WorldWideScience

Sample records for wheat leaf rust

  1. Induced resistance and gene expression in wheat against leaf rust ...

    African Journals Online (AJOL)

    uvp

    2013-05-15

    May 15, 2013 ... 2Department of Soil, Crop and Climate Sciences, University of the Free State, P.O Box ... Key words: Wheat leaf rust, induced resistance, priming, gene ..... transformation: susceptibility of transgenic Nicotiana sylvestris plants.

  2. Leaf and stripe rust resistance among Ethiopian grown wheat ...

    African Journals Online (AJOL)

    The result indicated that 20 varieties and lines harbor resistance to the leaf rust and 26 to the stripe rust pathotypes showing infection types <2+. Twelve bread wheat varieties and lines (Et-13 A2, HAR 1407 [Tusie], HAR 1775 [Tura], HAR 1920, HAR 2192, HAR 2534, HAR 2536, HAR 2561, HAR 2563 and three durum lines ...

  3. Studies on stem and leaf rust resistance in wheat

    International Nuclear Information System (INIS)

    Knott, D.R.

    1983-01-01

    Stem and leaf rust resistance was successfully transferred from Agropyron to wheat by radiation-induced translocations. Mutation induction subsequently proved to be useful in separating an undesired gene for yellow pigment from the resistance. The homoeologous pairing mutant obtained by Sears was also used successfully in obtaining transfers through crossing-over between wheat and Agropyron chromosomes. Another experimental series succeeded in accumulating minor genes for rust resistance, after eliminating major genes for specific resistance. The resistance is polygenic and widely effective although not general. It is recessively inherited, and hoped to be more durable than major gene resistance used so far in the Canadian prairies. An attempt to induce mutations for leaf rust resistance in a small-scale experiment with leading Canadian wheat varieties Manitou and Neepawa using gamma rays and EMS has not been successful. (author)

  4. Induced mutations for resistance to leaf rust in wheat

    International Nuclear Information System (INIS)

    Borojevic, K.

    1983-01-01

    Problems related to the induction of mutations for disease resistance were investigated under several aspects, using the wheat/leaf rust system. Previously selected mutant lines, tested in M 11 and M 13 , were found to differ with regard to infection type and disease severity from the original varieties. To verify the induced-mutation origin, these mutants were examined further using test crosses with carriers of known genes for leaf rust resistance and electrophoresis. A separate experiment to induce mutations for leaf rust resistance in the wheat varieties Sava, Aurora and Siete Cerros, using gamma rays, fast neutrons and EMS, yielded mutants with different disease reaction in the varieties Sava and Aurora at a frequency of about 1x10 - 3 per M 1 plant progenies. (author)

  5. Inheritance and bulked segregant analysis of leaf rust and stem rust resistance genes in eight durum wheat genotypes

    Science.gov (United States)

    Leaf rust, caused by Puccinia triticina (Pt) and stem rust caused by Puccinia graminis f. sp. tritici (Pgt) are important diseases of durum wheat. This study determined the inheritance and genomic locations of leaf rust resistance (Lr) genes to Pt-race BBBQJ and stem rust resistance (Sr) genes to Pg...

  6. Identification of leaf rust resistant gene Lr10 in Pakistani wheat ...

    African Journals Online (AJOL)

    Leaf (brown) rust is the major disease of wheat in Pakistan and other countries. The disease is more effectively controlled when several rust resistance genes are pyramided into a single line. Molecular survey was conducted to screen 25 Pakistan wheat germplasm for the presence of leaf rust resistance gene Lr10 using ...

  7. Inheritance and Bulked Segregant Analysis of Leaf Rust and Stem Rust Resistance in Durum Wheat Genotypes.

    Science.gov (United States)

    Aoun, Meriem; Kolmer, James A; Rouse, Matthew N; Chao, Shiaoman; Bulbula, Worku Denbel; Elias, Elias M; Acevedo, Maricelis

    2017-12-01

    Leaf rust, caused by Puccinia triticina, and stem rust, caused by P. graminis f. sp. tritici, are important diseases of durum wheat. This study determined the inheritance and genomic locations of leaf rust resistance (Lr) genes to P. triticina race BBBQJ and stem rust resistance (Sr) genes to P. graminis f. sp. tritici race TTKSK in durum accessions. Eight leaf-rust-resistant genotypes were used to develop biparental populations. Accessions PI 192051 and PI 534304 were also resistant to P. graminis f. sp. tritici race TTKSK. The resulting progenies were phenotyped for leaf rust and stem rust response at seedling stage. The Lr and Sr genes were mapped in five populations using single-nucleotide polymorphisms and bulked segregant analysis. Five leaf-rust-resistant genotypes carried single dominant Lr genes whereas, in the remaining accessions, there was deviation from the expected segregation ratio of a single dominant Lr gene. Seven genotypes carried Lr genes different from those previously characterized in durum. The single dominant Lr genes in PI 209274, PI 244061, PI387263, and PI 313096 were mapped to chromosome arms 6BS, 2BS, 6BL, and 6BS, respectively. The Sr gene in PI 534304 mapped to 6AL and is most likely Sr13, while the Sr gene in PI 192051 could be uncharacterized in durum.

  8. Prehaustorial and posthaustorial resistance to wheat leaf rust in diploid wheat

    NARCIS (Netherlands)

    Anker, C.C.

    2001-01-01

    In modern wheat cultivars, resistance to wheat leaf rust, Puccinia triticina , is either based on hypersensitivity resistance or on partial resistance. Hypersensitivity resistance in wheat is monogenic, often complete and posthaustorial: it is induced after the

  9. Genetics of leaf rust resistance in the hard red winter wheat cultivars Santa Fe and Duster

    Science.gov (United States)

    Leaf rust caused by Puccinia triticina is a common and important disease of hard red winter wheat in the Great Plains of the United States. The hard red winter wheat cultivars 'Santa Fe' and 'Duster' have had effective leaf rust resistance since their release in 2003 and 2006, respectively. Both cul...

  10. A perspective of leaf rust race fhprn and its impact on leaf rust resistance in pakistani wheat varieties

    International Nuclear Information System (INIS)

    Sohail, Y.

    2015-01-01

    Leaf rust infected leaves of a widely growing variety Seher-06 were collected in wheat season of 2011-12. The leaf rust isolates were assessed on Thatcher derived Lr isogenic lines and a race FHPRN was identified. Seventy six wheat varieties/lines besides Lr isogenic lines were screened against this race for seedling in glass house and for adult plant resistance at Bahawalpur and Faisalabad during 2012-13. Lr1, Lr2a, Lr9, Lr19, Lr24, Lr10+27+31 (Gatcher) and Lr28 were found completely resistant at both stages against FHPRN. Molecular screening of the wheat varieties/lines indicated the presence of leaf rust resistance genes Lr9 (0%), Lr13 (43%), Lr19 (1%), Lr20 (0%), Lr24 (4%), Lr26 (23%), Lr28 (0%), Lr34 (38%), Lr37 (1%) and Lr47 (1%) in them. Field data suggested that As-02 (Lr10+26+34), Bhakar-02 (Lr13) and Shafaq-06 (Lr10+13+27) were resistant; Pasban-90 (Lr10+13+26+27), Chenab-2000 (Lr10+13+26+27+31+34), Fbd-08 (Lr10), Millat-11 (unknown) and Punjab-11 (unknown) were found moderately resistant; Blue silver (Lr13+14a), Pak-81 (Lr10+23+26+31), Bahawalpur-97 (Lr13+26) and Lasani-08 (Lr13+27+31) were susceptible while Sh-88 (unknown), Auqab-2000 (Lr10+23+26+27+31), Iqbal-2000 (Lr3+10+13+26+27+31), Bahawalpur-2000 (Lr34) and Seher-06 (Lr10+27+31) were found highly susceptible against FHPRN. Present and previous studies revealed the presence of Lr3, 10, 13, 14a, 23, 26, 27, 31 and 34 in the Pakistani wheat varieties yet lacking Lr9, 19, 24 and 28. Therefore, the latter genes and their effective combinations should be incorporated in Pakistani varieties to combat leaf rust effectively. (author)

  11. Introgression of leaf rust and stripe rust resistance from Sharon goatgrass (Aegilops sharonensis Eig) into bread wheat (Triticum aestivum L.).

    Science.gov (United States)

    Millet, E; Manisterski, J; Ben-Yehuda, P; Distelfeld, A; Deek, J; Wan, A; Chen, X; Steffenson, B J

    2014-06-01

    Leaf rust and stripe rust are devastating wheat diseases, causing significant yield losses in many regions of the world. The use of resistant varieties is the most efficient way to protect wheat crops from these diseases. Sharon goatgrass (Aegilops sharonensis or AES), which is a diploid wild relative of wheat, exhibits a high frequency of leaf and stripe rust resistance. We used the resistant AES accession TH548 and induced homoeologous recombination by the ph1b allele to obtain resistant wheat recombinant lines carrying AES chromosome segments in the genetic background of the spring wheat cultivar Galil. The gametocidal effect from AES was overcome by using an "anti-gametocidal" wheat mutant. These recombinant lines were found resistant to highly virulent races of the leaf and stripe rust pathogens in Israel and the United States. Molecular DArT analysis of the different recombinant lines revealed different lengths of AES segments on wheat chromosome 6B, which indicates the location of both resistance genes.

  12. Genome-Wide Association Mapping of Leaf Rust Response in a Durum Wheat Worldwide Germplasm Collection.

    Science.gov (United States)

    Aoun, Meriem; Breiland, Matthew; Kathryn Turner, M; Loladze, Alexander; Chao, Shiaoman; Xu, Steven S; Ammar, Karim; Anderson, James A; Kolmer, James A; Acevedo, Maricelis

    2016-11-01

    Leaf rust (caused by Erikss. []) is increasingly impacting durum wheat ( L. var. ) production with the recent appearance of races with virulence to widely grown cultivars in many durum producing areas worldwide. A highly virulent race on durum wheat was recently detected in Kansas. This race may spread to the northern Great Plains, where most of the US durum wheat is produced. The objective of this study was to identify sources of resistance to several races from the United States and Mexico at seedling stage in the greenhouse and at adult stage in field experiments. Genome-wide association study (GWAS) was used to identify single-nucleotide polymorphism (SNP) markers associated with leaf rust response in a worldwide durum wheat collection of 496 accessions. Thirteen accessions were resistant across all experiments. Association mapping revealed 88 significant SNPs associated with leaf rust response. Of these, 33 SNPs were located on chromosomes 2A and 2B, and 55 SNPs were distributed across all other chromosomes except for 1B and 7B. Twenty markers were associated with leaf rust response at seedling stage, while 68 markers were associated with leaf rust response at adult plant stage. The current study identified a total of 14 previously uncharacterized loci associated with leaf rust response in durum wheat. The discovery of these loci through association mapping (AM) is a significant step in identifying useful sources of resistance that can be used to broaden the relatively narrow leaf rust resistance spectrum in durum wheat germplasm. Copyright © 2016 Crop Science Society of America.

  13. Slow rusting response of different wheat genotypes against the leaf rust in relation to epidemiological factors in Faisalabad

    International Nuclear Information System (INIS)

    Khan, M.A.; Haider, M.M.; Hussain, M.; Ahmad, S.

    2007-01-01

    Wheat genotypes were screened against leaf rust to evaluate slow rusting response. Among one hundred and sixty varieties/lines, 86 showed response to leaf rust while all other remained immune or showed no response. The slow rusting, wheat varieties/ lines displayed 20-40% severity level and these were Maxi-Pak65, Blue silver, Pothohar, Punjab81, Faisalabd-83, Shalimar-88, Kohnoor-83, Pasban-90, Inqilab-91, Uqab-99-94105, Punjab-76, Parwaz-94, HD2169, HD2179, HD2204, HD2285, Lr27+31, LrB, LR17, Lr14A, Lr15 and Yr1-E-1 while the fast rusting varieties/lines that showed severity level up to 90% were WL-711, Morocco, PAK-1, Punjab-85 and Chakwal-86 SA42, SA75, Lr1, Lr2A, Lr2B. Lr23, Lr3KA, Lr3g, Lr10, Lr18, Lr21, Lr24, Yr2-E35 and 95153 respectively. Slow rusting genotypes exhibited low AUDPC (200-400) values while fast rusters displayed high AUDPC (400-1500) values. Leaf rust severity displayed significant correlation with maximum and minimum temperatures, rainfall and sunshine radiation. It was observed that with an increase of these environmental conditions a significant increase in disease severity was recorded

  14. Stripe rust and leaf rust resistance QTL mapping, epistatic interactions, and co-localization with stem rust resistance loci in spring wheat evaluated over three continents.

    Science.gov (United States)

    Singh, A; Knox, R E; DePauw, R M; Singh, A K; Cuthbert, R D; Campbell, H L; Shorter, S; Bhavani, S

    2014-11-01

    In wheat, advantageous gene-rich or pleiotropic regions for stripe, leaf, and stem rust and epistatic interactions between rust resistance loci should be accounted for in plant breeding strategies. Leaf rust (Puccinia triticina Eriks.) and stripe rust (Puccinia striiformis f. tritici Eriks) contribute to major production losses in many regions worldwide. The objectives of this research were to identify and study epistatic interactions of quantitative trait loci (QTL) for stripe and leaf rust resistance in a doubled haploid (DH) population derived from the cross of Canadian wheat cultivars, AC Cadillac and Carberry. The relationship of leaf and stripe rust resistance QTL that co-located with stem rust resistance QTL previously mapped in this population was also investigated. The Carberry/AC Cadillac population was genotyped with DArT(®) and simple sequence repeat markers. The parents and population were phenotyped for stripe rust severity and infection response in field rust nurseries in Kenya (Njoro), Canada (Swift Current), and New Zealand (Lincoln); and for leaf rust severity and infection response in field nurseries in Canada (Swift Current) and New Zealand (Lincoln). AC Cadillac was a source of stripe rust resistance QTL on chromosomes 2A, 2B, 3A, 3B, 5B, and 7B; and Carberry was a source of resistance on chromosomes 2B, 4B, and 7A. AC Cadillac contributed QTL for resistance to leaf rust on chromosome 2A and Carberry contributed QTL on chromosomes 2B and 4B. Stripe rust resistance QTL co-localized with previously reported stem rust resistance QTL on 2B, 3B, and 7B, while leaf rust resistance QTL co-localized with 4B stem rust resistance QTL. Several epistatic interactions were identified both for stripe and leaf rust resistance QTL. We have identified useful combinations of genetic loci with main and epistatic effects. Multiple disease resistance regions identified on chromosomes 2A, 2B, 3B, 4B, 5B, and 7B are prime candidates for further investigation and

  15. Molecular mapping and improvement of leaf rust resistance in wheat breeding lines.

    Science.gov (United States)

    Tsilo, Toi J; Kolmer, James A; Anderson, James A

    2014-08-01

    Leaf rust, caused by Puccinia triticina, is the most common and widespread disease of wheat (Triticum aestivum) worldwide. Deployment of host-plant resistance is one of the strategies to reduce losses due to leaf rust disease. The objective of this study was to map genes for adult-plant resistance to leaf rust in a recombinant inbred line (RIL) population originating from MN98550-5/MN99394-1. The mapping population of 139 RILs and five checks were evaluated in 2005, 2009, and 2010 in five environments. Natural infection occurred in the 2005 trials and trials in 2009 and 2010 were inoculated with leaf rust. Four quantitative trait loci (QTL) on chromosomes 2BS, 2DS, 7AL, and 7DS were detected. The QTL on 2BS explained up to 33.6% of the phenotypic variation in leaf rust response, whereas the QTL on 2DS, 7AL, and 7DS explained up to 15.7, 8.1, and 34.2%, respectively. Seedling infection type tests conducted with P. triticina races BBBD and SBDG confirmed that the QTL on 2BS and 2DS were Lr16 and Lr2a, respectively, and these genes were expressed in the seedling and field plot tests. The Lr2a gene mapped at the same location as Sr6. The QTL on 7DS was Lr34. The QTL on 7AL is a new QTL for leaf rust resistance. The joint effects of all four QTL explained 74% of the total phenotypic variation in leaf rust severity. Analysis of different combinations of QTL showed that the RILs containing all four or three of the QTL had the lowest average leaf rust severity in all five environments. Deployment of these QTL in combination or with other effective genes will lead to successful control of leaf rust.

  16. Evidence of isolate-specificity in non-hypersensitive resistance in spring wheat (Triticum aestivum) to wheat leaf rust

    NARCIS (Netherlands)

    Qamar, Maqsood; Niks, R.E.

    2007-01-01

    Isolate-specific aspect of non-hypersensitive resistance in wheat to wheat leaf rust was studied at seedling stage in the green house. Isolate-specific response of non-hypersensitive resistance was assessed from latency period (LP) and infection frequency (IF) of two single-pustule isolates of

  17. Identification and Severity Determination of Wheat Stripe Rust and Wheat Leaf Rust Based on Hyperspectral Data Acquired Using a Black-Paper-Based Measuring Method

    Science.gov (United States)

    Ruan, Liu; Wang, Rui; Liu, Qi; Ma, Zhanhong; Li, Xiaolong; Cheng, Pei; Wang, Haiguang

    2016-01-01

    It is important to implement detection and assessment of plant diseases based on remotely sensed data for disease monitoring and control. Hyperspectral data of healthy leaves, leaves in incubation period and leaves in diseased period of wheat stripe rust and wheat leaf rust were collected under in-field conditions using a black-paper-based measuring method developed in this study. After data preprocessing, the models to identify the diseases were built using distinguished partial least squares (DPLS) and support vector machine (SVM), and the disease severity inversion models of stripe rust and the disease severity inversion models of leaf rust were built using quantitative partial least squares (QPLS) and support vector regression (SVR). All the models were validated by using leave-one-out cross validation and external validation. The diseases could be discriminated using both distinguished partial least squares and support vector machine with the accuracies of more than 99%. For each wheat rust, disease severity levels were accurately retrieved using both the optimal QPLS models and the optimal SVR models with the coefficients of determination (R2) of more than 0.90 and the root mean square errors (RMSE) of less than 0.15. The results demonstrated that identification and severity evaluation of stripe rust and leaf rust at the leaf level could be implemented based on the hyperspectral data acquired using the developed method. A scientific basis was provided for implementing disease monitoring by using aerial and space remote sensing technologies. PMID:27128464

  18. Identification and Severity Determination of Wheat Stripe Rust and Wheat Leaf Rust Based on Hyperspectral Data Acquired Using a Black-Paper-Based Measuring Method.

    Science.gov (United States)

    Wang, Hui; Qin, Feng; Ruan, Liu; Wang, Rui; Liu, Qi; Ma, Zhanhong; Li, Xiaolong; Cheng, Pei; Wang, Haiguang

    2016-01-01

    It is important to implement detection and assessment of plant diseases based on remotely sensed data for disease monitoring and control. Hyperspectral data of healthy leaves, leaves in incubation period and leaves in diseased period of wheat stripe rust and wheat leaf rust were collected under in-field conditions using a black-paper-based measuring method developed in this study. After data preprocessing, the models to identify the diseases were built using distinguished partial least squares (DPLS) and support vector machine (SVM), and the disease severity inversion models of stripe rust and the disease severity inversion models of leaf rust were built using quantitative partial least squares (QPLS) and support vector regression (SVR). All the models were validated by using leave-one-out cross validation and external validation. The diseases could be discriminated using both distinguished partial least squares and support vector machine with the accuracies of more than 99%. For each wheat rust, disease severity levels were accurately retrieved using both the optimal QPLS models and the optimal SVR models with the coefficients of determination (R2) of more than 0.90 and the root mean square errors (RMSE) of less than 0.15. The results demonstrated that identification and severity evaluation of stripe rust and leaf rust at the leaf level could be implemented based on the hyperspectral data acquired using the developed method. A scientific basis was provided for implementing disease monitoring by using aerial and space remote sensing technologies.

  19. Adult plant leaf rust resistance derived from Toropi wheat is conditioned by Lr78 and three minor QTL

    Science.gov (United States)

    Brazil, was noted to have long lasting leaf rust resistance that was effective only in adult plants. The objectives of this study were to determine the chromosome location of the leaf rust resistance genes derived from Toropi in two populations of recombinant inbred lines in a partial Thatcher wheat...

  20. Comparison of multi- and hyperspectral imaging data of leaf rust infected wheat plants

    Science.gov (United States)

    Franke, Jonas; Menz, Gunter; Oerke, Erich-Christian; Rascher, Uwe

    2005-10-01

    In the context of precision agriculture, several recent studies have focused on detecting crop stress caused by pathogenic fungi. For this purpose, several sensor systems have been used to develop in-field-detection systems or to test possible applications of remote sensing. The objective of this research was to evaluate the potential of different sensor systems for multitemporal monitoring of leaf rust (puccinia recondita) infected wheat crops, with the aim of early detection of infected stands. A comparison between a hyperspectral (120 spectral bands) and a multispectral (3 spectral bands) imaging system shows the benefits and limitations of each approach. Reflectance data of leaf rust infected and fungicide treated control wheat stand boxes (1sqm each) were collected before and until 17 days after inoculation. Plants were grown under controlled conditions in the greenhouse and measurements were taken under consistent illumination conditions. The results of mixture tuned matched filtering analysis showed the suitability of hyperspectral data for early discrimination of leaf rust infected wheat crops due to their higher spectral sensitivity. Five days after inoculation leaf rust infected leaves were detected, although only slight visual symptoms appeared. A clear discrimination between infected and control stands was possible. Multispectral data showed a higher sensitivity to external factors like illumination conditions, causing poor classification accuracy. Nevertheless, if these factors could get under control, even multispectral data may serve a good indicator for infection severity.

  1. Mapping of stripe rust resistance gene in an Aegilops caudate introgression line in wheat and its genetic association with leaf rust resistance.

    Science.gov (United States)

    Toor, Puneet Inder; Kaur, Satinder; Bansal, Mitaly; Yadav, Bharat; Chhuneja, Parveen

    2016-12-01

    A pair of stripe rust and leaf rust resistance genes was introgressed from Aegilops caudata, a nonprogenitor diploid species with the CC genome, to cultivated wheat. Inheritance and genetic mapping of stripe rust resistance gene in backcrossrecombinant inbred line (BC-RIL) population derived from the cross of a wheat-Ae. caudata introgression line (IL) T291- 2(pau16060) with wheat cv. PBW343 is reported here. Segregation of BC-RILs for stripe rust resistance depicted a single major gene conditioning adult plant resistance (APR) with stripe rust reaction varying from TR-20MS in resistant RILs signifying the presence of some minor genes as well. Genetic association with leaf rust resistance revealed that two genes are located at a recombination distance of 13%. IL T291-2 had earlier been reported to carry introgressions on wheat chromosomes 2D, 3D, 4D, 5D, 6D and 7D. Genetic mapping indicated the introgression of stripe rust resistance gene on wheat chromosome 5DS in the region carrying leaf rust resistance gene LrAc, but as an independent introgression. Simple sequence repeat (SSR) and sequence-tagged site (STS) markers designed from the survey sequence data of 5DS enriched the target region harbouring stripe and leaf rust resistance genes. Stripe rust resistance locus, temporarily designated as YrAc, mapped at the distal most end of 5DS linked with a group of four colocated SSRs and two resistance gene analogue (RGA)-STS markers at a distance of 5.3 cM. LrAc mapped at a distance of 9.0 cM from the YrAc and at 2.8 cM from RGA-STS marker Ta5DS_2737450, YrAc and LrAc appear to be the candidate genes for marker-assisted enrichment of the wheat gene pool for rust resistance.

  2. Adult Plant Leaf Rust Resistance Derived from Toropi Wheat is Conditioned by Lr78 and Three Minor QTL.

    Science.gov (United States)

    Kolmer, J A; Bernardo, A; Bai, G; Hayden, M J; Chao, S

    2018-02-01

    Leaf rust caused by Puccinia triticina is an important disease of wheat in many regions worldwide. Durable or long-lasting leaf rust resistance has been difficult to achieve because populations of P. triticina are highly variable for virulence to race-specific resistance genes, and respond to selection by resistance genes in released wheat cultivars. The wheat cultivar Toropi, developed and grown in Brazil, was noted to have long-lasting leaf rust resistance that was effective only in adult plants. The objectives of this study were to determine the chromosome location of the leaf rust resistance genes derived from Toropi in two populations of recombinant inbred lines in a partial Thatcher wheat background. In the first population, a single gene with major effects on chromosome 5DS that mapped 2.2 centimorgans distal to IWA6289, strongly reduced leaf rust severity in all 3 years of field plot tests. This gene for adult plant leaf rust resistance was designated as Lr78. In the second population, quantitative trait loci (QTL) with small effects on chromosomes 1BL, 3BS, and 4BS were found. These QTL expressed inconsistently over 4 years of field plot tests. The adult plant leaf rust resistance derived from Toropi involved a complex combination of QTL with large and small effects.

  3. Induced mutations for horizontal resistance. A model study using leaf rust resistance in wheat

    International Nuclear Information System (INIS)

    Chopra, V.L.; Sawhney, R.N.; Kumar, R.

    1983-01-01

    A mutant with seemingly non-specific resistance to leaf rust was obtained some time ago from the wheat variety Kharchia Local treated with NMH. This mutant is being studied genetically and in its disease reaction by laboratories in Australia, Canada and India in co-operation. The mutant showed a dominant inheritance of resistance in F 1 , but different segregation in F 2 and F 3 . This peculiar genetic behaviour has so far not been explained. (author)

  4. [Analysis of methylation-sensitive amplified polymorphism in wheat genome under the wheat leaf rust stress].

    Science.gov (United States)

    Fu, Sheng-Jie; Wang, Hui; Feng, Li-Na; Sun, Yi; Yang, Wen-Xiang; Liu, Da-Qun

    2009-03-01

    Intrinsic DNA methylation pattern is an integral component of the epigenetic network in many eukaryotes. DNA methylation plays an important role in regulating gene expression in eukaryotes. Biological stress in plant provides an inherent epigenetic driving force of evolution. Study of DNA methylation patterns arising from biological stress will help us fully understand the epigenetic regulation of gene expression and DNA methylation of biological functions. The wheat near-isogenic lines TcLr19 and TcLr41 were resistant to races THTT and TKTJ, respectively, and Thatcher is compatible in the interaction with Puccinia triticina THTT and TKTJ, respectively. By means of methylation-sensitive amplified polymorphism (MSAP) analysis, the patterns of cytosine methylation in TcLr19, TcLr41, and Thatcher inoculated with P. triticina THTT and TKTJ were compared with those of the untreated samples. All the DNA fragments, each representing a recognition site cleaved by each or both of isoschizomers, were amplified using 60 pairs of selective primers. The results indicated that there was no significant difference between the challenged and unchallenged plants at DNA methylation level. However, epigenetic difference between the near-isogenic line for wheat leaf rust resistance gene Lr41 and Thatcher was present.

  5. Attempts to induce mutations for resistance of wheat to mildew, stem rust and leaf rust

    International Nuclear Information System (INIS)

    Kiraly, Z.; Barabas, Z.

    1983-01-01

    Research carried out between 1971 and 1981 is summarized. Attempts to find induced mutants with full resistance to pathotype mixtures of the three pathogens were not successful. Reasons are discussed. Studies on wheat lines tolerant to stem rust infection led to the conclusion that this disease reaction may be often accompanied by a reduced number of infection sites and a longer lag period resulting in reduced spore production. Various selection methods have been evaluated. Selecting for the multigenic 'non race specific' way is promising. (author)

  6. Genetic differentiation of the wheat leaf rust fungus Puccinia triticina in Pakistan and genetic relationship to other worldwide populations

    Science.gov (United States)

    Collections of Puccinia triticina, the wheat leaf rust pathogen, were obtained from Pakistan in 2008, 2010, 2011, 2013, and 2014. Collections were also obtained from Bhutan in 2013. Single uredinial isolates were derived and tested for virulence phenotype to 20 lines of Thatcher wheat that differ fo...

  7. Mapping and characterization of the new adult plant leaf rust resistance gene Lr77 derived from Santa Fe winter wheat.

    Science.gov (United States)

    Kolmer, James A; Su, Zhenqi; Bernardo, Amy; Bai, Guihua; Chao, Shiaoman

    2018-04-25

    A new gene for adult plant leaf rust resistance in wheat was mapped to chromosome 3BL. This gene was designated as Lr77. 'Santa Fe' is a hard red winter cultivar that has had long-lasting resistance to the leaf rust fungus, Puccinia triticina. The objective of this study was to determine the chromosome location of the adult plant leaf rust resistance in Santa Fe wheat. A partial backcross line of 'Thatcher' (Tc) wheat with adult plant leaf rust resistance derived from Santa Fe was crossed with Thatcher to develop a Thatcher//Tc*2/Santa Fe F 6 recombinant inbred line (RIL) population. The RIL population and parental lines were evaluated for segregation of leaf rust resistance in three field plot tests and in an adult plant greenhouse test. A genetic map of the RIL population was constructed using 90,000 single-nucleotide polymorphism (SNP) markers with the Illumina Infinium iSelect 90K wheat bead array. A significant quantitative trait locus for reduction of leaf rust severity in all four tests was found on chromosome 3BL that segregated as a single adult plant resistance gene. The RILs with the allele from the resistant parent for SNP marker IWB10344 had lower leaf rust severity and a moderately resistant to moderately susceptible response compared to the susceptible RILs and Thatcher. The gene derived from Santa Fe on chromosome 3BL was designated as Lr77. Kompetitive allele-specific polymerase chain reaction assay markers linked to Lr77 on 3BL should be useful for selection of wheat germplasm with this gene.

  8. Mapping of quantitative adult plant field resistance to leaf rust and stripe rust in two European winter wheat populations reveals co-location of three QTL conferring resistance to both rust pathogens.

    Science.gov (United States)

    Buerstmayr, Maria; Matiasch, Lydia; Mascher, Fabio; Vida, Gyula; Ittu, Marianna; Robert, Olivier; Holdgate, Sarah; Flath, Kerstin; Neumayer, Anton; Buerstmayr, Hermann

    2014-09-01

    We detected several, most likely novel QTL for adult plant resistance to rusts. Notably three QTL improved resistance to leaf rust and stripe rust simultaneously indicating broad spectrum resistance QTL. The rusts of wheat (Puccinia spp.) are destructive fungal wheat diseases. The deployment of resistant cultivars plays a central role in integrated rust disease management. Durability of resistance would be preferred, but is difficult to analyse. The Austrian winter wheat cultivar Capo was released in the 1989 and grown on a large acreage during more than two decades and maintained a good level of quantitative leaf rust and stripe rust resistance. Two bi-parental mapping populations: Capo × Arina and Capo × Furore were tested in multiple environments for severity of leaf rust and stripe rust at the adult plant stage in replicated field experiments. Quantitative trait loci associated with leaf rust and stripe rust severity were mapped using DArT and SSR markers. Five QTL were detected in multiple environments associated with resistance to leaf rust designated as QLr.ifa-2AL, QLr.ifa-2BL, QLr.ifa-2BS, QLr.ifa-3BS, and QLr.ifa-5BL, and five for resistance to stripe rust QYr.ifa-2AL, QYr.ifa-2BL, QYr.ifa-3AS, QYr.ifa-3BS, and QYr.ifa-5A. For all QTL apart from two (QYr.ifa-3AS, QLr.ifa-5BL) Capo contributed the resistance improving allele. The leaf rust and stripe rust resistance QTL on 2AL, 2BL and 3BS mapped to the same chromosome positions, indicating either closely linked genes or pleiotropic gene action. These three multiple disease resistance QTL (QLr.ifa-2AL/QYr.ifa-2AL, QLr.ifa.2BL/QYr.ifa-2BL, QLr.ifa-3BS/QYr.ifa.3BS) potentially contribute novel resistance sources for stripe rust and leaf rust. The long-lasting resistance of Capo apparently rests upon a combination of several genes. The described germplasm, QTL and markers are applicable for simultaneous resistance improvement against leaf rust and stripe rust.

  9. Genomic and pedigree-based prediction for leaf, stem, and stripe rust resistance in wheat.

    Science.gov (United States)

    Juliana, Philomin; Singh, Ravi P; Singh, Pawan K; Crossa, Jose; Huerta-Espino, Julio; Lan, Caixia; Bhavani, Sridhar; Rutkoski, Jessica E; Poland, Jesse A; Bergstrom, Gary C; Sorrells, Mark E

    2017-07-01

    Genomic prediction for seedling and adult plant resistance to wheat rusts was compared to prediction using few markers as fixed effects in a least-squares approach and pedigree-based prediction. The unceasing plant-pathogen arms race and ephemeral nature of some rust resistance genes have been challenging for wheat (Triticum aestivum L.) breeding programs and farmers. Hence, it is important to devise strategies for effective evaluation and exploitation of quantitative rust resistance. One promising approach that could accelerate gain from selection for rust resistance is 'genomic selection' which utilizes dense genome-wide markers to estimate the breeding values (BVs) for quantitative traits. Our objective was to compare three genomic prediction models including genomic best linear unbiased prediction (GBLUP), GBLUP A that was GBLUP with selected loci as fixed effects and reproducing kernel Hilbert spaces-markers (RKHS-M) with least-squares (LS) approach, RKHS-pedigree (RKHS-P), and RKHS markers and pedigree (RKHS-MP) to determine the BVs for seedling and/or adult plant resistance (APR) to leaf rust (LR), stem rust (SR), and stripe rust (YR). The 333 lines in the 45th IBWSN and the 313 lines in the 46th IBWSN were genotyped using genotyping-by-sequencing and phenotyped in replicated trials. The mean prediction accuracies ranged from 0.31-0.74 for LR seedling, 0.12-0.56 for LR APR, 0.31-0.65 for SR APR, 0.70-0.78 for YR seedling, and 0.34-0.71 for YR APR. For most datasets, the RKHS-MP model gave the highest accuracies, while LS gave the lowest. GBLUP, GBLUP A, RKHS-M, and RKHS-P models gave similar accuracies. Using genome-wide marker-based models resulted in an average of 42% increase in accuracy over LS. We conclude that GS is a promising approach for improvement of quantitative rust resistance and can be implemented in the breeding pipeline.

  10. Induced resistance and gene expression in wheat against leaf rust ...

    African Journals Online (AJOL)

    uvp

    2013-05-15

    associated molecular .... Total RNA was extracted from approximately 0.1 g ground leaf tissue harvested at 0, 24, 48, 72, 96 and ... The RNA was finally dissolved in 100 µl 0.1% (v/v) DMPC treated water. Residual DNA was eliminated ...

  11. Simultaneous Transfer of Leaf Rust and Powdery Mildew Resistance Genes from Hexaploid Triticale Cultivar Sorento into Bread Wheat.

    Science.gov (United States)

    Li, Feng; Li, Yinghui; Cao, Lirong; Liu, Peiyuan; Geng, Miaomiao; Zhang, Qiang; Qiu, Lina; Sun, Qixin; Xie, Chaojie

    2018-01-01

    Wheat powdery mildew, caused by Blumeria graminis f. sp. tritici , and wheat leaf rust, caused by Puccinia triticina Eriks, are two important diseases that severely threaten wheat production. Sorento, a hexaploid triticale cultivar from Poland, shows high resistance to the wheat powdery mildew isolate E09 and the leaf rust isolate PHT in Beijing, China. To introduce resistance genes into common wheat, Sorento was crossed with wheat line Xuezao, which is susceptible to both diseases, and the F 1 hybrids were then backcrossed with Xuezao as the recurrent male parent. By marker analysis, we demonstrate that the long arm of the 2R (2RL) chromosome confers resistance to both the leaf rust and powdery mildew isolates at adult-plant and seedling stages, while the long arm of 4R (4RL) confers resistance only to powdery mildew at both stages. The chromosomal composition of BC 2 F 3 plants containing 2R or 2RL and 4R or 4RL in the form of substitution and translocation were confirmed by GISH (genomic in situ hybridization) and FISH (fluorescence in situ hybridization). Monosomic and disomic substitutions of a wheat chromosome with chromosome 2R or 4R, as well as one 4RS-4DL/4DS-4RL reciprocal translocation homozigote and one 2RL-1DL translocation hemizigote, were recovered. Such germplasms are of great value in wheat improvement.

  12. Expression of apoplast-targeted plant defensin MtDef4.2 confers resistance to leaf rust pathogen Puccinia triticina but does not affect mycorrhizal symbiosis in transgenic wheat

    Science.gov (United States)

    Rust diseases caused by Puccinia spp. pose a major threat to global wheat production. Puccinia triticina (Pt), an obligate basidiomycete biotroph, causes leaf rust disease which incurs yield losses of up to 50% in wheat. Historically, resistant wheat cultivars have been used to control leaf rust, bu...

  13. Adult plant leaf rust resistance derived from the soft red winter wheat cultivar Caldwell maps to chromosome 3BS

    Science.gov (United States)

    'Caldwell' is a U.S. soft red winter wheat that has partial, adult plant resistance to the leaf rust pathogen Puccinia triticina. A line of 'Thatcher*2/Caldwell' with adult plant resistance derived from Caldwell was crossed with 'Thatcher' to develop a population of recombinant inbred lines (RILs). ...

  14. Genetics of leaf rust-resistant mutant WH 147-LM-1 in hexaploid wheat variety WH 147

    International Nuclear Information System (INIS)

    Reddy, V.R.K.; Viswanathan, P.

    1999-01-01

    By applying gamma rays, EMS and their combination in hexaploid wheat variety WH 147, a total of 20 mutants (0.0226%) exhibiting complete leaf rust resistance were isolated from segregating M2 rows.When one of the rust-resistant mutants, WH 147-LM-1 was crossed with the universally susceptible, suggesting that the mutant character is controlled by one dominant gene and one recessive gene.The F2 plants derived by crossing the mutant WH 147-LM with seven near-isogenic wheat lines showed segregation for susceptibility, indicating that the mutant character was indeed generated through induced mutations

  15. Identification and characterization of pleiotropic and co-located resistance loci to leaf rust and stripe rust in bread wheat cultivar Sujata.

    Science.gov (United States)

    Lan, Caixia; Zhang, Yelun; Herrera-Foessel, Sybil A; Basnet, Bhoja R; Huerta-Espino, Julio; Lagudah, Evans S; Singh, Ravi P

    2015-03-01

    Two new co-located resistance loci, QLr.cim - 1AS/QYr.cim - 1AS and QLr.cim - 7BL/YrSuj , in combination with Lr46 / Yr29 and Lr67/Yr46 , and a new leaf rust resistance quantitative trait loci, conferred high resistance to rusts in adult plant stage. The tall Indian bread wheat cultivar Sujata displays high and low infection types to leaf rust and stripe rust, respectively, at the seedling stage in greenhouse tests. It was also highly resistant to both rusts at adult plant stage in field trials in Mexico. The genetic basis of this resistance was investigated in a population of 148 F5 recombinant inbred lines (RILs) derived from the cross Avocet × Sujata. The parents and RIL population were characterized in field trials for resistance to leaf rust during 2011 at El Batán, and 2012 and 2013 at Ciudad Obregón, Mexico, and for stripe rust during 2011 and 2012 at Toluca, Mexico; they were also characterized three times for stripe rust at seedling stage in the greenhouse. The RILs were genotyped with diversity arrays technology and simple sequence repeat markers. The final genetic map was constructed with 673 polymorphic markers. Inclusive composite interval mapping analysis detected two new significant co-located resistance loci, QLr.cim-1AS/QYr.cim-1AS and QLr.cim-7BL/YrSuj, on chromosomes 1AS and 7BL, respectively. The chromosomal position of QLr.cim-7BL overlapped with the seedling stripe rust resistance gene, temporarily designated as YrSuj. Two previously reported pleiotropic adult plant resistance genes, Lr46/Yr29 and Lr67/Yr46, and a new leaf rust resistance quantitative trait loci derived from Avocet were also mapped in the population. The two new co-located resistance loci are expected to contribute to breeding durable rust resistance in wheat. Closely linked molecular markers can be used to transfer all four resistance loci simultaneously to modern wheat varieties.

  16. Genome-Wide Association Mapping for Resistance to Leaf and Stripe Rust in Winter-Habit Hexaploid Wheat Landraces.

    Directory of Open Access Journals (Sweden)

    Albert Kertho

    Full Text Available Leaf rust, caused by Puccinia triticina (Pt, and stripe rust, caused by P. striiformis f. sp. tritici (Pst, are destructive foliar diseases of wheat worldwide. Breeding for disease resistance is the preferred strategy of managing both diseases. The continued emergence of new races of Pt and Pst requires a constant search for new sources of resistance. Here we report a genome-wide association analysis of 567 winter wheat (Triticum aestivum landrace accessions using the Infinium iSelect 9K wheat SNP array to identify loci associated with seedling resistance to five races of Pt (MDCL, MFPS, THBL, TDBG, and TBDJ and one race of Pst (PSTv-37 frequently found in the Northern Great Plains of the United States. Mixed linear models identified 65 and eight significant markers associated with leaf rust and stripe rust, respectively. Further, we identified 31 and three QTL associated with resistance to Pt and Pst, respectively. Eleven QTL, identified on chromosomes 3A, 4A, 5A, and 6D, are previously unknown for leaf rust resistance in T. aestivum.

  17. Cytological and molecular analysis of nonhost resistance in rice to wheat powdery mildew and leaf rust pathogens.

    Science.gov (United States)

    Cheng, Yulin; Yao, Juanni; Zhang, Hongchang; Huang, Lili; Kang, Zhensheng

    2015-07-01

    Cereal powdery mildews caused by Blumeria graminis and cereal rusts caused by Puccinia spp. are constant disease threats that limit the production of almost all important cereal crops. Rice is an intensively grown agricultural cereal that is atypical because of its immunity to all powdery mildew and rust fungi. We analyzed the nonhost interactions between rice and the wheat powdery mildew fungus B. graminis f. sp. tritici (Bgt) and the wheat leaf rust fungus Puccinia triticina (Ptr) to identify the basis of nonhost resistance (NHR) in rice against cereal powdery mildew and rust fungi at cytological and molecular levels. No visible symptoms were observed on rice leaves inoculated with Bgt or Ptr. Microscopic observations showed that both pathogens exhibited aberrant differentiation and significantly reduced penetration frequencies on rice compared to wheat. The development of Bgt and Ptr was also completely arrested at early infection stages in cases of successful penetration into rice leaves. Attempted infection of rice by Bgt and Ptr induced similar defense responses, including callose deposition, accumulation of reactive oxygen species, and hypersensitive response in rice epidermal and mesophyll cells, respectively. Furthermore, a set of defense-related genes were upregulated in rice against Bgt and Ptr infection. Rice is an excellent monocot model for genetic and molecular studies. Therefore, our results demonstrate that rice is a useful model to study the mechanisms of NHR to cereal powdery mildew and rust fungi, which provides useful information for the development of novel and durable strategies to control these important pathogens.

  18. Characterization and Mapping of Leaf Rust and Stripe Rust Resistance Loci in Hexaploid Wheat Lines UC1110 and PI610750 under Mexican Environments.

    Science.gov (United States)

    Lan, Caixia; Hale, Iago L; Herrera-Foessel, Sybil A; Basnet, Bhoja R; Randhawa, Mandeep S; Huerta-Espino, Julio; Dubcovsky, Jorge; Singh, Ravi P

    2017-01-01

    Growing resistant wheat varieties is a key method of minimizing the extent of yield losses caused by the globally important wheat leaf rust (LR) and stripe rust (YR) diseases. In this study, a population of 186 F 8 recombinant inbred lines (RILs) derived from a cross between a synthetic wheat derivative (PI610750) and an adapted common wheat line (cv. "UC1110") were phenotyped for LR and YR response at both seedling and adult plant stages over multiple seasons. Using a genetic linkage map consisting of single sequence repeats and diversity arrays technology markers, in combination with inclusive composite interval mapping analysis, we detected a new LR adult plant resistance (APR) locus, QLr.cim-2DS , contributed by UC1110. One co-located resistance locus to both rusts, QLr.cim-3DC/QYr.cim-3DC , and the known seedling resistance gene Lr26 were also mapped. QLr.cim-2DS and QLr.cim-3DC showed a marginally significant interaction for LR resistance in the adult plant stage. In addition, two previously reported YR APR loci, QYr.ucw-3BS and Yr48 , were found to exhibit stable performances in rust environments in both Mexico and the United States and showed a highly significant interaction in the field. Yr48 was also observed to confer intermediate seedling resistance against Mexican YR races, thus suggesting it should be re-classified as an all-stage resistance gene. We also identified 5 and 2 RILs that possessed all detected YR and LR resistance loci, respectively. With the closely linked molecular markers reported here, these RILs could be used as donors for multiple resistance loci to both rusts in wheat breeding programs.

  19. Prediction and analysis of three gene families related to leaf rust (Puccinia triticina) resistance in wheat (Triticum aestivum L.).

    Science.gov (United States)

    Peng, Fred Y; Yang, Rong-Cai

    2017-06-20

    The resistance to leaf rust (Lr) caused by Puccinia triticina in wheat (Triticum aestivum L.) has been well studied over the past decades with over 70 Lr genes being mapped on different chromosomes and numerous QTLs (quantitative trait loci) being detected or mapped using DNA markers. Such resistance is often divided into race-specific and race-nonspecific resistance. The race-nonspecific resistance can be further divided into resistance to most or all races of the same pathogen and resistance to multiple pathogens. At the molecular level, these three types of resistance may cover across the whole spectrum of pathogen specificities that are controlled by genes encoding different protein families in wheat. The objective of this study is to predict and analyze genes in three such families: NBS-LRR (nucleotide-binding sites and leucine-rich repeats or NLR), START (Steroidogenic Acute Regulatory protein [STaR] related lipid-transfer) and ABC (ATP-Binding Cassette) transporter. The focus of the analysis is on the patterns of relationships between these protein-coding genes within the gene families and QTLs detected for leaf rust resistance. We predicted 526 ABC, 1117 NLR and 144 START genes in the hexaploid wheat genome through a domain analysis of wheat proteome. Of the 1809 SNPs from leaf rust resistance QTLs in seedling and adult stages of wheat, 126 SNPs were found within coding regions of these genes or their neighborhood (5 Kb upstream from transcription start site [TSS] or downstream from transcription termination site [TTS] of the genes). Forty-three of these SNPs for adult resistance and 18 SNPs for seedling resistance reside within coding or neighboring regions of the ABC genes whereas 14 SNPs for adult resistance and 29 SNPs for seedling resistance reside within coding or neighboring regions of the NLR gene. Moreover, we found 17 nonsynonymous SNPs for adult resistance and five SNPs for seedling resistance in the ABC genes, and five nonsynonymous SNPs for

  20. Rapid detection of Puccinia triticina causing leaf rust of wheat by PCR and loop mediated isothermal amplification.

    Science.gov (United States)

    Manjunatha, C; Sharma, Sapna; Kulshreshtha, Deepika; Gupta, Sangeeta; Singh, Kartar; Bhardwaj, Subhash C; Aggarwal, Rashmi

    2018-01-01

    Leaf rust of wheat caused by Puccinia triticina has significant impact on wheat production worldwide. Effective and quick detection methodologies are required to mitigate yield loss and time constraints associated with monitoring and management of leaf rust of wheat. In the present study, detection of P. triticina has been simplified by developing a rapid, reliable, efficient and visual colorimetric method i.e., loop mediated isothermal amplification of DNA (LAMP). Based on in silico analysis of P. triticina genome, PTS68, a simple sequence repeat was found highly specific to leaf rust fungus. A marker (PtRA68) was developed and its specificity was validated through PCR technique which gave a unique and sharp band of 919 bp in P. triticina pathotypes only. A novel gene amplification method LAMP which enables visual detection of pathogen by naked eye was developed for leaf rust pathogen. A set of six primers was designed from specific region of P. triticina and conditions were optimised to complete the observation process in 60 minutes at 65o C. The assay developed in the study could detect presence of P. triticina on wheat at 24 hpi (pre-symptomatic stage) which was much earlier than PCR without requiring thermal cycler. Sensitivity of LAMP assay developed in the study was 100 fg which was more sensitive than conventional PCR (50 pg) and equivalent to qPCR (100 fg). The protocol developed in the study was utilized for detection of leaf rust infected samples collected from different wheat fields. LAMP based colorimetric detection assay showed sky blue color in positive reaction and violet color in negative reaction after addition of 120 μM hydroxyl napthol blue (HNB) solution to reaction mixture. Similarly, 0.6 mg Ethidium bromide/ml was added to LAMP products, placed on transilluminator to witness full brightness in positive reaction and no such brightness could be seen in negative reaction mixture. Further, LAMP products spread in a ladder like banding pattern in

  1. Uncovering leaf rust responsive miRNAs in wheat (Triticum aestivum L.) using high-throughput sequencing and prediction of their targets through degradome analysis.

    Science.gov (United States)

    Kumar, Dhananjay; Dutta, Summi; Singh, Dharmendra; Prabhu, Kumble Vinod; Kumar, Manish; Mukhopadhyay, Kunal

    2017-01-01

    Deep sequencing identified 497 conserved and 559 novel miRNAs in wheat, while degradome analysis revealed 701 targets genes. QRT-PCR demonstrated differential expression of miRNAs during stages of leaf rust progression. Bread wheat (Triticum aestivum L.) is an important cereal food crop feeding 30 % of the world population. Major threat to wheat production is the rust epidemics. This study was targeted towards identification and functional characterizations of micro(mi)RNAs and their target genes in wheat in response to leaf rust ingression. High-throughput sequencing was used for transcriptome-wide identification of miRNAs and their expression profiling in retort to leaf rust using mock and pathogen-inoculated resistant and susceptible near-isogenic wheat plants. A total of 1056 mature miRNAs were identified, of which 497 miRNAs were conserved and 559 miRNAs were novel. The pathogen-inoculated resistant plants manifested more miRNAs compared with the pathogen infected susceptible plants. The miRNA counts increased in susceptible isoline due to leaf rust, conversely, the counts decreased in the resistant isoline in response to pathogenesis illustrating precise spatial tuning of miRNAs during compatible and incompatible interaction. Stem-loop quantitative real-time PCR was used to profile 10 highly differentially expressed miRNAs obtained from high-throughput sequencing data. The spatio-temporal profiling validated the differential expression of miRNAs between the isolines as well as in retort to pathogen infection. Degradome analysis provided 701 predicted target genes associated with defense response, signal transduction, development, metabolism, and transcriptional regulation. The obtained results indicate that wheat isolines employ diverse arrays of miRNAs that modulate their target genes during compatible and incompatible interaction. Our findings contribute to increase knowledge on roles of microRNA in wheat-leaf rust interactions and could help in rust

  2. Gene discovery in EST sequences from the wheat leaf rust fungus Puccinia triticina sexual spores, asexual spores and haustoria, compared to other rust and corn smut fungi

    Science.gov (United States)

    2011-01-01

    Background Rust fungi are biotrophic basidiomycete plant pathogens that cause major diseases on plants and trees world-wide, affecting agriculture and forestry. Their biotrophic nature precludes many established molecular genetic manipulations and lines of research. The generation of genomic resources for these microbes is leading to novel insights into biology such as interactions with the hosts and guiding directions for breakthrough research in plant pathology. Results To support gene discovery and gene model verification in the genome of the wheat leaf rust fungus, Puccinia triticina (Pt), we have generated Expressed Sequence Tags (ESTs) by sampling several life cycle stages. We focused on several spore stages and isolated haustorial structures from infected wheat, generating 17,684 ESTs. We produced sequences from both the sexual (pycniospores, aeciospores and teliospores) and asexual (germinated urediniospores) stages of the life cycle. From pycniospores and aeciospores, produced by infecting the alternate host, meadow rue (Thalictrum speciosissimum), 4,869 and 1,292 reads were generated, respectively. We generated 3,703 ESTs from teliospores produced on the senescent primary wheat host. Finally, we generated 6,817 reads from haustoria isolated from infected wheat as well as 1,003 sequences from germinated urediniospores. Along with 25,558 previously generated ESTs, we compiled a database of 13,328 non-redundant sequences (4,506 singlets and 8,822 contigs). Fungal genes were predicted using the EST version of the self-training GeneMarkS algorithm. To refine the EST database, we compared EST sequences by BLASTN to a set of 454 pyrosequencing-generated contigs and Sanger BAC-end sequences derived both from the Pt genome, and to ESTs and genome reads from wheat. A collection of 6,308 fungal genes was identified and compared to sequences of the cereal rusts, Puccinia graminis f. sp. tritici (Pgt) and stripe rust, P. striiformis f. sp. tritici (Pst), and poplar

  3. Gene discovery in EST sequences from the wheat leaf rust fungus Puccinia triticina sexual spores, asexual spores and haustoria, compared to other rust and corn smut fungi

    Directory of Open Access Journals (Sweden)

    Wynhoven Brian

    2011-03-01

    Full Text Available Abstract Background Rust fungi are biotrophic basidiomycete plant pathogens that cause major diseases on plants and trees world-wide, affecting agriculture and forestry. Their biotrophic nature precludes many established molecular genetic manipulations and lines of research. The generation of genomic resources for these microbes is leading to novel insights into biology such as interactions with the hosts and guiding directions for breakthrough research in plant pathology. Results To support gene discovery and gene model verification in the genome of the wheat leaf rust fungus, Puccinia triticina (Pt, we have generated Expressed Sequence Tags (ESTs by sampling several life cycle stages. We focused on several spore stages and isolated haustorial structures from infected wheat, generating 17,684 ESTs. We produced sequences from both the sexual (pycniospores, aeciospores and teliospores and asexual (germinated urediniospores stages of the life cycle. From pycniospores and aeciospores, produced by infecting the alternate host, meadow rue (Thalictrum speciosissimum, 4,869 and 1,292 reads were generated, respectively. We generated 3,703 ESTs from teliospores produced on the senescent primary wheat host. Finally, we generated 6,817 reads from haustoria isolated from infected wheat as well as 1,003 sequences from germinated urediniospores. Along with 25,558 previously generated ESTs, we compiled a database of 13,328 non-redundant sequences (4,506 singlets and 8,822 contigs. Fungal genes were predicted using the EST version of the self-training GeneMarkS algorithm. To refine the EST database, we compared EST sequences by BLASTN to a set of 454 pyrosequencing-generated contigs and Sanger BAC-end sequences derived both from the Pt genome, and to ESTs and genome reads from wheat. A collection of 6,308 fungal genes was identified and compared to sequences of the cereal rusts, Puccinia graminis f. sp. tritici (Pgt and stripe rust, P. striiformis f. sp

  4. Screening of wheat germplasm for the source of resistance against leaf and stripe rust under climatic conditions in Bhakkar

    International Nuclear Information System (INIS)

    Bhatti, M.A.; Burhan, M.; Shahzad, M.A.; Aslam, M.

    2009-01-01

    A field experiment was conducted to assess the level of resistance and susceptibility against stripe and leaf rust of wheat at Arid Zone Research 1, Institute, Bhakkar during, Rabi 2009, One hundred wheat genotypes were sown in second week of November. Each test line/variety of planted in two rows of 2 meter reach will two row of Morocco after every three entries to increase the disease pressure, fest lines/ varieties were inoculated thrice with highly susceptible Morocco and two most virulent Lr-26 and Lr-23 patho type. Out of eighty four test entries/varieties screened against le leaf rust, 5 exhibited resistant 21 moderately susceptible, 20 susceptible, 28 moderately resistant and 10 were highly susceptible. The present investigation indicated that there was no highly resistant lines/variety with zero disease severity. On the other hand, as regards stripe rust, out of thirty seven lines/varieties only two lines were susceptible to disease, Among other lines/ varieties, 12 resistant, 11 moderately resistant, 6 moderately susceptible and 2 susceptible against disease. Four (4) lines /varieties proved as highly resistant with zero disease severity.

  5. Cytogenetic analysis and mapping of leaf rust resistance in Aegilops speltoides Tausch derived bread wheat line Selection2427 carrying putative gametocidal gene(s).

    Science.gov (United States)

    Niranjana, M; Vinod; Sharma, J B; Mallick, Niharika; Tomar, S M S; Jha, S K

    2017-12-01

    Leaf rust (Puccinia triticina) is a major biotic stress affecting wheat yields worldwide. Host-plant resistance is the best method for controlling leaf rust. Aegilops speltoides is a good source of resistance against wheat rusts. To date, five Lr genes, Lr28, Lr35, Lr36, Lr47, and Lr51, have been transferred from Ae. speltoides to bread wheat. In Selection2427, a bread wheat introgresed line with Ae. speltoides as the donor parent, a dominant gene for leaf rust resistance was mapped to the long arm of chromosome 3B (LrS2427). None of the Lr genes introgressed from Ae. speltoides have been mapped to chromosome 3B. Since none of the designated seedling leaf rust resistance genes have been located on chromosome 3B, LrS2427 seems to be a novel gene. Selection2427 showed a unique property typical of gametocidal genes, that when crossed to other bread wheat cultivars, the F 1 showed partial pollen sterility and poor seed setting, whilst Selection2427 showed reasonable male and female fertility. Accidental co-transfer of gametocidal genes with LrS2427 may have occurred in Selection2427. Though LrS2427 did not show any segregation distortion and assorted independently of putative gametocidal gene(s), its utilization will be difficult due to the selfish behavior of gametocidal genes.

  6. Identification and molecular characterization of a trans-acting small interfering RNA producing locus regulating leaf rust responsive gene expression in wheat (Triticum aestivum L.).

    Science.gov (United States)

    Dutta, Summi; Kumar, Dhananjay; Jha, Shailendra; Prabhu, Kumble Vinod; Kumar, Manish; Mukhopadhyay, Kunal

    2017-11-01

    A novel leaf rust responsive ta-siRNA-producing locus was identified in wheat showing similarity to 28S rRNA and generated four differentially expressing ta-siRNAs by phasing which targeted stress responsive genes. Trans-acting-small interfering RNAs (Ta-siRNAs) are plant specific molecules generally involved in development and are also stress responsive. Ta-siRNAs identified in wheat till date are all responsive to abiotic stress only. Wheat cultivation is severely affected by rusts and leaf rust particularly affects grain filling. This study reports a novel ta-siRNA producing locus (TAS) in wheat which is a segment of 28S ribosomal RNA but shows differential expression during leaf rust infestation. Four small RNA libraries prepared from wheat Near Isogenic Lines were treated with leaf rust pathogen and compared with untreated controls. A TAS with the ability to generate four ta-siRNAs by phasing events was identified along with the microRNA TamiR16 as the phase initiator. The targets of the ta-siRNAs included α-gliadin, leucine rich repeat, trans-membrane proteins, glutathione-S-transferase, and fatty acid desaturase among others, which are either stress responsive genes or are essential for normal growth and development of plants. Expression of the TAS, its generated ta-siRNAs, and their target genes were profiled at five different time points after pathogen inoculation of susceptible and resistant wheat isolines and compared with mock-inoculated controls. Comparative analysis of expression unveiled differential and reciprocal relationship as well as discrete patterns between susceptible and resistant isolines. The expression profiles of the target genes of the identified ta-siRNAs advocate more towards effector triggered susceptibility favouring pathogenesis. The study helps in discerning the functions of wheat genes regulated by ta-siRNAs in response to leaf rust.

  7. Protection of wheat against leaf and stem rust and powdery mildew diseases by inhibition of polyamine metabolism

    Science.gov (United States)

    Weinstein, L. H.; Osmeloski, J. F.; Wettlaufer, S. H.; Galston, A. W.

    1987-01-01

    In higher plants, polyamines arise from arginine by one of two pathways: via ornithine and ornithine decarboxylase or via agmatine and arginine decarboxylase but in fungi, only the ornithine decarboxylase pathway is present. Since polyamines are required for normal growth of microorganisms and plants and since the ornithine pathway can be irreversibly blocked by alpha-difluoromethylornithine (DFMO) which has no effect on arginine decarboxylase, fungal infection of green plants might be controlled by the site-directed use of such a specific metabolic inhibitor. DFMO at relatively low concentrations provided effective control of the three biotrophic fungal pathogens studied, Puccinia recondita (leaf rust), P. graminis f. sp. tritici (stem rust), and Erysiphe graminis (powdery mildew) on wheat (Triticum aestivum L.) Effective control of infection by leaf or stem rust fungi was obtained with sprays of DFMO that ranged from about 0.01 to 0.20 mM in experiments where the inhibitor was applied after spore inoculation. The powdery mildew fungus was somewhat more tolerant of DFMO, but good control of the pathogen was obtained at less than 1.0 mM. In general, application of DFMO after spore inoculation was more effective than application before inoculation. Less control was obtained following treatment with alpha-difluoromethylarginine (DFMA) but the relatively high degree of control obtained raises the possibility of a DFMA to DFMO conversion by arginase.

  8. Heritable, De Novo Resistance to Leaf Rust and Other Novel Traits in Selfed Descendants of Wheat Responding to Inoculation with Wheat Streak Mosaic Virus

    Science.gov (United States)

    Seifers, Dallas L.; Haber, Steve; Martin, Terry J.; McCallum, Brent D.

    2014-01-01

    Stable resistance to infection with Wheat streak mosaic virus (WSMV) can be evolved de novo in selfing bread wheat lines subjected to cycles of WSMV inoculation and selection of best-performing plants or tillers. To learn whether this phenomenon might be applied to evolve resistance de novo to pathogens unrelated to WSMV, we examined the responses to leaf rust of succeeding generations of the rust- and WSMV-susceptible cultivar ‘Lakin’ following WSMV inoculation and derived rust-resistant sublines. After three cycles of the iterative protocol five plants, in contrast to all others, expressed resistance to leaf and stripe rust. A subset of descendant sublines of one of these, ‘R1’, heritably and uniformly expressed the new trait of resistance to leaf rust. Such sublines, into which no genes from a known source of resistance had been introgressed, conferred resistance to progeny of crosses with susceptible parents. The F1 populations produced from crosses between, respectively, susceptible and resistant ‘Lakin’ sublines 4-3-3 and 4-12-3 were not all uniform in their response to seedling inoculation with race TDBG. In seedling tests against TDBG and MKPS races the F2s from F1 populations that were uniformly resistant had 3∶1 ratios of resistant to susceptible individuals but the F2s from susceptible F1 progenitors were uniformly susceptible. True-breeding lines derived from resistant individuals in F2 populations were resistant to natural stripe and leaf rust inoculum in the field, while the ‘Lakin’ progenitor was susceptible. The next generation of six of the ‘Lakin’-derived lines exhibited moderate to strong de novo resistance to stem rust races TPMK, QFCS and RKQQ in seedling tests while the ‘Lakin’ progenitor was susceptible. These apparently epigenetic effects in response to virus infection may help researchers fashion a new tool that expands the range of genetic resources already available in adapted germplasm. PMID:24497941

  9. Mapping of Leaf Rust Resistance Genes and Molecular Characterization of the 2NS/2AS Translocation in the Wheat Cultivar Jagger.

    Science.gov (United States)

    Xue, Shulin; Kolmer, James A; Wang, Shuwen; Yan, Liuling

    2018-04-19

    Winter wheat cultivar 'Jagger' was recently found to have an alien chromosomal segment 2NS that has Lr37 , a gene conferring resistance against leaf rust caused by Puccinia triticina The objective of this study was to map and characterize the gene(s) for seedling leaf rust resistance in Jagger. The recombinant inbred line (RIL) population of Jagger × '2174' was inoculated with leaf rust pathogen THBJG and BBBDB, and evaluated for infection type (IT) response. A major quantitative trait locus (QTL) for THBJG and BBBDB was coincidently mapped to chromosome arm 2AS, and the QTL accounted for 56.6% - 66.2% of total phenotypic variation in infection type (IT) response to THBJG, and 72.1% - 86.9% to BBBDB. The causal gene for resistance to these rust races was mapped to the 2NS segment in Jagger. The 2NS segment was located in a region of approximately 27.8 Mb starting from the telomere of chromosome arm 2AS, based on the sequences of the A genome in tetraploid wheat. The Lr17a gene on chromosome arm 2AS was delimited to 3.1 Mb in the genomic region, which was orthologous to the 2NS segment. Therefore, the Lr37 gene in the 2NS segment can be pyramided with other effective resistance genes, rather than Lr17a in wheat, to improve resistance to rust diseases. Copyright © 2018, G3: Genes, Genomes, Genetics.

  10. Temporal Gene Expression Profiling of the Wheat Leaf Rust Pathosystem Using cDNA Microarray Reveals Differences in Compatible and Incompatible Defence Pathways

    OpenAIRE

    Fofana, Bourlaye; Banks, Travis W.; McCallum, Brent; Strelkov, Stephen E.; Cloutier, Sylvie

    2007-01-01

    In this study, we detail the construction of a custom cDNA spotted microarray containing 7728 wheat ESTs and the use of the array to identify host genes that are differentially expressed upon challenges with leaf rust fungal pathogens. Wheat cultivar RL6003 (Thatcher Lr1) was inoculated with Puccinia triticina virulence phenotypes BBB (incompatible) or TJB (7-2) (compatible) and sampled at four different time points (3, 6, 12, and 24 hours) after inoculation. Transcript expression levels rela...

  11. Molecular and genetic study of wheat rusts | Le Maitre | African ...

    African Journals Online (AJOL)

    Puccinia triticina, Puccinia graminis and Puccinia striiformis cause leaf, stem and yellow rust, respectively. Wheat rusts can cause losses as high as 70%. The rusts ability to evolve fungicide resistance has resulted in the use of resistant cultivars as the primary method of control. Breeding resistant cultivars is a long process ...

  12. Genome-wide identification and characterization of NB-ARC resistant genes in wheat (Triticum aestivum L.) and their expression during leaf rust infection.

    Science.gov (United States)

    Chandra, Saket; Kazmi, Andaleeb Z; Ahmed, Zainab; Roychowdhury, Gargi; Kumari, Veena; Kumar, Manish; Mukhopadhyay, Kunal

    2017-07-01

    NB-ARC domain-containing resistance genes from the wheat genome were identified, characterized and localized on chromosome arms that displayed differential yet positive response during incompatible and compatible leaf rust interactions. Wheat (Triticum aestivum L.) is an important cereal crop; however, its production is affected severely by numerous diseases including rusts. An efficient, cost-effective and ecologically viable approach to control pathogens is through host resistance. In wheat, high numbers of resistance loci are present but only few have been identified and cloned. A comprehensive analysis of the NB-ARC-containing genes in complete wheat genome was accomplished in this study. Complete NB-ARC encoding genes were mined from the Ensembl Plants database to predict 604 NB-ARC containing sequences using the HMM approach. Genome-wide analysis of orthologous clusters in the NB-ARC-containing sequences of wheat and other members of the Poaceae family revealed maximum homology with Oryza sativa indica and Brachypodium distachyon. The identification of overlap between orthologous clusters enabled the elucidation of the function and evolution of resistance proteins. The distributions of the NB-ARC domain-containing sequences were found to be balanced among the three wheat sub-genomes. Wheat chromosome arms 4AL and 7BL had the most NB-ARC domain-containing contigs. The spatio-temporal expression profiling studies exemplified the positive role of these genes in resistant and susceptible wheat plants during incompatible and compatible interaction in response to the leaf rust pathogen Puccinia triticina. Two NB-ARC domain-containing sequences were modelled in silico, cloned and sequenced to analyze their fine structures. The data obtained in this study will augment isolation, characterization and application NB-ARC resistance genes in marker-assisted selection based breeding programs for improving rust resistance in wheat.

  13. Determination of rust resistance genes in pakistani bread wheats

    International Nuclear Information System (INIS)

    Qamar, M.; Ahmad, S.D.; Rabbani, M.A.; Shinwari, Z.K.

    2014-01-01

    Stripe and leaf rusts are the major constraints to bread wheat production in Pakistan. Molecular markers were used to investigate the presence of leaf rust and stripe rust resistance gene cluster Lr34/Yr18 and stem rust resistance gene Sr2 in 52 Pakistani bread wheat cultivars/lines. PCR amplification of DNA fragments using DNA marker csLV-34 showed that 13 of the studied cultivars/lines, namely 03FJ26, NR 337, NR 339, NR 347, NR 350, Manthar, Margalla 99, Iqbal 2000, Saleem 2000, Wafaq 2001, Marwat 2001, Pirsabak 2004 and Fareed 2006 carry leaf rust and stripe rust resistance genes Lr34/Yr18. Stem rust resistance gene Sr2 was observed in 36 Pakistani spring wheat cultivars/lines using stm560.3tgag marker. The slow rusting gene Sr2 needs to be combined with additional stem rust resistance genes to establish durable resistance against Ug99 in modern wheat cultivars. Low frequency of Lr34/Yr18 was found in Pakistani wheats. This gene cluster needs to be incorporated into Pakistani wheats for durable rust resistance. (author)

  14. Identification of isoforms of microRNAs in wheat (Triticum aestivum L. and their role in leaf rust pathogenesis

    Directory of Open Access Journals (Sweden)

    Summi Dutta

    2017-10-01

    Full Text Available Bread wheat, a type of grass under genus Triticum and species aestivum covers the largest land area when production of cereal crops is considered. Being an allohexaploid (2n=6x=42; AABBDD, its genome is contributed by three progenitors and is evolutionarily rich. Rust in leaves, caused by Puccinia triticina, severely affects grain quality. MicroRNAs are considered as major components of gene silencing and so have deep role to play during stress. Post transcriptional modification of miRNAs which generates isomiRNAs significantly affects target specificity especially when the modification occurs in 5′end. A total of four small RNA libraries were prepared through next-generation Illumina sequencing techniques from leaves of two wheat Near Isogenic Lines (NILs, HD2329 (susceptible and HD2329 + LR24 (resistant. Prior to this, one set of the two NILs was mock inoculated and considered as control (with sRNA library code named SM-mi and RM-mi while other was treated with urediniospores of leaf rust fungus (with sRNA library code named SPI-mi and RPI-mi. Clean reads in all four libraries were previously used for prediction of 559 novel miRNAs and in the current study it was used to detect isoforms of these miRNAs. A total of 237 isoforms were detected for 41 miRNAs. These isoforms included both 5′ and 3′ modifications of miRNAs. There were 27 miRNAs with 5′ modifications and five miRNAs with 3′ modifications while nine miRNAs showed both types of modifications.

  15. Reaction of Rust on Some Bread Wheat Varieties in Çukurova Region

    OpenAIRE

    AY, Hasan

    2013-01-01

    This study was conducted with 126 varieties of wheat between 2009-2010 years in Adana. There has not been artificially inoculated yellow, leaf and stem rusts. Races of rust in natural were evaluated in both years. Between 2009-2010 this study was conducted in Adana, with 126 varieties of bread wheat. In both years, only the natural environment leaf rust races inoculated for assessments reactions of bread wheat. According to results, 49 bread wheat varieties were found resistant, 6 bread wheat...

  16. Host-induced silencing of essential genes in Puccinia triticina through transgenic expression of RNAi sequences reduces severity of leaf rust infection in wheat.

    Science.gov (United States)

    Panwar, Vinay; Jordan, Mark; McCallum, Brent; Bakkeren, Guus

    2018-05-01

    Leaf rust, caused by the pathogenic fungus Puccinia triticina (Pt), is one of the most serious biotic threats to sustainable wheat production worldwide. This obligate biotrophic pathogen is prevalent worldwide and is known for rapid adaptive evolution to overcome resistant wheat varieties. Novel disease control approaches are therefore required to minimize the yield losses caused by Pt. Having shown previously the potential of host-delivered RNA interference (HD-RNAi) in functional screening of Pt genes involved in pathogenesis, we here evaluated the use of this technology in transgenic wheat plants as a method to achieve protection against wheat leaf rust (WLR) infection. Stable expression of hairpin RNAi constructs with sequence homology to Pt MAP-kinase (PtMAPK1) or a cyclophilin (PtCYC1) encoding gene in susceptible wheat plants showed efficient silencing of the corresponding genes in the interacting fungus resulting in disease resistance throughout the T 2 generation. Inhibition of Pt proliferation in transgenic lines by in planta-induced RNAi was associated with significant reduction in target fungal transcript abundance and reduced fungal biomass accumulation in highly resistant plants. Disease protection was correlated with the presence of siRNA molecules specific to targeted fungal genes in the transgenic lines harbouring the complementary HD-RNAi construct. This work demonstrates that generating transgenic wheat plants expressing RNAi-inducing transgenes to silence essential genes in rust fungi can provide effective disease resistance, thus opening an alternative way for developing rust-resistant crops. © 2017 Her Majesty the Queen in Right of Canada. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

  17. In vivo assessment of plant extracts for control of plant diseases: A sesquiterpene ketolactone isolated from Curcuma zedoaria suppresses wheat leaf rust.

    Science.gov (United States)

    Han, Jae Woo; Shim, Sang Hee; Jang, Kyoung Soo; Choi, Yong Ho; Dang, Quang Le; Kim, Hun; Choi, Gyung Ja

    2018-02-01

    As an alternative to synthetic pesticides, natural materials such as plant extracts and microbes have been considered to control plant diseases. In this study, methanol extracts of 120 plants were explored for in vivo antifungal activity against Rhizoctonia solani, Botrytis cinerea, Phytophthora infestans, Puccinia triticina, and Blumeria graminis f. sp. hordei. Of the 120 plant extracts, eight plant extracts exhibited a disease control efficacy of more than 90% against at least one of five plant diseases. In particular, a methanol extract of Curcuma zedoaria rhizomes exhibited strong activity against wheat leaf rust caused by P. triticina. When the C. zedoaria methanol extracts were partitioned with various solvents, the layers of n-hexane, methylene chloride, and ethyl acetate showed disease control values of 100, 80, and 43%, respectively, against wheat leaf rust. From the C. zedoaria rhizome extracts, an antifungal substance was isolated and identified as a sesquiterpene ketolactone based on the mass and nuclear magnetic resonance spectral data. The active compound controlled the development of rice sheath blight, wheat leaf rust, and tomato late blight. Considering the in vivo antifungal activities of the sesquiterpene ketolactone and the C. zedoaria extracts, these results suggest that C. zedoaria can be used as a potent fungicide in organic agriculture.

  18. Expression of apoplast-targeted plant defensin MtDef4.2 confers resistance to leaf rust pathogen Puccinia triticina but does not affect mycorrhizal symbiosis in transgenic wheat.

    Science.gov (United States)

    Kaur, Jagdeep; Fellers, John; Adholeya, Alok; Velivelli, Siva L S; El-Mounadi, Kaoutar; Nersesian, Natalya; Clemente, Thomas; Shah, Dilip

    2017-02-01

    Rust fungi of the order Pucciniales are destructive pathogens of wheat worldwide. Leaf rust caused by the obligate, biotrophic basidiomycete fungus Puccinia triticina (Pt) is an economically important disease capable of causing up to 50 % yield losses. Historically, resistant wheat cultivars have been used to control leaf rust, but genetic resistance is ephemeral and breaks down with the emergence of new virulent Pt races. There is a need to develop alternative measures for control of leaf rust in wheat. Development of transgenic wheat expressing an antifungal defensin offers a promising approach to complement the endogenous resistance genes within the wheat germplasm for durable resistance to Pt. To that end, two different wheat genotypes, Bobwhite and Xin Chun 9 were transformed with a chimeric gene encoding an apoplast-targeted antifungal plant defensin MtDEF4.2 from Medicago truncatula. Transgenic lines from four independent events were further characterized. Homozygous transgenic wheat lines expressing MtDEF4.2 displayed resistance to Pt race MCPSS relative to the non-transgenic controls in growth chamber bioassays. Histopathological analysis suggested the presence of both pre- and posthaustorial resistance to leaf rust in these transgenic lines. MtDEF4.2 did not, however, affect the root colonization of a beneficial arbuscular mycorrhizal fungus Rhizophagus irregularis. This study demonstrates that the expression of apoplast-targeted plant defensin MtDEF4.2 can provide substantial resistance to an economically important leaf rust disease in transgenic wheat without negatively impacting its symbiotic relationship with the beneficial mycorrhizal fungus.

  19. Genetic analysis of rust resistance genes in global wheat cultivars: an overview

    International Nuclear Information System (INIS)

    Aktar-Uz-Zaman, Md; Tuhina-Khatun, Mst; Hanafi, Mohamed Musa; Sahebi, Mahbod

    2017-01-01

    Rust is the most devastating fungal disease in wheat. Three rust diseases, namely, leaf or brown rust caused by Puccinia triticina Eriks, stem or black rust caused by Puccinia graminis f. sp. tritici West, and stripe or yellow rust caused by Puccinia striiformis f. Tritici Eriks, are the most economically significant and common diseases among global wheat cultivars. Growing cultivars resistant to rust is the most sustainable, cost-effective and environmentally friendly approach for controlling rust diseases. To date, more than 187 rust resistance genes (80 leaf rust, 58 stem rust and 49 stripe rust) have been derived from diverse wheat or durum wheat cultivars and the related wild species using different molecular methods. This review provides a detailed discussion of the different aspects of rust resistance genes, their primitive sources, their distribution in global wheat cultivars and the importance of durable resistant varieties for controlling rust diseases. This information will serve as a foundation for plant breeders and geneticists to develop durable rust-resistant wheat varieties through marker-assisted breeding or gene pyramiding

  20. QTL Mapping of Adult-Plant Resistance to Leaf Rust in the Wheat Cross Zhou 8425B/Chinese Spring Using High-Density SNP Markers

    Directory of Open Access Journals (Sweden)

    Peipei Zhang

    2017-05-01

    Full Text Available Wheat leaf rust is an important disease worldwide. Growing resistant cultivars is an effective means to control the disease. In the present study, 244 recombinant inbred lines from Zhou 8425B/Chinese Spring cross were phenotyped for leaf rust severities during the 2011–2012, 2012–2013, 2013–2014, and 2014–2015 cropping seasons at Baoding, Hebei province, and 2012–2013 and 2013–2014 cropping seasons in Zhoukou, Henan province. The population was genotyped using the high-density Illumina iSelect 90K SNP assay and SSR markers. Inclusive composite interval mapping identified eight QTL, designated as QLr.hebau-2AL, QLr.hebau-2BS, QLr.hebau-3A, QLr.hebau-3BS, QLr.hebau-4AL, QLr.hebau-4B, QLr.hebau-5BL, and QLr.hebau-7DS, respectively. QLr.hebau-2BS, QLr.hebau-3A, QLr.hebau-3BS, and QLr.hebau-5BL were derived from Zhou 8425B, whereas the other four were from Chinese Spring. Three stable QTL on chromosomes 2BS, 4B and 7DS explained 7.5–10.6%, 5.5–24.4%, and 11.2–20.9% of the phenotypic variance, respectively. QLr.hebau-2BS in Zhou 8425B might be the same as LrZH22 in Zhoumai 22; QLr.hebau-4B might be the residual resistance of Lr12, and QLr.hebau-7DS is Lr34. QLr.hebau-2AL, QLr.hebau-3BS, QLr.hebau-4AL, and QLr.hebau-5BL are likely to be novel QTL for leaf rust. These QTL and their closely linked SNP and SSR markers can be used for fine mapping, candidate gene discovery, and marker-assisted selection in wheat breeding.

  1. Wheat Rust Toolbox Related to New Initiatives on Yellow Rust

    DEFF Research Database (Denmark)

    Hansen, Jens Grønbech; Lassen, Poul

    ://www.fao.org/agriculture/crops/rust/stem/rust-report/en/). The Wheat rust toolbox is one of several International research platforms hosted by Aarhus University, and it uses the same ICT framework and databases as EuroWheat (www.eurowheat.org) and EuroBlight (www.EuroBlight.net). The Wheat Rust Toolbox will also serve the Global Rust Reference Centre (GRRC) as well...... – 2009), and as soon as possible this will be expanded to cover all global yellow rust data available via the GRRC. The presentation will focus on experiences from the previous work on global databases and web based information systems, as well as propose ideas how the toolbox can be helpful regarding...

  2. WHEAT LEAF RUST SEVERITY AS AFFECTED BY PLANT DENSITY AND SPECIES PROPORTION IN SIMPLE COMMUNITIES OF WHEAT AND WILD OATS

    Science.gov (United States)

    While it is generally accepted that dense stands of plants exacerbate epidemics caused by foliar pathogens, there is little experimental evidence to support this view. We grew model plant communities consisting of wheat and wild oats at different densities and proportions and exp...

  3. Marker-assisted pyramiding of Thinopyrum-derived leaf rust ...

    Indian Academy of Sciences (India)

    Annual Meetings · Mid Year Meetings · Discussion Meetings · Public Lectures · Lecture Workshops · Refresher Courses · Symposia · Live Streaming. Home; Journals; Journal of Genetics; Volume 96; Issue 6. Marker-assisted pyramiding of Thinopyrum-derived leaf rust resistance genes Lr19 and Lr24 in bread wheat variety ...

  4. Conserved loci of leaf and stem rust fungi of wheat share synteny interrupted by lineage-specific influx of repeat elements

    Directory of Open Access Journals (Sweden)

    Fellers John P

    2013-01-01

    Full Text Available Abstract Background Wheat leaf rust (Puccinia triticina Eriks; Pt and stem rust fungi (P. graminis f.sp. tritici; Pgt are significant economic pathogens having similar host ranges and life cycles, but different alternate hosts. The Pt genome, currently estimated at 135 Mb, is significantly larger than Pgt, at 88 Mb, but the reason for the expansion is unknown. Three genomic loci of Pt conserved proteins were characterized to gain insight into gene content, genome complexity and expansion. Results A bacterial artificial chromosome (BAC library was made from P. triticina race 1, BBBD and probed with Pt homologs of genes encoding two predicted Pgt secreted effectors and a DNA marker mapping to a region of avirulence. Three BACs, 103 Kb, 112 Kb, and 166 Kb, were sequenced, assembled, and open reading frames were identified. Orthologous genes were identified in Pgt and local conservation of gene order (microsynteny was observed. Pairwise protein identities ranged from 26 to 99%. One Pt BAC, containing a RAD18 ortholog, shares syntenic regions with two Pgt scaffolds, which could represent both haplotypes of Pgt. Gene sequence is diverged between the species as well as within the two haplotypes. In all three BAC clones, gene order is locally conserved, however, gene shuffling has occurred relative to Pgt. These regions are further diverged by differing insertion loci of LTR-retrotransposon, Gypsy, Copia, Mutator, and Harbinger mobile elements. Uncharacterized Pt open reading frames were also found; these proteins are high in lysine and similar to multiple proteins in Pgt. Conclusions The three Pt loci are conserved in gene order, with a range of gene sequence divergence. Conservation of predicted haustoria expressed secreted protein genes between Pt and Pgt is extended to the more distant poplar rust, Melampsora larici-populina. The loci also reveal that genome expansion in Pt is in part due to higher occurrence of repeat-elements in this species.

  5. Genetic characterisation of novel resistance alleles to stem rust and stripe rust in wheat-alien introgression lines

    OpenAIRE

    Rahmatov, Mahbubjon

    2016-01-01

    Bread wheat (Triticum aestivum L., 2n = 6x = 42, AABBDD) is one of the most important food crops world-wide, but is attacked by many diseases and pests that cause significant yield losses. Globally, stem rust (Sr) (Puccinia graminis f. sp. tritici Erikss & E. Henning), stripe rust (Yr) (Puccinia striiformis Westend. f. sp. tritici Eriks) and leaf rust (Lr) (Puccinia triticina Eriks) are a great threat to wheat production. The majority of the Sr, Yr and Lr resistance genes are already defeated...

  6. Molecular and genetic study of wheat rusts

    African Journals Online (AJOL)

    Nicholas Le Maitre

    Phylogenetic trees were created for leaf and stem rust pathotypes. Field isolates of ... Key words: Prevalence, microsatellite, amplified fragment length polymorphisms (AFLP), phylogeny, Puccinia. INTRODUCTION. Puccinia triticina Eriks ..... Genetic distances and reconstruction phylogenetic trees from microsatellite DNA.

  7. Short communication: Emergence of a new race of leaf rust with combined virulence to Lr14a and Lr72 genes on durum wheat

    Energy Technology Data Exchange (ETDEWEB)

    Soleiman, N.H; Solis, I.; Soliman, M.H.; Sillero, J.C.; Villegas, D.; Alvaro, F.; Royo, C.; Serra, J.; Ammar, K.; Martínez-Moreno, F.

    2016-11-01

    Leaf rust is a foliar disease caused by the fungus Puccinia triticina that may severely reduce durum wheat yield. Resistance to this pathogen is common in modern durum germplasm but is frequently based on Lr72 and Lr14a. After accounts of races with virulence to Lr14a gene in France in 2000, the present study reports the detection in 2013 for the first time of a new race with virulence to Lr14a and Lr72. The aim of this work was to characterize the virulence pattern of four Spanish isolates with virulence to Lr14a, and to discuss the consequences of this presence. Rusted leaves from cultivars ‘Don Jaime’ (Lr14a) and ‘Gallareta’ (Lr72) were collected in 2013 in the field at two Spanish sites, one in the south (near Cadiz) and another in the north (near Girona). Spores from single pustule for each cultivar and site were multiplied on susceptible cultivar ‘Don Rafael’. Then, the four isolates were inoculated on a set of 19 isogenic lines Thatcher to characterize their virulence spectrum. All isolates presented the same virulence pattern. They were virulent on both Lr14a and Lr72 and the race was named DBB/BS. This race was very similar to those reported in 2009-11, but with added virulence to Lr14a. The resistance based on Lr14a has therefore been overcome in Spain, by a new race that has likely emerged via stepwise mutation from the local predominating races. This information is important to guide breeders in their breeding programmes and gene deployment strategies. (Author)

  8. Introgression of a leaf rust resistance gene from Aegilops caudata to ...

    Indian Academy of Sciences (India)

    tance genes (Lr) and 48 stripe rust resistance genes (Yr) have .... Leaf rust reaction of the parents, wheat – Ae. caudata introgression lines and representative F2 plants developed from the cross: .... segregation ratio, which is otherwise a serious problem with ... Financial assistance was provided by the USDA-ARS under the.

  9. Development of RAPD based markers for wheat rust resistance ...

    African Journals Online (AJOL)

    Rust diseases are the major cause of low yield of wheat in Pakistan. Wheat breeders all over the world as well as in Pakistan are deriving rust resistance genes from alien species like Triticum ventricosum and introducing them in common wheat (Triticum aestivum). One such example is the introgression of rust resistance ...

  10. Sources of resistance to yellow rust and stem rust in wheat-alien introgressions

    OpenAIRE

    Rahmatov, Mahbubjon

    2013-01-01

    Wheat is the staple food and the main source of caloric intake in most developing countries, and thereby an important source in order to maintain food security for the growing populations in those countries. Stem rust Puccinia graminis f. sp. tritici, and yellow rust P. striiformis f. sp. tritici of wheat continues to cause severe damage locally and globally, thereby contributing to food insecurity. In this paper biology and taxonomy of stem rust and yellow rust, breeding for resistance, util...

  11. The Lr34 adult plant rust resistance gene provides seedling resistance in durum wheat without senescence.

    Science.gov (United States)

    Rinaldo, Amy; Gilbert, Brian; Boni, Rainer; Krattinger, Simon G; Singh, Davinder; Park, Robert F; Lagudah, Evans; Ayliffe, Michael

    2017-07-01

    The hexaploid wheat (Triticum aestivum) adult plant resistance gene, Lr34/Yr18/Sr57/Pm38/Ltn1, provides broad-spectrum resistance to wheat leaf rust (Lr34), stripe rust (Yr18), stem rust (Sr57) and powdery mildew (Pm38) pathogens, and has remained effective in wheat crops for many decades. The partial resistance provided by this gene is only apparent in adult plants and not effective in field-grown seedlings. Lr34 also causes leaf tip necrosis (Ltn1) in mature adult plant leaves when grown under field conditions. This D genome-encoded bread wheat gene was transferred to tetraploid durum wheat (T. turgidum) cultivar Stewart by transformation. Transgenic durum lines were produced with elevated gene expression levels when compared with the endogenous hexaploid gene. Unlike nontransgenic hexaploid and durum control lines, these transgenic plants showed robust seedling resistance to pathogens causing wheat leaf rust, stripe rust and powdery mildew disease. The effectiveness of seedling resistance against each pathogen correlated with the level of transgene expression. No evidence of accelerated leaf necrosis or up-regulation of senescence gene markers was apparent in these seedlings, suggesting senescence is not required for Lr34 resistance, although leaf tip necrosis occurred in mature plant flag leaves. Several abiotic stress-response genes were up-regulated in these seedlings in the absence of rust infection as previously observed in adult plant flag leaves of hexaploid wheat. Increasing day length significantly increased Lr34 seedling resistance. These data demonstrate that expression of a highly durable, broad-spectrum adult plant resistance gene can be modified to provide seedling resistance in durum wheat. © 2016 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

  12. Molecular and genetic study of wheat rusts | Le Maitre | African ...

    African Journals Online (AJOL)

    Microsatellite markers were used to differentiate P. triticina and P. striiformis pathotypes. Amplified fragment length polymorphisms (AFLP) were used to differentiate stem rust P. graminis pathotypes. Phylogenetic trees were created for leaf and stem rust pathotypes. Field isolates of leaf, stem and yellow rust were collected ...

  13. development of wheat germplasm for stem rust resistance in eastern ...

    African Journals Online (AJOL)

    ACSS

    Wheat (Triticum aestivum) rust outbreak is the primary production constraint in Eastern Africa. Ethiopia, Kenya and Uganda are hot spots for the epidemic of rusts, due to higher rates of evolution of new pathogen races, especially of the virulent stem rust (Puccinia graminis) race, Ug99. The objective of this study was to ...

  14. Development of wheat germplasm for stem rust resistance in eastern ...

    African Journals Online (AJOL)

    Wheat (Triticum aestivum) rust outbreak is the primary production constraint in Eastern Africa. Ethiopia, Kenya and Uganda are hot spots for the epidemic of rusts, due to higher rates of evolution of new pathogen races, especially of the virulent stem rust (Puccinia graminis) race, Ug99. The objective of this study was to ...

  15. stem rust seedling resistance genes in ethiopian wheat cultivars

    African Journals Online (AJOL)

    Prof. Adipala Ekwamu

    Stem rust caused by Puccinia graminis f. sp. tritici is one of the major biotic limiting factors for wheat production in Ethiopia. Host plant resistance is the best option to manage stem rust from its economic and environmental points of view. Wheat cultivars are released for production without carrying race specific tests against ...

  16. Rust resistance evaluation of advanced wheat (triticum aestivum l.) genotypes using pcr-based dna markers

    International Nuclear Information System (INIS)

    Rahman, S.U.; Younis, M.; Iqbal, M.Z.; Nawaz, M.

    2014-01-01

    The most effective and environmental friendly approach for the control of wheat rust disease is the use of resistant genotypes. The present study was conducted to explore rust resistance potential of 85 elite wheat genotypes (36 varieties and 49 advanced lines) using various types of DNA markers like STS, SCAR and SSR. DNA markers linked with different genes conferring resistance to rusts (Leaf rust=Lr, Yellow rust=Yr and Stem rust=Sr) were employed in this study. A total of 18 genes, consisting of eleven Lr (lr1, lr10, lr19, lr21, lr28, lr34, lr39, lr46, lr47, lr51 and lr52), four Yr (yr5, yr18, yr26 and yr29) and three Sr genes (sr2, sr29, and sr36) were studied through linked DNA markers. Maximum number of Lr genes was found in 17 advanced lines and 9 varieties, Yr genes in 26 advanced lines and 20 wheat varieties, and Sr genes in 43 advanced lines and 27 varieties. Minimum number of Lr genes was found in advanced line D-97 and variety Kohinoor-83, Yr genes in wheat variety Bwp-97 and Sr genes in 6 advanced lines and 8 varieties. Molecular data revealed that genotypes having same origin, from a specified area showed resistance for similar type of genes. In this study, an average similarity of 84% was recorded among wheat genotypes. Out of 18 loci, 15 were found to be polymorphic. (author)

  17. Stem and stripe rust resistance in wheat induced by gamma rays and thermal neutrons

    International Nuclear Information System (INIS)

    Skorda, E.A.

    1977-01-01

    Attempts were made to produce rust-resistant mutants in wheat cultivars. Seeds of G-38290 and G-58383 (T. aestivum), Methoni and Ilectra (T. durum) varieties were irradiated with different doses of γ-rays (3.5, 5, 8, 11, 15 and 21 krad) and thermal neutrons (1.7, 4, 5.5, 7.5, 10.5 and 12.5x10 12 ) and the M 1 plants were grown under isolation in the field. The objective was mainly to induce stripe, leaf and stem rust resistance in G-38290, Methoni and Ilectra varieties and leaf rust resistance in G-58383. Mutations for rust resistance were detected by using the ''chimera method'' under natural and artificial field epiphytotic conditions in M 2 and successive generations. The mutants detected were tested for resistance to a broad spectrum of available races. Mutants resistant or moderately resistant to stripe and stem rusts but not to leaf rust, were selected from G-38290. From the other three varieties tested no rust-resistant mutants were detected. The frequency of resistant mutants obtained increased with increased γ-ray dose-rate, but not with increased thermal neutron doses. Some mutants proved to be resistant or moderately resistant to both rusts and others to one of them. Twenty of these mutants were evaluated for yield from M 5 to M 8 . Some of them have reached the final stage of regional yield trials and one, induced by thermal neutrons, was released this year. (author)

  18. Laboratory, greenhouse and field methods for screening rust-resistant wheat cultivars

    International Nuclear Information System (INIS)

    Mashaal, S.F.; Kiraly, Z.; Barabas, Z.; Barna, B.; Cereal Research Inst., Szeged, Hungary)

    1977-01-01

    Detached flag leaf cultures were not suitable for evaluation of stem-rust resistance in our screening programme. On the basis of yield evaluation it was possible to screen out ten stem-rust ''tolerant'' wheat lines in field experiments. Rusted and protected microplots of each line were paired within a replicate. After artificial inoculation, the protected plants were sprayed with fungicides (benomyl plus dithiocarbamate plus copper salt) at weekly intervals until maturation to keep each protected plot rust-free. The thousand-kernel weights of rusted and protected plots were compared. When the thousand-kernel weight of protected plot increased only slightly and the rust reaction type of plants was susceptible in the rusted plot, the line was screened out as putative ''tolerant''. On the basis of three-year field trial ten ''tolerant'' lines were selected. Nine out of ten lines proved to be resistant to two stem-rust races in greenhouse tests in the seedling stage, when resistance was determined on the basis of reduced spore production instead of infection types. Resistance of these seedlings related partly to the reduced number of pustules and partly to a slow rusting character of plants. It seems possible to screen resistant cultivars in the greenhouse by the method outlined in this paper, when resistance is determined on the basis of a reduced number of infection sites and/or by the slow rusting capacity. (author)

  19. Genetics and mapping of a new leaf rust resistance gene in Triticum ...

    Indian Academy of Sciences (India)

    AMIT KUMAR SINGH

    seedling stage revealed that leaf rust resistance in Selection G12 is conditioned by a single ... closely or distantly related species of wheat (McIntosh et al. 2013 ... An effort was also made to determine the chromo- ... Materials and methods.

  20. Genetics and mapping of a new leaf rust resistance gene in Triticum ...

    Indian Academy of Sciences (India)

    A Triticum timopheevii-derived bread wheat line, Selection G12, was screened with 40 pathotypes of leaf rust pathogen, Puccinia triticina at seedling stage and with two most commonly prevalent pathotypes 77-5 and 104-2 at adult plant stage. Selection G12 showed resistance at both seedling and adult plant stages.

  1. McGISH identification and phenotypic description of leaf rust and yellow rust resistant partial amphiploids originating from a wheat × Thinopyrum synthetic hybrid cross.

    Science.gov (United States)

    Kruppa, Klaudia; Türkösi, Edina; Mayer, Marianna; Tóth, Viola; Vida, Gyula; Szakács, Éva; Molnár-Láng, Márta

    2016-11-01

    A Thinopyrum intermedium × Thinopyrum ponticum synthetic hybrid wheatgrass is an excellent source of leaf and stem rust resistance produced by N.V.Tsitsin. Wheat line Mv9kr1 was crossed with this hybrid (Agropyron glael) in Hungary in order to transfer its advantageous agronomic traits into wheat. As the wheat parent was susceptible to leaf rust, the transfer of resistance was easily recognizable in the progenies. Three different partial amphiploid lines with leaf rust resistance were selected from the wheat/Thinopyrum hybrid derivatives by multicolour genomic in situ hybridization. Chromosome counting on the partial amphiploids revealed 58 chromosomes (18 wheatgrass) in line 194, 56 (14 wheatgrass) in line 195 and 54 (12 wheatgrass) in line 196. The wheat chromosomes present in these lines were identified and the wheatgrass chromosomes were characterized by fluorescence in situ hybridization using the repetitive DNA probes Afa-family, pSc119.2 and pTa71. The 3D wheat chromosome was missing from the lines. Molecular marker analysis showed the presence of the Lr24 leaf rust resistance gene in lines 195 and 196. The morphological traits were evaluated in the field during two consecutive seasons in two different locations.

  2. Glyphosate inhibits rust diseases in glyphosate-resistant wheat and soybean

    OpenAIRE

    Feng, Paul C. C.; Baley, G. James; Clinton, William P.; Bunkers, Greg J.; Alibhai, Murtaza F.; Paulitz, Timothy C.; Kidwell, Kimberlee K.

    2005-01-01

    Glyphosate is a broad-spectrum herbicide used for the control of weeds in glyphosate-resistant crops. Glyphosate inhibits 5-enolpyruvyl shikimate 3-phosphate synthase, a key enzyme in the synthesis of aromatic amino acids in plants, fungi, and bacteria. Studies with glyphosate-resistant wheat have shown that glyphosate provided both preventive and curative activities against Puccinia striiformis f. sp. tritici and Puccinia triticina, which cause stripe and leaf rusts, respectively, in wheat. ...

  3. Lr67/Yr46 confers adult plant resistance to stem rust and powdery mildew in wheat.

    Science.gov (United States)

    Herrera-Foessel, Sybil A; Singh, Ravi P; Lillemo, Morten; Huerta-Espino, Julio; Bhavani, Sridhar; Singh, Sukhwinder; Lan, Caixia; Calvo-Salazar, Violeta; Lagudah, Evans S

    2014-04-01

    We demonstrate that Lr67/Yr46 has pleiotropic effect on stem rust and powdery mildew resistance and is associated with leaf tip necrosis. Genes are designated as Sr55, Pm46 and Ltn3 , respectively. Wheat (Triticum aestivum) accession RL6077, known to carry the pleiotropic slow rusting leaf and yellow rust resistance genes Lr67/Yr46 in Thatcher background, displayed significantly lower stem rust (P. graminis tritici; Pgt) and powdery mildew (Blumeria graminis tritici; Bgt) severities in Kenya and in Norway, respectively, compared to its recurrent parent Thatcher. We investigated the resistance of RL6077 to stem rust and powdery mildew using Avocet × RL6077 F6 recombinant inbred lines (RILs) derived from two photoperiod-insensitive F3 families segregating for Lr67/Yr46. Greenhouse seedling tests were conducted with Mexican Pgt race RTR. Field evaluations were conducted under artificially initiated stem rust epidemics with Pgt races RTR and TTKST (Ug99 + Sr24) at Ciudad Obregon (Mexico) and Njoro (Kenya) during 2010-2011; and under natural powdery mildew epiphytotic in Norway at Ås and Hamar during 2011 and 2012. In Mexico, a mean reduction of 41 % on stem rust severity was obtained for RILs carrying Lr67/Yr46, compared to RILs that lacked the gene, whereas in Kenya the difference was smaller (16 %) but significant. In Norway, leaf tip necrosis was associated with Lr67/Yr46 and RILs carrying Lr67/Yr46 showed a 20 % reduction in mean powdery mildew severity at both sites across the 2 years of evaluation. Our study demonstrates that Lr67/Yr46 confers partial resistance to stem rust and powdery mildew and is associated with leaf tip necrosis. The corresponding pleiotropic, or tightly linked, genes, designated as Sr55, Pm46, and Ltn3, can be utilized to provide broad-spectrum durable disease resistance in wheat.

  4. Incomplete resistance to coffee leaf rust (Hemileia vastatrix)

    NARCIS (Netherlands)

    Eskes, A.B.

    1983-01-01

    Incomplete resistance to coffee leaf rust ( Hemileia vastatrix ) may be of value in obtaining durable resistance, which is of great importance for the perennial coffee crop. Methods were developed to assess incomplete resistance to coffee leaf rust by using illustrated scales

  5. Characterization of stem rust resistance gene Sr2 in Indian wheat ...

    African Journals Online (AJOL)

    Stem rust or black rust is one of the most important diseases of wheat worldwide. In India, central, peninsular and southern hill zones are particularly prone to stem rust where favourable environmental conditions exist. The recent emergence of wheat stem rust race Ug99 (TTKSK) and related strains threatens global wheat ...

  6. Stem rust seedling resistance genes in Ethiopian wheat cultivars ...

    African Journals Online (AJOL)

    Thirty durum wheat (19 commercial cultivars and 11 breeding lines) and 30 bread wheat (20 commercial cultivars and 10 breeding lines) were tested for gene postulation. Stem rust infection types produced on wheat cultivars and breeding lines by ten Pgt races was compared with infection types produced on 40 near ...

  7. Sources of stem rust resistance in Ethiopian tetraploid wheat ...

    African Journals Online (AJOL)

    Stem or black rust of wheat caused by the fungus Puccinia graminis f. sp. tritici Ericks and Henn (Pgt) is an important disease on wheat worldwide. Pgt is an obligate biotroph, heteroceous in its life cycle and heterothallic in mating type. Seedlings of 41 emmer (Triticum dicoccum), 56 durum (T. durum) wheat accessions were ...

  8. Wheat rusts in the United States in 2016

    Science.gov (United States)

    In 2016, wheat stripe rust caused by Puccinia striiformis f. sp. graminis was widespread throughout the United States. Cool temperatures and abundant rainfall in the southern Great Plains allowed stripe rust to become widely established and spread throughout the Great Plains and eastern United State...

  9. Postulation of rust resistance genes in Nordic spring wheat genotypes and identification of widely effective sources of resistance against the Australian rust flora.

    Science.gov (United States)

    Randhawa, Mandeep; Bansal, Urmil; Lillemo, Morten; Miah, Hanif; Bariana, Harbans

    2016-11-01

    Wild relatives, landraces and cultivars from different geographical regions have been demonstrated as the sources of genetic variation for resistance to rust diseases. This study involved assessment of diversity for resistance to three rust diseases among a set of Nordic spring wheat cultivars. These cultivars were tested at the seedling stage against several pathotypes of three rust pathogens in the greenhouse. All stage stem rust resistance genes Sr7b, Sr8a, Sr12, Sr15, Sr17, Sr23 and Sr30, and leaf rust resistance genes Lr1, Lr3a, Lr13, Lr14a, Lr16 and Lr20 were postulated either singly or in different combinations among these cultivars. A high proportion of cultivars were identified to carry linked rust resistance genes Sr15 and Lr20. Although 51 cultivars showed variation against Puccinia striiformis f. sp. tritici (Pst) pathotypes used in this study, results were not clearly contrasting to enable postulation of stripe rust resistance genes in these genotypes. Stripe rust resistance gene Yr27 was postulated in four cultivars and Yr1 was present in cultivar Zebra. Cultivar Tjalve produced low stripe rust response against all Pst pathotypes indicating the presence either of a widely effective resistance gene or combination of genes with compensating pathogenic specificities. Several cultivars carried moderate to high level of APR to leaf rust and stripe rust. Seedling stem rust susceptible cultivar Aston exhibited moderately resistant to moderately susceptible response, whereas other cultivars belonging to this class were rated moderately susceptible or higher. Molecular markers linked with APR genes Yr48, Lr34/Yr18/Sr57, Lr68 and Sr2 detected the presence of these genes in some genotypes.

  10. Molecular Cytogenetic Characterization of two Triticum-Secale-Thinopyrum Trigeneric Hybrids Exhibiting Superior Resistance to Fusarium Head Blight, Leaf Rust, and Stem Rust Race Ug99.

    Science.gov (United States)

    Dai, Yi; Duan, Yamei; Liu, Huiping; Chi, Dawn; Cao, Wenguang; Xue, Allen; Gao, Yong; Fedak, George; Chen, Jianmin

    2017-01-01

    Fusarium head blight (FHB), leaf rust, and stem rust are the most destructive fungal diseases in current world wheat production. The diploid wheatgrass, Thinopyrum elongatum (Host) Dewey (2 n = 2 x = 14, EE) is an excellent source of disease resistance genes. Two new Triticum-Secale-Thinopyrum trigeneric hybrids were derived from a cross between a hexaploid triticale (X Triticosecale Wittmack, 2 n = 6 x = 42, AABBRR) and a hexaploid Triticum trititrigia (2 n = 6 x = 42, AABBEE), were produced and analyzed using genomic in situ hybridization and molecular markers. The results indicated that line RE21 contained 14 A-chromosomes, 14 B-chromosomes, three pairs of R-chromosomes (4R, 6R, and 7R), and four pairs of E-chromosomes (1E, 2E, 3E, and 5E) for a total chromosome number of 2 n = 42. Line RE62 contained 14 A-chromosomes, 14 B-chromosomes, six pairs of R-chromosomes, and one pair of translocation chromosomes between chromosome 5R and 5E, for a total chromosome number of 2 n = 42. At the seedling and adult growth stages under greenhouse conditions, line RE21 showed high levels of resistance to FHB, leaf rust, and stem rust race Ug99, and line RE62 was highly resistant to leaf rust and stem rust race Ug99. These two lines (RE21 and RE62) display superior disease resistance characteristics and have the potential to be utilized as valuable germplasm sources for future wheat improvement.

  11. Reação de cultivares de trigo à ferrugem da folha e mancha amarela e responsividade a fungicidas Reaction of wheat cultivars to leaf rust and yellow spot and responsiveness to fungicides

    Directory of Open Access Journals (Sweden)

    Nédio Rodrigo Tormen

    2013-02-01

    Full Text Available Com o objetivo de avaliar a reação de cultivares de trigo à ferrugem da folha, causada por Puccinia triticina, e mancha amarela, causada por Drechslera tritici-repentis, e sua responsividade ao controle químico com fungicidas, foi conduzido experimento de campo durante os invernos de 2009 e 2010, Itaara-RS. As cultivares avaliadas foram 'FCEP 51', 'FCEP 52', 'CD 114', 'FCEP Campo Real', 'FCEP Cristalino', 'FCEP Nova Era', 'OR Marfim', 'OR Abalone', 'OR Safira' e 'OR Pampeano'; na safra 2010, a cultivar 'CD 114' foi substituída pela OR Quartzo. Os tratamentos avaliados foram: P1 - testemunha sem aplicação de fungicida; P2 - fempropimorfe (560g ha-1 de i.a.; P3 - azoxistrobina + ciproconazol (60+24g ha-1 de i.a.; e P4 - piraclostrobina + metconazol (60+97,5g ha-1 de i.a.. Após a segunda aplicação, efetuaram-se avaliações semanais de severidade das doenças, cujos dados foram utilizados para o cálculo da Área Abaixo da Curva de Progresso da Doença (AACPD. Também foram determinados a produtividade e o peso do hectolitro. No que se refere à suscetibilidade às doenças, as cultivares estudadas apresentaram respostas distintas de um ano para o outro. Para ferrugem, o comportamento mostrou-se similar em ambos os anos, enquanto que, para mancha amarela, houve variação. Quanto à resposta ao controle químico, ocorreram variações de acordo com o patógeno e com o grau de suscetibilidade das cultivares. O uso integrado de resistência genética e controle químico mostrou-se mais efetivo para ferrugem da folha.Aiming to evaluate the susceptibility of wheat cultivars to leaf rust and yellow spot and their responsiveness to chemical fungicides, two field trials were carried out, during 2009 and 2010 winter's. The cultivars evaluated were: 'FCEP 51', 'FCEP 52', 'CD114', 'FCEP Campo Real', 'FCEP Cristalino', 'FCEP Nova Era', 'OR Marfim', 'OR Abalone', 'OR Safira' and 'OR Pampeano'. In 2010, the 'CD 114' cultivar was replaced by Quartzo

  12. Molecular Characterization of wheat stem rust races in Kenya

    Science.gov (United States)

    Stem or black rust caused by Puccinia graminis f. sp. tritici (Pgt) Erikss. & Henning causes severe losses to wheat (Triticum aestivum L.), historically threatening global wheat production. Characterizing prevalent isolates of Pgt would enhance the knowledge of population dynamics and evolution of t...

  13. Marker-assisted pyramiding of Thinopyrum-derived leaf rust ...

    Indian Academy of Sciences (India)

    Mona Singh

    2017-12-08

    Dec 8, 2017 ... Abstract. This study was undertaken to pyramid two effective leaf rust resistance genes (Lr19 and Lr24) derived from ... genes such as Lr9, Lr19, Lr26 and Lr28 became ineffective ..... Disease management recommendations.

  14. Rust fungi on some poaceous weeds of wheat crops in Pakistan

    OpenAIRE

    NAJAM-UL-SEHAR AFSHAN*; ABDUL REHMAN NIAZI

    2013-01-01

    The article enlists common poaceous weeds found in wheat crop sand their specific parasitic rust fungi. In this study, four (04) plant taxa of Poaceae infected with rust fungi are collected from different wheat crops grown in different areas of Pakistan. The rust fungi are isolated, characterized and identified. All these host plants are known weeds of wheat crop in Pakistan. This work would help to identify and enlist the potential rust fungi on weeds of wheat crop that could be utilized to ...

  15. Leaf rust of cultivated barley: pathology and control.

    Science.gov (United States)

    Park, Robert F; Golegaonkar, Prashant G; Derevnina, Lida; Sandhu, Karanjeet S; Karaoglu, Haydar; Elmansour, Huda M; Dracatos, Peter M; Singh, Davinder

    2015-01-01

    Leaf rust of barley is caused by the macrocyclic, heteroecious rust pathogen Puccinia hordei, with aecia reported from selected species of the genera Ornithogalum, Leopoldia, and Dipcadi, and uredinia and telia occurring on Hordeum vulgare, H. vulgare ssp. spontaneum, Hordeum bulbosum, and Hordeum murinum, on which distinct parasitic specialization occurs. Although Puccinia hordei is sporadic in its occurrence, it is probably the most common and widely distributed rust disease of barley. Leaf rust has increased in importance in recent decades in temperate barley-growing regions, presumably because of more intensive agricultural practices. Although total crop loss does not occur, under epidemic conditions yield reductions of up to 62% have been reported in susceptible varieties. Leaf rust is primarily controlled by the use of resistant cultivars, and, to date, 21 seedling resistance genes and two adult plant resistance (APR) genes have been identified. Virulence has been detected for most seedling resistance genes but is unknown for the APR genes Rph20 and Rph23. Other potentially new sources of APR have been reported, and additivity has been described for some of these resistances. Approaches to achieving durable resistance to leaf rust in barley are discussed.

  16. Wheat Rust Information Resources - Integrated tools and data for improved decision making

    DEFF Research Database (Denmark)

    Hodson, David; Hansen, Jens Grønbech; Lassen, Poul

    giving access to an unprecedented set of data for rust surveys, alternate hosts (barberry), rust pathotypes, trap nurseries and resistant cultivars. Standardized protocols for data collection have permitted the development of a comprehensive data management system, named the Wheat Rust Toolbox....... Integration of the CIMMYT Wheat Atlas and the Genetic Resources Information System (GRIS) databases provides a rich resource on wheat cultivars and their resistance to important rust races. Data access is facilitated via dedicated web portals such as Rust Tracker (www.rusttracker.org) and the Global Rust...

  17. Evaluation of 19,460 Wheat Accessions Conserved in the Indian National Genebank to Identify New Sources of Resistance to Rust and Spot Blotch Diseases.

    Science.gov (United States)

    Kumar, Sundeep; Archak, Sunil; Tyagi, R K; Kumar, Jagdish; Vk, Vikas; Jacob, Sherry R; Srinivasan, Kalyani; Radhamani, J; Parimalan, R; Sivaswamy, M; Tyagi, Sandhya; Yadav, Mamata; Kumari, Jyotisna; Deepali; Sharma, Sandeep; Bhagat, Indoo; Meeta, Madhu; Bains, N S; Chowdhury, A K; Saha, B C; Bhattacharya, P M; Kumari, Jyoti; Singh, M C; Gangwar, O P; Prasad, P; Bharadwaj, S C; Gogoi, Robin; Sharma, J B; Gm, Sandeep Kumar; Saharan, M S; Bag, Manas; Roy, Anirban; Prasad, T V; Sharma, R K; Dutta, M; Sharma, Indu; Bansal, K C

    2016-01-01

    A comprehensive germplasm evaluation study of wheat accessions conserved in the Indian National Genebank was conducted to identify sources of rust and spot blotch resistance. Genebank accessions comprising three species of wheat-Triticum aestivum, T. durum and T. dicoccum were screened sequentially at multiple disease hotspots, during the 2011-14 crop seasons, carrying only resistant accessions to the next step of evaluation. Wheat accessions which were found to be resistant in the field were then assayed for seedling resistance and profiled using molecular markers. In the primary evaluation, 19,460 accessions were screened at Wellington (Tamil Nadu), a hotspot for wheat rusts. We identified 4925 accessions to be resistant and these were further evaluated at Gurdaspur (Punjab), a hotspot for stripe rust and at Cooch Behar (West Bengal), a hotspot for spot blotch. The second round evaluation identified 498 accessions potentially resistant to multiple rusts and 868 accessions potentially resistant to spot blotch. Evaluation of rust resistant accessions for seedling resistance against seven virulent pathotypes of three rusts under artificial epiphytotic conditions identified 137 accessions potentially resistant to multiple rusts. Molecular analysis to identify different combinations of genetic loci imparting resistance to leaf rust, stem rust, stripe rust and spot blotch using linked molecular markers, identified 45 wheat accessions containing known resistance genes against all three rusts as well as a QTL for spot blotch resistance. The resistant germplasm accessions, particularly against stripe rust, identified in this study can be excellent potential candidates to be employed for breeding resistance into the background of high yielding wheat cultivars through conventional or molecular breeding approaches, and are expected to contribute toward food security at national and global levels.

  18. Evaluation of 19,460 Wheat Accessions Conserved in the Indian National Genebank to Identify New Sources of Resistance to Rust and Spot Blotch Diseases.

    Directory of Open Access Journals (Sweden)

    Sundeep Kumar

    Full Text Available A comprehensive germplasm evaluation study of wheat accessions conserved in the Indian National Genebank was conducted to identify sources of rust and spot blotch resistance. Genebank accessions comprising three species of wheat-Triticum aestivum, T. durum and T. dicoccum were screened sequentially at multiple disease hotspots, during the 2011-14 crop seasons, carrying only resistant accessions to the next step of evaluation. Wheat accessions which were found to be resistant in the field were then assayed for seedling resistance and profiled using molecular markers. In the primary evaluation, 19,460 accessions were screened at Wellington (Tamil Nadu, a hotspot for wheat rusts. We identified 4925 accessions to be resistant and these were further evaluated at Gurdaspur (Punjab, a hotspot for stripe rust and at Cooch Behar (West Bengal, a hotspot for spot blotch. The second round evaluation identified 498 accessions potentially resistant to multiple rusts and 868 accessions potentially resistant to spot blotch. Evaluation of rust resistant accessions for seedling resistance against seven virulent pathotypes of three rusts under artificial epiphytotic conditions identified 137 accessions potentially resistant to multiple rusts. Molecular analysis to identify different combinations of genetic loci imparting resistance to leaf rust, stem rust, stripe rust and spot blotch using linked molecular markers, identified 45 wheat accessions containing known resistance genes against all three rusts as well as a QTL for spot blotch resistance. The resistant germplasm accessions, particularly against stripe rust, identified in this study can be excellent potential candidates to be employed for breeding resistance into the background of high yielding wheat cultivars through conventional or molecular breeding approaches, and are expected to contribute toward food security at national and global levels.

  19. Genetic characterization of stem rust resistance in a global spring wheat germplasm collection

    Science.gov (United States)

    Stem rust is considered one of the most damaging diseases of wheat. The recent emergence of the stem rust Ug99 race group poses a serious threat to world wheat production. Utilization of genetic resistance in cultivar development is the optimal way to control stem rust. Here we report association ma...

  20. Survey the Effect of Mycorrhiza and Azospirillum of Wheat Cultivars Resistance in Yellow Rust

    Directory of Open Access Journals (Sweden)

    M. Jiriaie

    2017-01-01

    -levels (non-inoculated seeds and inoculated seed and wheat cultivars in three levels, Chamran (bread wheat, Dena and Behrang (durum wheat varieties. In this experiment evaluated, to yellow rust disease, the intensity of infection, the average coefficient of infection, type of infection and area under disease progress curve (AUDPC. Infection type and disease severity were also recorded at flag leaf stage using modified Cobb’s scale. First symptoms of yellow rust were observed in middle January of 2013. Analysis of variance was performed using PROC ANOVA of SAS (version 9.1.3, 2004The comparison of the means was done by Duncan test at a probability level of 5 percent. Results and Discussion: Survey on the resistance to yellow rust in wheat cultivars treated with Mycorrhiza and Azospirillum showed that seed inoculation with Azospirillum traits reduced between 10 percent to 13 percent and the use strains of Mycorrhiza fungi intensity of infection 45-51 percent, the average coefficient of infection and AUDPC 74-85 percent respectively for G. intraradices and G. mosseae strains have been reduced compared with control and Chamran cultivar between 40-70 percent showed more Sensitivity to disease from durum varieties. Generally, the lowest of infection intensity (18.33 was obtained from inoculation of C.V Dena seeds with Azospirillum and G. mosseae strain. According to the result, we found yellow rust in all experiment field also the incidence varied between 10-70 percent. Therefore, it is concluded that, given the climatic conditions favorable to the spread of yellow rust, the incidence of yellow rust in the region that have a high degree of pathogenicity. In general the results of this test, mycorrhiza application has a significant role in enhancing wheat resistance to yellow rust. The seed inoculation with Azospirillum although did not have significant role in disease control, but increased at an acceptable level resistance to wheat rust. But the important point was the combined

  1. Protein modeling of yellow rust disease in wheat

    International Nuclear Information System (INIS)

    Aziz, S.E.; Bano, R.; Zayed, M.E.; Elshikh, M.S.; Khan, M.H.; Chaudhry, Z.

    2017-01-01

    Wheat production in Pakistan is affected by yellow rust disease caused by a fungus Puccinia striiformis. There is a need to broaden the genetic basis of wheat by identifying new resistance genes. The present study was aimed to identify an alternate resistance gene for yellow rust disease in wheat caused by Puccinia striiformis. Genome sequence was compared with databases and similar gene was identified for disease resistance in rye plant. Structural analysis of RGA1 gene (resistance gene in wheat) was carried out using different bioinformatics tools and an alternative gene having same structure was identified on the basis of structural and sequence homology. Rye plant is the proposed plant for the alternate new resistance gene. The result of pairwise alignment of RGA1 gene in wheat and gene of rye plant is 94.2% with accession DQ494535 .The secondary structures of both the genes was compared and found similar to each other. These comparisons between the wheat resistance gene and gene from rye plant depict structural similarities between the two genes. Results of RGA1 gene's structural analysis in wheat is as follow: Helices: 59, Extended sheets: 30, Turns: 12, Coils: 13 and for alternate resistance genes in Rye is as follow: Helices: 52, Extended sheets: 30, Turns: 14, Coils: 17. As structures are similar, the alternate identified gene could be used for resistance in wheat. (author)

  2. Dissection of the multigenic wheat stem rust resistance present in the Montenegrin spring wheat accession PI 362698

    Science.gov (United States)

    Research to identify and characterize stem rust resistance genes in common wheat, Triticum aestivum, has been stimulated by the emergence of Ug99-lineage races of the wheat stem rust pathogen, Puccinia graminis f. sp. tritici (Pgt), in Eastern Africa. The Montenegrin spring wheat landrace PI 362698 ...

  3. Evaluation of 19,460 Wheat Accessions Conserved in the Indian National Genebank to Identify New Sources of Resistance to Rust and Spot Blotch Diseases

    Science.gov (United States)

    Jacob, Sherry R.; Srinivasan, Kalyani; Radhamani, J.; Parimalan, R.; Sivaswamy, M.; Tyagi, Sandhya; Yadav, Mamata; Kumari, Jyotisna; Deepali; Sharma, Sandeep; Bhagat, Indoo; Meeta, Madhu; Bains, N. S.; Chowdhury, A. K.; Saha, B. C.; Bhattacharya, P. M.; Kumari, Jyoti; Singh, M. C.; Gangwar, O. P.; Prasad, P.; Bharadwaj, S. C.; Gogoi, Robin; Sharma, J. B.; GM, Sandeep Kumar; Saharan, M. S.; Bag, Manas; Roy, Anirban; Prasad, T. V.; Sharma, R. K.; Dutta, M.; Sharma, Indu; Bansal, K. C.

    2016-01-01

    A comprehensive germplasm evaluation study of wheat accessions conserved in the Indian National Genebank was conducted to identify sources of rust and spot blotch resistance. Genebank accessions comprising three species of wheat–Triticum aestivum, T. durum and T. dicoccum were screened sequentially at multiple disease hotspots, during the 2011–14 crop seasons, carrying only resistant accessions to the next step of evaluation. Wheat accessions which were found to be resistant in the field were then assayed for seedling resistance and profiled using molecular markers. In the primary evaluation, 19,460 accessions were screened at Wellington (Tamil Nadu), a hotspot for wheat rusts. We identified 4925 accessions to be resistant and these were further evaluated at Gurdaspur (Punjab), a hotspot for stripe rust and at Cooch Behar (West Bengal), a hotspot for spot blotch. The second round evaluation identified 498 accessions potentially resistant to multiple rusts and 868 accessions potentially resistant to spot blotch. Evaluation of rust resistant accessions for seedling resistance against seven virulent pathotypes of three rusts under artificial epiphytotic conditions identified 137 accessions potentially resistant to multiple rusts. Molecular analysis to identify different combinations of genetic loci imparting resistance to leaf rust, stem rust, stripe rust and spot blotch using linked molecular markers, identified 45 wheat accessions containing known resistance genes against all three rusts as well as a QTL for spot blotch resistance. The resistant germplasm accessions, particularly against stripe rust, identified in this study can be excellent potential candidates to be employed for breeding resistance into the background of high yielding wheat cultivars through conventional or molecular breeding approaches, and are expected to contribute toward food security at national and global levels. PMID:27942031

  4. Molecular Cytogenetic Characterization of two Triticum–Secale–Thinopyrum Trigeneric Hybrids Exhibiting Superior Resistance to Fusarium Head Blight, Leaf Rust, and Stem Rust Race Ug99

    Directory of Open Access Journals (Sweden)

    Yi Dai

    2017-05-01

    Full Text Available Fusarium head blight (FHB, leaf rust, and stem rust are the most destructive fungal diseases in current world wheat production. The diploid wheatgrass, Thinopyrum elongatum (Host Dewey (2n = 2x = 14, EE is an excellent source of disease resistance genes. Two new Triticum–Secale–Thinopyrum trigeneric hybrids were derived from a cross between a hexaploid triticale (X Triticosecale Wittmack, 2n = 6x = 42, AABBRR and a hexaploid Triticum trititrigia (2n = 6x = 42, AABBEE, were produced and analyzed using genomic in situ hybridization and molecular markers. The results indicated that line RE21 contained 14 A-chromosomes, 14 B-chromosomes, three pairs of R-chromosomes (4R, 6R, and 7R, and four pairs of E-chromosomes (1E, 2E, 3E, and 5E for a total chromosome number of 2n = 42. Line RE62 contained 14 A-chromosomes, 14 B-chromosomes, six pairs of R-chromosomes, and one pair of translocation chromosomes between chromosome 5R and 5E, for a total chromosome number of 2n = 42. At the seedling and adult growth stages under greenhouse conditions, line RE21 showed high levels of resistance to FHB, leaf rust, and stem rust race Ug99, and line RE62 was highly resistant to leaf rust and stem rust race Ug99. These two lines (RE21 and RE62 display superior disease resistance characteristics and have the potential to be utilized as valuable germplasm sources for future wheat improvement.

  5. Induced mutations for rust resistance in bread wheat

    International Nuclear Information System (INIS)

    Sawhney, R.N.

    1989-01-01

    Full text: Seeds of variety ''Lalbahadur'' were treated with 0.04% NMH. M 2 plants were inoculated with a mixture of pathotypes of each of the 3 Puccinia species (P. graminis, P. recondita, P. striiformis). Plants with simultaneous resistance to all 3 rusts were selected. Repeated testing in subsequent generations confirmed the resistance. The mutant lines are morphologically similar to the parent cultivar and therefore could be used as components of a multiline variety. Comparison of variety pattern against the Indian pathotypes of rusts suggests that the mutant genes are different from the ones known already in bread wheat. (author)

  6. Effect of fungicide on the development of wheat stem rust and yield ...

    African Journals Online (AJOL)

    Stem rust caused by Puccinia graminis f.sp tritici Erik. & E. Henn. is a highly destructive disease of wheat (Triticum aestivum L.). The effects of fungicide application on stem rust (Puccinia graminis tritici) epidemics and yield of three bread wheat varieties varying in reaction to the disease were studied in two major wheat ...

  7. Evaluation of Local Wheat Cultivars Susceptibility to infection with Black Stem Rust

    International Nuclear Information System (INIS)

    Batta, Y.A.

    2007-01-01

    The present study was conducted to assess the susceptibility of seven local wheat cultivars from Palestine to infection with black stem rust caused by Puccinia graminis f. sp. tritici. Two techniques of disease inoculation were applied during bioassays: global inoculation of entire wheat plants with urediospores and localized inoculation with urediospores and localized inoculation with urediospores on wheat leaf-pieces incubated under humid conditions. Susceptibility of tested cultivars was evaluated according to disease scale based on number and size of typical unredial pustules that appeared after inoculation on entire plants or leaf pieces. Results obtained on bioassay of susceptibility and disease rating on entire plants indicated that Anbar, Kamata and Hetiya safra cultivars were the least susceptible to P. g. tritici infection, whereas Debiya beda cultivar was the most susceptible. The other tested cultivars such as Nab-El-Jama, sawda and Senf 870 were moderately susceptible. On leaf-pieces, Anbar and Kamatat were the least susceptible cultivars, whereas Debiya beda and Nab-El-Jamal were the most susceptible cultivars. The other tested cultivars such as Debiya swada, Senf 870 and Hetiya safra were moderately susceptible. Significant reductions were obtained for the size of unredial postules formed on leaf-pieces when inoculated in an unwounded state compared to the wounded indicating the importance of wounds during inoculation. The global results indicated the possibility of using above method of disease inoculating, scaling and rating for evaluation of wheat cultivars susceptibility for the eventual use in breeding program for resistant varieties in Palestine. (author)

  8. Effectors from Wheat Rust Fungi Suppress Multiple Plant Defense Responses.

    Science.gov (United States)

    Ramachandran, Sowmya R; Yin, Chuntao; Kud, Joanna; Tanaka, Kiwamu; Mahoney, Aaron K; Xiao, Fangming; Hulbert, Scot H

    2017-01-01

    Fungi that cause cereal rust diseases (genus Puccinia) are important pathogens of wheat globally. Upon infection, the fungus secretes a number of effector proteins. Although a large repository of putative effectors has been predicted using bioinformatic pipelines, the lack of available high-throughput effector screening systems has limited functional studies on these proteins. In this study, we mined the available transcriptomes of Puccinia graminis and P. striiformis to look for potential effectors that suppress host hypersensitive response (HR). Twenty small (wheat, confirming its activity in a homologous system. Overall, this study provides the first evidence for the presence of effectors in Puccinia species suppressing multiple plant defense responses.

  9. Targeted introgression of stem rust Ug99 resistance from wheatgrasses into pasta and bread wheat

    Science.gov (United States)

    In the past 50 years, a number of stem rust resistance (Sr) genes have been transferred from several wheat-related grasses into durum (i.e. pasta) and bread wheat through chromosome translocations and additions. To utilize these genes for controlling the Ug99 races of the stem rust pathogen, we ini...

  10. Detection of wheat stem rust race RRTTF in Ecuador in 2016

    Science.gov (United States)

    Wheat stem rust is a devastating disease that has incited numerous severe epidemics resulting in extreme yield losses over the past century. Stem rust infection in plots of wheat line UC11075, known to carry the Sr38 resistance gene, was severe in February 2016 in a nursery at the Instituto Nacional...

  11. Genomic dissection of nonhost resistance to wheat stem rust in Brachypodium distachyon

    Science.gov (United States)

    Wheat stem rust caused by the fungus Puccinia graminis f.sp. tritici (Pgt) is a devastating disease that has largely been controlled for decades by the deployment of resistance genes. However, new races of this pathogen have emerged that overcome many important wheat stem rust resistance genes used ...

  12. Mapping genes for resistance to stripe rust in spring wheat landrace PI 480035

    Science.gov (United States)

    Stripe rust caused by Puccinia striiformis Westend. f. sp. tritici Erikks. is an economically important disease of wheat (Triticum aestivum L.). Hexaploid spring wheat landrace PI 480035 was highly resistant to stripe rust in the field in Washington during 2011 and 2012. The objective of this resear...

  13. Resistance Potential of Bread Wheat Genotypes Against Yellow Rust Disease Under Egyptian Climate.

    Science.gov (United States)

    Mahmoud, Amer F; Hassan, Mohamed I; Amein, Karam A

    2015-12-01

    Yellow rust (stripe rust), caused by Puccinia striiformis f. sp. tritici, is one of the most destructive foliar diseases of wheat in Egypt and worldwide. In order to identify wheat genotypes resistant to yellow rust and develop molecular markers associated with the resistance, fifty F8 recombinant inbred lines (RILs) derived from a cross between resistant and susceptible bread wheat landraces were obtained. Artificial infection of Puccinia striiformis was performed under greenhouse conditions during two growing seasons and relative resistance index (RRI) was calculated. Two Egyptian bread wheat cultivars i.e. Giza-168 (resistant) and Sakha-69 (susceptible) were also evaluated. RRI values of two-year trial showed that 10 RILs responded with RRI value >6 2 rust. However, further molecular analyses would be performed to confirm markers associated with the resistance and suitable for marker-assisted selection. Resistant RILs identified in the study could be efficiently used to improve the resistance to yellow rust in wheat.

  14. Physical Localization of a Locus from Agropyron cristatum Conferring Resistance to Stripe Rust in Common Wheat.

    Science.gov (United States)

    Zhang, Zhi; Song, Liqiang; Han, Haiming; Zhou, Shenghui; Zhang, Jinpeng; Yang, Xinming; Li, Xiuquan; Liu, Weihua; Li, Lihui

    2017-11-13

    Stripe rust, caused by Puccinia striiformis f. sp. tritici ( Pst ), is one of the most destructive diseases of wheat ( Triticum aestivum L.) worldwide. Agropyron cristatum (L.) Gaertn. (2 n = 28, PPPP), one of the wild relatives of wheat, exhibits resistance to stripe rust. In this study, wheat- A . cristatum 6P disomic addition line 4844-12 also exhibited resistance to stripe rust. To identify the stripe rust resistance locus from A . cristatum 6P, ten translocation lines, five deletion lines and the BC₂F₂ and BC₃F₂ populations of two wheat- A . cristatum 6P whole-arm translocation lines were tested with a mixture of two races of Pst in two sites during 2015-2016 and 2016-2017, being genotyped with genomic in situ hybridization (GISH) and molecular markers. The result indicated that the locus conferring stripe rust resistance was located on the terminal 20% of 6P short arm's length. Twenty-nine 6P-specific sequence-tagged-site (STS) markers mapped on the resistance locus have been acquired, which will be helpful for the fine mapping of the stripe rust resistance locus. The stripe rust-resistant translocation lines were found to carry some favorable agronomic traits, which could facilitate their use in wheat improvement. Collectively, the stripe rust resistance locus from A . cristatum 6P could be a novel resistance source and the screened stripe rust-resistant materials will be valuable for wheat disease breeding.

  15. Development of COS-SNP and HRM markers for cost efficient and reliable haplotype-based detection of Lr14a in durum wheat (Triticum durum Desf.)

    Science.gov (United States)

    Leaf rust (Puccinia triticina Eriks. & Henn.) is a major disease affecting durum wheat production. The Lr14a leaf rust resistant gene present in the durum wheat cv. Creso and its derivative Colosseo is one of the best characterized leaf rust resistance sources presently deployed in durum wheat breed...

  16. Sources of stem rust resistance in wheat-alien introgression lines

    Science.gov (United States)

    Stem rust, caused by Puccinia graminis f. sp. tritici, is one of the most devastating diseases of wheat and the novel highly virulent race of TTKSK and its lineage are threatening wheat production worldwide. The objective of the study was to identify new sources of resistance in wheat-alien introgre...

  17. Wheat stem rust in South Africa: Current status and future research ...

    African Journals Online (AJOL)

    . In South Africa, stem rust caused by Puccinia graminis Pers. f. sp. tritici. Eriks. & E. Henn. (Pgt) is an important disease of wheat. Records of stem rust occurrence in South Africa date back to the late 1720's, when it was first discovered in the ...

  18. Discovery of a novel stem rust resistance allele in durum wheat that exhibits differential reactions to Ug99 isolates

    Science.gov (United States)

    Wheat stem rust, caused by Puccinia graminis f. sp. tritici Erikss. & E. Henn, can incur yield losses on susceptible cultivars of durum wheat, Triticum turgidum ssp. durum (Desf.) Husnot. Though several durum cultivars possess the stem rust resistance gene Sr13, additional genes in durum wheat effec...

  19. Mapping and characterization of wheat stem rust resistance genes SrTm5 and Sr60 from Triticum monococcum

    Science.gov (United States)

    The emergence and spread of new virulent races of the wheat stem rust pathogen (Puccinia graminis f. sp. tritici; Pgt), including the TTKSK (Ug99) race group, is a serious threat to global wheat production. In this study, we mapped and characterized two stem rust resistance genes from diploid wheat ...

  20. Identification of QTL conferring resistance to stripe rust (Puccinia striiformis f. sp. hordei) and leaf rust (Puccinia hordei) in barley using nested association mapping (NAM).

    Science.gov (United States)

    Vatter, Thomas; Maurer, Andreas; Perovic, Dragan; Kopahnke, Doris; Pillen, Klaus; Ordon, Frank

    2018-01-01

    The biotrophic rust fungi Puccinia hordei and Puccinia striiformis are important barley pathogens with the potential to cause high yield losses through an epidemic spread. The identification of QTL conferring resistance to these pathogens is the basis for targeted breeding approaches aiming to improve stripe rust and leaf rust resistance of modern cultivars. Exploiting the allelic richness of wild barley accessions proved to be a valuable tool to broaden the genetic base of resistance of barley cultivars. In this study, SNP-based nested association mapping (NAM) was performed to map stripe rust and leaf rust resistance QTL in the barley NAM population HEB-25, comprising 1,420 lines derived from BC1S3 generation. By scoring the percentage of infected leaf area, followed by calculation of the area under the disease progress curve and the average ordinate during a two-year field trial, a large variability of resistance across and within HEB-25 families was observed. NAM based on 5,715 informative SNPs resulted in the identification of twelve and eleven robust QTL for resistance against stripe rust and leaf rust, respectively. Out of these, eight QTL for stripe rust and two QTL for leaf rust are considered novel showing no overlap with previously reported resistance QTL. Overall, resistance to both pathogens in HEB-25 is most likely due to the accumulation of numerous small effect loci. In addition, the NAM results indicate that the 25 wild donor QTL alleles present in HEB-25 strongly differ in regard to their individual effect on rust resistance. In future, the NAM concept will allow to select and combine individual wild barley alleles from different HEB parents to increase rust resistance in barley. The HEB-25 results will support to unravel the genetic basis of rust resistance in barley, and to improve resistance against stripe rust and leaf rust of modern barley cultivars.

  1. Identification of QTL conferring resistance to stripe rust (Puccinia striiformis f. sp. hordei) and leaf rust (Puccinia hordei) in barley using nested association mapping (NAM)

    Science.gov (United States)

    Vatter, Thomas; Maurer, Andreas; Perovic, Dragan; Kopahnke, Doris; Pillen, Klaus

    2018-01-01

    The biotrophic rust fungi Puccinia hordei and Puccinia striiformis are important barley pathogens with the potential to cause high yield losses through an epidemic spread. The identification of QTL conferring resistance to these pathogens is the basis for targeted breeding approaches aiming to improve stripe rust and leaf rust resistance of modern cultivars. Exploiting the allelic richness of wild barley accessions proved to be a valuable tool to broaden the genetic base of resistance of barley cultivars. In this study, SNP-based nested association mapping (NAM) was performed to map stripe rust and leaf rust resistance QTL in the barley NAM population HEB-25, comprising 1,420 lines derived from BC1S3 generation. By scoring the percentage of infected leaf area, followed by calculation of the area under the disease progress curve and the average ordinate during a two-year field trial, a large variability of resistance across and within HEB-25 families was observed. NAM based on 5,715 informative SNPs resulted in the identification of twelve and eleven robust QTL for resistance against stripe rust and leaf rust, respectively. Out of these, eight QTL for stripe rust and two QTL for leaf rust are considered novel showing no overlap with previously reported resistance QTL. Overall, resistance to both pathogens in HEB-25 is most likely due to the accumulation of numerous small effect loci. In addition, the NAM results indicate that the 25 wild donor QTL alleles present in HEB-25 strongly differ in regard to their individual effect on rust resistance. In future, the NAM concept will allow to select and combine individual wild barley alleles from different HEB parents to increase rust resistance in barley. The HEB-25 results will support to unravel the genetic basis of rust resistance in barley, and to improve resistance against stripe rust and leaf rust of modern barley cultivars. PMID:29370232

  2. Identification of QTL conferring resistance to stripe rust (Puccinia striiformis f. sp. hordei and leaf rust (Puccinia hordei in barley using nested association mapping (NAM.

    Directory of Open Access Journals (Sweden)

    Thomas Vatter

    Full Text Available The biotrophic rust fungi Puccinia hordei and Puccinia striiformis are important barley pathogens with the potential to cause high yield losses through an epidemic spread. The identification of QTL conferring resistance to these pathogens is the basis for targeted breeding approaches aiming to improve stripe rust and leaf rust resistance of modern cultivars. Exploiting the allelic richness of wild barley accessions proved to be a valuable tool to broaden the genetic base of resistance of barley cultivars. In this study, SNP-based nested association mapping (NAM was performed to map stripe rust and leaf rust resistance QTL in the barley NAM population HEB-25, comprising 1,420 lines derived from BC1S3 generation. By scoring the percentage of infected leaf area, followed by calculation of the area under the disease progress curve and the average ordinate during a two-year field trial, a large variability of resistance across and within HEB-25 families was observed. NAM based on 5,715 informative SNPs resulted in the identification of twelve and eleven robust QTL for resistance against stripe rust and leaf rust, respectively. Out of these, eight QTL for stripe rust and two QTL for leaf rust are considered novel showing no overlap with previously reported resistance QTL. Overall, resistance to both pathogens in HEB-25 is most likely due to the accumulation of numerous small effect loci. In addition, the NAM results indicate that the 25 wild donor QTL alleles present in HEB-25 strongly differ in regard to their individual effect on rust resistance. In future, the NAM concept will allow to select and combine individual wild barley alleles from different HEB parents to increase rust resistance in barley. The HEB-25 results will support to unravel the genetic basis of rust resistance in barley, and to improve resistance against stripe rust and leaf rust of modern barley cultivars.

  3. Plant-pathogen interactions: leaf physiology alterations in poplars infected with rust (Melampsora medusae).

    Science.gov (United States)

    Gortari, Fermín; Guiamet, Juan José; Graciano, Corina

    2018-01-23

    Rust produced by Melampsora sp. is considered one of the most relevant diseases in poplar plantations. Growth reduction in poplar plantations takes place because rust, like other pathogens, alters leaf physiology. There is not a complete evaluation of several of the physiological traits that can be affected by rust at leaf level. Therefore, the aim of this work was to evaluate, in an integrative way and in the same pathosystem, which physiological processes are affected when Populus deltoides Bartr. ex Marsh. leaves are infected by rust (Melampsora medusae Thümen). Leaves of two clones with different susceptibility to rust were analyzed. Field and pot experiments were performed, and several physiological traits were measured in healthy and infected leaves. We conclude that rust affects leaf mesophyll integrity, and so water movement in the leaf in liquid phase is affected. As a consequence, gas exchange is reduced, affecting both carbon fixation and transpiration. However, there is an increase in respiration rate, probably due to plant and fungal respiration. The increase in respiration rate is important in the reduction of net photosynthetic rate, but also some damage in the photosynthetic apparatus limits leaf capacity to fix carbon. The decrease in chlorophyll content would start later and seems not to explain the reduction in net photosynthetic rate. Both clones, although they have different susceptibility to rust, are affected in the same physiological mechanisms. © The Author(s) 2018. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  4. Characterization of stem rust resistance gene Sr2 in Indian wheat ...

    African Journals Online (AJOL)

    SONY

    2013-05-01

    May 1, 2013 ... accelerating wheat production in the last forty years and ensured food security of the Nation. In the present investigation, Sr2 specific molecular markers were used to assess their efficacy for assessing the deployment of Sr2 gene in Indian wheat cultivars of highly productive north-west plains and stem rust ...

  5. Genetics and mapping of a new leaf rust resistance gene in Triticum ...

    Indian Academy of Sciences (India)

    Genetic analysis in F1, F2 and F2.3 families at the seedling stage revealed that leaf rust resistance in Selection G12 is conditioned by a single incompletely dominant gene. The leaf rust resistance gene was mapped to chromosome 3BL with SSR markers Xgwm114 and Xgwm547 flanking the gene at a distance of 28.3 cM ...

  6. LEAF WHORL INOCULATION METHOD FOR SCREENING SUGARCANE RUST RESISTANCE

    Science.gov (United States)

    Technical Abstract: Sugarcane rust diseases, brown rust caused by Puccinia melanocephala, and orange rust caused by P. kuehnii, are agronomically important diseases in Florida. Cultivar resistance is the best means of controlling these diseases. Natural infection has been the primary means of asses...

  7. Evidence for Increased Aggressiveness in a Recent Widespread Strain of Puccinia striiformis f. sp. tritici Causing Stripe Rust of Wheat

    DEFF Research Database (Denmark)

    Milus, Eugene A; Kristensen, Kristian; Hovmøller, Mogens S

    2009-01-01

    Stripe rust (yellow rust) of wheat, caused by Puccinia striiformis f. sp. tritici, has become more severe in eastern United States, Australia, and elsewhere since 2000. Recent research has shown that this coincided with a global spread of two closely related strains that were similar based on vir...... that wheat rust fungi can adapt to warmer temperatures and cause severe disease in previously unfavorable environments......Stripe rust (yellow rust) of wheat, caused by Puccinia striiformis f. sp. tritici, has become more severe in eastern United States, Australia, and elsewhere since 2000. Recent research has shown that this coincided with a global spread of two closely related strains that were similar based...... regimes for latent period, lesion length, lesion width, lesion area, and spore production on adult plants of a susceptible wheat cultivar with no known genes for resistance to stripe rust. "New" isolates (since 2000) were significantly more aggressive than "old" isolates (before 2000) for all variables...

  8. Characterization of molecular diversity and genome-wide mapping of loci associated with resistance to stripe rust and stem rust in Ethiopian bread wheat accessions.

    Science.gov (United States)

    Muleta, Kebede T; Rouse, Matthew N; Rynearson, Sheri; Chen, Xianming; Buta, Bedada G; Pumphrey, Michael O

    2017-08-04

    The narrow genetic basis of resistance in modern wheat cultivars and the strong selection response of pathogen populations have been responsible for periodic and devastating epidemics of the wheat rust diseases. Characterizing new sources of resistance and incorporating multiple genes into elite cultivars is the most widely accepted current mechanism to achieve durable varietal performance against changes in pathogen virulence. Here, we report a high-density molecular characterization and genome-wide association study (GWAS) of stripe rust and stem rust resistance in 190 Ethiopian bread wheat lines based on phenotypic data from multi-environment field trials and seedling resistance screening experiments. A total of 24,281 single nucleotide polymorphism (SNP) markers filtered from the wheat 90 K iSelect genotyping assay was used to survey Ethiopian germplasm for population structure, genetic diversity and marker-trait associations. Upon screening for field resistance to stripe rust in the Pacific Northwest of the United States and Ethiopia over multiple growing seasons, and against multiple races of stripe rust and stem rust at seedling stage, eight accessions displayed resistance to all tested races of stem rust and field resistance to stripe rust in all environments. Our GWAS results show 15 loci were significantly associated with seedling and adult plant resistance to stripe rust at false discovery rate (FDR)-adjusted probability (P) rust in the Ethiopian wheat accessions. Many of the identified resistance loci were mapped close to previously identified rust resistance genes; however, three loci on the short arms of chromosomes 5A and 7B for stripe rust resistance and two on chromosomes 3B and 7B for stem rust resistance may be novel. Our results demonstrate that considerable genetic variation resides within the landrace accessions that can be utilized to broaden the genetic base of rust resistance in wheat breeding germplasm. The molecular markers identified in

  9. Remapping of the stripe rust resistance gene Yr10 in common wheat.

    Science.gov (United States)

    Yuan, Cuiling; Wu, Jingzheng; Yan, Baiqiang; Hao, Qunqun; Zhang, Chaozhong; Lyu, Bo; Ni, Fei; Caplan, Allan; Wu, Jiajie; Fu, Daolin

    2018-02-23

    Yr10 is an important gene to control wheat stripe rust, and the search for Yr10 needs to be continued. Wheat stripe rust or yellow rust is a devastating fungal disease caused by Puccinia striiformis f. sp. tritici (Pst). Host disease resistance offers a primary source for controlling wheat stripe rust. The stripe rust resistance gene Yr10 confers the race-specific resistance to most tested Pst races in China including CYR29. Early studies proposed that Yr10 was a nucleotide-binding site, leucine-rich repeat gene archived as GenBank accession AF149112 (hereafter designated the Yr10 candidate gene or Yr10 CG ). In this study, we revealed that 15 Chinese wheat cultivars positive for Yr10 CG are susceptible to CYR29. We then expressed the Yr10 CG cDNA in the common wheat 'Bobwhite'. The Yr10 CG -cDNA positive transgenic plants were also susceptible to CYR29. Thus, it is highly unlikely that Yr10 CG corresponds to the Yr10 resistance gene. Using the Yr10 donor 'Moro' and the Pst-susceptible wheat 'Huixianhong', we generated two F 3 populations that displayed a single Mendelian segregation on the Yr10 gene, and used them to remap the Yr10 gene. Six markers were placed in the Yr10 region, with the Yr10 CG gene now mapping about 1.2-cM proximal to the Yr10 locus and the Xsdauw79 marker is completely linked to the Yr10 locus. Apparently, the Yr10 gene has not yet been identified. Fine mapping and positional cloning of Yr10 is important for gene pyramiding for stripe rust resistance in wheat.

  10. Partial resistance to stripe rust and its effect on sustainability of wheat yield

    International Nuclear Information System (INIS)

    Qamar, M.; Din, R.U.; Gardazi, D.A.

    2014-01-01

    Stripe rust (Puccinia striiformis Westend. f. sp. tritici) poses a serious threat to wheat production in cooler areas of Pakistan. The 70% area of wheat in Pakistan is prone to stripe rust disease. It can cause 10-17% yield losses if susceptible cultivars are planted under favorable conditions. Level of partial plant resistance in bread wheat and its impact on sustainable wheat production was studied at the National Agricultural Research Centre, Islamabad under natural conditions in the field. Eleven Pakistani commercial wheat cultivars/advance lines including check (Inqalab 91) were assessed for the level of partial resistance against stripe rust using Area Under the Disease Progress Curve (AUDPC), disease severity (DS) and epidemic growth rate in comparison with wheat cultivar, Inqalab 91. During 2007 cropping season, natural epidemic was developed and relative AUDPC was recorded from 0 to 100% whereas the 2008 cropping season was dry and no stripe rust appeared. Two advanced lines (NR 268 and NR 285) showed the infection type (IT) less than 7 (incompatible reaction) to the mixture of prevailing stripe rust inoculums. Very low level of DS and AUDPC were recorded in the remaining cultivars/lines indicating a high level of partial resistance to stripe rust compared to the susceptible check cultivar, Inqalab 91. Among eight cultivars/lines that showed compatible type of reaction (IT greater then equal to 7), one was resistant (relative AUDPC = 20% of Inqalab 91) and six showed very high resistance levels (relative AUDPC greater then equal to 5%). Maximum level of resistance (relative AUDPC = 0.1%) was observed in advanced line, NR 271. The wheat cultivars/lines that showed a slow disease development (low DS and AUDPC), could be considered as -1 partially resistant for stripe rust infection. The yield (2178 kg ha) of susceptible check cultivar Inqalab-91 during 2007 was reduced to 45% as -1 compared to its yield (3945 kg ha) in epidemic free year (2008). Thus the use

  11. Localising QTLs for leaf rust resistance and agronomic traits in barley (¤Hordeum vulgare¤ L.)

    DEFF Research Database (Denmark)

    Kicherer, S.; Backes, G.; Walther, U.

    2000-01-01

    to leaf rust by means of artificial infection, heading date, plant height and Kernel weight were assessed. For leaf rust resistance, 4 QTLs were localised, that explained 96.1% of the genetic variation. One QTL on chromosome 4H confirmed a position found in another genetic background and one mapped...

  12. Somatic recombination in wheat stem rust leads to virulence for Ug99-effective SR50 resistance

    Science.gov (United States)

    Race-specific resistance genes protect much of the global wheat crop from stem rust disease caused by Puccinia graminis f. sp. tritici (Pgt), but often break down due to evolution of new virulent pathogen races. To understand the molecular mechanisms of virulence evolution in Pgt we identified the p...

  13. Multi-location wheat stripe rust QTL analysis: genetic background and epistatic interactions.

    Science.gov (United States)

    Vazquez, M Dolores; Zemetra, Robert; Peterson, C James; Chen, Xianming M; Heesacker, Adam; Mundt, Christopher C

    2015-07-01

    Epistasis and genetic background were important influences on expression of stripe rust resistance in two wheat RIL populations, one with resistance conditioned by two major genes and the other conditioned by several minor QTL. Stripe rust is a foliar disease of wheat (Triticum aestivum L.) caused by the air-borne fungus Puccinia striiformis f. sp. tritici and is present in most regions around the world where commercial wheat is grown. Breeding for durable resistance to stripe rust continues to be a priority, but also is a challenge due to the complexity of interactions among resistance genes and to the wide diversity and continuous evolution of the pathogen races. The goal of this study was to detect chromosomal regions for resistance to stripe rust in two winter wheat populations, 'Tubbs'/'NSA-98-0995' (T/N) and 'Einstein'/'Tubbs' (E/T), evaluated across seven environments and mapped with diversity array technology and simple sequence repeat markers covering polymorphic regions of ≈1480 and 1117 cM, respectively. Analysis of variance for phenotypic data revealed significant (P located in chromosomes 2AS and 6AL, with epistatic interaction between them, were responsible for the main phenotypic response. For the T/N population, eight QTL were identified, with those in chromosomes 2AL and 2BL accounting for the largest percentage of the phenotypic variance.

  14. Molecular and cytogenetic characterization of wheat introgression lines carrying the stem rust resistance gene Sr39.

    Science.gov (United States)

    Stem rust, caused by Puccinia graminis Pers.:Pers. f.sp. tritici Eriks. and Henn., poses a serious threat to global wheat production because of the emergence of Pgt-TTKSK (Ug99). The TTKSK resistant gene Sr39 was derived from Aegilops speltoides through chromosome translocation. In this study, we ch...

  15. Development and characterization of a Psathyrostachys huashanica Keng 7Ns chromosome addition line with leaf rust resistance.

    Directory of Open Access Journals (Sweden)

    Wanli Du

    Full Text Available The aim of this study was to characterize a Triticum aestivum-Psathyrostachys huashanica Keng (2n = 2x = 14, NsNs disomic addition line 2-1-6-3. Individual line 2-1-6-3 plants were analyzed using cytological, genomic in situ hybridization (GISH, EST-SSR, and EST-STS techniques. The alien addition line 2-1-6-3 was shown to have two P. huashanica chromosomes, with a meiotic configuration of 2n = 44 = 22 II. We tested 55 EST-SSR and 336 EST-STS primer pairs that mapped onto seven different wheat chromosomes using DNA from parents and the P. huashanica addition line. One EST-SSR and nine EST-STS primer pairs indicated that the additional chromosome of P. huashanica belonged to homoeologous group 7, the diagnostic fragments of five EST-STS markers (BE404955, BE591127, BE637663, BF482781 and CD452422 were cloned, sequenced and compared. The results showed that the amplified polymorphic bands of P. huashanica and disomic addition line 2-1-6-3 shared 100% sequence identity, which was designated as the 7Ns disomic addition line. Disomic addition line 2-1-6-3 was evaluated to test the leaf rust resistance of adult stages in the field. We found that one pair of the 7Ns genome chromosomes carried new leaf rust resistance gene(s. Moreover, wheat line 2-1-6-3 had a superior numbers of florets and grains per spike, which were associated with the introgression of the paired P. huashanica chromosomes. These high levels of disease resistance and stable, excellent agronomic traits suggest that this line could be utilized as a novel donor in wheat breeding programs.

  16. Cytogenetics and stripe rust resistance of wheat-Thinopyrum elongatum hybrid derivatives.

    Science.gov (United States)

    Li, Daiyan; Long, Dan; Li, Tinghui; Wu, Yanli; Wang, Yi; Zeng, Jian; Xu, Lili; Fan, Xing; Sha, Lina; Zhang, Haiqin; Zhou, Yonghong; Kang, Houyang

    2018-01-01

    Amphidiploids generated by distant hybridization are commonly used as genetic bridge to transfer desirable genes from wild wheat species into cultivated wheat. This method is typically used to enhance the resistance of wheat to biotic or abiotic stresses, and to increase crop yield and quality. Tetraploid Thinopyrum elongatum exhibits strong adaptability, resistance to stripe rust and Fusarium head blight, and tolerance to salt, drought, and cold. In the present study, we produced hybrid derivatives by crossing and backcrossing the Triticum durum-Th. elongatum partial amphidiploid ( Trititrigia 8801, 2 n  = 6 ×  = 42, AABBEE) with wheat cultivars common to the Sichuan Basin. By means of cytogenetic and disease resistance analyses, we identified progeny harboring alien chromosomes and measured their resistance to stripe rust. Hybrid progenies possessed chromosome numbers ranging from 40 to 47 (mean = 42.72), with 40.0% possessing 42 chromosomes. Genomic in situ hybridization revealed that the number of alien chromosomes ranged from 1 to 11. Out of the 50 of analyzed lines, five represented chromosome addition (2 n  = 44 = 42 W + 2E) and other five were chromosome substitution lines (2 n  = 42 = 40 W + 2E). Importantly, a single chromosome derived from wheat- Th. elongatum intergenomic Robertsonian translocations chromosome was occurred in 12 lines. Compared with the wheat parental cultivars ('CN16' and 'SM482'), the majority (70%) of the derivative lines were highly resistant to strains of stripe rust pathogen known to be prevalent in China. The findings suggest that these hybrid-derivative lines with stripe rust resistance could potentially be used as germplasm sources for further wheat improvement.

  17. Identification and validation of single nucleotide polymorphic markers linked to Ug99 stem rust resistance in spring wheat

    Science.gov (United States)

    Wheat stem rust (Puccinia graminis f. sp. tritici Eriks. and E. Henn.) is one of the most destructive diseases world-wide. Races belonging to Ug99 (or TTKSK) continue to cause crop losses in East Africa and threaten global wheat production. Developing and deploying wheat varieties with multiple race...

  18. Appraisal of wheat germplasm for adult plant resistance against stripe rust

    Directory of Open Access Journals (Sweden)

    Saleem Kamran

    2015-12-01

    Full Text Available The resurgence of wheat stripe rust is of great concern for world food security. Owing to resistance breakdown and the appearance of new virulent high-temperature adapted races of Puccinia striiformis f. sp. tritici (Pst, many high yielding commercial varieties in the country lost their yield potential. Searching for new sources of resistance is the best approach to mitigate the problem. Quantitative resistance (partial or adult plant or durable resistance is reported to be more stable than race specific resistance. In the current perusal, a repertoire of 57 promising wheat lines along with the KLcheck line Morocco, developed through hybridisation and selection of local and international lines with International Maize and Wheat Improvement Center (CIMMYT origin, were evaluated under natural field conditions at Nuclear Institute for Agriculture and Biology (NIAB during the 2012−2013 and 2013−2014 time periods. Final rust severity (FRS, the area under the rust progress curve (AURPC, the relative area under the rust progress curve (rAURPC, and the coefficient of infection (CI were unraveled to infer the level of quantitative resistance. Final rust severity was recorded when the susceptible check exhibited 100% severity. There were 21 lines which were immune (no disease, 16 which were resistant, five moderately resistant, two resistant-to-moderately resistant, one moderately resistant-to-moderately susceptible, 5 moderately susceptible-to-susceptible, one moderately susceptible, and six exhibited a susceptible response. Nevertheless, 51 lines exhibited a high level of partial resistance while the three lines, NW-5-1212-1, NW-7-30-1, and NW-7-5 all showed a moderate level of partial resistance based on FRS, while 54 lines, on the basis of AURPC and rAURPC, were identified as conferring a high level of partial resistance. Moreover, adult plant resistance was conferred by 47 wheat lines, based on CI value. It was striking that, 13 immune lines

  19. Grain yield losses in yellow-rusted durum wheat estimated using digital and conventional parameters under field conditions

    Directory of Open Access Journals (Sweden)

    Omar Vergara-Diaz

    2015-06-01

    Full Text Available The biotrophic fungus Puccinia striiformis f. sp. tritici is the causal agent of the yellow rust in wheat. Between the years 2010–2013 a new strain of this pathogen (Warrior/Ambition, against which the present cultivated wheat varieties have no resistance, appeared and spread rapidly. It threatens cereal production in most of Europe. The search for sources of resistance to this strain is proposed as the most efficient and safe solution to ensure high grain production. This will be helped by the development of high performance and low cost techniques for field phenotyping. In this study we analyzed vegetation indices in the Red, Green, Blue (RGB images of crop canopies under field conditions. We evaluated their accuracy in predicting grain yield and assessing disease severity in comparison to other field measurements including the Normalized Difference Vegetation Index (NDVI, leaf chlorophyll content, stomatal conductance, and canopy temperature. We also discuss yield components and agronomic parameters in relation to grain yield and disease severity. RGB-based indices proved to be accurate predictors of grain yield and grain yield losses associated with yellow rust (R2 = 0.581 and R2 = 0.536, respectively, far surpassing the predictive ability of NDVI (R2 = 0.118 and R2 = 0.128, respectively. In comparison to potential yield, we found the presence of disease to be correlated with reductions in the number of grains per spike, grains per square meter, kernel weight and harvest index. Grain yield losses in the presence of yellow rust were also greater in later heading varieties. The combination of RGB-based indices and days to heading together explained 70.9% of the variability in grain yield and 62.7% of the yield losses.

  20. Genetic mapping of stem rust resistance to Puccinia graminis f. sp. tritici race TRTTF in the Canadian wheat cultivar 'Harvest'

    Science.gov (United States)

    Stem rust, caused by Puccinia graminis Pers.:Pers. f. sp. tritici Eriks. & E. Henn.(Pgt), is a destructive disease of wheat that can be controlled by deploying effective stem rust resistance (Sr) genes. Highly virulent races of Pgt in Africa have been detected and characterized. These include race T...

  1. Enhanced resistance to stripe rust disease in transgenic wheat expressing the rice chitinase gene RC24.

    Science.gov (United States)

    Huang, Xuan; Wang, Jian; Du, Zhen; Zhang, Chen; Li, Lan; Xu, Ziqin

    2013-10-01

    Stripe rust is a devastating fungal disease of wheat worldwide which is primarily caused by Puccinia striiformis f. sp tritici. Transgenic wheat (Triticum aestivum L.) expressing rice class chitinase gene RC24 were developed by particle bombardment of immature embryos and tested for resistance to Puccinia striiformis f.sp tritici. under greenhouse and field conditions. Putative transformants were selected on kanamycin-containing media. Polymease chain reaction indicated that RC24 was transferred into 17 transformants obtained from bombardment of 1,684 immature embryos. Integration of RC24 was confirmed by Southern blot with a RC24-labeled probe and expression of RC24 was verified by RT-PCR. Nine transgenic T1 lines exhibited enhanced resistance to stripe rust infection with lines XN8 and BF4 showing the highest level of resistance. Southern blot hybridization confirmed the stable inheritance of RC24 in transgenic T1 plants. Resistance to stripe rust in transgenic T2 and T3 XN8 and BF4 plants was confirmed over two consecutive years in the field. Increased yield (27-36 %) was recorded for transgenic T2 and T3 XN8 and BF4 plants compared to controls. These results suggest that rice class I chitinase RC24 can be used to engineer stripe rust resistance in wheat.

  2. New Spectral Index for Detecting Wheat Yellow Rust Using Sentinel-2 Multispectral Imagery

    Directory of Open Access Journals (Sweden)

    Qiong Zheng

    2018-03-01

    Full Text Available Yellow rust is one of the most destructive diseases for winter wheat and has led to a significant decrease in winter wheat quality and yield. Identifying and monitoring yellow rust is of great importance for guiding agricultural production over large areas. Compared with traditional crop disease discrimination methods, remote sensing technology has proven to be a useful tool for accomplishing such a task at large scale. This study explores the potential of the Sentinel-2 Multispectral Instrument (MSI, a newly launched satellite with refined spatial resolution and three red-edge bands, for discriminating between yellow rust infection severities (i.e., healthy, slight, and severe in winter wheat. The corresponding simulative multispectral bands for the Sentinel-2 sensor were calculated by the sensor’s relative spectral response (RSR function based on the in situ hyperspectral data acquired at the canopy level. Three Sentinel-2 spectral bands, including B4 (Red, B5 (Re1, and B7 (Re3, were found to be sensitive bands using the random forest (RF method. A new multispectral index, the Red Edge Disease Stress Index (REDSI, which consists of these sensitive bands, was proposed to detect yellow rust infection at different severity levels. The overall identification accuracy for REDSI was 84.1% and the kappa coefficient was 0.76. Moreover, REDSI performed better than other commonly used disease spectral indexes for yellow rust discrimination at the canopy scale. The optimal threshold method was adopted for mapping yellow rust infection at regional scales based on realistic Sentinel-2 multispectral image data to further assess REDSI’s ability for yellow rust detection. The overall accuracy was 85.2% and kappa coefficient was 0.67, which was found through validation against a set of field survey data. This study suggests that the Sentinel-2 MSI has the potential for yellow rust discrimination, and the newly proposed REDSI has great robustness and

  3. New Spectral Index for Detecting Wheat Yellow Rust Using Sentinel-2 Multispectral Imagery.

    Science.gov (United States)

    Zheng, Qiong; Huang, Wenjiang; Cui, Ximin; Shi, Yue; Liu, Linyi

    2018-03-15

    Yellow rust is one of the most destructive diseases for winter wheat and has led to a significant decrease in winter wheat quality and yield. Identifying and monitoring yellow rust is of great importance for guiding agricultural production over large areas. Compared with traditional crop disease discrimination methods, remote sensing technology has proven to be a useful tool for accomplishing such a task at large scale. This study explores the potential of the Sentinel-2 Multispectral Instrument (MSI), a newly launched satellite with refined spatial resolution and three red-edge bands, for discriminating between yellow rust infection severities (i.e., healthy, slight, and severe) in winter wheat. The corresponding simulative multispectral bands for the Sentinel-2 sensor were calculated by the sensor's relative spectral response (RSR) function based on the in situ hyperspectral data acquired at the canopy level. Three Sentinel-2 spectral bands, including B4 (Red), B5 (Re1), and B7 (Re3), were found to be sensitive bands using the random forest (RF) method. A new multispectral index, the Red Edge Disease Stress Index (REDSI), which consists of these sensitive bands, was proposed to detect yellow rust infection at different severity levels. The overall identification accuracy for REDSI was 84.1% and the kappa coefficient was 0.76. Moreover, REDSI performed better than other commonly used disease spectral indexes for yellow rust discrimination at the canopy scale. The optimal threshold method was adopted for mapping yellow rust infection at regional scales based on realistic Sentinel-2 multispectral image data to further assess REDSI's ability for yellow rust detection. The overall accuracy was 85.2% and kappa coefficient was 0.67, which was found through validation against a set of field survey data. This study suggests that the Sentinel-2 MSI has the potential for yellow rust discrimination, and the newly proposed REDSI has great robustness and generalized ability

  4. SCREENING OF Lr GENES PROVIDING RESISTANCE TO LEAF RUST IN WHEATH USING MULTIPLEX PCR METHOD

    Directory of Open Access Journals (Sweden)

    Mehmet AYBEKE

    2015-12-01

    Full Text Available Leaf rust is a fungal disease in wheat that causes significant decrease in yield around the world. In Turkey, several genes, including leaf rust-resistant (Lr Lr9, Lr19, Lr24 and Lr28, have been found to induce disease resistance. To obtain resistant cultivars during the breeding process, screening of these genes in various specimens is crucial. Thus, we aimed in the present study primarily to improve the multiplex polymerase chain reaction (PCR methodology by which four Lr genes could be simultaneously screened in plant samples carrying these genes. Serial PCR experiments were carried out for determination of optimal PCR conditions for each Lr gene and in all studies nursery lines were used. PCR conditions were determined as follows: 35 cycles of 95°C for denaturation (30 s, 58°C for annealing (30 s and 72°C for elongation (60 s, with an initial 94°C denaturation (3 min and a 72°C extension (30 min. The primers used in the PCR runs were as follows: Lr9F: TCCTTTTATTCCGCACGCCGG, Lr9R: CCACACTACCCCAAAGAGACG; Lr19F: CATCCTTGGGGACCTC, Lr19R: CCAGCTCGCATACATCCA; Lr24F: TCTAGTCTGTACATGGGGGC, Lr24R: TGGCACATGAACTCCATACG; Lr28F: CCCGGCATAAGTCTATGGTT, Lr28R: CAATGAATGAGATACGTGAA. We found that the optimum annealing temperature for all four genes was 61°C and extension temperatures were 62°C or 64°C. Finally, using this new PCR method, we successfully screened these genes in specimens carrying only one single Lr gene. Optimal multiplex PCR conditions were; denaturation at 94°C for 1 min, 35 extension cycles [94°C for 30 s, 57–61ºC (ideal 61°C for 30 s, and 64–68°C for 2 min] and final extension at 72°C for 30 min. In addition, we achieved positive results when running the optimised multiplex PCR tests on Lr19, Lr24 and Lr28. Future studies are planned to expand new wide multiplex PCR method to include all other Lr genes.

  5. A mutagenesis-derived broad-spectrum disease resistance locus in wheat

    Science.gov (United States)

    Wheat leaf rust, stem rust, stripe rust, and powdery mildew caused by the fungal pathogens Puccinia triticina, P. graminis f. sp. tritici, P. striiformis f. sp. tritici, and Blumeria graminis f. sp. tritici, respectively, are destructive diseases of wheat worldwide. The most effective and widely uti...

  6. First report of leaf rust of blueberry caused by Thekopsora minima in Mexico

    Science.gov (United States)

    Blueberry (Vaccinium corymbosum L.) is becoming an important crop in the states of Jalisco and Michoacan in Mexico. As the area under blueberry cultivation increases, new diseases causing severe losses are appearing. Leaf rust is one of the most destructive diseases of blueberry in Mexico. Sori on t...

  7. Genetics and mapping of a new leaf rust resistance gene in Triticum ...

    Indian Academy of Sciences (India)

    AMIT KUMAR SINGH

    Selection G12 carries a new gene for leaf rust resistance, tentatively named as LrSelG12. [Singh A. K. ..... long arm of chromosome 3B were found to be polymor- phic between ... due to the evolution of new virulent races in India (Tomar et al.

  8. Transfer of genes for stem rust resistance from Agropyron elongatum and imperial rye to durum wheat

    International Nuclear Information System (INIS)

    Prabhakara Rao, M.V.

    1977-01-01

    The Agropyron elongatum gene for stem rust resistance on chromosome 6A of Knott's Thatcher translocation line was transferred to a susceptible local durum wheat variety, Jaya, through a series of back-crosses. Plants heterozygous for the Agropyron translocation always show at least one open bivalent. Homozygotes have not been obtained, probably because of the absence of male transmission in durum background. Monotelosomic addition of the short arm of Imperial rye chromosome 3R (formerly ''G'' of Sears), which carries a gene(s) for resistance to wheat stem rust, was obtained in the local durum variety. Rust-resistant plants from parents having the added rye telocentric were irradiated with gamma rays just before meiosis, and the pollen obtained from the irradiated spikes was used to pollinate euploid plants. In addition, seeds harvested from 2n+1 resistant plants were irradiated with thermal neutrons and the resistant M 1 plants were selfed to raise M 2 families. Two durum-rye translocation lines were obtained following irradiation. DRT-1 was transmitted normally through the female gametes but showed no male transmission. As a result of this, homozygotes have not been obtained. Gametic transmission rates of DRT-2 are being tested. Alien translocations, which show normal gametic and zygotic transmissions in the hexaploid wheat, may behave differently in a tetraploid background. The results indicate that alien genetic transfers may be more difficult to obtain in durum wheat, probably owing to the reduced buffering effect of the tetraploid genome. (author)

  9. [Prediction model of meteorological grade of wheat stripe rust in winter-reproductive area, Sichuan Basin, China].

    Science.gov (United States)

    Guo, Xiang; Wang, Ming Tian; Zhang, Guo Zhi

    2017-12-01

    The winter reproductive areas of Puccinia striiformis var. striiformis in Sichuan Basin are often the places mostly affected by wheat stripe rust. With data on the meteorological condition and stripe rust situation at typical stations in the winter reproductive area in Sichuan Basin from 1999 to 2016, this paper classified the meteorological conditions inducing wheat stripe rust into 5 grades, based on the incidence area ratio of the disease. The meteorological factors which were biologically related to wheat stripe rust were determined through multiple analytical methods, and a meteorological grade model for forecasting wheat stripe rust was created. The result showed that wheat stripe rust in Sichuan Basin was significantly correlated with many meteorological factors, such as the ave-rage (maximum and minimum) temperature, precipitation and its anomaly percentage, relative humidity and its anomaly percentage, average wind speed and sunshine duration. Among these, the average temperature and the anomaly percentage of relative humidity were the determining factors. According to a historical retrospective test, the accuracy of the forecast based on the model was 64% for samples in the county-level test, and 89% for samples in the municipal-level test. In a meteorological grade forecast of wheat stripe rust in the winter reproductive areas in Sichuan Basin in 2017, the prediction was accurate for 62.8% of the samples, with 27.9% error by one grade and only 9.3% error by two or more grades. As a result, the model could deliver satisfactory forecast results, and predicate future wheat stripe rust from a meteorological point of view.

  10. Marker-assisted pyramiding of Thinopyrumderived leaf rust ...

    Indian Academy of Sciences (India)

    2017-03-20

    Mar 20, 2017 ... resistance genes Lr19 and Lr24 using marker assisted foreground .... is linked with stem rust resistance gene Sr24(McIntosh et al. 1976). .... Received 29 July 2016, in final revised form 3 March 2017; accepted 16 March 2017.

  11. Studies on general resistance to stem rust in wheat

    International Nuclear Information System (INIS)

    Knott, D.R.

    1977-01-01

    Eight cultivars that were thought to have field resistance to stem rust were selected and crossed to produce four four-cultivar hybrids. From those crosses lines were produced that lacked seedling resistance to race 15B-1 of stem rust but had good field resistance to it. They also proved to have field resistance to many other races and it is hoped that the resistance is general. Genetic studies indicated that there is some variation in the lines, but resistance is generally inherited as a quantitative character with several largely recessive genes having small additive effects. This suggests that in an induced mutation programme, no one plant is likely to accumulate sufficient mutant genes that it will appear resistant. (author)

  12. Mapping genes for resistance to stripe rust in spring wheat landrace PI 480035.

    Directory of Open Access Journals (Sweden)

    Jinita Sthapit Kandel

    Full Text Available Stripe rust caused by Puccinia striiformis Westend. f. sp. tritici Erikks. is an economically important disease of wheat (Triticum aestivum L.. Hexaploid spring wheat landrace PI 480035 was highly resistant to stripe rust in the field in Washington during 2011 and 2012. The objective of this research was to identify quantitative trait loci (QTL for stripe rust resistance in PI 480035. A spring wheat, "Avocet Susceptible" (AvS, was crossed with PI 480035 to develop a biparental population of 110 recombinant inbred lines (RIL. The population was evaluated in the field in 2013 and 2014 and seedling reactions were examined against three races (PSTv-14, PSTv-37, and PSTv-40 of the pathogen under controlled conditions. The population was genotyped with genotyping-by-sequencing and microsatellite markers across the whole wheat genome. A major QTL, QYr.wrsggl1-1BS was identified on chromosome 1B. The closest flanking markers were Xgwm273, Xgwm11, and Xbarc187 1.01 cM distal to QYr.wrsggl1-1BS, Xcfd59 0.59 cM proximal and XA365 3.19 cM proximal to QYr.wrsggl1-1BS. Another QTL, QYr.wrsggl1-3B, was identified on 3B, which was significant only for PSTv-40 and was not significant in the field, indicating it confers a race-specific resistance. Comparison with markers associated with previously reported Yr genes on 1B (Yr64, Yr65, and YrH52 indicated that QYr.wrsggl1-1BS is potentially a novel stripe rust resistance gene that can be incorporated into modern breeding materials, along with other all-stage and adult-plant resistance genes to develop cultivars that can provide durable resistance.

  13. Molecular mapping of Yr53, a new gene for stripe rust resistance in durum wheat accession PI 480148 and its transfer to common wheat

    Science.gov (United States)

    Stripe rust, caused by Puccinia striiformis f. sp. tritici (Pst), is one of the most damaging diseases of wheat worldwide. It is essential to identify new genes for effective resistance against the disease. Durum wheat PI 480148, originally from Ethiopia, was resistant in all seedling tests with s...

  14. SEASONALITY OF THE LEAF MINER, LEVEL OF PREDATION AND TEMPORAL OCCURRENCE OF RUST CORRELATED TO ABIOTIC FACTORS

    OpenAIRE

    B. M. R. Melo; F. B. S. Botelho; J. S. M. Silva; D. F. F. Lima; E. R. Moreira

    2018-01-01

    The coffee leaf miner and a rust are considered as major diseases that are able to reduce productivity in coffee plantations. These agents are influenced by abiotic factors, and their occurrence may suffer oscillation over the years. The objective of this study was to evaluate the seasonal fluctuation of the coffee leaf miner, incidence of coffee prediction and rust, correlated with abiotic factors. The study was performed IFSULDEMINAS-Campus Inconfidentes, in a coffee crop of the cultivar Ru...

  15. Resistance to stem rust Ug99 in six bread wheat cultivars maps to chromosome 6DS.

    Science.gov (United States)

    Lopez-Vera, Eric E; Nelson, Sarah; Singh, Ravi P; Basnet, Bhoja R; Haley, Scott D; Bhavani, Sridhar; Huerta-Espino, Julio; Xoconostle-Cazares, Beatriz G; Ruiz-Medrano, Roberto; Rouse, Matthew N; Singh, Sukhwinder

    2014-01-01

    Identified SSR markers ( Xcfd49 and Xbarc183 ) linked with stem rust resistance for efficient use in marker-assisted selection and stacking of resistance genes in wheat breeding programs. More than 80 % of the worldwide wheat (Triticum aestivum L.) area is currently sown with varieties susceptible to the Ug99 race group of stem rust fungus. However, wheat lines Niini, Tinkio, Coni, Pfunye, Blouk, and Ripper have demonstrated Ug99 resistance at the seedling and adult plant stages. We mapped stem rust resistance in populations derived from crosses of a susceptible parent with each of the resistant lines. The segregation of resistance in each population indicated the presence of a single gene. The resistance gene in Niini mapped to short arm of chromosome 6D and was flanked by SSR markers Xcfd49 at distances of 3.9 cM proximal and Xbarc183 8.4 cM distal, respectively. The chromosome location of this resistance was validated in three other populations: PBW343/Coni, PBW343/Tinkio, and Cacuke/Pfunye. Resistance initially postulated to be conferred by the SrTmp gene in Blouk and Ripper was also linked to Xcfd49 and Xbarc183 on 6DS, but it was mapped proximal to Xbarc183 at a similar position to previously mapped genes Sr42 and SrCad. Based on the variation in diagnostic marker alleles, it is possible that Niini and Pfunye may carry different resistance genes/alleles. Further studies are needed to determine the allelic relationships between various genes located on chromosome arm 6DS. Our results provide valuable molecular marker and genetic information for developing Ug99 resistant wheat varieties in diverse germplasm and using these markers to tag the resistance genes in wheat breeding.

  16. Race-Specific Adult-Plant Resistance in Winter Wheat to Stripe Rust and Characterization of Pathogen Virulence Patterns.

    Science.gov (United States)

    Milus, Eugene A; Moon, David E; Lee, Kevin D; Mason, R Esten

    2015-08-01

    Stripe rust, caused by Puccinia striiformis f. sp. tritici, is an important disease of wheat in the Great Plains and southeastern United States. Growing resistant cultivars is the preferred means for managing stripe rust, but new virulence in the pathogen population overcomes some of the resistance. The objectives of this study were to characterize the stripe rust resistance in contemporary soft and hard red winter wheat cultivars, to characterize the virulence of P. striiformis f. sp. tritici isolates based on the resistances found in the cultivars, and to determine wheat breeders' perceptions on the importance and methods for achieving stripe rust resistance. Seedlings of cultivars were susceptible to recent isolates, indicating they lacked effective all-stage resistance. However, adult-plants were resistant or susceptible depending on the isolate, indicating they had race-specific adult-plant resistance. Using isolates collected from 1990 to 2013, six major virulence patterns were identified on adult plants of twelve cultivars that were selected as adult-plant differentials. Race-specific adult-plant resistance appears to be the only effective type of resistance protecting wheat from stripe rust in eastern United States. Among wheat breeders, the importance of incorporating stripe rust resistance into cultivars ranged from high to low depending on the frequency of epidemics in their region, and most sources of stripe rust resistance were either unknown or already overcome by virulence in the pathogen population. Breeders with a high priority for stripe rust resistance made most of their selections based on adult-plant reactions in the field, whereas breeders with a low priority for resistance based selections on molecular markers for major all-stage resistance genes.

  17. Seedling Resistance to Stem Rust and Molecular Marker Analysis of Resistance Genes in Wheat Cultivars of Yunnan, China.

    Directory of Open Access Journals (Sweden)

    Tian Ya Li

    Full Text Available Stem rust is one of the most potentially harmful wheat diseases, but has been effectively controlled in China since 1970s. However, the interest in breeding wheat with durable resistance to stem rust has been renewed with the emergence of Ug99 (TTKSK virulent to the widely used resistance gene Sr31, and by which the wheat stem rust was controlled for 40 years in wheat production area worldwide. Yunnan Province, located on the Southwest border of China, is one of the main wheat growing regions, playing a pivotal role in the wheat stem rust epidemic in China. This study investigated the levels of resistance in key wheat cultivars (lines of Yunnan Province. In addition, the existence of Sr25, Sr26, Sr28, Sr31, Sr32, and Sr38 genes in 119 wheat cultivars was assessed using specific DNA markers. The results indicated that 77 (64.7% tested wheat varieties showed different levels of resistance to all the tested races of Puccinia graminis f. sp. tritici. Using molecular markers, we identified the resistance gene Sr31 in 43 samples; Sr38 in 10 samples; Sr28 in 12 samples, and one sample which was resistant against Ug99 (avirulent to Sr32. No Sr25 or Sr26 (effective against Ug99 was identified in any cultivars tested. Furthermore, 5 out of 119 cultivars tested carried both Sr31 and Sr38 and eight contained both Sr31 and Sr28. The results enable the development of appropriate strategies to breed varieties resistant to stem rust.

  18. A new 2DS·2RL Robertsonian translocation transfers stem rust resistance gene Sr59 into wheat.

    Science.gov (United States)

    Rahmatov, Mahbubjon; Rouse, Matthew N; Nirmala, Jayaveeramuthu; Danilova, Tatiana; Friebe, Bernd; Steffenson, Brian J; Johansson, Eva

    2016-07-01

    A new stem rust resistance gene Sr59 from Secale cereale was introgressed into wheat as a 2DS·2RL Robertsonian translocation. Emerging new races of the wheat stem rust pathogen (Puccinia graminis f. sp. tritici), from Africa threaten global wheat (Triticum aestivum L.) production. To broaden the resistance spectrum of wheat to these widely virulent African races, additional resistance genes must be identified from all possible gene pools. From the screening of a collection of wheat-rye (Secale cereale L.) chromosome substitution lines developed at the Swedish University of Agricultural Sciences, we described the line 'SLU238' 2R (2D) as possessing resistance to many races of P. graminis f. sp. tritici, including the widely virulent race TTKSK (isolate synonym Ug99) from Africa. The breakage-fusion mechanism of univalent chromosomes was used to produce a new Robertsonian translocation: T2DS·2RL. Molecular marker analysis and stem rust seedling assays at multiple generations confirmed that the stem rust resistance from 'SLU238' is present on the rye chromosome arm 2RL. Line TA5094 (#101) was derived from 'SLU238' and was found to be homozygous for the T2DS·2RL translocation. The stem rust resistance gene on chromosome 2RL arm was designated as Sr59. Although introgressions of rye chromosome arms into wheat have most often been facilitated by irradiation, this study highlights the utility of the breakage-fusion mechanism for rye chromatin introgression. Sr59 provides an additional asset for wheat improvement to mitigate yield losses caused by stem rust.

  19. Induced mutations of rust resistance genes in wheat

    International Nuclear Information System (INIS)

    McIntosh, R.A.

    1983-01-01

    Induced mutations are being used as a tool to study genes for resistance in wheat. It was found that Pm1 can be separated from Lr20 and Sr15, but these two react like a single pleiotropic gene. Mutants were further examined in crosses and backmutations have been attempted. (author)

  20. Using RNA-sequencing and in silico subtraction to identify resistance gene analog markers for Lr16 in wheat

    Science.gov (United States)

    Leaf rust, caused by Puccinia triticina Eriks., is one of the most widespread diseases of wheat worldwide and breeding for resistance is one of the most effective methods of control. Lr16 is a wheat leaf rust resistance gene that provides resistance at both the seedling and adult stages. Simple s...

  1. Prediction of yield losses in wheat (triticum aestivum l.) caused by yellow rust in relation to epidemiological factors in Faisalabad

    International Nuclear Information System (INIS)

    Ahmad, S.; Afzal, M.; Noorka, I.R.; Iqbal, Z.; Akhtar, N.; Iiftikhar, Y.; Kamran, M.

    2010-01-01

    Thirty six genotypes were screened against yellow rust to check their level of susceptibility or resistance. Among 36 genotypes screened against yellow rust, 18 were susceptible, 6 were moderately susceptible to susceptible, 7 were moderately resistant to moderately susceptible and 5 genotypes remained resistant. Yield losses were predicted in wheat on the basis of varying level of yellow rust severities. It was observed that susceptible genotypes showed higher yield losses as compared to resistant genotypes. Maximum severity of 90% of yellow rust resulted in 54% to 55% calculated and predicted losses, respectively. While 40, 50, 60 and 70% disease severity of yellow rust caused 35-34%, 38-37%, 42-40% and 46-47% calculated and predicted losses, respectively. However, the decline in losses was observed as the genotypes changed their reaction from susceptible to moderate susceptible. Similarly, losses were diminished as the varieties/lines showed moderate resistant reaction from moderate susceptible. Minimum temperature and relative humidity remained positively correlated while the maximum temperature showed negative correlation with stripe rust severity. With the increase of minimum temperature and relative humidity a rise up in stripe rust infection was seen while as the maximum temperature increased stripe rust infection decreased on different genotypes. It may be concluded from the study that environmental factors played major role in the spread of the disease which result in yield losses. (author)

  2. Rust scoring guide

    NARCIS (Netherlands)

    Anonymous,

    1986-01-01

    This brief guide for identifying rust diseases of smaill grain cereals contains color photos depicting the growth stages of small grain cereal crops and provides instructions for recording rust severity and field response for stripe rust (Puccinia striiformis), stem rust (P. graminis), and leaf rust

  3. Rust scoring guide

    OpenAIRE

    Anonymous

    1986-01-01

    This brief guide for identifying rust diseases of smaill grain cereals contains color photos depicting the growth stages of small grain cereal crops and provides instructions for recording rust severity and field response for stripe rust (Puccinia striiformis), stem rust (P. graminis), and leaf rust (P. recondita).

  4. Influence of stripe rust infection on the photosynthetic characteristics and antioxidant system of susceptible and resistant wheat cultivars at the adult plant stage.

    Science.gov (United States)

    Chen, Yang-Er; Cui, Jun-Mei; Su, Yan-Qiu; Yuan, Shu; Yuan, Ming; Zhang, Huai-Yu

    2015-01-01

    Wheat stripe rust (Puccinia striiformis f. sp. tritici, Pst), is one of the most serious diseases of wheat (Triticum aestivum L.) worldwide. To gain a better understanding of the protective mechanism against stripe rust at the adult plant stage, the differences in photosystem II and antioxidant enzymatic systems between susceptible and resistant wheat in response to stripe rust disease (P. striiformis) were investigated. We found that chlorophyll fluorescence and the activities of the antioxidant enzymes were higher in resistant wheat than in susceptible wheat after stripe rust infection. Compared with the susceptible wheat, the resistant wheat accumulated a higher level of D1 protein and a lower level of reactive oxygen species after infection. Furthermore, our results demonstrate that D1 and light-harvesting complex II (LHCII) phosphorylation are involved in the resistance to stripe rust in wheat. The CP29 protein was phosphorylated under stripe rust infection, like its phosphorylation in other monocots under environmental stresses. More extensive damages occur on the thylakoid membranes in the susceptible wheat compared with the resistant wheat. The findings provide evidence that thylakoid protein phosphorylation and antioxidant enzyme systems play important roles in plant responses and defense to biotic stress.

  5. Genomic Selection for Quantitative Adult Plant Stem Rust Resistance in Wheat

    Directory of Open Access Journals (Sweden)

    Jessica E. Rutkoski

    2014-11-01

    Full Text Available Quantitative adult plant resistance (APR to stem rust ( f. sp. is an important breeding target in wheat ( L. and a potential target for genomic selection (GS. To evaluate the relative importance of known APR loci in applying GS, we characterized a set of CIMMYT germplasm at important APR loci and on a genome-wide profile using genotyping-by-sequencing (GBS. Using this germplasm, we describe the genetic architecture and evaluate prediction models for APR using data from the international Ug99 stem rust screening nurseries. Prediction models incorporating markers linked to important APR loci and seedling phenotype scores as fixed effects were evaluated along with the classic prediction models: Multiple linear regression (MLR, Genomic best linear unbiased prediction (G-BLUP, Bayesian Lasso (BL, and Bayes Cπ (BCπ. We found the region to play an important role in APR in this germplasm. A model using linked markers as fixed effects in G-BLUP was more accurate than MLR with linked markers (-value = 0.12, and ordinary G-BLUP (-value = 0.15. Incorporating seedling phenotype information as fixed effects in G-BLUP did not consistently increase accuracy. Overall, levels of prediction accuracy found in this study indicate that GS can be effectively applied to improve stem rust APR in this germplasm, and if genotypes at linked markers are available, modeling these genotypes as fixed effects could lead to better predictions.

  6. Genetic studies in wheat for leaf rust resistance (Puccinia recondita)

    African Journals Online (AJOL)

    user

    2011-04-18

    Apr 18, 2011 ... Generation means and variance analyses were performed for the estimation of ... population falls into clearly defined and easily recogni- zable categories by ... additive x dominance and dominance x dominance gene effects.

  7. Characterization of non-host resistance in broad bean to the wheat stripe rust pathogen

    Directory of Open Access Journals (Sweden)

    Cheng Yulin

    2012-06-01

    Full Text Available Abstract Background Non-host resistance (NHR confers plant species immunity against the majority of microbial pathogens and represents the most robust and durable form of plant resistance in nature. As one of the main genera of rust fungi with economic and biological importance, Puccinia infects almost all cereals but is unable to cause diseases on legumes. Little is known about the mechanism of this kind of effective defense in legumes to these non-host pathogens. Results In this study, the basis of NHR in broad bean (Vicia faba L. against the wheat stripe rust pathogen, Puccinia striiformis f. sp. tritici (Pst, was characterized. No visible symptoms were observed on broad bean leaves inoculated with Pst. Microscopic observations showed that successful location of stomata and haustoria formation were significantly reduced in Pst infection of broad bean. Attempted infection induced the formation of papillae, cell wall thickening, production of reactive oxygen species, callose deposition and accumulation of phenolic compounds in plant cell walls. The few Pst haustoria that did form in broad bean cells were encased in reactive oxygen and callose materials and those cells elicited cell death. Furthermore, a total of seven defense-related genes were identified and found to be up-regulated during the Pst infection. Conclusions The results indicate that NHR in broad bean against Pst results from a continuum of layered defenses, including basic incompatibility, structural and chemical strengthening of cell wall, posthaustorial hypersensitive response and induction of several defense-related genes, demonstrating the multi-layered feature of NHR. This work also provides useful information for further determination of resistance mechanisms in broad bean to rust fungi, especially the adapted important broad bean rust pathogen, Uromyces viciae-fabae, because of strong similarity and association between NHR of plants to unadapted pathogens and basal

  8. The wheat Lr34 multipathogen resistance gene confers resistance to anthracnose and rust in sorghum.

    Science.gov (United States)

    Schnippenkoetter, Wendelin; Lo, Clive; Liu, Guoquan; Dibley, Katherine; Chan, Wai Lung; White, Jodie; Milne, Ricky; Zwart, Alexander; Kwong, Eunjung; Keller, Beat; Godwin, Ian; Krattinger, Simon G; Lagudah, Evans

    2017-11-01

    The ability of the wheat Lr34 multipathogen resistance gene (Lr34res) to function across a wide taxonomic boundary was investigated in transgenic Sorghum bicolor. Increased resistance to sorghum rust and anthracnose disease symptoms following infection with the biotrophic pathogen Puccinia purpurea and the hemibiotroph Colletotrichum sublineolum, respectively, occurred in transgenic plants expressing the Lr34res ABC transporter. Transgenic sorghum lines that highly expressed the wheat Lr34res gene exhibited immunity to sorghum rust compared to the low-expressing single copy Lr34res genotype that conferred partial resistance. Pathogen-induced pigmentation mediated by flavonoid phytoalexins was evident on transgenic sorghum leaves following P. purpurea infection within 24-72 h, which paralleled Lr34res gene expression. Elevated expression of flavone synthase II, flavanone 4-reductase and dihydroflavonol reductase genes which control the biosynthesis of flavonoid phytoalexins characterized the highly expressing Lr34res transgenic lines 24-h post-inoculation with P. purpurea. Metabolite analysis of mesocotyls infected with C. sublineolum showed increased levels of 3-deoxyanthocyanidin metabolites were associated with Lr34res expression, concomitant with reduced symptoms of anthracnose. © 2017 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

  9. Molecular and cytogenetic characterization of a durum wheat Aegilops speltoides chromosome translocation conferring resistance to stem rust

    Science.gov (United States)

    Stem rust is a serious disease of wheat that has caused historical epidemics, but it has not been a threat in recent decades in North America due to the eradication of the alternate host and deployment of resistant cultivars. However, the recent emergence of Ug99 (or race TTKS) poses a threat to glo...

  10. New Seeds are Resistant to Wheat Stem Rust (Ug99) Multinational Programme Supported by FAO and IAEA

    International Nuclear Information System (INIS)

    2013-01-01

    Full text: A multinational effort supported by the International Atomic Energy Agency and the U.N. Food and Agriculture Organization marked a key milestone this week when a Kenyan university debuted two new varieties of disease-resistant wheat to the nation's farmers. Over the past two days, thousands of Kenyan farmers have visited Eldoret University in western Kenya for a two-day agriculture fair highlighting the latest farming technologies. Supporting the development of the new varieties were the IAEA's Technical Cooperation Department and the Joint FAO/IAEA Programme of Nuclear Techniques in Food and Agriculture. They manage an interregional Technical Cooperation project to develop varieties of wheat that are resistant to a devastating type of fungus, causing a disease known as wheat stem rust. Wheat stem rust under control for over 30 years, but a resurgence of the disease was discovered in 1999 in Uganda that swiftly spread to neighbouring Kenya. The wheat stem rust, caused by the strain of the fungus known as Ug99, named after its place and year of origin, has since spread to Iran, Yemen and South Africa and threatens crops as far away as India as spores are carried by wind. Parasitic rusts threaten global wheat production, reducing plant growth and crop yields. The disease can destroy up to 70-100 percent of the yield of wheat crop if not prevented. 'Improving food security in developing countries through the use of nuclear techniques is an important priority of the IAEA', said IAEA Director General Yukiya Amano. 'I am pleased that we have been able to make an important contribution to fighting wheat rust'. 'Wheat rusts, particularly the Ug99 strain, are a major threat to food security because rust epidemics can result in devastating yield losses. This international project involving affected countries, plant scientists and breeders and international organizations is a major breakthrough. It clearly shows the benefits of FAO/IAEA collaboration and that

  11. Identification and characterization of resistance to yellow rust and powdery mildew in wild emmer wheat and their transfer to bread wheat

    NARCIS (Netherlands)

    Silfhout, van C.H.

    1989-01-01

    In wild emmer wheat three different kinds of genes for resistance to yellow rust were found, namely genes causing overall resistance, genes causing adult-plant resistance and genes which induce resistance detectable at higher temperatures. At least eleven different and probably novel major

  12. Phenylalanine ammonia-lyase (pal) and peroxidase activity in brown rust infected tissues of pakistani wheat cultivars

    International Nuclear Information System (INIS)

    Riaz, A.; Tahir, M.I.

    2014-01-01

    Besides other factors resistance and susceptibility is the outcome of biochemical processes such as activities of defense-related enzymes. So in this study, Phenylalanine ammonia-lyase (PAL) and Peroxidase activity of resistant (Inqilab-91) and susceptible (Kirin-95) wheat cultivars were determined through spectrophotometer to address the biochemical aspect related to the disease after 8 hours, 24 hours, 48 hours and 72 hours of leaf rust inoculation. The results have shown that these enzymes were present in both the resistant and susceptible cultivars but the activity was more pronounced in the resistant one. The effect of PAL and peroxidase activity was also investigated among inoculated and uninoculated plants within the same cultivar. The activity of both PAL and peroxidase were more significant in inoculated ones. The results have shown that the after 72 hours of inoculation Inqilab-91 had more PAL activity i.e., 5.47 IU/ml/min than in Kirin-95 i.e., 2.08 IU/ml/min at 270 nm. While peroxidase activity in Inqilab-91 was 6.41 IU/ml/min and in Kirin-95, 3.66 IU/ml/min after 72 hours of inoculation, observed under 470 nm wavelength. Increase in one's activity increases the other enzyme's activity. The activity was more prominent after 72 hours of infection as pathogen had successfully established itself in the host plant tissue. The activities of these enzymes act as plants active defense mechanism against the attack of pathogen. (author)

  13. Identification and characterization of Sr13, a tetraploid wheat gene that confers resistance to the Ug99 stem rust race group

    Science.gov (United States)

    The Puccinia graminis f. sp. tritici (Pgt) Ug99 race group is virulent to most stem rust resistance genes currently deployed in wheat and poses a serious threat to global wheat production. The durum wheat (Triticum turgidum ssp. durum) gene Sr13 confers resistance to Ug99 in addition to virulent rac...

  14. Comparative Analysis Highlights Variable Genome Content of Wheat Rusts and Divergence of the Mating Loci

    Directory of Open Access Journals (Sweden)

    Christina A. Cuomo

    2017-02-01

    Full Text Available Three members of the Puccinia genus, Puccinia triticina (Pt, P. striiformis f.sp. tritici (Pst, and P. graminis f.sp. tritici (Pgt, cause the most common and often most significant foliar diseases of wheat. While similar in biology and life cycle, each species is uniquely adapted and specialized. The genomes of Pt and Pst were sequenced and compared to that of Pgt to identify common and distinguishing gene content, to determine gene variation among wheat rust pathogens, other rust fungi, and basidiomycetes, and to identify genes of significance for infection. Pt had the largest genome of the three, estimated at 135 Mb with expansion due to mobile elements and repeats encompassing 50.9% of contig bases; in comparison, repeats occupy 31.5% for Pst and 36.5% for Pgt. We find all three genomes are highly heterozygous, with Pst [5.97 single nucleotide polymorphisms (SNPs/kb] nearly twice the level detected in Pt (2.57 SNPs/kb and that previously reported for Pgt. Of 1358 predicted effectors in Pt, 784 were found expressed across diverse life cycle stages including the sexual stage. Comparison to related fungi highlighted the expansion of gene families involved in transcriptional regulation and nucleotide binding, protein modification, and carbohydrate degradation enzymes. Two allelic homeodomain pairs, HD1 and HD2, were identified in each dikaryotic Puccinia species along with three pheromone receptor (STE3 mating-type genes, two of which are likely representing allelic specificities. The HD proteins were active in a heterologous Ustilago maydis mating assay and host-induced gene silencing (HIGS of the HD and STE3 alleles reduced wheat host infection.

  15. Major Gene for Field Stem Rust Resistance Co-Locates with Resistance Gene Sr12 in 'Thatcher' Wheat.

    Science.gov (United States)

    Hiebert, Colin W; Kolmer, James A; McCartney, Curt A; Briggs, Jordan; Fetch, Tom; Bariana, Harbans; Choulet, Frederic; Rouse, Matthew N; Spielmeyer, Wolfgang

    2016-01-01

    Stem rust, caused by Puccinia graminis (Pgt), is a damaging disease of wheat that can be controlled by utilizing effective stem rust resistance genes. 'Thatcher' wheat carries complex resistance to stem rust that is enhanced in the presence of the resistance gene Lr34. The purpose of this study was to examine APR in 'Thatcher' and look for genetic interactions with Lr34. A RIL population was tested for stem rust resistance in field nurseries in Canada, USA, and Kenya. BSA was used to find SNP markers associated with reduced stem rust severity. A major QTL was identified on chromosome 3BL near the centromere in all environments. Seedling testing showed that Sr12 mapped to the same region as the QTL for APR. The SNP markers were physically mapped and the region carrying the resistance was searched for sequences with homology to members of the NB-LRR resistance gene family. SNP marker from one NB-LRR-like sequence, NB-LRR3 co-segregated with Sr12. Two additional populations, including one that lacked Lr34, were tested in field nurseries. NB-LRR3 mapped near the maximum LOD for reduction in stem rust severity in both populations. Lines from a population that segregated for Sr12 and Lr34 were tested for seedling Pgt biomass and infection type, as well as APR to field stem rust which showed an interaction between the genes. We concluded that Sr12, or a gene closely linked to Sr12, was responsible for 'Thatcher'-derived APR in several environments and this resistance was enhanced in the presence of Lr34.

  16. Major Gene for Field Stem Rust Resistance Co-Locates with Resistance Gene Sr12 in ‘Thatcher’ Wheat

    Science.gov (United States)

    Hiebert, Colin W.; Kolmer, James A.; McCartney, Curt A.; Briggs, Jordan; Fetch, Tom; Bariana, Harbans; Choulet, Frederic; Rouse, Matthew N.; Spielmeyer, Wolfgang

    2016-01-01

    Stem rust, caused by Puccinia graminis (Pgt), is a damaging disease of wheat that can be controlled by utilizing effective stem rust resistance genes. ‘Thatcher’ wheat carries complex resistance to stem rust that is enhanced in the presence of the resistance gene Lr34. The purpose of this study was to examine APR in ‘Thatcher’ and look for genetic interactions with Lr34. A RIL population was tested for stem rust resistance in field nurseries in Canada, USA, and Kenya. BSA was used to find SNP markers associated with reduced stem rust severity. A major QTL was identified on chromosome 3BL near the centromere in all environments. Seedling testing showed that Sr12 mapped to the same region as the QTL for APR. The SNP markers were physically mapped and the region carrying the resistance was searched for sequences with homology to members of the NB-LRR resistance gene family. SNP marker from one NB-LRR-like sequence, NB-LRR3 co-segregated with Sr12. Two additional populations, including one that lacked Lr34, were tested in field nurseries. NB-LRR3 mapped near the maximum LOD for reduction in stem rust severity in both populations. Lines from a population that segregated for Sr12 and Lr34 were tested for seedling Pgt biomass and infection type, as well as APR to field stem rust which showed an interaction between the genes. We concluded that Sr12, or a gene closely linked to Sr12, was responsible for ‘Thatcher’-derived APR in several environments and this resistance was enhanced in the presence of Lr34. PMID:27309724

  17. Genome-wide association mapping for stripe rust (Puccinia striiformis F. sp. tritici) in US Pacific Northwest winter wheat (Triticum aestivum L.).

    Science.gov (United States)

    Naruoka, Y; Garland-Campbell, K A; Carter, A H

    2015-06-01

    Potential novel and known QTL for race-specific all-stage and adult plant resistance to stripe rust were identified by genome-wide association mapping in the US PNW winter wheat accessions. Stripe rust (Puccinia striiformis F. sp. tritici; also known as yellow rust) is a globally devastating disease of wheat (Triticum aestivum L.) and a major threat to wheat production in the US Pacific Northwest (PNW), therefore both adult plant and all-stage resistance have been introduced into the winter wheat breeding programs in the PNW. The goal of this study was to identify quantitative trait loci (QTL) and molecular markers for these resistances through genome-wide association (GWAS) mapping in winter wheat accessions adapted to the PNW. Stripe rust response for adult plants was evaluated in naturally occurring epidemics in a total of nine environments in Washington State, USA. Seedling response was evaluated with three races under artificial inoculation in the greenhouse. The panel was genotyped with the 9K Illumina Wheat single nucleotide polymorphism (SNP) array and additional markers linked to previously reported genes and QTL for stripe rust resistance. The population was grouped into three sub-populations. Markers linked to Yr17 and previously reported QTL for stripe rust resistance were identified on chromosomes 1B, 2A, and 2B. Potentially novel QTL associated with race-specific seedling response were identified on chromosomes 1B and 1D. Potentially novel QTL associated with adult plant response were located on chromosomes 2A, 2B, 3B, 4A, and 4B. Stripe rust was reduced when multiple alleles for resistance were present. The resistant allele frequencies were different among sub-populations in the panel. This information provides breeders with germplasm and closely linked markers for stripe rust resistance to facilitate the transfer of multiple loci for durable stripe rust resistance into wheat breeding lines and cultivars.

  18. SH1 leaf rust and bacterial halo blight coffee resistances are genetically independent

    Directory of Open Access Journals (Sweden)

    Lucas Mateus Rivero Rodrigues

    Full Text Available ABSTRACT Coffee resistance to Pseudomonas syringae pv. garcae has been associated to pleiotropic effect of SH1 allele, present in coffee plants resistant to certain races of Hemileia vastatrix, the causal agent of leaf rust, or genetic linkage between resistance alleles to both pathogens. To validate this hypothesis, 63 coffee plants in F2 generation were evaluated for resistance to 2 isolates of H. vastatrix carriers of alleles, respectively, v2, v5 (isolate I/2015 and v1; v2; v5 (isolate II/2015 with the objective to confirm presence of SH1 allele in resistant plants to isolate I/2015. The same coffee plants were evaluated for resistance to a mixture of P. syringae pv. garcae strains highly pathogenic to coffee. Results showed that, among F2 coffee allele SH1 carriers, resistant to isolate I/2015, resistant and susceptible plants to bacterial halo blight were found; the same segregation occurs between F2 homozygous for SH1 allele, susceptible to the same isolate (I/2015 of H. vastatrix. Results also indicate that there is no pleiotropic effect of gene or allele SH1 connection between genes conferring resistance to leaf rust caused by H. vastatrix and bacterial halo blight caused by P. syringae pv. garcae.

  19. Targeted introgression of a wheat stem rust resistance gene by DNA marker-assisted chromosome engineering.

    Science.gov (United States)

    Niu, Zhixia; Klindworth, Daryl L; Friesen, Timothy L; Chao, Shiaoman; Jin, Yue; Cai, Xiwen; Xu, Steven S

    2011-04-01

    Chromosome engineering is a useful strategy for transfer of alien genes from wild relatives into modern crops. However, this strategy has not been extensively used for alien gene introgression in most crops due to low efficiency of conventional cytogenetic techniques. Here, we report an improved scheme of chromosome engineering for efficient elimination of a large amount of goatgrass (Aegilops speltoides) chromatin surrounding Sr39, a gene that provides resistance to multiple stem rust races, including Ug99 (TTKSK) in wheat. The wheat ph1b mutation, which promotes meiotic pairing between homoeologous chromosomes, was employed to induce recombination between wheat chromosome 2B and goatgrass 2S chromatin using a backcross scheme favorable for inducing and detecting the homoeologous recombinants with small goatgrass chromosome segments. Forty recombinants with Sr39 with reduced surrounding goatgrass chromatin were quickly identified from 1048 backcross progenies through disease screening and molecular marker analysis. Four of the recombinants carrying Sr39 with a minimal amount of goatgrass chromatin (2.87-9.15% of the translocated chromosomes) were verified using genomic in situ hybridization. Approximately 97% of the goatgrass chromatin was eliminated in one of the recombinants, in which a tiny goatgrass chromosome segment containing Sr39 was retained in the wheat genome. Localization of the goatgrass chromatin in the recombinants led to rapid development of three molecular markers tightly linked to Sr39. The new wheat lines and markers provide useful resources for the ongoing global effort to combat Ug99. This study has demonstrated great potential of chromosome engineering in genome manipulation for plant improvement.

  20. Identification of Leaf Promoters for Use in Transgenic Wheat

    Directory of Open Access Journals (Sweden)

    Saqer S. Alotaibi

    2018-03-01

    Full Text Available Wheat yields have plateaued in recent years and given the growing global population there is a pressing need to develop higher yielding varieties to meet future demand. Genetic manipulation of photosynthesis in elite wheat varieties offers the opportunity to significantly increase yields. However, the absence of a well-defined molecular tool-box of promoters to manipulate leaf processes in wheat hinders advancements in this area. Two promoters, one driving the expression of sedoheptulose-1,7-bisphosphatase (SBPase and the other fructose-1,6-bisphosphate aldolase (FBPA from Brachypodium distachyon were identified and cloned into a vector in front of the GUS reporter gene. Both promoters were shown to be functionally active in wheat in both transient assays and in stably transformed wheat plants. Analysis of the stable transformants of wheat (cv. Cadenza showed that both promoters controlled gus expression throughout leaf development as well as in other green tissues. The availability of these promoters provides new tools for the expression of genes in transgenic wheat leaves and also paves the way for multigene manipulation of photosynthesis to improve yields.

  1. Induced multiple disease resistance in wheat

    International Nuclear Information System (INIS)

    Borojevic, K.; Worland, A.J.

    1990-01-01

    Full text: The existence of genes suppressing resistance to leaf rust, stem rust and yellow rust in hexaploid wheat has been suggested. If such genes are deleted or inactivated, a more resistant variety may be obtained. In mutant lines of the wheat variety San Pastore, selected after treatment with 20,000 rad of gamma-rays, resistance to leaf rust, yellow rust, stem rust, and to some extent to Erysiphe graminis was determined. The mutants responded to infection by producing necrotic flecks in the presence of high level of disease inoculum. Similar flecks develop under stress condition. It is likely that the mother variety San Pastore carries genes for resistance which are masked by suppressor genes. Irradiation inactivates suppressors so that resistance genes which were previously masked are expressed. The first results of monosomic analysis indicate that chromosomes of groups 4 and 5 or possibly 7 may be critical for expression of resistance in the mutant lines. (author)

  2. A genome-wide association study of field and seedling response to stem rust pathogen races reveals combinations of race-specific resistance genes in North American spring wheat

    Science.gov (United States)

    Stem rust of wheat caused by the fungal pathogen Puccinia graminis f. sp. tritici historically caused major yield losses of wheat worldwide. To understand the genetic basis of stem rust resistance in conventional North American spring wheat, genome-wide association analysis (GWAS) was conducted on a...

  3. SEASONALITY OF THE LEAF MINER, LEVEL OF PREDATION AND TEMPORAL OCCURRENCE OF RUST CORRELATED TO ABIOTIC FACTORS

    Directory of Open Access Journals (Sweden)

    B. M. R. Melo

    2018-04-01

    Full Text Available The coffee leaf miner and a rust are considered as major diseases that are able to reduce productivity in coffee plantations. These agents are influenced by abiotic factors, and their occurrence may suffer oscillation over the years. The objective of this study was to evaluate the seasonal fluctuation of the coffee leaf miner, incidence of coffee prediction and rust, correlated with abiotic factors. The study was performed IFSULDEMINAS-Campus Inconfidentes, in a coffee crop of the cultivar Rubi. A sample for a rust and a coffee leaf miner, in addition to the middle and upper third of the plants, totaling 42 plants in the study area. At the same sampling point, perform soil analysis to correlate nutrients as studied variables. The Pearson correlation of the biotic variables was performed with a precipitation and fertility, a rate of 1 and 5% probability. It was verified that the rust cycle alternated its incidence for the same period in different years and the miner showed behavior coincident to the driest periods of the year. Data not available on precipitation data and number of mines. These diseases had no significant correlation with the fertility parameter. The coffee leaf miner yielded higher rates of occurrence in June and December of 2014. It was concluded that the percentage of coffee leaf miner was higher in the months with lower rainfall indices or no longer summer period; What is it you want to know about the one-time development that may have been influenced by the nearby woods under study and the rust alternated the peaks of occurrence for the two autumners, correlating with a precipitation.

  4. Gene effects and combining ability in some bread wheat genotypes to yellow rust disease.

    Science.gov (United States)

    Razavi, A R; Taeb, M; Afshari, F; Khavari, S; Abbaspoor, M

    2009-01-15

    Ten wheat lines were studied to determine gene effects and combining ability in some bread wheat genotypes to yellow rust disease. Ten parental lines and F1 were evaluated in a randomized complete block design with three replications in Agricultural and Natural Resources Research Center, Mashhad, Iran. Two races (134E134A+ and 4E0A+) were used for this study. Latent Period (LP) and Infection Type (IT) were measured in the field and greenhouse. Results showed significant differences between races in their pathogenicity and between genotypes in their resistance to the pathogen. Diallel cross carried out between the parents and progenies and thereafter were analyzed by the method of Griffing and Haymans. The General Combining Ability (GCA) and Special Combining Ability (SCA) for all traits were significant and showed additive variance was more important. Test for validity of diallel hypothesis proved epistasis effect for all traits. P1, P2 and F1 showed significant difference between all traits in generations mean analysis. Average degree of dominance ranged from partial to over dominance for resistance or susceptibility. Dominance, additive and epistatic types of gene action were responsible for the genetic control of the traits. However, except for additive-additive component, non-additive effect of genes could not be fixed by self-fertilization.

  5. Mutation breeding for disease resistance in wheat and field beans in Egypt

    International Nuclear Information System (INIS)

    Abdel-Hak, T.M.

    1983-01-01

    Seeds of three varieties of hexaploid wheat and of one variety of tetraploid wheat were treated with gamma rays in order to obtain mutants with improved resistance to stem rust, leaf rust and stripe rust. Mutants with resistance to prevailing races of rusts were selected; however, the race spectrum shifted and made the mutants useless for the time being. Induction of mutations for resistance to chocolate spot and rusts was attempted in Vicia faba. No resistant mutant was found but some mutants with lower levels of infection were. (author)

  6. Wheat TaRab7 GTPase is part of the signaling pathway in responses to stripe rust and abiotic stimuli.

    Directory of Open Access Journals (Sweden)

    Furong Liu

    Full Text Available Small GTP-binding proteins function as regulators of specific intercellular fundamental biological processes. In this study, a small GTP-binding protein Rab7 gene, designated as TaRab7, was identified and characterized from a cDNA library of wheat leaves infected with Puccinia striiformis f. sp. tritici (Pst the wheat stripe rust pathogen. The gene was predicted to encode a protein of 206 amino acids, with a molecular mass of 23.13 KDa and an isoeletric point (pI of 5.13. Further analysis revealed the presence of a conserved signature that is characteristic of Rab7, and phylogenetic analysis demonstrated that TaRab7 has the highest similarity to a small GTP binding protein gene (BdRab7-like from Brachypodium distachyon. Quantitative real-time PCR assays revealed that the expression of TaRab7 was higher in the early stage of the incompatible interactions between wheat and Pst than in the compatible interaction, and the transcription level of TaRab7 was also highly induced by environmental stress stimuli. Furthermore, knocking down TaRab7 expression by virus induced gene silencing enhanced the susceptibility of wheat cv. Suwon 11 to an avirulent race CYR23. These results imply that TaRab7 plays an important role in the early stage of wheat-stripe rust fungus interaction and in stress tolerance.

  7. Mining centuries old in-situ conserved Turkish wheat landraces for grain yield and stripe rust resistance genes

    Directory of Open Access Journals (Sweden)

    Deepmala Sehgal

    2016-11-01

    Full Text Available Wheat landraces in Turkey are an important genetic resource for wheat improvement. An exhaustive five-year (2009-2014 effort made by the International Winter Wheat Improvement Programme (IWWIP a cooperative program between the Ministry of Food, Agriculture and Livestock of Turkey, the International Center for Maize and Wheat Improvement (CIMMYT and the International Center for Agricultural Research in the Dry Areas (ICARDA, led to the collection and documentation of around 2,000 landrace populations from 55 provinces throughout Turkey. This study reports the genetic characterization of a subset of bread wheat landraces collected in 2010 from 11 diverse provinces using genotyping-by-sequencing (GBS technology. The potential of this collection to identify loci determining grain yield and stripe rust resistance via genome-wide association (GWA analysis was explored. A high genetic diversity (diversity index = 0.260 and a moderate population structure based on highly inherited spike traits was revealed in the panel. The linkage disequilibrium decayed at 10 cM across the whole genome and was slower as compared to other landrace collections. In addition to previously reported QTL, GWA analysis also identified new candidate genomic regions for stripe rust resistance, grain yield and spike productivity components. New candidate genomic regions reflect the potential of this landrace collection to further increase genetic diversity in elite germplasm.

  8. Host status of false brome grass to the leaf rust fungus Puccinia brachypodii and the stripe rust fungus P. Striiformis

    NARCIS (Netherlands)

    Barbieri, M.; Marcel, T.C.; Niks, R.E.

    2011-01-01

    Purple false brome grass (Brachypodium distachyon) has recently emerged as a model system for temperate grasses and is also a potential model plant to investigate plant interactions with economically important pathogens such as rust fungi. We determined the host status of five Brachypodium species

  9. Molecular mapping of stripe rust resistance gene YrSE5756 in synthetic hexaploid wheat and its transfer to common wheat

    International Nuclear Information System (INIS)

    Wang, Y.J.; Wang, C.Y.; Zhang, H.

    2015-01-01

    Synthetic hexaploid wheat is an important germplasm resource for transfer of beneficial genes from alien species to common wheat (Triticum aestivum L.). Synthetic hexaploid wheat SE5756 confers a high level of resistance against a wide range of races of Puccinia striiformis West. f. sp. tritici Eriks. et Henn.(Pst). The objectives of this study were to determine the inheritance pattern, adjacent molecular markers, and chromosomal location of the stripe rust resistance gene in SE5756 and to develop new germplasm. We constructed a segregating population of 116 F2 plants and corresponding F2:3 families from a cross between SE5756 and Xinong979 with Pst races CYR32. Genetic analysis revealed that a single dominant gene, tentatively designated as YrSE5756, was responsible for seedling stage stripe rust resistance in SE5756. A genetic map, encompassing Xwmc626, Xwmc269, Xgwm11, Xbarx137, Xwmc419, Xwmc85, Xgpw5237, Xwmc134, WE173, Xwmc631, and YrSE5756, spanned 70.1 cM on chromosome 1BS. Xwmc419 and Xwmc85 were flanking markers tightly linked to YrSE5756 at genetic distances of 2.3 and 1.8 cM. Typical adult plant responses of the SE5756, varieties of the carrier Yr10 and Yr15, Chuanmai 42 (Yr24/Yr26), Yuanfeng 175 (Yr24/Yr26) and Huixianhong resistant to mixture Pst races (CYR32, CYR33 and V26) were experimented. The results showed that YrSE5756 was likely a new resistance stripe rust gene different from Yr24/Yr26, Yr10 and Yr15. From cross and backcross populations of SE5756/Xinong 979, we developed four new wheat lines with large seeds, stripe rust resistance, and improved agronomic traits: N07178-1, N07178-2, N08256-1, and N08256-2. These new germplasm lines could serve as sources of resistance to stripe rust in wheat breeding. SE5756 has the very vital significance in the development of breeding and expand our resistance germplasm resource gene pool. (author)

  10. Wheat Ammonium Transporter (AMT) Gene Family: Diversity and Possible Role in Host-Pathogen Interaction with Stem Rust.

    Science.gov (United States)

    Li, Tianya; Liao, Kai; Xu, Xiaofeng; Gao, Yue; Wang, Ziyuan; Zhu, Xiaofeng; Jia, Baolei; Xuan, Yuanhu

    2017-01-01

    Ammonium transporter (AMT) proteins have been reported in many plants, but no comprehensive analysis was performed in wheat. In this study, we identified 23 AMT members (hereafter TaAMTs) using a protein homology search in wheat genome. Tissue-specific expression analysis showed that TaAMT1;1a, TaAMT1;1b , and TaAMT1;3a were relatively more highly expressed in comparison with other TaAMTs . TaAMT1;1a, TaAMT1;1b, and TaAMT1;3a-GFP were localized in the plasma membrane in tobacco leaves, and TaAMT1;1a, TaAMT1;1b , and TaAMT1;3a successfully complemented a yeast 31019b strain in which ammonium uptake was deficient. In addition, the expression of TaAMT1;1b in an Arabidopsis AMT quadruple mutant ( qko ) successfully restored [Formula: see text] uptake ability. Resupply of [Formula: see text] rapidly increased cellular [Formula: see text] contents and suppressed expression of TaAMT1;3a , but not of TaAMT;1;1a and TaAMT1;1b expressions. Expression of TaAMT1;1a, TaAMT1;1b , and TaAMT1;3a was not changed in leaves after [Formula: see text] resupply. In contrast, nitrogen (N) deprivation induced TaAMT1;1a, TaAMT1;1b , and TaAMT1;3a gene expressions in the roots and leaves. Expression analysis in the leaves of the stem rust-susceptible wheat line "Little Club" and the rust-tolerant strain "Mini 2761" revealed that TaAMT1;1a, TaAMT1;1b , and TaAMT1;3a were specifically induced in the former but not in the latter. Rust-susceptible wheat plants grown under N-free conditions exhibited a lower disease index than plants grown with [Formula: see text] as the sole N source in the medium after infection with Puccinia graminis f. sp. tritici , suggesting that [Formula: see text] and its transport may facilitate the infection of wheat stem rust disease. Our findings may be important for understanding the potential function TaAMTs in wheat plants.

  11. Stability of rust resistance and yield potential of some icarda bread wheat lines in Pakistan

    International Nuclear Information System (INIS)

    Shah, S.J.A.; Khan, A.J.; Azam, F.; Mirza, J.I.; Atiq-ur-Rehman

    2003-01-01

    Thirty bread wheat lines resistant to Yellow rust (Yr) were selected after careful screening from two ICARDA nurseries during 1998 - 1999, Rabi season at Nuclear Institute for Food and Agriculture (NIFA), Tarnab, Peshawar under severe disease pressure. In the following crop cycle, these selections were again field evaluated for stability and effectiveness of Yr resistance at multilocations while their yield potential was ascertained at Tarnab in two different trials with Tatara as commercial check. Results revealed that uniformity was found in the potential behavior of 23 lines (77%) in both the cropping seasons against Yr. This included some high yielding (up to 7067 kg/ ha) and low yielding lines (up to 4333 kg / ha) when compared with the check (6089 kg / ha). Yield potential of some high yielding lines with stable Yr resistance should be further evaluated over sites and seasons for wide adaptability, under national uniform testing in order to select and deploy future varieties to combat Yr for acquiring food security in Pakistan.(author)

  12. Discovery of a Novel Stem Rust Resistance Allele in Durum Wheat that Exhibits Differential Reactions to Ug99 Isolates

    Directory of Open Access Journals (Sweden)

    Jayaveeramuthu Nirmala

    2017-10-01

    Full Text Available Wheat stem rust, caused by Puccinia graminis f. sp. tritici Eriks. & E. Henn, can incur yield losses in susceptible cultivars of durum wheat, Triticum turgidum ssp. durum (Desf. Husnot. Although several durum cultivars possess the stem rust resistance gene Sr13, additional genes in durum wheat effective against emerging virulent races have not been described. Durum line 8155-B1 confers resistance against the P. graminis f. sp. tritici race TTKST, the variant race of the Ug99 race group with additional virulence to wheat stem rust resistance gene Sr24. However, 8155-B1 does not confer resistance to the first-described race in the Ug99 race group: TTKSK. We mapped a single gene conferring resistance in 8155-B1 against race TTKST, Sr8155B1, to chromosome arm 6AS by utilizing Rusty/8155-B1 and Rusty*2/8155-B1 populations and the 90K Infinium iSelect Custom bead chip supplemented by KASP assays. One marker, KASP_6AS_IWB10558, cosegregated with Sr8155B1 in both populations and correctly predicted Sr8155B1 presence or absence in 11 durum cultivars tested. We confirmed the presence of Sr8155B1 in cultivar Mountrail by mapping in the population Choteau/Mountrail. The marker developed in this study could be used to predict the presence of resistance to race TTKST in uncharacterized durum breeding lines, and also to combine Sr8155B1 with resistance genes effective to Ug99 such as Sr13. The map location of Sr8155B1 cannot rule out the possibility that this gene is an allele at the Sr8 locus. However, race specificity indicates that Sr8155B1 is different from the known alleles Sr8a and Sr8b.

  13. Effects of sowing time on pink snow mould, leaf rust and winter damage in winter rye varieties in Finland

    Directory of Open Access Journals (Sweden)

    M. SERENIUS

    2008-12-01

    Full Text Available Disease infection in relation to sowing time of winter rye (Secale cereale was studied in southern Finland in order to compare overwintering capacity of modern rye varieties and to give recommendations for rye cultivation. This was done by using three sowing times and four rye varieties in field trials conducted at three locations in 1999–2001. The early sown rye (beginning of August was severely affected by diseases caused by Puccinia recondita and Microdochium nivale, whereas postponing sowing for two weeks after the recommended sowing time resulted in considerably less infection. The infection levels of diseases differed among rye varieties. Finnish rye varieties Anna and Bor 7068 were more resistant to snow mould and more winter hardy than the Polish variety Amilo, or the German hybrid varieties Picasso and Esprit. However, Amilo was the most resistant to leaf rust. In the first year snow mould appeared to be the primary cause of winter damage, but in the second year the winter damage was positively correlated with leaf rust. No significant correlation between frit fly infestation and winter damage or disease incidence of snow mould or leaf rust was established. The late sowing of rye (in the beginning of September is recommended in Finland, particularly with hybrid varieties, to minimize the need for chemical plant protection in autumn.;

  14. Genome-wide association mapping reveals a rich genetic architecture of stripe rust resistance loci in emmer wheat (Triticum turgidum ssp. dicoccum).

    Science.gov (United States)

    Liu, Weizhen; Maccaferri, Marco; Chen, Xianming; Laghetti, Gaetano; Pignone, Domenico; Pumphrey, Michael; Tuberosa, Roberto

    2017-11-01

    SNP-based genome scanning in worldwide domesticated emmer germplasm showed high genetic diversity, rapid linkage disequilibrium decay and 51 loci for stripe rust resistance, a large proportion of which were novel. Cultivated emmer wheat (Triticum turgidum ssp. dicoccum), one of the oldest domesticated crops in the world, is a potentially rich reservoir of variation for improvement of resistance/tolerance to biotic and abiotic stresses in wheat. Resistance to stripe rust (Puccinia striiformis f. sp. tritici) in emmer wheat has been under-investigated. Here, we employed genome-wide association (GWAS) mapping with a mixed linear model to dissect effective stripe rust resistance loci in a worldwide collection of 176 cultivated emmer wheat accessions. Adult plants were tested in six environments and seedlings were evaluated with five races from the United States and one from Italy under greenhouse conditions. Five accessions were resistant across all experiments. The panel was genotyped with the wheat 90,000 Illumina iSelect single nucleotide polymorphism (SNP) array and 5106 polymorphic SNP markers with mapped positions were obtained. A high level of genetic diversity and fast linkage disequilibrium decay were observed. In total, we identified 14 loci associated with field resistance in multiple environments. Thirty-seven loci were significantly associated with all-stage (seedling) resistance and six of them were effective against multiple races. Of the 51 total loci, 29 were mapped distantly from previously reported stripe rust resistance genes or quantitative trait loci and represent newly discovered resistance loci. Our results suggest that GWAS is an effective method for characterizing genes in cultivated emmer wheat and confirm that emmer wheat is a rich source of stripe rust resistance loci that can be used for wheat improvement.

  15. Mapping resistance to the Ug99 race group of the stem rust pathogen in a spring wheat landrace.

    Science.gov (United States)

    Babiker, E M; Gordon, T C; Chao, S; Newcomb, M; Rouse, M N; Jin, Y; Wanyera, R; Acevedo, M; Brown-Guedira, G; Williamson, S; Bonman, J M

    2015-04-01

    A new gene for Ug99 resistance from wheat landrace PI 374670 was detected on the long arm of chromosome 7A. Wheat landrace PI 374670 has seedling and field resistance to stem rust caused by Puccinia graminis f. sp tritici Eriks. & E. Henn (Pgt) race TTKSK. To elucidate the inheritance of resistance, 216 BC1F2 families, 192 double haploid (DH) lines, and 185 recombinant inbred lines (RILs) were developed by crossing PI 374670 and the susceptible line LMPG-6. The parents and progeny were evaluated for seedling resistance to Pgt races TTKSK, MCCFC, and TPMKC. The DH lines were tested in field stem rust nurseries in Kenya and Ethiopia. The DH lines were genotyped with the 90K wheat iSelect SNP genotyping platform. Goodness-of-fit tests indicated that a single dominant gene in PI 374670 conditioned seedling resistance to the three Pgt races. The seedling resistance locus mapped to the long arm of chromosome 7A and this result was verified in the RIL population screened with the flanking SNP markers using KASP assays. In the same region, a major QTL for field resistance was detected in a 7.7 cM interval and explained 34-54 and 29-36% of the variation in Kenya and Ethiopia, respectively. Results from tests with specific Pgt races and the csIH81 marker showed that the resistance was not due to Sr22. Thus, a new stem rust resistance gene or allele, either closely linked or allelic to Sr15, is responsible for the seedling and field resistance of PI 374670 to Ug99.

  16. Modelling coffee leaf rust risk in Colombia with climate reanalysis data.

    Science.gov (United States)

    Bebber, Daniel P; Castillo, Ángela Delgado; Gurr, Sarah J

    2016-12-05

    Many fungal plant diseases are strongly controlled by weather, and global climate change is thus likely to have affected fungal pathogen distributions and impacts. Modelling the response of plant diseases to climate change is hampered by the difficulty of estimating pathogen-relevant microclimatic variables from standard meteorological data. The availability of increasingly sophisticated high-resolution climate reanalyses may help overcome this challenge. We illustrate the use of climate reanalyses by testing the hypothesis that climate change increased the likelihood of the 2008-2011 outbreak of Coffee Leaf Rust (CLR, Hemileia vastatrix) in Colombia. We develop a model of germination and infection risk, and drive this model using estimates of leaf wetness duration and canopy temperature from the Japanese 55-Year Reanalysis (JRA-55). We model germination and infection as Weibull functions with different temperature optima, based upon existing experimental data. We find no evidence for an overall trend in disease risk in coffee-growing regions of Colombia from 1990 to 2015, therefore, we reject the climate change hypothesis. There was a significant elevation in predicted CLR infection risk from 2008 to 2011 compared with other years. JRA-55 data suggest a decrease in canopy surface water after 2008, which may have helped terminate the outbreak. The spatial resolution and accuracy of climate reanalyses are continually improving, increasing their utility for biological modelling. Confronting disease models with data requires not only accurate climate data, but also disease observations at high spatio-temporal resolution. Investment in monitoring, storage and accessibility of plant disease observation data are needed to match the quality of the climate data now available.This article is part of the themed issue 'Tackling emerging fungal threats to animal health, food security and ecosystem resilience'. © 2016 The Authors.

  17. Emergence and Spread of New Races of Wheat Stem Rust Fungus: Continued Threat to Food Security and Prospects of Genetic Control.

    Science.gov (United States)

    Singh, Ravi P; Hodson, David P; Jin, Yue; Lagudah, Evans S; Ayliffe, Michael A; Bhavani, Sridhar; Rouse, Matthew N; Pretorius, Zacharias A; Szabo, Les J; Huerta-Espino, Julio; Basnet, Bhoja R; Lan, Caixia; Hovmøller, Mogens S

    2015-07-01

    Race Ug99 (TTKSK) of Puccinia graminis f. sp. tritici, detected in Uganda in 1998, has been recognized as a serious threat to food security because it possesses combined virulence to a large number of resistance genes found in current widely grown wheat (Triticum aestivum) varieties and germplasm, leading to its potential for rapid spread and evolution. Since its initial detection, variants of the Ug99 lineage of stem rust have been discovered in Eastern and Southern African countries, Yemen, Iran, and Egypt. To date, eight races belonging to the Ug99 lineage are known. Increased pathogen monitoring activities have led to the identification of other races in Africa and Asia with additional virulence to commercially important resistance genes. This has led to localized but severe stem rust epidemics becoming common once again in East Africa due to the breakdown of race-specific resistance gene SrTmp, which was deployed recently in the 'Digalu' and 'Robin' varieties in Ethiopia and Kenya, respectively. Enhanced research in the last decade under the umbrella of the Borlaug Global Rust Initiative has identified various race-specific resistance genes that can be utilized, preferably in combinations, to develop resistant varieties. Research and development of improved wheat germplasm with complex adult plant resistance (APR) based on multiple slow-rusting genes has also progressed. Once only the Sr2 gene was known to confer slow rusting APR; now, four more genes-Sr55, Sr56, Sr57, and Sr58-have been characterized and additional quantitative trait loci identified. Cloning of some rust resistance genes opens new perspectives on rust control in the future through the development of multiple resistance gene cassettes. However, at present, disease-surveillance-based chemical control, large-scale deployment of new varieties with multiple race-specific genes or adequate levels of APR, and reducing the cultivation of susceptible varieties in rust hot-spot areas remains the best

  18. Identification and evaluation of resistance to powdery mildew and yellow rust in a wheat mapping population.

    Directory of Open Access Journals (Sweden)

    Lijun Yang

    Full Text Available Deployment of cultivars with genetic resistance is an effective approach to control the diseases of powdery mildew (PM and yellow rust (YR. Chinese wheat cultivar XK0106 exhibits high levels of resistance to both diseases, while cultivar E07901 has partial, adult plant resistance (APR. The aim of this study was to map resistance loci derived from the two cultivars and analyze their effects against PM and YR in a range of environments. A doubled haploid population (388 lines was used to develop a framework map consisting of 117 SSR markers, while a much higher density map using the 90K Illumina iSelect SNP array was produced with a subset of 80 randomly selected lines. Seedling resistance was characterized against a range of PM and YR isolates, while field scores in multiple environments were used to characterize APR. Composite interval mapping (CIM of seedling PM scores identified two QTLs (QPm.haas-6A and QPm.haas-2A, the former being located at the Pm21 locus. These QTLs were also significant in field scores, as were Qpm.haas-3A and QPm.haas-5A. QYr.haas-1B-1 and QYr.haas-2A were identified in field scores of YR and were located at the Yr24/26 and Yr17 chromosomal regions respectively. A second 1B QTL, QYr.haas-1B-2 was also identified. QPm.haas-2A and QYr.haas-1B-2 are likely to be new QTLs that have not been previously identified. Effects of the QTLs were further investigated in multiple environments through the testing of selected lines predicted to contain various QTL combinations. Significant additive interactions between the PM QTLs highlighted the ability to pyramid these loci to provide higher level of resistance. Interactions between the YR QTLs gave insights into the pathogen populations in the different locations as well as showing genetic interactions between these loci.

  19. Influence of Environmental Conditions and Genetic Background of Arabica Coffee (C. arabica L) on Leaf Rust (Hemileia vastatrix) Pathogenesis.

    Science.gov (United States)

    Toniutti, Lucile; Breitler, Jean-Christophe; Etienne, Hervé; Campa, Claudine; Doulbeau, Sylvie; Urban, Laurent; Lambot, Charles; Pinilla, Juan-Carlos H; Bertrand, Benoît

    2017-01-01

    Global warming is a major threat to agriculture worldwide. Between 2008 and 2013, some coffee producing countries in South and Central America suffered from severe epidemics of coffee leaf rust (CLR), resulting in high economic losses with social implications for coffee growers. The climatic events not only favored the development of the pathogen but also affected the physiological status of the coffee plant. The main objectives of the study were to evaluate how the physiological status of the coffee plant modified by different environmental conditions impact on the pathogenesis of CLR and to identify indicators of the physiological status able to predict rust incidence. Three rust susceptible genotypes (one inbred line and two hybrids) were grown in controlled conditions with a combination of thermal regime (TR), nitrogen and light intensity close to the field situation before being inoculated with the rust fungus Hemileia vastatrix . It has been demonstrated that a TR of 27-22°C resulted in 2000 times higher sporulation than with a TR of 23-18°C. It has been also shown that high light intensity combined with low nitrogen fertilization modified the CLR pathogenesis resulting in huge sporulation. CLR sporulation was significantly lower in the F1 hybrids than in the inbred line. The hybrid vigor may have reduced disease incidence. Among the many parameters studied, parameters related to photosystem II and photosynthetic electron transport chain components appeared as indicators of the physiological status of the coffee plant able to predict rust sporulation intensity. Taken together, these results show that CLR sporulation not only depends on the TR but also on the physiological status of the coffee plant, which itself depends on agronomic conditions. Our work suggests that vigorous varieties combined with a shaded system and appropriate nitrogen fertilization should be part of an agro-ecological approach to disease control.

  20. Genetic effects for controlling stripe rust (Puccinia striiformis f. sp. tritici resistance in wheat through joint segregation analysis

    Directory of Open Access Journals (Sweden)

    Kalim Ullah

    2016-06-01

    Full Text Available Mixed inheritance analysis using joint segregation analysis (JSA for stripe rust (Puccinia striiformis f. sp. tritici resistance was carried out in six basic populations (P1, F1, P2, BC1, BC2 and F2 of four wheat crosses (Hashim-08 × LU-26, Farid-06 × Shafaq, Parula × Blue Silver, TD-1 × D-97603 during crop season 2009 to 2012. Genes controlling stripe rust resistance were assessed by using area under disease progress curve (AUDPC. The AUDPC was controlled by mixed two additive-dominant-epistatic major genes plus additive-dominant-epistasis of polygenes in cross Hashim-08 × LU-26 (model E, while in Farid-06 × Shafaq, it was controlled by mixed two major additive-dominant genes plus additive-dominant polygenes (model E-2. In cross Parula × Blue Silver, the AUDPC was managed by additive, dominance and epistasis of two major genes (model B-1, however, it was controlled by mixed one major gene and additive dominant polygenes in cross TD-1 × D-97603 (model D-1. Genetic variation and heritability was higher in major genes than polygene for all the crosses showing that AUDPC was mainly controlled by major genes. The genetic behavior of the AUDPC revealed that stripe rust resistance was controlled by mixed interaction of one to two major genes plus polygenes.

  1. Characterization of the Wheat Stripe Rust (Puccinia striiformis f. sp. tritici) Fungal Effector Candidate PEC6 and Its Corresponding Host Targets

    DEFF Research Database (Denmark)

    Liu, Changhai

    Stripe rust caused by Puccinia striiformis f. sp. tritici (Pst), is one of the most important fungal diseases on wheat worldwide and a serious threat to wheat production. Understanding the plant-microbe interaction mechanism is the basic step to assist future plant breeding aiming at increasing...... factor. By using the yeast two-hybrid system, the adenosine kinase (ADK) was identified as a host target of PEC6. Virus-induced gene silencing (VIGS) of ADK enhanced wheat susceptibility to stripe rust indicates that ADK is a positive regulator in plant defense. Based on EtHAn-mediated effector delivery......, seventy-two wheat landraces were screened to search for the presence of potential resistance (R) genes. Three landraces showed strong hypersensitive response (HR) when PEC6 was expressed in the cells, suggesting the presence of certain R gene(s) recognizing PEC6. However, these landraces did not show...

  2. Breeding wheat for disease resistance in Kenya

    International Nuclear Information System (INIS)

    Njau, P.N.; Kinyua, M.G.; Karanja, L.; Maling'a, J.

    2001-01-01

    Yellow rust caused by Puccinia striformis and stem rust caused by Puccinia graminis tritici are most destructive diseases in Kenya. In wheat improvement, development of varieties of wheat with resistance to these diseases has been among the foremost contributions in wheat breeding. In breeding programs each disease is considered as a separate problem. Attention has been given to varieties resistant to stem rust, yellow rust and leaf rust among other diseases. In the year 2001 program stem rust and yellow rust were recorded in all the sites where NPT was performed. Breeding for resistance for the two diseases is approached through the Introductions and Hybridisation. The Doubled Haploid Technique is used to quicken the time of homozygous lines production. The introduction and the homozygous lines are then evaluated for yield and disease resistance in the field under preliminary yield trials and the National Performance Trials (NPT) in 2001, 18 lines and 2 check varieties were included in the NPT. The results show that there were some differences in reaction to the three diseases where lines R946, K7972-1 and R899 had the lowest score of the diseases in all sites. In the commercial variety trial the results show that all the varietieshave become susceptible to stem rust and so the need to develop new cultivars which will be resistance to the rusts. Yombi a newly developed variety showed a substantially high level resistance. (author)

  3. Genome-wide association study for Identification and validation of novel SNP markers for Sr6 stem rust resistance gene in bread wheat

    Science.gov (United States)

    Stem rust (caused by Puccinia graminis f. sp. tritici Erikss. & E. Henn.), is a major disease in wheat (Triticum aestivium L.). However, in recent years it occurs rarely in Nebraska due to weather and the effective selection and gene pyramiding of resistance genes. To understand the genetic basis of...

  4. Identification of New Resistance Loci to African Stem Rust Race TTKSK in Tetraploid Wheats Based on Linkage and Genome-Wide Association Mapping.

    Science.gov (United States)

    Laidò, Giovanni; Panio, Giosuè; Marone, Daniela; Russo, Maria A; Ficco, Donatella B M; Giovanniello, Valentina; Cattivelli, Luigi; Steffenson, Brian; de Vita, Pasquale; Mastrangelo, Anna M

    2015-01-01

    Stem rust, caused by Puccinia graminis Pers. f. sp. tritici Eriks. and E. Henn. (Pgt), is one of the most destructive diseases of wheat. Races of the pathogen in the "Ug99 lineage" are of international concern due to their virulence for widely used stem rust resistance genes and their spread throughout Africa. Disease resistant cultivars provide one of the best means for controlling stem rust. To identify quantitative trait loci (QTL) conferring resistance to African stem rust race TTKSK at the seedling stage, we evaluated an association mapping (AM) panel consisting of 230 tetraploid wheat accessions under greenhouse conditions. A high level of phenotypic variation was observed in response to race TTKSK in the AM panel, allowing for genome-wide association mapping of resistance QTL in wild, landrace, and cultivated tetraploid wheats. Thirty-five resistance QTL were identified on all chromosomes, and seventeen are of particular interest as identified by multiple associations. Many of the identified resistance loci were coincident with previously identified rust resistance genes; however, nine on chromosomes 1AL, 2AL, 4AL, 5BL, and 7BS may be novel. To validate AM results, a biparental population of 146 recombinant inbred lines was also considered, which derived from a cross between the resistant cultivar "Cirillo" and susceptible "Neodur." The stem rust resistance of Cirillo was conferred by a single gene on the distal region of chromosome arm 6AL in an interval map coincident with the resistance gene Sr13, and confirmed one of the resistance loci identified by AM. A search for candidate resistance genes was carried out in the regions where QTL were identified, and many of them corresponded to NBS-LRR genes and protein kinases with LRR domains. The results obtained in the present study are of great interest as a high level of genetic variability for resistance to race TTKSK was described in a germplasm panel comprising most of the tetraploid wheat sub-species.

  5. IPR 118 - Bread wheat cultivar

    Directory of Open Access Journals (Sweden)

    Carlos Roberto Riede

    2007-01-01

    Full Text Available Wheat cultivar IPR 118 developed by IAPAR has a good yield potential and is widely adapted. It is earlymaturing and moderately tolerant to shattering and soil aluminum, moderately resistant to leaf rust and presents high glutenstrength for bread-making. The overall yield exceeded controls by 13%.

  6. Mapping of stripe rust resistance QTL in Cappelle-Desprez × PBW343 RIL population effective in northern wheat belt of India.

    Science.gov (United States)

    Pawar, Sushma Kumari; Sharma, Davinder; Duhan, Joginder Singh; Saharan, Mahender Singh; Tiwari, Ratan; Sharma, Indu

    2016-06-01

    Stripe rust caused by Puccinia striiformis f. sp. tritici is most important and devastating disease of wheat worldwide, which affects the grain yields, quality and nutrition. To elucidate, the genetic basis of resistance, a mapping population of recombinant inbred lines was developed from a cross between resistant Cappelle-Desprez and susceptible cultivar PBW343 using single-seed descent. Variety PBW343 had been one of the most popular cultivars of North Western Plains Zone, for more than a decade, before succumbing to the stripe rust. Cappelle-Desprez, a source of durable adult plant resistance, has maintained its resistance against stripe rust for a long time in Europe. Map construction and QTL analysis were completed with 1012 polymorphic (DArT and SSR) markers. Screenings for stripe rust disease were carried out in field condition for two consecutive crop seasons (2012-2013 and 2013-2014). Susceptible parent (PBW343) achieved a significant level of disease i.e., 100 % in both the years. In present investigations, resistance in Cappelle-Desprez was found stable and response to the rust ranged from 0 to 1.5 % over the years. The estimated broad-sense heritability (h 2 ) of stripe rust rAUDPC in the mapping population was 0.82. The relative area under the disease progress curve data showed continuous distributions, indicating that trait was controlled multigenically. Genomic region identified on chromosome 2D, was located within the short arm, with flanking markers (Xgwm484-Xcfd73), explained phenotypic variation (PVE) ranged from 13.9 to 31.8 %. The genomic region identified on chromosome 5B was found with the effect of maximum contribution with flanking DArT markers (1376633|F|0-1207571|F|0), PVE ranged from 24 to 27.0 %. This can, therefore, be utilized for marker assisted selection in developing much needed stripe rust resistant lines for the northern wheat belt of India.

  7. Aegilops tauschii Accessions with Geographically Diverse Origin Show Differences in Chromosome Organization and Polymorphism of Molecular Markers Linked to Leaf Rust and Powdery Mildew Resistance Genes.

    Science.gov (United States)

    Majka, Maciej; Kwiatek, Michał T; Majka, Joanna; Wiśniewska, Halina

    2017-01-01

    Aegilops tauschii (2n = 2x = 14) is a diploid wild species which is reported as a donor of the D-genome of cultivated bread wheat. The main goal of this study was to examine the differences and similarities in chromosomes organization among accessions of Ae. tauschii with geographically diversed origin, which is believed as a potential source of genes, especially determining resistance to fungal diseases (i.e., leaf rust and powdery mildew) for breeding of cereals. We established and compared the fluorescence in situ hybridization patterns of 21 accessions of Ae. tauschii using various repetitive sequences mainly from the BAC library of wheat cultivar Chinese Spring. Results obtained for Ae. tauschii chromosomes revealed many similarities between analyzed accessions, however, some hybridization patterns were specific for accessions, which become from cognate regions of the World. The most noticeable differences were observed for accessions from China which were characterized by presence of distinct signals of pTa-535 in the interstitial region of chromosome 3D, less intensity of pTa-86 signals in chromosome 2D, as well as lack of additional signals of pTa-86 in chromosomes 1D, 5D, or 6D. Ae. tauschii of Chinese origin appeared homogeneous and separate from landraces that originated in western Asia. Ae. tauschii chromosomes showed similar hybridization patterns to wheat D-genome chromosomes, but some differences were also observed among both species. What is more, we identified reciprocal translocation between short arm of chromosome 1D and long arm of chromosome 7D in accession with Iranian origin. High polymorphism between analyzed accessions and extensive allelic variation were revealed using molecular markers associated with resistance genes. Majority of the markers localized in chromosomes 1D and 2D showed the diversity of banding patterns between accessions. Obtained results imply, that there is a moderate or high level of polymorphism in the genome of Ae

  8. Genome-Wide Association Study for Identification and Validation of Novel SNP Markers for Sr6 Stem Rust Resistance Gene in Bread Wheat.

    Science.gov (United States)

    Mourad, Amira M I; Sallam, Ahmed; Belamkar, Vikas; Wegulo, Stephen; Bowden, Robert; Jin, Yue; Mahdy, Ezzat; Bakheit, Bahy; El-Wafaa, Atif A; Poland, Jesse; Baenziger, Peter S

    2018-01-01

    Stem rust (caused by Puccinia graminis f. sp. tritici Erikss. & E. Henn.), is a major disease in wheat ( Triticum aestivium L.). However, in recent years it occurs rarely in Nebraska due to weather and the effective selection and gene pyramiding of resistance genes. To understand the genetic basis of stem rust resistance in Nebraska winter wheat, we applied genome-wide association study (GWAS) on a set of 270 winter wheat genotypes (A-set). Genotyping was carried out using genotyping-by-sequencing and ∼35,000 high-quality SNPs were identified. The tested genotypes were evaluated for their resistance to the common stem rust race in Nebraska (QFCSC) in two replications. Marker-trait association identified 32 SNP markers, which were significantly (Bonferroni corrected P < 0.05) associated with the resistance on chromosome 2D. The chromosomal location of the significant SNPs (chromosome 2D) matched the location of Sr6 gene which was expected in these genotypes based on pedigree information. A highly significant linkage disequilibrium (LD, r 2 ) was found between the significant SNPs and the specific SSR marker for the Sr6 gene ( Xcfd43 ). This suggests the significant SNP markers are tagging Sr6 gene. Out of the 32 significant SNPs, eight SNPs were in six genes that are annotated as being linked to disease resistance in the IWGSC RefSeq v1.0. The 32 significant SNP markers were located in nine haplotype blocks. All the 32 significant SNPs were validated in a set of 60 different genotypes (V-set) using single marker analysis. SNP markers identified in this study can be used in marker-assisted selection, genomic selection, and to develop KASP (Kompetitive Allele Specific PCR) marker for the Sr6 gene. Novel SNPs for Sr6 gene, an important stem rust resistant gene, were identified and validated in this study. These SNPs can be used to improve stem rust resistance in wheat.

  9. Molecular cytogenetic characterization and stem rust resistance of five wheat-thinopyrum ponticum partial amphiploids

    Science.gov (United States)

    Partial amphiploids created by crossing common wheat (Triticum aestivum L.) and Thinopyrum ponticum (Podp.), Barkworth & D. R. Dewey may be resistant to major wheat diseases and are an important intermediate material in wheat breeding. In this study, we examined chromosome composition of five Xiaoy...

  10. The estimation of rust disease of daylily leaf images with GLCM based different classification methods

    OpenAIRE

    ÖZERDEM, Mehmet Siraç; ACAR, Emrullah

    2011-01-01

    Crop diseases can affect yield and/or quality of the harvested commodity. This can influence profitability and raise the risks of farming. When the diseases are estimated early, the yield will increase by taking measures thanks to farmers. The rust disease is one of the most major crop diseases that affect crop yield. Rust disease can be defined as a fungus; it makes the crops weak by blocking food to the roots and leaves. It is named “rust” disease, since the spots on the leaves look like gr...

  11. A novel Robertsonian translocation event leads to transfer of a stem rust resistance gene (Sr52) effective against race Ug99 from Dasypyrum villosum into bread wheat.

    Science.gov (United States)

    Qi, L L; Pumphrey, M O; Friebe, Bernd; Zhang, P; Qian, C; Bowden, R L; Rouse, M N; Jin, Y; Gill, B S

    2011-06-01

    Stem rust (Puccinia graminis f. sp. tritici Eriks. & E. Henn.) (the causal agent of wheat stem rust) race Ug99 (also designated TTKSK) and its derivatives have defeated several important stem rust resistance genes widely used in wheat (Triticum aestivum L.) production, rendering much of the worldwide wheat acreage susceptible. In order to identify new resistance sources, a large collection of wheat relatives and genetic stocks maintained at the Wheat Genetic and Genomic Resources Center was screened. The results revealed that most accessions of the diploid relative Dasypyrum villosum (L.) Candargy were highly resistant. The screening of a set of wheat-D. villosum chromosome addition lines revealed that the wheat-D. villosum disomic addition line DA6V#3 was moderately resistant to race Ug99. The objective of the present study was to produce and characterize compensating wheat-D. villosum whole arm Robertsonian translocations (RobTs) involving chromosomes 6D of wheat and 6V#3 of D. villosum through the mechanism of centric breakage-fusion. Seven 6V#3-specific EST-STS markers were developed for screening F(2) progeny derived from plants double-monosomic for chromosomes 6D and 6V#3. Surprisingly, although 6D was the target chromosome, all recovered RobTs involved chromosome 6A implying a novel mechanism for the origin of RobTs. Homozygous translocations (T6AS·6V#3L and T6AL·6V#3S) with good plant vigor and full fertility were selected from F(3) families. A stem rust resistance gene was mapped to the long arm 6V#3L in T6AS·6V#3L and was designated as Sr52. Sr52 is temperature-sensitive and is most effective at 16°C, partially effective at 24°C, and ineffective at 28°C. The T6AS·6V#3L stock is a new source of resistance to Ug99, is cytogenetically stable, and may be useful in wheat improvement.

  12. The genome sequence and effector complement of the flax rust pathogen Melampsora lini

    Directory of Open Access Journals (Sweden)

    Adnane eNemri

    2014-03-01

    Full Text Available Rust fungi cause serious yield reductions on crops, including wheat, barley, soybean, coffee, and represent real threats to global food security. Of these fungi, the flax rust pathogen Melampsora lini has been developed extensively over the past 80 years as a model to understand the molecular mechanisms that underpin pathogenesis. During infection, M. lini secretes virulence effectors to promote disease. The number of these effectors, their function and their degree of conservation across rust fungal species is unknown. To assess this, we sequenced and assembled de novo the genome of M. lini isolate CH5 into 21,130 scaffolds spanning 189 Mbp (scaffold N50 of 31 kbp. Global analysis of the DNA sequence revealed that repetitive elements, primarily retrotransposons, make up at least 45% of the genome. Using ab initio predictions, transcriptome data and homology searches, we identified 16,271 putative protein-coding genes. An analysis pipeline was then implemented to predict the effector complement of M. lini and compare it to that of the poplar rust, wheat stem rust and wheat stripe rust pathogens to identify conserved and species-specific effector candidates. Previous knowledge of four cloned M. lini avirulence effector proteins and two basidiomycete effectors was used to optimise parameters of the effector prediction pipeline. Markov clustering based on sequence similarity was performed to group effector candidates from all four rust pathogens. Clusters containing at least one member from M. lini were further analysed and prioritized based on features including expression in isolated haustoria and infected leaf tissue and conservation across rust species. Herein, we describe 200 of 940 clusters that ranked highest on our priority list, representing 725 flax rust candidate effectors. Our findings on this important model rust species provide insight into how effectors of rust fungi are conserved across species and how they may act to promote

  13. The genome sequence and effector complement of the flax rust pathogen Melampsora lini.

    Science.gov (United States)

    Nemri, Adnane; Saunders, Diane G O; Anderson, Claire; Upadhyaya, Narayana M; Win, Joe; Lawrence, Gregory J; Jones, David A; Kamoun, Sophien; Ellis, Jeffrey G; Dodds, Peter N

    2014-01-01

    Rust fungi cause serious yield reductions on crops, including wheat, barley, soybean, coffee, and represent real threats to global food security. Of these fungi, the flax rust pathogen Melampsora lini has been developed most extensively over the past 80 years as a model to understand the molecular mechanisms that underpin pathogenesis. During infection, M. lini secretes virulence effectors to promote disease. The number of these effectors, their function and their degree of conservation across rust fungal species is unknown. To assess this, we sequenced and assembled de novo the genome of M. lini isolate CH5 into 21,130 scaffolds spanning 189 Mbp (scaffold N50 of 31 kbp). Global analysis of the DNA sequence revealed that repetitive elements, primarily retrotransposons, make up at least 45% of the genome. Using ab initio predictions, transcriptome data and homology searches, we identified 16,271 putative protein-coding genes. An analysis pipeline was then implemented to predict the effector complement of M. lini and compare it to that of the poplar rust, wheat stem rust and wheat stripe rust pathogens to identify conserved and species-specific effector candidates. Previous knowledge of four cloned M. lini avirulence effector proteins and two basidiomycete effectors was used to optimize parameters of the effector prediction pipeline. Markov clustering based on sequence similarity was performed to group effector candidates from all four rust pathogens. Clusters containing at least one member from M. lini were further analyzed and prioritized based on features including expression in isolated haustoria and infected leaf tissue and conservation across rust species. Herein, we describe 200 of 940 clusters that ranked highest on our priority list, representing 725 flax rust candidate effectors. Our findings on this important model rust species provide insight into how effectors of rust fungi are conserved across species and how they may act to promote infection on their

  14. Secretome Characterization and Correlation Analysis Reveal Putative Pathogenicity Mechanisms and Identify Candidate Avirulence Genes in the Wheat Stripe Rust Fungus Puccinia striiformis f. sp. tritici.

    Science.gov (United States)

    Xia, Chongjing; Wang, Meinan; Cornejo, Omar E; Jiwan, Derick A; See, Deven R; Chen, Xianming

    2017-01-01

    Stripe (yellow) rust, caused by Puccinia striiformis f. sp. tritici ( Pst ), is one of the most destructive diseases of wheat worldwide. Planting resistant cultivars is an effective way to control this disease, but race-specific resistance can be overcome quickly due to the rapid evolving Pst population. Studying the pathogenicity mechanisms is critical for understanding how Pst virulence changes and how to develop wheat cultivars with durable resistance to stripe rust. We re-sequenced 7 Pst isolates and included additional 7 previously sequenced isolates to represent balanced virulence/avirulence profiles for several avirulence loci in seretome analyses. We observed an uneven distribution of heterozygosity among the isolates. Secretome comparison of Pst with other rust fungi identified a large portion of species-specific secreted proteins, suggesting that they may have specific roles when interacting with the wheat host. Thirty-two effectors of Pst were identified from its secretome. We identified candidates for Avr genes corresponding to six Yr genes by correlating polymorphisms for effector genes to the virulence/avirulence profiles of the 14 Pst isolates. The putative AvYr76 was present in the avirulent isolates, but absent in the virulent isolates, suggesting that deleting the coding region of the candidate avirulence gene has produced races virulent to resistance gene Yr76 . We conclude that incorporating avirulence/virulence phenotypes into correlation analysis with variations in genomic structure and secretome, particularly presence/absence polymorphisms of effectors, is an efficient way to identify candidate Avr genes in Pst . The candidate effector genes provide a rich resource for further studies to determine the evolutionary history of Pst populations and the co-evolutionary arms race between Pst and wheat. The Avr candidates identified in this study will lead to cloning avirulence genes in Pst , which will enable us to understand molecular mechanisms

  15. QTL mapping of flag leaf-related traits in wheat (Triticum aestivum L.).

    Science.gov (United States)

    Liu, Kaiye; Xu, Hao; Liu, Gang; Guan, Panfeng; Zhou, Xueyao; Peng, Huiru; Yao, Yingyin; Ni, Zhongfu; Sun, Qixin; Du, Jinkun

    2018-04-01

    QTL controlling flag leaf length, flag leaf width, flag leaf area and flag leaf angle were mapped in wheat. This study aimed to advance our understanding of the genetic mechanisms underlying morphological traits of the flag leaves of wheat (Triticum aestivum L.). A recombinant inbred line (RIL) population derived from ND3331 and the Tibetan semi-wild wheat Zang1817 was used to identify quantitative trait loci (QTLs) controlling flag leaf length (FLL), flag leaf width (FLW), flag leaf area (FLA), and flag leaf angle (FLANG). Using an available simple sequence repeat genetic linkage map, 23 putative QTLs for FLL, FLW, FLA, and FLANG were detected on chromosomes 1B, 2B, 3A, 3D, 4B, 5A, 6B, 7B, and 7D. Individual QTL explained 4.3-68.52% of the phenotypic variance in different environments. Four QTLs for FLL, two for FLW, four for FLA, and five for FLANG were detected in at least two environments. Positive alleles of 17 QTLs for flag leaf-related traits originated from ND3331 and 6 originated from Zang1817. QTLs with pleiotropic effects or multiple linked QTL were also identified on chromosomes 1B, 4B, and 5A; these are potential target regions for fine-mapping and marker-assisted selection in wheat breeding programs.

  16. Quantitative trait loci for resistance to stripe rust of wheat revealed using global field nurseries and opportunities for stacking resistance genes.

    Science.gov (United States)

    Bokore, Firdissa E; Cuthbert, Richard D; Knox, Ron E; Randhawa, Harpinder S; Hiebert, Colin W; DePauw, Ron M; Singh, Asheesh K; Singh, Arti; Sharpe, Andrew G; N'Diaye, Amidou; Pozniak, Curtis J; McCartney, Curt; Ruan, Yuefeng; Berraies, Samia; Meyer, Brad; Munro, Catherine; Hay, Andy; Ammar, Karim; Huerta-Espino, Julio; Bhavani, Sridhar

    2017-12-01

    Quantitative trait loci controlling stripe rust resistance were identified in adapted Canadian spring wheat cultivars providing opportunity for breeders to stack loci using marker-assisted breeding. Stripe rust or yellow rust, caused by Puccinia striiformis Westend. f. sp. tritici Erikss., is a devastating disease of common wheat (Triticum aestivum L.) in many regions of the world. The objectives of this research were to identify and map quantitative trait loci (QTL) associated with stripe rust resistance in adapted Canadian spring wheat cultivars that are effective globally, and investigate opportunities for stacking resistance. Doubled haploid (DH) populations from the crosses Vesper/Lillian, Vesper/Stettler, Carberry/Vesper, Stettler/Red Fife and Carberry/AC Cadillac were phenotyped for stripe rust severity and infection response in field nurseries in Canada (Lethbridge and Swift Current), New Zealand (Lincoln), Mexico (Toluca) and Kenya (Njoro), and genotyped with SNP markers. Six QTL for stripe rust resistance in the population of Vesper/Lillian, five in Vesper/Stettler, seven in Stettler/Red Fife, four in Carberry/Vesper and nine in Carberry/AC Cadillac were identified. Lillian contributed stripe rust resistance QTL on chromosomes 4B, 5A, 6B and 7D, AC Cadillac on 2A, 2B, 3B and 5B, Carberry on 1A, 1B, 4A, 4B, 7A and 7D, Stettler on 1A, 2A, 3D, 4A, 5B and 6A, Red Fife on 2D, 3B and 4B, and Vesper on 1B, 2B and 7A. QTL on 1A, 1B, 2A, 2B, 3B, 4A, 4B, 5B, 7A and 7D were observed in multiple parents. The populations are compelling sources of recombination of many stripe rust resistance QTL for stacking disease resistance. Gene pyramiding should be possible with little chance of linkage drag of detrimental genes as the source parents were mostly adapted cultivars widely grown in Canada.

  17. Identification and mapping of Sr46 from Aegilops tauschii accession CIae 25 conferring resistance to race TTKSK (Ug99) of wheat stem rust pathogen.

    Science.gov (United States)

    Yu, Guotai; Zhang, Qijun; Friesen, Timothy L; Rouse, Matthew N; Jin, Yue; Zhong, Shaobin; Rasmussen, Jack B; Lagudah, Evans S; Xu, Steven S

    2015-03-01

    Mapping studies confirm that resistance to Ug99 race of stem rust pathogen in Aegilops tauschii accession Clae 25 is conditioned by Sr46 and markers linked to the gene were developed for marker-assisted selection. The race TTKSK (Ug99) of Puccinia graminis f. sp. tritici, the causal pathogen for wheat stem rust, is considered as a major threat to global wheat production. To address this threat, researchers across the world have been devoted to identifying TTKSK-resistant genes. Here, we report the identification and mapping of a stem rust resistance gene in Aegilops tauschii accession CIae 25 that confers resistance to TTKSK and the development of molecular markers for the gene. An F2 population of 710 plants from an Ae. tauschii cross CIae 25 × AL8/78 were first evaluated against race TPMKC. A set of 14 resistant and 116 susceptible F2:3 families from the F2 plants were then evaluated for their reactions to TTKSK. Based on the tests, 179 homozygous susceptible F2 plants were selected as the mapping population to identify the simple sequence repeat (SSR) and sequence tagged site (STS) markers linked to the gene by bulk segregant analysis. A dominant stem rust resistance gene was identified and mapped with 16 SSR and five new STS markers to the deletion bin 2DS5-0.47-1.00 of chromosome arm 2DS in which Sr46 was located. Molecular marker and stem rust tests on CIae 25 and two Ae. tauschii accessions carrying Sr46 confirmed that the gene in CIae 25 is Sr46. This study also demonstrated that Sr46 is temperature-sensitive being less effective at low temperatures. The marker validation indicated that two closely linked markers Xgwm210 and Xwmc111 can be used for marker-assisted selection of Sr46 in wheat breeding programs.

  18. Loci associated with resistance to stripe rust (Puccinia striiformis f. sp. tritici) in a core collection of spring wheat (Triticum aestivum)

    Science.gov (United States)

    Bulli, Peter; Rynearson, Sheri; Chen, Xianming; Pumphrey, Michael

    2017-01-01

    Stripe rust, caused by Puccinia striiformis Westend. f. sp. tritici Erikss. (Pst) remains one of the most significant diseases of wheat worldwide. We investigated stripe rust resistance by genome-wide association analysis (GWAS) in 959 spring wheat accessions from the United States Department of Agriculture-Agricultural Research Service National Small Grains Collection, representing major global production environments. The panel was characterized for field resistance in multi-environment field trials and seedling resistance under greenhouse conditions. A genome-wide set of 5,619 informative SNP markers were used to examine the population structure, linkage disequilibrium and marker-trait associations in the germplasm panel. Based on model-based analysis of population structure and hierarchical Ward clustering algorithm, the accessions were clustered into two major subgroups. These subgroups were largely separated according to geographic origin and improvement status of the accessions. A significant correlation was observed between the population sub-clusters and response to stripe rust infection. We identified 11 and 7 genomic regions with significant associations with stripe rust resistance at adult plant and seedling stages, respectively, based on a false discovery rate multiple correction method. The regions harboring all, except three, of the QTL identified from the field and greenhouse studies overlap with positions of previously reported QTL. Further work should aim at validating the identified QTL using proper germplasm and populations to enhance their utility in marker assisted breeding. PMID:28591221

  19. Smallholder Food and Water Security in the Face of Climatic Stress and the Coffee Leaf Rust: Lessons from Nicaragua

    Science.gov (United States)

    Stewart, I. T.; Bacon, C. M.; Sundstrom, W.

    2015-12-01

    Smallholder farmers in Nicaragua and throughout much of Central America preserve forest biodiversity and contribute to the sustainable production of coffee and other crops while, paradoxically, they themselves must cope with recurring periods of seasonal hunger. Smallholder food and water security in the region is affected by hurricanes, periodic drought events, climatic changes, an on-going outbreak of the coffee leaf rust, and fluctuations in food prices. Using regression analysis, our research examines what factors strengthened resilience to these hazards at the household level over the 1981 - 2014 time period. To this end, we integrate qualitative research on coping responses and local institutions, a participatory survey of 368 households, and an analysis of hydro-climatic data. Our results indicate that coping responses to the coffee leaf rust outbreak and the 2014 drought are comparable in severity to those used to endure Hurricane Mitch in 1998, and a severe 2009 drought. Higher smallholder resilience to stresses affecting food and water security is associated with larger farms, off-farm employment, more on-farm food production, higher numbers of fruit trees, and greater coffee harvests. Households that reported more severe coping responses to hazards earlier in the study period tended to be more strongly impacted by later hazards and reported generally greater seasonal hunger. Affiliation with local farmer-to-farmer institutions prioritizing either subsistence-oriented production or sales to international fair-trade markets did not correlate strongly with coping responses; however, subsistence-oriented institutions promote several resilience-enhancing practices. Lessons learned by adapting to past hazards may be used to develop adaptation and mitigation strategies for smallholders under continued climate variability and change.

  20. IPR 107 – Dwarf arabic coffee cultivar with resistance to coffee leaf rust

    Directory of Open Access Journals (Sweden)

    Tumoru Sera

    2013-01-01

    Full Text Available ‘IPR 107’ was derived from a cross between ‘IAPAR 59’ and ‘Mundo Novo IAC 376-4’. ‘IPR 107’ is a dwarf medium sizeplant with medium precocity in ripening and with complete resistance to rust races in this time. This cultivar presents superior qualityand high yield in many coffee regions.

  1. QTL-seq approach identified genomic regions and diagnostic markers for rust and late leaf spot resistance in groundnut (Arachis hypogaea L.).

    Science.gov (United States)

    Pandey, Manish K; Khan, Aamir W; Singh, Vikas K; Vishwakarma, Manish K; Shasidhar, Yaduru; Kumar, Vinay; Garg, Vanika; Bhat, Ramesh S; Chitikineni, Annapurna; Janila, Pasupuleti; Guo, Baozhu; Varshney, Rajeev K

    2017-08-01

    Rust and late leaf spot (LLS) are the two major foliar fungal diseases in groundnut, and their co-occurrence leads to significant yield loss in addition to the deterioration of fodder quality. To identify candidate genomic regions controlling resistance to rust and LLS, whole-genome resequencing (WGRS)-based approach referred as 'QTL-seq' was deployed. A total of 231.67 Gb raw and 192.10 Gb of clean sequence data were generated through WGRS of resistant parent and the resistant and susceptible bulks for rust and LLS. Sequence analysis of bulks for rust and LLS with reference-guided resistant parent assembly identified 3136 single-nucleotide polymorphisms (SNPs) for rust and 66 SNPs for LLS with the read depth of ≥7 in the identified genomic region on pseudomolecule A03. Detailed analysis identified 30 nonsynonymous SNPs affecting 25 candidate genes for rust resistance, while 14 intronic and three synonymous SNPs affecting nine candidate genes for LLS resistance. Subsequently, allele-specific diagnostic markers were identified for three SNPs for rust resistance and one SNP for LLS resistance. Genotyping of one RIL population (TAG 24 × GPBD 4) with these four diagnostic markers revealed higher phenotypic variation for these two diseases. These results suggest usefulness of QTL-seq approach in precise and rapid identification of candidate genomic regions and development of diagnostic markers for breeding applications. © 2016 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

  2. Molecular mapping of a stripe rust resistance gene in wheat line C51

    Indian Academy of Sciences (India)

    2014-08-18

    Aug 18, 2014 ... This disease causes significant economic losses in terms of .... Development of STS markers. Primers of ..... reference manual, 3rd edition. Whitehead ... Proceedings of the 11th International Wheat Genetic Symposium, pp.

  3. Molecular implications from ssr markers for stripe rust (puccinia striiformis F.Sp. tritici) resistance gene in bread wheat line N95175

    International Nuclear Information System (INIS)

    Ali, M.; Ji, W.G.; Hu, Y.G; Zhong, H.; Wang, C.Y.; Baloch, G.M.

    2010-01-01

    Stripe rust caused by Puccinia striiformis f. sp. tritici is one of the most devastating diseases of wheat in China as well as in Pakistan. In the present studies F2 population was established by crossing N95175 resistant to stripe rust race CYR32 with two susceptible lines Huixianhong and Abbondanza to molecularly tag resistance gene existing in wheat line N95175. The segregation of phenotype was accorded with an expected 3:1 ratio in both combinations studied and fit the model of a single dominant gene controlling stripe rust resistance in N95175. Thirty five SSR primer pairs were screened on the parents and bulks and also on individuals since resistance gene to be located in chromosome 1B. The result indicated that most of resistant plants amplified same band as resistant parent while susceptible plants amplified same as susceptible parents studied and considered that markers co-segregated with resistant loci in N95175. This yellow rust resistance gene was considered to be Yr26 originally thought to be also located in chromosome arm 1BS linked to marker loci Xgwm273 and Xgwm11 with genetic distances ranging from 1.075cM to 2.74cM in both combinations studied. However, the closest loci were observed 2.67cM for Xgwm273 and 1.075cM for Xgwm11 in Huixianhong XN95175 and Abbondanza XN95175 crosses respectively. Hence, it has been concluded that the PCR-based micro satellite markers Xgwm273 and Xgwm11 located in chromosome 1B were shown to be very effective for the detection of Yr26 gene in segregating population and can be applied in future wheat breeding strategies. (author)

  4. Isolation and molecular cytogenetic characterization of a wheat - Leymus mollis double monosomic addition line and its progenies with resistance to stripe rust.

    Science.gov (United States)

    Yang, Xiaofei; Li, Xin; Wang, Changyou; Chen, Chunhuan; Tian, Zengrong; Ji, Wanquan

    2017-12-01

    A common wheat - Leymus mollis (2n = 4x = 28, NsNsXmXm) double monosomic addition line, M11003-4-3-8/13/15 (2n = 44 = 42T.a + L.m2 + L.m3), with stripe rust resistance was developed (where T.a represents Triticum aestivum chromosome, L.m represents L. mollis chromosome, and L.m2/3 represents L. mollis chromosome of homoeologous groups 2 and 3). The progenies of line M11003-4-3-8/13/15 were characterized by cytological observation, specific molecular markers, fluorescence in situ hybridization (FISH), and genomic in situ hybridization (GISH). Among the progenies, there existed five different types (I, II, III, IV, and V) of chromosome constitution, the formulas of which were 2n = 44 = 42T.a + 1L.m2 + 1L.m3, 2n = 43 = 42T.a + 1L.m2, 2n = 43 = 42T.a + 1L.m3, 2n = 42 = 42T.a, and 2n = 44 = 42T.a + 2L.m2, respectively. Field disease screening showed that types I and III showed high resistance to stripe rust, while types II, IV, and V were susceptible. Leymus mollis was almost immune to stripe rust, whereas the wheat parent, cultivar 7182, was susceptible. Therefore, we concluded that the stripe rust resistance originated from L. mollis. These various lines could be further fully exploited as important disease resistance materials to enrich wheat genetic resources.

  5. Assessment of leaf/stem ratio in wheat straw feedstock and impact on enzymatic conversion

    DEFF Research Database (Denmark)

    Zhang, Heng; Fangel, Jonatan Ulrik; Willats, William George Tycho

    2014-01-01

    . By preparing samples of various leaf-to-stem (L/S) ratios, we found shifting conversion behavior as processing parameters were modified. Increasing the enzyme dosage, pretreatment temperature and pretreatment time all significantly improved conversion rates in samples with more than 50% leaf content, whereas...... less impact was observed on samples with less than 50% leaf content. Enzyme affinity, desorption and readsorption with leaf and stem fractions may affect the sugar yield in wheat straw saccharification. The data suggest that the L/S ratio is an important parameter when adjusting or optimizing...... conversion processes and additionally in feedstock breeding. Furthermore, this highlights the need for rapid techniques for determining L/S ratio in wheat straw harvests. The CoMPP data on specific carbohydrates and leaf pectin highlight carbohydrate epitopes that may be useful as markers in the development...

  6. Diversifying Selection in the Wheat Stem Rust Fungus Acts Predominantly on Pathogen-Associated Gene Families and Reveals Candidate Effectors

    Directory of Open Access Journals (Sweden)

    Jana eSperschneider

    2014-09-01

    Full Text Available Plant pathogens cause severe losses to crop plants and threaten global food production. One striking example is the wheat stem rust fungus, Puccinia graminis f. sp. tritici, which can rapidly evolve new virulent pathotypes in response to resistant host lines. Like several other filamentous fungal and oomycete plant pathogens, its genome features expanded gene families that have been implicated in host-pathogen interactions, possibly encoding effector proteins that interact directly with target host defence proteins. Previous efforts to understand virulence largely relied on the prediction of secreted, small and cysteine-rich proteins as candidate effectors and thus delivered an overwhelming number of candidates. Here, we implement an alternative analysis strategy that uses the signal of adaptive evolution as a line of evidence for effector function, combined with comparative information and expression data. We demonstrate that in planta up-regulated genes that are rapidly evolving are found almost exclusively in pathogen-associated gene families, affirming the impact of host-pathogen co-evolution on genome structure and the adaptive diversification of specialised gene families. In particular, we predict 42 effector candidates that are conserved only across pathogens, induced during infection and rapidly evolving. One of our top candidates has recently been shown to induce genotype-specific hypersensitive cell death in wheat. This shows that comparative genomics incorporating the evolutionary signal of adaptation is powerful for predicting effector candidates for laboratory verification. Our system can be applied to a wide range of pathogens and will give insight into host-pathogen dynamics, ultimately leading to progress in strategies for disease control.

  7. Long-term Low Radiation Decreases Leaf Photosynthesis, Photochemical Efficiency and Grain Yield in Winter Wheat

    DEFF Research Database (Denmark)

    Mu, H; Jiang, D; Wollenweber, Bernd

    2010-01-01

    the impact of low radiation on crop growth, photosynthesis and yield. Grain yield losses and leaf area index (LAI) reduction were less than the reduction in solar radiation under both shading treatment in both cultivars. Compared with the control (S0), grain yield only reduced 6.4 % and 9.9 % under 22.......0-22.9 % (S1) and 29.5-49.6 % (S2), which was consistent with the reduction in radiation. The reduction in LAI was partially compensated by increases in the fraction of the top and bottom leaf area to the total leaf area, which facilitated to intercept more solar radiation by the canopy. The decrease......Low radiation reduces wheat grain yield in tree-crop intercropping systems in the major wheat planting area of China. Here, two winter wheat (Triticum aestivum L) cultivars, Yangmai 158 (shading tolerant) and Yangmai 11 (shading sensitive), were shaded from jointing to maturity to evaluate...

  8. Evaluation of Six Algorithms to Monitor Wheat Leaf Nitrogen Concentration

    Directory of Open Access Journals (Sweden)

    Xia Yao

    2015-11-01

    Full Text Available The rapid and non-destructive monitoring of the canopy leaf nitrogen concentration (LNC in crops is important for precise nitrogen (N management. Nowadays, there is an urgent need to identify next-generation bio-physical variable retrieval algorithms that can be incorporated into an operational processing chain for hyperspectral satellite missions. We assessed six retrieval algorithms for estimating LNC from canopy reflectance of winter wheat in eight field experiments. These experiments represented variations in the N application rates, planting densities, ecological sites and cultivars and yielded a total of 821 samples from various places in Jiangsu, China over nine consecutive years. Based on the reflectance spectra and their first derivatives, six methods using different numbers of wavelengths were applied to construct predictive models for estimating wheat LNC, including continuum removal (CR, vegetation indices (VIs, stepwise multiple linear regression (SMLR, partial least squares regression (PLSR, artificial neural networks (ANNs, and support vector machines (SVMs. To assess the performance of these six methods, we provided a systematic evaluation of the estimation accuracies using the six metrics that were the coefficients of determination for the calibration (R2C and validation (R2V sets, the root mean square errors of prediction (RMSEP for the calibration and validation sets, the ratio of prediction to deviation (RPD, the computational efficiency (CE and the complexity level (CL. The following results were obtained: (1 For the VIs method, SAVI(R1200, R705 produced a more accurate estimation of the LNC than other indices, with R²C, R²V, RMSEP, RPD and CE values of 0.844, 0.795, 0.384, 2.005 and 0.10 min, respectively; (2 For the SMLR, PLSR, ANNs and SVMs methods, the SVMs using the first derivative canopy spectra (SVM-FDS offered the best accuracy in terms of R²C, R²V, RMSEP, RPD, and CE, at 0.96, 0.78, 0.37, 2.02, and 21

  9. Nonhost resistance to rust pathogens – a continuation of continua

    Directory of Open Access Journals (Sweden)

    Jan eBettgenhaeuser

    2014-12-01

    Full Text Available The rust fungi (order: Pucciniales are a group of widely distributed fungal plant pathogens, which can infect representatives of all vascular plant groups. Rust diseases significantly impact several crop species and considerable research focuses on understanding the basis of host specificity and nonhost resistance. Like many pathogens, rust fungi vary considerably in the number of hosts they can infect, such as wheat leaf rust (Puccinia triticina, which can only infect species in the genera Triticum and Aegilops, whereas Asian soybean rust (Phakopsora pachyrhizi is known to infect over 95 species from over 42 genera. A greater understanding of the genetic basis determining host range has the potential to identify sources of durable resistance for agronomically important crops. Delimiting the boundary between host and nonhost has been complicated by the quantitative nature of phenotypes in the transition between these two states. Plant-pathogen interactions in this intermediate state are characterized either by (1 the majority of accessions of a species being resistant to the rust or (2 the rust only being able to partially complete key components of its life cycle. This leads to a continuum of disease phenotypes in the interaction with different plant species, observed as a range from compatibility (host to complete immunity within a species (nonhost. In this review we will highlight how the quantitative nature of disease resistance in these intermediate interactions is caused by a continuum of defense barriers, which a pathogen needs to overcome for successfully establishing itself in the host. To illustrate continua as this underlying principle, we will discuss the advances that have been made in studying nonhost resistance towards rust pathogens, particularly cereal rust pathogens.

  10. Nonhost resistance to rust pathogens – a continuation of continua

    Science.gov (United States)

    Bettgenhaeuser, Jan; Gilbert, Brian; Ayliffe, Michael; Moscou, Matthew J.

    2014-01-01

    The rust fungi (order: Pucciniales) are a group of widely distributed fungal plant pathogens, which can infect representatives of all vascular plant groups. Rust diseases significantly impact several crop species and considerable research focuses on understanding the basis of host specificity and nonhost resistance. Like many pathogens, rust fungi vary considerably in the number of hosts they can infect, such as wheat leaf rust (Puccinia triticina), which can only infect species in the genera Triticum and Aegilops, whereas Asian soybean rust (Phakopsora pachyrhizi) is known to infect over 95 species from over 42 genera. A greater understanding of the genetic basis determining host range has the potential to identify sources of durable resistance for agronomically important crops. Delimiting the boundary between host and nonhost has been complicated by the quantitative nature of phenotypes in the transition between these two states. Plant–pathogen interactions in this intermediate state are characterized either by (1) the majority of accessions of a species being resistant to the rust or (2) the rust only being able to partially complete key components of its life cycle. This leads to a continuum of disease phenotypes in the interaction with different plant species, observed as a range from compatibility (host) to complete immunity within a species (nonhost). In this review we will highlight how the quantitative nature of disease resistance in these intermediate interactions is caused by a continuum of defense barriers, which a pathogen needs to overcome for successfully establishing itself in the host. To illustrate continua as this underlying principle, we will discuss the advances that have been made in studying nonhost resistance towards rust pathogens, particularly cereal rust pathogens. PMID:25566270

  11. Nonhost resistance to rust pathogens - a continuation of continua.

    Science.gov (United States)

    Bettgenhaeuser, Jan; Gilbert, Brian; Ayliffe, Michael; Moscou, Matthew J

    2014-01-01

    The rust fungi (order: Pucciniales) are a group of widely distributed fungal plant pathogens, which can infect representatives of all vascular plant groups. Rust diseases significantly impact several crop species and considerable research focuses on understanding the basis of host specificity and nonhost resistance. Like many pathogens, rust fungi vary considerably in the number of hosts they can infect, such as wheat leaf rust (Puccinia triticina), which can only infect species in the genera Triticum and Aegilops, whereas Asian soybean rust (Phakopsora pachyrhizi) is known to infect over 95 species from over 42 genera. A greater understanding of the genetic basis determining host range has the potential to identify sources of durable resistance for agronomically important crops. Delimiting the boundary between host and nonhost has been complicated by the quantitative nature of phenotypes in the transition between these two states. Plant-pathogen interactions in this intermediate state are characterized either by (1) the majority of accessions of a species being resistant to the rust or (2) the rust only being able to partially complete key components of its life cycle. This leads to a continuum of disease phenotypes in the interaction with different plant species, observed as a range from compatibility (host) to complete immunity within a species (nonhost). In this review we will highlight how the quantitative nature of disease resistance in these intermediate interactions is caused by a continuum of defense barriers, which a pathogen needs to overcome for successfully establishing itself in the host. To illustrate continua as this underlying principle, we will discuss the advances that have been made in studying nonhost resistance towards rust pathogens, particularly cereal rust pathogens.

  12. Leaf Chlorophyll Content Estimation of Winter Wheat Based on Visible and Near-Infrared Sensors.

    Science.gov (United States)

    Zhang, Jianfeng; Han, Wenting; Huang, Lvwen; Zhang, Zhiyong; Ma, Yimian; Hu, Yamin

    2016-03-25

    The leaf chlorophyll content is one of the most important factors for the growth of winter wheat. Visual and near-infrared sensors are a quick and non-destructive testing technology for the estimation of crop leaf chlorophyll content. In this paper, a new approach is developed for leaf chlorophyll content estimation of winter wheat based on visible and near-infrared sensors. First, the sliding window smoothing (SWS) was integrated with the multiplicative scatter correction (MSC) or the standard normal variable transformation (SNV) to preprocess the reflectance spectra images of wheat leaves. Then, a model for the relationship between the leaf relative chlorophyll content and the reflectance spectra was developed using the partial least squares (PLS) and the back propagation neural network. A total of 300 samples from areas surrounding Yangling, China, were used for the experimental studies. The samples of visible and near-infrared spectroscopy at the wavelength of 450,900 nm were preprocessed using SWS, MSC and SNV. The experimental results indicate that the preprocessing using SWS and SNV and then modeling using PLS can achieve the most accurate estimation, with the correlation coefficient at 0.8492 and the root mean square error at 1.7216. Thus, the proposed approach can be widely used for winter wheat chlorophyll content analysis.

  13. Efficient Use of Historical Data for Genomic Selection: A Case Study of Stem Rust Resistance in Wheat

    Directory of Open Access Journals (Sweden)

    J. Rutkoski

    2015-03-01

    Full Text Available Genomic selection (GS is a methodology that can improve crop breeding efficiency. To implement GS, a training population (TP with phenotypic and genotypic data is required to train a statistical model used to predict genotyped selection candidates (SCs. A key factor impacting prediction accuracy is the relationship between the TP and the SCs. This study used empirical data for quantitative adult plant resistance to stem rust of wheat ( L. to investigate the utility of a historical TP (TP compared with a population-specific TP (TP, the potential for TP optimization, and the utility of TP data when close relative data is available for training. We found that, depending on the population size, a TP was 1.5 to 4.4 times more accurate than a TP, and TP optimization based on the mean of the generalized coefficient of determination or prediction error variance enabled the selection of subsets that led to significantly higher accuracy than randomly selected subsets. Retaining historical data when data on close relatives were available lead to a 11.9% increase in accuracy, at best, and a 12% decrease in accuracy, at worst, depending on the heritability. We conclude that historical data could be used successfully to initiate a GS program, especially if the dataset is very large and of high heritability. Training population optimization would be useful for the identification of TP subsets to phenotype additional traits. However, after model updating, discarding historical data may be warranted. More studies are needed to determine if these observations represent general trends.

  14. Disease Impact on Wheat Yield Potential and Prospects of Genetic Control

    DEFF Research Database (Denmark)

    Singh, Ravi P.; Singh, Pawan K.; Rutkoski, Jessica

    2016-01-01

    Wheat is grown worldwide in diverse geographical regions, environments, and production systems. Although many diseases and pests are known to reduce grain yield potential and quality, the three rusts and powdery mildew fungi have historically caused major crop losses and continue to remain...... economically important despite the widespread use of host resistance and fungicides. The evolution and fast spread of virulent and more aggressive race lineages of rust fungi have only worsened the situation. Fusarium head blight, leaf spotting diseases, and, more recently, wheat blast (in South America...... for most diseases; their selection through phenotyping reinforced with molecular strategies offers great promise in achieving more durable resistance and enhancing global wheat productivity....

  15. Inter- and intraspecific variation in leaf economic traits in wheat and maize.

    Science.gov (United States)

    Martin, Adam R; Hale, Christine E; Cerabolini, Bruno E L; Cornelissen, Johannes H C; Craine, Joseph; Gough, William A; Kattge, Jens; Tirona, Cairan K F

    2018-02-01

    Leaf Economics Spectrum (LES) trait variation underpins multiple agroecological processes and many prominent crop yield models. While there are numerous independent studies assessing trait variation in crops, to date there have been no comprehensive assessments of intraspecific trait variation (ITV) in LES traits for wheat and maize: the world's most widespread crops. Using trait databases and peer-reviewed literature, we compiled over 700 records of specific leaf area (SLA), maximum photosynthetic rates ( A max ) and leaf nitrogen (N) concentrations, for wheat and maize. We evaluated intraspecific LES trait variation, and intraspecific trait-environment relationships. While wheat and maize occupy the upper 90th percentile of LES trait values observed across a global species pool, ITV ranged widely across the LES in wheat and maize. Fertilization treatments had strong impacts on leaf N, while plant developmental stage (here standardized as the number of days since planting) had strong impacts on A max ; days since planting, N fertilization and irrigation all influenced SLA. When controlling for these factors, intraspecific responses to temperature and precipitation explained 39.4 and 43.7 % of the variation in A max and SLA, respectively, but only 5.4 % of the variation in leaf N. Despite a long history of domestication in these species, ITV in wheat and maize among and within cultivars remains large. Intraspecific trait variation is a critical consideration to refine regional to global models of agroecosystem structure, function and food security. Considerable opportunities and benefits exist for consolidating a crop trait database for a wider range of domesticated plant species.

  16. QTL mapping provides evidence for lack of association of the avoidance of leaf rust in Hordeum chilense with stomata density

    NARCIS (Netherlands)

    Vaz Patto, M.C.; Rubiales, D.; Martin, A.; Hernandez, P.; Lindhout, W.H.; Niks, R.E.; Stam, P.

    2003-01-01

    In cereals, rust fungi are among the most harmful pathogens. Breeders usually rely on short-lived hypersensitivity resistance. As an alternative, "avoidance" may be a more durable defence mechanism to protect plants to rust fungi. In Hordeum chilense avoidance is based on extensive wax covering of

  17. Yellow Rust Resistance in Advanced Lines and Commercial ...

    African Journals Online (AJOL)

    The objective of this study was to characterize seedling yellow rust resistance in 21 advanced bread wheat lines and 20 cultivars from Ethiopia. Yellow rust infection types (ITs) produced on test wheat lines and cultivars from nine yellow rust races were compared with ITs produced on standard differential lines that differed ...

  18. High-resolution mapping reveals linkage between genes in common bean cultivar Ouro Negro conferring resistance to the rust, anthracnose, and angular leaf spot diseases.

    Science.gov (United States)

    Valentini, Giseli; Gonçalves-Vidigal, Maria Celeste; Hurtado-Gonzales, Oscar P; de Lima Castro, Sandra Aparecida; Cregan, Perry B; Song, Qijian; Pastor-Corrales, Marcial A

    2017-08-01

    Co-segregation analysis and high-throughput genotyping using SNP, SSR, and KASP markers demonstrated genetic linkage between Ur-14 and Co-3 4 /Phg-3 loci conferring resistance to the rust, anthracnose and angular leaf spot diseases of common bean. Rust, anthracnose, and angular leaf spot are major diseases of common bean in the Americas and Africa. The cultivar Ouro Negro has the Ur-14 gene that confers broad spectrum resistance to rust and the gene cluster Co-3 4 /Phg-3 containing two tightly linked genes conferring resistance to anthracnose and angular leaf spot, respectively. We used co-segregation analysis and high-throughput genotyping of 179 F 2:3 families from the Rudá (susceptible) × Ouro Negro (resistant) cross-phenotyped separately with races of the rust and anthracnose pathogens. The results confirmed that Ur-14 and Co-3 4 /Phg-3 cluster in Ouro Negro conferred resistance to rust and anthracnose, respectively, and that Ur-14 and the Co-3 4 /Phg-3 cluster were closely linked. Genotyping the F 2:3 families, first with 5398 SNPs on the Illumina BeadChip BARCBEAN6K_3 and with 15 SSR, and eight KASP markers, specifically designed for the candidate region containing Ur-14 and Co-3 4 /Phg-3, permitted the creation of a high-resolution genetic linkage map which revealed that Ur-14 was positioned at 2.2 cM from Co-3 4 /Phg-3 on the short arm of chromosome Pv04 of the common bean genome. Five flanking SSR markers were tightly linked at 0.1 and 0.2 cM from Ur-14, and two flanking KASP markers were tightly linked at 0.1 and 0.3 cM from Co-3 4 /Phg-3. Many other SSR, SNP, and KASP markers were also linked to these genes. These markers will be useful for the development of common bean cultivars combining the important Ur-14 and Co-3 4 /Phg-3 genes conferring resistance to three of the most destructive diseases of common bean.

  19. Evaluation of wavelet spectral features in pathological detection and discrimination of yellow rust and powdery mildew in winter wheat with hyperspectral reflectance data

    Science.gov (United States)

    Shi, Yue; Huang, Wenjiang; Zhou, Xianfeng

    2017-04-01

    Hyperspectral absorption features are important indicators of characterizing plant biophysical variables for the automatic diagnosis of crop diseases. Continuous wavelet analysis has proven to be an advanced hyperspectral analysis technique for extracting absorption features; however, specific wavelet features (WFs) and their relationship with pathological characteristics induced by different infestations have rarely been summarized. The aim of this research is to determine the most sensitive WFs for identifying specific pathological lesions from yellow rust and powdery mildew in winter wheat, based on 314 hyperspectral samples measured in field experiments in China in 2002, 2003, 2005, and 2012. The resultant WFs could be used as proxies to capture the major spectral absorption features caused by infestation of yellow rust or powdery mildew. Multivariate regression analysis based on these WFs outperformed conventional spectral features in disease detection; meanwhile, a Fisher discrimination model exhibited considerable potential for generating separable clusters for each infestation. Optimal classification returned an overall accuracy of 91.9% with a Kappa of 0.89. This paper also emphasizes the WFs and their relationship with pathological characteristics in order to provide a foundation for the further application of this approach in monitoring winter wheat diseases at the regional scale.

  20. 29-34 Yellow Rust Resistance in Advanced Lines and Commercial ...

    African Journals Online (AJOL)

    rust pathogen. The objective of this study was to characterize seedling yellow rust resistance in 21 advanced bread wheat lines and 20 cultivars from Ethiopia. Yellow rust infection types (ITs) produced on test wheat lines and cultivars from nine yellow rust races were compared with ITs produced on standard differential lines ...

  1. Impact of Regionally Distinct Agroecosystem Communities on the Potential for Autonomous Control of the Coffee Leaf Rust.

    Science.gov (United States)

    Hajian-Forooshani, Zachary; Rivera Salinas, Iris Saraeny; Jiménez-Soto, Estelí; Perfecto, Ivette; Vandermeer, John

    2016-12-01

    Recent theoretical work suggests that two ineffective control agents can provide effective biological control when coupled together. We explore the implications of this work with the system of coffee leaf rust (CLR), caused by the fungal agent Hemileiae vastatrix, and two of its natural enemies, a fungal pathogen (Lecanicillium lecanii) and a spore predator (Mycodiplosis hemileiae). Here we report on comparative surveys of the CLR and its two natural enemies in Mexico, where the CLR has been at epidemic status since 2012, and Puerto Rico, where the CLR is present but has not reached epidemic densities. We found that the densities of the two control agents per CLR lesion is higher in Puerto Rico than in Mexico, and we hypothesize that their joint presence at higher densities is contributing to the suppression of the CLR in Puerto Rico but not in Mexico. Furthermore, we found that the presence of Azteca sericeasur, a keystone ant species that occurs in Mexico but not Puerto Rico, significantly reduces the prevalence of M. hemileiae on coffee plants. Our work provides data that allows us to hypothesize that the joint presence of these two control agents may potentially provide control of the CLR and also highlights the importance of regionally specific communities within agroecosystems, and how variation in community composition may lead to varying outcomes for biological control. Additionally, this is the first report of the presence of a potentially important biological control agent, M. hemileiae, in Latin America and the Caribbean. © The Authors 2016. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  2. Effect of foliar fertilizer and fungicidal protection against leaf spot diseases on winter wheat

    Directory of Open Access Journals (Sweden)

    Agnieszka Mączyńska

    2012-12-01

    Full Text Available Field experiments were carried out in the seasons 2000/2001 and 2001/2002 in Plant Protection Institute, Sooenicowice Branch to assess the influence of foliar fertilizers such as Ekolist PK 1, Ekolist Mg, Mikrosol Z and Urea on healthiness of winter wheat. Foliar fertilizers were mixed with fungicides. The fungicides were applied at full or half recommended doses. The effect of the disease on wheat leaves was evaluated three times in each vegetation season. Remaining green leaf area (GLA of leaves was also determined. GLA of the leaves F-1 was not significantly different for each combination with different fertilization and different levels of chemical treatment. The application of foliar fertilizer only had no effect on green leaf area (GLA. The results indicate that foliar fertilization of all experimental plots improved leaf condition and therefore halted the development of wheat leaf diseases. The increases of 1000 grain mass and yield was high for each plot where a fertilizer and a full or half dose of a fungicide was applied. Foliar fertilizing with no chemical control had no proven effect on studied parameters.

  3. Leaf senescence and nutrient remobilisation in barley and wheat

    DEFF Research Database (Denmark)

    Gregersen, P L; Holm, P B; Krupinska, K

    2008-01-01

    Extensive studies have been undertaken on senescence processes in barley and wheat and their importance for the nitrogen use efficiency of these crop plants. During the senescence processes, proteins are degraded and nutrients are re-mobilised from senescing leaves to other organs, especially...... of chloroplasts is summarised. Rubisco is thought to be released from chloroplasts into vesicles containing stroma material (RCB = Rubisco-containing bodies). These vesicles may then take different routes for their degradation. Transcriptome analyses on barley and wheat senescence have identified genes involved...... in degradative, metabolic and regulatory processes that could be used in future strategies aimed at modifying the senescence process. The breeding of crops for characters related to senescence processes, e.g. higher yields and better nutrient use efficiency, is complex. Such breeding has to cope with the dilemma...

  4. Mapping and characterization of wheat stem rust resistance genes SrTm5 and Sr60 from Triticum monococcum.

    Science.gov (United States)

    Chen, Shisheng; Guo, Yan; Briggs, Jordan; Dubach, Felix; Chao, Shiaoman; Zhang, Wenjun; Rouse, Matthew N; Dubcovsky, Jorge

    2018-03-01

    The new stem rust resistance gene Sr60 was fine-mapped to the distal region of chromosome arm 5A m S, and the TTKSK-effective gene SrTm5 could be a new allele of Sr22. The emergence and spread of new virulent races of the wheat stem rust pathogen (Puccinia graminis f. sp. tritici; Pgt), including the Ug99 race group, is a serious threat to global wheat production. In this study, we mapped and characterized two stem rust resistance genes from diploid wheat Triticum monococcum accession PI 306540. We mapped SrTm5, a previously postulated gene effective to Ug99, on chromosome arm 7A m L, completely linked to Sr22. SrTm5 displayed a different race specificity compared to Sr22 indicating that they are distinct. Sequencing of the Sr22 homolog in PI 306540 revealed a novel haplotype. Characterization of the segregating populations with Pgt race QFCSC revealed an additional resistance gene on chromosome arm 5A m S that was assigned the official name Sr60. This gene was also effective against races QTHJC and SCCSC but not against TTKSK (a Ug99 group race). Using two large mapping populations (4046 gametes), we mapped Sr60 within a 0.44 cM interval flanked by sequenced-based markers GH724575 and CJ942731. These two markers delimit a 54.6-kb region in Brachypodium distachyon chromosome 4 and a 430-kb region in the Chinese Spring reference genome. Both regions include a leucine-rich repeat protein kinase (LRRK123.1) that represents a potential candidate gene. Three CC-NBS-LRR genes were found in the colinear Brachypodium region but not in the wheat genome. We are currently developing a Bacterial Artificial Chromosome library of PI 306540 to determine which of these candidate genes are present in the T. monococcum genome and to complete the cloning of Sr60.

  5. WHEAT PATHOGEN RESISTANCE AND CHITINASE PROFILE

    Directory of Open Access Journals (Sweden)

    Zuzana Gregorová

    2015-02-01

    Full Text Available The powdery mildew and leaf rust caused by Blumeria graminis and Puccinia recondita (respectively are common diseases of wheat throughout the world. These fungal diseases greatly affect crop productivity. Incorporation of effective and durable disease resistance is an important breeding objective for wheat improvement. We have evaluated resistance of four bread wheat (Triticum aestivum and four spelt wheat (Triticum spelta cultivars. Chitinases occurrence as well as their activity was determined in leaf tissues. There was no correlation between resistance rating and activity of chitinase. The pattern of chitinases reveals four isoforms with different size in eight wheat cultivars. A detailed understanding of the molecular events that take place during a plant–pathogen interaction is an essential goal for disease control in the future.

  6. Characterization of Novel Gene Yr79 and Four Additional Quantitative Trait Loci for All-Stage and High-Temperature Adult-Plant Resistance to Stripe Rust in Spring Wheat PI 182103.

    Science.gov (United States)

    Feng, Junyan; Wang, Meinan; See, Deven R; Chao, Shiaoman; Zheng, Youliang; Chen, Xianming

    2018-06-01

    Stripe rust, caused by Puccinia striiformis f. sp. tritici, is an important disease of wheat worldwide. Exploring new resistance genes is essential for breeding resistant wheat cultivars. PI 182103, a spring wheat landrace originally from Pakistan, has shown a high level of resistance to stripe rust in fields for many years, but genes for resistance to stripe rust in the variety have not been studied. To map the resistance gene(s) in PI 182103, 185 recombinant inbred lines (RILs) were developed from a cross with Avocet Susceptible (AvS). The RIL population was genotyped with simple sequence repeat (SSR) and single nucleotide polymorphism markers and tested with races PST-100 and PST-114 at the seedling stage under controlled greenhouse conditions and at the adult-plant stage in fields at Pullman and Mt. Vernon, Washington under natural infection by the stripe rust pathogen in 2011, 2012, and 2013. A total of five quantitative trait loci (QTL) were detected. QyrPI182103.wgp-2AS and QyrPI182103.wgp-3AL were detected at the seedling stage, QyrPI182103.wgp-4DL was detected only in Mt. Vernon field tests, and QyrPI182103.wgp-5BS was detected in both seedling and field tests. QyrPI182103.wgp-7BL was identified as a high-temperature adult-plant resistance gene and detected in all field tests. Interactions among the QTL were mostly additive, but some negative interactions were detected. The 7BL QTL was mapped in chromosomal bin 7BL 0.40 to 0.45 and identified as a new gene, permanently designated as Yr79. SSR markers Xbarc72 and Xwmc335 flanking the Yr79 locus were highly polymorphic in various wheat genotypes, indicating that the molecular markers are useful for incorporating the new gene for potentially durable stripe rust resistance into new wheat cultivars.

  7. Comparison of sodium carbonate pretreatment for enzymatic hydrolysis of wheat straw stem and leaf to produce fermentable sugars.

    Science.gov (United States)

    Jin, Yongcan; Huang, Ting; Geng, Wenhui; Yang, Linfeng

    2013-06-01

    The specific characteristics of biomass structure and chemical composition of straw stem and leaf may result in different behavior of pretreatment and enzymatic hydrolysis. In this work, sodium carbonate (SC) was employed as a pretreatment to improve the enzymatic digestibility of wheat straw. The chemical composition and enzymatic hydrolysis of wheat straw stem and leaf (sheath included) were investigated comparatively. Most of the polysaccharides are kept in the solid fractions after SC pretreatment, while the stem has better delignification selectivity than leaf at high temperature. The enzymatic hydrolysis efficiency of wheat straw leaf is significantly higher than that of stem. The maximum total sugar yield from SC pretreated leaf was about 16% higher than stem. The results show that sodium carbonate is of great potential to be used as a pretreatment for the production of bioethanol from straw handling waste in a straw pulp mill with a low feedstock cost. Copyright © 2013 Elsevier Ltd. All rights reserved.

  8. Effect of leaf and soil contaminations on heavy metals content in spring wheat crops

    International Nuclear Information System (INIS)

    Weber, R.; Hrynczuk, B.

    2000-01-01

    Glass house experiments were carried out in Wagner pots containing 6 kg of soil. The amounts were compared of Zn, Pb and Cd taken up by the crop of spring wheat from contamination introduced into the soil or upon leaves. The heavy metals were labelled with the radioactive isotopes 65 Zn, 210 Pb and 115 Cd. The experiment was performed as a series of independent analyses in four replications. The dynamics of the labelled heavy metals translocation from contaminations sprayed on the upper or bottom side of the flag leaf was also tested. The highest concentration of 65 Zn was found in the straw and gain of wheat. much higher amounts of the metals appeared to have been taken up by the plants from leaf contamination than from soil. The highest dynamics of translocation from leaves to other vegetative and generative organs of plants was that of zinc. (author)

  9. Emergence of virulence to SrTmp in the Ug99 race group of wheat stem rust, Puccinia graminis f. sp. tritici, in Africa

    DEFF Research Database (Denmark)

    Patpour, M.; Hovmøller, M. S.; Justesen, A. F.

    2016-01-01

    of wheat fields in Africa (Kenya, 9; Uganda, 28; Rwanda, 41; and Egypt, 6) were sent to the Global Rust Reference Center (GRRC, Denmark) for race analysis. Puccinia graminis f. sp. tritici (Pgt) samples were recovered on cv. Morocco, and resulting urediniospores of 53 single-pustule isolates were......Tmp) to confirm their virulence/avirulence combinations to Sr24, Sr31, Sr36, and SrTmp. Race TTKTK was also detected at two locations in Uganda (Rubaya and Muko in Kabale region) and at five locations in Rwanda (Kinigi, Rwerere, Rufungo, Gatebe, and Kamenyo). Three isolates derived from stem rust samples...

  10. Using hierarchical clustering of secreted protein families to classify and rank candidate effectors of rust fungi.

    Directory of Open Access Journals (Sweden)

    Diane G O Saunders

    Full Text Available Rust fungi are obligate biotrophic pathogens that cause considerable damage on crop plants. Puccinia graminis f. sp. tritici, the causal agent of wheat stem rust, and Melampsora larici-populina, the poplar leaf rust pathogen, have strong deleterious impacts on wheat and poplar wood production, respectively. Filamentous pathogens such as rust fungi secrete molecules called disease effectors that act as modulators of host cell physiology and can suppress or trigger host immunity. Current knowledge on effectors from other filamentous plant pathogens can be exploited for the characterisation of effectors in the genome of recently sequenced rust fungi. We designed a comprehensive in silico analysis pipeline to identify the putative effector repertoire from the genome of two plant pathogenic rust fungi. The pipeline is based on the observation that known effector proteins from filamentous pathogens have at least one of the following properties: (i contain a secretion signal, (ii are encoded by in planta induced genes, (iii have similarity to haustorial proteins, (iv are small and cysteine rich, (v contain a known effector motif or a nuclear localization signal, (vi are encoded by genes with long intergenic regions, (vii contain internal repeats, and (viii do not contain PFAM domains, except those associated with pathogenicity. We used Markov clustering and hierarchical clustering to classify protein families of rust pathogens and rank them according to their likelihood of being effectors. Using this approach, we identified eight families of candidate effectors that we consider of high value for functional characterization. This study revealed a diverse set of candidate effectors, including families of haustorial expressed secreted proteins and small cysteine-rich proteins. This comprehensive classification of candidate effectors from these devastating rust pathogens is an initial step towards probing plant germplasm for novel resistance components.

  11. Characterization of the Wheat Leaf Metabolome during Grain Filling and under Varied N-Supply

    Directory of Open Access Journals (Sweden)

    Elmien Heyneke

    2017-11-01

    Full Text Available Progress in improving crop growth is an absolute goal despite the influence multifactorial components have on crop yield and quality. An Avalon × Cadenza doubled-haploid wheat mapping population was used to study the leaf metabolome of field grown wheat at weekly intervals during the time in which the canopy contributes to grain filling, i.e., from anthesis to 5 weeks post-anthesis. Wheat was grown under four different nitrogen supplies reaching from residual soil N to a luxury over-fertilization (0, 100, 200, and 350 kg N ha−1. Four lines from a segregating doubled haploid population derived of a cross of the wheat elite cvs. Avalon and Cadenza were chosen as they showed pairwise differences in either N utilization efficiency (NUtE or senescence timing. 108 annotated metabolites of primary metabolism and ions were determined. The analysis did not provide genotype specific markers because of a remarkable stability of the metabolome between lines. We speculate that the reason for failing to identify genotypic markers might be due to insufficient genetic diversity of the wheat parents and/or the known tendency of plants to keep metabolome homeostasis even under adverse conditions through multiple adaptations and rescue mechanism. The data, however, provided a consistent catalogue of metabolites and their respective responses to environmental and developmental factors and may bode well for future systems biology approaches, and support plant breeding and crop improvement.

  12. Development and Molecular Cytogenetic Identification of a Novel Wheat-Leymus mollis Lm#7Ns (7D Disomic Substitution Line with Stripe Rust Resistance.

    Directory of Open Access Journals (Sweden)

    Xiaofei Yang

    Full Text Available Leymus mollis (2n = 4x = 28, NsNsXmXm possesses novel and important genes for resistance against multi-fungal diseases. The development of new wheat-L. mollis introgression lines is of great significance for wheat disease resistance breeding. M11003-3-1-15-8, a novel disomic substitution line of common wheat cv. 7182 -L. mollis, developed and selected from the BC1F5 progeny between wheat cv. 7182 and octoploid Tritileymus M47 (2n = 8x = 56, AABBDDNsNs, was characterized by morphological and cytogenetic identification, analysis of functional molecular markers, genomic in situ hybridization (GISH, sequential fluorescence in situ hybridization (FISH-genomic in situ hybridization (GISH and disease resistance evaluation. Cytological observations suggested that M11003-3-1-15-8 contained 42 chromosomes and formed 21 bivalents at meiotic metaphase I. The GISH investigations showed that line contained 40 wheat chromosomes and a pair of L. mollis chromosomes. EST-STS multiple loci markers and PLUG (PCR-based Landmark Unique Gene markers confirmed that the introduced L. mollis chromosomes belonged to homoeologous group 7, it was designated as Lm#7Ns. While nulli-tetrasomic and sequential FISH-GISH analysis using the oligonucleotide Oligo-pSc119.2 and Oligo-pTa535 as probes revealed that the wheat 7D chromosomes were absent in M11003-3-1-15-8. Therefore, it was deduced that M11003-3-1-15-8 was a wheat-L. mollis Lm#7Ns (7D disomic substitution line. Field disease resistance demonstrated that the introduced L. mollis chromosomes Lm#7Ns were responsible for the stripe rust resistance at the adult stage. Moreover, M11003-3-1-15-8 had a superior numbers of florets. The novel disomic substitution line M11003-3-1-15-8, could be exploited as an important genetic material in wheat resistance breeding programs and genetic resources.

  13. Next generation sequencing provides rapid access to the genome of Puccinia striiformis f. sp. tritici, the causal agent of wheat stripe rust.

    Directory of Open Access Journals (Sweden)

    Dario Cantu

    Full Text Available BACKGROUND: The wheat stripe rust fungus (Puccinia striiformis f. sp. tritici, PST is responsible for significant yield losses in wheat production worldwide. In spite of its economic importance, the PST genomic sequence is not currently available. Fortunately Next Generation Sequencing (NGS has radically improved sequencing speed and efficiency with a great reduction in costs compared to traditional sequencing technologies. We used Illumina sequencing to rapidly access the genomic sequence of the highly virulent PST race 130 (PST-130. METHODOLOGY/PRINCIPAL FINDINGS: We obtained nearly 80 million high quality paired-end reads (>50x coverage that were assembled into 29,178 contigs (64.8 Mb, which provide an estimated coverage of at least 88% of the PST genes and are available through GenBank. Extensive micro-synteny with the Puccinia graminis f. sp. tritici (PGTG genome and high sequence similarity with annotated PGTG genes support the quality of the PST-130 contigs. We characterized the transposable elements present in the PST-130 contigs and using an ab initio gene prediction program we identified and tentatively annotated 22,815 putative coding sequences. We provide examples on the use of comparative approaches to improve gene annotation for both PST and PGTG and to identify candidate effectors. Finally, the assembled contigs provided an inventory of PST repetitive elements, which were annotated and deposited in Repbase. CONCLUSIONS/SIGNIFICANCE: The assembly of the PST-130 genome and the predicted proteins provide useful resources to rapidly identify and clone PST genes and their regulatory regions. Although the automatic gene prediction has limitations, we show that a comparative genomics approach using multiple rust species can greatly improve the quality of gene annotation in these species. The PST-130 sequence will also be useful for comparative studies within PST as more races are sequenced. This study illustrates the power of NGS for

  14. Durum and bread wheat differ in their ability to retain potassium in leaf mesophyll: implications for salinity stress tolerance.

    Science.gov (United States)

    Wu, Honghong; Shabala, Lana; Zhou, Meixue; Shabala, Sergey

    2014-10-01

    Understanding the intrinsic mechanisms involved in the differential salinity tolerance between bread wheat and durum wheat is essential for breeding salt-tolerant varieties to cope with the global salinity issue threatening future food supply. In the past, higher salinity tolerance in bread wheat compared with durum wheat has been attributed to its better ability to exclude Na(+) from uptake. Here we show that another mechanism, namely more superior K(+) retention ability in the leaf mesophyll, also contributes to this difference. A strong positive correlation (R(2) > 0.41, P varieties. However, while the above correlation was strong in bread wheat, it was statistically insignificant in durum wheat. Consistent with these findings, a significantly higher relative leaf K(+) content was found in bread wheat than in durum wheat. In contrast to root tissues, the role of voltage-gated K(+) channels in K(+) retention in the wheat mesophyll was relatively small, and non-selective cation channels played a major role in controlling intracellular K(+) homeostasis. Moreover, a significant negative correlation between NaCl-induced mesophyll H(+) flux and mesophyll K(+) retention was found, and interpreted as a compensatory mechanism employed by sensitive varieties to regain K(+) leaked into the apoplast. It is concluded that bread wheat and durum wheat show different strategies of coping with salinity, and that targeting mechanisms conferring K(+) retention in the leaf mesophyll may be a promising way to improve the overall salinity tolerance in these species. © The Author 2014. Published by Oxford University Press on behalf of Japanese Society of Plant Physiologists. All rights reserved. For permissions, please email: journals.permissions@oup.com.

  15. Allelopathic potential of jatropha curcas L. leaf aqueous extracts on seedling growth of wheat

    International Nuclear Information System (INIS)

    Khattak, A.; Ullah, F.; Wazir, S. M.; Shinwari, Z. K.

    2015-01-01

    Allelopathic effects of aqueous leaf extracts of Jatropha curcas on seed germination and early seedling growth of wheat cv. Inqlab-91 were investigated. The extracts were applied at 50 percentage, 25 percentage, 12.5 percentage, 6.25 percentage and 3.12 percentage as seed soaking for 5h prior to sowing of seeds in the pots. The J. curcas leaf characterized for composition of macronutrients showed Na (304 micro g/g), K (267 micro g/g), Mg (92 micro g/g) and Ca (12 micro g/g). Among micronutrients Fe (92 micro g/g), Cr (92 micro g/g), Ni (48 micro g/g), Co (38 μg/g), Cu (23 micro g/g, Mn (12 micro g/g) and Zn (15.22 micro g/g) were found. Phenolic compounds were detected in the extracts and were found maximum (8.12 mg gallic acid/g extract) in 50 percentage extract. Lower concentrations (6.25 percentage, 3.25 percentage) of the extracts significantly improved seed germination (percentage), germination index, shoot length, shoot fresh weight, shoot dry weight, root fresh weight, root dry weight and root area of wheat plants (p<0.05). At higher concentration of the extract, root length was significantly reduced. It is inferred that lower concentrations (6.25 percentage and 3.12 percentage) of the extracts exhibited beneficial effects on growth of wheat plants. (author)

  16. A change in temperature modulates defence to yellow (stripe) rust in wheat line UC1041 independently of resistance gene Yr36.

    Science.gov (United States)

    Bryant, Ruth R M; McGrann, Graham R D; Mitchell, Alice R; Schoonbeek, Henk-Jan; Boyd, Lesley A; Uauy, Cristobal; Dorling, Steve; Ridout, Christopher J

    2014-01-08

    Rust diseases are of major importance in wheat production worldwide. With the constant evolution of new rust strains and their adaptation to higher temperatures, consistent and durable disease resistance is a key challenge. Environmental conditions affect resistance gene performance, but the basis for this is poorly understood. Here we show that a change in day temperature affects wheat resistance to Puccinia striiformis f. sp tritici (Pst), the causal agent of yellow (or stripe) rust. Using adult plants of near-isogenic lines UC1041 +/- Yr36, there was no significant difference between Pst percentage uredia coverage in plants grown at day temperatures of 18°C or 25°C in adult UC1041 + Yr36 plants. However, when plants were transferred to the lower day temperature at the time of Pst inoculation, infection increased up to two fold. Interestingly, this response was independent of Yr36, which has previously been reported as a temperature-responsive resistance gene as Pst development in adult UC1041 -Yr36 plants was similarly affected by the plants experiencing a temperature reduction. In addition, UC1041 -Yr36 plants grown at the lower temperature then transferred to the higher temperature were effectively resistant and a temperature change in either direction was shown to affect Pst development up to 8 days prior to inoculation. Results for seedlings were similar, but more variable compared to adult plants. Enhanced resistance to Pst was observed in seedlings of UC1041 and the cultivar Shamrock when transferred to the higher temperature. Resistance was not affected in seedlings of cultivar Solstice by a temperature change in either direction. Yr36 is effective at 18°C, refining the lower range of temperature at which resistance against Pst is conferred compared to previous studies. Results reveal previously uncharacterised defence temperature sensitivity in the UC1041 background which is caused by a change in temperature and independently of Yr36. This novel

  17. Mapping of stripe rust resistance gene in an Aegilops caudata ...

    Indian Academy of Sciences (India)

    PUNEET INDER TOOR

    A pair of stripe rust and leaf rust resistance genes was introgressed from Aegilops caudata, a nonprogenitor diploid species with the CC genome, to cultivated .... infector rows and experimental material with the mixture of uredinospores of Pst ...

  18. MALDI-MS Imaging Analysis of Fungicide Residue Distributions on Wheat Leaf Surfaces.

    Science.gov (United States)

    Annangudi, Suresh P; Myung, Kyung; Avila Adame, Cruz; Gilbert, Jeffrey R

    2015-05-05

    Improved retention and distribution of agrochemicals on plant surfaces is an important attribute in the biological activity of pesticide. Although retention of agrochemicals on plants after spray application can be quantified using traditional analytical techniques including LC or GC, the spatial distribution of agrochemicals on the plants surfaces has received little attention. Matrix assisted laser desorption/ionization (MALDI) imaging technology has been widely used to determine the distribution of proteins, peptides and metabolites in different tissue sections, but its application to environmental research has been limited. Herein, we probed the potential utility of MALDI imaging in characterizing the distribution of three commercial fungicides on wheat leaf surfaces. Using this MALDI imaging method, we were able to detect 500 ng of epoxiconazole, azoxystrobin, and pyraclostrobin applied in 1 μL drop on the leaf surfaces using MALDI-MS. Subsequent dilutions of pyraclostrobin revealed that the compound can be chemically imaged on the leaf surfaces at levels as low as 60 ng of total applied in the area of 1 μL droplet. After application of epoxiconazole, azoxystrobin, and pyraclostrobin at a field rate of 100 gai/ha in 200 L water using a track sprayer system, residues of these fungicides on the leaf surfaces were sufficiently visualized. These results suggest that MALDI imaging can be used to monitor spatial distribution of agrochemicals on leaf samples after pesticide application.

  19. Molecular Cytogenetic Mapping of Satellite DNA Sequences in Aegilops geniculata and Wheat

    Czech Academy of Sciences Publication Activity Database

    Koo, D.H.; Tiwari, V.K.; Hřibová, Eva; Doležel, Jaroslav; Friebe, B.; Gill, B.S.

    2016-01-01

    Roč. 148, č. 4 (2016), s. 314-321 ISSN 1424-8581 R&D Projects: GA MŠk(CZ) LO1204 Institutional support: RVO:61389030 Keywords : in-situ hybridization * chromosome addition lines * resistance genes lr57 * repetitive dna * triticum-ovatum * powdery mildew * plant genome * bread wheat * leaf rust * identification * Aegilops geniculata * Chromosome identification * Fluorescence in situ hybridization * Satellite DNA * Wheat Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 1.354, year: 2016

  20. Overview of the functional virulent genome of the coffee leaf rust pathogen Hemileia vastatrix with an emphasis on early stages of infection

    Directory of Open Access Journals (Sweden)

    Pedro eTalhinhas

    2014-03-01

    Full Text Available Hemileia vastatrix is the causal agent of coffee leaf rust, the most important disease of coffee (Coffea arabica. In this work, a 454-pyrosequencing transcriptome analysis of H. vastatrix germinating urediniospores (gU and appressoria (Ap was performed and compared to previously published in planta haustoria-rich (H data. A total of 9234 transcripts were identified and annotated. Ca. 50% of these transcripts showed no significant homology to international databases. Only 784 sequences were shared by the three conditions, and 75% were exclusive of either gU (2146, Ap (1479 or H (3270. Relative transcript abundance and RT-qPCR analyses for a selection of genes indicated a particularly active metabolism, translational activity and production of new structures in the appressoria and intense signalling, transport, secretory activity and cellular multiplication in the germinating urediniospores, suggesting the onset of a plant-fungus dialogue as early as at the germ tube stage. Gene expression related to the production of carbohydrate-active enzymes and accumulation of glycerol in germinating urediniospores and appressoria suggests that combined lytic and physical mechanisms are involved in appressoria-mediated penetration. Besides contributing to the characterisation of molecular processes leading to appressoria-mediated infection by rust fungi, these results point towards the identification of new H. vastatrix candidate virulence factors, with 516 genes predicted to encode secreted proteins.

  1. Breeding wheat mutant Longfu 03D51 with resisting stem rust and genetic analyzation of resisting disease and RAPD maker

    International Nuclear Information System (INIS)

    Sun Yan; Yin Jing; Wang Guangjin; Zhang Hongji; Huang Jinghua; Guo Qiang; Diao Yanling; Liu Dongjun

    2007-01-01

    Longfu 03D51 was bred using Long 6239 immature embryo as explants through radiation mutagenesis breeding coupled with tissue culture technique. By artificial inoculation and field breeding identified Longfu 03D51 was identified with high resistance to dominant strain 21C 3 CPH, good quality and high yield. Genetic analysis suggested that stem rust was controlled by a single gene. The DNA polymorphism on Longfu 03D51 and its parents were studied by random amplified polymorphic DNA (RAPD), 3 primers out of 60 RAPD primers were found polymorphism between the Longfu 03D51 and its parent Long 6239, and 3 stable polyphymorphic bands amplified in Longfu 03D51 with the size of 380bp, 700bp, 600 bp by random primer E07, E11, E17, respectively. Genetic and RAPD analysis indicated that 3 RAPD primers E07, E11, E17 might be linked to the gene of stem rust resistance. (authors)

  2. The evaluation of winter wheat roots and leaf sheath diseases diagnostic methods

    Directory of Open Access Journals (Sweden)

    Ewa Solarska

    2012-12-01

    Full Text Available The maltose and mineral media for isolation of Gaeumannomyces graminis from roots were assessed. The differences in numbers of obtained isolates were found depending on the medium used and sampling date. Easier identification of pathogen was possible employing maltose medium. The fungi from genus Fusarium occurring on winter wheat leaf sheaths were identified by mycological analysis and PCR, while the fungus Pseudocercosporella herpotrichoides was detected by PCR and ELISA methods. PCR and ELISA methods enabled to detect pathogens also in periods before the disease symptoms on plants occurred.

  3. [Exploring novel hyperspectral band and key index for leaf nitrogen accumulation in wheat].

    Science.gov (United States)

    Yao, Xia; Zhu, Yan; Feng, Wei; Tian, Yong-Chao; Cao, Wei-Xing

    2009-08-01

    The objectives of the present study were to explore new sensitive spectral bands and ratio spectral indices based on precise analysis of ground-based hyperspectral information, and then develop regression model for estimating leaf N accumulation per unit soil area (LNA) in winter wheat (Triticum aestivum L.). Three field experiments were conducted with different N rates and cultivar types in three consecutive growing seasons, and time-course measurements were taken on canopy hyperspectral reflectance and LNA tinder the various treatments. By adopting the method of reduced precise sampling, the detailed ratio spectral indices (RSI) within the range of 350-2 500 nm were constructed, and the quantitative relationships between LNA (gN m(-2)) and RSI (i, j) were analyzed. It was found that several key spectral bands and spectral indices were suitable for estimating LNA in wheat, and the spectral parameter RSI (990, 720) was the most reliable indicator for LNA in wheat. The regression model based on the best RSI was formulated as y = 5.095x - 6.040, with R2 of 0.814. From testing of the derived equations with independent experiment data, the model on RSI (990, 720) had R2 of 0.847 and RRMSE of 24.7%. Thus, it is concluded that the present hyperspectral parameter of RSI (990, 720) and derived regression model can be reliably used for estimating LNA in winter wheat. These results provide the feasible key bands and technical basis for developing the portable instrument of monitoring wheat nitrogen status and for extracting useful spectral information from remote sensing images.

  4. Identification, Characterization and Full-Length Sequence Analysis of a Novel Polerovirus Associated with Wheat Leaf Yellowing Disease.

    Science.gov (United States)

    Zhang, Peipei; Liu, Yan; Liu, Wenwen; Cao, Mengji; Massart, Sebastien; Wang, Xifeng

    2017-01-01

    To identify the pathogens responsible for leaf yellowing symptoms on wheat samples collected from Jinan, China, we tested for the presence of three known barley/wheat yellow dwarf viruses (BYDV-GAV, -PAV, WYDV-GPV) (most likely pathogens) using RT-PCR. A sample that tested negative for the three viruses was selected for small RNA sequencing. Twenty-five million sequences were generated, among which 5% were of viral origin. A novel polerovirus was discovered and temporarily named wheat leaf yellowing-associated virus (WLYaV). The full genome of WLYaV corresponds to 5,772 nucleotides (nt), with six AUG-initiated open reading frames, one non-AUG-initiated open reading frame, and three untranslated regions, showing typical features of the family Luteoviridae . Sequence comparison and phylogenetic analyses suggested that WLYaV had the closest relationship with sugarcane yellow leaf virus (ScYLV), but the identities of full genomic nucleotides and deduced amino acid sequence of coat protein (CP) were 64.9 and 86.2%, respectively, below the species demarcation thresholds (90%) in the family Luteoviridae . Furthermore, agroinoculation of Nicotiana benthamiana leaves with a cDNA clone of WLYaV caused yellowing symptoms on the plant. Our study adds a new polerovirus that is associated with wheat leaf yellowing disease, which would help to identify and control pathogens of wheat.

  5. Identification, Characterization and Full-Length Sequence Analysis of a Novel Polerovirus Associated with Wheat Leaf Yellowing Disease

    Directory of Open Access Journals (Sweden)

    Peipei Zhang

    2017-09-01

    Full Text Available To identify the pathogens responsible for leaf yellowing symptoms on wheat samples collected from Jinan, China, we tested for the presence of three known barley/wheat yellow dwarf viruses (BYDV-GAV, -PAV, WYDV-GPV (most likely pathogens using RT-PCR. A sample that tested negative for the three viruses was selected for small RNA sequencing. Twenty-five million sequences were generated, among which 5% were of viral origin. A novel polerovirus was discovered and temporarily named wheat leaf yellowing-associated virus (WLYaV. The full genome of WLYaV corresponds to 5,772 nucleotides (nt, with six AUG-initiated open reading frames, one non-AUG-initiated open reading frame, and three untranslated regions, showing typical features of the family Luteoviridae. Sequence comparison and phylogenetic analyses suggested that WLYaV had the closest relationship with sugarcane yellow leaf virus (ScYLV, but the identities of full genomic nucleotides and deduced amino acid sequence of coat protein (CP were 64.9 and 86.2%, respectively, below the species demarcation thresholds (90% in the family Luteoviridae. Furthermore, agroinoculation of Nicotiana benthamiana leaves with a cDNA clone of WLYaV caused yellowing symptoms on the plant. Our study adds a new polerovirus that is associated with wheat leaf yellowing disease, which would help to identify and control pathogens of wheat.

  6. Influence of Leaf Tolerance Mechanisms and Rain on Boron Toxicity in Barley and Wheat1[C

    Science.gov (United States)

    Reid, Rob; Fitzpatrick, Kate

    2009-01-01

    Boron (B) toxicity is common in many areas of the world. Plant tolerance to high B varies widely and has previously been attributed to reduced uptake of B, most commonly as a result of B efflux from roots. In this study, it is shown that the expression of genes encoding B efflux transporters in leaves of wheat (Triticum aestivum) and barley (Hordeum vulgare) is associated with an ability of leaf tissues to withstand higher concentrations of B. In tolerant cultivars, necrosis in leaves occurred at B concentrations more than 2-fold higher than in sensitive cultivars. It is hypothesized that this leaf tolerance is achieved via redistribution of B by efflux transporters from sensitive symplastic compartments into the leaf apoplast. Measurements of B concentrations in leaf protoplasts, and of B released following infiltration of leaves, support this hypothesis. It was also shown that under B-toxic conditions, leaching of B from leaves by rain had a strong positive effect on growth of both roots and shoots. Measurements of rates of guttation and the concentration of B in guttation droplets indicated that the impact of guttation on the alleviation of B toxicity would be small. PMID:19625636

  7. Unlocking Diversity in Germplasm Collections via Genomic Selection: A Case Study Based on Quantitative Adult Plant Resistance to Stripe Rust in Spring Wheat.

    Science.gov (United States)

    Muleta, Kebede T; Bulli, Peter; Zhang, Zhiwu; Chen, Xianming; Pumphrey, Michael

    2017-11-01

    Harnessing diversity from germplasm collections is more feasible today because of the development of lower-cost and higher-throughput genotyping methods. However, the cost of phenotyping is still generally high, so efficient methods of sampling and exploiting useful diversity are needed. Genomic selection (GS) has the potential to enhance the use of desirable genetic variation in germplasm collections through predicting the genomic estimated breeding values (GEBVs) for all traits that have been measured. Here, we evaluated the effects of various scenarios of population genetic properties and marker density on the accuracy of GEBVs in the context of applying GS for wheat ( L.) germplasm use. Empirical data for adult plant resistance to stripe rust ( f. sp. ) collected on 1163 spring wheat accessions and genotypic data based on the wheat 9K single nucleotide polymorphism (SNP) iSelect assay were used for various genomic prediction tests. Unsurprisingly, the results of the cross-validation tests demonstrated that prediction accuracy increased with an increase in training population size and marker density. It was evident that using all the available markers (5619) was unnecessary for capturing the trait variation in the germplasm collection, with no further gain in prediction accuracy beyond 1 SNP per 3.2 cM (∼1850 markers), which is close to the linkage disequilibrium decay rate in this population. Collectively, our results suggest that larger germplasm collections may be efficiently sampled via lower-density genotyping methods, whereas genetic relationships between the training and validation populations remain critical when exploiting GS to select from germplasm collections. Copyright © 2017 Crop Science Society of America.

  8. Assessing the ratio of leaf carbon to nitrogen in winter wheat and spring barley based on hyperspectral data

    Science.gov (United States)

    Xu, Xin-gang; Gu, Xiao-he; Song, Xiao-yu; Xu, Bo; Yu, Hai-yang; Yang, Gui-jun; Feng, Hai-kuan

    2016-10-01

    The metabolic status of carbon (C) and nitrogen (N) as two essential elements of crop plants has significant influence on the ultimate formation of yield and quality in crop production. The ratio of carbon to nitrogen (C/N) from crop leaves, defined as ratio of LCC (leaf carbon concentration) to LNC (leaf nitrogen concentration), is an important index that can be used to diagnose the balance between carbon and nitrogen, nutrient status, growth vigor and disease resistance in crop plants. Thus, it is very significant for effectively evaluating crop growth in field to monitor changes of leaf C/N quickly and accurately. In this study, some typical indices aimed at N estimation and chlorophyll evaluation were tested to assess leaf C/N in winter wheat and spring barley. The multi-temporal hyperspectral measurements from the flag-leaf, anthesis, filling, and milk-ripe stages were used to extract these selected spectral indices to estimate leaf C/N in wheat and barley. The analyses showed that some tested indices such as MTCI, MCARI/OSAVI2, and R-M had the better performance of assessing C/N for both of crops. Besides, a mathematic algorithm, Branch-and-Bound (BB) method was coupled with the spectral indices to assess leaf C/N in wheat and barley, and yielded the R2 values of 0.795 for winter wheat, R2 of 0.727 for spring barley, 0.788 for both crops combined. It demonstrates that using hyperspectral data has a good potential for remote assessment of leaf C/N in crops.

  9. Comparison of Leaf Sheath Transcriptome Profiles with Physiological Traits of Bread Wheat Cultivars under Salinity Stress

    KAUST Repository

    Takahashi, Fuminori

    2015-08-05

    Salinity stress has significant negative effects on plant biomass production and crop yield. Salinity tolerance is controlled by complex systems of gene expression and ion transport. The relationship between specific features of mild salinity stress adaptation and gene expression was analyzed using four commercial varieties of bread wheat (Triticum aestivum) that have different levels of salinity tolerance. The high-throughput phenotyping system in The Plant Accelerator at the Australian Plant Phenomics Facility revealed variation in shoot relative growth rate and salinity tolerance among the four cultivars. Comparative analysis of gene expression in the leaf sheaths identified genes whose functions are potentially linked to shoot biomass development and salinity tolerance. Early responses to mild salinity stress through changes in gene expression have an influence on the acquisition of stress tolerance and improvement in biomass accumulation during the early “osmotic” phase of salinity stress. In addition, results revealed transcript profiles for the wheat cultivars that were different from those of usual stress-inducible genes, but were related to those of plant growth. These findings suggest that, in the process of breeding, selection of specific traits with various salinity stress-inducible genes in commercial bread wheat has led to adaptation to mild salinity conditions.

  10. Comparison of Leaf Sheath Transcriptome Profiles with Physiological Traits of Bread Wheat Cultivars under Salinity Stress.

    Directory of Open Access Journals (Sweden)

    Fuminori Takahashi

    Full Text Available Salinity stress has significant negative effects on plant biomass production and crop yield. Salinity tolerance is controlled by complex systems of gene expression and ion transport. The relationship between specific features of mild salinity stress adaptation and gene expression was analyzed using four commercial varieties of bread wheat (Triticum aestivum that have different levels of salinity tolerance. The high-throughput phenotyping system in The Plant Accelerator at the Australian Plant Phenomics Facility revealed variation in shoot relative growth rate and salinity tolerance among the four cultivars. Comparative analysis of gene expression in the leaf sheaths identified genes whose functions are potentially linked to shoot biomass development and salinity tolerance. Early responses to mild salinity stress through changes in gene expression have an influence on the acquisition of stress tolerance and improvement in biomass accumulation during the early "osmotic" phase of salinity stress. In addition, results revealed transcript profiles for the wheat cultivars that were different from those of usual stress-inducible genes, but were related to those of plant growth. These findings suggest that, in the process of breeding, selection of specific traits with various salinity stress-inducible genes in commercial bread wheat has led to adaptation to mild salinity conditions.

  11. Comparison of Leaf Sheath Transcriptome Profiles with Physiological Traits of Bread Wheat Cultivars under Salinity Stress.

    Science.gov (United States)

    Takahashi, Fuminori; Tilbrook, Joanne; Trittermann, Christine; Berger, Bettina; Roy, Stuart J; Seki, Motoaki; Shinozaki, Kazuo; Tester, Mark

    2015-01-01

    Salinity stress has significant negative effects on plant biomass production and crop yield. Salinity tolerance is controlled by complex systems of gene expression and ion transport. The relationship between specific features of mild salinity stress adaptation and gene expression was analyzed using four commercial varieties of bread wheat (Triticum aestivum) that have different levels of salinity tolerance. The high-throughput phenotyping system in The Plant Accelerator at the Australian Plant Phenomics Facility revealed variation in shoot relative growth rate and salinity tolerance among the four cultivars. Comparative analysis of gene expression in the leaf sheaths identified genes whose functions are potentially linked to shoot biomass development and salinity tolerance. Early responses to mild salinity stress through changes in gene expression have an influence on the acquisition of stress tolerance and improvement in biomass accumulation during the early "osmotic" phase of salinity stress. In addition, results revealed transcript profiles for the wheat cultivars that were different from those of usual stress-inducible genes, but were related to those of plant growth. These findings suggest that, in the process of breeding, selection of specific traits with various salinity stress-inducible genes in commercial bread wheat has led to adaptation to mild salinity conditions.

  12. Using hierarchical clustering of secreted protein families to classify and rank candidate effectors of rust fungi

    Science.gov (United States)

    Rust fungi are obligate biotrophic pathogens causing considerable damage on crop plants. P. graminis f. sp. tritici, the causal agent of wheat stem rust, and M. larici-populina, the poplar rust pathogen, have strong deleterious impact on wheat and poplar wood production, respectively. The recently r...

  13. Estimating grain yield losses caused by septoria leaf blotch on durum wheat in Tunisia

    Directory of Open Access Journals (Sweden)

    Samia Berraies

    2014-12-01

    Full Text Available Septoria leaf blotch (SLB, caused by Zymoseptoria tritici (Desm. Quaedvlieg & Crous, 2011 (teleomorph: Mycosphaerella graminicola (Fuckel J. Schrot., is an important wheat disease in the Mediterranean region. In Tunisia, SLB has become a major disease of durum wheat (Triticum turgidum L. subsp. durum [Desf.] Husn. particularly during favorable growing seasons where significant yield losses and increase of fungicides use were recorded over the last three decades. The objectives of this study were to evaluate the effect of SLB severity on grain yield of new elite durum wheat breeding lines and to measure the relative effect of fungicide control on grain yield. Experiments were conducted during 2007-2008 and 2008-2009 cropping seasons. A set of 800 breeding lines were screened for reaction to SLB under natural infection at Beja research station. To estimate the disease effect, correlation between disease severity at early grain filling stage and grain yield was performed. Results showed that susceptible varieties yield was significantly reduced by SLB. Average yield reduction was as high as 384 and 325 kg ha-1 for every increment in disease severity on a 0-9 scale in both seasons, respectively. A negative correlation coefficient varied between -0.61 and -0.66 in both seasons. Treated and untreated trials conducted during 2008-2009 and 2009-2010 showed that yield of treated plots increased by 50% on the commonly cultivated susceptible varieties. The results of this investigation suggested that septoria incidence is related to large grain yield losses particularly on susceptible high yielding cultivars. However, appropriate fungicide application at booting growth stage could be beneficial for farmers. The development and use of more effective fungicide could be sought to alleviate the disease effects and therefore could be considered as a part of the integrated pest management and responsible use strategy on septoria leaf blotch in Tunisia.

  14. A Near-Complete Haplotype-Phased Genome of the Dikaryotic Wheat Stripe Rust Fungus Puccinia striiformis f. sp. tritici Reveals High Interhaplotype Diversity.

    Science.gov (United States)

    Schwessinger, Benjamin; Sperschneider, Jana; Cuddy, William S; Garnica, Diana P; Miller, Marisa E; Taylor, Jennifer M; Dodds, Peter N; Figueroa, Melania; Park, Robert F; Rathjen, John P

    2018-02-20

    A long-standing biological question is how evolution has shaped the genomic architecture of dikaryotic fungi. To answer this, high-quality genomic resources that enable haplotype comparisons are essential. Short-read genome assemblies for dikaryotic fungi are highly fragmented and lack haplotype-specific information due to the high heterozygosity and repeat content of these genomes. Here, we present a diploid-aware assembly of the wheat stripe rust fungus Puccinia striiformis f. sp. tritici based on long reads using the FALCON-Unzip assembler. Transcriptome sequencing data sets were used to infer high-quality gene models and identify virulence genes involved in plant infection referred to as effectors. This represents the most complete Puccinia striiformis f. sp. tritici genome assembly to date (83 Mb, 156 contigs, N 50 of 1.5 Mb) and provides phased haplotype information for over 92% of the genome. Comparisons of the phase blocks revealed high interhaplotype diversity of over 6%. More than 25% of all genes lack a clear allelic counterpart. When we investigated genome features that potentially promote the rapid evolution of virulence, we found that candidate effector genes are spatially associated with conserved genes commonly found in basidiomycetes. Yet, candidate effectors that lack an allelic counterpart are more distant from conserved genes than allelic candidate effectors and are less likely to be evolutionarily conserved within the P. striiformis species complex and Pucciniales In summary, this haplotype-phased assembly enabled us to discover novel genome features of a dikaryotic plant-pathogenic fungus previously hidden in collapsed and fragmented genome assemblies. IMPORTANCE Current representations of eukaryotic microbial genomes are haploid, hiding the genomic diversity intrinsic to diploid and polyploid life forms. This hidden diversity contributes to the organism's evolutionary potential and ability to adapt to stress conditions. Yet, it is

  15. Induced resistant mutations in alfalfa and broad bean against rust, leaf spot and wilh diseases by Gamma rays and ethylmethanesulfonate

    International Nuclear Information System (INIS)

    1988-01-01

    In alfalfa after gamma irradiation with 50,100, and 150 krads, 38 rust resistant plants have been selected throughout a screening programme. During four months, cuttings were obtained from these plants individually. Results revealed that 20 plants were remar-kably surpassed the origin in the total fresh weight and in the average weight of each cutting. In broad bean, following gamma irradiation and EMS in two cuitivars for induction of wilt resistance. Seeds of these plants were sown in artificially infested soil . During the growing season, all susceptible plants were removed and at epidemic form of wilt disease

  16. Mechanical behavior of cells within a cell-based model of wheat leaf growth

    Directory of Open Access Journals (Sweden)

    Ulyana Zubairova

    2016-12-01

    Full Text Available Understanding the principles and mechanisms of cell growth coordination in plant tissue remains an outstanding challenge for modern developmental biology. Cell-based modeling is a widely used technique for studying the geometric and topological features of plant tissue morphology during growth. We developed a quasi-one-dimensional model of unidirectional growth of a tissue layer in a linear leaf blade that takes cell autonomous growth mode into account. The model allows for fitting of the visible cell length using the experimental cell length distribution along the longitudinal axis of a wheat leaf epidermis. Additionally, it describes changes in turgor and osmotic pressures for each cell in the growing tissue. Our numerical experiments show that the pressures in the cell change over the cell cycle, and in symplastically growing tissue, they vary from cell to cell and strongly depend on the leaf growing zone to which the cells belong. Therefore, we believe that the mechanical signals generated by pressures are important to consider in simulations of tissue growth as possible targets for molecular genetic regulators of individual cell growth.

  17. Risk assessment studies on succinate dehydrogenase inhibitors, the new weapons in the battle to control Septoria leaf blotch in wheat

    NARCIS (Netherlands)

    Fraaije, Bart A.; Bayon, Carlos; Atkins, Sarah; Cools, Hans J.; Lucas, John A.; Fraaije, Marco W.

    Chemical control of Septoria leaf blotch, caused by Mycosphaerella graminicola, is essential to ensure wheat yield and food security in most European countries. Mycosphaerella graminicola has developed resistance to several classes of fungicide and, with the efficacy of azoles gradually declining

  18. Stomatal conductance, mesophyll conductance, and trans piration efficiency in relation to leaf anatomy in rice and wheat genotypes under drought

    NARCIS (Netherlands)

    Ouyang, Wenjing; Struik, Paul C.; Yin, Xinyou; Yang, Jianchang

    2017-01-01

    Increasing leaf transpiration efficiency (TE) may provide leads for growing rice like dryland cereals such as wheat (Triticum aestivum). To explore avenues for improving TE in rice, variations in stomatal conductance (g s) and mesophyll conductance (g m) and their anatomical determinants were

  19. Flutuação populacional do bicho-mineiro em cultivares de café arábica resistentes à ferrugem Fluctuation of leaf miner population in resistant arabica coffee cultivars to leaf rust

    Directory of Open Access Journals (Sweden)

    Celso Henrique Costa Conceição

    2005-01-01

    Full Text Available A intensidade de infestação pelo bicho-mineiro, Leucoptera coffeella (Guérin-Méneville (Lepidoptera: Lyonetiidae foi investigada nas cultivares Obatã IAC 1669-20 e Tupi IAC 1669-33, com resistência à ferrugem das folhas do cafeeiro, Hemileia vastatrix Berk. et Br., e Ouro Verde Amarelo IAC 4397, suscetível à doença, em ensaios de campo, localizados em Campinas (SP, Brasil. A incidência de ferrugem e a ocorrência de inimigos naturais da praga, assim como o enfolhamento das plantas, foram também observados nas três cultivares. As curvas de flutuação populacional obtidas para Obatã IAC 1669-20 e Tupi IAC 1669-33 revelaram maior incidência do bicho-mineiro entre abril e novembro. Já na cultivar Ouro Verde Amarelo IAC 4397, observaram-se dois picos de infestação, sendo o primeiro em abril-maio e o segundo em agosto-setembro. No entanto, a elevada percentagem de folhas minadas nas cultivares Tupi IAC 1669-33 e Obatã IAC 1669-20 em relação à Ouro Verde Amarelo IAC 4397 não é evidência de maior suscetibilidade à praga, mas sim devido à maior retenção foliar dessas cultivares, em conseqüência da resistência à ferrugem das folhas observada em ambas. De maneira oposta, na cultivar Ouro Verde Amarelo IAC 4397, os sintomas de ataque do bicho-mineiro ocorreram em menor nível especialmente devido a maior queda de folhas. Com base nas diferenças observadas entre as cultivares, sugere-se a adoção de estratégias distintas de manejo da praga.The intensity of infestation of leaf-miner, Leucoptera coffeella (Guérin-Méneville was investigated in coffee cultivars Obatã IAC 1669-20 and Tupi IAC 1669-33, both resistant to the leaf rust agent, Hemileia vastatrix Berk. et Br., and Ouro Verde Amarelo IAC 4397, susceptible to this coffee disease, at field assays in Campinas, SP, Brazil. The incidence of coffee rust and presence of natural enemies, as well as the plant leafiness, were also observed. In Obatã IAC 1669-20 and Tupi

  20. Induced mutations for disease resistance in wheat and field beans

    International Nuclear Information System (INIS)

    Abdel-Hak, T.M.; Kamel, A.H.

    1976-01-01

    Wheat disease in Egypt is reviewed and results of mutation breeding by γ irradiation for disease resistance in wheat and field beans are described. Wheat mutants of the variety Giza 155 resistant to leaf rust, Giza 156 resistant to both leaf and yellow rusts, and Tosson with a reasonable level of combined resistance to the three rusts in addition to mutants of the tetraploid variety Dakar 52 with a good level of stem and yellow rust resistance are required. Their seeds were subjected to 10, 15 and 20 krad. Of 3000-3700 M 2 plants from each variety and dosage, 22 plants from both Giza 155 and Giza 156, although susceptible, showed a lower level of disease development. In 1975, M 3 families of these selected plants and 6000 plants from bulked material were grown from each variety and dosage at two locations. Simultaneously, an additional population consisting of 3000 mutagen-treated seeds was grown to have a reasonable chance of detecting mutants; 2 heads from each plant were harvested. These will be grown next season (1976) to make a population of 25,000-30,000 M 2 plants and screened to composite cultures of specific rusts. Vicia faba seeds of field bean varieties Giza 1, Giza 2 and Rebaya 40, equally susceptible to rust and chocolate spot, were subjected to 3, 5 and 7 krad of 60 Co gamma radiation and 800 M 1 plants were grown in 1972 per variety and dose. Up to this later growing season (M 3 ) no resistance was detected in M 3 plank

  1. [Effects of reduced solar radiation on winter wheat flag leaf net photosynthetic rate].

    Science.gov (United States)

    Zheng, You-Fei; Ni, Yan-Li; Mai, Bo-Ru; Wu, Rong-Jun; Feng, Yan; Sun, Jian; Li, Jian; Xu, Jing-Xin

    2011-06-01

    Taking winter wheat Triticum aestivum L. (cv. Yangmai 13) as test material, a field experiment was conducted in Nanjing City to study the effects of simulated reduced solar radiation on the diurnal variation of winter wheat flag leaf photosynthetic rate and the main affecting factors. Five treatments were installed, i. e., 15% (T15), 20% (T20) , 40% (T40), 60% (T60), and 100% (CK) of total incident solar radiation. Reduced solar irradiance increased the chlorophyll and lutein contents significantly, but decreased the net photosynthetic rate (Pn). Under different solar irradiance, the diurnal variation of Pn had greater difference, and the daily maximum Pn was in the order of CK > T60 > T40 > T 20 > T15. In CK, the Pn exhibited a double peak diurnal curve; while in the other four treatments, the Pn showed a single peak curve, and the peak was lagged behind that of CK. Correlation analysis showed that reduced solar irradiance was the main factor affecting the diurnal variation of Pn, but the physiological parameters also played important roles in determining the diurnal variation of Pn. In treatments T60 and T40, the photosynthesis active radiation (PAR), leaf temperature (T1) , stomatal conductance (Gs) , and transpiration rate (Tr) were significantly positively correlated with Pn, suggesting their positive effects on Pn. The intercellular CO2 concentration (Ci) and stomatal limitation (Ls) had significant negative correlations with Pn in treatments T60 and T40 but significant positive correlations with Pn in treatments T20 and T15, implying that the Ci and Ls had negative (or positive) effects on Pn when the solar irradiance was higher (or lower) than 40% of incident solar irradiance.

  2. Transfer Factor of Radioactive Cs and Sr from Egyptian Soils to Roots and Leafs of Wheat Plant

    International Nuclear Information System (INIS)

    Abu Khadra, S.A.; Abdel Fattah, A.T.; Eissa, H.S.; Abdel Sabour, M.F.

    2009-01-01

    Transfer factors (TFs) of long lived radionuclide such as 137 Cs and 90 Sr from three different Egyptian soils type to wheat plant have been studied by radiotracer experiments. Most typical Egyptian soils (sandy, sandy loam and clayey) from three different locations (Al -Oboor, Abu- Zaabal and Shebeen cities) were selected for the experiments carried out under outdoor conditions. The plant selected was wheat because the high consumption of wheat in Egypt. In the present study radioactive strontium and caesium uptake from different types of soil was investigated .These radionuclide showed a considerable difference in their distribution within the plant .The results showed that soil type influences the transfer factors. Sandy soil resulted in the highest transfer factor for both (Cs and Sr) from soil to wheat. TFs for leafs were higher than those for roots in case of 90 Sr (for all types of soil). However, TFs of ( 137 Cs) for roots were higher than those for leafs for all soils. Grains of the wheat showed the lowest transfer factor for the Cs and Sr (for all types of soil)

  3. Effects of ozone on growth, yield and leaf gas exchange rates of two Bangladeshi cultivars of wheat (Triticum aestivum L.)

    International Nuclear Information System (INIS)

    Akhtar, Nahid; Yamaguchi, Masahiro; Inada, Hidetoshi; Hoshino, Daiki; Kondo, Taisuke; Izuta, Takeshi

    2010-01-01

    To clarify the effects of O 3 on crop plants cultivated in Bangladesh, two Bangladeshi wheat cultivars (Sufi and Bijoy) were grown in plastic boxes filled with Andisol and exposed daily to charcoal-filtered air or O 3 at 60 and 100 nl l -1 (10:00-17:00) from 13 March to 4 June 2008. The whole-plant dry mass and grain yield per plant of the two cultivars at the final harvest were significantly reduced by the exposure to O 3 . Although there was no significant effect of O 3 on stomatal diffusive conductance to H 2 O of flag leaf, net photosynthetic rate of the leaf was significantly reduced by the exposure to O 3. The sensitivity of growth, yield, yield components and leaf gas exchange rates to O 3 was not significantly different between the two cultivars. The results obtained in the present study suggest that ambient levels of O 3 may detrimentally affect wheat production in Bangladesh. - The exposure to ambient levels of ozone decreases growth, yield and leaf gas exchange rates of two Bangladeshi cultivars of wheat.

  4. Identification of new SSR markers linked to leaf chlorophyll content, flag leaf senescence and cell membrane stability traits in wheat under water stressed condition.

    Science.gov (United States)

    Barakat, Mohamed N; Saleh, Mohamed; Al-Doss, Abdullah A; Moustafa, Khaled A; Elshafei, Adel A; Al-Qurainy, Fahed H

    2015-03-01

    Segregating F4 families from the cross between drought sensitive (Yecora Rojo) and drought tolerant (Pavon 76) genotypes were made to identify SSR markers linked to leaf chlorophyll content, flag leaf senescence and cell membrane stability traits in wheat (Triticum aestivum L.) under water-stressed condition and to map quantitative trait locus (QTL) for the three physiological traits. The parents and 150 F4 families were evaluated phenotypically for drought tolerance using two irrigation treatments (2500 and 7500 m3/ha). Using 400 SSR primers tested for polymorphism in testing parental and F4 families genotypes, the results revealed that QTL for leaf chlorophyll content, flag leaf senescence and cell membrane stability traits were associated with 12, 5 and 12 SSR markers, respectively and explained phenotypic variation ranged from 6 to 42%. The SSR markers for physiological traits had genetic distances ranged from 12.5 to 25.5 cM. These SSR markers can be further used in breeding programs for drought tolerance in wheat.

  5. A Near-Complete Haplotype-Phased Genome of the Dikaryotic Wheat Stripe Rust Fungus Puccinia striiformis f. sp. tritici Reveals High Interhaplotype Diversity

    Directory of Open Access Journals (Sweden)

    Benjamin Schwessinger

    2018-02-01

    Full Text Available A long-standing biological question is how evolution has shaped the genomic architecture of dikaryotic fungi. To answer this, high-quality genomic resources that enable haplotype comparisons are essential. Short-read genome assemblies for dikaryotic fungi are highly fragmented and lack haplotype-specific information due to the high heterozygosity and repeat content of these genomes. Here, we present a diploid-aware assembly of the wheat stripe rust fungus Puccinia striiformis f. sp. tritici based on long reads using the FALCON-Unzip assembler. Transcriptome sequencing data sets were used to infer high-quality gene models and identify virulence genes involved in plant infection referred to as effectors. This represents the most complete Puccinia striiformis f. sp. tritici genome assembly to date (83 Mb, 156 contigs, N50 of 1.5 Mb and provides phased haplotype information for over 92% of the genome. Comparisons of the phase blocks revealed high interhaplotype diversity of over 6%. More than 25% of all genes lack a clear allelic counterpart. When we investigated genome features that potentially promote the rapid evolution of virulence, we found that candidate effector genes are spatially associated with conserved genes commonly found in basidiomycetes. Yet, candidate effectors that lack an allelic counterpart are more distant from conserved genes than allelic candidate effectors and are less likely to be evolutionarily conserved within the P. striiformis species complex and Pucciniales. In summary, this haplotype-phased assembly enabled us to discover novel genome features of a dikaryotic plant-pathogenic fungus previously hidden in collapsed and fragmented genome assemblies.

  6. Breeding bread wheat cultivars for high protein content by transfer of protein genes from Triticum dicoccoides

    International Nuclear Information System (INIS)

    Grama, A.; Gerechter-Amitai, Z.K.; Blum, A.; Rubenthaler, G.L.

    1984-01-01

    Triticum dicoccoides sel. G-25, a selection of wild emmer with a protein content of 20.5% and a kernel weight of 31.5 mg, was used as the donor of protein genes. Since this selection is highly resistant to stripe rust, the object of the crossing programme was to transfer this resistance, together with the high protein potential, to durum and bread wheat cultivars susceptible to the disease. In the tetraploid lines obtained from the T. dicoccoides/T. durum cross, the protein values ranged from 17 to 22%. These lines had resistance to stripe rust from the wild emmer and to stem rust from the durum. After two further crosses between these tetraploid lines and T. aestivum cultivars, several lines were selected which combined good yield, high protein level and resistance to rust diseases. These lines attained protein levels of 14 to 19% in the whole grain and 14 to 17% in the flour, combined with yields of 4.5 to 6.0 t/ha. They had also inherited resistance to stem rust, and in some instances also to leaf rust, from the cultivated wheat parental lines. (author)

  7. Estimates of leaf area index from spectral reflectance of wheat under different cultural practices and solar angle

    Science.gov (United States)

    Asrar, G.; Kanemasu, E. T.; Yoshida, M.

    1985-01-01

    The influence of management practices and solar illumination angle on the leaf area index (LAI) was estimated from measurements of wheat canopy reflectance evaluated by two methods, a regression formula and an indirect technique. The date of planting and the time of irrigation in relation to the stage of plant growth were found to have significant effects on the development of leaves in spring wheat. A reduction in soil moisture adversely affected both the duration and magnitude of the maximum LAI for late planting dates. In general, water stress during vegetative stages resulted in a reduction in maximum LAI, while water stress during the reproductive period shortened the duration of green LAI in spring wheat. Canopy geometry and solar angle also affected the spectral properties of the canopies, and hence the estimated LAI. Increase in solar zenith angles resulted in a general increase in estimated LAI obtained from both methods.

  8. Variation in chlorophyll content per unit leaf area in spring wheat and implications for selection in segregating material.

    Directory of Open Access Journals (Sweden)

    John Hamblin

    Full Text Available Reduced levels of leaf chlorophyll content per unit leaf area in crops may be of advantage in the search for higher yields. Possible reasons include better light distribution in the crop canopy and less photochemical damage to leaves absorbing more light energy than required for maximum photosynthesis. Reduced chlorophyll may also reduce the heat load at the top of canopy, reducing water requirements to cool leaves. Chloroplasts are nutrient rich and reducing their number may increase available nutrients for growth and development. To determine whether this hypothesis has any validity in spring wheat requires an understanding of genotypic differences in leaf chlorophyll content per unit area in diverse germplasm. This was measured with a SPAD 502 as SPAD units. The study was conducted in series of environments involving up to 28 genotypes, mainly spring wheat. In general, substantial and repeatable genotypic variation was observed. Consistent SPAD readings were recorded for different sampling positions on leaves, between different leaves on single plant, between different plants of the same genotype, and between different genotypes grown in the same or different environments. Plant nutrition affected SPAD units in nutrient poor environments. Wheat genotypes DBW 10 and Transfer were identified as having consistent and contrasting high and low average SPAD readings of 52 and 32 units, respectively, and a methodology to allow selection in segregating populations has been developed.

  9. Off-Nadir Hyperspectral Sensing for Estimation of Vertical Profile of Leaf Chlorophyll Content within Wheat Canopies.

    Science.gov (United States)

    Kong, Weiping; Huang, Wenjiang; Casa, Raffaele; Zhou, Xianfeng; Ye, Huichun; Dong, Yingying

    2017-11-23

    Monitoring the vertical profile of leaf chlorophyll (Chl) content within winter wheat canopies is of significant importance for revealing the real nutritional status of the crop. Information on the vertical profile of Chl content is not accessible to nadir-viewing remote or proximal sensing. Off-nadir or multi-angle sensing would provide effective means to detect leaf Chl content in different vertical layers. However, adequate information on the selection of sensitive spectral bands and spectral index formulas for vertical leaf Chl content estimation is not yet available. In this study, all possible two-band and three-band combinations over spectral bands in normalized difference vegetation index (NDVI)-, simple ratio (SR)- and chlorophyll index (CI)-like types of indices at different viewing angles were calculated and assessed for their capability of estimating leaf Chl for three vertical layers of wheat canopies. The vertical profiles of Chl showed top-down declining trends and the patterns of band combinations sensitive to leaf Chl content varied among different vertical layers. Results indicated that the combinations of green band (520 nm) with NIR bands were efficient in estimating upper leaf Chl content, whereas the red edge (695 nm) paired with NIR bands were dominant in quantifying leaf Chl in the lower layers. Correlations between published spectral indices and all NDVI-, SR- and CI-like types of indices and vertical distribution of Chl content showed that reflectance measured from 50°, 30° and 20° backscattering viewing angles were the most promising to obtain information on leaf Chl in the upper-, middle-, and bottom-layer, respectively. Three types of optimized spectral indices improved the accuracy for vertical leaf Chl content estimation. The optimized three-band CI-like index performed the best in the estimation of vertical distribution of leaf Chl content, with R² of 0.84-0.69, and RMSE of 5.37-5.56 µg/cm² from the top to the bottom layers

  10. Association Mapping of Quantitative Trait Loci in Spring Wheat Landraces Conferring Resistance to Bacterial Leaf Streak and Spot Blotch

    Directory of Open Access Journals (Sweden)

    Tika B. Adhikari

    2012-03-01

    Full Text Available Bacterial leaf streak (BLS, caused by pv. (Smith et al. Bragard et al., and spot blotch (SB, caused by (S. Ito & Kurib. Drechs. ex Dastur, are two emerging diseases of wheat ( L.. To achieve sustainable disease management strategies and reduce yield losses, identifying new genes that confer quantitative resistance would benefit resistance breeding efforts. The main objective of this study was to use association mapping (AM with 832 polymorphic Diversity Arrays Technology (DArT markers to identify genomic regions associated with resistance to BLS and SB in 566 spring wheat landraces. From data analysis of this diverse panel of wheat accessions, we discovered five novel genomic regions significantly associated with resistance to BLS on chromosomes 1A, 4A, 4B, 6B, and 7D. Similarly, four genomic regions were found to be associated with resistance to SB on chromosomes 1A, 3B, 7B, and 7D. A high degree of linkage disequilibrium (LD decayed over short genetic distance in the set of wheat accessions studied, and some of these genomic regions appear to be involved in multiple disease resistance (MDR. These results suggest that the AM approach provides a platform for discovery of resistance conditioned by multiple genes with quantitative effects, which could be validated and deployed in wheat breeding programs.

  11. Evolution of Mycosphaerella graminicola at the wheat leaf and field levels

    Directory of Open Access Journals (Sweden)

    Léa El Chartouni

    2012-09-01

    Full Text Available The aim of this study was to compare Mycosphaerella graminicola populations at the field and lesion levels. The evolution of M. graminicola populations from a single field in the “Morbihan” county (France, between 2005 and 2006, was first investigated for 37 strains using molecular fingerprinting by microsatellite markers (ST1A4, ST1E3, ST1E7 and ST1D7 and SSCP analysis of partial actin and β-tubulin encoding sequences. Similar gene diversity was observed in the 2005 and 2006 populations, with no common clones between the two years. This indicates frequent sexual recombination by the fungus. When considering each marker independently and comparing marker genetic variability for the two populations, differences in the genetic variability were detected in 2006 population compared to the 2005 population. ST1A4, ST1D7 and the partial sequence of actin presented a decrease in genetic variability of the 2006 strains, while for ST1E3, ST1E7 and the partial sequence of β-tubulin showed an increase, revealing the importance of the chosen markers. In addition, 29 strains collected in 2006 from three distinct lesions on the same wheat leaf in the “Nord” county were also investigated for genetic diversity. MAT1-1 and MAT1-2 were found in the same lesion offering opportunities for sexual contact.

  12. Genome-Wide Analysis of Simple Sequence Repeats and Efficient Development of Polymorphic SSR Markers Based on Whole Genome Re-Sequencing of Multiple Isolates of the Wheat Stripe Rust Fungus.

    Directory of Open Access Journals (Sweden)

    Huaiyong Luo

    Full Text Available The biotrophic parasitic fungus Puccinia striiformis f. sp. tritici (Pst causes stripe rust, a devastating disease of wheat, endangering global food security. Because the Pst population is highly dynamic, it is difficult to develop wheat cultivars with durable and highly effective resistance. Simple sequence repeats (SSRs are widely used as molecular markers in genetic studies to determine population structure in many organisms. However, only a small number of SSR markers have been developed for Pst. In this study, a total of 4,792 SSR loci were identified using the whole genome sequences of six isolates from different regions of the world, with a marker density of one SSR per 22.95 kb. The majority of the SSRs were di- and tri-nucleotide repeats. A database containing 1,113 SSR markers were established. Through in silico comparison, the previously reported SSR markers were found mainly in exons, whereas the SSR markers in the database were mostly in intergenic regions. Furthermore, 105 polymorphic SSR markers were confirmed in silico by their identical positions and nucleotide variations with INDELs identified among the six isolates. When 104 in silico polymorphic SSR markers were used to genotype 21 Pst isolates, 84 produced the target bands, and 82 of them were polymorphic and revealed the genetic relationships among the isolates. The results show that whole genome re-sequencing of multiple isolates provides an ideal resource for developing SSR markers, and the newly developed SSR markers are useful for genetic and population studies of the wheat stripe rust fungus.

  13. Genome-Wide Analysis of Simple Sequence Repeats and Efficient Development of Polymorphic SSR Markers Based on Whole Genome Re-Sequencing of Multiple Isolates of the Wheat Stripe Rust Fungus.

    Science.gov (United States)

    Luo, Huaiyong; Wang, Xiaojie; Zhan, Gangming; Wei, Guorong; Zhou, Xinli; Zhao, Jing; Huang, Lili; Kang, Zhensheng

    2015-01-01

    The biotrophic parasitic fungus Puccinia striiformis f. sp. tritici (Pst) causes stripe rust, a devastating disease of wheat, endangering global food security. Because the Pst population is highly dynamic, it is difficult to develop wheat cultivars with durable and highly effective resistance. Simple sequence repeats (SSRs) are widely used as molecular markers in genetic studies to determine population structure in many organisms. However, only a small number of SSR markers have been developed for Pst. In this study, a total of 4,792 SSR loci were identified using the whole genome sequences of six isolates from different regions of the world, with a marker density of one SSR per 22.95 kb. The majority of the SSRs were di- and tri-nucleotide repeats. A database containing 1,113 SSR markers were established. Through in silico comparison, the previously reported SSR markers were found mainly in exons, whereas the SSR markers in the database were mostly in intergenic regions. Furthermore, 105 polymorphic SSR markers were confirmed in silico by their identical positions and nucleotide variations with INDELs identified among the six isolates. When 104 in silico polymorphic SSR markers were used to genotype 21 Pst isolates, 84 produced the target bands, and 82 of them were polymorphic and revealed the genetic relationships among the isolates. The results show that whole genome re-sequencing of multiple isolates provides an ideal resource for developing SSR markers, and the newly developed SSR markers are useful for genetic and population studies of the wheat stripe rust fungus.

  14. Transfer of stripe rust resistance from Aegilops variabilis to bread ...

    African Journals Online (AJOL)

    In terms of area, the bread wheat producing regions of China comprise the largest area in the world that is constantly threatened by stripe rust epidemics. Consequently, it is important to exploit new adultplant resistance genes in breeding. This study reports the transfer of stripe rust resistance from Aegilops variabilis to ...

  15. Bioprospecting endophytic bacteria for biological control of coffee leaf rust Bioprospecção de bactérias endofíticas como agentes de biocontrole da ferrugem do cafeeiro

    Directory of Open Access Journals (Sweden)

    Humberto Franco Shiomi

    2006-02-01

    Full Text Available Suppression of plant diseases due to the action of endophytic microorganisms has been demonstrated in several pathosystems. Experiments under controlled conditions involving endophytic bacteria isolated from leaves and branches of Coffea arabica L and Coffea robusta L were conducted with the objective of evaluating the inhibition of germination of Hemileia vastatrix Berk. & Br., race II, urediniospores and the control of coffee leaf rust development in tests with leaf discs, detached leaves, and on potted seedling of cv. Mundo Novo. The endophytic bacterial isolates tested proved to be effective in inhibiting urediniospore germination and/or rust development, with values above 50%, although the results obtained in urediniospore germination tests were inferior to the treatment with fungicide propiconazole. Endophytic isolates TG4-Ia, TF2-IIc, TF9-Ia, TG11-IIa, and TF7-IIa, demonstrated better coffee leaf rust control in leaf discs, detached leaves, and coffee plant tests. The endophytic isolates TG4-Ia and TF9-Ia were identified as Bacillus lentimorbus Dutky and Bacillus cereus Frank. & Frank., respectively. Some endophytic bacterial isolates were effective in controlling the coffee leaf rust, although some increased the severity of the disease. Even though a relatively small number of endophytic bacteria were tested, promising results were obtained regarding the efficiency of coffee leaf rust biocontrol. These selected agents appears to be an alternative for future replacement of chemical fungicide.Supressão de doenças de plantas por microrganismos endofíticos tem sido demonstrada em diversos patossistemas. Neste trabalho foram selecionados isolados de bactérias endofíticas de folhas e ramos de cafeeiro com potencial para o controle biológico da ferrugem do cafeeiro, pois é conhecido que esses microrganismos podem possuir essa característica. Bactérias endofíticas isoladas previamente de folhas e ramos de Coffea arabica L e Coffea

  16. Radiation and nitrogen use at the leaf and canopy level by wheat and oilseed rape during the critical period for grain number definition

    International Nuclear Information System (INIS)

    Dreccer, M.F.; Schapendonk, H.C.M.; Oijen, M. van; Pot, C.S.; Rabbinge, R.

    2000-01-01

    During the critical period for grain number definition, the amount of biomass produced per unit absorbed radiation is more sensitive to nitrogen (N) supply in oilseed rape than in wheat, and reaches a higher value at high N. This response was investigated by combining experimental and modelling work. Oilseed rape and wheat were grown at three levels of N supply, combined with two levels of plant density at high N supply. Canopy photosynthesis and daytime radiation use efficiency (RUE A ) were calculated with a model based on observed N-dependent leaf photosynthesis and observed canopy vertical distribution of light and leaf N. In oilseed rape, RUE A was higher than in wheat and, in contrast to wheat, the sensitivity to canopy leaf N content increased from the start to the end of the critical period. These results were partly explained by the higher leaf photosynthesis in oilseed rape vs wheat. In addition, oilseed rape leaves were increasingly shaded by the inflorescence. Thus, RUE A increased because more leaves were operating at non-saturating light levels. In both species, the vertical distribution of leaf N was close to that optimising canopy photosynthesis. The results are discussed in relation to possibilities for improvement of N productivity in these crops. (author)

  17. Stomatal conductance, mesophyll conductance, and transpiration efficiency in relation to leaf anatomy in rice and wheat genotypes under drought.

    Science.gov (United States)

    Ouyang, Wenjing; Struik, Paul C; Yin, Xinyou; Yang, Jianchang

    2017-11-02

    Increasing leaf transpiration efficiency (TE) may provide leads for growing rice like dryland cereals such as wheat (Triticum aestivum). To explore avenues for improving TE in rice, variations in stomatal conductance (gs) and mesophyll conductance (gm) and their anatomical determinants were evaluated in two cultivars from each of lowland, aerobic, and upland groups of Oryza sativa, one cultivar of O. glaberrima, and two cultivars of T. aestivum, under three water regimes. The TE of upland rice, O. glaberrima, and wheat was more responsive to the gm/gs ratio than that of lowland and aerobic rice. Overall, the explanatory power of the particular anatomical trait varied among species. Low stomatal density mostly explained the low gs in drought-tolerant rice, whereas rice genotypes with smaller stomata generally responded more strongly to drought. Compared with rice, wheat had a higher gm, which was associated with thicker mesophyll tissue, mesophyll and chloroplasts more exposed to intercellular spaces, and thinner cell walls. Upland rice, O. glaberrima, and wheat cultivars minimized the decrease in gm under drought by maintaining high ratios of chloroplasts to exposed mesophyll cell walls. Rice TE could be improved by increasing the gm/gs ratio via modifying anatomical traits. © The Author 2017. Published by Oxford University Press on behalf of the Society for Experimental Biology.

  18. Abnormal germling development by brown rust and powdery mildew on cer barley mutants

    NARCIS (Netherlands)

    Rubiales, D.; Ramirez, M.C.; Carver, T.L.W.; Niks, R.E.

    2001-01-01

    The barley leaf rust fungus forms appressoria over host leaf stomata and penetrates via the stomatal pore. High levels of avoidance to leaf rust fungi have been described in some wild accessions of Hordeum species where a prominent wax layer on the stomata inhibits triggering of fungal appressorium

  19. Rust essentials

    CERN Document Server

    Balbaert, Ivo

    2015-01-01

    This book is intended for software developers interested in systems level and application programming, and are looking for a quick entry into using Rust and understanding the core features of the framework. It is assumed that you have a basic understanding of Java, C#, Ruby, Python or JavaScript.

  20. Winnie Rust

    African Journals Online (AJOL)

    Owner

    Om te trek is om jou kortstondig in 'n liminale staat te bevind. Nóg by jou vertrekpunt, nóg by jou uiteindelike bestemming, sonder die geborgenheid wat hierdie twee vaste plekke kwansuis bied. In 'n hele aantal opsigte is Trek van Winnie Rust 'n beskrywing van verskil- lende liminale state. Dit is egter nie 'n reisverhaal met ...

  1. Seeing Rust

    Science.gov (United States)

    2004-01-01

    The rust color of the Martian landscape is apparent in this low-resolution thumbnail image taken by the panoramic camera on the Mars Exploration Rover Spirit. This image is part of a larger image currently stored onboard the rover in its memory.

  2. Co-ordinate regulation of cytokinin gene family members during flag leaf and reproductive development in wheat.

    Science.gov (United States)

    Song, Jiancheng; Jiang, Lijun; Jameson, Paula Elizabeth

    2012-06-06

    As the global population continues to expand, increasing yield in bread wheat is of critical importance as 20% of the world's food supply is sourced from this cereal. Several recent studies of the molecular basis of grain yield indicate that the cytokinins are a key factor in determining grain yield. In this study, cytokinin gene family members in bread wheat were isolated from four multigene families which regulate cytokinin synthesis and metabolism, the isopentenyl transferases (IPT), cytokinin oxidases (CKX), zeatin O-glucosyltransferases (ZOG), and β-glucosidases (GLU). As bread wheat is hexaploid, each gene family is also likely to be represented on the A, B and D genomes. By using a novel strategy of qRT-PCR with locus-specific primers shared among the three homoeologues of each family member, detailed expression profiles are provided of family members of these multigene families expressed during leaf, spike and seed development. The expression patterns of individual members of the IPT, CKX, ZOG, and GLU multigene families in wheat are shown to be tissue- and developmentally-specific. For instance, TaIPT2 and TaCKX1 were the most highly expressed family members during early seed development, with relative expression levels of up to 90- and 900-fold higher, respectively, than those in the lowest expressed samples. The expression of two cis-ZOG genes was sharply increased in older leaves, while an extremely high mRNA level of TaGLU1-1 was detected in young leaves. Key genes with tissue- and developmentally-specific expression have been identified which would be prime targets for genetic manipulation towards yield improvement in bread wheat breeding programmes, utilising TILLING and MAS strategies.

  3. Manthar-03: a high-yielding cultivar of wheat released for general cultivation in Southern Punjab

    International Nuclear Information System (INIS)

    Hussain, M.; Akhtar, L.H.; Nasim, M.

    2010-01-01

    We report the release of a new wheat variety Manthar-03. 'Manthar-03' is a high yielding and rust resistant variety of bread wheat with erect growth habit. It was released in the year 2003 as a general purpose variety. Manthar-03 is a selection from CIMMYT material (Entry No. 42 of 29 International Bread Wheat Screening Nursery) made at Regional Agricultural Research Institute (RARI), Bahawalpur during 1996-97. This strain has the famous CIMMYT line 'Kauz' in its parentage (KAUZ//ALTAR 84/AOS). Its pedigree is CM11163-6M-20Y-10M- 0M-0B. It is a more adapted and a high yielder. Genetically, this strain differs from existing commercial cultivars of Punjab. Resistance against leaf rust (5MRMS to 10MR), RRI value of 6.7 and 7.6 for leaf rust and ACI values of 3.4 and 0.7 for leaf rust) and high yield potential (6300 kg ha-1 ) are the major attributes of Manthar-03 that make it a superior variety for its target regions. Manthar-03 is tolerant to wheat aphid and Helicoverpa armigera. The thousand seed weight of this variety is 40-44 g. Seed is amber in color and contains 12.97% protein, 8.2% dry gluten and 1.55% ash. It has good chapati making quality. Plant type of Manthar-03 is erect with plant height 94 cm and droopy flag leaves. It is lodging resistant. It completes heading in 98 days and matures in 142 days. Manthar-03 performs better when planted from 15, November to 1, December, keeping 125 kg ha/sup -1/ seed rate and 125-85-50 kg NPK ha/sup -1/ are applied. (author)

  4. Genetic variability among the brown rust resistant and susceptible genotypes of sugarcane by RAPD technique

    Science.gov (United States)

    Brown leaf rust in sugarcane is caused by Puccinia melanocephala (Syd. & P. Syd.), which is major cause of cultivar withdrawal. We attempted to analyze the RAPD diversity of two discrete phenotypic classes i.e. rust resistant (R) and rust susceptible (S) of six commercially available sugarcane elite...

  5. Genotypic variation in carbon isotope discrimination and transpiration efficiency in wheat. Leaf gas exchange and whole plant studies

    International Nuclear Information System (INIS)

    Condon, A.G.; Farquhar, G.D.; Richards, R.A.

    1990-01-01

    The relationship between carbon isotope discrimination, Δ, measured in plant dry matter and the ratio of intercellular to atmospheric partial pressures of CO 2 ,p i /p a , in leaves was examined in two glasshouse experiments using 14 wheat genotypes selected on the basis of variation in Δ of dry matter. Genotypic variation in Δ was similar in both experiments, with an average range of 1.8 x 10 -3 . Δ measured in dry matter and p i /p a measured in flag leaves were positively correlated. Variation among genotypes in p i /p a was attributed, approximately equally, to variation in leaf conductance and in photosynthetic capacity. The relationship between plant transpiration efficiency, W * (the amount of above-ground dry matter produced per unit water transpired) and Δ was was also examined. The results indicate that genotypic variation in Δ, measured in dry matter, should provide a reasonable measure of genotypic variation in long-term mean leaf p i /p a in wheat. 42 refs., 2 tabs., 5 figs

  6. Allelopathic effects of leaf extracts of three agroforestry trees on germination and early seedling growth of wheat (Triticum aestivum L.

    Directory of Open Access Journals (Sweden)

    Abdul Majeed

    2017-06-01

    Full Text Available Understanding of the growth promotory or inhibitory allelopathic effects of agroforestry trees on other plants is necessary for selection of suitable crops to be cultivated in their vicinity. In this experiment, aqueous leaf extracts of three agroforestry trees (Populus deltoides, Melia azedarach and Morus alba were evaluated on germination and seedling growth of wheat applied at concentration 1, 1.5, 2.0 and 2.5 g L-1 while distilled water was used as control treatment. Lower concentration of extracts (1 and 1.5 g L-1 of P. deltoides stimulated percent germination, root and stem height and dry biomass while higher concentration (2 and 2.5 g L-1 had no effect on these parameters. Mean germination time (MGT was not affected by the extract and its concentration. Aqueous extracts of M. azedarach and M. alba at concentration > 1 g L-1 significantly lowered the studied parameters except MGT which was significantly prolonged. Negative allelopathy was more evident at the highest aqueous extract concentration (2.5 g L-1 of the two trees. Extracts of M. alba were found more growth inhibitory than those of M. azedarach. The study suggests that lower concentration of leaf extracts of P. deltoides imparts stimulatory while M. azedarch and M. alba have negative allelopathic effects on wheat germination.

  7. [Flag leaf photosynthetic characteristics, change in chlorophyll fluorescence parameters, and their relationships with yield of winter wheat sowed in spring].

    Science.gov (United States)

    Xu, Lan; Gao, Zhi-qang; An, Wei; Li, Yan-liang; Jiao, Xiong-fei; Wang, Chuang-yun

    2016-01-01

    With five good winter wheat cultivars selected from the middle and lower reaches of Yangtze River and Southwest China as test materials, a field experiment in Xinding basin area of Shanxi Province was conducted to study the photosynthetic characteristics, chlorophyll content, and chlorophyll fluorescence parameters of flag leaf at different sowing dates, as well as the correlations between these indices and yield for two years (2013-2014). The results showed that the difference in most fluorescence parameters except chlorophyll content among cultivars was significant. The correlations between these fluorescence parameters and yield were significant. The variation coefficient of chlorophyll (Chl) content was low (0.12-0.17), and that of performance index based on absorption (PIabs) was high (0.32-0.39), with the partial correlation coefficients of them with grain yield from 2013 to 2014 ranged in 0.70-0.81. Under the early sowing condition, the grain yield positively correlated with PIabs at flowering and filling stages and chlorophyll content at grain filling stage, but negatively correlated with the relative variable fluorescence at I point (Vi) at grain filling stage. About 81.1%-82.8% of grain yield were determined by the variations of PIabs, Chl, and Vi. Wheat cultivars had various performances in the treatments with different sowing dates and a consistent trend was observed in the two experimental years. Among these 5 cultivars, Yangmai 13 was suitable for early sowing, with the flag leaf photosynthetic rate (Pn), Chl, most fluorescence parame-ters, and grain yield showed obviously high levels. In conclusion, under early sowing condition chlorophyll content at grain filling stages, PIabs at flowering and filling stages, and Pn were important indices for selecting wheat cultivars with high photosynthetic efficiency.

  8. Genetics and molecular mapping of genes for race-specific all-stage resistance and non-race-specific high-temperature adult-plant resistance to stripe rust in spring wheat cultivar Alpowa.

    Science.gov (United States)

    Lin, F; Chen, X M

    2007-05-01

    Stripe rust, caused by Puccinia striiformis f. sp. tritici, is one of the most widespread and destructive wheat diseases worldwide. Growing resistant cultivars is the preferred control of the disease. The spring wheat cultivar 'Alpowa' has both race-specific, all-stage resistance and non-race-specific, high-temperature adult-plant (HTAP) resistances to stripe rust. To identify genes for the stripe rust resistances, Alpowa was crossed with 'Avocet Susceptible' (AVS). Seedlings of the parents, and F(1), F(2) and F(3) progeny were tested with races PST-1 and PST-21 of P. striiformis f. sp. tritici under controlled greenhouse conditions. Alpowa has a single partially dominant gene, designated as YrAlp, conferring all-stage resistance. Resistance gene analog polymorphism (RGAP) and simple sequence repeat (SSR) techniques were used to identify molecular markers linked to YrAlp. A linkage group of five RGAP markers and two SSR markers was constructed for YrAlp using 136 F(3) lines. Amplification of a set of nulli-tetrasomic Chinese Spring lines with RGAP markers Xwgp47 and Xwgp48 and the two SSR markers indicated that YrAlp is located on the short arm of chromosome 1B. To map quantitative trait loci (QTLs) for the non-race-specific HTAP resistance, the parents and 136 F(3) lines were tested at two sites near Pullman and one site near Mount Vernon, Washington, under naturally infected conditions. A major HTAP QTL was consistently detected across environments and was located on chromosome 7BL. Because of its chromosomal location and the non-race-specific nature of the HTAP resistance, this gene is different from previously described genes for adult-plant resistance, and is therefore designated Yr39. The gene contributed to 64.2% of the total variation of relative area under disease progress curve (AUDPC) data and 59.1% of the total variation of infection type data recorded at the heading-flowering stages. Two RGAP markers, Xwgp36 and Xwgp45 with the highest R (2) values

  9. Comparison of Leaf Sheath Transcriptome Profiles with Physiological Traits of Bread Wheat Cultivars under Salinity Stress

    KAUST Repository

    Takahashi, Fuminori; Tilbrook, Joanne; Trittermann, Christine; Berger, Bettina; Roy, Stuart J.; Seki, Motoaki; Shinozaki, Kazuo; Tester, Mark A.

    2015-01-01

    , results revealed transcript profiles for the wheat cultivars that were different from those of usual stress-inducible genes, but were related to those of plant growth. These findings suggest that, in the process of breeding, selection of specific traits

  10. Dynamics of leaf and spikelet primordia initiation in wheat as affected by Ppd-1a alleles under field conditions.

    Science.gov (United States)

    Ochagavía, Helga; Prieto, Paula; Savin, Roxana; Griffiths, Simon; Slafer, GustavoA

    2018-04-27

    Wheat adaptation is affected by Ppd genes, but the role of these alleles in the rates of leaf and spikelet initiation has not been properly analysed. Twelve near isogenic lines (NILs) combining Ppd-1a alleles from different donors introgressed in A, B, and/or D genomes were tested under field conditions during two growing seasons together with the wild type, Paragon. Leaf initiation rate was unaffected by Ppd-1a alleles so the final leaf number (FLN) was reduced in parallel with reductions in the duration of the vegetative phase. Spikelet primordia initiation was accelerated and consequently the effect on spikelets per spike was less than proportional to the effect on the duration of spikelet initiation. The magnitude of these effects on spikelet plastochron depended on the doses of Ppd-1 homoeoalleles and the specific insensitivity alleles carried. Double ridge was consistently later than floral initiation, but the difference between them was not affected by Ppd-1a alleles. These findings have potential for selecting the best combinations from the Ppd-1 homoeoallelic series for manipulating adaptation taking into consideration particular effects on spikelet number.

  11. Registration of 'Linkert' spring wheat with good straw strength and field resistance to the Ug99 family of stem rust races

    Science.gov (United States)

    Straw strength is one of the most important criteria for spring wheat cultivar selection in the north central U.S. ‘Linkert’ (PI 672164) hard red spring wheat was released by the University of Minnesota Agricultural Experiment Station in 2013 and has very good straw strength, high grain protein con...

  12. Using transcription of six Puccinia triticina races to identify the effective secretome during infection of wheat.

    Directory of Open Access Journals (Sweden)

    Myron eBruce

    2014-01-01

    Full Text Available Wheat leaf rust, caused by the basidiomycete Puccinia triticina, can cause yield losses of up to 20% in wheat producing regions. During infection, the fungus forms haustoria that secrete proteins into the plant cell and effect changes in plant transcription, metabolism and defense. It is hypothesized that new races emerge as a result of overcoming plant resistance via changes in the secreted effector proteins. To understand gene expression during infection and find genetic differences associated with races, RNA from wheat leaves infected with six different rust races, at six days post inoculation, was sequenced using Illumina. As P. triticina is an obligate biotroph, RNA from both the host and fungi were present and separated by alignment to the P. triticina genome and a wheat EST reference. A total of 222,571 rust contigs were assembled from 165 million reads. An examination of the resulting contigs revealed 532 predicted secreted proteins among the transcripts. Of these, 456 were found in all races. Fifteen genes were found with amino acid changes, corresponding to putative avirulence effectors potentially recognized by 11 different leaf rust resistance (Lr genes. Thirteen of the potential avirulence effectors have no homology to known genes. One gene had significant similarity to cerato-platanin, a known fungal elicitor, and another showed similarity to fungal tyrosinase, an enzyme involved in melanin synthesis. Temporal expression profiles were developed for these genes by qRT-PCR and show that the 15 genes share similar expression patterns from infection initiation to just prior to spore eruption.

  13. Development of new iraqi wheat varieties induced by gamma rays

    International Nuclear Information System (INIS)

    Ibrahim, I.F.; Al-Janabi, K.K.; Al-Maaroof, E.M.; Al-Aubaidi, M.O.; Mahmoud, A.H.; Al-Janabi, A.A.

    1991-01-01

    The aim of the present investigation is to study agronomic traits of three wheat mutants induced by gamma rays and compared with their origin 'Saber Beg' during M 8 - M 11 generations. These mutants showed a moderate resistance to leaf rust and lodging, while the origin was susceptible. Also, these mutants surpassed their origin in seed weight of 100 spikes, weight of 1000 kernels and protein yield per unit area. Chemical and physical analyses of mutant flours indicated that it could be used for bread making successfully.2 fig.,4 tab

  14. Selection and characterization of Argentine isolates of Trichoderma harzianum for effective biocontrol of Septoria leaf blotch of wheat.

    Science.gov (United States)

    Stocco, Marina C; Mónaco, Cecilia I; Abramoff, Cecilia; Lampugnani, Gladys; Salerno, Graciela; Kripelz, Natalia; Cordo, Cristina A; Consolo, Verónica F

    2016-03-01

    Species of the genus Trichoderma are economically important as biocontrol agents, serving as a potential alternative to chemical control. The applicability of Trichoderma isolates to different ecozones will depend on the behavior of the strains selected from each zone. The present study was undertaken to isolate biocontrol populations of Trichoderma spp. from the Argentine wheat regions and to select and characterize the best strains of Trichoderma harzianum by means of molecular techniques. A total of 84 out of the 240 strains of Trichoderma were able to reduce the disease severity of the leaf blotch of wheat. Thirty-seven strains were selected for the reduction equal to or greater than 50% of the severity, compared with the control. The percentage values of reduction of the pycnidial coverage ranged between 45 and 80%. The same last strains were confirmed as T. harzianum by polymerase chain reaction amplification of internal transcribed spacers, followed by sequencing. Inter-simple sequence repeat was used to examine the genetic variability among isolates. This resulted in a total of 132 bands. Further numerical analysis revealed 19 haplotypes, grouped in three clusters (I, II, III). Shared strains, with different geographical origins and isolated in different years, were observed within each cluster. The origin of the isolates and the genetic group were partially related. All isolates from Paraná were in cluster I, all isolates from Lobería were in cluster II, and all isolates from Pergamino and Santa Fe were in cluster III. Our results suggest that the 37 native strains of T. harzianum are important in biocontrol programs and could be advantageous for the preparation of biopesticides adapted to the agroecological conditions of wheat culture.

  15. Rust transformation/rust compatible primers

    Science.gov (United States)

    Emeric, Dario A.; Miller, Christopher E.

    1993-01-01

    Proper surface preparation has been the key to obtain good performance by a surface coating. The major obstacle in preparing a corroded or rusted surface is the complete removal of the contaminants and the corrosion products. Sandblasting has been traditionally used to remove the corrosion products before painting. However, sandblasting can be expensive, may be prohibited by local health regulations and is not applicable in every situation. To get around these obstacles, Industry developed rust converters/rust transformers and rust compatible primers (high solids epoxies). The potential use of these products for military equipment led personnel of the Belvoir Research, Development and Engineering Center (BRDEC) to evaluate the commercially available rust transformers and rust compatible primers. Prior laboratory experience with commercially available rust converters, as well as field studies in Hawaii and Puerto Rico, revealed poor performance, several inherent limitations, and lack of reliability. It was obvious from our studies that the performance of rust converting products was more dependent on the amount and type of rust present, as well as the degree of permeability of the coating, than on the product's ability to form an organometallic complex with the rust. Based on these results, it was decided that the Military should develop their own rust converter formulation and specification. The compound described in the specification is for use on a rusted surface before the application of an organic coating (bituminous compounds, primer or topcoat). These coatings should end the need for sandblasting or the removing of the adherent corrosion products. They also will prepare the surface for the application of the organic coating. Several commercially available rust compatible primers (RCP) were also tested using corroded surfaces. All of the evaluated RCP failed our laboratory tests for primers.

  16. Assimilating Remote Sensing Observations of Leaf Area Index and Soil Moisture for Wheat Yield Estimates: An Observing System Simulation Experiment

    Science.gov (United States)

    Nearing, Grey S.; Crow, Wade T.; Thorp, Kelly R.; Moran, Mary S.; Reichle, Rolf H.; Gupta, Hoshin V.

    2012-01-01

    Observing system simulation experiments were used to investigate ensemble Bayesian state updating data assimilation of observations of leaf area index (LAI) and soil moisture (theta) for the purpose of improving single-season wheat yield estimates with the Decision Support System for Agrotechnology Transfer (DSSAT) CropSim-Ceres model. Assimilation was conducted in an energy-limited environment and a water-limited environment. Modeling uncertainty was prescribed to weather inputs, soil parameters and initial conditions, and cultivar parameters and through perturbations to model state transition equations. The ensemble Kalman filter and the sequential importance resampling filter were tested for the ability to attenuate effects of these types of uncertainty on yield estimates. LAI and theta observations were synthesized according to characteristics of existing remote sensing data, and effects of observation error were tested. Results indicate that the potential for assimilation to improve end-of-season yield estimates is low. Limitations are due to a lack of root zone soil moisture information, error in LAI observations, and a lack of correlation between leaf and grain growth.

  17. Leaf absorption of atmospheric ammonia emitted from pig slurry applied beneath the canopy of winter wheat

    International Nuclear Information System (INIS)

    Gjedde Sommer, S.; Jensen, E.S.; Kofoed Schjoerring, J.

    1993-01-01

    Absorption of volatilized ammonia after application of slurry onto the soil surface (sand) between rows of a wheat crop was studied in two experiments. The slurry was labelled with 15 N-NH 4 . During seven days the accumulated gaseous N loss from the slurry varied from 6.9 to 11.1 g N m -2 . In April ammonia losses from slurry applied beneath a 5 cm high wheat crop were equal to losses from slurry applied to a fallow, but 2.2% of the lost atmospheric ammonia was taken up by the leaves. In May ammonia loss from slurry applied between the rows of a 43 cm high crop was reduced by 6% compared to the loss from fallow, because of a reduced transfer of ammonia from the slurry to the air. Of the emitted ammonia 3.3% was absorbed by the canopy. (au)

  18. Population structure of Chinese southwest wheat germplasms resistant to stripe rust and powdery mildew using the DArT-seq technique

    Directory of Open Access Journals (Sweden)

    Tianqing Chen

    2018-04-01

    Full Text Available ABSTRACT: Understanding genetic variability in existing wheat accessions is critical for collection, conservation and use of wheat germplasms. In this study, 138 Chinese southwest wheat accessions were investigated by genotyping using two resistance gene makers (Pm21 and Yr26 and DArT-seq technique. Finally, about 50% cultivars (lines amplified the specific allele for the Yr26 gene (Gwm11 and 40.6% for the Pm21 gene (SCAR1265. By DArT-seq analysis, 30,485 markers (6486 SNPs and 23999 DArTs were obtained with mean polymorphic information content (PIC value 0.33 and 0.28 for DArT and SNP marker, respectively. The mean Dice genetic similarity coefficient (GS was 0.72. Two consistent groups of wheat varieties were identified using principal coordinate analysis (PCoA at the level of both the chromosome 6AS and the whole-genome, respectively. Group I was composed of non-6VS/6AL translocation lines of different origins, while Group II was composed of 6VS/6AL translocation (T6VS/6AL lines, most of which carried the Yr26 and Pm21 genes and originated from Guizhou. Besides, a model-based population structure analysis revealed extensive admixture and further divided these wheat accessions into six subgroups (SG1, SG2, SG3, SG4, SG5 and SG6, based on their origin, pedigree or disease resistance. This information is useful for wheat breeding in southwestern China and association mapping for disease resistance using these wheat germplasms in future.

  19. Leaf-GP: an open and automated software application for measuring growth phenotypes for arabidopsis and wheat.

    Science.gov (United States)

    Zhou, Ji; Applegate, Christopher; Alonso, Albor Dobon; Reynolds, Daniel; Orford, Simon; Mackiewicz, Michal; Griffiths, Simon; Penfield, Steven; Pullen, Nick

    2017-01-01

    Plants demonstrate dynamic growth phenotypes that are determined by genetic and environmental factors. Phenotypic analysis of growth features over time is a key approach to understand how plants interact with environmental change as well as respond to different treatments. Although the importance of measuring dynamic growth traits is widely recognised, available open software tools are limited in terms of batch image processing, multiple traits analyses, software usability and cross-referencing results between experiments, making automated phenotypic analysis problematic. Here, we present Leaf-GP (Growth Phenotypes), an easy-to-use and open software application that can be executed on different computing platforms. To facilitate diverse scientific communities, we provide three software versions, including a graphic user interface (GUI) for personal computer (PC) users, a command-line interface for high-performance computer (HPC) users, and a well-commented interactive Jupyter Notebook (also known as the iPython Notebook) for computational biologists and computer scientists. The software is capable of extracting multiple growth traits automatically from large image datasets. We have utilised it in Arabidopsis thaliana and wheat ( Triticum aestivum ) growth studies at the Norwich Research Park (NRP, UK). By quantifying a number of growth phenotypes over time, we have identified diverse plant growth patterns between different genotypes under several experimental conditions. As Leaf-GP has been evaluated with noisy image series acquired by different imaging devices (e.g. smartphones and digital cameras) and still produced reliable biological outputs, we therefore believe that our automated analysis workflow and customised computer vision based feature extraction software implementation can facilitate a broader plant research community for their growth and development studies. Furthermore, because we implemented Leaf-GP based on open Python-based computer vision, image

  20. TaNAC1 acts as a negative regulator of stripe rust resistance in wheat, enhances susceptibility to Pseudomonas syringae, and promotes lateral root development in transgenic Arabidopsis thaliana

    Directory of Open Access Journals (Sweden)

    Fengtao eWang

    2015-02-01

    Full Text Available Plant-specific NAC transcription factors constitute a large family and play important roles in regulating plant developmental processes and responses to environmental stresses, but only some of them have been investigated for effects on disease reaction in cereal crops. Virus-induced gene silencing (VIGS is an effective strategy for rapid functional analysis of genes in plant tissues. In this study, TaNAC1, encoding a new member of the NAC1 subgroup, was cloned from bread wheat and characterized. It is a transcription factor localized in the cell nucleus, and contains an activation domain in its C-terminal. TaNAC1 was strongly expressed in wheat roots and was involved in responses to infection by the obligate pathogen Puccinia striiformis f. sp. tritici and defense-related hormone treatments such as salicylic acid, methyl jasmonate and ethylene. Knockdown of TaNAC1 with barley stripe mosaic virus-induced gene silencing (BSMV-VIGS enhanced stripe rust resistance. TaNAC1-overexpression in Arabidopsis plants gave enhanced susceptibility, attenuated systemic-acquired resistance to Pseudomonas syringae DC3000, and promoted lateral root development. Jasmonic acid-signaling pathway genes PDF1.2 and ORA59 were constitutively expressed in transgenic plants. TaNAC1 overexpression suppressed the expression levels of resistance-related genes PR1 and PR2 involved in SA signaling and AtWRKY70, which functions as a connection node between the JA- and SA-signaling pathways. Collectively, TaNAC1 is a novel NAC member of the NAC1 subgroup, negatively regulates plant disease resistance, and may modulate plant JA- and SA-signaling defense cascades.

  1. Allelopathic effects of eucalyptus camaldulensis leaf leachate on the growth of wheat and green gram and its control by farm yard manure

    International Nuclear Information System (INIS)

    Ibrahim, S.; Bibi, S.

    2012-01-01

    Farm Yard Manure (FYM) significantly reduced the allelopathic effects of Eucalyptus camaldulensis leachate. This influence was studied on morphological and physiological aspect of two taxonomically different plants (wheat and green gram). E. camaldulensis aqueous leachate applied (4), 1% and 5% alone and together with FYM and the results showed that E. camaldulensis leaf leachate had inhibitory effects on wheat growth, while promoted shoot and root growth in green gram when supplied in low concentration. The combined effects of litter and FYM reduced the inhibitory effects of leachate and supported the growth of both plants. These results suggested that, if both studied crops have to be cultivated in an agricultural land surrounded by E. camaldulensis tree, the possible growth rate could be supported by the application of FYM. But in the absence of this support, the plant growth was significantly arrested due to allelopathic effect of E. ctunaldulensis leaf leachate. (author)

  2. Allelopathic effects of eucalyptus camaldulensis leaf leachate on the growth of wheat and green gram and its control by farm yard manure

    International Nuclear Information System (INIS)

    Ibrahim, S.; Bibi, S.

    2012-01-01

    Farm Yard Manure (FYM) significantly reduced the allelopathic effects of Eucalyptus camaldulensis leachate. This influence was studied on morphological and physiological aspect of two taxonomically different plants (wheat and green gram). E. camaldtllensis aqueous leachate applied at the rate of 1% and 5% alone and together with FYM and the results showed that E. camaldulensis leaf leachate had inhibitory effects on wheat growth, while promoted shoot and root growth in green gram when supplied in low concentration. The combined effects of litter and FYM reduced the inhibitory effects of leachate and supported the growth of both plants. These results suggested that, if both studied crops have to be cultivated in an agricultural land surrounded by E. camaldulensis tree, the possible growth rate could be supported by the application Of FYM. But in the absence of this support, the plant growth was significantly arrested due to allelopathic effect of E. camaldulensis leaf leachate. (author)

  3. Transformation of the flax rust fungus, Melampsora lini: selection via silencing of an avirulence gene

    OpenAIRE

    Lawrence, Gregory J.; Dodds, Peter N.; Ellis, Jeffrey G.

    2009-01-01

    Rust fungi cause devastating diseases on many important food crops, with a damaging stem rust epidemic currently affecting wheat production in Africa and the Middle East. These parasitic fungi propagate exclusively on plants, precluding the use of many biotechnological tools available for other culturable fungi. In particular the lack of a stable transformation system has been an impediment to the genetic manipulation required for molecular analysis of rust pathogenicity. We have developed an...

  4. Fine mapping TaFLW1, a major QTL controlling flag leaf width in bread wheat (Triticum aestivum L.).

    Science.gov (United States)

    Xue, Shulin; Xu, Feng; Li, Guoqiang; Zhou, Yan; Lin, Musen; Gao, Zhongxia; Su, Xiuhong; Xu, Xiaowu; Jiang, Ge; Zhang, Shuang; Jia, Haiyan; Kong, Zhongxin; Zhang, Lixia; Ma, Zhengqiang

    2013-08-01

    Flag leaf width (FLW) is directly related to photosynthetic capacity and yield potential in wheat. In a previous study, Qflw.nau-5A controlling FLW was detected on chromosome 5A in the interval possessing Fhb5 for type I Fusarium head blight (FHB) resistance using a recombinant inbred line population derived from Nanda2419 × Wangshuibai. Qflw.nau-5A near-isogenic line (NIL) with the background of Mianyang 99-323 and PH691 was developed and evaluated. FLW inheritance was investigated using two F2 populations developed from crossing the Qflw.nau-5A NILs with their recurrent parents. One hundred ten and 28 recombinants, which included 10 and 5 types of recombinants, were identified from 2816 F2 plants with Mianyang 99-323 background and 1277 F2 plants with PH691 background, respectively, and phenotyped in field trials for FLW and type I FHB resistance. Deletion bin mapping was applied to physically map Qflw.nau-5A. The introduction of Wangshuibai Qflw.nau-5A allele reduced the FLW up to 3 mm. In the F2 populations, Qflw.nau-5A was inherited like a semi-dominant gene, and was therefore designated as TaFLW1. The FLW of the recombinant lines displayed a distinct two-peak distribution. Recombinants with wider leaves commonly have Mianyang 99-323 or PH691 chromatin in the 0.2 cM Xwmc492-Xwmc752 interval that resided in the 5AL12-0.35-0.57 deletion bin, and recombinants with narrow leaves were Wangshuibai genotype in this interval. Phenotypic recombination between FLW and type I FHB resistance was identified, implying TaFLW1 was in close linkage with Fhb5. These results should aid wheat breeders to break the linkage drag through marker-assisted selection and assist in the map-based cloning of TaFLW1.

  5. Recent invasion of world-wide wheat growing areas by two aggressive strains of Puccinia striiformis

    DEFF Research Database (Denmark)

    Walter, Stephanie; Ali, Sajid; Justesen, Annemarie Fejer

    2012-01-01

    The ever more frequent and severe large-scale epidemics of wheat yellow/stripe rust disease (caused by Puccinia striiformis) pose a severe threat to the world’s wheat production (Hovmøller et al. 2010). The onset of a new series of world-wide wheat yellow rust epidemics in 2000 has been linked...

  6. Relationship between incident radiation, leaf area and dry-matter yield in wheat

    International Nuclear Information System (INIS)

    Saini, A.D.; Nanda, R.

    1986-01-01

    Light-utilization efficiency was evaluated between 20 and 50 days of crop growth period in 'Kalyansona', 'Sonalika' (semi-dwarf), 'Hindi 62' (tall) varieties of bread-wheat (Triticum aestivum Linn. emend., Fiori and Paol.) and semi-dwarf 'HD 4502' variety of macaroni wheat (T. durum Desf.). In the first model, the relationship between absorbed photosynthetic radiation and crop growth rates showed above-ground dry matter of 2.9 g in 'Sonalika', 2.5 g each in 'Kalyansona' and 'HD 4502' and 1.8 g in 'Hindi 62' were produced for each megajoule of absorbed photosynthetic radiation corresponding to the growth efficiency of 5.1, 4.4 and 3.1% respectively. In the second model of partial regression analysis, the rate of change in dry matter due to mean green area index as well as photosynthetic radiation was low in 'Hindi 62'. However, the dry matter changes due to mean green area index were similar in 'Kalyansona', 'HD4502' and 'Sonalika', but was high due to photosynthetic radiation in 'Sonalika' only. Both models gave similar conclusion

  7. Overexpression of the TaSHN1 transcription factor in bread wheat leads to leaf surface modifications, improved drought tolerance and no yield penalty under controlled growth conditions.

    Science.gov (United States)

    Bi, Huihui; Shi, Jianxin; Kovalchuk, Natalia; Luang, Sukanya; Bazanova, Natalia; Chirkova, Larissa; Zhang, Dabing; Shavrukov, Yuri; Stepanenko, Anton; Tricker, Penny; Langridge, Peter; Hrmova, Maria; Lopato, Sergiy; Borisjuk, Nikolai

    2018-05-14

    Transcription factors regulate multiple networks, mediating the responses of organisms to stresses, including drought. Here we investigated the role of the wheat transcription factor TaSHN1 in crop growth and drought tolerance. TaSHN1, isolated from bread wheat, was characterised for molecular interactions and functionality. The overexpression of TaSHN1 in wheat was followed by the evaluation of T 2 and T 3 transgenic lines for drought tolerance, growth and yield components. Leaf surface changes were analysed by light microscopy, SEM, TEM and GC-MS/GC-FID. TaSHN1 behaves as a transcriptional activator in a yeast transactivation assay and binds stress-related DNA cis-elements, determinants of which were revealed using 3D molecular modelling. The overexpression of TaSHN1 in transgenic wheat did not result in a yield penalty under the controlled plant growth conditions of a glasshouse. Transgenic lines had significantly lower stomatal density and leaf water loss, and exhibited improved recovery after severe drought, compared to control plants. The comparative analysis of cuticular waxes revealed an increased accumulation of alkanes in leaves of transgenic lines. Our data demonstrate that TaSHN1 may operate as a positive modulator of drought stress tolerance. Positive attributes could be mediated through an enhanced accumulation of alkanes and reduced stomatal density. This article is protected by copyright. All rights reserved.

  8. [PS II photochemical efficiency in flag leaf of wheat varieties and its adaptation to strong sun- light intensity on farmland of Xiangride in Qinghai Province, Northwest China].

    Science.gov (United States)

    Shi, Sheng-Bo; Chen, Wen-Jie; Shi, Rui; Li, Miao; Zhang, Huai-Gang; Sun, Ya-Nan

    2014-09-01

    Taking four wheat varieties developed by Northwest Institute of Plateau Biology, Chinese Academy of Sciences, as test materials, with the measurement of content of photosynthetic pigments, leaf area, fresh and dry mass of flag leaf, the PS II photochemistry efficiency of abaxial and adaxial surface of flag leaf and its adaptation to strong solar radiation during the period of heading stage in Xiangride region were investigated with the pulse-modulated in-vivo chlorophyll fluorescence technique. The results indicated that flag leaf angle mainly grew in horizontal state in Gaoyuan 314, Gaoyuan 363 and Gaoyuan 584, and mainly in vertical state in Gaoyuan 913 because of its smaller leaf area and larger width. Photosynthetic pigments were different among the 4 varieties, and positively correlated with intrinsic PS II photochemistry efficiencies (Fv/Fm). In clear days, especially at noon, the photosynthetic photoinhibition was more serious in abaxial surface of flag leaf due to directly facing the solar radiation, but it could recover after reduction of sunlight intensity in the afternoon, which meant that no inactive damage happened in PS II reaction centers. There were significant differences of PS II actual and maximum photochemical efficiencies at the actinic light intensity (ΦPS II and Fv'/Fm') between abaxial and adaxial surface, and their relative variation trends were on the contrary. The photochemical and non-photochemical quenching coefficients (qP and NPQ) had a similar tendency in both abaxial and adaxial surfaces. Although ΦPS II and qP were lower in adaxial surface of flag leaf, the Fv'/Fm' was significantly higher, which indicated that the potential PS II capture efficiency of excited energy was higher. The results demonstrated that process of photochemical and non-photochemical quenching could effectively dissipate excited energy caused by strong solar radiation, and there were higher adaptation capacities in wheat varieties natively cultivated in

  9. Studies of the genetics of inheritance of stem rust resistance in ...

    African Journals Online (AJOL)

    Five resistant wheat lines (KSL-2, KSL-3, KSL-5, KSL-12 and KSL-19) which were resistant in tests during 2008, 2009 and 2010 were used as parents in crosses with stem rust susceptible line CACUKE to develop genetic populations for determining the inheritance of resistance to stem rust. F3 populations were evaluated ...

  10. Studies of the genetics of inheritance of stem rust resistance in ...

    African Journals Online (AJOL)

    User

    2013-05-22

    May 22, 2013 ... increased production of wheat could help to ensure food and nutritional ... also characterized by genes with additive effects and non hypersensitive .... to create an artificial stem rust epidemic in the field (Hickey et al.,. 2012 ...

  11. Water- and nitrogen-dependent alterations in the inheritance mode of transpiration efficiency in winter wheat at the leaf and whole-plant level.

    Science.gov (United States)

    Ratajczak, Dominika; Górny, Andrzej G

    2012-11-01

    The effects of contrasting water and nitrogen (N) supply on the observed inheritance mode of transpiration efficiency (TE) at the flag-leaf and whole-season levels were examined in winter wheat. Major components of the photosynthetic capacity of leaves and the season-integrated efficiency of water use in vegetative and grain mass formation were evaluated in parental lines of various origins and their diallel F(2)-hybrids grown in a factorial experiment under different moisture and N status of the soil. A broad genetic variation was mainly found for the season-long TE measures. The variation range in the leaf photosynthetic indices was usually narrow, but tended to slightly enhance under water and N shortage. Genotype-treatment interaction effects were significant for most characters. No consistency between the leaf- and season-long TE measures was observed. Preponderance of additivity-dependent variance was mainly identified for the season-integrated TE and leaf CO(2) assimilation rate. Soil treatments exhibited considerable influence on the phenotypic expression of gene action for the residual leaf measures. The contribution of non-additive gene effects and degree of dominance tended to increase in water- and N-limited plants, especially for the leaf transpiration rate and stomatal conductance. The results indicate that promise exists to improve the season-integrated TE. However, selection for TE components should be prolonged for later hybrid generations to eliminate the masking of non-additive causes. Such evaluation among families grown under sub-optimal water and nitrogen supply seems to be the most promising strategy in winter wheat.

  12. Construction and characterization of a full-length cDNA library for the wheat stripe rust pathogen (Puccinia striiformis f. sp. tritici

    Directory of Open Access Journals (Sweden)

    Chen Xianming

    2007-06-01

    Full Text Available Abstract Background Puccinia striiformis is a plant pathogenic fungus causing stripe rust, one of the most important diseases on cereal crops and grasses worldwide. However, little is know about its genome and genes involved in the biology and pathogenicity of the pathogen. We initiated the functional genomic research of the fungus by constructing a full-length cDNA and determined functions of the first group of genes by sequence comparison of cDNA clones to genes reported in other fungi. Results A full-length cDNA library, consisting of 42,240 clones with an average cDNA insert of 1.9 kb, was constructed using urediniospores of race PST-78 of P. striiformis f. sp. tritici. From 196 sequenced cDNA clones, we determined functions of 73 clones (37.2%. In addition, 36 clones (18.4% had significant homology to hypothetical proteins, 37 clones (18.9% had some homology to genes in other fungi, and the remaining 50 clones (25.5% did not produce any hits. From the 73 clones with functions, we identified 51 different genes encoding protein products that are involved in amino acid metabolism, cell defense, cell cycle, cell signaling, cell structure and growth, energy cycle, lipid and nucleotide metabolism, protein modification, ribosomal protein complex, sugar metabolism, transcription factor, transport metabolism, and virulence/infection. Conclusion The full-length cDNA library is useful in identifying functional genes of P. striiformis.

  13. Defining the predicted protein secretome of the fungal wheat leaf pathogen Mycosphaerella graminicola.

    Directory of Open Access Journals (Sweden)

    Alexandre Morais do Amaral

    Full Text Available The Dothideomycete fungus Mycosphaerella graminicola is the causal agent of Septoria tritici blotch, a devastating disease of wheat leaves that causes dramatic decreases in yield. Infection involves an initial extended period of symptomless intercellular colonisation prior to the development of visible necrotic disease lesions. Previous functional genomics and gene expression profiling studies have implicated the production of secreted virulence effector proteins as key facilitators of the initial symptomless growth phase. In order to identify additional candidate virulence effectors, we re-analysed and catalogued the predicted protein secretome of M. graminicola isolate IPO323, which is currently regarded as the reference strain for this species. We combined several bioinformatic approaches in order to increase the probability of identifying truly secreted proteins with either a predicted enzymatic function or an as yet unknown function. An initial secretome of 970 proteins was predicted, whilst further stringent selection criteria predicted 492 proteins. Of these, 321 possess some functional annotation, the composition of which may reflect the strictly intercellular growth habit of this pathogen, leaving 171 with no functional annotation. This analysis identified a protein family encoding secreted peroxidases/chloroperoxidases (PF01328 which is expanded within all members of the family Mycosphaerellaceae. Further analyses were done on the non-annotated proteins for size and cysteine content (effector protein hallmarks, and then by studying the distribution of homologues in 17 other sequenced Dothideomycete fungi within an overall total of 91 predicted proteomes from fungal, oomycete and nematode species. This detailed M. graminicola secretome analysis provides the basis for further functional and comparative genomics studies.

  14. Phenotyping of field-grown wheat in the UK highlights contribution of light response of photosynthesis and flag leaf longevity to grain yield.

    Science.gov (United States)

    Carmo-Silva, Elizabete; Andralojc, P John; Scales, Joanna C; Driever, Steven M; Mead, Andrew; Lawson, Tracy; Raines, Christine A; Parry, Martin A J

    2017-06-15

    Improving photosynthesis is a major target for increasing crop yields and ensuring food security. Phenotyping of photosynthesis in the field is critical to understand the limits to crop performance in agricultural settings. Yet, detailed phenotyping of photosynthetic traits is relatively scarce in field-grown wheat, with previous studies focusing on narrow germplasm selections. Flag leaf photosynthetic traits, crop development, and yield traits were compared in 64 field-grown wheat cultivars in the UK. Pre-anthesis and post-anthesis photosynthetic traits correlated significantly and positively with grain yield and harvest index (HI). These traits included net CO2 assimilation measured at ambient CO2 concentrations and a range of photosynthetic photon flux densities, and traits associated with the light response of photosynthesis. In most cultivars, photosynthesis decreased post-anthesis compared with pre-anthesis, and this was associated with decreased Rubisco activity and abundance. Heritability of photosynthetic traits suggests that phenotypic variation can be used to inform breeding programmes. Specific cultivars were identified with traits relevant to breeding for increased crop yields in the UK: pre-anthesis photosynthesis, post-anthesis photosynthesis, light response of photosynthesis, and Rubisco amounts. The results indicate that flag leaf longevity and operating photosynthetic activity in the canopy can be further exploited to maximize grain filling in UK bread wheat. © The Author 2017. Published by Oxford University Press on behalf of the Society for Experimental Biology.

  15. Morphology and AFLP markers suggest three Hordeum chilense ecotypes that differ in avoidance to rust fungi

    NARCIS (Netherlands)

    Vaz Patto, M.C.; Aardse, A.; Buntjer, J.; Rubiales, D.; Martin, A.; Niks, R.E.

    2001-01-01

    In Hordeum chilense Roem. & Schult., a high variation in the level of avoidance to infection of barley leaf rust (Puccinia hordei Otth) occurs. Probably resulting from the properties of the stomata, the rust germ tube overgrows stomata, and the infection process fails in an early stage. In the

  16. FAR5, a fatty acyl-coenzyme A reductase, is involved in primary alcohol biosynthesis of the leaf blade cuticular wax in wheat (Triticum aestivum L.).

    Science.gov (United States)

    Wang, Yong; Wang, Meiling; Sun, Yulin; Wang, Yanting; Li, Tingting; Chai, Guaiqiang; Jiang, Wenhui; Shan, Liwei; Li, Chunlian; Xiao, Enshi; Wang, Zhonghua

    2015-03-01

    A waxy cuticle that serves as a protective barrier against non-stomatal water loss and environmental damage coats the aerial surfaces of land plants. It comprises a cutin polymer matrix and waxes. Cuticular waxes are complex mixtures of very long chain fatty acids (VLCFAs) and their derivatives. Results show that primary alcohols are the major components of bread wheat (Triticum aestivum L.) leaf blade cuticular waxes. Here, the characterization of TaFAR5 from wheat cv Xinong 2718, which is allelic to TAA1b, an anther-specific gene, is reported. Evidence is presented for a new function for TaFAR5 in the biosynthesis of primary alcohols of leaf blade cuticular wax in wheat. Expression of TaFAR5 cDNA in yeast (Saccharomyces cerevisiae) led to production of C22:0 primary alcohol. The transgenic expression of TaFAR5 in tomato (Solanum lycopersicum) cv MicroTom leaves resulted in the accumulation of C26:0, C28:0, and C30:0 primary alcohols. TaFAR5 encodes an alcohol-forming fatty acyl-coenzyme A reductase (FAR). Expression analysis revealed that TaFAR5 was expressed at high levels in the leaf blades, anthers, pistils, and seeds. Fully functional green fluorescent protein-tagged TaFAR5 protein was localized to the endoplasmic reticulum (ER), the site of primary alcohol biosynthesis. SDS-PAGE analysis indicated that the TaFAR5 protein possessed a molecular mass of 58.4kDa, and it was also shown that TaFAR5 transcript levels were regulated in response to drought, cold, and abscisic acid (ABA). Overall, these data suggest that TaFAR5 plays an important role in the synthesis of primary alcohols in wheat leaf blade. © The Author 2014. Published by Oxford University Press on behalf of the Society for Experimental Biology. All rights reserved. For permissions, please email: journals.permissions@oup.com.

  17. Herança da resistência do Híbrido de Timor UFV 443-03 à ferrugem-do-cafeeiro Inheritance of coffee leaf rust resistance in Timor Hybrid UFV 443-03

    Directory of Open Access Journals (Sweden)

    Alexandre Sandri Capucho

    2009-03-01

    Full Text Available O objetivo deste trabalho foi caracterizar a herança da resistência do Híbrido de Timor UFV 443-03 à ferrugem-do-cafeeiro (Hemileia vastatrix. Para isso, a raça II e o patótipo 001 de ferrugem foram inoculados em 246 plantas da população F2, 115 plantas do retrocruzamento suscetível (RC S e 87 plantas do retrocruzamento resistente (RC R, originadas do cruzamento entre o genótipo suscetível cv. Catuaí Amarelo IAC 64 e a fonte de resistência Híbrido de Timor UFV 443-03. Para ambos os inóculos, a cv. Catuaí Amarelo IAC 64 foi suscetível, enquanto o Híbrido de Timor UFV 443-03, a planta representante da geração F1 e as plantas do RC R foram resistentes. As plantas F2, quando inoculadas com a raça II, apresentaram dois padrões de segregação significativos: 15:1 e 61:3. A herança da resistência foi confirmada pela inoculação das plantas do RC S, que segregaram na proporção de 3:1, padrão esperado para herança condicionada por dois genes. A hipótese de segregação 7:1 para três genes foi rejeitada. Resultados semelhantes foram obtidos para o patótipo 001. Dois genes dominantes e independentes conferem a resistência genética do Híbrido de Timor UFV 443-03 à raça II e ao patótipo 001 de H. vastatrix.The aim of this work was to characterize the resistance inheritance of the Timor Hybrid UFV 443-03 to coffee leaf rust (Hemileia vastatrix. For this, the race II and pathotype 001 of coffee leaf rust were inoculated in 246 F2 plants, 115 susceptible backcrossing (BCS plants, and 87 resistant backcrossing (BC R plants, derived from the crossing between the susceptible genotype 'Catuaí Amarelo' IAC 64 and the resistance source Timor Hybrid UFV 443-03. For both inoculums, the 'Catuaí Amarelo' IAC 64 was susceptible, while the Timor Hybrid, the plant representing F1 generation, and the BC R plants were resistant. The F2 plants inoculated with race II presented two significant segregation ratios: 15:1 and 61:3. The

  18. Influence of yellow rust infection on /sup 32/P transport in detached barley leaves

    Energy Technology Data Exchange (ETDEWEB)

    Schubert, J. (Akademie der Landwirtschaftswissenschaften der DDR, Aschersleben. Inst. fuer Phytopathologie)

    1982-01-01

    Several barley cultivars (Hordeum vulgare L.) differing in their resistance to yellow rust (Puccinia striiformis West.) were tested for relationships between changes of /sup 32/P transport in detached leaves and resistance to yellow rust disease. Investigation carried out with detached second leaves from plants infected at their first leaf revealed a matter transport in these leaves changed by the infection. Transport was also influenced by inoculation with yellow rust uredospores. In that case rust infection influenced the basipetal transport less strongly in resistent plants than in susceptible ones. Connected with the findings the influence of fungal substances on transport processes is discussed in general.

  19. Influence of yellow rust infextion on 32P transport in detached barley leaves

    International Nuclear Information System (INIS)

    Schubert, J.

    1982-01-01

    Several barley cultivars (Hordeum vulgare L.) differing in their resistance to yellow rust (Puccinia striiformis West.) were tested for relationships between changes of 32 P transport in detached leaves and resistance to yellow rust disease. Investigation carried out with detached second leaves from plants infected at their first leaf revealed a matter transport in these leaves changed by the infection. Transport was also influenced by inoculation with yellow rust uredospores. In that case rust infection influenced the basipetal transport less strongly in resistent plants than in susceptible ones. Connected with the findings the influence of fungal substances on transport processes is discussed in general. (author)

  20. Anatomical features of leaves of three cultivars of winter wheat (Triticum aestivum L. and settling the plants by cereal leaf beetles, Oulema spp. (Coleoptera, Chrysomelidae

    Directory of Open Access Journals (Sweden)

    Elżbieta Weryszko-Chmielewska

    2013-12-01

    Full Text Available Investigations of flag leaves anatomy of three winter wheat cultivars: Almari, Gama and Weneda were carried out as it was state that there are great differences in the intensity of cereal leaf beetle feeding on the leaves. In order to determine the features conditioning the differentiated resistance of these cultivars following parameters were measured: the thickness of leaf blade, the length of trichomes and their density in the adaxial epidermis, the number of silicon cells in 1 mm2 epidermis and the thickness of the external cell walls of epidermis. The observations of cross section of the leaves were made in a light microscope and that of surface of the adaxial epidermis in a scanning electron microscope. In this study it was shown that Gama cv. distinguishes of the shortest trichomes with poor density, the lowest number of the silicon cells in 1 mm2 and epidermis cells with the thinest walls. This features indicate a poor resistance of Gama cv. against feeding of the pests and give reasons for the presence a much higher number of the cereal leaf beetle larvae (about 100% than at the extant two cultivars. Dependence between the thickness of leaf blades and the number of larvae of the infesting pests has not been stated.

  1. New Rust Disease of Korean Willow (Salix koreensis) Caused by Melampsora yezoensis, Unrecorded Pathogen in Korea.

    Science.gov (United States)

    Yun, Yeo Hong; Ahn, Geum Ran; Yoon, Seong Kwon; Kim, Hoo Hyun; Son, Seung Yeol; Kim, Seong Hwan

    2016-12-01

    During the growing season of 2015, leaf specimens with yellow rust spots were collected from Salix koreensis Andersson, known as Korean willow, in riverine areas in Cheonan, Korea. The fungus on S. koreensis was identified as the rust species, Melampsora yezoensis , based on the morphology of urediniospores observed by light and scanning electron microscopy, and the molecular properties of the internal transcribed spacer rDNA region. Pathogenicity tests confirmed that the urediniospores are the causal agent of the rust symptoms on the leaves and young stems of S. koreensis . Here, we report a new rust disease of S. koreensis caused by the rust fungus, M. yezoensis , a previously unrecorded rust pathogen in Korea.

  2. Obligate Biotrophy Features Unraveled by the Genomic Analysis of the Rust Fungi, Melampsora larici-populina and Puccinia graminis f. sp. tritici

    Energy Technology Data Exchange (ETDEWEB)

    Duplessis, Sebastien; Cuomo, Christina A.; Lin, Yao-Cheng; Aerts, Andrea; Tisserant, Emilie; Veneault-Fourrey, Claire; Joly, David L.; Hacquard, Stephane; Amselem, Joelle; Cantarel, Brandi; Chiu, Readman; Couthinho, Pedro; Feau, Nicolas; Field, Matthew; Frey, Pascal; Gelhaye, Eric; Goldberg, Jonathan; Grabherr, Manfred; Kodira, Chinnappa; Kohler, Annegret; Kues, Ursula; Lindquist, Erika; Lucas, Susan; Mago, Rohit; Mauceli, Evan; Morin, Emmanuelle; Murat, Claude; Pangilinan, Jasmyn L.; Park, Robert; Pearson, Matthew; Quesneville, Hadi; Rouhier, Nicolas; Sakthikumar, Sharadha; Salamov, Asaf A.; Schmutz, Jeremy; Selles, Benjamin; Shapiro, Harris; Tangay, Philippe; Tuskan, Gerald A.; Peer, Yves Van de; Henrissat, Bernard; Rouze, Pierre; Ellis, Jeffrey G.; Dodds, Peter N.; Schein, Jacqueline E.; Zhong, Shaobin; Hamelin, Richard C.; Grigoriev, Igor V.; Szabo, Les J.; Martin1, Francis

    2011-04-27

    Rust fungi are some of the most devastating pathogens of crop plants. They are obligate biotrophs, which extract nutrients only from living plant tissues and cannot grow apart from their hosts. Their lifestyle has slowed the dissection of molecular mechanisms underlying host invasion and avoidance or suppression of plant innate immunity. We sequenced the 101 mega base pair genome of Melampsora larici-populina, the causal agent of poplar leaf rust, and the 89 mega base pair genome of Puccinia graminis f. sp. tritici, the causal agent of wheat and barley stem rust. We then compared the 16,841 predicted proteins of M. larici-populina to the 18,241 predicted proteins of P. graminis f. sp tritici. Genomic features related to their obligate biotrophic life-style include expanded lineage-specific gene families, a large repertoire of effector-like small secreted proteins (SSPs), impaired nitrogen and sulfur assimilation pathways, and expanded families of amino-acid, oligopeptide and hexose membrane transporters. The dramatic upregulation of transcripts coding for SSPs, secreted hydrolytic enzymes, and transporters in planta suggests that they play a role in host infection and nutrient acquisition. Some of these genomic hallmarks are mirrored in the genomes of other microbial eukaryotes that have independently evolved to infect plants, indicating convergent adaptation to a biotrophic existence inside plant cells

  3. Comparative role of neem seed extract, moringa leaf extract and imidacloprid in the management of wheat aphids in relation to yield losses in Pakistan.

    Science.gov (United States)

    Shah, Farhan Mahmood; Razaq, Muhammad; Ali, Abid; Han, Peng; Chen, Julian

    2017-01-01

    Wheat being staple food of Pakistan is constantly attacked by major wheat aphid species, Schizaphis graminum (R.), Rhopalosiphum padi (L.) and Sitobion avenae (F.). Due to concern on synthetic chemical use in wheat, it is imperative to search for alternative environment- and human- friendly control measures such as botanical pesticides. In the present study, we evaluated the comparative role of neem seed extract (NSE), moringa leaf extract (MLE) and imidacloprid (I) in the management of the aphid as well as the yield losses parameters in late planted wheat fields. Imidacloprid reduced significantly aphids infestation compared to the other treatments, hence resulting in higher yield, particularly when applied with MLE. The percentages of yield increase in I+MLE treated plots over the control were 19.15-81.89% for grains per spike, 5.33-37.62% for thousand grain weight and 27.59-61.12% for yield kg/ha. NSE was the second most effective control measure in suppressing aphid population, but the yield protected by NSE treatment over the control was comparable to that by imidacloprid. Population densities of coccinellids and syrphids in the plots treated with NSE-2 were higher than those treated with imidacloprid in two out of three experiments during 2013-14. Low predator density in imidacloprid-treated plots was attributed to the lower availability of prey aphids. The efficacy of NSE against aphids varied depending on degree of synchronization among the application timing, the activity of aphids, crop variety and environmental conditions. Despite that, we suggested NSE to be a promising alternative botanical insecticide compared to the most commonly recommended imidiacloprid. Further studies should consider the side effects of biopesticides on non-target organisms in order to provide better management practices in the field.

  4. Swedish Spring Wheat Varieties with the Rare High Grain Protein Allele of NAM-B1 Differ in Leaf Senescence and Grain Mineral Content

    Science.gov (United States)

    Asplund, Linnéa; Bergkvist, Göran; Leino, Matti W.; Westerbergh, Anna; Weih, Martin

    2013-01-01

    Some Swedish spring wheat varieties have recently been shown to carry a rare wildtype (wt) allele of the gene NAM-B1, known to affect leaf senescence and nutrient retranslocation to the grain. The wt allele is believed to increase grain protein concentration and has attracted interest from breeders since it could contribute to higher grain quality and more nitrogen-efficient varieties. This study investigated whether Swedish varieties with the wt allele differ from varieties with one of the more common, non-functional alleles in order to examine the effect of the gene in a wide genetic background, and possibly explain why the allele has been retained in Swedish varieties. Forty varieties of spring wheat differing in NAM-B1 allele type were cultivated under controlled conditions. Senescence was monitored and grains were harvested and analyzed for mineral nutrient concentration. Varieties with the wt allele reached anthesis earlier and completed senescence faster than varieties with the non-functional allele. The wt varieties also had more ears, lighter grains and higher yields of P and K. Contrary to previous information on effects of the wt allele, our wt varieties did not have increased grain N concentration or grain N yield. In addition, temporal studies showed that straw length has decreased but grain N yield has remained unaffected over a century of Swedish spring wheat breeding. The faster development of wt varieties supports the hypothesis of NAM-B1 being preserved in Fennoscandia, with its short growing season, because of accelerated development conferred by the NAM-B1 wt allele. Although the possible effects of other gene actions were impossible to distinguish, the genetic resource of Fennoscandian spring wheats with the wt NAM-B1 allele is interesting to investigate further for breeding purposes. PMID:23555754

  5. Characterization of a new synthetic wheat – Aegilops biuncialis ...

    African Journals Online (AJOL)

    The aim of the experiments was to identify the synthetic wheat – Aegilops biuncialis germplasm Line 15-3-2 with 42 chromosomes. Morphologically, the spike of line 15-3-2 is intermediate to those of its wheat and Aegilops parents. Line 15-3-2 displays stable fertility and immunity to wheat powdery mildew and stripe rust.

  6. Recovery of leaf elongation during short term osmotic stress correlates with osmotic adjustment and cell turgor restoration in different durum wheat cultivars

    International Nuclear Information System (INIS)

    Mahdid, M.

    2014-01-01

    In order to investigate the responses of leaf elongation rate (LER), turgor and osmotic adjustment (OA) during a short-term stress (7 hours) imposed by PEG6000 and a recovery phase, three durum wheat (Triticum durum L.) varieties (Inrat; MBB; and OZ ) were grown in aerated nutrient solutions. Leaf elongation kinetics of leaf 3 was estimated using LVDT. Turgor was estimated using a cell pressure probe; osmotic potential as well as total sugars and potassium (K+) concentrations were estimated from expressed sap of elongation zone. Growth recovered rapidly and then stabilised at a lower value. A significant difference was found in % recovery of LER between the varieties. The cessation of growth after stress coincided with a decrease in turgor followed by a recovery period reaching control values in MBB and Inrat. A strong correlation (R2 = 0.83) between the reduction in turgor (turgor) and % recovery of LER was found at 7 hours after stress. The difference in the partial recovery of LER between varieties was thus related to the capacity of partial turgor recovery. Partial turgor recovery is associated with sugar or K+ based OA which indicates its importance in maintaining high LER values under water deficit. (author)

  7. Mutational rectification for resistance to diseases in rice and bread wheat

    International Nuclear Information System (INIS)

    Chakrabarti, S.N.; Kar, G.N.; Sen, B.

    1976-01-01

    The mutation breeding programme with a view to rectify the defects of severe susceptibility to important diseases of a few varieties of rice and bread wheat was undertaken using different mutagenic treatments with radiation (X-rays and gamma rays), chemical mutagens (EMS, NMU, NEU) and combination of radiation and chemical mutagens (gamma rays + EMS). In rice two mutant strains have shown moderate resistance to helminthosporiose, one strain to both helminthosporiose and blast and five strains resistant to bacterial leaf blight under artificial epiphytotic conditions. In bread wheat, out of large M 2 population, derived from different mutagenic treatments, the frequencies of appearance of mutants resistant to rust diseases were observed to be 0.03 percent in H.D. 1944 from 0.2 percent EMS treatment, 0.06 percent in H.D. 1999 from 0.01 percent NEU treatment and 0.07 percent in Kalyan Sona from combined treatment with 20 krad gamma rays and 0.4 percent EMS. The mutants bred true for resistance upto M 6 generations. A few of the mutants, resistant to different diseases in rjce and bread wheat, proved to be very promising in yield. An early (earlier to Kalyan Sona by 25 days) mutant, derived from Kalyan Sona, topped in yield out of 49 varieties tested in 1974l75 in Delhi and Pusa. The Kalyan Sona early tested in 1974-75 in Delhi and Pusa. The Kalyan Sona early mutant is having resistance to yellow and brown rusts. (author)

  8. Leaf Gas Exchange and Fluorescence of Two Winter Wheat Varieties in Response to Drought Stress and Nitrogen Supply.

    Science.gov (United States)

    Wang, Xiubo; Wang, Lifang; Shangguan, Zhouping

    2016-01-01

    Water and nitrogen supply are the two primary factors limiting productivity of wheat (Triticum aestivum L.). In our study, two winter wheat varieties, Xinong 979 and large-spike wheat, were evaluated for their physiological responses to different levels of nitrogen and water status during their seedling stage grown in a phytotron. Our results indicated that drought stress greatly reduced the net photosynthetic rate (Pn), transpiration rate (E), and stomatal conductance (Gs), but with a greater increase in instantaneous water use efficiency (WUE). At the meantime, the nitrogen (N) supply improved photosynthetic efficiency under water deficit. Parameters inferred from chlorophyll a measurements, i.e., photochemical quenching coefficient (qP), the maximum photochemical efficiency (Fv/Fm), the quantum yield of photosystemII(ΦPSII), and the apparent photosynthetic electron transport rate (ETR) decreased under water stress at all nitrogen levels and declined in N-deficient plants. The root-shoot ratio (R/S) increased slightly with water stress at a low N level; the smallest root-shoot ratio was found at a high N level and moderate drought stress treatment. These results suggest that an appropriate nitrogen supply may be necessary to enhance drought resistance in wheat by improving photosynthetic efficiency and relieving photoinhibition under drought stress. However, an excessive N supply had no effect on drought resistance, which even showed an adverse effect on plant growth. Comparing the two cultivars, Xinong 979 has a stronger drought resistance compared with large-spike wheat under N deficiency.

  9. Leaf Gas Exchange and Fluorescence of Two Winter Wheat Varieties in Response to Drought Stress and Nitrogen Supply.

    Directory of Open Access Journals (Sweden)

    Xiubo Wang

    Full Text Available Water and nitrogen supply are the two primary factors limiting productivity of wheat (Triticum aestivum L.. In our study, two winter wheat varieties, Xinong 979 and large-spike wheat, were evaluated for their physiological responses to different levels of nitrogen and water status during their seedling stage grown in a phytotron. Our results indicated that drought stress greatly reduced the net photosynthetic rate (Pn, transpiration rate (E, and stomatal conductance (Gs, but with a greater increase in instantaneous water use efficiency (WUE. At the meantime, the nitrogen (N supply improved photosynthetic efficiency under water deficit. Parameters inferred from chlorophyll a measurements, i.e., photochemical quenching coefficient (qP, the maximum photochemical efficiency (Fv/Fm, the quantum yield of photosystemII(ΦPSII, and the apparent photosynthetic electron transport rate (ETR decreased under water stress at all nitrogen levels and declined in N-deficient plants. The root-shoot ratio (R/S increased slightly with water stress at a low N level; the smallest root-shoot ratio was found at a high N level and moderate drought stress treatment. These results suggest that an appropriate nitrogen supply may be necessary to enhance drought resistance in wheat by improving photosynthetic efficiency and relieving photoinhibition under drought stress. However, an excessive N supply had no effect on drought resistance, which even showed an adverse effect on plant growth. Comparing the two cultivars, Xinong 979 has a stronger drought resistance compared with large-spike wheat under N deficiency.

  10. Yr10 gene polymorphism in bread wheat varieties | Temel | African ...

    African Journals Online (AJOL)

    Yellow rust resistance locus Yr10 located on chromosome 1B in Moro and originated from the Turkish line PI178383 was investigated in terms of polymorphism in seven winter type bread wheat cvs. (Triticum aestivum ssp. Aestivum) Altay2000, zgi2001, Sönmez2001 (yellow rust resistant), Aytýn98, ES14, Harmankaya99 ...

  11. Pushing the boundaries of resistance: insights from Brachypodium-rust interactions

    OpenAIRE

    Figueroa, Melania; Castell-Miller, Claudia V.; Li, Feng; Hulbert, Scot H.; Bradeen, James M.

    2015-01-01

    The implications of global population growth urge transformation of current food and bioenergy production systems to sustainability. Members of the family Poaceae are of particular importance both in food security and for their applications as biofuel substrates. For centuries, rust fungi have threatened the production of valuable crops such as wheat, barley, oat, and other small grains; similarly, biofuel crops can also be susceptible to these pathogens. Emerging rust pathogenic races with i...

  12. Mutation breeding for disease resistance in wheat and field beans

    International Nuclear Information System (INIS)

    Abdel-Hak, T.M.; Kamel, A.H.

    1977-01-01

    Wheat and broad-bean diseases cause considerable losses under Egyptian conditions; therefore, an attempt was made to induce useful mutations in both crops resistant to diseases which may be of direct or indirect use in breeding programmes. The methodology of artificial inoculation, evaluation, selection, radiation levels used are reported, in addition to the economic importance of the varieties used. This work passed through two phases, the first started in the 1972/73 crop season with a small population, while the second in 1974/75 with a larger one to have a better chance of detecting resistant mutants. In the first phase, a total of 3563M 1 wheat plants was grown in addition to approximately 3600-44,000M 2 and 77,646M 3 plants. Twenty-two M 2 plants were selected as showing lower level of leaf rust development, but further tests showed these plants are not true mutants since they rusted at the same level of their parent varieties. Out of the M 3 plants none showed good resistance. In the second phase, 36,000, 277,080 and 289,492 plants of M 1 , M 2 and M 3 , respectively, were grown and 73M 2 plants were selected as showing complete resistance to leaf and stem rusts. In field beans out of the first phase, a total of 5760, 37,200 and 33,240M 1 , M 2 and M 3 plants, respectively, was grown and none showed a good level of disease resistance although some were less diseased. These were further tested and proved not true mutants for reduced disease development. In the second phase, 8747, 203,520 and 90,285 plants of M 1 , M 2 and M 3 , respectively, were grown and 27M 2 plants were selected as showing a lower level of chocolate spot and rust development. The paper also discusses the use of single versus composite cultures in mutation breeding for disease resistance. (author)

  13. Copy Number Variation of Cytokinin Oxidase Gene Tackx4 Associated with Grain Weight and Chlorophyll Content of Flag Leaf in Common Wheat.

    Science.gov (United States)

    Chang, Cheng; Lu, Jie; Zhang, Hai-Ping; Ma, Chuan-Xi; Sun, Genlou

    2015-01-01

    As the main pigment in photosynthesis, chlorophyll significantly affects grain filling and grain weight of crop. Cytokinin (CTK) can effectively increase chlorophyll content and chloroplast stability, but it is irreversibly inactivated by cytokinin oxidase (CKX). In this study, therefore, twenty-four pairs of primers were designed to identify variations of wheat CKX (Tackx) genes associated with flag leaf chlorophyll content after anthesis, as well as grain weight in 169 recombinant inbred lines (RIL) derived from Triticum aestivum Jing 411 × Hongmangchun 21. Results indicated variation of Tackx4, identified by primer pair T19-20, was proven to significantly associate with chlorophyll content and grain weight in the RIL population. Here, two Tackx4 patterns were identified: one with two co-segregated fragments (Tackx4-1/Tackx4-2) containing 618 bp and 620 bp in size (as in Jing 411), and another with no PCR product. The two genotypes were designated as genotype-A and genotype-B, respectively. Grain weight and leaf chlorophyll content at 5~15 days after anthesis (DAA) were significantly higher in genotype-A lines than those in genotype-B lines. Mapping analysis indicated Tackx4 was closely linked to Xwmc169 on chromosome 3AL, as well as co-segregated with a major quantitative trait locus (QTL) for both grain weight and chlorophyll content of flag leaf at 5~15 DAA. This QTL explained 8.9~22.3% phenotypic variations of the two traits across four cropping seasons. Among 102 wheat varieties, a third genotype of Tackx4 was found and designated as genotype-C, also having two co-segregated fragments, Tackx4-2 and Tackx4-3 (615bp). The sequences of three fragments, Tackx4-1, Tackx4-2, and Tackx4-3, showed high identity (>98%). Therefore, these fragments could be considered as different copies at Tackx4 locus on chromosome 3AL. The effect of copy number variation (CNV) of Tackx4 was further validated. In general, genotype-A contains both significantly higher grain weight

  14. Development of COS-SNP and HRM markers for high-throughput and reliable haplotype-based detection of Lr14a in durum wheat (Triticum durum Desf.).

    Science.gov (United States)

    Terracciano, Irma; Maccaferri, Marco; Bassi, Filippo; Mantovani, Paola; Sanguineti, Maria C; Salvi, Silvio; Simková, Hana; Doležel, Jaroslav; Massi, Andrea; Ammar, Karim; Kolmer, James; Tuberosa, Roberto

    2013-04-01

    Leaf rust (Puccinia triticina Eriks. & Henn.) is a major disease affecting durum wheat production. The Lr14a-resistant gene present in the durum wheat cv. Creso and its derivative cv. Colosseo is one of the best characterized leaf-rust resistance sources deployed in durum wheat breeding. Lr14a has been mapped close to the simple sequence repeat markers gwm146, gwm344 and wmc10 in the distal portion of the chromosome arm 7BL, a gene-dense region. The objectives of this study were: (1) to enrich the Lr14a region with single nucleotide polymorphisms (SNPs) and high-resolution melting (HRM)-based markers developed from conserved ortholog set (COS) genes and from sequenced Diversity Array Technology (DArT(®)) markers; (2) to further investigate the gene content and colinearity of this region with the Brachypodium and rice genomes. Ten new COS-SNP and five HRM markers were mapped within an 8.0 cM interval spanning Lr14a. Two HRM markers pinpointed the locus in an interval of HRM designed for agarose gel electrophoresis/KASPar(®) assays and high-resolution melting analysis, respectively, as well as the double-marker combinations ubw14/ubw18, ubw14/ubw35 and wPt-4038-HRM-ubw35 will be useful for germplasm haplotyping and for molecular-assisted breeding.

  15. Characterization of rust, early and late leaf spot resistance in wild and cultivated peanut germplasm Caracterização da resistência à ferrugem, mancha preta e mancha castanha em germoplasma silvestre e cultivado de amendoim

    Directory of Open Access Journals (Sweden)

    Alessandra Pereira Fávero

    2009-02-01

    Full Text Available Groundnut (Arachis hypogaea has an AB genome and is one of the most important oil crops in the world. The main constraints of crop management in Brazil are fungal diseases. Several species of the genus Arachis are resistant to pests and diseases. The objective of our experiments was to identify wild species belonging to the taxonomic section Arachis with either A or B (or " non-A" genomes that are resistant to early leaf spot (Cercospora arachidicola, late leaf spot (Cercosporidium personatum and rust (Puccinia arachidis. For the identification of genotypes resistant to fungal diseases, bioassays with detached leaves were done in laboratory conditions, with artificial inoculation, a controlled temperature of 25ºC and a photoperiod of 10 h light/14 h dark, for 20-42 days, depending on the fungi species. Most of the accessions of wild species were more resistant than accessions of A. hypogaea for one, two or all three fungi species studied. Arachis monticola, considered to be a possible tetraploid ancestor or a derivative of A. hypogaea, was also more susceptible to Cercosporidium personatum and Puccinia arachidis, as compared to most of the wild species. Therefore, wild germplasm accessions of both genome types are available to be used for the introgression of resistance genes against three fungal diseases of peanut.O amendoim (Arachis hypogaea possui genoma AB e é uma das mais importantes culturas oleaginosas em todo o mundo. Os principais problemas da cultura no Brasil são as doenças fúngicas. Várias espécies do gênero Arachis são resistentes a pragas e doenças. Este trabalho visou a identificar espécies silvestres pertencentes à seção Arachis associadas aos genomas A ou B (ou " não-A" do amendoim que são resistentes à mancha castanha (Cercospora arachidicola, mancha preta (Cercosporidium personatum e ferrugem (Puccinia arachidis. Para a identificação de genótipos resistentes a doenças fúngicas, bioensaios utilizando

  16. Overexpression of GmDREB1 improves salt tolerance in transgenic wheat and leaf protein response to high salinity

    Directory of Open Access Journals (Sweden)

    Qiyan Jiang

    2014-04-01

    Full Text Available The transcription factor dehydration-responsive element binding protein (DREB is able to improve tolerance to abiotic stress in plants by regulating the expression of downstream genes involved in environmental stress resistance. The objectives of this study were to evaluate the salt tolerance of GmDREB1 transgenic wheat (Triticum aestivum L. and to evaluate its physiological and protein responses to salt stress. Compared with the wild type, the transgenic lines overexpressing GmDREB1 showed longer coleoptiles and radicles and a greater radicle number at the germination stage, as well as greater root length, fresh weight, and tiller number per plant at the seedling stage. The yield-related traits of transgenic lines were also improved compared with the wild type, indicating enhanced salt tolerance in transgenic lines overexpressing GmDREB1. Proteomics analysis revealed that osmotic- and oxidative-stress-related proteins were up-regulated in transgenic wheat leaves under salt stress conditions. Transgenic wheat had higher levels of proline and betaine and lower levels of malondialdehyde and relative electrolyte leakage than the wild type. These results suggest that GmDREB1 regulates the expression of osmotic- and oxidative-stress-related proteins that reduce the occurrence of cell injury caused by high salinity, thus improving the salt tolerance of transgenic wheat.

  17. SNP Discovery for mapping alien introgressions in wheat

    Science.gov (United States)

    2014-01-01

    Background Monitoring alien introgressions in crop plants is difficult due to the lack of genetic and molecular mapping information on the wild crop relatives. The tertiary gene pool of wheat is a very important source of genetic variability for wheat improvement against biotic and abiotic stresses. By exploring the 5Mg short arm (5MgS) of Aegilops geniculata, we can apply chromosome genomics for the discovery of SNP markers and their use for monitoring alien introgressions in wheat (Triticum aestivum L). Results The short arm of chromosome 5Mg of Ae. geniculata Roth (syn. Ae. ovata L.; 2n = 4x = 28, UgUgMgMg) was flow-sorted from a wheat line in which it is maintained as a telocentric chromosome. DNA of the sorted arm was amplified and sequenced using an Illumina Hiseq 2000 with ~45x coverage. The sequence data was used for SNP discovery against wheat homoeologous group-5 assemblies. A total of 2,178 unique, 5MgS-specific SNPs were discovered. Randomly selected samples of 59 5MgS-specific SNPs were tested (44 by KASPar assay and 15 by Sanger sequencing) and 84% were validated. Of the selected SNPs, 97% mapped to a chromosome 5Mg addition to wheat (the source of t5MgS), and 94% to 5Mg introgressed from a different accession of Ae. geniculata substituting for chromosome 5D of wheat. The validated SNPs also identified chromosome segments of 5MgS origin in a set of T5D-5Mg translocation lines; eight SNPs (25%) mapped to TA5601 [T5DL · 5DS-5MgS(0.75)] and three (8%) to TA5602 [T5DL · 5DS-5MgS (0.95)]. SNPs (gsnp_5ms83 and gsnp_5ms94), tagging chromosome T5DL · 5DS-5MgS(0.95) with the smallest introgression carrying resistance to leaf rust (Lr57) and stripe rust (Yr40), were validated in two released germplasm lines with Lr57 and Yr40 genes. Conclusion This approach should be widely applicable for the identification of species/genome-specific SNPs. The development of a large number of SNP markers will facilitate the precise introgression and

  18. SNP Discovery for mapping alien introgressions in wheat.

    Science.gov (United States)

    Tiwari, Vijay K; Wang, Shichen; Sehgal, Sunish; Vrána, Jan; Friebe, Bernd; Kubaláková, Marie; Chhuneja, Praveen; Doležel, Jaroslav; Akhunov, Eduard; Kalia, Bhanu; Sabir, Jamal; Gill, Bikram S

    2014-04-10

    Monitoring alien introgressions in crop plants is difficult due to the lack of genetic and molecular mapping information on the wild crop relatives. The tertiary gene pool of wheat is a very important source of genetic variability for wheat improvement against biotic and abiotic stresses. By exploring the 5Mg short arm (5MgS) of Aegilops geniculata, we can apply chromosome genomics for the discovery of SNP markers and their use for monitoring alien introgressions in wheat (Triticum aestivum L). The short arm of chromosome 5Mg of Ae. geniculata Roth (syn. Ae. ovata L.; 2n = 4x = 28, UgUgMgMg) was flow-sorted from a wheat line in which it is maintained as a telocentric chromosome. DNA of the sorted arm was amplified and sequenced using an Illumina Hiseq 2000 with ~45x coverage. The sequence data was used for SNP discovery against wheat homoeologous group-5 assemblies. A total of 2,178 unique, 5MgS-specific SNPs were discovered. Randomly selected samples of 59 5MgS-specific SNPs were tested (44 by KASPar assay and 15 by Sanger sequencing) and 84% were validated. Of the selected SNPs, 97% mapped to a chromosome 5Mg addition to wheat (the source of t5MgS), and 94% to 5Mg introgressed from a different accession of Ae. geniculata substituting for chromosome 5D of wheat. The validated SNPs also identified chromosome segments of 5MgS origin in a set of T5D-5Mg translocation lines; eight SNPs (25%) mapped to TA5601 [T5DL · 5DS-5MgS(0.75)] and three (8%) to TA5602 [T5DL · 5DS-5MgS (0.95)]. SNPs (gsnp_5ms83 and gsnp_5ms94), tagging chromosome T5DL · 5DS-5MgS(0.95) with the smallest introgression carrying resistance to leaf rust (Lr57) and stripe rust (Yr40), were validated in two released germplasm lines with Lr57 and Yr40 genes. This approach should be widely applicable for the identification of species/genome-specific SNPs. The development of a large number of SNP markers will facilitate the precise introgression and monitoring of alien segments in crop

  19. Shiitake Medicinal Mushroom, Lentinus edodes (Higher Basidiomycetes) Productivity and Lignocellulolytic Enzyme Profiles during Wheat Straw and Tree Leaf Bioconversion.

    Science.gov (United States)

    Elisashvili, Vladimir; Kachlishvili, Eva; Asatiani, Mikheil D

    2015-01-01

    Two commercial strains of Lentinus edodes have been comparatively evaluated for their productivity and lignocellulolytic enzyme profiles in mushroom cultivation using wheat straw or tree leaves as the growth substrates. Both substrates are profitable for recycling into shiitake fruit bodies. L. edodes 3715 gave the lowest yield of mushroom during tree leaves bioconversion with the biological efficiency (BE) 74.8% while the L. edodes 3721 BE achieved 83.4%. Cultivation of shiitake on wheat straw, especially in the presence of additional nitrogen source, increased the L. edodes 3721 BE to 92-95.3% owing to the high hydrolases activity and favorable conditions. Despite the quantitative variations, each strain of L. edodes had a similar pattern for secreting enzymes into the wheat straw and tree leaves. The mushrooms laccase and MnP activities were high during substrate colonization and declined rapidly during primordia appearance and fruit body development. While oxidase activity decreased, during the same period cellulases and xylanase activity raised sharply. Both cellulase and xylanase activity peaked at the mature fruit body stage. When mushrooms again shifted to the vegetative growth, oxidase activity gradually increased, whereas the hydrolases activity dropped rapidly. The MnP, CMCase, and FP activities of L. edodes 3721 during cultivation on wheat straw were higher than those during mushroom growth on tree leaves whereas the laccase activity was rather higher in fermentation of tree leaves. Enrichment of wheat straw with an additional nitrogen source rather favored to laccase, MnP, and FPA secretion during the vegetative stage of the L. edodes 3721 growth.

  20. Induced mutations in Iraqi bread wheat cv. Saber Beg

    Energy Technology Data Exchange (ETDEWEB)

    Ibrahim, I F; Haidar, H O [Department of Plant Protection, Faculty of Agriculture and Biology, NRC and Agriculture Research Station, Telafor (Iraq)

    1989-07-01

    ''Saber Beg'', is a local wheat cultivar important in the semi-arid zone of Iraq where the rainfall is less than 450 mm per year. This cultivar has a good baking quality, but is of low productivity, high susceptibility to common bunt (Tilletia spp.) and to leaf rust (Puccinia recondita Rob. ex Desm.), but only in the rainy season. A mutation breeding programme using gamma irradiation has been started in 1978 to improve this cultivar. Seeds of all main tillers from M{sub 1} plants were harvested and artificially inoculated with teliospores of Tilletia spp. All the seeds from healthy M{sub 2} plants were inoculated again and sown in the same area. Out of 22920 M{sub 3} plants, 244 resistant ones were selected. During subsequent screening for 4 generations, however, only 3 mutants were confirmed.

  1. Induced mutations in Iraqi bread wheat cv. Saber Beg

    International Nuclear Information System (INIS)

    Ibrahim, I.F.; Haidar, H.O.

    1989-01-01

    ''Saber Beg'', is a local wheat cultivar important in the semi-arid zone of Iraq where the rainfall is less than 450 mm per year. This cultivar has a good baking quality, but is of low productivity, high susceptibility to common bunt (Tilletia spp.) and to leaf rust (Puccinia recondita Rob. ex Desm.), but only in the rainy season. A mutation breeding programme using gamma irradiation has been started in 1978 to improve this cultivar. Seeds of all main tillers from M 1 plants were harvested and artificially inoculated with teliospores of Tilletia spp. All the seeds from healthy M 2 plants were inoculated again and sown in the same area. Out of 22920 M 3 plants, 244 resistant ones were selected. During subsequent screening for 4 generations, however, only 3 mutants were confirmed

  2. Functional and DNA-protein binding studies of WRKY transcription factors and their expression analysis in response to biotic and abiotic stress in wheat (Triticum aestivum L.).

    Science.gov (United States)

    Satapathy, Lopamudra; Kumar, Dhananjay; Kumar, Manish; Mukhopadhyay, Kunal

    2018-01-01

    WRKY, a plant-specific transcription factor family, plays vital roles in pathogen defense, abiotic stress, and phytohormone signalling. Little is known about the roles and function of WRKY transcription factors in response to rust diseases in wheat. In the present study, three TaWRKY genes encoding complete protein sequences were cloned. They belonged to class II and III WRKY based on the number of WRKY domains and the pattern of zinc finger structures. Twenty-two DNA-protein binding docking complexes predicted stable interactions of WRKY domain with W-box. Quantitative real-time-PCR using wheat near-isogenic lines with or without Lr28 gene revealed differential up- or down-regulation in response to biotic and abiotic stress treatments which could be responsible for their functional divergence in wheat. TaWRKY62 was found to be induced upon treatment with JA, MJ, and SA and reduced after ABA treatments. Maximum induction of six out of seven genes occurred at 48 h post inoculation due to pathogen inoculation. Hence, TaWRKY (49, 50 , 52 , 55 , 57, and 62 ) can be considered as potential candidate genes for further functional validation as well as for crop improvement programs for stress resistance. The results of the present study will enhance knowledge towards understanding the molecular basis of mode of action of WRKY transcription factor genes in wheat and their role during leaf rust pathogenesis in particular.

  3. Genetic control and combining ability of flag leaf area and relative water content traits of bread wheat cultivars under drought stress condition

    Directory of Open Access Journals (Sweden)

    Golparvar Ahmad Reza

    2013-01-01

    Full Text Available In order to compare mode of inheritance, combining ability, heterosis and gene action in genetic control of traits flag leaf area, relative water content and grain filling rate of bread wheat under drought stress, a study was conducted on 8 cultivars using of Griffing’s method2 in fixed model. Mean square of general combining ability was significant also for all traits and mean square of specific combining ability was significant also for all traits except relative water content of leaf which show importance of both additive and dominant effects of genes in heredity of these traits under stress. GCA to SCA mean square ratio was significant for none of traits. Results of this study showed that non additive effects of genes were more important than additive effect for all traits. According to results we can understand that genetic improvement of mentioned traits will have low genetic efficiency by selection from the best crosses of early generations. Then it is better to delay selection until advanced generations and increase in heritability of these traits.

  4. Discovery and characterization of two new stem rust resistance genes in Aegilops sharonensis.

    Science.gov (United States)

    Yu, Guotai; Champouret, Nicolas; Steuernagel, Burkhard; Olivera, Pablo D; Simmons, Jamie; Williams, Cole; Johnson, Ryan; Moscou, Matthew J; Hernández-Pinzón, Inmaculada; Green, Phon; Sela, Hanan; Millet, Eitan; Jones, Jonathan D G; Ward, Eric R; Steffenson, Brian J; Wulff, Brande B H

    2017-06-01

    We identified two novel wheat stem rust resistance genes, Sr-1644-1Sh and Sr-1644-5Sh in Aegilops sharonensis that are effective against widely virulent African races of the wheat stem rust pathogen. Stem rust is one of the most important diseases of wheat in the world. When single stem rust resistance (Sr) genes are deployed in wheat, they are often rapidly overcome by the pathogen. To this end, we initiated a search for novel sources of resistance in diverse wheat relatives and identified the wild goatgrass species Aegilops sharonesis (Sharon goatgrass) as a rich reservoir of resistance to wheat stem rust. The objectives of this study were to discover and map novel Sr genes in Ae. sharonensis and to explore the possibility of identifying new Sr genes by genome-wide association study (GWAS). We developed two biparental populations between resistant and susceptible accessions of Ae. sharonensis and performed QTL and linkage analysis. In an F 6 recombinant inbred line and an F 2 population, two genes were identified that mapped to the short arm of chromosome 1S sh , designated as Sr-1644-1Sh, and the long arm of chromosome 5S sh , designated as Sr-1644-5Sh. The gene Sr-1644-1Sh confers a high level of resistance to race TTKSK (a member of the Ug99 race group), while the gene Sr-1644-5Sh conditions strong resistance to TRTTF, another widely virulent race found in Yemen. Additionally, GWAS was conducted on 125 diverse Ae. sharonensis accessions for stem rust resistance. The gene Sr-1644-1Sh was detected by GWAS, while Sr-1644-5Sh was not detected, indicating that the effectiveness of GWAS might be affected by marker density, population structure, low allele frequency and other factors.

  5. Fungicides efficiency on wheat diseases control in response to the application with different spray nozzles

    Directory of Open Access Journals (Sweden)

    Felipe Rafael Garcés Fiallos

    2011-12-01

    Full Text Available This study aimed to evaluate the efficiency of fungicides to leaf control diseases of wheat, when applied to different models of spray nozzles. The experiment was conducted in a randomized block design with four replicates of factorial (4 x 3+1. Data were subjected to analysis of variance and means compared by Tukey test at 5% probability. The fungicides used were: Opera® (pyraclostrobin+epoxiconazole 0.75 L.ha-1 , Opera® 0.75 L.ha-1 +Folicur® (tebuconazole 0.3 L.ha-1 , Priori Xtra® (azoxystrobin+cyproconazole 0.3 L.ha-1 , Priori Xtra® 0.3 L.ha-1 +Tilt® (propiconazole 0.3 L.ha-1 . These fungicides were applied with three models of spray nozzles jet planes: XR 11 001 (fine drop, AIRMIX 11,001 (average drop and AVI 11,001 (coarse drop. We evaluated the incidence and severity (damage per plant leaf of yellow spot (Drechslera tritici-repentis, spot blotch (Bipolaris sorokiniana, leaf rust (Puccinia triticina and grain yield (kg.ha-1 culture. The results show that the application of fungicides for control of leaf diseases in wheat resulted in increases in grain yield, and yield higher values were observed with the application of Opera®, using the XR 11001.

  6. Virulence and molecular characterization of experimental isolates of the stripe rust pathogen (Puccinia striiformis) indicate somatic recombination

    Science.gov (United States)

    Puccinia striiformis causes stripe rust on wheat, barley, and grasses. Natural population studies have indicated that somatic recombination plays a possible role in the pathogen variation. To determine if somatic recombination can occur, susceptible wheat or barley plants were inoculated with mixe...

  7. Genomic analysis of a novel gene conferring resistance to Ug99 stem rust in Triticum turgidum ssp. dicoccum

    Science.gov (United States)

    Wheat production is threatened by the disease stem rust, which is caused by the biotrophic fungal pathogen Puccinia graminis Pers.:Pers. f. sp. tritici (Pgt). Among all known Pgt races, TTKSK (Ug99) and TRTTF are significant threats to North American wheat production due to their virulence against f...

  8. Overexpression of GmDREB1 improves salt tolerance in transgenic wheat and leaf protein response to high salinity

    OpenAIRE

    Qiyan Jiang; Zheng Hu; Hui Zhang; Youzhi Ma

    2014-01-01

    The transcription factor dehydration-responsive element binding protein (DREB) is able to improve tolerance to abiotic stress in plants by regulating the expression of downstream genes involved in environmental stress resistance. The objectives of this study were to evaluate the salt tolerance of GmDREB1 transgenic wheat (Triticum aestivum L.) and to evaluate its physiological and protein responses to salt stress. Compared with the wild type, the transgenic lines overexpressing GmDREB1 showed...

  9. Genetic characterization of Moroccan and the exotic bread wheat cultivars using functional and random DNA markers linked to the agronomic traits for genomics-assisted improvement.

    Science.gov (United States)

    Henkrar, Fatima; El-Haddoury, Jamal; Ouabbou, Hassan; Bendaou, Najib; Udupa, Sripada M

    2016-06-01

    Genetic characterization, diversity analysis and estimate of the genetic relationship among varieties using functional and random DNA markers linked to agronomic traits can provide relevant guidelines in selecting parents and designing new breeding strategies for marker-assisted wheat cultivar improvement. Here, we characterize 20 Moroccan and 19 exotic bread wheat (Triticum aestivum L.) cultivars using 47 functional and 7 linked random DNA markers associated with 21 loci of the most important traits for wheat breeding. The functional marker analysis revealed that 35, 45, and 10 % of the Moroccan cultivars, respectively have the rust resistance genes (Lr34/Yr18/Pm38), dwarfing genes (Rht1b or Rht2b alleles) and the leaf rust resistance gene (Lr68). The marker alleles for genes Lr37/Yr17/Sr38, Sr24 and Yr36 were present only in the exotic cultivars and absent in Moroccan cultivars. 25 % of cultivars had 1BL.1RS translocation. 70 % of the wheat cultivars had Ppo-D1a and Ppo-A1b associated with low polyphenol oxidase activity. 10 % of cultivars showed presence of a random DNA marker allele (175 bp) linked to Hessian fly resistance gene H22. The majority of the Moroccan cultivars were carrying alleles that impart good bread making quality. Neighbor joining (NJ) and principal coordinate analysis based on the marker data revealed a clear differentiation between elite Moroccan and exotic wheat cultivars. The results of this study are useful for selecting suitable parents for making targeted crosses in marker-assisted wheat breeding and enhancing genetic diversity in the wheat cultivars.

  10. Experimental mutation of disease resistance in wheat

    International Nuclear Information System (INIS)

    Hanisova, A.; Hanis, M.; Knytl, V.; Cerny, J.

    1980-01-01

    In 1968 to 1974, 19 cultivars and lines of wheat were treated with mutagens (i.e., with X rays, gamma radiation, neutrons, EMS). ALtogether 140 lines were obtained showing better resistance and/or tolerance to black stem rust, yellow rust, stem rust of wheat, powdery mildew of cereals, and root-rot of wheat. The frequency of the induced mutations was sufficiently high, i.e., 0.0012 to 0.078 mutants per 100 plants of M 2 . The major part of mutant lines showed a lower agronomical value due to negative pleiotropy of mutant genes and a changed genetic background of mutants. Some mutant lines can be used as the starting material in hybridization programmes. (author)

  11. Commandra Blister Rust

    Science.gov (United States)

    David W. Johnson

    1986-01-01

    Commandra blister rust is a disease of hard pines that is caused by a fungus growing in the inner bark. The fungus (Cronartium commandrae Pk.) has a complex life cycle. It infects hard pines but needs an alternate host, an unrelated plant, to spread from one pine to another.

  12. Identification of Putative Coffee Rust Mycoparasites via Single-Molecule DNA Sequencing of Infected Pustules.

    Science.gov (United States)

    James, Timothy Y; Marino, John A; Perfecto, Ivette; Vandermeer, John

    2016-01-15

    The interaction of crop pests with their natural enemies is a fundament to their control. Natural enemies of fungal pathogens of crops are poorly known relative to those of insect pests, despite the diversity of fungal pathogens and their economic importance. Currently, many regions across Latin America are experiencing unprecedented epidemics of coffee rust (Hemileia vastatrix). Identification of natural enemies of coffee rust could aid in developing management strategies or in pinpointing species that could be used for biocontrol. In the present study, we characterized fungal communities associated with coffee rust lesions by single-molecule DNA sequencing of fungal rRNA gene bar codes from leaf discs (≈28 mm(2)) containing rust lesions and control discs with no rust lesions. The leaf disc communities were hyperdiverse in terms of fungi, with up to 69 operational taxonomic units (putative species) per control disc, and the diversity was only slightly reduced in rust-infected discs, with up to 63 putative species. However, geography had a greater influence on the fungal community than whether the disc was infected by coffee rust. Through comparisons between control and rust-infected leaf discs, as well as taxonomic criteria, we identified 15 putative mycoparasitic fungi. These fungi are concentrated in the fungal family Cordycipitaceae and the order Tremellales. These data emphasize the complexity of diverse fungi of unknown ecological function within a leaf that might influence plant disease epidemics or lead to the development of species for biocontrol of fungal disease. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

  13. Effects of tillage technologies and application of biopreparations on micromycetes in the rhizosphere and rhizoplane of spring wheat

    Science.gov (United States)

    Shirokikh, I. G.; Kozlova, L. M.; Shirokikh, A. A.; Popov, F. A.; Tovstik, E. V.

    2017-07-01

    The population density and structure of complexes of soil microscopic fungi in the rhizosphere and rhizoplane of spring wheat ( Triticum aestivum L.), plant damage by root rot and leaf diseases, and crop yield were determined in a stationary field experiment on a silty loamy soddy-podzolic soil (Albic Retisol (Loamic, Aric)) in dependence on the soil tillage technique: (a) moldboard plowing to 20-22 cm and (b) non-inversive tillage to 14-16 cm. The results were treated with the two-way ANOVA method. It was shown that the number of fungal propagules in the rhizosphere and rhizoplane of plants in the variant with non-inversive tillage was significantly smaller than that in the variant with plowing. Minimization of the impact on the soil during five years led to insignificant changes in the structure of micromycete complexes in the rhizosphere of wheat. The damage of the plants with root rot and leaf diseases upon non-inversive tillage did not increase in comparison with that upon plowing. Wheat yield in the variant with non-inversive tillage was insignificantly lower than that in the variant with moldboard plowing. The application of biopreparations based on the Streptomyces hygroscopicus A4 and Pseudomonas aureofaciens BS 1393 resulted in a significant decrease of plant damage with leaf rust.

  14. Genetic and environmental variation in rust frequency on mature mountain birch trees

    Energy Technology Data Exchange (ETDEWEB)

    Elamo, Pirjo; Saloniemi, Irma; Helander, M.L.; Neuvonen, Seppo [Turku Univ. (Finland). Dept. of Biology) and (Kevo Subarctic Research Inst., Turku (Finland)

    2000-07-01

    This study investigated genetic and environmental variation in the frequency of birch rust, the most important leaf disease of birch species, The same half-sib families of mature mountain birch trees were studied in two areas corresponding to their natural growing habitats over 3 yrs. The frequency of birch rust was examined both in the field and from detached leaves inoculated in the laboratory. The frequency of birch rust varied among the mountain birch families. However, the heritability of birch rust resistance was found to be fairly low, with the heritability of naturally occurring birch rust varying between 0.27 and 0.41. The frequency of birch rust varied highly between the two study areas and among study years. Nevertheless, the relative frequency of birch rust among tree individuals and tree families remained similar and as a result no notable genotype x environment interaction was observed. The field and in vitro results differed with respect to the ranking of birch families by birch rust resistance.

  15. Barberry rust survey – developing tools for diagnosis, analysis and data management

    DEFF Research Database (Denmark)

    Justesen, Annemarie Fejer; Hansen, Jens Grønbech; Hovmøller, Mogens Støvring

    Barberry (Berberis spp.) may serve as alternate host of several Puccinia species including Puccinia graminis and P. striiformis causing stem and yellow rust on cereals and grasses, respectively. In order to study the importance of barberry in the epidemiology of Puccinia species in the CWANA regi...... a rust survey was initiated. The aim was to 1) develop a surveillance protocol 2) develop molecular diagnostic tools for identifying Puccinia spp. from aecial samples, and 3) develop a data management and display system of results as part of the Wheat Rust ToolBox (http....... Due to variable quality of aecial samples DNA extraction was not successful for 40% of the samples. Sequences of EF1α, β-tubulin or ITS were analysed and compared to reference sequences of rust fungi infecting cereals and grasses. The analysis supported the presence of P. graminis s.l., P....... arrhenatheri and P. striiformoides on barberry species. Survey and DNA sample maps with species designation were displayed in the Wheat Rust ToolBox. The future aim is to integrate barberry rust survey data based on molecular diagnostics and infection assays from research groups world-wide in order to gain...

  16. Investigating Gene Function in Cereal Rust Fungi by Plant-Mediated Virus-Induced Gene Silencing.

    Science.gov (United States)

    Panwar, Vinay; Bakkeren, Guus

    2017-01-01

    Cereal rust fungi are destructive pathogens, threatening grain production worldwide. Targeted breeding for resistance utilizing host resistance genes has been effective. However, breakdown of resistance occurs frequently and continued efforts are needed to understand how these fungi overcome resistance and to expand the range of available resistance genes. Whole genome sequencing, transcriptomic and proteomic studies followed by genome-wide computational and comparative analyses have identified large repertoire of genes in rust fungi among which are candidates predicted to code for pathogenicity and virulence factors. Some of these genes represent defence triggering avirulence effectors. However, functions of most genes still needs to be assessed to understand the biology of these obligate biotrophic pathogens. Since genetic manipulations such as gene deletion and genetic transformation are not yet feasible in rust fungi, performing functional gene studies is challenging. Recently, Host-induced gene silencing (HIGS) has emerged as a useful tool to characterize gene function in rust fungi while infecting and growing in host plants. We utilized Barley stripe mosaic virus-mediated virus induced gene silencing (BSMV-VIGS) to induce HIGS of candidate rust fungal genes in the wheat host to determine their role in plant-fungal interactions. Here, we describe the methods for using BSMV-VIGS in wheat for functional genomics study in cereal rust fungi.

  17. PITHOMYCES CHARTARUM AS A PATHOGEN OF WHEAT

    NARCIS (Netherlands)

    Tóth, B; Csösz, M; Dijksterhuis, J; Frisvad, J C; Varga, J

    2007-01-01

    During routine surveys of wheat-growing (Triticum aestivum L.) areas of Hungary, symptomatic leaf samples were collected from different wheat cultivars. Macro- and micromorphological examinations of singlespore isolates showed some of them to belong to Pithomyces chartarum (teleomorph:

  18. Phylogeny in Defining Model Plants for Lignocellulosic Ethanol Production: A Comparative Study of Brachypodium distachyon, Wheat, Maize, and Miscanthus x giganteus Leaf and Stem Biomass

    Science.gov (United States)

    Meineke, Till; Manisseri, Chithra; Voigt, Christian A.

    2014-01-01

    The production of ethanol from pretreated plant biomass during fermentation is a strategy to mitigate climate change by substituting fossil fuels. However, biomass conversion is mainly limited by the recalcitrant nature of the plant cell wall. To overcome recalcitrance, the optimization of the plant cell wall for subsequent processing is a promising approach. Based on their phylogenetic proximity to existing and emerging energy crops, model plants have been proposed to study bioenergy-related cell wall biochemistry. One example is Brachypodium distachyon, which has been considered as a general model plant for cell wall analysis in grasses. To test whether relative phylogenetic proximity would be sufficient to qualify as a model plant not only for cell wall composition but also for the complete process leading to bioethanol production, we compared the processing of leaf and stem biomass from the C3 grasses B. distachyon and Triticum aestivum (wheat) with the C4 grasses Zea mays (maize) and Miscanthus x giganteus, a perennial energy crop. Lambda scanning with a confocal laser-scanning microscope allowed a rapid qualitative analysis of biomass saccharification. A maximum of 108–117 mg ethanol·g−1 dry biomass was yielded from thermo-chemically and enzymatically pretreated stem biomass of the tested plant species. Principal component analysis revealed that a relatively strong correlation between similarities in lignocellulosic ethanol production and phylogenetic relation was only given for stem and leaf biomass of the two tested C4 grasses. Our results suggest that suitability of B. distachyon as a model plant for biomass conversion of energy crops has to be specifically tested based on applied processing parameters and biomass tissue type. PMID:25133818

  19. Avaliação e seleção de progênies F3 de cafeeiros de porte baixo com o gene SH3 de resistência a Hemileia vastatrix Berk. et Br. Evaluation and selection of Coffea arabica F3 progenies with low height and the leaf-rust SH3 resistence gene

    Directory of Open Access Journals (Sweden)

    Albano Silva da Conceição

    2005-01-01

    porte baixo portando o gene SH3 de resistência ao agente da ferrugem.The present work evaluated 36 arabic coffee (Coffea arabica L. F3 progenies, originated from crosses among cultivars Catuaí Vermelho IAC 46 and Catuaí Vermelho IAC 81 and access IAC 1110 (BA-10. This last cultivar came from India and exhibits SH2 and SH3 rust resistance genes. The experiment was installed in 1988 at the Experimental Center of the Agronomic Institute (IAC/APTA, in Campinas, using random blocks design with six repetitions and two plants per plot. Field evaluations included yield (average of seven annual harvests, vegetative vigor, resistance to leaf rust, plant size, color of young leaves and complete fruit maturation period. Based on these evaluations, plants exhibiting high yield, good vegetative vigor, low height, and resistance to the leaf rust agent Hemileia vastatrix were selected. Fruit yield of selected plants was calculated and seeds were characterized according to type (flat, peaberry and elephant, outturn and grain size. A total of 11 optimal F3 progenies were identified as rust resistant. By further classifications, 39 plants out from these progenies were selected, along with 15 plants from other 25 evaluated progenies. Laboratory analyses lead to a final selection of 18 coffee trees, all exhibiting leaf rust resistance, high yield and low height. Also, F4 progenies of selected plants had been evaluated regarding height and leaf rust resistance, at seedling stage, in greenhouse conditions. Eighteen plants were selected for further analysis and move forward from F3 to F4 generation in the coffee breeding program developed by IAC.

  20. Extraction of High Molecular Weight DNA from Fungal Rust Spores for Long Read Sequencing.

    Science.gov (United States)

    Schwessinger, Benjamin; Rathjen, John P

    2017-01-01

    Wheat rust fungi are complex organisms with a complete life cycle that involves two different host plants and five different spore types. During the asexual infection cycle on wheat, rusts produce massive amounts of dikaryotic urediniospores. These spores are dikaryotic (two nuclei) with each nucleus containing one haploid genome. This dikaryotic state is likely to contribute to their evolutionary success, making them some of the major wheat pathogens globally. Despite this, most published wheat rust genomes are highly fragmented and contain very little haplotype-specific sequence information. Current long-read sequencing technologies hold great promise to provide more contiguous and haplotype-phased genome assemblies. Long reads are able to span repetitive regions and phase structural differences between the haplomes. This increased genome resolution enables the identification of complex loci and the study of genome evolution beyond simple nucleotide polymorphisms. Long-read technologies require pure high molecular weight DNA as an input for sequencing. Here, we describe a DNA extraction protocol for rust spores that yields pure double-stranded DNA molecules with molecular weight of >50 kilo-base pairs (kbp). The isolated DNA is of sufficient purity for PacBio long-read sequencing, but may require additional purification for other sequencing technologies such as Nanopore and 10× Genomics.

  1. Identification of rust resistance genes Lr10 and Sr9a in Pakistani ...

    African Journals Online (AJOL)

    Identification of rust resistance genes Lr10 and Sr9a in Pakistani wheat germplasm using PCR based molecular markers. M Babar, AF Mashhadi, A Mehvish, AN Zahra, R Waheed, A Hasnain, S ur-Rahman, N Hussain, M Ali, I Khaliq, A Aziz ...

  2. Winter wheat yield estimation of remote sensing research based on WOFOST crop model and leaf area index assimilation

    Science.gov (United States)

    Chen, Yanling; Gong, Adu; Li, Jing; Wang, Jingmei

    2017-04-01

    Accurate crop growth monitoring and yield predictive information are significant to improve the sustainable development of agriculture and ensure the security of national food. Remote sensing observation and crop growth simulation models are two new technologies, which have highly potential applications in crop growth monitoring and yield forecasting in recent years. However, both of them have limitations in mechanism or regional application respectively. Remote sensing information can not reveal crop growth and development, inner mechanism of yield formation and the affection of environmental meteorological conditions. Crop growth simulation models have difficulties in obtaining data and parameterization from single-point to regional application. In order to make good use of the advantages of these two technologies, the coupling technique of remote sensing information and crop growth simulation models has been studied. Filtering and optimizing model parameters are key to yield estimation by remote sensing and crop model based on regional crop assimilation. Winter wheat of GaoCheng was selected as the experiment object in this paper. And then the essential data was collected, such as biochemical data and farmland environmental data and meteorological data about several critical growing periods. Meanwhile, the image of environmental mitigation small satellite HJ-CCD was obtained. In this paper, research work and major conclusions are as follows. (1) Seven vegetation indexes were selected to retrieve LAI, and then linear regression model was built up between each of these indexes and the measured LAI. The result shows that the accuracy of EVI model was the highest (R2=0.964 at anthesis stage and R2=0.920 at filling stage). Thus, EVI as the most optimal vegetation index to predict LAI in this paper. (2) EFAST method was adopted in this paper to conduct the sensitive analysis to the 26 initial parameters of the WOFOST model and then a sensitivity index was constructed

  3. Effect of Addition of Moringa Leaf By-Product (Leaf-Waste) on ...

    African Journals Online (AJOL)

    The effects of incorporation of Moringa leaf fibre (a by-product of leaf processing which contains 24% Crude Fibre by dry weight at 0, 5 and 10 % substitution of wheat flour in cookies was investigated. Three products containing wheat flour: Moringa leaf fibre ratios of 100:0, 95:5, and 90:10 respectively were prepared, and a ...

  4. Induced resistance to septorial leaf blotch disease in wheat cv. 'SaberBeg' and its hybrids by fast neutrons

    International Nuclear Information System (INIS)

    Ibrahim, I.; Al-Marooff, E.; AI-Janabi, A.; Mahmood, A.; AI-Aubaidi

    1990-01-01

    Full text: Seeds of 'SaberBeg' and its hybrids in F 2 generation were irradiated with different doses of fast neutrons. 1324 variants selected from M 2 and F 4 M 2 were evaluated for resistance to septorial leaf blotch (Septoria tritici Rob ex Desm) with artificial inoculation under field conditions, through 3 successive generations. Results revealed 55 variants moderately resistant, along with better agronomic traits such as stiff stem, earliness in maturity and good adaption to semiarid zone conditions. The highest number of such variants was obtained from irradiated 'SaberBeg' x 'Mexipak' and 'SaberBeg' x ('Mexipak' x 'AbuGhraib 4'), while the lowest number was found from 'SaberBeg' x 'Araz'. (author)

  5. Effector proteins of rust fungi.

    Science.gov (United States)

    Petre, Benjamin; Joly, David L; Duplessis, Sébastien

    2014-01-01

    Rust fungi include many species that are devastating crop pathogens. To develop resistant plants, a better understanding of rust virulence factors, or effector proteins, is needed. Thus far, only six rust effector proteins have been described: AvrP123, AvrP4, AvrL567, AvrM, RTP1, and PGTAUSPE-10-1. Although some are well established model proteins used to investigate mechanisms of immune receptor activation (avirulence activities) or entry into plant cells, how they work inside host tissues to promote fungal growth remains unknown. The genome sequences of four rust fungi (two Melampsoraceae and two Pucciniaceae) have been analyzed so far. Genome-wide analyses of these species, as well as transcriptomics performed on a broader range of rust fungi, revealed hundreds of small secreted proteins considered as rust candidate secreted effector proteins (CSEPs). The rust community now needs high-throughput approaches (effectoromics) to accelerate effector discovery/characterization and to better understand how they function in planta. However, this task is challenging due to the non-amenability of rust pathosystems (obligate biotrophs infecting crop plants) to traditional molecular genetic approaches mainly due to difficulties in culturing these species in vitro. The use of heterologous approaches should be promoted in the future.

  6. Crown rust control on oats

    International Nuclear Information System (INIS)

    Frey, K.J.; Browning, J.A.; Simons, M.D.

    1976-01-01

    Attempts have been made to test the relative effectiveness of EMS treatment for inducing tolerance to crown rust among oat strains Clintland-60 of different ploidy levels. One strain of diploid and one of tetraploid oats were treated with EMS. These two strains are as susceptible to damage from crown rust as are cultivars of hexaploid oats. Multiline cultivars of oats have been shown to provide adequate protection from economic loss due to crown-rust disease in Iowa. Since 1968, eleven multiline cultivars of oats have been released from the Iowa station for use in commercial production in the midwestern USA. During the past two winter seasons, the effectiveness of multiline oat cultivars against crown-rust disease has been researched in Texas, USA, which has a ''long rust season'' of about four months, not an Iowa ''short rust season''. The protection against crown rust afforded by the multiline cultivars appeared equally good in Texas and Iowa. The seasonal productions of crown-rust spores relative to completely resistant and susceptible checks were nearly identical in both environments. Fifteen new isolines of oats have been developed for use in multiline varieties, with seed supplies sufficiently large for immediate use

  7. Protecting steel from rusting by rust. The mechanism of rust formation and its control

    International Nuclear Information System (INIS)

    Kimura, Masao

    2008-01-01

    Weathering steel, when exposed outdoors for a few years, forms a protective layer resulting in reduction of the corrosion rate. The state of rusts is fundamental for understanding its mechanisms, but the structure and its relationship with the mechanism have not been understood. In this study, a new crystallographic approach was applied to reveal nano-structure of rusts with using of X-ray synchrotron radiation. It has been shown that additional elements alter the corrosion process in its early stage, resulting in formation of protective rusts. (author)

  8. Community composition of target vs. non-target fungi in fungicide treated wheat

    DEFF Research Database (Denmark)

    Knorr, Kamilla; Jørgensen, Lise Nistrup; Justesen, Annemarie Fejer

    2012-01-01

    disease in wheat and within the last decade, new aggressive strains of yellow rust has caused severe epidemics that lead to substantial yield losses. This study explored the community composition of target versus non-target fungi in yellow rust infected wheat as affected by treatment timing and dose......Fungicide treatments are common control strategies used to manage fungal pathogens in agricultural fields, however, effects of treatments on the composition of total fungal communities, including non-target fungi, in the phyllosphere is not well known. Yellow rust (Puccinia striiformis) is a common...

  9. Research on spatial distribution of photosynthetic characteristics of Winter Wheat

    Science.gov (United States)

    Yan, Q. Q.; Zhou, Q. Y.; Zhang, B. Z.; Han, X.; Han, N. N.; Li, S. M.

    2018-03-01

    In order to explore the spatial distribution of photosynthetic characteristics of winter wheat leaf, the photosynthetic rate on different parts of leaf (leaf base-leaf middle-leaf apex) and that on each canopy (top layer-middle layer-bottom layer) leaf during the whole growth period of winter wheat were measured. The variation of photosynthetic rate with PAR and the spatial distribution of winter wheat leaf during the whole growth periods were analysed. The results showed that the photosynthetic rate of different parts of winter wheat increased with the increase of PAR, which was showed as leaf base>leaf middle>leaf apex. In the same growth period, photosynthetic rate in different parts of the tablet was showed as leaf middle>leaf base>leaf apex. For the different canopy layer of winter wheat, the photosynthetic rate of the top layer leaf was significantly greater than that of the middle layer and lower layer leaf. The photosynthetic rate of the top layer leaf was the largest in the leaf base position. The photosynthetic rate of leaf of the same canopy layer at different growth stages were showed as tasseling stage >grain filling stage > maturation stage.

  10. Effect of Early Foliar Disease Control on Wheat Scab Severity (Fusarium graminearum in Argentina

    Directory of Open Access Journals (Sweden)

    Jorge David Mantecón

    2013-01-01

    Full Text Available Wheat scab is common in Argentina mainly durum wheat and some bread varieties. The epidemics occur every 5 to 7 years. During the 2007, 2008, and 2009 growing seasons, three trials were conducted at the INTA Balcarce Experimental Station. Each plot had six rows of 5 m long, spaced 0.15 m apart and was set up in a randomized complete block design with four replications. Trifloxystrobin plus cyproconazole was sprayed at Z3.1 stage. Treatments were sprayed at Z6.1 stage with tebuconazole, prochloraz, and metconazole to improve scab control. Artificial inoculations were made in Z6.1. Severity of Septoria leaf bloth and leaf rust was assessed in boot stage (Z3.9. Scab severity was rated at early dough stage (Z8.3. Yields were recorded each year. Fungicide only applied at Z3.1 stage did not reduce field scab severity but reduced the seeds infection and increased the yields. Early fungicide spray produced yield increase at about 22% and a decrease in seed infection of up to 40%. Yields increased in a 55.3% and in a 19.6% when compared with the inoculated and not inoculated check, respectively. The purpose of this study was to evaluate the effect of foliar disease control on scab, crop yield, and seed health.

  11. In situ hybridization for the detection of rust fungi in paraffin embedded plant tissue sections.

    Science.gov (United States)

    Ellison, Mitchell A; McMahon, Michael B; Bonde, Morris R; Palmer, Cristi L; Luster, Douglas G

    2016-01-01

    Rust fungi are obligate pathogens with multiple life stages often including different spore types and multiple plant hosts. While individual rust pathogens are often associated with specific plants, a wide range of plant species are infected with rust fungi. To study the interactions between these important pathogenic fungi and their host plants, one must be able to differentiate fungal tissue from plant tissue. This can be accomplished using the In situ hybridization (ISH) protocol described here. To validate reproducibility using the ISH protocol, samples of Chrysanthemum × morifolium infected with Puccinia horiana, Gladiolus × hortulanus infected with Uromyces transversalis and Glycine max infected with Phakopsora pachyrhizi were tested alongside uninfected leaf tissue samples. The results of these tests show that this technique clearly distinguishes between rust pathogens and their respective host plant tissues. This ISH protocol is applicable to rust fungi and potentially other plant pathogenic fungi as well. It has been shown here that this protocol can be applied to pathogens from different genera of rust fungi with no background staining of plant tissue. We encourage the use of this protocol for the study of plant pathogenic fungi in paraffin embedded sections of host plant tissue.

  12. [Photosynthetic gas exchange and water utilization of flag leaf of spring wheat with bunch sowing and field plastic mulching below soil on semi-arid rain-fed area.

    Science.gov (United States)

    Yang, Wen Xiong; Liu, Na; Liu, Xiao Hua; Zhang, Xue Ting; Wang, Shi Hong; Yuan, Jun Xiu; Zhang, Xu Cheng

    2016-07-01

    Based on the field experiment which was conducted in Dingxi County of Gansu Province, and involved in the three treatments: (1) plastic mulching on entire land with soil coverage and bunching (PMS), (2) plastic mulching on entire land and bunching (PM), and (3) direct bunching without mulching (CK). The parameters of SPAD values, chlorophyll fluorescence parameters, photosynthetic gas exchange parameters, as well as leaf area index (LAI), yield, evapotranspiration, and water use efficiency in flag leaves of spring wheat were recorded and analyzed from 2012 to 2013 continuously. The results showed that SPAD values of wheat flag leaves increased in PMS by 10.0%-21.5% and 3.2%-21.6% compared to PM and CK in post-flowering stage, respectively. The maximum photochemical efficiency (F v /F m ) , actual photochemical efficiency (Φ PS 2 ) of photosystem 2 (PS2), and photochemical quenching coefficient (q P ) of PMS were higher than those of PM and CK, the maximum increment values were 6.1%, 9.6% and 30.9% as compared with PM, and significant differences were observed in filling stage (P<0.05). The values of q N in PMS were lowest among the three treatments, and it decreased significantly by 23.8% and 15.4% in heading stage in 2012 and 2013 respectively, as compared with PM. The stoma conductance (g s ) of wheat flag leaves in PMS was higher than that of PM and CK, with significant difference being observed in filling stage, and it increased by 17.1% and 21.1% in 2012 and 2013 respectively, as compared with PM. The transpiration rate (T r ), net photosynthetic rate (P n ), and leaf instantaneous water use efficiency (WUE i ) except heading stage in 2013 of PMS increased by 5.4%-16.7%, 11.2%-23.7%, and 5.6%-7.2%, respectively, as compared with PM, and significant difference of WUE i was observed in flowering stage in 2012. The leaf area index (LAI) of PMS was higher than that of PM and CK, especially, it differed significantly in seasonal drought of 2013. Consequently

  13. Apoplastic Sugar Extraction and Quantification from Wheat Leaves Infected with Biotrophic Fungi.

    Science.gov (United States)

    Roman-Reyna, Veronica; Rathjen, John P

    2017-01-01

    Biotrophic fungi such as rusts modify the nutrient status of their hosts by extracting sugars. Hemibiotrophic and biotrophic fungi obtain nutrients from the cytoplasm of host cells and/or the apoplastic spaces. Uptake of nutrients from the cytoplasm is via intracellular hyphae or more complex structures such as haustoria. Apoplastic nutrients are taken up by intercellular hyphae. Overall the infection creates a sink causing remobilization of nutrients from local and distal tissues. The main mobile sugar in plants is sucrose which is absorbed via plant or fungal transporters once unloaded into the cytoplasm or the apoplast. Infection by fungal pathogens alters the apoplastic sugar contents and stimulates the influx of nutrients towards the site of infection as the host tissue transitions to sink. Quantification of solutes in the apoplast can help to understand the allocation of nutrients during infection. However, separation of apoplastic fluids from whole tissue is not straightforward and leakage from damaged cells can alter the results of the extraction. Here, we describe how variation in cytoplasmic contamination and infiltrated leaf volumes must be controlled when extracting apoplastic fluids from healthy and rust-infected wheat leaves. We show the importance of correcting the data for these parameters to measure sugar concentrations accurately.

  14. Application of Near-Infrared Spectroscopy to Quantitatively Determine Relative Content of Puccnia striiformis f. sp. tritici DNA in Wheat Leaves in Incubation Period

    Directory of Open Access Journals (Sweden)

    Yaqiong Zhao

    2017-01-01

    Full Text Available Stripe rust caused by Puccinia striiformis f. sp. tritici (Pst is a devastating wheat disease worldwide. Potential application of near-infrared spectroscopy (NIRS in detection of pathogen amounts in latently Pst-infected wheat leaves was investigated for disease prediction and control. A total of 300 near-infrared spectra were acquired from the Pst-infected leaf samples in an incubation period, and relative contents of Pst DNA in the samples were obtained using duplex TaqMan real-time PCR arrays. Determination models of the relative contents of Pst DNA in the samples were built using quantitative partial least squares (QPLS, support vector regression (SVR, and a method integrated with QPLS and SVR. The results showed that the kQPLS-SVR model built with a ratio of training set to testing set equal to 3 : 1 based on the original spectra, when the number of the randomly selected wavelength points was 700, the number of principal components was 8, and the number of the built QPLS models was 5, was the best. The results indicated that quantitative detection of Pst DNA in leaves in the incubation period could be implemented using NIRS. A novel method for determination of latent infection levels of Pst and early detection of stripe rust was provided.

  15. Wheat transcription factor TaWRKY70 is positively involved in high-temperature seedling-plant resistance to Puccinia striiformis f. sp. tritici

    Science.gov (United States)

    Wheat stripe rust, caused by Puccinia striiformis f. sp. tritici (Pst), is a devastating disease of wheat (Triticum aestivum) worldwide. Wheat high-temperature seedling-plant (HTSP) resistance to Pst is non-race-specific and durable. WRKY transcription factors have proven to play important roles in ...

  16. Rusted Designs: The New Apron

    OpenAIRE

    Swindells, Steve; Burcikova, Mila

    2013-01-01

    Articulated as a practice of design-couture, conceptualized as a project that seeks a sense \\ud of social engagement through research, design and making of everyday ‘common couture’, \\ud Rusted puts craft action in a very close relation with daily (political) or practical life. Rusted \\ud designs collage pre-used fabric and clothing (found, bought or gifted) with new cloth, thus \\ud using items of fabric and clothing from different times, countries and with variety of social \\ud histories. Th...

  17. Characteristics of spring wheat genotypes exhibiting high resistance to FHB in terms of their resistance to other fungal diseases

    Directory of Open Access Journals (Sweden)

    Danuta Kurasiak-Popowska

    2016-09-01

    Full Text Available The field experiment was carried out in 2010–2012 at the Dłoń Agricultural Research Station, the Poznań University of Life Sciences, Poland. The study was designed to evaluate the degree of infection by powdery mildew, brown rust, and septoria leaf blotch in 61 spring wheat genotypes differing in their resistance to Fusarium ssp. The vast majority of spring wheat genotypes in the collection of gene resources in the USA defined as resistant to Fusarium ssp. confirmed their resistance under Polish climatic conditions. The B .graminis infection rate of genotypes that are considered to be resistant to Fusarium head blight was high. The resistance ranged from 7 for Sumai 3 (PL2 up to 8.8 for Ning 8331 (in a 9-point scale. Most of the genotypes (56.5% were infected by Puccinia recondita at a level of 1–3 (in a 9-point scale. The genotypes of Sumai 3 exhibited high resistance to septoria leaf blotch, amounting to 1–2 in a 9-point scale; the resistance of Frontana ranged from 1 to 3.5, while the genotypes of Ning were infected by Mycosphaerella graminicola at 5–6.

  18. Fusiform Rust of Southern Pines

    Science.gov (United States)

    W. R. Phelps; F. L. Czabator

    1978-01-01

    Fusiform rust, caused by the fungus Cronartium fusiforme Hedg. & Hunt ex Cumm., is distributed in the Southern United States from Maryland to Florida and west to Texas and southern Arkansas. Infections by the fungus, which develops at or near the point of infection, result in tapered, spindle-shaped swells, called galls, on branches and stems of pines. (see photo...

  19. Characterization of mild steel pre rusted and rust converted surfaces through advanced electrochemical analysis

    International Nuclear Information System (INIS)

    Riaz, F.; Rizvi, Z.H.; Arshad, K.

    2008-01-01

    The present work evaluates the anti corrosive properties of a tannin based rust converter applied on the pre rusted steel coupons as compared with the grit blasted bare metal and pre rusted steel coupons. The mechanism and the corrosion control behaviour of the rust converter are characterized and monitored using EIS technique. The result suggested that when the tannin based rust converter applied on the pre rusted/corroded coupon, the protection properties of the mild steel coupon clearly improved because of the more compact conversion layer being formed on the coupon. It is inferred that the rust converter can be applied on the pre rusted samples as an alternative technique to the surface preparation for protection purpose. (author)

  20. Desenvolvimento vegetativo e reprodutivo de cultivares de trigo e sua associação com a emissão de folhas Vegetative and reproductive development of wheat cultivars and its association with leaf appearance

    Directory of Open Access Journals (Sweden)

    Lidiane Cristine Walter

    2009-11-01

    Full Text Available O objetivo deste estudo foi determinar a relação da duração das fases vegetativa, reprodutiva e total do ciclo de desenvolvimento com o número final de folhas e com a velocidade de aparecimento de folhas no colmo principal, em cultivares brasileiras de trigo, variando-se a data de semeadura. Um experimento de campo foi realizado em Santa Maria, Rio Grande do Sul (RS, com 13 datas de semeadura ao longo de três anos (2005, 2006 e 2007. Foram utilizados seis genótipos de trigo com ciclos de desenvolvimento variando de precoce a tardio: 'BRS LOURO', 'CEP 52', 'BRS 177', 'CEP 51', 'NOVA ERA' e 'BRS TARUMÃ'. Para cada cultivar e data de semeadura, foi determinada a duração, em °C dia, das fases vegetativa (emergência - antese e reprodutiva (antese - maturidade fisiológica e do ciclo total (emergência - maturidade fisiológica, o número final de folhas e o filocrono (tempo para aparecimento de duas folhas sucessivas no colmo principal e a relação entre essas variáveis por meio de análise de regressão. Os resultados indicam que a duração do ciclo total das cultivares de trigo tem relação direta com a duração da fase vegetativa e não com a fase reprodutiva, a qual foi similar entre as cultivares, e que a duração da fase vegetativa tem relação direta com o número final de folhas e não com a velocidade de aparecimento dessas folhas no colmo principal.The objective of this study was to determine the relationship between the duration of vegetative, reproductive and total developmental cycle with the main stem final leaf number and with the main stem leaf appearance rate in Brazilian wheat cultivars, varying the sowing date. A field experiment was carried out in Santa Maria, RS, in 13 sowing dates during three years (2005, 2006 and 2007. Six wheat genotypes with developmental cycle varying from early to late were used: BRS LOURO, CEP 52, BRS 177, CEP 51, NOVA ERA, and BRS TARUMÃ. For each cultivar and sowing date, the

  1. Radiation and nitrogen use at the leaf and canopy level by wheat and oilseed rape during the critical period for grain number definition

    NARCIS (Netherlands)

    Dreccer, M.F.; Schapendonk, A.H.C.M.; Oijen, van M.; Pot, C.S.; Rabbinge, R.

    2000-01-01

    During the critical period for grain number definition, the amount of biomass produced per unit absorbed radiation is more sensitive to nitrogen (N) supply in oilseed rape than in wheat, and reaches a higher value at high N. This response was investigated by combining experimental and modelling

  2. Genotyping-by-Sequencing derived High-Density Linkage Map and its Application to QTL Mapping of Flag Leaf Traits in Bread Wheat

    Science.gov (United States)

    Hard red winter wheat parents ‘Harry’ (drought tolerant) and ‘Wesley’ (drought susceptible) was used to develop a recombinant inbred population to identify genomic regions associated with drought and adaptation. To precisely map genomic regions high-density linkage maps are a prerequisite. In this s...

  3. Exploiting a wheat EST database to assess genetic diversity.

    Science.gov (United States)

    Karakas, Ozge; Gurel, Filiz; Uncuoglu, Ahu Altinkut

    2010-10-01

    Expressed sequence tag (EST) markers have been used to assess variety and genetic diversity in wheat (Triticum aestivum). In this study, 1549 ESTs from wheat infested with yellow rust were used to examine the genetic diversity of six susceptible and resistant wheat cultivars. The aim of using these cultivars was to improve the competitiveness of public wheat breeding programs through the intensive use of modern, particularly marker-assisted, selection technologies. The F(2) individuals derived from cultivar crosses were screened for resistance to yellow rust at the seedling stage in greenhouses and adult stage in the field to identify DNA markers genetically linked to resistance. Five hundred and sixty ESTs were assembled into 136 contigs and 989 singletons. BlastX search results showed that 39 (29%) contigs and 96 (10%) singletons were homologous to wheat genes. The database-matched contigs and singletons were assigned to eight functional groups related to protein synthesis, photosynthesis, metabolism and energy, stress proteins, transporter proteins, protein breakdown and recycling, cell growth and division and reactive oxygen scavengers. PCR analyses with primers based on the contigs and singletons showed that the most polymorphic functional categories were photosynthesis (contigs) and metabolism and energy (singletons). EST analysis revealed considerable genetic variability among the Turkish wheat cultivars resistant and susceptible to yellow rust disease and allowed calculation of the mean genetic distance between cultivars, with the greatest similarity (0.725) being between Harmankaya99 and Sönmez2001, and the lowest (0.622) between Aytin98 and Izgi01.

  4. Sustainable use of winter Durum wheat landraces under ...

    African Journals Online (AJOL)

    ... the two checks cultivars. Bi- plot analysis showed that some promising lines with reasonable grain yields, good quality parameters, winter hardiness and drought tolerances among yellow rust resistance durum wheat landraces can be selected for semiarid conditions of Mediterranean countries for sustainable production.

  5. Accelerating resistance breeding in wheat by integrating marker ...

    African Journals Online (AJOL)

    Genetic resistance is the simplest and most cost-effective way to guard against disease in plants. The pyramiding of resistance genes is a useful practice in bringing about durable resistance. This study aimed to develop a series of doubled haploid (DH) wheat lines containing combinations of wild species genes for rust ...

  6. AMMI and GGE biplot analysis for yield stability of promising bread wheat genotypes in bangladesh

    International Nuclear Information System (INIS)

    Ashrafulalam, M.; Li, M.; Farhad, M.; Hakim, M. A.

    2017-01-01

    Identification of stable and high yielding varieties under different environmental conditions prior to release as a variety is the major steps for plant breeding. Eight promising wheat genotypes were evaluated against two standard checks across five locations under terminal heat stress condition. The experimental design was an RCBD with three replications in over one year. AMMI analyses exhibited significant (p<0.01) variation in genotype, location and genotype by location interaction with respect to grain yield. The ASV value revealed that GEN4, GEN9, and GEN8 were stable, while GEN5, GEN1, and GEN6 were the most sensitive genotypes. The GGE results also confirmed GEN3, GEN7, GEN8, GEN9 and GEN4 were the most stable cultivars. Five distant mega-environments were identified including Dinajpur and Jamalpur with GEN3, GEN7 and GEN8 as the most favorable, Joydebpur, Rajshahi and Jessore with GEN4 and GEN9 as the most favorable. Genotype GEN7 and GEN8 showed highly resistant to BpLB, GEN3 and GEN4 showed moderately resistance to BpLB, and GEN9 showed moderate susceptible to BpLB. On the other hand, these five genotypes performed resistance to leaf rust. The genotype GEN7 (BAW 1202) was released as BARI Gom 32. Considering all analysis, GEN3 (BAW 1194), GEN7 (BAW 1202) and GEN8 (BAW 1203) demonstrated more stable genotypes with high mean yield, resistant to BpLB and leaf rust. Thus it is indicated that these genotypes can be used as suitable plant material for future breeding programs. (author)

  7. Cytogenetic and molecular identification of a wheat-Leymus mollis alien multiple substitution line from octoploid Tritileymus x Triticum durum.

    Science.gov (United States)

    Pang, Y H; Zhao, J X; Du, W L; Li, Y L; Wang, J; Wang, L M; Wu, J; Cheng, X N; Yang, Q H; Chen, X H

    2014-05-23

    Leymus mollis (Trin.) Pilger (NsNsXmXm, 2n = 28), a wild relative of common wheat, possesses many traits that are potentially valuable for wheat improvement. In order to exploit and utilize the useful genes of L. mollis, we developed a multiple alien substitution line, 10DM50, from the progenies of octoploid Tritileymus M842-16 x Triticum durum cv. D4286. Genomic in situ hybridization analysis of mitosis and meiosis (metaphase I), using labeled total DNA of Psathyrostachys huashanica as probe, showed that the substitution line 10DM50 was a cytogenetically stable alien substitution line with 36 chromosomes from wheat and three pairs of Ns genome chromosomes from L. mollis. Simple sequence repeat analysis showed that the chromosomes 3D, 6D, and 7D were absent in 10DM50. Expressed sequence tag-sequence tagged sites analysis showed that new chromatin from 3Ns, 6Ns, and 7Ns of L. mollis were detected in 10DM50. We deduced that the substitution line 10DM50 was a multiple alien substitution line with the 3D, 6D, and 7D chromosomes replaced by 3Ns, 6Ns, and 7Ns from L. mollis. 10DM50 showed high resistance to leaf rust and significantly improved spike length, spikes per plant, and kernels per spike, which are correlated with higher wheat yield. These results suggest that line 10DM50 could be used as intermediate material for transferring desirable traits from L. mollis into common wheat in breeding programs.

  8. Silicon leaf application and physiological quality of white oat and wheat seedsAplicação foliar de silício e qualidade fisiológica de sementes de aveia-branca e trigo

    Directory of Open Access Journals (Sweden)

    Mariane Sayuri Ishizuka

    2012-10-01

    Full Text Available Plant nutrition can positively influence quality of seeds by improving plant tolerance to adverse climate. In this context, silicon is currently considered a micronutrient and it is beneficial to plant growth, especially Poaceaes such as white oat and wheat, thereby improving physiological quality of seeds. This study had the objective of evaluating the effects of silicon leaf application on plant tillering, silicon levels and physiological quality of white oat and wheat seeds besides establishing correlations between them. Two experiments were carried out in winter with white oat and wheat. The experimental design was the completely randomized block with eight replications. Treatments consisted of foliar application of silicon (0.8% of soluble silicon, as stabilized orthosilicic acid and a control (with no application. Silicon levels in leaves were determined at flowering whereas the number of plants and panicles/spikes per area was counted right before harvest. Seed quality was evaluated right after harvest through mass, germination and vigor tests. Data was submitted to variance analysis and means were compared by the Tukey test at a probability level of 5%. Person’s linear correlation test was performed among silicon level in plants, tillering and seed quality data. Silicon leaf application increases root and total length of white oat seedlings as an effect of higher Si level in leaves. Silicon leaf application increases mass of wheat seeds without affecting germination or vigor. A nutrição das plantas pode influenciar positivamente a qualidade das sementes por proporcionar maior tolerância às adversidades climáticas. Neste contexto, o silício é atualmente considerado um micronutriente e tem efeito benéfico no crescimento das plantas, especialmente Poaceaes como aveia-branca e trigo, consequentemente melhorando a qualidade fisiológica das sementes. Este estudo objetivou avaliar os efeitos da aplicação foliar de silício no

  9. New wheat cultivars induced by fast neutrons in Iraq

    International Nuclear Information System (INIS)

    Ibrahim, I.F.; Al-Maaroof, E.M.; Al-Aubaidi, M.O.; Al-Janabi, K.K.; Al-Janabi, A.A.; Al-Rawi, L.; Ali, A.H.

    1994-01-01

    Wheat (Triticum aestivum L. ssp. aestivum) seeds from the cultivar Mexipak and F2 of the cross SaberBeg/Mexipak and saberBeg/Mexipak/Abu-Ghraib-4 were irradiated with fast neutrons and screened for resistance to leaf rust (Puccinia recondita Rob. ex Desm.) during three generations. Thirty-eight and 226 variants showing resistant and moderately resistant reactions, respectively, were selected. Of these variants three mutants showing genetic purity and stability were studied for yield components for four successive generations. Analyses of proteins and isozymes along with chemical and physical properties were conducted on these mutants and their parents. Data on disease incidence, lodging, shattering and yield components indicated that all the mutants significantly surpassed the cultivars Mexipak, SaberBeg and Abu-Ghraib-4. Both mutants Tamuz-1 and Tamuz-2 surpassed Mexipak in bread-making quality, while the mutant Tamuz-3 had a higher tendency for better bread-making quality than Mexipak or SeberBeg

  10. Application of DNA RFLP procedures in interspecific gene transfer: The Lr19 translocation of wheat

    International Nuclear Information System (INIS)

    Prins, R.; Marais, G.F.; Marais, A.S.; Pretorius, Z.A.; Janse, B.J.H.

    1998-01-01

    Twenty-nine lines with deletions in the Lr19 ('Indis') translocated chromosome segment were used to physically map Thinopyrum Restriction Fragment Length Polymorphism (RFLP) loci as well as the Sr25 and Sdl loci. The relative distances between marker loci on the translocation were then calculated. The information was then used as an aid to characterize several recombined forms of the translocation. The data confirmed the reported homoeology between the Lr19 segment and chromosome arm 7DL of wheat. Also, it seems that the Lr19 translocation in 'Indis' is very similar to the Lr19 segment in the T4 source and that the former may not derive from Thinopyrum distichum. Near-isogenic lines of the recombined segments were derived and used to study their expression of leaf rust resistance. It became evident that only one potentially useful recombinant was obtained in an earlier attempt to induce allosyndetic pairing between the Lr19 translocation and 7DL of wheat. (author)

  11. Genome-Wide Association Mapping of Stem Rust Resistance in Hordeum vulgare subsp. spontaneum.

    Science.gov (United States)

    Sallam, Ahmad H; Tyagi, Priyanka; Brown-Guedira, Gina; Muehlbauer, Gary J; Hulse, Alex; Steffenson, Brian J

    2017-10-05

    Stem rust was one of the most devastating diseases of barley in North America. Through the deployment of cultivars with the resistance gene Rpg1 , losses to stem rust have been minimal over the past 70 yr. However, there exist both domestic (QCCJB) and foreign (TTKSK aka isolate Ug99) pathotypes with virulence for this important gene. To identify new sources of stem rust resistance for barley, we evaluated the Wild Barley Diversity Collection (WBDC) (314 ecogeographically diverse accessions of Hordeum vulgare subsp. spontaneum ) for seedling resistance to four pathotypes (TTKSK, QCCJB, MCCFC, and HKHJC) of the wheat stem rust pathogen ( Puccinia graminis f. sp. tritici , Pgt ) and one isolate (92-MN-90) of the rye stem rust pathogen ( P. graminis f. sp. secalis , Pgs ). Based on a coefficient of infection, the frequency of resistance in the WBDC was low ranging from 0.6% with HKHJC to 19.4% with 92-MN-90. None of the accessions was resistant to all five cultures of P. graminis A genome-wide association study (GWAS) was conducted to map stem rust resistance loci using 50,842 single-nucleotide polymorphic markers generated by genotype-by-sequencing and ordered using the new barley reference genome assembly. After proper accounting for genetic relatedness and structure among accessions, 45 quantitative trait loci were identified for resistance to P. graminis across all seven barley chromosomes. Three novel loci associated with resistance to TTKSK, QCCJB, MCCFC, and 92-MN-90 were identified on chromosomes 5H and 7H, and two novel loci associated with resistance to HKHJC were identified on chromosomes 1H and 3H. These novel alleles will enhance the diversity of resistance available for cultivated barley. Copyright © 2017 Sallam et al.

  12. Strategies for improving rust resistance in oats

    International Nuclear Information System (INIS)

    Harder, D.E.; McKenzie, R.I.H.; Martens, J.W.; Brown, P.D.

    1977-01-01

    During the history of breeding oats for rust resistance in Canada the known sources of resistance proved inadequate to counter the virulence potential of both stem rust (Puccinia graminis avenae) and crown rust (P. coronata avenae). A major programme to overcome the rust problem was undertaken at Winnipeg, involving four alternate approaches: (1) A search for new resistance in wild oat species, particularly Avena sterilis, has provided a wealth of good resistance to crown rust, but less to stem rust. Much of the A. sterilis-derived crown rust resistance is now being used world-wide; (2) Efforts at synthesizing new resistance by mutation breeding methods have not been successful. Of about seven million plants examined, only one showed significant new resistance, but this was associated with poor plant type; (3) Resistance with low levels of expression but which appears broadly effective has been observed against both stem and crown rusts. It appears that numbers of these low-level genes exist, and that they can be accumulated to provide increasingly effective resistance. Problems in using this type of resistance in a practical way are discussed; (4) Excellent rust resistance has been found in lower ploidy species such as A. barbata, but it was not previously possible to stabilize this resistance in hexaploid species. By using mutagenic treatments attempts have been made to translocate smaller portions of the A. barbata chromosome carrying the resistance to the hexaploid cultivar Rodney. In conclusion, mutation breeding methods at present appear to have limited application in synthesizing new rust-resistant genotypes in oats. The search for already existing genetic resistance and its synthesis into multi-genic resistant lines appears to be the most effective way at present of resolving the rust problem in oats. (author)

  13. Estudo comparativo de cultivares de trigo em latossolo roxo no estado de São Paulo em 1974 A comparative study on wheat cultivars on latossolic B "Terra Roxa" soils in the state of São Paulo in 1974

    Directory of Open Access Journals (Sweden)

    João Carlos Felício

    1976-01-01

    Full Text Available Este trabalho foi executado com o propósito de estudar o comportamento de diferentes cultivares de trigo, em latossolo roxo na região tritícola do Vale do Paranapanema no Estado de São Paulo. Foram instalados três experimentos em 1974. Os cultivares IRN-526-63, IAS-55, Sonora-63, BH-1146, IAS-54, Londrina, LA-1434 e Pitic-62 foram os que apresentaram maior produtividade por unidade de área; os cultivares IAC-5, Sonora-63, Sonora-64 x Selkirk, Triticum agropyrum, Tobari-66, IAC-11, Sonora-64, Norteno-67 e Super X mostraram-se resistentes às raças prevalentes de ferrugem do colmo. Os cultivares Super X, Sonora-64 x Selkirk, IRN-152-63 e Triticum agropyrum mostraram-se resistentes à ferrugem da folha, e BH-1146, IAC-5, IAC-11, LA-1434, T. agropyrum e IRN-152-63 foram suscetíveis ao acamamento.Selected germplasms of wheat were tested for yield potential and resistance to rusts and cultivar trials in the State of São Paulo. Performance was evaluated in several locations in 1974 in the wheat area of the State on Latossolic B "Terra Roxa" soils. The cultivars IRN-526-63, IAS-55, Sonora-63, BH-1146, IAS-54, Londrina, LA-1434 and Pitic-62 showed superior performance for yield. The cultivars IAC-5, Sonora-63, Sonora-64 x Selkink, Triticum agropyrum, Tobai-66, IAC-11, Sonora-64, Norteno-67, and Super X showed better resistance to stem rust. The cultivars Super X, Sonora-64 x Selkink, IRN-152,63, and Triticum agropyrum, were more resistant to leaf rust. The cultivars BH-1146, IAC-5, Triticum agropyrum, IRN-152-62, LA-1434 and IAC-11 were susceptible to lay.

  14. Herança da resistência à ferrugem da folha da aveia (Puccinia coronata f. sp. avenae Fraser & Led. em genótipos brasileiros de aveia branca Inheritance of oat leaf rust (Puccinia coronata f. sp. avenae Fraser & Led. resistance in white oat brazilian genotypes

    Directory of Open Access Journals (Sweden)

    Eduardo Alano Vieira

    2006-02-01

    the use of resistant cultivars. However, for the durable resistance to be acquired, it is necessary to know the genetics of resistance to crown rust in oats. Thus, the objective of this work was to determine the type of inheritance of resistance to three Puccinia coronata f. sp. avenae Fraser & Led., isolates (collected in southern Brazil in brazilian white oat genotypes. To determine the inheritance of resistance to each one of three isolates,F2 populations were used generated through artificial crosses, between resistant (R and susceptible (S and between resistant genotypes (R. Thus, F2 populations from the following artificial crosses: i URPEL 15 (R x UFRGS 7 (S, UPF 16 (R x UFRGS 7 (S and URPEL 15 (R x UPF 16 (R, were used to determine the inheritance of resistance to isolate one (1; ii URPEL 15 (R x UFRGS 7 (S, UPF 18 (R x UFRGS 7 (S and URPEL 15 (R x UPF 18 (R, to determine the inheritance of resistance to isolate two (2; iii URPEL 15 (R x UFRGS 7 (S and URPEL 15 (R x UPF 18 (S, to determine the inheritance of resistance to isolate three (3. The obtained results indicate that the genotype URPEL 15 present dominants genes for resistance to the three oat leaf rust isolates evaluated, the cultivar UPF 16 presents a recessive gene for resistance to isolate 1 and the cultivar UPF 18 has a recessive gene of resistence to isolate 2. Also, the resistance genes presented by genotypes URPEL 15, UPF 16 and UPF 18, segregate in an independent manner.

  15. Historic Rust College: Fulfilling a Mission.

    Science.gov (United States)

    Hoffman, Carl

    1989-01-01

    Describes Rust College, a Mississippi college dedicated to educating Blacks from economically and educationally impoverished backgrounds. Discusses the college's financial management, recent fund-raising efforts, building program, and academic programs. Examines the role of the predominantly Black college and Rust's mission to help students…

  16. Screening oat populations for rust resistant mutants

    International Nuclear Information System (INIS)

    McKenzie, R.I.H.; Martens, J.W.; Harder, D.E.; Brown, P.D.

    1976-01-01

    In 1972 a two million M 2 plants were grown at Morden, Manitoba. Thirteen plants which were thought to have possible resistance to race CI0 of oat stem rust were harvested. After extensive seedling and adult plant rust tests the best of the selected plant progenies was crossed and backcrossed to Rodney 0, a stem rust susceptible oat. The resistance in this line M-72-6 was found to be controlled by a single gene. In 1973 another two million M 2 plants were examined for rust resistance at Morden and 38 were harvested. None of the M 2 plants selected in 1973 appeared to have any seedling or adult resistance when examined more thoroughly in the greenhouse and again in the field in 1974. In 1974 one million M 2 plants were examined for resistance and 73 selected. None appeared to have any resistance when tested further. The strain CI3034 which was good adult plant stem rust resistance associated with weak straw and a light green plant colour was treated with gamma radiation and EMS in 1973 and the M 2 grown in the C10 rust nursery at Morden in 1974. A considerable number of dark green plants were present in all treatments but unfortunately all were found to be stem rust susceptible. Thus it would appear to be difficult if not impossible to separate the rust resistance in CI3034 from the undesirable characters, weak straw and light green plant colour. (author)

  17. Defeating the Warrior: genetic architecture of triticale resistance against a novel aggressive yellow rust race.

    Science.gov (United States)

    Losert, Dominik; Maurer, Hans Peter; Leiser, Willmar L; Würschum, Tobias

    2017-04-01

    Genome-wide association mapping of resistance against the novel, aggressive 'Warrior' race of yellow rust in triticale revealed a genetic architecture with some medium-effect QTL and a quantitative component, which in combination confer high levels of resistance on both leaves and ears. Yellow rust is an important destructive fungal disease in small grain cereals and the exotic 'Warrior' race has recently conquered Europe. The aim of this study was to investigate the genetic architecture of yellow rust resistance in hexaploid winter triticale as the basis for a successful resistance breeding. To this end, a diverse panel of 919 genotypes was evaluated for yellow rust infection on leaves and ears in multi-location field trials and genotyped by genotyping-by-sequencing as well as for known Yr resistance loci. Genome-wide association mapping identified ten quantitative trait loci (QTL) for yellow rust resistance on the leaves and seven of these also for ear resistance. The total genotypic variance explained by the QTL amounted to 44.0% for leaf and 26.0% for ear resistance. The same three medium-effect QTL were identified for both traits on chromosomes 1B, 2B, and 7B. Interestingly, plants pyramiding the resistance allele of all three medium-effect QTL were generally most resistant, but constitute less than 5% of the investigated triticale breeding material. Nevertheless, a genome-wide prediction yielded a higher predictive ability than prediction based on these three QTL. Taken together, our results show that yellow rust resistance in winter triticale is genetically complex, including both medium-effect QTL as well as a quantitative resistance component. Resistance to the novel 'Warrior' race of this fungal pathogen is consequently best achieved by recurrent selection in the field based on identified resistant lines and can potentially be assisted by genomic approaches.

  18. Characterization and comparative analysis of the genome of Puccinia sorghi Schwein, the causal agent of maize common rust.

    Science.gov (United States)

    Rochi, Lucia; Diéguez, María José; Burguener, Germán; Darino, Martín Alejandro; Pergolesi, María Fernanda; Ingala, Lorena Romina; Cuyeu, Alba Romina; Turjanski, Adrián; Kreff, Enrique Domingo; Sacco, Francisco

    2018-03-01

    Rust fungi are one of the most devastating pathogens of crop plants. The biotrophic fungus Puccinia sorghi Schwein (Ps) is responsible for maize common rust, an endemic disease of maize (Zea mays L.) in Argentina that causes significant yield losses in corn production. In spite of this, the Ps genomic sequence was not available. We used Illumina sequencing to rapidly produce the 99.6Mbdraft genome sequence of Ps race RO10H11247, derived from a single-uredinial isolate from infected maize leaves collected in the Argentine Corn Belt Region during 2010. High quality reads were obtained from 200bppaired-end and 5000bpmate-paired libraries and assembled in 15,722 scaffolds. A pipeline which combined an ab initio program with homology-based models and homology to in planta enriched ESTs from four cereal pathogenic fungus (the three sequenced wheat rusts and Ustilago maydis) was used to identify 21,087 putative coding sequences, of which 1599 might be part of the Ps RO10H11247 secretome. Among the 458 highly conserved protein families from the euKaryotic Orthologous Groups (KOG) that occur in a wide range of eukaryotic organisms, 97.5% have at least one member with high homology in the Ps assembly (TBlastN, E-value⩽e-10) covering more than 50% of the length of the KOG protein. Comparative studies with the three sequenced wheat rust fungus, and microsynteny analysis involving Puccinia striiformis f. sp. tritici (Pst, wheat stripe rust fungus), support the quality achieved. The results presented here show the effectiveness of the Illumina strategy for sequencing dikaryotic genomes of non-model organisms and provides reliable DNA sequence information for genomic studies, including pathogenic mechanisms of this maize fungus and molecular marker design. Copyright © 2016 Elsevier Inc. All rights reserved.

  19. Determination of Radiographic Healing: An Assessment of Consistency Using RUST and Modified RUST in Metadiaphyseal Fractures.

    Science.gov (United States)

    Litrenta, Jody; Tornetta, Paul; Mehta, Samir; Jones, Clifford; OʼToole, Robert V; Bhandari, Mohit; Kottmeier, Stephen; Ostrum, Robert; Egol, Kenneth; Ricci, William; Schemitsch, Emil; Horwitz, Daniel

    2015-11-01

    To determine the reliability of the Radiographic Union Scale for Tibia (RUST) score and a new modified RUST score in quantifying healing and to define a value for radiographic union in a large series of metadiaphyseal fractures treated with plates or intramedullary nails. Healing was evaluated using 2 methods: (1) evaluation of interrater agreement in a series of radiographs and (2) analysis of prospectively gathered data from 2 previous large multicenter trials to define thresholds for radiographic union. Part 1: 12 orthopedic trauma surgeons evaluated a series of radiographs of 27 distal femur fractures treated with either plate or retrograde nail fixation at various stages of healing in random order using a modified RUST score. For each radiographic set, the reviewer indicated if the fracture was radiographically healed. Part 2: The radiographic results of 2 multicenter randomized trials comparing plate versus nail fixation of 81 distal femur and 46 proximal tibia fractures were reviewed. Orthopaedic surgeons at 24 trauma centers scored radiographs at 3, 6, and 12 months postoperatively using the modified RUST score above. Additionally, investigators indicated if the fracture was healed or not healed. The intraclass correlation coefficient (ICC) with 95% confidence intervals was determined for each cortex, the standard and modified RUST score, and the assignment of union for part 1 data. The RUST and modified RUST that defined "union" were determined for both parts of the study. ICC: The modified RUST score demonstrated slightly higher ICCs than the standard RUST (0.68 vs. 0.63). Nails had substantial agreement, whereas plates had moderate agreement using both modified and standard RUST (0.74 and 0.67 vs. 0.59 and 0.53). The average standard and modified RUST at union among all fractures was 8.5 and 11.4. Nails had higher standard and modified RUST scores than plates at union. The ICC for union was 0.53 (nails: 0.58; plates: 0.51), which indicates moderate

  20. Pre-anthesis high-temperature acclimation alleviates damage to the flag leaf caused by post-anthesis heat stress in wheat

    DEFF Research Database (Denmark)

    Wang, Xiao; Cai, Jian; Jian, Dong

    2011-01-01

    and enhanced cell membrane peroxidation, as exemplified by increased O2-• production rate and reduction in activities of antioxiditave enzymes. However, under post-anthesis heat stress, plants with pre-anthesis hightemperature acclimation (HH)showedmuchhigher photosynthetic rates than those without pre...... all up-regulated under HH, whereas a gene encoding a major chlorophyll a/b-binding protein (Cab) was up-regulated by post-anthesis heat stress at 10 DAA, but was down-regulated at 13 DAA. The changes in the expression levels of the HH plants were more pronounced than those for the CH. Collectively......, the results indicated that pre-anthesis high-temperature acclimation could effectively alleviate the photosynthetic and oxidative damage caused by post-anthesis heat stress in wheat flag leaves, which was partially attributable to modifications in the expression of the photosythesis-responsive and antioxidant...

  1. Induced resistance to rust disease in lentil

    International Nuclear Information System (INIS)

    Paul, Amitava; Singh, D.P.

    2006-01-01

    Considerable yield reduction in lentil is due to rust caused by Uromyces fabae. So far the sources of resistance to rust are available in the small seeded background. There is a need to develop rust resistant/tolerant bold seeded cultivars. Mutations were induced by gamma rays (10 and 15 kR) for incorporating resistance to rust in K-75(Mallika), a high yielding bold seeded, but rust susceptible cultivar at Pantnagar which is the hot spot for this disease. Dry seeds (300) were irradiated for each treatment. In M 1 generation, individual plants from each treatment were selfed and harvested separately which constituted the M 2 generation. In M 2 individual plant progenies were scored following a rating scale of 1 (Free) to 9(highly susceptible). At 15 kR dose, 8 plants were resistant (score 3.0) and 14 plants were tolerant (score 5.0) to rust, while in control and 10 kR populations, all plants were susceptible or highly susceptible having score of 7 or 9, respectively. The M 2 plants segregated in ratio of 1 resistant: 3 susceptible. The progenies of resistant/tolerant M 2 plants were bred true in the M 3 generation suggesting that the resistance to rust is controlled by one recessive gene. (author)

  2. Structure of titanium-doped goethite rust

    International Nuclear Information System (INIS)

    Nakayama, Takenori; Ishikawa, Tatsuo; Konno, Toyohiko J.

    2005-01-01

    To investigate the influence of titanium addition on the formation and structure of goethite (α-FeOOH) rust which is one of main corrosion products of weathering steel, the artificially synthesized α-FeOOH rusts were prepared by hydrolysis of aqueous solutions of Fe(III) containing Ti(IV) at different atomic ratios (Ti/Fe) in the range 0-0.1. The obtained rusts particles were observed by TEM. Characterization by XRD, N 2 absorption, Moessbauer spectroscopy was also done. TEM observation revealed that the α-FeOOH rust particle size increased with the increase of Ti/Fe, and that Ti-enriched poorly crystalline particles were formed around the rust particles. XRD confirmed that the crystallite size increased with the increase of Ti/Fe, while the XRD peaks decreased in intensity. Specific surface area obtained by N 2 absorption increased with the increase of Ti/Fe. It is deduced from the obtained results that the addition of Ti(IV) increases the crystallite size of α-FeOOH, and produces double domain particles consisting of the particle core and a porous poorly crystalline shell. It is thought that such unique rust structure produced by titanium addition contributes to the protective properties of rust layer of the weathering steel

  3. Effects of Variety and Fungicidal Rate on Cercospora Leaf Spots ...

    African Journals Online (AJOL)

    Singh, V.R., Pandes, A.K., Reddy, P.M. and. Pao P.V. (1995). Resistance to Rust and Late leaf Spot of Groundnut. ICRISAT. Information Bulletin. No.47, Patancheru,. 502, 324, Andra Pradesh, India. P.24. Thapar, S., Bhusham, R. and Mathur, R.P.. (1995). Degradation of organophosphorus and carbamate pesticides in soils- ...

  4. Dryland wheat domestication changed the development of aboveground architecture for a well-structured canopy.

    Directory of Open Access Journals (Sweden)

    Pu-Fang Li

    Full Text Available We examined three different-ploidy wheat species to elucidate the development of aboveground architecture and its domesticated mechanism under environment-controlled field conditions. Architecture parameters including leaf, stem, spike and canopy morphology were measured together with biomass allocation, leaf net photosynthetic rate and instantaneous water use efficiency (WUE(i. Canopy biomass density was decreased from diploid to tetraploid wheat, but increased to maximum in hexaploid wheat. Population yield in hexaploid wheat was higher than in diploid wheat, but the population fitness and individual competition ability was higher in diploid wheats. Plant architecture was modified from a compact type in diploid wheats to an incompact type in tetraploid wheats, and then to a more compact type of hexaploid wheats. Biomass accumulation, population yield, harvest index and the seed to leaf ratio increased from diploid to tetraploid and hexaploid, associated with heavier specific internode weight and greater canopy biomass density in hexaploid and tetraploid than in diploid wheat. Leaf photosynthetic rate and WUEi were decreased from diploid to tetraploid and increased from tetraploid to hexaploid due to more compact leaf type in hexaploid and diploid than in tetraploid. Grain yield formation and WUEi were closely associated with spatial stance of leaves and stems. We conclude that the ideotype of dryland wheats could be based on spatial reconstruction of leaf type and further exertion of leaf photosynthetic rate.

  5. Pushing the boundaries of resistance: insights from Brachypodium-rust interactions

    Directory of Open Access Journals (Sweden)

    Melania eFigueroa

    2015-07-01

    Full Text Available The implications of global population growth urge transformation of current food and bioenergy production systems to sustainability. Members of the family Poaceae are of particular importance both in food security and for their applications as biofuel substrates. For centuries, rust fungi have threatened the production of valuable crops such as wheat, barley, oat and other small grains; similarly, biofuel crops can also be susceptible to these pathogens. Emerging rust pathogenic races with increased virulence and recurrent rust epidemics around the world point out the vulnerability of monocultures. Basic research in plant immunity, especially in model plants, can make contributions to understanding plant resistance mechanisms and improve disease management strategies. The development of the grass Brachypodium distachyon as a genetically tractable model for monocots, especially temperate cereals and grasses, offers the possibility to overcome the experimental challenges presented by the genetic and genomic complexities of economically valuable crop plants. The numerous resources and tools available in Brachypodium have opened new doors to investigate the underlying molecular and genetic bases of plant-microbe interactions in grasses and evidence demonstrating the applicability and advantages of working with B. distachyon is increasing. Importantly, several interactions between B. distachyon and devastating plant pathogens, such rust fungi, have been examined in the context of non-host resistance. Here, we discuss the use of B. distachyon in these various pathosystems. Exploiting B. distachyon to understand the mechanisms underpinning disease resistance to non-adapted rust fungi may provide effective and durable approaches to fend off these pathogens. The close phylogenetic relationship among Brachypodium spp. and grasses with industrial and agronomic value support harnessing this model plant to improve cropping systems and encourage its use in

  6. Wheat Allergy

    Science.gov (United States)

    ... of reactions. Learn more here. Milk Egg Peanut Tree Nuts Soy Wheat Fish Shellfish Sesame Other Food ... federal law. Download our resource on how to identify wheat on food labels. Avoid foods that contain ...

  7. Leaf and sidedressing nitrogen application on wheat crop in savannaAplicação foliar e em cobertura de nitrogênio na cultura do trigo no cerrado

    Directory of Open Access Journals (Sweden)

    Marcelo Andreotti

    2011-08-01

    Full Text Available The nitrogen in wheat is essential for obtaining high yields, not only the dose but also the time and the way of application are critical, reducing potential leaching and the cost of production. The objective is evaluating leaf and sidedressing nitrogen application on wheat crop in years of 2006 and 2007. A randomized blocks design in a factorial scheme 5x3x2 was used. The treatments consisted of five doses of nitrogen in the solution (0; 2.5; 5.0; 7.5 and 10%, three application times (at tillering: 30 days after plant emergency (DAE, at full flowering (50 DAE + in the beginning of grain formation (70 DAE and at tillering + in the beginning of grain formation, with and without sidedressing nitrogen applied at 40 DAE, using urea as source. They were evaluated: chlorophyll and nitrogen content in leaf, number of spikelets per ear, number of grains per ear, mass of grains per ear, number of grains per spikelet, mass hectolitric, mass of 100 grains and productivity of grains. The application of nitrogen topdressing in both years, influenced the yield characteristics of wheat. The times of leaf nitrogen only affected the leaf N content. The leaf nitrogen concentrations increased linearly the number of grains per spikelets, grains per spike, chlorophyll content, grain weight per ear and grain yield, and reduced mean weight per hectoliter, only in 2007.A adubação nitrogenada na cultura do trigo é essencial para a obtenção de altas produtividades da cultura, não somente a dose, como também a época e o modo de aplicação são fundamentais no rendimento, reduzindo possíveis problemas de lixiviação e o custo de produção. O trabalho teve como objetivo avaliar os efeitos da adubação nitrogenada em cobertura e foliar em diferentes estádios sobre as características produtivas da cultura do trigo em dois agrícolas, em condições irrigadas no cerrado. Os tratamentos foram originados do fatorial 5x3x2 e consistiram de cinco concentrações de

  8. The proportion of nitrate in leaf nitrogen, but not changes in root growth, are associated with decreased grain protein in wheat under elevated [CO2].

    Science.gov (United States)

    Bahrami, Helale; De Kok, Luit J; Armstrong, Roger; Fitzgerald, Glenn J; Bourgault, Maryse; Henty, Samuel; Tausz, Michael; Tausz-Posch, Sabine

    2017-09-01

    The atmospheric CO 2 concentration ([CO 2 ]) is increasing and predicted to reach ∼550ppm by 2050. Increasing [CO 2 ] typically stimulates crop growth and yield, but decreases concentrations of nutrients, such as nitrogen ([N]), and therefore protein, in plant tissues and grains. Such changes in grain composition are expected to have negative implications for the nutritional and economic value of grains. This study addresses two mechanisms potentially accountable for the phenomenon of elevated [CO 2 ]-induced decreases in [N]: N uptake per unit length of roots as well as inhibition of the assimilation of nitrate (NO 3 - ) into protein are investigated and related to grain protein. We analysed two wheat cultivars from a similar genetic background but contrasting in agronomic features (Triticum aestivum L. cv. Scout and Yitpi). Plants were field-grown within the Australian Grains Free Air CO 2 Enrichment (AGFACE) facility under two atmospheric [CO 2 ] (ambient, ∼400ppm, and elevated, ∼550ppm) and two water treatments (rain-fed and well-watered). Aboveground dry weight (ADW) and root length (RL, captured by a mini-rhizotron root growth monitoring system), as well as [N] and NO 3 - concentrations ([NO 3 - ]) were monitored throughout the growing season and related to grain protein at harvest. RL generally increased under e[CO 2 ] and varied between water supply and cultivars. The ratio of total aboveground N (TN) taken up per RL was affected by CO 2 treatment only later in the season and there was no significant correlation between TN/RL and grain protein concentration across cultivars and [CO 2 ] treatments. In contrast, a greater percentage of N remained as unassimilated [NO 3 - ] in the tissue of e[CO 2 ] grown crops (expressed as the ratio of NO 3 - to total N) and this was significantly correlated with decreased grain protein. These findings suggest that e[CO 2 ] directly affects the nitrate assimilation capacity of wheat with direct negative implications

  9. Rust Inhibitor And Fungicide For Cooling Systems

    Science.gov (United States)

    Adams, James F.; Greer, D. Clay

    1988-01-01

    Mixture of benzotriazole, benzoic acid, and fungicide prevents growth of rust and fungus. Water-based cooling mixture made from readily available materials prevents formation of metallic oxides and growth of fungi in metallic pipes. Coolant remains clear and does not develop thick sludge tending to collect in low points in cooling systems with many commercial rust inhibitors. Coolant compatible with iron, copper, aluminum, and stainless steel. Cannot be used with cadmium or cadmium-plated pipes.

  10. Expression of Leaf Proteins in Two Cultivars of Bread Wheat under Cadmium and Mercury Stress Using Two-Dimensional Gel Electrophoresis

    Directory of Open Access Journals (Sweden)

    S. Y. Raeesi Sadati

    2016-02-01

    Full Text Available Wheat is an important source of human food. Cadmium and mercury bind to sulfhydryl groups of structural proteins and enzymes and cause inhibition in activity and decrease in protein production or interfere with the regulation of the enzymes. To study the effect of protein expression under different levels of cadmium and mercury, the experiment was conducted in a completely randomized design with three replications in Mohaghegh Ardabili University, Ardabil, Iran. Experimental factors consisted of two Gonbad and Tajan bread what cultivars, heavy metals in seven levels (four concentrations of mercuric chloride in 5, 10, 15 and 20 µM and cadmium chloride at two concentrations of 0.25 and 0.5 mM and sampling time after 8 and 16 hours of treatment. The Bradford method was used for quantitative analysis of proteins and 12% SDS-PAGE and two dimensional electrophorese techniques were hired for analysis of their expression. The results showed that under cadmium and mercury stresses, the total protein content increased compared to the control. Two-dimensional electrophoresis of proteins under cadmium stress showed differential expression of the protein spots on the plant leaves, than the control. In general, changes in the expression of proteins under the effect of cadmium stress were divided into two main categories: Spots 9, 10, 13, 14 and 16 belonged to proteins with reduced expression and the spots 1, 2, 8, 19 and 20 belonged to proteins with increased expression, in comparison to non-stressed control. These spots of up regulated proteins were directly related to the defense system against the heavy metal stress.

  11. Nuclear and allied approaches in improvement of wheat for disease and pest resistance

    Energy Technology Data Exchange (ETDEWEB)

    Sawhney, R N

    1987-09-01

    The paper attempts to review information on the role of physical and chemical mutagens used directly and indirectly in the improvement of wheat for disease and pest resistance. The illustrations relate to transfer of many useful genes for resistance to rusts and pest from alien sources to Triticum aestivum. Popular wheats have been rectified for resistance to rusts mostly without any negative effects on yield potential. The mutation approach has also been successful in the development of multilines. Multiline constituting mutant components conferring simultaneous resistance to more than one rust pathogen has an additional value. The use of induced mutagenesis in breaking linkage between the genes conferring resistance and other genes for undesirable characters has been described. New disease resistant mutant variations with additional changes of positive effect have been obtained for practical utilization with widening the genetic base of future breeding programmes. (author). 56 refs.

  12. A physical map of the 1-gigabase bread wheat chromosome 3B

    Czech Academy of Sciences Publication Activity Database

    Paux, E.; Sourdille, P.; Salse, J.; Saintenac, C.; Choulet, F.; LeRoy, P.; Korol, A.; Michalak, M.; Kianian, S.; Spielmeyer, W.; Lagudah, E.; Somers, D.; Kilian, A.; Alaux, M.; Vautrin, S.; Bergès, H.; Eversole, K.; Appels, R.; Šafář, Jan; Šimková, Hana; Doležel, Jaroslav; Bernard, M.; Feuillet, C.

    2008-01-01

    Roč. 322, č. 5898 (2008), s. 101-104 ISSN 0036-8075 R&D Projects: GA MŠk(CZ) LC06004 Institutional research plan: CEZ:AV0Z5038910 Keywords : RUST RESISTANCE GENE * TRITICUM-AESTIVUM * HEXAPLOID WHEAT Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 28.103, year: 2008

  13. Spatially resolved sulfur K-edge XANES spectroscopy of wheat leaves infected by Puccinia triticina

    International Nuclear Information System (INIS)

    Lichtenberg, H; Prange, A; Hormes, J; Steiner, U; Oerke, E-C

    2009-01-01

    In this study, wheat leaves infected with brown rust, a plant disease of serious economic concern caused by the fungus Puccinia triticina, were investigated using spatially resolved XANES (X-ray Absorption Near Edge Structure) spectroscopy at the sulfur K-absorption edge.

  14. Spatially resolved sulfur K-edge XANES spectroscopy of wheat leaves infected by Puccinia triticina

    Energy Technology Data Exchange (ETDEWEB)

    Lichtenberg, H; Prange, A; Hormes, J [CAMD, Louisiana State University, 6980 Jefferson Hwy, Baton Rouge, LA 70806 (United States); Steiner, U; Oerke, E-C, E-mail: lichtenberg@lsu.ed [INRES-Phytomedicine, University of Bonn, Nussallee 9, 53115 Bonn (Germany)

    2009-11-15

    In this study, wheat leaves infected with brown rust, a plant disease of serious economic concern caused by the fungus Puccinia triticina, were investigated using spatially resolved XANES (X-ray Absorption Near Edge Structure) spectroscopy at the sulfur K-absorption edge.

  15. Estimation and Validation of RapidEye-Based Time-Series of Leaf Area Index for Winter Wheat in the Rur Catchment (Germany

    Directory of Open Access Journals (Sweden)

    Muhammad Ali

    2015-03-01

    Full Text Available Leaf Area Index (LAI is an important variable for numerous processes in various disciplines of bio- and geosciences. In situ measurements are the most accurate source of LAI among the LAI measuring methods, but the in situ measurements have the limitation of being labor intensive and site specific. For spatial-explicit applications (from regional to continental scales, satellite remote sensing is a promising source for obtaining LAI with different spatial resolutions. However, satellite-derived LAI measurements using empirical models require calibration and validation with the in situ measurements. In this study, we attempted to validate a direct LAI retrieval method from remotely sensed images (RapidEye with in situ LAI (LAIdestr. Remote sensing LAI (LAIrapideye were derived using different vegetation indices, namely SAVI (Soil Adjusted Vegetation Index and NDVI (Normalized Difference Vegetation Index. Additionally, applicability of the newly available red-edge band (RE was also analyzed through Normalized Difference Red-Edge index (NDRE and Soil Adjusted Red-Edge index (SARE. The LAIrapideye obtained from vegetation indices with red-edge band showed better correlation with LAIdestr (r = 0.88 and Root Mean Square Devation, RMSD = 1.01 & 0.92. This study also investigated the need to apply radiometric/atmospheric correction methods to the time-series of RapidEye Level 3A data prior to LAI estimation. Analysis of the the RapidEye Level 3A data set showed that application of the radiometric/atmospheric correction did not improve correlation of the estimated LAI with in situ LAI.

  16. Trigo duro: comportamento de genótipos no estado de São Paulo Durum wheat: evaluation of genotypes for the state of São Paulo, Brazil

    Directory of Open Access Journals (Sweden)

    Carlos Eduardo de Oliveira Camargo

    1995-01-01

    Full Text Available Compararam-se 25 linhagens de trigo duro (Triticum durum L., um cultivar de triticale (X Triticosecale Wittmack e quatro cultivares de trigo (T. aestivum L. em seis experimentos em condição de irrigação por aspersão, analisando-se a produção de grãos, características agronômicas e resistência às doenças. As linhagens de trigo duro 14 (61150/Leeds//Gallo "S"/3/Garza "S"/4/Mexicali "S"/5/S-15-Crane "S", 21 (Boyeros "S"/Cocorit-71/5/Crane "S"/Ganso "S"//Marte "S"/3/Tildillo "S"/4/Memo "S", 25 (Gallareta "S" e 8 (Gediz "S"/Yavaros "S", de porte baixo a médio, foram resistentes às ferrugens-do-colmo (com exceção da 21 e da-folha, moderadamente resistentes ao oídio, suscetíveis à mancha foliar, e destacaram-se quanto à produção de grãos em solos com baixa acidez, não diferindo nem do trigo comum IAC-60, o mais cultivado atualmente no Estado de São Paulo, nem do triticale Álamos. Em condições de campo, a linhagem de trigo duro 19 (Mindum/Kingfisher "S"//Sandpiper apresentou imunidade às ferrugens-do-colmo e da-folha e foi moderadamente resistente ao oídio. O triticale Álamos e o trigo comum IAC-29 foram imunes ao oídio. Todos os genótipos avaliados foram altamente suscetíveis à mancha foliar, com exceção da linhagem 6 (Dackiye/Gerardo Vezio 394, moderadamente resistente.Twenty-five durum wheat (Triticum durum L. lines, one triticale (X Triticosecale Wittmack cultivar and four wheat (T aestivum L. cultivars were evaluated in six trials under sprinkler irrigation taking into account the grain yield, agronomic characteristics and disease resistance. The durum wheat lines 14 (61150/Leeds//Gallo "S"/3/Garza "S"/4/Mexicali "S"/5/S-15-Crane "S", 21 (Boyeros "S"/Cocorit-71/5/Crane "S"/Ganso "S"//Marte "S"/3/Tildillo "S"/4/Memo "S", 25 (Gallareta "S" and 8 (Gediz "S"/Yavaros "S", showed the following traites: resistant to stem and leaf rusts; moderately resistant to powdery mildew; susceptible to leaf spot, and short to

  17. Occurrence of barley leaf disease and control strategies in Denmark

    DEFF Research Database (Denmark)

    Jørgensen, Lise Nistrup; Ørum, Jens Erik; Heick, Thies Marten

    Barley (Hordeum vulgare) is one of the major crops in Denmark and of special importance for malting and for pig feed. In 2016, the crop was grown covering a total area of 700,000 ha; approximately 25% of arable area in Denmark. To ensure high yield of around 60 dt ha-1, disease-tolerant cultivars...... have proven to be quite effective against all leaf diseases, aside from brown rust and mildew. Denmark has a national record system for pesticide usages. All farmers upload their fungicide use by crop, creating a good basis for assessing the differences in use pattern across different regions...... and fungicide treatments are required. Each year, barley cultivars are assessed for susceptibility towards leaf diseases in national observation plots. The most predominant fungal leaf diseases in Denmark are barley scald (Rhynchosporium secalis), net blotch (Pyrenophora teres), brown rust (Puccinia hordei...

  18. Exploiting a wheat EST database to assess genetic diversity

    Directory of Open Access Journals (Sweden)

    Ozge Karakas

    2010-01-01

    Full Text Available Expressed sequence tag (EST markers have been used to assess variety and genetic diversity in wheat (Triticum aestivum. In this study, 1549 ESTs from wheat infested with yellow rust were used to examine the genetic diversity of six susceptible and resistant wheat cultivars. The aim of using these cultivars was to improve the competitiveness of public wheat breeding programs through the intensive use of modern, particularly marker-assisted, selection technologies. The F2 individuals derived from cultivar crosses were screened for resistance to yellow rust at the seedling stage in greenhouses and adult stage in the field to identify DNA markers genetically linked to resistance. Five hundred and sixty ESTs were assembled into 136 contigs and 989 singletons. BlastX search results showed that 39 (29% contigs and 96 (10% singletons were homologous to wheat genes. The database-matched contigs and singletons were assigned to eight functional groups related to protein synthesis, photosynthesis, metabolism and energy, stress proteins, transporter proteins, protein breakdown and recycling, cell growth and division and reactive oxygen scavengers. PCR analyses with primers based on the contigs and singletons showed that the most polymorphic functional categories were photosynthesis (contigs and metabolism and energy (singletons. EST analysis revealed considerable genetic variability among the Turkish wheat cultivars resistant and susceptible to yellow rust disease and allowed calculation of the mean genetic distance between cultivars, with the greatest similarity (0.725 being between Harmankaya99 and Sönmez2001, and the lowest (0.622 between Aytin98 and Izgi01.

  19. Frequency of comandra blister rust infection episodes on lodgepole pine

    Science.gov (United States)

    William R. Jacobi; Brian W. Geils; Jane E. Taylor

    2002-01-01

    Comandra blister rust is a damaging canker disease of lodgepole pine in the Central Rocky Mountains. Our knowledge of previous blister rust outbreaks and the effects of weather and climate on rust epidemiology has not been sufficient to explain the frequency and severity of disease outbreaks. Thus, we sought to describe the seasonal and annual frequency and duration of...

  20. Inheritance of resistance to orange rust in sugarcane

    Science.gov (United States)

    Orange rust, caused by Puccinia kuehnii, is an economically important disease in the Florida sugarcane industry. In this study, orange rust reactions of seedlings in progenies originating from 12 crosses between female and male parents with differing resistance to orange rust (three of each categor...

  1. Iguaçu (IAC-21 e Araguaia (IAC -22: cultivares de trigo de sequeiro para o Estado de São Paulo Iguaçu (IAC 21 and Araguaia (IAC 22: wheat cultivars for upland conditions of the State of São Paulo, Brazil

    Directory of Open Access Journals (Sweden)

    João Carlos Felício

    1985-01-01

    Full Text Available Em experimentos localizados nas principais regiões tritícolas paulistas, comparou-se a produtividade e as reações aos agentes de ferrugem-do-colmo e da-folha, bem como as qualidades industriais de panificação de dois novos cultivares de trigo - Iguaçu (IAC-21 e Araguaia (IAC-22 - provenientes de cruzamentos artificiais e obtidos por seleção por método genealógico, com os cultivares BH-1146 e Maringá (IAC-5. A produção média de grãos do 'Iguaçu' foi 8% e 12% estatisticamente superior respectivamente aos cultivares testemunhas, e o 'Araguaia' superou-os em 5 e 14%. Os novos cultivares apresentaram, ao longo dos cinco anos de estudo, menores níveis de infecção de ferrugem-do-colmo (Puccinia gramínis f, sp. tritici que as testemunhas, sobressaindo-se o 'Araguaia', com baixíssimos níveis de infecção. Os novos cultivares, bem como as testemunhas, mostraram reações médias para ferrugem-da-folha. Nos ensaios de panificação a farinha do 'Araguaia', de maneira geral, exibiu melhor potencial panificável que a do Iguaçu, sendo ambas levemente superiores à farinha de trigo comercial.Two new selected germoplasms of wheat (Iguaçu and Araguaia were tested against two commercial varieties (BH-1146 and IAC-5 for yield and resistance to stem and leaf rusts in several experiments carried out in different locations of the wheat areas of the State of São Paulo, Brazil, in the period 1978-1982. Cultivar Iguaçu produced 8% and 12% more grain per hectare in comparison with respectively, cultivars BH-1146 and IAC-5; cultivar Araguaia had, respectively, 5% and 14% more grain yield than the same commercial varieties. Iguaçu and Araguaia cultivars presented less stem rust infection than BH-1146 and IAC-5 while Araguaia had a lower infection level than Iguaçu under field conditions. It was not observed differences in resistance to leaf rust among them. Araguaia exhibited better bread qualities than Iguaçu but both showed better

  2. Influence of temperature, precipitation, and cultivar characteristics on changes in the spectrum of pathogenic fungi in winter wheat.

    Science.gov (United States)

    Hýsek, Josef; Vavera, Radek; Růžek, Pavel

    2017-06-01

    In view of the threat posed by climate change, we studied the influence of temperature, precipitation, cultivar characteristics, and technical management measures on the occurrence of phytopathogenic fungi in wheat during 2009-2013. This work involved experiments at two sites differing in average temperatures and precipitation. Temperature and precipitation appear to influence differences in the spectrum of phytopathogenic fungi at the individual sites. In 2009 (the warmest year), Alternaria triticina was dominant. In 2010 (having the smallest deviations from the average for individual years), Septoria tritici dominated. In 2011, Puccinia triticina was most prominent, while in 2012, the genus Drechslera (Pyrenophora) and in 2013, S. tritici and Drechslera tritici-repentis (DTR) dominated. Temperature and precipitation levels in the individual spring months (warmer March to May) played a large role, especially for the leaf rust P. triticina in 2011. A change of only 1 °C with different precipitation during a year played a significant role in changing wheat's fungal spectrum. Cluster analysis showed the differences between single pathogenic fungi on wheat in a single year due to temperature and precipitation. Alternaria abundance was strongly influenced by year (p < 0.001) while locality was significant only in certain years (2012, 2013; p = 0.004 and 0.015, respectively). The same factors were revealed to be significant in the case of Puccinia, but locality played a role (p < 0.001) in different years (2011, 2013). The abundance of S. tritici and Pyrenophora tritici-repentis (Drechslera tritici-repentis) was influenced only by year (p < 0.001).

  3. The Big Rust and the Red Queen: Long-Term Perspectives on Coffee Rust Research.

    Science.gov (United States)

    McCook, Stuart; Vandermeer, John

    2015-09-01

    Since 2008, there has been a cluster of outbreaks of the coffee rust (Hemileia vastatrix) across the coffee-growing regions of the Americas, which have been collectively described as the Big Rust. These outbreaks have caused significant hardship to coffee producers and laborers. This essay situates the Big Rust in a broader historical context. Over the past two centuries, coffee farmers have had to deal with the "curse of the Red Queen"-the need to constantly innovate in the face of an increasing range of threats, which includes the rust. Over the 20th century, particularly after World War II, national governments and international organizations developed a network of national, regional, and international coffee research institutions. These public institutions played a vital role in helping coffee farmers manage the rust. Coffee farmers have pursued four major strategies for managing the rust: bioprospecting for resistant coffee plants, breeding resistant coffee plants, chemical control, and agroecological control. Currently, the main challenge for researchers is to develop rust control strategies that are both ecologically and economically viable for coffee farmers, in the context of a volatile, deregulated coffee industry and the emergent challenges of climate change.

  4. Wheat and triticale breeding using gamma-ray-induced variability

    International Nuclear Information System (INIS)

    Parodi, P.C.; Nebreda, I.M.

    1984-01-01

    Use of gamma-ray-induced variability in wheat has proved to be a valuable breeding methodology. Results with triticale are still inconclusive. After several years of research a number of wheat mutants have been developed which possess an improved protein content, high yield, good agronomic type and wide adaptability. A change in the stem rust (Puccinia graminis f. sp. tritici) population, however, rendered most of the mutants susceptible to this disease. One mutant, recently named Carolina, which was able to withstand the effects of stem rust without serious yield deterioration, was registered and released to farmers. Efforts are being made to add stem rust resistance to the susceptible mutants by conventional backcrossing. Also, new material and the most outstanding susceptible mutants were gamma irradiated in an effort to induce resistance. Other mutants, not necessarily with an improved protein content, were grouped according to disease reaction and phenotypic similarity to form multilineal composites, some of which have had a superior performance and may be released to farmers in late 1984. A study conducted under four nitrogen levels with six wheat protein mutants showed a weak and inconsistent negative correlation between yield and protein content. The mutants could be differentiated by their increased protein content under most nitrogen rates. (author)

  5. Application of quantitative variables in the sampling method to evaluate the sugarcane rust brown

    Directory of Open Access Journals (Sweden)

    Joaquín Montalván Delgado

    2017-01-01

    Full Text Available To develop a system that increase the precision in the resistance evaluations to sugarcane brown rust disease through the use of the quantitative sampling, six cultivars of differential behavior versus the disease (PR980, My5514, Ja60-5, C334-64, C323-68 and B4362 were studied. A random block experimental design with three replications was used in a heavy infections conditions obtained from the cultivar highly susceptible B4362. The evaluations were done at three and five months of age, in the three-thirds: bottom, half and top of the +1, +3 and +5 sugarcane plant leaves of 10 plants for replica. The variable total leaf area affected of the leaf and in each third was analyzed. In 2 cm2 were observed the long and wide of the biggest and more frequent pustule, the total of pustule and the area of the biggest and more frequent pustule, and the area percentage occupied by the most frequent pustule by each cm2 were determined. Variance analysis and Tukey tests as well as confidence intervals analysis to determine the coefficient to use as constant of the pustule width, due to the little variation of this parameter were realized. The +3 leaf represented the half infection of the incidence of the brown rust, constituting for it the most appropriate to carry out the observations and the half third. An equation was also obtained to calculate the area occupied by pustules with a high level of confidence.

  6. Eat Wheat!

    Science.gov (United States)

    Idaho Wheat Commission, Boise.

    This pamphlet contains puzzles, games, and a recipe designed to teach elementary school pupils about wheat. It includes word games based on the U.S. Department of Agriculture Food Guide Pyramid and on foods made from wheat. The Food Guide Pyramid can be cut out of the pamphlet and assembled as a three-dimensional information source and food guide.…

  7. Identification of Green Rust in Groundwater

    DEFF Research Database (Denmark)

    Christiansen, Bo C.; Balic Zunic, Tonci; Dideriksen, Knud

    2009-01-01

    to air. In this paper, we present a sampling method for capturing green rust so it is not oxidized. We then we used the method to identify the compound in a groundwater sample taken below the water table from fractures in granite. X-ray diffraction patterns were weak, but clearly identical to those......Green rust, a family of Fe(II),Fe(III) layered double hydroxides, is believed to be present in environments close to the Fe(II)/Fe(III) transition zone. Attempts to identify members of this family in nature have proven difficult because the material is oxidized after only a few minutes exposure...

  8. Estimación del area de las hojas en plantas de trigo bajo diferentes tipos de estrés abiótico Leaf area estimation in wheat plants suffering several kinds of abiotic stress

    Directory of Open Access Journals (Sweden)

    D.H. Cogliatti

    2010-06-01

    Full Text Available En trigo, es posible estimar el área de las hojas (AF utilizando el producto del largo, el ancho de la lámina (LxA y un coeficiente de proporcionalidad (b m. Sin embargo, no hay información sobre la posibilidad de usar el mismo valor del coeficiente para estimar el área en plantas que sufren estrés hídrico, lumínico o nutricional. Para estudiar este punto se realizaron dos experimentos en los cuales se aplicó sequía, sombreo y deficiencias de N y P a plantas de trigo. El coeficiente b m se calculó a partir de la regresión lineal entre AF y LxA y fue similar entre las plantas control y aquellas que sufrieron sequía o deficiencias de N o P, pero fue distinto en plantas sombreadas. El mayor valor de b m en las plantas sombreadas se debió a una mayor proporción del sector medio de la lámina, definido por su forma rectangular. La validación de la posibilidad de usar el b m del control para estimar AF en plantas estresadas se realizó por regresión lineal entre el AF medida y calculada. Se concluye que puede usarse el mismo coeficiente b m para estimar el AF en plantas no estresadas y en plantas que sufren sequía o deficiencias de N o P. El uso del mismo valor del coeficiente b m en plantas sombreadas llevó a una subestimación del AF, la que fue más pronunciada a medida que aumentó el sombreo.In wheat, leaf area (LA can be estimated as the product between length, maximum blade width (LxW and a proportionality coefficient b m. However, it is unknown whether this coefficient is the same in stressed and non stressed plants. In order to study this, two experiments in which drought, shading and N and P deficiencies were applied to wheat plants were performed. The b m coefficient was calculated by linear regression between LA and LxW. The coefficient was similar in control plants as compared to those suffering wilting or N or P-deficiency, but different in shaded plants. The greater b m in shaded plants was due to an increased

  9. 75 FR 44881 - Black Stem Rust; Additions of Rust-Resistant Varieties

    Science.gov (United States)

    2010-07-30

    ...;Prices of new books are listed in the first FEDERAL REGISTER issue of each #0;week. #0; #0; #0; #0;#0... direct final rule notified the public of our intention to amend the black stem rust quarantine and...

  10. 76 FR 3011 - Black Stem Rust; Additions of Rust-Resistant Varieties

    Science.gov (United States)

    2011-01-19

    ...;Prices of new books are listed in the first FEDERAL REGISTER issue of each #0;week. #0; #0; #0; #0;#0... notified the public of our intention to amend the black stem rust quarantine and regulations by adding four...

  11. Rust dissolution and removal by iron-reducing bacteria: A potential rehabilitation of rusted equipment

    International Nuclear Information System (INIS)

    Starosvetsky, J.; Kamari, R.; Farber, Y.; Bilanović, D.; Armon, R.

    2016-01-01

    Highlights: • The present study demonstrated the high reductive capacity of both strains: the collection S. oneidensis and the wild strain Geobacter spp. (soil isolate). • The experimental strains were successful in Fe 3+ reduction for both states: soluble and crystalline (originally prepared from rust). • Rust dissolution can be improved by: addition of AFC at low concentration (0.2 g/l), increasing bacterial initial inoculum and rust reactive surface. • Both experimental IRB strains were able to completely remove previously formed rust on carbon steel coupons. • Additional results (not showed) revealed that culture S. oneidensis and the environmental isolate Geobacter spp., apparently have a different mechanism of iron reduction that requires further study. - Abstract: Iron reducing bacteria (IRB), to be used in rust dissolution and removal, have been isolated and enriched from different environmental sources. Comparative measurements revealed that a soil isolate (Geobacter sulfurreducens sp.) had the highest reductive activity equivalent to Shewanella oneidensis (strain CIP 106686, pure culture). Both reductive microorganisms can use Fe 3+ ions as electron acceptors from soluble as well as from crystalline sources. In nutrient medium containing soluble Fe 3+ , the highest reductive activity obtained for G. sulfurreducens sp. and S. oneidensis was 93 and 97% respectively. Successful removal of rust from carbon steel coupons has been achieved with both experimental bacteria.

  12. Identifying and utilizing resistance to Puccinia striiformis in wheat

    International Nuclear Information System (INIS)

    Line, R.F.; Allan, R.E.; Konzak, C.F.

    1976-01-01

    Resistance to Puccinia striiformis in wheat cultivars, breeding lines, and induced mutants, was studied on plants exposed to natural rust inoculum at field sites and on plants inoculated with specific races and grown under controlled temperatures. Based on infection types and disease intensity at various stages of plant growth throughout the duration of rust establishment, the following resistance-types (R-types) were identified: R-type 1, plants resistant or susceptible at all stages of growth and at both low and high temperatures throughout duration of rust establishment; R-type 2, plants initially resistant in the seedling stage but eventually become susceptible, plants resistant at later stages in the field; R-type 3, variable resistance in the seedling stage, high resistance in later growth stages; R-type 4, plants resistant in the eedling stage, but susceptible in late stages of growth; R-type 5, plants susceptible, but the pathogen is slow to sporulate and consequently, rust increases slower in the field; R-type 6, plants susceptible at low temperatures and resistant at high temperatures at all stages of growth; R-type 7, plants very susceptible at both low and high temperatures in the seedling stage and at low temperatures in later stages; when temperatures are high, plants become more resistant in later stages; R-type 8, plants susceptible at all stages, when rust intensity is low and when not under stress, but become more resistant when intensity is high or under moderate stress in the field. Combinations of the above types were also observed. Techniques for identifying resistance to stripe rust, race specificity of the resistance-types, relationship of plant growth habit and head characteristics to disease intensity, historical significance of various types of resistance in the United States, and methods of using the resistance-types are also discussed. (author)

  13. Major transcriptome reprogramming underlies floral mimicry induced by the rust fungus Puccinia monoica in Boechera stricta.

    Directory of Open Access Journals (Sweden)

    Liliana M Cano

    Full Text Available Pucciniamonoica is a spectacular plant parasitic rust fungus that triggers the formation of flower-like structures (pseudoflowers in its Brassicaceae host plant Boecherastricta. Pseudoflowers mimic in shape, color, nectar and scent co-occurring and unrelated flowers such as buttercups. They act to attract insects thereby aiding spore dispersal and sexual reproduction of the rust fungus. Although much ecological research has been performed on P. monoica-induced pseudoflowers, this system has yet to be investigated at the molecular or genomic level. To date, the molecular alterations underlying the development of pseudoflowers and the genes involved have not been described. To address this, we performed gene expression profiling to reveal 256 plant biological processes that are significantly altered in pseudoflowers. Among these biological processes, plant genes involved in cell fate specification, regulation of transcription, reproduction, floral organ development, anthocyanin (major floral pigments and terpenoid biosynthesis (major floral volatile compounds were down-regulated in pseudoflowers. In contrast, plant genes involved in shoot, cotyledon and leaf development, carbohydrate transport, wax biosynthesis, cutin transport and L-phenylalanine metabolism (pathway that results in phenylethanol and phenylacetaldehyde volatile production were up-regulated. These findings point to an extensive reprogramming of host genes by the rust pathogen to induce floral mimicry. We also highlight 31 differentially regulated plant genes that are enriched in the biological processes mentioned above, and are potentially involved in the formation of pseudoflowers. This work illustrates the complex perturbations induced by rust pathogens in their host plants, and provides a starting point for understanding the molecular mechanisms of pathogen-induced floral mimicry.

  14. FLUXAPYROXAD IN THE ASIAN SOYBEAN RUST CONTROL IN THE CERRADO BIOME

    Directory of Open Access Journals (Sweden)

    RAFAEL MENEZES SILVA DE FREITAS

    2016-01-01

    Full Text Available The etiologic agent of the Asian soybean rust is the Phakopsora pachyrhizi, which causes a reduction in the photosynthetic leaf area and, consequently, in the crop yield. Chemical control is one of the main measures for its management. The objective of this work was to evaluate the efficacy and selectivity of the fluxapyroxad fungicide on controlling the Asian soybean rust, under the edaphoclimatic conditions of the Cerrado biome. The experiment was conducted in an area under no-tillage system, in the Agricultural Research Center, Rio Verde, Goias, Brazil, during the 2012/2013 crop season, using the cultivar NA7337. A randomized block experimental design was used, with twelve treatments and four replications. The treatments consisted of applications of fluxapyroxad (FX, pyraclostrobin (PT, epoxiconazole (EX and metconazole (MZ. The average severity of the disease in the plants reached 37% in the Control. All treatments with fungicides differed from the Control. Treatments 9, 10, 11 and 12 provided the greatest rates of soybean rust control. The treatments 10, 11 and 12 had the highest thousand grain weights, and the yields of the treatments 2, 3 and 11, despite higher than the Control, were lower than the treatments 4, 5, 6, 7, 8, 9, 10 and 12, which had statistically equal yields. The increasing in yield, compared to the Control, ranged from 10.05% (pyraclostrobin, epoxiconazole + pyraclostrobin + mineral oil to 30.55% (pyraclostrobin, pyraclostrobin + fluxapyroxad + mineral oil and pyraclostrobin + metconazole + mineral oil. The highest rates of soybean rust control were presented by fungicides containing fluxapyroxad.

  15. Zoete rust : Een muzikale soap-detective

    NARCIS (Netherlands)

    Maas, P.

    1989-01-01

    De komedie' Zoete Rust' werd geschreven in opdracht van Theater de Tobbe in Voorburg . Naast de circa 120 professionele voorstellingen die elk seizoen in dit theater plaats vinden, organiseert De Tobbe een maal per laar een eigen theaterproduktie, die wordt gespeeld door het Tobbe-toneel, een ad-hoc

  16. Induced mutations for soybean rust resistance

    International Nuclear Information System (INIS)

    Smutkupt, S.; Wongpiyasatid, A.; Lamseejan, S.

    1983-01-01

    Soybean mutation experiments for inducing rust resistance in the cultivars G 8375, Wakashima mutant number 10, Taichung N, S.J.2, S.J.4, BM 50, BM 98, G 8377, G 8586 and G 8587 have been carried out since 1979. Six pods from each of 4438 control and 43,907 M 1 plants were randomly harvested. M 2 seeds of each cultivar of different doses were bulked (M 2 bulk). In addition, 270 good M 1 plants were selected and threshed singly (M 2 single). M 2 -bulk and M 2 -single seeds were advanced to M 3 . Both, M 3 -bulk and M 3 -single plants, together with the remaining M 2 -bulk seeds were screened for rust resistance in the rainy season of 1980 in Nong Hoi Valley (altitude about 1000 m above sea level) and at Mae Joe Station, both in Chiang Mai Province (latitude 18 deg. 31'-19 deg. N). Based on the IWGSR rating system, soybean plants with slow growth of rust were selected from both locations. The results were as follows: Six plants were selected from a total of 2802 control plants, and 115 from a total of 28,834 M 2 and M 3 plants. Further evaluation of these selections for rust resistance will be carried out in the rainy season of 1981 in Nong Hoi Valley, Chiang Mai. (author)

  17. Progresso temporal da ferrugem e redução sobre a área foliar e os componentes do rendimento de grãos em soja Temporal progress of rust and reduced leaf area and yield components in soybean grain

    Directory of Open Access Journals (Sweden)

    Felipe Rafael Garcés Fiallos

    2011-04-01

    em experimento de campo com 64 parcelas (2.7 x 5 m da cultivar Glycine max L. (Nidera 5909 RG, estabelecida em 05/12/09. Para gerar gradientes de doença utilizaram-se dois fungicidas (tebuconazol e epoxiconazol + piraclostrobina, em uma, duas ou três aplicações em estádios fonológicos diferentes. A doença foi quantificada por número de lesões e urédias, posteriormente convertido para severidade (%. Quantificou-se também o índice de área foliar ao final do enchimento de grãos e os componentes do rendimento após a colheita. A severidade média final da ferrugem superou 50%. As diferenças em severidade entre os estratos da planta foram influenciadas pela quantidade inicial de doença, uma vez que as taxas de progresso, determinadas pelos modelos logístico e de Gompertz, foram semelhantes entre os estratos (0.13 a 0.14 para o logístico e 0.10 a 0.11 para Gompertz. O índice de área foliar (IAF foi de apenas 1.96 nas plantas não tratadas, contra 4.40 no tratamento com quatro aplicações de epoxiconazol + piraclostrobina. Programas de controle iniciados em estádio fonológico V9, com duas ou três aplicações, diferiram da testemunha em IAF. O número de legumes e grãos por planta, assim como grãos por legume não variaram entre os tratamentos. Só houve diferença no peso de grãos do estrato superior, quando os fungicidas foram aplicados duas ou três vezes a partir de estádio fonológico V9.The harvest of the year 2009-10 of soybean crop in Southern Brazil occurred under higher intensity of soybean rust (Phakopsora pachyrhizi Sydow y Sydow, which allowed studies on disease progress and crop reduction. A field experiment with 64 plots (2.7 x 5 m of the cultivar Glycine max L. (Nidera 5909 RG sown on 5/Dec/2009 was used for the evaluations. Disease gradients were obtained by spraying the fungicides tebuconazol or epoxiconazol + pyraclostrobin once, twice or three times, at different plant growth stages. Disease progress was assessed as number of

  18. Ultrastructure of the Rust Fungus Puccinia miscanthi in the Teliospore Stage Interacting with the Biofuel Plant Miscanthus sinensis

    Directory of Open Access Journals (Sweden)

    Ki Woo Kim

    2015-09-01

    Full Text Available Interaction of the the rust fungus Puccinia miscanthi with the biofuel plant Miscanthus sinensis during the teliospore phase was investigated by light and electron microscopy. P. miscanthi telia were oval-shaped and present on both the adaxial and abaxial leaf surfaces. Teliospores were brown, one-septate (two-celled, and had pedicels attached to one end. Transmission electron microscopy revealed numerous electron-translucent lipid globules in the cytoplasm of teliospores. Extensive cell wall dissolution around hyphae was not observed in the host tissues beneath the telia. Hyphae were found between mesophyll cells in the leaf tissues as well as in host cells. Intracellular hyphae, possibly haustoria, possessed electron-dense fungal cell walls encased by an electron-transparent fibrillar extrahaustorial sheath that had an electron-dense extrahaustorial membrane. The infected host cells appeared to maintain their membrane-bound structures such as nuclei and chloroplasts. These results suggest that the rust fungus maintains its biotrophic phase with most mesophyll cells of M. sinensis. Such a nutritional mode would permit the rust fungus to obtain food reserves for transient growth in the course of host alteration.

  19. Wheat: The Whole Story.

    Science.gov (United States)

    Oklahoma State Dept. of Education, Oklahoma City.

    This publication presents information on wheat. Wheat was originally a wild grass and not native to the United States. Wheat was not planted there until 1777 (and then only as a hobby crop). Wheat is grown on more acres than any other grain in this country. Soft wheats are grown east of the Mississippi River, and hard wheats are grown west of the…

  20. Leaf appearance rate and final main stem leaf number as affected by temperature and photoperiod in cereals grown in Mediterranean environment

    Directory of Open Access Journals (Sweden)

    Ezio Riggi

    2017-09-01

    Full Text Available In the present study, a two-year field trial was carried out with the aim to evaluate daylength and air temperature effects on leaf appearance and related rates in two durum wheat (Triticum durum Desf., two bread wheat (Triticum aestivum L. and two barley (Hordeum vulgare L. cultivars, using six different sowing dates (SD. Significant effects of SD on final main stem leaf number (FLN, thermal leaf appearance rate (TLAR, daily leaf appearance rate (DLAR and phyllochron (PhL were found. Cultivars resulted inversely correlated to mean air temperature in the interval emergence - fifth leaf full expansion (E-V. Linear response of leaf number over days after sowing was shown for all SD and cultivars, with R2 higher than 0.95. FLN linearly decreased from the first to the last SD for durum wheat, while more variable behaviour was observed in bread wheat. TLAR and DLAR showed a linear increment of the rate from the first to the last SD in durum wheat, while did not for bread wheat and barley. PhL in durum wheat decreased from the first to the last SD. Barley and bread wheat showed the highest values on those SDs which did not reach flowering. The increase of TLAR was affected by photoperiod and photothermal units in durum wheat, while by temperatures only in barley and bread wheat. Present results might find practical application in the improvement of phenology simulation models for durum wheat, bread wheat and barley grown in Mediterranean area in absence of water and nutrient stress.

  1. Comparison of foliar anatomy of ten bread wheat (triticum, poaceae) and ten barley (hordeum, poaceae) cultivars

    International Nuclear Information System (INIS)

    Ardic, M.; Sezer, O.; Ozgdsd, K.; Yaylaci, O. K.; Koyuncu, O.; Olgun, M.; Bascdftcd, Z. B.; Ayter, N. G.

    2015-01-01

    The aim of this study is to determine anatomical differences and classification of leaf and leaf cell characteristics (cuticle thickness, upper epidermis thickness, lower epidermis thickness, mesophyll thickness, parenchyma thickness and leaf thickness) between 10 bread wheat cultivars (Triticum aestivum L.) and 10 barley cultivars (Hordeum vulgare L.). Classification of leaf characteristics in bread wheat and barley cultivars and relationship between leaf characteristics are made by principal component and correlation analyses. Highest thickness belongs to W8 Mufitbey cultivar in mesophyll and lower epidermis and W1 Sonmez 01 cultivar have the lowest thickness of upper epidermis in bread wheat. In Barley, B1 Ince cultivar has highest leaf thickness mesophyll and parenchyma; lowest thickness of cuticle is included B7 Cumhuriyet 50 cultivar. All other cultivars have homogenous contents of leaf characteristics. (author)

  2. Effect of Puccinia silphii on Yield Components and Leaf Physiology in Silphium integrifolium: Lessons for the Domestication of a Perennial Oilseed Crop

    Directory of Open Access Journals (Sweden)

    M. Kathryn Turner

    2018-03-01

    Full Text Available New crops with greater capacity for delivering ecosystem services are needed to increase agricultural sustainability. However, even in these crops, seed yield is usually the main criteria for grain domestication. This focus on yield can cause unintended structural and functional changes. Leaves of selected plants tend to be more vulnerable to infection, which can reduce performance, assimilates, and ultimately yield. Our objectives were to determine the impact of rust (caused by Puccinia silphii on yield and leaf function in selected Silphium integrifolium (Asteraceae plants. We tested the effect of a fungicide treatment on rust severity and yield, compared the rust infection of individuals in a population selected for yield, and related this to chemical changes at the leaf level. We also estimated heritability for rust resistance. We found that productivity indicators (head number and weight, leaf weight and leaf processes (photosynthetic capacity, water use efficiency were reduced when silphium leaves and stems were more heavily infected by P. silphii. Leaf resin content increased when susceptible plants were infected. Fungicide treatments were effective at reducing rust infection severity, but were ineffective at preventing yield losses. We propose that disease resistance should be included early in the selection process of new perennial crops.

  3. Effect of solar radiation on severity of soybean rust.

    Science.gov (United States)

    Young, Heather M; George, Sheeja; Narváez, Dario F; Srivastava, Pratibha; Schuerger, Andrew C; Wright, David L; Marois, James J

    2012-08-01

    Soybean rust (SBR), caused by Phakopsora pachyrhizi, is a damaging fungal disease of soybean (Glycine max). Although solar radiation can reduce SBR urediniospore survival, limited information is available on how solar radiation affects SBR progress within soybean canopies. Such information can aid in developing accurate SBR prediction models. To manipulate light penetration into soybean canopies, structures of shade cloth attenuating 30, 40, and 60% sunlight were constructed over soybean plots. In each plot, weekly evaluations of severity in lower, middle, and upper canopies, and daily temperature and relative humidity were recorded. Final plant height and leaf area index were also recorded for each plot. The correlation between amount of epicuticular wax and susceptibility of leaves in the lower, middle, and upper canopies was assessed with a detached leaf assay. Final disease severity was 46 to 150% greater in the lower canopy of all plots and in the middle canopy of 40 and 60% shaded plots. While daytime temperature within the canopy of nonshaded soybean was greater than shaded soybean by 2 to 3°C, temperatures recorded throughout typical evenings and mornings of the growing season in all treatments were within the range (10 to 28.5°C) for SBR development as was relative humidity. This indicates temperature and relative humidity were not limiting factors in this experiment. Epicuticular wax and disease severity in detached leaf assays from the upper canopy had significant negative correlation (P = 0.009, R = -0.84) regardless of shade treatment. In laboratory experiments, increasing simulated total solar radiation (UVA, UVB, and PAR) from 0.15 to 11.66 MJ m(-2) increased mortality of urediniospores from 2 to 91%. Variability in disease development across canopy heights in early planted soybean may be attributed to the effects of solar radiation not only on urediniospore viability, but also on plant height, leaf area index, and epicuticular wax, which influence

  4. Climate change impacts on coffee rust disease

    Science.gov (United States)

    Alfonsi, W. M. V.; Koga-Vicente, A.; Pinto, H. S.; Alfonsi, E. L., Sr.; Coltri, P. P.; Zullo, J., Jr.; Patricio, F. R.; Avila, A. M. H. D.; Gonçalves, R. R. D. V.

    2016-12-01

    Changes in climate conditions and in extreme weather events may affect the food security due to impacts in agricultural production. Despite several researches have been assessed the impacts of extremes in yield crops in climate change scenarios, there is the need to consider the effects in pests and diseases which increase losses in the sector. Coffee Arabica is an important commodity in world and plays a key role in Brazilian agricultural exports. Although the coffee crop has a world highlight, its yield is affected by several factors abiotic or biotic. The weather as well pests and diseases directly influence the development and coffee crop yield. These problems may cause serious damage with significant economic impacts. The coffee rust, caused by the fungus Hemileia vastarix,is among the diseases of greatest impact for the crop. The disease emerged in Brazil in the 70s and is widely spread in all producing regions of coffee in Brazil, and in the world. Regions with favorable weather conditions for the pathogen may exhibit losses ranging from 30% to 50% of the total grain production. The evaluation of extreme weather events of coffee rust disease in futures scenarios was carried out using the climatic data from CMIP5 models, data field of coffee rust disease incidence and, incubation period simulation data for Brazilian municipalities. Two Regional Climate Models were selected, Eta-HadGEM2-ES and Eta-MIROC5, and the Representative Concentration Pathways 8.5 w/m2 was adopted. The outcomes pointed out that in these scenarios the period of incubation tends to decrease affecting the coffee rust disease incidence, which tends to increase. Nevertheless, the changing in average trends tends to benefit the reproduction of the pathogen. Once the temperature threshold for the disease reaches the adverse conditions it may be unfavorable for the incidence.

  5. Waste management regroups units into Rust International

    International Nuclear Information System (INIS)

    Kirschner, E.

    1992-01-01

    Three Waste Management (Oak Brook, IL) subsidiaries have proposed merging units from Chemical Waste Management (CWM) and Wheelabrator Technologies with the Brand Companies (Park Ridge, IL). Waste Management says the new company, to be called Rust International, will become one of the US's largest environmental consulting and infrastructure organizations and will include design and construction services. Waste Management expects the merged company's 1993 revenues to reach $1.8 billion. It will be based in Birmingham, AL and have 12,000 employees

  6. Tolerance of Loblolly Pines to Fusiform Rust

    Science.gov (United States)

    Charles H. Walkinshaw; James P. Barnett

    1995-01-01

    Loblolly pines (Pinus taeda L.) that were 8 to 17 yr old tolerated one to three fusiform rust (Cronartium quercuum [Berk.] Miyabe ex Shirai f. sp. fusiforme) galls in their stems.Families with four or more galls in their stems lost 2.5% or more of the trees by age 17.In living trees with less than four stem galls, diameter growth was comparable to...

  7. Control of wheat diseases using phosphites and acibenzolar-s-methyl alone or associated with piraclostrobina + epoxiconazoleControle de doenças do trigo com fosfitos e acibenzolar-s-metil isoladamente ou associados a piraclostrobina + epoxiconazole

    Directory of Open Access Journals (Sweden)

    Olavio Correa Silva

    2011-07-01

    Full Text Available The objective of this study was to evaluate the effect of different sources of phosphite to control leaf rust, powdery mildew, yellow and brown spot in the wheat crop in Palmeira, Paraná state, Brazil. The treatments were: four commercial sources of phosphites (A, B, C and D, applied at 1500 mL ha-1, (applied in rate of active product acibenzolar-S-methyl (ASM at 500 mL ha-1 (isolad or association, pyraclostrobin + epoxiconazole (fungicide at 400 mL ha-1 and phosphite A with pyraclostrobin + epoxiconazole (at 300 mL ha-1, phosphite A with pyraclostrobin + epoxiconazole (400 mL ha-1, acibenzolar-S-methyl with pyraclostrobin + epoxiconazole (400 mL ha-1 and control (water, . The experimental design adopted was complete randomized blocks with four replications. Regarding diseases, evaluations were done on the determination of severity and the calculation of the area below the curve of the disease progress in the flag leaf and entire plant. Leaf area index, thousand seeds weight, hectoliter weight and yield were also evaluated. Phosphite, independently source, did not act on leaf rust, powdery mildew, yellow and brown spot. The resistance inducer acibenzolar-S-methyl either isolated or associated to other fungicides affected leaf rust and powdery mildew of the wheat. Only phosphites associated to the fungicide controlled diseases, however there was no additional increase in yield whether compared to the control promoted by the fungicide.Foi realizado um experimento no município de Palmeira-PR, visando avaliar o efeito de diferentes fontes de fosfitos no controle da ferrugem da folha, do oídio e das manchas amarela e marrom na cultura do trigo. Os tratamentos foram: quatro fontes comerciais de fosfitos (A, B, C e D aplicados na dose de 1500 mL ha-1 (dose de produto ativo isolado ou associado aos demais produtos, acibenzolar-S-metil (ASM na dose de 500 mL ha-1 (isolado ou associado, piraclostrobina + epoxiconazole (fungicida na dose de 500 mL ha-1

  8. Effect of Low Temperature and Wheat Winter-Hardiness on Survival of Puccinia striiformis f. sp. tritici under Controlled Conditions.

    Directory of Open Access Journals (Sweden)

    Lijie Ma

    Full Text Available Wheat stripe rust, caused by Puccinia striiformis f. sp. tritici (Pst, is one of the most important diseases of wheat worldwide. Understanding the survival of Pst during the overwintering period is critical for predicting Pst epidemics in the spring. Real-time quantitative PCR (qPCR methods quantifying Pst DNA and RNA (cDNA were developed and compared for the ability to quantify viable Pst in leaf tissues. Both qPCR of DNA and RNA can provide reliable measurement of viable Pst in plant tissues prior to the late sporulation stage for which qPCR of DNA gave a much higher estimate of fungal biomass than qPCR of RNA. The percentage of Pst biomass that was viable in detached and attached leaves under low temperatures decreased over time. Pst survived longer on attached leaves than on detached leaves. The survival of Pst in cultivars with strong winter-hardiness at 0°C and -5°C was greater than those with weak winter-hardiness. However, such differences in Pst survival among cultivars were negligible at -10, -15 and -20°C. Results indicated that Pst mycelia inside green leaves can also be killed by low temperatures rather than through death of green leaves under low temperatures. The relationship of Pst survival in attached leaves with temperature and winter-hardiness was well described by logistic models. Further field evaluation is necessary to assess whether inclusion of other factors such as moisture and snow cover could improve the model performance in predicting Pst overwintering potential, and hence the epidemic in spring.

  9. Pushing Wheat

    DEFF Research Database (Denmark)

    Sharp, Paul Richard

    This paper documents the evolution of variables central to understanding the creation of an Atlantic Economy in wheat between the US and the UK in the nineteenth century. The cointegrated VAR model is then applied to the period 1838-1913 in order to find long-run relationships between these varia......This paper documents the evolution of variables central to understanding the creation of an Atlantic Economy in wheat between the US and the UK in the nineteenth century. The cointegrated VAR model is then applied to the period 1838-1913 in order to find long-run relationships between...

  10. Essential Oils for Alternative Teak Rust Control

    Directory of Open Access Journals (Sweden)

    Pedro Raymundo Argüelles Osorio

    2018-03-01

    Full Text Available ABSTRACT The objectives of this study were to evaluate the effect of lemon grass, citronella grass, Mexican-tea and noni essential oils on urediniospore germination of Olivea neotectonae , the agent responsible for rust in Teak (Tectona grandis L.f.; to evaluate the phytotoxic effect of these essential oils on teak seedlings; and to evaluate the use of essential oils to control rust in teak plants when preventively and curatively applied. We found that the noni and lemon grass essential oils inhibited 100% of urediniospore germination. On the other hand, the essential oils from noni and lemon grass caused phytotoxicity when applied to seedlings at concentrations of 2000 and 1500 μL L-1, respectively. The major constituents found in lemon grass essential oil were Geranial and Neral, while Octanoic Acid was found in noni oil. Lower values in the area below the rust progress curve were observed with the preventive application of lemon grass and noni essential oils.

  11. Changing the game: using integrative genomics to probe virulence mechanisms of the stem rust pathogen Puccinia graminis f. sp. tritici

    Directory of Open Access Journals (Sweden)

    Melania eFigueroa

    2016-02-01

    Full Text Available The recent resurgence of wheat stem rust caused by new virulent races of Puccinia graminis f. sp. tritici (Pgt poses a threat to food security. These concerns have catalyzed an extensive global effort towards controlling this disease. Substantial research and breeding programs target the identification and introduction of new stem rust resistance (Sr genes in cultivars for genetic protection against the disease. Such resistance genes typically encode immune receptor proteins that recognize specific components of the pathogen, known as avirulence (Avr proteins. A significant drawback to deploying cultivars with single Sr genes is that they are often overcome by evolution of the pathogen to escape recognition through alterations in Avr genes. Thus, a key element in achieving durable rust control is the deployment of multiple effective Sr genes in combination, either through conventional breeding or transgenic approaches, to minimize the risk of resistance breakdown. In this situation, evolution of pathogen virulence would require simultaneous changes in multiple Avr genes in order to bypass recognition. However, choosing the optimal Sr gene combinations to deploy is a challenge that requires detailed knowledge of the pathogen Avr genes with which they interact and the virulence phenotypes of Pgt existing in nature. Identifying specific Avr genes from Pgt will provide screening tools to enhance pathogen virulence monitoring, assess heterozygosity and propensity for mutation in pathogen populations, and confirm individual Sr gene functions in crop varieties carrying multiple effective resistance genes. Towards this goal, much progress has been made in assembling a high quality reference genome sequence for Pgt, as well as a Pan-genome encompassing variation between multiple field isolates with diverse virulence spectra. In turn this has allowed prediction of Pgt effector gene candidates based on known features of Avr genes in other plant pathogens

  12. Changing the Game: Using Integrative Genomics to Probe Virulence Mechanisms of the Stem Rust Pathogen Puccinia graminis f. sp. tritici.

    Science.gov (United States)

    Figueroa, Melania; Upadhyaya, Narayana M; Sperschneider, Jana; Park, Robert F; Szabo, Les J; Steffenson, Brian; Ellis, Jeff G; Dodds, Peter N

    2016-01-01

    The recent resurgence of wheat stem rust caused by new virulent races of Puccinia graminis f. sp. tritici (Pgt) poses a threat to food security. These concerns have catalyzed an extensive global effort toward controlling this disease. Substantial research and breeding programs target the identification and introduction of new stem rust resistance (Sr) genes in cultivars for genetic protection against the disease. Such resistance genes typically encode immune receptor proteins that recognize specific components of the pathogen, known as avirulence (Avr) proteins. A significant drawback to deploying cultivars with single Sr genes is that they are often overcome by evolution of the pathogen to escape recognition through alterations in Avr genes. Thus, a key element in achieving durable rust control is the deployment of multiple effective Sr genes in combination, either through conventional breeding or transgenic approaches, to minimize the risk of resistance breakdown. In this situation, evolution of pathogen virulence would require changes in multiple Avr genes in order to bypass recognition. However, choosing the optimal Sr gene combinations to deploy is a challenge that requires detailed knowledge of the pathogen Avr genes with which they interact and the virulence phenotypes of Pgt existing in nature. Identifying specific Avr genes from Pgt will provide screening tools to enhance pathogen virulence monitoring, assess heterozygosity and propensity for mutation in pathogen populations, and confirm individual Sr gene functions in crop varieties carrying multiple effective resistance genes. Toward this goal, much progress has been made in assembling a high quality reference genome sequence for Pgt, as well as a Pan-genome encompassing variation between multiple field isolates with diverse virulence spectra. In turn this has allowed prediction of Pgt effector gene candidates based on known features of Avr genes in other plant pathogens, including the related flax rust

  13. Coprecipitation of Arsenate and Arsenite with Green Rust Minerals

    Science.gov (United States)

    The objectives of this experiment were to evaluate the extent and nature of arsenic co-precipitation with green rusts and to examine the influence of arsenic incorporation on the mineralogy of formed solid phases. Stoichiometric green rusts were obtained by coprecipitation of fe...

  14. Interacting genes in the pine-fusiform rust forest pathosystem

    Science.gov (United States)

    H.V. Amerson; T.L. Kubisiak; S.A. Garcia; G.C. Kuhlman; C.D. Nelson; S.E. McKeand; T.J. Mullin; B. Li

    2005-01-01

    Fusiform rust (FR) disease of pines, caused by Cronartium quercuum f.sp. fusiforme (Cqf), is the most destructive disease in pine plantations of the southern U. S. The NCSU fusiform rust program, in conjunction with the USDA-Forest Service in Saucier, MS and Athens, GA, has research underway to elucidate some of the genetic interactions in this...

  15. White pines, blister rust, and management in the Southwest

    Science.gov (United States)

    D. A. Conklin; M Fairweather; D Ryerson; B Geils; D Vogler

    2009-01-01

    White pines in New Mexico and Arizona are threatened by the invasive disease white pine blister rust, Cronartium ribicola. Blister rust is already causing severe damage to a large population of southwestern white pine in the Sacramento Mountains of southern New Mexico. Recent detection in northern and western New Mexico suggests that a major expansion of the...

  16. Identification of genomic associations for adult plant resistance in the background of popular South Asian wheat cultivar, PBW343

    Directory of Open Access Journals (Sweden)

    Huihui Li

    2016-11-01

    Full Text Available Rusts, a fungal disease as old as its host plant wheat, an enemy as old as wheat, has caused havoc for over 8,000 years. As the rust pathogens can evolve into new virulent races which quickly defeat to qualitative or vertical the resistance that primarily rely on race specificity over time, adult plant resistance (APR has often been found to be race non-specific and hence is considered have been proven to be a more to be a more reliable and durable strategy to combat this malady. Over decades sets of donor lines have been identified at International Maize and Wheat Improvement Center (CIMMYT representing a wide range of APR sources in wheat. In this study, using nine donors and a common parent ‘PBW343’, a popular Green Revolution variety at CIMMYT, the nested association mapping (NAM population of 1122 lines was constructed to understand the APR genetics underlying these founder lines. Thirty-four QTL were associated with APR to rusts, and 20 of 34 QTL had pleiotropic effects on SR, YR and LR resistance. Three chromosomal regions, associated with known APR genes (Sr58/Yr29/Lr46, Sr2/Yr30/Lr27, and Sr57/Yr18/Lr34, were also identified, 13 previously reported QTL regions were validated. Of the 18 QTL first detected in this study, 7 were pleiotropic QTL, distributing on chromosomes 3A, 3B, 6B, 3D, and 6D. The present investigation revealed the genetic relationship of historical APR donor lines, the novel knowledge on APR, as well as the new analytical methodologies to facilitate the applications of NAM design in crop genetics. Results shown in this study will aid the parental selection for hybridization in wheat breeding, and envision the future rust management breeding for addressing potential threat to wheat production and food security.

  17. Control Of Rust Disease In Irradiated Vicia Faba By Using Safe Alternative Methods

    International Nuclear Information System (INIS)

    Ahmed, B.M.; Helal, I.M.; Mohamed, G.A.

    2013-01-01

    Infection of Vicia faba with Uromyces viciae-fabae causes significant decrease in growth and total nitrogen content and increase in the phenolic compounds. The study was carried out to investigate the effects of chemicals used as drench application in soil (e.g. saccharin), biotic agents (e.g. Bacillus subtilis) and artificial essential oils (e.g. rosemary) in irradiated (0, 5, 10, 15 Gy) broad bean Vicia faba on the rust fungus Uromyces viciae-fabae. Bacillus subtilis was inoculated to beans at the third leaf then saccharin (5 mM/l) was used as drench application in the soil and the essential oil was used for foliar application at concentrations 0, 500, 1000 and 1500 ppm. All treatments gave positive results to control the disease but differ in the mechanism of action. The control of the disease with saccharin application may be due to the formation of antimicrobial components (wyrone acid) by plant tissues and increase with increasing the concentration of saccharin. In case of using the essential oil, the affect on the microbe was directly observed within 28 h because the oil affect the permeability of cell membrane of the pathogen but in case of Bacillus, it acts as biological control agent induced resistance of plant by affecting the activity of antioxidant enzymes; peroxidase and chitinase. Saccharin and spore suspension induce systemic protection to rust infection after 72 and 96 hours. The disease index and the phenolic compounds were determined because they play important role in the systemic protection of rust disease 96 h after application. The results showed that the phytoalexin wyerone acid was formed in case of biotic agent (Bacillus subtilis) and the chemical (saccharin) but did not form in case of essential oil (rosemary)

  18. Evaluation of spray and point inoculation methods for the phenotyping of Puccinia striiformis on wheat

    DEFF Research Database (Denmark)

    Sørensen, Chris Khadgi; Thach, Tine; Hovmøller, Mogens Støvring

    2016-01-01

    flexible application procedure for spray inoculation and it gave highly reproducible results for virulence phenotyping. Six point inoculation methods were compared to find the most suitable for assessment of pathogen aggressiveness. The use of Novec 7100 and dry dilution with Lycopodium spores gave...... for the assessment of quantitative epidemiological parameters. New protocols for spray and point inoculation of P. striiformis on wheat are presented, along with the prospect for applying these in rust research and resistance breeding activities....

  19. Physical water treatment against calcification and rust

    International Nuclear Information System (INIS)

    Burger, A.

    1995-01-01

    In contrast to Germany, where the installation of small-sized, decentralised plants is still prefered, water supply companies in countries such as Denmark have already for some time successfully been using physical water treatment systems. Although the health and environmental benefits of this non-chemical method of water treatment are undisputed and its proper application is also economically beneficial, there is still a widerspread lack of information as to where such plants can be used. Consequently, older methods are often resorted to combatting calcification and rust. (orig.) [de

  20. Genome-wide identification of the SWEET gene family in wheat.

    Science.gov (United States)

    Gao, Yue; Wang, Zi Yuan; Kumar, Vikranth; Xu, Xiao Feng; Yuan, De Peng; Zhu, Xiao Feng; Li, Tian Ya; Jia, Baolei; Xuan, Yuan Hu

    2018-02-05

    The SWEET (sugars will eventually be exported transporter) family is a newly characterized group of sugar transporters. In plants, the key roles of SWEETs in phloem transport, nectar secretion, pollen nutrition, stress tolerance, and plant-pathogen interactions have been identified. SWEET family genes have been characterized in many plant species, but a comprehensive analysis of SWEET members has not yet been performed in wheat. Here, 59 wheat SWEETs (hereafter TaSWEETs) were identified through homology searches. Analyses of phylogenetic relationships, numbers of transmembrane helices (TMHs), gene structures, and motifs showed that TaSWEETs carrying 3-7 TMHs could be classified into four clades with 10 different types of motifs. Examination of the expression patterns of 18 SWEET genes revealed that a few are tissue-specific while most are ubiquitously expressed. In addition, the stem rust-mediated expression patterns of SWEET genes were monitored using a stem rust-susceptible cultivar, 'Little Club' (LC). The resulting data showed that the expression of five out of the 18 SWEETs tested was induced following inoculation. In conclusion, we provide the first comprehensive analysis of the wheat SWEET gene family. Information regarding the phylogenetic relationships, gene structures, and expression profiles of SWEET genes in different tissues and following stem rust disease inoculation will be useful in identifying the potential roles of SWEETs in specific developmental and pathogenic processes. Copyright © 2017 Elsevier B.V. All rights reserved.

  1. Relationship between sugarcane rust severity and soil properties in louisiana.

    Science.gov (United States)

    Johnson, Richard M; Grisham, Michael P; Richard, Edward P

    2007-06-01

    ABSTRACT The extent of spatial and temporal variability of sugarcane rust (Puccinia melanocephala) infestation was related to variation in soil properties in five commercial fields of sugarcane (interspecific hybrids of Saccharum spp., cv. LCP 85-384) in southern Louisiana. Sugarcane fields were grid-soil sampled at several intensities and rust ratings were collected at each point over 6 to 7 weeks. Soil properties exhibited significant variability (coefficients of variation = 9 to 70.1%) and were spatially correlated in 39 of 40 cases with a range of spatial correlation varying from 39 to 201 m. Rust ratings were spatially correlated in 32 of 33 cases, with a range varying from 29 to 241 m. Rust ratings were correlated with several soil properties, most notably soil phosphorus (r = 0.40 to 0.81) and soil sulfur (r = 0.36 to 0.68). Multiple linear regression analysis resulted in coefficients of determination that ranged from 0.22 to 0.73, and discriminant analysis further improved the overall predictive ability of rust models. Finally, contour plots of soil properties and rust levels clearly suggested a link between these two parameters. These combined data suggest that sugarcane growers that apply fertilizer in excess of plant requirements will increase the incidence and severity of rust infestations in their fields.

  2. Host jumps shaped the diversity of extant rust fungi (Pucciniales).

    Science.gov (United States)

    McTaggart, Alistair R; Shivas, Roger G; van der Nest, Magriet A; Roux, Jolanda; Wingfield, Brenda D; Wingfield, Michael J

    2016-02-01

    The aim of this study was to determine the evolutionary time line for rust fungi and date key speciation events using a molecular clock. Evidence is provided that supports a contemporary view for a recent origin of rust fungi, with a common ancestor on a flowering plant. Divergence times for > 20 genera of rust fungi were studied with Bayesian evolutionary analyses. A relaxed molecular clock was applied to ribosomal and mitochondrial genes, calibrated against estimated divergence times for the hosts of rust fungi, such as Acacia (Fabaceae), angiosperms and the cupressophytes. Results showed that rust fungi shared a most recent common ancestor with a mean age between 113 and 115 million yr. This dates rust fungi to the Cretaceous period, which is much younger than previous estimations. Host jumps, whether taxonomically large or between host genera in the same family, most probably shaped the diversity of rust genera. Likewise, species diversified by host shifts (through coevolution) or via subsequent host jumps. This is in contrast to strict coevolution with their hosts. Puccinia psidii was recovered in Sphaerophragmiaceae, a family distinct from Raveneliaceae, which were regarded as confamilial in previous studies. © 2015 The Authors. New Phytologist © 2015 New Phytologist Trust.

  3. Effects of Fungicide Treatment on Free Amino Acid Concentration and Acrylamide-Forming Potential in Wheat.

    Science.gov (United States)

    Curtis, Tanya Y; Powers, Stephen J; Halford, Nigel G

    2016-12-28

    Acrylamide forms from free asparagine and reducing sugars during frying, baking, roasting, or high-temperature processing, and cereal products are major contributors to dietary acrylamide intake. Free asparagine concentration is the determining factor for acrylamide-forming potential in cereals, and this study investigated the effect of fungicide application on free asparagine accumulation in wheat grain. Free amino acid concentrations were measured in flour from 47 varieties of wheat grown in a field trial in 2011-2012. The wheat had been supplied with nitrogen and sulfur and treated with growth regulators and fungicides. Acrylamide formation was measured after the flour had been heated at 180 °C for 20 min. Flour was also analyzed from 24 (of the 47) varieties grown in adjacent plots that were treated in identical fashion except that no fungicide was applied, resulting in visible infection by Septoria tritici, yellow rust, and brown rust. Free asparagine concentration in the fungicide-treated wheat ranged from 1.596 to 3.987 mmol kg -1 , with a significant (p fungicide treatment, the increases in acrylamide ranging from 2.7 to 370%. Free aspartic acid concentration also increased, whereas free glutamic acid concentration increased in some varieties but decreased in others, and free proline concentration decreased. The study showed disease control by fungicide application to be an important crop management measure for mitigating the problem of acrylamide formation in wheat products.

  4. The effects of oil palm leaf meal-based diets on the growth ...

    African Journals Online (AJOL)

    ... diets on the growth performance and haematological indices of red Sokoto goats. ... Journal of Agriculture, Forestry and the Social Sciences ... indices of Red Sokoto goats placed on oil palm leaf meal (OPLM)-wheat offal based diet.

  5. The Development of “Eldo Ngano 1”: The World’s World’s First Ug99 Resistant Mutant Wheat Variety

    International Nuclear Information System (INIS)

    Forster, Brian P.

    2014-01-01

    The wheat black stem rust disease is a virulent race of fungus, Puccinia graminis, which affects wheat plants and is caused by a strain of fungus known as Ug99. Named for its place and year of origin, Ug99 was first discovered on wheat in Uganda in 1999. The spores of this plant disease are airborne and can be easily spread by wind. If not prevented, the disease can destroy 70 to 100 per cent of the yield of wheat crops. Annually on average 8.3 million tonnes of wheat grain is lost to this disease, costing US $1.23 billion per year. Ethiopia, Kenya and Uganda are hot spots for this disease. In 2009, growing international concern regarding the horrific impact of Ug99 on wheat led to the establishment of IAEA project INT/5/150, Responding to the Transboundary Threat of Wheat Black Stem Rust (Ug99). This project has involved over 18 countries and 5 national and international institutions, and examined possible mutation induction treatments to deal with the challenges posed by Ug99. Meetings and workshops to facilitate the project efforts have been held in Kenya and Turkey. Ug99 continues to spread globally and has now reached the Islamic Republic of Iran. There are also reports of suspected disease occurrences in Europe. It is essential that work continues on developing mutant lines for further crop protection that can be utilized worldwide to safeguard the wheat crop from this devastating disease

  6. Incorporation of Monovalent Cations in Sulfate Green Rust

    DEFF Research Database (Denmark)

    Christiansen, B. C.; Dideriksen, K.; Katz, A.

    2014-01-01

    Green rust is a naturally occurring layered mixed-valent ferrous-ferric hydroxide, which can react with a range of redox-active compounds. Sulfate-bearing green rust is generally thought to have interlayers composed of sulfate and water. Here, we provide evidence that the interlayers also contain...... with water showed that Na+ and K+ were structurally fixed in the interlayer, whereas Rb+ and Cs+ could be removed, resulting in a decrease in the basal layer spacing. The incorporation of cations in the interlayer opens up new possibilities for the use of sulfate green rust for exchange reactions with both...

  7. Cytogenetics and immature embryo culture at Embrapa Trigo breeding program: transfer of disease resistance from related species by artificial resynthesis of hexaploid wheat (Triticum aestivum L. em. Thell

    Directory of Open Access Journals (Sweden)

    Maria Irene Baggio de Moraes Fernandes

    2000-12-01

    to facilitate gene flow between wheat and related species. Since the environment at the center of origin of wheat in Southern Asia is quite different from subtropical environments, Brazilian breeding programs overcome more challenges to adapt wheat crop to biotic and abiotic stresses than some other countries. The germplasm bank of Embrapa Trigo has about 1000 registered entries of Triticum relatives, Aegilops, Secale and Agropyron species supplied from several germplasm banks distributed over the world which were multiplied and/or selected for naturally occurring or artificially inoculated fungal diseases. Since Aegilops squarrosa L. entries showed very good performance, the genetic variability observed in this species was firstly exploited. It is reported here the strategy used for transferring useful genes from Ae. squarrosa (DD, 2n = 14: crossing with tetraploid species (AABB, 2n = 28, rescue and in vitro culture of immature embryos for regeneration of the trihaploid (ABD, 2n = 21 hybri