

    Science.gov (United States)

    Stem rust is considered one of the most damaging diseases of wheat. The recent emergence of the stem rust Ug99 race group poses a serious threat to world wheat production. Utilization of genetic resistance in cultivar development is the optimal way to control stem rust. Here we report association ma...

  7. Molecular and genetic study of wheat rusts

    African Journals Online (AJOL)

    Nicholas Le Maitre

    Phylogenetic trees were created for leaf and stem rust pathotypes. Field isolates of ... Key words: Prevalence, microsatellite, amplified fragment length polymorphisms (AFLP), phylogeny, Puccinia. INTRODUCTION. Puccinia triticina Eriks ..... Genetic distances and reconstruction phylogenetic trees from microsatellite DNA.

  8. Influence of yellow rust infection on /sup 32/P transport in detached barley leaves

    Energy Technology Data Exchange (ETDEWEB)

    Schubert, J. (Akademie der Landwirtschaftswissenschaften der DDR, Aschersleben. Inst. fuer Phytopathologie)

    1982-01-01

    Several barley cultivars (Hordeum vulgare L.) differing in their resistance to yellow rust (Puccinia striiformis West.) were tested for relationships between changes of /sup 32/P transport in detached leaves and resistance to yellow rust disease. Investigation carried out with detached second leaves from plants infected at their first leaf revealed a matter transport in these leaves changed by the infection. Transport was also influenced by inoculation with yellow rust uredospores. In that case rust infection influenced the basipetal transport less strongly in resistent plants than in susceptible ones. Connected with the findings the influence of fungal substances on transport processes is discussed in general.

  9. Influence of yellow rust infextion on 32P transport in detached barley leaves

    International Nuclear Information System (INIS)

    Schubert, J.

    1982-01-01

    Several barley cultivars (Hordeum vulgare L.) differing in their resistance to yellow rust (Puccinia striiformis West.) were tested for relationships between changes of 32 P transport in detached leaves and resistance to yellow rust disease. Investigation carried out with detached second leaves from plants infected at their first leaf revealed a matter transport in these leaves changed by the infection. Transport was also influenced by inoculation with yellow rust uredospores. In that case rust infection influenced the basipetal transport less strongly in resistent plants than in susceptible ones. Connected with the findings the influence of fungal substances on transport processes is discussed in general. (author)

  10. Dissection of the multigenic wheat stem rust resistance present in the Montenegrin spring wheat accession PI 362698

    Science.gov (United States)

    Research to identify and characterize stem rust resistance genes in common wheat, Triticum aestivum, has been stimulated by the emergence of Ug99-lineage races of the wheat stem rust pathogen, Puccinia graminis f. sp. tritici (Pgt), in Eastern Africa. The Montenegrin spring wheat landrace PI 362698 ...

  11. Induced mutations for rust resistance in bread wheat

    International Nuclear Information System (INIS)

    Sawhney, R.N.

    1989-01-01

    Full text: Seeds of variety ''Lalbahadur'' were treated with 0.04% NMH. M 2 plants were inoculated with a mixture of pathotypes of each of the 3 Puccinia species (P. graminis, P. recondita, P. striiformis). Plants with simultaneous resistance to all 3 rusts were selected. Repeated testing in subsequent generations confirmed the resistance. The mutant lines are morphologically similar to the parent cultivar and therefore could be used as components of a multiline variety. Comparison of variety pattern against the Indian pathotypes of rusts suggests that the mutant genes are different from the ones known already in bread wheat. (author)

  12. Effect of fungicide on the development of wheat stem rust and yield ...

    African Journals Online (AJOL)

    Stem rust caused by Puccinia graminis f.sp tritici Erik. & E. Henn. is a highly destructive disease of wheat (Triticum aestivum L.). The effects of fungicide application on stem rust (Puccinia graminis tritici) epidemics and yield of three bread wheat varieties varying in reaction to the disease were studied in two major wheat ...

  13. Genome-wide association mapping for stripe rust (Puccinia striiformis F. sp. tritici) in US Pacific Northwest winter wheat (Triticum aestivum L.).

    Science.gov (United States)

    Naruoka, Y; Garland-Campbell, K A; Carter, A H

    2015-06-01

    Potential novel and known QTL for race-specific all-stage and adult plant resistance to stripe rust were identified by genome-wide association mapping in the US PNW winter wheat accessions. Stripe rust (Puccinia striiformis F. sp. tritici; also known as yellow rust) is a globally devastating disease of wheat (Triticum aestivum L.) and a major threat to wheat production in the US Pacific Northwest (PNW), therefore both adult plant and all-stage resistance have been introduced into the winter wheat breeding programs in the PNW. The goal of this study was to identify quantitative trait loci (QTL) and molecular markers for these resistances through genome-wide association (GWAS) mapping in winter wheat accessions adapted to the PNW. Stripe rust response for adult plants was evaluated in naturally occurring epidemics in a total of nine environments in Washington State, USA. Seedling response was evaluated with three races under artificial inoculation in the greenhouse. The panel was genotyped with the 9K Illumina Wheat single nucleotide polymorphism (SNP) array and additional markers linked to previously reported genes and QTL for stripe rust resistance. The population was grouped into three sub-populations. Markers linked to Yr17 and previously reported QTL for stripe rust resistance were identified on chromosomes 1B, 2A, and 2B. Potentially novel QTL associated with race-specific seedling response were identified on chromosomes 1B and 1D. Potentially novel QTL associated with adult plant response were located on chromosomes 2A, 2B, 3B, 4A, and 4B. Stripe rust was reduced when multiple alleles for resistance were present. The resistant allele frequencies were different among sub-populations in the panel. This information provides breeders with germplasm and closely linked markers for stripe rust resistance to facilitate the transfer of multiple loci for durable stripe rust resistance into wheat breeding lines and cultivars.

  14. Effectors from Wheat Rust Fungi Suppress Multiple Plant Defense Responses.

    Science.gov (United States)

    Ramachandran, Sowmya R; Yin, Chuntao; Kud, Joanna; Tanaka, Kiwamu; Mahoney, Aaron K; Xiao, Fangming; Hulbert, Scot H

    2017-01-01

    Fungi that cause cereal rust diseases (genus Puccinia) are important pathogens of wheat globally. Upon infection, the fungus secretes a number of effector proteins. Although a large repository of putative effectors has been predicted using bioinformatic pipelines, the lack of available high-throughput effector screening systems has limited functional studies on these proteins. In this study, we mined the available transcriptomes of Puccinia graminis and P. striiformis to look for potential effectors that suppress host hypersensitive response (HR). Twenty small (wheat, confirming its activity in a homologous system. Overall, this study provides the first evidence for the presence of effectors in Puccinia species suppressing multiple plant defense responses.

  15. Genetic characterisation of novel resistance alleles to stem rust and stripe rust in wheat-alien introgression lines

    OpenAIRE

    Rahmatov, Mahbubjon

    2016-01-01

    Bread wheat (Triticum aestivum L., 2n = 6x = 42, AABBDD) is one of the most important food crops world-wide, but is attacked by many diseases and pests that cause significant yield losses. Globally, stem rust (Sr) (Puccinia graminis f. sp. tritici Erikss & E. Henning), stripe rust (Yr) (Puccinia striiformis Westend. f. sp. tritici Eriks) and leaf rust (Lr) (Puccinia triticina Eriks) are a great threat to wheat production. The majority of the Sr, Yr and Lr resistance genes are already defeated...

  16. Targeted introgression of stem rust Ug99 resistance from wheatgrasses into pasta and bread wheat

    Science.gov (United States)

    In the past 50 years, a number of stem rust resistance (Sr) genes have been transferred from several wheat-related grasses into durum (i.e. pasta) and bread wheat through chromosome translocations and additions. To utilize these genes for controlling the Ug99 races of the stem rust pathogen, we ini...

  17. Genetics of leaf rust resistance in the hard red winter wheat cultivars Santa Fe and Duster

    Science.gov (United States)

    Leaf rust caused by Puccinia triticina is a common and important disease of hard red winter wheat in the Great Plains of the United States. The hard red winter wheat cultivars 'Santa Fe' and 'Duster' have had effective leaf rust resistance since their release in 2003 and 2006, respectively. Both cul...

  18. Detection of wheat stem rust race RRTTF in Ecuador in 2016

    Science.gov (United States)

    Wheat stem rust is a devastating disease that has incited numerous severe epidemics resulting in extreme yield losses over the past century. Stem rust infection in plots of wheat line UC11075, known to carry the Sr38 resistance gene, was severe in February 2016 in a nursery at the Instituto Nacional...

  19. Genomic dissection of nonhost resistance to wheat stem rust in Brachypodium distachyon

    Science.gov (United States)

    Wheat stem rust caused by the fungus Puccinia graminis f.sp. tritici (Pgt) is a devastating disease that has largely been controlled for decades by the deployment of resistance genes. However, new races of this pathogen have emerged that overcome many important wheat stem rust resistance genes used ...

  20. Mapping genes for resistance to stripe rust in spring wheat landrace PI 480035

    Science.gov (United States)

    Stripe rust caused by Puccinia striiformis Westend. f. sp. tritici Erikks. is an economically important disease of wheat (Triticum aestivum L.). Hexaploid spring wheat landrace PI 480035 was highly resistant to stripe rust in the field in Washington during 2011 and 2012. The objective of this resear...

  1. Physical Localization of a Locus from Agropyron cristatum Conferring Resistance to Stripe Rust in Common Wheat.

    Science.gov (United States)

    Zhang, Zhi; Song, Liqiang; Han, Haiming; Zhou, Shenghui; Zhang, Jinpeng; Yang, Xinming; Li, Xiuquan; Liu, Weihua; Li, Lihui

    2017-11-13

    Stripe rust, caused by Puccinia striiformis f. sp. tritici ( Pst ), is one of the most destructive diseases of wheat ( Triticum aestivum L.) worldwide. Agropyron cristatum (L.) Gaertn. (2 n = 28, PPPP), one of the wild relatives of wheat, exhibits resistance to stripe rust. In this study, wheat- A . cristatum 6P disomic addition line 4844-12 also exhibited resistance to stripe rust. To identify the stripe rust resistance locus from A . cristatum 6P, ten translocation lines, five deletion lines and the BC₂F₂ and BC₃F₂ populations of two wheat- A . cristatum 6P whole-arm translocation lines were tested with a mixture of two races of Pst in two sites during 2015-2016 and 2016-2017, being genotyped with genomic in situ hybridization (GISH) and molecular markers. The result indicated that the locus conferring stripe rust resistance was located on the terminal 20% of 6P short arm's length. Twenty-nine 6P-specific sequence-tagged-site (STS) markers mapped on the resistance locus have been acquired, which will be helpful for the fine mapping of the stripe rust resistance locus. The stripe rust-resistant translocation lines were found to carry some favorable agronomic traits, which could facilitate their use in wheat improvement. Collectively, the stripe rust resistance locus from A . cristatum 6P could be a novel resistance source and the screened stripe rust-resistant materials will be valuable for wheat disease breeding.

  2. Stripe rust and leaf rust resistance QTL mapping, epistatic interactions, and co-localization with stem rust resistance loci in spring wheat evaluated over three continents.

    Science.gov (United States)

    Singh, A; Knox, R E; DePauw, R M; Singh, A K; Cuthbert, R D; Campbell, H L; Shorter, S; Bhavani, S

    2014-11-01

    In wheat, advantageous gene-rich or pleiotropic regions for stripe, leaf, and stem rust and epistatic interactions between rust resistance loci should be accounted for in plant breeding strategies. Leaf rust (Puccinia triticina Eriks.) and stripe rust (Puccinia striiformis f. tritici Eriks) contribute to major production losses in many regions worldwide. The objectives of this research were to identify and study epistatic interactions of quantitative trait loci (QTL) for stripe and leaf rust resistance in a doubled haploid (DH) population derived from the cross of Canadian wheat cultivars, AC Cadillac and Carberry. The relationship of leaf and stripe rust resistance QTL that co-located with stem rust resistance QTL previously mapped in this population was also investigated. The Carberry/AC Cadillac population was genotyped with DArT(®) and simple sequence repeat markers. The parents and population were phenotyped for stripe rust severity and infection response in field rust nurseries in Kenya (Njoro), Canada (Swift Current), and New Zealand (Lincoln); and for leaf rust severity and infection response in field nurseries in Canada (Swift Current) and New Zealand (Lincoln). AC Cadillac was a source of stripe rust resistance QTL on chromosomes 2A, 2B, 3A, 3B, 5B, and 7B; and Carberry was a source of resistance on chromosomes 2B, 4B, and 7A. AC Cadillac contributed QTL for resistance to leaf rust on chromosome 2A and Carberry contributed QTL on chromosomes 2B and 4B. Stripe rust resistance QTL co-localized with previously reported stem rust resistance QTL on 2B, 3B, and 7B, while leaf rust resistance QTL co-localized with 4B stem rust resistance QTL. Several epistatic interactions were identified both for stripe and leaf rust resistance QTL. We have identified useful combinations of genetic loci with main and epistatic effects. Multiple disease resistance regions identified on chromosomes 2A, 2B, 3B, 4B, 5B, and 7B are prime candidates for further investigation and

  3. Attempts to induce mutations for resistance of wheat to mildew, stem rust and leaf rust

    International Nuclear Information System (INIS)

    Kiraly, Z.; Barabas, Z.

    1983-01-01

    Research carried out between 1971 and 1981 is summarized. Attempts to find induced mutants with full resistance to pathotype mixtures of the three pathogens were not successful. Reasons are discussed. Studies on wheat lines tolerant to stem rust infection led to the conclusion that this disease reaction may be often accompanied by a reduced number of infection sites and a longer lag period resulting in reduced spore production. Various selection methods have been evaluated. Selecting for the multigenic 'non race specific' way is promising. (author)

  4. Introgression of leaf rust and stripe rust resistance from Sharon goatgrass (Aegilops sharonensis Eig) into bread wheat (Triticum aestivum L.).

    Science.gov (United States)

    Millet, E; Manisterski, J; Ben-Yehuda, P; Distelfeld, A; Deek, J; Wan, A; Chen, X; Steffenson, B J

    2014-06-01

    Leaf rust and stripe rust are devastating wheat diseases, causing significant yield losses in many regions of the world. The use of resistant varieties is the most efficient way to protect wheat crops from these diseases. Sharon goatgrass (Aegilops sharonensis or AES), which is a diploid wild relative of wheat, exhibits a high frequency of leaf and stripe rust resistance. We used the resistant AES accession TH548 and induced homoeologous recombination by the ph1b allele to obtain resistant wheat recombinant lines carrying AES chromosome segments in the genetic background of the spring wheat cultivar Galil. The gametocidal effect from AES was overcome by using an "anti-gametocidal" wheat mutant. These recombinant lines were found resistant to highly virulent races of the leaf and stripe rust pathogens in Israel and the United States. Molecular DArT analysis of the different recombinant lines revealed different lengths of AES segments on wheat chromosome 6B, which indicates the location of both resistance genes.

  5. Slow rusting response of different wheat genotypes against the leaf rust in relation to epidemiological factors in Faisalabad

    International Nuclear Information System (INIS)

    Khan, M.A.; Haider, M.M.; Hussain, M.; Ahmad, S.

    2007-01-01

    Wheat genotypes were screened against leaf rust to evaluate slow rusting response. Among one hundred and sixty varieties/lines, 86 showed response to leaf rust while all other remained immune or showed no response. The slow rusting, wheat varieties/ lines displayed 20-40% severity level and these were Maxi-Pak65, Blue silver, Pothohar, Punjab81, Faisalabd-83, Shalimar-88, Kohnoor-83, Pasban-90, Inqilab-91, Uqab-99-94105, Punjab-76, Parwaz-94, HD2169, HD2179, HD2204, HD2285, Lr27+31, LrB, LR17, Lr14A, Lr15 and Yr1-E-1 while the fast rusting varieties/lines that showed severity level up to 90% were WL-711, Morocco, PAK-1, Punjab-85 and Chakwal-86 SA42, SA75, Lr1, Lr2A, Lr2B. Lr23, Lr3KA, Lr3g, Lr10, Lr18, Lr21, Lr24, Yr2-E35 and 95153 respectively. Slow rusting genotypes exhibited low AUDPC (200-400) values while fast rusters displayed high AUDPC (400-1500) values. Leaf rust severity displayed significant correlation with maximum and minimum temperatures, rainfall and sunshine radiation. It was observed that with an increase of these environmental conditions a significant increase in disease severity was recorded

  6. Identification and Severity Determination of Wheat Stripe Rust and Wheat Leaf Rust Based on Hyperspectral Data Acquired Using a Black-Paper-Based Measuring Method

    Science.gov (United States)

    Ruan, Liu; Wang, Rui; Liu, Qi; Ma, Zhanhong; Li, Xiaolong; Cheng, Pei; Wang, Haiguang

    2016-01-01

    It is important to implement detection and assessment of plant diseases based on remotely sensed data for disease monitoring and control. Hyperspectral data of healthy leaves, leaves in incubation period and leaves in diseased period of wheat stripe rust and wheat leaf rust were collected under in-field conditions using a black-paper-based measuring method developed in this study. After data preprocessing, the models to identify the diseases were built using distinguished partial least squares (DPLS) and support vector machine (SVM), and the disease severity inversion models of stripe rust and the disease severity inversion models of leaf rust were built using quantitative partial least squares (QPLS) and support vector regression (SVR). All the models were validated by using leave-one-out cross validation and external validation. The diseases could be discriminated using both distinguished partial least squares and support vector machine with the accuracies of more than 99%. For each wheat rust, disease severity levels were accurately retrieved using both the optimal QPLS models and the optimal SVR models with the coefficients of determination (R2) of more than 0.90 and the root mean square errors (RMSE) of less than 0.15. The results demonstrated that identification and severity evaluation of stripe rust and leaf rust at the leaf level could be implemented based on the hyperspectral data acquired using the developed method. A scientific basis was provided for implementing disease monitoring by using aerial and space remote sensing technologies. PMID:27128464

  7. Identification and Severity Determination of Wheat Stripe Rust and Wheat Leaf Rust Based on Hyperspectral Data Acquired Using a Black-Paper-Based Measuring Method.

    Science.gov (United States)

    Wang, Hui; Qin, Feng; Ruan, Liu; Wang, Rui; Liu, Qi; Ma, Zhanhong; Li, Xiaolong; Cheng, Pei; Wang, Haiguang

    2016-01-01

    It is important to implement detection and assessment of plant diseases based on remotely sensed data for disease monitoring and control. Hyperspectral data of healthy leaves, leaves in incubation period and leaves in diseased period of wheat stripe rust and wheat leaf rust were collected under in-field conditions using a black-paper-based measuring method developed in this study. After data preprocessing, the models to identify the diseases were built using distinguished partial least squares (DPLS) and support vector machine (SVM), and the disease severity inversion models of stripe rust and the disease severity inversion models of leaf rust were built using quantitative partial least squares (QPLS) and support vector regression (SVR). All the models were validated by using leave-one-out cross validation and external validation. The diseases could be discriminated using both distinguished partial least squares and support vector machine with the accuracies of more than 99%. For each wheat rust, disease severity levels were accurately retrieved using both the optimal QPLS models and the optimal SVR models with the coefficients of determination (R2) of more than 0.90 and the root mean square errors (RMSE) of less than 0.15. The results demonstrated that identification and severity evaluation of stripe rust and leaf rust at the leaf level could be implemented based on the hyperspectral data acquired using the developed method. A scientific basis was provided for implementing disease monitoring by using aerial and space remote sensing technologies.

  8. Sources of stem rust resistance in wheat-alien introgression lines

    Science.gov (United States)

    Stem rust, caused by Puccinia graminis f. sp. tritici, is one of the most devastating diseases of wheat and the novel highly virulent race of TTKSK and its lineage are threatening wheat production worldwide. The objective of the study was to identify new sources of resistance in wheat-alien introgre...

  9. Wheat stem rust in South Africa: Current status and future research ...

    African Journals Online (AJOL)

    . In South Africa, stem rust caused by Puccinia graminis Pers. f. sp. tritici. Eriks. & E. Henn. (Pgt) is an important disease of wheat. Records of stem rust occurrence in South Africa date back to the late 1720's, when it was first discovered in the ...

  10. Defeating the Warrior: genetic architecture of triticale resistance against a novel aggressive yellow rust race.

    Science.gov (United States)

    Losert, Dominik; Maurer, Hans Peter; Leiser, Willmar L; Würschum, Tobias

    2017-04-01

    Genome-wide association mapping of resistance against the novel, aggressive 'Warrior' race of yellow rust in triticale revealed a genetic architecture with some medium-effect QTL and a quantitative component, which in combination confer high levels of resistance on both leaves and ears. Yellow rust is an important destructive fungal disease in small grain cereals and the exotic 'Warrior' race has recently conquered Europe. The aim of this study was to investigate the genetic architecture of yellow rust resistance in hexaploid winter triticale as the basis for a successful resistance breeding. To this end, a diverse panel of 919 genotypes was evaluated for yellow rust infection on leaves and ears in multi-location field trials and genotyped by genotyping-by-sequencing as well as for known Yr resistance loci. Genome-wide association mapping identified ten quantitative trait loci (QTL) for yellow rust resistance on the leaves and seven of these also for ear resistance. The total genotypic variance explained by the QTL amounted to 44.0% for leaf and 26.0% for ear resistance. The same three medium-effect QTL were identified for both traits on chromosomes 1B, 2B, and 7B. Interestingly, plants pyramiding the resistance allele of all three medium-effect QTL were generally most resistant, but constitute less than 5% of the investigated triticale breeding material. Nevertheless, a genome-wide prediction yielded a higher predictive ability than prediction based on these three QTL. Taken together, our results show that yellow rust resistance in winter triticale is genetically complex, including both medium-effect QTL as well as a quantitative resistance component. Resistance to the novel 'Warrior' race of this fungal pathogen is consequently best achieved by recurrent selection in the field based on identified resistant lines and can potentially be assisted by genomic approaches.

  11. Discovery of a novel stem rust resistance allele in durum wheat that exhibits differential reactions to Ug99 isolates

    Science.gov (United States)

    Wheat stem rust, caused by Puccinia graminis f. sp. tritici Erikss. & E. Henn, can incur yield losses on susceptible cultivars of durum wheat, Triticum turgidum ssp. durum (Desf.) Husnot. Though several durum cultivars possess the stem rust resistance gene Sr13, additional genes in durum wheat effec...

  12. Mapping and characterization of wheat stem rust resistance genes SrTm5 and Sr60 from Triticum monococcum

    Science.gov (United States)

    The emergence and spread of new virulent races of the wheat stem rust pathogen (Puccinia graminis f. sp. tritici; Pgt), including the TTKSK (Ug99) race group, is a serious threat to global wheat production. In this study, we mapped and characterized two stem rust resistance genes from diploid wheat ...

  13. Evidence of isolate-specificity in non-hypersensitive resistance in spring wheat (Triticum aestivum) to wheat leaf rust

    NARCIS (Netherlands)

    Qamar, Maqsood; Niks, R.E.

    2007-01-01

    Isolate-specific aspect of non-hypersensitive resistance in wheat to wheat leaf rust was studied at seedling stage in the green house. Isolate-specific response of non-hypersensitive resistance was assessed from latency period (LP) and infection frequency (IF) of two single-pustule isolates of

  14. Laboratory, greenhouse and field methods for screening rust-resistant wheat cultivars

    International Nuclear Information System (INIS)

    Mashaal, S.F.; Kiraly, Z.; Barabas, Z.; Barna, B.; Cereal Research Inst., Szeged, Hungary)

    1977-01-01

    Detached flag leaf cultures were not suitable for evaluation of stem-rust resistance in our screening programme. On the basis of yield evaluation it was possible to screen out ten stem-rust ''tolerant'' wheat lines in field experiments. Rusted and protected microplots of each line were paired within a replicate. After artificial inoculation, the protected plants were sprayed with fungicides (benomyl plus dithiocarbamate plus copper salt) at weekly intervals until maturation to keep each protected plot rust-free. The thousand-kernel weights of rusted and protected plots were compared. When the thousand-kernel weight of protected plot increased only slightly and the rust reaction type of plants was susceptible in the rusted plot, the line was screened out as putative ''tolerant''. On the basis of three-year field trial ten ''tolerant'' lines were selected. Nine out of ten lines proved to be resistant to two stem-rust races in greenhouse tests in the seedling stage, when resistance was determined on the basis of reduced spore production instead of infection types. Resistance of these seedlings related partly to the reduced number of pustules and partly to a slow rusting character of plants. It seems possible to screen resistant cultivars in the greenhouse by the method outlined in this paper, when resistance is determined on the basis of a reduced number of infection sites and/or by the slow rusting capacity. (author)

  15. Mapping of stripe rust resistance gene in an Aegilops caudate introgression line in wheat and its genetic association with leaf rust resistance.

    Science.gov (United States)

    Toor, Puneet Inder; Kaur, Satinder; Bansal, Mitaly; Yadav, Bharat; Chhuneja, Parveen

    2016-12-01

    A pair of stripe rust and leaf rust resistance genes was introgressed from Aegilops caudata, a nonprogenitor diploid species with the CC genome, to cultivated wheat. Inheritance and genetic mapping of stripe rust resistance gene in backcrossrecombinant inbred line (BC-RIL) population derived from the cross of a wheat-Ae. caudata introgression line (IL) T291- 2(pau16060) with wheat cv. PBW343 is reported here. Segregation of BC-RILs for stripe rust resistance depicted a single major gene conditioning adult plant resistance (APR) with stripe rust reaction varying from TR-20MS in resistant RILs signifying the presence of some minor genes as well. Genetic association with leaf rust resistance revealed that two genes are located at a recombination distance of 13%. IL T291-2 had earlier been reported to carry introgressions on wheat chromosomes 2D, 3D, 4D, 5D, 6D and 7D. Genetic mapping indicated the introgression of stripe rust resistance gene on wheat chromosome 5DS in the region carrying leaf rust resistance gene LrAc, but as an independent introgression. Simple sequence repeat (SSR) and sequence-tagged site (STS) markers designed from the survey sequence data of 5DS enriched the target region harbouring stripe and leaf rust resistance genes. Stripe rust resistance locus, temporarily designated as YrAc, mapped at the distal most end of 5DS linked with a group of four colocated SSRs and two resistance gene analogue (RGA)-STS markers at a distance of 5.3 cM. LrAc mapped at a distance of 9.0 cM from the YrAc and at 2.8 cM from RGA-STS marker Ta5DS_2737450, YrAc and LrAc appear to be the candidate genes for marker-assisted enrichment of the wheat gene pool for rust resistance.

  16. Characterization of stem rust resistance gene Sr2 in Indian wheat ...

    African Journals Online (AJOL)

    SONY

    2013-05-01

    May 1, 2013 ... accelerating wheat production in the last forty years and ensured food security of the Nation. In the present investigation, Sr2 specific molecular markers were used to assess their efficacy for assessing the deployment of Sr2 gene in Indian wheat cultivars of highly productive north-west plains and stem rust ...

  17. Recent invasion of world-wide wheat growing areas by two aggressive strains of Puccinia striiformis

    DEFF Research Database (Denmark)

    Walter, Stephanie; Ali, Sajid; Justesen, Annemarie Fejer

    2012-01-01

    The ever more frequent and severe large-scale epidemics of wheat yellow/stripe rust disease (caused by Puccinia striiformis) pose a severe threat to the world’s wheat production (Hovmøller et al. 2010). The onset of a new series of world-wide wheat yellow rust epidemics in 2000 has been linked...

  18. The Lr34 adult plant rust resistance gene provides seedling resistance in durum wheat without senescence.

    Science.gov (United States)

    Rinaldo, Amy; Gilbert, Brian; Boni, Rainer; Krattinger, Simon G; Singh, Davinder; Park, Robert F; Lagudah, Evans; Ayliffe, Michael

    2017-07-01

    The hexaploid wheat (Triticum aestivum) adult plant resistance gene, Lr34/Yr18/Sr57/Pm38/Ltn1, provides broad-spectrum resistance to wheat leaf rust (Lr34), stripe rust (Yr18), stem rust (Sr57) and powdery mildew (Pm38) pathogens, and has remained effective in wheat crops for many decades. The partial resistance provided by this gene is only apparent in adult plants and not effective in field-grown seedlings. Lr34 also causes leaf tip necrosis (Ltn1) in mature adult plant leaves when grown under field conditions. This D genome-encoded bread wheat gene was transferred to tetraploid durum wheat (T. turgidum) cultivar Stewart by transformation. Transgenic durum lines were produced with elevated gene expression levels when compared with the endogenous hexaploid gene. Unlike nontransgenic hexaploid and durum control lines, these transgenic plants showed robust seedling resistance to pathogens causing wheat leaf rust, stripe rust and powdery mildew disease. The effectiveness of seedling resistance against each pathogen correlated with the level of transgene expression. No evidence of accelerated leaf necrosis or up-regulation of senescence gene markers was apparent in these seedlings, suggesting senescence is not required for Lr34 resistance, although leaf tip necrosis occurred in mature plant flag leaves. Several abiotic stress-response genes were up-regulated in these seedlings in the absence of rust infection as previously observed in adult plant flag leaves of hexaploid wheat. Increasing day length significantly increased Lr34 seedling resistance. These data demonstrate that expression of a highly durable, broad-spectrum adult plant resistance gene can be modified to provide seedling resistance in durum wheat. © 2016 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

  19. Genome-Wide Association Mapping of Leaf Rust Response in a Durum Wheat Worldwide Germplasm Collection.

    Science.gov (United States)

    Aoun, Meriem; Breiland, Matthew; Kathryn Turner, M; Loladze, Alexander; Chao, Shiaoman; Xu, Steven S; Ammar, Karim; Anderson, James A; Kolmer, James A; Acevedo, Maricelis

    2016-11-01

    Leaf rust (caused by Erikss. []) is increasingly impacting durum wheat ( L. var. ) production with the recent appearance of races with virulence to widely grown cultivars in many durum producing areas worldwide. A highly virulent race on durum wheat was recently detected in Kansas. This race may spread to the northern Great Plains, where most of the US durum wheat is produced. The objective of this study was to identify sources of resistance to several races from the United States and Mexico at seedling stage in the greenhouse and at adult stage in field experiments. Genome-wide association study (GWAS) was used to identify single-nucleotide polymorphism (SNP) markers associated with leaf rust response in a worldwide durum wheat collection of 496 accessions. Thirteen accessions were resistant across all experiments. Association mapping revealed 88 significant SNPs associated with leaf rust response. Of these, 33 SNPs were located on chromosomes 2A and 2B, and 55 SNPs were distributed across all other chromosomes except for 1B and 7B. Twenty markers were associated with leaf rust response at seedling stage, while 68 markers were associated with leaf rust response at adult plant stage. The current study identified a total of 14 previously uncharacterized loci associated with leaf rust response in durum wheat. The discovery of these loci through association mapping (AM) is a significant step in identifying useful sources of resistance that can be used to broaden the relatively narrow leaf rust resistance spectrum in durum wheat germplasm. Copyright © 2016 Crop Science Society of America.

  20. A perspective of leaf rust race fhprn and its impact on leaf rust resistance in pakistani wheat varieties

    International Nuclear Information System (INIS)

    Sohail, Y.

    2015-01-01

    Leaf rust infected leaves of a widely growing variety Seher-06 were collected in wheat season of 2011-12. The leaf rust isolates were assessed on Thatcher derived Lr isogenic lines and a race FHPRN was identified. Seventy six wheat varieties/lines besides Lr isogenic lines were screened against this race for seedling in glass house and for adult plant resistance at Bahawalpur and Faisalabad during 2012-13. Lr1, Lr2a, Lr9, Lr19, Lr24, Lr10+27+31 (Gatcher) and Lr28 were found completely resistant at both stages against FHPRN. Molecular screening of the wheat varieties/lines indicated the presence of leaf rust resistance genes Lr9 (0%), Lr13 (43%), Lr19 (1%), Lr20 (0%), Lr24 (4%), Lr26 (23%), Lr28 (0%), Lr34 (38%), Lr37 (1%) and Lr47 (1%) in them. Field data suggested that As-02 (Lr10+26+34), Bhakar-02 (Lr13) and Shafaq-06 (Lr10+13+27) were resistant; Pasban-90 (Lr10+13+26+27), Chenab-2000 (Lr10+13+26+27+31+34), Fbd-08 (Lr10), Millat-11 (unknown) and Punjab-11 (unknown) were found moderately resistant; Blue silver (Lr13+14a), Pak-81 (Lr10+23+26+31), Bahawalpur-97 (Lr13+26) and Lasani-08 (Lr13+27+31) were susceptible while Sh-88 (unknown), Auqab-2000 (Lr10+23+26+27+31), Iqbal-2000 (Lr3+10+13+26+27+31), Bahawalpur-2000 (Lr34) and Seher-06 (Lr10+27+31) were found highly susceptible against FHPRN. Present and previous studies revealed the presence of Lr3, 10, 13, 14a, 23, 26, 27, 31 and 34 in the Pakistani wheat varieties yet lacking Lr9, 19, 24 and 28. Therefore, the latter genes and their effective combinations should be incorporated in Pakistani varieties to combat leaf rust effectively. (author)

  1. Characterization of molecular diversity and genome-wide mapping of loci associated with resistance to stripe rust and stem rust in Ethiopian bread wheat accessions.

    Science.gov (United States)

    Muleta, Kebede T; Rouse, Matthew N; Rynearson, Sheri; Chen, Xianming; Buta, Bedada G; Pumphrey, Michael O

    2017-08-04

    The narrow genetic basis of resistance in modern wheat cultivars and the strong selection response of pathogen populations have been responsible for periodic and devastating epidemics of the wheat rust diseases. Characterizing new sources of resistance and incorporating multiple genes into elite cultivars is the most widely accepted current mechanism to achieve durable varietal performance against changes in pathogen virulence. Here, we report a high-density molecular characterization and genome-wide association study (GWAS) of stripe rust and stem rust resistance in 190 Ethiopian bread wheat lines based on phenotypic data from multi-environment field trials and seedling resistance screening experiments. A total of 24,281 single nucleotide polymorphism (SNP) markers filtered from the wheat 90 K iSelect genotyping assay was used to survey Ethiopian germplasm for population structure, genetic diversity and marker-trait associations. Upon screening for field resistance to stripe rust in the Pacific Northwest of the United States and Ethiopia over multiple growing seasons, and against multiple races of stripe rust and stem rust at seedling stage, eight accessions displayed resistance to all tested races of stem rust and field resistance to stripe rust in all environments. Our GWAS results show 15 loci were significantly associated with seedling and adult plant resistance to stripe rust at false discovery rate (FDR)-adjusted probability (P) rust in the Ethiopian wheat accessions. Many of the identified resistance loci were mapped close to previously identified rust resistance genes; however, three loci on the short arms of chromosomes 5A and 7B for stripe rust resistance and two on chromosomes 3B and 7B for stem rust resistance may be novel. Our results demonstrate that considerable genetic variation resides within the landrace accessions that can be utilized to broaden the genetic base of rust resistance in wheat breeding germplasm. The molecular markers identified in

  2. Yellow Rust Epidemics Worldwide Were Caused by Pathogen Races from Divergent Genetic Lineages

    Science.gov (United States)

    Ali, Sajid; Rodriguez-Algaba, Julian; Thach, Tine; Sørensen, Chris K.; Hansen, Jens G.; Lassen, Poul; Nazari, Kumarse; Hodson, David P.; Justesen, Annemarie F.; Hovmøller, Mogens S.

    2017-01-01

    We investigated whether the recent worldwide epidemics of wheat yellow rust were driven by races of few clonal lineage(s) or populations of divergent races. Race phenotyping of 887 genetically diverse Puccinia striiformis isolates sampled in 35 countries during 2009–2015 revealed that these epidemics were often driven by races from few but highly divergent genetic lineages. PstS1 was predominant in North America; PstS2 in West Asia and North Africa; and both PstS1 and PstS2 in East Africa. PstS4 was prevalent in Northern Europe on triticale; PstS5 and PstS9 were prevalent in Central Asia; whereas PstS6 was prevalent in epidemics in East Africa. PstS7, PstS8 and PstS10 represented three genetic lineages prevalent in Europe. Races from other lineages were in low frequencies. Virulence to Yr9 and Yr27 was common in epidemics in Africa and Asia, while virulence to Yr17 and Yr32 were prevalent in Europe, corresponding to widely deployed resistance genes. The highest diversity was observed in South Asian populations, where frequent recombination has been reported, and no particular race was predominant in this area. The results are discussed in light of the role of invasions in shaping pathogen population across geographical regions. The results emphasized the lack of predictability of emergence of new races with high epidemic potential, which stresses the need for additional investments in population biology and surveillance activities of pathogens on global food crops, and assessments of disease vulnerability of host varieties prior to their deployment at larger scales. PMID:28676811

  3. Yellow Rust Epidemics Worldwide Were Caused by Pathogen Races from Divergent Genetic Lineages

    Directory of Open Access Journals (Sweden)

    Sajid Ali

    2017-06-01

    Full Text Available We investigated whether the recent worldwide epidemics of wheat yellow rust were driven by races of few clonal lineage(s or populations of divergent races. Race phenotyping of 887 genetically diverse Puccinia striiformis isolates sampled in 35 countries during 2009–2015 revealed that these epidemics were often driven by races from few but highly divergent genetic lineages. PstS1 was predominant in North America; PstS2 in West Asia and North Africa; and both PstS1 and PstS2 in East Africa. PstS4 was prevalent in Northern Europe on triticale; PstS5 and PstS9 were prevalent in Central Asia; whereas PstS6 was prevalent in epidemics in East Africa. PstS7, PstS8 and PstS10 represented three genetic lineages prevalent in Europe. Races from other lineages were in low frequencies. Virulence to Yr9 and Yr27 was common in epidemics in Africa and Asia, while virulence to Yr17 and Yr32 were prevalent in Europe, corresponding to widely deployed resistance genes. The highest diversity was observed in South Asian populations, where frequent recombination has been reported, and no particular race was predominant in this area. The results are discussed in light of the role of invasions in shaping pathogen population across geographical regions. The results emphasized the lack of predictability of emergence of new races with high epidemic potential, which stresses the need for additional investments in population biology and surveillance activities of pathogens on global food crops, and assessments of disease vulnerability of host varieties prior to their deployment at larger scales.

  4. McGISH identification and phenotypic description of leaf rust and yellow rust resistant partial amphiploids originating from a wheat × Thinopyrum synthetic hybrid cross.

    Science.gov (United States)

    Kruppa, Klaudia; Türkösi, Edina; Mayer, Marianna; Tóth, Viola; Vida, Gyula; Szakács, Éva; Molnár-Láng, Márta

    2016-11-01

    A Thinopyrum intermedium × Thinopyrum ponticum synthetic hybrid wheatgrass is an excellent source of leaf and stem rust resistance produced by N.V.Tsitsin. Wheat line Mv9kr1 was crossed with this hybrid (Agropyron glael) in Hungary in order to transfer its advantageous agronomic traits into wheat. As the wheat parent was susceptible to leaf rust, the transfer of resistance was easily recognizable in the progenies. Three different partial amphiploid lines with leaf rust resistance were selected from the wheat/Thinopyrum hybrid derivatives by multicolour genomic in situ hybridization. Chromosome counting on the partial amphiploids revealed 58 chromosomes (18 wheatgrass) in line 194, 56 (14 wheatgrass) in line 195 and 54 (12 wheatgrass) in line 196. The wheat chromosomes present in these lines were identified and the wheatgrass chromosomes were characterized by fluorescence in situ hybridization using the repetitive DNA probes Afa-family, pSc119.2 and pTa71. The 3D wheat chromosome was missing from the lines. Molecular marker analysis showed the presence of the Lr24 leaf rust resistance gene in lines 195 and 196. The morphological traits were evaluated in the field during two consecutive seasons in two different locations.

  5. Stem and stripe rust resistance in wheat induced by gamma rays and thermal neutrons

    International Nuclear Information System (INIS)

    Skorda, E.A.

    1977-01-01

    Attempts were made to produce rust-resistant mutants in wheat cultivars. Seeds of G-38290 and G-58383 (T. aestivum), Methoni and Ilectra (T. durum) varieties were irradiated with different doses of γ-rays (3.5, 5, 8, 11, 15 and 21 krad) and thermal neutrons (1.7, 4, 5.5, 7.5, 10.5 and 12.5x10 12 ) and the M 1 plants were grown under isolation in the field. The objective was mainly to induce stripe, leaf and stem rust resistance in G-38290, Methoni and Ilectra varieties and leaf rust resistance in G-58383. Mutations for rust resistance were detected by using the ''chimera method'' under natural and artificial field epiphytotic conditions in M 2 and successive generations. The mutants detected were tested for resistance to a broad spectrum of available races. Mutants resistant or moderately resistant to stripe and stem rusts but not to leaf rust, were selected from G-38290. From the other three varieties tested no rust-resistant mutants were detected. The frequency of resistant mutants obtained increased with increased γ-ray dose-rate, but not with increased thermal neutron doses. Some mutants proved to be resistant or moderately resistant to both rusts and others to one of them. Twenty of these mutants were evaluated for yield from M 5 to M 8 . Some of them have reached the final stage of regional yield trials and one, induced by thermal neutrons, was released this year. (author)

  6. Partial resistance to stripe rust and its effect on sustainability of wheat yield

    International Nuclear Information System (INIS)

    Qamar, M.; Din, R.U.; Gardazi, D.A.

    2014-01-01

    Stripe rust (Puccinia striiformis Westend. f. sp. tritici) poses a serious threat to wheat production in cooler areas of Pakistan. The 70% area of wheat in Pakistan is prone to stripe rust disease. It can cause 10-17% yield losses if susceptible cultivars are planted under favorable conditions. Level of partial plant resistance in bread wheat and its impact on sustainable wheat production was studied at the National Agricultural Research Centre, Islamabad under natural conditions in the field. Eleven Pakistani commercial wheat cultivars/advance lines including check (Inqalab 91) were assessed for the level of partial resistance against stripe rust using Area Under the Disease Progress Curve (AUDPC), disease severity (DS) and epidemic growth rate in comparison with wheat cultivar, Inqalab 91. During 2007 cropping season, natural epidemic was developed and relative AUDPC was recorded from 0 to 100% whereas the 2008 cropping season was dry and no stripe rust appeared. Two advanced lines (NR 268 and NR 285) showed the infection type (IT) less than 7 (incompatible reaction) to the mixture of prevailing stripe rust inoculums. Very low level of DS and AUDPC were recorded in the remaining cultivars/lines indicating a high level of partial resistance to stripe rust compared to the susceptible check cultivar, Inqalab 91. Among eight cultivars/lines that showed compatible type of reaction (IT greater then equal to 7), one was resistant (relative AUDPC = 20% of Inqalab 91) and six showed very high resistance levels (relative AUDPC greater then equal to 5%). Maximum level of resistance (relative AUDPC = 0.1%) was observed in advanced line, NR 271. The wheat cultivars/lines that showed a slow disease development (low DS and AUDPC), could be considered as -1 partially resistant for stripe rust infection. The yield (2178 kg ha) of susceptible check cultivar Inqalab-91 during 2007 was reduced to 45% as -1 compared to its yield (3945 kg ha) in epidemic free year (2008). Thus the use

  7. Mapping of quantitative adult plant field resistance to leaf rust and stripe rust in two European winter wheat populations reveals co-location of three QTL conferring resistance to both rust pathogens.

    Science.gov (United States)

    Buerstmayr, Maria; Matiasch, Lydia; Mascher, Fabio; Vida, Gyula; Ittu, Marianna; Robert, Olivier; Holdgate, Sarah; Flath, Kerstin; Neumayer, Anton; Buerstmayr, Hermann

    2014-09-01

    We detected several, most likely novel QTL for adult plant resistance to rusts. Notably three QTL improved resistance to leaf rust and stripe rust simultaneously indicating broad spectrum resistance QTL. The rusts of wheat (Puccinia spp.) are destructive fungal wheat diseases. The deployment of resistant cultivars plays a central role in integrated rust disease management. Durability of resistance would be preferred, but is difficult to analyse. The Austrian winter wheat cultivar Capo was released in the 1989 and grown on a large acreage during more than two decades and maintained a good level of quantitative leaf rust and stripe rust resistance. Two bi-parental mapping populations: Capo × Arina and Capo × Furore were tested in multiple environments for severity of leaf rust and stripe rust at the adult plant stage in replicated field experiments. Quantitative trait loci associated with leaf rust and stripe rust severity were mapped using DArT and SSR markers. Five QTL were detected in multiple environments associated with resistance to leaf rust designated as QLr.ifa-2AL, QLr.ifa-2BL, QLr.ifa-2BS, QLr.ifa-3BS, and QLr.ifa-5BL, and five for resistance to stripe rust QYr.ifa-2AL, QYr.ifa-2BL, QYr.ifa-3AS, QYr.ifa-3BS, and QYr.ifa-5A. For all QTL apart from two (QYr.ifa-3AS, QLr.ifa-5BL) Capo contributed the resistance improving allele. The leaf rust and stripe rust resistance QTL on 2AL, 2BL and 3BS mapped to the same chromosome positions, indicating either closely linked genes or pleiotropic gene action. These three multiple disease resistance QTL (QLr.ifa-2AL/QYr.ifa-2AL, QLr.ifa.2BL/QYr.ifa-2BL, QLr.ifa-3BS/QYr.ifa.3BS) potentially contribute novel resistance sources for stripe rust and leaf rust. The long-lasting resistance of Capo apparently rests upon a combination of several genes. The described germplasm, QTL and markers are applicable for simultaneous resistance improvement against leaf rust and stripe rust.

  8. Stability of rust resistance and yield potential of some icarda bread wheat lines in Pakistan

    International Nuclear Information System (INIS)

    Shah, S.J.A.; Khan, A.J.; Azam, F.; Mirza, J.I.; Atiq-ur-Rehman

    2003-01-01

    Thirty bread wheat lines resistant to Yellow rust (Yr) were selected after careful screening from two ICARDA nurseries during 1998 - 1999, Rabi season at Nuclear Institute for Food and Agriculture (NIFA), Tarnab, Peshawar under severe disease pressure. In the following crop cycle, these selections were again field evaluated for stability and effectiveness of Yr resistance at multilocations while their yield potential was ascertained at Tarnab in two different trials with Tatara as commercial check. Results revealed that uniformity was found in the potential behavior of 23 lines (77%) in both the cropping seasons against Yr. This included some high yielding (up to 7067 kg/ ha) and low yielding lines (up to 4333 kg / ha) when compared with the check (6089 kg / ha). Yield potential of some high yielding lines with stable Yr resistance should be further evaluated over sites and seasons for wide adaptability, under national uniform testing in order to select and deploy future varieties to combat Yr for acquiring food security in Pakistan.(author)

  9. Secretome Characterization and Correlation Analysis Reveal Putative Pathogenicity Mechanisms and Identify Candidate Avirulence Genes in the Wheat Stripe Rust Fungus Puccinia striiformis f. sp. tritici.

    Science.gov (United States)

    Xia, Chongjing; Wang, Meinan; Cornejo, Omar E; Jiwan, Derick A; See, Deven R; Chen, Xianming

    2017-01-01

    Stripe (yellow) rust, caused by Puccinia striiformis f. sp. tritici ( Pst ), is one of the most destructive diseases of wheat worldwide. Planting resistant cultivars is an effective way to control this disease, but race-specific resistance can be overcome quickly due to the rapid evolving Pst population. Studying the pathogenicity mechanisms is critical for understanding how Pst virulence changes and how to develop wheat cultivars with durable resistance to stripe rust. We re-sequenced 7 Pst isolates and included additional 7 previously sequenced isolates to represent balanced virulence/avirulence profiles for several avirulence loci in seretome analyses. We observed an uneven distribution of heterozygosity among the isolates. Secretome comparison of Pst with other rust fungi identified a large portion of species-specific secreted proteins, suggesting that they may have specific roles when interacting with the wheat host. Thirty-two effectors of Pst were identified from its secretome. We identified candidates for Avr genes corresponding to six Yr genes by correlating polymorphisms for effector genes to the virulence/avirulence profiles of the 14 Pst isolates. The putative AvYr76 was present in the avirulent isolates, but absent in the virulent isolates, suggesting that deleting the coding region of the candidate avirulence gene has produced races virulent to resistance gene Yr76 . We conclude that incorporating avirulence/virulence phenotypes into correlation analysis with variations in genomic structure and secretome, particularly presence/absence polymorphisms of effectors, is an efficient way to identify candidate Avr genes in Pst . The candidate effector genes provide a rich resource for further studies to determine the evolutionary history of Pst populations and the co-evolutionary arms race between Pst and wheat. The Avr candidates identified in this study will lead to cloning avirulence genes in Pst , which will enable us to understand molecular mechanisms

  10. Glyphosate inhibits rust diseases in glyphosate-resistant wheat and soybean

    OpenAIRE

    Feng, Paul C. C.; Baley, G. James; Clinton, William P.; Bunkers, Greg J.; Alibhai, Murtaza F.; Paulitz, Timothy C.; Kidwell, Kimberlee K.

    2005-01-01

    Glyphosate is a broad-spectrum herbicide used for the control of weeds in glyphosate-resistant crops. Glyphosate inhibits 5-enolpyruvyl shikimate 3-phosphate synthase, a key enzyme in the synthesis of aromatic amino acids in plants, fungi, and bacteria. Studies with glyphosate-resistant wheat have shown that glyphosate provided both preventive and curative activities against Puccinia striiformis f. sp. tritici and Puccinia triticina, which cause stripe and leaf rusts, respectively, in wheat. ...

  11. Somatic recombination in wheat stem rust leads to virulence for Ug99-effective SR50 resistance

    Science.gov (United States)

    Race-specific resistance genes protect much of the global wheat crop from stem rust disease caused by Puccinia graminis f. sp. tritici (Pgt), but often break down due to evolution of new virulent pathogen races. To understand the molecular mechanisms of virulence evolution in Pgt we identified the p...

  12. Multi-location wheat stripe rust QTL analysis: genetic background and epistatic interactions.

    Science.gov (United States)

    Vazquez, M Dolores; Zemetra, Robert; Peterson, C James; Chen, Xianming M; Heesacker, Adam; Mundt, Christopher C

    2015-07-01

    Epistasis and genetic background were important influences on expression of stripe rust resistance in two wheat RIL populations, one with resistance conditioned by two major genes and the other conditioned by several minor QTL. Stripe rust is a foliar disease of wheat (Triticum aestivum L.) caused by the air-borne fungus Puccinia striiformis f. sp. tritici and is present in most regions around the world where commercial wheat is grown. Breeding for durable resistance to stripe rust continues to be a priority, but also is a challenge due to the complexity of interactions among resistance genes and to the wide diversity and continuous evolution of the pathogen races. The goal of this study was to detect chromosomal regions for resistance to stripe rust in two winter wheat populations, 'Tubbs'/'NSA-98-0995' (T/N) and 'Einstein'/'Tubbs' (E/T), evaluated across seven environments and mapped with diversity array technology and simple sequence repeat markers covering polymorphic regions of ≈1480 and 1117 cM, respectively. Analysis of variance for phenotypic data revealed significant (P located in chromosomes 2AS and 6AL, with epistatic interaction between them, were responsible for the main phenotypic response. For the T/N population, eight QTL were identified, with those in chromosomes 2AL and 2BL accounting for the largest percentage of the phenotypic variance.

  13. Molecular and cytogenetic characterization of wheat introgression lines carrying the stem rust resistance gene Sr39.

    Science.gov (United States)

    Stem rust, caused by Puccinia graminis Pers.:Pers. f.sp. tritici Eriks. and Henn., poses a serious threat to global wheat production because of the emergence of Pgt-TTKSK (Ug99). The TTKSK resistant gene Sr39 was derived from Aegilops speltoides through chromosome translocation. In this study, we ch...

  14. Cytogenetics and stripe rust resistance of wheat-Thinopyrum elongatum hybrid derivatives.

    Science.gov (United States)

    Li, Daiyan; Long, Dan; Li, Tinghui; Wu, Yanli; Wang, Yi; Zeng, Jian; Xu, Lili; Fan, Xing; Sha, Lina; Zhang, Haiqin; Zhou, Yonghong; Kang, Houyang

    2018-01-01

    Amphidiploids generated by distant hybridization are commonly used as genetic bridge to transfer desirable genes from wild wheat species into cultivated wheat. This method is typically used to enhance the resistance of wheat to biotic or abiotic stresses, and to increase crop yield and quality. Tetraploid Thinopyrum elongatum exhibits strong adaptability, resistance to stripe rust and Fusarium head blight, and tolerance to salt, drought, and cold. In the present study, we produced hybrid derivatives by crossing and backcrossing the Triticum durum-Th. elongatum partial amphidiploid ( Trititrigia 8801, 2 n  = 6 ×  = 42, AABBEE) with wheat cultivars common to the Sichuan Basin. By means of cytogenetic and disease resistance analyses, we identified progeny harboring alien chromosomes and measured their resistance to stripe rust. Hybrid progenies possessed chromosome numbers ranging from 40 to 47 (mean = 42.72), with 40.0% possessing 42 chromosomes. Genomic in situ hybridization revealed that the number of alien chromosomes ranged from 1 to 11. Out of the 50 of analyzed lines, five represented chromosome addition (2 n  = 44 = 42 W + 2E) and other five were chromosome substitution lines (2 n  = 42 = 40 W + 2E). Importantly, a single chromosome derived from wheat- Th. elongatum intergenomic Robertsonian translocations chromosome was occurred in 12 lines. Compared with the wheat parental cultivars ('CN16' and 'SM482'), the majority (70%) of the derivative lines were highly resistant to strains of stripe rust pathogen known to be prevalent in China. The findings suggest that these hybrid-derivative lines with stripe rust resistance could potentially be used as germplasm sources for further wheat improvement.

  15. Molecular mapping and improvement of leaf rust resistance in wheat breeding lines.

    Science.gov (United States)

    Tsilo, Toi J; Kolmer, James A; Anderson, James A

    2014-08-01

    Leaf rust, caused by Puccinia triticina, is the most common and widespread disease of wheat (Triticum aestivum) worldwide. Deployment of host-plant resistance is one of the strategies to reduce losses due to leaf rust disease. The objective of this study was to map genes for adult-plant resistance to leaf rust in a recombinant inbred line (RIL) population originating from MN98550-5/MN99394-1. The mapping population of 139 RILs and five checks were evaluated in 2005, 2009, and 2010 in five environments. Natural infection occurred in the 2005 trials and trials in 2009 and 2010 were inoculated with leaf rust. Four quantitative trait loci (QTL) on chromosomes 2BS, 2DS, 7AL, and 7DS were detected. The QTL on 2BS explained up to 33.6% of the phenotypic variation in leaf rust response, whereas the QTL on 2DS, 7AL, and 7DS explained up to 15.7, 8.1, and 34.2%, respectively. Seedling infection type tests conducted with P. triticina races BBBD and SBDG confirmed that the QTL on 2BS and 2DS were Lr16 and Lr2a, respectively, and these genes were expressed in the seedling and field plot tests. The Lr2a gene mapped at the same location as Sr6. The QTL on 7DS was Lr34. The QTL on 7AL is a new QTL for leaf rust resistance. The joint effects of all four QTL explained 74% of the total phenotypic variation in leaf rust severity. Analysis of different combinations of QTL showed that the RILs containing all four or three of the QTL had the lowest average leaf rust severity in all five environments. Deployment of these QTL in combination or with other effective genes will lead to successful control of leaf rust.

  16. Identification and validation of single nucleotide polymorphic markers linked to Ug99 stem rust resistance in spring wheat

    Science.gov (United States)

    Wheat stem rust (Puccinia graminis f. sp. tritici Eriks. and E. Henn.) is one of the most destructive diseases world-wide. Races belonging to Ug99 (or TTKSK) continue to cause crop losses in East Africa and threaten global wheat production. Developing and deploying wheat varieties with multiple race...

  17. [Analysis of methylation-sensitive amplified polymorphism in wheat genome under the wheat leaf rust stress].

    Science.gov (United States)

    Fu, Sheng-Jie; Wang, Hui; Feng, Li-Na; Sun, Yi; Yang, Wen-Xiang; Liu, Da-Qun

    2009-03-01

    Intrinsic DNA methylation pattern is an integral component of the epigenetic network in many eukaryotes. DNA methylation plays an important role in regulating gene expression in eukaryotes. Biological stress in plant provides an inherent epigenetic driving force of evolution. Study of DNA methylation patterns arising from biological stress will help us fully understand the epigenetic regulation of gene expression and DNA methylation of biological functions. The wheat near-isogenic lines TcLr19 and TcLr41 were resistant to races THTT and TKTJ, respectively, and Thatcher is compatible in the interaction with Puccinia triticina THTT and TKTJ, respectively. By means of methylation-sensitive amplified polymorphism (MSAP) analysis, the patterns of cytosine methylation in TcLr19, TcLr41, and Thatcher inoculated with P. triticina THTT and TKTJ were compared with those of the untreated samples. All the DNA fragments, each representing a recognition site cleaved by each or both of isoschizomers, were amplified using 60 pairs of selective primers. The results indicated that there was no significant difference between the challenged and unchallenged plants at DNA methylation level. However, epigenetic difference between the near-isogenic line for wheat leaf rust resistance gene Lr41 and Thatcher was present.

  18. Appraisal of wheat germplasm for adult plant resistance against stripe rust

    Directory of Open Access Journals (Sweden)

    Saleem Kamran

    2015-12-01

    Full Text Available The resurgence of wheat stripe rust is of great concern for world food security. Owing to resistance breakdown and the appearance of new virulent high-temperature adapted races of Puccinia striiformis f. sp. tritici (Pst, many high yielding commercial varieties in the country lost their yield potential. Searching for new sources of resistance is the best approach to mitigate the problem. Quantitative resistance (partial or adult plant or durable resistance is reported to be more stable than race specific resistance. In the current perusal, a repertoire of 57 promising wheat lines along with the KLcheck line Morocco, developed through hybridisation and selection of local and international lines with International Maize and Wheat Improvement Center (CIMMYT origin, were evaluated under natural field conditions at Nuclear Institute for Agriculture and Biology (NIAB during the 2012−2013 and 2013−2014 time periods. Final rust severity (FRS, the area under the rust progress curve (AURPC, the relative area under the rust progress curve (rAURPC, and the coefficient of infection (CI were unraveled to infer the level of quantitative resistance. Final rust severity was recorded when the susceptible check exhibited 100% severity. There were 21 lines which were immune (no disease, 16 which were resistant, five moderately resistant, two resistant-to-moderately resistant, one moderately resistant-to-moderately susceptible, 5 moderately susceptible-to-susceptible, one moderately susceptible, and six exhibited a susceptible response. Nevertheless, 51 lines exhibited a high level of partial resistance while the three lines, NW-5-1212-1, NW-7-30-1, and NW-7-5 all showed a moderate level of partial resistance based on FRS, while 54 lines, on the basis of AURPC and rAURPC, were identified as conferring a high level of partial resistance. Moreover, adult plant resistance was conferred by 47 wheat lines, based on CI value. It was striking that, 13 immune lines

  19. Quantitative trait loci for resistance to stripe rust of wheat revealed using global field nurseries and opportunities for stacking resistance genes.

    Science.gov (United States)

    Bokore, Firdissa E; Cuthbert, Richard D; Knox, Ron E; Randhawa, Harpinder S; Hiebert, Colin W; DePauw, Ron M; Singh, Asheesh K; Singh, Arti; Sharpe, Andrew G; N'Diaye, Amidou; Pozniak, Curtis J; McCartney, Curt; Ruan, Yuefeng; Berraies, Samia; Meyer, Brad; Munro, Catherine; Hay, Andy; Ammar, Karim; Huerta-Espino, Julio; Bhavani, Sridhar

    2017-12-01

    Quantitative trait loci controlling stripe rust resistance were identified in adapted Canadian spring wheat cultivars providing opportunity for breeders to stack loci using marker-assisted breeding. Stripe rust or yellow rust, caused by Puccinia striiformis Westend. f. sp. tritici Erikss., is a devastating disease of common wheat (Triticum aestivum L.) in many regions of the world. The objectives of this research were to identify and map quantitative trait loci (QTL) associated with stripe rust resistance in adapted Canadian spring wheat cultivars that are effective globally, and investigate opportunities for stacking resistance. Doubled haploid (DH) populations from the crosses Vesper/Lillian, Vesper/Stettler, Carberry/Vesper, Stettler/Red Fife and Carberry/AC Cadillac were phenotyped for stripe rust severity and infection response in field nurseries in Canada (Lethbridge and Swift Current), New Zealand (Lincoln), Mexico (Toluca) and Kenya (Njoro), and genotyped with SNP markers. Six QTL for stripe rust resistance in the population of Vesper/Lillian, five in Vesper/Stettler, seven in Stettler/Red Fife, four in Carberry/Vesper and nine in Carberry/AC Cadillac were identified. Lillian contributed stripe rust resistance QTL on chromosomes 4B, 5A, 6B and 7D, AC Cadillac on 2A, 2B, 3B and 5B, Carberry on 1A, 1B, 4A, 4B, 7A and 7D, Stettler on 1A, 2A, 3D, 4A, 5B and 6A, Red Fife on 2D, 3B and 4B, and Vesper on 1B, 2B and 7A. QTL on 1A, 1B, 2A, 2B, 3B, 4A, 4B, 5B, 7A and 7D were observed in multiple parents. The populations are compelling sources of recombination of many stripe rust resistance QTL for stacking disease resistance. Gene pyramiding should be possible with little chance of linkage drag of detrimental genes as the source parents were mostly adapted cultivars widely grown in Canada.

  20. Postulation of rust resistance genes in Nordic spring wheat genotypes and identification of widely effective sources of resistance against the Australian rust flora.

    Science.gov (United States)

    Randhawa, Mandeep; Bansal, Urmil; Lillemo, Morten; Miah, Hanif; Bariana, Harbans

    2016-11-01

    Wild relatives, landraces and cultivars from different geographical regions have been demonstrated as the sources of genetic variation for resistance to rust diseases. This study involved assessment of diversity for resistance to three rust diseases among a set of Nordic spring wheat cultivars. These cultivars were tested at the seedling stage against several pathotypes of three rust pathogens in the greenhouse. All stage stem rust resistance genes Sr7b, Sr8a, Sr12, Sr15, Sr17, Sr23 and Sr30, and leaf rust resistance genes Lr1, Lr3a, Lr13, Lr14a, Lr16 and Lr20 were postulated either singly or in different combinations among these cultivars. A high proportion of cultivars were identified to carry linked rust resistance genes Sr15 and Lr20. Although 51 cultivars showed variation against Puccinia striiformis f. sp. tritici (Pst) pathotypes used in this study, results were not clearly contrasting to enable postulation of stripe rust resistance genes in these genotypes. Stripe rust resistance gene Yr27 was postulated in four cultivars and Yr1 was present in cultivar Zebra. Cultivar Tjalve produced low stripe rust response against all Pst pathotypes indicating the presence either of a widely effective resistance gene or combination of genes with compensating pathogenic specificities. Several cultivars carried moderate to high level of APR to leaf rust and stripe rust. Seedling stem rust susceptible cultivar Aston exhibited moderately resistant to moderately susceptible response, whereas other cultivars belonging to this class were rated moderately susceptible or higher. Molecular markers linked with APR genes Yr48, Lr34/Yr18/Sr57, Lr68 and Sr2 detected the presence of these genes in some genotypes.

  1. Adult plant leaf rust resistance derived from Toropi wheat is conditioned by Lr78 and three minor QTL

    Science.gov (United States)

    Brazil, was noted to have long lasting leaf rust resistance that was effective only in adult plants. The objectives of this study were to determine the chromosome location of the leaf rust resistance genes derived from Toropi in two populations of recombinant inbred lines in a partial Thatcher wheat...

  2. Genetic mapping of stem rust resistance to Puccinia graminis f. sp. tritici race TRTTF in the Canadian wheat cultivar 'Harvest'

    Science.gov (United States)

    Stem rust, caused by Puccinia graminis Pers.:Pers. f. sp. tritici Eriks. & E. Henn.(Pgt), is a destructive disease of wheat that can be controlled by deploying effective stem rust resistance (Sr) genes. Highly virulent races of Pgt in Africa have been detected and characterized. These include race T...

  3. Comparison of multi- and hyperspectral imaging data of leaf rust infected wheat plants

    Science.gov (United States)

    Franke, Jonas; Menz, Gunter; Oerke, Erich-Christian; Rascher, Uwe

    2005-10-01

    In the context of precision agriculture, several recent studies have focused on detecting crop stress caused by pathogenic fungi. For this purpose, several sensor systems have been used to develop in-field-detection systems or to test possible applications of remote sensing. The objective of this research was to evaluate the potential of different sensor systems for multitemporal monitoring of leaf rust (puccinia recondita) infected wheat crops, with the aim of early detection of infected stands. A comparison between a hyperspectral (120 spectral bands) and a multispectral (3 spectral bands) imaging system shows the benefits and limitations of each approach. Reflectance data of leaf rust infected and fungicide treated control wheat stand boxes (1sqm each) were collected before and until 17 days after inoculation. Plants were grown under controlled conditions in the greenhouse and measurements were taken under consistent illumination conditions. The results of mixture tuned matched filtering analysis showed the suitability of hyperspectral data for early discrimination of leaf rust infected wheat crops due to their higher spectral sensitivity. Five days after inoculation leaf rust infected leaves were detected, although only slight visual symptoms appeared. A clear discrimination between infected and control stands was possible. Multispectral data showed a higher sensitivity to external factors like illumination conditions, causing poor classification accuracy. Nevertheless, if these factors could get under control, even multispectral data may serve a good indicator for infection severity.

  4. Enhanced resistance to stripe rust disease in transgenic wheat expressing the rice chitinase gene RC24.

    Science.gov (United States)

    Huang, Xuan; Wang, Jian; Du, Zhen; Zhang, Chen; Li, Lan; Xu, Ziqin

    2013-10-01

    Stripe rust is a devastating fungal disease of wheat worldwide which is primarily caused by Puccinia striiformis f. sp tritici. Transgenic wheat (Triticum aestivum L.) expressing rice class chitinase gene RC24 were developed by particle bombardment of immature embryos and tested for resistance to Puccinia striiformis f.sp tritici. under greenhouse and field conditions. Putative transformants were selected on kanamycin-containing media. Polymease chain reaction indicated that RC24 was transferred into 17 transformants obtained from bombardment of 1,684 immature embryos. Integration of RC24 was confirmed by Southern blot with a RC24-labeled probe and expression of RC24 was verified by RT-PCR. Nine transgenic T1 lines exhibited enhanced resistance to stripe rust infection with lines XN8 and BF4 showing the highest level of resistance. Southern blot hybridization confirmed the stable inheritance of RC24 in transgenic T1 plants. Resistance to stripe rust in transgenic T2 and T3 XN8 and BF4 plants was confirmed over two consecutive years in the field. Increased yield (27-36 %) was recorded for transgenic T2 and T3 XN8 and BF4 plants compared to controls. These results suggest that rice class I chitinase RC24 can be used to engineer stripe rust resistance in wheat.

  5. Studies on /sup 32/P transport and yellow rust resistance in barley

    Energy Technology Data Exchange (ETDEWEB)

    Schubert, J. (Akademie der Landwirtschaftswissenschaften der DDR, Aschersleben. Inst. fuer Phytopathologie)

    1982-01-01

    Several cultivars of barley (Hordeum vulgare L.) differing in their resistance to yellow rust were used to study the influence of the infection with Puccinia striiformis West. (strain 24) on /sup 32/P transport in intact plants and isolated leaves. Close correlations exist between transport processes and resistance. For example, resistant plants seem to have a more intensive matter transport than susceptible ones. The importance of the rate of transport to the effectiveness of hypothetic inducers of resistance reactions and defence substances is discussed.

  6. Transfer of genes for stem rust resistance from Agropyron elongatum and imperial rye to durum wheat

    International Nuclear Information System (INIS)

    Prabhakara Rao, M.V.

    1977-01-01

    The Agropyron elongatum gene for stem rust resistance on chromosome 6A of Knott's Thatcher translocation line was transferred to a susceptible local durum wheat variety, Jaya, through a series of back-crosses. Plants heterozygous for the Agropyron translocation always show at least one open bivalent. Homozygotes have not been obtained, probably because of the absence of male transmission in durum background. Monotelosomic addition of the short arm of Imperial rye chromosome 3R (formerly ''G'' of Sears), which carries a gene(s) for resistance to wheat stem rust, was obtained in the local durum variety. Rust-resistant plants from parents having the added rye telocentric were irradiated with gamma rays just before meiosis, and the pollen obtained from the irradiated spikes was used to pollinate euploid plants. In addition, seeds harvested from 2n+1 resistant plants were irradiated with thermal neutrons and the resistant M 1 plants were selfed to raise M 2 families. Two durum-rye translocation lines were obtained following irradiation. DRT-1 was transmitted normally through the female gametes but showed no male transmission. As a result of this, homozygotes have not been obtained. Gametic transmission rates of DRT-2 are being tested. Alien translocations, which show normal gametic and zygotic transmissions in the hexaploid wheat, may behave differently in a tetraploid background. The results indicate that alien genetic transfers may be more difficult to obtain in durum wheat, probably owing to the reduced buffering effect of the tetraploid genome. (author)

  7. [Prediction model of meteorological grade of wheat stripe rust in winter-reproductive area, Sichuan Basin, China].

    Science.gov (United States)

    Guo, Xiang; Wang, Ming Tian; Zhang, Guo Zhi

    2017-12-01

    The winter reproductive areas of Puccinia striiformis var. striiformis in Sichuan Basin are often the places mostly affected by wheat stripe rust. With data on the meteorological condition and stripe rust situation at typical stations in the winter reproductive area in Sichuan Basin from 1999 to 2016, this paper classified the meteorological conditions inducing wheat stripe rust into 5 grades, based on the incidence area ratio of the disease. The meteorological factors which were biologically related to wheat stripe rust were determined through multiple analytical methods, and a meteorological grade model for forecasting wheat stripe rust was created. The result showed that wheat stripe rust in Sichuan Basin was significantly correlated with many meteorological factors, such as the ave-rage (maximum and minimum) temperature, precipitation and its anomaly percentage, relative humidity and its anomaly percentage, average wind speed and sunshine duration. Among these, the average temperature and the anomaly percentage of relative humidity were the determining factors. According to a historical retrospective test, the accuracy of the forecast based on the model was 64% for samples in the county-level test, and 89% for samples in the municipal-level test. In a meteorological grade forecast of wheat stripe rust in the winter reproductive areas in Sichuan Basin in 2017, the prediction was accurate for 62.8% of the samples, with 27.9% error by one grade and only 9.3% error by two or more grades. As a result, the model could deliver satisfactory forecast results, and predicate future wheat stripe rust from a meteorological point of view.

  8. Adult Plant Leaf Rust Resistance Derived from Toropi Wheat is Conditioned by Lr78 and Three Minor QTL.

    Science.gov (United States)

    Kolmer, J A; Bernardo, A; Bai, G; Hayden, M J; Chao, S

    2018-02-01

    Leaf rust caused by Puccinia triticina is an important disease of wheat in many regions worldwide. Durable or long-lasting leaf rust resistance has been difficult to achieve because populations of P. triticina are highly variable for virulence to race-specific resistance genes, and respond to selection by resistance genes in released wheat cultivars. The wheat cultivar Toropi, developed and grown in Brazil, was noted to have long-lasting leaf rust resistance that was effective only in adult plants. The objectives of this study were to determine the chromosome location of the leaf rust resistance genes derived from Toropi in two populations of recombinant inbred lines in a partial Thatcher wheat background. In the first population, a single gene with major effects on chromosome 5DS that mapped 2.2 centimorgans distal to IWA6289, strongly reduced leaf rust severity in all 3 years of field plot tests. This gene for adult plant leaf rust resistance was designated as Lr78. In the second population, quantitative trait loci (QTL) with small effects on chromosomes 1BL, 3BS, and 4BS were found. These QTL expressed inconsistently over 4 years of field plot tests. The adult plant leaf rust resistance derived from Toropi involved a complex combination of QTL with large and small effects.

  9. Molecular implications from ssr markers for stripe rust (puccinia striiformis F.Sp. tritici) resistance gene in bread wheat line N95175

    International Nuclear Information System (INIS)

    Ali, M.; Ji, W.G.; Hu, Y.G; Zhong, H.; Wang, C.Y.; Baloch, G.M.

    2010-01-01

    Stripe rust caused by Puccinia striiformis f. sp. tritici is one of the most devastating diseases of wheat in China as well as in Pakistan. In the present studies F2 population was established by crossing N95175 resistant to stripe rust race CYR32 with two susceptible lines Huixianhong and Abbondanza to molecularly tag resistance gene existing in wheat line N95175. The segregation of phenotype was accorded with an expected 3:1 ratio in both combinations studied and fit the model of a single dominant gene controlling stripe rust resistance in N95175. Thirty five SSR primer pairs were screened on the parents and bulks and also on individuals since resistance gene to be located in chromosome 1B. The result indicated that most of resistant plants amplified same band as resistant parent while susceptible plants amplified same as susceptible parents studied and considered that markers co-segregated with resistant loci in N95175. This yellow rust resistance gene was considered to be Yr26 originally thought to be also located in chromosome arm 1BS linked to marker loci Xgwm273 and Xgwm11 with genetic distances ranging from 1.075cM to 2.74cM in both combinations studied. However, the closest loci were observed 2.67cM for Xgwm273 and 1.075cM for Xgwm11 in Huixianhong XN95175 and Abbondanza XN95175 crosses respectively. Hence, it has been concluded that the PCR-based micro satellite markers Xgwm273 and Xgwm11 located in chromosome 1B were shown to be very effective for the detection of Yr26 gene in segregating population and can be applied in future wheat breeding strategies. (author)

  10. Studies on general resistance to stem rust in wheat

    International Nuclear Information System (INIS)

    Knott, D.R.

    1977-01-01

    Eight cultivars that were thought to have field resistance to stem rust were selected and crossed to produce four four-cultivar hybrids. From those crosses lines were produced that lacked seedling resistance to race 15B-1 of stem rust but had good field resistance to it. They also proved to have field resistance to many other races and it is hoped that the resistance is general. Genetic studies indicated that there is some variation in the lines, but resistance is generally inherited as a quantitative character with several largely recessive genes having small additive effects. This suggests that in an induced mutation programme, no one plant is likely to accumulate sufficient mutant genes that it will appear resistant. (author)

  11. Induced mutations for horizontal resistance. A model study using leaf rust resistance in wheat

    International Nuclear Information System (INIS)

    Chopra, V.L.; Sawhney, R.N.; Kumar, R.

    1983-01-01

    A mutant with seemingly non-specific resistance to leaf rust was obtained some time ago from the wheat variety Kharchia Local treated with NMH. This mutant is being studied genetically and in its disease reaction by laboratories in Australia, Canada and India in co-operation. The mutant showed a dominant inheritance of resistance in F 1 , but different segregation in F 2 and F 3 . This peculiar genetic behaviour has so far not been explained. (author)

  12. Mapping genes for resistance to stripe rust in spring wheat landrace PI 480035.

    Directory of Open Access Journals (Sweden)

    Jinita Sthapit Kandel

    Full Text Available Stripe rust caused by Puccinia striiformis Westend. f. sp. tritici Erikks. is an economically important disease of wheat (Triticum aestivum L.. Hexaploid spring wheat landrace PI 480035 was highly resistant to stripe rust in the field in Washington during 2011 and 2012. The objective of this research was to identify quantitative trait loci (QTL for stripe rust resistance in PI 480035. A spring wheat, "Avocet Susceptible" (AvS, was crossed with PI 480035 to develop a biparental population of 110 recombinant inbred lines (RIL. The population was evaluated in the field in 2013 and 2014 and seedling reactions were examined against three races (PSTv-14, PSTv-37, and PSTv-40 of the pathogen under controlled conditions. The population was genotyped with genotyping-by-sequencing and microsatellite markers across the whole wheat genome. A major QTL, QYr.wrsggl1-1BS was identified on chromosome 1B. The closest flanking markers were Xgwm273, Xgwm11, and Xbarc187 1.01 cM distal to QYr.wrsggl1-1BS, Xcfd59 0.59 cM proximal and XA365 3.19 cM proximal to QYr.wrsggl1-1BS. Another QTL, QYr.wrsggl1-3B, was identified on 3B, which was significant only for PSTv-40 and was not significant in the field, indicating it confers a race-specific resistance. Comparison with markers associated with previously reported Yr genes on 1B (Yr64, Yr65, and YrH52 indicated that QYr.wrsggl1-1BS is potentially a novel stripe rust resistance gene that can be incorporated into modern breeding materials, along with other all-stage and adult-plant resistance genes to develop cultivars that can provide durable resistance.

  13. Identification and characterization of pleiotropic and co-located resistance loci to leaf rust and stripe rust in bread wheat cultivar Sujata.

    Science.gov (United States)

    Lan, Caixia; Zhang, Yelun; Herrera-Foessel, Sybil A; Basnet, Bhoja R; Huerta-Espino, Julio; Lagudah, Evans S; Singh, Ravi P

    2015-03-01

    Two new co-located resistance loci, QLr.cim - 1AS/QYr.cim - 1AS and QLr.cim - 7BL/YrSuj , in combination with Lr46 / Yr29 and Lr67/Yr46 , and a new leaf rust resistance quantitative trait loci, conferred high resistance to rusts in adult plant stage. The tall Indian bread wheat cultivar Sujata displays high and low infection types to leaf rust and stripe rust, respectively, at the seedling stage in greenhouse tests. It was also highly resistant to both rusts at adult plant stage in field trials in Mexico. The genetic basis of this resistance was investigated in a population of 148 F5 recombinant inbred lines (RILs) derived from the cross Avocet × Sujata. The parents and RIL population were characterized in field trials for resistance to leaf rust during 2011 at El Batán, and 2012 and 2013 at Ciudad Obregón, Mexico, and for stripe rust during 2011 and 2012 at Toluca, Mexico; they were also characterized three times for stripe rust at seedling stage in the greenhouse. The RILs were genotyped with diversity arrays technology and simple sequence repeat markers. The final genetic map was constructed with 673 polymorphic markers. Inclusive composite interval mapping analysis detected two new significant co-located resistance loci, QLr.cim-1AS/QYr.cim-1AS and QLr.cim-7BL/YrSuj, on chromosomes 1AS and 7BL, respectively. The chromosomal position of QLr.cim-7BL overlapped with the seedling stripe rust resistance gene, temporarily designated as YrSuj. Two previously reported pleiotropic adult plant resistance genes, Lr46/Yr29 and Lr67/Yr46, and a new leaf rust resistance quantitative trait loci derived from Avocet were also mapped in the population. The two new co-located resistance loci are expected to contribute to breeding durable rust resistance in wheat. Closely linked molecular markers can be used to transfer all four resistance loci simultaneously to modern wheat varieties.

  14. Breeding of new variety Yangfumai 4 with high resistance to wheat yellow mosaic disease

    International Nuclear Information System (INIS)

    He Zhentian; Chen Xiulan; Zhang Rong; Wang Jianhua; Wang Jinrong; Liu Jian

    2011-01-01

    To control the infection of wheat yellow mosaic disease,new wheat variety with high-yield, disease-resistant was selected. Ningmai 9, which carries yellow mosaic disease resistant genes, was used as original material. Combination of conventional breeding technique and radiation methods, a new wheat variety Yangfumai 4 was developed during 1996-2007, and registered in 2008. The new wheat variety with high yield and resistance to yellow mosaic disease is suitable to plant in the Yangtze River region. (authors)

  15. Genomic and pedigree-based prediction for leaf, stem, and stripe rust resistance in wheat.

    Science.gov (United States)

    Juliana, Philomin; Singh, Ravi P; Singh, Pawan K; Crossa, Jose; Huerta-Espino, Julio; Lan, Caixia; Bhavani, Sridhar; Rutkoski, Jessica E; Poland, Jesse A; Bergstrom, Gary C; Sorrells, Mark E

    2017-07-01

    Genomic prediction for seedling and adult plant resistance to wheat rusts was compared to prediction using few markers as fixed effects in a least-squares approach and pedigree-based prediction. The unceasing plant-pathogen arms race and ephemeral nature of some rust resistance genes have been challenging for wheat (Triticum aestivum L.) breeding programs and farmers. Hence, it is important to devise strategies for effective evaluation and exploitation of quantitative rust resistance. One promising approach that could accelerate gain from selection for rust resistance is 'genomic selection' which utilizes dense genome-wide markers to estimate the breeding values (BVs) for quantitative traits. Our objective was to compare three genomic prediction models including genomic best linear unbiased prediction (GBLUP), GBLUP A that was GBLUP with selected loci as fixed effects and reproducing kernel Hilbert spaces-markers (RKHS-M) with least-squares (LS) approach, RKHS-pedigree (RKHS-P), and RKHS markers and pedigree (RKHS-MP) to determine the BVs for seedling and/or adult plant resistance (APR) to leaf rust (LR), stem rust (SR), and stripe rust (YR). The 333 lines in the 45th IBWSN and the 313 lines in the 46th IBWSN were genotyped using genotyping-by-sequencing and phenotyped in replicated trials. The mean prediction accuracies ranged from 0.31-0.74 for LR seedling, 0.12-0.56 for LR APR, 0.31-0.65 for SR APR, 0.70-0.78 for YR seedling, and 0.34-0.71 for YR APR. For most datasets, the RKHS-MP model gave the highest accuracies, while LS gave the lowest. GBLUP, GBLUP A, RKHS-M, and RKHS-P models gave similar accuracies. Using genome-wide marker-based models resulted in an average of 42% increase in accuracy over LS. We conclude that GS is a promising approach for improvement of quantitative rust resistance and can be implemented in the breeding pipeline.

  16. Genetic differentiation of the wheat leaf rust fungus Puccinia triticina in Pakistan and genetic relationship to other worldwide populations

    Science.gov (United States)

    Collections of Puccinia triticina, the wheat leaf rust pathogen, were obtained from Pakistan in 2008, 2010, 2011, 2013, and 2014. Collections were also obtained from Bhutan in 2013. Single uredinial isolates were derived and tested for virulence phenotype to 20 lines of Thatcher wheat that differ fo...

  17. Yr10 gene polymorphism in bread wheat varieties | Temel | African ...

    African Journals Online (AJOL)

    Yellow rust resistance locus Yr10 located on chromosome 1B in Moro and originated from the Turkish line PI178383 was investigated in terms of polymorphism in seven winter type bread wheat cvs. (Triticum aestivum ssp. Aestivum) Altay2000, zgi2001, Sönmez2001 (yellow rust resistant), Aytýn98, ES14, Harmankaya99 ...

  18. Molecular mapping of Yr53, a new gene for stripe rust resistance in durum wheat accession PI 480148 and its transfer to common wheat

    Science.gov (United States)

    Stripe rust, caused by Puccinia striiformis f. sp. tritici (Pst), is one of the most damaging diseases of wheat worldwide. It is essential to identify new genes for effective resistance against the disease. Durum wheat PI 480148, originally from Ethiopia, was resistant in all seedling tests with s...

  19. Resistance to stem rust Ug99 in six bread wheat cultivars maps to chromosome 6DS.

    Science.gov (United States)

    Lopez-Vera, Eric E; Nelson, Sarah; Singh, Ravi P; Basnet, Bhoja R; Haley, Scott D; Bhavani, Sridhar; Huerta-Espino, Julio; Xoconostle-Cazares, Beatriz G; Ruiz-Medrano, Roberto; Rouse, Matthew N; Singh, Sukhwinder

    2014-01-01

    Identified SSR markers ( Xcfd49 and Xbarc183 ) linked with stem rust resistance for efficient use in marker-assisted selection and stacking of resistance genes in wheat breeding programs. More than 80 % of the worldwide wheat (Triticum aestivum L.) area is currently sown with varieties susceptible to the Ug99 race group of stem rust fungus. However, wheat lines Niini, Tinkio, Coni, Pfunye, Blouk, and Ripper have demonstrated Ug99 resistance at the seedling and adult plant stages. We mapped stem rust resistance in populations derived from crosses of a susceptible parent with each of the resistant lines. The segregation of resistance in each population indicated the presence of a single gene. The resistance gene in Niini mapped to short arm of chromosome 6D and was flanked by SSR markers Xcfd49 at distances of 3.9 cM proximal and Xbarc183 8.4 cM distal, respectively. The chromosome location of this resistance was validated in three other populations: PBW343/Coni, PBW343/Tinkio, and Cacuke/Pfunye. Resistance initially postulated to be conferred by the SrTmp gene in Blouk and Ripper was also linked to Xcfd49 and Xbarc183 on 6DS, but it was mapped proximal to Xbarc183 at a similar position to previously mapped genes Sr42 and SrCad. Based on the variation in diagnostic marker alleles, it is possible that Niini and Pfunye may carry different resistance genes/alleles. Further studies are needed to determine the allelic relationships between various genes located on chromosome arm 6DS. Our results provide valuable molecular marker and genetic information for developing Ug99 resistant wheat varieties in diverse germplasm and using these markers to tag the resistance genes in wheat breeding.

  20. Race-Specific Adult-Plant Resistance in Winter Wheat to Stripe Rust and Characterization of Pathogen Virulence Patterns.

    Science.gov (United States)

    Milus, Eugene A; Moon, David E; Lee, Kevin D; Mason, R Esten

    2015-08-01

    Stripe rust, caused by Puccinia striiformis f. sp. tritici, is an important disease of wheat in the Great Plains and southeastern United States. Growing resistant cultivars is the preferred means for managing stripe rust, but new virulence in the pathogen population overcomes some of the resistance. The objectives of this study were to characterize the stripe rust resistance in contemporary soft and hard red winter wheat cultivars, to characterize the virulence of P. striiformis f. sp. tritici isolates based on the resistances found in the cultivars, and to determine wheat breeders' perceptions on the importance and methods for achieving stripe rust resistance. Seedlings of cultivars were susceptible to recent isolates, indicating they lacked effective all-stage resistance. However, adult-plants were resistant or susceptible depending on the isolate, indicating they had race-specific adult-plant resistance. Using isolates collected from 1990 to 2013, six major virulence patterns were identified on adult plants of twelve cultivars that were selected as adult-plant differentials. Race-specific adult-plant resistance appears to be the only effective type of resistance protecting wheat from stripe rust in eastern United States. Among wheat breeders, the importance of incorporating stripe rust resistance into cultivars ranged from high to low depending on the frequency of epidemics in their region, and most sources of stripe rust resistance were either unknown or already overcome by virulence in the pathogen population. Breeders with a high priority for stripe rust resistance made most of their selections based on adult-plant reactions in the field, whereas breeders with a low priority for resistance based selections on molecular markers for major all-stage resistance genes.

  1. Characterization and Mapping of Leaf Rust and Stripe Rust Resistance Loci in Hexaploid Wheat Lines UC1110 and PI610750 under Mexican Environments.

    Science.gov (United States)

    Lan, Caixia; Hale, Iago L; Herrera-Foessel, Sybil A; Basnet, Bhoja R; Randhawa, Mandeep S; Huerta-Espino, Julio; Dubcovsky, Jorge; Singh, Ravi P

    2017-01-01

    Growing resistant wheat varieties is a key method of minimizing the extent of yield losses caused by the globally important wheat leaf rust (LR) and stripe rust (YR) diseases. In this study, a population of 186 F 8 recombinant inbred lines (RILs) derived from a cross between a synthetic wheat derivative (PI610750) and an adapted common wheat line (cv. "UC1110") were phenotyped for LR and YR response at both seedling and adult plant stages over multiple seasons. Using a genetic linkage map consisting of single sequence repeats and diversity arrays technology markers, in combination with inclusive composite interval mapping analysis, we detected a new LR adult plant resistance (APR) locus, QLr.cim-2DS , contributed by UC1110. One co-located resistance locus to both rusts, QLr.cim-3DC/QYr.cim-3DC , and the known seedling resistance gene Lr26 were also mapped. QLr.cim-2DS and QLr.cim-3DC showed a marginally significant interaction for LR resistance in the adult plant stage. In addition, two previously reported YR APR loci, QYr.ucw-3BS and Yr48 , were found to exhibit stable performances in rust environments in both Mexico and the United States and showed a highly significant interaction in the field. Yr48 was also observed to confer intermediate seedling resistance against Mexican YR races, thus suggesting it should be re-classified as an all-stage resistance gene. We also identified 5 and 2 RILs that possessed all detected YR and LR resistance loci, respectively. With the closely linked molecular markers reported here, these RILs could be used as donors for multiple resistance loci to both rusts in wheat breeding programs.

  2. Expression of apoplast-targeted plant defensin MtDef4.2 confers resistance to leaf rust pathogen Puccinia triticina but does not affect mycorrhizal symbiosis in transgenic wheat

    Science.gov (United States)

    Rust diseases caused by Puccinia spp. pose a major threat to global wheat production. Puccinia triticina (Pt), an obligate basidiomycete biotroph, causes leaf rust disease which incurs yield losses of up to 50% in wheat. Historically, resistant wheat cultivars have been used to control leaf rust, bu...

  3. Seedling Resistance to Stem Rust and Molecular Marker Analysis of Resistance Genes in Wheat Cultivars of Yunnan, China.

    Directory of Open Access Journals (Sweden)

    Tian Ya Li

    Full Text Available Stem rust is one of the most potentially harmful wheat diseases, but has been effectively controlled in China since 1970s. However, the interest in breeding wheat with durable resistance to stem rust has been renewed with the emergence of Ug99 (TTKSK virulent to the widely used resistance gene Sr31, and by which the wheat stem rust was controlled for 40 years in wheat production area worldwide. Yunnan Province, located on the Southwest border of China, is one of the main wheat growing regions, playing a pivotal role in the wheat stem rust epidemic in China. This study investigated the levels of resistance in key wheat cultivars (lines of Yunnan Province. In addition, the existence of Sr25, Sr26, Sr28, Sr31, Sr32, and Sr38 genes in 119 wheat cultivars was assessed using specific DNA markers. The results indicated that 77 (64.7% tested wheat varieties showed different levels of resistance to all the tested races of Puccinia graminis f. sp. tritici. Using molecular markers, we identified the resistance gene Sr31 in 43 samples; Sr38 in 10 samples; Sr28 in 12 samples, and one sample which was resistant against Ug99 (avirulent to Sr32. No Sr25 or Sr26 (effective against Ug99 was identified in any cultivars tested. Furthermore, 5 out of 119 cultivars tested carried both Sr31 and Sr38 and eight contained both Sr31 and Sr28. The results enable the development of appropriate strategies to breed varieties resistant to stem rust.

  4. A new 2DS·2RL Robertsonian translocation transfers stem rust resistance gene Sr59 into wheat.

    Science.gov (United States)

    Rahmatov, Mahbubjon; Rouse, Matthew N; Nirmala, Jayaveeramuthu; Danilova, Tatiana; Friebe, Bernd; Steffenson, Brian J; Johansson, Eva

    2016-07-01

    A new stem rust resistance gene Sr59 from Secale cereale was introgressed into wheat as a 2DS·2RL Robertsonian translocation. Emerging new races of the wheat stem rust pathogen (Puccinia graminis f. sp. tritici), from Africa threaten global wheat (Triticum aestivum L.) production. To broaden the resistance spectrum of wheat to these widely virulent African races, additional resistance genes must be identified from all possible gene pools. From the screening of a collection of wheat-rye (Secale cereale L.) chromosome substitution lines developed at the Swedish University of Agricultural Sciences, we described the line 'SLU238' 2R (2D) as possessing resistance to many races of P. graminis f. sp. tritici, including the widely virulent race TTKSK (isolate synonym Ug99) from Africa. The breakage-fusion mechanism of univalent chromosomes was used to produce a new Robertsonian translocation: T2DS·2RL. Molecular marker analysis and stem rust seedling assays at multiple generations confirmed that the stem rust resistance from 'SLU238' is present on the rye chromosome arm 2RL. Line TA5094 (#101) was derived from 'SLU238' and was found to be homozygous for the T2DS·2RL translocation. The stem rust resistance gene on chromosome 2RL arm was designated as Sr59. Although introgressions of rye chromosome arms into wheat have most often been facilitated by irradiation, this study highlights the utility of the breakage-fusion mechanism for rye chromatin introgression. Sr59 provides an additional asset for wheat improvement to mitigate yield losses caused by stem rust.

  5. Induced mutations of rust resistance genes in wheat

    International Nuclear Information System (INIS)

    McIntosh, R.A.

    1983-01-01

    Induced mutations are being used as a tool to study genes for resistance in wheat. It was found that Pm1 can be separated from Lr20 and Sr15, but these two react like a single pleiotropic gene. Mutants were further examined in crosses and backmutations have been attempted. (author)

  6. Mapping and characterization of the new adult plant leaf rust resistance gene Lr77 derived from Santa Fe winter wheat.

    Science.gov (United States)

    Kolmer, James A; Su, Zhenqi; Bernardo, Amy; Bai, Guihua; Chao, Shiaoman

    2018-04-25

    A new gene for adult plant leaf rust resistance in wheat was mapped to chromosome 3BL. This gene was designated as Lr77. 'Santa Fe' is a hard red winter cultivar that has had long-lasting resistance to the leaf rust fungus, Puccinia triticina. The objective of this study was to determine the chromosome location of the adult plant leaf rust resistance in Santa Fe wheat. A partial backcross line of 'Thatcher' (Tc) wheat with adult plant leaf rust resistance derived from Santa Fe was crossed with Thatcher to develop a Thatcher//Tc*2/Santa Fe F 6 recombinant inbred line (RIL) population. The RIL population and parental lines were evaluated for segregation of leaf rust resistance in three field plot tests and in an adult plant greenhouse test. A genetic map of the RIL population was constructed using 90,000 single-nucleotide polymorphism (SNP) markers with the Illumina Infinium iSelect 90K wheat bead array. A significant quantitative trait locus for reduction of leaf rust severity in all four tests was found on chromosome 3BL that segregated as a single adult plant resistance gene. The RILs with the allele from the resistant parent for SNP marker IWB10344 had lower leaf rust severity and a moderately resistant to moderately susceptible response compared to the susceptible RILs and Thatcher. The gene derived from Santa Fe on chromosome 3BL was designated as Lr77. Kompetitive allele-specific polymerase chain reaction assay markers linked to Lr77 on 3BL should be useful for selection of wheat germplasm with this gene.

  7. Simultaneous Transfer of Leaf Rust and Powdery Mildew Resistance Genes from Hexaploid Triticale Cultivar Sorento into Bread Wheat.

    Science.gov (United States)

    Li, Feng; Li, Yinghui; Cao, Lirong; Liu, Peiyuan; Geng, Miaomiao; Zhang, Qiang; Qiu, Lina; Sun, Qixin; Xie, Chaojie

    2018-01-01

    Wheat powdery mildew, caused by Blumeria graminis f. sp. tritici , and wheat leaf rust, caused by Puccinia triticina Eriks, are two important diseases that severely threaten wheat production. Sorento, a hexaploid triticale cultivar from Poland, shows high resistance to the wheat powdery mildew isolate E09 and the leaf rust isolate PHT in Beijing, China. To introduce resistance genes into common wheat, Sorento was crossed with wheat line Xuezao, which is susceptible to both diseases, and the F 1 hybrids were then backcrossed with Xuezao as the recurrent male parent. By marker analysis, we demonstrate that the long arm of the 2R (2RL) chromosome confers resistance to both the leaf rust and powdery mildew isolates at adult-plant and seedling stages, while the long arm of 4R (4RL) confers resistance only to powdery mildew at both stages. The chromosomal composition of BC 2 F 3 plants containing 2R or 2RL and 4R or 4RL in the form of substitution and translocation were confirmed by GISH (genomic in situ hybridization) and FISH (fluorescence in situ hybridization). Monosomic and disomic substitutions of a wheat chromosome with chromosome 2R or 4R, as well as one 4RS-4DL/4DS-4RL reciprocal translocation homozigote and one 2RL-1DL translocation hemizigote, were recovered. Such germplasms are of great value in wheat improvement.

  8. Genetics of leaf rust-resistant mutant WH 147-LM-1 in hexaploid wheat variety WH 147

    International Nuclear Information System (INIS)

    Reddy, V.R.K.; Viswanathan, P.

    1999-01-01

    By applying gamma rays, EMS and their combination in hexaploid wheat variety WH 147, a total of 20 mutants (0.0226%) exhibiting complete leaf rust resistance were isolated from segregating M2 rows.When one of the rust-resistant mutants, WH 147-LM-1 was crossed with the universally susceptible, suggesting that the mutant character is controlled by one dominant gene and one recessive gene.The F2 plants derived by crossing the mutant WH 147-LM with seven near-isogenic wheat lines showed segregation for susceptibility, indicating that the mutant character was indeed generated through induced mutations

  9. Influence of stripe rust infection on the photosynthetic characteristics and antioxidant system of susceptible and resistant wheat cultivars at the adult plant stage.

    Science.gov (United States)

    Chen, Yang-Er; Cui, Jun-Mei; Su, Yan-Qiu; Yuan, Shu; Yuan, Ming; Zhang, Huai-Yu

    2015-01-01

    Wheat stripe rust (Puccinia striiformis f. sp. tritici, Pst), is one of the most serious diseases of wheat (Triticum aestivum L.) worldwide. To gain a better understanding of the protective mechanism against stripe rust at the adult plant stage, the differences in photosystem II and antioxidant enzymatic systems between susceptible and resistant wheat in response to stripe rust disease (P. striiformis) were investigated. We found that chlorophyll fluorescence and the activities of the antioxidant enzymes were higher in resistant wheat than in susceptible wheat after stripe rust infection. Compared with the susceptible wheat, the resistant wheat accumulated a higher level of D1 protein and a lower level of reactive oxygen species after infection. Furthermore, our results demonstrate that D1 and light-harvesting complex II (LHCII) phosphorylation are involved in the resistance to stripe rust in wheat. The CP29 protein was phosphorylated under stripe rust infection, like its phosphorylation in other monocots under environmental stresses. More extensive damages occur on the thylakoid membranes in the susceptible wheat compared with the resistant wheat. The findings provide evidence that thylakoid protein phosphorylation and antioxidant enzyme systems play important roles in plant responses and defense to biotic stress.

  10. Evaluation of 19,460 Wheat Accessions Conserved in the Indian National Genebank to Identify New Sources of Resistance to Rust and Spot Blotch Diseases.

    Science.gov (United States)

    Kumar, Sundeep; Archak, Sunil; Tyagi, R K; Kumar, Jagdish; Vk, Vikas; Jacob, Sherry R; Srinivasan, Kalyani; Radhamani, J; Parimalan, R; Sivaswamy, M; Tyagi, Sandhya; Yadav, Mamata; Kumari, Jyotisna; Deepali; Sharma, Sandeep; Bhagat, Indoo; Meeta, Madhu; Bains, N S; Chowdhury, A K; Saha, B C; Bhattacharya, P M; Kumari, Jyoti; Singh, M C; Gangwar, O P; Prasad, P; Bharadwaj, S C; Gogoi, Robin; Sharma, J B; Gm, Sandeep Kumar; Saharan, M S; Bag, Manas; Roy, Anirban; Prasad, T V; Sharma, R K; Dutta, M; Sharma, Indu; Bansal, K C

    2016-01-01

    A comprehensive germplasm evaluation study of wheat accessions conserved in the Indian National Genebank was conducted to identify sources of rust and spot blotch resistance. Genebank accessions comprising three species of wheat-Triticum aestivum, T. durum and T. dicoccum were screened sequentially at multiple disease hotspots, during the 2011-14 crop seasons, carrying only resistant accessions to the next step of evaluation. Wheat accessions which were found to be resistant in the field were then assayed for seedling resistance and profiled using molecular markers. In the primary evaluation, 19,460 accessions were screened at Wellington (Tamil Nadu), a hotspot for wheat rusts. We identified 4925 accessions to be resistant and these were further evaluated at Gurdaspur (Punjab), a hotspot for stripe rust and at Cooch Behar (West Bengal), a hotspot for spot blotch. The second round evaluation identified 498 accessions potentially resistant to multiple rusts and 868 accessions potentially resistant to spot blotch. Evaluation of rust resistant accessions for seedling resistance against seven virulent pathotypes of three rusts under artificial epiphytotic conditions identified 137 accessions potentially resistant to multiple rusts. Molecular analysis to identify different combinations of genetic loci imparting resistance to leaf rust, stem rust, stripe rust and spot blotch using linked molecular markers, identified 45 wheat accessions containing known resistance genes against all three rusts as well as a QTL for spot blotch resistance. The resistant germplasm accessions, particularly against stripe rust, identified in this study can be excellent potential candidates to be employed for breeding resistance into the background of high yielding wheat cultivars through conventional or molecular breeding approaches, and are expected to contribute toward food security at national and global levels.

  11. Evaluation of 19,460 Wheat Accessions Conserved in the Indian National Genebank to Identify New Sources of Resistance to Rust and Spot Blotch Diseases.

    Directory of Open Access Journals (Sweden)

    Sundeep Kumar

    Full Text Available A comprehensive germplasm evaluation study of wheat accessions conserved in the Indian National Genebank was conducted to identify sources of rust and spot blotch resistance. Genebank accessions comprising three species of wheat-Triticum aestivum, T. durum and T. dicoccum were screened sequentially at multiple disease hotspots, during the 2011-14 crop seasons, carrying only resistant accessions to the next step of evaluation. Wheat accessions which were found to be resistant in the field were then assayed for seedling resistance and profiled using molecular markers. In the primary evaluation, 19,460 accessions were screened at Wellington (Tamil Nadu, a hotspot for wheat rusts. We identified 4925 accessions to be resistant and these were further evaluated at Gurdaspur (Punjab, a hotspot for stripe rust and at Cooch Behar (West Bengal, a hotspot for spot blotch. The second round evaluation identified 498 accessions potentially resistant to multiple rusts and 868 accessions potentially resistant to spot blotch. Evaluation of rust resistant accessions for seedling resistance against seven virulent pathotypes of three rusts under artificial epiphytotic conditions identified 137 accessions potentially resistant to multiple rusts. Molecular analysis to identify different combinations of genetic loci imparting resistance to leaf rust, stem rust, stripe rust and spot blotch using linked molecular markers, identified 45 wheat accessions containing known resistance genes against all three rusts as well as a QTL for spot blotch resistance. The resistant germplasm accessions, particularly against stripe rust, identified in this study can be excellent potential candidates to be employed for breeding resistance into the background of high yielding wheat cultivars through conventional or molecular breeding approaches, and are expected to contribute toward food security at national and global levels.

  12. Genomic Selection for Quantitative Adult Plant Stem Rust Resistance in Wheat

    Directory of Open Access Journals (Sweden)

    Jessica E. Rutkoski

    2014-11-01

    Full Text Available Quantitative adult plant resistance (APR to stem rust ( f. sp. is an important breeding target in wheat ( L. and a potential target for genomic selection (GS. To evaluate the relative importance of known APR loci in applying GS, we characterized a set of CIMMYT germplasm at important APR loci and on a genome-wide profile using genotyping-by-sequencing (GBS. Using this germplasm, we describe the genetic architecture and evaluate prediction models for APR using data from the international Ug99 stem rust screening nurseries. Prediction models incorporating markers linked to important APR loci and seedling phenotype scores as fixed effects were evaluated along with the classic prediction models: Multiple linear regression (MLR, Genomic best linear unbiased prediction (G-BLUP, Bayesian Lasso (BL, and Bayes Cπ (BCπ. We found the region to play an important role in APR in this germplasm. A model using linked markers as fixed effects in G-BLUP was more accurate than MLR with linked markers (-value = 0.12, and ordinary G-BLUP (-value = 0.15. Incorporating seedling phenotype information as fixed effects in G-BLUP did not consistently increase accuracy. Overall, levels of prediction accuracy found in this study indicate that GS can be effectively applied to improve stem rust APR in this germplasm, and if genotypes at linked markers are available, modeling these genotypes as fixed effects could lead to better predictions.

  13. Cytological and molecular analysis of nonhost resistance in rice to wheat powdery mildew and leaf rust pathogens.

    Science.gov (United States)

    Cheng, Yulin; Yao, Juanni; Zhang, Hongchang; Huang, Lili; Kang, Zhensheng

    2015-07-01

    Cereal powdery mildews caused by Blumeria graminis and cereal rusts caused by Puccinia spp. are constant disease threats that limit the production of almost all important cereal crops. Rice is an intensively grown agricultural cereal that is atypical because of its immunity to all powdery mildew and rust fungi. We analyzed the nonhost interactions between rice and the wheat powdery mildew fungus B. graminis f. sp. tritici (Bgt) and the wheat leaf rust fungus Puccinia triticina (Ptr) to identify the basis of nonhost resistance (NHR) in rice against cereal powdery mildew and rust fungi at cytological and molecular levels. No visible symptoms were observed on rice leaves inoculated with Bgt or Ptr. Microscopic observations showed that both pathogens exhibited aberrant differentiation and significantly reduced penetration frequencies on rice compared to wheat. The development of Bgt and Ptr was also completely arrested at early infection stages in cases of successful penetration into rice leaves. Attempted infection of rice by Bgt and Ptr induced similar defense responses, including callose deposition, accumulation of reactive oxygen species, and hypersensitive response in rice epidermal and mesophyll cells, respectively. Furthermore, a set of defense-related genes were upregulated in rice against Bgt and Ptr infection. Rice is an excellent monocot model for genetic and molecular studies. Therefore, our results demonstrate that rice is a useful model to study the mechanisms of NHR to cereal powdery mildew and rust fungi, which provides useful information for the development of novel and durable strategies to control these important pathogens.

  14. Genome-Wide Association Mapping for Resistance to Leaf and Stripe Rust in Winter-Habit Hexaploid Wheat Landraces.

    Directory of Open Access Journals (Sweden)

    Albert Kertho

    Full Text Available Leaf rust, caused by Puccinia triticina (Pt, and stripe rust, caused by P. striiformis f. sp. tritici (Pst, are destructive foliar diseases of wheat worldwide. Breeding for disease resistance is the preferred strategy of managing both diseases. The continued emergence of new races of Pt and Pst requires a constant search for new sources of resistance. Here we report a genome-wide association analysis of 567 winter wheat (Triticum aestivum landrace accessions using the Infinium iSelect 9K wheat SNP array to identify loci associated with seedling resistance to five races of Pt (MDCL, MFPS, THBL, TDBG, and TBDJ and one race of Pst (PSTv-37 frequently found in the Northern Great Plains of the United States. Mixed linear models identified 65 and eight significant markers associated with leaf rust and stripe rust, respectively. Further, we identified 31 and three QTL associated with resistance to Pt and Pst, respectively. Eleven QTL, identified on chromosomes 3A, 4A, 5A, and 6D, are previously unknown for leaf rust resistance in T. aestivum.

  15. Induced multiple disease resistance in wheat

    International Nuclear Information System (INIS)

    Borojevic, K.; Worland, A.J.

    1990-01-01

    Full text: The existence of genes suppressing resistance to leaf rust, stem rust and yellow rust in hexaploid wheat has been suggested. If such genes are deleted or inactivated, a more resistant variety may be obtained. In mutant lines of the wheat variety San Pastore, selected after treatment with 20,000 rad of gamma-rays, resistance to leaf rust, yellow rust, stem rust, and to some extent to Erysiphe graminis was determined. The mutants responded to infection by producing necrotic flecks in the presence of high level of disease inoculum. Similar flecks develop under stress condition. It is likely that the mother variety San Pastore carries genes for resistance which are masked by suppressor genes. Irradiation inactivates suppressors so that resistance genes which were previously masked are expressed. The first results of monosomic analysis indicate that chromosomes of groups 4 and 5 or possibly 7 may be critical for expression of resistance in the mutant lines. (author)

  16. Characterization of non-host resistance in broad bean to the wheat stripe rust pathogen

    Directory of Open Access Journals (Sweden)

    Cheng Yulin

    2012-06-01

    Full Text Available Abstract Background Non-host resistance (NHR confers plant species immunity against the majority of microbial pathogens and represents the most robust and durable form of plant resistance in nature. As one of the main genera of rust fungi with economic and biological importance, Puccinia infects almost all cereals but is unable to cause diseases on legumes. Little is known about the mechanism of this kind of effective defense in legumes to these non-host pathogens. Results In this study, the basis of NHR in broad bean (Vicia faba L. against the wheat stripe rust pathogen, Puccinia striiformis f. sp. tritici (Pst, was characterized. No visible symptoms were observed on broad bean leaves inoculated with Pst. Microscopic observations showed that successful location of stomata and haustoria formation were significantly reduced in Pst infection of broad bean. Attempted infection induced the formation of papillae, cell wall thickening, production of reactive oxygen species, callose deposition and accumulation of phenolic compounds in plant cell walls. The few Pst haustoria that did form in broad bean cells were encased in reactive oxygen and callose materials and those cells elicited cell death. Furthermore, a total of seven defense-related genes were identified and found to be up-regulated during the Pst infection. Conclusions The results indicate that NHR in broad bean against Pst results from a continuum of layered defenses, including basic incompatibility, structural and chemical strengthening of cell wall, posthaustorial hypersensitive response and induction of several defense-related genes, demonstrating the multi-layered feature of NHR. This work also provides useful information for further determination of resistance mechanisms in broad bean to rust fungi, especially the adapted important broad bean rust pathogen, Uromyces viciae-fabae, because of strong similarity and association between NHR of plants to unadapted pathogens and basal

  17. Evaluation of 19,460 Wheat Accessions Conserved in the Indian National Genebank to Identify New Sources of Resistance to Rust and Spot Blotch Diseases

    Science.gov (United States)

    Jacob, Sherry R.; Srinivasan, Kalyani; Radhamani, J.; Parimalan, R.; Sivaswamy, M.; Tyagi, Sandhya; Yadav, Mamata; Kumari, Jyotisna; Deepali; Sharma, Sandeep; Bhagat, Indoo; Meeta, Madhu; Bains, N. S.; Chowdhury, A. K.; Saha, B. C.; Bhattacharya, P. M.; Kumari, Jyoti; Singh, M. C.; Gangwar, O. P.; Prasad, P.; Bharadwaj, S. C.; Gogoi, Robin; Sharma, J. B.; GM, Sandeep Kumar; Saharan, M. S.; Bag, Manas; Roy, Anirban; Prasad, T. V.; Sharma, R. K.; Dutta, M.; Sharma, Indu; Bansal, K. C.

    2016-01-01

    A comprehensive germplasm evaluation study of wheat accessions conserved in the Indian National Genebank was conducted to identify sources of rust and spot blotch resistance. Genebank accessions comprising three species of wheat–Triticum aestivum, T. durum and T. dicoccum were screened sequentially at multiple disease hotspots, during the 2011–14 crop seasons, carrying only resistant accessions to the next step of evaluation. Wheat accessions which were found to be resistant in the field were then assayed for seedling resistance and profiled using molecular markers. In the primary evaluation, 19,460 accessions were screened at Wellington (Tamil Nadu), a hotspot for wheat rusts. We identified 4925 accessions to be resistant and these were further evaluated at Gurdaspur (Punjab), a hotspot for stripe rust and at Cooch Behar (West Bengal), a hotspot for spot blotch. The second round evaluation identified 498 accessions potentially resistant to multiple rusts and 868 accessions potentially resistant to spot blotch. Evaluation of rust resistant accessions for seedling resistance against seven virulent pathotypes of three rusts under artificial epiphytotic conditions identified 137 accessions potentially resistant to multiple rusts. Molecular analysis to identify different combinations of genetic loci imparting resistance to leaf rust, stem rust, stripe rust and spot blotch using linked molecular markers, identified 45 wheat accessions containing known resistance genes against all three rusts as well as a QTL for spot blotch resistance. The resistant germplasm accessions, particularly against stripe rust, identified in this study can be excellent potential candidates to be employed for breeding resistance into the background of high yielding wheat cultivars through conventional or molecular breeding approaches, and are expected to contribute toward food security at national and global levels. PMID:27942031

  18. The wheat Lr34 multipathogen resistance gene confers resistance to anthracnose and rust in sorghum.

    Science.gov (United States)

    Schnippenkoetter, Wendelin; Lo, Clive; Liu, Guoquan; Dibley, Katherine; Chan, Wai Lung; White, Jodie; Milne, Ricky; Zwart, Alexander; Kwong, Eunjung; Keller, Beat; Godwin, Ian; Krattinger, Simon G; Lagudah, Evans

    2017-11-01

    The ability of the wheat Lr34 multipathogen resistance gene (Lr34res) to function across a wide taxonomic boundary was investigated in transgenic Sorghum bicolor. Increased resistance to sorghum rust and anthracnose disease symptoms following infection with the biotrophic pathogen Puccinia purpurea and the hemibiotroph Colletotrichum sublineolum, respectively, occurred in transgenic plants expressing the Lr34res ABC transporter. Transgenic sorghum lines that highly expressed the wheat Lr34res gene exhibited immunity to sorghum rust compared to the low-expressing single copy Lr34res genotype that conferred partial resistance. Pathogen-induced pigmentation mediated by flavonoid phytoalexins was evident on transgenic sorghum leaves following P. purpurea infection within 24-72 h, which paralleled Lr34res gene expression. Elevated expression of flavone synthase II, flavanone 4-reductase and dihydroflavonol reductase genes which control the biosynthesis of flavonoid phytoalexins characterized the highly expressing Lr34res transgenic lines 24-h post-inoculation with P. purpurea. Metabolite analysis of mesocotyls infected with C. sublineolum showed increased levels of 3-deoxyanthocyanidin metabolites were associated with Lr34res expression, concomitant with reduced symptoms of anthracnose. © 2017 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

  19. Adult plant leaf rust resistance derived from the soft red winter wheat cultivar Caldwell maps to chromosome 3BS

    Science.gov (United States)

    'Caldwell' is a U.S. soft red winter wheat that has partial, adult plant resistance to the leaf rust pathogen Puccinia triticina. A line of 'Thatcher*2/Caldwell' with adult plant resistance derived from Caldwell was crossed with 'Thatcher' to develop a population of recombinant inbred lines (RILs). ...

  20. Molecular and cytogenetic characterization of a durum wheat Aegilops speltoides chromosome translocation conferring resistance to stem rust

    Science.gov (United States)

    Stem rust is a serious disease of wheat that has caused historical epidemics, but it has not been a threat in recent decades in North America due to the eradication of the alternate host and deployment of resistant cultivars. However, the recent emergence of Ug99 (or race TTKS) poses a threat to glo...

  1. Gene discovery in EST sequences from the wheat leaf rust fungus Puccinia triticina sexual spores, asexual spores and haustoria, compared to other rust and corn smut fungi

    Science.gov (United States)

    2011-01-01

    Background Rust fungi are biotrophic basidiomycete plant pathogens that cause major diseases on plants and trees world-wide, affecting agriculture and forestry. Their biotrophic nature precludes many established molecular genetic manipulations and lines of research. The generation of genomic resources for these microbes is leading to novel insights into biology such as interactions with the hosts and guiding directions for breakthrough research in plant pathology. Results To support gene discovery and gene model verification in the genome of the wheat leaf rust fungus, Puccinia triticina (Pt), we have generated Expressed Sequence Tags (ESTs) by sampling several life cycle stages. We focused on several spore stages and isolated haustorial structures from infected wheat, generating 17,684 ESTs. We produced sequences from both the sexual (pycniospores, aeciospores and teliospores) and asexual (germinated urediniospores) stages of the life cycle. From pycniospores and aeciospores, produced by infecting the alternate host, meadow rue (Thalictrum speciosissimum), 4,869 and 1,292 reads were generated, respectively. We generated 3,703 ESTs from teliospores produced on the senescent primary wheat host. Finally, we generated 6,817 reads from haustoria isolated from infected wheat as well as 1,003 sequences from germinated urediniospores. Along with 25,558 previously generated ESTs, we compiled a database of 13,328 non-redundant sequences (4,506 singlets and 8,822 contigs). Fungal genes were predicted using the EST version of the self-training GeneMarkS algorithm. To refine the EST database, we compared EST sequences by BLASTN to a set of 454 pyrosequencing-generated contigs and Sanger BAC-end sequences derived both from the Pt genome, and to ESTs and genome reads from wheat. A collection of 6,308 fungal genes was identified and compared to sequences of the cereal rusts, Puccinia graminis f. sp. tritici (Pgt) and stripe rust, P. striiformis f. sp. tritici (Pst), and poplar

  2. Gene discovery in EST sequences from the wheat leaf rust fungus Puccinia triticina sexual spores, asexual spores and haustoria, compared to other rust and corn smut fungi

    Directory of Open Access Journals (Sweden)

    Wynhoven Brian

    2011-03-01

    Full Text Available Abstract Background Rust fungi are biotrophic basidiomycete plant pathogens that cause major diseases on plants and trees world-wide, affecting agriculture and forestry. Their biotrophic nature precludes many established molecular genetic manipulations and lines of research. The generation of genomic resources for these microbes is leading to novel insights into biology such as interactions with the hosts and guiding directions for breakthrough research in plant pathology. Results To support gene discovery and gene model verification in the genome of the wheat leaf rust fungus, Puccinia triticina (Pt, we have generated Expressed Sequence Tags (ESTs by sampling several life cycle stages. We focused on several spore stages and isolated haustorial structures from infected wheat, generating 17,684 ESTs. We produced sequences from both the sexual (pycniospores, aeciospores and teliospores and asexual (germinated urediniospores stages of the life cycle. From pycniospores and aeciospores, produced by infecting the alternate host, meadow rue (Thalictrum speciosissimum, 4,869 and 1,292 reads were generated, respectively. We generated 3,703 ESTs from teliospores produced on the senescent primary wheat host. Finally, we generated 6,817 reads from haustoria isolated from infected wheat as well as 1,003 sequences from germinated urediniospores. Along with 25,558 previously generated ESTs, we compiled a database of 13,328 non-redundant sequences (4,506 singlets and 8,822 contigs. Fungal genes were predicted using the EST version of the self-training GeneMarkS algorithm. To refine the EST database, we compared EST sequences by BLASTN to a set of 454 pyrosequencing-generated contigs and Sanger BAC-end sequences derived both from the Pt genome, and to ESTs and genome reads from wheat. A collection of 6,308 fungal genes was identified and compared to sequences of the cereal rusts, Puccinia graminis f. sp. tritici (Pgt and stripe rust, P. striiformis f. sp

  3. New Seeds are Resistant to Wheat Stem Rust (Ug99) Multinational Programme Supported by FAO and IAEA

    International Nuclear Information System (INIS)

    2013-01-01

    Full text: A multinational effort supported by the International Atomic Energy Agency and the U.N. Food and Agriculture Organization marked a key milestone this week when a Kenyan university debuted two new varieties of disease-resistant wheat to the nation's farmers. Over the past two days, thousands of Kenyan farmers have visited Eldoret University in western Kenya for a two-day agriculture fair highlighting the latest farming technologies. Supporting the development of the new varieties were the IAEA's Technical Cooperation Department and the Joint FAO/IAEA Programme of Nuclear Techniques in Food and Agriculture. They manage an interregional Technical Cooperation project to develop varieties of wheat that are resistant to a devastating type of fungus, causing a disease known as wheat stem rust. Wheat stem rust under control for over 30 years, but a resurgence of the disease was discovered in 1999 in Uganda that swiftly spread to neighbouring Kenya. The wheat stem rust, caused by the strain of the fungus known as Ug99, named after its place and year of origin, has since spread to Iran, Yemen and South Africa and threatens crops as far away as India as spores are carried by wind. Parasitic rusts threaten global wheat production, reducing plant growth and crop yields. The disease can destroy up to 70-100 percent of the yield of wheat crop if not prevented. 'Improving food security in developing countries through the use of nuclear techniques is an important priority of the IAEA', said IAEA Director General Yukiya Amano. 'I am pleased that we have been able to make an important contribution to fighting wheat rust'. 'Wheat rusts, particularly the Ug99 strain, are a major threat to food security because rust epidemics can result in devastating yield losses. This international project involving affected countries, plant scientists and breeders and international organizations is a major breakthrough. It clearly shows the benefits of FAO/IAEA collaboration and that

  4. Evaluation of Local Wheat Cultivars Susceptibility to infection with Black Stem Rust

    International Nuclear Information System (INIS)

    Batta, Y.A.

    2007-01-01

    The present study was conducted to assess the susceptibility of seven local wheat cultivars from Palestine to infection with black stem rust caused by Puccinia graminis f. sp. tritici. Two techniques of disease inoculation were applied during bioassays: global inoculation of entire wheat plants with urediospores and localized inoculation with urediospores and localized inoculation with urediospores on wheat leaf-pieces incubated under humid conditions. Susceptibility of tested cultivars was evaluated according to disease scale based on number and size of typical unredial pustules that appeared after inoculation on entire plants or leaf pieces. Results obtained on bioassay of susceptibility and disease rating on entire plants indicated that Anbar, Kamata and Hetiya safra cultivars were the least susceptible to P. g. tritici infection, whereas Debiya beda cultivar was the most susceptible. The other tested cultivars such as Nab-El-Jama, sawda and Senf 870 were moderately susceptible. On leaf-pieces, Anbar and Kamatat were the least susceptible cultivars, whereas Debiya beda and Nab-El-Jamal were the most susceptible cultivars. The other tested cultivars such as Debiya swada, Senf 870 and Hetiya safra were moderately susceptible. Significant reductions were obtained for the size of unredial postules formed on leaf-pieces when inoculated in an unwounded state compared to the wounded indicating the importance of wounds during inoculation. The global results indicated the possibility of using above method of disease inoculating, scaling and rating for evaluation of wheat cultivars susceptibility for the eventual use in breeding program for resistant varieties in Palestine. (author)

  5. Identification and characterization of Sr13, a tetraploid wheat gene that confers resistance to the Ug99 stem rust race group

    Science.gov (United States)

    The Puccinia graminis f. sp. tritici (Pgt) Ug99 race group is virulent to most stem rust resistance genes currently deployed in wheat and poses a serious threat to global wheat production. The durum wheat (Triticum turgidum ssp. durum) gene Sr13 confers resistance to Ug99 in addition to virulent rac...

  6. Comparative Analysis Highlights Variable Genome Content of Wheat Rusts and Divergence of the Mating Loci

    Directory of Open Access Journals (Sweden)

    Christina A. Cuomo

    2017-02-01

    Full Text Available Three members of the Puccinia genus, Puccinia triticina (Pt, P. striiformis f.sp. tritici (Pst, and P. graminis f.sp. tritici (Pgt, cause the most common and often most significant foliar diseases of wheat. While similar in biology and life cycle, each species is uniquely adapted and specialized. The genomes of Pt and Pst were sequenced and compared to that of Pgt to identify common and distinguishing gene content, to determine gene variation among wheat rust pathogens, other rust fungi, and basidiomycetes, and to identify genes of significance for infection. Pt had the largest genome of the three, estimated at 135 Mb with expansion due to mobile elements and repeats encompassing 50.9% of contig bases; in comparison, repeats occupy 31.5% for Pst and 36.5% for Pgt. We find all three genomes are highly heterozygous, with Pst [5.97 single nucleotide polymorphisms (SNPs/kb] nearly twice the level detected in Pt (2.57 SNPs/kb and that previously reported for Pgt. Of 1358 predicted effectors in Pt, 784 were found expressed across diverse life cycle stages including the sexual stage. Comparison to related fungi highlighted the expansion of gene families involved in transcriptional regulation and nucleotide binding, protein modification, and carbohydrate degradation enzymes. Two allelic homeodomain pairs, HD1 and HD2, were identified in each dikaryotic Puccinia species along with three pheromone receptor (STE3 mating-type genes, two of which are likely representing allelic specificities. The HD proteins were active in a heterologous Ustilago maydis mating assay and host-induced gene silencing (HIGS of the HD and STE3 alleles reduced wheat host infection.

  7. Breeding wheat for disease resistance in Kenya

    International Nuclear Information System (INIS)

    Njau, P.N.; Kinyua, M.G.; Karanja, L.; Maling'a, J.

    2001-01-01

    Yellow rust caused by Puccinia striformis and stem rust caused by Puccinia graminis tritici are most destructive diseases in Kenya. In wheat improvement, development of varieties of wheat with resistance to these diseases has been among the foremost contributions in wheat breeding. In breeding programs each disease is considered as a separate problem. Attention has been given to varieties resistant to stem rust, yellow rust and leaf rust among other diseases. In the year 2001 program stem rust and yellow rust were recorded in all the sites where NPT was performed. Breeding for resistance for the two diseases is approached through the Introductions and Hybridisation. The Doubled Haploid Technique is used to quicken the time of homozygous lines production. The introduction and the homozygous lines are then evaluated for yield and disease resistance in the field under preliminary yield trials and the National Performance Trials (NPT) in 2001, 18 lines and 2 check varieties were included in the NPT. The results show that there were some differences in reaction to the three diseases where lines R946, K7972-1 and R899 had the lowest score of the diseases in all sites. In the commercial variety trial the results show that all the varietieshave become susceptible to stem rust and so the need to develop new cultivars which will be resistance to the rusts. Yombi a newly developed variety showed a substantially high level resistance. (author)

  8. Major Gene for Field Stem Rust Resistance Co-Locates with Resistance Gene Sr12 in 'Thatcher' Wheat.

    Science.gov (United States)

    Hiebert, Colin W; Kolmer, James A; McCartney, Curt A; Briggs, Jordan; Fetch, Tom; Bariana, Harbans; Choulet, Frederic; Rouse, Matthew N; Spielmeyer, Wolfgang

    2016-01-01

    Stem rust, caused by Puccinia graminis (Pgt), is a damaging disease of wheat that can be controlled by utilizing effective stem rust resistance genes. 'Thatcher' wheat carries complex resistance to stem rust that is enhanced in the presence of the resistance gene Lr34. The purpose of this study was to examine APR in 'Thatcher' and look for genetic interactions with Lr34. A RIL population was tested for stem rust resistance in field nurseries in Canada, USA, and Kenya. BSA was used to find SNP markers associated with reduced stem rust severity. A major QTL was identified on chromosome 3BL near the centromere in all environments. Seedling testing showed that Sr12 mapped to the same region as the QTL for APR. The SNP markers were physically mapped and the region carrying the resistance was searched for sequences with homology to members of the NB-LRR resistance gene family. SNP marker from one NB-LRR-like sequence, NB-LRR3 co-segregated with Sr12. Two additional populations, including one that lacked Lr34, were tested in field nurseries. NB-LRR3 mapped near the maximum LOD for reduction in stem rust severity in both populations. Lines from a population that segregated for Sr12 and Lr34 were tested for seedling Pgt biomass and infection type, as well as APR to field stem rust which showed an interaction between the genes. We concluded that Sr12, or a gene closely linked to Sr12, was responsible for 'Thatcher'-derived APR in several environments and this resistance was enhanced in the presence of Lr34.

  9. Major Gene for Field Stem Rust Resistance Co-Locates with Resistance Gene Sr12 in ‘Thatcher’ Wheat

    Science.gov (United States)

    Hiebert, Colin W.; Kolmer, James A.; McCartney, Curt A.; Briggs, Jordan; Fetch, Tom; Bariana, Harbans; Choulet, Frederic; Rouse, Matthew N.; Spielmeyer, Wolfgang

    2016-01-01

    Stem rust, caused by Puccinia graminis (Pgt), is a damaging disease of wheat that can be controlled by utilizing effective stem rust resistance genes. ‘Thatcher’ wheat carries complex resistance to stem rust that is enhanced in the presence of the resistance gene Lr34. The purpose of this study was to examine APR in ‘Thatcher’ and look for genetic interactions with Lr34. A RIL population was tested for stem rust resistance in field nurseries in Canada, USA, and Kenya. BSA was used to find SNP markers associated with reduced stem rust severity. A major QTL was identified on chromosome 3BL near the centromere in all environments. Seedling testing showed that Sr12 mapped to the same region as the QTL for APR. The SNP markers were physically mapped and the region carrying the resistance was searched for sequences with homology to members of the NB-LRR resistance gene family. SNP marker from one NB-LRR-like sequence, NB-LRR3 co-segregated with Sr12. Two additional populations, including one that lacked Lr34, were tested in field nurseries. NB-LRR3 mapped near the maximum LOD for reduction in stem rust severity in both populations. Lines from a population that segregated for Sr12 and Lr34 were tested for seedling Pgt biomass and infection type, as well as APR to field stem rust which showed an interaction between the genes. We concluded that Sr12, or a gene closely linked to Sr12, was responsible for ‘Thatcher’-derived APR in several environments and this resistance was enhanced in the presence of Lr34. PMID:27309724

  10. Targeted introgression of a wheat stem rust resistance gene by DNA marker-assisted chromosome engineering.

    Science.gov (United States)

    Niu, Zhixia; Klindworth, Daryl L; Friesen, Timothy L; Chao, Shiaoman; Jin, Yue; Cai, Xiwen; Xu, Steven S

    2011-04-01

    Chromosome engineering is a useful strategy for transfer of alien genes from wild relatives into modern crops. However, this strategy has not been extensively used for alien gene introgression in most crops due to low efficiency of conventional cytogenetic techniques. Here, we report an improved scheme of chromosome engineering for efficient elimination of a large amount of goatgrass (Aegilops speltoides) chromatin surrounding Sr39, a gene that provides resistance to multiple stem rust races, including Ug99 (TTKSK) in wheat. The wheat ph1b mutation, which promotes meiotic pairing between homoeologous chromosomes, was employed to induce recombination between wheat chromosome 2B and goatgrass 2S chromatin using a backcross scheme favorable for inducing and detecting the homoeologous recombinants with small goatgrass chromosome segments. Forty recombinants with Sr39 with reduced surrounding goatgrass chromatin were quickly identified from 1048 backcross progenies through disease screening and molecular marker analysis. Four of the recombinants carrying Sr39 with a minimal amount of goatgrass chromatin (2.87-9.15% of the translocated chromosomes) were verified using genomic in situ hybridization. Approximately 97% of the goatgrass chromatin was eliminated in one of the recombinants, in which a tiny goatgrass chromosome segment containing Sr39 was retained in the wheat genome. Localization of the goatgrass chromatin in the recombinants led to rapid development of three molecular markers tightly linked to Sr39. The new wheat lines and markers provide useful resources for the ongoing global effort to combat Ug99. This study has demonstrated great potential of chromosome engineering in genome manipulation for plant improvement.

  11. A genome-wide association study of field and seedling response to stem rust pathogen races reveals combinations of race-specific resistance genes in North American spring wheat

    Science.gov (United States)

    Stem rust of wheat caused by the fungal pathogen Puccinia graminis f. sp. tritici historically caused major yield losses of wheat worldwide. To understand the genetic basis of stem rust resistance in conventional North American spring wheat, genome-wide association analysis (GWAS) was conducted on a...

  12. Community composition of target vs. non-target fungi in fungicide treated wheat

    DEFF Research Database (Denmark)

    Knorr, Kamilla; Jørgensen, Lise Nistrup; Justesen, Annemarie Fejer

    2012-01-01

    disease in wheat and within the last decade, new aggressive strains of yellow rust has caused severe epidemics that lead to substantial yield losses. This study explored the community composition of target versus non-target fungi in yellow rust infected wheat as affected by treatment timing and dose......Fungicide treatments are common control strategies used to manage fungal pathogens in agricultural fields, however, effects of treatments on the composition of total fungal communities, including non-target fungi, in the phyllosphere is not well known. Yellow rust (Puccinia striiformis) is a common...

  13. Wheat TaRab7 GTPase is part of the signaling pathway in responses to stripe rust and abiotic stimuli.

    Directory of Open Access Journals (Sweden)

    Furong Liu

    Full Text Available Small GTP-binding proteins function as regulators of specific intercellular fundamental biological processes. In this study, a small GTP-binding protein Rab7 gene, designated as TaRab7, was identified and characterized from a cDNA library of wheat leaves infected with Puccinia striiformis f. sp. tritici (Pst the wheat stripe rust pathogen. The gene was predicted to encode a protein of 206 amino acids, with a molecular mass of 23.13 KDa and an isoeletric point (pI of 5.13. Further analysis revealed the presence of a conserved signature that is characteristic of Rab7, and phylogenetic analysis demonstrated that TaRab7 has the highest similarity to a small GTP binding protein gene (BdRab7-like from Brachypodium distachyon. Quantitative real-time PCR assays revealed that the expression of TaRab7 was higher in the early stage of the incompatible interactions between wheat and Pst than in the compatible interaction, and the transcription level of TaRab7 was also highly induced by environmental stress stimuli. Furthermore, knocking down TaRab7 expression by virus induced gene silencing enhanced the susceptibility of wheat cv. Suwon 11 to an avirulent race CYR23. These results imply that TaRab7 plays an important role in the early stage of wheat-stripe rust fungus interaction and in stress tolerance.

  14. Mining centuries old in-situ conserved Turkish wheat landraces for grain yield and stripe rust resistance genes

    Directory of Open Access Journals (Sweden)

    Deepmala Sehgal

    2016-11-01

    Full Text Available Wheat landraces in Turkey are an important genetic resource for wheat improvement. An exhaustive five-year (2009-2014 effort made by the International Winter Wheat Improvement Programme (IWWIP a cooperative program between the Ministry of Food, Agriculture and Livestock of Turkey, the International Center for Maize and Wheat Improvement (CIMMYT and the International Center for Agricultural Research in the Dry Areas (ICARDA, led to the collection and documentation of around 2,000 landrace populations from 55 provinces throughout Turkey. This study reports the genetic characterization of a subset of bread wheat landraces collected in 2010 from 11 diverse provinces using genotyping-by-sequencing (GBS technology. The potential of this collection to identify loci determining grain yield and stripe rust resistance via genome-wide association (GWA analysis was explored. A high genetic diversity (diversity index = 0.260 and a moderate population structure based on highly inherited spike traits was revealed in the panel. The linkage disequilibrium decayed at 10 cM across the whole genome and was slower as compared to other landrace collections. In addition to previously reported QTL, GWA analysis also identified new candidate genomic regions for stripe rust resistance, grain yield and spike productivity components. New candidate genomic regions reflect the potential of this landrace collection to further increase genetic diversity in elite germplasm.

  15. Uncovering leaf rust responsive miRNAs in wheat (Triticum aestivum L.) using high-throughput sequencing and prediction of their targets through degradome analysis.

    Science.gov (United States)

    Kumar, Dhananjay; Dutta, Summi; Singh, Dharmendra; Prabhu, Kumble Vinod; Kumar, Manish; Mukhopadhyay, Kunal

    2017-01-01

    Deep sequencing identified 497 conserved and 559 novel miRNAs in wheat, while degradome analysis revealed 701 targets genes. QRT-PCR demonstrated differential expression of miRNAs during stages of leaf rust progression. Bread wheat (Triticum aestivum L.) is an important cereal food crop feeding 30 % of the world population. Major threat to wheat production is the rust epidemics. This study was targeted towards identification and functional characterizations of micro(mi)RNAs and their target genes in wheat in response to leaf rust ingression. High-throughput sequencing was used for transcriptome-wide identification of miRNAs and their expression profiling in retort to leaf rust using mock and pathogen-inoculated resistant and susceptible near-isogenic wheat plants. A total of 1056 mature miRNAs were identified, of which 497 miRNAs were conserved and 559 miRNAs were novel. The pathogen-inoculated resistant plants manifested more miRNAs compared with the pathogen infected susceptible plants. The miRNA counts increased in susceptible isoline due to leaf rust, conversely, the counts decreased in the resistant isoline in response to pathogenesis illustrating precise spatial tuning of miRNAs during compatible and incompatible interaction. Stem-loop quantitative real-time PCR was used to profile 10 highly differentially expressed miRNAs obtained from high-throughput sequencing data. The spatio-temporal profiling validated the differential expression of miRNAs between the isolines as well as in retort to pathogen infection. Degradome analysis provided 701 predicted target genes associated with defense response, signal transduction, development, metabolism, and transcriptional regulation. The obtained results indicate that wheat isolines employ diverse arrays of miRNAs that modulate their target genes during compatible and incompatible interaction. Our findings contribute to increase knowledge on roles of microRNA in wheat-leaf rust interactions and could help in rust

  16. Prediction and analysis of three gene families related to leaf rust (Puccinia triticina) resistance in wheat (Triticum aestivum L.).

    Science.gov (United States)

    Peng, Fred Y; Yang, Rong-Cai

    2017-06-20

    The resistance to leaf rust (Lr) caused by Puccinia triticina in wheat (Triticum aestivum L.) has been well studied over the past decades with over 70 Lr genes being mapped on different chromosomes and numerous QTLs (quantitative trait loci) being detected or mapped using DNA markers. Such resistance is often divided into race-specific and race-nonspecific resistance. The race-nonspecific resistance can be further divided into resistance to most or all races of the same pathogen and resistance to multiple pathogens. At the molecular level, these three types of resistance may cover across the whole spectrum of pathogen specificities that are controlled by genes encoding different protein families in wheat. The objective of this study is to predict and analyze genes in three such families: NBS-LRR (nucleotide-binding sites and leucine-rich repeats or NLR), START (Steroidogenic Acute Regulatory protein [STaR] related lipid-transfer) and ABC (ATP-Binding Cassette) transporter. The focus of the analysis is on the patterns of relationships between these protein-coding genes within the gene families and QTLs detected for leaf rust resistance. We predicted 526 ABC, 1117 NLR and 144 START genes in the hexaploid wheat genome through a domain analysis of wheat proteome. Of the 1809 SNPs from leaf rust resistance QTLs in seedling and adult stages of wheat, 126 SNPs were found within coding regions of these genes or their neighborhood (5 Kb upstream from transcription start site [TSS] or downstream from transcription termination site [TTS] of the genes). Forty-three of these SNPs for adult resistance and 18 SNPs for seedling resistance reside within coding or neighboring regions of the ABC genes whereas 14 SNPs for adult resistance and 29 SNPs for seedling resistance reside within coding or neighboring regions of the NLR gene. Moreover, we found 17 nonsynonymous SNPs for adult resistance and five SNPs for seedling resistance in the ABC genes, and five nonsynonymous SNPs for

  17. Rapid detection of Puccinia triticina causing leaf rust of wheat by PCR and loop mediated isothermal amplification.

    Science.gov (United States)

    Manjunatha, C; Sharma, Sapna; Kulshreshtha, Deepika; Gupta, Sangeeta; Singh, Kartar; Bhardwaj, Subhash C; Aggarwal, Rashmi

    2018-01-01

    Leaf rust of wheat caused by Puccinia triticina has significant impact on wheat production worldwide. Effective and quick detection methodologies are required to mitigate yield loss and time constraints associated with monitoring and management of leaf rust of wheat. In the present study, detection of P. triticina has been simplified by developing a rapid, reliable, efficient and visual colorimetric method i.e., loop mediated isothermal amplification of DNA (LAMP). Based on in silico analysis of P. triticina genome, PTS68, a simple sequence repeat was found highly specific to leaf rust fungus. A marker (PtRA68) was developed and its specificity was validated through PCR technique which gave a unique and sharp band of 919 bp in P. triticina pathotypes only. A novel gene amplification method LAMP which enables visual detection of pathogen by naked eye was developed for leaf rust pathogen. A set of six primers was designed from specific region of P. triticina and conditions were optimised to complete the observation process in 60 minutes at 65o C. The assay developed in the study could detect presence of P. triticina on wheat at 24 hpi (pre-symptomatic stage) which was much earlier than PCR without requiring thermal cycler. Sensitivity of LAMP assay developed in the study was 100 fg which was more sensitive than conventional PCR (50 pg) and equivalent to qPCR (100 fg). The protocol developed in the study was utilized for detection of leaf rust infected samples collected from different wheat fields. LAMP based colorimetric detection assay showed sky blue color in positive reaction and violet color in negative reaction after addition of 120 μM hydroxyl napthol blue (HNB) solution to reaction mixture. Similarly, 0.6 mg Ethidium bromide/ml was added to LAMP products, placed on transilluminator to witness full brightness in positive reaction and no such brightness could be seen in negative reaction mixture. Further, LAMP products spread in a ladder like banding pattern in

  18. Molecular mapping of stripe rust resistance gene YrSE5756 in synthetic hexaploid wheat and its transfer to common wheat

    International Nuclear Information System (INIS)

    Wang, Y.J.; Wang, C.Y.; Zhang, H.

    2015-01-01

    Synthetic hexaploid wheat is an important germplasm resource for transfer of beneficial genes from alien species to common wheat (Triticum aestivum L.). Synthetic hexaploid wheat SE5756 confers a high level of resistance against a wide range of races of Puccinia striiformis West. f. sp. tritici Eriks. et Henn.(Pst). The objectives of this study were to determine the inheritance pattern, adjacent molecular markers, and chromosomal location of the stripe rust resistance gene in SE5756 and to develop new germplasm. We constructed a segregating population of 116 F2 plants and corresponding F2:3 families from a cross between SE5756 and Xinong979 with Pst races CYR32. Genetic analysis revealed that a single dominant gene, tentatively designated as YrSE5756, was responsible for seedling stage stripe rust resistance in SE5756. A genetic map, encompassing Xwmc626, Xwmc269, Xgwm11, Xbarx137, Xwmc419, Xwmc85, Xgpw5237, Xwmc134, WE173, Xwmc631, and YrSE5756, spanned 70.1 cM on chromosome 1BS. Xwmc419 and Xwmc85 were flanking markers tightly linked to YrSE5756 at genetic distances of 2.3 and 1.8 cM. Typical adult plant responses of the SE5756, varieties of the carrier Yr10 and Yr15, Chuanmai 42 (Yr24/Yr26), Yuanfeng 175 (Yr24/Yr26) and Huixianhong resistant to mixture Pst races (CYR32, CYR33 and V26) were experimented. The results showed that YrSE5756 was likely a new resistance stripe rust gene different from Yr24/Yr26, Yr10 and Yr15. From cross and backcross populations of SE5756/Xinong 979, we developed four new wheat lines with large seeds, stripe rust resistance, and improved agronomic traits: N07178-1, N07178-2, N08256-1, and N08256-2. These new germplasm lines could serve as sources of resistance to stripe rust in wheat breeding. SE5756 has the very vital significance in the development of breeding and expand our resistance germplasm resource gene pool. (author)

  19. Cytogenetic analysis and mapping of leaf rust resistance in Aegilops speltoides Tausch derived bread wheat line Selection2427 carrying putative gametocidal gene(s).

    Science.gov (United States)

    Niranjana, M; Vinod; Sharma, J B; Mallick, Niharika; Tomar, S M S; Jha, S K

    2017-12-01

    Leaf rust (Puccinia triticina) is a major biotic stress affecting wheat yields worldwide. Host-plant resistance is the best method for controlling leaf rust. Aegilops speltoides is a good source of resistance against wheat rusts. To date, five Lr genes, Lr28, Lr35, Lr36, Lr47, and Lr51, have been transferred from Ae. speltoides to bread wheat. In Selection2427, a bread wheat introgresed line with Ae. speltoides as the donor parent, a dominant gene for leaf rust resistance was mapped to the long arm of chromosome 3B (LrS2427). None of the Lr genes introgressed from Ae. speltoides have been mapped to chromosome 3B. Since none of the designated seedling leaf rust resistance genes have been located on chromosome 3B, LrS2427 seems to be a novel gene. Selection2427 showed a unique property typical of gametocidal genes, that when crossed to other bread wheat cultivars, the F 1 showed partial pollen sterility and poor seed setting, whilst Selection2427 showed reasonable male and female fertility. Accidental co-transfer of gametocidal genes with LrS2427 may have occurred in Selection2427. Though LrS2427 did not show any segregation distortion and assorted independently of putative gametocidal gene(s), its utilization will be difficult due to the selfish behavior of gametocidal genes.

  20. Wheat Ammonium Transporter (AMT) Gene Family: Diversity and Possible Role in Host-Pathogen Interaction with Stem Rust.

    Science.gov (United States)

    Li, Tianya; Liao, Kai; Xu, Xiaofeng; Gao, Yue; Wang, Ziyuan; Zhu, Xiaofeng; Jia, Baolei; Xuan, Yuanhu

    2017-01-01

    Ammonium transporter (AMT) proteins have been reported in many plants, but no comprehensive analysis was performed in wheat. In this study, we identified 23 AMT members (hereafter TaAMTs) using a protein homology search in wheat genome. Tissue-specific expression analysis showed that TaAMT1;1a, TaAMT1;1b , and TaAMT1;3a were relatively more highly expressed in comparison with other TaAMTs . TaAMT1;1a, TaAMT1;1b, and TaAMT1;3a-GFP were localized in the plasma membrane in tobacco leaves, and TaAMT1;1a, TaAMT1;1b , and TaAMT1;3a successfully complemented a yeast 31019b strain in which ammonium uptake was deficient. In addition, the expression of TaAMT1;1b in an Arabidopsis AMT quadruple mutant ( qko ) successfully restored [Formula: see text] uptake ability. Resupply of [Formula: see text] rapidly increased cellular [Formula: see text] contents and suppressed expression of TaAMT1;3a , but not of TaAMT;1;1a and TaAMT1;1b expressions. Expression of TaAMT1;1a, TaAMT1;1b , and TaAMT1;3a was not changed in leaves after [Formula: see text] resupply. In contrast, nitrogen (N) deprivation induced TaAMT1;1a, TaAMT1;1b , and TaAMT1;3a gene expressions in the roots and leaves. Expression analysis in the leaves of the stem rust-susceptible wheat line "Little Club" and the rust-tolerant strain "Mini 2761" revealed that TaAMT1;1a, TaAMT1;1b , and TaAMT1;3a were specifically induced in the former but not in the latter. Rust-susceptible wheat plants grown under N-free conditions exhibited a lower disease index than plants grown with [Formula: see text] as the sole N source in the medium after infection with Puccinia graminis f. sp. tritici , suggesting that [Formula: see text] and its transport may facilitate the infection of wheat stem rust disease. Our findings may be important for understanding the potential function TaAMTs in wheat plants.

  1. Heritable, De Novo Resistance to Leaf Rust and Other Novel Traits in Selfed Descendants of Wheat Responding to Inoculation with Wheat Streak Mosaic Virus

    Science.gov (United States)

    Seifers, Dallas L.; Haber, Steve; Martin, Terry J.; McCallum, Brent D.

    2014-01-01

    Stable resistance to infection with Wheat streak mosaic virus (WSMV) can be evolved de novo in selfing bread wheat lines subjected to cycles of WSMV inoculation and selection of best-performing plants or tillers. To learn whether this phenomenon might be applied to evolve resistance de novo to pathogens unrelated to WSMV, we examined the responses to leaf rust of succeeding generations of the rust- and WSMV-susceptible cultivar ‘Lakin’ following WSMV inoculation and derived rust-resistant sublines. After three cycles of the iterative protocol five plants, in contrast to all others, expressed resistance to leaf and stripe rust. A subset of descendant sublines of one of these, ‘R1’, heritably and uniformly expressed the new trait of resistance to leaf rust. Such sublines, into which no genes from a known source of resistance had been introgressed, conferred resistance to progeny of crosses with susceptible parents. The F1 populations produced from crosses between, respectively, susceptible and resistant ‘Lakin’ sublines 4-3-3 and 4-12-3 were not all uniform in their response to seedling inoculation with race TDBG. In seedling tests against TDBG and MKPS races the F2s from F1 populations that were uniformly resistant had 3∶1 ratios of resistant to susceptible individuals but the F2s from susceptible F1 progenitors were uniformly susceptible. True-breeding lines derived from resistant individuals in F2 populations were resistant to natural stripe and leaf rust inoculum in the field, while the ‘Lakin’ progenitor was susceptible. The next generation of six of the ‘Lakin’-derived lines exhibited moderate to strong de novo resistance to stem rust races TPMK, QFCS and RKQQ in seedling tests while the ‘Lakin’ progenitor was susceptible. These apparently epigenetic effects in response to virus infection may help researchers fashion a new tool that expands the range of genetic resources already available in adapted germplasm. PMID:24497941

  2. Screening of wheat germplasm for the source of resistance against leaf and stripe rust under climatic conditions in Bhakkar

    International Nuclear Information System (INIS)

    Bhatti, M.A.; Burhan, M.; Shahzad, M.A.; Aslam, M.

    2009-01-01

    A field experiment was conducted to assess the level of resistance and susceptibility against stripe and leaf rust of wheat at Arid Zone Research 1, Institute, Bhakkar during, Rabi 2009, One hundred wheat genotypes were sown in second week of November. Each test line/variety of planted in two rows of 2 meter reach will two row of Morocco after every three entries to increase the disease pressure, fest lines/ varieties were inoculated thrice with highly susceptible Morocco and two most virulent Lr-26 and Lr-23 patho type. Out of eighty four test entries/varieties screened against le leaf rust, 5 exhibited resistant 21 moderately susceptible, 20 susceptible, 28 moderately resistant and 10 were highly susceptible. The present investigation indicated that there was no highly resistant lines/variety with zero disease severity. On the other hand, as regards stripe rust, out of thirty seven lines/varieties only two lines were susceptible to disease, Among other lines/ varieties, 12 resistant, 11 moderately resistant, 6 moderately susceptible and 2 susceptible against disease. Four (4) lines /varieties proved as highly resistant with zero disease severity.

  3. Discovery of a Novel Stem Rust Resistance Allele in Durum Wheat that Exhibits Differential Reactions to Ug99 Isolates

    Directory of Open Access Journals (Sweden)

    Jayaveeramuthu Nirmala

    2017-10-01

    Full Text Available Wheat stem rust, caused by Puccinia graminis f. sp. tritici Eriks. & E. Henn, can incur yield losses in susceptible cultivars of durum wheat, Triticum turgidum ssp. durum (Desf. Husnot. Although several durum cultivars possess the stem rust resistance gene Sr13, additional genes in durum wheat effective against emerging virulent races have not been described. Durum line 8155-B1 confers resistance against the P. graminis f. sp. tritici race TTKST, the variant race of the Ug99 race group with additional virulence to wheat stem rust resistance gene Sr24. However, 8155-B1 does not confer resistance to the first-described race in the Ug99 race group: TTKSK. We mapped a single gene conferring resistance in 8155-B1 against race TTKST, Sr8155B1, to chromosome arm 6AS by utilizing Rusty/8155-B1 and Rusty*2/8155-B1 populations and the 90K Infinium iSelect Custom bead chip supplemented by KASP assays. One marker, KASP_6AS_IWB10558, cosegregated with Sr8155B1 in both populations and correctly predicted Sr8155B1 presence or absence in 11 durum cultivars tested. We confirmed the presence of Sr8155B1 in cultivar Mountrail by mapping in the population Choteau/Mountrail. The marker developed in this study could be used to predict the presence of resistance to race TTKST in uncharacterized durum breeding lines, and also to combine Sr8155B1 with resistance genes effective to Ug99 such as Sr13. The map location of Sr8155B1 cannot rule out the possibility that this gene is an allele at the Sr8 locus. However, race specificity indicates that Sr8155B1 is different from the known alleles Sr8a and Sr8b.

  4. Identification and molecular characterization of a trans-acting small interfering RNA producing locus regulating leaf rust responsive gene expression in wheat (Triticum aestivum L.).

    Science.gov (United States)

    Dutta, Summi; Kumar, Dhananjay; Jha, Shailendra; Prabhu, Kumble Vinod; Kumar, Manish; Mukhopadhyay, Kunal

    2017-11-01

    A novel leaf rust responsive ta-siRNA-producing locus was identified in wheat showing similarity to 28S rRNA and generated four differentially expressing ta-siRNAs by phasing which targeted stress responsive genes. Trans-acting-small interfering RNAs (Ta-siRNAs) are plant specific molecules generally involved in development and are also stress responsive. Ta-siRNAs identified in wheat till date are all responsive to abiotic stress only. Wheat cultivation is severely affected by rusts and leaf rust particularly affects grain filling. This study reports a novel ta-siRNA producing locus (TAS) in wheat which is a segment of 28S ribosomal RNA but shows differential expression during leaf rust infestation. Four small RNA libraries prepared from wheat Near Isogenic Lines were treated with leaf rust pathogen and compared with untreated controls. A TAS with the ability to generate four ta-siRNAs by phasing events was identified along with the microRNA TamiR16 as the phase initiator. The targets of the ta-siRNAs included α-gliadin, leucine rich repeat, trans-membrane proteins, glutathione-S-transferase, and fatty acid desaturase among others, which are either stress responsive genes or are essential for normal growth and development of plants. Expression of the TAS, its generated ta-siRNAs, and their target genes were profiled at five different time points after pathogen inoculation of susceptible and resistant wheat isolines and compared with mock-inoculated controls. Comparative analysis of expression unveiled differential and reciprocal relationship as well as discrete patterns between susceptible and resistant isolines. The expression profiles of the target genes of the identified ta-siRNAs advocate more towards effector triggered susceptibility favouring pathogenesis. The study helps in discerning the functions of wheat genes regulated by ta-siRNAs in response to leaf rust.

  5. Molecular and Ultrastructural Mechanisms Underlying Yellow Dwarf Symptom Formation in Wheat after Infection of Barley Yellow Dwarf Virus.

    Science.gov (United States)

    Rong, Wei; Wang, Xindong; Wang, Xifeng; Massart, Sebastien; Zhang, Zengyan

    2018-04-13

    Wheat ( Tritium aestivum L.) production is essential for global food security. Infection of barley yellow dwarf virus-GAV (BYDV-GAV) results in wheat showing leaf yellowing and plant dwarfism symptom. To explore the molecular and ultrastructural mechanisms underlying yellow dwarf symptom formation in BYDV-GAV-infected wheat, we investigated the chloroplast ultrastructure via transmission electron microscopy (TEM), examined the contents of the virus, H₂O₂, and chlorophyll in Zhong8601, and studied the comparative transcriptome through microarray analyses in the susceptible wheat line Zhong8601 after virus infection. TEM images indicated that chloroplasts in BYDV-GAV-infected Zhong8601 leaf cells were fragmentized. Where thylakoids were not well developed, starch granules and plastoglobules were rare. Compared with mock-inoculated Zhong8601, chlorophyll content was markedly reduced, but the virus and H₂O₂ contents were significantly higher in BYDV-GAV-infected Zhong8601. The transcriptomic analyses revealed that chlorophyll biosynthesis and chloroplast related transcripts, encoding chlorophyll a/b binding protein, glucose-6-phosphate/phosphate translocator 2, and glutamyl-tRNA reductase 1, were down-regulated in BYDV-GAV-infected Zhong8601. Some phytohormone signaling-related transcripts, including abscisic acid (ABA) signaling factors (phospholipase D alpha 1 and calcineurin B-like protein 9) and nine ethylene response factors, were up-regulated. Additionally, reactive oxygen species (ROS)-related genes were transcriptionally regulated in BYDV-GAV infected Zhong8601, including three up-regulated transcripts encoding germin-like proteins (promoting ROS accumulation) and four down-regulated transcripts encoding peroxides (scavenging ROS). These results clearly suggest that the yellow dwarf symptom formation is mainly attributed to reduced chlorophyll content and fragmentized chloroplasts caused by down-regulation of the chlorophyll and chloroplast biosynthesis

  6. Genome-wide association mapping reveals a rich genetic architecture of stripe rust resistance loci in emmer wheat (Triticum turgidum ssp. dicoccum).

    Science.gov (United States)

    Liu, Weizhen; Maccaferri, Marco; Chen, Xianming; Laghetti, Gaetano; Pignone, Domenico; Pumphrey, Michael; Tuberosa, Roberto

    2017-11-01

    SNP-based genome scanning in worldwide domesticated emmer germplasm showed high genetic diversity, rapid linkage disequilibrium decay and 51 loci for stripe rust resistance, a large proportion of which were novel. Cultivated emmer wheat (Triticum turgidum ssp. dicoccum), one of the oldest domesticated crops in the world, is a potentially rich reservoir of variation for improvement of resistance/tolerance to biotic and abiotic stresses in wheat. Resistance to stripe rust (Puccinia striiformis f. sp. tritici) in emmer wheat has been under-investigated. Here, we employed genome-wide association (GWAS) mapping with a mixed linear model to dissect effective stripe rust resistance loci in a worldwide collection of 176 cultivated emmer wheat accessions. Adult plants were tested in six environments and seedlings were evaluated with five races from the United States and one from Italy under greenhouse conditions. Five accessions were resistant across all experiments. The panel was genotyped with the wheat 90,000 Illumina iSelect single nucleotide polymorphism (SNP) array and 5106 polymorphic SNP markers with mapped positions were obtained. A high level of genetic diversity and fast linkage disequilibrium decay were observed. In total, we identified 14 loci associated with field resistance in multiple environments. Thirty-seven loci were significantly associated with all-stage (seedling) resistance and six of them were effective against multiple races. Of the 51 total loci, 29 were mapped distantly from previously reported stripe rust resistance genes or quantitative trait loci and represent newly discovered resistance loci. Our results suggest that GWAS is an effective method for characterizing genes in cultivated emmer wheat and confirm that emmer wheat is a rich source of stripe rust resistance loci that can be used for wheat improvement.

  7. Mapping resistance to the Ug99 race group of the stem rust pathogen in a spring wheat landrace.

    Science.gov (United States)

    Babiker, E M; Gordon, T C; Chao, S; Newcomb, M; Rouse, M N; Jin, Y; Wanyera, R; Acevedo, M; Brown-Guedira, G; Williamson, S; Bonman, J M

    2015-04-01

    A new gene for Ug99 resistance from wheat landrace PI 374670 was detected on the long arm of chromosome 7A. Wheat landrace PI 374670 has seedling and field resistance to stem rust caused by Puccinia graminis f. sp tritici Eriks. & E. Henn (Pgt) race TTKSK. To elucidate the inheritance of resistance, 216 BC1F2 families, 192 double haploid (DH) lines, and 185 recombinant inbred lines (RILs) were developed by crossing PI 374670 and the susceptible line LMPG-6. The parents and progeny were evaluated for seedling resistance to Pgt races TTKSK, MCCFC, and TPMKC. The DH lines were tested in field stem rust nurseries in Kenya and Ethiopia. The DH lines were genotyped with the 90K wheat iSelect SNP genotyping platform. Goodness-of-fit tests indicated that a single dominant gene in PI 374670 conditioned seedling resistance to the three Pgt races. The seedling resistance locus mapped to the long arm of chromosome 7A and this result was verified in the RIL population screened with the flanking SNP markers using KASP assays. In the same region, a major QTL for field resistance was detected in a 7.7 cM interval and explained 34-54 and 29-36% of the variation in Kenya and Ethiopia, respectively. Results from tests with specific Pgt races and the csIH81 marker showed that the resistance was not due to Sr22. Thus, a new stem rust resistance gene or allele, either closely linked or allelic to Sr15, is responsible for the seedling and field resistance of PI 374670 to Ug99.

  8. Emergence and Spread of New Races of Wheat Stem Rust Fungus: Continued Threat to Food Security and Prospects of Genetic Control.

    Science.gov (United States)

    Singh, Ravi P; Hodson, David P; Jin, Yue; Lagudah, Evans S; Ayliffe, Michael A; Bhavani, Sridhar; Rouse, Matthew N; Pretorius, Zacharias A; Szabo, Les J; Huerta-Espino, Julio; Basnet, Bhoja R; Lan, Caixia; Hovmøller, Mogens S

    2015-07-01

    Race Ug99 (TTKSK) of Puccinia graminis f. sp. tritici, detected in Uganda in 1998, has been recognized as a serious threat to food security because it possesses combined virulence to a large number of resistance genes found in current widely grown wheat (Triticum aestivum) varieties and germplasm, leading to its potential for rapid spread and evolution. Since its initial detection, variants of the Ug99 lineage of stem rust have been discovered in Eastern and Southern African countries, Yemen, Iran, and Egypt. To date, eight races belonging to the Ug99 lineage are known. Increased pathogen monitoring activities have led to the identification of other races in Africa and Asia with additional virulence to commercially important resistance genes. This has led to localized but severe stem rust epidemics becoming common once again in East Africa due to the breakdown of race-specific resistance gene SrTmp, which was deployed recently in the 'Digalu' and 'Robin' varieties in Ethiopia and Kenya, respectively. Enhanced research in the last decade under the umbrella of the Borlaug Global Rust Initiative has identified various race-specific resistance genes that can be utilized, preferably in combinations, to develop resistant varieties. Research and development of improved wheat germplasm with complex adult plant resistance (APR) based on multiple slow-rusting genes has also progressed. Once only the Sr2 gene was known to confer slow rusting APR; now, four more genes-Sr55, Sr56, Sr57, and Sr58-have been characterized and additional quantitative trait loci identified. Cloning of some rust resistance genes opens new perspectives on rust control in the future through the development of multiple resistance gene cassettes. However, at present, disease-surveillance-based chemical control, large-scale deployment of new varieties with multiple race-specific genes or adequate levels of APR, and reducing the cultivation of susceptible varieties in rust hot-spot areas remains the best

  9. Genome-wide identification and characterization of NB-ARC resistant genes in wheat (Triticum aestivum L.) and their expression during leaf rust infection.

    Science.gov (United States)

    Chandra, Saket; Kazmi, Andaleeb Z; Ahmed, Zainab; Roychowdhury, Gargi; Kumari, Veena; Kumar, Manish; Mukhopadhyay, Kunal

    2017-07-01

    NB-ARC domain-containing resistance genes from the wheat genome were identified, characterized and localized on chromosome arms that displayed differential yet positive response during incompatible and compatible leaf rust interactions. Wheat (Triticum aestivum L.) is an important cereal crop; however, its production is affected severely by numerous diseases including rusts. An efficient, cost-effective and ecologically viable approach to control pathogens is through host resistance. In wheat, high numbers of resistance loci are present but only few have been identified and cloned. A comprehensive analysis of the NB-ARC-containing genes in complete wheat genome was accomplished in this study. Complete NB-ARC encoding genes were mined from the Ensembl Plants database to predict 604 NB-ARC containing sequences using the HMM approach. Genome-wide analysis of orthologous clusters in the NB-ARC-containing sequences of wheat and other members of the Poaceae family revealed maximum homology with Oryza sativa indica and Brachypodium distachyon. The identification of overlap between orthologous clusters enabled the elucidation of the function and evolution of resistance proteins. The distributions of the NB-ARC domain-containing sequences were found to be balanced among the three wheat sub-genomes. Wheat chromosome arms 4AL and 7BL had the most NB-ARC domain-containing contigs. The spatio-temporal expression profiling studies exemplified the positive role of these genes in resistant and susceptible wheat plants during incompatible and compatible interaction in response to the leaf rust pathogen Puccinia triticina. Two NB-ARC domain-containing sequences were modelled in silico, cloned and sequenced to analyze their fine structures. The data obtained in this study will augment isolation, characterization and application NB-ARC resistance genes in marker-assisted selection based breeding programs for improving rust resistance in wheat.

  10. Protection of wheat against leaf and stem rust and powdery mildew diseases by inhibition of polyamine metabolism

    Science.gov (United States)

    Weinstein, L. H.; Osmeloski, J. F.; Wettlaufer, S. H.; Galston, A. W.

    1987-01-01

    In higher plants, polyamines arise from arginine by one of two pathways: via ornithine and ornithine decarboxylase or via agmatine and arginine decarboxylase but in fungi, only the ornithine decarboxylase pathway is present. Since polyamines are required for normal growth of microorganisms and plants and since the ornithine pathway can be irreversibly blocked by alpha-difluoromethylornithine (DFMO) which has no effect on arginine decarboxylase, fungal infection of green plants might be controlled by the site-directed use of such a specific metabolic inhibitor. DFMO at relatively low concentrations provided effective control of the three biotrophic fungal pathogens studied, Puccinia recondita (leaf rust), P. graminis f. sp. tritici (stem rust), and Erysiphe graminis (powdery mildew) on wheat (Triticum aestivum L.) Effective control of infection by leaf or stem rust fungi was obtained with sprays of DFMO that ranged from about 0.01 to 0.20 mM in experiments where the inhibitor was applied after spore inoculation. The powdery mildew fungus was somewhat more tolerant of DFMO, but good control of the pathogen was obtained at less than 1.0 mM. In general, application of DFMO after spore inoculation was more effective than application before inoculation. Less control was obtained following treatment with alpha-difluoromethylarginine (DFMA) but the relatively high degree of control obtained raises the possibility of a DFMA to DFMO conversion by arginase.

  11. Genetic effects for controlling stripe rust (Puccinia striiformis f. sp. tritici resistance in wheat through joint segregation analysis

    Directory of Open Access Journals (Sweden)

    Kalim Ullah

    2016-06-01

    Full Text Available Mixed inheritance analysis using joint segregation analysis (JSA for stripe rust (Puccinia striiformis f. sp. tritici resistance was carried out in six basic populations (P1, F1, P2, BC1, BC2 and F2 of four wheat crosses (Hashim-08 × LU-26, Farid-06 × Shafaq, Parula × Blue Silver, TD-1 × D-97603 during crop season 2009 to 2012. Genes controlling stripe rust resistance were assessed by using area under disease progress curve (AUDPC. The AUDPC was controlled by mixed two additive-dominant-epistatic major genes plus additive-dominant-epistasis of polygenes in cross Hashim-08 × LU-26 (model E, while in Farid-06 × Shafaq, it was controlled by mixed two major additive-dominant genes plus additive-dominant polygenes (model E-2. In cross Parula × Blue Silver, the AUDPC was managed by additive, dominance and epistasis of two major genes (model B-1, however, it was controlled by mixed one major gene and additive dominant polygenes in cross TD-1 × D-97603 (model D-1. Genetic variation and heritability was higher in major genes than polygene for all the crosses showing that AUDPC was mainly controlled by major genes. The genetic behavior of the AUDPC revealed that stripe rust resistance was controlled by mixed interaction of one to two major genes plus polygenes.

  12. Mapping of Leaf Rust Resistance Genes and Molecular Characterization of the 2NS/2AS Translocation in the Wheat Cultivar Jagger.

    Science.gov (United States)

    Xue, Shulin; Kolmer, James A; Wang, Shuwen; Yan, Liuling

    2018-04-19

    Winter wheat cultivar 'Jagger' was recently found to have an alien chromosomal segment 2NS that has Lr37 , a gene conferring resistance against leaf rust caused by Puccinia triticina The objective of this study was to map and characterize the gene(s) for seedling leaf rust resistance in Jagger. The recombinant inbred line (RIL) population of Jagger × '2174' was inoculated with leaf rust pathogen THBJG and BBBDB, and evaluated for infection type (IT) response. A major quantitative trait locus (QTL) for THBJG and BBBDB was coincidently mapped to chromosome arm 2AS, and the QTL accounted for 56.6% - 66.2% of total phenotypic variation in infection type (IT) response to THBJG, and 72.1% - 86.9% to BBBDB. The causal gene for resistance to these rust races was mapped to the 2NS segment in Jagger. The 2NS segment was located in a region of approximately 27.8 Mb starting from the telomere of chromosome arm 2AS, based on the sequences of the A genome in tetraploid wheat. The Lr17a gene on chromosome arm 2AS was delimited to 3.1 Mb in the genomic region, which was orthologous to the 2NS segment. Therefore, the Lr37 gene in the 2NS segment can be pyramided with other effective resistance genes, rather than Lr17a in wheat, to improve resistance to rust diseases. Copyright © 2018, G3: Genes, Genomes, Genetics.

  13. Characterization of the Wheat Stripe Rust (Puccinia striiformis f. sp. tritici) Fungal Effector Candidate PEC6 and Its Corresponding Host Targets

    DEFF Research Database (Denmark)

    Liu, Changhai

    Stripe rust caused by Puccinia striiformis f. sp. tritici (Pst), is one of the most important fungal diseases on wheat worldwide and a serious threat to wheat production. Understanding the plant-microbe interaction mechanism is the basic step to assist future plant breeding aiming at increasing...... factor. By using the yeast two-hybrid system, the adenosine kinase (ADK) was identified as a host target of PEC6. Virus-induced gene silencing (VIGS) of ADK enhanced wheat susceptibility to stripe rust indicates that ADK is a positive regulator in plant defense. Based on EtHAn-mediated effector delivery......, seventy-two wheat landraces were screened to search for the presence of potential resistance (R) genes. Three landraces showed strong hypersensitive response (HR) when PEC6 was expressed in the cells, suggesting the presence of certain R gene(s) recognizing PEC6. However, these landraces did not show...

  14. Temporal Gene Expression Profiling of the Wheat Leaf Rust Pathosystem Using cDNA Microarray Reveals Differences in Compatible and Incompatible Defence Pathways

    OpenAIRE

    Fofana, Bourlaye; Banks, Travis W.; McCallum, Brent; Strelkov, Stephen E.; Cloutier, Sylvie

    2007-01-01

    In this study, we detail the construction of a custom cDNA spotted microarray containing 7728 wheat ESTs and the use of the array to identify host genes that are differentially expressed upon challenges with leaf rust fungal pathogens. Wheat cultivar RL6003 (Thatcher Lr1) was inoculated with Puccinia triticina virulence phenotypes BBB (incompatible) or TJB (7-2) (compatible) and sampled at four different time points (3, 6, 12, and 24 hours) after inoculation. Transcript expression levels rela...

  15. The carotenoid biosynthetic and catabolic genes in wheat and their association with yellow pigments.

    Science.gov (United States)

    Colasuonno, Pasqualina; Lozito, Maria Luisa; Marcotuli, Ilaria; Nigro, Domenica; Giancaspro, Angelica; Mangini, Giacomo; De Vita, Pasquale; Mastrangelo, Anna Maria; Pecchioni, Nicola; Houston, Kelly; Simeone, Rosanna; Gadaleta, Agata; Blanco, Antonio

    2017-01-31

    In plants carotenoids play an important role in the photosynthetic process and photo-oxidative protection, and are the substrate for the synthesis of abscisic acid and strigolactones. In addition to their protective role as antioxidants and precursors of vitamin A, in wheat carotenoids are important as they influence the colour (whiteness vs. yellowness) of the grain. Understanding the genetic basis of grain yellow pigments, and identifying associated markers provide the basis for improving wheat quality by molecular breeding. Twenty-four candidate genes involved in the biosynthesis and catabolism of carotenoid compounds have been identified in wheat by comparative genomics. Single nucleotide polymorphisms (SNPs) found in the coding sequences of 19 candidate genes allowed their chromosomal location and accurate map position on two reference consensus maps to be determined. The genome-wide association study based on genotyping a tetraploid wheat collection with 81,587 gene-associated SNPs validated quantitative trait loci (QTLs) previously detected in biparental populations and discovered new QTLs for grain colour-related traits. Ten carotenoid genes mapped in chromosome regions underlying pigment content QTLs indicating possible functional relationships between candidate genes and the trait. The availability of linked, candidate gene-based markers can facilitate breeding wheat cultivars with desirable levels of carotenoids. Identifying QTLs linked to carotenoid pigmentation can contribute to understanding genes underlying carotenoid accumulation in the wheat kernels. Together these outputs can be combined to exploit the genetic variability of colour-related traits for the nutritional and commercial improvement of wheat products.

  16. Genome-wide association study for Identification and validation of novel SNP markers for Sr6 stem rust resistance gene in bread wheat

    Science.gov (United States)

    Stem rust (caused by Puccinia graminis f. sp. tritici Erikss. & E. Henn.), is a major disease in wheat (Triticum aestivium L.). However, in recent years it occurs rarely in Nebraska due to weather and the effective selection and gene pyramiding of resistance genes. To understand the genetic basis of...

  17. Identification of New Resistance Loci to African Stem Rust Race TTKSK in Tetraploid Wheats Based on Linkage and Genome-Wide Association Mapping.

    Science.gov (United States)

    Laidò, Giovanni; Panio, Giosuè; Marone, Daniela; Russo, Maria A; Ficco, Donatella B M; Giovanniello, Valentina; Cattivelli, Luigi; Steffenson, Brian; de Vita, Pasquale; Mastrangelo, Anna M

    2015-01-01

    Stem rust, caused by Puccinia graminis Pers. f. sp. tritici Eriks. and E. Henn. (Pgt), is one of the most destructive diseases of wheat. Races of the pathogen in the "Ug99 lineage" are of international concern due to their virulence for widely used stem rust resistance genes and their spread throughout Africa. Disease resistant cultivars provide one of the best means for controlling stem rust. To identify quantitative trait loci (QTL) conferring resistance to African stem rust race TTKSK at the seedling stage, we evaluated an association mapping (AM) panel consisting of 230 tetraploid wheat accessions under greenhouse conditions. A high level of phenotypic variation was observed in response to race TTKSK in the AM panel, allowing for genome-wide association mapping of resistance QTL in wild, landrace, and cultivated tetraploid wheats. Thirty-five resistance QTL were identified on all chromosomes, and seventeen are of particular interest as identified by multiple associations. Many of the identified resistance loci were coincident with previously identified rust resistance genes; however, nine on chromosomes 1AL, 2AL, 4AL, 5BL, and 7BS may be novel. To validate AM results, a biparental population of 146 recombinant inbred lines was also considered, which derived from a cross between the resistant cultivar "Cirillo" and susceptible "Neodur." The stem rust resistance of Cirillo was conferred by a single gene on the distal region of chromosome arm 6AL in an interval map coincident with the resistance gene Sr13, and confirmed one of the resistance loci identified by AM. A search for candidate resistance genes was carried out in the regions where QTL were identified, and many of them corresponded to NBS-LRR genes and protein kinases with LRR domains. The results obtained in the present study are of great interest as a high level of genetic variability for resistance to race TTKSK was described in a germplasm panel comprising most of the tetraploid wheat sub-species.

  18. Mapping of stripe rust resistance QTL in Cappelle-Desprez × PBW343 RIL population effective in northern wheat belt of India.

    Science.gov (United States)

    Pawar, Sushma Kumari; Sharma, Davinder; Duhan, Joginder Singh; Saharan, Mahender Singh; Tiwari, Ratan; Sharma, Indu

    2016-06-01

    Stripe rust caused by Puccinia striiformis f. sp. tritici is most important and devastating disease of wheat worldwide, which affects the grain yields, quality and nutrition. To elucidate, the genetic basis of resistance, a mapping population of recombinant inbred lines was developed from a cross between resistant Cappelle-Desprez and susceptible cultivar PBW343 using single-seed descent. Variety PBW343 had been one of the most popular cultivars of North Western Plains Zone, for more than a decade, before succumbing to the stripe rust. Cappelle-Desprez, a source of durable adult plant resistance, has maintained its resistance against stripe rust for a long time in Europe. Map construction and QTL analysis were completed with 1012 polymorphic (DArT and SSR) markers. Screenings for stripe rust disease were carried out in field condition for two consecutive crop seasons (2012-2013 and 2013-2014). Susceptible parent (PBW343) achieved a significant level of disease i.e., 100 % in both the years. In present investigations, resistance in Cappelle-Desprez was found stable and response to the rust ranged from 0 to 1.5 % over the years. The estimated broad-sense heritability (h 2 ) of stripe rust rAUDPC in the mapping population was 0.82. The relative area under the disease progress curve data showed continuous distributions, indicating that trait was controlled multigenically. Genomic region identified on chromosome 2D, was located within the short arm, with flanking markers (Xgwm484-Xcfd73), explained phenotypic variation (PVE) ranged from 13.9 to 31.8 %. The genomic region identified on chromosome 5B was found with the effect of maximum contribution with flanking DArT markers (1376633|F|0-1207571|F|0), PVE ranged from 24 to 27.0 %. This can, therefore, be utilized for marker assisted selection in developing much needed stripe rust resistant lines for the northern wheat belt of India.

  19. Host-induced silencing of essential genes in Puccinia triticina through transgenic expression of RNAi sequences reduces severity of leaf rust infection in wheat.

    Science.gov (United States)

    Panwar, Vinay; Jordan, Mark; McCallum, Brent; Bakkeren, Guus

    2018-05-01

    Leaf rust, caused by the pathogenic fungus Puccinia triticina (Pt), is one of the most serious biotic threats to sustainable wheat production worldwide. This obligate biotrophic pathogen is prevalent worldwide and is known for rapid adaptive evolution to overcome resistant wheat varieties. Novel disease control approaches are therefore required to minimize the yield losses caused by Pt. Having shown previously the potential of host-delivered RNA interference (HD-RNAi) in functional screening of Pt genes involved in pathogenesis, we here evaluated the use of this technology in transgenic wheat plants as a method to achieve protection against wheat leaf rust (WLR) infection. Stable expression of hairpin RNAi constructs with sequence homology to Pt MAP-kinase (PtMAPK1) or a cyclophilin (PtCYC1) encoding gene in susceptible wheat plants showed efficient silencing of the corresponding genes in the interacting fungus resulting in disease resistance throughout the T 2 generation. Inhibition of Pt proliferation in transgenic lines by in planta-induced RNAi was associated with significant reduction in target fungal transcript abundance and reduced fungal biomass accumulation in highly resistant plants. Disease protection was correlated with the presence of siRNA molecules specific to targeted fungal genes in the transgenic lines harbouring the complementary HD-RNAi construct. This work demonstrates that generating transgenic wheat plants expressing RNAi-inducing transgenes to silence essential genes in rust fungi can provide effective disease resistance, thus opening an alternative way for developing rust-resistant crops. © 2017 Her Majesty the Queen in Right of Canada. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

  20. Genome-Wide Association Study for Identification and Validation of Novel SNP Markers for Sr6 Stem Rust Resistance Gene in Bread Wheat.

    Science.gov (United States)

    Mourad, Amira M I; Sallam, Ahmed; Belamkar, Vikas; Wegulo, Stephen; Bowden, Robert; Jin, Yue; Mahdy, Ezzat; Bakheit, Bahy; El-Wafaa, Atif A; Poland, Jesse; Baenziger, Peter S

    2018-01-01

    Stem rust (caused by Puccinia graminis f. sp. tritici Erikss. & E. Henn.), is a major disease in wheat ( Triticum aestivium L.). However, in recent years it occurs rarely in Nebraska due to weather and the effective selection and gene pyramiding of resistance genes. To understand the genetic basis of stem rust resistance in Nebraska winter wheat, we applied genome-wide association study (GWAS) on a set of 270 winter wheat genotypes (A-set). Genotyping was carried out using genotyping-by-sequencing and ∼35,000 high-quality SNPs were identified. The tested genotypes were evaluated for their resistance to the common stem rust race in Nebraska (QFCSC) in two replications. Marker-trait association identified 32 SNP markers, which were significantly (Bonferroni corrected P < 0.05) associated with the resistance on chromosome 2D. The chromosomal location of the significant SNPs (chromosome 2D) matched the location of Sr6 gene which was expected in these genotypes based on pedigree information. A highly significant linkage disequilibrium (LD, r 2 ) was found between the significant SNPs and the specific SSR marker for the Sr6 gene ( Xcfd43 ). This suggests the significant SNP markers are tagging Sr6 gene. Out of the 32 significant SNPs, eight SNPs were in six genes that are annotated as being linked to disease resistance in the IWGSC RefSeq v1.0. The 32 significant SNP markers were located in nine haplotype blocks. All the 32 significant SNPs were validated in a set of 60 different genotypes (V-set) using single marker analysis. SNP markers identified in this study can be used in marker-assisted selection, genomic selection, and to develop KASP (Kompetitive Allele Specific PCR) marker for the Sr6 gene. Novel SNPs for Sr6 gene, an important stem rust resistant gene, were identified and validated in this study. These SNPs can be used to improve stem rust resistance in wheat.

  1. Molecular cytogenetic characterization and stem rust resistance of five wheat-thinopyrum ponticum partial amphiploids

    Science.gov (United States)

    Partial amphiploids created by crossing common wheat (Triticum aestivum L.) and Thinopyrum ponticum (Podp.), Barkworth & D. R. Dewey may be resistant to major wheat diseases and are an important intermediate material in wheat breeding. In this study, we examined chromosome composition of five Xiaoy...

  2. Impact of transgenic wheat with wheat yellow mosaic virus resistance on microbial community diversity and enzyme activity in rhizosphere soil.

    Science.gov (United States)

    Wu, Jirong; Yu, Mingzheng; Xu, Jianhong; Du, Juan; Ji, Fang; Dong, Fei; Li, Xinhai; Shi, Jianrong

    2014-01-01

    The transgenic wheat line N12-1 containing the WYMV-Nib8 gene was obtained previously through particle bombardment, and it can effectively control the wheat yellow mosaic virus (WYMV) disease transmitted by Polymyxa graminis at turngreen stage. Due to insertion of an exogenous gene, the transcriptome of wheat may be altered and affect root exudates. Thus, it is important to investigate the potential environmental risk of transgenic wheat before commercial release because of potential undesirable ecological side effects. Our 2-year study at two different experimental locations was performed to analyze the impact of transgenic wheat N12-1 on bacterial and fungal community diversity in rhizosphere soil using polymerase chain reaction-denaturing gel gradient electrophoresis (PCR-DGGE) at four growth stages (seeding stage, turngreen stage, grain-filling stage, and maturing stage). We also explored the activities of urease, sucrase and dehydrogenase in rhizosphere soil. The results showed that there was little difference in bacterial and fungal community diversity in rhizosphere soil between N12-1 and its recipient Y158 by comparing Shannon's, Simpson's diversity index and evenness (except at one or two growth stages). Regarding enzyme activity, only one significant difference was found during the maturing stage at Xinxiang in 2011 for dehydrogenase. Significant growth stage variation was observed during 2 years at two experimental locations for both soil microbial community diversity and enzyme activity. Analysis of bands from the gel for fungal community diversity showed that the majority of fungi were uncultured. The results of this study suggested that virus-resistant transgenic wheat had no adverse impact on microbial community diversity and enzyme activity in rhizosphere soil during 2 continuous years at two different experimental locations. This study provides a theoretical basis for environmental impact monitoring of transgenic wheat when the introduced gene is

  3. Impact of transgenic wheat with wheat yellow mosaic virus resistance on microbial community diversity and enzyme activity in rhizosphere soil.

    Directory of Open Access Journals (Sweden)

    Jirong Wu

    Full Text Available The transgenic wheat line N12-1 containing the WYMV-Nib8 gene was obtained previously through particle bombardment, and it can effectively control the wheat yellow mosaic virus (WYMV disease transmitted by Polymyxa graminis at turngreen stage. Due to insertion of an exogenous gene, the transcriptome of wheat may be altered and affect root exudates. Thus, it is important to investigate the potential environmental risk of transgenic wheat before commercial release because of potential undesirable ecological side effects. Our 2-year study at two different experimental locations was performed to analyze the impact of transgenic wheat N12-1 on bacterial and fungal community diversity in rhizosphere soil using polymerase chain reaction-denaturing gel gradient electrophoresis (PCR-DGGE at four growth stages (seeding stage, turngreen stage, grain-filling stage, and maturing stage. We also explored the activities of urease, sucrase and dehydrogenase in rhizosphere soil. The results showed that there was little difference in bacterial and fungal community diversity in rhizosphere soil between N12-1 and its recipient Y158 by comparing Shannon's, Simpson's diversity index and evenness (except at one or two growth stages. Regarding enzyme activity, only one significant difference was found during the maturing stage at Xinxiang in 2011 for dehydrogenase. Significant growth stage variation was observed during 2 years at two experimental locations for both soil microbial community diversity and enzyme activity. Analysis of bands from the gel for fungal community diversity showed that the majority of fungi were uncultured. The results of this study suggested that virus-resistant transgenic wheat had no adverse impact on microbial community diversity and enzyme activity in rhizosphere soil during 2 continuous years at two different experimental locations. This study provides a theoretical basis for environmental impact monitoring of transgenic wheat when the

  4. Identification of isoforms of microRNAs in wheat (Triticum aestivum L. and their role in leaf rust pathogenesis

    Directory of Open Access Journals (Sweden)

    Summi Dutta

    2017-10-01

    Full Text Available Bread wheat, a type of grass under genus Triticum and species aestivum covers the largest land area when production of cereal crops is considered. Being an allohexaploid (2n=6x=42; AABBDD, its genome is contributed by three progenitors and is evolutionarily rich. Rust in leaves, caused by Puccinia triticina, severely affects grain quality. MicroRNAs are considered as major components of gene silencing and so have deep role to play during stress. Post transcriptional modification of miRNAs which generates isomiRNAs significantly affects target specificity especially when the modification occurs in 5′end. A total of four small RNA libraries were prepared through next-generation Illumina sequencing techniques from leaves of two wheat Near Isogenic Lines (NILs, HD2329 (susceptible and HD2329 + LR24 (resistant. Prior to this, one set of the two NILs was mock inoculated and considered as control (with sRNA library code named SM-mi and RM-mi while other was treated with urediniospores of leaf rust fungus (with sRNA library code named SPI-mi and RPI-mi. Clean reads in all four libraries were previously used for prediction of 559 novel miRNAs and in the current study it was used to detect isoforms of these miRNAs. A total of 237 isoforms were detected for 41 miRNAs. These isoforms included both 5′ and 3′ modifications of miRNAs. There were 27 miRNAs with 5′ modifications and five miRNAs with 3′ modifications while nine miRNAs showed both types of modifications.

  5. A novel Robertsonian translocation event leads to transfer of a stem rust resistance gene (Sr52) effective against race Ug99 from Dasypyrum villosum into bread wheat.

    Science.gov (United States)

    Qi, L L; Pumphrey, M O; Friebe, Bernd; Zhang, P; Qian, C; Bowden, R L; Rouse, M N; Jin, Y; Gill, B S

    2011-06-01

    Stem rust (Puccinia graminis f. sp. tritici Eriks. & E. Henn.) (the causal agent of wheat stem rust) race Ug99 (also designated TTKSK) and its derivatives have defeated several important stem rust resistance genes widely used in wheat (Triticum aestivum L.) production, rendering much of the worldwide wheat acreage susceptible. In order to identify new resistance sources, a large collection of wheat relatives and genetic stocks maintained at the Wheat Genetic and Genomic Resources Center was screened. The results revealed that most accessions of the diploid relative Dasypyrum villosum (L.) Candargy were highly resistant. The screening of a set of wheat-D. villosum chromosome addition lines revealed that the wheat-D. villosum disomic addition line DA6V#3 was moderately resistant to race Ug99. The objective of the present study was to produce and characterize compensating wheat-D. villosum whole arm Robertsonian translocations (RobTs) involving chromosomes 6D of wheat and 6V#3 of D. villosum through the mechanism of centric breakage-fusion. Seven 6V#3-specific EST-STS markers were developed for screening F(2) progeny derived from plants double-monosomic for chromosomes 6D and 6V#3. Surprisingly, although 6D was the target chromosome, all recovered RobTs involved chromosome 6A implying a novel mechanism for the origin of RobTs. Homozygous translocations (T6AS·6V#3L and T6AL·6V#3S) with good plant vigor and full fertility were selected from F(3) families. A stem rust resistance gene was mapped to the long arm 6V#3L in T6AS·6V#3L and was designated as Sr52. Sr52 is temperature-sensitive and is most effective at 16°C, partially effective at 24°C, and ineffective at 28°C. The T6AS·6V#3L stock is a new source of resistance to Ug99, is cytogenetically stable, and may be useful in wheat improvement.

  6. Durable field resistance to wheat yellow mosaic virus in transgenic wheat containing the antisense virus polymerase gene.

    Science.gov (United States)

    Chen, Ming; Sun, Liying; Wu, Hongya; Chen, Jiong; Ma, Youzhi; Zhang, Xiaoxiang; Du, Lipu; Cheng, Shunhe; Zhang, Boqiao; Ye, Xingguo; Pang, Junlan; Zhang, Xinmei; Li, Liancheng; Andika, Ida B; Chen, Jianping; Xu, Huijun

    2014-05-01

    Wheat yellow mosaic virus (WYMV) has spread rapidly and causes serious yield losses in the major wheat-growing areas in China. Because it is vectored by the fungus-like organism Polymyxa graminis that survives for long periods in soil, it is difficult to eliminate by conventional crop management or fungicides. There is also only limited resistance in commercial cultivars. In this research, fourteen independent transgenic events were obtained by co-transformation with the antisense NIb8 gene (the NIb replicase of WYMV) and a selectable gene bar. Four original transgenic lines (N12, N13, N14 and N15) and an offspring line (N12-1) showed high and durable resistance to WYMV in the field. Four resistant lines were shown to have segregated and only contain NIb8 (without bar) by PCR and herbicide resistance testing in the later generations. Line N12-1 showed broad-spectrum resistance to WYMV isolates from different sites in China. After growing in the infested soil, WYMV could not be detected by tissue printing and Western blot assays of transgenic wheat. The grain yield of transgenic wheat was about 10% greater than the wild-type susceptible control. Northern blot and small RNA deep sequencing analyses showed that there was no accumulation of small interfering RNAs targeting the NIb8 gene in transgenic wheat plants, suggesting that transgene RNA silencing, a common mechanism of virus-derived disease resistance, is not involved in the process of WYMV resistance. This durable and broad-spectrum resistance to WYMV in transgenic wheat will be useful for alleviating the damage caused by WYMV. © 2013 Society for Experimental Biology, Association of Applied Biologists and John Wiley & Sons Ltd.

  7. Identification and mapping of Sr46 from Aegilops tauschii accession CIae 25 conferring resistance to race TTKSK (Ug99) of wheat stem rust pathogen.

    Science.gov (United States)

    Yu, Guotai; Zhang, Qijun; Friesen, Timothy L; Rouse, Matthew N; Jin, Yue; Zhong, Shaobin; Rasmussen, Jack B; Lagudah, Evans S; Xu, Steven S

    2015-03-01

    Mapping studies confirm that resistance to Ug99 race of stem rust pathogen in Aegilops tauschii accession Clae 25 is conditioned by Sr46 and markers linked to the gene were developed for marker-assisted selection. The race TTKSK (Ug99) of Puccinia graminis f. sp. tritici, the causal pathogen for wheat stem rust, is considered as a major threat to global wheat production. To address this threat, researchers across the world have been devoted to identifying TTKSK-resistant genes. Here, we report the identification and mapping of a stem rust resistance gene in Aegilops tauschii accession CIae 25 that confers resistance to TTKSK and the development of molecular markers for the gene. An F2 population of 710 plants from an Ae. tauschii cross CIae 25 × AL8/78 were first evaluated against race TPMKC. A set of 14 resistant and 116 susceptible F2:3 families from the F2 plants were then evaluated for their reactions to TTKSK. Based on the tests, 179 homozygous susceptible F2 plants were selected as the mapping population to identify the simple sequence repeat (SSR) and sequence tagged site (STS) markers linked to the gene by bulk segregant analysis. A dominant stem rust resistance gene was identified and mapped with 16 SSR and five new STS markers to the deletion bin 2DS5-0.47-1.00 of chromosome arm 2DS in which Sr46 was located. Molecular marker and stem rust tests on CIae 25 and two Ae. tauschii accessions carrying Sr46 confirmed that the gene in CIae 25 is Sr46. This study also demonstrated that Sr46 is temperature-sensitive being less effective at low temperatures. The marker validation indicated that two closely linked markers Xgwm210 and Xwmc111 can be used for marker-assisted selection of Sr46 in wheat breeding programs.

  8. Loci associated with resistance to stripe rust (Puccinia striiformis f. sp. tritici) in a core collection of spring wheat (Triticum aestivum)

    Science.gov (United States)

    Bulli, Peter; Rynearson, Sheri; Chen, Xianming; Pumphrey, Michael

    2017-01-01

    Stripe rust, caused by Puccinia striiformis Westend. f. sp. tritici Erikss. (Pst) remains one of the most significant diseases of wheat worldwide. We investigated stripe rust resistance by genome-wide association analysis (GWAS) in 959 spring wheat accessions from the United States Department of Agriculture-Agricultural Research Service National Small Grains Collection, representing major global production environments. The panel was characterized for field resistance in multi-environment field trials and seedling resistance under greenhouse conditions. A genome-wide set of 5,619 informative SNP markers were used to examine the population structure, linkage disequilibrium and marker-trait associations in the germplasm panel. Based on model-based analysis of population structure and hierarchical Ward clustering algorithm, the accessions were clustered into two major subgroups. These subgroups were largely separated according to geographic origin and improvement status of the accessions. A significant correlation was observed between the population sub-clusters and response to stripe rust infection. We identified 11 and 7 genomic regions with significant associations with stripe rust resistance at adult plant and seedling stages, respectively, based on a false discovery rate multiple correction method. The regions harboring all, except three, of the QTL identified from the field and greenhouse studies overlap with positions of previously reported QTL. Further work should aim at validating the identified QTL using proper germplasm and populations to enhance their utility in marker assisted breeding. PMID:28591221

  9. Identification, Characterization and Full-Length Sequence Analysis of a Novel Polerovirus Associated with Wheat Leaf Yellowing Disease.

    Science.gov (United States)

    Zhang, Peipei; Liu, Yan; Liu, Wenwen; Cao, Mengji; Massart, Sebastien; Wang, Xifeng

    2017-01-01

    To identify the pathogens responsible for leaf yellowing symptoms on wheat samples collected from Jinan, China, we tested for the presence of three known barley/wheat yellow dwarf viruses (BYDV-GAV, -PAV, WYDV-GPV) (most likely pathogens) using RT-PCR. A sample that tested negative for the three viruses was selected for small RNA sequencing. Twenty-five million sequences were generated, among which 5% were of viral origin. A novel polerovirus was discovered and temporarily named wheat leaf yellowing-associated virus (WLYaV). The full genome of WLYaV corresponds to 5,772 nucleotides (nt), with six AUG-initiated open reading frames, one non-AUG-initiated open reading frame, and three untranslated regions, showing typical features of the family Luteoviridae . Sequence comparison and phylogenetic analyses suggested that WLYaV had the closest relationship with sugarcane yellow leaf virus (ScYLV), but the identities of full genomic nucleotides and deduced amino acid sequence of coat protein (CP) were 64.9 and 86.2%, respectively, below the species demarcation thresholds (90%) in the family Luteoviridae . Furthermore, agroinoculation of Nicotiana benthamiana leaves with a cDNA clone of WLYaV caused yellowing symptoms on the plant. Our study adds a new polerovirus that is associated with wheat leaf yellowing disease, which would help to identify and control pathogens of wheat.

  10. Identification, Characterization and Full-Length Sequence Analysis of a Novel Polerovirus Associated with Wheat Leaf Yellowing Disease

    Directory of Open Access Journals (Sweden)

    Peipei Zhang

    2017-09-01

    Full Text Available To identify the pathogens responsible for leaf yellowing symptoms on wheat samples collected from Jinan, China, we tested for the presence of three known barley/wheat yellow dwarf viruses (BYDV-GAV, -PAV, WYDV-GPV (most likely pathogens using RT-PCR. A sample that tested negative for the three viruses was selected for small RNA sequencing. Twenty-five million sequences were generated, among which 5% were of viral origin. A novel polerovirus was discovered and temporarily named wheat leaf yellowing-associated virus (WLYaV. The full genome of WLYaV corresponds to 5,772 nucleotides (nt, with six AUG-initiated open reading frames, one non-AUG-initiated open reading frame, and three untranslated regions, showing typical features of the family Luteoviridae. Sequence comparison and phylogenetic analyses suggested that WLYaV had the closest relationship with sugarcane yellow leaf virus (ScYLV, but the identities of full genomic nucleotides and deduced amino acid sequence of coat protein (CP were 64.9 and 86.2%, respectively, below the species demarcation thresholds (90% in the family Luteoviridae. Furthermore, agroinoculation of Nicotiana benthamiana leaves with a cDNA clone of WLYaV caused yellowing symptoms on the plant. Our study adds a new polerovirus that is associated with wheat leaf yellowing disease, which would help to identify and control pathogens of wheat.

  11. Experimental mutation of disease resistance in wheat

    International Nuclear Information System (INIS)

    Hanisova, A.; Hanis, M.; Knytl, V.; Cerny, J.

    1980-01-01

    In 1968 to 1974, 19 cultivars and lines of wheat were treated with mutagens (i.e., with X rays, gamma radiation, neutrons, EMS). ALtogether 140 lines were obtained showing better resistance and/or tolerance to black stem rust, yellow rust, stem rust of wheat, powdery mildew of cereals, and root-rot of wheat. The frequency of the induced mutations was sufficiently high, i.e., 0.0012 to 0.078 mutants per 100 plants of M 2 . The major part of mutant lines showed a lower agronomical value due to negative pleiotropy of mutant genes and a changed genetic background of mutants. Some mutant lines can be used as the starting material in hybridization programmes. (author)

  12. In vivo assessment of plant extracts for control of plant diseases: A sesquiterpene ketolactone isolated from Curcuma zedoaria suppresses wheat leaf rust.

    Science.gov (United States)

    Han, Jae Woo; Shim, Sang Hee; Jang, Kyoung Soo; Choi, Yong Ho; Dang, Quang Le; Kim, Hun; Choi, Gyung Ja

    2018-02-01

    As an alternative to synthetic pesticides, natural materials such as plant extracts and microbes have been considered to control plant diseases. In this study, methanol extracts of 120 plants were explored for in vivo antifungal activity against Rhizoctonia solani, Botrytis cinerea, Phytophthora infestans, Puccinia triticina, and Blumeria graminis f. sp. hordei. Of the 120 plant extracts, eight plant extracts exhibited a disease control efficacy of more than 90% against at least one of five plant diseases. In particular, a methanol extract of Curcuma zedoaria rhizomes exhibited strong activity against wheat leaf rust caused by P. triticina. When the C. zedoaria methanol extracts were partitioned with various solvents, the layers of n-hexane, methylene chloride, and ethyl acetate showed disease control values of 100, 80, and 43%, respectively, against wheat leaf rust. From the C. zedoaria rhizome extracts, an antifungal substance was isolated and identified as a sesquiterpene ketolactone based on the mass and nuclear magnetic resonance spectral data. The active compound controlled the development of rice sheath blight, wheat leaf rust, and tomato late blight. Considering the in vivo antifungal activities of the sesquiterpene ketolactone and the C. zedoaria extracts, these results suggest that C. zedoaria can be used as a potent fungicide in organic agriculture.

  13. Molecular mapping of a stripe rust resistance gene in wheat line C51

    Indian Academy of Sciences (India)

    2014-08-18

    Aug 18, 2014 ... This disease causes significant economic losses in terms of .... Development of STS markers. Primers of ..... reference manual, 3rd edition. Whitehead ... Proceedings of the 11th International Wheat Genetic Symposium, pp.

  14. Sustainable use of winter Durum wheat landraces under ...

    African Journals Online (AJOL)

    ... the two checks cultivars. Bi- plot analysis showed that some promising lines with reasonable grain yields, good quality parameters, winter hardiness and drought tolerances among yellow rust resistance durum wheat landraces can be selected for semiarid conditions of Mediterranean countries for sustainable production.

  15. WHEAT LEAF RUST SEVERITY AS AFFECTED BY PLANT DENSITY AND SPECIES PROPORTION IN SIMPLE COMMUNITIES OF WHEAT AND WILD OATS

    Science.gov (United States)

    While it is generally accepted that dense stands of plants exacerbate epidemics caused by foliar pathogens, there is little experimental evidence to support this view. We grew model plant communities consisting of wheat and wild oats at different densities and proportions and exp...

  16. Expression of apoplast-targeted plant defensin MtDef4.2 confers resistance to leaf rust pathogen Puccinia triticina but does not affect mycorrhizal symbiosis in transgenic wheat.

    Science.gov (United States)

    Kaur, Jagdeep; Fellers, John; Adholeya, Alok; Velivelli, Siva L S; El-Mounadi, Kaoutar; Nersesian, Natalya; Clemente, Thomas; Shah, Dilip

    2017-02-01

    Rust fungi of the order Pucciniales are destructive pathogens of wheat worldwide. Leaf rust caused by the obligate, biotrophic basidiomycete fungus Puccinia triticina (Pt) is an economically important disease capable of causing up to 50 % yield losses. Historically, resistant wheat cultivars have been used to control leaf rust, but genetic resistance is ephemeral and breaks down with the emergence of new virulent Pt races. There is a need to develop alternative measures for control of leaf rust in wheat. Development of transgenic wheat expressing an antifungal defensin offers a promising approach to complement the endogenous resistance genes within the wheat germplasm for durable resistance to Pt. To that end, two different wheat genotypes, Bobwhite and Xin Chun 9 were transformed with a chimeric gene encoding an apoplast-targeted antifungal plant defensin MtDEF4.2 from Medicago truncatula. Transgenic lines from four independent events were further characterized. Homozygous transgenic wheat lines expressing MtDEF4.2 displayed resistance to Pt race MCPSS relative to the non-transgenic controls in growth chamber bioassays. Histopathological analysis suggested the presence of both pre- and posthaustorial resistance to leaf rust in these transgenic lines. MtDEF4.2 did not, however, affect the root colonization of a beneficial arbuscular mycorrhizal fungus Rhizophagus irregularis. This study demonstrates that the expression of apoplast-targeted plant defensin MtDEF4.2 can provide substantial resistance to an economically important leaf rust disease in transgenic wheat without negatively impacting its symbiotic relationship with the beneficial mycorrhizal fungus.

  17. Isolation and molecular cytogenetic characterization of a wheat - Leymus mollis double monosomic addition line and its progenies with resistance to stripe rust.

    Science.gov (United States)

    Yang, Xiaofei; Li, Xin; Wang, Changyou; Chen, Chunhuan; Tian, Zengrong; Ji, Wanquan

    2017-12-01

    A common wheat - Leymus mollis (2n = 4x = 28, NsNsXmXm) double monosomic addition line, M11003-4-3-8/13/15 (2n = 44 = 42T.a + L.m2 + L.m3), with stripe rust resistance was developed (where T.a represents Triticum aestivum chromosome, L.m represents L. mollis chromosome, and L.m2/3 represents L. mollis chromosome of homoeologous groups 2 and 3). The progenies of line M11003-4-3-8/13/15 were characterized by cytological observation, specific molecular markers, fluorescence in situ hybridization (FISH), and genomic in situ hybridization (GISH). Among the progenies, there existed five different types (I, II, III, IV, and V) of chromosome constitution, the formulas of which were 2n = 44 = 42T.a + 1L.m2 + 1L.m3, 2n = 43 = 42T.a + 1L.m2, 2n = 43 = 42T.a + 1L.m3, 2n = 42 = 42T.a, and 2n = 44 = 42T.a + 2L.m2, respectively. Field disease screening showed that types I and III showed high resistance to stripe rust, while types II, IV, and V were susceptible. Leymus mollis was almost immune to stripe rust, whereas the wheat parent, cultivar 7182, was susceptible. Therefore, we concluded that the stripe rust resistance originated from L. mollis. These various lines could be further fully exploited as important disease resistance materials to enrich wheat genetic resources.

  18. Diversifying Selection in the Wheat Stem Rust Fungus Acts Predominantly on Pathogen-Associated Gene Families and Reveals Candidate Effectors

    Directory of Open Access Journals (Sweden)

    Jana eSperschneider

    2014-09-01

    Full Text Available Plant pathogens cause severe losses to crop plants and threaten global food production. One striking example is the wheat stem rust fungus, Puccinia graminis f. sp. tritici, which can rapidly evolve new virulent pathotypes in response to resistant host lines. Like several other filamentous fungal and oomycete plant pathogens, its genome features expanded gene families that have been implicated in host-pathogen interactions, possibly encoding effector proteins that interact directly with target host defence proteins. Previous efforts to understand virulence largely relied on the prediction of secreted, small and cysteine-rich proteins as candidate effectors and thus delivered an overwhelming number of candidates. Here, we implement an alternative analysis strategy that uses the signal of adaptive evolution as a line of evidence for effector function, combined with comparative information and expression data. We demonstrate that in planta up-regulated genes that are rapidly evolving are found almost exclusively in pathogen-associated gene families, affirming the impact of host-pathogen co-evolution on genome structure and the adaptive diversification of specialised gene families. In particular, we predict 42 effector candidates that are conserved only across pathogens, induced during infection and rapidly evolving. One of our top candidates has recently been shown to induce genotype-specific hypersensitive cell death in wheat. This shows that comparative genomics incorporating the evolutionary signal of adaptation is powerful for predicting effector candidates for laboratory verification. Our system can be applied to a wide range of pathogens and will give insight into host-pathogen dynamics, ultimately leading to progress in strategies for disease control.

  19. Phenylalanine ammonia-lyase (pal) and peroxidase activity in brown rust infected tissues of pakistani wheat cultivars

    International Nuclear Information System (INIS)

    Riaz, A.; Tahir, M.I.

    2014-01-01

    Besides other factors resistance and susceptibility is the outcome of biochemical processes such as activities of defense-related enzymes. So in this study, Phenylalanine ammonia-lyase (PAL) and Peroxidase activity of resistant (Inqilab-91) and susceptible (Kirin-95) wheat cultivars were determined through spectrophotometer to address the biochemical aspect related to the disease after 8 hours, 24 hours, 48 hours and 72 hours of leaf rust inoculation. The results have shown that these enzymes were present in both the resistant and susceptible cultivars but the activity was more pronounced in the resistant one. The effect of PAL and peroxidase activity was also investigated among inoculated and uninoculated plants within the same cultivar. The activity of both PAL and peroxidase were more significant in inoculated ones. The results have shown that the after 72 hours of inoculation Inqilab-91 had more PAL activity i.e., 5.47 IU/ml/min than in Kirin-95 i.e., 2.08 IU/ml/min at 270 nm. While peroxidase activity in Inqilab-91 was 6.41 IU/ml/min and in Kirin-95, 3.66 IU/ml/min after 72 hours of inoculation, observed under 470 nm wavelength. Increase in one's activity increases the other enzyme's activity. The activity was more prominent after 72 hours of infection as pathogen had successfully established itself in the host plant tissue. The activities of these enzymes act as plants active defense mechanism against the attack of pathogen. (author)

  20. Exploiting a wheat EST database to assess genetic diversity.

    Science.gov (United States)

    Karakas, Ozge; Gurel, Filiz; Uncuoglu, Ahu Altinkut

    2010-10-01

    Expressed sequence tag (EST) markers have been used to assess variety and genetic diversity in wheat (Triticum aestivum). In this study, 1549 ESTs from wheat infested with yellow rust were used to examine the genetic diversity of six susceptible and resistant wheat cultivars. The aim of using these cultivars was to improve the competitiveness of public wheat breeding programs through the intensive use of modern, particularly marker-assisted, selection technologies. The F(2) individuals derived from cultivar crosses were screened for resistance to yellow rust at the seedling stage in greenhouses and adult stage in the field to identify DNA markers genetically linked to resistance. Five hundred and sixty ESTs were assembled into 136 contigs and 989 singletons. BlastX search results showed that 39 (29%) contigs and 96 (10%) singletons were homologous to wheat genes. The database-matched contigs and singletons were assigned to eight functional groups related to protein synthesis, photosynthesis, metabolism and energy, stress proteins, transporter proteins, protein breakdown and recycling, cell growth and division and reactive oxygen scavengers. PCR analyses with primers based on the contigs and singletons showed that the most polymorphic functional categories were photosynthesis (contigs) and metabolism and energy (singletons). EST analysis revealed considerable genetic variability among the Turkish wheat cultivars resistant and susceptible to yellow rust disease and allowed calculation of the mean genetic distance between cultivars, with the greatest similarity (0.725) being between Harmankaya99 and Sönmez2001, and the lowest (0.622) between Aytin98 and Izgi01.

  1. Barberry rust survey – developing tools for diagnosis, analysis and data management

    DEFF Research Database (Denmark)

    Justesen, Annemarie Fejer; Hansen, Jens Grønbech; Hovmøller, Mogens Støvring

    Barberry (Berberis spp.) may serve as alternate host of several Puccinia species including Puccinia graminis and P. striiformis causing stem and yellow rust on cereals and grasses, respectively. In order to study the importance of barberry in the epidemiology of Puccinia species in the CWANA regi...... a rust survey was initiated. The aim was to 1) develop a surveillance protocol 2) develop molecular diagnostic tools for identifying Puccinia spp. from aecial samples, and 3) develop a data management and display system of results as part of the Wheat Rust ToolBox (http....... Due to variable quality of aecial samples DNA extraction was not successful for 40% of the samples. Sequences of EF1α, β-tubulin or ITS were analysed and compared to reference sequences of rust fungi infecting cereals and grasses. The analysis supported the presence of P. graminis s.l., P....... arrhenatheri and P. striiformoides on barberry species. Survey and DNA sample maps with species designation were displayed in the Wheat Rust ToolBox. The future aim is to integrate barberry rust survey data based on molecular diagnostics and infection assays from research groups world-wide in order to gain...

  2. Efficient Use of Historical Data for Genomic Selection: A Case Study of Stem Rust Resistance in Wheat

    Directory of Open Access Journals (Sweden)

    J. Rutkoski

    2015-03-01

    Full Text Available Genomic selection (GS is a methodology that can improve crop breeding efficiency. To implement GS, a training population (TP with phenotypic and genotypic data is required to train a statistical model used to predict genotyped selection candidates (SCs. A key factor impacting prediction accuracy is the relationship between the TP and the SCs. This study used empirical data for quantitative adult plant resistance to stem rust of wheat ( L. to investigate the utility of a historical TP (TP compared with a population-specific TP (TP, the potential for TP optimization, and the utility of TP data when close relative data is available for training. We found that, depending on the population size, a TP was 1.5 to 4.4 times more accurate than a TP, and TP optimization based on the mean of the generalized coefficient of determination or prediction error variance enabled the selection of subsets that led to significantly higher accuracy than randomly selected subsets. Retaining historical data when data on close relatives were available lead to a 11.9% increase in accuracy, at best, and a 12% decrease in accuracy, at worst, depending on the heritability. We conclude that historical data could be used successfully to initiate a GS program, especially if the dataset is very large and of high heritability. Training population optimization would be useful for the identification of TP subsets to phenotype additional traits. However, after model updating, discarding historical data may be warranted. More studies are needed to determine if these observations represent general trends.

  3. QTL Mapping of Adult-Plant Resistance to Leaf Rust in the Wheat Cross Zhou 8425B/Chinese Spring Using High-Density SNP Markers

    Directory of Open Access Journals (Sweden)

    Peipei Zhang

    2017-05-01

    Full Text Available Wheat leaf rust is an important disease worldwide. Growing resistant cultivars is an effective means to control the disease. In the present study, 244 recombinant inbred lines from Zhou 8425B/Chinese Spring cross were phenotyped for leaf rust severities during the 2011–2012, 2012–2013, 2013–2014, and 2014–2015 cropping seasons at Baoding, Hebei province, and 2012–2013 and 2013–2014 cropping seasons in Zhoukou, Henan province. The population was genotyped using the high-density Illumina iSelect 90K SNP assay and SSR markers. Inclusive composite interval mapping identified eight QTL, designated as QLr.hebau-2AL, QLr.hebau-2BS, QLr.hebau-3A, QLr.hebau-3BS, QLr.hebau-4AL, QLr.hebau-4B, QLr.hebau-5BL, and QLr.hebau-7DS, respectively. QLr.hebau-2BS, QLr.hebau-3A, QLr.hebau-3BS, and QLr.hebau-5BL were derived from Zhou 8425B, whereas the other four were from Chinese Spring. Three stable QTL on chromosomes 2BS, 4B and 7DS explained 7.5–10.6%, 5.5–24.4%, and 11.2–20.9% of the phenotypic variance, respectively. QLr.hebau-2BS in Zhou 8425B might be the same as LrZH22 in Zhoumai 22; QLr.hebau-4B might be the residual resistance of Lr12, and QLr.hebau-7DS is Lr34. QLr.hebau-2AL, QLr.hebau-3BS, QLr.hebau-4AL, and QLr.hebau-5BL are likely to be novel QTL for leaf rust. These QTL and their closely linked SNP and SSR markers can be used for fine mapping, candidate gene discovery, and marker-assisted selection in wheat breeding.

  4. Tripartite Interactions of Barley Yellow Dwarf Virus, Sitobion avenae and Wheat Varieties

    Science.gov (United States)

    Liu, Xiao-Feng; Hu, Xiang-Shun; Keller, Mike A.; Zhao, Hui-Yan; Wu, Yun-Feng; Liu, Tong-Xian

    2014-01-01

    The tripartite interactions in a pathosystem involving wheat (Triticum aestivum L.), the Barley yellow dwarf virus (BYDV), and the BYDV vector aphid Sitobion avenae were studied under field conditions to determine the impact of these interactions on aphid populations, virus pathology and grain yield. Wheat varietal resistance to BYDV and aphids varied among the three wheat varieties studied over two consecutive years. The results demonstrated that (1) aphid peak number (APN) in the aphid + BYDV (viruliferous aphid) treatment was greater and occurred earlier than that in the non-viruliferous aphid treatment. The APN and the area under the curve of population dynamics (AUC) on a S. avenae-resistant variety 98-10-30 was significantly lower than on two aphid-susceptible varieties Tam200(13)G and Xiaoyan6. (2) The production of alatae (PA) was greater on the variety 98-10-30 than on the other varieties, and PA was greater in the aphid + BYDV treatment on 98-10-30 than in the non-viruliferous aphid treatment, but this trend was reversed on Tam200(13)G and Xiaoyan6. (3) The BYDV disease incidence (DIC) on the variety 98-10-30 was greater than that on the other two varieties in 2012, and the disease index (DID) on Tam200(13)G was lower than on the other varieties in the aphid + BYDV and BYDV treatments in 2012, but not in 2011 when aphid vector numbers were generally lower. (4) Yield loss in the aphid + BYDV treatment tended to be greater than that in the aphid or BYDV alone treatments across varieties and years. We suggested that aphid population development and BYDV transmission tend to promote each other under field conditions. The aphids + BYDV treatment caused greater yield reductions than non-viruliferous aphids or virus treatment. Wheat varietal resistance in 98-10-30 affects the aphid dispersal, virus transmission and wheat yield loss though inhibits aphid populations from increasing. PMID:25184214

  5. Tripartite interactions of Barley yellow dwarf virus, Sitobion avenae and wheat varieties.

    Directory of Open Access Journals (Sweden)

    Xiao-Feng Liu

    Full Text Available The tripartite interactions in a pathosystem involving wheat (Triticum aestivum L., the Barley yellow dwarf virus (BYDV, and the BYDV vector aphid Sitobion avenae were studied under field conditions to determine the impact of these interactions on aphid populations, virus pathology and grain yield. Wheat varietal resistance to BYDV and aphids varied among the three wheat varieties studied over two consecutive years. The results demonstrated that (1 aphid peak number (APN in the aphid + BYDV (viruliferous aphid treatment was greater and occurred earlier than that in the non-viruliferous aphid treatment. The APN and the area under the curve of population dynamics (AUC on a S. avenae-resistant variety 98-10-30 was significantly lower than on two aphid-susceptible varieties Tam200(13G and Xiaoyan6. (2 The production of alatae (PA was greater on the variety 98-10-30 than on the other varieties, and PA was greater in the aphid + BYDV treatment on 98-10-30 than in the non-viruliferous aphid treatment, but this trend was reversed on Tam200(13G and Xiaoyan6. (3 The BYDV disease incidence (DIC on the variety 98-10-30 was greater than that on the other two varieties in 2012, and the disease index (DID on Tam200(13G was lower than on the other varieties in the aphid + BYDV and BYDV treatments in 2012, but not in 2011 when aphid vector numbers were generally lower. (4 Yield loss in the aphid + BYDV treatment tended to be greater than that in the aphid or BYDV alone treatments across varieties and years. We suggested that aphid population development and BYDV transmission tend to promote each other under field conditions. The aphids + BYDV treatment caused greater yield reductions than non-viruliferous aphids or virus treatment. Wheat varietal resistance in 98-10-30 affects the aphid dispersal, virus transmission and wheat yield loss though inhibits aphid populations from increasing.

  6. Mapping and characterization of wheat stem rust resistance genes SrTm5 and Sr60 from Triticum monococcum.

    Science.gov (United States)

    Chen, Shisheng; Guo, Yan; Briggs, Jordan; Dubach, Felix; Chao, Shiaoman; Zhang, Wenjun; Rouse, Matthew N; Dubcovsky, Jorge

    2018-03-01

    The new stem rust resistance gene Sr60 was fine-mapped to the distal region of chromosome arm 5A m S, and the TTKSK-effective gene SrTm5 could be a new allele of Sr22. The emergence and spread of new virulent races of the wheat stem rust pathogen (Puccinia graminis f. sp. tritici; Pgt), including the Ug99 race group, is a serious threat to global wheat production. In this study, we mapped and characterized two stem rust resistance genes from diploid wheat Triticum monococcum accession PI 306540. We mapped SrTm5, a previously postulated gene effective to Ug99, on chromosome arm 7A m L, completely linked to Sr22. SrTm5 displayed a different race specificity compared to Sr22 indicating that they are distinct. Sequencing of the Sr22 homolog in PI 306540 revealed a novel haplotype. Characterization of the segregating populations with Pgt race QFCSC revealed an additional resistance gene on chromosome arm 5A m S that was assigned the official name Sr60. This gene was also effective against races QTHJC and SCCSC but not against TTKSK (a Ug99 group race). Using two large mapping populations (4046 gametes), we mapped Sr60 within a 0.44 cM interval flanked by sequenced-based markers GH724575 and CJ942731. These two markers delimit a 54.6-kb region in Brachypodium distachyon chromosome 4 and a 430-kb region in the Chinese Spring reference genome. Both regions include a leucine-rich repeat protein kinase (LRRK123.1) that represents a potential candidate gene. Three CC-NBS-LRR genes were found in the colinear Brachypodium region but not in the wheat genome. We are currently developing a Bacterial Artificial Chromosome library of PI 306540 to determine which of these candidate genes are present in the T. monococcum genome and to complete the cloning of Sr60.

  7. Characterization of Novel Gene Yr79 and Four Additional Quantitative Trait Loci for All-Stage and High-Temperature Adult-Plant Resistance to Stripe Rust in Spring Wheat PI 182103.

    Science.gov (United States)

    Feng, Junyan; Wang, Meinan; See, Deven R; Chao, Shiaoman; Zheng, Youliang; Chen, Xianming

    2018-06-01

    Stripe rust, caused by Puccinia striiformis f. sp. tritici, is an important disease of wheat worldwide. Exploring new resistance genes is essential for breeding resistant wheat cultivars. PI 182103, a spring wheat landrace originally from Pakistan, has shown a high level of resistance to stripe rust in fields for many years, but genes for resistance to stripe rust in the variety have not been studied. To map the resistance gene(s) in PI 182103, 185 recombinant inbred lines (RILs) were developed from a cross with Avocet Susceptible (AvS). The RIL population was genotyped with simple sequence repeat (SSR) and single nucleotide polymorphism markers and tested with races PST-100 and PST-114 at the seedling stage under controlled greenhouse conditions and at the adult-plant stage in fields at Pullman and Mt. Vernon, Washington under natural infection by the stripe rust pathogen in 2011, 2012, and 2013. A total of five quantitative trait loci (QTL) were detected. QyrPI182103.wgp-2AS and QyrPI182103.wgp-3AL were detected at the seedling stage, QyrPI182103.wgp-4DL was detected only in Mt. Vernon field tests, and QyrPI182103.wgp-5BS was detected in both seedling and field tests. QyrPI182103.wgp-7BL was identified as a high-temperature adult-plant resistance gene and detected in all field tests. Interactions among the QTL were mostly additive, but some negative interactions were detected. The 7BL QTL was mapped in chromosomal bin 7BL 0.40 to 0.45 and identified as a new gene, permanently designated as Yr79. SSR markers Xbarc72 and Xwmc335 flanking the Yr79 locus were highly polymorphic in various wheat genotypes, indicating that the molecular markers are useful for incorporating the new gene for potentially durable stripe rust resistance into new wheat cultivars.

  8. Effects of nitrogen and irrigation on gluten protein composition and their relationship to yellow berry disorder in wheat (triticum aestivum)

    International Nuclear Information System (INIS)

    Wong, B.R.; Felix, F.R.; Chavez, T

    2014-01-01

    In Mexico and the rest of the world, the presence of yellow berry (YB) in wheat grains (Triticum aestivum) has been related with poor quality, this defect is associated with low protein content in the grains. However, the quality of the wheat depends not only on the protein content, but also on the composition of the gluten proteins. The effect of the various agronomic factors on the composition of wheat gluten has been a subject of study worldwide. However, in Mexico, wheat quality still remains an issue, as there is a lack of knowledge regarding the optimal agronomic conditions to produce wheat with good-quality gluten. For this reason, the effects of nitrogen (N) rates and irrigations on the amount of gliadin subclasses, glutenin subunits (two main groups) and grain protein content as well as the relation of these proteins to the YB content in wheat grains were investigated. The experiment was conducted on arable farmland in the Valley of Empalme, Sonora, Mexico (27 degree 58' N, 110 degree 49' W; 10 m altitude), during the fall-winter period of 2009-2010. Tarachi, the hard wheat cultivar studied, was selected for its relative susceptibility to the presence of elevated YB content in mature wheat kernels. Three levels of N (75, 150 or 250 kg ha-1) and three levels of irrigation (1, 2 or 3 auxiliary irrigations) were studied. Using a N rate of 150 kg ha-1 with 3 auxiliary irrigations, wheat with good-quality gluten was obtained. The results suggest that the YB disorder is primarily related to the amount of protein in the wheat grain. (author)

  9. Emergence of virulence to SrTmp in the Ug99 race group of wheat stem rust, Puccinia graminis f. sp. tritici, in Africa

    DEFF Research Database (Denmark)

    Patpour, M.; Hovmøller, M. S.; Justesen, A. F.

    2016-01-01

    of wheat fields in Africa (Kenya, 9; Uganda, 28; Rwanda, 41; and Egypt, 6) were sent to the Global Rust Reference Center (GRRC, Denmark) for race analysis. Puccinia graminis f. sp. tritici (Pgt) samples were recovered on cv. Morocco, and resulting urediniospores of 53 single-pustule isolates were......Tmp) to confirm their virulence/avirulence combinations to Sr24, Sr31, Sr36, and SrTmp. Race TTKTK was also detected at two locations in Uganda (Rubaya and Muko in Kabale region) and at five locations in Rwanda (Kinigi, Rwerere, Rufungo, Gatebe, and Kamenyo). Three isolates derived from stem rust samples...

  10. Conserved loci of leaf and stem rust fungi of wheat share synteny interrupted by lineage-specific influx of repeat elements

    Directory of Open Access Journals (Sweden)

    Fellers John P

    2013-01-01

    Full Text Available Abstract Background Wheat leaf rust (Puccinia triticina Eriks; Pt and stem rust fungi (P. graminis f.sp. tritici; Pgt are significant economic pathogens having similar host ranges and life cycles, but different alternate hosts. The Pt genome, currently estimated at 135 Mb, is significantly larger than Pgt, at 88 Mb, but the reason for the expansion is unknown. Three genomic loci of Pt conserved proteins were characterized to gain insight into gene content, genome complexity and expansion. Results A bacterial artificial chromosome (BAC library was made from P. triticina race 1, BBBD and probed with Pt homologs of genes encoding two predicted Pgt secreted effectors and a DNA marker mapping to a region of avirulence. Three BACs, 103 Kb, 112 Kb, and 166 Kb, were sequenced, assembled, and open reading frames were identified. Orthologous genes were identified in Pgt and local conservation of gene order (microsynteny was observed. Pairwise protein identities ranged from 26 to 99%. One Pt BAC, containing a RAD18 ortholog, shares syntenic regions with two Pgt scaffolds, which could represent both haplotypes of Pgt. Gene sequence is diverged between the species as well as within the two haplotypes. In all three BAC clones, gene order is locally conserved, however, gene shuffling has occurred relative to Pgt. These regions are further diverged by differing insertion loci of LTR-retrotransposon, Gypsy, Copia, Mutator, and Harbinger mobile elements. Uncharacterized Pt open reading frames were also found; these proteins are high in lysine and similar to multiple proteins in Pgt. Conclusions The three Pt loci are conserved in gene order, with a range of gene sequence divergence. Conservation of predicted haustoria expressed secreted protein genes between Pt and Pgt is extended to the more distant poplar rust, Melampsora larici-populina. The loci also reveal that genome expansion in Pt is in part due to higher occurrence of repeat-elements in this species.

  11. Development and Molecular Cytogenetic Identification of a Novel Wheat-Leymus mollis Lm#7Ns (7D Disomic Substitution Line with Stripe Rust Resistance.

    Directory of Open Access Journals (Sweden)

    Xiaofei Yang

    Full Text Available Leymus mollis (2n = 4x = 28, NsNsXmXm possesses novel and important genes for resistance against multi-fungal diseases. The development of new wheat-L. mollis introgression lines is of great significance for wheat disease resistance breeding. M11003-3-1-15-8, a novel disomic substitution line of common wheat cv. 7182 -L. mollis, developed and selected from the BC1F5 progeny between wheat cv. 7182 and octoploid Tritileymus M47 (2n = 8x = 56, AABBDDNsNs, was characterized by morphological and cytogenetic identification, analysis of functional molecular markers, genomic in situ hybridization (GISH, sequential fluorescence in situ hybridization (FISH-genomic in situ hybridization (GISH and disease resistance evaluation. Cytological observations suggested that M11003-3-1-15-8 contained 42 chromosomes and formed 21 bivalents at meiotic metaphase I. The GISH investigations showed that line contained 40 wheat chromosomes and a pair of L. mollis chromosomes. EST-STS multiple loci markers and PLUG (PCR-based Landmark Unique Gene markers confirmed that the introduced L. mollis chromosomes belonged to homoeologous group 7, it was designated as Lm#7Ns. While nulli-tetrasomic and sequential FISH-GISH analysis using the oligonucleotide Oligo-pSc119.2 and Oligo-pTa535 as probes revealed that the wheat 7D chromosomes were absent in M11003-3-1-15-8. Therefore, it was deduced that M11003-3-1-15-8 was a wheat-L. mollis Lm#7Ns (7D disomic substitution line. Field disease resistance demonstrated that the introduced L. mollis chromosomes Lm#7Ns were responsible for the stripe rust resistance at the adult stage. Moreover, M11003-3-1-15-8 had a superior numbers of florets. The novel disomic substitution line M11003-3-1-15-8, could be exploited as an important genetic material in wheat resistance breeding programs and genetic resources.

  12. Next generation sequencing provides rapid access to the genome of Puccinia striiformis f. sp. tritici, the causal agent of wheat stripe rust.

    Directory of Open Access Journals (Sweden)

    Dario Cantu

    Full Text Available BACKGROUND: The wheat stripe rust fungus (Puccinia striiformis f. sp. tritici, PST is responsible for significant yield losses in wheat production worldwide. In spite of its economic importance, the PST genomic sequence is not currently available. Fortunately Next Generation Sequencing (NGS has radically improved sequencing speed and efficiency with a great reduction in costs compared to traditional sequencing technologies. We used Illumina sequencing to rapidly access the genomic sequence of the highly virulent PST race 130 (PST-130. METHODOLOGY/PRINCIPAL FINDINGS: We obtained nearly 80 million high quality paired-end reads (>50x coverage that were assembled into 29,178 contigs (64.8 Mb, which provide an estimated coverage of at least 88% of the PST genes and are available through GenBank. Extensive micro-synteny with the Puccinia graminis f. sp. tritici (PGTG genome and high sequence similarity with annotated PGTG genes support the quality of the PST-130 contigs. We characterized the transposable elements present in the PST-130 contigs and using an ab initio gene prediction program we identified and tentatively annotated 22,815 putative coding sequences. We provide examples on the use of comparative approaches to improve gene annotation for both PST and PGTG and to identify candidate effectors. Finally, the assembled contigs provided an inventory of PST repetitive elements, which were annotated and deposited in Repbase. CONCLUSIONS/SIGNIFICANCE: The assembly of the PST-130 genome and the predicted proteins provide useful resources to rapidly identify and clone PST genes and their regulatory regions. Although the automatic gene prediction has limitations, we show that a comparative genomics approach using multiple rust species can greatly improve the quality of gene annotation in these species. The PST-130 sequence will also be useful for comparative studies within PST as more races are sequenced. This study illustrates the power of NGS for

  13. Breeding wheat mutant Longfu 03D51 with resisting stem rust and genetic analyzation of resisting disease and RAPD maker

    International Nuclear Information System (INIS)

    Sun Yan; Yin Jing; Wang Guangjin; Zhang Hongji; Huang Jinghua; Guo Qiang; Diao Yanling; Liu Dongjun

    2007-01-01

    Longfu 03D51 was bred using Long 6239 immature embryo as explants through radiation mutagenesis breeding coupled with tissue culture technique. By artificial inoculation and field breeding identified Longfu 03D51 was identified with high resistance to dominant strain 21C 3 CPH, good quality and high yield. Genetic analysis suggested that stem rust was controlled by a single gene. The DNA polymorphism on Longfu 03D51 and its parents were studied by random amplified polymorphic DNA (RAPD), 3 primers out of 60 RAPD primers were found polymorphism between the Longfu 03D51 and its parent Long 6239, and 3 stable polyphymorphic bands amplified in Longfu 03D51 with the size of 380bp, 700bp, 600 bp by random primer E07, E11, E17, respectively. Genetic and RAPD analysis indicated that 3 RAPD primers E07, E11, E17 might be linked to the gene of stem rust resistance. (authors)

  14. Unlocking Diversity in Germplasm Collections via Genomic Selection: A Case Study Based on Quantitative Adult Plant Resistance to Stripe Rust in Spring Wheat.

    Science.gov (United States)

    Muleta, Kebede T; Bulli, Peter; Zhang, Zhiwu; Chen, Xianming; Pumphrey, Michael

    2017-11-01

    Harnessing diversity from germplasm collections is more feasible today because of the development of lower-cost and higher-throughput genotyping methods. However, the cost of phenotyping is still generally high, so efficient methods of sampling and exploiting useful diversity are needed. Genomic selection (GS) has the potential to enhance the use of desirable genetic variation in germplasm collections through predicting the genomic estimated breeding values (GEBVs) for all traits that have been measured. Here, we evaluated the effects of various scenarios of population genetic properties and marker density on the accuracy of GEBVs in the context of applying GS for wheat ( L.) germplasm use. Empirical data for adult plant resistance to stripe rust ( f. sp. ) collected on 1163 spring wheat accessions and genotypic data based on the wheat 9K single nucleotide polymorphism (SNP) iSelect assay were used for various genomic prediction tests. Unsurprisingly, the results of the cross-validation tests demonstrated that prediction accuracy increased with an increase in training population size and marker density. It was evident that using all the available markers (5619) was unnecessary for capturing the trait variation in the germplasm collection, with no further gain in prediction accuracy beyond 1 SNP per 3.2 cM (∼1850 markers), which is close to the linkage disequilibrium decay rate in this population. Collectively, our results suggest that larger germplasm collections may be efficiently sampled via lower-density genotyping methods, whereas genetic relationships between the training and validation populations remain critical when exploiting GS to select from germplasm collections. Copyright © 2017 Crop Science Society of America.

  15. Induced mutations for disease resistance in wheat and field beans

    International Nuclear Information System (INIS)

    Abdel-Hak, T.M.; Kamel, A.H.

    1976-01-01

    Wheat disease in Egypt is reviewed and results of mutation breeding by γ irradiation for disease resistance in wheat and field beans are described. Wheat mutants of the variety Giza 155 resistant to leaf rust, Giza 156 resistant to both leaf and yellow rusts, and Tosson with a reasonable level of combined resistance to the three rusts in addition to mutants of the tetraploid variety Dakar 52 with a good level of stem and yellow rust resistance are required. Their seeds were subjected to 10, 15 and 20 krad. Of 3000-3700 M 2 plants from each variety and dosage, 22 plants from both Giza 155 and Giza 156, although susceptible, showed a lower level of disease development. In 1975, M 3 families of these selected plants and 6000 plants from bulked material were grown from each variety and dosage at two locations. Simultaneously, an additional population consisting of 3000 mutagen-treated seeds was grown to have a reasonable chance of detecting mutants; 2 heads from each plant were harvested. These will be grown next season (1976) to make a population of 25,000-30,000 M 2 plants and screened to composite cultures of specific rusts. Vicia faba seeds of field bean varieties Giza 1, Giza 2 and Rebaya 40, equally susceptible to rust and chocolate spot, were subjected to 3, 5 and 7 krad of 60 Co gamma radiation and 800 M 1 plants were grown in 1972 per variety and dose. Up to this later growing season (M 3 ) no resistance was detected in M 3 plank

  16. Short communication: Emergence of a new race of leaf rust with combined virulence to Lr14a and Lr72 genes on durum wheat

    Energy Technology Data Exchange (ETDEWEB)

    Soleiman, N.H; Solis, I.; Soliman, M.H.; Sillero, J.C.; Villegas, D.; Alvaro, F.; Royo, C.; Serra, J.; Ammar, K.; Martínez-Moreno, F.

    2016-11-01

    Leaf rust is a foliar disease caused by the fungus Puccinia triticina that may severely reduce durum wheat yield. Resistance to this pathogen is common in modern durum germplasm but is frequently based on Lr72 and Lr14a. After accounts of races with virulence to Lr14a gene in France in 2000, the present study reports the detection in 2013 for the first time of a new race with virulence to Lr14a and Lr72. The aim of this work was to characterize the virulence pattern of four Spanish isolates with virulence to Lr14a, and to discuss the consequences of this presence. Rusted leaves from cultivars ‘Don Jaime’ (Lr14a) and ‘Gallareta’ (Lr72) were collected in 2013 in the field at two Spanish sites, one in the south (near Cadiz) and another in the north (near Girona). Spores from single pustule for each cultivar and site were multiplied on susceptible cultivar ‘Don Rafael’. Then, the four isolates were inoculated on a set of 19 isogenic lines Thatcher to characterize their virulence spectrum. All isolates presented the same virulence pattern. They were virulent on both Lr14a and Lr72 and the race was named DBB/BS. This race was very similar to those reported in 2009-11, but with added virulence to Lr14a. The resistance based on Lr14a has therefore been overcome in Spain, by a new race that has likely emerged via stepwise mutation from the local predominating races. This information is important to guide breeders in their breeding programmes and gene deployment strategies. (Author)

  17. Using hierarchical clustering of secreted protein families to classify and rank candidate effectors of rust fungi

    Science.gov (United States)

    Rust fungi are obligate biotrophic pathogens causing considerable damage on crop plants. P. graminis f. sp. tritici, the causal agent of wheat stem rust, and M. larici-populina, the poplar rust pathogen, have strong deleterious impact on wheat and poplar wood production, respectively. The recently r...

  18. A Near-Complete Haplotype-Phased Genome of the Dikaryotic Wheat Stripe Rust Fungus Puccinia striiformis f. sp. tritici Reveals High Interhaplotype Diversity.

    Science.gov (United States)

    Schwessinger, Benjamin; Sperschneider, Jana; Cuddy, William S; Garnica, Diana P; Miller, Marisa E; Taylor, Jennifer M; Dodds, Peter N; Figueroa, Melania; Park, Robert F; Rathjen, John P

    2018-02-20

    A long-standing biological question is how evolution has shaped the genomic architecture of dikaryotic fungi. To answer this, high-quality genomic resources that enable haplotype comparisons are essential. Short-read genome assemblies for dikaryotic fungi are highly fragmented and lack haplotype-specific information due to the high heterozygosity and repeat content of these genomes. Here, we present a diploid-aware assembly of the wheat stripe rust fungus Puccinia striiformis f. sp. tritici based on long reads using the FALCON-Unzip assembler. Transcriptome sequencing data sets were used to infer high-quality gene models and identify virulence genes involved in plant infection referred to as effectors. This represents the most complete Puccinia striiformis f. sp. tritici genome assembly to date (83 Mb, 156 contigs, N 50 of 1.5 Mb) and provides phased haplotype information for over 92% of the genome. Comparisons of the phase blocks revealed high interhaplotype diversity of over 6%. More than 25% of all genes lack a clear allelic counterpart. When we investigated genome features that potentially promote the rapid evolution of virulence, we found that candidate effector genes are spatially associated with conserved genes commonly found in basidiomycetes. Yet, candidate effectors that lack an allelic counterpart are more distant from conserved genes than allelic candidate effectors and are less likely to be evolutionarily conserved within the P. striiformis species complex and Pucciniales In summary, this haplotype-phased assembly enabled us to discover novel genome features of a dikaryotic plant-pathogenic fungus previously hidden in collapsed and fragmented genome assemblies. IMPORTANCE Current representations of eukaryotic microbial genomes are haploid, hiding the genomic diversity intrinsic to diploid and polyploid life forms. This hidden diversity contributes to the organism's evolutionary potential and ability to adapt to stress conditions. Yet, it is

  19. Association of VPg and eIF4E in the host tropism at the cellular level of Barley yellow mosaic virus and Wheat yellow mosaic virus in the genus Bymovirus.

    Science.gov (United States)

    Li, Huangai; Shirako, Yukio

    2015-02-01

    Barley yellow mosaic virus (BaYMV) and Wheat yellow mosaic virus (WYMV) are separate species in the genus Bymovirus with bipartite plus-sense RNA genomes. In fields, BaYMV infects only barley and WYMV infects only wheat. Here, we studied the replicative capability of the two viruses in barley and wheat mesophyll protoplasts. BaYMV replicated in both barley and wheat protoplasts, but WYMV replicated only in wheat protoplasts. The expression of wheat translation initiation factor 4E (eIF4E), a common host factor for potyviruses, from the WYMV genome enabled WYMV replication in barley protoplasts. Replacing the BaYMV VPg gene with that of WYMV abolished BaYMV replication in barley protoplasts, whereas the additional expression of wheat eIF4E from BaYMV genome restored the replication of the BaYMV mutant in barley protoplasts. These results indicate that both VPg and the host eIF4E are involved in the host tropism of BaYMV and WYMV at the replication level. Copyright © 2014 Elsevier Inc. All rights reserved.

  20. Exploiting a wheat EST database to assess genetic diversity

    Directory of Open Access Journals (Sweden)

    Ozge Karakas

    2010-01-01

    Full Text Available Expressed sequence tag (EST markers have been used to assess variety and genetic diversity in wheat (Triticum aestivum. In this study, 1549 ESTs from wheat infested with yellow rust were used to examine the genetic diversity of six susceptible and resistant wheat cultivars. The aim of using these cultivars was to improve the competitiveness of public wheat breeding programs through the intensive use of modern, particularly marker-assisted, selection technologies. The F2 individuals derived from cultivar crosses were screened for resistance to yellow rust at the seedling stage in greenhouses and adult stage in the field to identify DNA markers genetically linked to resistance. Five hundred and sixty ESTs were assembled into 136 contigs and 989 singletons. BlastX search results showed that 39 (29% contigs and 96 (10% singletons were homologous to wheat genes. The database-matched contigs and singletons were assigned to eight functional groups related to protein synthesis, photosynthesis, metabolism and energy, stress proteins, transporter proteins, protein breakdown and recycling, cell growth and division and reactive oxygen scavengers. PCR analyses with primers based on the contigs and singletons showed that the most polymorphic functional categories were photosynthesis (contigs and metabolism and energy (singletons. EST analysis revealed considerable genetic variability among the Turkish wheat cultivars resistant and susceptible to yellow rust disease and allowed calculation of the mean genetic distance between cultivars, with the greatest similarity (0.725 being between Harmankaya99 and Sönmez2001, and the lowest (0.622 between Aytin98 and Izgi01.

  1. Origin, Migration Routes and Worldwide Population Genetic Structure of the Wheat Yellow Rust Pathogen Puccinia striiformis f.sp. tritici

    Science.gov (United States)

    Ali, Sajid; Gladieux, Pierre; Leconte, Marc; Gautier, Angélique; Justesen, Annemarie F.; Hovmøller, Mogens S.; Enjalbert, Jérôme; de Vallavieille-Pope, Claude

    2014-01-01

    Analyses of large-scale population structure of pathogens enable the identification of migration patterns, diversity reservoirs or longevity of populations, the understanding of current evolutionary trajectories and the anticipation of future ones. This is particularly important for long-distance migrating fungal pathogens such as Puccinia striiformis f.sp. tritici (PST), capable of rapid spread to new regions and crop varieties. Although a range of recent PST invasions at continental scales are well documented, the worldwide population structure and the center of origin of the pathogen were still unknown. In this study, we used multilocus microsatellite genotyping to infer worldwide population structure of PST and the origin of new invasions based on 409 isolates representative of distribution of the fungus on six continents. Bayesian and multivariate clustering methods partitioned the set of multilocus genotypes into six distinct genetic groups associated with their geographical origin. Analyses of linkage disequilibrium and genotypic diversity indicated a strong regional heterogeneity in levels of recombination, with clear signatures of recombination in the Himalayan (Nepal and Pakistan) and near-Himalayan regions (China) and a predominant clonal population structure in other regions. The higher genotypic diversity, recombinant population structure and high sexual reproduction ability in the Himalayan and neighboring regions suggests this area as the putative center of origin of PST. We used clustering methods and approximate Bayesian computation (ABC) to compare different competing scenarios describing ancestral relationship among ancestral populations and more recently founded populations. Our analyses confirmed the Middle East-East Africa as the most likely source of newly spreading, high-temperature-adapted strains; Europe as the source of South American, North American and Australian populations; and Mediterranean-Central Asian populations as the origin of South African populations. Although most geographic populations are not markedly affected by recent dispersal events, this study emphasizes the influence of human activities on recent long-distance spread of the pathogen. PMID:24465211

  2. A Near-Complete Haplotype-Phased Genome of the Dikaryotic Wheat Stripe Rust Fungus Puccinia striiformis f. sp. tritici Reveals High Interhaplotype Diversity

    Directory of Open Access Journals (Sweden)

    Benjamin Schwessinger

    2018-02-01

    Full Text Available A long-standing biological question is how evolution has shaped the genomic architecture of dikaryotic fungi. To answer this, high-quality genomic resources that enable haplotype comparisons are essential. Short-read genome assemblies for dikaryotic fungi are highly fragmented and lack haplotype-specific information due to the high heterozygosity and repeat content of these genomes. Here, we present a diploid-aware assembly of the wheat stripe rust fungus Puccinia striiformis f. sp. tritici based on long reads using the FALCON-Unzip assembler. Transcriptome sequencing data sets were used to infer high-quality gene models and identify virulence genes involved in plant infection referred to as effectors. This represents the most complete Puccinia striiformis f. sp. tritici genome assembly to date (83 Mb, 156 contigs, N50 of 1.5 Mb and provides phased haplotype information for over 92% of the genome. Comparisons of the phase blocks revealed high interhaplotype diversity of over 6%. More than 25% of all genes lack a clear allelic counterpart. When we investigated genome features that potentially promote the rapid evolution of virulence, we found that candidate effector genes are spatially associated with conserved genes commonly found in basidiomycetes. Yet, candidate effectors that lack an allelic counterpart are more distant from conserved genes than allelic candidate effectors and are less likely to be evolutionarily conserved within the P. striiformis species complex and Pucciniales. In summary, this haplotype-phased assembly enabled us to discover novel genome features of a dikaryotic plant-pathogenic fungus previously hidden in collapsed and fragmented genome assemblies.

  3. Genome-Wide Analysis of Simple Sequence Repeats and Efficient Development of Polymorphic SSR Markers Based on Whole Genome Re-Sequencing of Multiple Isolates of the Wheat Stripe Rust Fungus.

    Directory of Open Access Journals (Sweden)

    Huaiyong Luo

    Full Text Available The biotrophic parasitic fungus Puccinia striiformis f. sp. tritici (Pst causes stripe rust, a devastating disease of wheat, endangering global food security. Because the Pst population is highly dynamic, it is difficult to develop wheat cultivars with durable and highly effective resistance. Simple sequence repeats (SSRs are widely used as molecular markers in genetic studies to determine population structure in many organisms. However, only a small number of SSR markers have been developed for Pst. In this study, a total of 4,792 SSR loci were identified using the whole genome sequences of six isolates from different regions of the world, with a marker density of one SSR per 22.95 kb. The majority of the SSRs were di- and tri-nucleotide repeats. A database containing 1,113 SSR markers were established. Through in silico comparison, the previously reported SSR markers were found mainly in exons, whereas the SSR markers in the database were mostly in intergenic regions. Furthermore, 105 polymorphic SSR markers were confirmed in silico by their identical positions and nucleotide variations with INDELs identified among the six isolates. When 104 in silico polymorphic SSR markers were used to genotype 21 Pst isolates, 84 produced the target bands, and 82 of them were polymorphic and revealed the genetic relationships among the isolates. The results show that whole genome re-sequencing of multiple isolates provides an ideal resource for developing SSR markers, and the newly developed SSR markers are useful for genetic and population studies of the wheat stripe rust fungus.

  4. Genome-Wide Analysis of Simple Sequence Repeats and Efficient Development of Polymorphic SSR Markers Based on Whole Genome Re-Sequencing of Multiple Isolates of the Wheat Stripe Rust Fungus.

    Science.gov (United States)

    Luo, Huaiyong; Wang, Xiaojie; Zhan, Gangming; Wei, Guorong; Zhou, Xinli; Zhao, Jing; Huang, Lili; Kang, Zhensheng

    2015-01-01

    The biotrophic parasitic fungus Puccinia striiformis f. sp. tritici (Pst) causes stripe rust, a devastating disease of wheat, endangering global food security. Because the Pst population is highly dynamic, it is difficult to develop wheat cultivars with durable and highly effective resistance. Simple sequence repeats (SSRs) are widely used as molecular markers in genetic studies to determine population structure in many organisms. However, only a small number of SSR markers have been developed for Pst. In this study, a total of 4,792 SSR loci were identified using the whole genome sequences of six isolates from different regions of the world, with a marker density of one SSR per 22.95 kb. The majority of the SSRs were di- and tri-nucleotide repeats. A database containing 1,113 SSR markers were established. Through in silico comparison, the previously reported SSR markers were found mainly in exons, whereas the SSR markers in the database were mostly in intergenic regions. Furthermore, 105 polymorphic SSR markers were confirmed in silico by their identical positions and nucleotide variations with INDELs identified among the six isolates. When 104 in silico polymorphic SSR markers were used to genotype 21 Pst isolates, 84 produced the target bands, and 82 of them were polymorphic and revealed the genetic relationships among the isolates. The results show that whole genome re-sequencing of multiple isolates provides an ideal resource for developing SSR markers, and the newly developed SSR markers are useful for genetic and population studies of the wheat stripe rust fungus.

  5. Transfer of stripe rust resistance from Aegilops variabilis to bread ...

    African Journals Online (AJOL)

    In terms of area, the bread wheat producing regions of China comprise the largest area in the world that is constantly threatened by stripe rust epidemics. Consequently, it is important to exploit new adultplant resistance genes in breeding. This study reports the transfer of stripe rust resistance from Aegilops variabilis to ...

  6. Rust scoring guide

    NARCIS (Netherlands)

    Anonymous,

    1986-01-01

    This brief guide for identifying rust diseases of smaill grain cereals contains color photos depicting the growth stages of small grain cereal crops and provides instructions for recording rust severity and field response for stripe rust (Puccinia striiformis), stem rust (P. graminis), and leaf rust

  7. Rust scoring guide

    OpenAIRE

    Anonymous

    1986-01-01

    This brief guide for identifying rust diseases of smaill grain cereals contains color photos depicting the growth stages of small grain cereal crops and provides instructions for recording rust severity and field response for stripe rust (Puccinia striiformis), stem rust (P. graminis), and leaf rust (P. recondita).

  8. Rust essentials

    CERN Document Server

    Balbaert, Ivo

    2015-01-01

    This book is intended for software developers interested in systems level and application programming, and are looking for a quick entry into using Rust and understanding the core features of the framework. It is assumed that you have a basic understanding of Java, C#, Ruby, Python or JavaScript.

  9. Winnie Rust

    African Journals Online (AJOL)

    Owner

    Om te trek is om jou kortstondig in 'n liminale staat te bevind. Nóg by jou vertrekpunt, nóg by jou uiteindelike bestemming, sonder die geborgenheid wat hierdie twee vaste plekke kwansuis bied. In 'n hele aantal opsigte is Trek van Winnie Rust 'n beskrywing van verskil- lende liminale state. Dit is egter nie 'n reisverhaal met ...

  10. Seeing Rust

    Science.gov (United States)

    2004-01-01

    The rust color of the Martian landscape is apparent in this low-resolution thumbnail image taken by the panoramic camera on the Mars Exploration Rover Spirit. This image is part of a larger image currently stored onboard the rover in its memory.

  11. Growth performance, carcass traits and meat quality of yellow-feathered broilers fed graded levels of alfalfa meal with or without wheat.

    Science.gov (United States)

    Jiang, Shouqun; Gou, Zhongyong; Li, Long; Lin, Xiajing; Jiang, Zongyong

    2018-03-01

    The effects of 0, 40 and 80 g/kg alfalfa meal on growth performance, carcass traits and meat quality of Chinese yellow-feathered broilers fed diets containing or lacking wheat (0 or 200 g/kg) as part of the energy source, were examined using random design with a 2 × 3 factorial arrangement of treatments. Dressing percentage and semi-eviscerated proportion were lower, and meat color a* (redness) value was higher in birds fed diets containing wheat than diets lacking wheat (P meat was higher in chickens fed corn-based diets than in those fed wheat (P Meat from those supplemented with 40 g/kg alfalfa meal had better taste than the other two levels (P meat color and lower drip loss than those fed the diets without wheat, and adding 40 g/kg alfalfa meal generally improved meat quality and taste. © 2017 Japanese Society of Animal Science.

  12. Genetics and molecular mapping of genes for race-specific all-stage resistance and non-race-specific high-temperature adult-plant resistance to stripe rust in spring wheat cultivar Alpowa.

    Science.gov (United States)

    Lin, F; Chen, X M

    2007-05-01

    Stripe rust, caused by Puccinia striiformis f. sp. tritici, is one of the most widespread and destructive wheat diseases worldwide. Growing resistant cultivars is the preferred control of the disease. The spring wheat cultivar 'Alpowa' has both race-specific, all-stage resistance and non-race-specific, high-temperature adult-plant (HTAP) resistances to stripe rust. To identify genes for the stripe rust resistances, Alpowa was crossed with 'Avocet Susceptible' (AVS). Seedlings of the parents, and F(1), F(2) and F(3) progeny were tested with races PST-1 and PST-21 of P. striiformis f. sp. tritici under controlled greenhouse conditions. Alpowa has a single partially dominant gene, designated as YrAlp, conferring all-stage resistance. Resistance gene analog polymorphism (RGAP) and simple sequence repeat (SSR) techniques were used to identify molecular markers linked to YrAlp. A linkage group of five RGAP markers and two SSR markers was constructed for YrAlp using 136 F(3) lines. Amplification of a set of nulli-tetrasomic Chinese Spring lines with RGAP markers Xwgp47 and Xwgp48 and the two SSR markers indicated that YrAlp is located on the short arm of chromosome 1B. To map quantitative trait loci (QTLs) for the non-race-specific HTAP resistance, the parents and 136 F(3) lines were tested at two sites near Pullman and one site near Mount Vernon, Washington, under naturally infected conditions. A major HTAP QTL was consistently detected across environments and was located on chromosome 7BL. Because of its chromosomal location and the non-race-specific nature of the HTAP resistance, this gene is different from previously described genes for adult-plant resistance, and is therefore designated Yr39. The gene contributed to 64.2% of the total variation of relative area under disease progress curve (AUDPC) data and 59.1% of the total variation of infection type data recorded at the heading-flowering stages. Two RGAP markers, Xwgp36 and Xwgp45 with the highest R (2) values

  13. Development of COS-SNP and HRM markers for cost efficient and reliable haplotype-based detection of Lr14a in durum wheat (Triticum durum Desf.)

    Science.gov (United States)

    Leaf rust (Puccinia triticina Eriks. & Henn.) is a major disease affecting durum wheat production. The Lr14a leaf rust resistant gene present in the durum wheat cv. Creso and its derivative Colosseo is one of the best characterized leaf rust resistance sources presently deployed in durum wheat breed...

  14. A mutagenesis-derived broad-spectrum disease resistance locus in wheat

    Science.gov (United States)

    Wheat leaf rust, stem rust, stripe rust, and powdery mildew caused by the fungal pathogens Puccinia triticina, P. graminis f. sp. tritici, P. striiformis f. sp. tritici, and Blumeria graminis f. sp. tritici, respectively, are destructive diseases of wheat worldwide. The most effective and widely uti...

  15. Registration of 'Linkert' spring wheat with good straw strength and field resistance to the Ug99 family of stem rust races

    Science.gov (United States)

    Straw strength is one of the most important criteria for spring wheat cultivar selection in the north central U.S. ‘Linkert’ (PI 672164) hard red spring wheat was released by the University of Minnesota Agricultural Experiment Station in 2013 and has very good straw strength, high grain protein con...

  16. Rust transformation/rust compatible primers

    Science.gov (United States)

    Emeric, Dario A.; Miller, Christopher E.

    1993-01-01

    Proper surface preparation has been the key to obtain good performance by a surface coating. The major obstacle in preparing a corroded or rusted surface is the complete removal of the contaminants and the corrosion products. Sandblasting has been traditionally used to remove the corrosion products before painting. However, sandblasting can be expensive, may be prohibited by local health regulations and is not applicable in every situation. To get around these obstacles, Industry developed rust converters/rust transformers and rust compatible primers (high solids epoxies). The potential use of these products for military equipment led personnel of the Belvoir Research, Development and Engineering Center (BRDEC) to evaluate the commercially available rust transformers and rust compatible primers. Prior laboratory experience with commercially available rust converters, as well as field studies in Hawaii and Puerto Rico, revealed poor performance, several inherent limitations, and lack of reliability. It was obvious from our studies that the performance of rust converting products was more dependent on the amount and type of rust present, as well as the degree of permeability of the coating, than on the product's ability to form an organometallic complex with the rust. Based on these results, it was decided that the Military should develop their own rust converter formulation and specification. The compound described in the specification is for use on a rusted surface before the application of an organic coating (bituminous compounds, primer or topcoat). These coatings should end the need for sandblasting or the removing of the adherent corrosion products. They also will prepare the surface for the application of the organic coating. Several commercially available rust compatible primers (RCP) were also tested using corroded surfaces. All of the evaluated RCP failed our laboratory tests for primers.

  17. Effects of Fungicide Treatment on Free Amino Acid Concentration and Acrylamide-Forming Potential in Wheat.

    Science.gov (United States)

    Curtis, Tanya Y; Powers, Stephen J; Halford, Nigel G

    2016-12-28

    Acrylamide forms from free asparagine and reducing sugars during frying, baking, roasting, or high-temperature processing, and cereal products are major contributors to dietary acrylamide intake. Free asparagine concentration is the determining factor for acrylamide-forming potential in cereals, and this study investigated the effect of fungicide application on free asparagine accumulation in wheat grain. Free amino acid concentrations were measured in flour from 47 varieties of wheat grown in a field trial in 2011-2012. The wheat had been supplied with nitrogen and sulfur and treated with growth regulators and fungicides. Acrylamide formation was measured after the flour had been heated at 180 °C for 20 min. Flour was also analyzed from 24 (of the 47) varieties grown in adjacent plots that were treated in identical fashion except that no fungicide was applied, resulting in visible infection by Septoria tritici, yellow rust, and brown rust. Free asparagine concentration in the fungicide-treated wheat ranged from 1.596 to 3.987 mmol kg -1 , with a significant (p fungicide treatment, the increases in acrylamide ranging from 2.7 to 370%. Free aspartic acid concentration also increased, whereas free glutamic acid concentration increased in some varieties but decreased in others, and free proline concentration decreased. The study showed disease control by fungicide application to be an important crop management measure for mitigating the problem of acrylamide formation in wheat products.

  18. Population structure of Chinese southwest wheat germplasms resistant to stripe rust and powdery mildew using the DArT-seq technique

    Directory of Open Access Journals (Sweden)

    Tianqing Chen

    2018-04-01

    Full Text Available ABSTRACT: Understanding genetic variability in existing wheat accessions is critical for collection, conservation and use of wheat germplasms. In this study, 138 Chinese southwest wheat accessions were investigated by genotyping using two resistance gene makers (Pm21 and Yr26 and DArT-seq technique. Finally, about 50% cultivars (lines amplified the specific allele for the Yr26 gene (Gwm11 and 40.6% for the Pm21 gene (SCAR1265. By DArT-seq analysis, 30,485 markers (6486 SNPs and 23999 DArTs were obtained with mean polymorphic information content (PIC value 0.33 and 0.28 for DArT and SNP marker, respectively. The mean Dice genetic similarity coefficient (GS was 0.72. Two consistent groups of wheat varieties were identified using principal coordinate analysis (PCoA at the level of both the chromosome 6AS and the whole-genome, respectively. Group I was composed of non-6VS/6AL translocation lines of different origins, while Group II was composed of 6VS/6AL translocation (T6VS/6AL lines, most of which carried the Yr26 and Pm21 genes and originated from Guizhou. Besides, a model-based population structure analysis revealed extensive admixture and further divided these wheat accessions into six subgroups (SG1, SG2, SG3, SG4, SG5 and SG6, based on their origin, pedigree or disease resistance. This information is useful for wheat breeding in southwestern China and association mapping for disease resistance using these wheat germplasms in future.

  19. Use of some chemical inducers to improve wheat resistance to Puccinia striiformis f. Sp. Tritici

    Directory of Open Access Journals (Sweden)

    Al-Maaroof Emad

    2014-01-01

    Full Text Available The effect of DL-β-aminobutyric acid (BABA, benzothiadiazole (BTH, indoleacetic acid (IAA and salicylic acid (SA on induced systemic resistance was investigated in moderately susceptible and susceptible wheat genotypes Tamuz-2 and AL-8/70 against Puccinia striiformis f. sp. tritici. Resistance was characterized by reduced infection of yellow rust disease (Yrd. Changes in peroxidase, phenylalanine ammonia-lyase activities and in total phenolic compound content demonstrated that the resistance to Puccinia striiformis can be induced by BABA, BTH, IAA and SA in these two wheat genotypes. Further studies are needed before a practical method using many analogue compounds, such as potassium phosphate and biotic agent for Yrd resistance in wheat is developed.

  20. TaNAC1 acts as a negative regulator of stripe rust resistance in wheat, enhances susceptibility to Pseudomonas syringae, and promotes lateral root development in transgenic Arabidopsis thaliana

    Directory of Open Access Journals (Sweden)

    Fengtao eWang

    2015-02-01

    Full Text Available Plant-specific NAC transcription factors constitute a large family and play important roles in regulating plant developmental processes and responses to environmental stresses, but only some of them have been investigated for effects on disease reaction in cereal crops. Virus-induced gene silencing (VIGS is an effective strategy for rapid functional analysis of genes in plant tissues. In this study, TaNAC1, encoding a new member of the NAC1 subgroup, was cloned from bread wheat and characterized. It is a transcription factor localized in the cell nucleus, and contains an activation domain in its C-terminal. TaNAC1 was strongly expressed in wheat roots and was involved in responses to infection by the obligate pathogen Puccinia striiformis f. sp. tritici and defense-related hormone treatments such as salicylic acid, methyl jasmonate and ethylene. Knockdown of TaNAC1 with barley stripe mosaic virus-induced gene silencing (BSMV-VIGS enhanced stripe rust resistance. TaNAC1-overexpression in Arabidopsis plants gave enhanced susceptibility, attenuated systemic-acquired resistance to Pseudomonas syringae DC3000, and promoted lateral root development. Jasmonic acid-signaling pathway genes PDF1.2 and ORA59 were constitutively expressed in transgenic plants. TaNAC1 overexpression suppressed the expression levels of resistance-related genes PR1 and PR2 involved in SA signaling and AtWRKY70, which functions as a connection node between the JA- and SA-signaling pathways. Collectively, TaNAC1 is a novel NAC member of the NAC1 subgroup, negatively regulates plant disease resistance, and may modulate plant JA- and SA-signaling defense cascades.

  1. Transformation of the flax rust fungus, Melampsora lini: selection via silencing of an avirulence gene

    OpenAIRE

    Lawrence, Gregory J.; Dodds, Peter N.; Ellis, Jeffrey G.

    2009-01-01

    Rust fungi cause devastating diseases on many important food crops, with a damaging stem rust epidemic currently affecting wheat production in Africa and the Middle East. These parasitic fungi propagate exclusively on plants, precluding the use of many biotechnological tools available for other culturable fungi. In particular the lack of a stable transformation system has been an impediment to the genetic manipulation required for molecular analysis of rust pathogenicity. We have developed an...

  2. The P2 of Wheat yellow mosaic virus rearranges the endoplasmic reticulum and recruits other viral proteins into replication-associated inclusion bodies.

    Science.gov (United States)

    Sun, Liying; Andika, Ida Bagus; Shen, Jiangfeng; Yang, Di; Chen, Jianping

    2014-06-01

    Viruses commonly modify host endomembranes to facilitate biological processes in the viral life cycle. Infection by viruses belonging to the genus Bymovirus (family Potyviridae) has long been known to induce the formation of large membranous inclusion bodies in host cells, but their assembly and biological roles are still unclear. Immunoelectron microscopy of cells infected with the bymovirus Wheat yellow mosaic virus (WYMV) showed that P1, P2 and P3 are the major viral protein constituents of the membranous inclusions, whereas NIa-Pro (nuclear inclusion-a protease) and VPg (viral protein genome-linked) are probable minor components. P1, P2 and P3 associated with the endoplasmic reticulum (ER), but only P2 was able to rearrange ER and form large aggregate structures. Bioinformatic analyses and chemical experiments showed that P2 is an integral membrane protein and depends on the active secretory pathway to form aggregates of ER membranes. In planta and in vitro assays demonstrated that P2 interacts with P1, P3, NIa-Pro or VPg and recruits these proteins into the aggregates. In vivo RNA labelling using WYMV-infected wheat protoplasts showed that the synthesis of viral RNAs occurs in the P2-associated inclusions. Our results suggest that P2 plays a major role in the formation of membranous compartments that house the genomic replication of WYMV. © 2013 BSPP AND JOHN WILEY & SONS LTD.

  3. Introgression of a leaf rust resistance gene from Aegilops caudata to ...

    Indian Academy of Sciences (India)

    tance genes (Lr) and 48 stripe rust resistance genes (Yr) have .... Leaf rust reaction of the parents, wheat – Ae. caudata introgression lines and representative F2 plants developed from the cross: .... segregation ratio, which is otherwise a serious problem with ... Financial assistance was provided by the USDA-ARS under the.

  4. Studies of the genetics of inheritance of stem rust resistance in ...

    African Journals Online (AJOL)

    Five resistant wheat lines (KSL-2, KSL-3, KSL-5, KSL-12 and KSL-19) which were resistant in tests during 2008, 2009 and 2010 were used as parents in crosses with stem rust susceptible line CACUKE to develop genetic populations for determining the inheritance of resistance to stem rust. F3 populations were evaluated ...

  5. Studies of the genetics of inheritance of stem rust resistance in ...

    African Journals Online (AJOL)

    User

    2013-05-22

    May 22, 2013 ... increased production of wheat could help to ensure food and nutritional ... also characterized by genes with additive effects and non hypersensitive .... to create an artificial stem rust epidemic in the field (Hickey et al.,. 2012 ...

  6. Recovery and virulence phenotyping of the historic 'Stubbs Collection' of the yellow rust fungus Puccinia striiformis from wheat

    DEFF Research Database (Denmark)

    Thach, T.; Ali, S.; Justesen, A. F.

    2015-01-01

    A unique collection of spore samples of Puccinia striiformis, often referred to as the ‘Stubbs collection’, has been stored in liquid nitrogen from 18 to 45 years. A subset of samples representing 35 countries and 28 years was investigated to assess recovery rate, race identity and previously...

  7. Construction and characterization of a full-length cDNA library for the wheat stripe rust pathogen (Puccinia striiformis f. sp. tritici

    Directory of Open Access Journals (Sweden)

    Chen Xianming

    2007-06-01

    Full Text Available Abstract Background Puccinia striiformis is a plant pathogenic fungus causing stripe rust, one of the most important diseases on cereal crops and grasses worldwide. However, little is know about its genome and genes involved in the biology and pathogenicity of the pathogen. We initiated the functional genomic research of the fungus by constructing a full-length cDNA and determined functions of the first group of genes by sequence comparison of cDNA clones to genes reported in other fungi. Results A full-length cDNA library, consisting of 42,240 clones with an average cDNA insert of 1.9 kb, was constructed using urediniospores of race PST-78 of P. striiformis f. sp. tritici. From 196 sequenced cDNA clones, we determined functions of 73 clones (37.2%. In addition, 36 clones (18.4% had significant homology to hypothetical proteins, 37 clones (18.9% had some homology to genes in other fungi, and the remaining 50 clones (25.5% did not produce any hits. From the 73 clones with functions, we identified 51 different genes encoding protein products that are involved in amino acid metabolism, cell defense, cell cycle, cell signaling, cell structure and growth, energy cycle, lipid and nucleotide metabolism, protein modification, ribosomal protein complex, sugar metabolism, transcription factor, transport metabolism, and virulence/infection. Conclusion The full-length cDNA library is useful in identifying functional genes of P. striiformis.

  8. Yellow berry, protein and agronomic characteristics in bread wheat under different conditions of nitrogen and irrigation in northwest mexico

    International Nuclear Information System (INIS)

    Felix, F.R.; Wong, B.R.; Chavez, P.I.T.; Alviles, A.; Salazar, S.M.; Martinez, M.E.R

    2014-01-01

    The aim of this research was to determine the effect of the amount of nitrogen fertilizer and number of irrigations on the YB disorder of wheat cultivar Tarachi, as well as its relationship with protein content, and the agronomic characteristics. The experiment was conducted in northwestern Mexico, during the fall-winter season, 2009-2010. Three levels of nitrogen (75, 150 or 250 kg ha-1) and three levels of irrigation (3, 4 or 5 irrigations) were studied. Increasing the nitrogen rate decreased the YB content, the thousand kernel weight and hectoliter weight; and increased the protein content and the number of grains per spike. The number of irrigations did not affect the number of grains per spike. However, increasing the number of irrigations increased the YB content, the thousand kernel weight and hectoliter weight; on the other hand, the protein content decreased. A negative correlation between protein content and percentage of YB was presented. It was concluded that the presence of the disorder YB in bread wheat, Tarachi, is due to a low nitrogen rate in the soil and an increase in number of irrigations. (author)

  9. The genome sequence and effector complement of the flax rust pathogen Melampsora lini

    Directory of Open Access Journals (Sweden)

    Adnane eNemri

    2014-03-01

    Full Text Available Rust fungi cause serious yield reductions on crops, including wheat, barley, soybean, coffee, and represent real threats to global food security. Of these fungi, the flax rust pathogen Melampsora lini has been developed extensively over the past 80 years as a model to understand the molecular mechanisms that underpin pathogenesis. During infection, M. lini secretes virulence effectors to promote disease. The number of these effectors, their function and their degree of conservation across rust fungal species is unknown. To assess this, we sequenced and assembled de novo the genome of M. lini isolate CH5 into 21,130 scaffolds spanning 189 Mbp (scaffold N50 of 31 kbp. Global analysis of the DNA sequence revealed that repetitive elements, primarily retrotransposons, make up at least 45% of the genome. Using ab initio predictions, transcriptome data and homology searches, we identified 16,271 putative protein-coding genes. An analysis pipeline was then implemented to predict the effector complement of M. lini and compare it to that of the poplar rust, wheat stem rust and wheat stripe rust pathogens to identify conserved and species-specific effector candidates. Previous knowledge of four cloned M. lini avirulence effector proteins and two basidiomycete effectors was used to optimise parameters of the effector prediction pipeline. Markov clustering based on sequence similarity was performed to group effector candidates from all four rust pathogens. Clusters containing at least one member from M. lini were further analysed and prioritized based on features including expression in isolated haustoria and infected leaf tissue and conservation across rust species. Herein, we describe 200 of 940 clusters that ranked highest on our priority list, representing 725 flax rust candidate effectors. Our findings on this important model rust species provide insight into how effectors of rust fungi are conserved across species and how they may act to promote

  10. The genome sequence and effector complement of the flax rust pathogen Melampsora lini.

    Science.gov (United States)

    Nemri, Adnane; Saunders, Diane G O; Anderson, Claire; Upadhyaya, Narayana M; Win, Joe; Lawrence, Gregory J; Jones, David A; Kamoun, Sophien; Ellis, Jeffrey G; Dodds, Peter N

    2014-01-01

    Rust fungi cause serious yield reductions on crops, including wheat, barley, soybean, coffee, and represent real threats to global food security. Of these fungi, the flax rust pathogen Melampsora lini has been developed most extensively over the past 80 years as a model to understand the molecular mechanisms that underpin pathogenesis. During infection, M. lini secretes virulence effectors to promote disease. The number of these effectors, their function and their degree of conservation across rust fungal species is unknown. To assess this, we sequenced and assembled de novo the genome of M. lini isolate CH5 into 21,130 scaffolds spanning 189 Mbp (scaffold N50 of 31 kbp). Global analysis of the DNA sequence revealed that repetitive elements, primarily retrotransposons, make up at least 45% of the genome. Using ab initio predictions, transcriptome data and homology searches, we identified 16,271 putative protein-coding genes. An analysis pipeline was then implemented to predict the effector complement of M. lini and compare it to that of the poplar rust, wheat stem rust and wheat stripe rust pathogens to identify conserved and species-specific effector candidates. Previous knowledge of four cloned M. lini avirulence effector proteins and two basidiomycete effectors was used to optimize parameters of the effector prediction pipeline. Markov clustering based on sequence similarity was performed to group effector candidates from all four rust pathogens. Clusters containing at least one member from M. lini were further analyzed and prioritized based on features including expression in isolated haustoria and infected leaf tissue and conservation across rust species. Herein, we describe 200 of 940 clusters that ranked highest on our priority list, representing 725 flax rust candidate effectors. Our findings on this important model rust species provide insight into how effectors of rust fungi are conserved across species and how they may act to promote infection on their

  11. New Rust Disease of Korean Willow (Salix koreensis) Caused by Melampsora yezoensis, Unrecorded Pathogen in Korea.

    Science.gov (United States)

    Yun, Yeo Hong; Ahn, Geum Ran; Yoon, Seong Kwon; Kim, Hoo Hyun; Son, Seung Yeol; Kim, Seong Hwan

    2016-12-01

    During the growing season of 2015, leaf specimens with yellow rust spots were collected from Salix koreensis Andersson, known as Korean willow, in riverine areas in Cheonan, Korea. The fungus on S. koreensis was identified as the rust species, Melampsora yezoensis , based on the morphology of urediniospores observed by light and scanning electron microscopy, and the molecular properties of the internal transcribed spacer rDNA region. Pathogenicity tests confirmed that the urediniospores are the causal agent of the rust symptoms on the leaves and young stems of S. koreensis . Here, we report a new rust disease of S. koreensis caused by the rust fungus, M. yezoensis , a previously unrecorded rust pathogen in Korea.

  12. Marker-assisted pyramiding of Thinopyrum-derived leaf rust ...

    Indian Academy of Sciences (India)

    Annual Meetings · Mid Year Meetings · Discussion Meetings · Public Lectures · Lecture Workshops · Refresher Courses · Symposia · Live Streaming. Home; Journals; Journal of Genetics; Volume 96; Issue 6. Marker-assisted pyramiding of Thinopyrum-derived leaf rust resistance genes Lr19 and Lr24 in bread wheat variety ...

  13. Basin Irrigation Design with Multi-Criteria Analysis Focusing on Water Saving and Economic Returns: Application to Wheat in Hetao, Yellow River Basin

    Directory of Open Access Journals (Sweden)

    Qingfeng Miao

    2018-01-01

    Full Text Available The sustainability of the Hetao Irrigation System, located in the water scarce upper Yellow River basin, is a priority considering the need for water saving, increased water productivity, and higher farmers’ incomes. The upgrading of basin irrigation, the main irrigation method, is essential and includes the adoption of precise land levelling, cut-off management, improved water distribution uniformity, and adequate irrigation scheduling. With this objective, the current study focuses on upgrading wheat basin irrigation through improved design using a decision support system (DSS model, which considers land parcels characteristics, crop irrigation scheduling, soil infiltration, hydraulic simulation, and environmental and economic impacts. Its use includes outlining water saving scenarios and ranking alternative designs through multi-criteria analysis considering the priorities of stakeholders. The best alternatives concern flat level basins with a 100 and 200 m length and inflow rates between 2 and 4 L s−1 m−1. The total irrigation cost of designed projects, including the cost of the autumn irrigation, varies between 2400 and 3300 Yuan ha−1; the major cost component is land levelling, corresponding to 33–46% of total irrigation costs. The economic land productivity is about 18,000 Yuan ha−1. The DSS modelling defined guidelines to be applied by an extension service aimed at implementing better performing irrigation practices, and encouraged a good interaction between farmers and the Water Users Association, thus making easier the implementation of appropriate irrigation management programs.

  14. Mutation breeding for disease resistance in wheat and field beans in Egypt

    International Nuclear Information System (INIS)

    Abdel-Hak, T.M.

    1983-01-01

    Seeds of three varieties of hexaploid wheat and of one variety of tetraploid wheat were treated with gamma rays in order to obtain mutants with improved resistance to stem rust, leaf rust and stripe rust. Mutants with resistance to prevailing races of rusts were selected; however, the race spectrum shifted and made the mutants useless for the time being. Induction of mutations for resistance to chocolate spot and rusts was attempted in Vicia faba. No resistant mutant was found but some mutants with lower levels of infection were. (author)

  15. Nonhost resistance to rust pathogens – a continuation of continua

    Directory of Open Access Journals (Sweden)

    Jan eBettgenhaeuser

    2014-12-01

    Full Text Available The rust fungi (order: Pucciniales are a group of widely distributed fungal plant pathogens, which can infect representatives of all vascular plant groups. Rust diseases significantly impact several crop species and considerable research focuses on understanding the basis of host specificity and nonhost resistance. Like many pathogens, rust fungi vary considerably in the number of hosts they can infect, such as wheat leaf rust (Puccinia triticina, which can only infect species in the genera Triticum and Aegilops, whereas Asian soybean rust (Phakopsora pachyrhizi is known to infect over 95 species from over 42 genera. A greater understanding of the genetic basis determining host range has the potential to identify sources of durable resistance for agronomically important crops. Delimiting the boundary between host and nonhost has been complicated by the quantitative nature of phenotypes in the transition between these two states. Plant-pathogen interactions in this intermediate state are characterized either by (1 the majority of accessions of a species being resistant to the rust or (2 the rust only being able to partially complete key components of its life cycle. This leads to a continuum of disease phenotypes in the interaction with different plant species, observed as a range from compatibility (host to complete immunity within a species (nonhost. In this review we will highlight how the quantitative nature of disease resistance in these intermediate interactions is caused by a continuum of defense barriers, which a pathogen needs to overcome for successfully establishing itself in the host. To illustrate continua as this underlying principle, we will discuss the advances that have been made in studying nonhost resistance towards rust pathogens, particularly cereal rust pathogens.

  16. Nonhost resistance to rust pathogens – a continuation of continua

    Science.gov (United States)

    Bettgenhaeuser, Jan; Gilbert, Brian; Ayliffe, Michael; Moscou, Matthew J.

    2014-01-01

    The rust fungi (order: Pucciniales) are a group of widely distributed fungal plant pathogens, which can infect representatives of all vascular plant groups. Rust diseases significantly impact several crop species and considerable research focuses on understanding the basis of host specificity and nonhost resistance. Like many pathogens, rust fungi vary considerably in the number of hosts they can infect, such as wheat leaf rust (Puccinia triticina), which can only infect species in the genera Triticum and Aegilops, whereas Asian soybean rust (Phakopsora pachyrhizi) is known to infect over 95 species from over 42 genera. A greater understanding of the genetic basis determining host range has the potential to identify sources of durable resistance for agronomically important crops. Delimiting the boundary between host and nonhost has been complicated by the quantitative nature of phenotypes in the transition between these two states. Plant–pathogen interactions in this intermediate state are characterized either by (1) the majority of accessions of a species being resistant to the rust or (2) the rust only being able to partially complete key components of its life cycle. This leads to a continuum of disease phenotypes in the interaction with different plant species, observed as a range from compatibility (host) to complete immunity within a species (nonhost). In this review we will highlight how the quantitative nature of disease resistance in these intermediate interactions is caused by a continuum of defense barriers, which a pathogen needs to overcome for successfully establishing itself in the host. To illustrate continua as this underlying principle, we will discuss the advances that have been made in studying nonhost resistance towards rust pathogens, particularly cereal rust pathogens. PMID:25566270

  17. Nonhost resistance to rust pathogens - a continuation of continua.

    Science.gov (United States)

    Bettgenhaeuser, Jan; Gilbert, Brian; Ayliffe, Michael; Moscou, Matthew J

    2014-01-01

    The rust fungi (order: Pucciniales) are a group of widely distributed fungal plant pathogens, which can infect representatives of all vascular plant groups. Rust diseases significantly impact several crop species and considerable research focuses on understanding the basis of host specificity and nonhost resistance. Like many pathogens, rust fungi vary considerably in the number of hosts they can infect, such as wheat leaf rust (Puccinia triticina), which can only infect species in the genera Triticum and Aegilops, whereas Asian soybean rust (Phakopsora pachyrhizi) is known to infect over 95 species from over 42 genera. A greater understanding of the genetic basis determining host range has the potential to identify sources of durable resistance for agronomically important crops. Delimiting the boundary between host and nonhost has been complicated by the quantitative nature of phenotypes in the transition between these two states. Plant-pathogen interactions in this intermediate state are characterized either by (1) the majority of accessions of a species being resistant to the rust or (2) the rust only being able to partially complete key components of its life cycle. This leads to a continuum of disease phenotypes in the interaction with different plant species, observed as a range from compatibility (host) to complete immunity within a species (nonhost). In this review we will highlight how the quantitative nature of disease resistance in these intermediate interactions is caused by a continuum of defense barriers, which a pathogen needs to overcome for successfully establishing itself in the host. To illustrate continua as this underlying principle, we will discuss the advances that have been made in studying nonhost resistance towards rust pathogens, particularly cereal rust pathogens.

  18. Mutational rectification for resistance to diseases in rice and bread wheat

    International Nuclear Information System (INIS)

    Chakrabarti, S.N.; Kar, G.N.; Sen, B.

    1976-01-01

    The mutation breeding programme with a view to rectify the defects of severe susceptibility to important diseases of a few varieties of rice and bread wheat was undertaken using different mutagenic treatments with radiation (X-rays and gamma rays), chemical mutagens (EMS, NMU, NEU) and combination of radiation and chemical mutagens (gamma rays + EMS). In rice two mutant strains have shown moderate resistance to helminthosporiose, one strain to both helminthosporiose and blast and five strains resistant to bacterial leaf blight under artificial epiphytotic conditions. In bread wheat, out of large M 2 population, derived from different mutagenic treatments, the frequencies of appearance of mutants resistant to rust diseases were observed to be 0.03 percent in H.D. 1944 from 0.2 percent EMS treatment, 0.06 percent in H.D. 1999 from 0.01 percent NEU treatment and 0.07 percent in Kalyan Sona from combined treatment with 20 krad gamma rays and 0.4 percent EMS. The mutants bred true for resistance upto M 6 generations. A few of the mutants, resistant to different diseases in rjce and bread wheat, proved to be very promising in yield. An early (earlier to Kalyan Sona by 25 days) mutant, derived from Kalyan Sona, topped in yield out of 49 varieties tested in 1974l75 in Delhi and Pusa. The Kalyan Sona early tested in 1974-75 in Delhi and Pusa. The Kalyan Sona early mutant is having resistance to yellow and brown rusts. (author)

  19. Characterization of a new synthetic wheat – Aegilops biuncialis ...

    African Journals Online (AJOL)

    The aim of the experiments was to identify the synthetic wheat – Aegilops biuncialis germplasm Line 15-3-2 with 42 chromosomes. Morphologically, the spike of line 15-3-2 is intermediate to those of its wheat and Aegilops parents. Line 15-3-2 displays stable fertility and immunity to wheat powdery mildew and stripe rust.

  20. Yellow Fever

    Science.gov (United States)

    ... Testing Vaccine Information Testing for Vaccine Adverse Events Yellow fever Vaccine Continuing Education Course Yellow Fever Home Prevention Vaccine Vaccine Recommendations Reactions to Yellow Fever Vacine Yellow Fever Vaccine, Pregnancy, & ... Transmission Symptoms, Diagnosis, & Treatment Maps Africa ...

  1. Variation in concentrations of high-molecular-weight glutenin subunits and macropolymers in wheat grains of a recombinant inbred lines population and in two contrasting eco-sites in China

    DEFF Research Database (Denmark)

    Li, Xiangnan; Cai, Jian; Liu, Fulai

    2012-01-01

    to be significantly correlated with the GMP concentration. CONCLUSION: Concentrations of HMW-GS andGMPare largely affected by the eco-sites and the composition ofHMW-GS, whilst not by the presence of 6 VS·6AL chromosome segment translocation. The 6 VS·6AL translocation is suggested as potential donor for breeding...... wheat cultivars for high resistence to powdery mildew and yellow rust with less risk of undesirable effects on grain quality. c 2012 Society of Chemical Industry Supporting information may be found in the online version of this article....

  2. Pushing the boundaries of resistance: insights from Brachypodium-rust interactions

    OpenAIRE

    Figueroa, Melania; Castell-Miller, Claudia V.; Li, Feng; Hulbert, Scot H.; Bradeen, James M.

    2015-01-01

    The implications of global population growth urge transformation of current food and bioenergy production systems to sustainability. Members of the family Poaceae are of particular importance both in food security and for their applications as biofuel substrates. For centuries, rust fungi have threatened the production of valuable crops such as wheat, barley, oat, and other small grains; similarly, biofuel crops can also be susceptible to these pathogens. Emerging rust pathogenic races with i...

  3. Using RNA-sequencing and in silico subtraction to identify resistance gene analog markers for Lr16 in wheat

    Science.gov (United States)

    Leaf rust, caused by Puccinia triticina Eriks., is one of the most widespread diseases of wheat worldwide and breeding for resistance is one of the most effective methods of control. Lr16 is a wheat leaf rust resistance gene that provides resistance at both the seedling and adult stages. Simple s...

  4. IPR 118 - Bread wheat cultivar

    Directory of Open Access Journals (Sweden)

    Carlos Roberto Riede

    2007-01-01

    Full Text Available Wheat cultivar IPR 118 developed by IAPAR has a good yield potential and is widely adapted. It is earlymaturing and moderately tolerant to shattering and soil aluminum, moderately resistant to leaf rust and presents high glutenstrength for bread-making. The overall yield exceeded controls by 13%.

  5. Molecular Cytogenetic Characterization of two Triticum-Secale-Thinopyrum Trigeneric Hybrids Exhibiting Superior Resistance to Fusarium Head Blight, Leaf Rust, and Stem Rust Race Ug99.

    Science.gov (United States)

    Dai, Yi; Duan, Yamei; Liu, Huiping; Chi, Dawn; Cao, Wenguang; Xue, Allen; Gao, Yong; Fedak, George; Chen, Jianmin

    2017-01-01

    Fusarium head blight (FHB), leaf rust, and stem rust are the most destructive fungal diseases in current world wheat production. The diploid wheatgrass, Thinopyrum elongatum (Host) Dewey (2 n = 2 x = 14, EE) is an excellent source of disease resistance genes. Two new Triticum-Secale-Thinopyrum trigeneric hybrids were derived from a cross between a hexaploid triticale (X Triticosecale Wittmack, 2 n = 6 x = 42, AABBRR) and a hexaploid Triticum trititrigia (2 n = 6 x = 42, AABBEE), were produced and analyzed using genomic in situ hybridization and molecular markers. The results indicated that line RE21 contained 14 A-chromosomes, 14 B-chromosomes, three pairs of R-chromosomes (4R, 6R, and 7R), and four pairs of E-chromosomes (1E, 2E, 3E, and 5E) for a total chromosome number of 2 n = 42. Line RE62 contained 14 A-chromosomes, 14 B-chromosomes, six pairs of R-chromosomes, and one pair of translocation chromosomes between chromosome 5R and 5E, for a total chromosome number of 2 n = 42. At the seedling and adult growth stages under greenhouse conditions, line RE21 showed high levels of resistance to FHB, leaf rust, and stem rust race Ug99, and line RE62 was highly resistant to leaf rust and stem rust race Ug99. These two lines (RE21 and RE62) display superior disease resistance characteristics and have the potential to be utilized as valuable germplasm sources for future wheat improvement.

  6. Discovery and characterization of two new stem rust resistance genes in Aegilops sharonensis.

    Science.gov (United States)

    Yu, Guotai; Champouret, Nicolas; Steuernagel, Burkhard; Olivera, Pablo D; Simmons, Jamie; Williams, Cole; Johnson, Ryan; Moscou, Matthew J; Hernández-Pinzón, Inmaculada; Green, Phon; Sela, Hanan; Millet, Eitan; Jones, Jonathan D G; Ward, Eric R; Steffenson, Brian J; Wulff, Brande B H

    2017-06-01

    We identified two novel wheat stem rust resistance genes, Sr-1644-1Sh and Sr-1644-5Sh in Aegilops sharonensis that are effective against widely virulent African races of the wheat stem rust pathogen. Stem rust is one of the most important diseases of wheat in the world. When single stem rust resistance (Sr) genes are deployed in wheat, they are often rapidly overcome by the pathogen. To this end, we initiated a search for novel sources of resistance in diverse wheat relatives and identified the wild goatgrass species Aegilops sharonesis (Sharon goatgrass) as a rich reservoir of resistance to wheat stem rust. The objectives of this study were to discover and map novel Sr genes in Ae. sharonensis and to explore the possibility of identifying new Sr genes by genome-wide association study (GWAS). We developed two biparental populations between resistant and susceptible accessions of Ae. sharonensis and performed QTL and linkage analysis. In an F 6 recombinant inbred line and an F 2 population, two genes were identified that mapped to the short arm of chromosome 1S sh , designated as Sr-1644-1Sh, and the long arm of chromosome 5S sh , designated as Sr-1644-5Sh. The gene Sr-1644-1Sh confers a high level of resistance to race TTKSK (a member of the Ug99 race group), while the gene Sr-1644-5Sh conditions strong resistance to TRTTF, another widely virulent race found in Yemen. Additionally, GWAS was conducted on 125 diverse Ae. sharonensis accessions for stem rust resistance. The gene Sr-1644-1Sh was detected by GWAS, while Sr-1644-5Sh was not detected, indicating that the effectiveness of GWAS might be affected by marker density, population structure, low allele frequency and other factors.

  7. Virulence and molecular characterization of experimental isolates of the stripe rust pathogen (Puccinia striiformis) indicate somatic recombination

    Science.gov (United States)

    Puccinia striiformis causes stripe rust on wheat, barley, and grasses. Natural population studies have indicated that somatic recombination plays a possible role in the pathogen variation. To determine if somatic recombination can occur, susceptible wheat or barley plants were inoculated with mixe...

  8. Genomic analysis of a novel gene conferring resistance to Ug99 stem rust in Triticum turgidum ssp. dicoccum

    Science.gov (United States)

    Wheat production is threatened by the disease stem rust, which is caused by the biotrophic fungal pathogen Puccinia graminis Pers.:Pers. f. sp. tritici (Pgt). Among all known Pgt races, TTKSK (Ug99) and TRTTF are significant threats to North American wheat production due to their virulence against f...

  9. Commandra Blister Rust

    Science.gov (United States)

    David W. Johnson

    1986-01-01

    Commandra blister rust is a disease of hard pines that is caused by a fungus growing in the inner bark. The fungus (Cronartium commandrae Pk.) has a complex life cycle. It infects hard pines but needs an alternate host, an unrelated plant, to spread from one pine to another.

  10. Investigating Gene Function in Cereal Rust Fungi by Plant-Mediated Virus-Induced Gene Silencing.

    Science.gov (United States)

    Panwar, Vinay; Bakkeren, Guus

    2017-01-01

    Cereal rust fungi are destructive pathogens, threatening grain production worldwide. Targeted breeding for resistance utilizing host resistance genes has been effective. However, breakdown of resistance occurs frequently and continued efforts are needed to understand how these fungi overcome resistance and to expand the range of available resistance genes. Whole genome sequencing, transcriptomic and proteomic studies followed by genome-wide computational and comparative analyses have identified large repertoire of genes in rust fungi among which are candidates predicted to code for pathogenicity and virulence factors. Some of these genes represent defence triggering avirulence effectors. However, functions of most genes still needs to be assessed to understand the biology of these obligate biotrophic pathogens. Since genetic manipulations such as gene deletion and genetic transformation are not yet feasible in rust fungi, performing functional gene studies is challenging. Recently, Host-induced gene silencing (HIGS) has emerged as a useful tool to characterize gene function in rust fungi while infecting and growing in host plants. We utilized Barley stripe mosaic virus-mediated virus induced gene silencing (BSMV-VIGS) to induce HIGS of candidate rust fungal genes in the wheat host to determine their role in plant-fungal interactions. Here, we describe the methods for using BSMV-VIGS in wheat for functional genomics study in cereal rust fungi.

  11. An analysis of the risk of introduction of additional strains of the rust puccinia psidii Winter ('Ohi'a Rust) to Hawai'i

    Science.gov (United States)

    Loope, Lloyd; La Rosa, Anne Marie

    2010-01-01

    In April 2005, the rust fungus Puccinia psidii (most widely known as guava rust or eucalyptus rust) was found in Hawai'i. This was the first time this rust had been found outside the Neotropics (broadly-defined, including subtropical Florida, where the rust first established in the 1970s). First detected on a nursery-grown 'ohi'a plant, it became known as ''ohi'a rust'in Hawai'i. The rust spread rapidly and by August 2005 had been found throughout the main Hawaiian Islands. The rust probably reached Hawai'i via the live plant trade or via the foliage trade. In Hawai'i, the rust has infected three native plant species and at least eight non-native species. Effects have been substantial on the endangered endemic plant Eugenia koolauensis and the introduced rose apple, Syzygium jambos. Billions of yellow, asexual urediniospores are produced on rose apple, but a complete life cycle (involving sexual reproduction) has not yet been observed. The rust is autoecious (no alternate host known) on Myrtaceae. The strain introduced into Hawai'i is found sparingly on 'ohi'a (Metrosideros polymorpha), the dominant tree of Hawai'i's forests, with sporadic damage detected to date. The introduction of a rust strain that causes widespread damage to 'ohi'a would be catastrophic for Hawai'i's native biodiversity. Most imports of material potentially contaminated with rust are shipped to Hawai'i from Florida and California (from which P. psidii was reported in late 2005 by Mellano, 2006). Florida is known to have multiple strains. The identity of the strain or strains in California is unclear, but one of them is known to infect myrtle, Myrtus communis, a species commonly imported into Hawai'i. It is important to ecosystem conservation and commercial forestry that additional rust strains or genotypes be prevented from establishing in Hawai'i. The purpose of this analysis of risk is to evaluate the need for an interim rule by the Hawai'i Department of Agriculture to regulate plant

  12. Bread wheat selection against abiotic and biotic stresses in highland Balochistan, Pakistan

    International Nuclear Information System (INIS)

    Begum, I.; Afzal, J.; Afzal, J.

    2008-01-01

    Bread wheat (Triticum aestivum L. ssp. aestivum) lines were screened in multi-location trials in highland Balochistan, Pakistan from 1982 (F2) to 1990 (fixed lines). Objective of the study was to select and evaluate desirable genotypes for winter planting, Of 816 entries, only four successfully passed through the observation nurseries and yield trials. After nine years of testing only genotype ICW81.1471 was selected for wide-scale agronomic testing. Although the yield potential of this genotype was not significantly higher than that of the local check, it had the important advantage of possessing good resistance to yellow rust (Puccinia striiformis West) The results showed that exposure of segregating population to the prevailing environmental stresses of cold and drought was an effective selection procedure for identifying genotypes which are resistant to such stresses. Effective selection can be made for other desirable attributes such as disease and pest resistance, plant height and time to maturity. (author)

  13. Using hierarchical clustering of secreted protein families to classify and rank candidate effectors of rust fungi.

    Directory of Open Access Journals (Sweden)

    Diane G O Saunders

    Full Text Available Rust fungi are obligate biotrophic pathogens that cause considerable damage on crop plants. Puccinia graminis f. sp. tritici, the causal agent of wheat stem rust, and Melampsora larici-populina, the poplar leaf rust pathogen, have strong deleterious impacts on wheat and poplar wood production, respectively. Filamentous pathogens such as rust fungi secrete molecules called disease effectors that act as modulators of host cell physiology and can suppress or trigger host immunity. Current knowledge on effectors from other filamentous plant pathogens can be exploited for the characterisation of effectors in the genome of recently sequenced rust fungi. We designed a comprehensive in silico analysis pipeline to identify the putative effector repertoire from the genome of two plant pathogenic rust fungi. The pipeline is based on the observation that known effector proteins from filamentous pathogens have at least one of the following properties: (i contain a secretion signal, (ii are encoded by in planta induced genes, (iii have similarity to haustorial proteins, (iv are small and cysteine rich, (v contain a known effector motif or a nuclear localization signal, (vi are encoded by genes with long intergenic regions, (vii contain internal repeats, and (viii do not contain PFAM domains, except those associated with pathogenicity. We used Markov clustering and hierarchical clustering to classify protein families of rust pathogens and rank them according to their likelihood of being effectors. Using this approach, we identified eight families of candidate effectors that we consider of high value for functional characterization. This study revealed a diverse set of candidate effectors, including families of haustorial expressed secreted proteins and small cysteine-rich proteins. This comprehensive classification of candidate effectors from these devastating rust pathogens is an initial step towards probing plant germplasm for novel resistance components.

  14. Extraction of High Molecular Weight DNA from Fungal Rust Spores for Long Read Sequencing.

    Science.gov (United States)

    Schwessinger, Benjamin; Rathjen, John P

    2017-01-01

    Wheat rust fungi are complex organisms with a complete life cycle that involves two different host plants and five different spore types. During the asexual infection cycle on wheat, rusts produce massive amounts of dikaryotic urediniospores. These spores are dikaryotic (two nuclei) with each nucleus containing one haploid genome. This dikaryotic state is likely to contribute to their evolutionary success, making them some of the major wheat pathogens globally. Despite this, most published wheat rust genomes are highly fragmented and contain very little haplotype-specific sequence information. Current long-read sequencing technologies hold great promise to provide more contiguous and haplotype-phased genome assemblies. Long reads are able to span repetitive regions and phase structural differences between the haplomes. This increased genome resolution enables the identification of complex loci and the study of genome evolution beyond simple nucleotide polymorphisms. Long-read technologies require pure high molecular weight DNA as an input for sequencing. Here, we describe a DNA extraction protocol for rust spores that yields pure double-stranded DNA molecules with molecular weight of >50 kilo-base pairs (kbp). The isolated DNA is of sufficient purity for PacBio long-read sequencing, but may require additional purification for other sequencing technologies such as Nanopore and 10× Genomics.

  15. Genetics and mapping of a new leaf rust resistance gene in Triticum ...

    Indian Academy of Sciences (India)

    AMIT KUMAR SINGH

    seedling stage revealed that leaf rust resistance in Selection G12 is conditioned by a single ... closely or distantly related species of wheat (McIntosh et al. 2013 ... An effort was also made to determine the chromo- ... Materials and methods.

  16. Genetics and mapping of a new leaf rust resistance gene in Triticum ...

    Indian Academy of Sciences (India)

    A Triticum timopheevii-derived bread wheat line, Selection G12, was screened with 40 pathotypes of leaf rust pathogen, Puccinia triticina at seedling stage and with two most commonly prevalent pathotypes 77-5 and 104-2 at adult plant stage. Selection G12 showed resistance at both seedling and adult plant stages.

  17. Identification of rust resistance genes Lr10 and Sr9a in Pakistani ...

    African Journals Online (AJOL)

    Identification of rust resistance genes Lr10 and Sr9a in Pakistani wheat germplasm using PCR based molecular markers. M Babar, AF Mashhadi, A Mehvish, AN Zahra, R Waheed, A Hasnain, S ur-Rahman, N Hussain, M Ali, I Khaliq, A Aziz ...

  18. Effector proteins of rust fungi.

    Science.gov (United States)

    Petre, Benjamin; Joly, David L; Duplessis, Sébastien

    2014-01-01

    Rust fungi include many species that are devastating crop pathogens. To develop resistant plants, a better understanding of rust virulence factors, or effector proteins, is needed. Thus far, only six rust effector proteins have been described: AvrP123, AvrP4, AvrL567, AvrM, RTP1, and PGTAUSPE-10-1. Although some are well established model proteins used to investigate mechanisms of immune receptor activation (avirulence activities) or entry into plant cells, how they work inside host tissues to promote fungal growth remains unknown. The genome sequences of four rust fungi (two Melampsoraceae and two Pucciniaceae) have been analyzed so far. Genome-wide analyses of these species, as well as transcriptomics performed on a broader range of rust fungi, revealed hundreds of small secreted proteins considered as rust candidate secreted effector proteins (CSEPs). The rust community now needs high-throughput approaches (effectoromics) to accelerate effector discovery/characterization and to better understand how they function in planta. However, this task is challenging due to the non-amenability of rust pathosystems (obligate biotrophs infecting crop plants) to traditional molecular genetic approaches mainly due to difficulties in culturing these species in vitro. The use of heterologous approaches should be promoted in the future.

  19. Crown rust control on oats

    International Nuclear Information System (INIS)

    Frey, K.J.; Browning, J.A.; Simons, M.D.

    1976-01-01

    Attempts have been made to test the relative effectiveness of EMS treatment for inducing tolerance to crown rust among oat strains Clintland-60 of different ploidy levels. One strain of diploid and one of tetraploid oats were treated with EMS. These two strains are as susceptible to damage from crown rust as are cultivars of hexaploid oats. Multiline cultivars of oats have been shown to provide adequate protection from economic loss due to crown-rust disease in Iowa. Since 1968, eleven multiline cultivars of oats have been released from the Iowa station for use in commercial production in the midwestern USA. During the past two winter seasons, the effectiveness of multiline oat cultivars against crown-rust disease has been researched in Texas, USA, which has a ''long rust season'' of about four months, not an Iowa ''short rust season''. The protection against crown rust afforded by the multiline cultivars appeared equally good in Texas and Iowa. The seasonal productions of crown-rust spores relative to completely resistant and susceptible checks were nearly identical in both environments. Fifteen new isolines of oats have been developed for use in multiline varieties, with seed supplies sufficiently large for immediate use

  20. Two barley yellow dwarf luteovirus serotypes associated with ...

    African Journals Online (AJOL)

    Barley yellow dwarf luteovirus (BYDV) serotypes PAV and RPV were identified from irrigated wheat (Triticum aestivum L.) samples from three provinces of Zambia by double antibody sandwich enzyme-linked immunosorbent assay using polyclonal and monoclonal antisera. Nine wheat cultivars were surveyed in 11 wheat ...

  1. Yellow fever

    Science.gov (United States)

    ... to thrive. Blood tests can confirm the diagnosis. Treatment There is no specific treatment for yellow fever. ... SJ, Endy TP, Rothman AL, Barrett AD. Flaviviruses (dengue, yellow fever, Japanese encephalitis, West Nile encephalitis, St. ...

  2. The complete nucleotide sequence of the Barley yellow dwarf virus-RMV genome reveals it to be a new Polerovirus distantly related to other yellow dwarf viruses

    Science.gov (United States)

    The yellow dwarf viruses (YDVs) of the Luteoviridae family represent the most widespread group of cereal viruses worldwide. They include the Barley yellow dwarf viruses (BYDVs) of genus Luteovirus, the Cereal yellow dwarf viruses (CYDVs) and Wheat yellow dwarf virus (WYDV) of genus Polerovirus. All ...

  3. Molecular Cytogenetic Characterization of two Triticum–Secale–Thinopyrum Trigeneric Hybrids Exhibiting Superior Resistance to Fusarium Head Blight, Leaf Rust, and Stem Rust Race Ug99

    Directory of Open Access Journals (Sweden)

    Yi Dai

    2017-05-01

    Full Text Available Fusarium head blight (FHB, leaf rust, and stem rust are the most destructive fungal diseases in current world wheat production. The diploid wheatgrass, Thinopyrum elongatum (Host Dewey (2n = 2x = 14, EE is an excellent source of disease resistance genes. Two new Triticum–Secale–Thinopyrum trigeneric hybrids were derived from a cross between a hexaploid triticale (X Triticosecale Wittmack, 2n = 6x = 42, AABBRR and a hexaploid Triticum trititrigia (2n = 6x = 42, AABBEE, were produced and analyzed using genomic in situ hybridization and molecular markers. The results indicated that line RE21 contained 14 A-chromosomes, 14 B-chromosomes, three pairs of R-chromosomes (4R, 6R, and 7R, and four pairs of E-chromosomes (1E, 2E, 3E, and 5E for a total chromosome number of 2n = 42. Line RE62 contained 14 A-chromosomes, 14 B-chromosomes, six pairs of R-chromosomes, and one pair of translocation chromosomes between chromosome 5R and 5E, for a total chromosome number of 2n = 42. At the seedling and adult growth stages under greenhouse conditions, line RE21 showed high levels of resistance to FHB, leaf rust, and stem rust race Ug99, and line RE62 was highly resistant to leaf rust and stem rust race Ug99. These two lines (RE21 and RE62 display superior disease resistance characteristics and have the potential to be utilized as valuable germplasm sources for future wheat improvement.

  4. Protecting steel from rusting by rust. The mechanism of rust formation and its control

    International Nuclear Information System (INIS)

    Kimura, Masao

    2008-01-01

    Weathering steel, when exposed outdoors for a few years, forms a protective layer resulting in reduction of the corrosion rate. The state of rusts is fundamental for understanding its mechanisms, but the structure and its relationship with the mechanism have not been understood. In this study, a new crystallographic approach was applied to reveal nano-structure of rusts with using of X-ray synchrotron radiation. It has been shown that additional elements alter the corrosion process in its early stage, resulting in formation of protective rusts. (author)

  5. Interactions between crop biomass and development of foliar diseases in winter wheat and the potential to graduate the fungicide dose according to crop biomass

    DEFF Research Database (Denmark)

    Jensen, Peter Kryger; Jørgensen, Lise Nistrup

    2016-01-01

    dose. The study was carried out investigating fungicide dose response controlling foliar diseases in winter wheat at three biomass densities obtained growing the crop at three nitrogen levels and using variable seed rates. Further the field experiments included three fungicide dose rates at each...... biomass level, an untreated control, and 75%, 50% and 33% of the recommended fungicide dose rate and the experiments were replicated for three years. Crop biomass had a significant influence on occurrence of septoria and yellow rust with greater disease severity at increasing crop biomass. In two of three...... years, the interaction of crop biomass and fungicide dose rate had a significant influence on disease severity indicating a biomassdependent dose response. The interaction occurred in the two years with high yield potential in combination with severe disease attack. If the variation in crop density...

  6. Digestion of Starch Granules from Maize, Potato and Wheat by Larvae of the the Yellow Mealworm, Tenebrio molitor and the Mexican Bean Weevil, Zabrotes subfasciatus

    Science.gov (United States)

    Meireles, Elaine A.; Carneiro, Cíntia N. B.; DaMatta, Renato A.; Samuels, Richard I.; Silva, Carlos P.

    2009-01-01

    Scanning electron microscopy images were taken of starch granules from different sources following exposure in vivo and in vitro to gut α-amylases isolated from Tenebrio molitor L. (Coleoptera: Tenebrionidae) and Zabrotes subfasciatus Boheman (Coleoptera: Bruchidae). One α-amylase was isolated from whole larval midguts of T. molitor using non-denaturing SDS-PAGE, while two other α-amylase fractions were isolated from whole larval midguts of Z. subfasciatus using hydrophobic interaction chromatography., Digested starch granules from larvae fed on maize, potato or wheat were isolated from midgut contents. Combinations of starch granules with isolated α-amylases from both species showed similar patterns of granule degradation. In vitro enzymatic degradation of maize starch granules by the three different α-amylase fractions began by creating small holes and crater-like areas on the surface of the granules. Over time, these holes increased in number and area resulting in extensive degradation of the granule structure. Granules from potato did not show formation of pits and craters on their surface, but presented extensive erosion in their interior. For all types of starch, as soon as the interior of the starch granule was reached, the inner layers of amylose and amylopectin were differentially hydrolyzed, resulting in a striated pattern. These data support the hypothesis that the pattern of starch degradation depends more on the granule type than on the α-amylase involved. PMID:19619014

  7. Wheat transcription factor TaWRKY70 is positively involved in high-temperature seedling-plant resistance to Puccinia striiformis f. sp. tritici

    Science.gov (United States)

    Wheat stripe rust, caused by Puccinia striiformis f. sp. tritici (Pst), is a devastating disease of wheat (Triticum aestivum) worldwide. Wheat high-temperature seedling-plant (HTSP) resistance to Pst is non-race-specific and durable. WRKY transcription factors have proven to play important roles in ...

  8. WHEAT PATHOGEN RESISTANCE AND CHITINASE PROFILE

    Directory of Open Access Journals (Sweden)

    Zuzana Gregorová

    2015-02-01

    Full Text Available The powdery mildew and leaf rust caused by Blumeria graminis and Puccinia recondita (respectively are common diseases of wheat throughout the world. These fungal diseases greatly affect crop productivity. Incorporation of effective and durable disease resistance is an important breeding objective for wheat improvement. We have evaluated resistance of four bread wheat (Triticum aestivum and four spelt wheat (Triticum spelta cultivars. Chitinases occurrence as well as their activity was determined in leaf tissues. There was no correlation between resistance rating and activity of chitinase. The pattern of chitinases reveals four isoforms with different size in eight wheat cultivars. A detailed understanding of the molecular events that take place during a plant–pathogen interaction is an essential goal for disease control in the future.

  9. Rusted Designs: The New Apron

    OpenAIRE

    Swindells, Steve; Burcikova, Mila

    2013-01-01

    Articulated as a practice of design-couture, conceptualized as a project that seeks a sense \\ud of social engagement through research, design and making of everyday ‘common couture’, \\ud Rusted puts craft action in a very close relation with daily (political) or practical life. Rusted \\ud designs collage pre-used fabric and clothing (found, bought or gifted) with new cloth, thus \\ud using items of fabric and clothing from different times, countries and with variety of social \\ud histories. Th...

  10. Disease Impact on Wheat Yield Potential and Prospects of Genetic Control

    DEFF Research Database (Denmark)

    Singh, Ravi P.; Singh, Pawan K.; Rutkoski, Jessica

    2016-01-01

    Wheat is grown worldwide in diverse geographical regions, environments, and production systems. Although many diseases and pests are known to reduce grain yield potential and quality, the three rusts and powdery mildew fungi have historically caused major crop losses and continue to remain...... economically important despite the widespread use of host resistance and fungicides. The evolution and fast spread of virulent and more aggressive race lineages of rust fungi have only worsened the situation. Fusarium head blight, leaf spotting diseases, and, more recently, wheat blast (in South America...... for most diseases; their selection through phenotyping reinforced with molecular strategies offers great promise in achieving more durable resistance and enhancing global wheat productivity....

  11. Fungicides efficiency on wheat diseases control in response to the application with different spray nozzles

    Directory of Open Access Journals (Sweden)

    Felipe Rafael Garcés Fiallos

    2011-12-01

    Full Text Available This study aimed to evaluate the efficiency of fungicides to leaf control diseases of wheat, when applied to different models of spray nozzles. The experiment was conducted in a randomized block design with four replicates of factorial (4 x 3+1. Data were subjected to analysis of variance and means compared by Tukey test at 5% probability. The fungicides used were: Opera® (pyraclostrobin+epoxiconazole 0.75 L.ha-1 , Opera® 0.75 L.ha-1 +Folicur® (tebuconazole 0.3 L.ha-1 , Priori Xtra® (azoxystrobin+cyproconazole 0.3 L.ha-1 , Priori Xtra® 0.3 L.ha-1 +Tilt® (propiconazole 0.3 L.ha-1 . These fungicides were applied with three models of spray nozzles jet planes: XR 11 001 (fine drop, AIRMIX 11,001 (average drop and AVI 11,001 (coarse drop. We evaluated the incidence and severity (damage per plant leaf of yellow spot (Drechslera tritici-repentis, spot blotch (Bipolaris sorokiniana, leaf rust (Puccinia triticina and grain yield (kg.ha-1 culture. The results show that the application of fungicides for control of leaf diseases in wheat resulted in increases in grain yield, and yield higher values were observed with the application of Opera®, using the XR 11001.

  12. Fusiform Rust of Southern Pines

    Science.gov (United States)

    W. R. Phelps; F. L. Czabator

    1978-01-01

    Fusiform rust, caused by the fungus Cronartium fusiforme Hedg. & Hunt ex Cumm., is distributed in the Southern United States from Maryland to Florida and west to Texas and southern Arkansas. Infections by the fungus, which develops at or near the point of infection, result in tapered, spindle-shaped swells, called galls, on branches and stems of pines. (see photo...

  13. Characterization of mild steel pre rusted and rust converted surfaces through advanced electrochemical analysis

    International Nuclear Information System (INIS)

    Riaz, F.; Rizvi, Z.H.; Arshad, K.

    2008-01-01

    The present work evaluates the anti corrosive properties of a tannin based rust converter applied on the pre rusted steel coupons as compared with the grit blasted bare metal and pre rusted steel coupons. The mechanism and the corrosion control behaviour of the rust converter are characterized and monitored using EIS technique. The result suggested that when the tannin based rust converter applied on the pre rusted/corroded coupon, the protection properties of the mild steel coupon clearly improved because of the more compact conversion layer being formed on the coupon. It is inferred that the rust converter can be applied on the pre rusted samples as an alternative technique to the surface preparation for protection purpose. (author)

  14. Accelerating resistance breeding in wheat by integrating marker ...

    African Journals Online (AJOL)

    Genetic resistance is the simplest and most cost-effective way to guard against disease in plants. The pyramiding of resistance genes is a useful practice in bringing about durable resistance. This study aimed to develop a series of doubled haploid (DH) wheat lines containing combinations of wild species genes for rust ...

  15. Yr10 gene polymorphism in bread wheat varieties

    African Journals Online (AJOL)

    STORAGESEVER

    2008-07-18

    Jul 18, 2008 ... Yellow rust resistance locus Yr10 located on chromosome 1B in Moro and originated from the Turkish line PI178383 was investigated ... analysis proved that there has been single nucleotide changes especially in the second exon. The most ..... Successes in breeding for and managing durable resistance ...

  16. Barley yellow dwarf virus: Luteoviridae or Tombusviridae?

    Science.gov (United States)

    Miller, W Allen; Liu, Sijun; Beckett, Randy

    2002-07-01

    Summary Barley yellow dwarf virus (BYDV), the most economically important virus of small grains, features highly specialised relationships with its aphid vectors, a plethora of novel translation mechanisms mediated by long-distance RNA interactions, and an ambiguous taxonomic status. The structural and movement proteins of BYDV that confer aphid transmission and phloem-limitation properties resemble those of the Luteoviridae, the family in which BYDV is classified. In contrast, many genes and cis-acting signals involved in replication and gene expression most closely resemble those of the Tombusviridae. BYDV is in genus Luteovirus, family Luteoviridae. BYDV includes at least two serotypes or viruses: BYDV-PAV and BYDV-MAV. The former BYDV-RPV is now Cereal yellow dwarf virus-RPV (CYDV-RPV). CYDV is in genus Polerovirus, family Luteoviridae. Genus Luteovirus shares many features with family Tombusviridae. Physical properties: approximately 25 nm icosahedral (T = 3) virions. One major (22 kDa) and one minor (50-55 kDa) coat protein. 5.6-5.8 kb positive sense RNA genome with no 5'-cap and no poly(A) tail. Most grasses. Most important in oats, barley and wheat. Also infects maize and rice. Yellowing and dwarfing in barley, stunting in wheat; reddening, yellowing and blasting in oats. Some isolates cause leaf notching and curling. Key attractions: Model for the study of circulative transmission of aphid-transmitted viruses. Plethora of unusual translation mechanisms. Evidence of recombination in recent evolutionary history creates taxonomic ambiguity. Economically important virus of wheat, barley and oats, worldwide. Useful websites/meetings: International symposium: 'Barley Yellow Dwarf Disease: Recent Advances and Future Strategies', CIMMYT, El Batan, Mexico, 1-5 September 2002, http://www.cimmyt.cgiar.org/Research/wheat/Conf_BYD_02/invitation.htm http://www.cimmyt.org/Research/wheat/BYDVNEWS/htm/BYDVNEWS.htm Aphid transmission animation: http://www.ppws.vt.edu/~sforza/tmv/bydv_aph.html.

  17. Genome-Wide Association Mapping of Stem Rust Resistance in Hordeum vulgare subsp. spontaneum.

    Science.gov (United States)

    Sallam, Ahmad H; Tyagi, Priyanka; Brown-Guedira, Gina; Muehlbauer, Gary J; Hulse, Alex; Steffenson, Brian J

    2017-10-05

    Stem rust was one of the most devastating diseases of barley in North America. Through the deployment of cultivars with the resistance gene Rpg1 , losses to stem rust have been minimal over the past 70 yr. However, there exist both domestic (QCCJB) and foreign (TTKSK aka isolate Ug99) pathotypes with virulence for this important gene. To identify new sources of stem rust resistance for barley, we evaluated the Wild Barley Diversity Collection (WBDC) (314 ecogeographically diverse accessions of Hordeum vulgare subsp. spontaneum ) for seedling resistance to four pathotypes (TTKSK, QCCJB, MCCFC, and HKHJC) of the wheat stem rust pathogen ( Puccinia graminis f. sp. tritici , Pgt ) and one isolate (92-MN-90) of the rye stem rust pathogen ( P. graminis f. sp. secalis , Pgs ). Based on a coefficient of infection, the frequency of resistance in the WBDC was low ranging from 0.6% with HKHJC to 19.4% with 92-MN-90. None of the accessions was resistant to all five cultures of P. graminis A genome-wide association study (GWAS) was conducted to map stem rust resistance loci using 50,842 single-nucleotide polymorphic markers generated by genotype-by-sequencing and ordered using the new barley reference genome assembly. After proper accounting for genetic relatedness and structure among accessions, 45 quantitative trait loci were identified for resistance to P. graminis across all seven barley chromosomes. Three novel loci associated with resistance to TTKSK, QCCJB, MCCFC, and 92-MN-90 were identified on chromosomes 5H and 7H, and two novel loci associated with resistance to HKHJC were identified on chromosomes 1H and 3H. These novel alleles will enhance the diversity of resistance available for cultivated barley. Copyright © 2017 Sallam et al.

  18. Strategies for improving rust resistance in oats

    International Nuclear Information System (INIS)

    Harder, D.E.; McKenzie, R.I.H.; Martens, J.W.; Brown, P.D.

    1977-01-01

    During the history of breeding oats for rust resistance in Canada the known sources of resistance proved inadequate to counter the virulence potential of both stem rust (Puccinia graminis avenae) and crown rust (P. coronata avenae). A major programme to overcome the rust problem was undertaken at Winnipeg, involving four alternate approaches: (1) A search for new resistance in wild oat species, particularly Avena sterilis, has provided a wealth of good resistance to crown rust, but less to stem rust. Much of the A. sterilis-derived crown rust resistance is now being used world-wide; (2) Efforts at synthesizing new resistance by mutation breeding methods have not been successful. Of about seven million plants examined, only one showed significant new resistance, but this was associated with poor plant type; (3) Resistance with low levels of expression but which appears broadly effective has been observed against both stem and crown rusts. It appears that numbers of these low-level genes exist, and that they can be accumulated to provide increasingly effective resistance. Problems in using this type of resistance in a practical way are discussed; (4) Excellent rust resistance has been found in lower ploidy species such as A. barbata, but it was not previously possible to stabilize this resistance in hexaploid species. By using mutagenic treatments attempts have been made to translocate smaller portions of the A. barbata chromosome carrying the resistance to the hexaploid cultivar Rodney. In conclusion, mutation breeding methods at present appear to have limited application in synthesizing new rust-resistant genotypes in oats. The search for already existing genetic resistance and its synthesis into multi-genic resistant lines appears to be the most effective way at present of resolving the rust problem in oats. (author)

  19. Historic Rust College: Fulfilling a Mission.

    Science.gov (United States)

    Hoffman, Carl

    1989-01-01

    Describes Rust College, a Mississippi college dedicated to educating Blacks from economically and educationally impoverished backgrounds. Discusses the college's financial management, recent fund-raising efforts, building program, and academic programs. Examines the role of the predominantly Black college and Rust's mission to help students…

  20. Screening oat populations for rust resistant mutants

    International Nuclear Information System (INIS)

    McKenzie, R.I.H.; Martens, J.W.; Harder, D.E.; Brown, P.D.

    1976-01-01

    In 1972 a two million M 2 plants were grown at Morden, Manitoba. Thirteen plants which were thought to have possible resistance to race CI0 of oat stem rust were harvested. After extensive seedling and adult plant rust tests the best of the selected plant progenies was crossed and backcrossed to Rodney 0, a stem rust susceptible oat. The resistance in this line M-72-6 was found to be controlled by a single gene. In 1973 another two million M 2 plants were examined for rust resistance at Morden and 38 were harvested. None of the M 2 plants selected in 1973 appeared to have any seedling or adult resistance when examined more thoroughly in the greenhouse and again in the field in 1974. In 1974 one million M 2 plants were examined for resistance and 73 selected. None appeared to have any resistance when tested further. The strain CI3034 which was good adult plant stem rust resistance associated with weak straw and a light green plant colour was treated with gamma radiation and EMS in 1973 and the M 2 grown in the C10 rust nursery at Morden in 1974. A considerable number of dark green plants were present in all treatments but unfortunately all were found to be stem rust susceptible. Thus it would appear to be difficult if not impossible to separate the rust resistance in CI3034 from the undesirable characters, weak straw and light green plant colour. (author)

  1. Characterization and comparative analysis of the genome of Puccinia sorghi Schwein, the causal agent of maize common rust.

    Science.gov (United States)

    Rochi, Lucia; Diéguez, María José; Burguener, Germán; Darino, Martín Alejandro; Pergolesi, María Fernanda; Ingala, Lorena Romina; Cuyeu, Alba Romina; Turjanski, Adrián; Kreff, Enrique Domingo; Sacco, Francisco

    2018-03-01

    Rust fungi are one of the most devastating pathogens of crop plants. The biotrophic fungus Puccinia sorghi Schwein (Ps) is responsible for maize common rust, an endemic disease of maize (Zea mays L.) in Argentina that causes significant yield losses in corn production. In spite of this, the Ps genomic sequence was not available. We used Illumina sequencing to rapidly produce the 99.6Mbdraft genome sequence of Ps race RO10H11247, derived from a single-uredinial isolate from infected maize leaves collected in the Argentine Corn Belt Region during 2010. High quality reads were obtained from 200bppaired-end and 5000bpmate-paired libraries and assembled in 15,722 scaffolds. A pipeline which combined an ab initio program with homology-based models and homology to in planta enriched ESTs from four cereal pathogenic fungus (the three sequenced wheat rusts and Ustilago maydis) was used to identify 21,087 putative coding sequences, of which 1599 might be part of the Ps RO10H11247 secretome. Among the 458 highly conserved protein families from the euKaryotic Orthologous Groups (KOG) that occur in a wide range of eukaryotic organisms, 97.5% have at least one member with high homology in the Ps assembly (TBlastN, E-value⩽e-10) covering more than 50% of the length of the KOG protein. Comparative studies with the three sequenced wheat rust fungus, and microsynteny analysis involving Puccinia striiformis f. sp. tritici (Pst, wheat stripe rust fungus), support the quality achieved. The results presented here show the effectiveness of the Illumina strategy for sequencing dikaryotic genomes of non-model organisms and provides reliable DNA sequence information for genomic studies, including pathogenic mechanisms of this maize fungus and molecular marker design. Copyright © 2016 Elsevier Inc. All rights reserved.

  2. Determination of Radiographic Healing: An Assessment of Consistency Using RUST and Modified RUST in Metadiaphyseal Fractures.

    Science.gov (United States)

    Litrenta, Jody; Tornetta, Paul; Mehta, Samir; Jones, Clifford; OʼToole, Robert V; Bhandari, Mohit; Kottmeier, Stephen; Ostrum, Robert; Egol, Kenneth; Ricci, William; Schemitsch, Emil; Horwitz, Daniel

    2015-11-01

    To determine the reliability of the Radiographic Union Scale for Tibia (RUST) score and a new modified RUST score in quantifying healing and to define a value for radiographic union in a large series of metadiaphyseal fractures treated with plates or intramedullary nails. Healing was evaluated using 2 methods: (1) evaluation of interrater agreement in a series of radiographs and (2) analysis of prospectively gathered data from 2 previous large multicenter trials to define thresholds for radiographic union. Part 1: 12 orthopedic trauma surgeons evaluated a series of radiographs of 27 distal femur fractures treated with either plate or retrograde nail fixation at various stages of healing in random order using a modified RUST score. For each radiographic set, the reviewer indicated if the fracture was radiographically healed. Part 2: The radiographic results of 2 multicenter randomized trials comparing plate versus nail fixation of 81 distal femur and 46 proximal tibia fractures were reviewed. Orthopaedic surgeons at 24 trauma centers scored radiographs at 3, 6, and 12 months postoperatively using the modified RUST score above. Additionally, investigators indicated if the fracture was healed or not healed. The intraclass correlation coefficient (ICC) with 95% confidence intervals was determined for each cortex, the standard and modified RUST score, and the assignment of union for part 1 data. The RUST and modified RUST that defined "union" were determined for both parts of the study. ICC: The modified RUST score demonstrated slightly higher ICCs than the standard RUST (0.68 vs. 0.63). Nails had substantial agreement, whereas plates had moderate agreement using both modified and standard RUST (0.74 and 0.67 vs. 0.59 and 0.53). The average standard and modified RUST at union among all fractures was 8.5 and 11.4. Nails had higher standard and modified RUST scores than plates at union. The ICC for union was 0.53 (nails: 0.58; plates: 0.51), which indicates moderate

  3. Induced resistance to rust disease in lentil

    International Nuclear Information System (INIS)

    Paul, Amitava; Singh, D.P.

    2006-01-01

    Considerable yield reduction in lentil is due to rust caused by Uromyces fabae. So far the sources of resistance to rust are available in the small seeded background. There is a need to develop rust resistant/tolerant bold seeded cultivars. Mutations were induced by gamma rays (10 and 15 kR) for incorporating resistance to rust in K-75(Mallika), a high yielding bold seeded, but rust susceptible cultivar at Pantnagar which is the hot spot for this disease. Dry seeds (300) were irradiated for each treatment. In M 1 generation, individual plants from each treatment were selfed and harvested separately which constituted the M 2 generation. In M 2 individual plant progenies were scored following a rating scale of 1 (Free) to 9(highly susceptible). At 15 kR dose, 8 plants were resistant (score 3.0) and 14 plants were tolerant (score 5.0) to rust, while in control and 10 kR populations, all plants were susceptible or highly susceptible having score of 7 or 9, respectively. The M 2 plants segregated in ratio of 1 resistant: 3 susceptible. The progenies of resistant/tolerant M 2 plants were bred true in the M 3 generation suggesting that the resistance to rust is controlled by one recessive gene. (author)

  4. Structure of titanium-doped goethite rust

    International Nuclear Information System (INIS)

    Nakayama, Takenori; Ishikawa, Tatsuo; Konno, Toyohiko J.

    2005-01-01

    To investigate the influence of titanium addition on the formation and structure of goethite (α-FeOOH) rust which is one of main corrosion products of weathering steel, the artificially synthesized α-FeOOH rusts were prepared by hydrolysis of aqueous solutions of Fe(III) containing Ti(IV) at different atomic ratios (Ti/Fe) in the range 0-0.1. The obtained rusts particles were observed by TEM. Characterization by XRD, N 2 absorption, Moessbauer spectroscopy was also done. TEM observation revealed that the α-FeOOH rust particle size increased with the increase of Ti/Fe, and that Ti-enriched poorly crystalline particles were formed around the rust particles. XRD confirmed that the crystallite size increased with the increase of Ti/Fe, while the XRD peaks decreased in intensity. Specific surface area obtained by N 2 absorption increased with the increase of Ti/Fe. It is deduced from the obtained results that the addition of Ti(IV) increases the crystallite size of α-FeOOH, and produces double domain particles consisting of the particle core and a porous poorly crystalline shell. It is thought that such unique rust structure produced by titanium addition contributes to the protective properties of rust layer of the weathering steel

  5. Pushing the boundaries of resistance: insights from Brachypodium-rust interactions

    Directory of Open Access Journals (Sweden)

    Melania eFigueroa

    2015-07-01

    Full Text Available The implications of global population growth urge transformation of current food and bioenergy production systems to sustainability. Members of the family Poaceae are of particular importance both in food security and for their applications as biofuel substrates. For centuries, rust fungi have threatened the production of valuable crops such as wheat, barley, oat and other small grains; similarly, biofuel crops can also be susceptible to these pathogens. Emerging rust pathogenic races with increased virulence and recurrent rust epidemics around the world point out the vulnerability of monocultures. Basic research in plant immunity, especially in model plants, can make contributions to understanding plant resistance mechanisms and improve disease management strategies. The development of the grass Brachypodium distachyon as a genetically tractable model for monocots, especially temperate cereals and grasses, offers the possibility to overcome the experimental challenges presented by the genetic and genomic complexities of economically valuable crop plants. The numerous resources and tools available in Brachypodium have opened new doors to investigate the underlying molecular and genetic bases of plant-microbe interactions in grasses and evidence demonstrating the applicability and advantages of working with B. distachyon is increasing. Importantly, several interactions between B. distachyon and devastating plant pathogens, such rust fungi, have been examined in the context of non-host resistance. Here, we discuss the use of B. distachyon in these various pathosystems. Exploiting B. distachyon to understand the mechanisms underpinning disease resistance to non-adapted rust fungi may provide effective and durable approaches to fend off these pathogens. The close phylogenetic relationship among Brachypodium spp. and grasses with industrial and agronomic value support harnessing this model plant to improve cropping systems and encourage its use in

  6. Yellow fever

    Directory of Open Access Journals (Sweden)

    Marcelo Nóbrega Litvoc

    Full Text Available Summary The yellow fever (YF virus is a Flavivirus, transmitted by Haemagogus, Sabethes or Aedes aegypti mosquitoes. The disease is endemic in forest areas in Africa and Latin America leading to epizootics in monkeys that constitute the reservoir of the disease. There are two forms of YF: sylvatic, transmitted accidentally when approaching the forests, and urban, which can be perpetuated by Aedes aegypti. In Brazil, the last case of urban YF occurred in 1942. Since then, there has been an expansion of transmission areas from the North and Midwest regions to the South and Southeast. In 2017, the country faced an important outbreak of the disease mainly in the states of Minas Gerais, Espírito Santo and Rio de Janeiro. In 2018, its reach extended from Minas Gerais toward São Paulo. Yellow fever has an incubation period of 3 to 6 days and sudden onset of symptoms with high fever, myalgia, headache, nausea/vomiting and increased transaminases. The disease ranges from asymptomatic to severe forms. The most serious forms occur in around 15% of those infected, with high lethality rates. These forms lead to renal, hepatic and neurological impairment, and bleeding episodes. Treatment of mild and moderate forms is symptomatic, while severe and malignant forms depend on intensive care. Prevention is achieved by administering the vaccine, which is an effective (immunogenicity at 90-98% and safe (0.4 severe events per 100,000 doses measure. In 2018, the first transplants in the world due to YF were performed. There is also an attempt to evaluate the use of active drugs against the virus in order to reduce disease severity.

  7. Induced resistance and gene expression in wheat against leaf rust ...

    African Journals Online (AJOL)

    uvp

    2013-05-15

    associated molecular .... Total RNA was extracted from approximately 0.1 g ground leaf tissue harvested at 0, 24, 48, 72, 96 and ... The RNA was finally dissolved in 100 µl 0.1% (v/v) DMPC treated water. Residual DNA was eliminated ...

  8. Genetic studies in wheat for leaf rust resistance (Puccinia recondita)

    African Journals Online (AJOL)

    user

    2011-04-18

    Apr 18, 2011 ... Generation means and variance analyses were performed for the estimation of ... population falls into clearly defined and easily recogni- zable categories by ... additive x dominance and dominance x dominance gene effects.

  9. Wheat Allergy

    Science.gov (United States)

    ... of reactions. Learn more here. Milk Egg Peanut Tree Nuts Soy Wheat Fish Shellfish Sesame Other Food ... federal law. Download our resource on how to identify wheat on food labels. Avoid foods that contain ...

  10. Breeding bread wheat cultivars for high protein content by transfer of protein genes from Triticum dicoccoides

    International Nuclear Information System (INIS)

    Grama, A.; Gerechter-Amitai, Z.K.; Blum, A.; Rubenthaler, G.L.

    1984-01-01

    Triticum dicoccoides sel. G-25, a selection of wild emmer with a protein content of 20.5% and a kernel weight of 31.5 mg, was used as the donor of protein genes. Since this selection is highly resistant to stripe rust, the object of the crossing programme was to transfer this resistance, together with the high protein potential, to durum and bread wheat cultivars susceptible to the disease. In the tetraploid lines obtained from the T. dicoccoides/T. durum cross, the protein values ranged from 17 to 22%. These lines had resistance to stripe rust from the wild emmer and to stem rust from the durum. After two further crosses between these tetraploid lines and T. aestivum cultivars, several lines were selected which combined good yield, high protein level and resistance to rust diseases. These lines attained protein levels of 14 to 19% in the whole grain and 14 to 17% in the flour, combined with yields of 4.5 to 6.0 t/ha. They had also inherited resistance to stem rust, and in some instances also to leaf rust, from the cultivated wheat parental lines. (author)

  11. Rust Inhibitor And Fungicide For Cooling Systems

    Science.gov (United States)

    Adams, James F.; Greer, D. Clay

    1988-01-01

    Mixture of benzotriazole, benzoic acid, and fungicide prevents growth of rust and fungus. Water-based cooling mixture made from readily available materials prevents formation of metallic oxides and growth of fungi in metallic pipes. Coolant remains clear and does not develop thick sludge tending to collect in low points in cooling systems with many commercial rust inhibitors. Coolant compatible with iron, copper, aluminum, and stainless steel. Cannot be used with cadmium or cadmium-plated pipes.

  12. Molecular Cytogenetic Mapping of Satellite DNA Sequences in Aegilops geniculata and Wheat

    Czech Academy of Sciences Publication Activity Database

    Koo, D.H.; Tiwari, V.K.; Hřibová, Eva; Doležel, Jaroslav; Friebe, B.; Gill, B.S.

    2016-01-01

    Roč. 148, č. 4 (2016), s. 314-321 ISSN 1424-8581 R&D Projects: GA MŠk(CZ) LO1204 Institutional support: RVO:61389030 Keywords : in-situ hybridization * chromosome addition lines * resistance genes lr57 * repetitive dna * triticum-ovatum * powdery mildew * plant genome * bread wheat * leaf rust * identification * Aegilops geniculata * Chromosome identification * Fluorescence in situ hybridization * Satellite DNA * Wheat Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 1.354, year: 2016

  13. Nuclear and allied approaches in improvement of wheat for disease and pest resistance

    Energy Technology Data Exchange (ETDEWEB)

    Sawhney, R N

    1987-09-01

    The paper attempts to review information on the role of physical and chemical mutagens used directly and indirectly in the improvement of wheat for disease and pest resistance. The illustrations relate to transfer of many useful genes for resistance to rusts and pest from alien sources to Triticum aestivum. Popular wheats have been rectified for resistance to rusts mostly without any negative effects on yield potential. The mutation approach has also been successful in the development of multilines. Multiline constituting mutant components conferring simultaneous resistance to more than one rust pathogen has an additional value. The use of induced mutagenesis in breaking linkage between the genes conferring resistance and other genes for undesirable characters has been described. New disease resistant mutant variations with additional changes of positive effect have been obtained for practical utilization with widening the genetic base of future breeding programmes. (author). 56 refs.

  14. Mapping of stripe rust resistance gene in an Aegilops caudata ...

    Indian Academy of Sciences (India)

    PUNEET INDER TOOR

    A pair of stripe rust and leaf rust resistance genes was introgressed from Aegilops caudata, a nonprogenitor diploid species with the CC genome, to cultivated .... infector rows and experimental material with the mixture of uredinospores of Pst ...

  15. A physical map of the 1-gigabase bread wheat chromosome 3B

    Czech Academy of Sciences Publication Activity Database

    Paux, E.; Sourdille, P.; Salse, J.; Saintenac, C.; Choulet, F.; LeRoy, P.; Korol, A.; Michalak, M.; Kianian, S.; Spielmeyer, W.; Lagudah, E.; Somers, D.; Kilian, A.; Alaux, M.; Vautrin, S.; Bergès, H.; Eversole, K.; Appels, R.; Šafář, Jan; Šimková, Hana; Doležel, Jaroslav; Bernard, M.; Feuillet, C.

    2008-01-01

    Roč. 322, č. 5898 (2008), s. 101-104 ISSN 0036-8075 R&D Projects: GA MŠk(CZ) LC06004 Institutional research plan: CEZ:AV0Z5038910 Keywords : RUST RESISTANCE GENE * TRITICUM-AESTIVUM * HEXAPLOID WHEAT Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 28.103, year: 2008

  16. Spatially resolved sulfur K-edge XANES spectroscopy of wheat leaves infected by Puccinia triticina

    International Nuclear Information System (INIS)

    Lichtenberg, H; Prange, A; Hormes, J; Steiner, U; Oerke, E-C

    2009-01-01

    In this study, wheat leaves infected with brown rust, a plant disease of serious economic concern caused by the fungus Puccinia triticina, were investigated using spatially resolved XANES (X-ray Absorption Near Edge Structure) spectroscopy at the sulfur K-absorption edge.

  17. Spatially resolved sulfur K-edge XANES spectroscopy of wheat leaves infected by Puccinia triticina

    Energy Technology Data Exchange (ETDEWEB)

    Lichtenberg, H; Prange, A; Hormes, J [CAMD, Louisiana State University, 6980 Jefferson Hwy, Baton Rouge, LA 70806 (United States); Steiner, U; Oerke, E-C, E-mail: lichtenberg@lsu.ed [INRES-Phytomedicine, University of Bonn, Nussallee 9, 53115 Bonn (Germany)

    2009-11-15

    In this study, wheat leaves infected with brown rust, a plant disease of serious economic concern caused by the fungus Puccinia triticina, were investigated using spatially resolved XANES (X-ray Absorption Near Edge Structure) spectroscopy at the sulfur K-absorption edge.

  18. Frequency of comandra blister rust infection episodes on lodgepole pine

    Science.gov (United States)

    William R. Jacobi; Brian W. Geils; Jane E. Taylor

    2002-01-01

    Comandra blister rust is a damaging canker disease of lodgepole pine in the Central Rocky Mountains. Our knowledge of previous blister rust outbreaks and the effects of weather and climate on rust epidemiology has not been sufficient to explain the frequency and severity of disease outbreaks. Thus, we sought to describe the seasonal and annual frequency and duration of...

  19. Inheritance of resistance to orange rust in sugarcane

    Science.gov (United States)

    Orange rust, caused by Puccinia kuehnii, is an economically important disease in the Florida sugarcane industry. In this study, orange rust reactions of seedlings in progenies originating from 12 crosses between female and male parents with differing resistance to orange rust (three of each categor...

  20. LEAF WHORL INOCULATION METHOD FOR SCREENING SUGARCANE RUST RESISTANCE

    Science.gov (United States)

    Technical Abstract: Sugarcane rust diseases, brown rust caused by Puccinia melanocephala, and orange rust caused by P. kuehnii, are agronomically important diseases in Florida. Cultivar resistance is the best means of controlling these diseases. Natural infection has been the primary means of asses...

  1. The Big Rust and the Red Queen: Long-Term Perspectives on Coffee Rust Research.

    Science.gov (United States)

    McCook, Stuart; Vandermeer, John

    2015-09-01

    Since 2008, there has been a cluster of outbreaks of the coffee rust (Hemileia vastatrix) across the coffee-growing regions of the Americas, which have been collectively described as the Big Rust. These outbreaks have caused significant hardship to coffee producers and laborers. This essay situates the Big Rust in a broader historical context. Over the past two centuries, coffee farmers have had to deal with the "curse of the Red Queen"-the need to constantly innovate in the face of an increasing range of threats, which includes the rust. Over the 20th century, particularly after World War II, national governments and international organizations developed a network of national, regional, and international coffee research institutions. These public institutions played a vital role in helping coffee farmers manage the rust. Coffee farmers have pursued four major strategies for managing the rust: bioprospecting for resistant coffee plants, breeding resistant coffee plants, chemical control, and agroecological control. Currently, the main challenge for researchers is to develop rust control strategies that are both ecologically and economically viable for coffee farmers, in the context of a volatile, deregulated coffee industry and the emergent challenges of climate change.

  2. Wheat and triticale breeding using gamma-ray-induced variability

    International Nuclear Information System (INIS)

    Parodi, P.C.; Nebreda, I.M.

    1984-01-01

    Use of gamma-ray-induced variability in wheat has proved to be a valuable breeding methodology. Results with triticale are still inconclusive. After several years of research a number of wheat mutants have been developed which possess an improved protein content, high yield, good agronomic type and wide adaptability. A change in the stem rust (Puccinia graminis f. sp. tritici) population, however, rendered most of the mutants susceptible to this disease. One mutant, recently named Carolina, which was able to withstand the effects of stem rust without serious yield deterioration, was registered and released to farmers. Efforts are being made to add stem rust resistance to the susceptible mutants by conventional backcrossing. Also, new material and the most outstanding susceptible mutants were gamma irradiated in an effort to induce resistance. Other mutants, not necessarily with an improved protein content, were grouped according to disease reaction and phenotypic similarity to form multilineal composites, some of which have had a superior performance and may be released to farmers in late 1984. A study conducted under four nitrogen levels with six wheat protein mutants showed a weak and inconsistent negative correlation between yield and protein content. The mutants could be differentiated by their increased protein content under most nitrogen rates. (author)

  3. Eat Wheat!

    Science.gov (United States)

    Idaho Wheat Commission, Boise.

    This pamphlet contains puzzles, games, and a recipe designed to teach elementary school pupils about wheat. It includes word games based on the U.S. Department of Agriculture Food Guide Pyramid and on foods made from wheat. The Food Guide Pyramid can be cut out of the pamphlet and assembled as a three-dimensional information source and food guide.…

  4. Identification of Green Rust in Groundwater

    DEFF Research Database (Denmark)

    Christiansen, Bo C.; Balic Zunic, Tonci; Dideriksen, Knud

    2009-01-01

    to air. In this paper, we present a sampling method for capturing green rust so it is not oxidized. We then we used the method to identify the compound in a groundwater sample taken below the water table from fractures in granite. X-ray diffraction patterns were weak, but clearly identical to those......Green rust, a family of Fe(II),Fe(III) layered double hydroxides, is believed to be present in environments close to the Fe(II)/Fe(III) transition zone. Attempts to identify members of this family in nature have proven difficult because the material is oxidized after only a few minutes exposure...

  5. Using the UK reference population Avalon × Cadenza as a platform to compare breeding strategies in elite Western European bread wheat.

    Science.gov (United States)

    Ma, Juan; Wingen, Luzie U; Orford, Simon; Fenwick, Paul; Wang, Jiankang; Griffiths, Simon

    Wheat breeders select for qualitative and quantitative traits, the latter often detected as quantitative trait loci (QTL). It is, however, a long procedure from QTL discovery to the successful introduction of favourable alleles into new elite varieties and finally into farmers' crops. As a proof of principle for this process, QTL for grain yield (GY), yield components, plant height (PH), ear emergence (EM), solid stem (SS) and yellow rust resistance ( Yr ) were identified in segregating UK bread wheat reference population, Avalon × Cadenza. Among the 163 detected QTL were several not reported before: 17 for GY, the major GY QTL on 2D; a major SS QTL on 3B; and Yr6 on 7B. Common QTL were identified on ten chromosomes, most interestingly, grain number (GN) was found to be associated with Rht - D1b ; and GY and GN with a potential new allele of Rht8 . The interaction of other QTL with GY and yield components was discussed in the context of designing a UK breeding target genotype. Desirable characteristics would be: similar PH and EM to Avalon; Rht - D1b and Vrn - A1b alleles; high TGW and GN; long and wide grains; a large root system, resistance to diseases; and maximum GY. The potential of the identified QTL maximising transgressive segregation to produce a high-yielding and resilient genotype was demonstrated by simulation. Moreover, simulating breeding strategies with F 2 enrichment revealed that the F 2 -DH procedure was superior to the RIL and the modified SSD procedure to achieve that genotype. The proposed strategies of parent selection and breeding methodology can be used as guidance for marker-assisted wheat breeding.

  6. 75 FR 44881 - Black Stem Rust; Additions of Rust-Resistant Varieties

    Science.gov (United States)

    2010-07-30

    ...;Prices of new books are listed in the first FEDERAL REGISTER issue of each #0;week. #0; #0; #0; #0;#0... direct final rule notified the public of our intention to amend the black stem rust quarantine and...

  7. 76 FR 3011 - Black Stem Rust; Additions of Rust-Resistant Varieties

    Science.gov (United States)

    2011-01-19

    ...;Prices of new books are listed in the first FEDERAL REGISTER issue of each #0;week. #0; #0; #0; #0;#0... notified the public of our intention to amend the black stem rust quarantine and regulations by adding four...

  8. Rust dissolution and removal by iron-reducing bacteria: A potential rehabilitation of rusted equipment

    International Nuclear Information System (INIS)

    Starosvetsky, J.; Kamari, R.; Farber, Y.; Bilanović, D.; Armon, R.

    2016-01-01

    Highlights: • The present study demonstrated the high reductive capacity of both strains: the collection S. oneidensis and the wild strain Geobacter spp. (soil isolate). • The experimental strains were successful in Fe 3+ reduction for both states: soluble and crystalline (originally prepared from rust). • Rust dissolution can be improved by: addition of AFC at low concentration (0.2 g/l), increasing bacterial initial inoculum and rust reactive surface. • Both experimental IRB strains were able to completely remove previously formed rust on carbon steel coupons. • Additional results (not showed) revealed that culture S. oneidensis and the environmental isolate Geobacter spp., apparently have a different mechanism of iron reduction that requires further study. - Abstract: Iron reducing bacteria (IRB), to be used in rust dissolution and removal, have been isolated and enriched from different environmental sources. Comparative measurements revealed that a soil isolate (Geobacter sulfurreducens sp.) had the highest reductive activity equivalent to Shewanella oneidensis (strain CIP 106686, pure culture). Both reductive microorganisms can use Fe 3+ ions as electron acceptors from soluble as well as from crystalline sources. In nutrient medium containing soluble Fe 3+ , the highest reductive activity obtained for G. sulfurreducens sp. and S. oneidensis was 93 and 97% respectively. Successful removal of rust from carbon steel coupons has been achieved with both experimental bacteria.

  9. Identifying and utilizing resistance to Puccinia striiformis in wheat

    International Nuclear Information System (INIS)

    Line, R.F.; Allan, R.E.; Konzak, C.F.

    1976-01-01

    Resistance to Puccinia striiformis in wheat cultivars, breeding lines, and induced mutants, was studied on plants exposed to natural rust inoculum at field sites and on plants inoculated with specific races and grown under controlled temperatures. Based on infection types and disease intensity at various stages of plant growth throughout the duration of rust establishment, the following resistance-types (R-types) were identified: R-type 1, plants resistant or susceptible at all stages of growth and at both low and high temperatures throughout duration of rust establishment; R-type 2, plants initially resistant in the seedling stage but eventually become susceptible, plants resistant at later stages in the field; R-type 3, variable resistance in the seedling stage, high resistance in later growth stages; R-type 4, plants resistant in the eedling stage, but susceptible in late stages of growth; R-type 5, plants susceptible, but the pathogen is slow to sporulate and consequently, rust increases slower in the field; R-type 6, plants susceptible at low temperatures and resistant at high temperatures at all stages of growth; R-type 7, plants very susceptible at both low and high temperatures in the seedling stage and at low temperatures in later stages; when temperatures are high, plants become more resistant in later stages; R-type 8, plants susceptible at all stages, when rust intensity is low and when not under stress, but become more resistant when intensity is high or under moderate stress in the field. Combinations of the above types were also observed. Techniques for identifying resistance to stripe rust, race specificity of the resistance-types, relationship of plant growth habit and head characteristics to disease intensity, historical significance of various types of resistance in the United States, and methods of using the resistance-types are also discussed. (author)

  10. Zoete rust : Een muzikale soap-detective

    NARCIS (Netherlands)

    Maas, P.

    1989-01-01

    De komedie' Zoete Rust' werd geschreven in opdracht van Theater de Tobbe in Voorburg . Naast de circa 120 professionele voorstellingen die elk seizoen in dit theater plaats vinden, organiseert De Tobbe een maal per laar een eigen theaterproduktie, die wordt gespeeld door het Tobbe-toneel, een ad-hoc

  11. Induced mutations for soybean rust resistance

    International Nuclear Information System (INIS)

    Smutkupt, S.; Wongpiyasatid, A.; Lamseejan, S.

    1983-01-01

    Soybean mutation experiments for inducing rust resistance in the cultivars G 8375, Wakashima mutant number 10, Taichung N, S.J.2, S.J.4, BM 50, BM 98, G 8377, G 8586 and G 8587 have been carried out since 1979. Six pods from each of 4438 control and 43,907 M 1 plants were randomly harvested. M 2 seeds of each cultivar of different doses were bulked (M 2 bulk). In addition, 270 good M 1 plants were selected and threshed singly (M 2 single). M 2 -bulk and M 2 -single seeds were advanced to M 3 . Both, M 3 -bulk and M 3 -single plants, together with the remaining M 2 -bulk seeds were screened for rust resistance in the rainy season of 1980 in Nong Hoi Valley (altitude about 1000 m above sea level) and at Mae Joe Station, both in Chiang Mai Province (latitude 18 deg. 31'-19 deg. N). Based on the IWGSR rating system, soybean plants with slow growth of rust were selected from both locations. The results were as follows: Six plants were selected from a total of 2802 control plants, and 115 from a total of 28,834 M 2 and M 3 plants. Further evaluation of these selections for rust resistance will be carried out in the rainy season of 1981 in Nong Hoi Valley, Chiang Mai. (author)

  12. Wheat: The Whole Story.

    Science.gov (United States)

    Oklahoma State Dept. of Education, Oklahoma City.

    This publication presents information on wheat. Wheat was originally a wild grass and not native to the United States. Wheat was not planted there until 1777 (and then only as a hobby crop). Wheat is grown on more acres than any other grain in this country. Soft wheats are grown east of the Mississippi River, and hard wheats are grown west of the…

  13. Yellow nail syndrome

    Directory of Open Access Journals (Sweden)

    Dixit Ramakant

    2007-01-01

    Full Text Available A case of yellow nail syndrome is described in a forty year old male patient who presented with classical triad of this syndrome i.e. deformed yellow nails, lymph-edema and chronic recurrent pleural effusion. The practical problems in the di-agnosis are also briefly discussed with emphasis on awareness of this rare clinical entity.

  14. Climate change impacts on coffee rust disease

    Science.gov (United States)

    Alfonsi, W. M. V.; Koga-Vicente, A.; Pinto, H. S.; Alfonsi, E. L., Sr.; Coltri, P. P.; Zullo, J., Jr.; Patricio, F. R.; Avila, A. M. H. D.; Gonçalves, R. R. D. V.

    2016-12-01

    Changes in climate conditions and in extreme weather events may affect the food security due to impacts in agricultural production. Despite several researches have been assessed the impacts of extremes in yield crops in climate change scenarios, there is the need to consider the effects in pests and diseases which increase losses in the sector. Coffee Arabica is an important commodity in world and plays a key role in Brazilian agricultural exports. Although the coffee crop has a world highlight, its yield is affected by several factors abiotic or biotic. The weather as well pests and diseases directly influence the development and coffee crop yield. These problems may cause serious damage with significant economic impacts. The coffee rust, caused by the fungus Hemileia vastarix,is among the diseases of greatest impact for the crop. The disease emerged in Brazil in the 70s and is widely spread in all producing regions of coffee in Brazil, and in the world. Regions with favorable weather conditions for the pathogen may exhibit losses ranging from 30% to 50% of the total grain production. The evaluation of extreme weather events of coffee rust disease in futures scenarios was carried out using the climatic data from CMIP5 models, data field of coffee rust disease incidence and, incubation period simulation data for Brazilian municipalities. Two Regional Climate Models were selected, Eta-HadGEM2-ES and Eta-MIROC5, and the Representative Concentration Pathways 8.5 w/m2 was adopted. The outcomes pointed out that in these scenarios the period of incubation tends to decrease affecting the coffee rust disease incidence, which tends to increase. Nevertheless, the changing in average trends tends to benefit the reproduction of the pathogen. Once the temperature threshold for the disease reaches the adverse conditions it may be unfavorable for the incidence.

  15. Waste management regroups units into Rust International

    International Nuclear Information System (INIS)

    Kirschner, E.

    1992-01-01

    Three Waste Management (Oak Brook, IL) subsidiaries have proposed merging units from Chemical Waste Management (CWM) and Wheelabrator Technologies with the Brand Companies (Park Ridge, IL). Waste Management says the new company, to be called Rust International, will become one of the US's largest environmental consulting and infrastructure organizations and will include design and construction services. Waste Management expects the merged company's 1993 revenues to reach $1.8 billion. It will be based in Birmingham, AL and have 12,000 employees

  16. Tolerance of Loblolly Pines to Fusiform Rust

    Science.gov (United States)

    Charles H. Walkinshaw; James P. Barnett

    1995-01-01

    Loblolly pines (Pinus taeda L.) that were 8 to 17 yr old tolerated one to three fusiform rust (Cronartium quercuum [Berk.] Miyabe ex Shirai f. sp. fusiforme) galls in their stems.Families with four or more galls in their stems lost 2.5% or more of the trees by age 17.In living trees with less than four stem galls, diameter growth was comparable to...

  17. Pushing Wheat

    DEFF Research Database (Denmark)

    Sharp, Paul Richard

    This paper documents the evolution of variables central to understanding the creation of an Atlantic Economy in wheat between the US and the UK in the nineteenth century. The cointegrated VAR model is then applied to the period 1838-1913 in order to find long-run relationships between these varia......This paper documents the evolution of variables central to understanding the creation of an Atlantic Economy in wheat between the US and the UK in the nineteenth century. The cointegrated VAR model is then applied to the period 1838-1913 in order to find long-run relationships between...

  18. Essential Oils for Alternative Teak Rust Control

    Directory of Open Access Journals (Sweden)

    Pedro Raymundo Argüelles Osorio

    2018-03-01

    Full Text Available ABSTRACT The objectives of this study were to evaluate the effect of lemon grass, citronella grass, Mexican-tea and noni essential oils on urediniospore germination of Olivea neotectonae , the agent responsible for rust in Teak (Tectona grandis L.f.; to evaluate the phytotoxic effect of these essential oils on teak seedlings; and to evaluate the use of essential oils to control rust in teak plants when preventively and curatively applied. We found that the noni and lemon grass essential oils inhibited 100% of urediniospore germination. On the other hand, the essential oils from noni and lemon grass caused phytotoxicity when applied to seedlings at concentrations of 2000 and 1500 μL L-1, respectively. The major constituents found in lemon grass essential oil were Geranial and Neral, while Octanoic Acid was found in noni oil. Lower values in the area below the rust progress curve were observed with the preventive application of lemon grass and noni essential oils.

  19. Effects of diet on growth and survival of rats fed toxic levels of tartrazine (FD & C Yellow No. 5) and sunset yellow FCF (FD & C Yellow No. 6).

    Science.gov (United States)

    Ershoff, B H

    1977-05-01

    Tests were conducted on the effects of diet on the response of immature male rats to massive doses of tartrazine (FD&C Yellow No.5) and Sunset Yellow FCF (FD&C Yellow No. 6). When incorporated at a 5% level in a stock diet, tartrazine and Sunset Yellow FCF had no grossly observable toxic effects. When fed with a purified diet, however, both tartrazine and Sunset Yellow FCF at 5% level in the diet resulted in a marked retardation in growth, an unthrifty appearance of the fur and death of 50% or more of the rats within an experimental period of 14 days. The toxic effects obtained by feeding the latter diets were counteracted by the concurrent feeding of blond psyllium seed powder, carrot root powder, alfalfa leaf meal and wheat bran. Supplements of the known nutrients had little if any protective effect. Supplements of purified cellulose were without protective effect for the rats fed tartrazine but had a moderate protective effect for those fed Sunset Yellow FCF.

  20. Changing the game: using integrative genomics to probe virulence mechanisms of the stem rust pathogen Puccinia graminis f. sp. tritici

    Directory of Open Access Journals (Sweden)

    Melania eFigueroa

    2016-02-01

    Full Text Available The recent resurgence of wheat stem rust caused by new virulent races of Puccinia graminis f. sp. tritici (Pgt poses a threat to food security. These concerns have catalyzed an extensive global effort towards controlling this disease. Substantial research and breeding programs target the identification and introduction of new stem rust resistance (Sr genes in cultivars for genetic protection against the disease. Such resistance genes typically encode immune receptor proteins that recognize specific components of the pathogen, known as avirulence (Avr proteins. A significant drawback to deploying cultivars with single Sr genes is that they are often overcome by evolution of the pathogen to escape recognition through alterations in Avr genes. Thus, a key element in achieving durable rust control is the deployment of multiple effective Sr genes in combination, either through conventional breeding or transgenic approaches, to minimize the risk of resistance breakdown. In this situation, evolution of pathogen virulence would require simultaneous changes in multiple Avr genes in order to bypass recognition. However, choosing the optimal Sr gene combinations to deploy is a challenge that requires detailed knowledge of the pathogen Avr genes with which they interact and the virulence phenotypes of Pgt existing in nature. Identifying specific Avr genes from Pgt will provide screening tools to enhance pathogen virulence monitoring, assess heterozygosity and propensity for mutation in pathogen populations, and confirm individual Sr gene functions in crop varieties carrying multiple effective resistance genes. Towards this goal, much progress has been made in assembling a high quality reference genome sequence for Pgt, as well as a Pan-genome encompassing variation between multiple field isolates with diverse virulence spectra. In turn this has allowed prediction of Pgt effector gene candidates based on known features of Avr genes in other plant pathogens

  1. Changing the Game: Using Integrative Genomics to Probe Virulence Mechanisms of the Stem Rust Pathogen Puccinia graminis f. sp. tritici.

    Science.gov (United States)

    Figueroa, Melania; Upadhyaya, Narayana M; Sperschneider, Jana; Park, Robert F; Szabo, Les J; Steffenson, Brian; Ellis, Jeff G; Dodds, Peter N

    2016-01-01

    The recent resurgence of wheat stem rust caused by new virulent races of Puccinia graminis f. sp. tritici (Pgt) poses a threat to food security. These concerns have catalyzed an extensive global effort toward controlling this disease. Substantial research and breeding programs target the identification and introduction of new stem rust resistance (Sr) genes in cultivars for genetic protection against the disease. Such resistance genes typically encode immune receptor proteins that recognize specific components of the pathogen, known as avirulence (Avr) proteins. A significant drawback to deploying cultivars with single Sr genes is that they are often overcome by evolution of the pathogen to escape recognition through alterations in Avr genes. Thus, a key element in achieving durable rust control is the deployment of multiple effective Sr genes in combination, either through conventional breeding or transgenic approaches, to minimize the risk of resistance breakdown. In this situation, evolution of pathogen virulence would require changes in multiple Avr genes in order to bypass recognition. However, choosing the optimal Sr gene combinations to deploy is a challenge that requires detailed knowledge of the pathogen Avr genes with which they interact and the virulence phenotypes of Pgt existing in nature. Identifying specific Avr genes from Pgt will provide screening tools to enhance pathogen virulence monitoring, assess heterozygosity and propensity for mutation in pathogen populations, and confirm individual Sr gene functions in crop varieties carrying multiple effective resistance genes. Toward this goal, much progress has been made in assembling a high quality reference genome sequence for Pgt, as well as a Pan-genome encompassing variation between multiple field isolates with diverse virulence spectra. In turn this has allowed prediction of Pgt effector gene candidates based on known features of Avr genes in other plant pathogens, including the related flax rust

  2. Coprecipitation of Arsenate and Arsenite with Green Rust Minerals

    Science.gov (United States)

    The objectives of this experiment were to evaluate the extent and nature of arsenic co-precipitation with green rusts and to examine the influence of arsenic incorporation on the mineralogy of formed solid phases. Stoichiometric green rusts were obtained by coprecipitation of fe...

  3. Incomplete resistance to coffee leaf rust (Hemileia vastatrix)

    NARCIS (Netherlands)

    Eskes, A.B.

    1983-01-01

    Incomplete resistance to coffee leaf rust ( Hemileia vastatrix ) may be of value in obtaining durable resistance, which is of great importance for the perennial coffee crop. Methods were developed to assess incomplete resistance to coffee leaf rust by using illustrated scales

  4. Interacting genes in the pine-fusiform rust forest pathosystem

    Science.gov (United States)

    H.V. Amerson; T.L. Kubisiak; S.A. Garcia; G.C. Kuhlman; C.D. Nelson; S.E. McKeand; T.J. Mullin; B. Li

    2005-01-01

    Fusiform rust (FR) disease of pines, caused by Cronartium quercuum f.sp. fusiforme (Cqf), is the most destructive disease in pine plantations of the southern U. S. The NCSU fusiform rust program, in conjunction with the USDA-Forest Service in Saucier, MS and Athens, GA, has research underway to elucidate some of the genetic interactions in this...

  5. White pines, blister rust, and management in the Southwest

    Science.gov (United States)

    D. A. Conklin; M Fairweather; D Ryerson; B Geils; D Vogler

    2009-01-01

    White pines in New Mexico and Arizona are threatened by the invasive disease white pine blister rust, Cronartium ribicola. Blister rust is already causing severe damage to a large population of southwestern white pine in the Sacramento Mountains of southern New Mexico. Recent detection in northern and western New Mexico suggests that a major expansion of the...

  6. Identification of genomic associations for adult plant resistance in the background of popular South Asian wheat cultivar, PBW343

    Directory of Open Access Journals (Sweden)

    Huihui Li

    2016-11-01

    Full Text Available Rusts, a fungal disease as old as its host plant wheat, an enemy as old as wheat, has caused havoc for over 8,000 years. As the rust pathogens can evolve into new virulent races which quickly defeat to qualitative or vertical the resistance that primarily rely on race specificity over time, adult plant resistance (APR has often been found to be race non-specific and hence is considered have been proven to be a more to be a more reliable and durable strategy to combat this malady. Over decades sets of donor lines have been identified at International Maize and Wheat Improvement Center (CIMMYT representing a wide range of APR sources in wheat. In this study, using nine donors and a common parent ‘PBW343’, a popular Green Revolution variety at CIMMYT, the nested association mapping (NAM population of 1122 lines was constructed to understand the APR genetics underlying these founder lines. Thirty-four QTL were associated with APR to rusts, and 20 of 34 QTL had pleiotropic effects on SR, YR and LR resistance. Three chromosomal regions, associated with known APR genes (Sr58/Yr29/Lr46, Sr2/Yr30/Lr27, and Sr57/Yr18/Lr34, were also identified, 13 previously reported QTL regions were validated. Of the 18 QTL first detected in this study, 7 were pleiotropic QTL, distributing on chromosomes 3A, 3B, 6B, 3D, and 6D. The present investigation revealed the genetic relationship of historical APR donor lines, the novel knowledge on APR, as well as the new analytical methodologies to facilitate the applications of NAM design in crop genetics. Results shown in this study will aid the parental selection for hybridization in wheat breeding, and envision the future rust management breeding for addressing potential threat to wheat production and food security.

  7. Yellow fever: an update.

    Science.gov (United States)

    Monath, T P

    2001-08-01

    Yellow fever, the original viral haemorrhagic fever, was one of the most feared lethal diseases before the development of an effective vaccine. Today the disease still affects as many as 200,000 persons annually in tropical regions of Africa and South America, and poses a significant hazard to unvaccinated travellers to these areas. Yellow fever is transmitted in a cycle involving monkeys and mosquitoes, but human beings can also serve as the viraemic host for mosquito infection. Recent increases in the density and distribution of the urban mosquito vector, Aedes aegypti, as well as the rise in air travel increase the risk of introduction and spread of yellow fever to North and Central America, the Caribbean and Asia. Here I review the clinical features of the disease, its pathogenesis and pathophysiology. The disease mechanisms are poorly understood and have not been the subject of modern clinical research. Since there is no specific treatment, and management of patients with the disease is extremely problematic, the emphasis is on preventative vaccination. As a zoonosis, yellow fever cannot be eradicated, but reduction of the human disease burden is achievable through routine childhood vaccination in endemic countries, with a low cost for the benefits obtained. The biological characteristics, safety, and efficacy of live attenuated, yellow fever 17D vaccine are reviewed. New applications of yellow fever 17D virus as a vector for foreign genes hold considerable promise as a means of developing new vaccines against other viruses, and possibly against cancers.

  8. Manthar-03: a high-yielding cultivar of wheat released for general cultivation in Southern Punjab

    International Nuclear Information System (INIS)

    Hussain, M.; Akhtar, L.H.; Nasim, M.

    2010-01-01

    We report the release of a new wheat variety Manthar-03. 'Manthar-03' is a high yielding and rust resistant variety of bread wheat with erect growth habit. It was released in the year 2003 as a general purpose variety. Manthar-03 is a selection from CIMMYT material (Entry No. 42 of 29 International Bread Wheat Screening Nursery) made at Regional Agricultural Research Institute (RARI), Bahawalpur during 1996-97. This strain has the famous CIMMYT line 'Kauz' in its parentage (KAUZ//ALTAR 84/AOS). Its pedigree is CM11163-6M-20Y-10M- 0M-0B. It is a more adapted and a high yielder. Genetically, this strain differs from existing commercial cultivars of Punjab. Resistance against leaf rust (5MRMS to 10MR), RRI value of 6.7 and 7.6 for leaf rust and ACI values of 3.4 and 0.7 for leaf rust) and high yield potential (6300 kg ha-1 ) are the major attributes of Manthar-03 that make it a superior variety for its target regions. Manthar-03 is tolerant to wheat aphid and Helicoverpa armigera. The thousand seed weight of this variety is 40-44 g. Seed is amber in color and contains 12.97% protein, 8.2% dry gluten and 1.55% ash. It has good chapati making quality. Plant type of Manthar-03 is erect with plant height 94 cm and droopy flag leaves. It is lodging resistant. It completes heading in 98 days and matures in 142 days. Manthar-03 performs better when planted from 15, November to 1, December, keeping 125 kg ha/sup -1/ seed rate and 125-85-50 kg NPK ha/sup -1/ are applied. (author)

  9. Evaluation of spray and point inoculation methods for the phenotyping of Puccinia striiformis on wheat

    DEFF Research Database (Denmark)

    Sørensen, Chris Khadgi; Thach, Tine; Hovmøller, Mogens Støvring

    2016-01-01

    flexible application procedure for spray inoculation and it gave highly reproducible results for virulence phenotyping. Six point inoculation methods were compared to find the most suitable for assessment of pathogen aggressiveness. The use of Novec 7100 and dry dilution with Lycopodium spores gave...... for the assessment of quantitative epidemiological parameters. New protocols for spray and point inoculation of P. striiformis on wheat are presented, along with the prospect for applying these in rust research and resistance breeding activities....

  10. Using transcription of six Puccinia triticina races to identify the effective secretome during infection of wheat.

    Directory of Open Access Journals (Sweden)

    Myron eBruce

    2014-01-01

    Full Text Available Wheat leaf rust, caused by the basidiomycete Puccinia triticina, can cause yield losses of up to 20% in wheat producing regions. During infection, the fungus forms haustoria that secrete proteins into the plant cell and effect changes in plant transcription, metabolism and defense. It is hypothesized that new races emerge as a result of overcoming plant resistance via changes in the secreted effector proteins. To understand gene expression during infection and find genetic differences associated with races, RNA from wheat leaves infected with six different rust races, at six days post inoculation, was sequenced using Illumina. As P. triticina is an obligate biotroph, RNA from both the host and fungi were present and separated by alignment to the P. triticina genome and a wheat EST reference. A total of 222,571 rust contigs were assembled from 165 million reads. An examination of the resulting contigs revealed 532 predicted secreted proteins among the transcripts. Of these, 456 were found in all races. Fifteen genes were found with amino acid changes, corresponding to putative avirulence effectors potentially recognized by 11 different leaf rust resistance (Lr genes. Thirteen of the potential avirulence effectors have no homology to known genes. One gene had significant similarity to cerato-platanin, a known fungal elicitor, and another showed similarity to fungal tyrosinase, an enzyme involved in melanin synthesis. Temporal expression profiles were developed for these genes by qRT-PCR and show that the 15 genes share similar expression patterns from infection initiation to just prior to spore eruption.

  11. Productivity and resource use in cotton and wheat relay intercropping

    NARCIS (Netherlands)

    Zhang, L.

    2007-01-01

    Keywords: Grain yield; lint yield; phenological delay; light use; nitrogen use; resource use efficiency; modelling; profitability; water productivity. From the early 1980s onwards, farmers in the Yellow River cotton producing region intercropped cotton and winter wheat; currently on more than 60% of

  12. Physical water treatment against calcification and rust

    International Nuclear Information System (INIS)

    Burger, A.

    1995-01-01

    In contrast to Germany, where the installation of small-sized, decentralised plants is still prefered, water supply companies in countries such as Denmark have already for some time successfully been using physical water treatment systems. Although the health and environmental benefits of this non-chemical method of water treatment are undisputed and its proper application is also economically beneficial, there is still a widerspread lack of information as to where such plants can be used. Consequently, older methods are often resorted to combatting calcification and rust. (orig.) [de

  13. Development of new iraqi wheat varieties induced by gamma rays

    International Nuclear Information System (INIS)

    Ibrahim, I.F.; Al-Janabi, K.K.; Al-Maaroof, E.M.; Al-Aubaidi, M.O.; Mahmoud, A.H.; Al-Janabi, A.A.

    1991-01-01

    The aim of the present investigation is to study agronomic traits of three wheat mutants induced by gamma rays and compared with their origin 'Saber Beg' during M 8 - M 11 generations. These mutants showed a moderate resistance to leaf rust and lodging, while the origin was susceptible. Also, these mutants surpassed their origin in seed weight of 100 spikes, weight of 1000 kernels and protein yield per unit area. Chemical and physical analyses of mutant flours indicated that it could be used for bread making successfully.2 fig.,4 tab

  14. Genome-wide identification of the SWEET gene family in wheat.

    Science.gov (United States)

    Gao, Yue; Wang, Zi Yuan; Kumar, Vikranth; Xu, Xiao Feng; Yuan, De Peng; Zhu, Xiao Feng; Li, Tian Ya; Jia, Baolei; Xuan, Yuan Hu

    2018-02-05

    The SWEET (sugars will eventually be exported transporter) family is a newly characterized group of sugar transporters. In plants, the key roles of SWEETs in phloem transport, nectar secretion, pollen nutrition, stress tolerance, and plant-pathogen interactions have been identified. SWEET family genes have been characterized in many plant species, but a comprehensive analysis of SWEET members has not yet been performed in wheat. Here, 59 wheat SWEETs (hereafter TaSWEETs) were identified through homology searches. Analyses of phylogenetic relationships, numbers of transmembrane helices (TMHs), gene structures, and motifs showed that TaSWEETs carrying 3-7 TMHs could be classified into four clades with 10 different types of motifs. Examination of the expression patterns of 18 SWEET genes revealed that a few are tissue-specific while most are ubiquitously expressed. In addition, the stem rust-mediated expression patterns of SWEET genes were monitored using a stem rust-susceptible cultivar, 'Little Club' (LC). The resulting data showed that the expression of five out of the 18 SWEETs tested was induced following inoculation. In conclusion, we provide the first comprehensive analysis of the wheat SWEET gene family. Information regarding the phylogenetic relationships, gene structures, and expression profiles of SWEET genes in different tissues and following stem rust disease inoculation will be useful in identifying the potential roles of SWEETs in specific developmental and pathogenic processes. Copyright © 2017 Elsevier B.V. All rights reserved.

  15. Effect of farming system on colour components of wheat noodles

    Directory of Open Access Journals (Sweden)

    Magdalena Lacko-Bartosova

    2016-07-01

    Full Text Available Colour of noodles is definitely a key element of a consumer's buying decisions. It can be influenced by many factors. Conditions, under which is winter wheat grown, can be considered as one of these factors. The aim of this work was to evaluate colour of noodles that were prepared from winter wheat grown in ecological and integrated arable farming systems, after different forecrops with two levels of fertilization (fertilized and unfertilized during the years 2009, 2010 and 2011. Winter wheat noodles were prepared from white flour and wholegrain flour and its colour was evaluated using the spectro-colorimeter. Colour was measured by three coordinates: lightness L*, red/ green value a* and yellow/ blue value b*. Wholegrain noodles had lower L* value, so they were darker than white flour noodles, with higher redness and higher yellowness. Colour of white flour noodles and wholegrain noodles was significantly influenced by crop nutrition (fertilized and unfertilized variants, farming system and meteorological conditions during experimental years. Wholegrain noodles from ecological system were darker, with lower lightness and higher redness compared to noodles from integrated system. White flour noodles from ecological system were also darker compared to noodles from integrated system. Fertilization decreased lightness of white flour noodles, on the contrary, fertilization increased the lightness and decreased the redness of wholegrain noodles. In non-fertilized treatment, ecological wheat noodles were darker, with higher redness and yellowness than noodles prepared from winter wheat grown in integrated arable farming system.

  16. Relationship between sugarcane rust severity and soil properties in louisiana.

    Science.gov (United States)

    Johnson, Richard M; Grisham, Michael P; Richard, Edward P

    2007-06-01

    ABSTRACT The extent of spatial and temporal variability of sugarcane rust (Puccinia melanocephala) infestation was related to variation in soil properties in five commercial fields of sugarcane (interspecific hybrids of Saccharum spp., cv. LCP 85-384) in southern Louisiana. Sugarcane fields were grid-soil sampled at several intensities and rust ratings were collected at each point over 6 to 7 weeks. Soil properties exhibited significant variability (coefficients of variation = 9 to 70.1%) and were spatially correlated in 39 of 40 cases with a range of spatial correlation varying from 39 to 201 m. Rust ratings were spatially correlated in 32 of 33 cases, with a range varying from 29 to 241 m. Rust ratings were correlated with several soil properties, most notably soil phosphorus (r = 0.40 to 0.81) and soil sulfur (r = 0.36 to 0.68). Multiple linear regression analysis resulted in coefficients of determination that ranged from 0.22 to 0.73, and discriminant analysis further improved the overall predictive ability of rust models. Finally, contour plots of soil properties and rust levels clearly suggested a link between these two parameters. These combined data suggest that sugarcane growers that apply fertilizer in excess of plant requirements will increase the incidence and severity of rust infestations in their fields.

  17. Host jumps shaped the diversity of extant rust fungi (Pucciniales).

    Science.gov (United States)

    McTaggart, Alistair R; Shivas, Roger G; van der Nest, Magriet A; Roux, Jolanda; Wingfield, Brenda D; Wingfield, Michael J

    2016-02-01

    The aim of this study was to determine the evolutionary time line for rust fungi and date key speciation events using a molecular clock. Evidence is provided that supports a contemporary view for a recent origin of rust fungi, with a common ancestor on a flowering plant. Divergence times for > 20 genera of rust fungi were studied with Bayesian evolutionary analyses. A relaxed molecular clock was applied to ribosomal and mitochondrial genes, calibrated against estimated divergence times for the hosts of rust fungi, such as Acacia (Fabaceae), angiosperms and the cupressophytes. Results showed that rust fungi shared a most recent common ancestor with a mean age between 113 and 115 million yr. This dates rust fungi to the Cretaceous period, which is much younger than previous estimations. Host jumps, whether taxonomically large or between host genera in the same family, most probably shaped the diversity of rust genera. Likewise, species diversified by host shifts (through coevolution) or via subsequent host jumps. This is in contrast to strict coevolution with their hosts. Puccinia psidii was recovered in Sphaerophragmiaceae, a family distinct from Raveneliaceae, which were regarded as confamilial in previous studies. © 2015 The Authors. New Phytologist © 2015 New Phytologist Trust.

  18. The Development of “Eldo Ngano 1”: The World’s World’s First Ug99 Resistant Mutant Wheat Variety

    International Nuclear Information System (INIS)

    Forster, Brian P.

    2014-01-01

    The wheat black stem rust disease is a virulent race of fungus, Puccinia graminis, which affects wheat plants and is caused by a strain of fungus known as Ug99. Named for its place and year of origin, Ug99 was first discovered on wheat in Uganda in 1999. The spores of this plant disease are airborne and can be easily spread by wind. If not prevented, the disease can destroy 70 to 100 per cent of the yield of wheat crops. Annually on average 8.3 million tonnes of wheat grain is lost to this disease, costing US $1.23 billion per year. Ethiopia, Kenya and Uganda are hot spots for this disease. In 2009, growing international concern regarding the horrific impact of Ug99 on wheat led to the establishment of IAEA project INT/5/150, Responding to the Transboundary Threat of Wheat Black Stem Rust (Ug99). This project has involved over 18 countries and 5 national and international institutions, and examined possible mutation induction treatments to deal with the challenges posed by Ug99. Meetings and workshops to facilitate the project efforts have been held in Kenya and Turkey. Ug99 continues to spread globally and has now reached the Islamic Republic of Iran. There are also reports of suspected disease occurrences in Europe. It is essential that work continues on developing mutant lines for further crop protection that can be utilized worldwide to safeguard the wheat crop from this devastating disease

  19. Incorporation of Monovalent Cations in Sulfate Green Rust

    DEFF Research Database (Denmark)

    Christiansen, B. C.; Dideriksen, K.; Katz, A.

    2014-01-01

    Green rust is a naturally occurring layered mixed-valent ferrous-ferric hydroxide, which can react with a range of redox-active compounds. Sulfate-bearing green rust is generally thought to have interlayers composed of sulfate and water. Here, we provide evidence that the interlayers also contain...... with water showed that Na+ and K+ were structurally fixed in the interlayer, whereas Rb+ and Cs+ could be removed, resulting in a decrease in the basal layer spacing. The incorporation of cations in the interlayer opens up new possibilities for the use of sulfate green rust for exchange reactions with both...

  20. Yellow fever: epidemiology and prevention.

    Science.gov (United States)

    Barnett, Elizabeth D

    2007-03-15

    Yellow fever continues to occur in regions of Africa and South America, despite the availability of effective vaccines. Recently, some cases of severe neurologic disease and multiorgan system disease have been described in individuals who received yellow fever vaccine. These events have focused attention on the need to define criteria for judicious use of yellow fever vaccine and to describe the spectrum of adverse events that may be associated with yellow fever vaccine. Describing host factors that would increase risk of these events and identifying potential treatment modalities for yellow fever and yellow fever vaccine-associated adverse events are subjects of intense investigation.

  1. Characterisation of Triticum vavilovii-derived stripe rust resistance using genetic, cytogenetic and molecular analyses and its marker-assisted selection.

    Science.gov (United States)

    Bariana, H. S.; Brown, G. N.; Ahmed, N. U.; Khatkar, S.; Conner, R. L.; Wellings, C. R.; Haley, S.; Sharp, P. J.; Laroche, A.

    2002-02-01

    Stripe rust resistance was identified in Triticum vavilovii( T. vaviloviiAus22498)-derived Russian wheat aphid (RWA)-resistant germplasm. Inheritance studies indicated monogenic control of resistance. The resistance gene was tentatively designated as Yrvav and was located on chromosome 1B by monosomic analysis. A close association (1.5+/-0.9% recombination) of Yrvav with a T. vavilovii-derived gliadin allele ( Gli-B1vav) placed it in chromosome arm 1BS. Yrvavwas allelic with Yr10. Tests with Yr10 avirulent and virulent pathotypes showed that Yrvav and Yr10 possess identical pathogenic specificity. Yrvav and Yr10 showed close genetic associations with alternate alleles at the Xpsp3000(microsatellite marker), Gli-B1 and Rg1 loci. Based on these observations Yrvav was named as Yr10vav. The close association between Xpsp3000 and Gli-B1 was also confirmed. The Yr10vav-linked Xpsp3000 allele (285 bp) was not present in 65 Australian cultivars, whereas seven Australian wheats lacking Yr10 carried the same Xpsp3000 allele (260 bp) as Yr10carrying wheat cultivar Moro. Xpsp3000 and/or Gli-B1 could be used in marker-assisted selection for pyramiding Yr10vavor Yr10 with other stripe rust resistance genes. Yr10vav was inherited independently of the T. vavilovii-derived RWA resistance.

  2. Development and characterization of a Psathyrostachys huashanica Keng 7Ns chromosome addition line with leaf rust resistance.

    Directory of Open Access Journals (Sweden)

    Wanli Du

    Full Text Available The aim of this study was to characterize a Triticum aestivum-Psathyrostachys huashanica Keng (2n = 2x = 14, NsNs disomic addition line 2-1-6-3. Individual line 2-1-6-3 plants were analyzed using cytological, genomic in situ hybridization (GISH, EST-SSR, and EST-STS techniques. The alien addition line 2-1-6-3 was shown to have two P. huashanica chromosomes, with a meiotic configuration of 2n = 44 = 22 II. We tested 55 EST-SSR and 336 EST-STS primer pairs that mapped onto seven different wheat chromosomes using DNA from parents and the P. huashanica addition line. One EST-SSR and nine EST-STS primer pairs indicated that the additional chromosome of P. huashanica belonged to homoeologous group 7, the diagnostic fragments of five EST-STS markers (BE404955, BE591127, BE637663, BF482781 and CD452422 were cloned, sequenced and compared. The results showed that the amplified polymorphic bands of P. huashanica and disomic addition line 2-1-6-3 shared 100% sequence identity, which was designated as the 7Ns disomic addition line. Disomic addition line 2-1-6-3 was evaluated to test the leaf rust resistance of adult stages in the field. We found that one pair of the 7Ns genome chromosomes carried new leaf rust resistance gene(s. Moreover, wheat line 2-1-6-3 had a superior numbers of florets and grains per spike, which were associated with the introgression of the paired P. huashanica chromosomes. These high levels of disease resistance and stable, excellent agronomic traits suggest that this line could be utilized as a novel donor in wheat breeding programs.

  3. Yellow Fever Vaccine: What You Need to Know

    Science.gov (United States)

    ... How can I prevent yellow fever? Yellow fever vaccine Yellow fever vaccine can prevent yellow fever. Yellow fever vaccine ... such as those containing DEET. 3 Yellow fever vaccine Yellow fever vaccine is a live, weakened virus. It is ...

  4. Improved wheat for baking.

    Science.gov (United States)

    Faridi, H; Finley, J W

    1989-01-01

    To bakers, wheat quality means the performance characteristics of the flour milled from the wheat when used in specific wheat products. The tremendous increase in the number of wheat cultivars grown in the U.S. in recent years, along with the unusual climate, new advances in milling technology, and increased automation of baking lines, have resulted in bakery production problems partly attributed to wheat flour quality. In this review various factors affecting wheat quality are explained. Concerns of bread and cookie/cracker manufacturers on deterioration of the wheat quality are discussed, and, finally, some solutions are proposed.

  5. Rust types from JSON samples - Approximating type providers with procedural macros in Rust

    OpenAIRE

    Vesteraas, Erik Andreas

    2017-01-01

    When programmers access external data in a statically typed programming language, they are often faced with a dilemma between convenient and type-safe access to the data. In the programming language F#, a concept called type providers has been proposed as a solution to this problem by having compiler support for libraries with the capability to generate types at compile time. This thesis presents "json_typegen", a project which aims to show the feasibility of similar solutions in the Rust pro...

  6. Using different classification models in wheat grading utilizing visual features

    Science.gov (United States)

    Basati, Zahra; Rasekh, Mansour; Abbaspour-Gilandeh, Yousef

    2018-04-01

    Wheat is one of the most important strategic crops in Iran and in the world. The major component that distinguishes wheat from other grains is the gluten section. In Iran, sunn pest is one of the most important factors influencing the characteristics of wheat gluten and in removing it from a balanced state. The existence of bug-damaged grains in wheat will reduce the quality and price of the product. In addition, damaged grains reduce the enrichment of wheat and the quality of bread products. In this study, after preprocessing and segmentation of images, 25 features including 9 colour features, 10 morphological features, and 6 textual statistical features were extracted so as to classify healthy and bug-damaged wheat grains of Azar cultivar of four levels of moisture content (9, 11.5, 14 and 16.5% w.b.) and two lighting colours (yellow light, the composition of yellow and white lights). Using feature selection methods in the WEKA software and the CfsSubsetEval evaluator, 11 features were chosen as inputs of artificial neural network, decision tree and discriment analysis classifiers. The results showed that the decision tree with the J.48 algorithm had the highest classification accuracy of 90.20%. This was followed by artificial neural network classifier with the topology of 11-19-2 and discrimient analysis classifier at 87.46 and 81.81%, respectively

  7. Mapping of stripe rust resistance gene in an Aegilops caudata ...

    Indian Academy of Sciences (India)

    Seedling resistance is usually race-specific, but often pro- vides complete ... Genomic DNA was extracted using the CTAB method of. Saghai-Maroof ... Polymerase chain reactions (PCR) were performed in ..... The continuous supply of the rust ...

  8. Marker-assisted pyramiding of Thinopyrum-derived leaf rust ...

    Indian Academy of Sciences (India)

    Mona Singh

    2017-12-08

    Dec 8, 2017 ... Abstract. This study was undertaken to pyramid two effective leaf rust resistance genes (Lr19 and Lr24) derived from ... genes such as Lr9, Lr19, Lr26 and Lr28 became ineffective ..... Disease management recommendations.

  9. Structural and molecular basis of starch viscosity in hexaploid wheat.

    Science.gov (United States)

    Ral, J-P; Cavanagh, C R; Larroque, O; Regina, A; Morell, M K

    2008-06-11

    Wheat starch is considered to have a low paste viscosity relative to other starches. Consequently, wheat starch is not preferred for many applications as compared to other high paste viscosity starches. Increasing the viscosity of wheat starch is expected to increase the functionality of a range of wheat flour-based products in which the texture is an important aspect of consumer acceptance (e.g., pasta, and instant and yellow alkaline noodles). To understand the molecular basis of starch viscosity, we have undertaken a comprehensive structural and rheological analysis of starches from a genetically diverse set of wheat genotypes, which revealed significant variation in starch traits including starch granule protein content, starch-associated lipid content and composition, phosphate content, and the structures of the amylose and amylopectin fractions. Statistical analysis highlighted the association between amylopectin chains of 18-25 glucose residues and starch pasting properties. Principal component analysis also identified an association between monoesterified phosphate and starch pasting properties in wheat despite the low starch-phosphate level in wheat as compared to tuber starches. We also found a strong negative correlation between the phosphate ester content and the starch content in flour. Previously observed associations between internal starch granule fatty acids and the swelling peak time and pasting temperature have been confirmed. This study has highlighted a range of parameters associated with increased starch viscosity that could be used in prebreeding/breeding programs to modify wheat starch pasting properties.

  10. Two distinct classes of QTL determine rust resistance in sorghum.

    Science.gov (United States)

    Wang, Xuemin; Mace, Emma; Hunt, Colleen; Cruickshank, Alan; Henzell, Robert; Parkes, Heidi; Jordan, David

    2014-12-31

    Agriculture is facing enormous challenges to feed a growing population in the face of rapidly evolving pests and pathogens. The rusts, in particular, are a major pathogen of cereal crops with the potential to cause large reductions in yield. Improving stable disease resistance is an on-going major and challenging focus for many plant breeding programs, due to the rapidly evolving nature of the pathogen. Sorghum is a major summer cereal crop that is also a host for a rust pathogen Puccinia purpurea, which occurs in almost all sorghum growing areas of the world, causing direct and indirect yield losses in sorghum worldwide, however knowledge about its genetic control is still limited. In order to further investigate this issue, QTL and association mapping methods were implemented to study rust resistance in three bi-parental populations and an association mapping set of elite breeding lines in different environments. In total, 64 significant or highly significant QTL and 21 suggestive rust resistance QTL were identified representing 55 unique genomic regions. Comparisons across populations within the current study and with rust QTL identified previously in both sorghum and maize revealed a high degree of correspondence in QTL location. Negative phenotypic correlations were observed between rust, maturity and height, indicating a trend for both early maturing and shorter genotypes to be more susceptible to rust. The significant amount of QTL co-location across traits, in addition to the consistency in the direction of QTL allele effects, has provided evidence to support pleiotropic QTL action across rust, height, maturity and stay-green, supporting the role of carbon stress in susceptibility to rust. Classical rust resistance QTL regions that did not co-locate with height, maturity or stay-green QTL were found to be significantly enriched for the defence-related NBS-encoding gene family, in contrast to the lack of defence-related gene enrichment in multi-trait effect

  11. Yellow substance (gelbstoff)

    International Nuclear Information System (INIS)

    Medina, A.

    1988-04-01

    The different values of the mean slope (S) of the absorption coefficient a(λ) of gelbstoff (yellow substance) for each region under the same hydrological conditions and the correlation between the quantity of absorption (CA) of gelbstoff and sea water parameter is discussed. 12 refs, 6 figs, 3 tabs

  12. Introducing the Yellow Laser

    Science.gov (United States)

    Lincoln, James

    2018-01-01

    The author has acquired a yellow laser with the specific wavelength of 589 nm. Because this is the first time such a laser has been discussed in this journal, I feel it is appropriate to provide a discussion of its function and capabilities. Normal laser safety should be employed, such as not pointing it into eyes or at people, and using eye…

  13. Leaf rust of cultivated barley: pathology and control.

    Science.gov (United States)

    Park, Robert F; Golegaonkar, Prashant G; Derevnina, Lida; Sandhu, Karanjeet S; Karaoglu, Haydar; Elmansour, Huda M; Dracatos, Peter M; Singh, Davinder

    2015-01-01

    Leaf rust of barley is caused by the macrocyclic, heteroecious rust pathogen Puccinia hordei, with aecia reported from selected species of the genera Ornithogalum, Leopoldia, and Dipcadi, and uredinia and telia occurring on Hordeum vulgare, H. vulgare ssp. spontaneum, Hordeum bulbosum, and Hordeum murinum, on which distinct parasitic specialization occurs. Although Puccinia hordei is sporadic in its occurrence, it is probably the most common and widely distributed rust disease of barley. Leaf rust has increased in importance in recent decades in temperate barley-growing regions, presumably because of more intensive agricultural practices. Although total crop loss does not occur, under epidemic conditions yield reductions of up to 62% have been reported in susceptible varieties. Leaf rust is primarily controlled by the use of resistant cultivars, and, to date, 21 seedling resistance genes and two adult plant resistance (APR) genes have been identified. Virulence has been detected for most seedling resistance genes but is unknown for the APR genes Rph20 and Rph23. Other potentially new sources of APR have been reported, and additivity has been described for some of these resistances. Approaches to achieving durable resistance to leaf rust in barley are discussed.

  14. Moessbauer Characterization of Rust Obtained in an Accelerated Corrosion Test

    International Nuclear Information System (INIS)

    Garcia, K. E.; Morales, A. L.; Arroyave, C. E.; Barrero, C. A.; Cook, D. C.

    2003-01-01

    We have performed drying-humectation cyclical processes (CEBELCOR) on eight A36 low carbon steel coupons in NaCl solutions containing 1x10 -2 M and 1x10 -1 M concentrations. The main purpose of these experiments is to contribute to the understanding of the conditions for akaganeite formation. Additionally, and with the idea to perform a complete characterization of the rust, this work also considers the formation of other iron oxide phases. The corrosion products were characterized by Moessbauer spectroscopy and X-ray diffraction techniques. Gravimetric analysis demonstrates that the coupons presented high corrosion rates. Magnetite/maghemite was common in the rust stuck to the steel surface, whereas akaganeite was present only in traces. In the rust collected from the solutions, i.e., the rust that goes away from the metal surface easily, a magnetite/maghemite was not present and akaganeite showed up in larger quantities. These results support the idea that high concentrations of Cl - ions are required for the akaganeite formation. We concluded that akaganeite is not easily bonded to the rust layer; this may lead to the formation of a less protective rust layer and to higher corrosion rates.

  15. Control of wheat diseases using phosphites and acibenzolar-s-methyl alone or associated with piraclostrobina + epoxiconazoleControle de doenças do trigo com fosfitos e acibenzolar-s-metil isoladamente ou associados a piraclostrobina + epoxiconazole

    Directory of Open Access Journals (Sweden)

    Olavio Correa Silva

    2011-07-01

    Full Text Available The objective of this study was to evaluate the effect of different sources of phosphite to control leaf rust, powdery mildew, yellow and brown spot in the wheat crop in Palmeira, Paraná state, Brazil. The treatments were: four commercial sources of phosphites (A, B, C and D, applied at 1500 mL ha-1, (applied in rate of active product acibenzolar-S-methyl (ASM at 500 mL ha-1 (isolad or association, pyraclostrobin + epoxiconazole (fungicide at 400 mL ha-1 and phosphite A with pyraclostrobin + epoxiconazole (at 300 mL ha-1, phosphite A with pyraclostrobin + epoxiconazole (400 mL ha-1, acibenzolar-S-methyl with pyraclostrobin + epoxiconazole (400 mL ha-1 and control (water, . The experimental design adopted was complete randomized blocks with four replications. Regarding diseases, evaluations were done on the determination of severity and the calculation of the area below the curve of the disease progress in the flag leaf and entire plant. Leaf area index, thousand seeds weight, hectoliter weight and yield were also evaluated. Phosphite, independently source, did not act on leaf rust, powdery mildew, yellow and brown spot. The resistance inducer acibenzolar-S-methyl either isolated or associated to other fungicides affected leaf rust and powdery mildew of the wheat. Only phosphites associated to the fungicide controlled diseases, however there was no additional increase in yield whether compared to the control promoted by the fungicide.Foi realizado um experimento no município de Palmeira-PR, visando avaliar o efeito de diferentes fontes de fosfitos no controle da ferrugem da folha, do oídio e das manchas amarela e marrom na cultura do trigo. Os tratamentos foram: quatro fontes comerciais de fosfitos (A, B, C e D aplicados na dose de 1500 mL ha-1 (dose de produto ativo isolado ou associado aos demais produtos, acibenzolar-S-metil (ASM na dose de 500 mL ha-1 (isolado ou associado, piraclostrobina + epoxiconazole (fungicida na dose de 500 mL ha-1

  16. Yellow Rust Epidemics Worldwide Were Caused by Pathogen Races from Divergent Genetic Lineages

    DEFF Research Database (Denmark)

    Ali, Sajid; Rodriguez Algaba, Julian; Thach, Tine

    2017-01-01

    population across geographical regions. The results emphasized the lack of predictability of emergence of new races with high epidemic potential, which stresses the need for additional investments in population biology and surveillance activities of pathogens on global food crops, and assessments of disease...... that these epidemics were often driven by races from few but highly divergent genetic lineages. PstS1 was predominant in North America; PstS2 in West Asia and North Africa; and both PstS1 and PstS2 in East Africa. PstS4 was prevalent in Northern Europe on triticale; PstS5 and PstS9 were prevalent in Central Asia......; whereas PstS6 was prevalent in epidemics in East Africa. PstS7, PstS8 and PstS10 represented three genetic lineages prevalent in Europe. Races from other lineages were in low frequencies. Virulence to Yr9 and Yr27 was common in epidemics in Africa and Asia, while virulence to Yr17 and Yr32 were prevalent...

  17. SNP Discovery for mapping alien introgressions in wheat

    Science.gov (United States)

    2014-01-01

    Background Monitoring alien introgressions in crop plants is difficult due to the lack of genetic and molecular mapping information on the wild crop relatives. The tertiary gene pool of wheat is a very important source of genetic variability for wheat improvement against biotic and abiotic stresses. By exploring the 5Mg short arm (5MgS) of Aegilops geniculata, we can apply chromosome genomics for the discovery of SNP markers and their use for monitoring alien introgressions in wheat (Triticum aestivum L). Results The short arm of chromosome 5Mg of Ae. geniculata Roth (syn. Ae. ovata L.; 2n = 4x = 28, UgUgMgMg) was flow-sorted from a wheat line in which it is maintained as a telocentric chromosome. DNA of the sorted arm was amplified and sequenced using an Illumina Hiseq 2000 with ~45x coverage. The sequence data was used for SNP discovery against wheat homoeologous group-5 assemblies. A total of 2,178 unique, 5MgS-specific SNPs were discovered. Randomly selected samples of 59 5MgS-specific SNPs were tested (44 by KASPar assay and 15 by Sanger sequencing) and 84% were validated. Of the selected SNPs, 97% mapped to a chromosome 5Mg addition to wheat (the source of t5MgS), and 94% to 5Mg introgressed from a different accession of Ae. geniculata substituting for chromosome 5D of wheat. The validated SNPs also identified chromosome segments of 5MgS origin in a set of T5D-5Mg translocation lines; eight SNPs (25%) mapped to TA5601 [T5DL · 5DS-5MgS(0.75)] and three (8%) to TA5602 [T5DL · 5DS-5MgS (0.95)]. SNPs (gsnp_5ms83 and gsnp_5ms94), tagging chromosome T5DL · 5DS-5MgS(0.95) with the smallest introgression carrying resistance to leaf rust (Lr57) and stripe rust (Yr40), were validated in two released germplasm lines with Lr57 and Yr40 genes. Conclusion This approach should be widely applicable for the identification of species/genome-specific SNPs. The development of a large number of SNP markers will facilitate the precise introgression and

  18. SNP Discovery for mapping alien introgressions in wheat.

    Science.gov (United States)

    Tiwari, Vijay K; Wang, Shichen; Sehgal, Sunish; Vrána, Jan; Friebe, Bernd; Kubaláková, Marie; Chhuneja, Praveen; Doležel, Jaroslav; Akhunov, Eduard; Kalia, Bhanu; Sabir, Jamal; Gill, Bikram S

    2014-04-10

    Monitoring alien introgressions in crop plants is difficult due to the lack of genetic and molecular mapping information on the wild crop relatives. The tertiary gene pool of wheat is a very important source of genetic variability for wheat improvement against biotic and abiotic stresses. By exploring the 5Mg short arm (5MgS) of Aegilops geniculata, we can apply chromosome genomics for the discovery of SNP markers and their use for monitoring alien introgressions in wheat (Triticum aestivum L). The short arm of chromosome 5Mg of Ae. geniculata Roth (syn. Ae. ovata L.; 2n = 4x = 28, UgUgMgMg) was flow-sorted from a wheat line in which it is maintained as a telocentric chromosome. DNA of the sorted arm was amplified and sequenced using an Illumina Hiseq 2000 with ~45x coverage. The sequence data was used for SNP discovery against wheat homoeologous group-5 assemblies. A total of 2,178 unique, 5MgS-specific SNPs were discovered. Randomly selected samples of 59 5MgS-specific SNPs were tested (44 by KASPar assay and 15 by Sanger sequencing) and 84% were validated. Of the selected SNPs, 97% mapped to a chromosome 5Mg addition to wheat (the source of t5MgS), and 94% to 5Mg introgressed from a different accession of Ae. geniculata substituting for chromosome 5D of wheat. The validated SNPs also identified chromosome segments of 5MgS origin in a set of T5D-5Mg translocation lines; eight SNPs (25%) mapped to TA5601 [T5DL · 5DS-5MgS(0.75)] and three (8%) to TA5602 [T5DL · 5DS-5MgS (0.95)]. SNPs (gsnp_5ms83 and gsnp_5ms94), tagging chromosome T5DL · 5DS-5MgS(0.95) with the smallest introgression carrying resistance to leaf rust (Lr57) and stripe rust (Yr40), were validated in two released germplasm lines with Lr57 and Yr40 genes. This approach should be widely applicable for the identification of species/genome-specific SNPs. The development of a large number of SNP markers will facilitate the precise introgression and monitoring of alien segments in crop

  19. Identification of QTL conferring resistance to stripe rust (Puccinia striiformis f. sp. hordei) and leaf rust (Puccinia hordei) in barley using nested association mapping (NAM).

    Science.gov (United States)

    Vatter, Thomas; Maurer, Andreas; Perovic, Dragan; Kopahnke, Doris; Pillen, Klaus; Ordon, Frank

    2018-01-01

    The biotrophic rust fungi Puccinia hordei and Puccinia striiformis are important barley pathogens with the potential to cause high yield losses through an epidemic spread. The identification of QTL conferring resistance to these pathogens is the basis for targeted breeding approaches aiming to improve stripe rust and leaf rust resistance of modern cultivars. Exploiting the allelic richness of wild barley accessions proved to be a valuable tool to broaden the genetic base of resistance of barley cultivars. In this study, SNP-based nested association mapping (NAM) was performed to map stripe rust and leaf rust resistance QTL in the barley NAM population HEB-25, comprising 1,420 lines derived from BC1S3 generation. By scoring the percentage of infected leaf area, followed by calculation of the area under the disease progress curve and the average ordinate during a two-year field trial, a large variability of resistance across and within HEB-25 families was observed. NAM based on 5,715 informative SNPs resulted in the identification of twelve and eleven robust QTL for resistance against stripe rust and leaf rust, respectively. Out of these, eight QTL for stripe rust and two QTL for leaf rust are considered novel showing no overlap with previously reported resistance QTL. Overall, resistance to both pathogens in HEB-25 is most likely due to the accumulation of numerous small effect loci. In addition, the NAM results indicate that the 25 wild donor QTL alleles present in HEB-25 strongly differ in regard to their individual effect on rust resistance. In future, the NAM concept will allow to select and combine individual wild barley alleles from different HEB parents to increase rust resistance in barley. The HEB-25 results will support to unravel the genetic basis of rust resistance in barley, and to improve resistance against stripe rust and leaf rust of modern barley cultivars.

  20. Identification of QTL conferring resistance to stripe rust (Puccinia striiformis f. sp. hordei) and leaf rust (Puccinia hordei) in barley using nested association mapping (NAM)

    Science.gov (United States)

    Vatter, Thomas; Maurer, Andreas; Perovic, Dragan; Kopahnke, Doris; Pillen, Klaus

    2018-01-01

    The biotrophic rust fungi Puccinia hordei and Puccinia striiformis are important barley pathogens with the potential to cause high yield losses through an epidemic spread. The identification of QTL conferring resistance to these pathogens is the basis for targeted breeding approaches aiming to improve stripe rust and leaf rust resistance of modern cultivars. Exploiting the allelic richness of wild barley accessions proved to be a valuable tool to broaden the genetic base of resistance of barley cultivars. In this study, SNP-based nested association mapping (NAM) was performed to map stripe rust and leaf rust resistance QTL in the barley NAM population HEB-25, comprising 1,420 lines derived from BC1S3 generation. By scoring the percentage of infected leaf area, followed by calculation of the area under the disease progress curve and the average ordinate during a two-year field trial, a large variability of resistance across and within HEB-25 families was observed. NAM based on 5,715 informative SNPs resulted in the identification of twelve and eleven robust QTL for resistance against stripe rust and leaf rust, respectively. Out of these, eight QTL for stripe rust and two QTL for leaf rust are considered novel showing no overlap with previously reported resistance QTL. Overall, resistance to both pathogens in HEB-25 is most likely due to the accumulation of numerous small effect loci. In addition, the NAM results indicate that the 25 wild donor QTL alleles present in HEB-25 strongly differ in regard to their individual effect on rust resistance. In future, the NAM concept will allow to select and combine individual wild barley alleles from different HEB parents to increase rust resistance in barley. The HEB-25 results will support to unravel the genetic basis of rust resistance in barley, and to improve resistance against stripe rust and leaf rust of modern barley cultivars. PMID:29370232

  1. Identification of QTL conferring resistance to stripe rust (Puccinia striiformis f. sp. hordei and leaf rust (Puccinia hordei in barley using nested association mapping (NAM.

    Directory of Open Access Journals (Sweden)

    Thomas Vatter

    Full Text Available The biotrophic rust fungi Puccinia hordei and Puccinia striiformis are important barley pathogens with the potential to cause high yield losses through an epidemic spread. The identification of QTL conferring resistance to these pathogens is the basis for targeted breeding approaches aiming to improve stripe rust and leaf rust resistance of modern cultivars. Exploiting the allelic richness of wild barley accessions proved to be a valuable tool to broaden the genetic base of resistance of barley cultivars. In this study, SNP-based nested association mapping (NAM was performed to map stripe rust and leaf rust resistance QTL in the barley NAM population HEB-25, comprising 1,420 lines derived from BC1S3 generation. By scoring the percentage of infected leaf area, followed by calculation of the area under the disease progress curve and the average ordinate during a two-year field trial, a large variability of resistance across and within HEB-25 families was observed. NAM based on 5,715 informative SNPs resulted in the identification of twelve and eleven robust QTL for resistance against stripe rust and leaf rust, respectively. Out of these, eight QTL for stripe rust and two QTL for leaf rust are considered novel showing no overlap with previously reported resistance QTL. Overall, resistance to both pathogens in HEB-25 is most likely due to the accumulation of numerous small effect loci. In addition, the NAM results indicate that the 25 wild donor QTL alleles present in HEB-25 strongly differ in regard to their individual effect on rust resistance. In future, the NAM concept will allow to select and combine individual wild barley alleles from different HEB parents to increase rust resistance in barley. The HEB-25 results will support to unravel the genetic basis of rust resistance in barley, and to improve resistance against stripe rust and leaf rust of modern barley cultivars.

  2. Legume breeding for rust resistance: Lessons to learn from the model Medicago truncatula

    OpenAIRE

    Rubiales, Diego; Castillejo Sánchez, M. Ángeles; Madrid, Eva; Barilli, Eleonora; Rispail, Nicolas

    2011-01-01

    Rusts are major biotic constraints of legumes worldwide. Breeding for rust resistance is regarded as the most cost efficient method for rust control. However, in contrast to common bean for which complete monogenic resistance exists and is efficiently used, most of the rust resistance reactions described so far in cool season food legumes are incomplete and of complex inheritance. Incomplete resistance has been described in faba bean, pea, chickpea and lentil and several of their associated Q...

  3. Introducing the yellow laser

    Science.gov (United States)

    Lincoln, James

    2018-02-01

    The author has acquired a yellow laser with the specific wavelength of 589 nm. Because this is the first time such a laser has been discussed in this journal, I feel it is appropriate to provide a discussion of its function and capabilities. Normal laser safety should be employed, such as not pointing it into eyes or at people, and using eye protection for the young and inexperienced. It is important to note that 589 nm is the same wavelength as the Sodium-D line (doublet). This allows for the laser to serve as a replacement for sodium lamps, and, considering its rather high price, this added value should be balanced against its cost. What follows is a list of activities that showcase the yellow laser's unique promise as an engaging piece of technology that can be used in the teaching of physics.

  4. Obligate Biotrophy Features Unraveled by the Genomic Analysis of the Rust Fungi, Melampsora larici-populina and Puccinia graminis f. sp. tritici

    Energy Technology Data Exchange (ETDEWEB)

    Duplessis, Sebastien; Cuomo, Christina A.; Lin, Yao-Cheng; Aerts, Andrea; Tisserant, Emilie; Veneault-Fourrey, Claire; Joly, David L.; Hacquard, Stephane; Amselem, Joelle; Cantarel, Brandi; Chiu, Readman; Couthinho, Pedro; Feau, Nicolas; Field, Matthew; Frey, Pascal; Gelhaye, Eric; Goldberg, Jonathan; Grabherr, Manfred; Kodira, Chinnappa; Kohler, Annegret; Kues, Ursula; Lindquist, Erika; Lucas, Susan; Mago, Rohit; Mauceli, Evan; Morin, Emmanuelle; Murat, Claude; Pangilinan, Jasmyn L.; Park, Robert; Pearson, Matthew; Quesneville, Hadi; Rouhier, Nicolas; Sakthikumar, Sharadha; Salamov, Asaf A.; Schmutz, Jeremy; Selles, Benjamin; Shapiro, Harris; Tangay, Philippe; Tuskan, Gerald A.; Peer, Yves Van de; Henrissat, Bernard; Rouze, Pierre; Ellis, Jeffrey G.; Dodds, Peter N.; Schein, Jacqueline E.; Zhong, Shaobin; Hamelin, Richard C.; Grigoriev, Igor V.; Szabo, Les J.; Martin1, Francis

    2011-04-27

    Rust fungi are some of the most devastating pathogens of crop plants. They are obligate biotrophs, which extract nutrients only from living plant tissues and cannot grow apart from their hosts. Their lifestyle has slowed the dissection of molecular mechanisms underlying host invasion and avoidance or suppression of plant innate immunity. We sequenced the 101 mega base pair genome of Melampsora larici-populina, the causal agent of poplar leaf rust, and the 89 mega base pair genome of Puccinia graminis f. sp. tritici, the causal agent of wheat and barley stem rust. We then compared the 16,841 predicted proteins of M. larici-populina to the 18,241 predicted proteins of P. graminis f. sp tritici. Genomic features related to their obligate biotrophic life-style include expanded lineage-specific gene families, a large repertoire of effector-like small secreted proteins (SSPs), impaired nitrogen and sulfur assimilation pathways, and expanded families of amino-acid, oligopeptide and hexose membrane transporters. The dramatic upregulation of transcripts coding for SSPs, secreted hydrolytic enzymes, and transporters in planta suggests that they play a role in host infection and nutrient acquisition. Some of these genomic hallmarks are mirrored in the genomes of other microbial eukaryotes that have independently evolved to infect plants, indicating convergent adaptation to a biotrophic existence inside plant cells

  5. Pilot experience yellow tariff

    International Nuclear Information System (INIS)

    Cassanti, W.A.; Esteves Junior, L.

    1990-01-01

    In the search for alternatives to reduce the probability of a electric energy shortage, the National Electric Sector decided to apply Real Cost Supply Tariff. The implementation of this tariff method to consumers supplied on low tension, Group B (lower than 2300 Volts), demands a better knowledge of measurement equipment, tariff values and consumers receptivity for energy modulation and/or conservation, all objects of this Yellow Tariff Experience. (author)

  6. Yellow cake product practice

    International Nuclear Information System (INIS)

    Bosina, B.

    1980-01-01

    The flow sheets of uranium ore processing plants at present operating throughout the world terminate with the production of yellow cake. The demands of the refineries on the quality of this commodity have become more stringent with time. The impurity content of yellow cake depends to a considerable extent on the nature of the technical operations preceding precipitation. As a rule the purity of the final product is greater when the uranium is precipitated from re-extractants or regenerators consisting of weakly basic resins. An analysis of 80 uranium precipitation flow sheets demonstrates the advantages of using ammonia, while to some extent use is made of caustic soda, magnesium oxide, hydrogen peroxide or calcium oxide; precipitation is carried out in one or two stages at high temperature. Use of a particular chemical is governed by its availability, price, effect on the environment, degree of filtrate utilization, etc. It may be anticipated that the perfecting of precipitation flow sheets will be directed towards achieving maximum concentration of uranium in the solutions before precipitation, reduction in the volume of liquid flows through the equipment, an improvement in the filtration qualities of the precipitate, etc. The paper gives the flow sheet for precipitation of uranium by means of gaseous ammonia from sulphate-carbonate solutions. For drying yellow cake use has been made of spray driers. The dry product is easily sampled and transported. (author)

  7. White pine blister rust in northern ldaho and western Montana: alternatives for integrated management

    Science.gov (United States)

    Susan K. Hagle; Geral I. McDonald; Eugene A. Norby

    1989-01-01

    This report comprises a handbook for managing western white pine in northern ldaho and western Montana, under the threat of white pine blister rust. Various sections cover the history of the disease and efforts to combat it, the ecology of the white pine and Ribes, alternate host of the rust, and techniques for evaluating the rust hazard and attenuating it. The authors...

  8. Strategies for managing whitebark pine in the presence of white pine blister rust [Chapter 17

    Science.gov (United States)

    Raymond J. Hoff; Dennis E. Ferguson; Geral I. McDonald; Robert E. Keane

    2001-01-01

    Whitebark pine (Pinus albicaulis) is one of many North American white pine species (Pinus subgenus Strobus) susceptible to the fungal disease white pine blister rust (Cronartium ribicola). Blister rust has caused severe mortality (often reaching nearly 100 percent) in many stands of white bark pine north of 45° latitude in western North America. The rust is slowly...

  9. Genetic variability among the brown rust resistant and susceptible genotypes of sugarcane by RAPD technique

    Science.gov (United States)

    Brown leaf rust in sugarcane is caused by Puccinia melanocephala (Syd. & P. Syd.), which is major cause of cultivar withdrawal. We attempted to analyze the RAPD diversity of two discrete phenotypic classes i.e. rust resistant (R) and rust susceptible (S) of six commercially available sugarcane elite...

  10. Glyphosate Control of Orange and Brown Rusts in Glyphosate-Sensitive Sugarcane Cultivars

    Science.gov (United States)

    Technical Abstract: Brown and orange rust diseases cause substantial yield reductions on sugarcane (Saccharum spp.) in Florida and other regions where sugarcane is grown. Brown rust caused by Puccinia melanocephala Syd. & P. Syd has been present in Florida since 1978 and orange rust caused by Pucci...

  11. DIVERSITY OF PUCCINIA KUEHNII AND P. MELANOCEPHALA CAUSING RUST DISEASES ON BRAZILIAN SUGARCANE

    Science.gov (United States)

    Sugarcane industry in Brazil suffers yield loss due to brown rust (Puccinia melanocephala) since 1986 and orange rust (P. kuehnii) as recent as 2009. The main control measure for both diseases has been cultivar resistance. Nevertheless, recent onsets of orange rust on previously resistant cultivars ...

  12. Aecidium kalanchoe sp. nov., a new rust on Kalanchoe blossfeldiana (Crassulaceae).

    Science.gov (United States)

    Hernádez, José R; Aime, M Catherine; Newbry, Brad

    2004-07-01

    A rust fungus found on cultivars of Kalanchoe blossfeldiana (Crassulaceae) is described as a new species, Aecidium kalanchoe sp. nov., and compared to the other described rusts on members of the Crassulaceae. Only one other rust is known to parasitize Kalanchoe spp. A DNA sequence of A. kalanchoe suggests that the teleomorph is related to Puccinia.

  13. Quantifying the non-fungicidal effects of foliar applications of fluxapyroxad (Xemium) on stomatal conductance, water use efficiency and yield in winter wheat.

    Science.gov (United States)

    Smith, J; Grimmer, M; Waterhouse, S; Paveley, N

    2013-01-01

    The active ingredient fluxapyroxad belongs to the chemical group of carboxamides and is a new generation succinate dehydrogenase inhibitor (SDHI) in complex II of the mitochondrial respiratory chain. It has strong efficacy against the key foliar diseases of winter wheat in the UK: Septoria leaf blotch, yellow stripe rust and brown rust. Fluxapyroxad is marketed under the brand name of Xemium, was launched in 2012 and is available in the UK as a solo product (Imtrex) for co-application with triazoles, in co-formulation with epoxiconazole (Adexar), or in a three way formulation with epoxiconazole and pyraclostrobin (Ceriax). The objective of the study was to quantify the direct effects of Xemium on stomatal conductance and yield, mediated through stimulation of host physiology. Three field experiments and two controlled environment (CE) experiments were conducted across three cropping seasons (2010-2012) in Herefordshire and Cambridge, in the UK. Xemium was evaluated against boscalid, pyraclostrobin (F500), epoxiconazole and an untreated control. Across site-seasons, disease severity was significantly reduced when Xemium was applied as a foliar spray. Healthy canopy size and duration was increased by Xemium and canopy greening effects were seen shortly after application. Stomatal conductance was found to be consistently lower in Xemium treated plants but reduced stomatal opening was not found to be detrimental to yield in these experiments. Large, beneficial effects of Xemium on water use efficiency were found at the canopy level and this finding was supported by measurements of instantaneous water use efficiency at the leaf level. Effects on season long water use efficiency were largely driven by improvements in yield for a given amount of water uptake. Foliar applications of Xemium reduced the water required to produce 1.0 t grain per hectare by 82,330 L(82 t) when compared with an untreated crop. Yield was significantly higher in Xemium treatments and this was

  14. Painting rusted steel: The role of aluminum phosphosilicate

    International Nuclear Information System (INIS)

    Roselli, S.N.; Amo, B. del; Carbonari, R.O.; Di Sarli, A.R.; Romagnoli, R.

    2013-01-01

    Highlights: •Aluminum phosphosilicate is an acid pigment which could act as mild phosphating agent. •Aluminum phosphosilicate can phosphatize iron oxides on rusted surfaces. •Aluminum phosphosilicate is compatible with acid binders. •Aluminum phosphosilicate could replace chromate in complete painting schemes. •Aluminum phosphosilicate primers improve paints adhesion on rusted surfaces. -- Abstract: Surface preparation is a key factor for the adequate performance of a paint system. The aim of this investigation is to employ a wash-primer to accomplish the chemical conversion of rusted surface when current cleaning operations are difficult to carry out. The active component of the wash-primer was aluminum phosphosilicate whose electrochemical behavior and the composition of the generated protective layer, both, were studied by electrochemical techniques and scanning electron microscopy (SEM), respectively. Primed rusted steel panels were coated with an alkyd system to perform accelerated tests in the salt spray chamber and electrochemical impedance measurements (EIS). These tests were conducted in parallel with a chromate wash primer and the same alkyd system. Results showed that the wash-primer containing aluminum phosphosilicate could be used satisfactorily to paint rusted steel exhibiting a similar performance to the chromate primer

  15. Weather and Climate Indicators for Coffee Rust Disease

    Science.gov (United States)

    Georgiou, S.; Imbach, P. A.; Avelino, J.; Anzueto, F.; del Carmen Calderón, G.

    2014-12-01

    Coffee rust is a disease that has significant impacts on the livelihoods of those who are dependent on the Central American coffee sector. Our investigation has focussed on the weather and climate indicators that favoured the high incidence of coffee rust disease in Central America in 2012 by assessing daily temperature and precipitation data available from 81 weather stations in the INSIVUMEH and ANACAFE networks located in Guatemala. The temperature data were interpolated to determine the corresponding daily data at 1250 farms located across Guatemala, between 400 and 1800 m elevation. Additionally, CHIRPS five day (pentad) data has been used to assess the anomalies between the 2012 and the climatological average precipitation data at farm locations. The weather conditions in 2012 displayed considerable variations from the climatological data. In general the minimum daily temperatures were higher than the corresponding climatology while the maximum temperatures were lower. As a result, the daily diurnal temperature range was generally lower than the corresponding climatological range, leading to an increased number of days where the temperatures fell within the optimal range for either influencing the susceptibility of the coffee plants to coffee rust development during the dry season, or for the development of lesions on the coffee leaves during the wet season. The coffee rust latency period was probably shortened as a result, and farms at high altitudes were impacted due to these increases in minimum temperature. Factors taken into consideration in developing indicators for coffee rust development include: the diurnal temperature range, altitude, the environmental lapse rate and the phenology. We will present the results of our study and discuss the potential for each of the derived weather and climatological indicators to be used within risk assessments and to eventually be considered for use within an early warning system for coffee rust disease.

  16. Mutation breeding for disease resistance in wheat and field beans

    International Nuclear Information System (INIS)

    Abdel-Hak, T.M.; Kamel, A.H.

    1977-01-01

    Wheat and broad-bean diseases cause considerable losses under Egyptian conditions; therefore, an attempt was made to induce useful mutations in both crops resistant to diseases which may be of direct or indirect use in breeding programmes. The methodology of artificial inoculation, evaluation, selection, radiation levels used are reported, in addition to the economic importance of the varieties used. This work passed through two phases, the first started in the 1972/73 crop season with a small population, while the second in 1974/75 with a larger one to have a better chance of detecting resistant mutants. In the first phase, a total of 3563M 1 wheat plants was grown in addition to approximately 3600-44,000M 2 and 77,646M 3 plants. Twenty-two M 2 plants were selected as showing lower level of leaf rust development, but further tests showed these plants are not true mutants since they rusted at the same level of their parent varieties. Out of the M 3 plants none showed good resistance. In the second phase, 36,000, 277,080 and 289,492 plants of M 1 , M 2 and M 3 , respectively, were grown and 73M 2 plants were selected as showing complete resistance to leaf and stem rusts. In field beans out of the first phase, a total of 5760, 37,200 and 33,240M 1 , M 2 and M 3 plants, respectively, was grown and none showed a good level of disease resistance although some were less diseased. These were further tested and proved not true mutants for reduced disease development. In the second phase, 8747, 203,520 and 90,285 plants of M 1 , M 2 and M 3 , respectively, were grown and 27M 2 plants were selected as showing a lower level of chocolate spot and rust development. The paper also discusses the use of single versus composite cultures in mutation breeding for disease resistance. (author)

  17. Use of gamma radiation for inducing rust resistance in soybean

    International Nuclear Information System (INIS)

    Smutkupt, Sumit; Wongpiyasatid, Arunee; Lamseejan, Siranut; Naritoom, Kruik

    1982-01-01

    Experiments on induced mutations for rust resistance in 11 soybean cultivars were started in the rainy season of 1979. M 1 seeds were grown at Farm Suwan, Pak Chong, Nakorn Rajchasima Province. Six plods from each of 4,438 control and 43,907 M 1 plants were randomly harvested. M 2 seeds of each cultivar of different doses were bulked. In addition, 270 good M 1 plants were selected and threshed singly. M 2 -bulk and M 2 -single seeds were advanced to M 3 . Both of M 3 -bulk and M 3 -single plants together with M 2 -bulk plants derived from remnant M 2 seeds were screened for rust resistance in the rainy season of 1980. The IWGSR rust rating system was used. Based on the slow growth of rust reaction on the plant (323,333) compared with the average IWGSR rust rating notation of the rates (343) in the same row, 121 plants were selected. Among them, six were selected from a total of 2802 control plants, and 115 from a total of 28,834 M 2 and M 3 plants. Seeds of each selection harvested. Only 88 lines of M 4 and M 5 were available for further rust evaluation in the rainy season of 1981. The results were as follows: At 77 days after planting, 82 selected lines were rated 333, 323 in comparison with 87 out of 137 rows of control S.J.1, S.J.2, S.J.4 and T.K.5 were rated 343. At 86 days after planting, most of the selections reached the diseased level 343. However, six lines which were derived from G8586 were still rated 333. In addition, a plant with slow growth of rust (323) from Taichung N No. 81-1-032 was selected. The six selected lines having characteristics of slow growth of rust reaction on the plants will be further tested. The high yielding selections among 82 selected lines having low percentage of shrivelled seeds will be used for further yield evaluation in the rainy season of 1982

  18. Febre amarela Yellow fever

    Directory of Open Access Journals (Sweden)

    Pedro Fernando da Costa Vasconcelos

    2003-04-01

    Full Text Available A febre amarela é doenca infecciosa não-contagiosa causada por um arbovírus mantido em ciclos silvestres em que macacos atuam como hospedeiros amplificadores e mosquitos dos gêneros Aedes na África, e Haemagogus e Sabethes na América, são os transmissores. Cerca de 90% dos casos da doença apresentam-se com formas clínicas benignas que evoluem para a cura, enquanto 10% desenvolvem quadros dramáticos com mortalidade em torno de 50%. O problema mostra-se mais grave em África onde ainda há casos urbanos. Nas Américas, no período de 1970-2001, descreveram-se 4.543 casos. Os países que mais diagnosticaram a doença foram o Peru (51,5%, a Bolívia (20,1% e o Brasil (18,7%. Os métodos diagnósticos utilizados incluem a sorologia (IgM, isolamento viral, imunohistoquímica e RT-PCR. A zoonose não pode ser erradicada, mas, a doença humana é prevenível mediante a vacinação com a amostra 17D do vírus amarílico. A OMS recomenda nova vacinação a cada 10 anos. Neste artigo são revistos os principais conceitos da doença e os casos de mortes associados à vacina.Yellow fever is an infectious and non-contagious disease caused by an arbovirus, the yellow fever virus. The agent is maintained in jungle cycles among primates as vertebrate hosts and mosquitoes, especially Aedes in Africa, and Haemagogus and Sabethes in America. Approximately 90% of the infections are mild or asymptomatic, while 10% course to a severe clinical picture with 50% case-fatality rate. Yellow fever is largely distributed in Africa where urban epidemics are still reported. In South America, between 1970-2001, 4,543 cases were reported, mostly from Peru (51.5%, Bolivia (20.1% and Brazil (18.7%. The disease is diagnosed by serology (detection of IgM, virus isolation, immunohistochemistry and RT-PCR. Yellow fever is a zoonosis and cannot be eradicated, but it is preventable in man by using the 17D vaccine. A single dose is enough to protect an individual for at least

  19. Need yellow fever vaccine? Plan ahead

    Science.gov (United States)

    ... Submit What's this? Submit Button Past Emails Need yellow fever vaccine? Plan ahead. Language: English (US) Español (Spanish) ... none were from the United States). What is yellow fever? Yellow fever is caused by a virus that ...

  20. Starch facilitates enzymatic wheat gluten hydrolysis

    NARCIS (Netherlands)

    Hardt, N.A.; Boom, R.M.; Goot, van der A.J.

    2015-01-01

    Wheat gluten can be hydrolyzed by either using (vital) wheat gluten or directly from wheat flour. This study investigates the influence of the presence of starch, the main component of wheat, on enzymatic wheat gluten hydrolysis. Wheat gluten present in wheat flour (WFG) and vital wheat gluten (VWG)

  1. Effectiveness of Fungicide on Soybean Rust in the Southeastern United States: A Meta-Analysis

    Directory of Open Access Journals (Sweden)

    Mary Delaney

    2018-05-01

    Full Text Available Soybean rust (SBR, caused by the fungus Phakopsora pachyrhizi Sydow, has been of concern to soybean (Glycine max Merrill growers in the southern United States since its introduction in 2004. As this fungus develops, pustules become numerous on the underside of leaves, which then turn yellow and drop prematurely, resulting in fewer pods, and poorly developed seeds. Our objective was to evaluate the efficacy of fungicide use in controlling SBR by conducting a meta-analysis of 61 published and unpublished trials across the southern United States from 2004 to 2014. We analyzed fungicide efficacy based on factors such as specific classes of fungicide, active ingredients, number of fungicide applications, target growth stage upon initial application, level of disease pressure, and year of the study. Fungicides significantly increased yield and 100-seed weight and decreased the severity of SBR. The means of SBR severity, yield, and 100-seed weight in fungicide-treated plants were 9% (95% confidence interval: 2%, 21%, 128% (121%, 135%, and 121% (116%, 128%, respectively, of those calculated in the control plants. By using meta-analysis to analyze fungicide efficacy across multiple field trials, we were able to determine that one application of a strobilurin fungicide when plants were either beginning pod development (R3 or developing seeds (R5 was the most cost-effective approach to controlling SBR and increasing 100-seed weight.

  2. Antibiotic Treatment of Blister Rust Cankers in Eastern White Pine

    Science.gov (United States)

    William R. Phelps; Ray Weber

    1970-01-01

    Cycloheximide (Acti-dione) and Phytoactin antibiotics, applied as basal stem treatments, aerial spray treatments, and complete foliar drenches were not effective in controlling blister rust cankers in eastern white pine. Cycloheximide was effective in suppressing canker activity and growth if directly applied to scarified cankers.

  3. Control of Bean Rust using Antibiotics Produced by Bacillus and ...

    African Journals Online (AJOL)

    Antibiotic culture filtrates produced by Bacillus (CA5) and Streptomyces spp. were tested for translocation and persistence when applied on snap beans inoculated with rust (Uromyces appendiculatus) in greenhouse pot experiments. The antibiotics were applied on the first trifoliate leaves and translocation was assessed as ...

  4. Blister rust control in the management of western white pine

    Science.gov (United States)

    Kenneth P. Davis; Virgil D. Moss

    1940-01-01

    The forest industry of the western white pine region depends on the production of white pine as a major species on about 2,670,000 acres of commercial forest land. Continued production of this species and maintenance of the forest industry at anything approaching its present level is impossible unless the white pine blister rust is controlled. Existing merchantable...

  5. Resistance of three interspecific white pine hybrids to blister rust

    Science.gov (United States)

    R. Z. Callaham

    1962-01-01

    Three white pine hybrids exposed to infection by white pine blister rust (Cronartium ribicola Fischer) since 1946 have inherited the relative resistance of their parental species. The hybrids were produced from controlled pollinations in 1940 and 1941 at the Institute of Forest Genetics, Placerville, Calif. Twelve seedlings of each hybrid were...

  6. Characteristics of Blister Rust Cankers on Eastern White Pine

    Science.gov (United States)

    William R. Phelps; Ray Weber

    1969-01-01

    The growth, development, and sporulation of white pine blister rust cankers were studied on eastern white pine in Wisconsin and Minnesota. Three district canker types were identified on the basis of physical appearance, growth rate, and sporulation. Canker growth rate and sporulation decreased as tree size or age increased, and many cankers apparently became inactive...

  7. Reductive and sorptive properties of sulfate green rust (GRSO4)

    DEFF Research Database (Denmark)

    Nedel, Sorin

    The Fe(II), Fe(III) hydroxide containing sulfate in its structure, called sulfate green rust (GRSO4), can effectively reduce and convert contaminants to less mobile and less toxic forms. However, the ability of GRSO4 to remove positively charged species from solution, via sorption, is very limited...

  8. White pine blister rust resistance research in Minnesota and Wisconsin

    Science.gov (United States)

    Andrew David; Paul Berrang; Carrie Pike

    2012-01-01

    The exotic fungus Cronartium ribicola causes the disease white pine blister rust on five-needled pines throughout North America. Although the effects of this disease are perhaps better known on pines in the western portion of the continent, the disease has also impacted regeneration and growth of eastern white pine (Pinus strobus L. ...

  9. White pines, Ribes, and blister rust: integration and action

    Science.gov (United States)

    R. S. Hunt; B. W. Geils; K. E. Hummer

    2010-01-01

    The preceding articles in this series review the history, biology and management of white pine blister rust in North America, Europe and eastern Asia. In this integration, we connect and discuss seven recurring themes important for understanding and managing epidemics of Cronartium ribicola in the white pines (five-needle pines in subgenus Strobus). Information and...

  10. White pines, Ribes, and blister rust: a review and synthesis

    Science.gov (United States)

    Brian W. Geils; Kim E. Hummer; Richard S. Hunt

    2010-01-01

    For over a century, white pine blister rust (Cronartium ribicola) has linked white pines (Strobus) with currants and gooseberries (Ribes) in a complex and serious disease epidemic in Asia, Europe, and North America. Because of ongoing changes in climate, societal demands for forests and their amenities, and scientific advances in genetics and proteomics, our current...

  11. White pine blister rust in the interior Mountain West

    Science.gov (United States)

    Kelly Burns; Jim Blodgett; Dave Conklin; Brian Geils; Jim Hoffman; Marcus Jackson; William Jacobi; Holly Kearns; Anna Schoettle

    2010-01-01

    White pine blister rust is an exotic, invasive disease of white, stone, and foxtail pines (also referred to as white pines or five-needle pines) in the genus Pinus and subgenus Strobus (Price and others 1998). Cronartium ribicola, the fungus that causes WPBR, requires an alternate host - currants and gooseberries in the genus Ribes and species of Pedicularis...

  12. Screening of fungicides for the management of wattle rust ...

    African Journals Online (AJOL)

    % of the revenue from the species obtained from the timber and 15% from the bark. From 2012/13 a wattle rust disease has spread throughout the black wattle plantation area in KwaZulu-Natal and from 2015 it was recorded in southern ...

  13. Developing clones of Eucalyptus cloeziana resistant to rust (Puccinia psidii)

    Science.gov (United States)

    Rafael F. Alfenas; Marcelo M. Coutinho; Camila S. Freitas; Rodrigo G. Freitas; Acelino C. Alfenas

    2012-01-01

    Besides its high resistance to Chrysoporthe cubensis canker, Eucalyptus cloeziana F. Muell. is a highly valuable tree species for wood production. It can be used for furniture, electric poles, fence posts, and charcoal. Nevertheless, it is highly susceptible to the rust caused by Puccinia psidii, which...

  14. Taxonomy, phylogeny, and coevolution of pines and their stem rusts

    Science.gov (United States)

    C. I. Millar; B. B. Kinloch

    1991-01-01

    We review and reinterpret major events in the evolution of pines and their stem rusts using information from their taxonomy, genetics, biogeography, and fossil history. Understanding of pine evolution has been significantly revised in the last 20 years. Pines appear to have evolved early in the Mesozoic and to have diversified and migrated throughout middle latitudes...

  15. HOW TO Identify White Pine Blister Rust and Remove Cankers

    Science.gov (United States)

    Thomas H. Nicholls; Robert L. Anderson

    1977-01-01

    White pine blister rust (caused by the fungus Cronartium ribicola J. C. Fisch. ex Rabenh.) was introduced into the United States about 1900 and has since spread throughout the range of white pine. The disease intensity varies throughout the range but is normally most severe where late summers (July-September) are cool (below 67? F) and damp, conditions necessary for...

  16. Marker-assisted pyramiding of Thinopyrumderived leaf rust ...

    Indian Academy of Sciences (India)

    2017-03-20

    Mar 20, 2017 ... resistance genes Lr19 and Lr24 using marker assisted foreground .... is linked with stem rust resistance gene Sr24(McIntosh et al. 1976). .... Received 29 July 2016, in final revised form 3 March 2017; accepted 16 March 2017.

  17. Contribution to Kinetics of Formation of White Rust on Galvanized Steel

    International Nuclear Information System (INIS)

    Han, D. J.; Pyun, Su Il; Hahn, Y. D.

    1981-01-01

    Kinetics of formation of white rust on galvanized steel coated with various chromating solutions was studied. White rust occurs as a mixture of zinc oxide and zinc hydroxide. White rust formation rate was measured with a salt spray test as related to Cr 3+ ion amount, ratio of Cr 3+ to Cr 6+ ion(by weight) and surface roughness of the chromate film. Incubation time of white rust formation increased as the ratio of Cr 3+ to Cr 6+ ion in the chromate film increased. White rust propagation rate decreased as the amount of Cr 3+ ion increased. Surface roughness had no detectable relationship with incubation time and white rust propagation rate. Experimental results showed that kinetics of white rust formation was as follows: chromate film consists of insoluble Cr 3+ ion and soluble Cr 6+ ion, the latter act: as a corrosion inhibitor. Leaching rate of Cr 6+ ion from the film decreases with an increase of the ratio of Cr 3+ to Cr 6+ ion in the chromate film. When Cr 6+ ion is leached from the film, a bare zine layer is exposed to air and discontinuities occur in the film where white rust formation is initiated. Further white rust formation occurs due to destruction of the chromate film by chlorine ion. It is concluded that two stages of white rust formation are present and can be ascribed to Cr 6+ ion leaching and destruction of the chromate film by chlorine ion

  18. Wheat biotechnology: A minireview

    OpenAIRE

    Patnaik, Debasis; Khurana, Paramjit

    2001-01-01

    Due to the inherent difficulties associated with gene delivery into regenerable explants and recovery of plantlets with the introduced transgene, wheat was the last among cereals to be genetically transformed. This review attempts to summarize different efforts in the direction of achieving genetic transformation of wheat by various methods. Particle bombardment is the most widely employed procedure for the introduction of marker genes and also for the generation of transformed wheat with int...

  19. Structure and Charge Hopping Dynamics in Green Rust

    International Nuclear Information System (INIS)

    Wander, Matthew C.; Rosso, Kevin M.; Schoonen, Martin A.

    2007-01-01

    Green rust is a family of mixed-valent iron phases formed by a number of abiotic and biotic processes under alkaline suboxic conditions. Due to its high Fe2+ content, green rust is a potentially important phase for pollution remediation by serving as a powerful electron donor for reductive transformation. However, mechanisms of oxidation of this material are poorly understood. An essential component of the green rust structure is a mixed-valent brucite-like Fe(OH)2 sheet comprised of a two dimensional network of edge-sharing iron octahedra. Room temperature Mossbauer spectra show a characteristic signature for intermediate valence on the iron atoms in this sheet, indicative of a Fe2+-Fe3+ valence interchange reaction faster than approximately 107s-1. Using Fe(OH)2 as structural analogue for reduced green rust, we performed Hartree-Fock calculations on periodic slab models and cluster representations to determine the structure and hopping mobility of Fe3+ hole polarons in this material, providing a first principles assessment of the Fe2+-Fe3+ valence interchange reaction rate. The calculations show that among three possible symmetry unique iron-to-iron hops within a sheet, a hop to next-nearest neighbors at an intermediate distance of 5.6Angstroms is the fastest. The predicted rate is on the order of 1012 s-1 consistent the Mossbauer-based constraint. All other possibilities, including hopping across interlayer spaces, are predicted to be slower than 107s-1. Collectively, the findings suggest the possibility of hole self-diffusion along sheets as a mechanism for regeneration of lattice Fe2+ sites, consistent with previous experimental observations of edge-inward progressive oxidation of green rust.

  20. Host status of false brome grass to the leaf rust fungus Puccinia brachypodii and the stripe rust fungus P. Striiformis

    NARCIS (Netherlands)

    Barbieri, M.; Marcel, T.C.; Niks, R.E.

    2011-01-01

    Purple false brome grass (Brachypodium distachyon) has recently emerged as a model system for temperate grasses and is also a potential model plant to investigate plant interactions with economically important pathogens such as rust fungi. We determined the host status of five Brachypodium species

  1. cDNA-AFLP analysis reveals differential gene expression in compatible interaction of wheat challenged with Puccinia striiformis f. sp. tritici

    Directory of Open Access Journals (Sweden)

    Huang Lili

    2009-06-01

    Full Text Available Abstract Background Puccinia striiformis f. sp. tritici is a fungal pathogen causing stripe rust, one of the most important wheat diseases worldwide. The fungus is strictly biotrophic and thus, completely dependent on living host cells for its reproduction, which makes it difficult to study genes of the pathogen. In spite of its economic importance, little is known about the molecular basis of compatible interaction between the pathogen and wheat host. In this study, we identified wheat and P. striiformis genes associated with the infection process by conducting a large-scale transcriptomic analysis using cDNA-AFLP. Results Of the total 54,912 transcript derived fragments (TDFs obtained using cDNA-AFLP with 64 primer pairs, 2,306 (4.2% displayed altered expression patterns after inoculation, of which 966 showed up-regulated and 1,340 down-regulated. 186 TDFs produced reliable sequences after sequencing of 208 TDFs selected, of which 74 (40% had known functions through BLAST searching the GenBank database. Majority of the latter group had predicted gene products involved in energy (13%, signal transduction (5.4%, disease/defence (5.9% and metabolism (5% of the sequenced TDFs. BLAST searching of the wheat stem rust fungus genome database identified 18 TDFs possibly from the stripe rust pathogen, of which 9 were validated of the pathogen origin using PCR-based assays followed by sequencing confirmation. Of the 186 reliable TDFs, 29 homologous to genes known to play a role in disease/defense, signal transduction or uncharacterized genes were further selected for validation of cDNA-AFLP expression patterns using qRT-PCR analyses. Results confirmed the altered expression patterns of 28 (96.5% genes revealed by the cDNA-AFLP technique. Conclusion The results show that cDNA-AFLP is a reliable technique for studying expression patterns of genes involved in the wheat-stripe rust interactions. Genes involved in compatible interactions between wheat and the

  2. Free and esterified carotenoids in pigmented wheat, tritordeum and barley grains.

    Science.gov (United States)

    Paznocht, Luboš; Kotíková, Zora; Šulc, Miloslav; Lachman, Jaromír; Orsák, Matyáš; Eliášová, Marie; Martinek, Petr

    2018-02-01

    Carotenoids are important phytonutrients responsible for the yellow endosperm color in cereal grains. Five carotenoids, namely lutein, zeaxanthin, antheraxanthin, α- and β-carotene, were quantified by HPLC-DAD-MS in fourteen genotypes of wheat, barley and tritordeum harvested in Czechia in 2014 and 2015. The highest carotenoid contents were found in yellow-grained tritordeum HT 439 (12.16μg/gDW), followed by blue-grained wheat V1-131-15 (7.46μg/gDW), and yellow-grained wheat TA 4024 (7.04μg/gDW). Comparing carotenoid contents, blue varieties had lower whereas purple ones had the same or higher levels than conventional bread wheat. Lutein was the main carotenoid found in wheat and tritordeum while zeaxanthin dominated in barley. The majority of cereals contained considerable levels of esterified forms (up to 61%) of which lutein esters prevailed. It was assessed that cereal genotype determines the proportion of free and esterified forms. High temperatures and drought during the growing season promoted carotenoid biosynthesis. Copyright © 2017 Elsevier Ltd. All rights reserved.

  3. Kinetics of structural rust transformation in environments containing chloride and SO2

    International Nuclear Information System (INIS)

    Rendon, J. L.; Valencia, A.

    2003-01-01

    The behaviour of the rusts produced on low carbon steel exposed in industrial atmospheres, at different distances from the sea, was studied by simulating the wetting-drying cycle in a CEBELCOR type apparatus. Coupons electrode potential was monitored and rust layer was analyzed by gravimetric techniques, optical microscopy and Moessbauer spectroscopy. A particular chloride/sulfur ratio in the atmosphere was found, for which there is a particular behaviour in rust formation. For this ratio, corrosion rates were much less than expected. it is postulated a kinetic mechanism for rust layer formation as the origin of this special behavior. An electrode potential similar to that in a weathering steel was observed, this is reflected in the low corrosion rate obtained. The proposed kinetic mechanism for rust formation under these exposure conditions enables new research lines on layer formation and the development of protective rust for industrial marine atmospheres. (Author) 8 refs

  4. Induced mutations in Iraqi bread wheat cv. Saber Beg

    Energy Technology Data Exchange (ETDEWEB)

    Ibrahim, I F; Haidar, H O [Department of Plant Protection, Faculty of Agriculture and Biology, NRC and Agriculture Research Station, Telafor (Iraq)

    1989-07-01

    ''Saber Beg'', is a local wheat cultivar important in the semi-arid zone of Iraq where the rainfall is less than 450 mm per year. This cultivar has a good baking quality, but is of low productivity, high susceptibility to common bunt (Tilletia spp.) and to leaf rust (Puccinia recondita Rob. ex Desm.), but only in the rainy season. A mutation breeding programme using gamma irradiation has been started in 1978 to improve this cultivar. Seeds of all main tillers from M{sub 1} plants were harvested and artificially inoculated with teliospores of Tilletia spp. All the seeds from healthy M{sub 2} plants were inoculated again and sown in the same area. Out of 22920 M{sub 3} plants, 244 resistant ones were selected. During subsequent screening for 4 generations, however, only 3 mutants were confirmed.

  5. Induced mutations in Iraqi bread wheat cv. Saber Beg

    International Nuclear Information System (INIS)

    Ibrahim, I.F.; Haidar, H.O.

    1989-01-01

    ''Saber Beg'', is a local wheat cultivar important in the semi-arid zone of Iraq where the rainfall is less than 450 mm per year. This cultivar has a good baking quality, but is of low productivity, high susceptibility to common bunt (Tilletia spp.) and to leaf rust (Puccinia recondita Rob. ex Desm.), but only in the rainy season. A mutation breeding programme using gamma irradiation has been started in 1978 to improve this cultivar. Seeds of all main tillers from M 1 plants were harvested and artificially inoculated with teliospores of Tilletia spp. All the seeds from healthy M 2 plants were inoculated again and sown in the same area. Out of 22920 M 3 plants, 244 resistant ones were selected. During subsequent screening for 4 generations, however, only 3 mutants were confirmed

  6. Phylogeny of Yellow Fever Virus, Uganda, 2016.

    Science.gov (United States)

    Hughes, Holly R; Kayiwa, John; Mossel, Eric C; Lutwama, Julius; Staples, J Erin; Lambert, Amy J

    2018-08-17

    In April 2016, a yellow fever outbreak was detected in Uganda. Removal of contaminating ribosomal RNA in a clinical sample improved the sensitivity of next-generation sequencing. Molecular analyses determined the Uganda yellow fever outbreak was distinct from the concurrent yellow fever outbreak in Angola, improving our understanding of yellow fever epidemiology.

  7. SCREENING OF Lr GENES PROVIDING RESISTANCE TO LEAF RUST IN WHEATH USING MULTIPLEX PCR METHOD

    Directory of Open Access Journals (Sweden)

    Mehmet AYBEKE

    2015-12-01

    Full Text Available Leaf rust is a fungal disease in wheat that causes significant decrease in yield around the world. In Turkey, several genes, including leaf rust-resistant (Lr Lr9, Lr19, Lr24 and Lr28, have been found to induce disease resistance. To obtain resistant cultivars during the breeding process, screening of these genes in various specimens is crucial. Thus, we aimed in the present study primarily to improve the multiplex polymerase chain reaction (PCR methodology by which four Lr genes could be simultaneously screened in plant samples carrying these genes. Serial PCR experiments were carried out for determination of optimal PCR conditions for each Lr gene and in all studies nursery lines were used. PCR conditions were determined as follows: 35 cycles of 95°C for denaturation (30 s, 58°C for annealing (30 s and 72°C for elongation (60 s, with an initial 94°C denaturation (3 min and a 72°C extension (30 min. The primers used in the PCR runs were as follows: Lr9F: TCCTTTTATTCCGCACGCCGG, Lr9R: CCACACTACCCCAAAGAGACG; Lr19F: CATCCTTGGGGACCTC, Lr19R: CCAGCTCGCATACATCCA; Lr24F: TCTAGTCTGTACATGGGGGC, Lr24R: TGGCACATGAACTCCATACG; Lr28F: CCCGGCATAAGTCTATGGTT, Lr28R: CAATGAATGAGATACGTGAA. We found that the optimum annealing temperature for all four genes was 61°C and extension temperatures were 62°C or 64°C. Finally, using this new PCR method, we successfully screened these genes in specimens carrying only one single Lr gene. Optimal multiplex PCR conditions were; denaturation at 94°C for 1 min, 35 extension cycles [94°C for 30 s, 57–61ºC (ideal 61°C for 30 s, and 64–68°C for 2 min] and final extension at 72°C for 30 min. In addition, we achieved positive results when running the optimised multiplex PCR tests on Lr19, Lr24 and Lr28. Future studies are planned to expand new wide multiplex PCR method to include all other Lr genes.

  8. Allelic variation at loci controlling stripe rust resistance in spring wheat

    Indian Academy of Sciences (India)

    2014-08-20

    Aug 20, 2014 ... 3Present Address: Department of Agricultural, Food and Nutritional Science, University of Alberta, ... 4Crop Diseases Research Program, National Agricultural Research .... PCR amplified products were resolved on 1.5–3%.

  9. Molecular mapping of stripe rust resistance gene Yr51 in chromosome 4AL of wheat

    Czech Academy of Sciences Publication Activity Database

    Randhawa, M.; Bansal, U.; Valárik, Miroslav; Klocová, Barbora; Doležel, Jaroslav; Bariana, H.

    2014-01-01

    Roč. 127, č. 2 (2014), s. 317-324 ISSN 0040-5752 R&D Projects: GA ČR GAP501/10/1740; GA MŠk(CZ) LO1204 Institutional support: RVO:61389030 Keywords : TRITICUM-AESTIVUM L. * DIVERSITY ARRAYS * MAP Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 3.790, year: 2014

  10. Allelic variation at loci controlling stripe rust resistance in spring wheat

    Indian Academy of Sciences (India)

    ... National Agricultural Research Centre, Islamabad 45500, Pakistan; National Institute for Genomics & Advanced Biotechnology, National Agricultural Research Centre, Park Road, Islamabad 45500, Pakistan; Department of Agricultural, Food and Nutritional Science, University of Alberta, Edmonton, AB T6G 2P5, Canada ...

  11. 21 CFR 137.195 - Crushed wheat.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Crushed wheat. 137.195 Section 137.195 Food and... Related Products § 137.195 Crushed wheat. Crushed wheat, coarse ground wheat, is the food prepared by so crushing cleaned wheat other than durum wheat and red durum wheat that, when tested by the method...

  12. Duplications and losses in gene families of rust pathogens highlight putative effectors

    Directory of Open Access Journals (Sweden)

    Amanda L. Pendleton

    2014-06-01

    Full Text Available Rust fungi are a group of fungal pathogens that cause some of the world’s most destructive diseases of trees and crops. A shared characteristic among rust fungi is obligate biotrophy, the inability to complete a lifecycle without a host. This dependence on a host species likely affects patterns of gene expansion, contraction, and innovation within rust pathogen genomes. The establishment of disease by biotrophic pathogens is reliant upon effector proteins that are encoded in the fungal genome and secreted from the pathogen into the host’s cell apoplast or within the cells. This study uses a comparative genomic approach to elucidate putative effectors and determine their evolutionary histories. We used OrthoMCL to identify nearly 20,000 gene families in proteomes of sixteen diverse fungal species, which include fifteen basidiomycetes and one ascomycete. We inferred patterns of duplication and loss for each gene family and identified families with distinctive patterns of expansion/contraction associated with the evolution of rust fungal genomes. To recognize potential contributors for the unique features of rust pathogens, we identified families harboring secreted proteins that: i arose or expanded in rust pathogens relative to other fungi, or ii contracted or were lost in rust fungal genomes. While the origin of rust fungi appears to be associated with considerable gene loss, there are many gene duplications associated with each sampled rust fungal genome. We also highlight two putative effector gene families that have expanded in Cqf that we hypothesize have roles in pathogenicity.

  13. Duplications and losses in gene families of rust pathogens highlight putative effectors.

    Science.gov (United States)

    Pendleton, Amanda L; Smith, Katherine E; Feau, Nicolas; Martin, Francis M; Grigoriev, Igor V; Hamelin, Richard; Nelson, C Dana; Burleigh, J Gordon; Davis, John M

    2014-01-01

    Rust fungi are a group of fungal pathogens that cause some of the world's most destructive diseases of trees and crops. A shared characteristic among rust fungi is obligate biotrophy, the inability to complete a lifecycle without a host. This dependence on a host species likely affects patterns of gene expansion, contraction, and innovation within rust pathogen genomes. The establishment of disease by biotrophic pathogens is reliant upon effector proteins that are encoded in the fungal genome and secreted from the pathogen into the host's cell apoplast or within the cells. This study uses a comparative genomic approach to elucidate putative effectors and determine their evolutionary histories. We used OrthoMCL to identify nearly 20,000 gene families in proteomes of 16 diverse fungal species, which include 15 basidiomycetes and one ascomycete. We inferred patterns of duplication and loss for each gene family and identified families with distinctive patterns of expansion/contraction associated with the evolution of rust fungal genomes. To recognize potential contributors for the unique features of rust pathogens, we identified families harboring secreted proteins that: (i) arose or expanded in rust pathogens relative to other fungi, or (ii) contracted or were lost in rust fungal genomes. While the origin of rust fungi appears to be associated with considerable gene loss, there are many gene duplications associated with each sampled rust fungal genome. We also highlight two putative effector gene families that have expanded in Cqf that we hypothesize have roles in pathogenicity.

  14. Resistance to rusts (uromyces pisi and u. viciae-fabae) in pea

    OpenAIRE

    Barilli, Eleonora; Sillero, Josefina C.; Prats, Elena; Rubiales, Diego

    2014-01-01

    Pea is the second most important food legume crop in the world. Rust is a pea disease widely distributed, particularly in regions with warm, humid weather. Pea rust can be incited by Uromyces viciae-fabae and by U. pisi. U. viciae-fabae prevails in tropical and subtropical regions such as India and China, while U. pisi prevails in temperate regions. Chemical control of rust is possible, but the use of host plant resistance is the most desired means of rust control. In this paper we revise and...

  15. Design and implementation of expert decision system in Yellow River Irrigation

    Science.gov (United States)

    Fuping, Wang; Bingbing, Lei; Jie, Pan

    2018-03-01

    How to make full use of water resources in the Yellow River irrigation is a problem needed to be solved urgently. On account of the different irrigation strategies in various growth stages of wheat, this paper proposes a novel irrigation expert decision system basing on fuzzy control technique. According to the control experience, expert knowledge and MATLAB simulation optimization, we obtain the irrigation fuzzy control table stored in the computer memory. The controlling irrigation is accomplished by reading the data from fuzzy control table. The experimental results show that the expert system can be used in the production of wheat to achieve timely and appropriate irrigation, and ensure that wheat growth cycle is always in the best growth environment.

  16. The complete nucleotide sequence of the genome of Barley yellow dwarf virus-RMV reveals it to be a new Polerovirus distantly related to other yellow dwarf viruses.

    Science.gov (United States)

    Krueger, Elizabeth N; Beckett, Randy J; Gray, Stewart M; Miller, W Allen

    2013-01-01

    The yellow dwarf viruses (YDVs) of the Luteoviridae family represent the most widespread group of cereal viruses worldwide. They include the Barley yellow dwarf viruses (BYDVs) of genus Luteovirus, the Cereal yellow dwarf viruses (CYDVs) and Wheat yellow dwarf virus (WYDV) of genus Polerovirus. All of these viruses are obligately aphid transmitted and phloem-limited. The first described YDVs (initially all called BYDV) were classified by their most efficient vector. One of these viruses, BYDV-RMV, is transmitted most efficiently by the corn leaf aphid, Rhopalosiphum maidis. Here we report the complete 5612 nucleotide sequence of the genomic RNA of a Montana isolate of BYDV-RMV (isolate RMV MTFE87, Genbank accession no. KC921392). The sequence revealed that BYDV-RMV is a polerovirus, but it is quite distantly related to the CYDVs or WYDV, which are very closely related to each other. Nor is BYDV-RMV closely related to any other particular polerovirus. Depending on the gene that is compared, different poleroviruses (none of them a YDV) share the most sequence similarity to BYDV-RMV. Because of its distant relationship to other YDVs, and because it commonly infects maize via its vector, R. maidis, we propose that BYDV-RMV be renamed Maize yellow dwarf virus-RMV (MYDV-RMV).

  17. The complete nucleotide sequence of the genome of Barley yellow dwarf virus-RMV reveals it to be a new Polerovirus distantly related to other yellow dwarf viruses

    Directory of Open Access Journals (Sweden)

    Elizabeth N. Krueger

    2013-07-01

    Full Text Available The yellow dwarf viruses (YDVs of the Luteoviridae family represent the most widespread group of cereal viruses worldwide. They include the Barley yellow dwarf viruses (BYDVs of genus Luteovirus, the Cereal yellow dwarf viruses (CYDVs and Wheat yellow dwarf virus (WYDV of genus Polerovirus. All of these viruses are obligately aphid transmitted and phloem-limited. The first described YDVs (initially all called BYDV were classified by their most efficient vector. One of these viruses, BYDV-RMV, is transmitted most efficiently by the corn leaf aphid, Rhopalosiphum maidis. Here we report the complete 5612 nucleotide sequence of the genomic RNA of a Montana isolate of BYDV-RMV (isolate RMV MTFE87, Genbank accession no. KC921392. The sequence revealed that BYDV-RMV is a polerovirus, but it is quite distantly related to the CYDVs or WYDV, which are very closely related to each other. Nor is BYDV-RMV closely related to any other particular polerovirus. Depending on the gene that is compared, different poleroviruses (none of them a YDV share the most sequence similarity to BYDV-RMV. Because of its distant relationship to other YDVs, and because it commonly infects maize via its vector, R. maidis, we propose that BYDV-RMV be renamed Maize yellow dwarf virus-RMV (MYDV-RMV.

  18. Tocotrienols and tocopherols in colored-grain wheat, tritordeum and barley.

    Science.gov (United States)

    Lachman, Jaromír; Hejtmánková, Alena; Orsák, Matyáš; Popov, Marek; Martinek, Petr

    2018-02-01

    Colored-grain spring and winter wheat, spring tritordeum and barley (blue aleurone, purple pericarp, and yellow endosperm) from the harvests 2014 and 2015 were evaluated for tocol contents by HPLC-FD. Higher content of total tocols was found in spring wheat varieties compared with winter varieties. Four tocols (β-tocotrienol, α-tocotrienol, β-tocopherol, and α-tocopherol) were identified in wheat and tritordeum varieties. Dominant tocols in purple- and blue-grained wheat and yellow-grained tritordeum were α-tocopherol and β-tocotrienol, whereas spring barley varieties differed from wheat and tritordeum by high α-tocotrienol content. Tocol content was significantly affected by genotype and in a lesser extent in some varieties and lines also by rainfall and temperatures during crop year. Higher rainfall and lower temperatures caused in most varieties higher tocol contents. Purple- and blue-grained wheat lines with higher tocol, anthocyanin and phenolic acids with health benefits may be useful for breeding new varieties. Copyright © 2017 Elsevier Ltd. All rights reserved.

  19. Magnetic property based characterization of rust on weathering steels

    International Nuclear Information System (INIS)

    Mizoguchi, T.; Ishii, Y.; Okada, T.; Kimura, M.; Kihira, H.

    2005-01-01

    The characterization of rusts on weathering steels is important in understanding the origin of their corrosion resistance. Rust consists of several phases, e.g. α-, β- and γ-FeOOH, which are anti-ferromagnetic with different Neel temperatures. Rust on so-called advanced weathering steel containing 3 wt.% Ni [H. Kihira, A. Usami, K. Tanabe, M. Ito, G. Shigesato, Y. Tomita, T. Kusunoki, T. Tsuzuki, S. Ito, T. Murata, in: Proc. Symp. on Corrosion and Corrosion Control in Saltwater Environments, Honolulu, 1999, The Electrochemical Soc., pp. 127-136] contains in addition a ferrimagnetic spinel phase [M. Kimura, H. Kihira, Y. Ishii, T. Mizoguchi, in: Proc. 13th Asian-Pacific Corrosion Control Conference, Osaka, 2003; M. Kimura, H. Kihira, N. Ohta, M. Hashimoto, T. Senuma, Corros. Sci., this volume; M. Kimura, N. Ohta, H. Kihira, Mater. Trans. JIM, in press]. The nanostructure of real rust cannot be elucidated satisfactorily only with conventional analytical methods such as X-ray diffraction, because of the complex mixture of phases with fine and imperfect crystallites. Because of the short range of the super-exchange coupling between Fe ions in a solid, the magnetic properties can give information on local configurations even in the absence of perfect crystalline coherence. Therefore, the magnetic properties of rust samples were investigated in detail using a Superconducting Quantum Interference Device (SQUID) magnetometer and Moessbauer spectroscopy. SQUID magnetometry is effective to determine the quantity of the ferrimagnetic phase. The temperature dependence of the Moessbauer spectrum gives information about not only the fractions of the phases but also the distribution of grain volume, V, in each phase according to the super-paramagnetic relaxation effect. This approach has been applied to rust of conventional [T. Okada, Y. Ishii, T. Mizoguchi, I. Tamura, Y. Kobayashi, Y. Takagi, S. Suzuki, H. Kihira, M. Ito, A. Usami, K. Tanabe, K. Masuda, Jpn. J. Appl. Phys. 39

  20. Protective, curative and eradicative activities of fungicides against grapevine rust

    Directory of Open Access Journals (Sweden)

    Francislene Angelotti

    2014-01-01

    Full Text Available The protective, eradicative and curative activities of the fungicides azoxystrobin, tebuconazole, pyraclostrobin+metiram, and ciproconazole against grapevine rust, were determined in greenhouse. To evaluate the protective activity, leaves of potted ´Niagara´ (Vitis labrusca vines were artificially inoculated with an urediniospore suspension of Phakopsora euvitis four, eight or forteen days after fungicidal spray; and to evaluate the curative and eradicative activities, leaves were sprayed with fungicides two, four or eight days after inoculation. Disease severity was assessed 14 days after each inoculation. All tested fungicides present excellent preventive activity against grapevine rust; however, tebuconazole and ciproconazole provide better curative activity than azoxystrobin and pyraclostrobin+metiram. It was observed also that all tested fungicides significantly reduced the germination of urediniospore produced on sprayed leaves.

  1. Study of a low alloy steel rust using Moessbauer spectroscopy

    International Nuclear Information System (INIS)

    Maier, I.A.; Saragovi-Badler, C.; Labenski, F.

    1978-01-01

    Moessbauer spectroscopy has been used to analyze the internal and external rust layers of a weathering steel exposed for ten months to an urban-industrial atmosphere. Superparamagnetic α-FeOOH and γ-FeOOH were found in both layers. The external one also contained small sized delta-FeOOH and/or amorphous iron oxyhydroxide. These compounds were not present in the internal layer at this stage of the patina formation. (author)

  2. Influence of lactate ions on the formation of rust

    International Nuclear Information System (INIS)

    Sabot, R.; Jeannin, M.; Gadouleau, M.; Guo, Q.; Sicre, E.; Refait, Ph.

    2007-01-01

    The formation of rust can be simulated by oxidation of aqueous suspensions of Fe(OH) 2 obtained by mixing solutions of NaOH and a Fe(II) salt. The aim of this study was to investigate the influence of organic species associated with microbially influenced corrosion. The lactate anion, often used as a carbon and electrons source for the development of microorganisms, was chosen as an example. Then, in the first part of the study, Fe(OH) 2 was precipitated using iron(II) lactate and NaOH. Its oxidation process involved two stages, as usually observed. The first stage led to a Fe(II-III) intermediate compound, the lactate green rust, GR(C 3 H 5 O 3 - ). This compound has never been reported yet. Its existence demonstrates that the GR structure is able to incorporate a very wide range of anions, whatever the size and geometry. The second stage corresponded to the oxidation of GR(C 3 H 5 O 3 - ). It led to ferrihydrite, the most poorly ordered form of iron(III) oxides and oxyhydroxides. In the second part of the study, the formation of rust in seawater was simulated by oxidation of Fe(OH) 2 in an aqueous media containing both Cl - and SO 4 2- anions. The first stage led to the sulphate green rust, GR(SO 4 2- ), the second stage to lepidocrocite γ-FeOOH. Small amounts of iron(II) lactate were added to the reactants. Lactate ions did not modify the first stage but drastically perturbed the second stage, as ferrihydrite was obtained instead of γ-FeOOH

  3. Induced mutations in beans and peas for resistance to rust

    International Nuclear Information System (INIS)

    Fadl, F.A.M.

    1983-01-01

    Gamma rays and ethyl methanesulphonate (EMS) were applied in a mutation-induction programme for rust resistance in bean and pea. Bean and pea seeds were pre-soaked 2 hours before irradiation with 9, 10 and 12 krad. For chemical mutagen treatments bean and pea seeds were pre-soaked for 8 hours and treated with 0.5 and 1.5% EMS for four hours. M 2 seeds of beans and peas were planted in 1979. Resistant M 2 plants were selected for their rust resistance and other morphological characters. M 3 seeds of selected plants were planted in 1980. In 1980 more seeds of the same varieties of beans and peas were treated with 0.1 and 0.3% EMS with the aim to produce rust-resistant mutants. Seed germination was reduced by gamma rays or EMS. Dwarf, malformed and abnormal plants were noticed. Some resistant M 2 plants selected gave high grain yields. Some were different in morphological characters. In the M 3 of selected plants various other mutant characters appeared, such as different height of plants, early and late flowering, resistance to powdery mildew in peas, altered grain yield, thickness of stem, pod shape and flower colour. (author)

  4. The complete nucleotide sequence of the barley yellow dwarf GPV isolate from China shows that it is a new member of the genus Polerovirus.

    Science.gov (United States)

    Zhang, Wenwei; Cheng, Zhuomin; Xu, Lei; Wu, Maosen; Waterhouse, Peter; Zhou, Guanghe; Li, Shifang

    2009-01-01

    The complete nucleotide sequence of the ssRNA genome of a Chinese GPV isolate of barley yellow dwarf virus (BYDV) was determined. It comprised 5673 nucleotides, and the deduced genome organization resembled that of members of the genus Polerovirus. It was most closely related to cereal yellow dwarf virus-RPV (77% nt identity over the entire genome; coat protein amino acid identity 79%). The GPV isolate also differs in vector specificity from other BYDV strains. Biological properties, phylogenetic analyses and detailed sequence comparisons suggest that GPV should be considered a member of a new species within the genus, and the name Wheat yellow dwarf virus-GPV is proposed.

  5. Smog Yellows Taj Mahal

    Science.gov (United States)

    2007-01-01

    Built as a monument to the favorite wife of the Mughal Emperor Shah Jahan, the Taj Mahal has watched over the city of Agra, India, since the mid-seventeenth century with its pillars of gleaming white marble. By the spring of 2007, however, one of the world's most visited landmarks was turning yellow, and a panel of India's parliament had little trouble identifying the culprit: pollution. The panel blamed particles of soot and dirt suspended high in the atmosphere for the Taj Mahal's dinginess. The Taj Mahal's home, Agra, sits not far from the base of the Himalaya, and smog regularly collects along the southern side of the mountain range. On May 16, 2007, the Moderate Resolution Imaging Spectroradiometer (MODIS) on NASA's Terra satellite captured this image of the area around Agra, India. The closeup image shows the immediate vicinity of the Taj Majal. The larger image shows the surrounding area. In both pictures, dingy, gray-beige haze obscures the satellite's view of the land surface. India had tried to minimize the adverse impact of air pollution on the famous landmark. According to the BBC, in the late 1990s, India's Supreme Court ordered the closure of thousands of iron foundries and kilns that had belched smoke near the monument. Many of the 3 million tourists who visited the Taj Majal each year approached the monument on horse-drawn carriages or battery-operated buses as fossil-fuel-powered vehicles could not drive within 2 kilometers (1.5 miles). Since those efforts have failed to save the Taj Majal's complexion, Indian officials have considered applying a cleansing mud pack to the monument's surface to draw out the dirt. As India industrializes, smog results, and the Taj Mahal's gleaming whiteness is only one casualty. Pollution has been blamed for a decrease in Indian rice harvests, which had soared during the 'Green Revolution' of the 1960s and 1970s. Haze and dust also appear to bring on the region's monsoon rains earlier than normal.

  6. 17DD yellow fever vaccine

    Science.gov (United States)

    Martins, Reinaldo M.; Maia, Maria de Lourdes S.; Farias, Roberto Henrique G.; Camacho, Luiz Antonio B.; Freire, Marcos S.; Galler, Ricardo; Yamamura, Anna Maya Yoshida; Almeida, Luiz Fernando C.; Lima, Sheila Maria B.; Nogueira, Rita Maria R.; Sá, Gloria Regina S.; Hokama, Darcy A.; de Carvalho, Ricardo; Freire, Ricardo Aguiar V.; Filho, Edson Pereira; Leal, Maria da Luz Fernandes; Homma, Akira

    2013-01-01

    Objective: To verify if the Bio-Manguinhos 17DD yellow fever vaccine (17DD-YFV) used in lower doses is as immunogenic and safe as the current formulation. Results: Doses from 27,476 IU to 587 IU induced similar seroconversion rates and neutralizing antibodies geometric mean titers (GMTs). Immunity of those who seroconverted to YF was maintained for 10 mo. Reactogenicity was low for all groups. Methods: Young and healthy adult males (n = 900) were recruited and randomized into 6 groups, to receive de-escalating doses of 17DD-YFV, from 27,476 IU to 31 IU. Blood samples were collected before vaccination (for neutralization tests to yellow fever, serology for dengue and clinical chemistry), 3 to 7 d after vaccination (for viremia and clinical chemistry) and 30 d after vaccination (for new yellow fever serology and clinical chemistry). Adverse events diaries were filled out by volunteers during 10 d after vaccination. Volunteers were retested for yellow fever and dengue antibodies 10 mo later. Seropositivity for dengue was found in 87.6% of volunteers before vaccination, but this had no significant influence on conclusions. Conclusion: In young healthy adults Bio-Manguinhos/Fiocruz yellow fever vaccine can be used in much lower doses than usual. International Register ISRCTN 38082350. PMID:23364472

  7. Spread, genetic variation and methods for the detection of Puccinia kuehnii, the causal agent of sugarcane orange rust.

    Science.gov (United States)

    Sugarcane is susceptible to infection by two rust pathogens, Puccinia melanocephala and P. kuehnii, causing brown and orange rust, respectively. Orange rust of sugarcane was first reported in the Western hemisphere in Florida in July 2007. The pathogen was found to be distributed widely throughout t...

  8. External nitrogen input affects pre- and post-harvest cell wall composition but not the enzymatic saccharification of wheat straw

    DEFF Research Database (Denmark)

    Baldwin, Laetitia Andrée; Glazowska, Sylwia Emilia; Mravec, Jozef

    2017-01-01

    Wheat is one of the most important crops for food and feed and its straw is a potential feedstock for biorefinery purposes. Nitrogen (N) is an essential input factor in wheat agriculture but no information is available on how it affects straw composition during maturation and at harvest....... To investigate this, we conducted a large scale field experiment in which wheat plants were cultivated at three levels of externally applied N. The plants were harvested at different stages of maturation, spanning green straw at heading (ear emergence) to fully yellow straw at final maturity. Defined parts...

  9. Morphology and AFLP markers suggest three Hordeum chilense ecotypes that differ in avoidance to rust fungi

    NARCIS (Netherlands)

    Vaz Patto, M.C.; Aardse, A.; Buntjer, J.; Rubiales, D.; Martin, A.; Niks, R.E.

    2001-01-01

    In Hordeum chilense Roem. & Schult., a high variation in the level of avoidance to infection of barley leaf rust (Puccinia hordei Otth) occurs. Probably resulting from the properties of the stomata, the rust germ tube overgrows stomata, and the infection process fails in an early stage. In the

  10. Unveiling common responses of Medicago truncatula to appropriate and inappropriate rust species

    Science.gov (United States)

    Vaz Patto, Maria Carlota; Rubiales, Diego

    2014-01-01

    Little is known about the nature of effective defense mechanisms in legumes to pathogens of remotely related plant species. Some rust species are among pathogens with broad host range causing dramatic losses in various crop plants. To understand and compare the different host and nonhost resistance (NHR) responses of legume species against rusts, we characterized the reaction of the model legume Medicago truncatula to one appropriate (Uromyces striatus) and two inappropriate (U. viciae-fabae and U. lupinicolus) rusts. We found that similar pre and post-haustorial mechanisms of resistance appear to be operative in M. truncatula against appropriate and inappropriate rust fungus. The appropriate U. striatus germinated better on M. truncatula accessions then the inappropriate U. viciae-fabae and U. lupinicolus, but once germinated, germ tubes of the three rusts had a similar level of success in finding stomata and forming an appressoria over a stoma. However, responses to different inappropriate rust species also showed some specificity, suggesting a combination of non-specific and specific responses underlying this legume NHR to rust fungi. Further genetic and expression analysis studies will contribute to the development of the necessary molecular tools to use the present information on host and NHR mechanisms to breed for broad-spectrum resistance to rust in legume species. PMID:25426128

  11. Bulked fusiform rust inocula and Fr gene interactions in loblolly pine

    Science.gov (United States)

    Fikret Isik; Henry Amerson; Saul Garcia; Ross Whetten; Steve. McKeand

    2012-01-01

    Fusiform rust disease in loblolly (Pinus taeda L.) and slash (Pinus elliottii Engelm. var elliottii) pine plantations in the southern United States causes multi-million dollar annual losses. The disease is endemic to the region. The fusiform rust fungus (Cronartium quercuum sp.

  12. Genetic and environmental variation in rust frequency on mature mountain birch trees

    Energy Technology Data Exchange (ETDEWEB)

    Elamo, Pirjo; Saloniemi, Irma; Helander, M.L.; Neuvonen, Seppo [Turku Univ. (Finland). Dept. of Biology) and (Kevo Subarctic Research Inst., Turku (Finland)

    2000-07-01

    This study investigated genetic and environmental variation in the frequency of birch rust, the most important leaf disease of birch species, The same half-sib families of mature mountain birch trees were studied in two areas corresponding to their natural growing habitats over 3 yrs. The frequency of birch rust was examined both in the field and from detached leaves inoculated in the laboratory. The frequency of birch rust varied among the mountain birch families. However, the heritability of birch rust resistance was found to be fairly low, with the heritability of naturally occurring birch rust varying between 0.27 and 0.41. The frequency of birch rust varied highly between the two study areas and among study years. Nevertheless, the relative frequency of birch rust among tree individuals and tree families remained similar and as a result no notable genotype x environment interaction was observed. The field and in vitro results differed with respect to the ranking of birch families by birch rust resistance.

  13. Current and future molecular approaches to investigate the white pine blister rust pathosystem

    Science.gov (United States)

    B. A. Richardson; A. K. M. Ekramoddoulah; J.-J. Liu; M.-S. Kim; N. B. Klopfenstein

    2010-01-01

    Molecular genetics is proving to be especially useful for addressing a wide variety of research and management questions on the white pine blister rust pathosystem. White pine blister rust, caused by Cronartium ribicola, is an ideal model for studying biogeography, genetics, and evolution because: (1) it involves an introduced pathogen; (2) it includes multiple primary...

  14. Effect of orange rust on sugarcane breeding program at canal Point

    Science.gov (United States)

    Orange rust of sugarcane (Saccharum spp. hybrids), caused by Puccinia kuehnii (W. Krüger) E.J. Butler, appeared in the Western Hemisphere ten years ago. Orange rust substantially reduces yields in susceptible sugarcane genotypes. Majority of the commercial cultivars were susceptible at the time of o...

  15. Abnormal germling development by brown rust and powdery mildew on cer barley mutants

    NARCIS (Netherlands)

    Rubiales, D.; Ramirez, M.C.; Carver, T.L.W.; Niks, R.E.

    2001-01-01

    The barley leaf rust fungus forms appressoria over host leaf stomata and penetrates via the stomatal pore. High levels of avoidance to leaf rust fungi have been described in some wild accessions of Hordeum species where a prominent wax layer on the stomata inhibits triggering of fungal appressorium

  16. Prescreening slash pine and Cronartium pedigrees for evaluation of complementary gene action in fusiform rust disease.

    Science.gov (United States)

    H.E. Stelzer; Robert L. Doudrick; Thomas L. Kubisiak; C. Dana Nelson

    1999-01-01

    Single-urediniospore cultures of the fusiform rust fungus were used to inoculate seedlings from 10 full-sib families of a five-parent slash pine diallel at two different times in 1994. The presence or absence of fusiform rust galls was recorded for each inoculated seedling at 9 months postinoculation, and percent infection levels for each family-inoculum-time...

  17. Unveiling common responses of Medicago truncatula to appropriate and inappropriate rust species

    Directory of Open Access Journals (Sweden)

    Maria Carlota eVaz Patto

    2014-11-01

    Full Text Available Little is known about the nature of effective defense mechanisms in legumes to pathogens of remotely related plant species. Some rust species are among pathogens with broad host range causing dramatic losses in various crop plants. To understand and compare the different host and nonhost resistance responses of legume species against rusts, we characterized the reaction of the model legume Medicago truncatula to one appropriate (Uromyces striatus and two inappropriate (U. viciae-fabae and U. lupinicolus rusts. We found that similar pre and post-haustorial mechanisms of resistance appear to be operative in M. truncatula against appropriate and inappropriate rust fungus. The appropriate U. striatus germinated better on M. truncatula accessions then the inappropriate U. viciae-fabae and U. lupinicolus, but once germinated, germ tubes of the three rusts had a similar level of success in finding stomata and forming an appressoria over a stoma. However responses to different inappropriate rust species also showed some specificity, suggesting a combination of non specific and specific responses underlying this legume nonhost resistance to rust fungi. Further genetic and expression analysis studies will contribute to the development of the necessary molecular tools to use the present information on host and nonhost resistance mechanisms to breed for broad-spectrum resistance to rust in legume species.

  18. Low average blister-rust infection rates may mean high control costs

    Science.gov (United States)

    Robert Marty

    1965-01-01

    The Northeastern Forest Experiment Station, in cooperation with Federal and State forest-pest-control agencies, undertook a survey of blister-rust infection rates in the white pine region of the East during 1962 and 1963. Those engaged in blister-rust-control activities will not be surprised at the survey's results. We found that infection rates were significantly...

  19. Determining yield loss caused by brown rust in production fields of sugarcane

    Science.gov (United States)

    Infections of Puccinia melanocephala, the causal agent of brown rust, appear on Louisiana sugarcane in the spring. Disease expression is usually limited to 2 to 3 months until temperatures exceed those favorable for spore production. The affected sugarcane is harvested 4 to 6 months after rust sympt...

  20. Utilization of a major brown rust resistance gene in sugarcane breeding

    Science.gov (United States)

    Brown rust, caused by Puccinia melanocephala has had devastating effects on sugarcane (Saccharum spp.) breeding programs and on commercial production. The discovery of Bru1, a major gene conferring resistance to brown rust represented a substantial breakthrough and markers for the detection of Bru1 ...

  1. Detection, breeding, and selection of durable resistance to brown rust in sugarcane

    Science.gov (United States)

    Brown rust, caused by Puccinia melanocephala, is an important disease of sugarcane in Louisiana. The adaptability of the pathogen has repeatedly resulted in resistant cultivars becoming susceptible once they are widely grown. The frequency of the brown rust resistance gene Bru1 was low in the breedi...

  2. Screening for sugarcane brown rust in first clonal stage of the Canal Point sugarcane breeding program

    Science.gov (United States)

    Sugarcane (Saccharum spp.) brown rust (caused by Puccinia melanocephala H. & P. Sydow) was first reported in the United States in 1978 and is still one of great challenges for sugarcane production. A better understanding of sugarcane genotypic variation in response to brown rust will help optimize b...

  3. Biology and pathology of Ribes and their implications for management of white pine blister rust

    Science.gov (United States)

    P. J. Zambino

    2010-01-01

    Ribes (currants and gooseberries) are telial hosts for the introduced and invasive white pine blister rust fungus, Cronartium ribicola. Knowledge of wild and introduced Ribes helps us understand the epidemiology of blister rust on its aecial hosts, white pines, and develop disease control and management strategies. Ribes differ by species in their contribution to...

  4. Genome-Wide Association Mapping of Crown Rust Resistance in Oat Elite Germplasm.

    Science.gov (United States)

    Klos, Kathy Esvelt; Yimer, Belayneh A; Babiker, Ebrahiem M; Beattie, Aaron D; Bonman, J Michael; Carson, Martin L; Chong, James; Harrison, Stephen A; Ibrahim, Amir M H; Kolb, Frederic L; McCartney, Curt A; McMullen, Michael; Fetch, Jennifer Mitchell; Mohammadi, Mohsen; Murphy, J Paul; Tinker, Nicholas A

    2017-07-01

    Oat crown rust, caused by f. sp. , is a major constraint to oat ( L.) production in many parts of the world. In this first comprehensive multienvironment genome-wide association map of oat crown rust, we used 2972 single-nucleotide polymorphisms (SNPs) genotyped on 631 oat lines for association mapping of quantitative trait loci (QTL). Seedling reaction to crown rust in these lines was assessed as infection type (IT) with each of 10 crown rust isolates. Adult plant reaction was assessed in the field in a total of 10 location-years as percentage severity (SV) and as infection reaction (IR) in a 0-to-1 scale. Overall, 29 SNPs on 12 linkage groups were predictive of crown rust reaction in at least one experiment at a genome-wide level of statistical significance. The QTL identified here include those in regions previously shown to be linked with seedling resistance genes , , , , , and and also with adult-plant resistance and adaptation-related QTL. In addition, QTL on linkage groups Mrg03, Mrg08, and Mrg23 were identified in regions not previously associated with crown rust resistance. Evaluation of marker genotypes in a set of crown rust differential lines supported as the identity of . The SNPs with rare alleles associated with lower disease scores may be suitable for use in marker-assisted selection of oat lines for crown rust resistance. Copyright © 2017 Crop Science Society of America.

  5. MICROCOSM STUDY OF DEGRADATION OF CHLORINATED SOLVENTS ON SYNTHETIC GREEN RUST MINERALS

    Science.gov (United States)

    Green rust minerals contain ferrous ion in their structure that can potentially serve as a chemical reductant for degradation of chlorinated solvents. Green rusts are found in zerovalent iron based permeable reactive barriers and in certain soil and sediments. Some previous labor...

  6. White pine blister rust resistance in limber pine: Evidence for a major gene

    Science.gov (United States)

    A. W. Schoettle; R. A. Sniezko; A. Kegley; K. S. Burns

    2014-01-01

    Limber pine (Pinus flexilis) is being threatened by the lethal disease white pine blister rust caused by the non-native pathogen Cronartium ribicola. The types and frequencies of genetic resistance to the rust will likely determine the potential success of restoration or proactive measures. These first extensive inoculation trials using individual tree seed collections...

  7. Genome-wide association study of rust traits in orchardgrass using SLAF-seq technology.

    Science.gov (United States)

    Zeng, Bing; Yan, Haidong; Liu, Xinchun; Zang, Wenjing; Zhang, Ailing; Zhou, Sifan; Huang, Linkai; Liu, Jinping

    2017-01-01

    While orchardgrass ( Dactylis glomerata L.) is a well-known perennial forage species, rust diseases cause serious reductions in the yield and quality of orchardgrass; however, genetic mechanisms of rust resistance are not well understood in orchardgrass. In this study, a genome-wide association study (GWAS) was performed using specific-locus amplified fragment sequencing (SLAF-seq) technology in orchardgrass. A total of 2,334,889 SLAF tags were generated to produce 2,309,777 SNPs. ADMIXTURE analysis revealed unstructured subpopulations for 33 accessions, indicating that this orchardgrass population could be used for association analysis. Linkage disequilibrium (LD) analysis revealed an average r 2 of 0.4 across all SNP pairs, indicating a high extent of LD in these samples. Through GWAS, a total of 4,604 SNPs were found to be significantly ( P  rust trait. The bulk analysis discovered a number of 5,211 SNPs related to rust trait. Two candidate genes, including cytochrome P450, and prolamin were implicated in disease resistance through prediction of functional genes surrounding each high-quality SNP ( P  rust traits based on GWAS analysis and bulk analysis. The large number of SNPs associated with rust traits and these two candidate genes may provide the basis for further research on rust resistance mechanisms and marker-assisted selection (MAS) for rust-resistant lineages.

  8. Resistance to white pine blister rust in Pinus flexilis and P

    Science.gov (United States)

    Anna W. Schoettle; Richard A. Sniezko; Angelia Kegley; Jerry Hill; Kelly S. Burns

    2010-01-01

    The non-native fungus Cronartium ribicola, that causes white pine blister rust (WPBR), is impacting or threatening limber pine, Pinus flexilis, and Rocky Mountain bristlecone pine, Pinus aristata. In the Southern Rockies, where the rust invasion is still expanding, we have the opportunity to be proactive and prepare the landscape for invasion. Genetic...

  9. Blister rust in North America: What we have not learned in the past 100 years

    Science.gov (United States)

    Eugene P. Van Arsdel; Brian W. Geils

    2011-01-01

    Introduction of Cronartium ribicola (white pine blister rust) greatly motivated development of tree disease control and research in America. Although foresters and pathologists have learned much in the past 100 years, more remains to learn. The most important lesson is that fear of blister rust has reduced pine regeneration more than the disease itself. Based on six...

  10. CHEMICAL INTERACTIONS OF ARSENATE, ARSENITE, PHOSPHATE, AND SILICATE WITH IRON (II, III) HYDROXYCARBONATE GREEN RUST

    Science.gov (United States)

    Granular zerovalent iron has been proposed to be used as a medium in permeable reactive barriers (PRBs) to remove arsenic from contaminated groundwater. Iron(II, III) hydroxycarbonate green rust (carbonate green rust, or CGR) is a major corrosion product of zerovalent iron under ...

  11. Long-term changes in fusiform rust incidence in the southeastern United States

    Science.gov (United States)

    KaDonna C. Randolph; Ellis B. Cowling; Dale A. Starkey

    2015-01-01

    Fusiform rust is the most devastating disease of slash pine (Pinus elliottii) and loblolly pine (Pinus taeda) in the southeastern United States. Since the 1970s, the USDA Forest Service Forest Inventory and Analysis (FIA) Program has assessed fusiform rust incidence on its network of ground plots in 13 states across the...

  12. Induced spherococcoid hard wheat

    International Nuclear Information System (INIS)

    Yanev, Sh.

    1981-01-01

    A mutant has been obtained - a spheroccocoid line -through irradiation of hard wheat seed with fast neutrons. It is distinguished by semispherical glumes and smaller grain; the plants have low stem with erect leaves but with shorter spikes and with lesser number of spikelets than those of the initial cultivar. Good productive tillering and resistance to lodging contributed to 23.5% higher yield. The line was superior to the standard and the initial cultivars by 14.2% as regards protein content, and by up to 22.8% - as to flour gluten. It has been successfully used in hybridization producing high-yielding hard wheat lines resistant to lodging, with good technological and other indicators. The possibility stated is of obtaining a spherococcoid mutant in tetraploid (hard) wheat out of the D-genome as well as its being suited to hard wheat breeding to enhance protein content, resistance to lodging, etc. (author)

  13. Genetic characterization of Moroccan and the exotic bread wheat cultivars using functional and random DNA markers linked to the agronomic traits for genomics-assisted improvement.

    Science.gov (United States)

    Henkrar, Fatima; El-Haddoury, Jamal; Ouabbou, Hassan; Bendaou, Najib; Udupa, Sripada M

    2016-06-01

    Genetic characterization, diversity analysis and estimate of the genetic relationship among varieties using functional and random DNA markers linked to agronomic traits can provide relevant guidelines in selecting parents and designing new breeding strategies for marker-assisted wheat cultivar improvement. Here, we characterize 20 Moroccan and 19 exotic bread wheat (Triticum aestivum L.) cultivars using 47 functional and 7 linked random DNA markers associated with 21 loci of the most important traits for wheat breeding. The functional marker analysis revealed that 35, 45, and 10 % of the Moroccan cultivars, respectively have the rust resistance genes (Lr34/Yr18/Pm38), dwarfing genes (Rht1b or Rht2b alleles) and the leaf rust resistance gene (Lr68). The marker alleles for genes Lr37/Yr17/Sr38, Sr24 and Yr36 were present only in the exotic cultivars and absent in Moroccan cultivars. 25 % of cultivars had 1BL.1RS translocation. 70 % of the wheat cultivars had Ppo-D1a and Ppo-A1b associated with low polyphenol oxidase activity. 10 % of cultivars showed presence of a random DNA marker allele (175 bp) linked to Hessian fly resistance gene H22. The majority of the Moroccan cultivars were carrying alleles that impart good bread making quality. Neighbor joining (NJ) and principal coordinate analysis based on the marker data revealed a clear differentiation between elite Moroccan and exotic wheat cultivars. The results of this study are useful for selecting suitable parents for making targeted crosses in marker-assisted wheat breeding and enhancing genetic diversity in the wheat cultivars.

  14. Characterization of the rust formed on weathering steel exposed to Qinghai salt lake atmosphere

    International Nuclear Information System (INIS)

    Li, Q.X.; Wang, Z.Y.; Han, W.; Han, E.H.

    2008-01-01

    The product formed on weathering steel exposed to salt lake atmosphere for 12 months was investigated by X-ray diffraction (XRD), infrared transmission spectroscopy (IRS), scanning electron microscopy (SEM), electron probe micro analyzer (EPMA) and electrochemical techniques. The rust was mainly composed of β-FeOOH, Fe 8 (O,OH) 16 Cl 1.3 and a little γ-FeOOH. Amorphous δ-FeOOH was only on skyward surface. The rust layer suppressed anodic reaction and facilitated the cathodic reaction. The very small value of rust resistance R r in this work indicated that the rust had poor protective ability. Cl element was rich in the whole rust layer and played an important role in accelerating the corrosion of weathering steel in salt lake atmosphere

  15. Mechanical properties of the rust layer induced by impressed current method in reinforced mortar

    International Nuclear Information System (INIS)

    Care, S.; Nguyen, Q.T.; L'Hostis, V.; Berthaud, Y.

    2008-01-01

    This paper describes the mechanical effects of rust layer formed in reinforced mortar through accelerated tests of corrosion. The morphological and physico-chemical properties (composition, structures) of the corrosion system were characterized at different stages by using optical microscope and scanning electron microscope coupled with energy dispersive spectroscopy. The corrosion pattern was mainly characterized by a rust layer confined at the interface between the steel and the mortar. Expansion coefficient of rust products was determined from the rust thickness and the Faraday's law. Furthermore, in order to understand the mechanical effects of corrosion on the damage of mortar, displacement field measurements were obtained by using digital image correlation. An analytical model (hollow cylinder subjected to inner and outer pressures) was used with a set of experimental data to deduce the time of cracking and the order of magnitude of the mechanical properties of the rust layer

  16. Functional and DNA-protein binding studies of WRKY transcription factors and their expression analysis in response to biotic and abiotic stress in wheat (Triticum aestivum L.).

    Science.gov (United States)

    Satapathy, Lopamudra; Kumar, Dhananjay; Kumar, Manish; Mukhopadhyay, Kunal

    2018-01-01

    WRKY, a plant-specific transcription factor family, plays vital roles in pathogen defense, abiotic stress, and phytohormone signalling. Little is known about the roles and function of WRKY transcription factors in response to rust diseases in wheat. In the present study, three TaWRKY genes encoding complete protein sequences were cloned. They belonged to class II and III WRKY based on the number of WRKY domains and the pattern of zinc finger structures. Twenty-two DNA-protein binding docking complexes predicted stable interactions of WRKY domain with W-box. Quantitative real-time-PCR using wheat near-isogenic lines with or without Lr28 gene revealed differential up- or down-regulation in response to biotic and abiotic stress treatments which could be responsible for their functional divergence in wheat. TaWRKY62 was found to be induced upon treatment with JA, MJ, and SA and reduced after ABA treatments. Maximum induction of six out of seven genes occurred at 48 h post inoculation due to pathogen inoculation. Hence, TaWRKY (49, 50 , 52 , 55 , 57, and 62 ) can be considered as potential candidate genes for further functional validation as well as for crop improvement programs for stress resistance. The results of the present study will enhance knowledge towards understanding the molecular basis of mode of action of WRKY transcription factor genes in wheat and their role during leaf rust pathogenesis in particular.

  17. 21 CFR 137.190 - Cracked wheat.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Cracked wheat. 137.190 Section 137.190 Food and... Related Products § 137.190 Cracked wheat. Cracked wheat is the food prepared by so cracking or cutting into angular fragments cleaned wheat other than durum wheat and red durum wheat that, when tested by...

  18. Wheat for Kids! [and] Teacher's Guide.

    Science.gov (United States)

    Idaho Wheat Commission, Boise.

    "Wheat for Kids" contains information at the elementary school level about: the structure of the wheat kernel; varieties of wheat and their uses; growing wheat; making wheat dough; the U.S. Department of Agriculture Food Guide Pyramid and nutrition; Idaho's part of the international wheat market; recipes; and word games based on the…

  19. Palm yellows phytoplasmas and their genetic classification

    African Journals Online (AJOL)

    ntushk

    African Journal of Biotechnology. Review. Palm yellows phytoplasmas and their genetic ... lethal yellowing-type phytoplasma disease was recorded on a number of palm species of mainly ..... Immunodominant membrane protein (imp) Gene.

  20. Correlation between RUST assessments of fracture healing to structural and biomechanical properties.

    Science.gov (United States)

    Cooke, Margaret E; Hussein, Amira I; Lybrand, Kyle E; Wulff, Alexander; Simmons, Erin; Choi, Jeffrey H; Litrenta, Jody; Ricci, William M; Nascone, Jason W; O'Toole, Robert V; Morgan, Elise F; Gerstenfeld, Louis C; Tornetta, Paul

    2018-03-01

    Radiographic Union Score for Tibia (RUST) and modified RUST (mRUST) are radiographic tools for quantitatively evaluating fracture healing using a cortical scoring system. This tool has high intra-class correlation coefficients (ICCs); however, little evidence has evaluated the scores against the physical properties of bone healing. Closed, stabilized fractures were made in the femora of C3H/HeJ male mice (8-12 week-old) of two dietary groups: A control and a phosphate restricted diet group. Micro-computed tomography (µCT) and torsion testing were carried out at post-operative days (POD) 14, 21, 35, and 42 (n = 10-16) per group time-point. Anteroposterior and lateral radiographic views were constructed from the µCT scans and scored by five raters. The raters also indicated if the fracture were healed. ICCs were 0.71 (mRUST) and 0.63 (RUST). Both RUST scores were positively correlated with callus bone mineral density (BMD) (r = 0.85 and 0.80, p RUST scores positively correlated with callus strength (r = 0.35 and 0.26, p RUST ≥10 and had excellent relationship to structural and biomechanical metrics. Effect of delayed healing due to phosphate dietary restrictions was found at later time points with all mechanical properties (p RUST scores (p > 0.318). Clinical relevance of this study is both RUST scores showed high correlation to physical properties of healing and generally distinguished healed vs. non-healed fractures. © 2017 Orthopaedic Research Society. Published by Wiley Periodicals, Inc. J Orthop Res 36:945-953, 2018. © 2017 Orthopaedic Research Society. Published by Wiley Periodicals, Inc.

  1. The half-yellow man

    African Journals Online (AJOL)

    The half-yellow man. BJ Merwitza* and FJ Raala. aFaculty of Health Sciences, Carbohydrate and Lipid Metabolism Research Unit, University of the Witswaterand, Johannesburg, South Africa. *Corresponding author, emails: bmerwitz@hotmail.com, brad.merwitz@gmail.com. Keywords: diffuse normolipaemic planar ...

  2. Plant Guide: Yellow beeplant (Cleome lutea Hook)

    Science.gov (United States)

    Derek Tilley; Jim Cane; Loren St. John; Dan Ogle; Nancy Shaw

    2012-01-01

    Yellow beeplant is a valuable native forage species for bees wasps and butterflies. Over 140 species of native bees have been observed foraging for nectar or pollen on yellow beeplant in southern Utah (Cane, 2008). Yellow beeplant is an annual forb which could provide food to insects in the first growing season of a range seeding (Ogle and others, 2011a). This...

  3. Screening and incorporation of rust resistance from Allium cepa into bunching onion (Allium fistulosum) via alien chromosome addition.

    Science.gov (United States)

    Wako, Tadayuki; Yamashita, Ken-ichiro; Tsukazaki, Hikaru; Ohara, Takayoshi; Kojima, Akio; Yaguchi, Shigenori; Shimazaki, Satoshi; Midorikawa, Naoko; Sakai, Takako; Yamauchi, Naoki; Shigyo, Masayoshi

    2015-04-01

    Bunching onion (Allium fistulosum L.; 2n = 16), bulb onion (Allium cepa L. Common onion group), and shallot (Allium cepa L. Aggregatum group) cultivars were inoculated with rust fungus, Puccinia allii, isolated from bunching onion. Bulb onions and shallots are highly resistant to rust, suggesting they would serve as useful resources for breeding rust resistant bunching onions. To identify the A. cepa chromosome(s) related to rust resistance, a complete set of eight A. fistulosum - shallot monosomic alien addition lines (MAALs) were inoculated with P. allii. At the seedling stage, FF+1A showed a high level of resistance in controlled-environment experiments, suggesting that the genes related to rust resistance could be located on shallot chromosome 1A. While MAAL, multi-chromosome addition line, and hypoallotriploid adult plants did not exhibit strong resistance to rust. In contrast to the high resistance of shallot, the addition line FF+1A+5A showed reproducibly high levels of rust resistance.

  4. Production and evaluation of dwarf and semi-dwarf winter wheat mutants

    International Nuclear Information System (INIS)

    Barabas, Z.; Kertesz, Z.

    1984-01-01

    A special research programme for evolving and evaluating dwarf wheat forms resistant to lodging was carried out at the Cereal Research Institute, Wheat Division, Szeged, Hungary. Seed lots of the two tall winter wheat varieties Jubilejnaya 50 and Partizanka were exposed to gamma ray of 60 Co. With irradiation of 15000 rad 60 Co all of M 1 plants grown in the field were almost totally destroyed in 1980 and about 50% in 1982. In the greenhouse the number of lost M 1 plants was insignificant. Only a small number of plants died both in the greenhouse and in the field when they were irradiated with 5000 rad. A treatment with this lower dose of irradiation probably may help the breeders in selection for winter hardiness. 97 dwarf wheat lines already established were analysed for height character by a top cross method using the variety Jubilejnaya 50 as a tester. Height data of the simultaneously grown parental as well as the F 1 and F 2 offsprings indicated that the majority of them were recessive, except 3 cases where dominant or semi-dominant dwarfism was observed. Noteworthy is the Mx 158 a new semi-dwarf variety candidate, 60-65 cm in height at normal stand and resistant to all the main diseases here (powdery mildew and rusts). Its grain and protein production per unit area is also very good. Some genetically lesser-known dwarf sources were investigated in a complete crossing diallel test. (author)

  5. Wheat Quality Council, Hard Spring Wheat Technical Committee, 2017 Crop

    Science.gov (United States)

    Nine experimental lines of hard spring wheat were grown at up to six locations in 2017 and evaluated for kernel, milling, and bread baking quality against the check variety Glenn. Wheat samples were submitted through the Wheat Quality Council and processed and milled at the USDA-ARS Hard Red Spring...

  6. Damage of Rhopalosiphum padi (L.) (Hemiptera: Aphididae) on wheat plants related to duration time and density of infestation

    International Nuclear Information System (INIS)

    Roza-Gomes, Margarida F.; Salvadori, Jose R.; Schons, Jurema

    2008-01-01

    Aphids are considered relevant pests on wheat either by direct damage through sap sucking or by indirect damage vectoring BYDV (Barley yellow dwarf virus). Rhopalosiphum padi L. has been observed infesting wheat fields with an increasing frequency. The knowledge and the available technology, besides being more related to other aphids species already recognized as pests, they are insufficient to control the specific c problem of R. padi. Thus, this work evaluated the effects of feeding duration and infestation densities of R. padi on seedlings of wheat cv. EMBRAPA 16. rain yield, yield components and the extent of symptoms were recorded. The experiment was carried out in the fi eld under a completely randomized split-plot experimental design with four replications. The main plot was feeding duration (two and seven days) and the sub-plots were infestation densities (zero, two and 10 aphids per plant). Independent on feeding duration, 10 aphids per plant resulted in significant yield losses, reduction of number of heads and tillers per plant. Canopy dry matter was also reduced. Infestations of two and 10 aphids per plant resulted in continuous yellowing of wheat plants from tillering to the end of flowering stage. When aphids fed for seven days on wheat, more yellowing symptoms were observed at the flower stage in comparison with two days feeding. (author)

  7. An overview of sugarcane brown rust in Cuba

    Directory of Open Access Journals (Sweden)

    María La O

    Full Text Available ABSTRACT: Multiple pathogens affect sugarcane, among them Puccinia melanocephala, the causal agent of brown rust. This disease was first reported in Cuba in 1979 when it was responsible for a severe attack on the main sugarcane variety B4362. The aims of the present study were to give an overview of sugarcane brown rust in Cuba and show the current disease situation in the country. A retrospective analysis regard to sugarcane cultivar composition resistant to brown rust in Cuba was carried out. In addition 154 genotypes, including the most used progenitors in the breeding program and commercial varieties were evaluated under natural infection conditions. The identity of P. melanocephala was verified by Polymerase Chain Reaction (PCR and by sequencing the ITS1 region. After the introduction of P. melanocephala into Cuba, the susceptible variety, B4362, was replaced by Ja60-5 which remained resistant until 1998. Since 2002, a varietal policy supported by a governmental resolution establishing that any single cultivar cannot occupy more than 20 % of the production area for each production company, local area and province, has been applied. Out of the genotypes evaluated, 49 showed resistance to the disease and 35 intermediate behavior, while 39 were susceptible and 31, highly susceptible. P. melanocephala was detected by PCR in all symptomatic samples and its identify confirmed by sequencing the ITS1 region. The adopted measurement together with permanent phytosanitary monitoring and commercial release of resistant or intermediate cultivars succeeded in avoiding any new epidemic. Inoculum pressure was reduced, even on susceptible and highly susceptible varieties since, by resolution, they cannot occupy more than 10 % of the planted area.

  8. Effectiveness of carboxylic acids from Pichia membranifaciens against coffee rust

    Directory of Open Access Journals (Sweden)

    Rosa Laura Andrade Melchor

    Full Text Available ABSTRACT Coffee rust is a fungal disease that has affected every coffee-producing region in the world. Given that the effectivity of the protectant and systemic fungicides applied routinely to control the spread of the causative agent of the disease (Hemileia vastatrix has gradually diminished, besides are harmful to mammals and ecosystems, the objective of this work was to search for a mixture of harmless natural compounds with the potential to be applied in the field. So, a yeast strain producing a battery of long-chain carboxylic acids (CA with fungicide properties was isolated from soil of coffee crop and identified as Pichia membranifaciens by ITS sequencing. Culture conditions of the yeast were optimized and the CA in the solution were characterized by Gas Chromatography-Mass Spectrometry (GC-MS as ethyl formate (55.5 g L-1, octadecenoic acid (3.5 g L-1, propionic acid (7.2 g L-1, 3-(octadecanoyl-propionic acid (7.2 g L-1 and methyl acetate (8.4 g L-1. Randomized field studies were conducted in three different locations in Chiapas, México. Five treatments were tested including three concentrations of the CA solution (389, 584 and 778 ppm and copper oxychloride (5 000 ppm as conventional control. The initial coffee rust incidence averages varied between sites: Maravillas (3-9%, Santo Domingo (10-16% and Búcaro (16-22%. The treatments of CA solution proved to be effective at slowing down the progress of the rust disease even for the sites where initial incidence was high. Likewise, the CA solution reduced the viability of H. vastatrix spores, as assessed by fluorescence microscopy.

  9. The effect of baking temperature and buckwheat flour addition on the selected properties of wheat bread

    Directory of Open Access Journals (Sweden)

    A. Selimović

    2014-01-01

    Full Text Available Wholegrain buckwheat flour was used to substitute 15 %, 30 % and 40 % of wheat flour to make buckwheat enriched wheat bread. Proximate composition, sensory evaluation, total phenols content and antioxidant activity of buckwheat enriched wheat breads were analysed and compared with wheat bread. Wholegrain buckwheat flour contained higher total phenols than wheat flour. The incorporation of buckwheat flour from 15 % to 40 % in bread samples increased the total phenols content from 0.25 (mg GA/g d.m. sample to 0.65 (mg GA/g d.m. sample, and antioxidant activity from 208.45 (µmol Fe2+/L extract to 354.45 (µmol Fe2+/L extract. Total phenols content decreased during the baking process, while the antioxidant activity increased. Bread samples with 15 %, 30 % and 40 % of wholegrain buckwheat flour showed lower lightness (L and whiteness index (WI values of crust and crumb colour compared to the wheat bread. Addition of buckwheat flour increased redness (a and yellowness (b colour values for crumb. Sensory results indicating that three breads with buckwheat flour were moderately acceptable. No differences were found in overall sensory attributes between buckwheat flour enriched bread samples with 15 % and wheat bread (control sample.

  10. Resistance of Select Winter Wheat (Triticum aestivum) Cultivars to Rhopalosiphum padi (Hemiptera: Aphididae).

    Science.gov (United States)

    Girvin, John; Whitworth, R Jeff; Rojas, Lina Maria Aguirre; Smith, C Michael

    2017-08-01

    The bird cherry-oat aphid (Rhopalosiphum padi L.) is a global pest of wheat and vectors some of the most damaging strains of barley yellow dwarf virus (BYDV). In years of heavy R. padi infestation, R. padi and BYDV together reduce wheat yields by 30-40% in Kansas and other states of the U.S. Great Plains wheat production area. Cultivation of wheat cultivars resistant to R. padi can greatly reduce production costs and mitigate R. padi-BYDV yield losses, and increase producer profits. This study identified cultivars of hard red and soft white winter wheat with R. padi resistance that suppress R. padi populations or tolerate the effects of R. padi feeding damage. 'Pioneer (S) 25R40,' 'MFA (S) 2248,' 'Pioneer (S) 25R77,' and 'Limagrain LCS Mint' significantly reduced R. padi populations. MFA (S) 2248, Pioneer (S) 25R40, and 'Limagrain LS Wizard' exhibited tolerance expressed as significantly greater aboveground biomass. These findings are significant in that they have identified wheat cultivars currently available to producers, enabling the immediate improvement of tactics to manage R. padi and BYDV in heavily infested areas. Secondarily, these results identify cultivars that are good candidates for use in breeding and genetic analyses of arthropod resistance genes in wheat. © The Authors 2017. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  11. Inheritance of resistance to barley yellow dwarf virus detected by northern blot analysis

    International Nuclear Information System (INIS)

    Lorens, G.F.; Falk, B.W.; Qualset, C.O.

    1989-01-01

    Development of wheat (Triticum aestivum L.) cultivars tolerant to the barley yellow dwarf virus disease (BYD) has been limited by lack of precision in rating plants for response to infection, usually done by visual scoring of plant symptoms under field conditions. Other methodologies have been developed to study the host/pathogen relationship and to assess resistance or susceptibility. In this study northern dot blot analysis was used to determine barley yellow dwarf virus (BYDV) RNA concentrations of six wheat cultivars that differed in visual BYD symptom expression. Plants were infected with the NYPAV (PAV) isolate of BYDV in the greenhouse. At several dates after inoculation crude plant extracts were blotted on nitrocellulose and hybridized with a 32 P-labeled probe of the pPA8 cDNA clone of BYDV. The distribution of PRC for the F 2 population was compared to the distribution of BYD visual symptom scores for 403 F 2 plants of a similar F 2 population of NS 879/4 x Seri 82 under field conditions. The results were qualitatively similar, suggesting that northern dot blot analysis to measure PRC may be useful in understanding the genetics of resistance to BYD. This technique, when incorporated into breeding programs, could be important in the development of highly tolerant wheat cultivars with reduced losses to BYD

  12. Characteristics of superior soybean breeding lines tolerance to rust (Phakopsora pachyrhizi Syd.

    Directory of Open Access Journals (Sweden)

    Alfi Inayati

    2016-04-01

    Full Text Available Soybean rust caused by Phakopsora pachyrhizi is one of the most important diseases which limits soybean production. The aim of this study was to evaluate the resistance of 28 superior soybean lines and their tolerance to rust. The study was conducted at a screen house and arranged in a completely randomized design (CRD; three replications. All genotypes tested were artificially inoculated with P. pachyrhizi, and a set of un-inoculated genotypes was planted as a comparison. Number of pustules was recorded weekly, and resistant criteria was rated based on the International working group on soybean rust IWGSR method. Lesion color (LC, sporulation level (SL, number of uredia (NoU, frequency of pustule which had uredia, and yield were also recorded. Among 28 genotypes tested, only one was categorized as resistant and 2 genotypes were susceptible. Resistant genotypes had few pustules, lower AUDPC values, low disease severity, and Reddish Brown lesion type. Soybean rust affected yield components, i.e. number of intact pods and yield per plant. Yield loses due to rust in this study varied from 5-89%, and the average was 51%. The set of lines from Tanggamus pedigree showed more resistant to rust but less tolerant compared to Sinabung pedigree.How to CiteInayati, A., & Yusnawan, E. (2016. Characteristics of superior soybean breeding lines tolerancet to rust (Phakopsora pachyrhizi Syd.. Biosaintifika: Journal of Biology & Biology Education, 8(1, 47-55.

  13. Study of Rust Effect on the Corrosion Behavior of Reinforcement Steel Using Impedance Spectroscopy

    Science.gov (United States)

    Bensabra, Hakim; Azzouz, Noureddine

    2013-12-01

    Most studies on corrosion of steel reinforcement in concrete are conducted on steel samples with polished surface (free of all oxides) in order to reproduce the same experimental conditions. However, before embedding in concrete, the steel bars are often covered with natural oxides (rust), which are formed during exposure to the atmosphere. The presence of this rust may affect the electrochemical behavior of steel rebar in concrete. In order to understand the effect of rust on the corrosion behavior of reinforcement steel, potentiodynamic and electrochemical impedance spectroscopy (EIS) tests were carried out in a simulated concrete pore solution using steel samples with two different surface conditions: polished and rusted samples. The obtained results have shown that the presence of rust on the steel bar has a negative effect on its corrosion behavior, with or without the presence of chlorides. This detrimental effect can be explained by the fact that the rust provokes a decrease of the electrolyte resistance at the metal-concrete interface and reduces the repassivating ability. In addition, the rust layer acts as a barrier against the hydroxyl ion diffusion, which prevents the realkalinization phenomenon.

  14. Plant-pathogen interactions: leaf physiology alterations in poplars infected with rust (Melampsora medusae).

    Science.gov (United States)

    Gortari, Fermín; Guiamet, Juan José; Graciano, Corina

    2018-01-23

    Rust produced by Melampsora sp. is considered one of the most relevant diseases in poplar plantations. Growth reduction in poplar plantations takes place because rust, like other pathogens, alters leaf physiology. There is not a complete evaluation of several of the physiological traits that can be affected by rust at leaf level. Therefore, the aim of this work was to evaluate, in an integrative way and in the same pathosystem, which physiological processes are affected when Populus deltoides Bartr. ex Marsh. leaves are infected by rust (Melampsora medusae Thümen). Leaves of two clones with different susceptibility to rust were analyzed. Field and pot experiments were performed, and several physiological traits were measured in healthy and infected leaves. We conclude that rust affects leaf mesophyll integrity, and so water movement in the leaf in liquid phase is affected. As a consequence, gas exchange is reduced, affecting both carbon fixation and transpiration. However, there is an increase in respiration rate, probably due to plant and fungal respiration. The increase in respiration rate is important in the reduction of net photosynthetic rate, but also some damage in the photosynthetic apparatus limits leaf capacity to fix carbon. The decrease in chlorophyll content would start later and seems not to explain the reduction in net photosynthetic rate. Both clones, although they have different susceptibility to rust, are affected in the same physiological mechanisms. © The Author(s) 2018. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  15. A reassessment of the risk of rust fungi developing resistance to fungicides.

    Science.gov (United States)

    Oliver, Richard P

    2014-11-01

    Rust fungi are major pathogens of many annual and perennial crops. Crop protection is largely based on genetic and chemical control. Fungicide resistance is a significant issue that has affected many crop pathogens. Some pathogens have rapidly developed resistance and hence are regarded as high-risk species. Rust fungi have been classified as being low risk, in spite of sharing many relevant features with high-risk pathogens. An examination of the evidence suggests that rust fungi may be wrongly classified as low risk. Of the nine classes of fungicide to which resistance has developed, six are inactive against rusts. The three remaining classes are quinone outside inhibitors (QoIs), demethylation inhibitors (DMIs) and succinate dehydrogenase inhibitors (SDHIs). QoIs have been protected by a recently discovered intron that renders resistant mutants unviable. Low levels of resistance have developed to DMIs, but with limited field significance. Older SDHI fungicides were inactive against rusts. Some of the SDHIs introduced since 2003 are active against rusts, so it may be that insufficient time has elapsed for resistance to develop, especially as SDHIs are generally sold in mixtures with other actives. It would therefore seem prudent to increase the level of vigilance for possible cases of resistance to established and new fungicides in rusts. © 2014 Society of Chemical Industry.

  16. Quantifying airborne dispersal routes of pathogens over continents to safeguard global wheat supply.

    Science.gov (United States)

    Meyer, M; Cox, J A; Hitchings, M D T; Burgin, L; Hort, M C; Hodson, D P; Gilligan, C A

    2017-10-01

    Infectious crop diseases spreading over large agricultural areas pose a threat to food security. Aggressive strains of the obligate pathogenic fungus Puccinia graminis f.sp. tritici (Pgt), causing the crop disease wheat stem rust, have been detected in East Africa and the Middle East, where they lead to substantial economic losses and threaten livelihoods of farmers. The majority of commercially grown wheat cultivars worldwide are susceptible to these emerging strains, which pose a risk to global wheat production, because the fungal spores transmitting the disease can be wind-dispersed over regions and even continents 1-11 . Targeted surveillance and control requires knowledge about airborne dispersal of pathogens, but the complex nature of long-distance dispersal poses significant challenges for quantitative research 12-14 . We combine international field surveys, global meteorological data, a Lagrangian dispersion model and high-performance computational resources to simulate a set of disease outbreak scenarios, tracing billions of stochastic trajectories of fungal spores over dynamically changing host and environmental landscapes for more than a decade. This provides the first quantitative assessment of spore transmission frequencies and amounts amongst all wheat producing countries in Southern/East Africa, the Middle East and Central/South Asia. We identify zones of high air-borne connectivity that geographically correspond with previously postulated wheat rust epidemiological zones (characterized by endemic disease and free movement of inoculum) 10,15 , and regions with genetic similarities in related pathogen populations 16,17 . We quantify the circumstances (routes, timing, outbreak sizes) under which virulent pathogen strains such as 'Ug99' 5,6 pose a threat from long-distance dispersal out of East Africa to the large wheat producing areas in Pakistan and India. Long-term mean spore dispersal trends (predominant direction, frequencies, amounts) are

  17. Creation and validation of a simulator for corneal rust ring removal.

    Science.gov (United States)

    Mednick, Zale; Tabanfar, Reza; Alexander, Ashley; Simpson, Sarah; Baxter, Stephanie

    2017-10-01

    To create and validate a simulation model for corneal rust ring removal. Rust rings were created on cadaveric eyes with the use of small particles of metal. The eyes were mounted on suction plates at slit lamps and the trainees practiced rust ring removal. An inexperienced cohort of medical students and first year ophthalmology residents (n=11), and an experienced cohort of senior residents and faculty (n=11) removed the rust rings from the eyes with the use of a burr. Rust ring removal was evaluated based on removal time, percentage of rust removed and incidence of corneal perforation. A survey was administered to participants to determine face validity. Time for rust ring removal was longer in the inexperienced group at 187±93 seconds (range of 66-408 seconds), compared to the experienced group at 117±54 seconds (range of 55-240 seconds) (p=0.046). Removal speed was similar between groups, at 4847±4355 pixels/minute and 7206±5181 pixels/minute in the inexperienced and experienced groups, respectively (p=0.26). Removal percentage values were similar between groups, at 61±15% and 69±18% (p=0.38). There were no corneal perforations. 100% (22/22) of survey respondents believed the simulator would be a valuable practice tool, and 89% (17/19) felt the simulation was a valid representation of the clinical correlate. The corneal rust ring simulator presented here is a valid training tool that could be used by early trainees to gain greater comfort level before attempting rust ring removal on a live patient. Copyright © 2017 Canadian Ophthalmological Society. Published by Elsevier Inc. All rights reserved.

  18. Characterization of Brachypodium distachyon as a nonhost model against switchgrass rust pathogen Puccinia emaculata.

    Science.gov (United States)

    Gill, Upinder S; Uppalapati, Srinivasa R; Nakashima, Jin; Mysore, Kirankumar S

    2015-05-08

    Switchgrass rust, caused by Puccinia emaculata, is an important disease of switchgrass, a potential biofuel crop in the United States. In severe cases, switchgrass rust has the potential to significantly affect biomass yield. In an effort to identify novel sources of resistance against switchgrass rust, we explored nonhost resistance against P. emaculata by characterizing its interactions with six monocot nonhost plant species. We also studied the genetic variations for resistance among Brachypodium inbred accessions and the involvement of various defense pathways in nonhost resistance of Brachypodium. We characterized P. emaculata interactions with six monocot nonhost species and identified Brachypodium distachyon (Bd21) as a suitable nonhost model to study switchgrass rust. Interestingly, screening of Brachypodium accessions identified natural variations in resistance to switchgrass rust. Brachypodium inbred accessions Bd3-1 and Bd30-1 were identified as most and least resistant to switchgrass rust, respectively, when compared to tested accessions. Transcript profiling of defense-related genes indicated that the genes which were induced in Bd21after P. emaculata inoculation also had higher basal transcript abundance in Bd3-1 when compared to Bd30-1 and Bd21 indicating their potential involvement in nonhost resistance against switchgrass rust. In the present study, we identified Brachypodium as a suitable nonhost model to study switchgrass rust which exhibit type I nonhost resistance. Variations in resistance response were also observed among tested Brachypodium accessions. Brachypodium nonhost resistance against P. emaculata may involve various defense pathways as indicated by transcript profiling of defense related genes. Overall, this study provides a new avenue to utilize novel sources of nonhost resistance in Brachypodium against switchgrass rust.

  19. Heat tolerance in wheat

    DEFF Research Database (Denmark)

    Sharma, Dew Kumari

    As a consequence of global climate change, heat stress together with other abiotic stresses will remain an important determinant of future food security. Wheat (Triticum aestivum L.) is the third most important crop of the world feeding one third of the world population. Being a crop of temperate...... climate, wheat is sensitive to heat stress. We need to understand how our crops will perform in these changing climatic conditions and how we can develop varieties, which are more tolerant. The PhD study focussed on understanding heat tolerance in wheat with a combined approach of plant physiology...... and quantitative genetics in particular, plant phenotyping based quantitative trait loci (QTL) discovery for a physiological trait under heat stress. Chlorophyll a fluorescence trait, Fv/Fm was used as a phenotyping tool, as it reflects the effect of heat stress on maximum photochemical efficiency of photosystem...

  20. Induced mutations for tolerance of oats to crown rust

    International Nuclear Information System (INIS)

    Simons, M.D.; Frey, K.J.

    1977-01-01

    Seeds of three oat (Avena sativa and A. abyssinica) strains were treated with ethyl methanesulphonate (EMS), and crown rust (caused by Puccinia coronata var. avenae) tolerance ratios of M 5 -derived lines were compared with untreated checks. Tolerance ratios of mutant lines tended to be distributed in both plus and minus directions. No mutant oat line had a significant increase in grain yield, but many showed significantly depressed yields. With C.I. 6665, only five of 130 mutagen-derived lines were not significantly below the check for grain yield; one of these had significantly improved tolerance. Re-treatment of selected strains from a previous EMS treatment (original cultivar was Clintland-60) gave one M 5 -derived oat line (of 100 tested) that was equal to Clintland-60 in grain yield and sustained no damage from crown rust (i.e. it had a tolerance ratio of 100). EMS treatment of the highly susceptible tetraploid C.I. 2110 resulted in both significantly increased and reduced tolerance. (author)