WorldWideScience

Sample records for wheat leaf rust

  1. Genetic studies in wheat for leaf rust resistance ( Puccinia recondita ...

    African Journals Online (AJOL)

    Genetic studies in wheat for leaf rust resistance (Puccinia recondita). F Hussain, M Ashraf, MA Hameed, N Hussain, RA Sial. Abstract. Leaf rust is a major disease of wheat crop in the world as a whole. This study was undertaken to find the genetic effects of adult plant leaf resistance in wheat (Triticum aestivum L.).

  2. leaf and stripe rust resistance among ethiopian grown wheat ...

    African Journals Online (AJOL)

    ADMIN

    ABSTRACT: Ethiopian grown wheat varieties and lines were studied to identify germplasm sources possessing resistance to leaf rust caused by Puccinia triticina and stripe rust (P. striiformis). Sixty-four lines were included of which 38 were bread wheat (Triticum aestivum, 2n=6x=42, AABBDD) and 26 durum wheat (T.

  3. Leaf Rust of Wheat: Pathogen Biology, Variation and Host Resistance

    Directory of Open Access Journals (Sweden)

    James Kolmer

    2013-01-01

    Full Text Available Rusts are important pathogens of angiosperms and gymnosperms including cereal crops and forest trees. With respect to cereals, rust fungi are among the most important pathogens. Cereal rusts are heteroecious and macrocyclic requiring two taxonomically unrelated hosts to complete a five spore stage life cycle. Cereal rust fungi are highly variable for virulence and molecular polymorphism. Leaf rust, caused by Puccinia triticina is the most common rust of wheat on a worldwide basis. Many different races of P. triticina that vary for virulence to leaf rust resistance genes in wheat differential lines are found annually in the US. Molecular markers have been used to characterize rust populations in the US and worldwide. Highly virulent races of P. triticina are selected by leaf rust resistance genes in the soft red winter wheat, hard red winter wheat and hard red spring wheat cultivars that are grown in different regions of the US. Cultivars that only have race-specific leaf rust resistance genes that are effective in seedling plants lose their effective resistance and become susceptible within a few years of release. Cultivars with combinations of race non-specific resistance genes have remained resistant over a period of years even though races of the leaf rust population have changed constantly.

  4. Induced resistance and gene expression in wheat against leaf rust ...

    African Journals Online (AJOL)

    uvp

    2013-05-15

    May 15, 2013 ... Key words: Wheat leaf rust, induced resistance, priming, gene expression, immunoblotting, crude Agapanthus africanus extract. ... agents, including several synthetic and natural plant activators (Garcia-Brugger et al., ... priming and direct defence activation (van Hulten et al.,. 2006). The identification of new ...

  5. Identification of leaf rust resistant gene Lr10 in Pakistani wheat ...

    African Journals Online (AJOL)

    Leaf (brown) rust is the major disease of wheat in Pakistan and other countries. The disease is more effectively controlled when several rust resistance genes are pyramided into a single line. Molecular survey was conducted to screen 25 Pakistan wheat germplasm for the presence of leaf rust resistance gene Lr10 using ...

  6. Prehaustorial and posthaustorial resistance to wheat leaf rust in diploid wheat

    NARCIS (Netherlands)

    Anker, C.C.

    2001-01-01

    In modern wheat cultivars, resistance to wheat leaf rust, Puccinia triticina , is either based on hypersensitivity resistance or on partial resistance. Hypersensitivity resistance in wheat is monogenic, often complete and posthaustorial: it is induced after the

  7. Genetics of leaf rust resistance in the hard red winter wheat cultivars Santa Fe and Duster

    Science.gov (United States)

    Leaf rust caused by Puccinia triticina is a common and important disease of hard red winter wheat in the Great Plains of the United States. The hard red winter wheat cultivars 'Santa Fe' and 'Duster' have had effective leaf rust resistance since their release in 2003 and 2006, respectively. Both cul...

  8. Genetics of leaf and stripe rust resistance in a bread wheat cultivar ...

    Indian Academy of Sciences (India)

    Leaf rust caused by Puccinia triticina (=P. recondita Rober- age ex Desmaz f. sp. tritici Eriks and E. Henn.) and stripe rust caused by P. striiformis Westend f. sp. tritici are the major foliar diseases of wheat, resulting in yield loss all over the world (Eversmeyer and Browder 1974; Kolmer 1996). The wheat cultivars become ...

  9. Prehaustorial resistance to the wheat leaf rust fungus, Puccinia triticina, in Triticum monococcum (s.s.)

    NARCIS (Netherlands)

    Anker, C.C.; Niks, R.E.

    2001-01-01

    Diploid wheat, Triticum monococcum s.l., is a host for the wheat leaf rust fungus, Puccinia triticina. Some accessions have been reported to show a high degree of prehaustorial resistance. This is non-hypersensitivity resistance, which acts before the formation of haustoria by the pathogen. To

  10. Genetic studies in wheat for leaf rust resistance (Puccinia recondita)

    African Journals Online (AJOL)

    user

    2011-04-18

    Apr 18, 2011 ... 3Plant Breeding institute, University of Sydney, Camden, NSW, Australia. .... leaf rust at the beginning of the culms elongation stage of plant growth. Fresh inoculum was collected from spreader rows, while plots were inoculated by spraying and dusting. ... modified Cobb scale method (Peterson et al., 1948).

  11. Resistance to brown leaf rust of hybrids between wheat and amphiploids wheat-thinopyrum

    Directory of Open Access Journals (Sweden)

    Alexander Lvovivh SECHNYAK

    2011-11-01

    Full Text Available The resistance to a brown leaf rust in 56 chromosomal partial аmphiploids (Triticum aestivum L. × Thinopyrum ponticum (Podp. Z.-W. Liu and R.-C. Wang, РА 2 (Triticum aestivum L. × Thinopyrum intermedium (Host Barkworth and D.R. Devey, H79/9-9 (Triticum aestivum L. × Elymus sp., Triticum aestivum L. cvs. Albatross odesskiy, Fantaziya odesskaya, Zhatva Altaya and their hybrids, F2-F4 were studied at artificial infection in field infectious nursery in 2009, 2010 and 2011. The investigated varieties of wheat have shown a high susceptibility to pathogen. Amphiploids РА 1 and РА 2 also are susceptible to pathogen, but in a lesser degree, than the wheat. Good resistance was shown only by amphiploid Н79/9-9, but its hybrid with wheat Albatross Odessa appeared is susceptible to pathogen. The hybrids with amphiploids РА 1 and РА 2 have shown a various degree of resistance to brown leaf rust. Hybrid Zhatva Altaya × РА 2 within three years stably showed 8 point resistance to disease. The reasonsfor different resistance of amphiploids and its hybrids with wheat are discussed.

  12. Efficacy of plant extracts in controlling wheat leaf rust disease caused by Puccinia triticina

    Directory of Open Access Journals (Sweden)

    Yasser M. Shabana

    2017-03-01

    Full Text Available The efficacy of eight plant extracts (garlic, clove, garden quinine, Brazilian pepper, anthi mandhaari, black cumin, white cedar and neem in controlling leaf rust disease of wheat was investigated in vitro and in vivo. In vitro, all treatments inhibited spore germination by more than 93%. Neem extract recorded 98.99% inhibition of spore germination with no significant difference from the fungicide Sumi-8 (100%. Under greenhouse conditions, seed soaking application in neem extract (at concentration of 2 ml/L resulted in 36.82% reduction in the number of pustules/leaf compared with the untreated control. Foliar spraying of plant extracts on wheat seedlings decreased the number of pustules/leaf. Foliar spraying of plant extracts four days after inoculation led to the highest resistance response of wheat plants against leaf rust pathogen. Spray application of wheat seedlings with neem, clove and garden quinine extracts, four days after inoculation with leaf rust pathogen completely prevented rust development (100% disease control and was comparable with the fungicide Sumi-8. Foliar spray application of wheat plants at mature stage with all plant extracts has significantly reduced the leaf rust infection (average coefficient of infection, ACI compared with the untreated control and neem was the most effective treatment. This was reflected on grain yield components, whereas the 1000-kernel weight and the test weight were improved whether under one- or two-spray applications, with two-spray application being more effective in this regard. Thus, it could be concluded that plant extracts may be useful to control leaf rust disease in Egypt as a safe alternative option to chemical fungicides.

  13. Evidence of isolate-specificity in non-hypersensitive resistance in spring wheat (Triticum aestivum) to wheat leaf rust

    NARCIS (Netherlands)

    Qamar, Maqsood; Niks, R.E.

    2007-01-01

    Isolate-specific aspect of non-hypersensitive resistance in wheat to wheat leaf rust was studied at seedling stage in the green house. Isolate-specific response of non-hypersensitive resistance was assessed from latency period (LP) and infection frequency (IF) of two single-pustule isolates of

  14. Genetics of leaf and stripe rust resistance in a bread wheat cultivar ...

    Indian Academy of Sciences (India)

    Home; Journals; Journal of Genetics; Volume 87; Issue 2. Genetics of leaf and stripe rust resistance in a bread wheat cultivar Tonichi. Satinder Kaur U. K. Bansal Renu Khanna R. G. Saini. Research Note Volume 87 Issue 2 August 2008 pp 191-194 ...

  15. Identifying leaf rust resistance gene Lr19 in durum wheat using ...

    African Journals Online (AJOL)

    Leaf rust, caused by Puccinia triticina Eriks., is an important disease affecting durum wheat (Triticum turgidum ssp. durum) worldwide, particularly in the Mediterranean region. The disease can be controlled through the use of plant host resistance. Based on seedling resistance tests of 103 durum genotypes against a bulk of ...

  16. Genome-Wide Association Mapping Reveals Novel QTL for Seedling Leaf Rust Resistance in a Worldwide Collection of Winter Wheat

    Directory of Open Access Journals (Sweden)

    Genqiao Li

    2016-11-01

    Full Text Available Leaf rust of wheat ( L. is a major disease that causes significant yield losses worldwide. The short-lived nature of leaf rust resistance ( genes necessitates a continuous search for novel sources of resistance. We performed a genome-wide association study (GWAS on a panel of 1596 wheat accessions. The panel was evaluated for leaf rust reaction by testing with a bulk of Eriks. ( isolates collected from multiple fields of Oklahoma in 2013 and two predominant races in the fields of Oklahoma in 2015. The panel was genotyped with a set of 5011 single-nucleotide polymorphism (SNP markers. A total of 14 quantitative trait loci (QTL for leaf rust resistance were identified at a false discovery rate (FDR of 0.01 using the mixed linear model (MLM. Of these, eight QTL reside in the vicinity of known genes or QTL, and more studies are needed to determine their relationship with known loci. is a new QTL to bread wheat but is close to a locus previously identified in durum wheat [ L. subsp. (Desf. Husn.]. The other five QTL, including , , , , and , are likely novel loci for leaf rust resistance. The uneven distribution of the 14 QTL in the six subpopulations of the panel suggests that wheat breeders can enhance leaf rust resistance by selectively introgressing some of these QTL into their breeding materials. In addition, another 31 QTL were significantly associated with leaf rust resistance at a FDR of 0.05.

  17. Cultivar mixtures for the simultaneous management of multiple diseases: tan spot and leaf rust of wheat.

    Science.gov (United States)

    Cox, C M; Garrett, K A; Bowden, R L; Fritz, A K; Dendy, S P; Heer, W F

    2004-09-01

    ABSTRACT Because of differences in life histories between Puccinia triticina, a highly specialized, polycyclic, windborne pathogen with a shallow dispersal gradient, and Pyrenophora tritici-repentis, a residue-borne pathogen with a steep dispersal gradient, wheat mixtures are expected to be more effective at controlling leaf rust than tan spot. The objectives of this research were to determine the effect of two-cultivar mixtures with varying proportions and different pathogen resistance profiles on the severity of tan spot and leaf rust, to evaluate yield of the mixtures in the presence or absence of disease, and to directly compare the relative effectiveness of cultivar mixing for tan spot versus leaf rust. In a field experiment at two sites in Kansas over two growing seasons, winter wheat cvs. Jagger and 2145, which have differential resistance reactions to leaf rust and tan spot, each were planted in proportions of 0.25, 0.50, 0.75, and 1.00. Plots were inoculated with each pathogen alone, both pathogens, treated with a fungicide, or exposed to ambient conditions. For both diseases for all siteyears, severity decreased substantially on the susceptible cultivar as the proportion of that cultivar decreased in mixture. Mixtures were significantly more effective at reducing leaf rust than tan spot in three of four site-years. Mixtures generally yielded the same as the weighted mean of components in monoculture although, in two of three site-years, at least one fungicide-treated and one diseased mixture each yielded higher than expected values. Although this particular mixture produced only modest yield benefits, the potential for simultaneous reductions in tan spot and leaf rust was demonstrated.

  18. Adult plant leaf rust resistance derived from Toropi wheat is conditioned by Lr78 and three minor QTL.

    Science.gov (United States)

    Kolmer, James; Bernardo, Amy; Bai, Guihua; Hayden, Matt; Chao, Shiaoman

    2017-10-09

    Leaf rust caused by Puccinia triticina is an important disease of wheat in many regions worldwide. Durable or long lasting leaf rust resistance has been difficult to achieve because populations of P. triticina are highly variable for virulence to race-specific resistance genes, and respond to selection by resistance genes in released wheat cultivars. The wheat cultivar Toropi, developed and grown in Brazil, was noted to have long lasting leaf rust resistance that was effective only in adult plants. The objectives of this study were to determine the chromosome location of the leaf rust resistance genes derived from Toropi in two populations of recombinant inbred lines in a partial Thatcher wheat background. In the first population, a single gene with major effects on chromosome 5DS that mapped 2.2 cM distal to IWA6289, strongly reduced leaf rust severity in all three years of field plot tests. This gene for adult plant leaf rust resistance was designated as Lr78. In the second population, QTL with small effects on chromosomes 1BL, 3BS, and 4BS were found. These QTL expressed inconsistently over four years of field plot tests. The adult plant leaf rust resistance derived from Toropi involved a complex combination of QTL with large and small effects.

  19. Winter wheat susceptibilty to leaf rust and resistance sources to diseases

    Directory of Open Access Journals (Sweden)

    Jerzy Chełkowski

    2012-12-01

    Full Text Available Winter wheat cultivars were significantly infected by Puccinia triticina causing leaf rust in seasons 2000-2002 in southern and also central regions of Poland. Resistance genes Lr9, Lr19 and Lr24 were found to be effective against dominating populations of the pathogen and typical isolates of P. triticina. Mentioned three resistance genes as well as genes Lr10 and Lr37 were identified using STS (Sequence Tagged Site DNA - PCR markers in cultivars and resistance sources. Mentioned markers were found very useful in resistance breeding of wheat.

  20. A candidate for Lr19, an exotic gene conditioning leaf rust resistance in wheat.

    Science.gov (United States)

    Gennaro, Andrea; Koebner, Robert M D; Ceoloni, Carla

    2009-08-01

    Lr19, one of the few widely effective genes conferring resistance to leaf rust in wheat, was transferred from the wild relative Thinopyrum ponticum to durum wheat. Since Lr19 confers a hypersensitive response to the pathogen, it was considered likely that the gene would be a member of the major nucleotide-binding site (NBS)-leucine-rich repeat (LRR) plant R gene family. NBS profiling, based on PCR amplification of conserved NBS motifs, was applied to durum wheat-Th. ponticum recombinant lines involving different segments of the alien 7AgL chromosome arm, carrying or lacking Lr19. Differential PCR products were isolated and sequenced. From one such sequence (AG15), tightly linked to Lr19, a 4,121-bp full-length cDNA was obtained. Its deduced 1,258 amino acid sequence has the characteristic NBS-LRR domains of plant R gene products and includes a coiled-coil (CC) region typical of monocots. The genomic DNA sequence showed the presence of two exons and a short intron upstream of the predicted stop codon. Homology searches revealed considerable identity of AG15 with the cloned wheat resistance gene Pm3a and a lower similarity with wheat Lr1, Lr21, and Lr10. Quantitative PCR on leaf-rust-infected and non-infected Lr19 carriers proved AG15 to be constitutively expressed, as is common for R genes.

  1. Morphological and molecular characterisation confirm that Triticum monococcum s.s. is resistant to wheat leaf rust

    NARCIS (Netherlands)

    Anker, C.C.; Buntjer, J.B.; Niks, R.E.

    2001-01-01

    The three diploid wheat species Triticum monococcum, Triticum boeoticum and Triticum urartu differ in their reaction to wheat leaf rust, Puccinia triticina. In general, T. monococcum is resistant while T. boeoticum and T. urartu are susceptible. However, upon screening a large collection of diploid

  2. Allelic variation at loci controlling stripe rust resistance in spring wheat

    Indian Academy of Sciences (India)

    2014-08-20

    Aug 20, 2014 ... Wheat (Triticum aestivum L.) rusts have been one of the main yield limiting factors in wheat cultivation throughout the world. Three kinds of rust diseases that attack wheat crop are leaf (brown) rust, stripe (yellow) rust and stem (black) rust. Leaf rust is caused by Puccinia triticina f.sp. tritici; stripe rust is ...

  3. Mapping of quantitative adult plant field resistance to leaf rust and stripe rust in two European winter wheat populations reveals co-location of three QTL conferring resistance to both rust pathogens.

    Science.gov (United States)

    Buerstmayr, Maria; Matiasch, Lydia; Mascher, Fabio; Vida, Gyula; Ittu, Marianna; Robert, Olivier; Holdgate, Sarah; Flath, Kerstin; Neumayer, Anton; Buerstmayr, Hermann

    2014-09-01

    We detected several, most likely novel QTL for adult plant resistance to rusts. Notably three QTL improved resistance to leaf rust and stripe rust simultaneously indicating broad spectrum resistance QTL. The rusts of wheat (Puccinia spp.) are destructive fungal wheat diseases. The deployment of resistant cultivars plays a central role in integrated rust disease management. Durability of resistance would be preferred, but is difficult to analyse. The Austrian winter wheat cultivar Capo was released in the 1989 and grown on a large acreage during more than two decades and maintained a good level of quantitative leaf rust and stripe rust resistance. Two bi-parental mapping populations: Capo × Arina and Capo × Furore were tested in multiple environments for severity of leaf rust and stripe rust at the adult plant stage in replicated field experiments. Quantitative trait loci associated with leaf rust and stripe rust severity were mapped using DArT and SSR markers. Five QTL were detected in multiple environments associated with resistance to leaf rust designated as QLr.ifa-2AL, QLr.ifa-2BL, QLr.ifa-2BS, QLr.ifa-3BS, and QLr.ifa-5BL, and five for resistance to stripe rust QYr.ifa-2AL, QYr.ifa-2BL, QYr.ifa-3AS, QYr.ifa-3BS, and QYr.ifa-5A. For all QTL apart from two (QYr.ifa-3AS, QLr.ifa-5BL) Capo contributed the resistance improving allele. The leaf rust and stripe rust resistance QTL on 2AL, 2BL and 3BS mapped to the same chromosome positions, indicating either closely linked genes or pleiotropic gene action. These three multiple disease resistance QTL (QLr.ifa-2AL/QYr.ifa-2AL, QLr.ifa.2BL/QYr.ifa-2BL, QLr.ifa-3BS/QYr.ifa.3BS) potentially contribute novel resistance sources for stripe rust and leaf rust. The long-lasting resistance of Capo apparently rests upon a combination of several genes. The described germplasm, QTL and markers are applicable for simultaneous resistance improvement against leaf rust and stripe rust.

  4. Expression of apoplast-targeted plant defensin MtDef4.2 confers resistance to leaf rust pathogen Puccinia triticina but does not affect mycorrhizal symbiosis in transgenic wheat

    Science.gov (United States)

    Rust diseases caused by Puccinia spp. pose a major threat to global wheat production. Puccinia triticina (Pt), an obligate basidiomycete biotroph, causes leaf rust disease which incurs yield losses of up to 50% in wheat. Historically, resistant wheat cultivars have been used to control leaf rust, bu...

  5. Pathogenesis-related protein expression in the apoplast of wheat leaves protected against leaf rust following application of plant extracts.

    Science.gov (United States)

    Naz, Rabia; Bano, Asghari; Wilson, Neil L; Guest, David; Roberts, Thomas H

    2014-09-01

    Leaf rust (Puccinia triticina) is a major disease of wheat. We tested aqueous leaf extracts of Jacaranda mimosifolia (Bignoniaceae), Thevetia peruviana (Apocynaceae), and Calotropis procera (Apocynaceae) for their ability to protect wheat from leaf rust. Extracts from all three species inhibited P. triticina urediniospore germination in vitro. Plants sprayed with extracts before inoculation developed significantly lower levels of disease incidence (number of plants infected) than unsprayed, inoculated controls. Sprays combining 0.6% leaf extracts and 2 mM salicylic acid with the fungicide Amistar Xtra at 0.05% (azoxystrobin at 10 μg/liter + cyproconazole at 4 μg/liter) reduced disease incidence significantly more effectively than sprays of fungicide at 0.1% alone. Extracts of J. mimosifolia were most active, either alone (1.2%) or in lower doses (0.6%) in combination with 0.05% Amistar Xtra. Leaf extracts combined with fungicide strongly stimulated defense-related gene expression and the subsequent accumulation of pathogenesis-related (PR) proteins in the apoplast of inoculated wheat leaves. The level of protection afforded was significantly correlated with the ability of extracts to increase PR protein expression. We conclude that pretreatment of wheat leaves with spray formulations containing previously untested plant leaf extracts enhances protection against leaf rust provided by fungicide sprays, offering an alternative disease management strategy.

  6. Adult plant leaf rust resistance derived from the soft red winter wheat cultivar Caldwell maps to chromosome 3BS

    Science.gov (United States)

    'Caldwell' is a U.S. soft red winter wheat that has partial, adult plant resistance to the leaf rust pathogen Puccinia triticina. A line of 'Thatcher*2/Caldwell' with adult plant resistance derived from Caldwell was crossed with 'Thatcher' to develop a population of recombinant inbred lines (RILs). ...

  7. Genome wide association study of seedling and adult plant leaf rust resistance in elite spring wheat breeding lines

    Science.gov (United States)

    Leaf rust is an important disease, threatening wheat production annually. Identification of resistance genes or QTLs for effective field resistance could greatly enhance our ability to breed durably resistant varieties. We applied a genome wide association study (GWAS) approach to identify resista...

  8. Genome-Wide Association Mapping for Resistance to Leaf and Stripe Rust in Winter-Habit Hexaploid Wheat Landraces.

    Directory of Open Access Journals (Sweden)

    Albert Kertho

    Full Text Available Leaf rust, caused by Puccinia triticina (Pt, and stripe rust, caused by P. striiformis f. sp. tritici (Pst, are destructive foliar diseases of wheat worldwide. Breeding for disease resistance is the preferred strategy of managing both diseases. The continued emergence of new races of Pt and Pst requires a constant search for new sources of resistance. Here we report a genome-wide association analysis of 567 winter wheat (Triticum aestivum landrace accessions using the Infinium iSelect 9K wheat SNP array to identify loci associated with seedling resistance to five races of Pt (MDCL, MFPS, THBL, TDBG, and TBDJ and one race of Pst (PSTv-37 frequently found in the Northern Great Plains of the United States. Mixed linear models identified 65 and eight significant markers associated with leaf rust and stripe rust, respectively. Further, we identified 31 and three QTL associated with resistance to Pt and Pst, respectively. Eleven QTL, identified on chromosomes 3A, 4A, 5A, and 6D, are previously unknown for leaf rust resistance in T. aestivum.

  9. Marker-assisted selection for leaf rust resistance genes Lr19 and Lr24 in wheat (Triticum aestivum L.).

    Science.gov (United States)

    Singh, Rajender; Datta, Dibendu; Priyamvada; Singh, Somvir; Tiwari, Ratan

    2004-01-01

    Leaf rust caused by Puccinia recondita f.sp. tritici is a wheat disease of worldwide importance. Wheat genotypes known to carry specific rust resistance genes and segregating lines that originated from various cross combinations and derived from distinct F2 lineage, so as to represent a diverse genetic background, were included in the present study for validation of molecular markers for Lr19 and Lr24. STS markers detected the presence of the leaf rust resistance gene Lr19 in a Thatcher NIL (Tc*Lrl9) and Inia66//CMH81A575 and of the gene Lr24 in the genotypes Arkan, Blue Boy II, Agent and CI 17907. Validation of molecular markers for Lr19 and Lr24 in parental lines, followed by successful detection of these genes in F3 lines from various cross combinations, was carried out. The molecular test corresponded well with the host-pathogen interaction test response of these lines.

  10. Monosomic and molecular mapping of adult plant leaf rust resistance genes in the Brazilian wheat cultivar Toropi.

    Science.gov (United States)

    Da-Silva, P R; Brammer, S P; Guerra, D; Milach, S C K; Barcellos, A L; Baggio, M I

    2012-08-24

    Leaf rust is one of the most destructive diseases affecting wheat worldwide. The most effective way to control it is to use resistant cultivars. Resistance based on slow-rusting adult plant resistance (APR) genes has proven to be the best method for developing cultivars with durable resistance. A source of slow-rusting APR for leaf rust is the Brazilian wheat cultivar Toropi. The Toropi/IAC 13 F₂ and F₇ recombinant inbred lines (RILs) were developed in previous studies. Phenotypic analysis of the F₂ and F₇ RILs showed that 2 recessive genes that were temporarily named trp-1 and trp-2 conferred APR in Toropi. In the present study, we used monosomic families and amplified fragment length polymorphism (AFLP), sequence-tagged site, and simple sequence repeat (SSR) markers to map trp-1 and trp-2 on wheat chromosomes. Analysis of the F₂ monosomic RIL showed that trp- 1 and trp-2 were located on chromosomes 1A and 4D, respectively. AFLP analysis of the F₇ RIL identified 2 independent AFLP markers, XPacgMcac3 and XPacgMcac6, which were associated with Toropi APR. These markers explained 71.5% of the variation in the phenotypic data in a multiple linear regression model. The AFLP markers XPacg/ Mcac3 and XPacg/Mcac6 were anchored by SSR markers previously mapped on the short arms of chromosomes 1A (1AS) and 4D (4DS), respectively. The trp-2 gene is the first leaf rust resistance gene mapped on wheat chromosome 4DS. The mapping of trp-1 and trp-2 provides novel and valuable information that could be used in future studies involving the fine mapping of these genes, as well as in the identification of molecular markers that are closely related to these genes for marker-assisted selection of this important trait in wheat.

  11. Characterization and Mapping of Leaf Rust and Stripe Rust Resistance Loci in Hexaploid Wheat Lines UC1110 and PI610750 under Mexican Environments

    Directory of Open Access Journals (Sweden)

    Caixia Lan

    2017-08-01

    Full Text Available Growing resistant wheat varieties is a key method of minimizing the extent of yield losses caused by the globally important wheat leaf rust (LR and stripe rust (YR diseases. In this study, a population of 186 F8 recombinant inbred lines (RILs derived from a cross between a synthetic wheat derivative (PI610750 and an adapted common wheat line (cv. “UC1110” were phenotyped for LR and YR response at both seedling and adult plant stages over multiple seasons. Using a genetic linkage map consisting of single sequence repeats and diversity arrays technology markers, in combination with inclusive composite interval mapping analysis, we detected a new LR adult plant resistance (APR locus, QLr.cim-2DS, contributed by UC1110. One co-located resistance locus to both rusts, QLr.cim-3DC/QYr.cim-3DC, and the known seedling resistance gene Lr26 were also mapped. QLr.cim-2DS and QLr.cim-3DC showed a marginally significant interaction for LR resistance in the adult plant stage. In addition, two previously reported YR APR loci, QYr.ucw-3BS and Yr48, were found to exhibit stable performances in rust environments in both Mexico and the United States and showed a highly significant interaction in the field. Yr48 was also observed to confer intermediate seedling resistance against Mexican YR races, thus suggesting it should be re-classified as an all-stage resistance gene. We also identified 5 and 2 RILs that possessed all detected YR and LR resistance loci, respectively. With the closely linked molecular markers reported here, these RILs could be used as donors for multiple resistance loci to both rusts in wheat breeding programs.

  12. Transcriptome-wide analysis of WRKY transcription factors in wheat and their leaf rust responsive expression profiling.

    Science.gov (United States)

    Satapathy, Lopamudra; Singh, Dharmendra; Ranjan, Prashant; Kumar, Dhananjay; Kumar, Manish; Prabhu, Kumble Vinod; Mukhopadhyay, Kunal

    2014-12-01

    WRKY, a plant-specific transcription factor family, has important roles in pathogen defense, abiotic cues and phytohormone signaling, yet little is known about their roles and molecular mechanism of function in response to rust diseases in wheat. We identified 100 TaWRKY sequences using wheat Expressed Sequence Tag database of which 22 WRKY sequences were novel. Identified proteins were characterized based on their zinc finger motifs and phylogenetic analysis clustered them into six clades consisting of class IIc and class III WRKY proteins. Functional annotation revealed major functions in metabolic and cellular processes in control plants; whereas response to stimuli, signaling and defense in pathogen inoculated plants, their major molecular function being binding to DNA. Tag-based expression analysis of the identified genes revealed differential expression between mock and Puccinia triticina inoculated wheat near isogenic lines. Gene expression was also performed with six rust-related microarray experiments at Gene Expression Omnibus database. TaWRKY10, 15, 17 and 56 were common in both tag-based and microarray-based differential expression analysis and could be representing rust specific WRKY genes. The obtained results will bestow insight into the functional characterization of WRKY transcription factors responsive to leaf rust pathogenesis that can be used as candidate genes in molecular breeding programs to improve biotic stress tolerance in wheat.

  13. Influence of cultivated landscape composition on variety resistance: an assessment based on wheat leaf rust epidemics.

    Science.gov (United States)

    Papaïx, Julien; Goyeau, Henriette; Du Cheyron, Philippe; Monod, Hervé; Lannou, Christian

    2011-09-01

    In plant pathology, the idea of designing variety management strategies at the scale of cultivated landscapes is gaining more and more attention. This requires the identification of effects that take place at large scales on host and pathogen populations. Here, we show how the landscape varietal composition influences the resistance level (as measured in the field) of the most grown wheat varieties by altering the structure of the pathogen populations. For this purpose, we jointly analysed three large datasets describing the wheat leaf rust pathosystem (Puccinia triticina/Triticum aestivum) at the country scale of France with a Bayesian hierarchical model. We showed that among all compatible pathotypes, some were preferentially associated with a variety, that the pathotype frequencies on a variety were affected by the landscape varietal composition, and that the observed resistance level of a variety was linked to the frequency of the most aggressive pathotypes among all compatible pathotypes. This data exploration establishes a link between the observed resistance level of a variety and landscape composition at the national scale. It illustrates that the quantitative aspects of the host-pathogen relationship have to be considered in addition to the major resistance/virulence factors in landscape epidemiology approaches. © 2011 The Authors. New Phytologist © 2011 New Phytologist Trust.

  14. Prediction and analysis of three gene families related to leaf rust (Puccinia triticina) resistance in wheat (Triticum aestivum L.)

    OpenAIRE

    Peng, Fred Y.; Yang, Rong-Cai

    2017-01-01

    Background The resistance to leaf rust (Lr) caused by Puccinia triticina in wheat (Triticum aestivum L.) has been well studied over the past decades with over 70 Lr genes being mapped on different chromosomes and numerous QTLs (quantitative trait loci) being detected or mapped using DNA markers. Such resistance is often divided into race-specific and race-nonspecific resistance. The race-nonspecific resistance can be further divided into resistance to most or all races of the same pathogen an...

  15. Molecular characterization of a wheat--Thinopyrum ponticum partial amphiploid and its derivatives for resistance to leaf rust.

    Science.gov (United States)

    Li, Hongjie; Chen, Qin; Conner, Robert L; Guo, Beihai; Zhang, Yanmin; Graf, Robert J; Laroche, André; Jia, Xu; Liu, Gongshe; Chu, Chihching

    2003-10-01

    Leaf rust (caused by Puccinia triticina Eriks.) occurs annually in most wheat-growing areas of the world. Thinopyrum ponticum (Podp.) Z.-W. Liu & R.-C. Wang has provided several leaf rust resistance genes to protect wheat from this fungal disease. Three chromosome substitution lines, Ji806, Ji807, and Ji859, and two chromosome addition lines, Ji791 and Ji924, with a winter growing habit were developed from crosses between wheat (Triticum aestivum L. em Thell.) and the wheat - Th. ponticum partial amphiploid line 693. These lines were resistant to leaf rust isolates from China. Sequence-tagged site (STS) analysis with the J09-STS marker, which is linked to the gene Lr24, revealed that the partial amphiploid line 693 and all of the substitution and addition lines carried gene Lr24. Genomic in situ hybridization (GISH) analysis was carried out on chromosome preparations using total genomic DNA from Pseudoroegneria strigosa (M. Bieb) A. Löve (St genome, 2n = 14) as a probe in the presence of total genomic DNA from T. aestivum 'Chinese Spring' wheat (ABD genomes, 2n = 42). The GISH analysis demonstrated that these lines had a pair of chromosomes displaying the typical pattern of a Js genome chromosome. This indicates that the chromosome that carries gene Lr24 belonged to the Js genome of Th. ponticum. In addition to 40 wheat chromosomes, eight Js and eight J genome chromosomes were also differentiated by GISH in the partial amphiploid line 693. Since most sources of Lr24 have a red grain color, the white-colored seeds in all of these substitution and addition lines, together with high protein content in some of the lines, make them very useful as a donor source for winter wheat breeding programs.

  16. Microscopic and Molecular Characterization of the Prehaustorial Resistance against Wheat Leaf Rust (Puccinia triticina) in Einkorn (Triticum monococcum)

    Science.gov (United States)

    Serfling, Albrecht; Templer, Sven E.; Winter, Peter; Ordon, Frank

    2016-01-01

    Puccinia triticina f. sp. tritici (Eriks.), the causal agent of leaf rust, causes substantial yield losses in wheat production. In wheat many major leaf rust resistance genes have been overcome by virulent races. In contrast, the prehaustorial resistance (phr) against wheat leaf rust detected in the diploid wheat Einkorn (Triticum monoccocum var. monococcum) accession PI272560 confers race-independent resistance against isolates virulent on accessions harboring resistance genes located on the A-genome of Triticum aestivum. Phr in PI272560 leads to abortion of fungal development during the formation of haustorial mother cells and to increased hydrogen peroxide concentration in comparison to the susceptible accession 36554 (Triticum boeoticum ssp. thaoudar var. reuteri). Increased peroxidase and endochitinase activity was detected in PI272560 within 6 h after inoculation (hai). Comparative transcriptome profiling using Massive Analysis of cDNA Ends (MACE) in infected and non-infected leaves detected 14220 differentially expressed tags in PI272560 and 15472 in accession 36554. Of these 2908 and 3004, respectively, could be assigned to Gene Ontology (GO) categories of which 463 were detected in both accessions and 311 were differentially expressed between the accessions. In accordance with the concept of non-host resistance in PI272560, genes with similarity to peroxidases, chitinases, β-1,3-glucanases and other pathogenesis-related genes were up-regulated within the first 8 hai, whereas up-regulation of such genes was delayed in 36554. Moreover, a Phosphoribulokinase gene contributing to non-host resistance in rice against stripe rust was exclusively expressed in the resistant accession PI272560. Gene expression underpinned physiological and phenotypic observations at the site of infection and are in accordance with the concept of non-host resistance. PMID:27881987

  17. Prediction and analysis of three gene families related to leaf rust (Puccinia triticina) resistance in wheat (Triticum aestivum L.).

    Science.gov (United States)

    Peng, Fred Y; Yang, Rong-Cai

    2017-06-20

    The resistance to leaf rust (Lr) caused by Puccinia triticina in wheat (Triticum aestivum L.) has been well studied over the past decades with over 70 Lr genes being mapped on different chromosomes and numerous QTLs (quantitative trait loci) being detected or mapped using DNA markers. Such resistance is often divided into race-specific and race-nonspecific resistance. The race-nonspecific resistance can be further divided into resistance to most or all races of the same pathogen and resistance to multiple pathogens. At the molecular level, these three types of resistance may cover across the whole spectrum of pathogen specificities that are controlled by genes encoding different protein families in wheat. The objective of this study is to predict and analyze genes in three such families: NBS-LRR (nucleotide-binding sites and leucine-rich repeats or NLR), START (Steroidogenic Acute Regulatory protein [STaR] related lipid-transfer) and ABC (ATP-Binding Cassette) transporter. The focus of the analysis is on the patterns of relationships between these protein-coding genes within the gene families and QTLs detected for leaf rust resistance. We predicted 526 ABC, 1117 NLR and 144 START genes in the hexaploid wheat genome through a domain analysis of wheat proteome. Of the 1809 SNPs from leaf rust resistance QTLs in seedling and adult stages of wheat, 126 SNPs were found within coding regions of these genes or their neighborhood (5 Kb upstream from transcription start site [TSS] or downstream from transcription termination site [TTS] of the genes). Forty-three of these SNPs for adult resistance and 18 SNPs for seedling resistance reside within coding or neighboring regions of the ABC genes whereas 14 SNPs for adult resistance and 29 SNPs for seedling resistance reside within coding or neighboring regions of the NLR gene. Moreover, we found 17 nonsynonymous SNPs for adult resistance and five SNPs for seedling resistance in the ABC genes, and five nonsynonymous SNPs for

  18. Heritable, de novo resistance to leaf rust and other novel traits in selfed descendants of wheat responding to inoculation with wheat streak mosaic virus.

    Directory of Open Access Journals (Sweden)

    Dallas L Seifers

    Full Text Available Stable resistance to infection with Wheat streak mosaic virus (WSMV can be evolved de novo in selfing bread wheat lines subjected to cycles of WSMV inoculation and selection of best-performing plants or tillers. To learn whether this phenomenon might be applied to evolve resistance de novo to pathogens unrelated to WSMV, we examined the responses to leaf rust of succeeding generations of the rust- and WSMV-susceptible cultivar 'Lakin' following WSMV inoculation and derived rust-resistant sublines. After three cycles of the iterative protocol five plants, in contrast to all others, expressed resistance to leaf and stripe rust. A subset of descendant sublines of one of these, 'R1', heritably and uniformly expressed the new trait of resistance to leaf rust. Such sublines, into which no genes from a known source of resistance had been introgressed, conferred resistance to progeny of crosses with susceptible parents. The F1 populations produced from crosses between, respectively, susceptible and resistant 'Lakin' sublines 4-3-3 and 4-12-3 were not all uniform in their response to seedling inoculation with race TDBG. In seedling tests against TDBG and MKPS races the F2s from F1 populations that were uniformly resistant had 3∶1 ratios of resistant to susceptible individuals but the F2s from susceptible F1 progenitors were uniformly susceptible. True-breeding lines derived from resistant individuals in F2 populations were resistant to natural stripe and leaf rust inoculum in the field, while the 'Lakin' progenitor was susceptible. The next generation of six of the 'Lakin'-derived lines exhibited moderate to strong de novo resistance to stem rust races TPMK, QFCS and RKQQ in seedling tests while the 'Lakin' progenitor was susceptible. These apparently epigenetic effects in response to virus infection may help researchers fashion a new tool that expands the range of genetic resources already available in adapted germplasm.

  19. Identification of leaf rust resistant gene Lr10 in Pakistani wheat ...

    African Journals Online (AJOL)

    Jane

    2011-08-10

    Aug 10, 2011 ... been reported in many wheat producing countries in most years and periodic epidemics during the last century resulted in famine situation in many parts of the world. Allan et al. (1963) and Ali et al. (2007) have also reported the existence of association between rust infection and grain yield losses. To date ...

  20. Gene discovery in EST sequences from the wheat leaf rust fungus Puccinia triticina sexual spores, asexual spores and haustoria, compared to other rust and corn smut fungi

    Directory of Open Access Journals (Sweden)

    Wynhoven Brian

    2011-03-01

    Full Text Available Abstract Background Rust fungi are biotrophic basidiomycete plant pathogens that cause major diseases on plants and trees world-wide, affecting agriculture and forestry. Their biotrophic nature precludes many established molecular genetic manipulations and lines of research. The generation of genomic resources for these microbes is leading to novel insights into biology such as interactions with the hosts and guiding directions for breakthrough research in plant pathology. Results To support gene discovery and gene model verification in the genome of the wheat leaf rust fungus, Puccinia triticina (Pt, we have generated Expressed Sequence Tags (ESTs by sampling several life cycle stages. We focused on several spore stages and isolated haustorial structures from infected wheat, generating 17,684 ESTs. We produced sequences from both the sexual (pycniospores, aeciospores and teliospores and asexual (germinated urediniospores stages of the life cycle. From pycniospores and aeciospores, produced by infecting the alternate host, meadow rue (Thalictrum speciosissimum, 4,869 and 1,292 reads were generated, respectively. We generated 3,703 ESTs from teliospores produced on the senescent primary wheat host. Finally, we generated 6,817 reads from haustoria isolated from infected wheat as well as 1,003 sequences from germinated urediniospores. Along with 25,558 previously generated ESTs, we compiled a database of 13,328 non-redundant sequences (4,506 singlets and 8,822 contigs. Fungal genes were predicted using the EST version of the self-training GeneMarkS algorithm. To refine the EST database, we compared EST sequences by BLASTN to a set of 454 pyrosequencing-generated contigs and Sanger BAC-end sequences derived both from the Pt genome, and to ESTs and genome reads from wheat. A collection of 6,308 fungal genes was identified and compared to sequences of the cereal rusts, Puccinia graminis f. sp. tritici (Pgt and stripe rust, P. striiformis f. sp

  1. Uncovering leaf rust responsive miRNAs in wheat (Triticum aestivum L.) using high-throughput sequencing and prediction of their targets through degradome analysis.

    Science.gov (United States)

    Kumar, Dhananjay; Dutta, Summi; Singh, Dharmendra; Prabhu, Kumble Vinod; Kumar, Manish; Mukhopadhyay, Kunal

    2017-01-01

    Deep sequencing identified 497 conserved and 559 novel miRNAs in wheat, while degradome analysis revealed 701 targets genes. QRT-PCR demonstrated differential expression of miRNAs during stages of leaf rust progression. Bread wheat (Triticum aestivum L.) is an important cereal food crop feeding 30 % of the world population. Major threat to wheat production is the rust epidemics. This study was targeted towards identification and functional characterizations of micro(mi)RNAs and their target genes in wheat in response to leaf rust ingression. High-throughput sequencing was used for transcriptome-wide identification of miRNAs and their expression profiling in retort to leaf rust using mock and pathogen-inoculated resistant and susceptible near-isogenic wheat plants. A total of 1056 mature miRNAs were identified, of which 497 miRNAs were conserved and 559 miRNAs were novel. The pathogen-inoculated resistant plants manifested more miRNAs compared with the pathogen infected susceptible plants. The miRNA counts increased in susceptible isoline due to leaf rust, conversely, the counts decreased in the resistant isoline in response to pathogenesis illustrating precise spatial tuning of miRNAs during compatible and incompatible interaction. Stem-loop quantitative real-time PCR was used to profile 10 highly differentially expressed miRNAs obtained from high-throughput sequencing data. The spatio-temporal profiling validated the differential expression of miRNAs between the isolines as well as in retort to pathogen infection. Degradome analysis provided 701 predicted target genes associated with defense response, signal transduction, development, metabolism, and transcriptional regulation. The obtained results indicate that wheat isolines employ diverse arrays of miRNAs that modulate their target genes during compatible and incompatible interaction. Our findings contribute to increase knowledge on roles of microRNA in wheat-leaf rust interactions and could help in rust

  2. Discovery of Novel Leaf Rust Responsive microRNAs in Wheat and Prediction of Their Target Genes.

    Science.gov (United States)

    Kumar, Dhananjay; Singh, Dharmendra; Kanodia, Pulkit; Prabhu, Kumble Vinod; Kumar, Manish; Mukhopadhyay, Kunal

    2014-01-01

    MicroRNAs are endogenous small noncoding RNAs which play critical roles in gene regulation. Few wheat (Triticum aestivum L.) miRNA sequences are available in miRBase repertoire and knowledge of their biological functions related to biotic stress is limited. We identified 52 miRNAs, belonging to 19 families, from next-generation transcriptome sequence data based on homology search. One wheat specific novel miRNA was identified but could not be ascribed or assigned to any known miRNA family. Differentially expressed 22 miRNAs were found between susceptible and resistant wheat near-isogenic lines inoculated with leaf rust pathogen Puccinia triticina and compared with mock inoculated controls. Most miRNAs were more upregulated in susceptible NIL compared to resistant NIL. We identified 1306 potential target genes for these 52 miRNAs with vital roles in response to stimuli, signaling, and diverse metabolic and cellular processes. Gene ontology analysis showed 66, 20, and 35 target genes to be categorized into biological process, molecular function, and cellular component, respectively. A miRNA-mediated regulatory network revealed relationships among the components of the targetome. The present study provides insight into potential miRNAs with probable roles in leaf rust pathogenesis and their target genes in wheat which establish a foundation for future studies.

  3. Discovery of Novel Leaf Rust Responsive microRNAs in Wheat and Prediction of Their Target Genes

    Directory of Open Access Journals (Sweden)

    Dhananjay Kumar

    2014-01-01

    Full Text Available MicroRNAs are endogenous small noncoding RNAs which play critical roles in gene regulation. Few wheat (Triticum aestivum L. miRNA sequences are available in miRBase repertoire and knowledge of their biological functions related to biotic stress is limited. We identified 52 miRNAs, belonging to 19 families, from next-generation transcriptome sequence data based on homology search. One wheat specific novel miRNA was identified but could not be ascribed or assigned to any known miRNA family. Differentially expressed 22 miRNAs were found between susceptible and resistant wheat near-isogenic lines inoculated with leaf rust pathogen Puccinia triticina and compared with mock inoculated controls. Most miRNAs were more upregulated in susceptible NIL compared to resistant NIL. We identified 1306 potential target genes for these 52 miRNAs with vital roles in response to stimuli, signaling, and diverse metabolic and cellular processes. Gene ontology analysis showed 66, 20, and 35 target genes to be categorized into biological process, molecular function, and cellular component, respectively. A miRNA-mediated regulatory network revealed relationships among the components of the targetome. The present study provides insight into potential miRNAs with probable roles in leaf rust pathogenesis and their target genes in wheat which establish a foundation for future studies.

  4. Pre symptomatic detection of wheat leaf rust in the susceptible cv Skalmeje and the resistant cv Esket by means of UV laser-induced fluorescence.

    Science.gov (United States)

    Bürling, K; Hunsche, M; Noga, G

    2010-01-01

    In modern agriculture there is a great demand for a rapid and objective screening method for stress resistance, because so far, the resistance of new cultivars is tested in time- and money consuming field experiments. Based on fluorescence ratios, and lifetime of fluorophores measured by fluorescence spectroscopy, we have postulated that an early discrimination of susceptible and resistant wheat cultivars to the leaf rust pathogen Puccinia triticina can be accomplished. As representative for leaf rust resistant and leaf rust susceptible wheat genotypes the cultivars Esket and Skalmeje, respectively, were chosen. Plants were grown under controlled environment conditions and inoculated with the leaf rust pathogen at the second-leaf-stage by single-droplet application. Fluorescence measurements were carried out from two to four days after inoculation (dai) by using a compact fibre-optic fluorescence spectrometer with nanosecond time-resolution. Experimental results indicated that UV laser-induced spectral characteristics as well as determination of fluorescence lifetime are suited to detect leaf rust two dai. For this purpose several ratios and wavelength can be considered. In general, the tested cultivars showed distinct responses to the pathogen development. In this context the ratio F451/F687 measured three dai and mean lifetimes at 500 nm and 530 nm are suited to differentiate the resistant Esket from the susceptible Skalmeje genotypes.

  5. Marker-assisted pyramiding of Thinopyrumderived leaf rust ...

    Indian Academy of Sciences (India)

    2017-03-20

    Mar 20, 2017 ... Key words: Wheat, leaf rust, molecular marker, gene pyramiding,marker assisted selection. Abstract. The study was undertaken to pyramid two effective leaf rust resistance genes (Lr19 and Lr24) derived from Thinopyrum(syn.Agropyron), in the susceptible but agronomically superior wheat cultivar HD2733 ...

  6. Dose and application rate of fungicide to control leaf rust (Puccinia triticina and yellow spot (Pyrenophora tritici repentis of wheat

    Directory of Open Access Journals (Sweden)

    Gustavo Migliorini de Oliveira

    2015-02-01

    Full Text Available The aim of this paper was to study the role of dose and rate of application, and the effect of concentration of fungicide in the spray solution resulted from the interaction of these factors, in the control of leaf rust and yellow spot of wheat. It was conducted two experiments, the first used the CD 104 cultivar (susceptible to lead rust and yellow spot. The experimental design was an factorial 3 x 3 + untreated control, that involve the factors dose (0,25, 0,30 and 0,35 L.ha-1 and application rate (143, 286 and 429 L.ha-1. The second experiment used the BRS 208 cultivar (resistant to leaf rust and moderately resistant to yellow spot. The experimental design was an factorial 2 x 2 + untreated control, consisting the factors dose (0,2 and 0,3 L.ha-1 and application rate (143 and 286 L.ha-1. The applications were made with a coastal sprayer by CO2, pressure of 250 kPa, XR 110-02 nozzle, which generated an application rate of 143 L.ha-1. The respective rates of each treatment were changed by the number of sprayers per area. It was also used a spore trap denominated Siga, associated with meteorological data and weather forecast, which detected spores of rust and yellow spot before the symptoms in the plants, helping in the identification of disease and in the timing of application. There wasn´t any interaction between dose and rate of application for any of the experiments, therefore, there wasn´t effect of concentration of fungicide in control. The dose and rate of application just influenced in the control of the yellow spot. Higher doses and rates were more effective. However, no difference was observed for yield and hectolitre weight among treatments, except untreated control

  7. Molecular and genetic study of wheat rusts | Le Maitre | African ...

    African Journals Online (AJOL)

    Puccinia triticina, Puccinia graminis and Puccinia striiformis cause leaf, stem and yellow rust, respectively. Wheat rusts can cause losses as high as 70%. The rusts ability to evolve fungicide resistance has resulted in the use of resistant cultivars as the primary method of control. Breeding resistant cultivars is a long process ...

  8. Wheat Rust Toolbox Related to New Initiatives on Yellow Rust

    DEFF Research Database (Denmark)

    Hansen, Jens Grønbech; Lassen, Poul

    A wheat rust toolbox was developed in the frame of the Borlaug Global Rust Initiative (BGRI) to support the early warning and monitoring of stem rust on a global scale. The toolbox consists of a number of databases and web applications for data management, quality control, dissemination and display......-report/en/). The Wheat rust toolbox is one of several International research platforms hosted by Aarhus University, and it uses the same ICT framework and databases as EuroWheat (www.eurowheat.org) and EuroBlight (www.EuroBlight.net). The Wheat Rust Toolbox will also serve the Global Rust Reference Centre (GRRC) as well...... as several other Institutions and information platforms in the Durable Rust Resistance in Wheat project under the BGRI. From the outset the databases and information tools were developed to handle all three rust types. The EuroWheat platform already contains data on yellow rust pathotypes from Europe (1993...

  9. Pathological and molecular characterizations of slow leaf rusting in ...

    African Journals Online (AJOL)

    Sundeep

    2012-10-18

    Oct 18, 2012 ... Leaf rust caused by Puccinia triticina, is a globally important fungal disease of wheat (Triticum aestivum L. em. Thell), resulting in significant yield losses, sometimes up to 40% worldwide. In this study we investigated slow rusting resistance at pathological and molecular level. Fifteen (15) wheat genotypes ...

  10. Genetic analysis of adult-plant resistance to leaf rust in a double haploid wheat (Triticum aestivum L. em Thell population

    Directory of Open Access Journals (Sweden)

    Sandra Patussi Brammer

    2004-01-01

    Full Text Available A genetic analysis of adult plant resistance to leaf rust (Puccinia triticina was performed in in vitro obtained double haploid progenies from a cross between the Brazilian wheat cultivar Trigo BR 35, which, under the high inoculum pressure of the southern region, has been resistant to leaf rust for more than 12 years, and the susceptible cultivar IAC 13-Lorena. Haplodiploidization via in vitro gimnogenesis was done by somatic elimination of the pollen donor genome after maize pollination of the F1 plants. The advantages and usefulness of double haploids (DH for genetic analysis of complex inherited traits like durable adult-plant resistance to wheat leaf rust were evident: it was possible to analyze inheritance patterns in this cross by using only the 35 DH homozygous segregant lines obtained by in vitro embryo culture of F1 flowers pollinated by maize, this number being equivalent to 1,225 conventional F2 lines because of lack of heterozygosity. After being infected with MCG and LPG races, the results indicated that Trigo BR 35 has two resistance genes. One of the genes expressed resistance only after the intermediate stage of plant development (5-6 leaves.

  11. Expression of apoplast-targeted plant defensin MtDef4.2 confers resistance to leaf rust pathogen Puccinia triticina but does not affect mycorrhizal symbiosis in transgenic wheat.

    Science.gov (United States)

    Kaur, Jagdeep; Fellers, John; Adholeya, Alok; Velivelli, Siva L S; El-Mounadi, Kaoutar; Nersesian, Natalya; Clemente, Thomas; Shah, Dilip

    2017-02-01

    Rust fungi of the order Pucciniales are destructive pathogens of wheat worldwide. Leaf rust caused by the obligate, biotrophic basidiomycete fungus Puccinia triticina (Pt) is an economically important disease capable of causing up to 50 % yield losses. Historically, resistant wheat cultivars have been used to control leaf rust, but genetic resistance is ephemeral and breaks down with the emergence of new virulent Pt races. There is a need to develop alternative measures for control of leaf rust in wheat. Development of transgenic wheat expressing an antifungal defensin offers a promising approach to complement the endogenous resistance genes within the wheat germplasm for durable resistance to Pt. To that end, two different wheat genotypes, Bobwhite and Xin Chun 9 were transformed with a chimeric gene encoding an apoplast-targeted antifungal plant defensin MtDEF4.2 from Medicago truncatula. Transgenic lines from four independent events were further characterized. Homozygous transgenic wheat lines expressing MtDEF4.2 displayed resistance to Pt race MCPSS relative to the non-transgenic controls in growth chamber bioassays. Histopathological analysis suggested the presence of both pre- and posthaustorial resistance to leaf rust in these transgenic lines. MtDEF4.2 did not, however, affect the root colonization of a beneficial arbuscular mycorrhizal fungus Rhizophagus irregularis. This study demonstrates that the expression of apoplast-targeted plant defensin MtDEF4.2 can provide substantial resistance to an economically important leaf rust disease in transgenic wheat without negatively impacting its symbiotic relationship with the beneficial mycorrhizal fungus.

  12. QTL Mapping of Adult-Plant Resistance to Leaf Rust in the Wheat Cross Zhou 8425B/Chinese Spring Using High-Density SNP Markers

    Directory of Open Access Journals (Sweden)

    Peipei Zhang

    2017-05-01

    Full Text Available Wheat leaf rust is an important disease worldwide. Growing resistant cultivars is an effective means to control the disease. In the present study, 244 recombinant inbred lines from Zhou 8425B/Chinese Spring cross were phenotyped for leaf rust severities during the 2011–2012, 2012–2013, 2013–2014, and 2014–2015 cropping seasons at Baoding, Hebei province, and 2012–2013 and 2013–2014 cropping seasons in Zhoukou, Henan province. The population was genotyped using the high-density Illumina iSelect 90K SNP assay and SSR markers. Inclusive composite interval mapping identified eight QTL, designated as QLr.hebau-2AL, QLr.hebau-2BS, QLr.hebau-3A, QLr.hebau-3BS, QLr.hebau-4AL, QLr.hebau-4B, QLr.hebau-5BL, and QLr.hebau-7DS, respectively. QLr.hebau-2BS, QLr.hebau-3A, QLr.hebau-3BS, and QLr.hebau-5BL were derived from Zhou 8425B, whereas the other four were from Chinese Spring. Three stable QTL on chromosomes 2BS, 4B and 7DS explained 7.5–10.6%, 5.5–24.4%, and 11.2–20.9% of the phenotypic variance, respectively. QLr.hebau-2BS in Zhou 8425B might be the same as LrZH22 in Zhoumai 22; QLr.hebau-4B might be the residual resistance of Lr12, and QLr.hebau-7DS is Lr34. QLr.hebau-2AL, QLr.hebau-3BS, QLr.hebau-4AL, and QLr.hebau-5BL are likely to be novel QTL for leaf rust. These QTL and their closely linked SNP and SSR markers can be used for fine mapping, candidate gene discovery, and marker-assisted selection in wheat breeding.

  13. WHEAT LEAF RUST SEVERITY AS AFFECTED BY PLANT DENSITY AND SPECIES PROPORTION IN SIMPLE COMMUNITIES OF WHEAT AND WILD OATS

    Science.gov (United States)

    While it is generally accepted that dense stands of plants exacerbate epidemics caused by foliar pathogens, there is little experimental evidence to support this view. We grew model plant communities consisting of wheat and wild oats at different densities and proportions and exp...

  14. Introgression of a leaf rust resistance gene from Aegilops caudata to ...

    Indian Academy of Sciences (India)

    Keywords. alien introgression; molecular mapping; leaf rust; Puccinia triticina; Triticum aestivum; Aegilops caudata. Abstract. Rusts are the most important biotic constraints limiting wheat productivity worldwide. Deployment of cultivars with broad spectrum rust resistance is the only environmentally viable option to combat ...

  15. Characterization of a leaf rust-resistant wheat-Thinopyrum ponticum partial amphiploid BE-1, using sequential multicolor GISH and FISH.

    Science.gov (United States)

    Sepsi, A; Molnár, I; Szalay, D; Molnár-Láng, M

    2008-04-01

    In situ hybridization (multicolor GISH and FISH) was used to characterize the genomic composition of the wheat-Thinopyrum ponticum partial amphiploid BE-1. The amphiploid is a high-protein line having resistance to leaf rust (Puccinia recondita f. sp. tritici) and powdery mildew (Blumeria graminis f. sp. tritici) and has in total 56 chromosomes per cell. Multicolor GISH using J, A and D genomic probes showed 16 chromosomes originating from Thinopyrum ponticum and 14 A genome, 14 B genome and 12 D genome chromosomes. Six of the Th. ponticum chromosomes carried segments different from the J genome in their centromeric regions. It was demonstrated that these alien chromosome segments did not originate from the A, B or D genomes of wheat, so the translocation chromosomes were considered to be J(s) type chromosomes carrying segments similar to the S genome near the centromeres. Rearrangements between the A and D genomes of wheat were detected. FISH using Afa family, pSc119.2 and pTa71 probes allowed the identification of all the wheat chromosomes present and the determination of the chromosomes involved in the translocations. The 4A and 7A chromosomes were identified as being involved in intergenomic translocations. The replaced wheat chromosome was identified as 7D. The localization of these repetitive DNA clones on the Th. ponticum chromosomes of the amphiploid was described in the present study. On the basis of their multicolor FISH patterns, the alien chromosomes could be arranged in eight pairs and could also be differentiated unequivocally from each other.

  16. Conserved loci of leaf and stem rust fungi of wheat share synteny interrupted by lineage-specific influx of repeat elements

    Directory of Open Access Journals (Sweden)

    Fellers John P

    2013-01-01

    Full Text Available Abstract Background Wheat leaf rust (Puccinia triticina Eriks; Pt and stem rust fungi (P. graminis f.sp. tritici; Pgt are significant economic pathogens having similar host ranges and life cycles, but different alternate hosts. The Pt genome, currently estimated at 135 Mb, is significantly larger than Pgt, at 88 Mb, but the reason for the expansion is unknown. Three genomic loci of Pt conserved proteins were characterized to gain insight into gene content, genome complexity and expansion. Results A bacterial artificial chromosome (BAC library was made from P. triticina race 1, BBBD and probed with Pt homologs of genes encoding two predicted Pgt secreted effectors and a DNA marker mapping to a region of avirulence. Three BACs, 103 Kb, 112 Kb, and 166 Kb, were sequenced, assembled, and open reading frames were identified. Orthologous genes were identified in Pgt and local conservation of gene order (microsynteny was observed. Pairwise protein identities ranged from 26 to 99%. One Pt BAC, containing a RAD18 ortholog, shares syntenic regions with two Pgt scaffolds, which could represent both haplotypes of Pgt. Gene sequence is diverged between the species as well as within the two haplotypes. In all three BAC clones, gene order is locally conserved, however, gene shuffling has occurred relative to Pgt. These regions are further diverged by differing insertion loci of LTR-retrotransposon, Gypsy, Copia, Mutator, and Harbinger mobile elements. Uncharacterized Pt open reading frames were also found; these proteins are high in lysine and similar to multiple proteins in Pgt. Conclusions The three Pt loci are conserved in gene order, with a range of gene sequence divergence. Conservation of predicted haustoria expressed secreted protein genes between Pt and Pgt is extended to the more distant poplar rust, Melampsora larici-populina. The loci also reveal that genome expansion in Pt is in part due to higher occurrence of repeat-elements in this species.

  17. Development of RAPD based markers for wheat rust resistance ...

    African Journals Online (AJOL)

    Rust diseases are the major cause of low yield of wheat in Pakistan. Wheat breeders all over the world as well as in Pakistan are deriving rust resistance genes from alien species like Triticum ventricosum and introducing them in common wheat (Triticum aestivum). One such example is the introgression of rust resistance ...

  18. Short communication: Emergence of a new race of leaf rust with combined virulence to Lr14a and Lr72 genes on durum wheat

    Energy Technology Data Exchange (ETDEWEB)

    Soleiman, N.H; Solis, I.; Soliman, M.H.; Sillero, J.C.; Villegas, D.; Alvaro, F.; Royo, C.; Serra, J.; Ammar, K.; Martínez-Moreno, F.

    2016-11-01

    Leaf rust is a foliar disease caused by the fungus Puccinia triticina that may severely reduce durum wheat yield. Resistance to this pathogen is common in modern durum germplasm but is frequently based on Lr72 and Lr14a. After accounts of races with virulence to Lr14a gene in France in 2000, the present study reports the detection in 2013 for the first time of a new race with virulence to Lr14a and Lr72. The aim of this work was to characterize the virulence pattern of four Spanish isolates with virulence to Lr14a, and to discuss the consequences of this presence. Rusted leaves from cultivars ‘Don Jaime’ (Lr14a) and ‘Gallareta’ (Lr72) were collected in 2013 in the field at two Spanish sites, one in the south (near Cadiz) and another in the north (near Girona). Spores from single pustule for each cultivar and site were multiplied on susceptible cultivar ‘Don Rafael’. Then, the four isolates were inoculated on a set of 19 isogenic lines Thatcher to characterize their virulence spectrum. All isolates presented the same virulence pattern. They were virulent on both Lr14a and Lr72 and the race was named DBB/BS. This race was very similar to those reported in 2009-11, but with added virulence to Lr14a. The resistance based on Lr14a has therefore been overcome in Spain, by a new race that has likely emerged via stepwise mutation from the local predominating races. This information is important to guide breeders in their breeding programmes and gene deployment strategies. (Author)

  19. Short communication: Emergence of a new race of leaf rust with combined virulence to Lr14a and Lr72 genes on durum wheat

    Directory of Open Access Journals (Sweden)

    Nour H. Soleiman

    2016-08-01

    Full Text Available Leaf rust is a foliar disease caused by the fungus Puccinia triticina that may severely reduce durum wheat yield. Resistance to this pathogen is common in modern durum germplasm but is frequently based on Lr72 and Lr14a. After accounts of races with virulence to Lr14a gene in France in 2000, the present study reports the detection in 2013 for the first time of a new race with virulence to Lr14a and Lr72. The aim of this work was to characterize the virulence pattern of four Spanish isolates with virulence to Lr14a, and to discuss the consequences of this presence. Rusted leaves from cultivars ‘Don Jaime’ (Lr14a and ‘Gallareta’ (Lr72 were collected in 2013 in the field at two Spanish sites, one in the south (near Cadiz and another in the north (near Girona. Spores from single pustule for each cultivar and site were multiplied on susceptible cultivar ‘Don Rafael’. Then, the four isolates were inoculated on a set of 19 isogenic lines Thatcher to characterize their virulence spectrum. All isolates presented the same virulence pattern. They were virulent on both Lr14a and Lr72 and the race was named DBB/BS. This race was very similar to those reported in 2009-11, but with added virulence to Lr14a. The resistance based on Lr14a has therefore been overcome in Spain, by a new race that has likely emerged via stepwise mutation from the local predominating races. This information is important to guide breeders in their breeding programmes and gene deployment strategies.

  20. RESEARCH ARTICLE Genetics and mapping of a new leaf rust ...

    Indian Academy of Sciences (India)

    3BL with SSR markers Xgwm114 and Xgwm547 flanking the gene at a distance of 28.3 cM and 6 cM, respectively. Based on nature of resistance and the chromosomal location, it is inferred that Selection G12 carries a new gene for leaf rust resistance, tentatively named as. LrSelG12. Key words:Wheat; alienintrogression ...

  1. Discovery of Novel Leaf Rust Responsive microRNAs in Wheat and Prediction of Their Target Genes

    OpenAIRE

    Dhananjay Kumar; Dharmendra Singh; Pulkit Kanodia; Kumble Vinod Prabhu; Manish Kumar; Kunal Mukhopadhyay

    2014-01-01

    MicroRNAs are endogenous small noncoding RNAs which play critical roles in gene regulation. Few wheat (Triticum aestivum L.) miRNA sequences are available in miRBase repertoire and knowledge of their biological functions related to biotic stress is limited. We identified 52 miRNAs, belonging to 19 families, from next-generation transcriptome sequence data based on homology search. One wheat specific novel miRNA was identified but could not be ascribed or assigned to any known miRNA family. Di...

  2. Development of wheat germplasm for stem rust resistance in eastern ...

    African Journals Online (AJOL)

    Wheat (Triticum aestivum) rust outbreak is the primary production constraint in Eastern Africa. Ethiopia, Kenya and Uganda are hot spots for the epidemic of rusts, due to higher rates of evolution of new pathogen races, especially of the virulent stem rust (Puccinia graminis) race, Ug99. The objective of this study was to ...

  3. Stem rust seedling resistance genes in Ethiopian wheat cultivars ...

    African Journals Online (AJOL)

    Stem rust caused by Puccinia graminis f. sp. tritici is one of the major biotic limiting factors for wheat production in Ethiopia. Host plant resistance is the best option to manage stem rust from its economic and environmental points of view. Wheat cultivars are released for production without carrying race specific tests against ...

  4. stem rust seedling resistance genes in ethiopian wheat cultivars

    African Journals Online (AJOL)

    Prof. Adipala Ekwamu

    Stem rust caused by Puccinia graminis f. sp. tritici is one of the major biotic limiting factors for wheat production in Ethiopia. Host plant resistance is the best option to manage stem rust from its economic and environmental points of view. Wheat cultivars are released for production without carrying race specific tests against ...

  5. Resistência à ferrugem da folha e potencial produtivo em genótipos de trigo Leaf rust resistance and grain yield potential in wheat genotypes

    Directory of Open Access Journals (Sweden)

    João Carlos Felicio

    2008-12-01

    o Paulo, Brazil, during 2003-2005 crop seasons. The evaluation of the genotypes to the causal agent of leaf rust was made at the seedling stage in greenhouse, where the genotypes were individually inoculated with spores of 12 races of Puccinia triticina, which represented the spectrum of pathogen virulence occurring in Brazil and under natural infection out in the field. Grain yield of each genotype was evaluated in the different regions and in a group of experiments, as well as the stability and adaptability. The genotypes 8 (BH1146// AA"S"/WIN"S"/3/BUC/FKL//MYNA/VUL, 12 and 14 (BH1146//AA"S"/WIN"S"/3/VEE //DOVE/BUC showed resistance the physiologic races of Puccinia triticina in greenhouse in the seedling stage. The genotypes 4, 5, 8, 12, 13, 16 e 20 and the cultivar IAC 1004 (T. durum presented leaf rust resistance, under natural disease infection conditions. The highest grain yields were obtained by the genotypes 8 (BH1146// AA"S"/WIN"S"/3/BUC/FKL//MYNA/VUL, 7 (BH1146//AA"S"/WIN"S"/3/HANN*2/ PRL and 18 (CMH75.A.66/SERI/ 3/BH1146// AA"S"/WIN"S". Genotype 16 (KAUZ/3/ BH1146//AA"S"/WIN"S" presented the lowest yield.

  6. Glyphosate inhibits rust diseases in glyphosate-resistant wheat and soybean

    OpenAIRE

    Feng, Paul C. C.; Baley, G. James; Clinton, William P.; Bunkers, Greg J.; Alibhai, Murtaza F.; Paulitz, Timothy C.; Kidwell, Kimberlee K.

    2005-01-01

    Glyphosate is a broad-spectrum herbicide used for the control of weeds in glyphosate-resistant crops. Glyphosate inhibits 5-enolpyruvyl shikimate 3-phosphate synthase, a key enzyme in the synthesis of aromatic amino acids in plants, fungi, and bacteria. Studies with glyphosate-resistant wheat have shown that glyphosate provided both preventive and curative activities against Puccinia striiformis f. sp. tritici and Puccinia triticina, which cause stripe and leaf rusts, respectively, in wheat. ...

  7. Characterization of stem rust resistance gene Sr2 in Indian wheat ...

    African Journals Online (AJOL)

    Stem rust or black rust is one of the most important diseases of wheat worldwide. In India, central, peninsular and southern hill zones are particularly prone to stem rust where favourable environmental conditions exist. The recent emergence of wheat stem rust race Ug99 (TTKSK) and related strains threatens global wheat ...

  8. Genetics and mapping of a new leaf rust resistance gene in Triticum ...

    Indian Academy of Sciences (India)

    AMIT KUMAR SINGH

    Abstract. A Triticum timopheevii-derived bread wheat line, Selection G12, was screened with 40 pathotypes of leaf rust pathogen,. Puccinia triticina at seedling stage and with two most commonly prevalent pathotypes 77-5 and 104-2 at adult plant stage. Selection G12 showed resistance at both seedling and adult plant ...

  9. McGISH identification and phenotypic description of leaf rust and yellow rust resistant partial amphiploids originating from a wheat × Thinopyrum synthetic hybrid cross.

    Science.gov (United States)

    Kruppa, Klaudia; Türkösi, Edina; Mayer, Marianna; Tóth, Viola; Vida, Gyula; Szakács, Éva; Molnár-Láng, Márta

    2016-11-01

    A Thinopyrum intermedium × Thinopyrum ponticum synthetic hybrid wheatgrass is an excellent source of leaf and stem rust resistance produced by N.V.Tsitsin. Wheat line Mv9kr1 was crossed with this hybrid (Agropyron glael) in Hungary in order to transfer its advantageous agronomic traits into wheat. As the wheat parent was susceptible to leaf rust, the transfer of resistance was easily recognizable in the progenies. Three different partial amphiploid lines with leaf rust resistance were selected from the wheat/Thinopyrum hybrid derivatives by multicolour genomic in situ hybridization. Chromosome counting on the partial amphiploids revealed 58 chromosomes (18 wheatgrass) in line 194, 56 (14 wheatgrass) in line 195 and 54 (12 wheatgrass) in line 196. The wheat chromosomes present in these lines were identified and the wheatgrass chromosomes were characterized by fluorescence in situ hybridization using the repetitive DNA probes Afa-family, pSc119.2 and pTa71. The 3D wheat chromosome was missing from the lines. Molecular marker analysis showed the presence of the Lr24 leaf rust resistance gene in lines 195 and 196. The morphological traits were evaluated in the field during two consecutive seasons in two different locations.

  10. Sources of stem rust resistance in Ethiopian tetraploid wheat ...

    African Journals Online (AJOL)

    Stem or black rust of wheat caused by the fungus Puccinia graminis f. sp. tritici Ericks and Henn (Pgt) is an important disease on wheat worldwide. Pgt is an obligate biotroph, heteroceous in its life cycle and heterothallic in mating type. Seedlings of 41 emmer (Triticum dicoccum), 56 durum (T. durum) wheat accessions were ...

  11. Wheat rusts in the United States in 2016

    Science.gov (United States)

    In 2016, wheat stripe rust caused by Puccinia striiformis f. sp. graminis was widespread throughout the United States. Cool temperatures and abundant rainfall in the southern Great Plains allowed stripe rust to become widely established and spread throughout the Great Plains and eastern United State...

  12. Genomic Prediction of Genetic Values for Resistance to Wheat Rusts

    Directory of Open Access Journals (Sweden)

    Leonardo Ornella

    2012-11-01

    Full Text Available Durable resistance to the rust diseases of wheat ( L. can be achieved by developing lines that have race-nonspecific adult plant resistance conferred by multiple minor slow-rusting genes. Genomic selection (GS is a promising tool for accumulating favorable alleles of slow-rusting genes. In this study, five CIMMYT wheat populations evaluated for resistance were used to predict resistance to stem rust ( and yellow rust ( using Bayesian least absolute shrinkage and selection operator (LASSO (BL, ridge regression (RR, and support vector regression with linear or radial basis function kernel models. All parents and populations were genotyped using 1400 Diversity Arrays Technology markers and different prediction problems were assessed. Results show that prediction ability for yellow rust was lower than for stem rust, probably due to differences in the conditions of infection of both diseases. For within population and environment, the correlation between predicted and observed values (Pearson’s correlation [ρ] was greater than 0.50 in 90% of the evaluations whereas for yellow rust, ρ ranged from 0.0637 to 0.6253. The BL and RR models have similar prediction ability, with a slight superiority of the BL confirming reports about the additive nature of rust resistance. When making predictions between environments and/or between populations, including information from another environment or environments or another population or populations improved prediction.

  13. Postulation of rust resistance genes in Nordic spring wheat genotypes and identification of widely effective sources of resistance against the Australian rust flora.

    Science.gov (United States)

    Randhawa, Mandeep; Bansal, Urmil; Lillemo, Morten; Miah, Hanif; Bariana, Harbans

    2016-11-01

    Wild relatives, landraces and cultivars from different geographical regions have been demonstrated as the sources of genetic variation for resistance to rust diseases. This study involved assessment of diversity for resistance to three rust diseases among a set of Nordic spring wheat cultivars. These cultivars were tested at the seedling stage against several pathotypes of three rust pathogens in the greenhouse. All stage stem rust resistance genes Sr7b, Sr8a, Sr12, Sr15, Sr17, Sr23 and Sr30, and leaf rust resistance genes Lr1, Lr3a, Lr13, Lr14a, Lr16 and Lr20 were postulated either singly or in different combinations among these cultivars. A high proportion of cultivars were identified to carry linked rust resistance genes Sr15 and Lr20. Although 51 cultivars showed variation against Puccinia striiformis f. sp. tritici (Pst) pathotypes used in this study, results were not clearly contrasting to enable postulation of stripe rust resistance genes in these genotypes. Stripe rust resistance gene Yr27 was postulated in four cultivars and Yr1 was present in cultivar Zebra. Cultivar Tjalve produced low stripe rust response against all Pst pathotypes indicating the presence either of a widely effective resistance gene or combination of genes with compensating pathogenic specificities. Several cultivars carried moderate to high level of APR to leaf rust and stripe rust. Seedling stem rust susceptible cultivar Aston exhibited moderately resistant to moderately susceptible response, whereas other cultivars belonging to this class were rated moderately susceptible or higher. Molecular markers linked with APR genes Yr48, Lr34/Yr18/Sr57, Lr68 and Sr2 detected the presence of these genes in some genotypes.

  14. Characterization of stem rust resistance gene Sr2 in Indian wheat ...

    African Journals Online (AJOL)

    SONY

    2013-05-01

    May 1, 2013 ... Stem rust or black rust is one of the most important diseases of wheat worldwide. In India, central, peninsular and southern hill zones are particularly prone to stem rust where favourable environmental conditions exist. The recent emergence of wheat stem rust race Ug99 (TTKSK) and related strains.

  15. Reação de cultivares de trigo à ferrugem da folha e mancha amarela e responsividade a fungicidas Reaction of wheat cultivars to leaf rust and yellow spot and responsiveness to fungicides

    Directory of Open Access Journals (Sweden)

    Nédio Rodrigo Tormen

    2013-02-01

    Full Text Available Com o objetivo de avaliar a reação de cultivares de trigo à ferrugem da folha, causada por Puccinia triticina, e mancha amarela, causada por Drechslera tritici-repentis, e sua responsividade ao controle químico com fungicidas, foi conduzido experimento de campo durante os invernos de 2009 e 2010, Itaara-RS. As cultivares avaliadas foram 'FCEP 51', 'FCEP 52', 'CD 114', 'FCEP Campo Real', 'FCEP Cristalino', 'FCEP Nova Era', 'OR Marfim', 'OR Abalone', 'OR Safira' e 'OR Pampeano'; na safra 2010, a cultivar 'CD 114' foi substituída pela OR Quartzo. Os tratamentos avaliados foram: P1 - testemunha sem aplicação de fungicida; P2 - fempropimorfe (560g ha-1 de i.a.; P3 - azoxistrobina + ciproconazol (60+24g ha-1 de i.a.; e P4 - piraclostrobina + metconazol (60+97,5g ha-1 de i.a.. Após a segunda aplicação, efetuaram-se avaliações semanais de severidade das doenças, cujos dados foram utilizados para o cálculo da Área Abaixo da Curva de Progresso da Doença (AACPD. Também foram determinados a produtividade e o peso do hectolitro. No que se refere à suscetibilidade às doenças, as cultivares estudadas apresentaram respostas distintas de um ano para o outro. Para ferrugem, o comportamento mostrou-se similar em ambos os anos, enquanto que, para mancha amarela, houve variação. Quanto à resposta ao controle químico, ocorreram variações de acordo com o patógeno e com o grau de suscetibilidade das cultivares. O uso integrado de resistência genética e controle químico mostrou-se mais efetivo para ferrugem da folha.Aiming to evaluate the susceptibility of wheat cultivars to leaf rust and yellow spot and their responsiveness to chemical fungicides, two field trials were carried out, during 2009 and 2010 winter's. The cultivars evaluated were: 'FCEP 51', 'FCEP 52', 'CD114', 'FCEP Campo Real', 'FCEP Cristalino', 'FCEP Nova Era', 'OR Marfim', 'OR Abalone', 'OR Safira' and 'OR Pampeano'. In 2010, the 'CD 114' cultivar was replaced by Quartzo

  16. Wheat Rust Information Resources - Integrated tools and data for improved decision making

    DEFF Research Database (Denmark)

    Hodson, David; Hansen, Jens Grønbech; Lassen, Poul

    Wheat rusts present an ever-changing global threat to the worlds wheat crop. Emergence of virulent new races in one region has implications for other regions, due to wind-borne or human-borne movements. Therefore informed decision making regarding control and mitigation of wheat rusts requires...... an integrated set of datasets on both pathogen and host at the global scale. The Global Cereal Rust Monitoring System (GCRMS), created under the Durable Rust resistance in Wheat (DRRW) project, represents a unique and increasingly comprehensive resource of rust information. A suite of tools are now available...... giving access to an unprecedented set of data for rust surveys, alternate hosts (barberry), rust pathotypes, trap nurseries and resistant cultivars. Standardized protocols for data collection have permitted the development of a comprehensive data management system, named the Wheat Rust Toolbox...

  17. QTL mapping of adult-plant resistance to stripe rust in wheat line P9897

    Science.gov (United States)

    Stripe rust (or yellow rust), caused by Puccinia striiformis f. sp. tritici (Pst), is a devastating fungal disease of common wheat. Wheat line P9897 showed adult-plant resistance (APR) to stripe rust for several years. To map resistance quantitative trait loci (QTL), F2:3 lines from a cross of P9897...

  18. Molecular and genetic study of wheat rusts

    African Journals Online (AJOL)

    Nicholas Le Maitre

    The effect of selection can be reduced by several methods. ... sition of the current and future rust population. In order to ... pathogen population structure, population genetic studies ..... The lack of diversity is probably due to reasons simi-.

  19. Coffee Leaf Rust Epidemics ( Hemileia vastatrix ) in Montane Coffee ...

    African Journals Online (AJOL)

    Thirty coffee trees were selected from each forest (three sites within a forest) coffee population to record incidence (percent rusted leaves), severity (percent leaf area damaged) and sporulated lesion density (number of lesion per leaf, SLD) from selected six branches per tree. An average of 10-12 leaves per branch was ...

  20. Effect of fungicide on the development of wheat stem rust and yield ...

    African Journals Online (AJOL)

    Stem rust caused by Puccinia graminis f.sp tritici Erik. & E. Henn. is a highly destructive disease of wheat (Triticum aestivum L.). The effects of fungicide application on stem rust (Puccinia graminis tritici) epidemics and yield of three bread wheat varieties varying in reaction to the disease were studied in two major wheat ...

  1. Seed treatment for control leaf spot diseases of spring wheat

    Directory of Open Access Journals (Sweden)

    Barbara Krzyzińska

    2012-12-01

    Full Text Available In the years 2001 and 2002 at the Institute of Plant Protection Branch in Sooenicowice research work was performed on seed treatment with fungicides against leaf diseases of spring wheat cv. Ismena caused by pathogenic fungi: Blumeria graminis, Phaeasphaeria nodorum, Puccinia recondita i Pyrenophora tritici-repentis. Two variants of protection were included in the experiment: seed dressing with fungicides or seed dressing and single application of foliar spray at GS 49. At early growth stages of spring wheat a very high biological activity against powdery mildew, septoria leaf spot, brown rust and tan spot was recorded for seed dressing containing triticonazole+prochloraz. In the case of triadimenol+imazalil+fuberidazole only a weak, but long-lasting effect against brown rust and septoria leaf spot was observed. Leaf infection as well as 1000 grain mass and yield, in the experimental combination with using triticonazole+prochloraz were on the same level as in the experimental variant where after seed dressing with triadimenol+imazalil+fuberidazole plots were sprayed with tridemorf+epoxykonazole at GS 49. It was concluded that seed dressing preparation containing triticonazole+prochloraz constituted a good base for protection of spring wheat against foliar diseases.

  2. Detection of wheat stem rust race RRTTF in Ecuador in 2016

    Science.gov (United States)

    Wheat stem rust is a devastating disease that has incited numerous severe epidemics resulting in extreme yield losses over the past century. Stem rust infection in plots of wheat line UC11075, known to carry the Sr38 resistance gene, was severe in February 2016 in a nursery at the Instituto Nacional...

  3. Virulence of wheat yellow rust races and resistance genes of wheat cultivars in Ecuador

    NARCIS (Netherlands)

    Ochoa, J.B.; Danial, D.L.; Paucar, B.

    2007-01-01

    Virulence factors of the yellow rust, Puccinia striiformis, populations in bread wheat were studied in Ecuador between 1973 and 2004. The number of virulence factors has increased markedly from very few in the early seventies to 16 at the end of the 90s. Isolates belonging to race 0E0 seem to be the

  4. In vivo sensitivity reduction of Puccinia triticina races, causal agent of wheat leaf rust, to DMI and QoI fungicides

    Directory of Open Access Journals (Sweden)

    Gisele da Silva Arduim

    2012-12-01

    Full Text Available Experiments were carried out to determine in vivo the IC50 and the IC90 for demethylation-inhibitor fungicides (DMIs, triazoles and quinone outside inhibitors (QoIs, strobilurins to the five most frequent races of Puccinia triticina in 2007 growing season in Southern Brazil. The tests were done in a greenhouse with wheat seedlings. DMI fungicides were tested at the concentrations, in mg/L, 0.0; 0.02; 0.2; 2.0; 20.0; 100.0 and 200.0, and QoIs at the concentrations 0.0; 0.0001; 0.001; 0.01; 0.1; 1 and 10.0 mg of active ingredient/L water. Fungicides were preventively applied at 24 hours before the inoculation of seedlings with the fungal spores. The effect of treatments was assessed based on the number of uredia/cm². The lowest IC50 (inhibitory concentration for DMI fungicides determined for MCG-MN, sensitive race, ranged from 0.33 to 0.91 mg/L, while the highest values for MDP-MR, MDT-MR, MDK-MR, MFH-HT races, varied from 9.63 to 85.64 mg/L (suspected insensitivity. QoI fungicide presented an IC50 varying from 0.0018 to 0.14 mg/L. The sensitivity reduction factor for DMIs varied from 8.8 to 238.8, and for QoIs from 0.3 to 1.5 mg/L. Sensitivity reduction was confirmed for the races MDP-MR, MDT-MR, MDK-MR, MFH-HT to DMIs, as well as their sensitivity to QoI fungicides.

  5. Strategies for Wheat Stripe Rust Pathogenicity Identified by Transcriptome Sequencing.

    Directory of Open Access Journals (Sweden)

    Diana P Garnica

    Full Text Available Stripe rust caused by the fungus Puccinia striiformis f.sp. tritici (Pst is a major constraint to wheat production worldwide. The molecular events that underlie Pst pathogenicity are largely unknown. Like all rusts, Pst creates a specialized cellular structure within host cells called the haustorium to obtain nutrients from wheat, and to secrete pathogenicity factors called effector proteins. We purified Pst haustoria and used next-generation sequencing platforms to assemble the haustorial transcriptome as well as the transcriptome of germinated spores. 12,282 transcripts were assembled from 454-pyrosequencing data and used as reference for digital gene expression analysis to compare the germinated uredinospores and haustoria transcriptomes based on Illumina RNAseq data. More than 400 genes encoding secreted proteins which constitute candidate effectors were identified from the haustorial transcriptome, with two thirds of these up-regulated in this tissue compared to germinated spores. RT-PCR analysis confirmed the expression patterns of 94 effector candidates. The analysis also revealed that spores rely mainly on stored energy reserves for growth and development, while haustoria take up host nutrients for massive energy production for biosynthetic pathways and the ultimate production of spores. Together, these studies substantially increase our knowledge of potential Pst effectors and provide new insights into the pathogenic strategies of this important organism.

  6. Effect of stripe rust on the yield response of wheat to nitrogen

    Directory of Open Access Journals (Sweden)

    Rakhesh Devadas

    2014-08-01

    Full Text Available Nitrogen (N is the most important fertiliser element determining the productivity of wheat. N nutrition is known to affect the level of stripe rust infection, with higher N associated with increased disease severity. Stripe rust, caused by Puccinia striiformis f. sp. tritici, is a major yield-limiting disease of wheat in Australia. This paper describes experiments designed to investigate the agronomic response to the interaction of various levels of N application and stripe rust severity in wheat varieties differing in response. Experimental plots were established in crop seasons 2006 and 2007 on the Liverpool Plains of northern NSW, Australia. Yield, biomass, grain protein content (GPC and harvest index (HI data were recorded. Increased rates of N increased the severity of stripe rust during grain filling. N application also increased yield and GPC in all varieties in both years. Stripe rust reduced the yield of the rust-susceptible wheat varieties, and GPC and proportion of added N recovered in the grain were also reduced in one year but not the other. It was evident from our experiment that stripe rust caused yield loss accompanied by either no change or reduction in GPC, indicating that the total amount of N entering the grain was reduced by stripe rust. The effects of stripe rust on N yield are most likely associated with reduced uptake of N during grain filling.

  7. Sources of stem rust resistance in wheat-alien introgression lines

    Science.gov (United States)

    Stem rust, caused by Puccinia graminis f. sp. tritici, is one of the most devastating diseases of wheat and the novel highly virulent race of TTKSK and its lineage are threatening wheat production worldwide. The objective of the study was to identify new sources of resistance in wheat-alien introgre...

  8. Wheat stem rust in South Africa: Current status and future research ...

    African Journals Online (AJOL)

    . In South Africa, stem rust caused by Puccinia graminis Pers. f. sp. tritici. Eriks. & E. Henn. (Pgt) is an important disease of wheat. Records of stem rust occurrence in South Africa date back to the late 1720's, when it was first discovered in the ...

  9. Discovery of a novel stem rust resistance allele in durum wheat that exhibits differential reactions to Ug99 isolates

    Science.gov (United States)

    Wheat stem rust, caused by Puccinia graminis f. sp. tritici Erikss. & E. Henn, can incur yield losses on susceptible cultivars of durum wheat, Triticum turgidum ssp. durum (Desf.) Husnot. Though several durum cultivars possess the stem rust resistance gene Sr13, additional genes in durum wheat effec...

  10. Molecular cytogenetic identification of a novel dwarf wheat line with ...

    Indian Academy of Sciences (India)

    2012-01-08

    Jan 8, 2012 ... It is known to possess a number of valuable genes for wheat improvement, such as tolerance to abiotic stresses, salinity and drought, and good resistance to leaf rust, yellow rust, stem rust, wheat curl mite, wheat streak mosaic virus (WSMV), barley yellow dwarf virus. (BYDV) resistance and tan spot (Jiang ...

  11. Introgression of a leaf rust resistance gene from Aegilops caudata to ...

    Indian Academy of Sciences (India)

    Abstract. Rusts are the most important biotic constraints limiting wheat productivity worldwide. Deployment of cultivars with broad spectrum rust resistance is the only environmentally viable option to combat these diseases. Identification and introgression of novel sources of resistance is a continuous process to combat the ...

  12. Molecular mapping of a stripe rust resistance gene in wheat line C51

    Indian Academy of Sciences (India)

    Stripe rust, a major disease in areas where cool temperatures prevail, can strongly influence grain yield. To control this disease, breeders have incorporated seedling resistance genes from a variety of sources outside the primary wheat gene pool. The wheat line C51, introduced from the International Center for Agricultural ...

  13. Identification of QTL conferring resistance to stripe rust (Puccinia striiformis f. sp. hordei) and leaf rust (Puccinia hordei) in barley using nested association mapping (NAM).

    Science.gov (United States)

    Vatter, Thomas; Maurer, Andreas; Perovic, Dragan; Kopahnke, Doris; Pillen, Klaus; Ordon, Frank

    2018-01-01

    The biotrophic rust fungi Puccinia hordei and Puccinia striiformis are important barley pathogens with the potential to cause high yield losses through an epidemic spread. The identification of QTL conferring resistance to these pathogens is the basis for targeted breeding approaches aiming to improve stripe rust and leaf rust resistance of modern cultivars. Exploiting the allelic richness of wild barley accessions proved to be a valuable tool to broaden the genetic base of resistance of barley cultivars. In this study, SNP-based nested association mapping (NAM) was performed to map stripe rust and leaf rust resistance QTL in the barley NAM population HEB-25, comprising 1,420 lines derived from BC1S3 generation. By scoring the percentage of infected leaf area, followed by calculation of the area under the disease progress curve and the average ordinate during a two-year field trial, a large variability of resistance across and within HEB-25 families was observed. NAM based on 5,715 informative SNPs resulted in the identification of twelve and eleven robust QTL for resistance against stripe rust and leaf rust, respectively. Out of these, eight QTL for stripe rust and two QTL for leaf rust are considered novel showing no overlap with previously reported resistance QTL. Overall, resistance to both pathogens in HEB-25 is most likely due to the accumulation of numerous small effect loci. In addition, the NAM results indicate that the 25 wild donor QTL alleles present in HEB-25 strongly differ in regard to their individual effect on rust resistance. In future, the NAM concept will allow to select and combine individual wild barley alleles from different HEB parents to increase rust resistance in barley. The HEB-25 results will support to unravel the genetic basis of rust resistance in barley, and to improve resistance against stripe rust and leaf rust of modern barley cultivars.

  14. Aspects of durable resistance in wheat to yellow rust

    NARCIS (Netherlands)

    Danial, D.L.

    1994-01-01

    In Kenya, the number of virulence factors of the yellow rust populations showed a considerable increase and a wide variability. Selecting for complete to near complete resistance to yellow rust and other cereal rust diseases, was followed by a rapid erosion of resistance.

    Partial

  15. Mapping of stripe rust resistance gene in an Aegilops caudata ...

    Indian Academy of Sciences (India)

    PUNEET INDER TOOR

    Abstract. A pair of stripe rust and leaf rust resistance genes was introgressed from Aegilops caudata, a nonprogenitor diploid species with the CC genome, to cultivated wheat. Inheritance and genetic mapping of stripe rust resistance gene in backcross- recombinant inbred line (BC-RIL) population derived from the cross of a ...

  16. Evidence for Increased Aggressiveness in a Recent Widespread Strain of Puccinia striiformis f. sp. tritici Causing Stripe Rust of Wheat

    DEFF Research Database (Denmark)

    Milus, Eugene A; Kristensen, Kristian; Hovmøller, Mogens S

    2009-01-01

    Stripe rust (yellow rust) of wheat, caused by Puccinia striiformis f. sp. tritici, has become more severe in eastern United States, Australia, and elsewhere since 2000. Recent research has shown that this coincided with a global spread of two closely related strains that were similar based...... regimes for latent period, lesion length, lesion width, lesion area, and spore production on adult plants of a susceptible wheat cultivar with no known genes for resistance to stripe rust. "New" isolates (since 2000) were significantly more aggressive than "old" isolates (before 2000) for all variables...... that wheat rust fungi can adapt to warmer temperatures and cause severe disease in previously unfavorable environments...

  17. Resistance Potential of Bread Wheat Genotypes Against Yellow Rust Disease Under Egyptian Climate

    Directory of Open Access Journals (Sweden)

    Amer F. Mahmoud

    2015-12-01

    Full Text Available Yellow rust (stripe rust, caused by Puccinia striiformis f. sp. tritici, is one of the most destructive foliar diseases of wheat in Egypt and worldwide. In order to identify wheat genotypes resistant to yellow rust and develop molecular markers associated with the resistance, fifty F₈ recombinant inbred lines (RILs derived from a cross between resistant and susceptible bread wheat landraces were obtained. Artificial infection of Puccinia striiformis was performed under greenhouse conditions during two growing seasons and relative resistance index (RRI was calculated. Two Egyptian bread wheat cultivars i.e. Giza-168 (resistant and Sakha-69 (susceptible were also evaluated. RRI values of two-year trial showed that 10 RILs responded with RRI value >6 2 <6. However, only 7 RILs showed RRI value <2. Five RILs expressed hypersensitive type of resistance (R against the pathogen and showed the lowest Average Coefficient of Infection (ACI. Bulked segregant analysis (BSA with eight simple sequence repeat (SSR, eight sequence-related amplified polymorphism (SRAP and sixteen random amplified polymorphic DNA (RAPD markers revealed that three SSR, three SRAP and six RAPD markers were found to be associated with the resistance to yellow rust. However, further molecular analyses would be performed to confirm markers associated with the resistance and suitable for marker-assisted selection. Resistant RILs identified in the study could be efficiently used to improve the resistance to yellow rust in wheat.

  18. Effectors from Wheat Rust Fungi Suppress Multiple Plant Defense Responses.

    Science.gov (United States)

    Ramachandran, Sowmya R; Yin, Chuntao; Kud, Joanna; Tanaka, Kiwamu; Mahoney, Aaron K; Xiao, Fangming; Hulbert, Scot H

    2017-01-01

    Fungi that cause cereal rust diseases (genus Puccinia) are important pathogens of wheat globally. Upon infection, the fungus secretes a number of effector proteins. Although a large repository of putative effectors has been predicted using bioinformatic pipelines, the lack of available high-throughput effector screening systems has limited functional studies on these proteins. In this study, we mined the available transcriptomes of Puccinia graminis and P. striiformis to look for potential effectors that suppress host hypersensitive response (HR). Twenty small (acids), secreted proteins, with no predicted functions were selected for the HR suppression assay using Nicotiana benthamiana, in which each of the proteins were transiently expressed and evaluated for their ability to suppress HR caused by four cytotoxic effector-R gene combinations (Cp/Rx, ATR13/RPP13, Rpt2/RPS-2, and GPA/RBP-1) and one mutated R gene-Pto(Y207D). Nine out of twenty proteins, designated Shr1 to Shr9 (suppressors of hypersensitive response), were found to suppress HR in N. benthamiana. These effectors varied in the effector-R gene defenses they suppressed, indicating these pathogens can interfere with a variety of host defense pathways. In addition to HR suppression, effector Shr7 also suppressed PAMP-triggered immune response triggered by flg22. Finally, delivery of Shr7 through Pseudomonas fluorescens EtHAn suppressed nonspecific HR induced by Pseudomonas syringae DC3000 in wheat, confirming its activity in a homologous system. Overall, this study provides the first evidence for the presence of effectors in Puccinia species suppressing multiple plant defense responses.

  19. Yr32 for resistance to stripe (yellow) rust present in the wheat cultivar Carstens V

    DEFF Research Database (Denmark)

    Eriksen, L.; Afshari, F.; Christiansen, M.J.

    2004-01-01

    Stripe or yellow rust of wheat, caused by Puccinia striiformis f. sp. tritici, is an important disease in many wheat-growing regions of the world. A number of major genes providing resistance to stripe rust have been used in breeding, including one gene that is present in the differential tester...... Carstens V. The objective of this study was to locate and map a stripe rust resistance gene transferred from Carstens V to Avocet S and to use molecular tools to locate a number of genes segregating in the cross Savannah/Senat. One of the genes present in Senat was predicted to be a gene that is present...... in Carstens V. For this latter purpose, stripe rust response data from both seedling and field tests on a doubled haploid population consisting of 77 lines were compared to an available molecular map for the same lines using a non-parametric quantitative trait loci (QTL) analysis. Results obtained in Denmark...

  20. Targeted introgression of a wheat stem rust resistance gene by DNA marker-assisted chromosome engineering genetics

    Science.gov (United States)

    In wheat (Triticum aestivum L.), stem rust resistance gene Sr39, derived from Aegilops speltoides Tausch, is highly resistant to multiple stem rust races including TTKSK (Ug99). However, the gene has not been used in wheat breeding because of linkage drag associated with the large 2S chromosome segm...

  1. The effect of nitrogen application on the development of rusts on wheat varieties

    Directory of Open Access Journals (Sweden)

    M. E. Haggag

    2014-11-01

    Full Text Available The effect of four different levels of nitrogen fertilization on the severity of rusts on three local Egyptian wheat varieties have been investigated. Nitrogen fertilizer was at the rates 0, 40, 60, and 80 kg nitrogen per feddan. Data obtained indicated that resistance of the varieties did not change while percent severity of postules on susceptible, moderately susceptible and moderately resistant varieties was increased as the level of nitrogen fertilization increased. Heavy doses of nitrogen promoted the size and frequency of postules and hence the rust growth and predisposed the plants to higher infection with rusts.

  2. Genetics and mapping of a new leaf rust resistance gene in Triticum ...

    Indian Academy of Sciences (India)

    AMIT KUMAR SINGH

    The leaf rust resistance gene was mapped to chromosome 3BL with SSR markers Xgwm114 and Xgwm547 flanking the gene at a distance of 28.3 cM and 6 cM, respectively. Based on the nature of resistance and chromosomal location, it is inferred that. Selection G12 carries a new gene for leaf rust resistance, tentatively ...

  3. TaLHY, a 1R-MYB Transcription Factor, Plays an Important Role in Disease Resistance against Stripe Rust Fungus and Ear Heading in Wheat.

    Directory of Open Access Journals (Sweden)

    Zijin Zhang

    Full Text Available LHY (late elongated hypocotyl is an important gene that regulates and controls biological rhythms in plants. Additionally, LHY is highly expressed in the SSH (suppression subtractive hybridization cDNA library-induced stripe rust pathogen (CYR32 in our previous research. To identify the function of the LHY gene in disease resistance against stripe rust, we used RACE-PCR technology to clone TaLHY in the wheat variety Chuannong19. The cDNA of TaLHY is 3085 bp long with an open reading frame of 1947 bp. TaLHY is speculated to encode a 70.3 kDa protein of 648 amino acids , which has one typical plant MYB-DNA binding domain; additionally, phylogenetic tree shows that TaLHY has the highest homology with LHY of Brachypodium distachyon(BdLHY-like. Quantitative fluorescence PCR indicates that TaLHY has higher expression in the leaf, ear and stem of wheat but lower expression in the root. Infestation of CYR32 can result in up-regulated expression of TaLHY, peaking at 72 h. Using VIGS (virus-induced gene silencing technology to disease-resistant wheat in the fourth leaf stage, plants with silenced TaLHY cannot complete their heading stage. Through the compatible interaction with the stripe rust physiological race CYR32, Chuannong 19 loses its immune capability toward the stripe rust pathogen, indicating that TaLHY may regulate and participate in the heading of wheat, as well as the defense responses against stripe rust infection.

  4. TaLHY, a 1R-MYB Transcription Factor, Plays an Important Role in Disease Resistance against Stripe Rust Fungus and Ear Heading in Wheat.

    Science.gov (United States)

    Zhang, Zijin; Chen, Jieming; Su, Yongying; Liu, Hanmei; Chen, Yanger; Luo, Peigao; Du, Xiaogang; Wang, Dan; Zhang, Huaiyu

    2015-01-01

    LHY (late elongated hypocotyl) is an important gene that regulates and controls biological rhythms in plants. Additionally, LHY is highly expressed in the SSH (suppression subtractive hybridization) cDNA library-induced stripe rust pathogen (CYR32) in our previous research. To identify the function of the LHY gene in disease resistance against stripe rust, we used RACE-PCR technology to clone TaLHY in the wheat variety Chuannong19. The cDNA of TaLHY is 3085 bp long with an open reading frame of 1947 bp. TaLHY is speculated to encode a 70.3 kDa protein of 648 amino acids , which has one typical plant MYB-DNA binding domain; additionally, phylogenetic tree shows that TaLHY has the highest homology with LHY of Brachypodium distachyon(BdLHY-like). Quantitative fluorescence PCR indicates that TaLHY has higher expression in the leaf, ear and stem of wheat but lower expression in the root. Infestation of CYR32 can result in up-regulated expression of TaLHY, peaking at 72 h. Using VIGS (virus-induced gene silencing) technology to disease-resistant wheat in the fourth leaf stage, plants with silenced TaLHY cannot complete their heading stage. Through the compatible interaction with the stripe rust physiological race CYR32, Chuannong 19 loses its immune capability toward the stripe rust pathogen, indicating that TaLHY may regulate and participate in the heading of wheat, as well as the defense responses against stripe rust infection.

  5. Genetics and mapping of stem rust resistance to Ug99 in the wheat cultivar Webster.

    Science.gov (United States)

    Hiebert, Colin W; Fetch, Thomas G; Zegeye, Taye

    2010-06-01

    New races of wheat stem rust, namely TTKSK (Ug99) and its variants, pose a threat to wheat production in the regions where they are found. The accession of the wheat cultivar Webster (RL6201) maintained at the Cereal Research Centre in Winnipeg, Canada, shows resistance to TTKSK and other races of stem rust. The purpose of this study was to study the inheritance of seedling resistance to stem rust in RL6201 and genetically map the resistance genes using microsatellite (SSR) markers. A population was produced by crossing the stem rust susceptible line RL6071 with Webster. The F(2) and F(3) were tested with TPMK, a stem rust race native to North America. The F(3) was also tested with TTKSK. Two independently assorting genes were identified in RL6201. Resistance to TPMK was conferred by Sr30, which was mapped with microsatellites on chromosome 5DL. The second gene, temporarily designated SrWeb, conferred resistance to TTKSK. SrWeb was mapped to chromosome 2BL using SSR markers. Comparison with previous genetic maps showed that SrWeb occupies a locus near Sr9. Further analysis will be required to determine if SrWeb is a new gene or an allele of a previously identified gene.

  6. Comparative analysis of secreted protein evolution using expressed sequence tags from four poplar leaf rusts (Melampsora spp.

    Directory of Open Access Journals (Sweden)

    Tanguay Philippe

    2010-07-01

    Full Text Available Abstract Background Obligate biotrophs such as rust fungi are believed to establish long-term relationships by modulating plant defenses through a plethora of effector proteins, whose most recognizable feature is the presence of a signal peptide for secretion. Since the phenotypes of these effectors extend to host cells, their genes are expected to be under accelerated evolution stimulated by host-pathogen coevolutionary arms races. Recently, whole genome sequence data has allowed the prediction of secretomes, facilitating the identification of putative effectors. Results We generated cDNA libraries from four poplar leaf rust pathogens (Melampsora spp. and used computational approaches to identify and annotate putative secreted proteins with the aim of uncovering new knowledge about the nature and evolution of the rust secretome. While more than half of the predicted secretome members encoded lineage-specific proteins, similarities with experimentally characterized fungal effectors were also identified. A SAGE analysis indicated a strong stage-specific regulation of transcripts encoding secreted proteins. The average sequence identity of putative secreted proteins to their closest orthologs in the wheat stem rust Puccinia graminis f. sp. tritici was dramatically reduced compared with non-secreted ones. A comparative genomics approach based on homologous gene groups unravelled positive selection in putative members of the secretome. Conclusion We uncovered robust evidence that different evolutionary constraints are acting on the rust secretome when compared to the rest of the genome. These results are consistent with the view that these genes are more likely to exhibit an effector activity and be involved in coevolutionary arms races with host factors.

  7. A stochastic model simulating the spatiotemporal dynamics of yellow rust on wheat

    DEFF Research Database (Denmark)

    Lett, C.; Østergård, Hanne

    2000-01-01

    A stochastic model of the spatiotemporal dynamics of plant disease epidemics in monocultures is described and applied to the simulation of yellow rust on wheat (Puccinia striiformis f. sp. tritici). The most sensitive parameters of the model are latent period, daily multiplication factor...

  8. Molecular cytogenetic characterization and stem rust resistance of five wheat-Thinopyrum ponticum partial amphiploids.

    Science.gov (United States)

    Zheng, Qi; Lv, Zhenling; Niu, Zhixia; Li, Bin; Li, Hongwei; Xu, Steven S; Han, Fangpu; Li, Zhensheng

    2014-11-20

    Partial amphiploids created by crossing common wheat (Triticum aestivum L.) and Thinopyrum ponticum (Podp.) Barkworth & D. R. Dewey are important intermediates in wheat breeding because of their resistance to major wheat diseases. In this study, we examined the chromosome compositions of five Xiaoyan-series wheat-Th. ponticum partial amphiploids (Xiaoyan 68, Xiaoyan 693, Xiaoyan 784, Xiaoyan 7430, and Xiaoyan 7631) using GISH, multicolor-GISH, and multicolor-FISH. We found several chromosome changes in these lines. For example, wheat chromosomes 1B and 2B were added in Xiaoyan 68 and Xiaoyan 7430, respectively, while wheat chromosome 6B was eliminated from Xiaoyan 693 and Xiaoyan 7631. Chromosome rearrangements were also detected in these amphiploids, including an interspecific translocation involving chromosome 4D and some intergenomic translocations, such as A-B and A-D translocations, among wheat genomes. Analysis of the Th. ponticum chromosomes in the amphiploids showed that some lines shared the same alien chromosomes. We also evaluated these partial amphiploids for resistance to nine races of stem rust, including TTKSK (commonly known as Ug99). Three lines, Xiaoyan 68, Xiaoyan 784, and Xiaoyan 7430, exhibited excellent resistance to all nine races, and could therefore be valuable sources of stem rust resistance in wheat breeding. Copyright © 2014 Institute of Genetics and Developmental Biology, Chinese Academy of Sciences, and Genetics Society of China. Published by Elsevier Ltd. All rights reserved.

  9. [Identification and classification of disease severity of wheat stripe rust using near infrared spectroscopy technology].

    Science.gov (United States)

    Li, Xiao-long; Qin, Feng; Zhao, Long-lian; Li, Jun-hui; Ma, Zhan-hong; Wang, Hai-guang

    2015-02-01

    Wheat stripe rust caused by Puccinia striiformis f. sp. tritici, is an economically important disease in the world. It is of great significance to assess disease severity of wheat stripe rust quickly and accurately for monitoring and controlling the disease. In this study, wheat leaves infected with stripe rust pathogen under different severity levels were acquired through artificial inoculation in artificial climate chamber. Thirty wheat leaves with disease severity equal to 1%, 5%, 10%, 20%, 40%, 60%, 80% or 100% were picked out, respectively, and 30 healthy leaves were chosen as controls. A total of 270 wheat leaves were obtained and then their near infrared spectra were measured using MPA spectrometer. According to disease severity levels, 270 near infrared spectra were divided into 9 categories and each category included 30 spectra. From each category, 7 or 8 spectra were randomly chosen to make up the testing set that included 67 spectra. The remaining spectra were treated as the training set. A qualitative model for identification and classification of disease severity of wheat stripe rust was built using near infrared reflectance spectroscopy (NIRS) technology combined with discriminant partial least squares (DPLS). The effects of different preprocessing methods of obtained spectra, ratios between training sets and testing sets, and spectral ranges on qualitative recognition results of the model were investigated. The optimal model based on DPLS was built using cross verification method in the spectral region of 4000-9000 cm(-1) when "centralization" was used as the preprocessing method of spectra and the spectra were divided into the training set and the testing set with the ratio equal to 3:1. Accuracy rate of the training set was 95.57% and accuracy rate of the testing set was 97.01%. The results showed that good recognition performance could be acquired using the model based on DPLS. The results indicated that the method using near infrared reflectance

  10. Appraisal of wheat germplasm for adult plant resistance against stripe rust

    Directory of Open Access Journals (Sweden)

    Saleem Kamran

    2015-12-01

    Full Text Available The resurgence of wheat stripe rust is of great concern for world food security. Owing to resistance breakdown and the appearance of new virulent high-temperature adapted races of Puccinia striiformis f. sp. tritici (Pst, many high yielding commercial varieties in the country lost their yield potential. Searching for new sources of resistance is the best approach to mitigate the problem. Quantitative resistance (partial or adult plant or durable resistance is reported to be more stable than race specific resistance. In the current perusal, a repertoire of 57 promising wheat lines along with the KLcheck line Morocco, developed through hybridisation and selection of local and international lines with International Maize and Wheat Improvement Center (CIMMYT origin, were evaluated under natural field conditions at Nuclear Institute for Agriculture and Biology (NIAB during the 2012−2013 and 2013−2014 time periods. Final rust severity (FRS, the area under the rust progress curve (AURPC, the relative area under the rust progress curve (rAURPC, and the coefficient of infection (CI were unraveled to infer the level of quantitative resistance. Final rust severity was recorded when the susceptible check exhibited 100% severity. There were 21 lines which were immune (no disease, 16 which were resistant, five moderately resistant, two resistant-to-moderately resistant, one moderately resistant-to-moderately susceptible, 5 moderately susceptible-to-susceptible, one moderately susceptible, and six exhibited a susceptible response. Nevertheless, 51 lines exhibited a high level of partial resistance while the three lines, NW-5-1212-1, NW-7-30-1, and NW-7-5 all showed a moderate level of partial resistance based on FRS, while 54 lines, on the basis of AURPC and rAURPC, were identified as conferring a high level of partial resistance. Moreover, adult plant resistance was conferred by 47 wheat lines, based on CI value. It was striking that, 13 immune lines

  11. Genetic mapping of stem rust resistance to Puccinia graminis f. sp. tritici race TRTTF in the Canadian wheat cultivar 'Harvest'

    Science.gov (United States)

    Stem rust, caused by Puccinia graminis Pers.:Pers. f. sp. tritici Eriks. & E. Henn.(Pgt), is a destructive disease of wheat that can be controlled by deploying effective stem rust resistance (Sr) genes. Highly virulent races of Pgt in Africa have been detected and characterized. These include race T...

  12. Development and characterization of a Psathyrostachys huashanica Keng 7Ns chromosome addition line with leaf rust resistance.

    Directory of Open Access Journals (Sweden)

    Wanli Du

    Full Text Available The aim of this study was to characterize a Triticum aestivum-Psathyrostachys huashanica Keng (2n = 2x = 14, NsNs disomic addition line 2-1-6-3. Individual line 2-1-6-3 plants were analyzed using cytological, genomic in situ hybridization (GISH, EST-SSR, and EST-STS techniques. The alien addition line 2-1-6-3 was shown to have two P. huashanica chromosomes, with a meiotic configuration of 2n = 44 = 22 II. We tested 55 EST-SSR and 336 EST-STS primer pairs that mapped onto seven different wheat chromosomes using DNA from parents and the P. huashanica addition line. One EST-SSR and nine EST-STS primer pairs indicated that the additional chromosome of P. huashanica belonged to homoeologous group 7, the diagnostic fragments of five EST-STS markers (BE404955, BE591127, BE637663, BF482781 and CD452422 were cloned, sequenced and compared. The results showed that the amplified polymorphic bands of P. huashanica and disomic addition line 2-1-6-3 shared 100% sequence identity, which was designated as the 7Ns disomic addition line. Disomic addition line 2-1-6-3 was evaluated to test the leaf rust resistance of adult stages in the field. We found that one pair of the 7Ns genome chromosomes carried new leaf rust resistance gene(s. Moreover, wheat line 2-1-6-3 had a superior numbers of florets and grains per spike, which were associated with the introgression of the paired P. huashanica chromosomes. These high levels of disease resistance and stable, excellent agronomic traits suggest that this line could be utilized as a novel donor in wheat breeding programs.

  13. Superação da resistência qualitativa da cultivar de trigo "BRS 194" por uma nova raça de Puccinia triticina Breakdown of qualitative leaf rust resistance in the wheat cultivar 'BRS 194' by a new race of Puccinia triticina

    Directory of Open Access Journals (Sweden)

    Márcia Soares Chaves

    2009-02-01

    Full Text Available A população de Puccinia triticina, agente causal da ferrugem da folha do trigo, é extremamente dinâmica na região do Cone Sul da América do Sul, onde o surgimento de novas raças é freqüente. A cultivar de trigo "BRS 194" foi a segunda variedade com maior disponibilidade de sementes para plantio no Rio Grande do Sul e em Santa Catarina em 2005, por apresentar características como rusticidade, elevado rendimento de grãos e resistência qualitativa a todas as raças de P. triticina ocorrentes no Brasil e em outros países da América do Sul. Em 2005, pústulas de ferrugem da folha foram observadas sobre plantas desta cultivar, tanto em lavouras quanto em campos experimentais, indicando a possível superação de sua resistência. O objetivo deste trabalho foi identificar a raça de P. triticina presente em amostras oriundas de "BRS 194" e verificar se esta se tratava de uma nova virulência do patógeno, a qual teria superado sua resistência. Oito amostras de ferrugem provenientes da cultivar "BRS 194" foram enviadas em 2005 à Embrapa Trigo, Passo Fundo, Rio Grande do Sul, para isolamento e identificação por meio da Série Internacional de Hospedeiros Diferenciais específica para este patógeno. Todas as amostras apresentaram a mesma combinação de virulência, a qual correspondeu ao código MFP-CT, conforme o Sistema Norte-Americano de nomenclatura do patógeno. Esta foi a primeira vez que este código foi detectado no Brasil, caracterizando o surgimento de uma nova raça de P. triticina virulenta à "BRS 194". Outras cultivares de trigo, também amplamente semeadas, foram inoculadas com a nova raça, sendo que algumas foram suscetíveis e outras resistentes. Entre as cultivares resistentes estão "Fundacep 30" e "IPR 84", as quais permanecem também resistentes a todas as raças do patógeno ocorrentes no Brasil.The population of Puccinia triticina, the causal agent of wheat leaf rust, is extremely dynamic in the South Cone

  14. SCREENING OF Lr GENES PROVIDING RESISTANCE TO LEAF RUST IN WHEATH USING MULTIPLEX PCR METHOD

    Directory of Open Access Journals (Sweden)

    Mehmet AYBEKE

    2015-12-01

    Full Text Available Leaf rust is a fungal disease in wheat that causes significant decrease in yield around the world. In Turkey, several genes, including leaf rust-resistant (Lr Lr9, Lr19, Lr24 and Lr28, have been found to induce disease resistance. To obtain resistant cultivars during the breeding process, screening of these genes in various specimens is crucial. Thus, we aimed in the present study primarily to improve the multiplex polymerase chain reaction (PCR methodology by which four Lr genes could be simultaneously screened in plant samples carrying these genes. Serial PCR experiments were carried out for determination of optimal PCR conditions for each Lr gene and in all studies nursery lines were used. PCR conditions were determined as follows: 35 cycles of 95°C for denaturation (30 s, 58°C for annealing (30 s and 72°C for elongation (60 s, with an initial 94°C denaturation (3 min and a 72°C extension (30 min. The primers used in the PCR runs were as follows: Lr9F: TCCTTTTATTCCGCACGCCGG, Lr9R: CCACACTACCCCAAAGAGACG; Lr19F: CATCCTTGGGGACCTC, Lr19R: CCAGCTCGCATACATCCA; Lr24F: TCTAGTCTGTACATGGGGGC, Lr24R: TGGCACATGAACTCCATACG; Lr28F: CCCGGCATAAGTCTATGGTT, Lr28R: CAATGAATGAGATACGTGAA. We found that the optimum annealing temperature for all four genes was 61°C and extension temperatures were 62°C or 64°C. Finally, using this new PCR method, we successfully screened these genes in specimens carrying only one single Lr gene. Optimal multiplex PCR conditions were; denaturation at 94°C for 1 min, 35 extension cycles [94°C for 30 s, 57–61ºC (ideal 61°C for 30 s, and 64–68°C for 2 min] and final extension at 72°C for 30 min. In addition, we achieved positive results when running the optimised multiplex PCR tests on Lr19, Lr24 and Lr28. Future studies are planned to expand new wide multiplex PCR method to include all other Lr genes.

  15. Identification of rust resistance genes Lr10 and Sr9a in Pakistani ...

    African Journals Online (AJOL)

    Wheat (Triticum aestivum L.) rusts are the most widespread and destructive among all other diseases of wheat because of their wide distribution, and their capacity to form new races that can attack previously resistant cultivars which result in serious yield losses. Stem rust caused by Puccinia graminis f. sp. tritici and leaf of ...

  16. Mapping genes for resistance to stripe rust in spring wheat landrace PI 480035.

    Directory of Open Access Journals (Sweden)

    Jinita Sthapit Kandel

    Full Text Available Stripe rust caused by Puccinia striiformis Westend. f. sp. tritici Erikks. is an economically important disease of wheat (Triticum aestivum L.. Hexaploid spring wheat landrace PI 480035 was highly resistant to stripe rust in the field in Washington during 2011 and 2012. The objective of this research was to identify quantitative trait loci (QTL for stripe rust resistance in PI 480035. A spring wheat, "Avocet Susceptible" (AvS, was crossed with PI 480035 to develop a biparental population of 110 recombinant inbred lines (RIL. The population was evaluated in the field in 2013 and 2014 and seedling reactions were examined against three races (PSTv-14, PSTv-37, and PSTv-40 of the pathogen under controlled conditions. The population was genotyped with genotyping-by-sequencing and microsatellite markers across the whole wheat genome. A major QTL, QYr.wrsggl1-1BS was identified on chromosome 1B. The closest flanking markers were Xgwm273, Xgwm11, and Xbarc187 1.01 cM distal to QYr.wrsggl1-1BS, Xcfd59 0.59 cM proximal and XA365 3.19 cM proximal to QYr.wrsggl1-1BS. Another QTL, QYr.wrsggl1-3B, was identified on 3B, which was significant only for PSTv-40 and was not significant in the field, indicating it confers a race-specific resistance. Comparison with markers associated with previously reported Yr genes on 1B (Yr64, Yr65, and YrH52 indicated that QYr.wrsggl1-1BS is potentially a novel stripe rust resistance gene that can be incorporated into modern breeding materials, along with other all-stage and adult-plant resistance genes to develop cultivars that can provide durable resistance.

  17. Severity of angular leaf spot and rust diseases on common beans in ...

    African Journals Online (AJOL)

    ACSS

    Angular leaf spot and rust of common beans can be controlled using fungicides, resistant varieties, biological control and cultural practices such as intercropping, crop rotation, optimum plant spacing and use of soil amendments that promote soil health and plant nutrition. In Uganda, the use of fungicide is limited to common ...

  18. Proteomic characterization of the Rph15 barley resistance gene-mediated defence responses to leaf rust

    Directory of Open Access Journals (Sweden)

    Bernardo Letizia

    2012-11-01

    Full Text Available Abstract Background Leaf rust, caused by the biotrophic fungal pathogen Puccinia hordei, is one of the most important foliar disease of barley (Hordeum vulgare and represents a serious threat in many production regions of the world. The leaf rust resistance gene Rph15 is of outstanding interest for resistance breeding because it confers resistance to over 350 Puccinia hordei isolates collected from around the world. Molecular and biochemical mechanisms responsible for the Rph15 effectiveness are currently not investigated. The aim of the present work was to study the Rph15-based defence responses using a proteomic approach. Results Protein pattern changes in response to the leaf rust pathogen infection were investigated in two barley near isogenic lines (NILs, Bowman (leaf rust susceptible and Bowman-Rph15 (leaf rust resistant, differing for the introgression of the leaf rust resistance gene Rph15. Two infection time points, 24 hours and four days post inoculation (dpi, were analysed. No statistically significant differences were identified at the early time point, while at 4 dpi eighteen protein spots were significantly up or down regulated with a fold-change equal or higher than two in response to pathogen infection. Almost all the pathogen-responsive proteins were identified in the Bowman-Rph15 resistant NIL. Protein spots were characterized by LC-MS/MS analysis and found to be involved in photosynthesis and energy metabolism, carbohydrate metabolism, protein degradation and defence. Proteomic data were complemented by transcriptional analysis of the respective genes. The identified proteins can be related to modulation of the photosynthetic apparatus components, re-direction of the metabolism to sustain defence responses and deployment of defence proteins. Conclusions The identification of leaf rust infection-modulated defence responses restricted to the resistant NIL support the hypothesis that basal defence responses of Bowman, but not the

  19. Molecular characterization of a wheat -Thinopyrum ponticum partial amphiploid and its derived substitution line for resistance to stripe rust.

    Science.gov (United States)

    Hu, Li-Jun; Li, Guang-Rong; Zeng, Zi-Xian; Chang, Zhi-Jian; Liu, Cheng; Yang, Zu-Jun

    2011-08-01

    Stripe rust (caused by Puccinia striiformis) occurs annually in most wheat-growing areas of the world. Thinopyrum ponticum has provided novel rust resistance genes to protect wheat from this fungal disease. Wheat - Th. ponticum partial amphiploid line 7430 and a substitution line X005 developed from crosses between wheat and 7430 were resistant to stripe rust isolates from China. Genomic in situ hybridization (GISH) analysis using Pseudoroegneria spicata genomic DNA as a probe demonstrated that the partial amphiploid line 7430 contained ten J(s) and six J genome chromosomes, and line X005 had a pair of J(s)-chromosomes. Giemsa-C banding further revealed that both lines 7430 and X005 were absent of wheat chromosomes 6B. The EST based PCR confirmed that the introduced J(s) chromosomes belonging to linkage group 6, indicating that line X005 was a 6J(s)/6B substitution line. Both resistance observation and sequence characterized amplified region (SCAR) markers displayed that the introduced chromosomes 6J(s) were responsible for the stripe rust resistances. Therefore, lines 7430 and X005 can be used as a donor in wheat breeding for stripe rust resistance.

  20. Resistance to recombinant stem rust race TPPKC in hard red spring wheat.

    Science.gov (United States)

    Klindworth, D L; Miller, J D; Williams, N D; Xu, S S

    2011-08-01

    The wheat (Triticum aestivum L.) stem rust (Puccinia graminis Pers.:Pers. f.sp. tritici Eriks. and Henn.) resistance gene SrWld1 conditions resistance to all North American stem rust races and is an important gene in hard red spring (HRS) wheat cultivars. A sexually recombined race having virulence to SrWld1 was isolated in the 1980s. Our objective was to determine the genetics of resistance to the race. The recombinant race was tested with the set of stem rust differentials and with a set of 36 HRS and 6 durum cultivars. Chromosomal location studies in cultivars Len, Coteau, and Stoa were completed using aneuploid analysis, molecular markers, and allelism tests. Stem rust differential tests coded the race as TPPKC, indicating it differed from TPMKC by having added virulence on Sr30 as well as SrWld1. Genes effective against TPPKC were Sr6, Sr9a, Sr9b, Sr13, Sr24, Sr31, and Sr38. Genetic studies of resistance to TPPKC indicated that Len, Coteau, and Stoa likely carried Sr9b, that Coteau and Stoa carried Sr6, and Stoa carried Sr24. Tests of HRS and durum cultivars indicated that five HRS and one durum cultivar were susceptible to TPPKC. Susceptible HRS cultivars were postulated to have SrWld1 as their major stem rust resistance gene. Divide, the susceptible durum cultivar, was postulated to lack Sr13. We concluded that although TPPKC does not constitute a threat similar to TTKSK and its variants, some cultivars would be lost from production if TPPKC became established in the field.

  1. The gene Sr33, an ortholog of barley Mla genes, encodes resistance to wheat stem rust race Ug99.

    Science.gov (United States)

    Periyannan, Sambasivam; Moore, John; Ayliffe, Michael; Bansal, Urmil; Wang, Xiaojing; Huang, Li; Deal, Karin; Luo, Mingcheng; Kong, Xiuying; Bariana, Harbans; Mago, Rohit; McIntosh, Robert; Dodds, Peter; Dvorak, Jan; Lagudah, Evans

    2013-08-16

    Wheat stem rust, caused by the fungus Puccinia graminis f. sp. tritici, afflicts bread wheat (Triticum aestivum). New virulent races collectively referred to as "Ug99" have emerged, which threaten global wheat production. The wheat gene Sr33, introgressed from the wild relative Aegilops tauschii into bread wheat, confers resistance to diverse stem rust races, including the Ug99 race group. We cloned Sr33, which encodes a coiled-coil, nucleotide-binding, leucine-rich repeat protein. Sr33 is orthologous to the barley (Hordeum vulgare) Mla mildew resistance genes that confer resistance to Blumeria graminis f. sp. hordei. The wheat Sr33 gene functions independently of RAR1, SGT1, and HSP90 chaperones. Haplotype analysis from diverse collections of Ae. tauschii placed the origin of Sr33 resistance near the southern coast of the Caspian Sea.

  2. Biological control of yellow rust of wheat (Puccinia striiformis) with Serenade®ASO (Bacillus subtilis strain QST713)

    DEFF Research Database (Denmark)

    Reiss, Antje; Jørgensen, Lise Nistrup

    2017-01-01

    Yellow rust (Puccinia striiformis f. sp. tritici) is an important disease in wheat causing significant yield reductions, if not effectively controlled. The biofungicide Bacillus subtilis strain QST 713 suspension concentrate (Serenade®ASO) was investigated for its potential for yellow rust control...... in winter wheat field trials. Serenade®ASO reduced severity of yellow rust significantly, providing up to 60% control at BBCH growth stage 65–69, under moderate disease pressure. Under high disease pressure reductions were more variable and provided less than 30% control. An increase in the number......®ASO at three dose rates. This trial confirmed the lack of a clear dose response but showed that timing had a major impact on control, with the best control obtained at the day of inoculation. This study revealed that Serenade®ASO cannot stand alone in the control of yellow rust. More research is needed...

  3. Seedling Resistance to Stem Rust and Molecular Marker Analysis of Resistance Genes in Wheat Cultivars of Yunnan, China.

    Directory of Open Access Journals (Sweden)

    Tian Ya Li

    Full Text Available Stem rust is one of the most potentially harmful wheat diseases, but has been effectively controlled in China since 1970s. However, the interest in breeding wheat with durable resistance to stem rust has been renewed with the emergence of Ug99 (TTKSK virulent to the widely used resistance gene Sr31, and by which the wheat stem rust was controlled for 40 years in wheat production area worldwide. Yunnan Province, located on the Southwest border of China, is one of the main wheat growing regions, playing a pivotal role in the wheat stem rust epidemic in China. This study investigated the levels of resistance in key wheat cultivars (lines of Yunnan Province. In addition, the existence of Sr25, Sr26, Sr28, Sr31, Sr32, and Sr38 genes in 119 wheat cultivars was assessed using specific DNA markers. The results indicated that 77 (64.7% tested wheat varieties showed different levels of resistance to all the tested races of Puccinia graminis f. sp. tritici. Using molecular markers, we identified the resistance gene Sr31 in 43 samples; Sr38 in 10 samples; Sr28 in 12 samples, and one sample which was resistant against Ug99 (avirulent to Sr32. No Sr25 or Sr26 (effective against Ug99 was identified in any cultivars tested. Furthermore, 5 out of 119 cultivars tested carried both Sr31 and Sr38 and eight contained both Sr31 and Sr28. The results enable the development of appropriate strategies to breed varieties resistant to stem rust.

  4. Marker-assisted pyramiding of Thinopyrum-derived leaf rust ...

    Indian Academy of Sciences (India)

    2017-12-08

    Lr19 and Lr24) derived from Thinopyrum (syn. Agropyron), in the susceptible, but agronomically superior wheat cultivar HD2733 using marker-assisted selection. In the year 2001, HD2733 was released for irrigated timely sown ...

  5. Cloning and characterization of a wheat beta-1,3-glucanase gene induced by the stripe rust pathogen Puccinia striiformis f. sp. tritici.

    Science.gov (United States)

    Liu, Bo; Xue, Xiaodan; Cui, Suping; Zhang, Xiaoyu; Han, Qingmei; Zhu, Lin; Liang, Xiaofei; Wang, Xiaojie; Huang, Lili; Chen, Xianming; Kang, Zhensheng

    2010-02-01

    b-1,3-Glucanases are a group of pathogenesis related proteins that have been reported to be involved in plant defense against pathogens in many other plant pathogen systems. However, it was not clear if these genes play similar role in wheat (Triticum aestivum L.) against Puccinia striiformis f. sp. tritici (Pst), the stripe rust pathogen. To investigate the role of b-1,3-glucanase (EC3.2.1.39) in the resistance response of wheat (cv. Suwon11) to stripe rust, a wheat b-1,3-glucanase gene induced by Pst, designated as TaGlu, was cloned and characterized.TaGlu was predicted to encode a basic protein of 334 amino acids. Quantitative real-time PCR analyses revealed that the transcription of TaGlu was induced during both compatible and incompatible interactions with Pst, but the transcription level was much higher in the incompatible interaction than that in the compatible interaction. TaGlu also showed noticeable induction of gene expression in young green leaf tissues treated with salicylic acid, methyl jasmonate or ethylene. Immunogold labeling assays showed that the enzyme were localized mainly in the host cell wall and over the extra haustorial matrix, and the labeling densities were found significantly higher in the incompatible interaction than those in the compatible interaction.

  6. Cloning of a putative hypersensitive induced reaction gene from wheat infected by stripe rust fungus.

    Science.gov (United States)

    Yu, Xiu-Mei; Yu, Xiu-Dao; Qu, Zhi-Peng; Huang, Xin-Jie; Guo, Jun; Han, Qing-Mei; Zhao, Jie; Huang, Li-Li; Kang, Zhen-Sheng

    2008-01-15

    The hypersensitive response (HR) is one of the most efficient forms of plant defense against biotrophic pathogens and results in localized cell death and the formation of necrotic lesions. In this study, a novel putative hypersensitive induced reaction (HIR) gene from wheat leaves infected by incompatible stripe rust pathogen CY23, designated as Ta-hir1, was identified by using rapid amplification of cDNA ends (RACE). Ta-hir1 encodes 284 amino acids, with a predicted molecular mass of 31.31 KDa. A phylogenetic analysis showed that Ta-hir1 was highly homologous to Hv-hir1 from barley at both cDNA and deduced amino-acid levels. Amino-acid sequence analysis of the wheat HIR protein indicated the presence of the SPFH (Stomatins, Prohibitins, Flotillins and HflK/C) protein domain typical for stomatins which served as a negative regulator of univalent cation permeability, especially for potassium. The expression profile of the Ta-hir1 transcript detected by reverse transcriptase-polymerase chain reaction (RT-PCR) and real-time polymerase chain reaction (real time-PCR), respectively, showed that the highest expression occurred 48 h post inoculation (hpi), which is consistent with our previous histopathology observations during the stripe rust fungus-wheat incompatible reaction.

  7. Determination of Response of Some Bread Wheat Varieties Against Leaf Diseases Under Ecological Conditions of Düzce in the Western Black Sea Region

    Directory of Open Access Journals (Sweden)

    Nedim Altın

    2017-07-01

    Full Text Available This study was conducted to determine the response of 19 bread wheat varieties to natural infection of leaf diseases under ecological conditions of Düzce in the Western Black Sea Region. The trial was established in accordance with randomized block with four replications and the seeds were planted on 17.11.2015. The wheat varities were observed for the associated diseases including septoria leaf spot disease (caused by Septoria tritici during milking stage, yellow rust disease (caused by Puccinia striiformis at the end of the flowering period, brown rust disease (caused by Puccinia recondita at the beginning of milking stage. The disease severity were assessed in the field conditions according to natural contamination. According to determined diseases severity, the most sensitive variety against septoria leaf spot disease was “Bereket” with 60%, while the most tolerant variety was “Aslı” with 14%. The most sensitive variety against yellow rust disease was “Tekirdağ” with 45.4%, while the most tolerant variety was “Midas” with 0.6%. The most sensitive variety against brown rust disease was “Tahirova” with 22%, while the most tolerant variety was “Midas” with 0.2%. The results indicated that promising wheat varieties for future breeding studies were: Aldane, Aslı, Konya 2002, Köprü, Masaccio and Tosunbey (against septoria leaf spot disease, Aslı, Esperia, Kate A1, Karasunya Odeska, Masaccio and Midas (against yellow rust disease, Aldane, Aslı, Bereket, Köprü, Masaccio, Midas and Tekirdağ (against brown rust disease.

  8. A novel fungal hyperparasite of Puccinia striiformis f. sp. tritici, the causal agent of wheat stripe rust.

    Directory of Open Access Journals (Sweden)

    Gangming Zhan

    Full Text Available Puccinia striiformis f. sp. tritici (Pst, the causal fungus of wheat stripe rust, was previously reported to be infected by Lecanicillium lecanii, Microdochium nivale and Typhula idahoensis. Here, we report a novel hyperparasite on Pst. This hyperparasitic fungus was identified as Cladosporium cladosporioides (Fresen. GA de Vries based on morphological characteristics observed by light and scanning electron microscopy together with molecular data. The hyperparasite reduced the production and viability of urediniospores and, therefore, could potentially be used for biological control of wheat stripe rust.

  9. Resistance in Salix against willow leaf rust caused by Melampsora epitea

    Energy Technology Data Exchange (ETDEWEB)

    Johansson, Leif [Swedish Univ. of Agricultural Sciences, Uppsala (Sweden). Dept. of Ecology and Crop Production Science

    2000-07-01

    Cultivation of Salix in short rotation forests (SRF), as a source of renewable energy is a relatively recent phenomenon in Sweden. As all other crops under intensive cultivation, Salix are attacked by pests. The economically most important disease is leaf rust caused by Melampsora epitea. For successful plant breeding of new sustainable rust resistant clones, it is important to have knowledge of the inheritance of resistance and the mechanisms underlying rust resistance. Species hybridisation is one technique used in plant breeding, hence the inheritance pattern of rust resistance in hybrids of two species, S. viminalis and S. dasyclados, selected for the purpose, was studied in greenhouse as well as under field conditions. The study in greenhouse showed that hybrids acquire intermediate rust resistance compared to pure species. Plants of same hybrids in field proved to be more resistant than their parental species. Observations in field also showed that abiotic factors such as weather tend to play a significant role in expression of inheritance pattern. It was further indicated that the interaction between rust and Salix might be race-specific. Metabolic changes in Salix, induced by the pathogen in incompatible and compatible interactions were studied in terms of peroxidase and chitinase activity which were measured in S. viminalis inoculated with rust of two different pathotypes of M. epitea rust. Peroxidase activity revealed an earlier response from plants in the incompatible interactions compared to compatible interactions. Records of the chitinase accumulation showed absence of one basic isoform of chitinase in the incompatible interaction. These results demonstrated physiological differences between incompatible and compatible interactions, and gave further indication toward occurrence of race-specific interactions in this pathosystem. Further, with use of molecular biology techniques, a gene designated svpk1, was cloned and partially characterised. The gene

  10. [Influence of salicylic and succinic acids on the cytophysiological reactions of wheat infected by brown rust].

    Science.gov (United States)

    Plotnikova, L Ia; Shtubeĭ, T Iu

    2009-01-01

    The influence of the salicylic and succinic acids on the cytophysiological reactions of the plants and cellular structures of the fungus were investigated using the model of common wheat Triticum aestivum L. infected by brown rust. The experiments were performed on seedlings of the isogenic line of var. Thatcher with resistant gene Lr19. The salicylic and succinic acids accelerated and enhanced to a different extent the generation of active oxygen species and synthesis of callose and phenylpropanoids by the plant cells contacting with cellular structures of avirulent and virulent fungal clones.

  11. Polyphenoloxidase activity in coffee leaves and its role in resistance against the coffee leaf miner and coffee leaf rust.

    Science.gov (United States)

    Melo, Geraldo Aclécio; Shimizu, Milton Massao; Mazzafera, Paulo

    2006-02-01

    In plants, PPO has been related to defense mechanism against pathogens and insects and this role was investigated in coffee trees regarding resistance against a leaf miner and coffee leaf rust disease. PPO activity was evaluated in different genotypes and in relation to methyl-jasmonate (Meja) treatment and mechanical damage. Evaluations were also performed using compatible and incompatible interactions of coffee with the fungus Hemileia vastatrix (causal agent of the leaf orange rust disease) and the insect Leucoptera coffeella (coffee leaf miner). The constitutive level of PPO activity observed for the 15 genotypes ranged from 3.8 to 88 units of activity/mg protein. However, no direct relationship was found with resistance of coffee to the fungus or insect. Chlorogenic acid (5-caffeoylquinic acid), the best substrate for coffee leaf PPO, was not related to resistance, suggesting that oxidation of other phenolics by PPO might play a role, as indicated by HPLC profiles. Mechanical damage, Meja treatment, H. vastatrix fungus inoculation and L. coffeella infestation caused different responses in PPO activity. These results suggest that coffee resistance may be related to the oxidative potential of the tissue regarding the phenolic composition rather than simply to a higher PPO activity.

  12. Ricoseius loxocheles, a phytoseiid mite that feeds on coffee leaf rust.

    Science.gov (United States)

    Oliveira, Cleber M; Ferreira, João A M; Oliveira, Rafael M; Santos, Francisco O; Pallini, Angelo

    2014-10-01

    One of the most important diseases of coffee plants is the coffee leaf rust fungus Hemileia vastatrix Berkeley and Broome (Uredinales). It can cause 30 % yield loss in some varieties of Coffea arabica (L.). Besides fungus, the coffee plants are attacked by phytophagous mites. The most common species is the coffee red mite, Oligonychus ilicis McGregor (Acari: Tetranychidae). Predatory mites of the Phytoseiidae family are well-known for their potential to control herbivorous mites and insects, but they can also develop and reproduce on various other food sources, such as plant pathogenic fungi. In a field survey, we found Ricoseius loxocheles (De Leon) (Acari: Phytoseiidae) on the necrotic areas caused by the coffee leaf rust fungus during the reproductive phase of the pathogen. We therefore assessed the development, survivorship and reproduction of R. loxocheles feeding on coffee leaf rust fungus and measured predation and oviposition of this phytoseiid having coffee red mite as prey under laboratory conditions. The mite fed, survived, developed and reproduced successfully on this pathogen but it was not able to prey on O. ilicis. Survival and oviposition with only prey were the same as without food. This phytoseiid mite does not really use O. ilicis as food. It is suggested that R. loxocheles is one phytoseiid that uses fungi as a main food source.

  13. Genomic Selection for Quantitative Adult Plant Stem Rust Resistance in Wheat

    Directory of Open Access Journals (Sweden)

    Jessica E. Rutkoski

    2014-11-01

    Full Text Available Quantitative adult plant resistance (APR to stem rust ( f. sp. is an important breeding target in wheat ( L. and a potential target for genomic selection (GS. To evaluate the relative importance of known APR loci in applying GS, we characterized a set of CIMMYT germplasm at important APR loci and on a genome-wide profile using genotyping-by-sequencing (GBS. Using this germplasm, we describe the genetic architecture and evaluate prediction models for APR using data from the international Ug99 stem rust screening nurseries. Prediction models incorporating markers linked to important APR loci and seedling phenotype scores as fixed effects were evaluated along with the classic prediction models: Multiple linear regression (MLR, Genomic best linear unbiased prediction (G-BLUP, Bayesian Lasso (BL, and Bayes Cπ (BCπ. We found the region to play an important role in APR in this germplasm. A model using linked markers as fixed effects in G-BLUP was more accurate than MLR with linked markers (-value = 0.12, and ordinary G-BLUP (-value = 0.15. Incorporating seedling phenotype information as fixed effects in G-BLUP did not consistently increase accuracy. Overall, levels of prediction accuracy found in this study indicate that GS can be effectively applied to improve stem rust APR in this germplasm, and if genotypes at linked markers are available, modeling these genotypes as fixed effects could lead to better predictions.

  14. Characterization of non-host resistance in broad bean to the wheat stripe rust pathogen

    Directory of Open Access Journals (Sweden)

    Cheng Yulin

    2012-06-01

    Full Text Available Abstract Background Non-host resistance (NHR confers plant species immunity against the majority of microbial pathogens and represents the most robust and durable form of plant resistance in nature. As one of the main genera of rust fungi with economic and biological importance, Puccinia infects almost all cereals but is unable to cause diseases on legumes. Little is known about the mechanism of this kind of effective defense in legumes to these non-host pathogens. Results In this study, the basis of NHR in broad bean (Vicia faba L. against the wheat stripe rust pathogen, Puccinia striiformis f. sp. tritici (Pst, was characterized. No visible symptoms were observed on broad bean leaves inoculated with Pst. Microscopic observations showed that successful location of stomata and haustoria formation were significantly reduced in Pst infection of broad bean. Attempted infection induced the formation of papillae, cell wall thickening, production of reactive oxygen species, callose deposition and accumulation of phenolic compounds in plant cell walls. The few Pst haustoria that did form in broad bean cells were encased in reactive oxygen and callose materials and those cells elicited cell death. Furthermore, a total of seven defense-related genes were identified and found to be up-regulated during the Pst infection. Conclusions The results indicate that NHR in broad bean against Pst results from a continuum of layered defenses, including basic incompatibility, structural and chemical strengthening of cell wall, posthaustorial hypersensitive response and induction of several defense-related genes, demonstrating the multi-layered feature of NHR. This work also provides useful information for further determination of resistance mechanisms in broad bean to rust fungi, especially the adapted important broad bean rust pathogen, Uromyces viciae-fabae, because of strong similarity and association between NHR of plants to unadapted pathogens and basal

  15. Novel QTL for stripe rust resistance on chromosomes 4A and 6B in soft white winter wheat cultivars

    Science.gov (United States)

    Stripe rust (caused by Puccinia striiformis f. sp. tritici) of wheat (Triticum aestivum) is a devastating disease in temperate regions when susceptible varieties are grown and environmental conditions sustain high disease pressures. With frequent and severe outbreaks, disease resistance is a key too...

  16. The influence of canopy density on willow leaf rust (Melampsora epitea) severity in willow short rotation coppice

    Energy Technology Data Exchange (ETDEWEB)

    Toome, M.; Heinsoo, K.; Holm, B.; Luik, A. [Institute of Agricultural and Environmental Sciences, Estonian University of Life Sciences, Kreutzwaldi 1A, Tartu 51014 (Estonia)

    2010-08-15

    Willow short rotation coppice is used as a renewable energy source and also as a vegetation filter for purifying wastewater. Wastewater irrigation might change microclimatic conditions and increase the canopy density in plantations, which might decrease production due to leaf rust (Melampsora epitea). The aim of this study was to estimate the impact of the canopy density on rust abundance on willows. For that, we counted rust pustules on leaves of five different willow clones from dense and sparse areas in both the wastewater irrigated and control part of the plantation. The results demonstrated clear differences between clones; clone '81090' was very susceptible, '78183' susceptible, '78021' fairly tolerant and 'Tora' rust resistant. Clone 'Gudrun', which was previously reported resistant, had severe rust damages in Estonia. In the case of clones '78183' and '78021' there were significantly more rust pustules per leaf unit area at areas with denser canopy, which confirmed that higher plant density could result in biomass losses caused by leaf rust. No differences, however, were detected between dense and sparse areas of hybrid clone 'Gudrun', most probably because in this particular case leaves from upper canopy layer were used. There was a tendency detected that clones with a higher number of shoots per plant had more rust damages on their leaves, however, the correlation was not statistically confirmed. In conclusion, the impact of canopy density on rust abundance is clone-specific and significant in the case of clones on which infection starts from the lower part of the canopy. (author)

  17. Molecular cytogenetic identification of a wheat - Thinopyrum ponticum substitution line with stripe rust resistance.

    Science.gov (United States)

    Zhu, Chen; Wang, Yanzhen; Chen, Chunhuan; Wang, Changyou; Zhang, Aicen; Peng, Nana; Wang, Yajuan; Zhang, Hong; Liu, Xinlun; Ji, Wanquan

    2017-10-01

    Thinopyrum ponticum (Th. ponticum) (2n = 10x = 70) is an important breeding material with excellent resistance and stress tolerance. In this study, we characterized the derivative line CH1113-B13-1-1-2-1 (CH1113-B13) through cytological, morphological, genomic in situ hybridization (GISH), fluorescence in situ hybridization (FISH), expressed sequence tag (EST), and PCR-based landmark unique gene (PLUG) marker analysis. The GISH analysis revealed that CH1113-B13 contained 20 pairs of common wheat chromosomes and one pair of JSt genomic chromosomes. Linkage analysis of Th. ponticum using seven EST and seven PLUG markers indicated that the pair of alien chromosomes belonged to the seventh homeologous group. Nulli-tetrasomic and FISH analysis revealed that wheat 7B chromosomes were absent in CH1113-B13; thus, CH1113-B13 was identified as a 7JSt (7B) substitution line. Finally, adult-stage CH1113-B13 exhibited immunity to wheat stripe rust. This substitution line is therefore a promising germplasm resource for wheat breeding.

  18. Identification and characterization of resistance to yellow rust and powdery mildew in wild emmer wheat and their transfer to bread wheat

    NARCIS (Netherlands)

    Silfhout, van C.H.

    1989-01-01

    In wild emmer wheat three different kinds of genes for resistance to yellow rust were found, namely genes causing overall resistance, genes causing adult-plant resistance and genes which induce resistance detectable at higher temperatures. At least eleven different and probably novel major

  19. TaRar1 Is Involved in Wheat Defense against Stripe Rust Pathogen Mediated by YrSu.

    Science.gov (United States)

    Wang, Xiaojing; Wang, Yaru; Liu, Peng; Ding, Yan; Mu, Xiaoqian; Liu, Xiping; Wang, Xiaojie; Zhao, Mengxin; Huai, Baoyu; Huang, Li; Kang, Zhensheng

    2017-01-01

    RAR1 is a eukaryotic zinc-binding protein first identified as required for race-specific resistance to powdery mildew in barley. To study the function of TaRAR1 involvement in wheat (Triticum aestivum L.) defense against the infection of stripe rust pathogen Puccinia striiformis f. sp. tritici (Pst), we identified and cloned three wheat homeologous genes highly similar to the barley HvRar1, designated as TaRar1-2A, TaRar1-2B, and TaRar1-2D. The three TaRAR1 proteins all contain two conserved cysteine-and histidine-rich domains (CHORD-I and -II) shared by known RAR1-like proteins. Characterization of TaRar1 expression revealed that the expression was tissue-specific and up-regulated in wheat during stripe rust infection. Moreover, the transcription of TaRar1 was induced by methyl jasmonate, ethylene, and abscisic acid hormones. The same results were observed with drought and wound treatments. After TaRar1 was silenced in wheat cultivar Suwon11 containing the stripe rust resistance gene YrSu, the endogenous salicylic acid (SA) level, the hydrogen peroxide (H2O2) accumulation and the degree of hypersensitive response (HR) were significantly decreased, and the resistance to the avirulent pathotype of stripe rust was compromised. Meanwhile, the expression of catalase, an enzyme required for H2O2-scavenging, was up-regulated. Taken together, we concluded that TaRar1 is involved in wheat defense against stripe rust mediated by YrSu, and the defense was through SA to influence reactive oxygen species accumulation and HR.

  20. Comparative Analysis Highlights Variable Genome Content of Wheat Rusts and Divergence of the Mating Loci

    Directory of Open Access Journals (Sweden)

    Christina A. Cuomo

    2017-02-01

    Full Text Available Three members of the Puccinia genus, Puccinia triticina (Pt, P. striiformis f.sp. tritici (Pst, and P. graminis f.sp. tritici (Pgt, cause the most common and often most significant foliar diseases of wheat. While similar in biology and life cycle, each species is uniquely adapted and specialized. The genomes of Pt and Pst were sequenced and compared to that of Pgt to identify common and distinguishing gene content, to determine gene variation among wheat rust pathogens, other rust fungi, and basidiomycetes, and to identify genes of significance for infection. Pt had the largest genome of the three, estimated at 135 Mb with expansion due to mobile elements and repeats encompassing 50.9% of contig bases; in comparison, repeats occupy 31.5% for Pst and 36.5% for Pgt. We find all three genomes are highly heterozygous, with Pst [5.97 single nucleotide polymorphisms (SNPs/kb] nearly twice the level detected in Pt (2.57 SNPs/kb and that previously reported for Pgt. Of 1358 predicted effectors in Pt, 784 were found expressed across diverse life cycle stages including the sexual stage. Comparison to related fungi highlighted the expansion of gene families involved in transcriptional regulation and nucleotide binding, protein modification, and carbohydrate degradation enzymes. Two allelic homeodomain pairs, HD1 and HD2, were identified in each dikaryotic Puccinia species along with three pheromone receptor (STE3 mating-type genes, two of which are likely representing allelic specificities. The HD proteins were active in a heterologous Ustilago maydis mating assay and host-induced gene silencing (HIGS of the HD and STE3 alleles reduced wheat host infection.

  1. Characterization of two adult-plant stripe rust resistance genes on chromosomes 3BS and 4BL in soft red winter wheat

    Science.gov (United States)

    Stripe rust, caused by Puccinia striiformis f. sp. tritici, is an important foliar disease of soft red winter wheat (SRWW) in the eastern U.S. However, very few resistance genes have been characterized in the SRWW germplasm pool. The SRWW line VA96W-270 is known to be resistant to stripe rust race P...

  2. Isolation and characterization of a wheat IF2 homolog required for innate immunity to stripe rust.

    Science.gov (United States)

    Zhang, Hong; Hu, Yingang; Yang, Baoju; Xue, Fei; Wang, Changyou; Kang, Zhensheng; Ji, Wanquan

    2013-05-01

    The wheat eIF2 homolog, TaIF2, is induced by the stripe rust pathogen CYR 32 at an early stage of inoculation and is related to the innate immunity resistance level in wheat. The initiation of translation represents a critical control point in the regulation of gene expression in all organisms. We previously identified an upregulated EST S186 (EL773056) from an SSH-cDNA library of the Shaanmai 139 strain of wheat (Triticum aestivum) infected with Puccinia striiformis (Pst). In the present work, we isolated a cDNA clone and identified it as a wheat IF2 homolog. This cDNA consisted of 1,314 nucleotides and contained an open reading frame of 795 nucleotides encoding a polypeptide of 254 amino acids. The amino acids represent a conserved domain in EF-Tu, mtIF2-II, and mtIF2-Ivc. The alignment result showed that it maybe a partial cDNA of the initiation factor 2/eukaryotic initiation factor 5B (IF2/eIF5B) superfamily gene. Paradoxically, results of a Swiss-model analysis suggesting a low QMEAN Z-score implied that it was a membrane protein. Quantitative RT-PCR studies confirmed that the wheat eIF2 (TaIF2) homolog was differentially expressed in three near-isogenic lines. Critical time points for the induction of resistance by inoculation with Pst CYR32 in YrSM139-1B + YrSM139-2D immune resistance genotype occurred at 1 and 3 dpi (days post-infection). RNAi test showed that the inoculated BSMV-IF2 leaves of Shaanmai 139 showed obvious cell death after 15 days of inoculation with CYR 32. qRT-PCR analysis of the target gene in cDNA samples isolated from BSMV-IF2-Pst, BSMV-0-Pst and Pst infected leaves confirmed that the expression of TaIF2 is suppressed by BSMV-IF2 at 3 dpi. This suggested that TaIF2/eIF5B plays an important role in the mechanism of innate immunity to stripe rust pathogen.

  3. Development and characterization of wheat lines carrying stem rust resistance gene Sr43 derived from Thinopyrum ponticum.

    Science.gov (United States)

    Niu, Z; Klindworth, D L; Yu, G; L Friesen, T; Chao, S; Jin, Y; Cai, X; Ohm, J-B; Rasmussen, J B; Xu, Steven S

    2014-04-01

    Wheat lines carrying Ug99-effective stem rust resistance gene Sr43 on shortened alien chromosome segments were produced using chromosome engineering, and molecular markers linked to Sr43 were identified for marker-assisted selection. Stem rust resistance gene Sr43, transferred into common wheat (Triticum aestivum) from Thinopyrum ponticum, is an effective gene against stem rust Ug99 races. However, this gene has not been used in wheat breeding because it is located on a large Th. ponticum 7el(2) chromosome segment, which also harbors genes for undesirable traits. The objective of this study was to eliminate excessive Th. ponticum chromatin surrounding Sr43 to make it usable in wheat breeding. The two original translocation lines KS10-2 and KS24-1 carrying Sr43 were first analyzed using simple sequence repeat (SSR) markers and florescent genomic in situ hybridization. Six SSR markers located on wheat chromosome arm 7DL were identified to be associated with the Th. ponticum chromatin in KS10-2 and KS24-1. The results confirmed that KS24-1 is a 7DS·7el(2)L Robertsonian translocation as previously reported. However, KS10-2, which was previously designated as a 7el(2)S·7el(2)L-7DL translocation, was identified as a 7DS-7el(2)S·7el(2)L translocation. To reduce the Th. ponticum chromatin carrying Sr43, a BC(2)F(1) population (Chinese Spring//Chinese Spring ph1bph1b*2/KS10-2) containing ph1b-induced homoeologous recombinants was developed, tested with stem rust, and genotyped with the six SSR markers identified above. Two new wheat lines (RWG33 and RWG34) carrying Sr43 on shortened alien chromosome segments (about 17.5 and 13.7 % of the translocation chromosomes, respectively) were obtained, and two molecular markers linked to Sr43 in these lines were identified. The new wheat lines with Sr43 and the closely linked markers provide new resources for improving resistance to Ug99 and other races of stem rust in wheat.

  4. Selection procedures for durable resistance in wheat

    NARCIS (Netherlands)

    Beek, M.A.

    1988-01-01

    A wheat breeding programme for durable resistance to all locally important pathogens: leaf rust, stem rust, powdery mildew, Septoria nodorum, Septoria tritici, Cochliobolus sativus, Fusarium graminearum, Common Root Rot, Barley Yellow Dwarf Virus and Soil Borne Mosaic

  5. SH1 leaf rust and bacterial halo blight coffee resistances are genetically independent

    Directory of Open Access Journals (Sweden)

    Lucas Mateus Rivero Rodrigues

    Full Text Available ABSTRACT Coffee resistance to Pseudomonas syringae pv. garcae has been associated to pleiotropic effect of SH1 allele, present in coffee plants resistant to certain races of Hemileia vastatrix, the causal agent of leaf rust, or genetic linkage between resistance alleles to both pathogens. To validate this hypothesis, 63 coffee plants in F2 generation were evaluated for resistance to 2 isolates of H. vastatrix carriers of alleles, respectively, v2, v5 (isolate I/2015 and v1; v2; v5 (isolate II/2015 with the objective to confirm presence of SH1 allele in resistant plants to isolate I/2015. The same coffee plants were evaluated for resistance to a mixture of P. syringae pv. garcae strains highly pathogenic to coffee. Results showed that, among F2 coffee allele SH1 carriers, resistant to isolate I/2015, resistant and susceptible plants to bacterial halo blight were found; the same segregation occurs between F2 homozygous for SH1 allele, susceptible to the same isolate (I/2015 of H. vastatrix. Results also indicate that there is no pleiotropic effect of gene or allele SH1 connection between genes conferring resistance to leaf rust caused by H. vastatrix and bacterial halo blight caused by P. syringae pv. garcae.

  6. Path coefficient analysis of the effects of stripe rust and cultivar mixtures on yield and yield components of winter wheat.

    Science.gov (United States)

    Akanda, S I; Mundt, C C

    1996-05-01

    Four club wheat cultivars and three two-component cultivar mixtures, planted at five frequencies, were grown in three environments in both the presence and absence of stripe rust. The effect of stripe rust on wheat yield was through the yield components, with weight of individual seed being the component most affected by rust. In some cases, yield component compensation was indicated by the presence of negative correlations among the yield components. Path analysis of the yield components revealed that components with the highest correlations to yield also had the largest direct effects on yield. Of the yield components, number of heads per unit area exerted the largest direct influence on yield. The direct effects of number of seeds per head and weight of individual seed were similar, although number of seeds per head was more important in the absence of rust than in its presence. The pure stands and mixtures differed considerably with respect to correlation coefficients, but were very similar for direct effects of yield components on yield. Most of these discrepancies were due to opposing indirect effects, which were not evident from correlation coefficients alone.

  7. Emergence of virulence to SrTmp in the Ug99 race group of wheat stem rust, Puccinia graminis f. sp. tritici, in Africa

    DEFF Research Database (Denmark)

    Patpour, M.; Hovmøller, M. S.; Justesen, A. F.

    2016-01-01

    The Ug99 race (TTKSK) of wheat stem rust was first detected in Uganda in 1998 (Pretorius et al. 2000) and since then, seven additional variants have been reported: TTKSF, TTKST, TTTSK, TTKSP, PTKSK, PTKST, and TTKSF+ (Pretorius et al. 2012). In this study, 84 stem rust samples from the 2014 surveys...... of wheat fields in Africa (Kenya, 9; Uganda, 28; Rwanda, 41; and Egypt, 6) were sent to the Global Rust Reference Center (GRRC, Denmark) for race analysis. Puccinia graminis f. sp. tritici (Pgt) samples were recovered on cv. Morocco, and resulting urediniospores of 53 single-pustule isolates were....... The identification of SrTmp virulence in the Ug99 race group in several countries in one year emphasizes the relevance of coordinated international surveillance efforts and utilization of diverse sources of resistance to control stem rust in wheat. Further studies are in progress to determine the detailed...

  8. Diagnostic and co-dominant PCR markers for wheat stem rust resistance genes Sr25 and Sr26.

    Science.gov (United States)

    Liu, Sixin; Yu, Long-Xi; Singh, Ravi P; Jin, Yue; Sorrells, Mark E; Anderson, James A

    2010-02-01

    Wheat stem rust, caused by Puccinia graminis f. sp. tritici, is one of the most destructive diseases of wheat. A new race of the pathogen named TTKSK (syn. Ug99) and its derivatives detected in East Africa are virulent to many designated and undesignated stem rust resistance genes. The emergence and spread of those races pose an imminent threat to wheat production worldwide. Genes Sr25 and Sr26 transferred into wheat from Thinopyrum ponticum are effective against these new races. DNA markers for Sr25 and Sr26 are needed to pyramid both genes into adapted germplasm. The previously published dominant markers Gb for Sr25 and Sr26#43 for Sr26 were validated with eight wheat lines with or without Sr25 or Sr26. We tested six published STS (sequence tagged site) markers amplifying diagnostic bands of Th. ponticum. Marker BF145935 consistently amplified well and can be used as a co-dominant marker for Sr25. Among 16 STS markers developed from wheat ESTs mapped to deletion bin 6AL8-0.90-1.00, none was co-dominant for tagging Sr26. However, five 6A-specific markers were identified. Multiplex PCR with marker Sr26#43 and 6A-specific marker BE518379 can be used as a co-dominant marker for Sr26. The co-dominant markers for Sr25 and Sr26 were validated with 37 lines with known stem rust resistance genes. A diverse set of germplasm consisting 170 lines from CIMMYT, China, USA and other counties were screened with the co-dominant markers for Sr25 and Sr26. Five lines with the diagnostic fragment for Sr25 were identified, and they all have 'Wheatear' in their pedigrees, which is known to carry Sr25. None of the 170 lines tested had Sr26, as expected.

  9. Development of monitoring method of coffee leaf rust fungus (Hemileia vastatrix) infected area using satellite remote sensing

    Science.gov (United States)

    Katsuhama, N.; Ikeda, K.; Imai, M.; Watanabe, K.; Marpaung, F.; Yoshii, T.; Naruse, N.; Takahashi, Y.

    2016-12-01

    Since 2008, coffee leaf rust fungus (Hemileia vastatrix) has expanded its infection in Latin America, and early trimming and burning infected trees have been only effective countermeasures to prevent spreading infection. Although some researchers reported a case about the monitoring of coffee leaf rust using satellite remote sensing in 1970s, the spatial resolution was unsatisfied, and therefore, further technological development has been required. The purpose of this research is to develop effective method of discovering coffee leaf rust infected areas using satellite remote sensing. Annual changes of vegetation indices, i.e. Normalized Difference Vegetation Index (NDVI) and Modified Structure Insensitive Pigment Index (MSIPI), around Cuchumatanes Mountains, Republic of Guatemala, were analyzed by Landsat 7 images. Study fields in the research were limited by the coffee farm areas based on a previous paper about on site surveys in different damage areas. As the result of the analysis, the annual change of NDVI at the coffee farm areas with damages tended to be lower than those without damages. Moreover, the decline of NDVI appear from 2008 before the damage was reported. On the other hand, the change of MSIPI had no significant difference. NDVI and MSIPI are mainly related to the amount of chlorophyll and carotenoid in the leaves respectively. This means that the infected coffee leaves turned yellow without defoliation. This situation well matches the symptom of coffee leaf rust. The research concluded that the property of infected leaves turning yellow is effective to monitoring of infection areas by satellite remote sensing.

  10. Effect of partial resistance to barley leaf rust, Puccinia hordei, on the yield of three barley cultivars

    NARCIS (Netherlands)

    Ochoa, J.; Parlevliet, J.E.

    2007-01-01

    Three barley cultivars, Shyri, Clipper and Terán, with different levels of partial resistance to barley leaf rust, caused by Puccinia hordei, were exposed to six levels of the pathogen. These levels were obtained by 5, 4, 3, 2, 1 and 0 fungicide (Propiconazol) applications respectively and occurred

  11. TaRar1 Is Involved in Wheat Defense against Stripe Rust Pathogen Mediated by YrSu

    OpenAIRE

    Wang, Xiaojing; Wang, Yaru; Liu, Peng; Ding, Yan; Mu, Xiaoqian; Liu, Xiping; Wang, Xiaojie; Zhao, Mengxin; Huai, Baoyu; Huang, Li; Kang, Zhensheng

    2017-01-01

    RAR1 is a eukaryotic zinc-binding protein first identified as required for race-specific resistance to powdery mildew in barley. To study the function of TaRAR1 involvement in wheat (Triticum aestivum L.) defense against the infection of stripe rust pathogen Puccinia striiformis f. sp. tritici (Pst), we identified and cloned three wheat homeologous genes highly similar to the barley HvRar1, designated as TaRar1-2A, TaRar1-2B, and TaRar1-2D. The three TaRAR1 proteins all contain two conserved ...

  12. Wheat TaRab7 GTPase is part of the signaling pathway in responses to stripe rust and abiotic stimuli.

    Science.gov (United States)

    Liu, Furong; Guo, Jun; Bai, Pengfei; Duan, Yinhui; Wang, Xiaodong; Cheng, Yulin; Feng, Hao; Huang, Lili; Kang, Zhensheng

    2012-01-01

    Small GTP-binding proteins function as regulators of specific intercellular fundamental biological processes. In this study, a small GTP-binding protein Rab7 gene, designated as TaRab7, was identified and characterized from a cDNA library of wheat leaves infected with Puccinia striiformis f. sp. tritici (Pst) the wheat stripe rust pathogen. The gene was predicted to encode a protein of 206 amino acids, with a molecular mass of 23.13 KDa and an isoeletric point (pI) of 5.13. Further analysis revealed the presence of a conserved signature that is characteristic of Rab7, and phylogenetic analysis demonstrated that TaRab7 has the highest similarity to a small GTP binding protein gene (BdRab7-like) from Brachypodium distachyon. Quantitative real-time PCR assays revealed that the expression of TaRab7 was higher in the early stage of the incompatible interactions between wheat and Pst than in the compatible interaction, and the transcription level of TaRab7 was also highly induced by environmental stress stimuli. Furthermore, knocking down TaRab7 expression by virus induced gene silencing enhanced the susceptibility of wheat cv. Suwon 11 to an avirulent race CYR23. These results imply that TaRab7 plays an important role in the early stage of wheat-stripe rust fungus interaction and in stress tolerance.

  13. Mining centuries old in-situ conserved Turkish wheat landraces for grain yield and stripe rust resistance genes

    Directory of Open Access Journals (Sweden)

    Deepmala Sehgal

    2016-11-01

    Full Text Available Wheat landraces in Turkey are an important genetic resource for wheat improvement. An exhaustive five-year (2009-2014 effort made by the International Winter Wheat Improvement Programme (IWWIP a cooperative program between the Ministry of Food, Agriculture and Livestock of Turkey, the International Center for Maize and Wheat Improvement (CIMMYT and the International Center for Agricultural Research in the Dry Areas (ICARDA, led to the collection and documentation of around 2,000 landrace populations from 55 provinces throughout Turkey. This study reports the genetic characterization of a subset of bread wheat landraces collected in 2010 from 11 diverse provinces using genotyping-by-sequencing (GBS technology. The potential of this collection to identify loci determining grain yield and stripe rust resistance via genome-wide association (GWA analysis was explored. A high genetic diversity (diversity index = 0.260 and a moderate population structure based on highly inherited spike traits was revealed in the panel. The linkage disequilibrium decayed at 10 cM across the whole genome and was slower as compared to other landrace collections. In addition to previously reported QTL, GWA analysis also identified new candidate genomic regions for stripe rust resistance, grain yield and spike productivity components. New candidate genomic regions reflect the potential of this landrace collection to further increase genetic diversity in elite germplasm.

  14. Wheat TaRab7 GTPase is part of the signaling pathway in responses to stripe rust and abiotic stimuli.

    Directory of Open Access Journals (Sweden)

    Furong Liu

    Full Text Available Small GTP-binding proteins function as regulators of specific intercellular fundamental biological processes. In this study, a small GTP-binding protein Rab7 gene, designated as TaRab7, was identified and characterized from a cDNA library of wheat leaves infected with Puccinia striiformis f. sp. tritici (Pst the wheat stripe rust pathogen. The gene was predicted to encode a protein of 206 amino acids, with a molecular mass of 23.13 KDa and an isoeletric point (pI of 5.13. Further analysis revealed the presence of a conserved signature that is characteristic of Rab7, and phylogenetic analysis demonstrated that TaRab7 has the highest similarity to a small GTP binding protein gene (BdRab7-like from Brachypodium distachyon. Quantitative real-time PCR assays revealed that the expression of TaRab7 was higher in the early stage of the incompatible interactions between wheat and Pst than in the compatible interaction, and the transcription level of TaRab7 was also highly induced by environmental stress stimuli. Furthermore, knocking down TaRab7 expression by virus induced gene silencing enhanced the susceptibility of wheat cv. Suwon 11 to an avirulent race CYR23. These results imply that TaRab7 plays an important role in the early stage of wheat-stripe rust fungus interaction and in stress tolerance.

  15. Quantitative trait loci (QTL) analysis of flag leaf senescence in wheat ...

    African Journals Online (AJOL)

    PAVILION DV6

    2012-07-10

    Jul 10, 2012 ... senescence in wheat (Triticum aestivum L.) with microsatellite DNA markers under water- ... in wheat genotypes by simple sequence repeat (SSR) markers and to provide valuable information for marker assisted selection. SSR markers ..... Barakat MN, Milad SI, Imbaby IA (2005). Field evaluation for rust.

  16. Characterization of the Wheat Stripe Rust (Puccinia striiformis f. sp. tritici) Fungal Effector Candidate PEC6 and Its Corresponding Host Targets

    DEFF Research Database (Denmark)

    Liu, Changhai

    Stripe rust caused by Puccinia striiformis f. sp. tritici (Pst), is one of the most important fungal diseases on wheat worldwide and a serious threat to wheat production. Understanding the plant-microbe interaction mechanism is the basic step to assist future plant breeding aiming at increasing...... factor. By using the yeast two-hybrid system, the adenosine kinase (ADK) was identified as a host target of PEC6. Virus-induced gene silencing (VIGS) of ADK enhanced wheat susceptibility to stripe rust indicates that ADK is a positive regulator in plant defense. Based on EtHAn-mediated effector delivery...... resistance upon Pst-inoculation. In conclusion, the stripe rust fungal effector candidate PEC6 works as a PTI suppressor probably by targeting host ADK protein and interfering with its activity. A few wheat lines apparently carry R-genes able to recognize PEC6 but still are susceptible to Pst, so some other...

  17. QTL-seq approach identified genomic regions and diagnostic markers for rust and late leaf spot resistance in groundnut (Arachis hypogaea L.)

    Science.gov (United States)

    Rust and late leaf spot (LLS) are the two major foliar fungal diseases in groundnut, and their co-occurrence leads to yield loss up to 50–70% in addition to the deterioration of fodder quality. To identify candidate genomic regions controlling rust and LLS resistance, we deployed whole genome re-seq...

  18. Survey of Barley and Wheat Diseases in the Central Highlands of Eritrea

    Directory of Open Access Journals (Sweden)

    A.H. Yahyaoui

    2004-04-01

    Full Text Available Annual surveys of barley and wheat diseases were conducted in Eritrea from 2000 to 2002. The surveys covered six zones of the central highlands where barley and wheat are grown. The main diseases of barley were netform net blotch, spot-form net blotch, leaf rust and scald. Other, less important diseases were loose smut, covered smut, barley stripe and septoria leaf blotch. Wheat was mainly affected by yellow rust and leaf rust. Loose smut, septoria leaf spot and tan spot diseases were less prevalent. The average incidence of these diseases varied according to the zone. Among barley diseases, net blotch incidence was high in four of the six zones surveyed. Leaf rust occurred at medium incidence in five zones. Loose smut was more severe in the southern highland plains, while covered smut was more common in the south-eastern highland terraces. For wheat, yellow rust incidence was high in two zones. Areas with a high incidence of yellow rust were not necessarily those with a high incidence of leaf rust. Leaf rust was important in the south-eastern and western highland terraces and in the western highland plains. The number of diseases found in the same field varied from 2 to 5. The south eastern highland terraces, the western highland terraces and the northern highland terraces had the highest proportions of individual barley fields with three or more diseases.

  19. Investigating successive Australian barley breeding populations for stable resistance to leaf rust.

    Science.gov (United States)

    Ziems, L A; Franckowiak, J D; Platz, G J; Mace, E S; Park, R F; Singh, D; Jordan, D R; Hickey, L T

    2017-11-01

    Genome-wide association studies of barley breeding populations identified candidate minor genes for pairing with the adult plant resistance gene Rph20 to provide stable leaf rust resistance across environments. Stable resistance to barley leaf rust (BLR, caused by Puccinia hordei) was evaluated across environments in barley breeding populations (BPs). To identify genomic regions that can be combined with Rph20 to improve adult plant resistance (APR), two BPs genotyped with the Diversity Arrays Technology genotyping-by-sequencing platform (DArT-seq) were examined for reaction to BLR at both seedling and adult growth stages in Australian environments. An integrated consensus map comprising both first- and second-generation DArT platforms was used to integrate QTL information across two additional BPs, providing a total of four interrelated BPs and 15 phenotypic data sets. This enabled identification of key loci underpinning BLR resistance. The APR gene Rph20 was the only active resistance region consistently detected across BPs. Of the QTL identified, RphQ27 on chromosome 6HL was considered the best candidate for pairing with Rph20. RphQ27 did not align or share proximity with known genes and was detected in three of the four BPs. The combination of RphQ27 and Rph20 was of low frequency in the breeding material; however, strong resistance responses were observed for the lines carrying this pairing. This suggests that the candidate minor gene RphQ27 can interact additively with Rph20 to provide stable resistance to BLR across diverse environments.

  20. Quantitative plant resistance in cultivar mixtures: wheat yellow rust as a modeling case study.

    Science.gov (United States)

    Sapoukhina, Natalia; Paillard, Sophie; Dedryver, Françoise; de Vallavieille-Pope, Claude

    2013-11-01

    Unlike qualitative plant resistance, which confers immunity to disease, quantitative resistance confers only a reduction in disease severity and this can be nonspecific. Consequently, the outcome of its deployment in cultivar mixtures is not easy to predict, as on the one hand it may reduce the heterogeneity of the mixture, but on the other it may induce competition between nonspecialized strains of the pathogen. To clarify the principles for the successful use of quantitative plant resistance in disease management, we built a parsimonious model describing the dynamics of competing pathogen strains spreading through a mixture of cultivars carrying nonspecific quantitative resistance. Using the parameterized model for a wheat-yellow rust system, we demonstrate that a more effective use of quantitative resistance in mixtures involves reinforcing the effect of the highly resistant cultivars rather than replacing them. We highlight the fact that the judicious deployment of the quantitative resistance in two- or three-component mixtures makes it possible to reduce disease severity using only small proportions of the highly resistant cultivar. Our results provide insights into the effects on pathogen dynamics of deploying quantitative plant resistance, and can provide guidance for choosing appropriate associations of cultivars and optimizing diversification strategies. © 2013 INRA. New Phytologist © 2013 New Phytologist Trust.

  1. Discovery of a Novel Stem Rust Resistance Allele in Durum Wheat that Exhibits Differential Reactions to Ug99 Isolates.

    Science.gov (United States)

    Nirmala, Jayaveeramuthu; Saini, Jyoti; Newcomb, Maria; Olivera, Pablo; Gale, Sam; Klindworth, Daryl; Elias, Elias; Talbert, Luther; Chao, Shiaoman; Faris, Justin; Xu, Steven; Jin, Yue; Rouse, Matthew N

    2017-10-05

    Wheat stem rust, caused by Puccinia graminis f. sp. tritici Eriks. & E. Henn, can incur yield losses in susceptible cultivars of durum wheat, Triticum turgidum ssp. durum (Desf.) Husnot. Although several durum cultivars possess the stem rust resistance gene Sr13, additional genes in durum wheat effective against emerging virulent races have not been described. Durum line 8155-B1 confers resistance against the P. graminis f. sp. tritici race TTKST, the variant race of the Ug99 race group with additional virulence to wheat stem rust resistance gene Sr24 However, 8155-B1 does not confer resistance to the first-described race in the Ug99 race group: TTKSK. We mapped a single gene conferring resistance in 8155-B1 against race TTKST, Sr8155B1, to chromosome arm 6AS by utilizing Rusty/8155-B1 and Rusty*2/8155-B1 populations and the 90K Infinium iSelect Custom bead chip supplemented by KASP assays. One marker, KASP_6AS_IWB10558, cosegregated with Sr8155B1 in both populations and correctly predicted Sr8155B1 presence or absence in 11 durum cultivars tested. We confirmed the presence of Sr8155B1 in cultivar Mountrail by mapping in the population Choteau/Mountrail. The marker developed in this study could be used to predict the presence of resistance to race TTKST in uncharacterized durum breeding lines, and also to combine Sr8155B1 with resistance genes effective to Ug99 such as Sr13 The map location of Sr8155B1 cannot rule out the possibility that this gene is an allele at the Sr8 locus. However, race specificity indicates that Sr8155B1 is different from the known alleles Sr8a and Sr8b. Copyright © 2017 Nirmala et al.

  2. Discovery of a Novel Stem Rust Resistance Allele in Durum Wheat that Exhibits Differential Reactions to Ug99 Isolates

    Directory of Open Access Journals (Sweden)

    Jayaveeramuthu Nirmala

    2017-10-01

    Full Text Available Wheat stem rust, caused by Puccinia graminis f. sp. tritici Eriks. & E. Henn, can incur yield losses in susceptible cultivars of durum wheat, Triticum turgidum ssp. durum (Desf. Husnot. Although several durum cultivars possess the stem rust resistance gene Sr13, additional genes in durum wheat effective against emerging virulent races have not been described. Durum line 8155-B1 confers resistance against the P. graminis f. sp. tritici race TTKST, the variant race of the Ug99 race group with additional virulence to wheat stem rust resistance gene Sr24. However, 8155-B1 does not confer resistance to the first-described race in the Ug99 race group: TTKSK. We mapped a single gene conferring resistance in 8155-B1 against race TTKST, Sr8155B1, to chromosome arm 6AS by utilizing Rusty/8155-B1 and Rusty*2/8155-B1 populations and the 90K Infinium iSelect Custom bead chip supplemented by KASP assays. One marker, KASP_6AS_IWB10558, cosegregated with Sr8155B1 in both populations and correctly predicted Sr8155B1 presence or absence in 11 durum cultivars tested. We confirmed the presence of Sr8155B1 in cultivar Mountrail by mapping in the population Choteau/Mountrail. The marker developed in this study could be used to predict the presence of resistance to race TTKST in uncharacterized durum breeding lines, and also to combine Sr8155B1 with resistance genes effective to Ug99 such as Sr13. The map location of Sr8155B1 cannot rule out the possibility that this gene is an allele at the Sr8 locus. However, race specificity indicates that Sr8155B1 is different from the known alleles Sr8a and Sr8b.

  3. Host status of false brome grass to the leaf rust fungus Puccinia brachypodii and the stripe rust fungus P. Striiformis

    NARCIS (Netherlands)

    Barbieri, M.; Marcel, T.C.; Niks, R.E.

    2011-01-01

    Purple false brome grass (Brachypodium distachyon) has recently emerged as a model system for temperate grasses and is also a potential model plant to investigate plant interactions with economically important pathogens such as rust fungi. We determined the host status of five Brachypodium species

  4. Molecular cytogenetic identification of a wheat (Triticum aestivum)-American dune grass (Leymus mollis) translocation line resistant to stripe rust.

    Science.gov (United States)

    Bao, Y; Wang, J; He, F; Ma, H; Wang, H

    2012-05-22

    Leymus mollis, a perennial allotetraploid (2n = 4x = 28), known as American dune grass, is a wild relative of wheat that could be useful for cultivar improvement. Shannong0096, developed from interspecific hybridization between common wheat cv. Yannong15 and L. mollis, was analyzed with cytological procedures, genomic in situ hybridization, stripe-rust resistance screening and molecular marker analysis. We found that Shannong0096 has 42 chromosomes in the root-tip cells at mitotic metaphase and 21 bivalents in the pollen mother cells at meiotic metaphase I, demonstrating cytogenetic stability. Genomic in situ hybridization probed with total genomic DNA from L. mollis gave strong hybridization signals in the distal region of two wheat chromosome arms. A single dominant Yr gene, derived from L. mollis and temporarily designated as YrSn0096, was found on the long arm of chromosome 4A of Shannong0096. YrSn0096 should be a novel Yr gene because none of the previously reported Yr genes on chromosome 4A are related to L. mollis. This gene was found to be closely linked to the loci Xbarc236 and Xksum134 with genetic distances of 5.0 and 4.8 cM, respectively. Based on data from 267 F(2) plants of Yannong15/Huixianhong, the linkage map of YrSn0096, using the two molecular markers, was established in the order Xbarc236-YrSn0096-Xksum134. Shannong0096 appeared to be a unique wheat-L. mollis translocation with cryptic alien introgression. Cytogenetic stability, a high level of stripe-rust resistance, the common wheat background, and other positive agronomic traits make it a desirable donor for introducing novel alien resistance genes in wheat breeding programs, with the advantage of molecular markers that can be used to confirm introgression.

  5. Genome-wide association mapping reveals a rich genetic architecture of stripe rust resistance loci in emmer wheat (Triticum turgidum ssp. dicoccum).

    Science.gov (United States)

    Liu, Weizhen; Maccaferri, Marco; Chen, Xianming; Laghetti, Gaetano; Pignone, Domenico; Pumphrey, Michael; Tuberosa, Roberto

    2017-11-01

    SNP-based genome scanning in worldwide domesticated emmer germplasm showed high genetic diversity, rapid linkage disequilibrium decay and 51 loci for stripe rust resistance, a large proportion of which were novel. Cultivated emmer wheat (Triticum turgidum ssp. dicoccum), one of the oldest domesticated crops in the world, is a potentially rich reservoir of variation for improvement of resistance/tolerance to biotic and abiotic stresses in wheat. Resistance to stripe rust (Puccinia striiformis f. sp. tritici) in emmer wheat has been under-investigated. Here, we employed genome-wide association (GWAS) mapping with a mixed linear model to dissect effective stripe rust resistance loci in a worldwide collection of 176 cultivated emmer wheat accessions. Adult plants were tested in six environments and seedlings were evaluated with five races from the United States and one from Italy under greenhouse conditions. Five accessions were resistant across all experiments. The panel was genotyped with the wheat 90,000 Illumina iSelect single nucleotide polymorphism (SNP) array and 5106 polymorphic SNP markers with mapped positions were obtained. A high level of genetic diversity and fast linkage disequilibrium decay were observed. In total, we identified 14 loci associated with field resistance in multiple environments. Thirty-seven loci were significantly associated with all-stage (seedling) resistance and six of them were effective against multiple races. Of the 51 total loci, 29 were mapped distantly from previously reported stripe rust resistance genes or quantitative trait loci and represent newly discovered resistance loci. Our results suggest that GWAS is an effective method for characterizing genes in cultivated emmer wheat and confirm that emmer wheat is a rich source of stripe rust resistance loci that can be used for wheat improvement.

  6. BRS 277: Wheat cultivar

    Directory of Open Access Journals (Sweden)

    Eduardo Caierão

    2009-01-01

    Full Text Available The wheat cultivar ‘BRS 277’ was developed by Embrapa (Empresa Brasileira de Pesquisa Agropecuária,resulting from a cross between OR1 and Coker 97-33. The plant height of ‘BRS 277’ is short, frost resistance in the vegetativestage is good and resistance to leaf rust moderate.

  7. Transcriptome Analysis Provides Insights into the Mechanisms Underlying Wheat Plant Resistance to Stripe Rust at the Adult Plant Stage.

    Science.gov (United States)

    Hao, Yingbin; Wang, Ting; Wang, Kang; Wang, Xiaojie; Fu, Yanping; Huang, Lili; Kang, Zhensheng

    2016-01-01

    Stripe rust (or yellow rust), which is caused by Puccinia striiformis f. sp. tritici (Pst), is one of the most devastating wheat diseases worldwide. The wheat cultivar Xingzi 9104 (XZ) is an elite wheat germplasm that possesses adult plant resistance (APR), which is non-race-specific and durable. Thus, to better understand the mechanism underlying APR, we performed transcriptome sequencing of wheat seedlings and adult plants without Pst infection, and a total of 157,689 unigenes were obtained as a reference. In total, 2,666, 783 and 2,587 differentially expressed genes (DEGs) were found to be up- or down-regulated after Pst infection at 24, 48 and 120 hours post-inoculation (hpi), respectively, based on a comparison of Pst- and mock-infected plants. Among these unigenes, the temporal pattern of the up-regulated unigenes exhibited transient expression patterns during Pst infection, as determined through a Gene Ontology (GO) enrichment analysis. In addition, a Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis showed that many biological processes, including phenylpropanoid biosynthesis, reactive oxygen species, photosynthesis and thiamine metabolism, which mainly control the mechanisms of lignification, reactive oxygen species and sugar, respectively, are involved in APR. In particular, the continuous accumulation of reactive oxygen species may potentially contribute to the ability of the adult plant to inhibit fungal growth and development. To validate the bioinformatics results, 6 candidate genes were selected for further functional identification using the virus-induced gene silencing (VIGS) system, and 4 candidate genes likely contribute to plant resistance against Pst infection. Our study provides new information concerning the transcriptional changes that occur during the Pst-wheat interaction at the adult stage and will help further our understanding of the detailed mechanisms underlying APR to Pst.

  8. Characterization of a wheat HSP70 gene and its expression in response to stripe rust infection and abiotic stresses.

    Science.gov (United States)

    Duan, Ying-Hui; Guo, Jun; Ding, Ke; Wang, Shu-Juan; Zhang, Hong; Dai, Xi-Wei; Chen, Yue-Ying; Govers, Francine; Huang, Li-Li; Kang, Zhen-Sheng

    2011-01-01

    Members of the family of 70-kD heat shock proteins (HSP70 s) play various stress-protective roles in plants. In this study, a wheat HSP70 gene was isolated from a suppression subtractive hybridization (SSH) cDNA library of wheat leaves infected by Puccinia striiformis f. sp. tritici. The gene, that was designated as TaHSC70, was predicted to encode a protein of 690 amino acids, with a molecular mass of 73.54 KDa and a pI of 5.01. Further analysis revealed the presence of a conserved signature that is characteristic for HSP70s and phylogenetic analysis demonstrated that TaHSC70 is a homolog of chloroplast HSP70s. TaHSC70 mRNA was present in leaves of both green and etiolated wheat seedlings and in stems and roots. The transcript level in roots was approximately threefold less than in leaves but light-dark treatment did not charge TaHSC70 expression. Following heat shock of wheat seedlings at 40°C, TaHSC70 expression increased in leaves of etiolated seedlings but remained stable at the same level in green seedlings. In addition, TaHSC70 was differentially expressed during an incompatible and compatible interaction with wheat-stripe rust, and there was a transient increase in expression upon treatment with methyl jasmonate (MeJA) treatment. Salicylic acid (SA), ethylene (ET) and abscisic acid (ABA) treatments had no influence on TaHSC70 expression. These results suggest that TaHSC70 plays a role in stress-related responses, and in defense responses elicited by infection with stripe rust fungus and does so via a JA-dependent signal transduction pathway.

  9. Effects of sowing time on pink snow mould, leaf rust and winter damage in winter rye varieties in Finland

    Directory of Open Access Journals (Sweden)

    M. SERENIUS

    2008-12-01

    Full Text Available Disease infection in relation to sowing time of winter rye (Secale cereale was studied in southern Finland in order to compare overwintering capacity of modern rye varieties and to give recommendations for rye cultivation. This was done by using three sowing times and four rye varieties in field trials conducted at three locations in 1999–2001. The early sown rye (beginning of August was severely affected by diseases caused by Puccinia recondita and Microdochium nivale, whereas postponing sowing for two weeks after the recommended sowing time resulted in considerably less infection. The infection levels of diseases differed among rye varieties. Finnish rye varieties Anna and Bor 7068 were more resistant to snow mould and more winter hardy than the Polish variety Amilo, or the German hybrid varieties Picasso and Esprit. However, Amilo was the most resistant to leaf rust. In the first year snow mould appeared to be the primary cause of winter damage, but in the second year the winter damage was positively correlated with leaf rust. No significant correlation between frit fly infestation and winter damage or disease incidence of snow mould or leaf rust was established. The late sowing of rye (in the beginning of September is recommended in Finland, particularly with hybrid varieties, to minimize the need for chemical plant protection in autumn.;

  10. An AFLP marker linked to the leaf rust resistance gene LrBi16 and test of allelism with Lr14a on chromosome arm 7BL

    Directory of Open Access Journals (Sweden)

    Peipei Zhang

    2015-04-01

    Full Text Available Leaf rust (LR, caused by Puccinia triticina, is one of the most widespread diseases of common wheat (Triticum aestivum L. worldwide. The LR resistance gene LrBi16 has been mapped on chromosome arm 7BL in Chinese wheat cultivar Bimai 16 and was closely linked to SSR loci Xcfa2257 and Xgwm344 with genetic distances of 2.8 cM and 2.9 cM, respectively. In the present study, a total of 304 AFLP primer pairs were used to screen Bimai 16 and Thatcher and resistant and susceptible DNA bulks. The polymorphic AFLP marker P-ATT/M-CGC173 bp was used to genotype F2 and F3 populations to identify markers more closely linked to LrBi16. Marker P-ATT/M-CGC173 bp was tightly linked to LrBi16 with a genetic distance of 0.5 cM. As LrBi16 was mapped near the Lr14a locus, 809 F2 plants from the Bimai 16/RL6013 (Lr14a cross were inoculated with the Pt pathotype FHNQ to test the allelism of Lr14a and LrBi16. All of the F2 plants were resistant to FHNQ (IT between; and 2, suggesting that Lr14a and LrBi16 are allelic.

  11. Identification and evaluation of resistance to powdery mildew and yellow rust in a wheat mapping population.

    Directory of Open Access Journals (Sweden)

    Lijun Yang

    Full Text Available Deployment of cultivars with genetic resistance is an effective approach to control the diseases of powdery mildew (PM and yellow rust (YR. Chinese wheat cultivar XK0106 exhibits high levels of resistance to both diseases, while cultivar E07901 has partial, adult plant resistance (APR. The aim of this study was to map resistance loci derived from the two cultivars and analyze their effects against PM and YR in a range of environments. A doubled haploid population (388 lines was used to develop a framework map consisting of 117 SSR markers, while a much higher density map using the 90K Illumina iSelect SNP array was produced with a subset of 80 randomly selected lines. Seedling resistance was characterized against a range of PM and YR isolates, while field scores in multiple environments were used to characterize APR. Composite interval mapping (CIM of seedling PM scores identified two QTLs (QPm.haas-6A and QPm.haas-2A, the former being located at the Pm21 locus. These QTLs were also significant in field scores, as were Qpm.haas-3A and QPm.haas-5A. QYr.haas-1B-1 and QYr.haas-2A were identified in field scores of YR and were located at the Yr24/26 and Yr17 chromosomal regions respectively. A second 1B QTL, QYr.haas-1B-2 was also identified. QPm.haas-2A and QYr.haas-1B-2 are likely to be new QTLs that have not been previously identified. Effects of the QTLs were further investigated in multiple environments through the testing of selected lines predicted to contain various QTL combinations. Significant additive interactions between the PM QTLs highlighted the ability to pyramid these loci to provide higher level of resistance. Interactions between the YR QTLs gave insights into the pathogen populations in the different locations as well as showing genetic interactions between these loci.

  12. Exploration of microRNAs and their targets engaging in the resistance interaction between wheat and stripe rust

    Directory of Open Access Journals (Sweden)

    Hao eFeng

    2015-06-01

    Full Text Available Wheat stripe rust, caused by Puccinia striiformis f. sp. tritici (Pst, is one of the most destructive diseases of wheat worldwide. miRNAs are important regulators, they play very central roles in plant organ development, vegetable phase change and defense responses. In this study, two miRNA libraries from wheat cultivar Xingzi 9104 (XZ challenged with the avirulent Pst race CYR32 and sterile water were constructed, respectively. A total of 596 miRNA candidates were obtained. 420 wheat-specific candidate miRNAs were screened in adult plants challenged with Pst using microarray-based analyses. We analyzed the abundance of candidate miRNAs, and the levels of a subset of candidate miRNAs were determined by quantitative real time PCR (qRT-PCR. The qRT-PCR results indicated that some miRNAs were involved in the incompatible interaction between wheat and Pst. In addition, we identified some miRNAs differentially expressed in different leaves. Additionally, the target genes of wheat miRNAs were confirmed by using degradome sequencing technology. Most of the annotated target genes are related to signal transduction, energy metabolism, and other functions. We selected some target genes for relative expression analysis using qRT-PCR, and found that RabGAP/TBC domain-containing protein, zinc finger protein and Cysteine-rich receptor-like protein kinase 41 may play important role in the incompatible interaction between XZ and CYR32. Intriguingly, miRNAs and target gene seem to form a complicated regulation network that regulates the wheat-Pst interaction. Our data provide the foundation for evaluating the important regulatory roles of miRNAs in the wheat-Pst interaction.

  13. Exploration of microRNAs and their targets engaging in the resistance interaction between wheat and stripe rust.

    Science.gov (United States)

    Feng, Hao; Wang, Bing; Zhang, Qiong; Fu, Yanping; Huang, Lili; Wang, Xiaojie; Kang, Zhensheng

    2015-01-01

    Wheat stripe rust, caused by Puccinia striiformis f. sp. tritici (Pst), is one of the most destructive diseases of wheat worldwide. miRNAs are important regulators, they play very central roles in plant organ development, vegetable phase change and defense responses. In this study, two miRNA libraries from wheat cultivar Xingzi 9104 (XZ) challenged with the avirulent Pst race CYR32 and sterile water were constructed, respectively. A total of 596 miRNA candidates were obtained. 420 wheat-specific candidate miRNAs were screened in adult plants challenged with Pst using microarray-based analyses. We analyzed the abundance of candidate miRNAs, and the levels of a subset of candidate miRNAs were determined by quantitative real time PCR (qRT-PCR). The qRT-PCR results indicated that some miRNAs were involved in the incompatible interaction between wheat and Pst. In addition, we identified some miRNAs differentially expressed in different leaves. Additionally, the target genes of wheat miRNAs were confirmed by using degradome sequencing technology. Most of the annotated target genes are related to signal transduction, energy metabolism, and other functions. We selected some target genes for relative expression analysis using qRT-PCR, and found that RabGAP/TBC domain-containing protein, zinc finger protein and Cysteine-rich receptor-like protein kinase 41 may play important role in the incompatible interaction between XZ and CYR32. Intriguingly, miRNAs and target gene seem to form a complicated regulation network that regulates the wheat-Pst interaction. Our data provide the foundation for evaluating the important regulatory roles of miRNAs in the wheat-Pst interaction.

  14. A new early-warning system for stripe rust affecting wheat and triticale: Host-pathogen interactions under different environmental conditions

    DEFF Research Database (Denmark)

    Rodriguez Algaba, Julian; Justesen, Annemarie Fejer; Hovmøller, Mogens Støvring

    Stripe (yellow) rust has been the most damaging disease in Danish organic wheat and triticale production since 2009. There were estimated losses of approximately 50 million DKK (9 million USD) in 2009. Until that time, triticale was considered the most robust cereal crop for organic farming....... In order to investigate this sudden ‘susceptibility’ of wheat/triticale two main tasks will be carried out to: 1) study the influence of environmental factors on changes in response of wheat and triticale varieties, and 2) investigate the influence of pathogen genetic background on changes in virulence...... to wheat and triticale varieties....

  15. Genetic effects for controlling stripe rust (Puccinia striiformis f. sp. tritici resistance in wheat through joint segregation analysis

    Directory of Open Access Journals (Sweden)

    Kalim Ullah

    2016-06-01

    Full Text Available Mixed inheritance analysis using joint segregation analysis (JSA for stripe rust (Puccinia striiformis f. sp. tritici resistance was carried out in six basic populations (P1, F1, P2, BC1, BC2 and F2 of four wheat crosses (Hashim-08 × LU-26, Farid-06 × Shafaq, Parula × Blue Silver, TD-1 × D-97603 during crop season 2009 to 2012. Genes controlling stripe rust resistance were assessed by using area under disease progress curve (AUDPC. The AUDPC was controlled by mixed two additive-dominant-epistatic major genes plus additive-dominant-epistasis of polygenes in cross Hashim-08 × LU-26 (model E, while in Farid-06 × Shafaq, it was controlled by mixed two major additive-dominant genes plus additive-dominant polygenes (model E-2. In cross Parula × Blue Silver, the AUDPC was managed by additive, dominance and epistasis of two major genes (model B-1, however, it was controlled by mixed one major gene and additive dominant polygenes in cross TD-1 × D-97603 (model D-1. Genetic variation and heritability was higher in major genes than polygene for all the crosses showing that AUDPC was mainly controlled by major genes. The genetic behavior of the AUDPC revealed that stripe rust resistance was controlled by mixed interaction of one to two major genes plus polygenes.

  16. Landscape context and scale differentially impact coffee leaf rust, coffee berry borer, and coffee root-knot nematodes.

    Science.gov (United States)

    Avelino, Jacques; Romero-Gurdián, Alí; Cruz-Cuellar, Héctor F; Declerck, Fabrice A J

    2012-03-01

    Crop pest and disease incidences at plot scale vary as a result of landscape effects. Two main effects can be distinguished. First, landscape context provides habitats of variable quality for pests, pathogens, and beneficial and vector organisms. Second, the movements of these organisms are dependent on the connectivity status of the landscape. Most of the studies focus on indirect effects of landscape context on pest abundance through their predators and parasitoids, and only a few on direct effects on pests and pathogens. Here we studied three coffee pests and pathogens, with limited or no pressure from host-specific natural enemies, and with widely varying life histories, to test their relationships with landscape context: a fungus, Hemileia vastatrix, causal agent of coffee leaf rust; an insect, the coffee berry borer, Hypothenemus hampei (Coleoptera: Curculionidae); and root-knot nematodes, Meloidogyne spp. Their incidence was assessed in 29 coffee plots from Turrialba, Costa Rica. In addition, we characterized the landscape context around these coffee plots in 12 nested circular sectors ranging from 50 to 1500 m in radius. We then performed correlation analysis between proportions of different land uses at different scales and coffee pest and disease incidences. We obtained significant positive correlations, peaking at the 150 m radius, between coffee berry borer abundance and proportion of coffee in the landscape. We also found significant positive correlations between coffee leaf rust incidence and proportion of pasture, peaking at the 200 m radius. Even after accounting for plot level predictors of coffee leaf rust and coffee berry borer through covariance analysis, the significance of landscape structure was maintained. We hypothesized that connected coffee plots favored coffee berry borer movements and improved its survival. We also hypothesized that wind turbulence, produced by low-wind-resistance land uses such as pasture, favored removal of coffee

  17. Identification of new resistance loci to African stem rust race TTKSK in tetraploid wheats based on linkage and genome-wide association mapping

    Directory of Open Access Journals (Sweden)

    Giovanni eLaidò

    2015-12-01

    Full Text Available Stem rust, caused by Puccinia graminis Pers. f. sp. tritici Eriks. & E. Henn. (Pgt, is one of the most destructive diseases of wheat. Races of the pathogen in the Ug99 lineage are of international concern due to their virulence for widely used stem rust resistance genes and their spread throughout Africa. Disease resistant cultivars provide one of the best means for controlling stem rust. To identify quantitative trait loci (QTL conferring resistance to African stem rust race TTKSK at the seedling stage, we evaluated an association mapping (AM panel consisting of 230 tetraploid wheat accessions under greenhouse conditions. A high level of phenotypic variation was observed in response to race TTKSK in the AM panel, allowing for genome-wide association mapping of resistance QTL in wild, landrace, and cultivated tetraploid wheats. Thirty-five resistance QTL were identified on all chromosomes, and seventeen are of particular interest as identified by multiple associations. Many of the identified resistance loci were coincident with previously identified rust resistance genes; however, nine on chromosomes 1AL, 2AL, 4AL, 5BL and 7BS may be novel. To validate AM results, a biparental population of 146 recombinant inbred lines was also considered, which derived from a cross between the resistant

  18. The poplar Rust-Induced Secreted Protein (RISP inhibits the growth of the leaf rust pathogen Melampsora larici-populina and triggers cell culture alkalinisation

    Directory of Open Access Journals (Sweden)

    Benjamin ePetre

    2016-02-01

    Full Text Available Plant cells secrete a wide range of proteins in extracellular spaces in response to pathogen attack. The poplar Rust-Induced Secreted Protein (RISP is a small cationic protein of unknown function that was identified as the most induced gene in poplar leaves during immune responses to the leaf rust pathogen Melampsora larici-populina, an obligate biotrophic parasite. Here, we combined in planta and in vitro molecular biology approaches to tackle the function of RISP. Using a RISP-mCherry fusion transiently expressed in Nicotiana benthamiana leaves, we demonstrated that RISP is secreted into the apoplast. A recombinant RISP specifically binds to M. larici-populina urediniospores and inhibits their germination. It also arrests the growth of the fungus in vitro and on poplar leaves. Interestingly, RISP also triggers poplar cell culture alkalinisation and is cleaved at the C-terminus by a plant-encoded mechanism. Altogether our results indicate that RISP is an antifungal protein that has the ability to trigger cellular responses.

  19. Modelling coffee leaf rust risk in Colombia with climate reanalysis data.

    Science.gov (United States)

    Bebber, Daniel P; Castillo, Ángela Delgado; Gurr, Sarah J

    2016-12-05

    Many fungal plant diseases are strongly controlled by weather, and global climate change is thus likely to have affected fungal pathogen distributions and impacts. Modelling the response of plant diseases to climate change is hampered by the difficulty of estimating pathogen-relevant microclimatic variables from standard meteorological data. The availability of increasingly sophisticated high-resolution climate reanalyses may help overcome this challenge. We illustrate the use of climate reanalyses by testing the hypothesis that climate change increased the likelihood of the 2008-2011 outbreak of Coffee Leaf Rust (CLR, Hemileia vastatrix) in Colombia. We develop a model of germination and infection risk, and drive this model using estimates of leaf wetness duration and canopy temperature from the Japanese 55-Year Reanalysis (JRA-55). We model germination and infection as Weibull functions with different temperature optima, based upon existing experimental data. We find no evidence for an overall trend in disease risk in coffee-growing regions of Colombia from 1990 to 2015, therefore, we reject the climate change hypothesis. There was a significant elevation in predicted CLR infection risk from 2008 to 2011 compared with other years. JRA-55 data suggest a decrease in canopy surface water after 2008, which may have helped terminate the outbreak. The spatial resolution and accuracy of climate reanalyses are continually improving, increasing their utility for biological modelling. Confronting disease models with data requires not only accurate climate data, but also disease observations at high spatio-temporal resolution. Investment in monitoring, storage and accessibility of plant disease observation data are needed to match the quality of the climate data now available.This article is part of the themed issue 'Tackling emerging fungal threats to animal health, food security and ecosystem resilience'. © 2016 The Authors.

  20. Insights into Tan Spot and Stem Rust Resistance and Susceptibility by Studying the Pre-Green Revolution Global Collection of Wheat.

    Science.gov (United States)

    Abdullah, Sidrat; Sehgal, Sunish Kumar; Jin, Yue; Turnipseed, Brent; Ali, Shaukat

    2017-04-01

    Tan spot (TS), caused by the fungus Pyrenophora tritici-repentis (Died) Drechs, is an important foliar disease of wheat and has become a threat to world wheat production since the 1970s. In this study a globally diverse pre-1940s collection of 247 wheat genotypes was evaluated against Ptr ToxA, P. tritici-repentis race 1, and stem rust to determine if; (i) acquisition of Ptr ToxA by the P. tritici-repentis from Stagonospora nodorum led to increased pathogen virulence or (ii) incorporation of TS susceptibility during development stem rust resistant cultivars led to an increase in TS epidemics globally. Most genotypes were susceptible to stem rust; however, a range of reactions to TS and Ptr ToxA were observed. Four combinations of disease-toxin reactions were observed among the genotypes; TS susceptible-Ptr ToxA sensitive, TS susceptible-Ptr ToxA insensitive, TS resistant-Ptr ToxA insensitive, and TS resistant-Ptr ToxA toxin sensitive. A weak correlation (r = 0.14 for bread wheat and -0.082 for durum) was observed between stem rust susceptibility and TS resistance. Even though there were no reported epidemics in the pre-1940s, TS sensitive genotypes were widely grown in that period, suggesting that Ptr ToxA may not be an important factor responsible for enhanced prevalence of TS.

  1. Influence of Environmental Conditions and Genetic Background of Arabica Coffee (C. arabica L) on Leaf Rust (Hemileia vastatrix) Pathogenesis

    Science.gov (United States)

    Toniutti, Lucile; Breitler, Jean-Christophe; Etienne, Hervé; Campa, Claudine; Doulbeau, Sylvie; Urban, Laurent; Lambot, Charles; Pinilla, Juan-Carlos H.; Bertrand, Benoît

    2017-01-01

    Global warming is a major threat to agriculture worldwide. Between 2008 and 2013, some coffee producing countries in South and Central America suffered from severe epidemics of coffee leaf rust (CLR), resulting in high economic losses with social implications for coffee growers. The climatic events not only favored the development of the pathogen but also affected the physiological status of the coffee plant. The main objectives of the study were to evaluate how the physiological status of the coffee plant modified by different environmental conditions impact on the pathogenesis of CLR and to identify indicators of the physiological status able to predict rust incidence. Three rust susceptible genotypes (one inbred line and two hybrids) were grown in controlled conditions with a combination of thermal regime (TR), nitrogen and light intensity close to the field situation before being inoculated with the rust fungus Hemileia vastatrix. It has been demonstrated that a TR of 27-22°C resulted in 2000 times higher sporulation than with a TR of 23–18°C. It has been also shown that high light intensity combined with low nitrogen fertilization modified the CLR pathogenesis resulting in huge sporulation. CLR sporulation was significantly lower in the F1 hybrids than in the inbred line. The hybrid vigor may have reduced disease incidence. Among the many parameters studied, parameters related to photosystem II and photosynthetic electron transport chain components appeared as indicators of the physiological status of the coffee plant able to predict rust sporulation intensity. Taken together, these results show that CLR sporulation not only depends on the TR but also on the physiological status of the coffee plant, which itself depends on agronomic conditions. Our work suggests that vigorous varieties combined with a shaded system and appropriate nitrogen fertilization should be part of an agro-ecological approach to disease control. PMID:29234340

  2. Leaf primordia initiation, leaf emergence and tillering in wheat (Triticum aestivum L.) grown under low phosphorus conditions.

    NARCIS (Netherlands)

    Rodriguez, D.; Pomar, M.C.; Goudriaan, J.

    1998-01-01

    In two simultaneous experiments we examined the effects of phosphorus (P) supply on leaf area development in wheat (Triticum aestivum L.) grown in sand with nutrient solutions. In Experiment 1 we studied leaf emergence, leaf elongation, tiller emergence, shoot growth, and P uptake under four levels

  3. Identification of expressed genes during compatible interaction between stripe rust (Puccinia striiformis and wheat using a cDNA library

    Directory of Open Access Journals (Sweden)

    Huang Lili

    2009-12-01

    Full Text Available Abstract Background Wheat stripe rust, caused by Puccinia striiformis f. sp. tritici (Pst, is one of the most destructive diseases of wheat worldwide. To establish compatibility with the host, Pst forms special infection structures to invade the plant with minimal damage to host cells. Although compatible interaction between wheat and Pst has been studied using various approaches, research on molecular mechanisms of the interaction is limited. The aim of this study was to develop an EST database of wheat infected by Pst in order to determine transcription profiles of genes involved in compatible wheat-Pst interaction. Results Total RNA, extracted from susceptible infected wheat leaves harvested at 3, 5 and 8 days post inoculation (dpi, was used to create a cDNA library, from which 5,793 ESTs with high quality were obtained and clustered into 583 contigs and 2,160 singletons to give a set of 2,743 unisequences (GenBank accessions: GR302385 to GR305127. The BLASTx program was used to search for homologous genes of the unisequences in the GenBank non-redundant protein database. Of the 2,743 unisequences, 52.8% (the largest category were highly homologous to plant genes; 16.3% to fungal genes and 30% of no-hit. The functional classification of all ESTs was established based on the database entry giving the best E-value using the Bevan's classification categories. About 50% of the ESTs were significantly homologous to genes encoding proteins with known functions; 20% were similar to genes encoding proteins with unknown functions and 30% did not have significant homology to any sequence in the database. The quantitative real-time PCR (qRT-PCR analysis determined the transcription profiles and their involvement in the wheat-Pst interaction for seven of the gene. Conclusion The cDNA library is useful for identifying the functional genes involved in the wheat-Pst compatible interaction, and established a new database for studying Pst pathogenesis genes

  4. Genome-Wide Linkage Mapping of QTL for Adult-Plant Resistance to Stripe Rust in a Chinese Wheat Population Linmai 2 × Zhong 892.

    Directory of Open Access Journals (Sweden)

    Jindong Liu

    Full Text Available Stripe rust is one of the most devastating diseases of wheat (Triticum aestivum worldwide. Adult-plant resistance (APR is an efficient approach to provide long-term protection of wheat from the disease. The Chinese winter wheat cultivar Zhong 892 has a moderate level of APR to stripe rust in the field. To determine the inheritance of the APR resistance in this cultivar, 273 F6 recombinant inbred lines (RILs were developed from a cross between Linmai 2 and Zhong 892. The RILs were evaluated for maximum disease severity (MDS in two sites during the 2011-2012, 2012-2013 and 2013-2014 cropping seasons, providing data for five environments. Illumina 90k SNP (single nucleotide polymorphism chips were used to genotype the RILs and their parents. Composite interval mapping (CIM detected eight QTL, namely QYr.caas-2AL, QYr.caas-2BL.3, QYr.caas-3AS, QYr.caas-3BS, QYr.caas-5DL, QYr.caas-6AL, QYr.caas-7AL and QYr.caas-7DS.1, respectively. All except QYr.caas-2BL.3 resistance alleles were contributed by Zhong 892. QYr.caas-3AS and QYr.caas-3BS conferred stable resistance to stripe rust in all environments, explaining 6.2-17.4% and 5.0-11.5% of the phenotypic variances, respectively. The genome scan of SNP sequences tightly linked to QTL for APR against annotated proteins in wheat and related cereals genomes identified two candidate genes (autophagy-related gene and disease resistance gene RGA1, significantly associated with stripe rust resistance. These QTL and their closely linked SNP markers, in combination with kompetitive allele specific PCR (KASP technology, are potentially useful for improving stripe rust resistances in wheat breeding.

  5. TaAbc1, a Member of Abc1-Like Family Involved in Hypersensitive Response against the Stripe Rust Fungal Pathogen in Wheat

    Science.gov (United States)

    Wang, Xiaojing; Wang, Xiaojie; Duan, Yinghui; Yin, Shuining; Zhang, Hongchang; Huang, Li; Kang, Zhensheng

    2013-01-01

    To search for genes involved in wheat (Triticum aestivum L.) defense response to the infection of stripe rust pathogen Puccinia striiformis f. sp. tritici (Pst), we identified and cloned a new wheat gene similar to the genes in the Abc1-like gene family. The new gene, designated as TaAbc1, encodes a 717-amino acid, 80.35 kD protein. The TaAbc1 protein contains two conserved domains shared by Abc1-like proteins, two trans-membrane domains at the C-terminal, and a 36-amino acid chloroplast targeting presequence at the N-terminal. Characterization of TaAbc1 expression revealed that gene expression was tissue-specific and could be up-regulated by biotic agents (e.g., stripe rust pathogen) and/or by an abiotic stress like wounding. High-fold induction was associated with the hypersensitive response (HR) triggered only by avirulent stripe rust pathotypes, suggesting that TaAbc1 is a rust-pathotype specific HR-mediator. Down-regulating TaAbc1 reduced HR but not the overall resistance level in Suwon11 to CYR23, suggesting TaAbc1 was involved in HR against stripe rust, but overall host resistance is not HR-dependent. PMID:23527058

  6. Population genomic footprints of host adaptation, introgression and recombination in coffee leaf rust.

    Science.gov (United States)

    Silva, Diogo Nuno; Várzea, Vítor; Paulo, Octávio Salgueiro; Batista, Dora

    2018-01-12

    Coffee leaf rust, caused by Hemileia vastatrix (Hv), represents the biggest threat to coffee production worldwide and ranks amongst the most serious fungal diseases in history. Despite a recent series of outbreaks and emergence of hypervirulent strains, the population evolutionary history and potential of this pathogen remain poorly understood. To address this issue, we used restriction site-associated DNA sequencing (RADseq) to generate ∼19 000 single nucleotide polymorphisms (SNPs) across a worldwide collection of 37 Hv samples. Contrary to the long-standing idea that Hv represents a genetically unstructured and cosmopolitan species, our results reveal the existence of a cryptic species complex with marked host tropism. Using phylogenetic and pathological data, we show that one of these lineages (C3) infects almost exclusively the most economically valuable coffee species (tetraploids that include Coffea arabica and interspecific hybrids), whereas the other lineages (C1 and C2) are severely maladapted to these hosts, but successfully infect diploid coffee species. Population dynamic analyses suggest that the C3 group may be a recent 'domesticated' lineage that emerged via host shift from diploid coffee hosts. We also found evidence of recombination occurring within this group, which could explain the high pace of pathotype emergence despite the low genetic variation. Moreover, genomic footprints of introgression between the C3 and C2 groups were discovered and raise the possibility that virulence factors may be quickly exchanged between groups with different pathogenic abilities. This work advances our understanding of the evolutionary strategies used by plant pathogens in agro-ecosystems with direct and far-reaching implications for disease control. © 2018 BSPP AND JOHN WILEY & SONS LTD.

  7. IPR 118 - Bread wheat cultivar

    Directory of Open Access Journals (Sweden)

    Carlos Roberto Riede

    2007-01-01

    Full Text Available Wheat cultivar IPR 118 developed by IAPAR has a good yield potential and is widely adapted. It is earlymaturing and moderately tolerant to shattering and soil aluminum, moderately resistant to leaf rust and presents high glutenstrength for bread-making. The overall yield exceeded controls by 13%.

  8. CD 122 - Bread wheat, suitable for cultivation across southern Brazil

    Directory of Open Access Journals (Sweden)

    Francisco de Assis Franco

    2014-07-01

    Full Text Available The cultivar CD 122 was tested in the wheat-producing regions VCU 1, 2 and 3, with an average grain yield of 3,527 kg ha-1 when fungicide-treated, exceeding the average of the control cultivars by 5%. CD 122 is resistant to leaf rust and was classified as bread wheat.

  9. Genetic evaluation of spring wheat (Triticum aestivum L.) genotypes ...

    African Journals Online (AJOL)

    SAM

    2014-04-30

    Apr 30, 2014 ... Several biotic and abiotic stresses such as spot blotch, leaf rust, terminal heat stress and drought stress have adverse impact on wheat productivity in the eastern regions of South Asia especially Eastern Gangetic Plains of India (Joshi et al., 2007). However, spot blotch is most serious constrain for the wheat ...

  10. Identification of RAPD markers linked to salinity tolerance in wheat

    African Journals Online (AJOL)

    armghan_shehzad

    tolerance in wheat. Waqas Manzoor Bhutta* and Muhammad Hanif. Department of Botany, Government College University Faisalabad, 38040-Pakistan. Accepted 24 August, 2009 ... Key words: Marker, RAPD, root length, salinity, wheat. INTRODUCTION. Salinity is a ..... to leaf rust resistance in barley. Theor. Appl. Genet.

  11. Large-Scale Atmospheric Dispersal Simulations Identify Likely Airborne Incursion Routes of Wheat Stem Rust Into Ethiopia.

    Science.gov (United States)

    Meyer, M; Burgin, L; Hort, M C; Hodson, D P; Gilligan, C A

    2017-10-01

    In recent years, severe wheat stem rust epidemics hit Ethiopia, sub-Saharan Africa's largest wheat-producing country. These were caused by race TKTTF (Digalu race) of the pathogen Puccinia graminis f. sp. tritici, which, in Ethiopia, was first detected at the beginning of August 2012. We use the incursion of this new pathogen race as a case study to determine likely airborne origins of fungal spores on regional and continental scales by means of a Lagrangian particle dispersion model (LPDM). Two different techniques, LPDM simulations forward and backward in time, are compared. The effects of release altitudes in time-backward simulations and P. graminis f. sp. tritici urediniospore viability functions in time-forward simulations are analyzed. Results suggest Yemen as the most likely origin but, also, point to other possible sources in the Middle East and the East African Rift Valley. This is plausible in light of available field surveys and phylogenetic data on TKTTF isolates from Ethiopia and other countries. Independent of the case involving TKTTF, we assess long-term dispersal trends (>10 years) to obtain quantitative estimates of the risk of exotic P. graminis f. sp. tritici spore transport (of any race) into Ethiopia for different 'what-if' scenarios of disease outbreaks in potential source countries in different months of the wheat season.

  12. Quackgrass- and ryegrass-adapted populations of the cereal rust mite, Abacarus hystrix (Acari: Eriophyidae), differ in their potential for wheat, Triticum aestivum, colonization.

    Science.gov (United States)

    Skoracka, A

    2009-02-01

    The cereal rust mite, Abacarus hystrix, is one of the most notable among mites causing losses in cultivated grasslands. It is one of a few eriophyoid species for which a broad host range has been reported. Recent studies, however, have shown that host specialization is very likely in this species. For two populations of A. hystrix (one inhabiting perennial ryegrass, the second inhabiting quackgrass), host-associated differences correlated with strong host fidelity, distinct phenotypes and reproductive barriers have been found. In the present study, the ability of wheat colonization by quackgrass- and ryegrass-adapted cereal rust mite was studied. The hypothesis that the potential for wheat colonization by the quackgrass strain is more likely was tested by comparing the colonization performance (assessed by female survival and fecundity) of quackgrass- and ryegrass-associated A. hystrix on their familiar hosts and on wheat. The ryegrass population had no success in wheat colonization (expressed by extremely low fecundity and female survival). Fecundity and survival of quackgrass strain were similar on wheat and the familiar host, or even higher on wheat. Phylogenetic similarity of quackgrass and wheat is discussed as a possible factor that might influence such patterns of host colonization. Since A. hystrix is the only vector of the ryegrass mosaic virus (RgMV), the presented results may be helpful in explaining the inability of RgMV to successfully infest wheat. The conclusions are that (i) quackgrass- and ryegrass-adapted strains of the cereal rust mite have different physiological host ranges and (ii) phylogenetic relationships between host plant species appear to be drivers for host specialization in this mite species.

  13. Tan spot - the most harmful wheat leaf disease in Latvia

    Directory of Open Access Journals (Sweden)

    Biruta Bankina

    2012-12-01

    Full Text Available Tan spot (Pyrenophora tritici-repentis is one of the most important wheat diseases in Latvia. Significant spreading of this disease was observed from 1998. Field experiments were carried out at the Research and Training Farm "Peterlauki" of the Latvia University of Agriculture, during 1998-2003. Development of diseases was observed on 14 winter wheat varieties, dynamics of development was investigated on 'Donskaja polukarlikovaja' and 'Stava'. Assessments of the disease severity were carried out on the upper three leaves each week from the start of stem elongation to full ripening. Tan spot was observed at the stage of stem elongation in 2003, and only after flowering in 1999. Increase of the disease severity was slow until stage of milk ripeness, and only in late stages of wheat development sharp increase of the disease was observed. Total rate of infection (through the session of vegetation was very slow (0,01-0,19, but during ripening rate achieved 0,5-0,6. The main reason of so unequal development of the disease seems changes in amount of infection sources. Other possible reason of rapid increase of the disease development is the relationship between leaf age and susceptibility to the disease. Further research is necessary for better understanding of tan spot life cycle.

  14. Quantitative Trait Loci in Sweet Corn Associated with Partial Resistance to Stewart's Wilt, Northern Corn Leaf Blight, and Common Rust.

    Science.gov (United States)

    Brown, A F; Juvik, J A; Pataky, J K

    2001-03-01

    ABSTRACT Partial resistance to Stewart's wilt (Erwina stewartii, syn. Pantoea stewartii), northern corn leaf blight (NCLB) (Exserohilum turcicum), and common rust (Puccinia sorghi) was observed in an F(2:3) population developed from a cross between the inbred sweet corn lines IL731a and W6786. The objective of this study was to identify quantitative trait loci (QTL) associated with partial resistance using restriction fragment length polymorphic markers. Phenotypic data were collected for 2 years for Stewart's wilt, NCLB, and common rust but, due to significant family-environment interaction, analysis was conducted individually on data from each year. In 2 years of evaluation for the three diseases, a total of 33 regions in the maize genome were associated with partial resistance describing from 5.9 to 18% of the total phenotypic variability. Of six regions common in both years, three were associated with partial resistance to Stewart's wilt (chromosomes 4:07, 5:03, and 6:04), one was associated with NCLB (chromosome 9:05), and two were associated with common rust (chromosomes 2:04 and 3:04). The rust QTL on 3S mapped to within 20 cM of the rp3 locus and explained 17.7% of the phenotypic variability. Some of the QTL associated with partial resistance to the three diseases have been reported previously, and some are described here for the first time. Results suggest it may be possible to consolidate QTL from various elite backgrounds in a manner analogous to the pyramiding of major resistance genes. We also report here on two QTL associated with anthocyanin production on chromosomes 10:6 and 5:03 in the general location of the a2 gene.

  15. The genome sequence and effector complement of the flax rust pathogen Melampsora lini.

    Science.gov (United States)

    Nemri, Adnane; Saunders, Diane G O; Anderson, Claire; Upadhyaya, Narayana M; Win, Joe; Lawrence, Gregory J; Jones, David A; Kamoun, Sophien; Ellis, Jeffrey G; Dodds, Peter N

    2014-01-01

    Rust fungi cause serious yield reductions on crops, including wheat, barley, soybean, coffee, and represent real threats to global food security. Of these fungi, the flax rust pathogen Melampsora lini has been developed most extensively over the past 80 years as a model to understand the molecular mechanisms that underpin pathogenesis. During infection, M. lini secretes virulence effectors to promote disease. The number of these effectors, their function and their degree of conservation across rust fungal species is unknown. To assess this, we sequenced and assembled de novo the genome of M. lini isolate CH5 into 21,130 scaffolds spanning 189 Mbp (scaffold N50 of 31 kbp). Global analysis of the DNA sequence revealed that repetitive elements, primarily retrotransposons, make up at least 45% of the genome. Using ab initio predictions, transcriptome data and homology searches, we identified 16,271 putative protein-coding genes. An analysis pipeline was then implemented to predict the effector complement of M. lini and compare it to that of the poplar rust, wheat stem rust and wheat stripe rust pathogens to identify conserved and species-specific effector candidates. Previous knowledge of four cloned M. lini avirulence effector proteins and two basidiomycete effectors was used to optimize parameters of the effector prediction pipeline. Markov clustering based on sequence similarity was performed to group effector candidates from all four rust pathogens. Clusters containing at least one member from M. lini were further analyzed and prioritized based on features including expression in isolated haustoria and infected leaf tissue and conservation across rust species. Herein, we describe 200 of 940 clusters that ranked highest on our priority list, representing 725 flax rust candidate effectors. Our findings on this important model rust species provide insight into how effectors of rust fungi are conserved across species and how they may act to promote infection on their

  16. The genome sequence and effector complement of the flax rust pathogen Melampsora lini

    Directory of Open Access Journals (Sweden)

    Adnane eNemri

    2014-03-01

    Full Text Available Rust fungi cause serious yield reductions on crops, including wheat, barley, soybean, coffee, and represent real threats to global food security. Of these fungi, the flax rust pathogen Melampsora lini has been developed extensively over the past 80 years as a model to understand the molecular mechanisms that underpin pathogenesis. During infection, M. lini secretes virulence effectors to promote disease. The number of these effectors, their function and their degree of conservation across rust fungal species is unknown. To assess this, we sequenced and assembled de novo the genome of M. lini isolate CH5 into 21,130 scaffolds spanning 189 Mbp (scaffold N50 of 31 kbp. Global analysis of the DNA sequence revealed that repetitive elements, primarily retrotransposons, make up at least 45% of the genome. Using ab initio predictions, transcriptome data and homology searches, we identified 16,271 putative protein-coding genes. An analysis pipeline was then implemented to predict the effector complement of M. lini and compare it to that of the poplar rust, wheat stem rust and wheat stripe rust pathogens to identify conserved and species-specific effector candidates. Previous knowledge of four cloned M. lini avirulence effector proteins and two basidiomycete effectors was used to optimise parameters of the effector prediction pipeline. Markov clustering based on sequence similarity was performed to group effector candidates from all four rust pathogens. Clusters containing at least one member from M. lini were further analysed and prioritized based on features including expression in isolated haustoria and infected leaf tissue and conservation across rust species. Herein, we describe 200 of 940 clusters that ranked highest on our priority list, representing 725 flax rust candidate effectors. Our findings on this important model rust species provide insight into how effectors of rust fungi are conserved across species and how they may act to promote

  17. Osmotic adjustment in wheat flag leaf in relation to flag leaf area and grain yield per plant

    OpenAIRE

    Farouk, S.

    2011-01-01

    BackgroundSalinity stress causes ion toxicity and osmotic imbalances, leading to oxidative stress in plants. Antioxidants are considered ameliorators of saline stress and could develop salinity tolerance in crop plants. To ascertain the role of antioxidants in inducing osmotic adjustment in salt stressed wheat flag leaf in terms of compatible solutes accumulation, water relations parameters and osmotic adjustment as well as flag leaf area and grain yield per plant, in addition, flag leaf ana...

  18. The impact of drought on wheat leaf cuticle properties.

    Science.gov (United States)

    Bi, Huihui; Kovalchuk, Nataliya; Langridge, Peter; Tricker, Penny J; Lopato, Sergiy; Borisjuk, Nikolai

    2017-05-08

    The plant cuticle is the outermost layer covering aerial tissues and is composed of cutin and waxes. The cuticle plays an important role in protection from environmental stresses and glaucousness, the bluish-white colouration of plant surfaces associated with cuticular waxes, has been suggested as a contributing factor in crop drought tolerance. However, the cuticle structure and composition is complex and it is not clear which aspects are important in determining a role in drought tolerance. Therefore, we analysed residual transpiration rates, cuticle structure and epicuticular wax composition under well-watered conditions and drought in five Australian bread wheat genotypes, Kukri, Excalibur, Drysdale, RAC875 and Gladius, with contrasting glaucousness and drought tolerance. Significant differences were detected in residual transpiration rates between non-glaucous and drought-sensitive Kukri and four glaucous and drought-tolerant lines. No simple correlation was found between residual transpiration rates and the level of glaucousness among glaucous lines. Modest differences in the thickness of cuticle existed between the examined genotypes, while drought significantly increased thickness in Drysdale and RAC875. Wax composition analyses showed various amounts of C31 β-diketone among genotypes and increases in the content of alkanes under drought in all examined wheat lines. The results provide new insights into the relationship between drought stress and the properties and structure of the wheat leaf cuticle. In particular, the data highlight the importance of the cuticle's biochemical makeup, rather than a simple correlation with glaucousness or stomatal density, for water loss under limited water conditions.

  19. Smallholder Food and Water Security in the Face of Climatic Stress and the Coffee Leaf Rust: Lessons from Nicaragua

    Science.gov (United States)

    Stewart, I. T.; Bacon, C. M.; Sundstrom, W.

    2015-12-01

    Smallholder farmers in Nicaragua and throughout much of Central America preserve forest biodiversity and contribute to the sustainable production of coffee and other crops while, paradoxically, they themselves must cope with recurring periods of seasonal hunger. Smallholder food and water security in the region is affected by hurricanes, periodic drought events, climatic changes, an on-going outbreak of the coffee leaf rust, and fluctuations in food prices. Using regression analysis, our research examines what factors strengthened resilience to these hazards at the household level over the 1981 - 2014 time period. To this end, we integrate qualitative research on coping responses and local institutions, a participatory survey of 368 households, and an analysis of hydro-climatic data. Our results indicate that coping responses to the coffee leaf rust outbreak and the 2014 drought are comparable in severity to those used to endure Hurricane Mitch in 1998, and a severe 2009 drought. Higher smallholder resilience to stresses affecting food and water security is associated with larger farms, off-farm employment, more on-farm food production, higher numbers of fruit trees, and greater coffee harvests. Households that reported more severe coping responses to hazards earlier in the study period tended to be more strongly impacted by later hazards and reported generally greater seasonal hunger. Affiliation with local farmer-to-farmer institutions prioritizing either subsistence-oriented production or sales to international fair-trade markets did not correlate strongly with coping responses; however, subsistence-oriented institutions promote several resilience-enhancing practices. Lessons learned by adapting to past hazards may be used to develop adaptation and mitigation strategies for smallholders under continued climate variability and change.

  20. IPR 107 – Dwarf arabic coffee cultivar with resistance to coffee leaf rust

    Directory of Open Access Journals (Sweden)

    Tumoru Sera

    2013-01-01

    Full Text Available ‘IPR 107’ was derived from a cross between ‘IAPAR 59’ and ‘Mundo Novo IAC 376-4’. ‘IPR 107’ is a dwarf medium sizeplant with medium precocity in ripening and with complete resistance to rust races in this time. This cultivar presents superior qualityand high yield in many coffee regions.

  1. Plant morphology, environment, and leaf area growth in wheat and maize

    NARCIS (Netherlands)

    Bos, H.J.

    1999-01-01

    Leaf area expansion of wheat (Triticum aestivum L.) and maize (Zea mays L.) plants, as contrasting representatives of the Gramineae family, was analysed. Seven variables were identified that together completely determine leaf area

  2. Kinetic properties of cell wall bound superoxide dismutase in leaves of wheat (Triticum aestivum L.) following stripe rust (Puccinia striiformis) infection.

    Science.gov (United States)

    Asthir, Bavita; Koundal, A; Bains, N S

    2011-10-01

    Stripe rust (Puccinia striiformis f.sp. tritici) is the most devastating disease of wheat (Triticum aestivum L.) accounting huge economical losses to the industry worldwide. HD 2329 was a widely grown wheat cultivar which had become highly susceptible to stripe rust and was used to understand the biochemical aspects of the host pathogen interaction through characterization of superoxide dismutase (SOD). In the present study, two types of SOD, ionically or covalently bound to the particulate fraction were found in the stripe rust infected and uninfected wheat leaves of susceptible cultivar HD 2329. Cell walls of leaves contained a high level of SOD, of which 41-44% was extractable by 2 M NaCl and 10-13% by 0.5% EDTA in infected and uninfected leaves. The NaCl-released SOD constituted the predominant fraction. It exhibited maximum activity at pH 9.0, had a Km value of 1.82-2.51 for uninfected and 1.77-2.37 mM for infected, respectively with pyrogallol as the substrate, and a Vmax of 9.55-21.4 and 12.4-24.1 delta A min(-1)g(-1)FW. A temperature optimum of 20 degrees C was observed for SOD of both uninfected and infected leaves. SOD showed differential response to metal ions, suggesting their distinctive nature. Inhibition of wall bound SOD by iodine and its partial regeneration of activity by mercaptoethanol suggested the involvement of cysteine in active site of the enzyme. These two forms showed greater differences with respect to thermodynamic properties like energy of activation (Ea) and enthalpy change (delta H), while entropy change (delta S) and free energy change (delta G) were similar. The results further showed that pathogen infection of the leaves of susceptible wheat cultivar induced a decrease in the SOD activity and kinetics which might be critical during the response of plant cells to the infection.

  3. Thinopyrum ponticum and Th. intermedium: the promising source of resistance to fungal and viral diseases of wheat.

    Science.gov (United States)

    Li, Hongjie; Wang, Xiaoming

    2009-09-01

    Thinopyrum ponticum and Th. intermedium provide superior resistance against various diseases in wheat (Ttricum aestivum). Because of their readily crossing with wheat, many genes for disease resistance have been introduced from the wheatgrasses into wheat. Genes for resistance to leaf rust, stem rust, powdery mildew, Barley yellow dwarf virus, Wheat streak mosaic virus, and its vector, the wheat curl mite, have been transferred into wheat by producing chromosome translocations. These genes offer an opportunity to improve resistance of wheat to the diseases; some of them have been extensively used in protecting wheat from damage of the diseases. Moreover, new resistance to diseases is continuously detected in the progenies of wheat-Thinopyrum derivatives. The present article summaries characterization and application of the genes for fungal and viral disease-resistance derived from Th. ponticum and Th. intermedium.

  4. Long-term Low Radiation Decreases Leaf Photosynthesis, Photochemical Efficiency and Grain Yield in Winter Wheat

    DEFF Research Database (Denmark)

    Mu, H; Jiang, D; Wollenweber, Bernd

    2010-01-01

    the impact of low radiation on crop growth, photosynthesis and yield. Grain yield losses and leaf area index (LAI) reduction were less than the reduction in solar radiation under both shading treatment in both cultivars. Compared with the control (S0), grain yield only reduced 6.4 % and 9.9 % under 22.......0-22.9 % (S1) and 29.5-49.6 % (S2), which was consistent with the reduction in radiation. The reduction in LAI was partially compensated by increases in the fraction of the top and bottom leaf area to the total leaf area, which facilitated to intercept more solar radiation by the canopy. The decrease......Low radiation reduces wheat grain yield in tree-crop intercropping systems in the major wheat planting area of China. Here, two winter wheat (Triticum aestivum L) cultivars, Yangmai 158 (shading tolerant) and Yangmai 11 (shading sensitive), were shaded from jointing to maturity to evaluate...

  5. In vivo sensitivity reduction of Puccinia triticina races, causal agent of wheat leaf rust, to DMI and QoI fungicides Redução da sensibilidade de raças de Puccinia triticina, agente causal da ferrugem da folha do trigo, aos fungicidas DMI e QoI, in vivo

    Directory of Open Access Journals (Sweden)

    Gisele da Silva Arduim

    2012-12-01

    Full Text Available Experiments were carried out to determine in vivo the IC50 and the IC90 for demethylation-inhibitor fungicides (DMIs, triazoles and quinone outside inhibitors (QoIs, strobilurins to the five most frequent races of Puccinia triticina in 2007 growing season in Southern Brazil. The tests were done in a greenhouse with wheat seedlings. DMI fungicides were tested at the concentrations, in mg/L, 0.0; 0.02; 0.2; 2.0; 20.0; 100.0 and 200.0, and QoIs at the concentrations 0.0; 0.0001; 0.001; 0.01; 0.1; 1 and 10.0 mg of active ingredient/L water. Fungicides were preventively applied at 24 hours before the inoculation of seedlings with the fungal spores. The effect of treatments was assessed based on the number of uredia/cm². The lowest IC50 (inhibitory concentration for DMI fungicides determined for MCG-MN, sensitive race, ranged from 0.33 to 0.91 mg/L, while the highest values for MDP-MR, MDT-MR, MDK-MR, MFH-HT races, varied from 9.63 to 85.64 mg/L (suspected insensitivity. QoI fungicide presented an IC50 varying from 0.0018 to 0.14 mg/L. The sensitivity reduction factor for DMIs varied from 8.8 to 238.8, and for QoIs from 0.3 to 1.5 mg/L. Sensitivity reduction was confirmed for the races MDP-MR, MDT-MR, MDK-MR, MFH-HT to DMIs, as well as their sensitivity to QoI fungicides.Experimentos foram conduzidos para determinar, in vivo a IC50 e CI90 para fungicidas inibidores da demetilação (IDM(triazois e inibidores da quinona externa (IQe (estrobilurinas a cinco raças de Puccinia triticina mais frequentes na safra 2007, no Sul do Brasil. Os experimentos foram realizados em câmara de crescimento com plântulas de trigo. Os fungicidas IDMs foram testados nas concentrações em mg/L de 0,0; 0,02; 0,2; 2,0; 20,0; 100,0 e 200,0 e os IQes nas concentrações de 0,0; 0,0001; 0,001; 0,01; 0,1, 1 e 10,0 mg de ingrediente activo/L de água. Os fungicidas foram aplicados preventivamente 24 horas antes da inoculação das plântulas com os esporos do fungo. O efeito

  6. Evaluation of Six Algorithms to Monitor Wheat Leaf Nitrogen Concentration

    Directory of Open Access Journals (Sweden)

    Xia Yao

    2015-11-01

    Full Text Available The rapid and non-destructive monitoring of the canopy leaf nitrogen concentration (LNC in crops is important for precise nitrogen (N management. Nowadays, there is an urgent need to identify next-generation bio-physical variable retrieval algorithms that can be incorporated into an operational processing chain for hyperspectral satellite missions. We assessed six retrieval algorithms for estimating LNC from canopy reflectance of winter wheat in eight field experiments. These experiments represented variations in the N application rates, planting densities, ecological sites and cultivars and yielded a total of 821 samples from various places in Jiangsu, China over nine consecutive years. Based on the reflectance spectra and their first derivatives, six methods using different numbers of wavelengths were applied to construct predictive models for estimating wheat LNC, including continuum removal (CR, vegetation indices (VIs, stepwise multiple linear regression (SMLR, partial least squares regression (PLSR, artificial neural networks (ANNs, and support vector machines (SVMs. To assess the performance of these six methods, we provided a systematic evaluation of the estimation accuracies using the six metrics that were the coefficients of determination for the calibration (R2C and validation (R2V sets, the root mean square errors of prediction (RMSEP for the calibration and validation sets, the ratio of prediction to deviation (RPD, the computational efficiency (CE and the complexity level (CL. The following results were obtained: (1 For the VIs method, SAVI(R1200, R705 produced a more accurate estimation of the LNC than other indices, with R²C, R²V, RMSEP, RPD and CE values of 0.844, 0.795, 0.384, 2.005 and 0.10 min, respectively; (2 For the SMLR, PLSR, ANNs and SVMs methods, the SVMs using the first derivative canopy spectra (SVM-FDS offered the best accuracy in terms of R²C, R²V, RMSEP, RPD, and CE, at 0.96, 0.78, 0.37, 2.02, and 21

  7. Induced gene expression in wheat seedlings treated with a crude ...

    African Journals Online (AJOL)

    This is also applied to a retrotransposon protein encoding gene whose expression was strongly induced following extract treatment. The induced expression of all these defence-related genes suggests that the crude A. africanus extract has the ability to prime the resistance response of wheat prior to leaf rust infection.

  8. Saturation Mapping of a Major Effect QTL for Stripe Rust Resistance on Wheat Chromosome 2B in Cultivar Napo 63 Using SNP Genotyping Arrays

    Directory of Open Access Journals (Sweden)

    Dejun Han

    2017-04-01

    Full Text Available Stripe rust or yellow rust (YR, caused by Puccinia striiformis f. sp. tritici (Pst, is one of the most important diseases of wheat (Triticum aestivum L.. Widespread deployment of resistant cultivars is the best means of achieving durable disease control. The red grain, spring wheat cultivar Napo 63 produced by CIMMYT in the 1960s shows a high level of adult-plant resistance to stripe rust in the field. To elucidate the genetic basis of resistance in this cultivar we evaluated 224 F2:3 lines and 175 F2:6 recombinant inbred lines (RILs derived from a cross between Napo 63 and the Pst-susceptible line Avocet S. The maximum disease severity (MDS data of F2:3 lines and the relative area under the disease progress curve (rAUDPC data of RILs were collected during the 2014–2015 and 2015–2016 wheat growing seasons, respectively. Combined bulked segregant analysis and 90K single nucleotide polymorphism (SNP arrays placed 275 of 511 polymorphic SNPs on chromosome 2B. Sixty four KASP markers selected from the 275 SNPs and 76 SSR markers on 2B were used to identify a chromosome region associated with rust response. A major effect QTL, named Qyrnap.nwafu-2BS, was identified by inclusive composite interval mapping and was preliminarily mapped to a 5.46 cM interval flanked by KASP markers 90K-AN34 and 90K-AN36 in chromosome 2BS. Fourteen KASP markers more closely linked to the locus were developed following a 660K SNP array analysis. The QTL region was finally narrowed to a 0.9 cM interval flanked by KASP markers 660K-AN21 and 660K-AN57 in bin region 2BS-1-0.53. The resistance of Napo 63 was stable across all environments, and as a QTL, explained an average 66.1% of the phenotypic variance in MDS of F2:3 lines and 55.7% of the phenotypic variance in rAUDPC of F5:6 RILs. The short genetic interval and flanking KASP markers developed in the study will facilitate marker-assisted selection, gene pyramiding, and eventual positional cloning of Qyrnap.nwafu-2BS.

  9. Disease Impact on Wheat Yield Potential and Prospects of Genetic Control

    DEFF Research Database (Denmark)

    Singh, Ravi P.; Singh, Pawan K.; Rutkoski, Jessica

    2016-01-01

    Wheat is grown worldwide in diverse geographical regions, environments, and production systems. Although many diseases and pests are known to reduce grain yield potential and quality, the three rusts and powdery mildew fungi have historically caused major crop losses and continue to remain...... economically important despite the widespread use of host resistance and fungicides. The evolution and fast spread of virulent and more aggressive race lineages of rust fungi have only worsened the situation. Fusarium head blight, leaf spotting diseases, and, more recently, wheat blast (in South America...... for most diseases; their selection through phenotyping reinforced with molecular strategies offers great promise in achieving more durable resistance and enhancing global wheat productivity....

  10. Characterization of Stripe Rust Resistance Genes in the Wheat Cultivar Chuanmai45

    Directory of Open Access Journals (Sweden)

    Ennian Yang

    2016-04-01

    Full Text Available The objective of this research was to characterize the high level of resistance to stripe that has been observed in the released wheat cultivar, Chuanmai45. A combination of classic genetic analysis, molecular and cytogenetic methods were used to characterize resistance in an F2 population derived from Chuanmai45 and the susceptible Chuanmai42. Inheritance of resistance was shown to be conferred by two genes in Chuanmai45. Fluorescence in situ hybridization (FISH was used along with segregation studies to show that one gene was located on a 1RS.1BL translocation. Molecular markers were employed to show that the other locus was located on chromosome 4B. The defeated gene, Yr24/26, on chromosome 1BL was present in the susceptible parent and lines that recombined this gene with the 1RS.1BL translocation were identified. The germplasm, loci, and associated markers identified in this study will be useful for application in breeding programs utilizing marker-assisted selection.

  11. for resistance to gray leaf spot and common rust diseases of maize

    African Journals Online (AJOL)

    STORAGESEVER

    2008-09-17

    Sep 17, 2008 ... or susceptible to the two diseases. Using the GLS ... loss of total photosynthetic leaf area, increased stalk lodging, and ... Many studies have reported on how resistance to the .... 1 = very small necrotic lesions on leaves; 2 = light necrosis covering. <40 percent of .... QTLs that have close effect on the traits.

  12. Genetic loci conditioning adult plant resistance to the Ug99 race group and seedling resistance to races TRTTF and TTTTF of the stem rust pathogen in wheat landrace CItr 15026

    Science.gov (United States)

    Wheat landrace CItr 15026 previously showed adult plant resistance (APR) to the Ug99 stem rust race group in Kenya and seedling resistance to Puccinia graminis f. sp tritici (Pgt) races QFCSC, TTTTF, and TRTTF. CItr 15026 was crossed to susceptible accessions LMPG-6 and Red Bobs, and 180 DH lines an...

  13. QTL mapping provides evidence for lack of association of the avoidance of leaf rust in Hordeum chilense with stomata density

    NARCIS (Netherlands)

    Vaz Patto, M.C.; Rubiales, D.; Martin, A.; Hernandez, P.; Lindhout, W.H.; Niks, R.E.; Stam, P.

    2003-01-01

    In cereals, rust fungi are among the most harmful pathogens. Breeders usually rely on short-lived hypersensitivity resistance. As an alternative, "avoidance" may be a more durable defence mechanism to protect plants to rust fungi. In Hordeum chilense avoidance is based on extensive wax covering of

  14. Quantitative trait loci (QTL) analysis of flag leaf senescence in wheat ...

    African Journals Online (AJOL)

    The objective of this study was to detect quantitative trait loci (QTL) associated with drought tolerance in wheat genotypes by simple sequence repeat (SSR) markers and to provide valuable information for marker assisted selection. SSR markers linked to flag leaf senescence (FLS) was identified in two DNA pools, which ...

  15. Assessment of leaf/stem ratio in wheat straw feedstock and impact on enzymatic conversion

    DEFF Research Database (Denmark)

    Zhang, Heng; Fangel, Jonatan Ulrik; Willats, William George Tycho

    2014-01-01

    The composition of wheat straw leaf and stem fractions were characterized using traditional strong acid hydrolysis, and monoclonal antibodies using comprehensive microarray polymer profiling (CoMPP). These results are then related to high throughput lignocellulose pretreatment and saccharificatio...... of novel screening techniques; especially pectin or arabinogalactan proteins related epitopes are promising....

  16. Reaction of wheat cultivars and differential lines to Puccinia triticina races in detached leaves

    Directory of Open Access Journals (Sweden)

    Camila Turra

    2014-12-01

    Full Text Available The method of preserving detached wheat leaves in Petri dish was used for the inoculation and development of the fungus Puccinia triticina, the causal agent of wheat leaf rust. The reaction of 26 wheat cultivars was compared by using seedlings cultivated in pots (in vivo and detached leaves (in vitro inoculated with four physiological races of the pathogen. After inoculation, the material was kept in a growth chamber for 15 days. The reaction was evaluated on the 15th day after inoculation. Results for each race in the evaluated genotypes confirmed the efficiency of the detached leaf method in assessing the reaction of wheat cultivars.

  17. High-resolution mapping reveals linkage between genes in common bean cultivar Ouro Negro conferring resistance to the rust, anthracnose, and angular leaf spot diseases.

    Science.gov (United States)

    Valentini, Giseli; Gonçalves-Vidigal, Maria Celeste; Hurtado-Gonzales, Oscar P; de Lima Castro, Sandra Aparecida; Cregan, Perry B; Song, Qijian; Pastor-Corrales, Marcial A

    2017-08-01

    Co-segregation analysis and high-throughput genotyping using SNP, SSR, and KASP markers demonstrated genetic linkage between Ur-14 and Co-3 4 /Phg-3 loci conferring resistance to the rust, anthracnose and angular leaf spot diseases of common bean. Rust, anthracnose, and angular leaf spot are major diseases of common bean in the Americas and Africa. The cultivar Ouro Negro has the Ur-14 gene that confers broad spectrum resistance to rust and the gene cluster Co-3 4 /Phg-3 containing two tightly linked genes conferring resistance to anthracnose and angular leaf spot, respectively. We used co-segregation analysis and high-throughput genotyping of 179 F2:3 families from the Rudá (susceptible) × Ouro Negro (resistant) cross-phenotyped separately with races of the rust and anthracnose pathogens. The results confirmed that Ur-14 and Co-3 4 /Phg-3 cluster in Ouro Negro conferred resistance to rust and anthracnose, respectively, and that Ur-14 and the Co-3 4 /Phg-3 cluster were closely linked. Genotyping the F2:3 families, first with 5398 SNPs on the Illumina BeadChip BARCBEAN6K_3 and with 15 SSR, and eight KASP markers, specifically designed for the candidate region containing Ur-14 and Co-3 4 /Phg-3, permitted the creation of a high-resolution genetic linkage map which revealed that Ur-14 was positioned at 2.2 cM from Co-3 4 /Phg-3 on the short arm of chromosome Pv04 of the common bean genome. Five flanking SSR markers were tightly linked at 0.1 and 0.2 cM from Ur-14, and two flanking KASP markers were tightly linked at 0.1 and 0.3 cM from Co-3 4 /Phg-3. Many other SSR, SNP, and KASP markers were also linked to these genes. These markers will be useful for the development of common bean cultivars combining the important Ur-14 and Co-3 4 /Phg-3 genes conferring resistance to three of the most destructive diseases of common bean.

  18. Inter- and intraspecific variation in leaf economic traits in wheat and maize.

    Science.gov (United States)

    Martin, Adam R; Hale, Christine E; Cerabolini, Bruno E L; Cornelissen, Johannes H C; Craine, Joseph; Gough, William A; Kattge, Jens; Tirona, Cairan K F

    2018-02-01

    Leaf Economics Spectrum (LES) trait variation underpins multiple agroecological processes and many prominent crop yield models. While there are numerous independent studies assessing trait variation in crops, to date there have been no comprehensive assessments of intraspecific trait variation (ITV) in LES traits for wheat and maize: the world's most widespread crops. Using trait databases and peer-reviewed literature, we compiled over 700 records of specific leaf area (SLA), maximum photosynthetic rates ( A max ) and leaf nitrogen (N) concentrations, for wheat and maize. We evaluated intraspecific LES trait variation, and intraspecific trait-environment relationships. While wheat and maize occupy the upper 90th percentile of LES trait values observed across a global species pool, ITV ranged widely across the LES in wheat and maize. Fertilization treatments had strong impacts on leaf N, while plant developmental stage (here standardized as the number of days since planting) had strong impacts on A max ; days since planting, N fertilization and irrigation all influenced SLA. When controlling for these factors, intraspecific responses to temperature and precipitation explained 39.4 and 43.7 % of the variation in A max and SLA, respectively, but only 5.4 % of the variation in leaf N. Despite a long history of domestication in these species, ITV in wheat and maize among and within cultivars remains large. Intraspecific trait variation is a critical consideration to refine regional to global models of agroecosystem structure, function and food security. Considerable opportunities and benefits exist for consolidating a crop trait database for a wider range of domesticated plant species.

  19. Impact of Regionally Distinct Agroecosystem Communities on the Potential for Autonomous Control of the Coffee Leaf Rust.

    Science.gov (United States)

    Hajian-Forooshani, Zachary; Rivera Salinas, Iris Saraeny; Jiménez-Soto, Estelí; Perfecto, Ivette; Vandermeer, John

    2016-12-01

    Recent theoretical work suggests that two ineffective control agents can provide effective biological control when coupled together. We explore the implications of this work with the system of coffee leaf rust (CLR), caused by the fungal agent Hemileiae vastatrix, and two of its natural enemies, a fungal pathogen (Lecanicillium lecanii) and a spore predator (Mycodiplosis hemileiae). Here we report on comparative surveys of the CLR and its two natural enemies in Mexico, where the CLR has been at epidemic status since 2012, and Puerto Rico, where the CLR is present but has not reached epidemic densities. We found that the densities of the two control agents per CLR lesion is higher in Puerto Rico than in Mexico, and we hypothesize that their joint presence at higher densities is contributing to the suppression of the CLR in Puerto Rico but not in Mexico. Furthermore, we found that the presence of Azteca sericeasur, a keystone ant species that occurs in Mexico but not Puerto Rico, significantly reduces the prevalence of M. hemileiae on coffee plants. Our work provides data that allows us to hypothesize that the joint presence of these two control agents may potentially provide control of the CLR and also highlights the importance of regionally specific communities within agroecosystems, and how variation in community composition may lead to varying outcomes for biological control. Additionally, this is the first report of the presence of a potentially important biological control agent, M. hemileiae, in Latin America and the Caribbean. © The Authors 2016. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  20. Genetic diversity of the wheat leaf blotch pathogen Mycosphaerella ...

    African Journals Online (AJOL)

    samia

    2013-03-20

    Mar 20, 2013 ... McDonald BA, Martinez JP (1990). DNA restriction fragment length polymorphisms among Mycosphaerella graminicola (anamorph. Septoria tritici) isolates collected from a single wheat field. Phytopathology 80:1368-1373. McDonald BA, McDermott JM (1993). Population genetics of plant pathogenic fungi.

  1. Production and cytomolecular identification of new wheat-perennial rye (Secale cereanum) disomic addition lines with yellow rust resistance (6R) and increased arabinoxylan and protein content (1R, 4R, 6R).

    Science.gov (United States)

    Schneider, Annamária; Rakszegi, Marianna; Molnár-Láng, Márta; Szakács, Éva

    2016-05-01

    Wheat-Secale cereanum addition lines with yellow rust resistance (6R) and increased arabinoxylan content (1R, 4R, 6R) have been selected and identified in order to increase biodiversity of wheat. Perennial rye (Secale cereanum, 2n = 2x = 14, RR) cultivar Kriszta has a large gene pool that can be exploited in wheat breeding. It has high protein and dietary fibre content, carries several resistance genes, tolerant to frost and drought, and adapts well to disadvantageous soil and weather conditions. In order to incorporate agronomically useful features from this perennial rye into cultivated wheat, backcross progenies derived from a cross between the wheat line Mv9kr1 and perennial rye 'Kriszta' have been produced, and addition lines disomic for 1R, 4R and 6R chromosomes have been selected using GISH, FISH and SSR markers. Quality measurements showed that addition of 'Kriszta' chromosomes 4R and 6R to the wheat genome had increased the total protein content. The 4R addition line contained slightly, while 1R and 6R additions significantly higher amount of arabinoxylan than the parental wheat line. Besides this, the 6R addition line appeared to be resistant to yellow rust in highly infected nurseries, consequently it may carry a new effective gene different from that harboured in the 1RS.1BL translocation for resistance to this disease.

  2. Development and Molecular Cytogenetic Identification of a Novel Wheat-Leymus mollis Lm#7Ns (7D Disomic Substitution Line with Stripe Rust Resistance.

    Directory of Open Access Journals (Sweden)

    Xiaofei Yang

    Full Text Available Leymus mollis (2n = 4x = 28, NsNsXmXm possesses novel and important genes for resistance against multi-fungal diseases. The development of new wheat-L. mollis introgression lines is of great significance for wheat disease resistance breeding. M11003-3-1-15-8, a novel disomic substitution line of common wheat cv. 7182 -L. mollis, developed and selected from the BC1F5 progeny between wheat cv. 7182 and octoploid Tritileymus M47 (2n = 8x = 56, AABBDDNsNs, was characterized by morphological and cytogenetic identification, analysis of functional molecular markers, genomic in situ hybridization (GISH, sequential fluorescence in situ hybridization (FISH-genomic in situ hybridization (GISH and disease resistance evaluation. Cytological observations suggested that M11003-3-1-15-8 contained 42 chromosomes and formed 21 bivalents at meiotic metaphase I. The GISH investigations showed that line contained 40 wheat chromosomes and a pair of L. mollis chromosomes. EST-STS multiple loci markers and PLUG (PCR-based Landmark Unique Gene markers confirmed that the introduced L. mollis chromosomes belonged to homoeologous group 7, it was designated as Lm#7Ns. While nulli-tetrasomic and sequential FISH-GISH analysis using the oligonucleotide Oligo-pSc119.2 and Oligo-pTa535 as probes revealed that the wheat 7D chromosomes were absent in M11003-3-1-15-8. Therefore, it was deduced that M11003-3-1-15-8 was a wheat-L. mollis Lm#7Ns (7D disomic substitution line. Field disease resistance demonstrated that the introduced L. mollis chromosomes Lm#7Ns were responsible for the stripe rust resistance at the adult stage. Moreover, M11003-3-1-15-8 had a superior numbers of florets. The novel disomic substitution line M11003-3-1-15-8, could be exploited as an important genetic material in wheat resistance breeding programs and genetic resources.

  3. Effect of foliar fertilizer and fungicidal protection against leaf spot diseases on winter wheat

    Directory of Open Access Journals (Sweden)

    Agnieszka Mączyńska

    2012-12-01

    Full Text Available Field experiments were carried out in the seasons 2000/2001 and 2001/2002 in Plant Protection Institute, Sooenicowice Branch to assess the influence of foliar fertilizers such as Ekolist PK 1, Ekolist Mg, Mikrosol Z and Urea on healthiness of winter wheat. Foliar fertilizers were mixed with fungicides. The fungicides were applied at full or half recommended doses. The effect of the disease on wheat leaves was evaluated three times in each vegetation season. Remaining green leaf area (GLA of leaves was also determined. GLA of the leaves F-1 was not significantly different for each combination with different fertilization and different levels of chemical treatment. The application of foliar fertilizer only had no effect on green leaf area (GLA. The results indicate that foliar fertilization of all experimental plots improved leaf condition and therefore halted the development of wheat leaf diseases. The increases of 1000 grain mass and yield was high for each plot where a fertilizer and a full or half dose of a fungicide was applied. Foliar fertilizing with no chemical control had no proven effect on studied parameters.

  4. Using hierarchical clustering of secreted protein families to classify and rank candidate effectors of rust fungi.

    Science.gov (United States)

    Saunders, Diane G O; Win, Joe; Cano, Liliana M; Szabo, Les J; Kamoun, Sophien; Raffaele, Sylvain

    2012-01-01

    Rust fungi are obligate biotrophic pathogens that cause considerable damage on crop plants. Puccinia graminis f. sp. tritici, the causal agent of wheat stem rust, and Melampsora larici-populina, the poplar leaf rust pathogen, have strong deleterious impacts on wheat and poplar wood production, respectively. Filamentous pathogens such as rust fungi secrete molecules called disease effectors that act as modulators of host cell physiology and can suppress or trigger host immunity. Current knowledge on effectors from other filamentous plant pathogens can be exploited for the characterisation of effectors in the genome of recently sequenced rust fungi. We designed a comprehensive in silico analysis pipeline to identify the putative effector repertoire from the genome of two plant pathogenic rust fungi. The pipeline is based on the observation that known effector proteins from filamentous pathogens have at least one of the following properties: (i) contain a secretion signal, (ii) are encoded by in planta induced genes, (iii) have similarity to haustorial proteins, (iv) are small and cysteine rich, (v) contain a known effector motif or a nuclear localization signal, (vi) are encoded by genes with long intergenic regions, (vii) contain internal repeats, and (viii) do not contain PFAM domains, except those associated with pathogenicity. We used Markov clustering and hierarchical clustering to classify protein families of rust pathogens and rank them according to their likelihood of being effectors. Using this approach, we identified eight families of candidate effectors that we consider of high value for functional characterization. This study revealed a diverse set of candidate effectors, including families of haustorial expressed secreted proteins and small cysteine-rich proteins. This comprehensive classification of candidate effectors from these devastating rust pathogens is an initial step towards probing plant germplasm for novel resistance components.

  5. Using hierarchical clustering of secreted protein families to classify and rank candidate effectors of rust fungi.

    Directory of Open Access Journals (Sweden)

    Diane G O Saunders

    Full Text Available Rust fungi are obligate biotrophic pathogens that cause considerable damage on crop plants. Puccinia graminis f. sp. tritici, the causal agent of wheat stem rust, and Melampsora larici-populina, the poplar leaf rust pathogen, have strong deleterious impacts on wheat and poplar wood production, respectively. Filamentous pathogens such as rust fungi secrete molecules called disease effectors that act as modulators of host cell physiology and can suppress or trigger host immunity. Current knowledge on effectors from other filamentous plant pathogens can be exploited for the characterisation of effectors in the genome of recently sequenced rust fungi. We designed a comprehensive in silico analysis pipeline to identify the putative effector repertoire from the genome of two plant pathogenic rust fungi. The pipeline is based on the observation that known effector proteins from filamentous pathogens have at least one of the following properties: (i contain a secretion signal, (ii are encoded by in planta induced genes, (iii have similarity to haustorial proteins, (iv are small and cysteine rich, (v contain a known effector motif or a nuclear localization signal, (vi are encoded by genes with long intergenic regions, (vii contain internal repeats, and (viii do not contain PFAM domains, except those associated with pathogenicity. We used Markov clustering and hierarchical clustering to classify protein families of rust pathogens and rank them according to their likelihood of being effectors. Using this approach, we identified eight families of candidate effectors that we consider of high value for functional characterization. This study revealed a diverse set of candidate effectors, including families of haustorial expressed secreted proteins and small cysteine-rich proteins. This comprehensive classification of candidate effectors from these devastating rust pathogens is an initial step towards probing plant germplasm for novel resistance components.

  6. Response of Winter Wheat (Triticum Aestivum L.) Canopy, Leaf Chlorophyll, and Yield to Nitrogen Fertilizer Application Methods

    National Research Council Canada - National Science Library

    S.K. Mousavi; M. Faizian; A. A. Ahmadi

    2011-01-01

    Abstract In order to evaluate the effect of different nitrogen application methods on wheat canopy, leaf chlorophyll, and yield, a field experiment with a split plot arrangement in complete randomized...

  7. Resistance of Some Iraqi Bread Wheat Cultivars to Puccinia triticina

    Directory of Open Access Journals (Sweden)

    E.M. Al-Maaroof

    2005-12-01

    Full Text Available Brown rust (leaf rust caused by Puccinia triticina is one of the most serious diseases of wheat worldwide. In Iraq the occurrence and distribution of brown rust is more regular and uniform than that of other wheat rusts. with yield losses as high as 44% on susceptible wheat cultivars in commercial fields. Recently several promising wheat (Triticum aestivum cultivars with different levels of rust resistance have been released in Iraq. The present work was conducted to postulate the resistance genes in twenty-two Iraqi bread wheat cultivars by testing them with thirteen Mexican races of P. triticina. ‘Thatcher’ near-isogenic lines were used as testers for known resistance genes. Ten day old seedling sets were artificially inoculated with each race, and the infection type was recorded ten days later. Field reactions of the cultivars with the predominantly Iraqi races were determined under field conditions for three years. Results revealed that the Iraqi wheat cultivars possessed brown rust resistance genes Lr1, 3, 10, 13, 16, 17, 23 and 26, either alone or in various combinations. The presence of unknown resistance genes was also postulated in some cultivars. Lr23, derived from Triticum turgidum var. durum, was present in 23% of tested cultivars, whereas Lr13 was present in 18%. The presence of Lr26 in ‘Al-Nour’ and ‘Hashemia’ indicated that they carried the 1BL.1RS wheat-rye translocation. ‘Al-Melad’ displayed resistant reactions to all races used in the study. ‘Tamuz 3’ and ‘Al- Nour’ displayed high adult-plant resistance to P. triticina in the field.

  8. Comparative genomics of Australian isolates of the wheat stem rust pathogen Puccinia graminis f. sp. tritici reveals extensive polymorphism in candidate effector genes

    Directory of Open Access Journals (Sweden)

    Narayana Mithur Upadhyaya

    2015-01-01

    Full Text Available The wheat stem rust fungus Puccinia graminis f. sp. tritici (Pgt, is one of the most destructive pathogens of wheat. In this study, a draft genome was built for a founder Australian Pgt isolate of pathotype (pt. 21-0 (collected in 1954 by next generation DNA sequencing. A combination of reference-based assembly using the genome of the previously sequenced American Pgt isolate CDL 75-36-700-3 (p7a and de novo assembly were performed resulting in a 92 Mbp reference genome for Pgt isolate 21-0. Approximately 13 Mbp of de novo assembled sequence in this genome is not present in the p7a reference assembly. This novel sequence is not specific to 21-0 as it is also present in three other Pgt rust isolates of independent origin.The new reference genome was subsequently used to build a pan-genome based on five Australian Pgt isolates. Transcriptomes from germinated urediniospores and haustoria were separately assembled for pt. 21-0 and comparison of gene expression profiles showed differential expression in ~10% of the genes each in germinated spores and haustoria. A total of 1,924 secreted proteins were predicted from the 21-0 transcriptome, of which 520 were classified as haustorial secreted proteins (HSPs. Comparison of 21-0 with two presumed clonal field derivatives of this lineage (collected in 1982 and 1984 that had evolved virulence on four additional resistance genes (Sr5, Sr11, Sr27, SrSatu identified mutations in 25 HSP effector candidates, some of which could explain their novel virulence phenotypes.

  9. Next generation sequencing provides rapid access to the genome of Puccinia striiformis f. sp. tritici, the causal agent of wheat stripe rust.

    Directory of Open Access Journals (Sweden)

    Dario Cantu

    Full Text Available BACKGROUND: The wheat stripe rust fungus (Puccinia striiformis f. sp. tritici, PST is responsible for significant yield losses in wheat production worldwide. In spite of its economic importance, the PST genomic sequence is not currently available. Fortunately Next Generation Sequencing (NGS has radically improved sequencing speed and efficiency with a great reduction in costs compared to traditional sequencing technologies. We used Illumina sequencing to rapidly access the genomic sequence of the highly virulent PST race 130 (PST-130. METHODOLOGY/PRINCIPAL FINDINGS: We obtained nearly 80 million high quality paired-end reads (>50x coverage that were assembled into 29,178 contigs (64.8 Mb, which provide an estimated coverage of at least 88% of the PST genes and are available through GenBank. Extensive micro-synteny with the Puccinia graminis f. sp. tritici (PGTG genome and high sequence similarity with annotated PGTG genes support the quality of the PST-130 contigs. We characterized the transposable elements present in the PST-130 contigs and using an ab initio gene prediction program we identified and tentatively annotated 22,815 putative coding sequences. We provide examples on the use of comparative approaches to improve gene annotation for both PST and PGTG and to identify candidate effectors. Finally, the assembled contigs provided an inventory of PST repetitive elements, which were annotated and deposited in Repbase. CONCLUSIONS/SIGNIFICANCE: The assembly of the PST-130 genome and the predicted proteins provide useful resources to rapidly identify and clone PST genes and their regulatory regions. Although the automatic gene prediction has limitations, we show that a comparative genomics approach using multiple rust species can greatly improve the quality of gene annotation in these species. The PST-130 sequence will also be useful for comparative studies within PST as more races are sequenced. This study illustrates the power of NGS for

  10. Leaf expansion and biomass allocation in wild wheat (Aegilops) species

    NARCIS (Netherlands)

    Bultynck, L.J.A. (Lieve Jenny Alfons)

    2001-01-01

    Fast expansion of leaf area is an important trait to select for in cereal crop species, especially in arid environments. It is associated with higher crop water-use efficiency, higher above-ground biomass production and yield, and increased competitive ability. This thesis examined the physiological

  11. Evaluation of triticale accessions for resistance to wheat bacterial leaf streak caused by Xanthomonas translucens pv. undulosa

    Science.gov (United States)

    The bacterium Xanthomonas translucens pv. undulosa (Xtu) causes bacterial leaf streak (BLS) on wheat and other small grains. Several triticale accessions were reported to possess high levels of resistance to wheat Xtu strains. In this study, we evaluated a worldwide collection of 502 triticale acces...

  12. A change in temperature modulates defence to yellow (stripe) rust in wheat line UC1041 independently of resistance gene Yr36.

    Science.gov (United States)

    Bryant, Ruth R M; McGrann, Graham R D; Mitchell, Alice R; Schoonbeek, Henk-Jan; Boyd, Lesley A; Uauy, Cristobal; Dorling, Steve; Ridout, Christopher J

    2014-01-08

    Rust diseases are of major importance in wheat production worldwide. With the constant evolution of new rust strains and their adaptation to higher temperatures, consistent and durable disease resistance is a key challenge. Environmental conditions affect resistance gene performance, but the basis for this is poorly understood. Here we show that a change in day temperature affects wheat resistance to Puccinia striiformis f. sp tritici (Pst), the causal agent of yellow (or stripe) rust. Using adult plants of near-isogenic lines UC1041 +/- Yr36, there was no significant difference between Pst percentage uredia coverage in plants grown at day temperatures of 18°C or 25°C in adult UC1041 + Yr36 plants. However, when plants were transferred to the lower day temperature at the time of Pst inoculation, infection increased up to two fold. Interestingly, this response was independent of Yr36, which has previously been reported as a temperature-responsive resistance gene as Pst development in adult UC1041 -Yr36 plants was similarly affected by the plants experiencing a temperature reduction. In addition, UC1041 -Yr36 plants grown at the lower temperature then transferred to the higher temperature were effectively resistant and a temperature change in either direction was shown to affect Pst development up to 8 days prior to inoculation. Results for seedlings were similar, but more variable compared to adult plants. Enhanced resistance to Pst was observed in seedlings of UC1041 and the cultivar Shamrock when transferred to the higher temperature. Resistance was not affected in seedlings of cultivar Solstice by a temperature change in either direction. Yr36 is effective at 18°C, refining the lower range of temperature at which resistance against Pst is conferred compared to previous studies. Results reveal previously uncharacterised defence temperature sensitivity in the UC1041 background which is caused by a change in temperature and independently of Yr36. This novel

  13. [Effects of nitrogen fertilization on wheat leaf photosynthesis under elevated atmospheric CO2 concentration].

    Science.gov (United States)

    Yu, Xian-feng; Zhang, Xu-cheng; Guo, Tian-wen; Yu, Jia

    2010-09-01

    In this paper, the effects of nitrogen (N) fertilization on the wheat leaf photosynthesis under long-term elevated atmospheric CO2 concentration (760 micromol x mol(-1)) was studied, based on the measurements of photosynthetic gas exchange parameters and light intensity-photosynthetic rate response curves at jointing stage. Under the long-term elevated atmospheric CO2 concentration, applying sufficient N could increase the wheat leaf photosynthetic rate (Pn), transpiration rate (Tr), and instantaneous water use efficiency (WUEi). Comparing with those under ambient atmospheric CO2 concentration, the Po and WUEi under the elevated atmospheric CO2 concentration increased, while the stomatal conductance (Gs) and intercellular CO2 concentration (Ci) decreased. With the increase of light flux intensity, the Pn and WUEi under the elevated atmospheric CO2 concentration were higher those under ambient atmospheric CO2 concentration, Gs was in adverse, while Ci and Tr had less change. At high fertilization rate of N, the Gs was linearly positively correlated with Pn, Tr, and WUEi, and the Gs and Ci had no correlation with each other under the elevated atmospheric CO2 concentration but negatively correlated under ambient atmospheric CO2 concentration. At low fertilization rate of N, the Gs had no correlations with Pn and WUEi but linearly positively correlated with Ci and Tr. It was suggested that under the elevated atmospheric CO2 concentration, the wheat leaf Pn at low N fertilization rate was limited by non-stomatal factor.

  14. Effects of planting density and the composition of wheat cultivar mixtures on stripe rust: an analysis taking into account limits to the replication of controls.

    Science.gov (United States)

    Garrett, K A; Mundt, C C

    2000-12-01

    ABSTRACT The effect of plant density on disease is not well understood in populations of a single host plant genotype and has been studied even less in mixtures of host genotypes. We performed an experiment to evaluate the effect of wheat planting density on infection by Puccinia striiformis in experimental plots with a single wheat genotype and in plots with two genotypes making up a range of frequencies. Stripe rust severity in single-genotype plots increased with planting density in 1997 but decreased with planting density in 1998. Disease in host mixtures was compared to the weighted mean of disease levels in the corresponding single-genotype plots. The design of the field experiment included limited replication of these reference treatments (that is, there was not a unique pair of single-genotype plots for each mixture plot); therefore, we devised an analysis based on collapsing the data into independent mean observations. Disease reduction due to host diversity was less when one genotype predominated than when both host genotypes were present at nearly equal frequencies. The greatest mean host-diversity effect for reduced disease was at the intermediate planting density of 250 seeds per m(2).

  15. Characterization of the Wheat Leaf Metabolome during Grain Filling and under Varied N-Supply

    Directory of Open Access Journals (Sweden)

    Elmien Heyneke

    2017-11-01

    Full Text Available Progress in improving crop growth is an absolute goal despite the influence multifactorial components have on crop yield and quality. An Avalon × Cadenza doubled-haploid wheat mapping population was used to study the leaf metabolome of field grown wheat at weekly intervals during the time in which the canopy contributes to grain filling, i.e., from anthesis to 5 weeks post-anthesis. Wheat was grown under four different nitrogen supplies reaching from residual soil N to a luxury over-fertilization (0, 100, 200, and 350 kg N ha−1. Four lines from a segregating doubled haploid population derived of a cross of the wheat elite cvs. Avalon and Cadenza were chosen as they showed pairwise differences in either N utilization efficiency (NUtE or senescence timing. 108 annotated metabolites of primary metabolism and ions were determined. The analysis did not provide genotype specific markers because of a remarkable stability of the metabolome between lines. We speculate that the reason for failing to identify genotypic markers might be due to insufficient genetic diversity of the wheat parents and/or the known tendency of plants to keep metabolome homeostasis even under adverse conditions through multiple adaptations and rescue mechanism. The data, however, provided a consistent catalogue of metabolites and their respective responses to environmental and developmental factors and may bode well for future systems biology approaches, and support plant breeding and crop improvement.

  16. Characterization of a wheat HSP70 gene and its expression in response to stripe rust infection and abiotic stresses

    NARCIS (Netherlands)

    Duan, Y.H.; Guo, J.; Ding, K.; Wang, S.J.; Zhang, H.; Dai, X.W.; Chen, Y.Y.; Govers, F.; Huang, L.L.; Kang, Z.S.

    2011-01-01

    Members of the family of 70-kD heat shock proteins (HSP70 s) play various stress-protective roles in plants. In this study, a wheat HSP70 gene was isolated from a suppression subtractive hybridization (SSH) cDNA library of wheat leaves infected by Puccinia striiformis f. sp. tritici. The gene, that

  17. TaRAR1 and TaSGT1 associate with TaHsp90 to function in bread wheat (Triticum aestivum L.) seedling growth and stripe rust resistance.

    Science.gov (United States)

    Wang, Guan-Feng; Fan, Renchun; Wang, Xianping; Wang, Daowen; Zhang, Xiangqi

    2015-04-01

    RAR1 and SGT1 are important co-chaperones of Hsp90. We previously showed that TaHsp90.1 is required for wheat seedling growth, and that TaHsp90.2 and TaHsp90.3 are essential for resistance (R) gene mediated resistance to stripe rust fungus. Here, we report the characterization of TaRAR1 and TaSGT1 genes in bread wheat. TaRAR1 and TaSGT1 each had three homoeologs, which were located on wheat groups 2 and 3 chromosomes, respectively. Strong inhibition of seedling growth was observed after silencing TaSGT1 but not TaRAR1. In contrast, decreasing the expression of TaRAR1 or TaSGT1 could all compromise R gene mediated resistance to stripe rust fungus infection. Protein-protein interactions were found among TaRAR1, TaSGT1 and TaHsp90. The N-terminus of TaHsp90, the CHORD-I and CHORD-II domains of TaRAR1 and the CS domain of TaSGT1 may be instrumental for the interactions among the three proteins. Based on this work and our previous study on TaHsp90, we speculate that the TaSGT1-TaHsp90.1 interaction is important for maintaining bread wheat seedling growth. The TaRAR1-TaSGT1-TaHsp90.2 and TaRAR1-TaSGT1-TaHsp90.3 interactions are involved in controlling the resistance to stripe rust disease. The new information obtained here should aid further functional investigations of TaRAR1-TaSGT1-TaHsp90 complexes in regulating bread wheat growth and disease resistance.

  18. Using hierarchical clustering of secreted protein families to classify and rank candidate effectors of rust fungi

    Science.gov (United States)

    Rust fungi are obligate biotrophic pathogens causing considerable damage on crop plants. P. graminis f. sp. tritici, the causal agent of wheat stem rust, and M. larici-populina, the poplar rust pathogen, have strong deleterious impact on wheat and poplar wood production, respectively. The recently r...

  19. Spatial prediction of wheat Septoria leaf blotch (Septoria tritici) disease severity in central Ethiopia

    Science.gov (United States)

    Wakie, Tewodros; Kumar, Sunil; Senay, Gabriel; Takele, Abera; Lencho, Alemu

    2016-01-01

    A number of studies have reported the presence of wheat septoria leaf blotch (Septoria tritici; SLB) disease in Ethiopia. However, the environmental factors associated with SLB disease, and areas under risk of SLB disease, have not been studied. Here, we tested the hypothesis that environmental variables can adequately explain observed SLB disease severity levels in West Shewa, Central Ethiopia. Specifically, we identified 50 environmental variables and assessed their relationships with SLB disease severity. Geographically referenced disease severity data were obtained from the field, and linear regression and Boosted Regression Trees (BRT) modeling approaches were used for developing spatial models. Moderate-resolution imaging spectroradiometer (MODIS) derived vegetation indices and land surface temperature (LST) variables highly influenced SLB model predictions. Soil and topographic variables did not sufficiently explain observed SLB disease severity variation in this study. Our results show that wheat growing areas in Central Ethiopia, including highly productive districts, are at risk of SLB disease. The study demonstrates the integration of field data with modeling approaches such as BRT for predicting the spatial patterns of severity of a pathogenic wheat disease in Central Ethiopia. Our results can aid Ethiopia's wheat disease monitoring efforts, while our methods can be replicated for testing related hypotheses elsewhere.

  20. MALDI-MS Imaging Analysis of Fungicide Residue Distributions on Wheat Leaf Surfaces.

    Science.gov (United States)

    Annangudi, Suresh P; Myung, Kyung; Avila Adame, Cruz; Gilbert, Jeffrey R

    2015-05-05

    Improved retention and distribution of agrochemicals on plant surfaces is an important attribute in the biological activity of pesticide. Although retention of agrochemicals on plants after spray application can be quantified using traditional analytical techniques including LC or GC, the spatial distribution of agrochemicals on the plants surfaces has received little attention. Matrix assisted laser desorption/ionization (MALDI) imaging technology has been widely used to determine the distribution of proteins, peptides and metabolites in different tissue sections, but its application to environmental research has been limited. Herein, we probed the potential utility of MALDI imaging in characterizing the distribution of three commercial fungicides on wheat leaf surfaces. Using this MALDI imaging method, we were able to detect 500 ng of epoxiconazole, azoxystrobin, and pyraclostrobin applied in 1 μL drop on the leaf surfaces using MALDI-MS. Subsequent dilutions of pyraclostrobin revealed that the compound can be chemically imaged on the leaf surfaces at levels as low as 60 ng of total applied in the area of 1 μL droplet. After application of epoxiconazole, azoxystrobin, and pyraclostrobin at a field rate of 100 gai/ha in 200 L water using a track sprayer system, residues of these fungicides on the leaf surfaces were sufficiently visualized. These results suggest that MALDI imaging can be used to monitor spatial distribution of agrochemicals on leaf samples after pesticide application.

  1. Wheat production performance in response to nitrogen sidedressing and molybdenum leaf application

    Directory of Open Access Journals (Sweden)

    José Henrique Bizzarri Bazzo

    2016-10-01

    Full Text Available The application of nitrogen (N at the appropriate time can be effective for crop productivity, changing the grain yield by increasing yield components. Thus, new alternatives that enable a better application of N fertilizer are sought. The aim of this study was to evaluate the components of yield and productivity of wheat cultivated with different doses of N sidedressing and molybdenum (Mo via leaf application, using two cultivars, CD 150 and Quartzo. The experiment was conducted in the crop years of 2013 and 2014. The experiment used a randomized, factorial 4 x 4 block design, with four replicates. Four doses of N sidedressing in the form of urea were applied (0, 30, 60, and 90 kg ha-1 during tillering. In the same period, leaf molybdic fertilizer was applied, using four dosages of Mo in the form of potassium molybdate (0, 20, 40, and 60 g ha-1. Grain number per ear (GNPE, 1,000-grain mass (TGM, hectoliter weight (HW, and grain productivity (PROD were evaluated. N fertilizer sidedressing did not promote the yield components of either of the wheat cultivars, although the GNPE of the Quartzo cultivar increased with increasing N doses in both crop years. The increase in N fertilizer increased the PROD of both wheat cultivars. The foliar application of Mo did not promote the yield components or wheat PROD of either cultivar. The HW was influenced by N and Mo rates, and was reduced in the absence of either of these fertilizer elements, indicating that the two nutrients were dependent on each other.

  2. Characterization of a pathogenesis-related thaumatin-like protein gene TaPR5 from wheat induced by stripe rust fungus.

    Science.gov (United States)

    Wang, Xiaojie; Tang, Chunlei; Deng, Lin; Cai, Gaolei; Liu, Xinying; Liu, Bo; Han, Qingmei; Buchenauer, Heinrich; Wei, Guorong; Han, Dejun; Huang, Lili; Kang, Zhensheng

    2010-05-01

    Pathogenesis-related (PR) proteins, induced in plants in response to various biotic and abiotic stresses, have been assumed to play a role in plant defense system. Proteins of the PR5 family, also named thaumatin-like proteins (TLPs), have been detected in numerous plant species. In this research, a novel PR5 gene, designated as TaPR5, was isolated and characterized from wheat leaves (cv. Suwon 11) infected by the stripe rust pathotype CY23 (incompatible interaction) using the rapid amplification of cDNA ends (RACE). TaPR5 was predicted to encode a protein of 173 amino acids with an estimated molecular mass of 17.6 kDa and a theoretical pI of 4.64. The deduced amino acid sequence of TaPR5 showed a significant sequence similarity with PR5 and TLPs from barley and other plants and contained a putative signal peptide at the amino terminus. Southern blot analysis indicated that TaPR5 is coded by a single-copy gene. Quantitative real-time polymerase chain reaction (qRT-PCR) analyses revealed that TaPR5 transcript is significantly induced and upregulated in the incompatible interaction while in the compatible interaction a relative low level of the transcript was detected. TaPR5 was also induced by phytohormones (SA, JA and ABA) and stress stimuli (wounding, cold temperature and high salinity). Using an assay of onion epidermal cells indicated accumulation of TaPR5 protein in the apoplast. The immunocytochemical method showed that the TaPR5 protein was detected on cell walls of wheat leaves in the incompatible interaction at markedly higher labeling density compared with the compatible interaction.

  3. Recovery and virulence phenotyping of the historic 'Stubbs Collection' of the yellow rust fungus Puccinia striiformis from wheat

    DEFF Research Database (Denmark)

    Thach, T.; Ali, S.; Justesen, A. F.

    2015-01-01

    undetected virulence. A new method for recovery using an airbrush sprayer and Novec™ 7100 for inoculating the host plants was highly successful. Ninety-six percent of 231 isolates were recovered. Virulence phenotyping was done using differential sets of wheat genotypes representing specific-resistance genes...... of updated and more informative wheat-differential sets. The remaining 35 isolates showed discrepancies for one or more virulences when compared with past results. Additional virulences corresponding to Yr17, Yr25 and Yr27, respectively, which were not assayed originally, were discovered. The value...

  4. Characterization of derivatives from wheat-Thinopyrum wide crosses.

    Science.gov (United States)

    Fedak, G; Han, F

    2005-01-01

    Partial amphiploids are lines that contain 42 (38-42) wheat and 14 (14-18) alien chromosomes. They are derived by backcrossing wheat onto hybrids between wheat and either Thinopyrum intermedium (6x) or Th. ponticum (10x). GISH analysis has shown that, with possibly one exception, the alien genomes (chromosome sets) in partial amphiploids are found to be hybrids i.e. composed of chromosomes from more than one alien genome. The individual partial amphiploids are meiotically stable and nearly perfectly fertile, but hybrids between different lines were characterized by varying numbers of unpaired chromosomes and consequently variable degrees of sterility. Translocated chromosomes involving different Thinopyrum genomes or Thinopyrum and wheat genomes were found in partial amphiploids and consequently in the addition lines derived from them. Partial amphiploids have proven to be an excellent tertiary gene pool for wheat improvement, containing resistance to biotic stresses not present in wheat itself. Resistance to Barley Yellow Dwarf Virus (BYDV) and Wheat Streak Mosaic Virus (WSMV) have been found in partial amphiploids and addition lines derived from both Th. intermedium and Th. ponticum. Excellent resistance to Fusarium head blight has been found on a Th. intermedium chromosome that had substituted for chromosome 2D in wheat. Genes for resistance to leaf rust and stem rust have already been incorporated into wheat and tagged with molecular markers. Copyright 2005 S. Karger AG, Basel.

  5. Identification, Characterization and Full-Length Sequence Analysis of a Novel Polerovirus Associated with Wheat Leaf Yellowing Disease

    Directory of Open Access Journals (Sweden)

    Peipei Zhang

    2017-09-01

    Full Text Available To identify the pathogens responsible for leaf yellowing symptoms on wheat samples collected from Jinan, China, we tested for the presence of three known barley/wheat yellow dwarf viruses (BYDV-GAV, -PAV, WYDV-GPV (most likely pathogens using RT-PCR. A sample that tested negative for the three viruses was selected for small RNA sequencing. Twenty-five million sequences were generated, among which 5% were of viral origin. A novel polerovirus was discovered and temporarily named wheat leaf yellowing-associated virus (WLYaV. The full genome of WLYaV corresponds to 5,772 nucleotides (nt, with six AUG-initiated open reading frames, one non-AUG-initiated open reading frame, and three untranslated regions, showing typical features of the family Luteoviridae. Sequence comparison and phylogenetic analyses suggested that WLYaV had the closest relationship with sugarcane yellow leaf virus (ScYLV, but the identities of full genomic nucleotides and deduced amino acid sequence of coat protein (CP were 64.9 and 86.2%, respectively, below the species demarcation thresholds (90% in the family Luteoviridae. Furthermore, agroinoculation of Nicotiana benthamiana leaves with a cDNA clone of WLYaV caused yellowing symptoms on the plant. Our study adds a new polerovirus that is associated with wheat leaf yellowing disease, which would help to identify and control pathogens of wheat.

  6. Influence of leaf tolerance mechanisms and rain on boron toxicity in barley and wheat.

    Science.gov (United States)

    Reid, Rob; Fitzpatrick, Kate

    2009-09-01

    Boron (B) toxicity is common in many areas of the world. Plant tolerance to high B varies widely and has previously been attributed to reduced uptake of B, most commonly as a result of B efflux from roots. In this study, it is shown that the expression of genes encoding B efflux transporters in leaves of wheat (Triticum aestivum) and barley (Hordeum vulgare) is associated with an ability of leaf tissues to withstand higher concentrations of B. In tolerant cultivars, necrosis in leaves occurred at B concentrations more than 2-fold higher than in sensitive cultivars. It is hypothesized that this leaf tolerance is achieved via redistribution of B by efflux transporters from sensitive symplastic compartments into the leaf apoplast. Measurements of B concentrations in leaf protoplasts, and of B released following infiltration of leaves, support this hypothesis. It was also shown that under B-toxic conditions, leaching of B from leaves by rain had a strong positive effect on growth of both roots and shoots. Measurements of rates of guttation and the concentration of B in guttation droplets indicated that the impact of guttation on the alleviation of B toxicity would be small.

  7. Influence of Leaf Tolerance Mechanisms and Rain on Boron Toxicity in Barley and Wheat1[C

    Science.gov (United States)

    Reid, Rob; Fitzpatrick, Kate

    2009-01-01

    Boron (B) toxicity is common in many areas of the world. Plant tolerance to high B varies widely and has previously been attributed to reduced uptake of B, most commonly as a result of B efflux from roots. In this study, it is shown that the expression of genes encoding B efflux transporters in leaves of wheat (Triticum aestivum) and barley (Hordeum vulgare) is associated with an ability of leaf tissues to withstand higher concentrations of B. In tolerant cultivars, necrosis in leaves occurred at B concentrations more than 2-fold higher than in sensitive cultivars. It is hypothesized that this leaf tolerance is achieved via redistribution of B by efflux transporters from sensitive symplastic compartments into the leaf apoplast. Measurements of B concentrations in leaf protoplasts, and of B released following infiltration of leaves, support this hypothesis. It was also shown that under B-toxic conditions, leaching of B from leaves by rain had a strong positive effect on growth of both roots and shoots. Measurements of rates of guttation and the concentration of B in guttation droplets indicated that the impact of guttation on the alleviation of B toxicity would be small. PMID:19625636

  8. 75 FR 29191 - Black Stem Rust; Additions of Rust-Resistant Varieties

    Science.gov (United States)

    2010-05-25

    ... by a fungus that reduces the quality and yield of infected wheat, oat, barley, and rye crops. In... to the list of rust-resistant Mahonia species or cultivars. The nursery and floriculture industries... determined to be rust-resistant. The introduction and spread of plant pests can result in damage to crops and...

  9. LEAF AREA INDEX IN WINTER WHEAT: RESPONSE ON SEED RATE AND NITROGEN APPLICATION BY DIFFERENT VARIETIES

    Directory of Open Access Journals (Sweden)

    M BAVEC

    2007-12-01

    Full Text Available The most important photosynthesis acceptor – leaf area vary among cultivation measures and it is limited factor for creating exact growth models in common winter wheat. The objective of this study was to investigate changes of leaf area index (LAI affected by agricultural treatments – 4 sowing rates and 9 nitrogen treatments based on fertilising rates, target values based on soil mineral nitrogen and plant sap tests target values including different varieties. Increasing sowing rates from 350 to 800 viable seeds m-2 increased LAI at EC 75 stage from 2.9 to 5.5, where LAI 4.1 at 500 seeds m-2 did not vary between lower and higher rates; also at EC 85 stage LAIs did not differ significantly. At EC 75 stage LAI differed among control and nitrogen treatments from 1.0 to 6.5 and at EC 85 stage from 0.1 to 2.4, with differences in interaction among varieties. Higher nitrogen rates for first and second top dressing increased LAI in both stages compared without dressing treatments. Due to significant differences among LAI as consequence of production system, we suggest to take this into account in every prediction and modelling of growth in winter wheat.

  10. Comparison of Leaf Sheath Transcriptome Profiles with Physiological Traits of Bread Wheat Cultivars under Salinity Stress.

    Directory of Open Access Journals (Sweden)

    Fuminori Takahashi

    Full Text Available Salinity stress has significant negative effects on plant biomass production and crop yield. Salinity tolerance is controlled by complex systems of gene expression and ion transport. The relationship between specific features of mild salinity stress adaptation and gene expression was analyzed using four commercial varieties of bread wheat (Triticum aestivum that have different levels of salinity tolerance. The high-throughput phenotyping system in The Plant Accelerator at the Australian Plant Phenomics Facility revealed variation in shoot relative growth rate and salinity tolerance among the four cultivars. Comparative analysis of gene expression in the leaf sheaths identified genes whose functions are potentially linked to shoot biomass development and salinity tolerance. Early responses to mild salinity stress through changes in gene expression have an influence on the acquisition of stress tolerance and improvement in biomass accumulation during the early "osmotic" phase of salinity stress. In addition, results revealed transcript profiles for the wheat cultivars that were different from those of usual stress-inducible genes, but were related to those of plant growth. These findings suggest that, in the process of breeding, selection of specific traits with various salinity stress-inducible genes in commercial bread wheat has led to adaptation to mild salinity conditions.

  11. Comparison of Leaf Sheath Transcriptome Profiles with Physiological Traits of Bread Wheat Cultivars under Salinity Stress

    KAUST Repository

    Takahashi, Fuminori

    2015-08-05

    Salinity stress has significant negative effects on plant biomass production and crop yield. Salinity tolerance is controlled by complex systems of gene expression and ion transport. The relationship between specific features of mild salinity stress adaptation and gene expression was analyzed using four commercial varieties of bread wheat (Triticum aestivum) that have different levels of salinity tolerance. The high-throughput phenotyping system in The Plant Accelerator at the Australian Plant Phenomics Facility revealed variation in shoot relative growth rate and salinity tolerance among the four cultivars. Comparative analysis of gene expression in the leaf sheaths identified genes whose functions are potentially linked to shoot biomass development and salinity tolerance. Early responses to mild salinity stress through changes in gene expression have an influence on the acquisition of stress tolerance and improvement in biomass accumulation during the early “osmotic” phase of salinity stress. In addition, results revealed transcript profiles for the wheat cultivars that were different from those of usual stress-inducible genes, but were related to those of plant growth. These findings suggest that, in the process of breeding, selection of specific traits with various salinity stress-inducible genes in commercial bread wheat has led to adaptation to mild salinity conditions.

  12. Comparison of Leaf Sheath Transcriptome Profiles with Physiological Traits of Bread Wheat Cultivars under Salinity Stress

    Science.gov (United States)

    Trittermann, Christine; Berger, Bettina; Roy, Stuart J.; Seki, Motoaki; Shinozaki, Kazuo; Tester, Mark

    2015-01-01

    Salinity stress has significant negative effects on plant biomass production and crop yield. Salinity tolerance is controlled by complex systems of gene expression and ion transport. The relationship between specific features of mild salinity stress adaptation and gene expression was analyzed using four commercial varieties of bread wheat (Triticum aestivum) that have different levels of salinity tolerance. The high-throughput phenotyping system in The Plant Accelerator at the Australian Plant Phenomics Facility revealed variation in shoot relative growth rate and salinity tolerance among the four cultivars. Comparative analysis of gene expression in the leaf sheaths identified genes whose functions are potentially linked to shoot biomass development and salinity tolerance. Early responses to mild salinity stress through changes in gene expression have an influence on the acquisition of stress tolerance and improvement in biomass accumulation during the early “osmotic” phase of salinity stress. In addition, results revealed transcript profiles for the wheat cultivars that were different from those of usual stress-inducible genes, but were related to those of plant growth. These findings suggest that, in the process of breeding, selection of specific traits with various salinity stress-inducible genes in commercial bread wheat has led to adaptation to mild salinity conditions. PMID:26244554

  13. Comparison of Leaf Sheath Transcriptome Profiles with Physiological Traits of Bread Wheat Cultivars under Salinity Stress.

    Science.gov (United States)

    Takahashi, Fuminori; Tilbrook, Joanne; Trittermann, Christine; Berger, Bettina; Roy, Stuart J; Seki, Motoaki; Shinozaki, Kazuo; Tester, Mark

    2015-01-01

    Salinity stress has significant negative effects on plant biomass production and crop yield. Salinity tolerance is controlled by complex systems of gene expression and ion transport. The relationship between specific features of mild salinity stress adaptation and gene expression was analyzed using four commercial varieties of bread wheat (Triticum aestivum) that have different levels of salinity tolerance. The high-throughput phenotyping system in The Plant Accelerator at the Australian Plant Phenomics Facility revealed variation in shoot relative growth rate and salinity tolerance among the four cultivars. Comparative analysis of gene expression in the leaf sheaths identified genes whose functions are potentially linked to shoot biomass development and salinity tolerance. Early responses to mild salinity stress through changes in gene expression have an influence on the acquisition of stress tolerance and improvement in biomass accumulation during the early "osmotic" phase of salinity stress. In addition, results revealed transcript profiles for the wheat cultivars that were different from those of usual stress-inducible genes, but were related to those of plant growth. These findings suggest that, in the process of breeding, selection of specific traits with various salinity stress-inducible genes in commercial bread wheat has led to adaptation to mild salinity conditions.

  14. Assessing the ratio of leaf carbon to nitrogen in winter wheat and spring barley based on hyperspectral data

    Science.gov (United States)

    Xu, Xin-gang; Gu, Xiao-he; Song, Xiao-yu; Xu, Bo; Yu, Hai-yang; Yang, Gui-jun; Feng, Hai-kuan

    2016-10-01

    The metabolic status of carbon (C) and nitrogen (N) as two essential elements of crop plants has significant influence on the ultimate formation of yield and quality in crop production. The ratio of carbon to nitrogen (C/N) from crop leaves, defined as ratio of LCC (leaf carbon concentration) to LNC (leaf nitrogen concentration), is an important index that can be used to diagnose the balance between carbon and nitrogen, nutrient status, growth vigor and disease resistance in crop plants. Thus, it is very significant for effectively evaluating crop growth in field to monitor changes of leaf C/N quickly and accurately. In this study, some typical indices aimed at N estimation and chlorophyll evaluation were tested to assess leaf C/N in winter wheat and spring barley. The multi-temporal hyperspectral measurements from the flag-leaf, anthesis, filling, and milk-ripe stages were used to extract these selected spectral indices to estimate leaf C/N in wheat and barley. The analyses showed that some tested indices such as MTCI, MCARI/OSAVI2, and R-M had the better performance of assessing C/N for both of crops. Besides, a mathematic algorithm, Branch-and-Bound (BB) method was coupled with the spectral indices to assess leaf C/N in wheat and barley, and yielded the R2 values of 0.795 for winter wheat, R2 of 0.727 for spring barley, 0.788 for both crops combined. It demonstrates that using hyperspectral data has a good potential for remote assessment of leaf C/N in crops.

  15. Scaling of photosynthesis and constitutive and induced volatile emissions with severity of leaf infection by rust fungus (Melampsora larici-populina) in Populus balsamifera var. suaveolens.

    Science.gov (United States)

    Jiang, Yifan; Ye, Jiayan; Veromann, Linda-Liisa; Niinemets, Ülo

    2016-07-01

    Fungal infections result in decreases in photosynthesis, induction of stress and signaling volatile emissions and reductions in constitutive volatile emissions, but the way different physiological processes scale with the severity of infection is poorly known. We studied the effects of infection by the obligate biotrophic fungal pathogen Melampsora larici-populina Kleb., the causal agent of poplar leaf rust disease, on photosynthetic characteristics, and constitutive isoprene and induced volatile emissions in leaves of Populus balsamifera var. suaveolens (Fisch.) Loudon. exhibiting different degrees of damage. The degree of fungal damage, quantified by the total area of chlorotic and necrotic leaf areas, varied between 0 (noninfected control) and ∼60%. The rates of all physiological processes scaled quantitatively with the degree of visual damage, but the scaling with damage severity was weaker for photosynthetic characteristics than for constitutive and induced volatile release. Over the whole range of damage severity, the net assimilation rate per area (AA) decreased 1.5-fold, dry mass per unit area 2.4-fold and constitutive isoprene emissions 5-fold, while stomatal conductance increased 1.9-fold and dark respiration rate 1.6-fold. The emissions of key stress and signaling volatiles (methanol, green leaf volatiles, monoterpenes, sesquiterpenes and methyl salicylate) were in most cases nondetectable in noninfested leaves, and increased strongly with increasing the spread of infection. The moderate reduction in AA resulted from the loss of photosynthetically active biomass, but the reduction in constitutive isoprene emissions and the increase in induced volatile emissions primarily reflected changes in the activities of corresponding biochemical pathways. Although all physiological alterations in fungal-infected leaves occurred in a stress severity-dependent manner, modifications in primary and secondary metabolic pathways scaled differently due to contrasting

  16. Intercropping with wheat lowers nutrient uptake and biomass accumulation of maize, but increases photosynthetic rate of the ear leaf.

    Science.gov (United States)

    Gou, Fang; van Ittersum, Martin K; Couëdel, Antoine; Zhang, Yue; Wang, Yajun; van der Putten, Peter E L; Zhang, Lizhen; van der Werf, Wopke

    2018-02-01

    Intercropping is an ancient agricultural practice that provides a possible pathway for sustainable increases in crop yields. Here, we determine how competition with wheat affects nutrient uptake (nitrogen and phosphorus) and leaf traits, such as photosynthetic rate, in maize. In a field experiment, maize was planted as a sole crop, in three different intercrop configurations with wheat (a replacement intercrop and two add-row intercrops), and as a skip-row system with one out of each three maize rows omitted. Nitrogen and phosphorus uptake were determined at flowering and maturity. Specific leaf area, leaf nitrogen concentration, chlorophyll content and photosynthetic rate of the ear leaf were determined at flowering. Nitrogen and phosphorus concentrations were significantly lower in intercropped maize than in sole maize and skip-row maize at flowering, but these differences were smaller at maturity. At flowering, specific leaf area was significantly greater in intercrops than in skip-row maize. Leaf nitrogen concentration was significantly lower in add-row intercrops than in sole maize, skip-row maize or maize in the replacement intercrop. Leaf chlorophyll content was highest in sole and skip-row maize, intermediate in maize in the replacement intercrop and lowest in maize grown in add-row intercrops. On the contrary, photosynthetic rate was significantly higher in the replacement intercrop than in sole maize, skip-row maize and the intercrop with an additional maize row. The findings indicate that competition with intercropped wheat severely constrained nutrient uptake in maize, while photosynthetic rate of the ear leaf was not negatively affected. Possible mechanisms for higher photosynthesis rate at lower leaf nitrogen content in intercropped maize are discussed.

  17. Stomatal conductance, mesophyll conductance, and trans piration efficiency in relation to leaf anatomy in rice and wheat genotypes under drought

    NARCIS (Netherlands)

    Ouyang, Wenjing; Struik, Paul C.; Yin, Xinyou; Yang, Jianchang

    2017-01-01

    Increasing leaf transpiration efficiency (TE) may provide leads for growing rice like dryland cereals such as wheat (Triticum aestivum). To explore avenues for improving TE in rice, variations in stomatal conductance (g s) and mesophyll conductance (g m) and their anatomical determinants were

  18. Mechanical behavior of cells within a cell-based model of wheat leaf growth

    Directory of Open Access Journals (Sweden)

    Ulyana Zubairova

    2016-12-01

    Full Text Available Understanding the principles and mechanisms of cell growth coordination in plant tissue remains an outstanding challenge for modern developmental biology. Cell-based modeling is a widely used technique for studying the geometric and topological features of plant tissue morphology during growth. We developed a quasi-one-dimensional model of unidirectional growth of a tissue layer in a linear leaf blade that takes cell autonomous growth mode into account. The model allows for fitting of the visible cell length using the experimental cell length distribution along the longitudinal axis of a wheat leaf epidermis. Additionally, it describes changes in turgor and osmotic pressures for each cell in the growing tissue. Our numerical experiments show that the pressures in the cell change over the cell cycle, and in symplastically growing tissue, they vary from cell to cell and strongly depend on the leaf growing zone to which the cells belong. Therefore, we believe that the mechanical signals generated by pressures are important to consider in simulations of tissue growth as possible targets for molecular genetic regulators of individual cell growth.

  19. Down-regulation of a wheat alkaline/neutral invertase correlates with reduced host susceptibility to wheat stripe rust caused by Puccinia striiformis.

    Science.gov (United States)

    Liu, Jie; Han, Lina; Huai, Baoyu; Zheng, Peijing; Chang, Qing; Guan, Tao; Li, Dan; Huang, Lili; Kang, Zhensheng

    2015-12-01

    Numerous studies have found that sucrose (Suc) metabolism plays a crucial role in the environmental stress response of many plant species. The majority of Suc metabolism-associated reports refer to acid invertases (Ac-Invs). However, alkaline/neutral Invs (A/N-Invs) have been poorly studied. In this study, a wheat A/N-Inv gene, Ta-A/N-Inv1, with three copies located on chromosomes 4A, 4B, and 4D, was cloned from a wheat-Puccinia striiformis f. sp. tritici (Pst) interaction cDNA library. Transcripts of the three Ta-A/N-Inv1 copies were up-regulated in wheat leaves that were infected by Pst or had experienced certain abiotic treatments. Furthermore, the expression of Ta-A/N-Inv1 was decreased by treatment with exogenous hormones. Heterologous mutant complementation and subcellular localization revealed that Ta-A/N-Inv1 is a cytoplasmic invertase. Knocking down all three copies of Ta-A/N-Inv1 using the barley stripe mosaic virus-induced gene silencing system reduced the susceptibility of wheat to the Pst virulent pathotype CYR31, which is associated with pathogen-induced H2O2 accumulation and enhanced necrosis. Interestingly, 48h dark treatment of the Ta-A/N-Inv1-knockdown plants immediately after inoculation abrogated their enhanced resistance, suggesting that H2O2 production and its associated cell death and resistance in the Ta-A/N-Inv1-silenced plants require light. Consistent with this observation, photosynthesis and reactive oxygen species (ROS)-related genes were significantly up-regulated in the Ta-A/N-Inv1-knockdown plants infected by CYR31 under light exposure. These results suggest that Ta-A/N-Inv1 might act as a negative regulator in wheat disease resistance to Pst by increasing cytoplasmic hexose accumulation and downregulating photosynthesis of the leaves to avoid cell death due to excessive ROS production. © The Author 2015. Published by Oxford University Press on behalf of the Society for Experimental Biology. All rights reserved. For permissions

  20. [Effects of reduced solar radiation on winter wheat flag leaf net photosynthetic rate].

    Science.gov (United States)

    Zheng, You-Fei; Ni, Yan-Li; Mai, Bo-Ru; Wu, Rong-Jun; Feng, Yan; Sun, Jian; Li, Jian; Xu, Jing-Xin

    2011-06-01

    Taking winter wheat Triticum aestivum L. (cv. Yangmai 13) as test material, a field experiment was conducted in Nanjing City to study the effects of simulated reduced solar radiation on the diurnal variation of winter wheat flag leaf photosynthetic rate and the main affecting factors. Five treatments were installed, i. e., 15% (T15), 20% (T20) , 40% (T40), 60% (T60), and 100% (CK) of total incident solar radiation. Reduced solar irradiance increased the chlorophyll and lutein contents significantly, but decreased the net photosynthetic rate (Pn). Under different solar irradiance, the diurnal variation of Pn had greater difference, and the daily maximum Pn was in the order of CK > T60 > T40 > T 20 > T15. In CK, the Pn exhibited a double peak diurnal curve; while in the other four treatments, the Pn showed a single peak curve, and the peak was lagged behind that of CK. Correlation analysis showed that reduced solar irradiance was the main factor affecting the diurnal variation of Pn, but the physiological parameters also played important roles in determining the diurnal variation of Pn. In treatments T60 and T40, the photosynthesis active radiation (PAR), leaf temperature (T1) , stomatal conductance (Gs) , and transpiration rate (Tr) were significantly positively correlated with Pn, suggesting their positive effects on Pn. The intercellular CO2 concentration (Ci) and stomatal limitation (Ls) had significant negative correlations with Pn in treatments T60 and T40 but significant positive correlations with Pn in treatments T20 and T15, implying that the Ci and Ls had negative (or positive) effects on Pn when the solar irradiance was higher (or lower) than 40% of incident solar irradiance.

  1. Effects of Terpene Chemotypes of Melaleuca alternifolia on Two Specialist Leaf Beetles and Susceptibility to Myrtle Rust.

    Science.gov (United States)

    Bustos-Segura, Carlos; Külheim, Carsten; Foley, William

    2015-10-01

    Plant chemical polymorphisms, or plant chemotypes, are characterized by intraspecific discrete differences of plant secondary metabolites in the same plant tissue. Chemotypes that differ in foliar terpene composition are found commonly in Myrtaceae. In this study, we focused on terpene chemotypes of medicinal tea tree, Melalecua alternifolia, to explore whether this variation affects two specialist herbivores Paropsisterna tigrina and Faex sp. (Coleoptera: Chrysomelidae), and if this could explain the maintenance of this variation. We tested whether insect performance, oviposition preference, and plant damage were associated with different chemotypes. We found that larval growth rate of Faex sp. was higher in chemotypes with high concentrations of 1,8-cineole, and that oviposition preference depended on the chemotype of the larval diet. Although performance traits and preference for oviposition of P. tigrina did not vary among chemotypes, adults inflicted less damage on plants with a high concentration of terpinolene. Additionally, we tested whether different chemotypes showed different levels of susceptibility by myrtle rust (Puccinia psidii). We found that plants with a high concentration of 1,8-cineole were more likely to be infected under controlled conditions. Although there is evidence that terpene chemotypes are a mediator of the interaction with natural enemies, the most detrimental pest of this plant, P. tigrina, does not seem to be affected by variation in plant terpenes.

  2. Photochemical and antioxidative responses of the glume and flag leaf to seasonal senescence in wheat

    Directory of Open Access Journals (Sweden)

    Lingan eKong

    2015-05-01

    Full Text Available The non-leaf photosynthetic organs have recently attracted much attention for the breeding and screening of varieties of cereal crops to achieve a high grain yield. However, the glume photosynthetic characteristics and responses to high temperature at the late stages of grain filling are not well known in winter wheat (Triticum aestivum L.. In the present study, an experiment was conducted to investigate the anatomy, chloroplast temporal changes, chlorophyll fluorescence, xanthophyll cycle and antioxidative defense system in glumes of field-grown wheat during grain filling compared with flag leaves. Observations using a light microscope revealed that the glumes developed a solid structural base for performing photosynthesis. Compared with the flag leaves, the glumes preserved a more integral ultrastructure, as observed under transmission electron microscopy, and had higher values of Fv/Fm and ΦPSII at the maturity stage. Further analysis of the chlorophyll fluorescence demonstrated that the glumes experienced high non-photochemical quenching (NPQ at the late stages. Determination of the pool size of the xanthophyll cycle suggested that the (A+Z/(V+A+Z ratio was consistently higher in glumes than in flag leaves and that the V+A+Z content was considerably higher in glumes at the maturity stage. In addition, the glumes exhibited a higher antioxidant enzyme activity and a lower accumulation of reactive oxygen species. These results suggest that the glumes are photosynthetically active and senesce later than the flag leaves; the advantages may have been achieved by coordinated contributions of the structural features, higher NPQ levels, greater de-epoxidation of the xanthophyll cycle components and antioxidative defense metabolism.

  3. Genome-Wide Analysis of Simple Sequence Repeats and Efficient Development of Polymorphic SSR Markers Based on Whole Genome Re-Sequencing of Multiple Isolates of the Wheat Stripe Rust Fungus.

    Science.gov (United States)

    Luo, Huaiyong; Wang, Xiaojie; Zhan, Gangming; Wei, Guorong; Zhou, Xinli; Zhao, Jing; Huang, Lili; Kang, Zhensheng

    2015-01-01

    The biotrophic parasitic fungus Puccinia striiformis f. sp. tritici (Pst) causes stripe rust, a devastating disease of wheat, endangering global food security. Because the Pst population is highly dynamic, it is difficult to develop wheat cultivars with durable and highly effective resistance. Simple sequence repeats (SSRs) are widely used as molecular markers in genetic studies to determine population structure in many organisms. However, only a small number of SSR markers have been developed for Pst. In this study, a total of 4,792 SSR loci were identified using the whole genome sequences of six isolates from different regions of the world, with a marker density of one SSR per 22.95 kb. The majority of the SSRs were di- and tri-nucleotide repeats. A database containing 1,113 SSR markers were established. Through in silico comparison, the previously reported SSR markers were found mainly in exons, whereas the SSR markers in the database were mostly in intergenic regions. Furthermore, 105 polymorphic SSR markers were confirmed in silico by their identical positions and nucleotide variations with INDELs identified among the six isolates. When 104 in silico polymorphic SSR markers were used to genotype 21 Pst isolates, 84 produced the target bands, and 82 of them were polymorphic and revealed the genetic relationships among the isolates. The results show that whole genome re-sequencing of multiple isolates provides an ideal resource for developing SSR markers, and the newly developed SSR markers are useful for genetic and population studies of the wheat stripe rust fungus.

  4. Genome-Wide Analysis of Simple Sequence Repeats and Efficient Development of Polymorphic SSR Markers Based on Whole Genome Re-Sequencing of Multiple Isolates of the Wheat Stripe Rust Fungus.

    Directory of Open Access Journals (Sweden)

    Huaiyong Luo

    Full Text Available The biotrophic parasitic fungus Puccinia striiformis f. sp. tritici (Pst causes stripe rust, a devastating disease of wheat, endangering global food security. Because the Pst population is highly dynamic, it is difficult to develop wheat cultivars with durable and highly effective resistance. Simple sequence repeats (SSRs are widely used as molecular markers in genetic studies to determine population structure in many organisms. However, only a small number of SSR markers have been developed for Pst. In this study, a total of 4,792 SSR loci were identified using the whole genome sequences of six isolates from different regions of the world, with a marker density of one SSR per 22.95 kb. The majority of the SSRs were di- and tri-nucleotide repeats. A database containing 1,113 SSR markers were established. Through in silico comparison, the previously reported SSR markers were found mainly in exons, whereas the SSR markers in the database were mostly in intergenic regions. Furthermore, 105 polymorphic SSR markers were confirmed in silico by their identical positions and nucleotide variations with INDELs identified among the six isolates. When 104 in silico polymorphic SSR markers were used to genotype 21 Pst isolates, 84 produced the target bands, and 82 of them were polymorphic and revealed the genetic relationships among the isolates. The results show that whole genome re-sequencing of multiple isolates provides an ideal resource for developing SSR markers, and the newly developed SSR markers are useful for genetic and population studies of the wheat stripe rust fungus.

  5. A systematic review of rye (Secale cereale L.) as a source of resistance to pathogens and pests in wheat (Triticum aestivum L.).

    Science.gov (United States)

    Crespo-Herrera, Leonardo A; Garkava-Gustavsson, Larisa; Åhman, Inger

    2017-01-01

    Wheat is globally one of the most important crops. With the current human population growth rate, there is an increasing need to raise wheat productivity by means of plant breeding, along with development of more efficient and sustainable agricultural systems. Damage by pathogens and pests, in combination with adverse climate effects, need to be counteracted by incorporating new germplasm that makes wheat more resistant/tolerant to such stress factors. Rye has been used as a source for improved resistance to pathogens and pests in wheat during more than 50 years. With new devastating stem and yellow rust pathotypes invading wheat at large acreage globally, along with new biotypes of pest insects, there is renewed interest in using rye as a source of resistance. Currently the proportion of wheat cultivars with rye chromatin varies between countries, with examples of up to 34%. There is mainly one rye source, Petkus, that has been widely exploited and that has contributed considerably to raise yields and increase disease resistance in wheat. Successively, the multiple disease resistances conferred by this source has been overcome by new pathotypes of leaf rust, yellow rust, stem rust and powdery mildew. However, there are several other rye sources reported to make wheat more resistant to various biotic constraints when their rye chromatin has been transferred to wheat. There is also development of knowledge on how to produce new rye translocation, substitution and addition lines. Here we compile information that may facilitate decision making for wheat breeders aiming to transfer resistance to biotic constraints from rye to elite wheat germplasm.

  6. Mapping of stripe rust resistance gene in an Aegilops caudata ...

    Indian Academy of Sciences (India)

    Inheritance and genetic mapping of stripe rust resistance gene in backcrossrecombinant inbred line (BC-RIL) population derived from the cross of a wheat–Ae. caudata introgression line (IL) T291-2(pau16060) with wheat cv. PBW343 is reported here. Segregation of BC-RILs for stripe rust resistance depicted a single major ...

  7. Transfer of stripe rust resistance from Aegilops variabilis to bread ...

    African Journals Online (AJOL)

    In terms of area, the bread wheat producing regions of China comprise the largest area in the world that is constantly threatened by stripe rust epidemics. Consequently, it is important to exploit new adultplant resistance genes in breeding. This study reports the transfer of stripe rust resistance from Aegilops variabilis to ...

  8. Variation in chlorophyll content per unit leaf area in spring wheat and implications for selection in segregating material.

    Directory of Open Access Journals (Sweden)

    John Hamblin

    Full Text Available Reduced levels of leaf chlorophyll content per unit leaf area in crops may be of advantage in the search for higher yields. Possible reasons include better light distribution in the crop canopy and less photochemical damage to leaves absorbing more light energy than required for maximum photosynthesis. Reduced chlorophyll may also reduce the heat load at the top of canopy, reducing water requirements to cool leaves. Chloroplasts are nutrient rich and reducing their number may increase available nutrients for growth and development. To determine whether this hypothesis has any validity in spring wheat requires an understanding of genotypic differences in leaf chlorophyll content per unit area in diverse germplasm. This was measured with a SPAD 502 as SPAD units. The study was conducted in series of environments involving up to 28 genotypes, mainly spring wheat. In general, substantial and repeatable genotypic variation was observed. Consistent SPAD readings were recorded for different sampling positions on leaves, between different leaves on single plant, between different plants of the same genotype, and between different genotypes grown in the same or different environments. Plant nutrition affected SPAD units in nutrient poor environments. Wheat genotypes DBW 10 and Transfer were identified as having consistent and contrasting high and low average SPAD readings of 52 and 32 units, respectively, and a methodology to allow selection in segregating populations has been developed.

  9. Rust essentials

    CERN Document Server

    Balbaert, Ivo

    2015-01-01

    This book is intended for software developers interested in systems level and application programming, and are looking for a quick entry into using Rust and understanding the core features of the framework. It is assumed that you have a basic understanding of Java, C#, Ruby, Python or JavaScript.

  10. The research of cytokinin and hydrogen peroxide influence on the leaf mesophyll structure and morphometric parameters of winter wheat

    Directory of Open Access Journals (Sweden)

    Vladislav V. Zhuk

    2013-04-01

    Full Text Available The last leaf mesophyll structure of Triticum aestivumcv. ‘Tronka’which was grown in the field experiment conditions was investigated by the method of confocal laser scanning microscopy. The experiment plants were treated by BAP and Н 2О2 in booting phase. It is established that plant treatment didn’t effect on structure of leaf tissues but enhanced the functional ability of chloroplast pigment complexes. It has shown that influence of exogenous BAP enhanced chlorophyll autofluorescence, especially in palisade mesophyll cells, delayed aging of pigment complex. The action of exogenous mainly increased chlorophyll fluorescence of spongy mesophyll near stomata, but its influence was less significant than BAP. In winter wheat plants treated by BAP and Н 2О2 plant height and last leaf length enlarged. The plant treatment by BAP increased productivity of T. aestivumcv. ‘Tronka’ mainly by the cost of increasing of corns’ quantity in ear and corns’weight.

  11. Genetics of adult plant stripe rust resistance in CSP44, a selection ...

    Indian Academy of Sciences (India)

    Wheat line CSP44, a selection from an Australian bread wheat cultivar Condor, has shown resistance to stripe rust in India since the last twenty years. Seedlings and adult plants of CSP44 showed susceptible infection types against stripe rust race 46S119 but displayed average terminal disease severity of 2.67 on adult ...

  12. Bioprospecting endophytic bacteria for biological control of coffee leaf rust Bioprospecção de bactérias endofíticas como agentes de biocontrole da ferrugem do cafeeiro

    Directory of Open Access Journals (Sweden)

    Humberto Franco Shiomi

    2006-02-01

    Full Text Available Suppression of plant diseases due to the action of endophytic microorganisms has been demonstrated in several pathosystems. Experiments under controlled conditions involving endophytic bacteria isolated from leaves and branches of Coffea arabica L and Coffea robusta L were conducted with the objective of evaluating the inhibition of germination of Hemileia vastatrix Berk. & Br., race II, urediniospores and the control of coffee leaf rust development in tests with leaf discs, detached leaves, and on potted seedling of cv. Mundo Novo. The endophytic bacterial isolates tested proved to be effective in inhibiting urediniospore germination and/or rust development, with values above 50%, although the results obtained in urediniospore germination tests were inferior to the treatment with fungicide propiconazole. Endophytic isolates TG4-Ia, TF2-IIc, TF9-Ia, TG11-IIa, and TF7-IIa, demonstrated better coffee leaf rust control in leaf discs, detached leaves, and coffee plant tests. The endophytic isolates TG4-Ia and TF9-Ia were identified as Bacillus lentimorbus Dutky and Bacillus cereus Frank. & Frank., respectively. Some endophytic bacterial isolates were effective in controlling the coffee leaf rust, although some increased the severity of the disease. Even though a relatively small number of endophytic bacteria were tested, promising results were obtained regarding the efficiency of coffee leaf rust biocontrol. These selected agents appears to be an alternative for future replacement of chemical fungicide.Supressão de doenças de plantas por microrganismos endofíticos tem sido demonstrada em diversos patossistemas. Neste trabalho foram selecionados isolados de bactérias endofíticas de folhas e ramos de cafeeiro com potencial para o controle biológico da ferrugem do cafeeiro, pois é conhecido que esses microrganismos podem possuir essa característica. Bactérias endofíticas isoladas previamente de folhas e ramos de Coffea arabica L e Coffea

  13. Abnormal germling development by brown rust and powdery mildew on cer barley mutants

    NARCIS (Netherlands)

    Rubiales, D.; Ramirez, M.C.; Carver, T.L.W.; Niks, R.E.

    2001-01-01

    The barley leaf rust fungus forms appressoria over host leaf stomata and penetrates via the stomatal pore. High levels of avoidance to leaf rust fungi have been described in some wild accessions of Hordeum species where a prominent wax layer on the stomata inhibits triggering of fungal appressorium

  14. Progress of foliar diseases in wheat crops at Passo Fundo, RS, Brazil

    Directory of Open Access Journals (Sweden)

    Felipe Rafael Garcés Fiallos

    2011-12-01

    Full Text Available The aim was to study the progress of the yellow spot, brown spot and leaf rust in wheat cultivar FUNDACEP 50 in Passo Fundo. Was evaluated the incidence of yellow spot [Drechslera tritici-repentis (Died Drechs.] brown spot [Bipolaris sorokiniana (Sacc.] and leaf rust [Puccinia triticina (Eriks]. Values obtained were integralized as Area Under the Disease Incidence Progress Curve (AUDIPC and to analyze the progress of the disease was considered the disease progress rate (r, which was obtained with the Logistic and Gompertz. Determination coefficients were high (0.93 to 0.98, as well as the mean square error (4.0706 to 7.6831. The r were 0.02 to 0.22 units, while the accumulated AUDIPC 787.5, 1216.3 and 1338.8 units for yellow spot, brown spot and leaf rust, respectively. The two models used satisfactorily explain the progress of yellow spot and brown spot, while the Gompertz explains better leaf rust.

  15. Rust Converters

    Science.gov (United States)

    1987-11-01

    phosphate and a ferric tannate , respectively, forming an adherent substrate which may then be coated with a bituminous coating. The ensuing experiments...pre-corroded substrate. Phosphoric acid and tannic acid based rust con- verters chemically change the composition of the ferrous oxide to a ferric ...resistance (reverse)." Steel Structures Painting Council, Surface Preparation, Specification No. 2 (SSPC-SP2), "Hand Tool Cleaning" Tests performed on

  16. Genome-wide association study reveals novel quantitative trait Loci associated with resistance to multiple leaf spot diseases of spring wheat.

    Directory of Open Access Journals (Sweden)

    Suraj Gurung

    Full Text Available Accelerated wheat development and deployment of high-yielding, climate resilient, and disease resistant cultivars can contribute to enhanced food security and sustainable intensification. To facilitate gene discovery, we assembled an association mapping panel of 528 spring wheat landraces of diverse geographic origin for a genome-wide association study (GWAS. All accessions were genotyped using an Illumina Infinium 9K wheat single nucleotide polymorphism (SNP chip and 4781 polymorphic SNPs were used for analysis. To identify loci underlying resistance to the major leaf spot diseases and to better understand the genomic patterns, we quantified population structure, allelic diversity, and linkage disequilibrium. Our results showed 32 loci were significantly associated with resistance to the major leaf spot diseases. Further analysis identified QTL effective against major leaf spot diseases of wheat which appeared to be novel and others that were previously identified by association analysis using Diversity Arrays Technology (DArT and bi-parental mapping. In addition, several identified SNPs co-localized with genes that have been implicated in plant disease resistance. Future work could aim to select the putative novel loci and pyramid them in locally adapted wheat cultivars to develop broad-spectrum resistance to multiple leaf spot diseases of wheat via marker-assisted selection (MAS.

  17. Wheat leaf lipids during heat stress: II. Lipids experiencing coordinated metabolism are detected by analysis of lipid co-occurrence.

    Science.gov (United States)

    Narayanan, Sruthi; Prasad, P V Vara; Welti, Ruth

    2016-03-01

    Identifying lipids that experience coordinated metabolism during heat stress would provide information regarding lipid dynamics under stress conditions and assist in developing heat-tolerant wheat varieties. We hypothesized that co-occurring lipids, which are up-regulated or down-regulated together through time during heat stress, represent groups that can be explained by coordinated metabolism. Wheat plants (Triticum aestivum L.) were subjected to 12 days of high day and/or night temperature stress, followed by a 4-day recovery period. Leaves were sampled at four time points, and 165 lipids were measured by electrospray ionization-tandem mass spectrometry. Correlation analysis of lipid levels in 160 leaf samples from each of two wheat genotypes revealed 13 groups of lipids. Lipids within each group co-occurred through the high day and night temperature stress treatments. The lipid groups can be broadly classified as groups containing extraplastidic phospholipids, plastidic glycerolipids, oxidized glycerolipids, triacylglycerols, acylated sterol glycosides and sterol glycosides. Current knowledge of lipid metabolism suggests that the lipids in each group co-occur because they are regulated by the same enzyme(s). The results suggest that increases in activities of desaturating, oxidizing, glycosylating and acylating enzymes lead to simultaneous changes in levels of multiple lipid species during high day and night temperature stress in wheat. © 2015 John Wiley & Sons Ltd.

  18. Wheat leaf lipids during heat stress: I. High day and night temperatures result in major lipid alterations

    Science.gov (United States)

    Narayanan, Sruthi; Tamura, Pamela J.; Roth, Mary R.; Vara Prasad, P.V.; Welti, Ruth

    2016-01-01

    Understanding how wheat (Triticum aestivum L.) plants under high temperature (HT) regulate lipid composition is critical to developing climate-resilient varieties. We measured 165 glycerolipids and sterol derivatives under optimum and high day and night temperatures in wheat leaves using electrospray ionization-tandem mass spectrometry. Levels of polar lipid fatty acyl chain unsaturation were lower in both heat-tolerant genotype Ventnor and susceptible genotype Karl 92 under HT, compared to optimum temperature. The lower unsaturation was predominantly due to lower levels of 18:3 and higher levels of 18:1 and 16:0 acyl chains. Levels of 18:3-containing triacylglycerols increased 3-fold/more under HT, consistent with their possible role in sequestering fatty acids during membrane lipid remodeling. Phospholipids containing odd-numbered or oxidized acyl chains accumulated in leaves under HT. Sterol glycosides (SG) and 16:0-acylated sterol glycosides (ASG) were higher under HT than optimum temperatures. Ventnor had lower amounts of phospholipids with oxidized acyl chains under HT and higher amounts of SG and 16:0-ASG than Karl 92. Taken together, the data demonstrate that wheat leaf lipid composition is altered by HT, that some lipids are particularly responsive to HT, and that two wheat genotypes, chosen for their differing physiological responses to HT, differ in lipid profile under HT. PMID:26436679

  19. Validation of RT-qPCR reference genes for in planta expression studies in Hemileia vastatrix, the causal agent of coffee leaf rust.

    Science.gov (United States)

    Vieira, Ana; Talhinhas, Pedro; Loureiro, Andreia; Duplessis, Sébastien; Fernandez, Diana; Silva, Maria do Céu; Paulo, Octávio S; Azinheira, Helena Gil

    2011-09-01

    Hemileia vastatrix is a biotrophic fungus, causing coffee leaf rust in all coffee growing countries, leading to serious social and economic problems. Gene expression studies may have a key role unravelling the transcriptomics of this pathogen during interaction with the plant host. Reverse transcription quantitative real-time polymerase chain reaction (RT-qPCR) is currently the golden standard for gene expression analysis, although an accurate normalisation is essential for adequate conclusions. Reference genes are often used for this purpose, but the stability of their expression levels requires validation under experimental conditions. Moreover, pathogenic fungi undergo important biomass variations along their infection process in planta, which raises the need for an adequate method to further normalise the proportion of fungal cDNA in the total plant and fungus cDNA pool. In this work, the expression profiles of seven reference genes [glyceraldehyde-3-phosphate dehydrogenase (GADPH), elongation factor (EF-1), Beta tubulin (β-tubulin), cytochrome c oxidase subunit III (Cyt III), cytochrome b (Cyt b), Hv00099, and 40S ribosomal protein (40S_Rib)] were analysed across 28 samples, obtained in vitro (germinated uredospores and appressoria) and in planta (post-penetration fungal growth phases). Gene stability was assessed using the statistical algorithms incorporated in geNorm and NormFinder tools. Cyt b, 40S_Rib, and Hv00099 were the most stable genes for the in vitro dataset, while 40S_Rib, GADPH, and Cyt III were the most stable in planta. For the combined datasets (in vitro and in planta), 40S_Rib, GADPH, and Hv00099 were selected as the most stable. Subsequent expression analysis for a gene encoding an alpha subunit of a heterotrimeric G-protein showed that the reference genes selected for the combined dataset do not differ significantly from those selected specifically for the in vitro and in planta datasets. Our study provides tools for correct validation

  20. Stay-green trait-antioxidant status interrelationship in durum wheat (Triticum durum) flag leaf during post-flowering.

    Science.gov (United States)

    De Simone, Vanessa; Soccio, Mario; Borrelli, Grazia Maria; Pastore, Donato; Trono, Daniela

    2014-01-01

    Three independent durum wheat mutant lines that show delayed leaf senescence or stay-green (SG) phenotype, SG196, SG310 and SG504, were compared to the parental genotype, cv. Trinakria, with respect to the photosynthetic parameters and the cellular redox state of the flag leaf in the period from flowering to senescence. The SG mutants maintained their chlorophyll content and net photosynthetic rate for longer than Trinakria, thus revealing a functional SG phenotype. They also showed a better redox state as demonstrated by: (1) a lower rate of superoxide anion production due to generally higher activity of the antioxidant enzymes superoxide dismutase and catalase in all of the SG mutants and also of the total peroxidase in SG196; (2) a higher thiol content that can be ascribed to a higher activity of the NADPH-providing enzyme glucose-6-phosphate dehydrogenase in all of the SG mutants and also of the NADP(+)-dependent malic enzyme in SG196; (3) a lower pro-oxidant activity of lipoxygenase that characterises SG196 and SG504 mutants close to leaf senescence. Overall, these results show a general relationship in durum wheat between the SG phenotype and a better redox state. This relationship differs across the different SG mutants, probably as a consequence of the different set of altered genes underlying the SG trait in these independent mutant lines.

  1. A comparative analysis of leaf shape of wheat, barley and maize using an empirical shape model.

    Science.gov (United States)

    Dornbusch, Tino; Watt, Jillian; Baccar, Rim; Fournier, Christian; Andrieu, Bruno

    2011-04-01

    The phenotypes of grasses show differences depending on growth conditions and ontogenetic stage. Understanding these responses and finding suitable mathematical formalizations are an essential part of the development of plant and crop models. Usually, a marked change in architecture between juvenile and adult plants is observed, where dimension and shape of leaves are likely to change. In this paper, the plasticity of leaf shape is analysed according to growth conditions and ontogeny. Leaf shape of Triticum aestivum, Hordeum vulgare and Zea mays cultivars grown under varying conditions was measured using digital image processing. An empirical leaf shape model was fitted to measured shape data of single leaves. Obtained values of model parameters were used to analyse the patterns in leaf shape. The model was able to delineate leaf shape of all studied species. The model error was small. Differences in leaf shape between juvenile and adult leaves in T. aestivum and H. vulgare were observed. Varying growth conditions impacted leaf dimensions but did not impact leaf shape of the respective species. Leaf shape of the studied T. aestivum and H. vulgare cultivars was remarkably stable for a comparable ontogenetic stage (leaf rank), but differed between stages. Along with other aspects of grass architecture, leaf shape changed during the transition from juvenile to adult growth phase. Model-based analysis of leaf shape is a method to investigate these differences. Presented results can be integrated into architectural models of plant development to delineate leaf shape for different species, cultivars and environmental conditions.

  2. Hydrogen isotope composition of leaf wax n-alkanes in glaucous and non-glaucous varieties of wheat (Triticum spp.)

    Science.gov (United States)

    Pedentchouk, Nikolai; Eley, Yvette; Frizell-Armitage, Amelia; Uauy, Cristobal

    2015-04-01

    The use of the 2H/1H composition of terrestrial plants in climate and ecology studies depends on fundamental understanding of the processes within the plant that control fractionation of these two isotopes. Little is currently known about the extent of 2H/1H fractionation at different steps of biosynthesis, after the initial H uptake following leaf water photolysis. Knowing this effect is particularly important when seeking to interpret the 2H/1H composition of leaf wax biomarkers from plants that differ in the amount and type of individual compound classes in their leaf waxes. The purpose of this study was to investigate the link between the quantity and distribution of n-alkyl lipids in leaf waxes and their isotopic composition. We used a genetic approach to suppress glaucousness in 2 varieties of wheat (Alchemy and Malacca), which resulted in glaucous and non-glaucous phenotypes of both varieties. Both phenotypes were then grown outdoors under identical environmental conditions in central Norfolk, UK. At the end of the growing season, the plants were sampled for soil water, leaf water, and leaf wax isotopic measurements. Comparison of the leaf wax composition of the non-glaucous and glaucous phenotypes revealed that the non-glaucous varieties were characterised by the absence of diketones and a greater concentration of n-alkanes and primary alcohols.. Our results showed very small differences between glaucous and non-glaucous varieties with regard to soil (mean values, <2 per mil) and leaf (<1 per mil) water 2H/1H. Conversely, there was 15-20 and 10-15 per mil 2H-depletion in the C29 and C31 n-alkanes, respectively, from the non-glaucous phenotype. This 2H-depletion in the non-glaucous phenotype demonstrated that the suppression of diketone production and the increase in n-alkane and primary alcohol concentrations are linked with a shift in the 2H/1H composition of n-alkanes. The initial results of this work suggest that plants using the same environmental water

  3. Reação de genótipos de nectarina (Prunus persica var. nucipersica à ferrugem da folha, ao chumbinho e evolução da desfolha Reaction of genotypes of the nectarine (Prunus persica var. Nucipersica to leaf rust and shot hole, and the development of defoliation

    Directory of Open Access Journals (Sweden)

    Ricardo Antônio Ayub

    2013-06-01

    Full Text Available A resistência genética às doenças é um progresso na produção de todas as culturas e fontes de resistência devem ser reportadas, auxiliando os programas de melhoramento. O presente trabalho objetivou avaliar a resistência de genótipos de nectarina à ferrugem da folha e ao chumbinho, assim como, correlacionar a intensidade das doenças com a desfolha prematura. Foram avaliados três genótipos de nectarina em delineamento de blocos ao acaso com dez repeticões. Com base nos resultados obtidos, o genótipo Bruna mostrou-se resistente ao chumbinho e suscetível à ferrugem, ao passo que o genótipo Sunripe foi resistente à ferrugem; FLA 9-15N foi moderadamente suscetível à ferrugem. Houve correlação apenas entre severidade da ferrugem e desfolha.Genetic resistance to disease can be seen as progress in the production of all crops, and sources of resistance have to be reported, thus helping improvement programs. This study aimed to evaluate the resistance of nectarine genotypes to leaf rust and shot hole, as well as to correlate the severity of the diseases with premature defoliation. Three genotypes of the nectarine were evaluated in a randomized block design with ten replications. Based on the results, the genotype Bruna proved resistant to shot hole and susceptible to leaf rust, while the genotype Sunripe was resistant to leaf rust. FLA 9-15N was moderately susceptible to leaf rust. There was correlation between leaf-rust severity and defoliation only.

  4. Effect of Drought Stress and Biological and Chemical Fertilizerson Wheat Flag Leaf Chlorophyll and Correlation with the Grain Yield

    Directory of Open Access Journals (Sweden)

    M. Namarvari

    2014-02-01

    Full Text Available The aim of this experiment was that study the effect of drought stress and different chemical and organic fertilizers systems on wheat flag leaf chlorophyll. This experiment was conducted as split plot based on completely randomized block design (CRBD with four replications during 2009-2010 at experimental fields of Ramin university. Irrigation treatments were achived in I1(irrigation droped from anthesis stage to harvesting 55 zadox and I2 (spike formation to harvesting 65 zadox and I3 (full irrigation, control treatment, and fertilizers treatment included chemical fertilizer (NPK, manure fertilizer (M, biological fertilizer (B, biological fertilizer + manure fertilizer (MB at the beginning of plantation. maximum and minimum chlorophyll leaf content were related to I3 and I1, respectively. Also, maximum chlorooyll was related to biological fertilizer mixed with manure (MB and chemical fertilizers (NPK and minimum was for biological fertilizer(B, respectively. A positive corelation was observed between grain yield and flag leaf chlorophyll at with high significance. Therefoere, flag leaf chlorophyll is a good trait selection performance under drought stress conditions and different fertilizer systems. .

  5. Allelopathic effects of leaf extracts of three agroforestry trees on germination and early seedling growth of wheat (Triticum aestivum L.

    Directory of Open Access Journals (Sweden)

    Abdul Majeed

    2017-06-01

    Full Text Available Understanding of the growth promotory or inhibitory allelopathic effects of agroforestry trees on other plants is necessary for selection of suitable crops to be cultivated in their vicinity. In this experiment, aqueous leaf extracts of three agroforestry trees (Populus deltoides, Melia azedarach and Morus alba were evaluated on germination and seedling growth of wheat applied at concentration 1, 1.5, 2.0 and 2.5 g L-1 while distilled water was used as control treatment. Lower concentration of extracts (1 and 1.5 g L-1 of P. deltoides stimulated percent germination, root and stem height and dry biomass while higher concentration (2 and 2.5 g L-1 had no effect on these parameters. Mean germination time (MGT was not affected by the extract and its concentration. Aqueous extracts of M. azedarach and M. alba at concentration > 1 g L-1 significantly lowered the studied parameters except MGT which was significantly prolonged. Negative allelopathy was more evident at the highest aqueous extract concentration (2.5 g L-1 of the two trees. Extracts of M. alba were found more growth inhibitory than those of M. azedarach. The study suggests that lower concentration of leaf extracts of P. deltoides imparts stimulatory while M. azedarch and M. alba have negative allelopathic effects on wheat germination.

  6. Stamena winter wheat variety

    Directory of Open Access Journals (Sweden)

    Mišić Todor

    2001-01-01

    Full Text Available Stamena is a winter wheat variety developed at the Institute of Field and Vegetable Crops in Novi Sad, Yugoslavia. It was released by the Federal Commission for varietals Approval in 1999. Stamena was developed by crossing genetically divergent and highly productive parents Lasta and Rodna (Breeders: T. Mišić. N. Mladenov, Z. Jerković and R. Jevtić. Spike is white, smooth, awn less, medium compact with 18-21 spike lets. The grain is vitreous and dark red (Triticum aestivum L. ssp. vulgar e var. lutescens. Stamena is a medium early variety, 1 day earlier than Partizanka and 3 days earlier than Jugoslavija (Table 4. It has excellent resistance to winterkilling, as in very winter hardy Partizanka. The average stem height is 78 cm, with a good resistance to lodging. Stamena has field resistance to leaf rust (Pucce, recondita tritict, horizontal resistance, which is the type of resistance that modern wheat breeding is interested in. The resistance to stem rust (Pucce, graminis tritict is good and to powdery mildew (Erysiphegraminis tritici very good. The 1000 grain mass is about 32 g and volume grain mass 81.3 kg/hi. (Table 2. Stamena is classified in the subgroup A-l. It has excellent milling and baking quality and it belong to the 1st technological group (quality enhancer. The quantity of dry gluten is about 9%. The variety Stamena is a very productive, with the genetic potential for grain above 11 t/ha suitable for growing on fertile and less fertile soils. It has started to be grown commercially in 2000.

  7. Using transcription of six Puccinia triticina races to identify the effective secretome during infection of wheat.

    Directory of Open Access Journals (Sweden)

    Myron eBruce

    2014-01-01

    Full Text Available Wheat leaf rust, caused by the basidiomycete Puccinia triticina, can cause yield losses of up to 20% in wheat producing regions. During infection, the fungus forms haustoria that secrete proteins into the plant cell and effect changes in plant transcription, metabolism and defense. It is hypothesized that new races emerge as a result of overcoming plant resistance via changes in the secreted effector proteins. To understand gene expression during infection and find genetic differences associated with races, RNA from wheat leaves infected with six different rust races, at six days post inoculation, was sequenced using Illumina. As P. triticina is an obligate biotroph, RNA from both the host and fungi were present and separated by alignment to the P. triticina genome and a wheat EST reference. A total of 222,571 rust contigs were assembled from 165 million reads. An examination of the resulting contigs revealed 532 predicted secreted proteins among the transcripts. Of these, 456 were found in all races. Fifteen genes were found with amino acid changes, corresponding to putative avirulence effectors potentially recognized by 11 different leaf rust resistance (Lr genes. Thirteen of the potential avirulence effectors have no homology to known genes. One gene had significant similarity to cerato-platanin, a known fungal elicitor, and another showed similarity to fungal tyrosinase, an enzyme involved in melanin synthesis. Temporal expression profiles were developed for these genes by qRT-PCR and show that the 15 genes share similar expression patterns from infection initiation to just prior to spore eruption.

  8. Obligate biotrophy features unraveled by the genomic analysis of rust fungi

    Science.gov (United States)

    Duplessis, Sébastien; Cuomo, Christina A.; Lin, Yao-Cheng; Aerts, Andrea; Tisserant, Emilie; Veneault-Fourrey, Claire; Joly, David L.; Hacquard, Stéphane; Amselem, Joëlle; Cantarel, Brandi L.; Chiu, Readman; Coutinho, Pedro M.; Feau, Nicolas; Field, Matthew; Frey, Pascal; Gelhaye, Eric; Goldberg, Jonathan; Grabherr, Manfred G.; Kodira, Chinnappa D.; Kohler, Annegret; Kües, Ursula; Lindquist, Erika A.; Lucas, Susan M.; Mago, Rohit; Mauceli, Evan; Morin, Emmanuelle; Murat, Claude; Pangilinan, Jasmyn L.; Park, Robert; Pearson, Matthew; Quesneville, Hadi; Rouhier, Nicolas; Sakthikumar, Sharadha; Salamov, Asaf A.; Schmutz, Jeremy; Selles, Benjamin; Shapiro, Harris; Tanguay, Philippe; Tuskan, Gerald A.; Henrissat, Bernard; Van de Peer, Yves; Rouzé, Pierre; Ellis, Jeffrey G.; Dodds, Peter N.; Schein, Jacqueline E.; Zhong, Shaobin; Hamelin, Richard C.; Grigoriev, Igor V.; Szabo, Les J.; Martin, Francis

    2011-01-01

    Rust fungi are some of the most devastating pathogens of crop plants. They are obligate biotrophs, which extract nutrients only from living plant tissues and cannot grow apart from their hosts. Their lifestyle has slowed the dissection of molecular mechanisms underlying host invasion and avoidance or suppression of plant innate immunity. We sequenced the 101-Mb genome of Melampsora larici-populina, the causal agent of poplar leaf rust, and the 89-Mb genome of Puccinia graminis f. sp. tritici, the causal agent of wheat and barley stem rust. We then compared the 16,399 predicted proteins of M. larici-populina with the 17,773 predicted proteins of P. graminis f. sp tritici. Genomic features related to their obligate biotrophic lifestyle include expanded lineage-specific gene families, a large repertoire of effector-like small secreted proteins, impaired nitrogen and sulfur assimilation pathways, and expanded families of amino acid and oligopeptide membrane transporters. The dramatic up-regulation of transcripts coding for small secreted proteins, secreted hydrolytic enzymes, and transporters in planta suggests that they play a role in host infection and nutrient acquisition. Some of these genomic hallmarks are mirrored in the genomes of other microbial eukaryotes that have independently evolved to infect plants, indicating convergent adaptation to a biotrophic existence inside plant cells. PMID:21536894

  9. A fertile amphiploid between durum wheat (Triticum turgidum) and the x Agroticum amphiploid (Agropyron cristatum x T. tauschii).

    Science.gov (United States)

    Soliman, M H; Rubiales, D; Cabrera, A

    2001-01-01

    Agropyron (Gaertn) is a genus of Triticeae which includes the crested wheatgrass complex, i.e. A. cristatum (L.) as representative species containing the P genome. This species is an important source for increase the genetic variability of both durum and bread wheat. Among the possible interesting features to be introgressed into wheat are resistance to wheat streak mosaic virus, rust diseases, and tolerance to drought, cold and moderate salinity. By crossing tetraploid wheat (Triticum turgidum conv durum, 2n = 4x = 28; AABB) with a fertile allotetraploid (2n = 4x = 28; DDPP) between diploid wheat (T. tauschii) and crested wheatgrass (A. cristatum L.), amphiploid plants were obtained. Fluorescence in situ hybridization (FISH) using both genomic DNA from A. cristatum and the repetitive probe pAs1, proved that the plants were true amphiploids with a chromosome number 2n = 8x = 56 and genomic constitution AABBDDPP. Using total genomic in situ hybridization (GISH) to study meiotic metaphase I, data on allosyndetic and autosyndetic chromosome pairing were obtained. The amphiploids were perennial like the male parent but their morphology was close to that of the wheat parent. They were resistant to wheat leaf rust and powdery mildew under field conditions.

  10. Measuring Leaf Penetration and Volatilization of Chlorothalonil and Epoxiconazole Applied on Wheat Leaves in a Laboratory-Scale Experiment.

    Science.gov (United States)

    Lichiheb, Nebila; Bedos, Carole; Personne, Erwan; Benoit, Pierre; Bergheaud, Valérie; Fanucci, Olivier; Bouhlel, Jihene; Barriuso, Enrique

    2015-11-01

    Estimation of pesticide volatilization from plants is difficult because of our poor understanding of foliar penetration by pesticides, which governs the amount of pesticide available for volatilization from the leaf surface. The description of foliar penetration is still incomplete because experimental measurements of this complex process are difficult. In this study, the dynamics of leaf penetration of C-chlorothalonil and C-epoxiconazole applied to wheat leaves were measured in a volatilization chamber, which allowed us to simultaneously measure pesticide volatilization. Fungicide penetration into leaves was characterized using a well-defined sequential extraction procedure distinguishing pesticide fractions residing at different foliar compartments; this enabled us to accurately measure the penetration rate constant into the leaves. The effect of pesticide formulation was also examined by comparing formulated and pure epoxiconazole. We observed a strong effect of formulation on leaf penetration in the case of a systemic product. Furthermore, the penetration rate constant of formulated epoxiconazole was almost three times that of pure epoxiconazole (0.47 ± 0.20 and 0.17 ± 0.07, respectively). Our experimental results showed high recovery rates of the radioactivity applied within the range of 90.5 to 105.2%. Moreover, our results confirm that pesticide physicochemical properties are key factors in understanding leaf penetration of pesticide and its volatilization. This study provides important and useful parameters for mechanistic models describing volatilization of fungicides applied to plants, which are scarce in the literature. Copyright © by the American Society of Agronomy, Crop Science Society of America, and Soil Science Society of America, Inc.

  11. TaNAC1 acts as a negative regulator of stripe rust resistance in wheat, enhances susceptibility to Pseudomonas syringae, and promotes lateral root development in transgenic Arabidopsis thaliana.

    Science.gov (United States)

    Wang, Fengtao; Lin, Ruiming; Feng, Jing; Chen, Wanquan; Qiu, Dewen; Xu, Shichang

    2015-01-01

    Plant-specific NAC transcription factors (TFs) constitute a large family and play important roles in regulating plant developmental processes and responses to environmental stresses, but only some of them have been investigated for effects on disease reaction in cereal crops. Virus-induced gene silencing (VIGS) is an effective strategy for rapid functional analysis of genes in plant tissues. In this study, TaNAC1, encoding a new member of the NAC1 subgroup, was cloned from bread wheat and characterized. It is a TF localized in the cell nucleus, and contains an activation domain in its C-terminal. TaNAC1 was strongly expressed in wheat roots and was involved in responses to infection by the obligate pathogen Puccinia striiformis f. sp. tritici and defense-related hormone treatments such as salicylic acid (SA), methyl jasmonate, and ethylene. Knockdown of TaNAC1 with barley stripe mosaic virus-induced gene silencing (BSMV-VIGS) enhanced stripe rust resistance. TaNAC1-overexpression in Arabidopsis thaliana plants gave enhanced susceptibility, attenuated systemic-acquired resistance to Pseudomonas syringae DC3000, and promoted lateral root development. Jasmonic acid-signaling pathway genes PDF1.2 and ORA59 were constitutively expressed in transgenic plants. TaNAC1 overexpression suppressed the expression levels of resistance-related genes PR1 and PR2 involved in SA signaling and AtWRKY70, which functions as a connection node between the JA- and SA-signaling pathways. Collectively, TaNAC1 is a novel NAC member of the NAC1 subgroup, negatively regulates plant disease resistance, and may modulate plant JA- and SA-signaling defense cascades.

  12. TaNAC1 acts as a negative regulator of stripe rust resistance in wheat, enhances susceptibility to Pseudomonas syringae, and promotes lateral root development in transgenic Arabidopsis thaliana

    Directory of Open Access Journals (Sweden)

    Fengtao eWang

    2015-02-01

    Full Text Available Plant-specific NAC transcription factors constitute a large family and play important roles in regulating plant developmental processes and responses to environmental stresses, but only some of them have been investigated for effects on disease reaction in cereal crops. Virus-induced gene silencing (VIGS is an effective strategy for rapid functional analysis of genes in plant tissues. In this study, TaNAC1, encoding a new member of the NAC1 subgroup, was cloned from bread wheat and characterized. It is a transcription factor localized in the cell nucleus, and contains an activation domain in its C-terminal. TaNAC1 was strongly expressed in wheat roots and was involved in responses to infection by the obligate pathogen Puccinia striiformis f. sp. tritici and defense-related hormone treatments such as salicylic acid, methyl jasmonate and ethylene. Knockdown of TaNAC1 with barley stripe mosaic virus-induced gene silencing (BSMV-VIGS enhanced stripe rust resistance. TaNAC1-overexpression in Arabidopsis plants gave enhanced susceptibility, attenuated systemic-acquired resistance to Pseudomonas syringae DC3000, and promoted lateral root development. Jasmonic acid-signaling pathway genes PDF1.2 and ORA59 were constitutively expressed in transgenic plants. TaNAC1 overexpression suppressed the expression levels of resistance-related genes PR1 and PR2 involved in SA signaling and AtWRKY70, which functions as a connection node between the JA- and SA-signaling pathways. Collectively, TaNAC1 is a novel NAC member of the NAC1 subgroup, negatively regulates plant disease resistance, and may modulate plant JA- and SA-signaling defense cascades.

  13. Amino acid uptake in rust fungi

    Science.gov (United States)

    Struck, Christine

    2015-01-01

    The plant pathogenic rust fungi colonize leaf tissue and feed off their host plants without killing them. Certain economically important species of different genera such as Melampsora, Phakopsora, Puccinia, or Uromyces are extensively studied for resolving the mechanisms of the obligate biotrophy. As obligate parasites rust fungi only can complete their life cycle on living hosts where they grow through the leaf tissue by developing an extended network of intercellular hyphae from which intracellular haustoria are differentiated. Haustoria are involved in key functions of the obligate biotrophic lifestyle: suppressing host defense responses and acquiring nutrients. This review provides a survey of rust fungi nitrogen nutrition with special emphasis on amino acid uptake. A variety of sequences of amino acid transporter genes of rust fungi have been published; however, transport activity of only three in planta highly up-regulated amino acid permeases have been characterized. Functional and immunohistochemical investigations have shown the specificity and localization of these transporters. Sequence data of various genome projects allowed identification of numerous rust amino acid transporter genes. An in silico analysis reveals that these genes can be classified into different transporter families. In addition, genetic and molecular data of amino acid transporters have provided new insights in the corresponding metabolic pathways. PMID:25699068

  14. Amino acid uptake in rust fungi

    Directory of Open Access Journals (Sweden)

    Christine eStruck

    2015-02-01

    Full Text Available The plant pathogenic rust fungi colonize leaf tissue and feed off their host plants without killing them. Certain economically important species of different genera such as Melampsora, Phakopsora, Puccinia or Uromyces are extensively studied for resolving the mechanisms of the obligate biotrophy. As obligate parasites rust fungi only can complete their life cycle on living hosts where they grow through the leaf tissue by developing an extended network of intercellular hyphae from which intracellular haustoria are differentiated. Haustoria are involved in key functions of the obligate biotrophic lifestyle: suppressing host defense responses and acquiring nutrients. This review provides a survey of rust fungi nitrogen nutrition with special emphasis on amino acid uptake. A variety of sequences of amino acid transporter genes of rust fungi have been published; however, transport activity of only three in planta highly up-regulated amino acid permeases have been characterized. Functional and immunohistochemical investigations have shown the specificity and localization of these transporters. Sequence data of various genome projects allowed identification of numerous rust amino acid tranporter genes. An in silico analysis reveals that these genes can be classified into different transporter families. In addition, genetic and molecular data of amino acid transporters have provided new insights in the corresponding metabolic pathways.

  15. Characterization of a tryptophan 2-monooxygenase gene from Puccinia graminis f. sp. tritici involved in auxin biosynthesis and rust pathogenicity.

    Science.gov (United States)

    Yin, Chuntao; Park, Jeong-Jin; Gang, David R; Hulbert, Scot H

    2014-03-01

    The plant hormone indole-3-acetic acid (IAA) is best known as a regulator of plant growth and development but its production can also affect plant-microbe interactions. Microorganisms, including numerous plant-associated bacteria and several fungi, are also capable of producing IAA. The stem rust fungus Puccinia graminis f. sp. tritici induced wheat plants to accumulate auxin in infected leaf tissue. A gene (Pgt-IaaM) encoding a putative tryptophan 2-monooxygenase, which makes the auxin precursor indole-3-acetamide (IAM), was identified in the P. graminis f. sp. tritici genome and found to be expressed in haustoria cells in infected plant tissue. Transient silencing of the gene in infected wheat plants indicated that it was required for full pathogenicity. Expression of Pgt-IaaM in Arabidopsis caused a typical auxin expression phenotype and promoted susceptibility to the bacterial pathogen Pseudomonas syringae pv. tomato DC3000.

  16. Selection and characterization of Argentine isolates of Trichoderma harzianum for effective biocontrol of Septoria leaf blotch of wheat.

    Science.gov (United States)

    Stocco, Marina C; Mónaco, Cecilia I; Abramoff, Cecilia; Lampugnani, Gladys; Salerno, Graciela; Kripelz, Natalia; Cordo, Cristina A; Consolo, Verónica F

    2016-03-01

    Species of the genus Trichoderma are economically important as biocontrol agents, serving as a potential alternative to chemical control. The applicability of Trichoderma isolates to different ecozones will depend on the behavior of the strains selected from each zone. The present study was undertaken to isolate biocontrol populations of Trichoderma spp. from the Argentine wheat regions and to select and characterize the best strains of Trichoderma harzianum by means of molecular techniques. A total of 84 out of the 240 strains of Trichoderma were able to reduce the disease severity of the leaf blotch of wheat. Thirty-seven strains were selected for the reduction equal to or greater than 50% of the severity, compared with the control. The percentage values of reduction of the pycnidial coverage ranged between 45 and 80%. The same last strains were confirmed as T. harzianum by polymerase chain reaction amplification of internal transcribed spacers, followed by sequencing. Inter-simple sequence repeat was used to examine the genetic variability among isolates. This resulted in a total of 132 bands. Further numerical analysis revealed 19 haplotypes, grouped in three clusters (I, II, III). Shared strains, with different geographical origins and isolated in different years, were observed within each cluster. The origin of the isolates and the genetic group were partially related. All isolates from Paraná were in cluster I, all isolates from Lobería were in cluster II, and all isolates from Pergamino and Santa Fe were in cluster III. Our results suggest that the 37 native strains of T. harzianum are important in biocontrol programs and could be advantageous for the preparation of biopesticides adapted to the agroecological conditions of wheat culture.

  17. Recent invasion of world-wide wheat growing areas by two aggressive strains of Puccinia striiformis

    DEFF Research Database (Denmark)

    Walter, Stephanie; Ali, Sajid; Justesen, Annemarie Fejer

    2012-01-01

    The ever more frequent and severe large-scale epidemics of wheat yellow/stripe rust disease (caused by Puccinia striiformis) pose a severe threat to the world’s wheat production (Hovmøller et al. 2010). The onset of a new series of world-wide wheat yellow rust epidemics in 2000 has been linked...

  18. Effective genes for resistance to stripe rust and virulence of Puccinia ...

    African Journals Online (AJOL)

    Effective genes for resistance to stripe rust and virulence of Puccinia striiformis f. sp. tritici in Pakistan. H Bux, M Ashraf, X Chen, S Mumtaz. Abstract. Virulence patterns of wheat stripe rust were studied under the field conditions across four environmentally different locations: Quaid-i-Azam University (Islamabad), Pirsabak ...

  19. Genetic analysis and location of gene for resistance to stripe rust in ...

    Indian Academy of Sciences (India)

    Strubes Dickkopf is the sixth differential in the world set for wheat stripe (yellow) rust. It is very important to clarify its genetic character of resistance to stripe rust and to develop the molecular markers linked to resistance genes. The NIL Taichung 29*6/Strubes Dickkopf, which was obtained by Strubes Dickkopf as the gene ...

  20. Assimilating Remote Sensing Observations of Leaf Area Index and Soil Moisture for Wheat Yield Estimates: An Observing System Simulation Experiment

    Science.gov (United States)

    Nearing, Grey S.; Crow, Wade T.; Thorp, Kelly R.; Moran, Mary S.; Reichle, Rolf H.; Gupta, Hoshin V.

    2012-01-01

    Observing system simulation experiments were used to investigate ensemble Bayesian state updating data assimilation of observations of leaf area index (LAI) and soil moisture (theta) for the purpose of improving single-season wheat yield estimates with the Decision Support System for Agrotechnology Transfer (DSSAT) CropSim-Ceres model. Assimilation was conducted in an energy-limited environment and a water-limited environment. Modeling uncertainty was prescribed to weather inputs, soil parameters and initial conditions, and cultivar parameters and through perturbations to model state transition equations. The ensemble Kalman filter and the sequential importance resampling filter were tested for the ability to attenuate effects of these types of uncertainty on yield estimates. LAI and theta observations were synthesized according to characteristics of existing remote sensing data, and effects of observation error were tested. Results indicate that the potential for assimilation to improve end-of-season yield estimates is low. Limitations are due to a lack of root zone soil moisture information, error in LAI observations, and a lack of correlation between leaf and grain growth.

  1. Structure and enzymatic accessibility of leaf and stem from wheat straw before and after hydrothermal pretreatment

    DEFF Research Database (Denmark)

    Zhang, Heng; Thygesen, Lisbeth Garbrecht; Mortensen, Kell

    2014-01-01

    . Comparing the locations of water in leaf and stem by low field NMR and FT-IR revealed that the glucan hydroxyl groups in leaves were more accessible to water than glucan hydroxyl groups in stems. No difference in crystallinity between leaf and stem was observed using wide angle x-ray diffraction...... by the accessibility of the hydroxyl groups to water. This suggests that water may be used to assess glucan accessibility in biomass samples. © 2014 Zhang et al.; licensee BioMed Central Ltd....

  2. Effects of alien and intraspecies cytoplasms on manifestation of nuclear genes for wheat resistance to brown rust: II. Specificity of cytoplasm influence on different Lr genes

    Energy Technology Data Exchange (ETDEWEB)

    Voluevich, E.A.; Buloichik, A.A.; Palilova, A.N. [Institute of Genetics and Cytology, Minsk (Belarus)

    1995-04-01

    Specificity of expression of the major nuclear genes Lr to two brown rust clones in hybrids with the same maternal cytoplasm was analyzed. It was evaluated by a resistant: susceptible ratio in the F{sub 2}. Reciprocal hybrids were obtained from the cross between the progeny of homozygous susceptible plants of the cultivar Penjamo 62 and its alloplasmatic lines carrying cytoplasms of Triticum dicoccoides var. fulvovillosum, Aegilops squarrosa var. typical, Agropyron trichophorum, and isogenic lines of the cultivar Thatcher (Th) with the Lr1, Lr9, Lr15, and Lr19 genes. It was shown that the effect of the Lr1 gene in the cytoplasm of cultivar Thatcher and in eu-, and alloplasmatic forms of Penjamo 62 was less expressed than that of other Lr genes. Cytoplasm of the alloplasmatic line (dicoccoides)-Penjamo 62 was the only exception: in the F{sub 2}, hybrids with Th (Lr1) had a higher yield of resistant forms than those with Th (Lr15). In the hybrid combinations studied, expression and/or transmission of the Lr19 gene was more significant than that of other genes. This gene had no advantages over Lr15 and Lr19 only in cytoplasm of the alloplasmatic line (squarrosa)-Penjamo 62. In certain hybrid cytoplasms, the display of the Lr1, Lr15, and Lr19 genes, in contrast to Lr9, varied with the virulence of the pathogen clones. 15 refs., 5 tabs.

  3. Construction and characterization of a full-length cDNA library for the wheat stripe rust pathogen (Puccinia striiformis f. sp. tritici

    Directory of Open Access Journals (Sweden)

    Chen Xianming

    2007-06-01

    Full Text Available Abstract Background Puccinia striiformis is a plant pathogenic fungus causing stripe rust, one of the most important diseases on cereal crops and grasses worldwide. However, little is know about its genome and genes involved in the biology and pathogenicity of the pathogen. We initiated the functional genomic research of the fungus by constructing a full-length cDNA and determined functions of the first group of genes by sequence comparison of cDNA clones to genes reported in other fungi. Results A full-length cDNA library, consisting of 42,240 clones with an average cDNA insert of 1.9 kb, was constructed using urediniospores of race PST-78 of P. striiformis f. sp. tritici. From 196 sequenced cDNA clones, we determined functions of 73 clones (37.2%. In addition, 36 clones (18.4% had significant homology to hypothetical proteins, 37 clones (18.9% had some homology to genes in other fungi, and the remaining 50 clones (25.5% did not produce any hits. From the 73 clones with functions, we identified 51 different genes encoding protein products that are involved in amino acid metabolism, cell defense, cell cycle, cell signaling, cell structure and growth, energy cycle, lipid and nucleotide metabolism, protein modification, ribosomal protein complex, sugar metabolism, transcription factor, transport metabolism, and virulence/infection. Conclusion The full-length cDNA library is useful in identifying functional genes of P. striiformis.

  4. Leaf-GP: an open and automated software application for measuring growth phenotypes for arabidopsis and wheat.

    Science.gov (United States)

    Zhou, Ji; Applegate, Christopher; Alonso, Albor Dobon; Reynolds, Daniel; Orford, Simon; Mackiewicz, Michal; Griffiths, Simon; Penfield, Steven; Pullen, Nick

    2017-01-01

    Plants demonstrate dynamic growth phenotypes that are determined by genetic and environmental factors. Phenotypic analysis of growth features over time is a key approach to understand how plants interact with environmental change as well as respond to different treatments. Although the importance of measuring dynamic growth traits is widely recognised, available open software tools are limited in terms of batch image processing, multiple traits analyses, software usability and cross-referencing results between experiments, making automated phenotypic analysis problematic. Here, we present Leaf-GP (Growth Phenotypes), an easy-to-use and open software application that can be executed on different computing platforms. To facilitate diverse scientific communities, we provide three software versions, including a graphic user interface (GUI) for personal computer (PC) users, a command-line interface for high-performance computer (HPC) users, and a well-commented interactive Jupyter Notebook (also known as the iPython Notebook) for computational biologists and computer scientists. The software is capable of extracting multiple growth traits automatically from large image datasets. We have utilised it in Arabidopsis thaliana and wheat (Triticum aestivum) growth studies at the Norwich Research Park (NRP, UK). By quantifying a number of growth phenotypes over time, we have identified diverse plant growth patterns between different genotypes under several experimental conditions. As Leaf-GP has been evaluated with noisy image series acquired by different imaging devices (e.g. smartphones and digital cameras) and still produced reliable biological outputs, we therefore believe that our automated analysis workflow and customised computer vision based feature extraction software implementation can facilitate a broader plant research community for their growth and development studies. Furthermore, because we implemented Leaf-GP based on open Python-based computer vision, image

  5. Performance of dihaploid wheat lines obtained via anther culture

    Directory of Open Access Journals (Sweden)

    Salomon Marcus Vinicius

    2003-01-01

    Full Text Available The anther culture technique has been used in breeding programs to obtain haploid plants from hybrid plants of F1 generation and to develop more efficiently wheat cultivars. To study the behavior of dihaploid wheat lines and two check cultivars, IAC-24 and IAC-289, experiments were carried out under sprinkler irrigation at Monte Alegre do Sul, SP, Brazil, in an Haplic Acrisol and at Tatuí, SP, Brazil, in a Rhodic Ferrasol, during the years 1999 and 2000. Genotypes were evaluated for grain yield, 100 grain weight, plant height, resistance to leaf rust (Puccinia recondita f. sp. tritici Rob. Desm. and lodging. The genotypes were also evaluated under laboratory conditions for their Al+3 toxicity tolerance using nutrient solutions. The line 8, originated from ANA/IAC-24 cross, presented high grain yield, semidwarf plant type, heavy grain, leaf rust resistance and tolerance to Al+3 toxicity. The lines 4, 11, 12 and 14, also presented high tolerance to Al+3 toxicity in association to grain yield above 3.000 kg ha-1. These lines are suitable to be used in breeding programs to develop cultivars for acid soils.

  6. UPLC-QTOF analysis reveals metabolomic changes in the flag leaf of wheat (Triticum aestivum L.) under low-nitrogen stress.

    Science.gov (United States)

    Zhang, Yang; Ma, Xin-Ming; Wang, Xiao-Chun; Liu, Ji-Hong; Huang, Bing-Yan; Guo, Xiao-Yang; Xiong, Shu-Ping; La, Gui-Xiao

    2017-02-01

    Wheat is one of the most important grain crop plants worldwide. Nitrogen (N) is an essential macronutrient for the growth and development of wheat and exerts a marked influence on its metabolites. To investigate the influence of low nitrogen stress on various metabolites of the flag leaf of wheat (Triticum aestivum L.), a metabolomic analysis of two wheat cultivars under different induced nitrogen levels was conducted during two important growth periods based on large-scale untargeted metabolomic analysis using ultra-performance liquid chromatography-quadrupole time-of-flight mass spectrometry (UPLC-QTOF). Multivariate analyses-such as principle components analysis (PCA) and orthogonal partial least square discriminant analysis (OPLS-DA)-were used for data analysis. PCA yielded distinctive clustering information among the samples, classifying the wheat flag samples into two categories: those under normal N treatment and low N treatment. By processing OPLS-DA, eleven secondary metabolites were shown to be responsible for classifying the two groups. The secondary metabolites may be considered potential biomarkers of low nitrogen stress. Chemical analyses showed that most of the identified secondary metabolites were flavonoids and their related derivatives, such as iso-vitexin, iso-orientin and methylisoorientin-2″-O-rhamnoside, etc. This study confirmed the effect of low nitrogen stress on the metabolism of wheat, and revealed that the accumulation of secondary metabolites is a response to abiotic stresses. Meanwhile, we aimed to identify markers which could be used to monitor the nitrogen status of wheat crops, presumably to guide appropriate fertilization regimens. Furthermore, the UPLC-QTOF metabolic platform technology can be used to study metabolomic variations of wheat under abiotic stresses. Copyright © 2016 Elsevier Masson SAS. All rights reserved.

  7. First Report of the Ug99 race group of Wheat Stem Rust, Puccinia graminis f. sp. tritici, in Egypt in 2014

    DEFF Research Database (Denmark)

    Patpour, Mehran; Hovmøller, Mogens; Shahin, Atef

    2016-01-01

    Disease-Weed Science Research Unit (Fort Detrick, MD). Urediniospores of each sample were recovered on susceptible wheat cv. Morocco and McNair 701. Twenty-three and 11 single pustule isolates were derived and analyzed at GRRC and USDA-ARS Cereals Disease Laboratory, respectively, using 20 North American......Tmp, and cv. Triumph 64) from Sakha, and TTKSK (2 isolates, IT 4 for Sr31) from Nubaria. This is the first confirmation of races in the Ug99 race group in Egypt, thereby extending the geographical distribution of Ug99-related races. Since Egypt may play a role as green-bridge for P. graminis f. sp. tritici...

  8. [PS II photochemical efficiency in flag leaf of wheat varieties and its adaptation to strong sun- light intensity on farmland of Xiangride in Qinghai Province, Northwest China].

    Science.gov (United States)

    Shi, Sheng-Bo; Chen, Wen-Jie; Shi, Rui; Li, Miao; Zhang, Huai-Gang; Sun, Ya-Nan

    2014-09-01

    Taking four wheat varieties developed by Northwest Institute of Plateau Biology, Chinese Academy of Sciences, as test materials, with the measurement of content of photosynthetic pigments, leaf area, fresh and dry mass of flag leaf, the PS II photochemistry efficiency of abaxial and adaxial surface of flag leaf and its adaptation to strong solar radiation during the period of heading stage in Xiangride region were investigated with the pulse-modulated in-vivo chlorophyll fluorescence technique. The results indicated that flag leaf angle mainly grew in horizontal state in Gaoyuan 314, Gaoyuan 363 and Gaoyuan 584, and mainly in vertical state in Gaoyuan 913 because of its smaller leaf area and larger width. Photosynthetic pigments were different among the 4 varieties, and positively correlated with intrinsic PS II photochemistry efficiencies (Fv/Fm). In clear days, especially at noon, the photosynthetic photoinhibition was more serious in abaxial surface of flag leaf due to directly facing the solar radiation, but it could recover after reduction of sunlight intensity in the afternoon, which meant that no inactive damage happened in PS II reaction centers. There were significant differences of PS II actual and maximum photochemical efficiencies at the actinic light intensity (ΦPS II and Fv'/Fm') between abaxial and adaxial surface, and their relative variation trends were on the contrary. The photochemical and non-photochemical quenching coefficients (qP and NPQ) had a similar tendency in both abaxial and adaxial surfaces. Although ΦPS II and qP were lower in adaxial surface of flag leaf, the Fv'/Fm' was significantly higher, which indicated that the potential PS II capture efficiency of excited energy was higher. The results demonstrated that process of photochemical and non-photochemical quenching could effectively dissipate excited energy caused by strong solar radiation, and there were higher adaptation capacities in wheat varieties natively cultivated in

  9. Barberry rust survey – developing tools for diagnosis, analysis and data management

    DEFF Research Database (Denmark)

    Justesen, Annemarie Fejer; Hansen, Jens Grønbech; Hovmøller, Mogens Støvring

    a rust survey was initiated. The aim was to 1) develop a surveillance protocol 2) develop molecular diagnostic tools for identifying Puccinia spp. from aecial samples, and 3) develop a data management and display system of results as part of the Wheat Rust ToolBox (http....... arrhenatheri and P. striiformoides on barberry species. Survey and DNA sample maps with species designation were displayed in the Wheat Rust ToolBox. The future aim is to integrate barberry rust survey data based on molecular diagnostics and infection assays from research groups world-wide in order to gain......Barberry (Berberis spp.) may serve as alternate host of several Puccinia species including Puccinia graminis and P. striiformis causing stem and yellow rust on cereals and grasses, respectively. In order to study the importance of barberry in the epidemiology of Puccinia species in the CWANA region...

  10. Transcription factor gene TuGTγ-3 is involved in the stripe rust resistance in Triticum urartu.

    Science.gov (United States)

    Ding, Liu-jun; Pu, Ming-yu; Wei, Bo; Wang, Xian-ping; Fan, Ren-chun; Zhang, Xiang-qi

    2016-12-20

    Wheat stripe rust, caused by Puccinia striiformis West. f. sp. tritici Eriks. &Henn. (Pst), is a serious fungal disease. Identification of new genes associate with stripe rust resistance is important for developing disease resistant wheat cultivars and studying the mechanism of disease resistance. Trihelix is a plant specific transcription factor family, which is involved in regulation of growth and development, morphogenesis, and response to stresses. So far, no study reports on the relationship between the Trihelix family and wheat stripe rust. In this study, a gene in the GTγ subfamily of Trihelix family, designated TuGTγ-3, was cloned from Triticum urartu Tum. (2n=2x=14, AA). The results of sequencing demonstrated that TuGTγ-3 gene consisted of a complete open reading frame (ORF), and its coding sequence was 1329 bp in length, which encoded a protein with 442 amino acids. The predicted molecular weight of this protein was 50.31 kDa and the theoretical isoelectric point was 6.12. Bioinformatic analysis revealed that TuGTγ-3 protein had a monopartite nuclear localization signal (GLPMQKKMRYT), and had neither transmembrane domain nor signal peptide. The conserved trihelix domain, the fourth α-helix and the CC domain were located in the regions of Q115?R187, F234?Y241 and K362?K436, respectively. Dissection of secondary structure showed that TuGTγ-3 protein comprised of 43.89% α-helix, 9.51% extended strand, 9.95% β-turn and 36.65% random coil structures. Based on the BLAST search against the genome database of common wheat from IWGSC, TuGTγ-3 was located on the long arm of chromosome 5A. Transient expression experiment using onion inner epidermal cell showed that the fusion protein TuGTγ-3-GFP distributed mainly in nuclear and slightly in cytoplasm. Expression profiles in different organs indicated that expression level of TuGTγ-3 was much higher in leaves than that in roots or leaf sheaths, and the expression in leaves was extremely up-regulated by

  11. The transcriptional response of hybrid poplar (Populus trichocarpa x P. deltoides) to infection by Melampsora medusae leaf rust involves induction of flavonoid pathway genes leading to the accumulation of proanthocyanidins.

    Science.gov (United States)

    Miranda, Manoela; Ralph, Steven G; Mellway, Robin; White, Rick; Heath, Michele C; Bohlmann, Jörg; Constabel, C Peter

    2007-07-01

    The transcriptional response of hybrid poplar (Populus trichocarpa x P. deltoides) to poplar leaf rust (Melampsora medusae) infection was studied using the Populus 15.5K cDNA microarray. Pronounced changes in the transcriptome were observed, with approximately 20% of genes on the array showing either induction or repression of transcription within the 9-day infection timecourse. A small number of pathogen-defense genes encoding PR-1, chitinases, and other pathogenesis-related proteins were consistently upregulated throughout the experimental period, but most genes were affected only at individual timepoints. The largest number of changes in gene expression was observed late in the infection at 6 to 9 days postinoculation (dpi). At these timepoints, genes encoding enzymes required for proanthocyanidin (condensed tannin) synthesis were upregulated dramatically. Phytochemical analysis confirmed that, late in the infection, proanthocyanidin levels increased in infected leaves. Strongly M. medusae-repressed genes at 9 dpi included previously characterized wound- and herbivore-induced defense genes, which suggests antagonism between the tree responses to insect feeding and M. medusae infection. In this highly compatible plant-pathogen interaction, we postulate that the biotrophic pathogen evades detection and suppresses early host responses.

  12. short communication sources of stem rust resistance in ethiopian ...

    African Journals Online (AJOL)

    Administrator

    SHORT COMMUNICATION. SOURCES OF STEM RUST RESISTANCE IN ETHIOPIAN TETRAPLOID. WHEAT ACCESSIONS ... 1Department of Plant Sciences, Alemaya University, P. O. Box 138, Dire Dawa, Ethiopia. 2Southern Agricultural Research Institute, P. O. Box 06, Awassa, Ethiopia. (Received 20 May, 2005; ...

  13. Mapping of stripe rust resistance gene in an Aegilops caudata ...

    Indian Academy of Sciences (India)

    Anonymous 2013 The package of practices for crops of Punjab, rabi. 2013–14. Punjab Agricultural University, Ludhiana, India. Bansal M., Kaur S., Dhaliwal H., Chhuneja P., Bariana H. and. Bansal U. 2016 Introgression of linked rust resistance genes Lr76 and Yr70 from Aegilops umbellulata to wheat chromosome 5DS.

  14. Interactions between crop biomass and development of foliar diseases in winter wheat and the potential to graduate the fungicide dose according to crop biomass

    DEFF Research Database (Denmark)

    Jensen, Peter Kryger; Jørgensen, Lise Nistrup

    2016-01-01

    Foliar pathogens such as Zymoseptoria tritici and Puccinia striiformis causing septoria leaf blotch and yellow rust respectively can cause serious yield reduction in winter wheat production, and control of the diseases often requires several fungicide applications during the growing season. Control...... and other foliar diseases in winter wheat was dependent on crop development and biomass level. If such a biomass dependent dose response was found it was further the purpose to evaluate the potential to optimize fungicide inputs in winter wheat crops applying a site-specific crop density dependent fungicide...... dose. The study was carried out investigating fungicide dose response controlling foliar diseases in winter wheat at three biomass densities obtained growing the crop at three nitrogen levels and using variable seed rates. Further the field experiments included three fungicide dose rates at each...

  15. Estimation of leaf nitrogen concentration on winter wheat by multispectral imaging

    Science.gov (United States)

    Leemans, Vincent; Marlier, Guillaume; Destain, Marie-France; Dumont, Benjamin; Mercatoris, Benoit

    2017-04-01

    Precision agriculture can be considered as one of the solutions to optimize agricultural practice such as nitrogen fertilization. Nitrogen deficiency is a major limitation to crop production worldwide whereas excess leads to environmental pollution. In this context, some devices were developed as reflectance spot sensors for on-the-go applications to detect leaves nitrogen concentration deduced from chlorophyll concentration. However, such measurements suffer from interferences with the crop growth stage and the water content of plants. The aim of this contribution is to evaluate the nitrogen status in winter wheat by using multispectral imaging. The proposed system is composed of a CMOS camera and a set of filters ranged from 450 nm to 950 nm and mounted on a wheel which moves due to a stepper motor. To avoid the natural irradiance variability, a white reference is used to adjust the integration time. The segmentation of Photosynthetically Active Leaves is performed by using Bayes theorem to extract their mean reflectance. In order to introduce information related to the canopy architecture, i.e. the crop growth stage, textural attributes are also extracted from raw images at different wavelength ranges. Nc was estimated by partial least squares regression (R² = 0.94). The best attribute was homogeneity extracted from the gray level co-occurrence matrix (R² = 0.91). In order to select in limited number of filters, best subset selection was performed. Nc could be estimated by four filters (450 +/- 40 nm, 500 +/- 20 nm, 650 +/- 40 nm, 800 +/- 50 nm) (R² = 0.91).

  16. Operational application and improvements of the disease risk forecast model PROCULTURE to optimize fungicides spray for the septoria leaf blotch disease in winter wheat in Luxembourg

    Directory of Open Access Journals (Sweden)

    J. Junk

    2008-05-01

    Full Text Available The model PROCULTURE has been developed by the Université Catholique de Louvain – UCL (Belgium to simulate the progress of the septoria leaf blotch disease on winter wheat during the cropping season. The model has been validated in Luxembourg for four years at four distinct representative sites. It is able to identify infection periods due to the causal agent Mycosphaerella graminicola on the last five leaf layers by combining meteorological data with phenological data from PROCULTURE's crop growth model component. The meteorological forcing consists of hourly time-series of air temperature, relative humidity and cumulative rainfall since the time of sowing, retrieved from automatic weather stations for hindcast and numerical weather prediction model outputs for the forecast periods. In order to improve the model, leaf wetness – which is one of the most important drivers for the spread of the disease – shall be added as an additional predictor. Therefore leaf wetness sensors were set up at four test sites during the 2007 growing season. To get a continuous spatial coverage of the country, it is planned to couple the PROCULTURE model offline to 12-hourly operational weather forecasts from an implementation of the Weather Research and Forecasting (WRF model for Luxembourg at 1 km resolution. Because the WRF model does not provide leaf wetness directly, an artificial neural network (ANN is used to model this parameter.

  17. Herança da resistência do Híbrido de Timor UFV 443-03 à ferrugem-do-cafeeiro Inheritance of coffee leaf rust resistance in Timor Hybrid UFV 443-03

    Directory of Open Access Journals (Sweden)

    Alexandre Sandri Capucho

    2009-03-01

    Full Text Available O objetivo deste trabalho foi caracterizar a herança da resistência do Híbrido de Timor UFV 443-03 à ferrugem-do-cafeeiro (Hemileia vastatrix. Para isso, a raça II e o patótipo 001 de ferrugem foram inoculados em 246 plantas da população F2, 115 plantas do retrocruzamento suscetível (RC S e 87 plantas do retrocruzamento resistente (RC R, originadas do cruzamento entre o genótipo suscetível cv. Catuaí Amarelo IAC 64 e a fonte de resistência Híbrido de Timor UFV 443-03. Para ambos os inóculos, a cv. Catuaí Amarelo IAC 64 foi suscetível, enquanto o Híbrido de Timor UFV 443-03, a planta representante da geração F1 e as plantas do RC R foram resistentes. As plantas F2, quando inoculadas com a raça II, apresentaram dois padrões de segregação significativos: 15:1 e 61:3. A herança da resistência foi confirmada pela inoculação das plantas do RC S, que segregaram na proporção de 3:1, padrão esperado para herança condicionada por dois genes. A hipótese de segregação 7:1 para três genes foi rejeitada. Resultados semelhantes foram obtidos para o patótipo 001. Dois genes dominantes e independentes conferem a resistência genética do Híbrido de Timor UFV 443-03 à raça II e ao patótipo 001 de H. vastatrix.The aim of this work was to characterize the resistance inheritance of the Timor Hybrid UFV 443-03 to coffee leaf rust (Hemileia vastatrix. For this, the race II and pathotype 001 of coffee leaf rust were inoculated in 246 F2 plants, 115 susceptible backcrossing (BCS plants, and 87 resistant backcrossing (BC R plants, derived from the crossing between the susceptible genotype 'Catuaí Amarelo' IAC 64 and the resistance source Timor Hybrid UFV 443-03. For both inoculums, the 'Catuaí Amarelo' IAC 64 was susceptible, while the Timor Hybrid, the plant representing F1 generation, and the BC R plants were resistant. The F2 plants inoculated with race II presented two significant segregation ratios: 15:1 and 61:3. The

  18. Obligate Biotrophy Features Unraveled by the Genomic Analysis of the Rust Fungi, Melampsora larici-populina and Puccinia graminis f. sp. tritici

    Energy Technology Data Exchange (ETDEWEB)

    Duplessis, Sebastien; Cuomo, Christina A.; Lin, Yao-Cheng; Aerts, Andrea; Tisserant, Emilie; Veneault-Fourrey, Claire; Joly, David L.; Hacquard, Stephane; Amselem, Joelle; Cantarel, Brandi; Chiu, Readman; Couthinho, Pedro; Feau, Nicolas; Field, Matthew; Frey, Pascal; Gelhaye, Eric; Goldberg, Jonathan; Grabherr, Manfred; Kodira, Chinnappa; Kohler, Annegret; Kues, Ursula; Lindquist, Erika; Lucas, Susan; Mago, Rohit; Mauceli, Evan; Morin, Emmanuelle; Murat, Claude; Pangilinan, Jasmyn L.; Park, Robert; Pearson, Matthew; Quesneville, Hadi; Rouhier, Nicolas; Sakthikumar, Sharadha; Salamov, Asaf A.; Schmutz, Jeremy; Selles, Benjamin; Shapiro, Harris; Tangay, Philippe; Tuskan, Gerald A.; Peer, Yves Van de; Henrissat, Bernard; Rouze, Pierre; Ellis, Jeffrey G.; Dodds, Peter N.; Schein, Jacqueline E.; Zhong, Shaobin; Hamelin, Richard C.; Grigoriev, Igor V.; Szabo, Les J.; Martin1, Francis

    2011-04-27

    Rust fungi are some of the most devastating pathogens of crop plants. They are obligate biotrophs, which extract nutrients only from living plant tissues and cannot grow apart from their hosts. Their lifestyle has slowed the dissection of molecular mechanisms underlying host invasion and avoidance or suppression of plant innate immunity. We sequenced the 101 mega base pair genome of Melampsora larici-populina, the causal agent of poplar leaf rust, and the 89 mega base pair genome of Puccinia graminis f. sp. tritici, the causal agent of wheat and barley stem rust. We then compared the 16,841 predicted proteins of M. larici-populina to the 18,241 predicted proteins of P. graminis f. sp tritici. Genomic features related to their obligate biotrophic life-style include expanded lineage-specific gene families, a large repertoire of effector-like small secreted proteins (SSPs), impaired nitrogen and sulfur assimilation pathways, and expanded families of amino-acid, oligopeptide and hexose membrane transporters. The dramatic upregulation of transcripts coding for SSPs, secreted hydrolytic enzymes, and transporters in planta suggests that they play a role in host infection and nutrient acquisition. Some of these genomic hallmarks are mirrored in the genomes of other microbial eukaryotes that have independently evolved to infect plants, indicating convergent adaptation to a biotrophic existence inside plant cells

  19. QTL analysis of crown rust resistance in perennial ryegrass under conditions of natural and artificial infection

    DEFF Research Database (Denmark)

    Schejbel, Britt; Jensen, Louise Friis Bach; Xing, Yongzhong

    2007-01-01

    Crown rust is an economically devastating disease of perennial ryegrass. Both artificial crown rust inoculations, with the possibility of several selection cycles in one year, as well as marker-assisted selection can be used for more efficient breeding of new resistant cultivars. The objective...... as well as by artificial pathogen inoculations using a detached leaf assessment. The broad sense heritability values for the field, detached leaf and combined assays were 0.42, 0.56, and 0.64, respectively, indicating a good potential for selection for crown rust resistance. A total of six QTLs were...

  20. Grain yield and agronomic characteristics of Romanian bread wheat ...

    African Journals Online (AJOL)

    STORAGESEVER

    2008-05-16

    May 16, 2008 ... In this study, fourteen bread wheat varieties, twelve of which were introduced into Turkey from. Romania, were evaluated for grain ... Romanian wheat varieties, to study the associations between yield and yield components, and to determine the most ...... Huerta-Espino J (1994). Rust diseases of wheat. In:.

  1. Sustainable use of winter Durum wheat landraces under ...

    African Journals Online (AJOL)

    This research expected to determine new durum wheat germplasm resistant to biotic and abiotic stress factors. Eighty durum wheat lines selected from eighteen diverse landraces were tested together with eight durum wheat cultivars under reliable yellow rust epidemic during two successive years. Average infection ...

  2. Genetic Diversity in Durum Wheat in Palestine: A Comparative Study

    African Journals Online (AJOL)

    NNU

    2012-08-16

    Aug 16, 2012 ... method to evaluate genetic variation and relatedness among ten wheat landraces and cultivars. Key words: Random amplified ... production of wheat in Palestine is 32000 ton (Palestinian. Central Bureau of Statistics, 2009), ..... marker linked with yellow rust resistance in wheat. Biol. Plantarum. 54:691-696.

  3. Characterization of a new synthetic wheat – Aegilops biuncialis ...

    African Journals Online (AJOL)

    The aim of the experiments was to identify the synthetic wheat – Aegilops biuncialis germplasm Line 15-3-2 with 42 chromosomes. Morphologically, the spike of line 15-3-2 is intermediate to those of its wheat and Aegilops parents. Line 15-3-2 displays stable fertility and immunity to wheat powdery mildew and stripe rust.

  4. Anatomical features of leaves of three cultivars of winter wheat (Triticum aestivum L. and settling the plants by cereal leaf beetles, Oulema spp. (Coleoptera, Chrysomelidae

    Directory of Open Access Journals (Sweden)

    Elżbieta Weryszko-Chmielewska

    2013-12-01

    Full Text Available Investigations of flag leaves anatomy of three winter wheat cultivars: Almari, Gama and Weneda were carried out as it was state that there are great differences in the intensity of cereal leaf beetle feeding on the leaves. In order to determine the features conditioning the differentiated resistance of these cultivars following parameters were measured: the thickness of leaf blade, the length of trichomes and their density in the adaxial epidermis, the number of silicon cells in 1 mm2 epidermis and the thickness of the external cell walls of epidermis. The observations of cross section of the leaves were made in a light microscope and that of surface of the adaxial epidermis in a scanning electron microscope. In this study it was shown that Gama cv. distinguishes of the shortest trichomes with poor density, the lowest number of the silicon cells in 1 mm2 and epidermis cells with the thinest walls. This features indicate a poor resistance of Gama cv. against feeding of the pests and give reasons for the presence a much higher number of the cereal leaf beetle larvae (about 100% than at the extant two cultivars. Dependence between the thickness of leaf blades and the number of larvae of the infesting pests has not been stated.

  5. Health of leaves and ears of spring wheat (Triticum aestivum L. cultivated after different forecrops

    Directory of Open Access Journals (Sweden)

    Barbara Majchrzak

    2013-12-01

    Full Text Available The research was conduced in the years 2000-2002. The aim of the research was to determinate the health of leaves and ears of spring wheat cultivated after spring cruciferae plants such as: spring oilseed rape (Brassica napus ssp. oleiferus Metz., chiiiese mustard (Brassica juncea L., white mustard (Sinapis alba L., ole iferous radish (Raphanus sativus var. oleiferus L., false flax (Camelina sativa L., crambe (Crambe abbysinica Hoechst., as well as after oat (Avena sativa L. as con trol. Spring wheat cv. Torka was sown after: pIoughed stubble cultivated on this field, ploughed stubble and straw, ploughed stubble with straw and 30 kg nitrogen per hectare. During all the years of studies on leaves and ears of spring wheat septo ria of leaf blotch and glume blotch (Mycosphaerella graminicola, Phaeosphaeria nodorum were found. Brown rust (Puccinia recondita f. sp. tritici was seen on leaves of wheat only during years 2001-2002. Besides on ears fusarium ear blight (Fusarimn sp. was present in 2002 and sooty mould (Cladosporium sp., Alternaria sp. in 2001. According to health of overground parts of plants the good forecrops to spring wheat were oat, chinese mustard, oleiferous radish. The biggest impact on presence of diseases of leaves and ears had the weather during years of studies. The use of after harvest rests didn't have significant influence on health of leaves and ears of spring wheat.

  6. Growth promoting potential of fresh and stored Moringa oleifera leaf extracts in improving seedling vigor, growth and productivity of wheat crop.

    Science.gov (United States)

    Khan, Shahbaz; Basra, Shahzad Maqsood Ahmed; Afzal, Irfan; Nawaz, Muhammad; Rehman, Hafeez Ur

    2017-12-01

    Wheat is staple food of region, as it contributes 60% of daily caloric intake, but its delayed sowing reduces yield due to short life span. Moringa leaf extract (MLE) is considered to improve growth and development of field crops. Study comprised of two experiments. First experiment, freshly extracted MLE and in combination with growth-promoting substances were stored at two temperature regimes. Chemical analysis, after 1, 2, and 3 months' storage period, showed that phenolics and ascorbic acid concentrations decreased with increasing storage period. Fresh extracts improved speed and spread of emergence and seedling vigor. Effectiveness of MLE in terms of phenolics and ascorbate concentrations was highest up to 1 month which decreased with prolonged storage. Growth enhancing potential of MLE also reduced with increasing storage duration. Under field conditions, the bio-efficacy of these fresh and stored MLE was compared when applied as foliar spray at tillering and booting stages of wheat. Foliar applied fresh MLE was the most effective in improving growth parameters. Fresh MLE enhanced biochemical and yield attributes in late sown wheat. This growth-promoting potential of MLE decreased with storage time. Application of fresh MLE helped to achieve higher economic yield.

  7. [Detection of Puccinia strii formis f. sp. tritici latent infections in wheat leaves using near infrared spectroscopy technology].

    Science.gov (United States)

    Li, Xiao-Long; Ma, Zhan-Hong; Zhao, Long-Lian; Li, Jun-Hui; Wang, Hai-Guang

    2014-07-01

    To realize the early detection of P. strii formis f. sp. tritici latent infections in wheat leaves while no disease symptoms appear, a qualitative model for identification of the wheat leaves in the incubation period of stripe rust was built using near infrared reflectance spectroscopy (NIRS) technology combined with qualitative partial least squares (DPLS). In this study, 30 leaf samples infected with P. strii formis f. sp. tritici were collected each day during the eleven-day incubation period. And 30 healthy leaf samples and 30 leaf samples showing disease symptoms infected with P. strii formis f. sp. tritici, were also collected as controls. In total, there were 390 leaf samples that were divided into thirteen categories. Near infrared spectra of 390 leaf samples were obtained using MPA spectrometer and then a model to identify the categories of wheat leaves was built using cross verification method. The effects of different spectral ranges, samples for building the model, preprocessing methods of spectra and number of principal components on NIRS prediction results for qualitative identification were investigated. The optimal identification results were obtained for the model built in the combined spectral region of 5 400-6 600 and 7 600-8 900 cm(-1) when the spectra were divided into the training set and the testing set with the ratio equal to 4 : 1, "scatter correction" was used as the preprocessing method and the number of principal components was 14. Accuracy rate, misjudgment rate and confusion rate of the training set were 95.51%, 1.28% and 3.21%, respectively. And accuracy rate, misjudgment rate and confusion rate of the testing set were 100.00%, 0.00% and 0.00%, respectively. The result showed that using near infrared reflectance spectroscopy technology, P. strii formis f. sp. tritici latent infections in wheat leaves could be detected as early as one day after inoculation (or 11 days before symptoms appearing) and the number of days when the leaf has

  8. Comparative role of neem seed extract, moringa leaf extract and imidacloprid in the management of wheat aphids in relation to yield losses in Pakistan.

    Science.gov (United States)

    Shah, Farhan Mahmood; Razaq, Muhammad; Ali, Abid; Han, Peng; Chen, Julian

    2017-01-01

    Wheat being staple food of Pakistan is constantly attacked by major wheat aphid species, Schizaphis graminum (R.), Rhopalosiphum padi (L.) and Sitobion avenae (F.). Due to concern on synthetic chemical use in wheat, it is imperative to search for alternative environment- and human- friendly control measures such as botanical pesticides. In the present study, we evaluated the comparative role of neem seed extract (NSE), moringa leaf extract (MLE) and imidacloprid (I) in the management of the aphid as well as the yield losses parameters in late planted wheat fields. Imidacloprid reduced significantly aphids infestation compared to the other treatments, hence resulting in higher yield, particularly when applied with MLE. The percentages of yield increase in I+MLE treated plots over the control were 19.15-81.89% for grains per spike, 5.33-37.62% for thousand grain weight and 27.59-61.12% for yield kg/ha. NSE was the second most effective control measure in suppressing aphid population, but the yield protected by NSE treatment over the control was comparable to that by imidacloprid. Population densities of coccinellids and syrphids in the plots treated with NSE-2 were higher than those treated with imidacloprid in two out of three experiments during 2013-14. Low predator density in imidacloprid-treated plots was attributed to the lower availability of prey aphids. The efficacy of NSE against aphids varied depending on degree of synchronization among the application timing, the activity of aphids, crop variety and environmental conditions. Despite that, we suggested NSE to be a promising alternative botanical insecticide compared to the most commonly recommended imidiacloprid. Further studies should consider the side effects of biopesticides on non-target organisms in order to provide better management practices in the field.

  9. Pattern of solutes accumulated during leaf osmotic adjustment as related to duration of water deficit for wheat at the reproductive stage.

    Science.gov (United States)

    Nio, S A; Cawthray, G R; Wade, L J; Colmer, T D

    2011-10-01

    This study examined expression of osmotic adjustment (OA) and accumulation of solutes in wheat (Triticum aestivum L.) leaves in response to water deficit (WD) imposed at the reproductive stage. Two contrasting cultivars, Hartog and Sunco (putatively high and low in OA capacity, respectively), were grown in deep (viz. 80 cm) pots in a controlled environment. In a sandy substrate, leaf OA was 5-times greater in Hartog compared with Sunco. At 21 d of WD treatment, K(+) only accounted for 12% of OA in Hartog and 48% in Sunco with less OA (i.e. tissue K(+) led to different proportions owing to different magnitudes of OA). Glycinebetaine and proline also increased under WD, but these were not significant osmotica on a whole tissue basis. Hartog accumulated dry matter faster than Sunco under WD, and this was consistent with greater water extraction by Hartog than by Sunco. In a second experiment on Hartog, with loam added to the sand to increase water-holding capacity and thus enable a longer draw-down period, leaf OA increased to 0.37 MPa at 37 d of withholding water. K(+) increased up to 16 d of drying and then decreased towards 37 d. Glycinebetaine, proline, glucose and fructose all increased during the draw-down period, although with different dynamics; e.g. glycinebetaine increased linearly whereas glucose showed an exponential increase. By contrast, sucrose declined. K(+) was the major contributor to OA (viz. 54%) up to 30 d of drying, whereas glycinebetaine, proline and glucose were major contributors later (at d 37 these organic solutes each accounted for 19, 21 and 21% of OA). Thus, the various solutes that contributed to leaf OA in wheat cv. Hartog accumulated at different times as WD developed. Copyright © 2011 Elsevier Masson SAS. All rights reserved.

  10. Factors contributing to seasonal fluctuations in rust severity on Ribes missouriense caused by Cronartium ribicola.

    Science.gov (United States)

    Newcomb, Maria; Upper, Christen D; Rouse, Douglas I

    2010-10-01

    Cronartium ribicola, causal agent of white pine blister rust, is a macrocyclic heteroecious rust that cycles between white pines and members of the genus Ribes, which are typically wild plants in North America. To improve predictability of inoculum available for infection of ecologically and commercially important white pines, this research was conducted to identify the factors that influence the development and persistence of uredinia and telia on Ribes in their natural habitats. Numbers of infectious C. ribicola rust lesions (with potentially sporulating rust sori) on tagged Ribes missouriense plants in the woods fluctuated during the season. Changes in numbers of infectious rust lesions were related to rain that occurred 13 days earlier. In field experiments, supplemental leaf wetness provided for 2 days on Ribes shoots resulted in the development of rust lesions more frequently than on control shoots. Viable inoculum and susceptible hosts were present, and the environment was the limiting factor for disease development. Lesion necrosis and leaf abscission contributed to decreases in numbers of infectious rust lesions. Higher lesion density was significantly related to earlier leaf abscission. Telial fruiting bodies occurred in low numbers from early June throughout the remainder of the season.

  11. SNP Discovery for mapping alien introgressions in wheat

    Science.gov (United States)

    2014-01-01

    Background Monitoring alien introgressions in crop plants is difficult due to the lack of genetic and molecular mapping information on the wild crop relatives. The tertiary gene pool of wheat is a very important source of genetic variability for wheat improvement against biotic and abiotic stresses. By exploring the 5Mg short arm (5MgS) of Aegilops geniculata, we can apply chromosome genomics for the discovery of SNP markers and their use for monitoring alien introgressions in wheat (Triticum aestivum L). Results The short arm of chromosome 5Mg of Ae. geniculata Roth (syn. Ae. ovata L.; 2n = 4x = 28, UgUgMgMg) was flow-sorted from a wheat line in which it is maintained as a telocentric chromosome. DNA of the sorted arm was amplified and sequenced using an Illumina Hiseq 2000 with ~45x coverage. The sequence data was used for SNP discovery against wheat homoeologous group-5 assemblies. A total of 2,178 unique, 5MgS-specific SNPs were discovered. Randomly selected samples of 59 5MgS-specific SNPs were tested (44 by KASPar assay and 15 by Sanger sequencing) and 84% were validated. Of the selected SNPs, 97% mapped to a chromosome 5Mg addition to wheat (the source of t5MgS), and 94% to 5Mg introgressed from a different accession of Ae. geniculata substituting for chromosome 5D of wheat. The validated SNPs also identified chromosome segments of 5MgS origin in a set of T5D-5Mg translocation lines; eight SNPs (25%) mapped to TA5601 [T5DL · 5DS-5MgS(0.75)] and three (8%) to TA5602 [T5DL · 5DS-5MgS (0.95)]. SNPs (gsnp_5ms83 and gsnp_5ms94), tagging chromosome T5DL · 5DS-5MgS(0.95) with the smallest introgression carrying resistance to leaf rust (Lr57) and stripe rust (Yr40), were validated in two released germplasm lines with Lr57 and Yr40 genes. Conclusion This approach should be widely applicable for the identification of species/genome-specific SNPs. The development of a large number of SNP markers will facilitate the precise introgression and

  12. Characterization of rust, early and late leaf spot resistance in wild and cultivated peanut germplasm Caracterização da resistência à ferrugem, mancha preta e mancha castanha em germoplasma silvestre e cultivado de amendoim

    Directory of Open Access Journals (Sweden)

    Alessandra Pereira Fávero

    2009-02-01

    Full Text Available Groundnut (Arachis hypogaea has an AB genome and is one of the most important oil crops in the world. The main constraints of crop management in Brazil are fungal diseases. Several species of the genus Arachis are resistant to pests and diseases. The objective of our experiments was to identify wild species belonging to the taxonomic section Arachis with either A or B (or " non-A" genomes that are resistant to early leaf spot (Cercospora arachidicola, late leaf spot (Cercosporidium personatum and rust (Puccinia arachidis. For the identification of genotypes resistant to fungal diseases, bioassays with detached leaves were done in laboratory conditions, with artificial inoculation, a controlled temperature of 25ºC and a photoperiod of 10 h light/14 h dark, for 20-42 days, depending on the fungi species. Most of the accessions of wild species were more resistant than accessions of A. hypogaea for one, two or all three fungi species studied. Arachis monticola, considered to be a possible tetraploid ancestor or a derivative of A. hypogaea, was also more susceptible to Cercosporidium personatum and Puccinia arachidis, as compared to most of the wild species. Therefore, wild germplasm accessions of both genome types are available to be used for the introgression of resistance genes against three fungal diseases of peanut.O amendoim (Arachis hypogaea possui genoma AB e é uma das mais importantes culturas oleaginosas em todo o mundo. Os principais problemas da cultura no Brasil são as doenças fúngicas. Várias espécies do gênero Arachis são resistentes a pragas e doenças. Este trabalho visou a identificar espécies silvestres pertencentes à seção Arachis associadas aos genomas A ou B (ou " não-A" do amendoim que são resistentes à mancha castanha (Cercospora arachidicola, mancha preta (Cercosporidium personatum e ferrugem (Puccinia arachidis. Para a identificação de genótipos resistentes a doenças fúngicas, bioensaios utilizando

  13. Functional and DNA-protein binding studies of WRKY transcription factors and their expression analysis in response to biotic and abiotic stress in wheat (Triticum aestivum L.).

    Science.gov (United States)

    Satapathy, Lopamudra; Kumar, Dhananjay; Kumar, Manish; Mukhopadhyay, Kunal

    2018-01-01

    WRKY, a plant-specific transcription factor family, plays vital roles in pathogen defense, abiotic stress, and phytohormone signalling. Little is known about the roles and function of WRKY transcription factors in response to rust diseases in wheat. In the present study, three TaWRKY genes encoding complete protein sequences were cloned. They belonged to class II and III WRKY based on the number of WRKY domains and the pattern of zinc finger structures. Twenty-two DNA-protein binding docking complexes predicted stable interactions of WRKY domain with W-box. Quantitative real-time-PCR using wheat near-isogenic lines with or without Lr28 gene revealed differential up- or down-regulation in response to biotic and abiotic stress treatments which could be responsible for their functional divergence in wheat. TaWRKY62 was found to be induced upon treatment with JA, MJ, and SA and reduced after ABA treatments. Maximum induction of six out of seven genes occurred at 48 h post inoculation due to pathogen inoculation. Hence, TaWRKY (49, 50, 52, 55, 57, and 62) can be considered as potential candidate genes for further functional validation as well as for crop improvement programs for stress resistance. The results of the present study will enhance knowledge towards understanding the molecular basis of mode of action of WRKY transcription factor genes in wheat and their role during leaf rust pathogenesis in particular.

  14. Effect of Glycine Betaine and Salicylic Acid on Growth and Productivity of Droughted Wheat Cultivars: Image Analysis for Measuring the Anatomical Features in Flag Leaf and Peduncle of the Main Shoot

    Directory of Open Access Journals (Sweden)

    Aldesuquy, Heshmat S.

    2013-04-01

    Full Text Available The present study was planned to investigate the possible role displayed by water stress and application of GB, SA or their interaction on some anatomical features in flag leaf at anthesis (after 95 days from sowing by measuring leaf thickness, ground tissue thickness, number of hairs, metaxylem vessel area, xylem vessel area, phloem tissue area, vascular bundle tissues area, number of motor cells as well as number of opened and closed stomata on both upper and lower epidermis and some anatomical features of peduncle (peduncle diameter, tracheids area, metaxylem vessel area, xylem area, phloem area, vascular area, number of vascular bundle as well as opened and closed stomata of the two wheat cultivars. Water stress markedly affected the anatomical features in flag leaves of both wheat cultivars. It caused massive decreases (P< 0.05 in the leaf thickness, ground tissue thickness, number of hairs, metaxylem vessel area, xylem vessel area, phloem tissue area, vascular bundle area, number of motor cells as well as number of opened stomata on both upper and lower epidermis. On the other hand, water stress increased (P< 0.05 the number of hairs and closed stomata on both upper and lower epidermis in flag leaves of the two wheat cultivars. The magnitude of decrease in all anatomical features in flag leaf was more pronounced with the sensitive cultivar. Furthermore, water stress led to a marked decrease (P< 0.05 in peduncle diameter, tracheids area, metaxylem vessel area, xylem tissue area, phloem tissue area, vascular tissue area, number of vascular bundles as well as opened stomata but increased the number of hairs and closed stomata on the peduncle surface of the two wheat cultivars. In relation to wheat cultivar, the sensitive was more affected by water stress than the resistant one. The application of GB, SA or their interaction induced some modifications in the anatomical features of the flag leaf and peduncle of main shoot which appeared to be

  15. Genetic diversity of the Novi Sad Wheat Core Collection revealed by microsatellites.

    Science.gov (United States)

    Kobiljski, Borislav; Quarrie, Steve; Dencić, Srbislav; Kirby, Jane; Iveges, Mirjana

    2002-01-01

    In recent years, considerable emphasis has been placed on the development of microsatellites to be used for a variety of objectives. Parental genetic diversity is a crucial requisition to derive desirable and superior progenies from crossing and selection. In order to determine desirable genotypes for hybridization, 710 wheat genotypes from the Novi Sad Core Collection, originating from 38 countries, have been evaluated during the 1993-2000 period. During those seven growth seasons, 54 agronomical, morphological, physiological and other traits have been evaluated in field and controlled conditions. In each year, the field experiment comprised 3-7 replications, while for each field replication the plot size was 1.2 m(2). Based on the results from this evaluation, 96 genotypes with the highest phenotypic variation for 26 of the very important traits for wheat breeding programmes in Yugoslavia and the UK, were identified for screening with microsatellites. A set of 36 microsatellite markers was used, covering all three wheat genomes and all 42 chromosomes. For the 36 microsatellites, a total of 46 loci and 366 alleles were detected, with the average number of 7.96 alleles per locus. For 35 loci, null alleles were detected. The association of microsatellite data with phenotypic data, for 6 important traits for wheat breeding (stem height, earliness, resistance to leaf rust and powdery mildew, sedimentation value and protein content), as well as the potential for their implementation in marker assisted selection (MAS) in wheat breeding programmes for both Yugoslavia and UK are discussed.

  16. Fungicides efficiency on wheat diseases control in response to the application with different spray nozzles

    Directory of Open Access Journals (Sweden)

    Felipe Rafael Garcés Fiallos

    2011-12-01

    Full Text Available This study aimed to evaluate the efficiency of fungicides to leaf control diseases of wheat, when applied to different models of spray nozzles. The experiment was conducted in a randomized block design with four replicates of factorial (4 x 3+1. Data were subjected to analysis of variance and means compared by Tukey test at 5% probability. The fungicides used were: Opera® (pyraclostrobin+epoxiconazole 0.75 L.ha-1 , Opera® 0.75 L.ha-1 +Folicur® (tebuconazole 0.3 L.ha-1 , Priori Xtra® (azoxystrobin+cyproconazole 0.3 L.ha-1 , Priori Xtra® 0.3 L.ha-1 +Tilt® (propiconazole 0.3 L.ha-1 . These fungicides were applied with three models of spray nozzles jet planes: XR 11 001 (fine drop, AIRMIX 11,001 (average drop and AVI 11,001 (coarse drop. We evaluated the incidence and severity (damage per plant leaf of yellow spot (Drechslera tritici-repentis, spot blotch (Bipolaris sorokiniana, leaf rust (Puccinia triticina and grain yield (kg.ha-1 culture. The results show that the application of fungicides for control of leaf diseases in wheat resulted in increases in grain yield, and yield higher values were observed with the application of Opera®, using the XR 11001.

  17. Improvement of Resistance Against Septoria Leaf Blotch Caused By Zymoseptoria tritici in Danish Winter Wheat Cultivars

    DEFF Research Database (Denmark)

    Vagndorf, Nana; Nielsen, Nanna Hellum; Edriss, Vahid

    Septoria tritici blotch (STB) caused by the ascomycete fungus Zymoseptoria tritici (formerly Mycosphaerella graminicola), is a devastating disease causing major yield losses in winter wheat. It is therefore important to develop varieties with a broad range of resistance towards the disease...

  18. Shiitake Medicinal Mushroom, Lentinus edodes (Higher Basidiomycetes) Productivity and Lignocellulolytic Enzyme Profiles during Wheat Straw and Tree Leaf Bioconversion.

    Science.gov (United States)

    Elisashvili, Vladimir; Kachlishvili, Eva; Asatiani, Mikheil D

    2015-01-01

    Two commercial strains of Lentinus edodes have been comparatively evaluated for their productivity and lignocellulolytic enzyme profiles in mushroom cultivation using wheat straw or tree leaves as the growth substrates. Both substrates are profitable for recycling into shiitake fruit bodies. L. edodes 3715 gave the lowest yield of mushroom during tree leaves bioconversion with the biological efficiency (BE) 74.8% while the L. edodes 3721 BE achieved 83.4%. Cultivation of shiitake on wheat straw, especially in the presence of additional nitrogen source, increased the L. edodes 3721 BE to 92-95.3% owing to the high hydrolases activity and favorable conditions. Despite the quantitative variations, each strain of L. edodes had a similar pattern for secreting enzymes into the wheat straw and tree leaves. The mushrooms laccase and MnP activities were high during substrate colonization and declined rapidly during primordia appearance and fruit body development. While oxidase activity decreased, during the same period cellulases and xylanase activity raised sharply. Both cellulase and xylanase activity peaked at the mature fruit body stage. When mushrooms again shifted to the vegetative growth, oxidase activity gradually increased, whereas the hydrolases activity dropped rapidly. The MnP, CMCase, and FP activities of L. edodes 3721 during cultivation on wheat straw were higher than those during mushroom growth on tree leaves whereas the laccase activity was rather higher in fermentation of tree leaves. Enrichment of wheat straw with an additional nitrogen source rather favored to laccase, MnP, and FPA secretion during the vegetative stage of the L. edodes 3721 growth.

  19. Identification of Putative Coffee Rust Mycoparasites via Single-Molecule DNA Sequencing of Infected Pustules.

    Science.gov (United States)

    James, Timothy Y; Marino, John A; Perfecto, Ivette; Vandermeer, John

    2015-11-13

    The interaction of crop pests with their natural enemies is a fundament to their control. Natural enemies of fungal pathogens of crops are poorly known relative to those of insect pests, despite the diversity of fungal pathogens and their economic importance. Currently, many regions across Latin America are experiencing unprecedented epidemics of coffee rust (Hemileia vastatrix). Identification of natural enemies of coffee rust could aid in developing management strategies or in pinpointing species that could be used for biocontrol. In the present study, we characterized fungal communities associated with coffee rust lesions by single-molecule DNA sequencing of fungal rRNA gene bar codes from leaf discs (≈28 mm(2)) containing rust lesions and control discs with no rust lesions. The leaf disc communities were hyperdiverse in terms of fungi, with up to 69 operational taxonomic units (putative species) per control disc, and the diversity was only slightly reduced in rust-infected discs, with up to 63 putative species. However, geography had a greater influence on the fungal community than whether the disc was infected by coffee rust. Through comparisons between control and rust-infected leaf discs, as well as taxonomic criteria, we identified 15 putative mycoparasitic fungi. These fungi are concentrated in the fungal family Cordycipitaceae and the order Tremellales. These data emphasize the complexity of diverse fungi of unknown ecological function within a leaf that might influence plant disease epidemics or lead to the development of species for biocontrol of fungal disease. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

  20. Genetic control and combining ability of flag leaf area and relative water content traits of bread wheat cultivars under drought stress condition

    Directory of Open Access Journals (Sweden)

    Golparvar Ahmad Reza

    2013-01-01

    Full Text Available In order to compare mode of inheritance, combining ability, heterosis and gene action in genetic control of traits flag leaf area, relative water content and grain filling rate of bread wheat under drought stress, a study was conducted on 8 cultivars using of Griffing’s method2 in fixed model. Mean square of general combining ability was significant also for all traits and mean square of specific combining ability was significant also for all traits except relative water content of leaf which show importance of both additive and dominant effects of genes in heredity of these traits under stress. GCA to SCA mean square ratio was significant for none of traits. Results of this study showed that non additive effects of genes were more important than additive effect for all traits. According to results we can understand that genetic improvement of mentioned traits will have low genetic efficiency by selection from the best crosses of early generations. Then it is better to delay selection until advanced generations and increase in heritability of these traits.

  1. Contribution of the ear and the flag leaf to grain filling in durum wheat inferred from the carbon isotope signature: genotypic and growing conditions effects.

    Science.gov (United States)

    Sanchez-Bragado, Rut; Elazab, Abdelhalim; Zhou, Bangwei; Serret, Maria Dolors; Bort, Jordi; Nieto-Taladriz, Maria Teresa; Araus, José Luis

    2014-05-01

    The ear, together with the flag leaf, is believed to play a major role as a source of assimilates during grain filling in C3 cereals. However, the intrusive nature of most of the available methodologies prevents reaching conclusive results in this regard. This study compares the carbon isotope composition (δ(13)C) in its natural abundance in the water-soluble fractions of the flag leaf blade and the ear with the δ(13)C of mature kernels to assess the relative contribution of both organs to grain filling in durum wheat (Triticum turgidum L. var. durum). The relative contribution of the ear was higher in landraces compared to modern cultivars, as well as in response to nitrogen fertilization and water stress. Such genotypic and environmentally driven differences were associated with changes in harvest index (HI), with the relative contribution of the ear being negatively associated with HI. In the case of the genotypic differences, the lower relative contribution of the ear in modern cultivars compared with landraces is probably associated with the appearance in the former of a certain amount of source limitation driven by a higher HI. In fact, the relative contribution of the ear was far more responsive to changes in HI in modern cultivars compared with landraces. © 2013 Institute of Botany, Chinese Academy of Sciences.

  2. Impact of ectomycorrhizal colonization and rust infection on the secondary metabolism of poplar (Populus trichocarpa x deltoides).

    Science.gov (United States)

    Pfabel, Cornelia; Eckhardt, Kai-Uwe; Baum, Christel; Struck, Christine; Frey, Pascal; Weih, Martin

    2012-11-01

    Fungal colonization can significantly affect the secondary metabolism of the host plants. We tested the impact of a common below-ground symbiosis, i.e., ectomycorrhiza formation, on poplar leaf chemical components that are involved in the defence against a common disease, i.e., rust fungi, in N-deficient soil. A rust-susceptible poplar clone (Populus trichocarpa × deltoides 'Beaupré') was (a) non-associated with ectomycorrhizal fungus (EM) Hebeloma mesophaeum (Pers.) Quélet MÜN and non-infected with rust fungus Melampsora larici-populina Kleb. (isolate 98AG31), (b) associated with EM, (c) inoculated with rust fungus and (d) associated with EM and inoculated with rust fungus. Poplar leaves were analysed by photometric and mass spectrometric techniques (liquid chromatography-tandem mass spectrometry (LC-MS/MS), pyrolysis-field ionization mass spectrometry (Py-FIMS)). Both rust infection and mycorrhiza formation led to increased proportions of condensed tannins in relation to total phenolics (13% in the control, 18-19% in the fungal treatments). In contrast, salicylic acid concentration (6.8 µg g(-1) in the control) was higher only in the rust treatments (17.9 and 25.4 µg g(-1) with rust infection). The Py-FIMS analysis revealed that the rust-infected treatments were significantly separated from the non-rust-infected treatments on the basis of six flavonoids and one lipid. The relative abundance of these components, which have known functions in plant defence, was decreased after rust infection of non-mycorrhizal plants, but not in mycorrhizal plants. The results indicate that the ectomycorrhizal formation compensated the rust infection by a decrease in the flavonoid syntheses. The study provides new evidence for an interactive response of mycorrhizal colonization and infection with rust fungi in the metabolism of poplar.

  3. [Effects of nitrogen application and elevated atmospheric CO2 on electron transport and energy partitioning in flag leaf photosynthesis of wheat].

    Science.gov (United States)

    Zhang, Xu-cheng; Yu, Xian-feng; Ma, Yi-fan

    2011-03-01

    Wheat (Triticum aestivum) plants were pot-cultured in open top chambers at the nitrogen application rate of 0 and 200 mg x kg(-1) soil and the atmospheric CO2 concentration of 400 and 760 micromol x mol(-1). Through the determination of flag leaf nitrogen and chlorophyll contents, photosynthetic rate (Pn)-intercellar CO2 concentration (Ci) response curve, and chlorophyll fluorescence parameters at heading stage, the photosynthetic electron transport rate and others were calculated, aimed to investigate the effects of nitrogen application and elevated atmospheric CO2 concentration on the photosynthetic energy partitioning in wheat flag leaves. Elevated atmospheric CO2 concentration decreased the leaf nitrogen and chlorophyll contents, compared with the ambient one, and the chlorophyll a/b ratio increased at the nitrogen application rate of 200 mg x kg(-1). With the application of nitrogen, no evident variations were observed in the maximal photochemical efficiency (Fv/Fm), maximal quantum yield under irradiance (Fv'/Fm') of PS II reaction center, photochemical fluorescence quenching coefficient (q(p)), and actual PS II efficiency under irradiance (phi(PS II) at elevated atmospheric CO2 concentration, and the total photosynthetic electron transport rate (J(F)) of PS II reaction center had no evident increase, though the non-photochemical fluorescence quenching coefficient (NPQ) decreased significantly. With no nitrogen application, the Fv'/Fm', psi(PS II), and NPQ at elevated atmospheric CO2 concentration decreased significantly, and the J(F) had a significant decrease though the Fv/Fm and q(p) did not vary remarkably. Nitrogen application increased the J(F) and photochemical electron transport rate (Jc); while elevated atmospheric CO2 concentration decreased the photorespiration electron transport rate (J0), Rubisco oxidation rate (V0), ratio of photorespiration to photochemical electron transport rate (J0/Jc) , and Rubisco oxidation/carboxylation rate (Vo/Vc), but

  4. Effects of tillage technologies and application of biopreparations on micromycetes in the rhizosphere and rhizoplane of spring wheat

    Science.gov (United States)

    Shirokikh, I. G.; Kozlova, L. M.; Shirokikh, A. A.; Popov, F. A.; Tovstik, E. V.

    2017-07-01

    The population density and structure of complexes of soil microscopic fungi in the rhizosphere and rhizoplane of spring wheat ( Triticum aestivum L.), plant damage by root rot and leaf diseases, and crop yield were determined in a stationary field experiment on a silty loamy soddy-podzolic soil (Albic Retisol (Loamic, Aric)) in dependence on the soil tillage technique: (a) moldboard plowing to 20-22 cm and (b) non-inversive tillage to 14-16 cm. The results were treated with the two-way ANOVA method. It was shown that the number of fungal propagules in the rhizosphere and rhizoplane of plants in the variant with non-inversive tillage was significantly smaller than that in the variant with plowing. Minimization of the impact on the soil during five years led to insignificant changes in the structure of micromycete complexes in the rhizosphere of wheat. The damage of the plants with root rot and leaf diseases upon non-inversive tillage did not increase in comparison with that upon plowing. Wheat yield in the variant with non-inversive tillage was insignificantly lower than that in the variant with moldboard plowing. The application of biopreparations based on the Streptomyces hygroscopicus A4 and Pseudomonas aureofaciens BS 1393 resulted in a significant decrease of plant damage with leaf rust.

  5. Assimilating a synthetic Kalman filter leaf area index series into the WOFOST model to improve regional winter wheat yield estimation

    Science.gov (United States)

    The scale mismatch between remotely sensed observations and crop growth models simulated state variables decreases the reliability of crop yield estimates. To overcome this problem, we used a two-step data assimilation phases: first we generated a complete leaf area index (LAI) time series by combin...

  6. Establishment of efficient in vitro culture protocol for wheat land ...

    African Journals Online (AJOL)

    The reliability of the production and presence of disease resistance especially rust has sparked a renewed interest in improving landraces and exploiting these in wheat variety development programs. In vitro culture is a pre-requisite for most of the tools of biotechnology. In this context, three Pakistani wheat (Triticum ...

  7. Yellow Rust Epidemics Worldwide Were Caused by Pathogen Races from Divergent Genetic Lineages

    DEFF Research Database (Denmark)

    Ali, Sajid; Rodriguez Algaba, Julian; Thach, Tine

    2017-01-01

    We investigated whether the recent worldwide epidemics of wheat yellow rust were driven by races of few clonal lineage(s) or populations of divergent races. Race phenotyping of 887 genetically diverse Puccinia striiformis isolates sampled in 35 countries during 2009–2015 revealed...

  8. Studies of the genetics of inheritance of stem rust resistance in ...

    African Journals Online (AJOL)

    Pgt race TTKSK (Ug99) has a wide virulence range with respect to currently grown wheat cultivars worldwide. Aspects of migration, mutation, recombination and selection in the pathogen have led to previously deployed stem rust resistance genes being ineffective. Race TTKSK has further evolved to acquire virulence for ...

  9. The Pontin series of recombinant alien translocations in bread wheat: single translocations integrating combinations of Bdv2, Lr19 and Sr25 disease-resistance genes from Thinopyrum intermedium and Th. ponticum.

    Science.gov (United States)

    Ayala-Navarrete, L I; Mechanicos, A A; Gibson, J M; Singh, D; Bariana, H S; Fletcher, J; Shorter, S; Larkin, Philip J

    2013-10-01

    Two bread wheat lines each with a translocation on chromosome 7DL from either Thinopyrum intermedium (TC5 and TC14) or Thinopyrum ponticum (T4m), were hybridized in a ph1b mutant background to enhance recombination between the two translocated chromosomal segments. The frequency of recombinants was high in lines derived from the larger and similar-sized translocations (TC5/T4m), but much lower when derived from different-sized translocations (TC14/T4m). Recombinant translocations contained combinations of resistance genes Bdv2, Lr19 and Sr25 conferring resistance to Barley yellow dwarf virus (BYDV), leaf rust and stem rust, respectively. Their genetic composition was identified using bioassays and molecular markers specific for the two progenitor Thinopyrum species. This set of 7DL Th. ponticum/intermedium recombinant translocations was termed the Pontin series. In addition to Thinopyrum markers, the size of the translocation was estimated with the aid of wheat markers mapped on each of the 7DL deletion bins. Bioassays for BYDV, leaf rust and stem rust were performed under greenhouse and field conditions. Once separated from ph1b background, the Pontin recombinant translocations were stable and showed normal inheritance in successive backcrosses. The reported Pontin translocations integrate important resistance genes in a single linkage block which will allow simultaneous selection of disease resistance. Combinations of Bdv2 + Lr19 or Lr19 + Sr25 in both long and short translocations, are available to date. The smaller Pontins, comprising only 20 % of the distal portion of 7DL, will be most attractive to breeders.

  10. The Effect of Rates and Times of Nitrogen Fertilizer on N Accumulation and Remobilization Efficiency at Flag Leaf in Two Winter Wheat (Triticum aestivum and Triticum.durum) Cultivars

    Science.gov (United States)

    Bahrani, A.; Sarvestani, Z. Tahmasebi; Bagheri, A. R.; Abad, H. Heidari Sharif

    2008-01-01

    Understanding the physiological basis of absorption and transportation of nitrogen by plants has specific importance. In this experiment, a bread cultivar and durum wheat cultivar, were treated with different rates and times of nitrogen application, by using split factorial with on the basis of randomized complete block design with three replications at Shiraz region during 2004-2005. Main plots were consisted of two levels of cultivars (Falat and Yavaros) and sub plots included nitrogen rates (40, 80 and 160 kg ha-1) and times of nitrogen application (T1 = all N fertilizer at planting, T2 = 1/2 at planting+1/2 during booting stage and T3 = 1/3 at planting+1/3 during booting stage+1/3 at heading stage). The results showed that there were significant differences between cultivars in flag leaf nitrogen content in maturity stage, N remobilization and its efficiency from flag leaf to grains and also grain protein percentage. Durum wheat was more efficient in nitrogen remobilization and therefore, had a higher grain protein percentage. Increasing in rates and times of nitrogen application had significant effect on most of the measured traits. There were significant interactions between cultivars, rates and times of N application, indicating that durum wheat was more efficient in N remobilization from flag leaf to the grain. It appeared that, N remobilization efficiency was the main factor affecting the grain protein percentage, under the conditions of low N absorption and drought after flowering, in this experiment.

  11. Phylogeny in defining model plants for lignocellulosic ethanol production: a comparative study of Brachypodium distachyon, wheat, maize, and Miscanthus x giganteus leaf and stem biomass.

    Directory of Open Access Journals (Sweden)

    Till Meineke

    Full Text Available The production of ethanol from pretreated plant biomass during fermentation is a strategy to mitigate climate change by substituting fossil fuels. However, biomass conversion is mainly limited by the recalcitrant nature of the plant cell wall. To overcome recalcitrance, the optimization of the plant cell wall for subsequent processing is a promising approach. Based on their phylogenetic proximity to existing and emerging energy crops, model plants have been proposed to study bioenergy-related cell wall biochemistry. One example is Brachypodium distachyon, which has been considered as a general model plant for cell wall analysis in grasses. To test whether relative phylogenetic proximity would be sufficient to qualify as a model plant not only for cell wall composition but also for the complete process leading to bioethanol production, we compared the processing of leaf and stem biomass from the C3 grasses B. distachyon and Triticum aestivum (wheat with the C4 grasses Zea mays (maize and Miscanthus x giganteus, a perennial energy crop. Lambda scanning with a confocal laser-scanning microscope allowed a rapid qualitative analysis of biomass saccharification. A maximum of 108-117 mg ethanol·g(-1 dry biomass was yielded from thermo-chemically and enzymatically pretreated stem biomass of the tested plant species. Principal component analysis revealed that a relatively strong correlation between similarities in lignocellulosic ethanol production and phylogenetic relation was only given for stem and leaf biomass of the two tested C4 grasses. Our results suggest that suitability of B. distachyon as a model plant for biomass conversion of energy crops has to be specifically tested based on applied processing parameters and biomass tissue type.

  12. Phylogeny in defining model plants for lignocellulosic ethanol production: a comparative study of Brachypodium distachyon, wheat, maize, and Miscanthus x giganteus leaf and stem biomass.

    Science.gov (United States)

    Meineke, Till; Manisseri, Chithra; Voigt, Christian A

    2014-01-01

    The production of ethanol from pretreated plant biomass during fermentation is a strategy to mitigate climate change by substituting fossil fuels. However, biomass conversion is mainly limited by the recalcitrant nature of the plant cell wall. To overcome recalcitrance, the optimization of the plant cell wall for subsequent processing is a promising approach. Based on their phylogenetic proximity to existing and emerging energy crops, model plants have been proposed to study bioenergy-related cell wall biochemistry. One example is Brachypodium distachyon, which has been considered as a general model plant for cell wall analysis in grasses. To test whether relative phylogenetic proximity would be sufficient to qualify as a model plant not only for cell wall composition but also for the complete process leading to bioethanol production, we compared the processing of leaf and stem biomass from the C3 grasses B. distachyon and Triticum aestivum (wheat) with the C4 grasses Zea mays (maize) and Miscanthus x giganteus, a perennial energy crop. Lambda scanning with a confocal laser-scanning microscope allowed a rapid qualitative analysis of biomass saccharification. A maximum of 108-117 mg ethanol·g(-1) dry biomass was yielded from thermo-chemically and enzymatically pretreated stem biomass of the tested plant species. Principal component analysis revealed that a relatively strong correlation between similarities in lignocellulosic ethanol production and phylogenetic relation was only given for stem and leaf biomass of the two tested C4 grasses. Our results suggest that suitability of B. distachyon as a model plant for biomass conversion of energy crops has to be specifically tested based on applied processing parameters and biomass tissue type.

  13. Interactome of signaling networks in wheat: the protein-protein interaction between TaRAR1 and TaSGT1.

    Science.gov (United States)

    Tai, Yin-Shan

    2008-09-01

    RAR1 and SGT1 are required for development and disease resistance in plants. In many cases, RAR1 and SGT1 regulate the resistance (R)-gene-mediated defense signaling pathways. Lr21 is the first identified NBS-LRR-type R protein in wheat and is required for resistance to the leaf rust pathogen. The Lr21-mediated signaling pathways require the wheat homologs of RAR1, SGT1, and HSP90. However, the molecular mechanisms of the Lr21-mediated signaling networks remain unknown. Here I present the DNA and protein sequences of TaRAR1 and TaSGT1, and demonstrate for the first time a direct protein-protein interaction between them.

  14. Avaliação e seleção de progênies F3 de cafeeiros de porte baixo com o gene SH3 de resistência a Hemileia vastatrix Berk. et Br. Evaluation and selection of Coffea arabica F3 progenies with low height and the leaf-rust SH3 resistence gene

    Directory of Open Access Journals (Sweden)

    Albano Silva da Conceição

    2005-01-01

    porte baixo portando o gene SH3 de resistência ao agente da ferrugem.The present work evaluated 36 arabic coffee (Coffea arabica L. F3 progenies, originated from crosses among cultivars Catuaí Vermelho IAC 46 and Catuaí Vermelho IAC 81 and access IAC 1110 (BA-10. This last cultivar came from India and exhibits SH2 and SH3 rust resistance genes. The experiment was installed in 1988 at the Experimental Center of the Agronomic Institute (IAC/APTA, in Campinas, using random blocks design with six repetitions and two plants per plot. Field evaluations included yield (average of seven annual harvests, vegetative vigor, resistance to leaf rust, plant size, color of young leaves and complete fruit maturation period. Based on these evaluations, plants exhibiting high yield, good vegetative vigor, low height, and resistance to the leaf rust agent Hemileia vastatrix were selected. Fruit yield of selected plants was calculated and seeds were characterized according to type (flat, peaberry and elephant, outturn and grain size. A total of 11 optimal F3 progenies were identified as rust resistant. By further classifications, 39 plants out from these progenies were selected, along with 15 plants from other 25 evaluated progenies. Laboratory analyses lead to a final selection of 18 coffee trees, all exhibiting leaf rust resistance, high yield and low height. Also, F4 progenies of selected plants had been evaluated regarding height and leaf rust resistance, at seedling stage, in greenhouse conditions. Eighteen plants were selected for further analysis and move forward from F3 to F4 generation in the coffee breeding program developed by IAC.

  15. Routine sample preparation and HPLC analysis for ascorbic acid (vitamin C) determination in wheat plants and Arabidopsis leaf tissues.

    Science.gov (United States)

    Szalai, Gabriella; Janda, T; Pál, Magda

    2014-06-01

    Plants have developed various mechanisms to protect themselves against oxidative stress. One of the most important non-enzymatic antioxidants is ascorbic acid. There is thus a need for a rapid, sensitive method for the analysis of the reduced and oxidised forms of ascorbic acid in crop plants. In this paper a simple, economic, selective, precise and stable HPLC method is presented for the detection of ascorbate in plant tissue. The sensitivity, the short retention time and the simple isocratic elution mean that the method is suitable for the routine quantification of ascorbate in a high daily sample number. The method has been found to be better than previously reported methods, because of the use of an economical, readily available mobile phase, UV detection and the lack of complicated extraction procedures. The method has been tested on Arabidopsis plants with different ascorbate levels and on wheat plants during Cd stress.

  16. Evaluation of spray and point inoculation methods for the phenotyping of Puccinia striiformis on wheat

    DEFF Research Database (Denmark)

    Sørensen, Chris Khadgi; Thach, Tine; Hovmøller, Mogens Støvring

    2016-01-01

    The fungus Puccinia striiformis causes yellow (stripe) rust on wheat worldwide. In the present article, new methods utilizing an engineered fluid (Novec 7100) as a carrier of urediniospores were compared with commonly used inoculation methods. In general, Novec 7100 facilitated a faster and more...... for the assessment of quantitative epidemiological parameters. New protocols for spray and point inoculation of P. striiformis on wheat are presented, along with the prospect for applying these in rust research and resistance breeding activities....

  17. Winter wheat yield estimation of remote sensing research based on WOFOST crop model and leaf area index assimilation

    Science.gov (United States)

    Chen, Yanling; Gong, Adu; Li, Jing; Wang, Jingmei

    2017-04-01

    Accurate crop growth monitoring and yield predictive information are significant to improve the sustainable development of agriculture and ensure the security of national food. Remote sensing observation and crop growth simulation models are two new technologies, which have highly potential applications in crop growth monitoring and yield forecasting in recent years. However, both of them have limitations in mechanism or regional application respectively. Remote sensing information can not reveal crop growth and development, inner mechanism of yield formation and the affection of environmental meteorological conditions. Crop growth simulation models have difficulties in obtaining data and parameterization from single-point to regional application. In order to make good use of the advantages of these two technologies, the coupling technique of remote sensing information and crop growth simulation models has been studied. Filtering and optimizing model parameters are key to yield estimation by remote sensing and crop model based on regional crop assimilation. Winter wheat of GaoCheng was selected as the experiment object in this paper. And then the essential data was collected, such as biochemical data and farmland environmental data and meteorological data about several critical growing periods. Meanwhile, the image of environmental mitigation small satellite HJ-CCD was obtained. In this paper, research work and major conclusions are as follows. (1) Seven vegetation indexes were selected to retrieve LAI, and then linear regression model was built up between each of these indexes and the measured LAI. The result shows that the accuracy of EVI model was the highest (R2=0.964 at anthesis stage and R2=0.920 at filling stage). Thus, EVI as the most optimal vegetation index to predict LAI in this paper. (2) EFAST method was adopted in this paper to conduct the sensitive analysis to the 26 initial parameters of the WOFOST model and then a sensitivity index was constructed

  18. Leaf gas exchange and chlorophyll a fluorescence in wheat plants supplied with silicon and infected with Pyricularia oryzae.

    Science.gov (United States)

    Perez, Carlos Eduardo Aucique; Rodrigues, Fabrício Ávila; Moreira, Wiler Ribas; DaMatta, Fábio Murilo

    2014-02-01

    This study investigated the effect of silicon (Si) on the photosynthetic gas exchange parameters (net CO2 assimilation rate [A], stomatal conductance to water vapor [gs], internal CO2 concentration [Ci], and transpiration rate [E]) and chlorophyll fluorescence a parameters (maximum quantum quenching [Fv/Fm and Fv'/Fm'], photochemical [qP] and nonphotochemical [NPQ] quenching coefficients, and electron transport rate [ETR]) in wheat plants grown in a nutrient solution containing 0 mM (-Si) or 2 mM (+Si) Si and noninoculated or inoculated with Pyricularia oryzae. Blast severity decreased due to higher foliar Si concentration. For the inoculated +Si plants, A, gs, and E were significantly higher in contrast to the inoculated -Si plants. For the inoculated +Si plants, significant differences of Fv/Fm between the -Si and +Si plants occurred at 48, 96, and 120 h after inoculation (hai) and at 72, 96, and 120 hai for Fv'/Fm'. The Fv/Fm and Fv'/Fm', in addition to total chlorophyll concentration (a + b) and the chlorophyll a/b ratio, significantly decreased in the -Si plants compared with the +Si plants. Significant differences between the -Si and +Si inoculated plants occurred for qP, NPQ, and ETR. The supply of Si contributed to decrease blast severity in addition to improving gas exchange performance and causing less dysfunction at the photochemical level.

  19. Anti-rust product poisoning

    Science.gov (United States)

    ... agents Hydrocarbons Hydrochloric acid Nitrites Oxalic acid Phosphoric acid ... red blood cells) Too much or too little acid in the blood, which ... anti-rust products come from inhaling the substance. LUNGS AND ...

  20. Silica detection in the flag leaf of wheatDetecção de sílica em folha bandeira de trigo

    Directory of Open Access Journals (Sweden)

    Édison Miglioranza

    2012-12-01

    Full Text Available Silicon is considered a beneficial element to plants and may increase productivity and health of many crops. In plants, silicon accumulates mainly in the areas of maximum transpiration. This study aimed to investigate and compare silicon accumulation in flag leaves of different genotypes of wheat (Triticum aestivum with the aid of scanning electron microscopy (SEM. The experiment was conducted in the field during the growing season 2010, eight wheat genotypes (BRS 208, RPI 85, BRS Pardela, BRS 210, RPI 130, CD 104, BRS 220 and WT 07106 lineage were used. Three months after sowing, the samples were collected from the leaves to perform the silicon analysis by SEM and energy dispersive X-ray (EDS. All genotypes accumulated silica bodies in their leaf epidermis, the bodies had a rounded shape and were deposited differently from one genotype to another.O silício é considerado um elemento benéfico às plantas, podendo trazer incrementos na produtividade e sanidade de diversas culturas. Nos vegetais, acumula-se principalmente nas áreas de máxima transpiração. Este trabalho teve por objetivo comparar o acúmulo de silício nas folhas bandeira de diferentes genótipos de trigo (Triticum aestivum L., com o auxílio da Microscopia Eletrônica de Varredura (MEV. O experimento foi conduzido a campo, durante o ano agrícola de 2010, aonde foram utilizados oito genótipos de trigo (cultivares BRS 208, IPR 85, BRS Pardela, BRS 210, IPR 130, CD 104, BRS 220 e a linhagem WT 07106. Aos três meses após o plantio, retiraram-se amostras das folhas para a análise de silício em MEV e espectroscopia de energia dispersiva de raios-X (EDS. Todos os genótipos avaliados acumularam corpos silicosos em suas epidermes foliares, sendo que esses corpos apresentaram formato arredondado e deposição diferenciada entre os diversos genótipos.

  1. Fighting Asian soybean rust

    Directory of Open Access Journals (Sweden)

    Caspar eLangenbach

    2016-06-01

    Full Text Available Phakopsora pachyrhizi is a biotrophic fungus provoking Asian soybean rust (SBR disease. SBR poses a major threat to global soybean production. Though several resistance genes provided soybean immunity to certain P. pachyrhizi races, the pathogen swiftly overcame this resistance. Therefore, fungicides are the only current means to control SBR. However, insensitivity to fungicides is soaring in P. pachyrhizi and, therefore, alternative measures are needed for SBR control. In this article, we discuss the different approaches for fighting SBR and their potential, disadvantages, and advantages over other measures. These encompass conventional breeding for SBR resistance, transgenic approaches, exploitation of transcription factors, secondary metabolites, and antimicrobial peptides, RNAi/HIGS, and biocontrol strategies. It seems that an integrating approach exploiting different measures is likely to provide the best possible means for the effective control of SBR.

  2. Jumping-Droplet Condensation Drives Pathogen Transport on Wheat Leaves

    Science.gov (United States)

    Nath, Saurabh; Gruszewski, Hope; Budhiraja, Stuti; Ahmadi, Farzad; Bisbano, Caitlin; Jung, Sunghwan; Schmale, David, III; Boreyko, Jonathan

    2017-11-01

    The classical viewpoint in phytopathology regarding how plant pathogens are liberated is based on active mechanisms such as shearing off spores via rain splash or wind. All of these mechanisms require some kind of impact on the surface. Here we show for the first time that there exists an entirely different mechanism in nature that drives pathogen transport on wheat leaves. Wheat leaves are inherently superhydrophobic, which enables microscopic dew droplets to spontaneously jump off the leaf surface during natural condensation cycles. We found that black rust (Puccinia graminis) spores often adhere to such coalescence-induced self-propelled dew droplets and subsequently get transported vertically as high as 5 mm. Once pathogens clear the quiescent boundary layer, typically of order 1 mm, they have the potential to be dispersed over large distances by the aid of atmospheric flows. A custom-made experimental set-up was devised to simulate multiple one hour long natural dew cycles and how they affect spore dispersal. Spore liberation rates via jumping-droplet condensation were found to be as high 100 spores/cm2-hr. These findings reveal that on a sufficiently non-wetting surface humidity alone can liberate fungal spores, adding it as a third mechanism besides wind and rain.

  3. Effect of Addition of Moringa Leaf By-Product (Leaf-Waste) on ...

    African Journals Online (AJOL)

    The effects of incorporation of Moringa leaf fibre (a by-product of leaf processing which contains 24% Crude Fibre by dry weight at 0, 5 and 10 % substitution of wheat flour in cookies was investigated. Three products containing wheat flour: Moringa leaf fibre ratios of 100:0, 95:5, and 90:10 respectively were prepared, and a ...

  4. Influence of agronomic conditions on the efficacy of different fungicides applied to wheat at heading: effect on flag leaf senescence, Fusarium head blight attack, grain yield and deoxynivalenol contamination

    Directory of Open Access Journals (Sweden)

    Massimo Blandino

    2011-10-01

    Full Text Available A series of field experiments has been conducted in North West Italy over a period of 3 years to evaluate the effect of fungicide applications on common wheat yield and safety, combined with different agronomic conditions (high: a susceptible variety to FHB planted in an untilled field; low: a medium tolerant variety to FHB planted in a ploughed field for Fusarium head blight (FHB infection risk. A azole mixture (prochloraz + epoxiconazole, applied at heading, was compared in each year and for each agronomic condition with a triazole with high activity against F. graminearum and F. culmorum (metconazole, a strobilurin-azole mixture with elevated action to control leaf diseases and delay leaf senescence (azoxystrobin + prochloraz and an untreated control. The following parameters were analyzed: flag leaf greenness, grain yield, test weight, thousand kernel weight (TKW, FHB incidence and severity and deoxynivalenol (DON contamination. The results of this research, conducted over three years with different meteorological conditions, underline the important link between fungicide efficacy and environmental and agronomic conditions that can influence fungal disease pressure. The fungicide effect on the control of FHB and the increase in flag leaf longevity and grain yield were greater with an increase in the disease pressure. On the other hand, the DON contamination was reduced by the fungicide to a greater extent in the low risk agronomic and environmental conditions compared to the high risk ones. Prochloraz + epoxiconazole showed a lower efficacy in reducing DON contamination compared to metconazole, particularly in the higher FHB pressure conditions. No significant differences were observed between the azole mixture and the strobilurin-azole mixture for flag leaf greenness, grain yield, test weight or TKW. This study provides useful information that can be used to evaluate, in naturally-infected field conditions, the effect of a fungicide

  5. Molecular Characterization of Wheat Genotypes Using SSR Markers

    Directory of Open Access Journals (Sweden)

    Sheikh Arslan Sehgal

    2012-07-01

    Full Text Available Wheat (Triticum aestivum L. rusts are the most destructive and widespread among all other diseases of wheat because of their wide distribution, and their capacity to form new races that can attack previously resistant cultivars which result in serious yield losses. The molecular characterization and genetic diversity of 20 wheat genotypes was investigated using 34 polymorphic Simple Sequence Repeats (SSR screened primers. About thirty-one loci were found. Lr-19 gene was present in all 20 wheat genotypes that cause resistance against wheat rust. Shalimar-86 and Chakwal-86 showed the highest genetic diversity with SH-02 and Ufaq respectively, giving a 98.94% genetic similarity and a minimum genetic diversity was observed between Chakwal-50 and Bhakar which showed that they are 74% similar. The current research found that SSR makers could distinguish and characterize all of the genotypes, more screened primers could be used for study and for saturation of different regions in further research. The identification of rust resistant genes in Pakistani wheat germplasm will help in accelerating the breeding program in future, including pyramiding of different wheat resistant genes in wheat genotypes and varieties.

  6. Effect of Early Foliar Disease Control on Wheat Scab Severity (Fusarium graminearum in Argentina

    Directory of Open Access Journals (Sweden)

    Jorge David Mantecón

    2013-01-01

    Full Text Available Wheat scab is common in Argentina mainly durum wheat and some bread varieties. The epidemics occur every 5 to 7 years. During the 2007, 2008, and 2009 growing seasons, three trials were conducted at the INTA Balcarce Experimental Station. Each plot had six rows of 5 m long, spaced 0.15 m apart and was set up in a randomized complete block design with four replications. Trifloxystrobin plus cyproconazole was sprayed at Z3.1 stage. Treatments were sprayed at Z6.1 stage with tebuconazole, prochloraz, and metconazole to improve scab control. Artificial inoculations were made in Z6.1. Severity of Septoria leaf bloth and leaf rust was assessed in boot stage (Z3.9. Scab severity was rated at early dough stage (Z8.3. Yields were recorded each year. Fungicide only applied at Z3.1 stage did not reduce field scab severity but reduced the seeds infection and increased the yields. Early fungicide spray produced yield increase at about 22% and a decrease in seed infection of up to 40%. Yields increased in a 55.3% and in a 19.6% when compared with the inoculated and not inoculated check, respectively. The purpose of this study was to evaluate the effect of foliar disease control on scab, crop yield, and seed health.

  7. Changing the game: using integrative genomics to probe virulence mechanisms of the stem rust pathogen Puccinia graminis f. sp. tritici

    Science.gov (United States)

    The recent resurgence of wheat stem rust caused by new virulent races of Puccinia graminis f. sp. tritici (Pgt) poses a threat to food security. These concerns have catalyzed an extensive global effort towards controlling this disease. Substantial research and breeding programs target the identifica...

  8. [Cloning and transcriptional profiling of a cell division cycle gene PsCdc2 from stripe rust fungus during incompatible and compatible interaction between wheat and Puccinia striiformis f. sp. tritici].

    Science.gov (United States)

    Dai, Xiwei; Guo, Jun; Chen, Yueying; Duan, Yinghui; Xia, Ning; Wei, Guorong; Huang, Lili; Kang, Zhensheng

    2010-02-01

    We cloned a cell division cycle PsCdc2 from Puccinia striiformis f. sp. tritici (Pst) and analyze its expression profile. Using PCR and RT-PCR methods, we isolated the cDNA and genomic DNA sequences of PsCdc2. We analyzed the amino acid sequence of PsCdc2 using bioinformatic softwares. In addition, Real time RT-PCR was used to analyze the gene expression pattern of PsCdc2 at different time points after wheat inoculated. A 2279 bp DNA sequence of PsCdc2 was cloned and comprised of 11 extrons and 10 introns. The cDNA sequence of PsCdc2 included a complete 885 bp open reading frame and encoded a putative protein composed of 294 amino acids, with a molecular weight of 33.14 KDa and a pI of 6.26. PsCdc2 contained two conserved kinase domains and a transmembrane domain. Phylogenetic analysis indicated that PsCdc2 showed high similarity with Cdc2 from Puccinia graminis (73.1%), Cryptococcus neoformans (72.4%) and Ustilago maydis (70.4%), respectively. Real time RT-PCR analysis showed that in compatible interaction between Pst and wheat, PsCdc2 was up-regulated at early stage of infection. The maximum induction occurred at 12 hpi, at which transcripts were 1.62 fold over that in urediniospore. From 24 to 268 hpi, the accumulation of transcripts decreased steadily. The minimum accumulation occurred at 96 h, at which transcripts were only 0.07 fold of that in uredinisopore. During incompatible interaction between Pst and wheat, PsCdc2 was down-regulated and its accumulation was lower than that in urediniospore. The maximum induction occurred at 12 h, at which transcripts were 0.34 fold of that in urediniospore. The minimum accumulation occurred at 96 h, whose transcript was only 0.02 fold of that in urediniospore. PsCdc2 might be involved in primary hyphal growth and haustorium formation during early infection by regulating cell cycle of Pst. The present study would be helpful for understanding the essence of cell cycle control and provided basis for new chemical control of

  9. Application of Near-Infrared Spectroscopy to Quantitatively Determine Relative Content of Puccnia striiformis f. sp. tritici DNA in Wheat Leaves in Incubation Period

    Directory of Open Access Journals (Sweden)

    Yaqiong Zhao

    2017-01-01

    Full Text Available Stripe rust caused by Puccinia striiformis f. sp. tritici (Pst is a devastating wheat disease worldwide. Potential application of near-infrared spectroscopy (NIRS in detection of pathogen amounts in latently Pst-infected wheat leaves was investigated for disease prediction and control. A total of 300 near-infrared spectra were acquired from the Pst-infected leaf samples in an incubation period, and relative contents of Pst DNA in the samples were obtained using duplex TaqMan real-time PCR arrays. Determination models of the relative contents of Pst DNA in the samples were built using quantitative partial least squares (QPLS, support vector regression (SVR, and a method integrated with QPLS and SVR. The results showed that the kQPLS-SVR model built with a ratio of training set to testing set equal to 3 : 1 based on the original spectra, when the number of the randomly selected wavelength points was 700, the number of principal components was 8, and the number of the built QPLS models was 5, was the best. The results indicated that quantitative detection of Pst DNA in leaves in the incubation period could be implemented using NIRS. A novel method for determination of latent infection levels of Pst and early detection of stripe rust was provided.

  10. Valor nutricional de farinha de trigo combinada com concentrado protéico de folha de mandioca Nutritional value of wheat flour mixed with cassava leaf protein concentrate

    Directory of Open Access Journals (Sweden)

    Ricardo Bryan Heinemann

    1998-06-01

    ímico apontem uma possível melhoria na qualidade protéica da farinha de trigo com 5 e 10 % de CPFM, esse fato não foi evidenciado no ensaio biológico. Isso pode ser devido à presença de fatores antinutricionais ou a possível baixa solubilidade da proteína, que estariam atuando na redução da digestibilidade do CPFM.Non - conventional foods, as cassava leaf, with about 20% of protein in dry-weight, have been often used in the human diet as alternative foods. The use of cassava leaf as a concentrate enables the elimination of part of its residue and makes it easier to be added to conventional foods, such as cereals, improving their protein value. The aim of this study was to evaluate the protein quality of mixtures of wheat flour (WF and cassava leaf protein concentrate (CLPC, onthe levels of 5 and 10% of CLPC in WF. The CLPC was obtained by grinding the fresh leaves with NaOH 0.1 N, followed by filtration, precipitation of the protein in the "juice" by natural fermentation,homogenization of the precipitate and dehydration by spray-dryer. The composition of CLPC was determined (protein 36.36%, fibers 3.79%, lipids 12.26%, ashes 8.59% and carbohydrates 39%. The amino acid level showed a good profile, except for methionine which was limiting. A biological assay was carried out with rats to determine the protein quality of the mixture of CLPC and WF by Net Protein Ratio and its digestibility. Although the chemical score of WF has been improved by the addition of CLPC, the mixture remained limiting in lysine. There was no significant difference in the weight gain of the rats fed with wheat flour diets with or without the addition of CLPC, being all below the values obtained for casein diet. The Net Protein Ratio values were 2.03, 1.98, 2.15 and 4.61 for diets containing zero, 5 and 10% of CLPC and casein, respectively. There was a significant decrease on the digestibility of he diet with increasing addition of CLPC to WF, from 99.6% for the diet without addition to 96

  11. Wheat transcription factor TaWRKY70 is positively involved in high-temperature seedling-plant resistance to Puccinia striiformis f. sp. tritici

    Science.gov (United States)

    Wheat stripe rust, caused by Puccinia striiformis f. sp. tritici (Pst), is a devastating disease of wheat (Triticum aestivum) worldwide. Wheat high-temperature seedling-plant (HTSP) resistance to Pst is non-race-specific and durable. WRKY transcription factors have proven to play important roles in ...

  12. Characteristics of spring wheat genotypes exhibiting high resistance to FHB in terms of their resistance to other fungal diseases

    Directory of Open Access Journals (Sweden)

    Danuta Kurasiak-Popowska

    2016-09-01

    Full Text Available The field experiment was carried out in 2010–2012 at the Dłoń Agricultural Research Station, the Poznań University of Life Sciences, Poland. The study was designed to evaluate the degree of infection by powdery mildew, brown rust, and septoria leaf blotch in 61 spring wheat genotypes differing in their resistance to Fusarium ssp. The vast majority of spring wheat genotypes in the collection of gene resources in the USA defined as resistant to Fusarium ssp. confirmed their resistance under Polish climatic conditions. The B .graminis infection rate of genotypes that are considered to be resistant to Fusarium head blight was high. The resistance ranged from 7 for Sumai 3 (PL2 up to 8.8 for Ning 8331 (in a 9-point scale. Most of the genotypes (56.5% were infected by Puccinia recondita at a level of 1–3 (in a 9-point scale. The genotypes of Sumai 3 exhibited high resistance to septoria leaf blotch, amounting to 1–2 in a 9-point scale; the resistance of Frontana ranged from 1 to 3.5, while the genotypes of Ning were infected by Mycosphaerella graminicola at 5–6.

  13. Accelerating resistance breeding in wheat by integrating marker ...

    African Journals Online (AJOL)

    Genetic resistance is the simplest and most cost-effective way to guard against disease in plants. The pyramiding of resistance genes is a useful practice in bringing about durable resistance. This study aimed to develop a series of doubled haploid (DH) wheat lines containing combinations of wild species genes for rust ...

  14. Response of Bread Wheat (Triticum aestivum L.) to Application of ...

    African Journals Online (AJOL)

    The bread wheat variety used for the experiment was Pica flor (kakaba), which is disease resistant, early maturing, and relatively high yielding, at Suluh kebele in Hawzien district. . Hidase variety, which is less susceptible to rust and has high grain yielding potential and disease resistant, was used at Atsela and Ayba in ...

  15. Assessment of genetic diversity among wheat somaclonal variants ...

    African Journals Online (AJOL)

    use

    2011-10-26

    Oct 26, 2011 ... variant lines obtained through in vitro selection for yellow rust disease among cells under different levels of p-fluorophenylalanine. (PFP) (Abouzied, 2004) as well as two check varieties (Sakha-94 and Giza-168) were used to establish the experimental materials for this investigation. All wheat varieties ...

  16. Molecular mapping of adult plant resistance to Parastagonospora nodorum leaf blotch in bread wheat lines ‘Shanghai-3/Catbird’ and ‘Naxos’

    DEFF Research Database (Denmark)

    Lu, Qiongxian; Lillemo, Morten

    2014-01-01

    supplied with mist irrigation. Leaf blotch severity was scored together with plant height, heading date and maturity date in these trials. A testing data set was also available from other field trials with the same population. Totally, two major and six minor QTL were detected for leaf blotch resistance...

  17. Wheat Allergy

    Science.gov (United States)

    ... Soy sauce Starch (gelatinized starch, modified starch, modified food starch, vegetable starch) Surimi Some Unexpected Sources of Wheat Ale Asian dishes can feature wheat flour flavored and shaped ...

  18. Genome-Wide Association Mapping of Stem Rust Resistance in Hordeum vulgare subsp. spontaneum

    Directory of Open Access Journals (Sweden)

    Ahmad H. Sallam

    2017-10-01

    Full Text Available Stem rust was one of the most devastating diseases of barley in North America. Through the deployment of cultivars with the resistance gene Rpg1, losses to stem rust have been minimal over the past 70 yr. However, there exist both domestic (QCCJB and foreign (TTKSK aka isolate Ug99 pathotypes with virulence for this important gene. To identify new sources of stem rust resistance for barley, we evaluated the Wild Barley Diversity Collection (WBDC (314 ecogeographically diverse accessions of Hordeum vulgare subsp. spontaneum for seedling resistance to four pathotypes (TTKSK, QCCJB, MCCFC, and HKHJC of the wheat stem rust pathogen (Puccinia graminis f. sp. tritici, Pgt and one isolate (92-MN-90 of the rye stem rust pathogen (P. graminis f. sp. secalis, Pgs. Based on a coefficient of infection, the frequency of resistance in the WBDC was low ranging from 0.6% with HKHJC to 19.4% with 92-MN-90. None of the accessions was resistant to all five cultures of P. graminis. A genome-wide association study (GWAS was conducted to map stem rust resistance loci using 50,842 single-nucleotide polymorphic markers generated by genotype-by-sequencing and ordered using the new barley reference genome assembly. After proper accounting for genetic relatedness and structure among accessions, 45 quantitative trait loci were identified for resistance to P. graminis across all seven barley chromosomes. Three novel loci associated with resistance to TTKSK, QCCJB, MCCFC, and 92-MN-90 were identified on chromosomes 5H and 7H, and two novel loci associated with resistance to HKHJC were identified on chromosomes 1H and 3H. These novel alleles will enhance the diversity of resistance available for cultivated barley.

  19. Molecular analysis of common wheat genes encoding three types of cytosolic heat shock protein 90 (Hsp90): functional involvement of cytosolic Hsp90s in the control of wheat seedling growth and disease resistance.

    Science.gov (United States)

    Wang, Guan-Feng; Wei, Xuening; Fan, Renchun; Zhou, Huanbin; Wang, Xianping; Yu, Chunmei; Dong, Lingli; Dong, Zhenying; Wang, Xiaojie; Kang, Zhensheng; Ling, Hongqing; Shen, Qian-Hua; Wang, Daowen; Zhang, Xiangqi

    2011-07-01

    Heat shock protein 90 (Hsp90) molecular chaperones play important roles in plant growth and responses to environmental stimuli. However, little is known about the genes encoding Hsp90s in common wheat. Here, we report genetic and functional analysis of the genes specifying cytosolic Hsp90s in this species. Three groups of homoeologous genes (TaHsp90.1, TaHsp90.2 and TaHsp90.3), encoding three types of cytosolic Hsp90, were isolated. The loci containing TaHsp90.1, TaHsp90.2 and TaHsp90.3 genes were assigned to groups 2, 7 and 5 chromosomes, respectively. TaHsp90.1 genes exhibited higher transcript levels in the stamen than in the leaf, root and culm. TaHsp90.2 and TaHsp90.3 genes were more ubiquitously transcribed in the vegetative and reproductive organs examined. Decreasing the expression of TaHsp90.1 genes through virus-induced gene silencing (VIGS) caused pronounced inhibition of wheat seedling growth, whereas the suppression of TaHsp90.2 or TaHsp90.3 genes via VIGS compromised the hypersensitive resistance response of the wheat variety Suwon 11 to stripe rust fungus. Our work represents the first systematic determination of wheat genes encoding cytosolic Hsp90s, and provides useful evidence for the functional involvement of cytosolic Hsp90s in the control of seedling growth and disease resistance in common wheat. © 2011 The Authors. New Phytologist © 2011 New Phytologist Trust.

  20. Distribution and frequency of a gene for resistance to white pine blister rust in natural populations of sugar pine

    Science.gov (United States)

    Bohun B. Kinloch Jr.

    1992-01-01

    The gametic frequency of a dominant allcle (R) for resistance to white pine blister rust, a disease caused by an introduced pathogen (Cronartium ribicola), in natural populations of sugar pine was estimated by the kind of leaf symptom expressed after artificial inoculation of wind-pollinated seedlings from susceptible seed-parent...

  1. MARKER ASSISTED SELECTION (MAS FOR DEVELOPMENT OF BARLEY AND WHEAT LINES WITH REQUESTED TRAITS

    Directory of Open Access Journals (Sweden)

    M. Hudcovicová

    2008-09-01

    Full Text Available Molecular markers closely linked to interesting genes enable early, proper and fast detection of plant individuals with desired allele during backcross breeding, what can make plant breeding faster and cheaper. We are focused on molecular breeding of barley and wheat lines for disease resistance and some important quality traits. As acceptors of interesting genes we use especially elite Slovak and Czech cultivars and lines. After five backcross generations with the help of MAS new created lines carrying markers linked to desired genes undergo resistance, agronomic and technological tests. In breeding of winter barley for resistance to BaYMV/BaMMV viruses we use codominant STS and SSR markers linked to rym4 and rym11 resistance genes. Cultivar Romanze has been used as a donor of rym4 gene and landrace Russia57 as gene rym11 donor. In spring barley we are focused on transfer of Yd2 gene from landraces Shannon and Sutter resistant to BYDV by use of dominant ASPCR marker. We are also working on transfer of effective leaf rust resistance genes Lr19, Lr24 derived from Thinopyrum ponticum and gene Lr35 from Aegilops speltoides into hexaploid wheat by use of dominant STS and SCAR markers. Near isogenic lines with these genes are used in gene pyramiding to develop a single line with all three genes. By use of protein markers we develop near isogenic wheat lines for higher sedimentation values, higher dough strength and better breadmaking quality. These are lines with new combination of HMW glutenin subunits (21*, 7+8, 5+10 as well as wheat lines with new unknown HMW-GS and with new HMW-GS pair.

  2. Genotyping-by-Sequencing derived High-Density Linkage Map and its Application to QTL Mapping of Flag Leaf Traits in Bread Wheat

    Science.gov (United States)

    Hard red winter wheat parents ‘Harry’ (drought tolerant) and ‘Wesley’ (drought susceptible) was used to develop a recombinant inbred population to identify genomic regions associated with drought and adaptation. To precisely map genomic regions high-density linkage maps are a prerequisite. In this s...

  3. The role of leaf epicuticular wax in the adaptation of wheat (Triticum aestivum L.) to high temperatures and moisture deficit conditions

    Science.gov (United States)

    Water deficit is one of the primary causes of decreasing wheat (Triticum aestivum L.) yields globally, resulting in 50–90% yield reduction for at least 60 Mha of cropland in developing countries (Reynolds et al. 2000). Previous studies have identified associations in genomic regions with cooler cano...

  4. Desenvolvimento vegetativo e reprodutivo de cultivares de trigo e sua associação com a emissão de folhas Vegetative and reproductive development of wheat cultivars and its association with leaf appearance

    Directory of Open Access Journals (Sweden)

    Lidiane Cristine Walter

    2009-11-01

    Full Text Available O objetivo deste estudo foi determinar a relação da duração das fases vegetativa, reprodutiva e total do ciclo de desenvolvimento com o número final de folhas e com a velocidade de aparecimento de folhas no colmo principal, em cultivares brasileiras de trigo, variando-se a data de semeadura. Um experimento de campo foi realizado em Santa Maria, Rio Grande do Sul (RS, com 13 datas de semeadura ao longo de três anos (2005, 2006 e 2007. Foram utilizados seis genótipos de trigo com ciclos de desenvolvimento variando de precoce a tardio: 'BRS LOURO', 'CEP 52', 'BRS 177', 'CEP 51', 'NOVA ERA' e 'BRS TARUMÃ'. Para cada cultivar e data de semeadura, foi determinada a duração, em °C dia, das fases vegetativa (emergência - antese e reprodutiva (antese - maturidade fisiológica e do ciclo total (emergência - maturidade fisiológica, o número final de folhas e o filocrono (tempo para aparecimento de duas folhas sucessivas no colmo principal e a relação entre essas variáveis por meio de análise de regressão. Os resultados indicam que a duração do ciclo total das cultivares de trigo tem relação direta com a duração da fase vegetativa e não com a fase reprodutiva, a qual foi similar entre as cultivares, e que a duração da fase vegetativa tem relação direta com o número final de folhas e não com a velocidade de aparecimento dessas folhas no colmo principal.The objective of this study was to determine the relationship between the duration of vegetative, reproductive and total developmental cycle with the main stem final leaf number and with the main stem leaf appearance rate in Brazilian wheat cultivars, varying the sowing date. A field experiment was carried out in Santa Maria, RS, in 13 sowing dates during three years (2005, 2006 and 2007. Six wheat genotypes with developmental cycle varying from early to late were used: BRS LOURO, CEP 52, BRS 177, CEP 51, NOVA ERA, and BRS TARUMÃ. For each cultivar and sowing date, the

  5. 77 FR 46339 - Chrysanthemum White Rust Regulatory Status and Restrictions

    Science.gov (United States)

    2012-08-03

    ... Chrysanthemum White Rust Regulatory Status and Restrictions AGENCY: Animal and Plant Health Inspection Service... chrysanthemum white rust (CWR) outbreaks and the importation of plant material that is a host of CWR... filamentous rust fungus and obligate parasite that is the causal agent of chrysanthemum white rust (CWR), an...

  6. Rust-Bio: a fast and safe bioinformatics library

    NARCIS (Netherlands)

    J. Köster (Johannes)

    2015-01-01

    textabstractWe present Rust-Bio, the first general purpose bioinformatics library for the innovative Rust programming language. Rust-Bio leverages the unique combination of speed, memory safety and high-level syntax offered by Rust to provide a fast and safe set of bioinformatics algorithms and data

  7. Complete Genome Sequencing and Targeted Mutagenesis Reveal Virulence Contributions of Tal2 and Tal4b of Xanthomonas translucens pv. undulosa ICMP11055 in Bacterial Leaf Streak of Wheat

    Science.gov (United States)

    Falahi Charkhabi, Nargues; Booher, Nicholas J.; Peng, Zhao; Wang, Li; Rahimian, Heshmat; Shams-Bakhsh, Masoud; Liu, Zhaohui; Liu, Sanzhen; White, Frank F.; Bogdanove, Adam J.

    2017-01-01

    Bacterial leaf streak caused by Xanthomonas translucens pv. undulosa (Xtu) is an important disease of wheat (Triticum aestivum) and barley (Hordeum vulgare) worldwide. Transcription activator-like effectors (TALEs) play determinative roles in many of the plant diseases caused by the different species and pathovars of Xanthomonas, but their role in this disease has not been characterized. ICMP11055 is a highly virulent Xtu strain from Iran. The aim of this study was to better understand genetic diversity of Xtu and to assess the role of TALEs in bacterial leaf streak of wheat by comparing the genome of this strain to the recently completely sequenced genome of a U.S. Xtu strain, and to several other draft X. translucens genomes, and by carrying out mutational analyses of the TALE (tal) genes the Iranian strain might harbor. The ICMP11055 genome, including its repeat-rich tal genes, was completely sequenced using single molecule, real-time technology (Pacific Biosciences). It consists of a single circular chromosome of 4,561,583 bp, containing 3,953 genes. Whole genome alignment with the genome of the United States Xtu strain XT4699 showed two major re-arrangements, nine genomic regions unique to ICMP11055, and one region unique to XT4699. ICMP110055 harbors 26 non-TALE type III effector genes and seven tal genes, compared to 25 and eight for XT4699. The tal genes occur singly or in pairs across five scattered loci. Four are identical to tal genes in XT4699. In addition to common repeat-variable diresidues (RVDs), the tal genes of ICMP11055, like those of XT4699, encode several RVDs rarely observed in Xanthomonas, including KG, NF, Y∗, YD, and YK. Insertion and deletion mutagenesis of ICMP11055 tal genes followed by genetic complementation analysis in wheat cv. Chinese Spring revealed that Tal2 and Tal4b of ICMP11055 each contribute individually to the extent of disease caused by this strain. A largely conserved ortholog of tal2 is present in XT4699, but for tal4b

  8. Tolerance of wheat varieties seedlings by glyphosate accelerated degradation

    Directory of Open Access Journals (Sweden)

    Jerković Zoran

    2014-01-01

    Full Text Available Lengths of seedlings aboveground parts of nine wheat varieties grown in greenhouse were reduced by 4-20%. They were tested during April at around 20oC after twice daily treatments with glyphosate based herbicide (0.5 ml in 1l water solution, 0.5 dl on 0.5 m2. When results of permanent artificially and daily lighted trials were compared, four groups of varieties were recognized same as was when near isogenic lines containing different leaf rust resistance genes (Lr NILs were focused in winter. Growth of variety Pobeda decreased more when seedlings were not permanent lighted which confirmed the common herbicide effect. Tolerance of other varieties was again explained by enzymatic degradation of glyphosate and chlorophyll inhibition by consequential phosphorus acids. Varieties Simonida, Tavita and Rapsodia were similar by reaction to glyphosate as Lr 1 and Lr 21 NILs. NS 40S contained Lr 3a with increased hydrolytic stability compared to Lr 24 but able to cleave external single phosphorus for the difference of Lr 19 or Lr 29. Their final effect was similar to previous stated of Lr 15 NIL during the winter. Varieties Gora and Metka had gene Lr 19, Enigma Lr 29 while Ilina Lr 24. Focusing herbicide residua transfer in seed probability, accounting optimal time for recovering ability of chlorophyll and temporary higher temperatures necessary for Lr genes even parasite free activity the varieties Gora, Metka and Enigma appeared to be possible solution for glyphosate apply near wheat heading in semiarid regions.

  9. Occurrence of Rust on Peucedanum japonicum Caused by Puccinia jogashimensis in Korea

    Directory of Open Access Journals (Sweden)

    Sug-Ju Ko

    2015-12-01

    Full Text Available During July to November 2014, severe rust infection was consistently found on Peucedanum japonicum growing farm in Yeosu, Korea. The rust was observed mainly on lower leaf surfaces. Symptoms of typical plants included yellow-orange rust pustules were observed on the petiole and leaf surface with small yellowish to chlorotic lesions on the upper surface. No symptom was observed on flowers. Uredinia were occurred amphigenous on leaf surface, and occasionally caulicolous, scattered or loosely aggregate, rounded to oblong, 0.4 to 4 mm in diameter, covered by epidermis, then naked, surrounded by ruptured epidermis, pulverulent, and brown. Urediniospores were ovate-ellipsoid, ellipsoid or subglobose, light brown, 20 to 45 ×15 to 35 µm, walls 2 to 4 µm thick. The resulting sequences were deposited in GenBank with accession No. KT778808, KT778809, and KT778810, respectively. Since this was the first accession of 28S sequence Puccinia jogashimensis, there was no exact match in GenBank nucleotide database. On the basis of the morphological characteristics and phylogenetic analyses of 28S rDNA, the fungus was identified as P. jogashimensis. To our knowledge, this is the first confirmed report on the occurrence of P. jogashimensis on P. japonicum in Korea.

  10. Silicon leaf application and physiological quality of white oat and wheat seedsAplicação foliar de silício e qualidade fisiológica de sementes de aveia-branca e trigo

    Directory of Open Access Journals (Sweden)

    Mariane Sayuri Ishizuka

    2012-10-01

    Full Text Available Plant nutrition can positively influence quality of seeds by improving plant tolerance to adverse climate. In this context, silicon is currently considered a micronutrient and it is beneficial to plant growth, especially Poaceaes such as white oat and wheat, thereby improving physiological quality of seeds. This study had the objective of evaluating the effects of silicon leaf application on plant tillering, silicon levels and physiological quality of white oat and wheat seeds besides establishing correlations between them. Two experiments were carried out in winter with white oat and wheat. The experimental design was the completely randomized block with eight replications. Treatments consisted of foliar application of silicon (0.8% of soluble silicon, as stabilized orthosilicic acid and a control (with no application. Silicon levels in leaves were determined at flowering whereas the number of plants and panicles/spikes per area was counted right before harvest. Seed quality was evaluated right after harvest through mass, germination and vigor tests. Data was submitted to variance analysis and means were compared by the Tukey test at a probability level of 5%. Person’s linear correlation test was performed among silicon level in plants, tillering and seed quality data. Silicon leaf application increases root and total length of white oat seedlings as an effect of higher Si level in leaves. Silicon leaf application increases mass of wheat seeds without affecting germination or vigor. A nutrição das plantas pode influenciar positivamente a qualidade das sementes por proporcionar maior tolerância às adversidades climáticas. Neste contexto, o silício é atualmente considerado um micronutriente e tem efeito benéfico no crescimento das plantas, especialmente Poaceaes como aveia-branca e trigo, consequentemente melhorando a qualidade fisiológica das sementes. Este estudo objetivou avaliar os efeitos da aplicação foliar de silício no

  11. Doenças foliares e o controle por fungicidas na produtividade e qualidade de grãos de trigo Foliar diseases and control by fungicides on yield and quality of wheat grains

    Directory of Open Access Journals (Sweden)

    Lucas Navarini

    2012-12-01

    -quality wheat. The results also showed that diseases compromise the remobilization of nitrogen from leaves to grains. The differences between strobilurins and triazoles were evident in the control of leaf spot and leaf rust, in which triazole fungicides were more effective in controlling the leaf spot complex, when compared to strobilurins. However, effective control of wheat leaf rust was provided by strobilurins. The phenological stages of elongation and emission of spikes are critical times for the chemical control of leaf spot under conditions of monoculture. In addition, the fungicide application after flowering is essential for the appropriate management of leaf rust.

  12. Herança da resistência à ferrugem da folha da aveia (Puccinia coronata f. sp. avenae Fraser & Led. em genótipos brasileiros de aveia branca Inheritance of oat leaf rust (Puccinia coronata f. sp. avenae Fraser & Led. resistance in white oat brazilian genotypes

    Directory of Open Access Journals (Sweden)

    Eduardo Alano Vieira

    2006-02-01

    the use of resistant cultivars. However, for the durable resistance to be acquired, it is necessary to know the genetics of resistance to crown rust in oats. Thus, the objective of this work was to determine the type of inheritance of resistance to three Puccinia coronata f. sp. avenae Fraser & Led., isolates (collected in southern Brazil in brazilian white oat genotypes. To determine the inheritance of resistance to each one of three isolates,F2 populations were used generated through artificial crosses, between resistant (R and susceptible (S and between resistant genotypes (R. Thus, F2 populations from the following artificial crosses: i URPEL 15 (R x UFRGS 7 (S, UPF 16 (R x UFRGS 7 (S and URPEL 15 (R x UPF 16 (R, were used to determine the inheritance of resistance to isolate one (1; ii URPEL 15 (R x UFRGS 7 (S, UPF 18 (R x UFRGS 7 (S and URPEL 15 (R x UPF 18 (R, to determine the inheritance of resistance to isolate two (2; iii URPEL 15 (R x UFRGS 7 (S and URPEL 15 (R x UPF 18 (S, to determine the inheritance of resistance to isolate three (3. The obtained results indicate that the genotype URPEL 15 present dominants genes for resistance to the three oat leaf rust isolates evaluated, the cultivar UPF 16 presents a recessive gene for resistance to isolate 1 and the cultivar UPF 18 has a recessive gene of resistence to isolate 2. Also, the resistance genes presented by genotypes URPEL 15, UPF 16 and UPF 18, segregate in an independent manner.

  13. Pushing the boundaries of resistance: insights from Brachypodium-rust interactions

    Directory of Open Access Journals (Sweden)

    Melania eFigueroa

    2015-07-01

    Full Text Available The implications of global population growth urge transformation of current food and bioenergy production systems to sustainability. Members of the family Poaceae are of particular importance both in food security and for their applications as biofuel substrates. For centuries, rust fungi have threatened the production of valuable crops such as wheat, barley, oat and other small grains; similarly, biofuel crops can also be susceptible to these pathogens. Emerging rust pathogenic races with increased virulence and recurrent rust epidemics around the world point out the vulnerability of monocultures. Basic research in plant immunity, especially in model plants, can make contributions to understanding plant resistance mechanisms and improve disease management strategies. The development of the grass Brachypodium distachyon as a genetically tractable model for monocots, especially temperate cereals and grasses, offers the possibility to overcome the experimental challenges presented by the genetic and genomic complexities of economically valuable crop plants. The numerous resources and tools available in Brachypodium have opened new doors to investigate the underlying molecular and genetic bases of plant-microbe interactions in grasses and evidence demonstrating the applicability and advantages of working with B. distachyon is increasing. Importantly, several interactions between B. distachyon and devastating plant pathogens, such rust fungi, have been examined in the context of non-host resistance. Here, we discuss the use of B. distachyon in these various pathosystems. Exploiting B. distachyon to understand the mechanisms underpinning disease resistance to non-adapted rust fungi may provide effective and durable approaches to fend off these pathogens. The close phylogenetic relationship among Brachypodium spp. and grasses with industrial and agronomic value support harnessing this model plant to improve cropping systems and encourage its use in

  14. Wheat Allergy

    Science.gov (United States)

    ... References Wheat allergy. American College of Allergy, Asthma & Immunology. http://www.acaai.org/allergist/allergies/Types/food- ... http://www.mayoclinic.org/diseases-conditions/wheat-allergy/basics/definition/CON-20031834 . Mayo Clinic Footer Legal Conditions ...

  15. substitution line for resistance to stripe rust

    Indian Academy of Sciences (India)

    2011-08-19

    2D) substitution line for resistance to stripe rust. MENGPING LEI, GUANGRONG LI, SUFEN ZHANG, CHENG LIU and ZUJUN YANG. ∗. School of Life Science and Technology, University of Electronic Science and Technology ...

  16. Een oase van rust op de boerderij

    NARCIS (Netherlands)

    Noorduyn, L.

    2010-01-01

    Rust is wat consumenten zoeken op een boerderij. Of ze er nou producten kopen of gaan boerengolfen. Dat komt naar voren uit onderzoek van Wageningen UR naar de beleving van consumenten die een boerderij bezoeken

  17. Marker-assisted pyramiding of Thinopyrum-derived leaf rust ...

    Indian Academy of Sciences (India)

    Mona Singh

    2017-12-08

    Dec 8, 2017 ... ilies carrying both Lr19 and Lr24 in homozygous state were developed. The details of gene pyramiding scheme are given in figure 1. Apart from the use of molecular markers, shuttle breed- ing was used to accelerate the development of NILs. Two generations in a year were raised; one at IARI, New Delhi,.

  18. Coffee Leaf Rust Epidemics ( Hemileia vastatrix ) in Montane Coffee ...

    African Journals Online (AJOL)

    Coffee (Coffea arabica L.) is native to southwestern Ethiopia growing as understory of the rainforests that harbor huge floral and faunal diversities. Besides drastic reduction in the forest cover and low average yield, the crop is attacked by several diseases among which coffee berry disease, coffee wilt disease and coffee ...

  19. Performance of Late Sown Wheat in Response to Foliar Application of Moringa oleifera Lam. Leaf Extract Rendimiento de Trigo Sembrado Tarde en Respuesta a la Aplicación Foliar de Extracto de Hojas de Moringa oleifera Lam.

    Directory of Open Access Journals (Sweden)

    Azra Yasmeen

    2012-03-01

    Full Text Available A rise in temperature during early spring inducing early maturity is a key yield-reducing factor in late sown wheat (Triticum aestivum L.. Moringa oleifera Lam. leaves are rich in zeatin, a cytokinin that plays a role in delaying leaf senescence, in addition to other growth-enhancing compounds such as ascorbates, phenolics, and minerals. The objective of this study was to optimize dose and optimum growth stage for foliar-applied moringa leaf extract (MLE and its role in delaying leaf senescence in late sown wheat. The wheat crop was shown on 16 December 2008; MLE (diluted 30 times was applied at different growth stages from tillering to heading and heading alone and distilled water was sprayed as a control. All the MLE treatment results were better than the control. However, an increase of 10.73%, 6.00%, 10.70%, and 4.00% was evident in 1000 grain weight, biological yield, grain yield, and harvest index, respectively, with MLE spray at tillering + jointing + booting + heading. The MLE spray used only at heading gave 6.84%, 3.17%, 6.80%, and 3.51% more than the control 1000 grain weight, biological yield, grain yield, and harvest index, respectively. The MLE extended seasonal leaf area duration (Seasonal LAD by 9.22 and 6.45 d over the control when applied at all growth stages and a single spray at heading, respectively. We conclude that it is possible that the presence of growth-promoting substances in MLE foliar spray can delay crop maturity and extend seasonal LAD and the grain-filling period, thereby leading to greater seed and biological yields in late sown wheat.Aumento en temperatura durante inicios de primavera induciendo madurez temprana es un factor clave en la reducción de rendimiento en siembra tardía de trigo (Triticum aestivum L.. Las hojas de Moringa oleifera Lam. son ricas en zeatina, una citoquinina que tiene rol en retraso de senescencia foliar, además de otros compuestos que mejoran crecimiento como ascorbatos, fenoles, y

  20. Leaf and sidedressing nitrogen application on wheat crop in savannaAplicação foliar e em cobertura de nitrogênio na cultura do trigo no cerrado

    Directory of Open Access Journals (Sweden)

    Marcelo Andreotti

    2011-08-01

    Full Text Available The nitrogen in wheat is essential for obtaining high yields, not only the dose but also the time and the way of application are critical, reducing potential leaching and the cost of production. The objective is evaluating leaf and sidedressing nitrogen application on wheat crop in years of 2006 and 2007. A randomized blocks design in a factorial scheme 5x3x2 was used. The treatments consisted of five doses of nitrogen in the solution (0; 2.5; 5.0; 7.5 and 10%, three application times (at tillering: 30 days after plant emergency (DAE, at full flowering (50 DAE + in the beginning of grain formation (70 DAE and at tillering + in the beginning of grain formation, with and without sidedressing nitrogen applied at 40 DAE, using urea as source. They were evaluated: chlorophyll and nitrogen content in leaf, number of spikelets per ear, number of grains per ear, mass of grains per ear, number of grains per spikelet, mass hectolitric, mass of 100 grains and productivity of grains. The application of nitrogen topdressing in both years, influenced the yield characteristics of wheat. The times of leaf nitrogen only affected the leaf N content. The leaf nitrogen concentrations increased linearly the number of grains per spikelets, grains per spike, chlorophyll content, grain weight per ear and grain yield, and reduced mean weight per hectoliter, only in 2007.A adubação nitrogenada na cultura do trigo é essencial para a obtenção de altas produtividades da cultura, não somente a dose, como também a época e o modo de aplicação são fundamentais no rendimento, reduzindo possíveis problemas de lixiviação e o custo de produção. O trabalho teve como objetivo avaliar os efeitos da adubação nitrogenada em cobertura e foliar em diferentes estádios sobre as características produtivas da cultura do trigo em dois agrícolas, em condições irrigadas no cerrado. Os tratamentos foram originados do fatorial 5x3x2 e consistiram de cinco concentrações de

  1. Spatially resolved sulfur K-edge XANES spectroscopy of wheat leaves infected by Puccinia triticina

    Energy Technology Data Exchange (ETDEWEB)

    Lichtenberg, H; Prange, A; Hormes, J [CAMD, Louisiana State University, 6980 Jefferson Hwy, Baton Rouge, LA 70806 (United States); Steiner, U; Oerke, E-C, E-mail: lichtenberg@lsu.ed [INRES-Phytomedicine, University of Bonn, Nussallee 9, 53115 Bonn (Germany)

    2009-11-15

    In this study, wheat leaves infected with brown rust, a plant disease of serious economic concern caused by the fungus Puccinia triticina, were investigated using spatially resolved XANES (X-ray Absorption Near Edge Structure) spectroscopy at the sulfur K-absorption edge.

  2. The proportion of nitrate in leaf nitrogen, but not changes in root growth, are associated with decreased grain protein in wheat under elevated [CO2].

    Science.gov (United States)

    Bahrami, Helale; De Kok, Luit J; Armstrong, Roger; Fitzgerald, Glenn J; Bourgault, Maryse; Henty, Samuel; Tausz, Michael; Tausz-Posch, Sabine

    2017-09-01

    The atmospheric CO2 concentration ([CO2]) is increasing and predicted to reach ∼550ppm by 2050. Increasing [CO2] typically stimulates crop growth and yield, but decreases concentrations of nutrients, such as nitrogen ([N]), and therefore protein, in plant tissues and grains. Such changes in grain composition are expected to have negative implications for the nutritional and economic value of grains. This study addresses two mechanisms potentially accountable for the phenomenon of elevated [CO2]-induced decreases in [N]: N uptake per unit length of roots as well as inhibition of the assimilation of nitrate (NO3-) into protein are investigated and related to grain protein. We analysed two wheat cultivars from a similar genetic background but contrasting in agronomic features (Triticum aestivum L. cv. Scout and Yitpi). Plants were field-grown within the Australian Grains Free Air CO2 Enrichment (AGFACE) facility under two atmospheric [CO2] (ambient, ∼400ppm, and elevated, ∼550ppm) and two water treatments (rain-fed and well-watered). Aboveground dry weight (ADW) and root length (RL, captured by a mini-rhizotron root growth monitoring system), as well as [N] and NO3- concentrations ([NO3-]) were monitored throughout the growing season and related to grain protein at harvest. RL generally increased under e[CO2] and varied between water supply and cultivars. The ratio of total aboveground N (TN) taken up per RL was affected by CO2 treatment only later in the season and there was no significant correlation between TN/RL and grain protein concentration across cultivars and [CO2] treatments. In contrast, a greater percentage of N remained as unassimilated [NO3-] in the tissue of e[CO2] grown crops (expressed as the ratio of NO3- to total N) and this was significantly correlated with decreased grain protein. These findings suggest that e[CO2] directly affects the nitrate assimilation capacity of wheat with direct negative implications for grain quality. Crown Copyright

  3. 77 FR 65840 - Chrysanthemum White Rust Regulatory Status and Restrictions

    Science.gov (United States)

    2012-10-31

    ... Chrysanthemum White Rust Regulatory Status and Restrictions AGENCY: Animal and Plant Health Inspection Service... whether and how we should amend our process for responding to domestic chrysanthemum white rust (CWR... chrysanthemum white rust (CWR) outbreaks and the importation of plant material that is a host of CWR. CWR is an...

  4. Genome-metabolite associations revealed low heritability, high genetic complexity, and causal relations for leaf metabolites in winter wheat (Triticum aestivum).

    Science.gov (United States)

    Matros, Andrea; Liu, Guozheng; Hartmann, Anja; Jiang, Yong; Zhao, Yusheng; Wang, Huange; Ebmeyer, Erhard; Korzun, Viktor; Schachschneider, Ralf; Kazman, Ebrahim; Schacht, Johannes; Longin, Friedrich; Reif, Jochen Christoph; Mock, Hans-Peter

    2017-01-01

    We investigated associations between the metabolic phenotype, consisting of quantitative data of 76 metabolites from 135 contrasting winter wheat (Triticum aestivum) lines, and 17 372 single nucleotide polymorphism (SNP) markers. Metabolite profiles were generated from flag leaves of plants from three different environments, with average repeatabilities of 0.5-0.6. The average heritability of 0.25 was unaffected by the heading date. Correlations among metabolites reflected their functional grouping, highlighting the strict coordination of various routes of the citric acid cycle. Genome-wide association studies identified significant associations for six metabolic traits, namely oxalic acid, ornithine, L-arginine, pentose alcohol III, L-tyrosine, and a sugar oligomer (oligo II), with between one and 17 associated SNPs. Notable associations with genes regulating transcription or translation explained between 2.8% and 32.5% of the genotypic variance (pG). Further candidate genes comprised metabolite carriers (pG 32.5-38.1%), regulatory proteins (pG 0.3-11.1%), and metabolic enzymes (pG 2.5-32.5%). The combinatorial use of genomic and metabolic data to construct partially directed networks revealed causal inferences in the correlated metabolite traits and associated SNPs. The evaluated causal relationships will provide a basis for predicting the effects of genetic interferences on groups of correlated metabolic traits, and thus on specific metabolic phenotypes. © The Author 2016. Published by Oxford University Press on behalf of the Society for Experimental Biology.

  5. Simultaneous effects of leaf irradiance and soil moisture on growth and root system architecture of novel wheat genotypes: implications for phenotyping

    Science.gov (United States)

    Nagel, Kerstin A.; Bonnett, David; Furbank, Robert; Walter, Achim; Schurr, Ulrich; Watt, Michelle

    2015-01-01

    Plants in the field are exposed to varying light and moisture. Agronomic improvement requires knowledge of whole-plant phenotypes expressed in response to simultaneous variation in these essential resources. Most phenotypes, however, have been described from experiments where resources are varied singularly. To test the importance of varying shoot and root resources for phenotyping studies, sister pre-breeding lines of wheat were phenotyped in response to independent or simultaneous exposure to two light levels and soil moisture profiles. The distribution and architecture of the root systems depended strongly on the moisture of the deeper soil layer. For one genotype, roots, specifically lateral roots, were stimulated to grow into moist soil when the upper zone was well-watered and were inhibited by drier deep zones. In contrast, the other genotype showed much less plasticity and responsiveness to upper moist soil, but maintained deeper penetration of roots into the dry layer. The sum of shoot and root responses was greater when treated simultaneously to low light and low soil water, compared to each treatment alone, suggesting the value of whole plant phenotyping in response to multiple conditions for agronomic improvement. The results suggest that canopy management for increased irradiation of leaves would encourage root growth into deeper drier soil, and that genetic variation within closely related breeding lines may exist to favour surface root growth in response to irrigation or in-season rainfall. PMID:26089535

  6. Characteristics of winter wheat varieties for resistance to causal agents and pests

    Directory of Open Access Journals (Sweden)

    Г. М. Ковалишина

    2016-02-01

    Full Text Available Purpose. Studying and identifying winter wheat varieties that are resistant to causal agents of major diseases and pests. Methods. Laboratory analysis, field study. Results. On artificial infection backgrounds of causal agents such varieties as ‘Smuhlianka’, ‘Svitanok Myronivskyi’, ‘Berehynia Myronіvska’, ‘Horlytsia Myronіvska’ have shown high level of resistance to brown rust; ‘Svitanok Myronivskyi’, ‘Berehynia Myronіvska’ – to powdery mildew; ‘Smuhlianka’ – to covered smut. Varieties ‘Voloshkova’, ‘Yuviliar Myronivskyi’, ‘Myrliena’, ‘Oberih Myronivskyi’, ‘Kolos Myronivschyny’, ‘Lehenda Myronivska’ had medium resistance to Septoria leaf blotch; ‘Smuhlianka’, ‘Myrliena’, ‘Oberih Myronivskyi’, ‘Berehynia Myronіvska’, ‘Horlytsia Myronіvska’, ‘Myronivska storichna’ – to Fusarium head blight; ‘Myronіvska 65’, ‘Smuhlianka’, ‘Lehenda Myronivska’, ‘Berehynia Myronіvska’ – to root rots. Among the varieties studied, there were those with group resistance to diseases: ‘Voloshkova’, ‘Myrliena’, ‘Yuviliar Myronivskyi’, ‘Oberih Myronivskyi’, ‘Bohdana’, ‘Myronivska storichna’, ‘Ekonomka’, ‘Svitanok Myronivskyi’, ‘Berehynia Myronіvska’, ‘Horlytsia Myronіvska’, ‘Smuhlianka’. Varieties bred at the V. M. Remeslo Myronivka Institute of Wheat are distinguished by pest resistance. During autumn tillering phase of winter wheat the smallest number of large cereal aphids was observed in varieties ‘Smuhlianka’ and ‘Myronivska storichna’, leafhoppers – in varieties ‘Smuhlianka’, ‘Myrliena’, ‘Yuviliar Myronivskyi’. The slight population of thrips in the phase of earing was marked in the variety ‘Kolos Myronivschyny’, in the milk-ripe stage the smallest number of larvae per ear was detected in varieties ‘Smuhlianka’, ‘Voloshkova’, ‘Kolos Myronivschyny’. Varieties

  7. The Big Rust and the Red Queen: Long-Term Perspectives on Coffee Rust Research.

    Science.gov (United States)

    McCook, Stuart; Vandermeer, John

    2015-09-01

    Since 2008, there has been a cluster of outbreaks of the coffee rust (Hemileia vastatrix) across the coffee-growing regions of the Americas, which have been collectively described as the Big Rust. These outbreaks have caused significant hardship to coffee producers and laborers. This essay situates the Big Rust in a broader historical context. Over the past two centuries, coffee farmers have had to deal with the "curse of the Red Queen"-the need to constantly innovate in the face of an increasing range of threats, which includes the rust. Over the 20th century, particularly after World War II, national governments and international organizations developed a network of national, regional, and international coffee research institutions. These public institutions played a vital role in helping coffee farmers manage the rust. Coffee farmers have pursued four major strategies for managing the rust: bioprospecting for resistant coffee plants, breeding resistant coffee plants, chemical control, and agroecological control. Currently, the main challenge for researchers is to develop rust control strategies that are both ecologically and economically viable for coffee farmers, in the context of a volatile, deregulated coffee industry and the emergent challenges of climate change.

  8. Comportamento de cultivares de trigo em duas regiões tritícolas do estado de São Paulo em 1976 Behavior of wheat cultivars in different regions of the State São Paulo in 1976

    Directory of Open Access Journals (Sweden)

    João Carlos Felício

    1978-01-01

    Full Text Available Com a finalidade de estudar o comportamento em duas regiões tritícolas do Estado de São Paulo foram instalados seis ensaios com trigo, sendo dois com cultivares sem tolerância ao Al+++ (comprovada, três com cultivares tolerante ao Al+++ e um com cultivares já em cultivo. BH-1146, IAC-5 (maringá tobari-F-66, LA-1434 e super X foram considerados cultivares preferenciais para a semeadura na região do Vale do Paranapanema, e IAC-5 (maringá foi considerado preferencial para a região sul do Estado de São Paulo. Os cultivares de origem mexicana têm-se mostrado suscetíveis a Puccinia graminis tritici.Competition trials of different wheat cultivars (Triticum aestivum L. were started for yield potencial and resistance to lay, to stem rust and to leaf rust, and for a wide adaptation in two regions of the State of São Paulo without irrigation. The cultivars BH-1146, IAC-5 (maringá, tobari-F-66, LA-1434 and super X showed superior performance in the Paranapanema Valley; the cultivars IAC-5 (maringá did so in the south of the State of São Paulo.

  9. Expression of Leaf Proteins in Two Cultivars of Bread Wheat under Cadmium and Mercury Stress Using Two-Dimensional Gel Electrophoresis

    Directory of Open Access Journals (Sweden)

    S. Y. Raeesi Sadati

    2016-02-01

    Full Text Available Wheat is an important source of human food. Cadmium and mercury bind to sulfhydryl groups of structural proteins and enzymes and cause inhibition in activity and decrease in protein production or interfere with the regulation of the enzymes. To study the effect of protein expression under different levels of cadmium and mercury, the experiment was conducted in a completely randomized design with three replications in Mohaghegh Ardabili University, Ardabil, Iran. Experimental factors consisted of two Gonbad and Tajan bread what cultivars, heavy metals in seven levels (four concentrations of mercuric chloride in 5, 10, 15 and 20 µM and cadmium chloride at two concentrations of 0.25 and 0.5 mM and sampling time after 8 and 16 hours of treatment. The Bradford method was used for quantitative analysis of proteins and 12% SDS-PAGE and two dimensional electrophorese techniques were hired for analysis of their expression. The results showed that under cadmium and mercury stresses, the total protein content increased compared to the control. Two-dimensional electrophoresis of proteins under cadmium stress showed differential expression of the protein spots on the plant leaves, than the control. In general, changes in the expression of proteins under the effect of cadmium stress were divided into two main categories: Spots 9, 10, 13, 14 and 16 belonged to proteins with reduced expression and the spots 1, 2, 8, 19 and 20 belonged to proteins with increased expression, in comparison to non-stressed control. These spots of up regulated proteins were directly related to the defense system against the heavy metal stress.

  10. Eat Wheat!

    Science.gov (United States)

    Idaho Wheat Commission, Boise.

    This pamphlet contains puzzles, games, and a recipe designed to teach elementary school pupils about wheat. It includes word games based on the U.S. Department of Agriculture Food Guide Pyramid and on foods made from wheat. The Food Guide Pyramid can be cut out of the pamphlet and assembled as a three-dimensional information source and food guide.…

  11. Estudo comparativo de cultivares de trigo em latossolo roxo no vale do Paranapanema A comparative study of wheat cultivars on Latossolic B "terra roxa" soils in the state of Sao Paulo

    Directory of Open Access Journals (Sweden)

    Carlos Eduardo de Oliveira Camargo

    1974-01-01

    Full Text Available Este trabalho foi executado com o propósito de estudar o comportamento de diferentes cultivares de trigo, na região tritícola do Estado de São Paulo. Foram instaladas cinco experiências em Latossolo Roxo, no Vale do Paranapanema, sendo duas em 1971 e três em 1972. Os cultivares Pel 4178-67, IAC-5, IAS-55, IRN-526-63, Londrina, Pitic-62, Cotiporã, IAS-54, LA-1434 e C-17 foram os que apresentaram maior produtividade por unidade de área; os cultivares Pel 4178-67 e Paraguai-214 mostraram-se resistentes às raças prevalentes de ferrugem do colmo e da folha. Entre os cultivares estudados, BH-1146, IAS-51, IAS-54, IAC-5, IRN-526-63, LA-1434, Pel 1403-64, S-12, S-43, Santa Elena, Pel 13180-65 foram suscetíveis à ferrugem da folha, e IAC-8, BH-1146, S-43, Pel 13295-65, IAC-5, S-12, Cotiporã, Pel 14603-64 e Santa Elena suscetíveis ao acamamento.Selected germoplasms of wheat were tested for yield potential and resistance to rusts and by cultivar trials in the State of São Paulo. Performance was evaluated in several locations in 1971 and 1972 in the wheat area of the State on Latossolic B "Terra Roxa" soils. The cultivars Pel 4178-67, IAC-5, IAS-55, IRN-526-63, Londrina, Pitic-62, Cotiporã, IAS-54 and LA-1434 showed superior performance for yield. The cultivars Pel 4178-67 and Paraguai-214 showed good resistance to leaf and stem rust while the cultivars BH-1146, IAS-51, IAS-54, IAC-5, IRN-526-63, LA-1434, Pel 14603-64, S-12, S-43, Santa Elena and Pel 13180-65 were susceptible to leaf rust. The cultivars IAC-8, BH-1146, S-43, Pel 13295-65, IAC-5, S-12, Cotiporã, Pel 14603-64 and Santa Eelena were susceptible to lay.

  12. Estimation and Validation of RapidEye-Based Time-Series of Leaf Area Index for Winter Wheat in the Rur Catchment (Germany

    Directory of Open Access Journals (Sweden)

    Muhammad Ali

    2015-03-01

    Full Text Available Leaf Area Index (LAI is an important variable for numerous processes in various disciplines of bio- and geosciences. In situ measurements are the most accurate source of LAI among the LAI measuring methods, but the in situ measurements have the limitation of being labor intensive and site specific. For spatial-explicit applications (from regional to continental scales, satellite remote sensing is a promising source for obtaining LAI with different spatial resolutions. However, satellite-derived LAI measurements using empirical models require calibration and validation with the in situ measurements. In this study, we attempted to validate a direct LAI retrieval method from remotely sensed images (RapidEye with in situ LAI (LAIdestr. Remote sensing LAI (LAIrapideye were derived using different vegetation indices, namely SAVI (Soil Adjusted Vegetation Index and NDVI (Normalized Difference Vegetation Index. Additionally, applicability of the newly available red-edge band (RE was also analyzed through Normalized Difference Red-Edge index (NDRE and Soil Adjusted Red-Edge index (SARE. The LAIrapideye obtained from vegetation indices with red-edge band showed better correlation with LAIdestr (r = 0.88 and Root Mean Square Devation, RMSD = 1.01 & 0.92. This study also investigated the need to apply radiometric/atmospheric correction methods to the time-series of RapidEye Level 3A data prior to LAI estimation. Analysis of the the RapidEye Level 3A data set showed that application of the radiometric/atmospheric correction did not improve correlation of the estimated LAI with in situ LAI.

  13. Rust in Plumeria spp. (Apocynaceae in the State of Mato Grosso do Sul, Brazil.

    Directory of Open Access Journals (Sweden)

    Cassia de Carvalho

    2014-11-01

    Full Text Available Frangipani (Plumeria spp. is a plant widely used in urban ornamentation, due to its hardiness, easy handling and exuberance of its flowers. Plumeria spp. Leaves were collected in Dourados, MS, Brazil, with typical symptoms and signs of the presence of rust: powdery yellowish uredinias in the abaxial and chlorotic and necrotic spots on the adaxial surface of the leaves, sometimes resulting in leaf abscission. The present study aims to record the occurrence of the disease in the State of Mato Grosso do Sul. Microscopic observations and measurements of uredinospores and teliospores confirmed that the fungus infecting plants was Coleosporium plumeriae.

  14. Effector-mining in the poplar rust fungus Melampsora larici populina secretome

    Directory of Open Access Journals (Sweden)

    Cecile eLorrain

    2015-12-01

    Full Text Available The poplar leaf rust fungus, Melampsora larici-populina has been established as a tree-microbe interaction model. Understanding the molecular mechanisms controlling infection by pathogens appears essential for durable management of tree plantations. In biotrophic plant parasites, effectors are known to condition host cell colonization. Thus, investigation of candidate secreted effector proteins is a major goal in the poplar-poplar rust interaction. Unlike oomycetes, fungal effectors do not share conserved motifs and candidate prediction relies on a set of a priori criteria established from reported bona fide effectors. Secretome prediction, genome-wide analysis of gene families and transcriptomics of M. larici-populina have led to catalogues of more than a thousand secreted proteins. Automatized effector mining pipelines hold great promise for rapid and systematic identification and prioritization of candidate secreted effector proteins for functional characterization. In this review, we report on and discuss the current status of the poplar rust fungus secretome and prediction of candidate effectors in this species.

  15. A putative amino acid transporter is specifically expressed in haustoria of the rust fungus Uromyces fabae.

    Science.gov (United States)

    Hahn, M; Neef, U; Struck, C; Göttfert, M; Mendgen, K

    1997-05-01

    A cDNA library constructed from haustoria of the rust fungus Uromyces fabae was screened for clones that are differentially expressed in haustoria. One family of cDNAs (in planta-induced gene 2 [PIG2] was isolated and found to encode a protein with high homologies to fungal amino acid transporters. A cDNA clone containing the complete coding region of PIG2 and the corresponding genomic clone were isolated and sequenced, revealing the presence of 17 introns in the PIG2 gene. Expression of PIG2 mRNA appeared to be restricted to haustoria. With antibodies raised against synthetic peptides, the PIG2-encoded protein was found in membranes fractions of isolated haustoria but not of germinated rust spores. With immunofluorescence microscopy, the putative amino acid transporter was localized to plasma membranes of the haustorial bodies, but not detected in the haustorial neck, haustorial mother cells, or intercellular fungal hyphae growing within infected leaf tissue. These data present for the first time molecular evidence that the rust haustorium plays a special role in the uptake of nutrients from an infected host cell.

  16. Identification of Green Rust in Groundwater

    DEFF Research Database (Denmark)

    Christiansen, Bo C.; Balic Zunic, Tonci; Dideriksen, Knud

    2009-01-01

    Green rust, a family of Fe(II),Fe(III) layered double hydroxides, is believed to be present in environments close to the Fe(II)/Fe(III) transition zone. Attempts to identify members of this family in nature have proven difficult because the material is oxidized after only a few minutes exposure t...

  17. Major transcriptome reprogramming underlies floral mimicry induced by the rust fungus Puccinia monoica in Boechera stricta.

    Directory of Open Access Journals (Sweden)

    Liliana M Cano

    Full Text Available Pucciniamonoica is a spectacular plant parasitic rust fungus that triggers the formation of flower-like structures (pseudoflowers in its Brassicaceae host plant Boecherastricta. Pseudoflowers mimic in shape, color, nectar and scent co-occurring and unrelated flowers such as buttercups. They act to attract insects thereby aiding spore dispersal and sexual reproduction of the rust fungus. Although much ecological research has been performed on P. monoica-induced pseudoflowers, this system has yet to be investigated at the molecular or genomic level. To date, the molecular alterations underlying the development of pseudoflowers and the genes involved have not been described. To address this, we performed gene expression profiling to reveal 256 plant biological processes that are significantly altered in pseudoflowers. Among these biological processes, plant genes involved in cell fate specification, regulation of transcription, reproduction, floral organ development, anthocyanin (major floral pigments and terpenoid biosynthesis (major floral volatile compounds were down-regulated in pseudoflowers. In contrast, plant genes involved in shoot, cotyledon and leaf development, carbohydrate transport, wax biosynthesis, cutin transport and L-phenylalanine metabolism (pathway that results in phenylethanol and phenylacetaldehyde volatile production were up-regulated. These findings point to an extensive reprogramming of host genes by the rust pathogen to induce floral mimicry. We also highlight 31 differentially regulated plant genes that are enriched in the biological processes mentioned above, and are potentially involved in the formation of pseudoflowers. This work illustrates the complex perturbations induced by rust pathogens in their host plants, and provides a starting point for understanding the molecular mechanisms of pathogen-induced floral mimicry.

  18. FLUXAPYROXAD IN THE ASIAN SOYBEAN RUST CONTROL IN THE CERRADO BIOME

    Directory of Open Access Journals (Sweden)

    RAFAEL MENEZES SILVA DE FREITAS

    2016-01-01

    Full Text Available The etiologic agent of the Asian soybean rust is the Phakopsora pachyrhizi, which causes a reduction in the photosynthetic leaf area and, consequently, in the crop yield. Chemical control is one of the main measures for its management. The objective of this work was to evaluate the efficacy and selectivity of the fluxapyroxad fungicide on controlling the Asian soybean rust, under the edaphoclimatic conditions of the Cerrado biome. The experiment was conducted in an area under no-tillage system, in the Agricultural Research Center, Rio Verde, Goias, Brazil, during the 2012/2013 crop season, using the cultivar NA7337. A randomized block experimental design was used, with twelve treatments and four replications. The treatments consisted of applications of fluxapyroxad (FX, pyraclostrobin (PT, epoxiconazole (EX and metconazole (MZ. The average severity of the disease in the plants reached 37% in the Control. All treatments with fungicides differed from the Control. Treatments 9, 10, 11 and 12 provided the greatest rates of soybean rust control. The treatments 10, 11 and 12 had the highest thousand grain weights, and the yields of the treatments 2, 3 and 11, despite higher than the Control, were lower than the treatments 4, 5, 6, 7, 8, 9, 10 and 12, which had statistically equal yields. The increasing in yield, compared to the Control, ranged from 10.05% (pyraclostrobin, epoxiconazole + pyraclostrobin + mineral oil to 30.55% (pyraclostrobin, pyraclostrobin + fluxapyroxad + mineral oil and pyraclostrobin + metconazole + mineral oil. The highest rates of soybean rust control were presented by fungicides containing fluxapyroxad.

  19. Wheat Allergy

    Science.gov (United States)

    ... Watery eyes Wheat allergy Symptoms & causes Diagnosis & treatment Advertisement Mayo Clinic does not endorse companies or products. ... a Job Site Map About This Site Twitter Facebook Google YouTube Pinterest Mayo Clinic is a not- ...

  20. Wheat: The Whole Story.

    Science.gov (United States)

    Oklahoma State Dept. of Education, Oklahoma City.

    This publication presents information on wheat. Wheat was originally a wild grass and not native to the United States. Wheat was not planted there until 1777 (and then only as a hobby crop). Wheat is grown on more acres than any other grain in this country. Soft wheats are grown east of the Mississippi River, and hard wheats are grown west of the…

  1. Ultrastructure of the Rust Fungus Puccinia miscanthi in the Teliospore Stage Interacting with the Biofuel Plant Miscanthus sinensis

    Directory of Open Access Journals (Sweden)

    Ki Woo Kim

    2015-09-01

    Full Text Available Interaction of the the rust fungus Puccinia miscanthi with the biofuel plant Miscanthus sinensis during the teliospore phase was investigated by light and electron microscopy. P. miscanthi telia were oval-shaped and present on both the adaxial and abaxial leaf surfaces. Teliospores were brown, one-septate (two-celled, and had pedicels attached to one end. Transmission electron microscopy revealed numerous electron-translucent lipid globules in the cytoplasm of teliospores. Extensive cell wall dissolution around hyphae was not observed in the host tissues beneath the telia. Hyphae were found between mesophyll cells in the leaf tissues as well as in host cells. Intracellular hyphae, possibly haustoria, possessed electron-dense fungal cell walls encased by an electron-transparent fibrillar extrahaustorial sheath that had an electron-dense extrahaustorial membrane. The infected host cells appeared to maintain their membrane-bound structures such as nuclei and chloroplasts. These results suggest that the rust fungus maintains its biotrophic phase with most mesophyll cells of M. sinensis. Such a nutritional mode would permit the rust fungus to obtain food reserves for transient growth in the course of host alteration.

  2. Estimación del area de las hojas en plantas de trigo bajo diferentes tipos de estrés abiótico Leaf area estimation in wheat plants suffering several kinds of abiotic stress

    Directory of Open Access Journals (Sweden)

    D.H. Cogliatti

    2010-06-01

    Full Text Available En trigo, es posible estimar el área de las hojas (AF utilizando el producto del largo, el ancho de la lámina (LxA y un coeficiente de proporcionalidad (b m. Sin embargo, no hay información sobre la posibilidad de usar el mismo valor del coeficiente para estimar el área en plantas que sufren estrés hídrico, lumínico o nutricional. Para estudiar este punto se realizaron dos experimentos en los cuales se aplicó sequía, sombreo y deficiencias de N y P a plantas de trigo. El coeficiente b m se calculó a partir de la regresión lineal entre AF y LxA y fue similar entre las plantas control y aquellas que sufrieron sequía o deficiencias de N o P, pero fue distinto en plantas sombreadas. El mayor valor de b m en las plantas sombreadas se debió a una mayor proporción del sector medio de la lámina, definido por su forma rectangular. La validación de la posibilidad de usar el b m del control para estimar AF en plantas estresadas se realizó por regresión lineal entre el AF medida y calculada. Se concluye que puede usarse el mismo coeficiente b m para estimar el AF en plantas no estresadas y en plantas que sufren sequía o deficiencias de N o P. El uso del mismo valor del coeficiente b m en plantas sombreadas llevó a una subestimación del AF, la que fue más pronunciada a medida que aumentó el sombreo.In wheat, leaf area (LA can be estimated as the product between length, maximum blade width (LxW and a proportionality coefficient b m. However, it is unknown whether this coefficient is the same in stressed and non stressed plants. In order to study this, two experiments in which drought, shading and N and P deficiencies were applied to wheat plants were performed. The b m coefficient was calculated by linear regression between LA and LxW. The coefficient was similar in control plants as compared to those suffering wilting or N or P-deficiency, but different in shaded plants. The greater b m in shaded plants was due to an increased

  3. Phylogenetic studies in Ravenelia esculenta and related rust fungi

    OpenAIRE

    Gandhe, K. R.; Kuvalekar, Aniket

    2007-01-01

    Ravenelia esculenta Naras. and Thium. is a rust fungus, which infects mostly thorns, inflorescences, flowers and fruits of Acacia eburnea Willd. Aecial stages of the rust produce hypertrophy in infected parts. DNA of the rust fungus was isolated from aeciospores by ‘freeze thaw’ method. 18S rDNA was amplified and sequenced by automated DNA sequencer. BLAST of the sequence at NCBI retrieved 96 sequences producing significant alignments. Multiple sequence alignment of these sequences was done b...

  4. Rapid cloning of genes in hexaploid wheat using cultivar-specific long-range chromosome assembly

    Czech Academy of Sciences Publication Activity Database

    Thind, A. K.; Wicker, T.; Šimková, Hana; Fossati, D.; Moullet, O.; Brabant, C.; Vrána, Jan; Doležel, Jaroslav; Krattinger, S.G.

    2017-01-01

    Roč. 35, č. 8 (2017), s. 793-796 ISSN 1087-0156 R&D Projects: GA MŠk(CZ) LO1204 Institutional support: RVO:61389030 Keywords : adult-plant resistance * leaf rust * sequence capture * genome * arabidopsis * virulence * barley * canada * locus * lr22a Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 41.667, year: 2016

  5. Climate change impacts on coffee rust disease

    Science.gov (United States)

    Alfonsi, W. M. V.; Koga-Vicente, A.; Pinto, H. S.; Alfonsi, E. L., Sr.; Coltri, P. P.; Zullo, J., Jr.; Patricio, F. R.; Avila, A. M. H. D.; Gonçalves, R. R. D. V.

    2016-12-01

    Changes in climate conditions and in extreme weather events may affect the food security due to impacts in agricultural production. Despite several researches have been assessed the impacts of extremes in yield crops in climate change scenarios, there is the need to consider the effects in pests and diseases which increase losses in the sector. Coffee Arabica is an important commodity in world and plays a key role in Brazilian agricultural exports. Although the coffee crop has a world highlight, its yield is affected by several factors abiotic or biotic. The weather as well pests and diseases directly influence the development and coffee crop yield. These problems may cause serious damage with significant economic impacts. The coffee rust, caused by the fungus Hemileia vastarix,is among the diseases of greatest impact for the crop. The disease emerged in Brazil in the 70s and is widely spread in all producing regions of coffee in Brazil, and in the world. Regions with favorable weather conditions for the pathogen may exhibit losses ranging from 30% to 50% of the total grain production. The evaluation of extreme weather events of coffee rust disease in futures scenarios was carried out using the climatic data from CMIP5 models, data field of coffee rust disease incidence and, incubation period simulation data for Brazilian municipalities. Two Regional Climate Models were selected, Eta-HadGEM2-ES and Eta-MIROC5, and the Representative Concentration Pathways 8.5 w/m2 was adopted. The outcomes pointed out that in these scenarios the period of incubation tends to decrease affecting the coffee rust disease incidence, which tends to increase. Nevertheless, the changing in average trends tends to benefit the reproduction of the pathogen. Once the temperature threshold for the disease reaches the adverse conditions it may be unfavorable for the incidence.

  6. Effect of solar radiation on severity of soybean rust.

    Science.gov (United States)

    Young, Heather M; George, Sheeja; Narváez, Dario F; Srivastava, Pratibha; Schuerger, Andrew C; Wright, David L; Marois, James J

    2012-08-01

    Soybean rust (SBR), caused by Phakopsora pachyrhizi, is a damaging fungal disease of soybean (Glycine max). Although solar radiation can reduce SBR urediniospore survival, limited information is available on how solar radiation affects SBR progress within soybean canopies. Such information can aid in developing accurate SBR prediction models. To manipulate light penetration into soybean canopies, structures of shade cloth attenuating 30, 40, and 60% sunlight were constructed over soybean plots. In each plot, weekly evaluations of severity in lower, middle, and upper canopies, and daily temperature and relative humidity were recorded. Final plant height and leaf area index were also recorded for each plot. The correlation between amount of epicuticular wax and susceptibility of leaves in the lower, middle, and upper canopies was assessed with a detached leaf assay. Final disease severity was 46 to 150% greater in the lower canopy of all plots and in the middle canopy of 40 and 60% shaded plots. While daytime temperature within the canopy of nonshaded soybean was greater than shaded soybean by 2 to 3°C, temperatures recorded throughout typical evenings and mornings of the growing season in all treatments were within the range (10 to 28.5°C) for SBR development as was relative humidity. This indicates temperature and relative humidity were not limiting factors in this experiment. Epicuticular wax and disease severity in detached leaf assays from the upper canopy had significant negative correlation (P = 0.009, R = -0.84) regardless of shade treatment. In laboratory experiments, increasing simulated total solar radiation (UVA, UVB, and PAR) from 0.15 to 11.66 MJ m(-2) increased mortality of urediniospores from 2 to 91%. Variability in disease development across canopy heights in early planted soybean may be attributed to the effects of solar radiation not only on urediniospore viability, but also on plant height, leaf area index, and epicuticular wax, which influence

  7. Progresso temporal da ferrugem e redução sobre a área foliar e os componentes do rendimento de grãos em soja Temporal progress of rust and reduced leaf area and yield components in soybean grain

    Directory of Open Access Journals (Sweden)

    Felipe Rafael Garcés Fiallos

    2011-04-01

    em experimento de campo com 64 parcelas (2.7 x 5 m da cultivar Glycine max L. (Nidera 5909 RG, estabelecida em 05/12/09. Para gerar gradientes de doença utilizaram-se dois fungicidas (tebuconazol e epoxiconazol + piraclostrobina, em uma, duas ou três aplicações em estádios fonológicos diferentes. A doença foi quantificada por número de lesões e urédias, posteriormente convertido para severidade (%. Quantificou-se também o índice de área foliar ao final do enchimento de grãos e os componentes do rendimento após a colheita. A severidade média final da ferrugem superou 50%. As diferenças em severidade entre os estratos da planta foram influenciadas pela quantidade inicial de doença, uma vez que as taxas de progresso, determinadas pelos modelos logístico e de Gompertz, foram semelhantes entre os estratos (0.13 a 0.14 para o logístico e 0.10 a 0.11 para Gompertz. O índice de área foliar (IAF foi de apenas 1.96 nas plantas não tratadas, contra 4.40 no tratamento com quatro aplicações de epoxiconazol + piraclostrobina. Programas de controle iniciados em estádio fonológico V9, com duas ou três aplicações, diferiram da testemunha em IAF. O número de legumes e grãos por planta, assim como grãos por legume não variaram entre os tratamentos. Só houve diferença no peso de grãos do estrato superior, quando os fungicidas foram aplicados duas ou três vezes a partir de estádio fonológico V9.The harvest of the year 2009-10 of soybean crop in Southern Brazil occurred under higher intensity of soybean rust (Phakopsora pachyrhizi Sydow y Sydow, which allowed studies on disease progress and crop reduction. A field experiment with 64 plots (2.7 x 5 m of the cultivar Glycine max L. (Nidera 5909 RG sown on 5/Dec/2009 was used for the evaluations. Disease gradients were obtained by spraying the fungicides tebuconazol or epoxiconazol + pyraclostrobin once, twice or three times, at different plant growth stages. Disease progress was assessed as number of

  8. Effect of incorporation of cauliflower leaf powder on sensory and ...

    African Journals Online (AJOL)

    PHT

    2014-02-26

    Feb 26, 2014 ... recorded highest value of crude fat (21.96%). On the basis of sensory evaluation, biscuits prepared from 90:10: malted wheat flour: cauliflower leaf powder was adjudged the best with regard to their acceptability and storability. Key words: Cauliflower leaves, biscuits, malted wheat, β-carotene, iron, protein, ...

  9. Statut des principales maladies cryptogamiques foliaires du blé au ...

    African Journals Online (AJOL)

    Septoria leaf blotch, brown rust and net blotch were by far the most important foliar diseases in wheat fields, with prevalence of 85.4, 76.6 and 63.0 % respectively. At fields of durum wheat, the situation was characterized by the predominance of brown rust (79.0 %), leaf blight (70,1 %), and Septoria (45.8 %). Powdery ...

  10. Optimization of callus induction and regeneration system for ...

    African Journals Online (AJOL)

    STORAGESEVER

    2009-10-19

    Oct 19, 2009 ... diseases of wheat are leaf rust, stem rust, loose smut and leaf blight that cause losses up to 50% of yield. The development of resistant cultivars appears to be the most effective and economical method for controlling the diseases. Therefore the genetic improvement of wheat has received considerable ...

  11. Pushing Wheat

    DEFF Research Database (Denmark)

    Sharp, Paul Richard

    This paper documents the evolution of variables central to understanding the creation of an Atlantic Economy in wheat between the US and the UK in the nineteenth century. The cointegrated VAR model is then applied to the period 1838-1913 in order to find long-run relationships between these varia......This paper documents the evolution of variables central to understanding the creation of an Atlantic Economy in wheat between the US and the UK in the nineteenth century. The cointegrated VAR model is then applied to the period 1838-1913 in order to find long-run relationships between...

  12. Field evaluation of durum wheat landraces for prevailing abiotic and biotic stresses in highland rainfed regions of Iran

    Directory of Open Access Journals (Sweden)

    Reza Mohammadi

    2015-10-01

    Full Text Available Biotic and abiotic stresses are major limiting factors for high crop productivity worldwide. A landrace collection consisting of 380 durum wheat (Triticum turgidum L. var. durum entries originating in several countries along with four check varieties were evaluated for biotic stresses: yellow rust (Puccinia striiformis Westendorf f. sp. tritici and wheat stem sawfly (WSS Cephus cinctus Norton (Hymenoptera: Cephidae, and abiotic stresses: cold and drought. The main objectives were to (i quantify phenotypic diversity and identify variation in the durum wheat landraces for the different stresses and (ii characterize the agronomic profiles of landraces in reaction to the stresses. Significant changes in reactions of landraces to stresses were observed. Landraces resistant to each stress were identified and agronomically characterized. Percentage reduction due to the stresses varied from 11.4% (yellow rust to 21.6% (cold stress for 1000-kernel weight (TKW and from 19.9 (yellow rust to 91.9% (cold stress for grain yield. Landraces from Asia and Europe showed enhanced genetic potential for both grain yield and cold tolerance under highland rainfed conditions of Iran. The findings showed that TKW and yield productivity could be used to assess the response of durum wheat landraces to different stresses. In conclusion, landraces showed high levels of resistance to both biotic and abiotic stresses, and selected landraces can serve in durum wheat breeding for adaptation to cold and drought-prone environments.

  13. Changing the game: using integrative genomics to probe virulence mechanisms of the stem rust pathogen Puccinia graminis f. sp. tritici

    Directory of Open Access Journals (Sweden)

    Melania eFigueroa

    2016-02-01

    Full Text Available The recent resurgence of wheat stem rust caused by new virulent races of Puccinia graminis f. sp. tritici (Pgt poses a threat to food security. These concerns have catalyzed an extensive global effort towards controlling this disease. Substantial research and breeding programs target the identification and introduction of new stem rust resistance (Sr genes in cultivars for genetic protection against the disease. Such resistance genes typically encode immune receptor proteins that recognize specific components of the pathogen, known as avirulence (Avr proteins. A significant drawback to deploying cultivars with single Sr genes is that they are often overcome by evolution of the pathogen to escape recognition through alterations in Avr genes. Thus, a key element in achieving durable rust control is the deployment of multiple effective Sr genes in combination, either through conventional breeding or transgenic approaches, to minimize the risk of resistance breakdown. In this situation, evolution of pathogen virulence would require simultaneous changes in multiple Avr genes in order to bypass recognition. However, choosing the optimal Sr gene combinations to deploy is a challenge that requires detailed knowledge of the pathogen Avr genes with which they interact and the virulence phenotypes of Pgt existing in nature. Identifying specific Avr genes from Pgt will provide screening tools to enhance pathogen virulence monitoring, assess heterozygosity and propensity for mutation in pathogen populations, and confirm individual Sr gene functions in crop varieties carrying multiple effective resistance genes. Towards this goal, much progress has been made in assembling a high quality reference genome sequence for Pgt, as well as a Pan-genome encompassing variation between multiple field isolates with diverse virulence spectra. In turn this has allowed prediction of Pgt effector gene candidates based on known features of Avr genes in other plant pathogens

  14. Two distinct Ras genes from Puccinia striiformis exhibit differential roles in rust pathogenicity and cell death.

    Science.gov (United States)

    Cheng, Yulin; Wang, Wumei; Yao, Juanni; Huang, Lili; Voegele, Ralf T; Wang, Xiaojie; Kang, Zhensheng

    2016-11-01

    Ras genes have been shown to regulate a variety of cellular processes in higher eukaryotes. However, much less is known about their function(s) in fungi, especially plant pathogenic fungi. Here, we report the identification and functional analysis of Ras genes from Puccinia striiformis f. sp. tritici (Pst), an important fungal pathogen in wheat production worldwide. Pst contains two Ras genes, PsRas1 and PsRas2, which share 48.6% similarity at the protein level and fall into two different phylogenetic clades. Both PsRas1 and PsRas2 have conserved protein sequences among different Pst isolates, but exhibit different transcript profiles during Pst infection. Silencing of PsRas1 or PsRas2 indicates that PsRas2 but not PsRas1 contributes significantly to rust pathogenicity. However, overexpression of PsRas1, but not PsRas2, promotes cell death in yeast and plants. Further studies show that all conserved domains of Ras GTPases in PsRas1 are needed to induce this cell death. In plants, PsRas1-triggered cell death shows similar characteristics as plant hypersensitive response. Our findings suggest that PsRas1 and PsRas2 take over different functions in rust pathogenicity and cell death, thus facilitating the understanding of cell death, pathogenic mechanisms of plant pathogenic fungi and the search for novel pathogen control strategies. © 2016 Society for Applied Microbiology and John Wiley & Sons Ltd.

  15. Coprecipitation of Arsenate and Arsenite with Green Rust Minerals

    Science.gov (United States)

    The objectives of this experiment were to evaluate the extent and nature of arsenic co-precipitation with green rusts and to examine the influence of arsenic incorporation on the mineralogy of formed solid phases. Stoichiometric green rusts were obtained by coprecipitation of fe...

  16. An economic evaluation of fusiform rust protection research

    Science.gov (United States)

    F.W. Cubbage; John M. Pye; T.P. Holmes; J.E. Wagner

    2000-01-01

    Fusiform rust is a widespread and damaging disease of loblolly pine (P. taeda) and slash pine (P. elliottii) in the South. Research has identified families of these pines with improved genetic resistance to the disease, allowing production and planting of resistant seedlings in areas at risk. This study compared the cost of fusiform rust research to the simulated...

  17. Interacting genes in the pine-fusiform rust forest pathosystem

    Science.gov (United States)

    H.V. Amerson; T.L. Kubisiak; S.A. Garcia; G.C. Kuhlman; C.D. Nelson; S.E. McKeand; T.J. Mullin; B. Li

    2005-01-01

    Fusiform rust (FR) disease of pines, caused by Cronartium quercuum f.sp. fusiforme (Cqf), is the most destructive disease in pine plantations of the southern U. S. The NCSU fusiform rust program, in conjunction with the USDA-Forest Service in Saucier, MS and Athens, GA, has research underway to elucidate some of the genetic interactions in this...

  18. Progress on introduction of rust resistance genes into confection sunflower

    Science.gov (United States)

    Sunflower rust (Puccinia helianthi) emerged as a serious disease in the last few years. Confection sunflower is particularly vulnerable to the disease due to the lack of resistance sources. The objectives of this project are to transfer rust resistance genes from oil sunflower to confectionery sunfl...

  19. Computer simulation of white pine blister rust epidemics

    Science.gov (United States)

    Geral I. McDonald; Raymond J. Hoff; William R. Wykoff

    1981-01-01

    A simulation of white pine blister rust is described in both word and mathematical models. The objective of this first generation simulation was to organize and analyze the available epidemiological knowledge to produce a foundation for integrated management of this destructive rust of 5-needle pines. Verification procedures and additional research needs are also...

  20. Genetic analysis of resistance to soybean rust disease | Kiryowa ...

    African Journals Online (AJOL)

    Soybean rust (Phakopsora pachyrhizi Sydow.) causes the most damage of all the pathogens known to attack soybean (Glycine max. Merril). A study was conducted in Uganda to estimate the magnitude of genetic parameters controlling soybean rust resistance and to estimate narrow sense heritability of the resistance.

  1. Effect of Low Temperature and Wheat Winter-Hardiness on Survival of Puccinia striiformis f. sp. tritici under Controlled Conditions.

    Directory of Open Access Journals (Sweden)

    Lijie Ma

    Full Text Available Wheat stripe rust, caused by Puccinia striiformis f. sp. tritici (Pst, is one of the most important diseases of wheat worldwide. Understanding the survival of Pst during the overwintering period is critical for predicting Pst epidemics in the spring. Real-time quantitative PCR (qPCR methods quantifying Pst DNA and RNA (cDNA were developed and compared for the ability to quantify viable Pst in leaf tissues. Both qPCR of DNA and RNA can provide reliable measurement of viable Pst in plant tissues prior to the late sporulation stage for which qPCR of DNA gave a much higher estimate of fungal biomass than qPCR of RNA. The percentage of Pst biomass that was viable in detached and attached leaves under low temperatures decreased over time. Pst survived longer on attached leaves than on detached leaves. The survival of Pst in cultivars with strong winter-hardiness at 0°C and -5°C was greater than those with weak winter-hardiness. However, such differences in Pst survival among cultivars were negligible at -10, -15 and -20°C. Results indicated that Pst mycelia inside green leaves can also be killed by low temperatures rather than through death of green leaves under low temperatures. The relationship of Pst survival in attached leaves with temperature and winter-hardiness was well described by logistic models. Further field evaluation is necessary to assess whether inclusion of other factors such as moisture and snow cover could improve the model performance in predicting Pst overwintering potential, and hence the epidemic in spring.

  2. Quantitative trait loci (QTLs) for resistance to gray leaf spot and ...

    African Journals Online (AJOL)

    Gray leaf spot and common rust diseases can greatly reduce grain yield of maize in susceptible genotypes by between 10 and 70% on average. Control of these diseases through conventional measures has been quite ineffective and difficult to sustain. The most feasible way to control them is by breeding and deploying ...

  3. Control of wheat diseases using phosphites and acibenzolar-s-methyl alone or associated with piraclostrobina + epoxiconazoleControle de doenças do trigo com fosfitos e acibenzolar-s-metil isoladamente ou associados a piraclostrobina + epoxiconazole

    Directory of Open Access Journals (Sweden)

    Olavio Correa Silva

    2011-07-01

    Full Text Available The objective of this study was to evaluate the effect of different sources of phosphite to control leaf rust, powdery mildew, yellow and brown spot in the wheat crop in Palmeira, Paraná state, Brazil. The treatments were: four commercial sources of phosphites (A, B, C and D, applied at 1500 mL ha-1, (applied in rate of active product acibenzolar-S-methyl (ASM at 500 mL ha-1 (isolad or association, pyraclostrobin + epoxiconazole (fungicide at 400 mL ha-1 and phosphite A with pyraclostrobin + epoxiconazole (at 300 mL ha-1, phosphite A with pyraclostrobin + epoxiconazole (400 mL ha-1, acibenzolar-S-methyl with pyraclostrobin + epoxiconazole (400 mL ha-1 and control (water, . The experimental design adopted was complete randomized blocks with four replications. Regarding diseases, evaluations were done on the determination of severity and the calculation of the area below the curve of the disease progress in the flag leaf and entire plant. Leaf area index, thousand seeds weight, hectoliter weight and yield were also evaluated. Phosphite, independently source, did not act on leaf rust, powdery mildew, yellow and brown spot. The resistance inducer acibenzolar-S-methyl either isolated or associated to other fungicides affected leaf rust and powdery mildew of the wheat. Only phosphites associated to the fungicide controlled diseases, however there was no additional increase in yield whether compared to the control promoted by the fungicide.Foi realizado um experimento no município de Palmeira-PR, visando avaliar o efeito de diferentes fontes de fosfitos no controle da ferrugem da folha, do oídio e das manchas amarela e marrom na cultura do trigo. Os tratamentos foram: quatro fontes comerciais de fosfitos (A, B, C e D aplicados na dose de 1500 mL ha-1 (dose de produto ativo isolado ou associado aos demais produtos, acibenzolar-S-metil (ASM na dose de 500 mL ha-1 (isolado ou associado, piraclostrobina + epoxiconazole (fungicida na dose de 500 mL ha-1

  4. Identification of genomic associations for adult plant resistance in the background of popular South Asian wheat cultivar, PBW343

    Directory of Open Access Journals (Sweden)

    Huihui Li

    2016-11-01

    Full Text Available Rusts, a fungal disease as old as its host plant wheat, an enemy as old as wheat, has caused havoc for over 8,000 years. As the rust pathogens can evolve into new virulent races which quickly defeat to qualitative or vertical the resistance that primarily rely on race specificity over time, adult plant resistance (APR has often been found to be race non-specific and hence is considered have been proven to be a more to be a more reliable and durable strategy to combat this malady. Over decades sets of donor lines have been identified at International Maize and Wheat Improvement Center (CIMMYT representing a wide range of APR sources in wheat. In this study, using nine donors and a common parent ‘PBW343’, a popular Green Revolution variety at CIMMYT, the nested association mapping (NAM population of 1122 lines was constructed to understand the APR genetics underlying these founder lines. Thirty-four QTL were associated with APR to rusts, and 20 of 34 QTL had pleiotropic effects on SR, YR and LR resistance. Three chromosomal regions, associated with known APR genes (Sr58/Yr29/Lr46, Sr2/Yr30/Lr27, and Sr57/Yr18/Lr34, were also identified, 13 previously reported QTL regions were validated. Of the 18 QTL first detected in this study, 7 were pleiotropic QTL, distributing on chromosomes 3A, 3B, 6B, 3D, and 6D. The present investigation revealed the genetic relationship of historical APR donor lines, the novel knowledge on APR, as well as the new analytical methodologies to facilitate the applications of NAM design in crop genetics. Results shown in this study will aid the parental selection for hybridization in wheat breeding, and envision the future rust management breeding for addressing potential threat to wheat production and food security.

  5. A greenhouse-based inoculation protocol for fungi causing crown rust and stem rust diseases of Kentucky bluegrass turf

    Science.gov (United States)

    Rusts are destructive fungal diseases that can cause severe thinning and unattractive discoloration of kentucky bluegrass (KBG; Poa pratensis L.). Currently, turfgrass breeding programs rely on field evaluations to screen KBG germplasm for rust resistance; methods that are expensive, labor intensive...

  6. Analyzing Genetic Diversity for Virulence and Resistance Phenotypes in Populations of Stem Rust (Puccinia graminis f. sp. secalis) and Winter Rye (Secale cereale).

    Science.gov (United States)

    Miedaner, Thomas; Schmitt, Ann-Kristin; Klocke, Bettina; Schmiedchen, Brigitta; Wilde, Peer; Spieß, Hartmut; Szabo, Lilla; Koch, Silvia; Flath, Kerstin

    2016-11-01

    Stem rust (Puccinia graminis f. sp. secalis) leads to considerable yield losses in rye-growing areas with continental climate, from Eastern Germany to Siberia. For implementing resistance breeding, it is of utmost importance to (i) analyze the diversity of stem rust populations in terms of pathotypes (= virulence combinations) and (ii) identify resistance sources in winter rye populations. We analyzed 323 single-uredinial isolates mainly collected from German rye-growing areas across 3 years for their avirulence/virulence on 15 rye inbred differentials. Out of these, 226 pathotypes were detected and only 56 pathotypes occurred more than once. This high diversity was confirmed by a Simpson index of 1.0, a high Shannon index (5.27), and an evenness index of 0.97. In parallel, we investigated stem rust resistance among and within 121 heterogeneous rye populations originating mainly from Russia, Poland, Austria, and the United States across 3 to 15 environments (location-year combinations). While German rye populations had an average stem rust severity of 49.7%, 23 nonadapted populations were significantly (P < 0.01) more resistant with a stem rust severity ranging from 3 to 40%. Out of these, two modern Russian breeding populations and two old Austrian landraces were the best harboring 32 to 70% fully resistant plants across 8 to 10 environments. These populations with the lowest disease severity in adult-plant stage in the field also displayed resistance in leaf segment tests. In conclusion, stem rust populations are highly diverse and the majority of resistances in rye populations seems to be race specific.

  7. A green method of diaphragm spring's anti-rusting with high quality and efficiency

    Science.gov (United States)

    Huang, Xinming; Hua, Wenlin

    2017-10-01

    This paper introduces a green method of diaphragm spring's anti-rusting, which is of high quality, high efficiency and low consumption. It transforms the phosphating way of anti-rusting to physical anti-rusting that directly coat anti-rusting oil on the surface of the spring, and transforms the manual-oiling or oil-immersion to fully-automatically ultrasonic oiling. Hence, this method will completely change the way of diaphgragm spring's anti-rusting.

  8. Aphid resistance in wheat varieties.

    Science.gov (United States)

    Elek, Henriett; Werner, Peter; Smart, Lesley; Gordon-Weeks, Ruth; Nádasy, Miklós; Pickett, John

    2009-01-01

    As an environmentally compatible alternative to the use of conventional insecticides to control cereal aphids, we have investigated the possibility to exploit natural resistance to insect pests in wheat varieties. We have tested a wide range of hexaploid (Triticum aestivum), tetraploid (T. durum) and diploid (T. boeoticum and T. monococcum) wheat lines for resistance to the bird cherry oat aphid (Rhopalosiphum padi). Lines tested included Russian wheat aphid (Diuraphis noxia), greenbug (Schizaphis graminum), hessian fly (Mayetiola destructor) and orange wheat blossom midge (Sitodiplosis mosellana) resistant varieties. Antixenosis and antibiosis were determined in the settling and fecundity tests respectively. Since hydroxamic acids (Hx), including the most generally active, 2,4-dihidroxy-7-methoxy-1,4-benzoxazin-3-one (DIMBOA), are biosynthesised in many cereal plants and are implicated in resistance against insects, leaf tissue was analysed for Hx and the glucosides from which they are produced. The hexaploid varieties, which contained relatively low levels of the DIMBOA glucoside, did not deter aphid feeding or reduce nymph production significantly. Reduced settlement and nymph production were recorded on the diploid varieties, but they contained no detectable level of the glucoside or the toxic aglucone.

  9. Rust fungi on Annonaceae: the genus Sphaerophragmium.

    Science.gov (United States)

    Beenken, Ludwig; Berndt, Reinhard

    2010-01-01

    Seven species of the rust genus Sphaerophragmium occur on members of the tropical plant family Annonaceae. Uropyxis gerstneri is recombined to S. gerstneri. A new species, S. xylopiae, is described from Xylopia acutiflora. The host plant of S. boanense is identified as Mitrella sp. Sphaerophragmium pulchrum is transferred to Dicheirinia. The anatomy of telia with teliospores and parasitizing mycelium is described and illustrated in detail. A new type of M-haustorium, which emanates laterally from intracellular hypha, is detected in S. monodorae. An identification key is given.

  10. Direct and indirect effects of chemical treatment against poplar rust attacks

    Directory of Open Access Journals (Sweden)

    Giorcelli A

    2012-06-01

    Full Text Available Some quantitative consequences of poplar rust attacks (Melampsora larici-populina and M. allii-populina were analysed, both in absence and in presence of some preventive chemical treatments. Their effectiveness was previously assessed only partially and without evaluations of plant behaviour in the following vegetative season. Three IBS systemic triazoles (tebuconazole, cyproconazole and epoxyconazole, the translaminar cytotropic mandipropamid and a mixture of cyproconazole and azoxystrobin (methoxyacrilate similar to strobilurines were tested on one-year plantlets of the susceptible clone ’€˜Neva’ (Populus ×canadensis. The products were sprayed twice in August 2010, the second treatment twenty days after the first one. The leaf area covered by uredinia was assessed in several dates from the beginning of August until the end of September, as well as the percentage of still living leaves on the plant (last ten days of October. In May 2011, the average leaf surface of side shoots close to the top of the crown and the Chlorophyll Content Index (CCI were measured. The tested fungicides dramatically reduced the infections, except mandipropamid which showed no effectiveness. Tebuconazole and cyproconazole, either alone or in mixture with azoxystrobin, have offered the best performance (at the end of September, less than 10% of leaf surface covered by uredinia vs. over 50% of the control and mandipropamid treatment, followed by epoxyconazole that is anyway satisfying (about 15% of surface covered by uredinia. The systemic properties of these fungicides allowed a preventive action on leaves sprouted after both of the treatments as well, thus uredinium eruption was limited to 20% of leaf surface instead 40% on the test thesis. The same effectiveness ranking was reiterated for the percentage of still living leaves on the plant at the end of October (about 45% vs. 4% of the control test and, during the following season, for the average leaf

  11. IAC 60 Centenário e IAC 162 Tuiuiú: cultivares de trigo para sequeiro e irrigado no Estado de São Paulo IAC 60 Centenário and IAC 162 Tuiuiú: wheat cultivars for upland and irrigated conditions in the State of São Paulo, Brazil

    Directory of Open Access Journals (Sweden)

    João Carlos Felício

    1991-01-01

    grain yield and reactions to the causal agents of leaf rust, blast, and leaf spot. Under greenhouse conditions, both cultivars were evaluated to the causal agent of the stem rust. Their industrial bread qualities were also assessed. In upland condition, using highly acid soils, the grain yield of the new cultivars did not differ from the cultivars BH 1146 and IAC 24. However, in upland conditions, but using soils with low acidity, there was no significant difference as compared to the control Anahuac. Under irrigation the cultivar IAC 60 and IAC 162 showed high grain yield, differing significantly of the controls BH 1146 and IAC 24. Considering the two regions, the cultivar IAC 60 showed moderate susceptibility to leaf spot, leaf rust and blast, while the cultivar IAC 162 exhibited resistance to leaf rust and blast, but susceptibility to leaf spot. Concerning their response to toxic aluminium, the cultivar IAC 60 was tolerant while IAC 162 showed moderate susceptibility. Both cultivars were moderately susceptible to iron toxicity and tolerant to manganese toxicity when they were tested in nutrient solutions with these elements. Considering bread characteristics trials, the new cultivars presented superior values in relation to the breads made with commercial flour. 'IAC 162' showed superior specific volume in comparison with 'IAC 60', but inferior in relation to intern (crumb and extern (crust characteristics.

  12. Genes for resistance to wheat powdery mildew in derivatives of Triticum Timopheevi and T. Carthlicum

    DEFF Research Database (Denmark)

    Jørgensen, Jørgen Helms; Jensen, C. J.

    1972-01-01

    and/or Ml designated genes; a temporary designation, Ml f ,is proposed for this gene. Gene Ml f is closely associated with a gene conditioning resistance to the stem rust fungus (Puccinia graminis f. sp. tritici), probably gene Sr9c. The winter wheat line TP 229 derived from Triticum carthlicum has......The winter wheat line TP 114 derived from CI 12633, a Triticum timopheevi derivative, has two unlinked dominant genes conditioning resistance to the powdery mildew fungus (Erysiphe graminis f. sp. tritici). One of the genes is identical to gene Pm2 (Ml u ). The other gene differs from the eleven Pm...

  13. Genome-wide identification of the SWEET gene family in wheat.

    Science.gov (United States)

    Gao, Yue; Wang, Zi Yuan; Kumar, Vikranth; Xu, Xiao Feng; Yuan, De Peng; Zhu, Xiao Feng; Li, Tian Ya; Jia, Baolei; Xuan, Yuan Hu

    2018-02-05

    The SWEET (sugars will eventually be exported transporter) family is a newly characterized group of sugar transporters. In plants, the key roles of SWEETs in phloem transport, nectar secretion, pollen nutrition, stress tolerance, and plant-pathogen interactions have been identified. SWEET family genes have been characterized in many plant species, but a comprehensive analysis of SWEET members has not yet been performed in wheat. Here, 59 wheat SWEETs (hereafter TaSWEETs) were identified through homology searches. Analyses of phylogenetic relationships, numbers of transmembrane helices (TMHs), gene structures, and motifs showed that TaSWEETs carrying 3-7 TMHs could be classified into four clades with 10 different types of motifs. Examination of the expression patterns of 18 SWEET genes revealed that a few are tissue-specific while most are ubiquitously expressed. In addition, the stem rust-mediated expression patterns of SWEET genes were monitored using a stem rust-susceptible cultivar, 'Little Club' (LC). The resulting data showed that the expression of five out of the 18 SWEETs tested was induced following inoculation. In conclusion, we provide the first comprehensive analysis of the wheat SWEET gene family. Information regarding the phylogenetic relationships, gene structures, and expression profiles of SWEET genes in different tissues and following stem rust disease inoculation will be useful in identifying the potential roles of SWEETs in specific developmental and pathogenic processes. Copyright © 2017 Elsevier B.V. All rights reserved.

  14. Incorporation of Monovalent Cations in Sulfate Green Rust

    DEFF Research Database (Denmark)

    Christiansen, B. C.; Dideriksen, K.; Katz, A.

    2014-01-01

    Green rust is a naturally occurring layered mixed-valent ferrous-ferric hydroxide, which can react with a range of redox-active compounds. Sulfate-bearing green rust is generally thought to have interlayers composed of sulfate and water. Here, we provide evidence that the interlayers also contain...... with water showed that Na+ and K+ were structurally fixed in the interlayer, whereas Rb+ and Cs+ could be removed, resulting in a decrease in the basal layer spacing. The incorporation of cations in the interlayer opens up new possibilities for the use of sulfate green rust for exchange reactions with both...

  15. Effects of Fungicide Treatment on Free Amino Acid Concentration and Acrylamide-Forming Potential in Wheat.

    Science.gov (United States)

    Curtis, Tanya Y; Powers, Stephen J; Halford, Nigel G

    2016-12-28

    Acrylamide forms from free asparagine and reducing sugars during frying, baking, roasting, or high-temperature processing, and cereal products are major contributors to dietary acrylamide intake. Free asparagine concentration is the determining factor for acrylamide-forming potential in cereals, and this study investigated the effect of fungicide application on free asparagine accumulation in wheat grain. Free amino acid concentrations were measured in flour from 47 varieties of wheat grown in a field trial in 2011-2012. The wheat had been supplied with nitrogen and sulfur and treated with growth regulators and fungicides. Acrylamide formation was measured after the flour had been heated at 180 °C for 20 min. Flour was also analyzed from 24 (of the 47) varieties grown in adjacent plots that were treated in identical fashion except that no fungicide was applied, resulting in visible infection by Septoria tritici, yellow rust, and brown rust. Free asparagine concentration in the fungicide-treated wheat ranged from 1.596 to 3.987 mmol kg(-1), with a significant (p acids apart from cysteine and ornithine. There was also a significant (p acid concentration also increased, whereas free glutamic acid concentration increased in some varieties but decreased in others, and free proline concentration decreased. The study showed disease control by fungicide application to be an important crop management measure for mitigating the problem of acrylamide formation in wheat products.

  16. trategies for durum wheat fertilization

    Directory of Open Access Journals (Sweden)

    L. Plescuta

    2016-06-01

    Full Text Available Abstract. Durum wheat (Tr. durum Desf. ranks second in the world cereal production after common wheat. It differs from the other species with its high grain protein content, especially with gluten quality, which makes it suitable for producing spaghetti, macaroni, semolina flour and other products for the food industry. The purpose of this review was to summarize the results obtained in Bulgaria and in the world on the impact of mineral fertilization on yield and quality of durum wheat. All authors confirm that a significant increase of the grain yield in the last decades was achieved by both using new varieties and through optimal fertilization. Nitrogen as a nutrient is of great importance for wheat productivity. Nitrogen fertilization leads to stronger increase of leaf area, dry matter accumulation, content of protein and gluten. Accumulated nitrogen and phosphorus depend mainly on the formed dry matter. At low nitrogen rates yield increased at higher phosphorus level. Suppressant effect of high nitrogen and phosphorus rates on growth and development is emphasized in richer soil. A number of authors have found genotypic specificity regarding grain yield in dependence on the level of fertilization. Problems of genetically determined and improved grain quality under different durum wheat varieties are the subject of extensive research. The opinions of all authors are one-way for the positive influence of fertilization and in particular nitrogen on the technological quality parameters – protein content, wet and dry gluten, vitreoussness, carotenoids pigment, although the values vary significantly. The influence of fertilization is insignificant on the test weight.

  17. A review of wheat diseases - a field perspective.

    Science.gov (United States)

    Figueroa, Melania; Hammond-Kosack, Kim E; Solomon, Peter S

    2017-10-18

    Wheat is one of the primary staple foods throughout the planet. Significant yield gains in wheat production over the past 40 years have resulted in a steady balance of supply versus demand. However, predicted global population growth rates and dietary changes necessitate substantial yield gains over the next several decades to meet this escalating demand. A key component to meeting this challenge is better management of fungal incited diseases, which can be responsible for 15-20% yield losses per annum. Prominent diseases of wheat that currently contribute to these losses include the rusts, the blotches and head blight/scab. Other recently emerged or relatively unnoticed diseases like wheat blast and spot blotch, respectively, also threaten grain production. This review seeks to provide an overview of the impact, distribution and management strategies of these diseases. Also, the biology of the pathogens and the molecular basis of their interaction with wheat are discussed. This article is protected by copyright. All rights reserved. © 2017 BSPP and John Wiley & Sons Ltd.

  18. Orange rust in sugarcane: molecular identification in Rio de Janeiro State

    Directory of Open Access Journals (Sweden)

    Carla Vanessa Borges Castro

    2013-09-01

    Full Text Available Sugarcane (Saccharum spp. cultivation is one of the major agricultural activities in the Brazilian states. This study aimed to molecularly identify the pathogen associated with rust in sugarcane cultivars in the state of Rio de Janeiro and to suggest a control strategy. Among the 14 PCR-tested cultivars, Puccinia kuehnii infection was identified for RB947520, RB92606, RB835486, RB72454, SP89-11I5, SP83-2847, both from infected leaf sample and from urediniospores. Puccinia kuehnii was not detected by PCR for the cultivars RB955971, RB951541, RB92579, RB867515, RB855536, SP91-1049, SP80-3280, SP80-1816. This is the first molecular detection of this fungus in the state of Rio de Janeiro for six of the 14 analyzed cultivars.

  19. RESEARCH ON THE RUST FUNGI DURING THE TWENTIETH CENTURY.

    Science.gov (United States)

    Staples, Richard C.

    2000-01-01

    Interest in the rust fungi derives from their success as plant pathogens. For example, the epidemic on coffee had serious economic and social impacts on diverse cultures. During the century, research on the rust germling shifted from a study of germling development, including a search for the signals that induce differentiation, to an examination of the genes expressed during host colonization. Research on host resistance was most influenced by Stakman, who studied the genetics and epidemiology of rust disease. His innovations enabled Flor to propose the gene-for-gene hypothesis, a concept that stimulated development of resistant crops, and led to research that gradually shifted during the century to an examination of the molecular basis of rust genetics.

  20. Transcriptome pathways unique to dehydration tolerant relatives of modern wheat

    OpenAIRE

    Ergen, Zahide Neslihan; Thimmapuram, Jyothi; Bohnert, Hans J; Budak, Hikmet

    2009-01-01

    Among abiotic stressors, drought is a major factor responsible for dramatic yield loss in agriculture. In order to reveal differences in global expression profiles of drought tolerant and sensitive wild emmer wheat genotypes, a previously deployed shock-like dehydration process was utilized to compare transcriptomes at two time points in root and leaf tissues using the Affymetrix GeneChip(R) Wheat Genome Array hybridization. The comparison of transcriptomes reveal several unique genes or expr...

  1. Cytogenetics and immature embryo culture at Embrapa Trigo breeding program: transfer of disease resistance from related species by artificial resynthesis of hexaploid wheat (Triticum aestivum L. em. Thell

    Directory of Open Access Journals (Sweden)

    Maria Irene Baggio de Moraes Fernandes

    2000-12-01

    to facilitate gene flow between wheat and related species. Since the environment at the center of origin of wheat in Southern Asia is quite different from subtropical environments, Brazilian breeding programs overcome more challenges to adapt wheat crop to biotic and abiotic stresses than some other countries. The germplasm bank of Embrapa Trigo has about 1000 registered entries of Triticum relatives, Aegilops, Secale and Agropyron species supplied from several germplasm banks distributed over the world which were multiplied and/or selected for naturally occurring or artificially inoculated fungal diseases. Since Aegilops squarrosa L. entries showed very good performance, the genetic variability observed in this species was firstly exploited. It is reported here the strategy used for transferring useful genes from Ae. squarrosa (DD, 2n = 14: crossing with tetraploid species (AABB, 2n = 28, rescue and in vitro culture of immature embryos for regeneration of the trihaploid (ABD, 2n = 21 hybrid, and colchicine treatment for genome duplication resulting in the artificial synthesis of hexaploid wheat lines (AABBDD, 2n = 42. Results of 10,739 artificial pollinations involving 28 cross combinations amongst eight T. durum L., T. dicoccum and T. cartlicum tetraploid entries used as female parents and ten selected Ae. squarrosa sources of resistance as male parents are presented here. Immature embryos from 18 cross combinations were recovered and cultured in vitro. Green plantlets from 13 combinations were regenerated. Fertile amphiploids were recovered only from crosses among entries of tetraploid T. durum and diploid Ae. squarrosa. They originated 11 fertile synthetic amphiploid lines from seven different combinations. Useful stem and leaf rust as well as powdery mildew resistance for future use in breeding programs were obtained.

  2. Moessbauer Characterization of Rust Obtained in an Accelerated Corrosion Test

    Energy Technology Data Exchange (ETDEWEB)

    Garcia, K. E.; Morales, A. L.; Arroyave, C. E.; Barrero, C. A. [Universidad de Antioquia, Grupo de Corrosion y Proteccion, Departamento de Ingenieria de Materiales (Colombia); Cook, D. C. [Old Dominion University, Department of Physics (United States)

    2003-06-15

    We have performed drying-humectation cyclical processes (CEBELCOR) on eight A36 low carbon steel coupons in NaCl solutions containing 1x10{sup -2} M and 1x10{sup -1} M concentrations. The main purpose of these experiments is to contribute to the understanding of the conditions for akaganeite formation. Additionally, and with the idea to perform a complete characterization of the rust, this work also considers the formation of other iron oxide phases. The corrosion products were characterized by Moessbauer spectroscopy and X-ray diffraction techniques. Gravimetric analysis demonstrates that the coupons presented high corrosion rates. Magnetite/maghemite was common in the rust stuck to the steel surface, whereas akaganeite was present only in traces. In the rust collected from the solutions, i.e., the rust that goes away from the metal surface easily, a magnetite/maghemite was not present and akaganeite showed up in larger quantities. These results support the idea that high concentrations of Cl{sup -} ions are required for the akaganeite formation. We concluded that akaganeite is not easily bonded to the rust layer; this may lead to the formation of a less protective rust layer and to higher corrosion rates.

  3. The Potential of Lr19 and Bdv2 Translocations to Improve Yield and Disease Resistance in the High Rainfall Wheat Zones of Australia

    Directory of Open Access Journals (Sweden)

    Garry Rosewarne

    2015-02-01

    Full Text Available Chromosomal translocations in wheat derived from alien species are a valuable source of genetic diversity that have provided increases in resistance to various diseases and improved tolerance to abiotic stresses in wheat. These alien genomic segments can also affect multiple traits, with a concomitant ability to alter yield potential in either a positive or negative fashion. The aim of this work was to characterize the effects on yield of two types of translocations, namely T4-derived translocations from Thinopyrum ponticum, carrying the leaf rust resistance gene Lr19, and the TC14 translocation from Th. intermedium, carrying the barley yellow dwarf virus resistance gene Bdv2, in Australian adapted genetic backgrounds and under Australian conditions. A large range of germplasm was developed by crossing donor sources of the translocations into 24 Australian adapted varieties producing 340 genotypes. Yield trials were conducted in 14 environments to identify effects on yield and yield components. The T4 translocations had a positive effect on yield in one high yielding environment, but negatively affected yield in low-yielding environments. The TC14 translocation was generally benign, however, it was associated with a negative impact on yield and reduced height in two genetic backgrounds. The translocation was also associated with a delayed maturity in several backgrounds. The T4 translocations results were consistent with previously published data, whilst this is the first time that such an investigation has been undertaken on the TC14 translocation. Our data suggests a limited role for each of these translocations in Australia. The T4 translocations may be useful in high yielding environments, such as under irrigation in NSW and in the more productive high rainfall regions of south-eastern Australia. Traits associated with the TC14 translocation, such as BYDV resistance and delayed maturity, would make this translocation useful in BYDV

  4. Tocantins (IAC-23 e Tucuruí (IAC-24: novos cultivares de trigo Tocantins (IAC-23 and Tucuruí (IAC-24: new wheat cultivars

    Directory of Open Access Journals (Sweden)

    João Carlos Felício

    1988-01-01

    Full Text Available Os cultivares de trigo Tocantins (IAC-23 e Tucuruí (IAC-24, provenientes de cruzamentos artificiais e obtidos por seleção pelo método genealógico, foram avaliados quanto à produtividade de grãos e às reações aos agentes causais das ferrugens-do-colmo e da-folha na região do Vale do Paranapanema, SP, em condição de sequeiro e, no caso do 'Tucuruí', com a utilização de irrigação por aspersão, na região Norte (SP. Esses cultivares foram avaliados também em relação às qualidades industriais de panificação. As produções médias de grãos de ambos não se apresentaram estatisticamente diferentes da produção da testemunha 'Anahuac', em condição de sequeiro. O 'Tucuruí' superou estatisticamente, em produção, o 'Anahuac' em solos com porcentagem de saturação por bases inferior a 60%, com irrigação, apresentando uma produtividade média de 2.842 kg/ha contra 2.421 kg/ha. O 'Tucuruí', de estatura semi-anã, apresentou-se tolerante à presença de 10 mg/litro de Al3+ e o 'Tocantins', de porte alto, exibiu sensibilidade à concentração de 6 mg/litro de Al3+, ambos em solução nutritiva. Os novos cultivares apresentaram moderada suscetibilidade à ferrugem-da-folha e baixos níveis de infecção para a ferrugem-do-colmo, bem próximos aos apresentados pelo 'Anahuac'. Nos ensaios de panificação, a farinha do 'Tucuruí', de maneira geral, propiciou pães de excelente qualidade física, com volume específico bastante superior à farinha de trigo comercial e levemente superior à do 'Tocantins'.The wheat cultivars Tocantins (IAC-23 and Tucuruí (IAC-24 were obtained by hybridization and screened by the pedigree method from the segregating generations. These genotypes were evaluated for grain yield and resistance to stem and leaf rusts in several experiments carried out in different locations, with and without irrigation, in the State of São Paulo, Brazil, in the period 1980-85. They were also evaluated in relation to

  5. Relationship between the specific surface area of rust and the electrochemical behavior of rusted steel in a wet-dry acid corrosion environment

    Science.gov (United States)

    Liu, Wei; Zhao, Qing-he; Li, Shuan-zhu

    2017-01-01

    The relationship between the specific surface area (SSA) of rust and the electrochemical behavior of rusted steel under wet-dry acid corrosion conditions was investigated. The results showed that the corrosion current density first increased and then decreased with increasing SSA of the rust during the corrosion process. The structure of the rust changed from single-layer to double-layer, and the γ-FeOOH content decreased in the inner layer of the rust with increasing corrosion time; by contrast, the γ-FeOOH content in the outer layer was constant. When the SSA of the rust was lower than the critical SSA corresponding to the relative humidity during the drying period, condensed water in the micropores of the rust could evaporate, which prompted the diffusion of O2 into the rust and the following formation process of γ-FeOOH, leading to an increase of corrosion current density with increasing corrosion time. However, when the SSA of the rust reached or exceeded the critical SSA, condensate water in the micro-pores of the inner layer of the rust could not evaporate which inhibited the diffusion of O2 and decreased the γ-FeOOH content in the inner rust, leading to a decrease of corrosion current density with increasing corrosion time.

  6. Effects of Controlled Release Fertilizer on the Flag Leaves Senescence in Dry-land Wheat

    OpenAIRE

    Dandan Liu; Yan Shi

    2013-01-01

    In order to select a reasonable controlled release fertilizer application method to slow down the senescence of flag leaf in dry-land wheat. The effects of controlled release fertilizer on soluble protein content, MDA content, the Catalase (CAT) activity, the Superoxide Dismutase (SOD) activity on the flag leaves senescence in dry-land wheat had been studied in the open field with the variety wheat Jimai22. The results indicated that, the combination application of controlled release fertiliz...

  7. Avaliação agronômica e de qualidade tecnológica de genótipos de trigo com irrigação por aspersão no estado de São Paulo Evaluation of agronomic and technological quality of wheat genotypes under sprinkler irrigation in the State of São Paulo

    Directory of Open Access Journals (Sweden)

    João Carlos Felício

    1996-01-01

    Full Text Available Em experimentos com irrigação por aspersão instalados em diferentes zonas tritícolas paulistas, avaliaram-se a produtividade de grãos, as reações aos agentes causais de ferrugem-da-folha, de oídio e de helmintosporiose e a qualidade tecnológica da farinha de dezesseis genótipos de trigo em 1991-93. O genótipo TUI"S" apresentou melhor produtividade e boa adaptação nas diferentes zonas estudadas. Destacaram-se também o IAC 289, IAC 335, IAC 338, IAC 286 e IAC 60. As zonas D (Tatuí e C (Paranapanema apresentaram, respectivamente, a maior e a menor produção, diferindo significativamente entre si. A ocorrência da mancha foliar, causada por Helmínthosporium sp., e do oídio foi generalizada em todas as zonas no decorrer do período. De acordo com os parâmetros físicos, químicos e reológicos, os genótipos IAC 24, IAC 315, IAC 334, TUI"S" e IAC 339 apresentaram farinha de qualidade superior (forte, enquanto a dos genótipos 79-218 e NS.55.58/PJN"S" foi considerada de baixa qualidade (fraca.From 1991 to 1993, sixteen wheat genotypes were evaluated in experiments carried out at the different wheat regions of the State of São Paulo, Brazil, under sprinkler irrigation. Grain yield, reactions to the causal agents of leaf rust, powdery mildew and leaf spots and the flour technological quality were evaluated. The genotype TUI"S" presented high productivity and good adaptation at the different studied wheat regions. The genotypes IAC 289, IAC 335, IAC 338, IAC 286 and IAC 60 also showed good performance. The wheat region D (Tatuf exhibited the highest grain yield, differing significantly from the region C (Paranapanema, which presented the lowest grain yield. The occurrence of leaf spots, caused by Helminthosporium sp. and powdery mildew were generalized in all regions during the considered period. Taking into account the physical, chemical and rheologic parameters, the genotypes IAC 24, IAC 315, IAC 334, TUI"S" and IAC 339 presented

  8. Effect of intercropping normal-leafed or semi-leafless winter peas and triticale after shallow and deep ploughing on agronomic performance, grain quality and succeeding winter wheat yield

    OpenAIRE

    Gronle, Annkathrin; Heß, Jürgen; Böhm, Herwart

    2015-01-01

    Winter peas (Pisum sativum L.) are a promising alternative to spring peas in organic farming. Intercroppingwinter peas and cereals may be a beneficial way to improve lodging resistance in normal-leafed andweed suppression in semi-leafless winter peas. At the same time, there is an increasing interest in areduction in tillage intensity, e.g. shallow ploughing. A normal-leafed, coloured-flowered (cv. E.F.B. 33)and a semi-leafless, white-flowered winter pea (cv. James) were cultivated as sole cr...

  9. Quantifying the non-fungicidal effects of foliar applications of fluxapyroxad (Xemium) on stomatal conductance, water use efficiency and yield in winter wheat.

    Science.gov (United States)

    Smith, J; Grimmer, M; Waterhouse, S; Paveley, N

    2013-01-01

    The active ingredient fluxapyroxad belongs to the chemical group of carboxamides and is a new generation succinate dehydrogenase inhibitor (SDHI) in complex II of the mitochondrial respiratory chain. It has strong efficacy against the key foliar diseases of winter wheat in the UK: Septoria leaf blotch, yellow stripe rust and brown rust. Fluxapyroxad is marketed under the brand name of Xemium, was launched in 2012 and is available in the UK as a solo product (Imtrex) for co-application with triazoles, in co-formulation with epoxiconazole (Adexar), or in a three way formulation with epoxiconazole and pyraclostrobin (Ceriax). The objective of the study was to quantify the direct effects of Xemium on stomatal conductance and yield, mediated through stimulation of host physiology. Three field experiments and two controlled environment (CE) experiments were conducted across three cropping seasons (2010-2012) in Herefordshire and Cambridge, in the UK. Xemium was evaluated against boscalid, pyraclostrobin (F500), epoxiconazole and an untreated control. Across site-seasons, disease severity was significantly reduced when Xemium was applied as a foliar spray. Healthy canopy size and duration was increased by Xemium and canopy greening effects were seen shortly after application. Stomatal conductance was found to be consistently lower in Xemium treated plants but reduced stomatal opening was not found to be detrimental to yield in these experiments. Large, beneficial effects of Xemium on water use efficiency were found at the canopy level and this finding was supported by measurements of instantaneous water use efficiency at the leaf level. Effects on season long water use efficiency were largely driven by improvements in yield for a given amount of water uptake. Foliar applications of Xemium reduced the water required to produce 1.0 t grain per hectare by 82,330 L(82 t) when compared with an untreated crop. Yield was significantly higher in Xemium treatments and this was

  10. Genetic analysis and location of gene for resistance to stripe rust in ...

    Indian Academy of Sciences (India)

    2013-08-06

    yellow) rust. It is very important to clarify its genetic character of resistance to stripe rust and to develop the molecular markers linked to resistance genes. The NIL Taichung. 29*6/Strubes Dickkopf, which was obtained by ...

  11. Project LEAF

    Science.gov (United States)

    Project LEAF has a goal of educating farmworkers about how to reduce pesticide exposure to their families from pesticide residues they may be inadvertently taking home on their clothing, etc. Find outreach materials.

  12. Variation in Susceptibility to Wheat dwarf virus among Wild and Domesticated Wheat

    Science.gov (United States)

    Nygren, Jim; Shad, Nadeem; Kvarnheden, Anders; Westerbergh, Anna

    2015-01-01

    We investigated the variation in plant response in host-pathogen interactions between wild (Aegilops spp., Triticum spp.) and domesticated wheat (Triticum spp.) and Wheat dwarf virus (WDV). The distribution of WDV and its wild host species overlaps in Western Asia in the Fertile Crescent, suggesting a coevolutionary relationship. Bread wheat originates from a natural hybridization between wild emmer wheat (carrying the A and B genomes) and the wild D genome donor Aegilops tauschii, followed by polyploidization and domestication. We studied whether the strong selection during these evolutionary processes, leading to genetic bottlenecks, may have resulted in a loss of resistance in domesticated wheat. In addition, we investigated whether putative fluctuations in intensity of selection imposed on the host-pathogen interactions have resulted in a variation in susceptibility to WDV. To test our hypotheses we evaluated eighteen wild and domesticated wheat taxa, directly or indirectly involved in wheat evolution, for traits associated with WDV disease such as leaf chlorosis, different growth traits and WDV content. The plants were exposed to viruliferous leafhoppers (Psammotettix alienus) in a greenhouse trial and evaluated at two time points. We found three different plant response patterns: i) continuous reduction in growth over time, ii) weak response at an early stage of plant development but a much stronger response at a later stage, and iii) remission of symptoms over time. Variation in susceptibility may be explained by differences in the intensity of natural selection, shaping the coevolutionary interaction between WDV and the wild relatives. However, genetic bottlenecks during wheat evolution have not had a strong impact on WDV resistance. Further, this study indicates that the variation in susceptibility may be associated with the genome type and that the ancestor Ae. tauschii may be useful as genetic resource for the improvement of WDV resistance in wheat. PMID

  13. Wheat Productivity Estimates Using LANDSAT Data. [Finney, Kansas

    Science.gov (United States)

    Nalepka, R. F.; Colwell, J. (Principal Investigator)

    1975-01-01

    The author has identified the following significant results. The biological leaf area index data show that there can be large variations in field vegetative condition from point to point. This is especially true in flood-irrigated fields, in which plant density (and development) varies drastically between rows that are in channels vs. those that are in raised areas. Considerable care must be used in interpreting the significance of isolated leaf area index measurements made from a single wheat row.

  14. Community composition of target vs. non-target fungi in fungicide treated wheat

    DEFF Research Database (Denmark)

    Knorr, Kamilla; Jørgensen, Lise Nistrup; Justesen, Annemarie Fejer

    2012-01-01

    Fungicide treatments are common control strategies used to manage fungal pathogens in agricultural fields, however, effects of treatments on the composition of total fungal communities, including non-target fungi, in the phyllosphere is not well known. Yellow rust (Puccinia striiformis) is a common...... of three fungicides. The fungal composition in bulked leaf samples and individual leaves was studied by deep amplicon 454 pyrosequencing targeting the internal transcribed spacer-1 (ITS1) region of the ribosomal DNA. Amount of yellow rust in individual samples was quantified by qPCR. Pyrosequencing...... resulted in 179,081 sequences from bulked leaf samples and 91,182 sequences from individual leaves excluding low quality sequences and singletons; in total 270,263 sequences clustering into 1operational taxonomic units (OTUs). Three different treatment regimens with two of the fungicides resulted...

  15. Duplications and losses in gene families of rust pathogens highlight putative effectors

    Science.gov (United States)

    Amanda L. Pendleton; Katherine E. Smith; Nicolas Feau; Francis M. Martin; Igor V. Grigoriev; Richard Hamelin; C.Dana Nelson; J.Gordon Burleigh; John M. Davis

    2014-01-01

    Rust fungi are a group of fungal pathogens that cause some of the world’s most destructive diseases of trees and crops . A shared characteristic among rust fungi is obligate biotrophy, the inability to complete a lifecycle without a host. This dependence on a host species likely affects patterns of gene expansion, contraction, and innovation within rust pathogen...

  16. Melhoramento do trigo: XXIX. Avaliação de linhagens da espécie Triticum durum L. no estado de São Paulo Wheat breeding: XXIX. Evaluation of Triticum durum L. inbred lines for the state of São Paulo, Brazil

    Directory of Open Access Journals (Sweden)

    Carlos Eduardo de Oliveira Camargo

    1995-01-01

    Full Text Available Compararam-se 23 linhagens de trigo duro (Triticum durum L. e dois cultivares de trigo (T. aestivum L., em 16 ensaios, tanto em condição de irrigação por aspersão como de sequeiro, analisando-se a produção de grãos, componentes da produção e resistência às doenças. As linhagens de trigo duro L3 (Gallareta "S", L4 (Yavaros "S", L12 [CI 14955 x (Yavaros "S" x Gediz] x Tropic Bird e L19 {{[(61150 x Leeds x Gallo "S"] x Garza "S"} x Mexicali "S"} x S15, resistentes às ferrugens-do-colmo e da-folha, suscetíveis ao oídio e à mancha foliar, de porte baixo (com exceção da L12, de ciclo precoce, destacaram-se quanto à produção de grãos, em solos com baixa acidez, não diferindo dos cultivares de trigo IAC-60 e IAC-24, os mais cultivados atualmente no Estado de São Paulo. A linhagem de trigo duro L22 (Sacaba-81 apresentou-se, ao mesmo tempo, imune ao agente causal das ferrugens-do-colmo e da-folha e moderadamente resistente ao de oídio. Todos os genótipos estudados foram suscetíveis ao agente causal das manchas foliares. A linhagem de trigo duro L3 mostrou ser fonte genética para grande número de grãos por espiga e por espigueta; os cultivares de trigo IAC-60 e IAC-24 possuem genes para maior comprimento da espiga e número de espiguetas por espiga; as linhagens de trigo duro L14 (Gediz "S" x Cocorit-71 e L19 têm genes para grãos mais pesados.Twenty-three durum wheat (Triticum durum L. inbred lines and two bread wheat (T. aestivum L. cultivars were evaluated in sixteen trials carried out under sprinkler irrigation and in upland conditions, taking into account the grain yield, yield components and disease resistance. The durum wheat lines L3 (Gallareta"S", L4 (Yavaros "S", L12 [CI 14955 x (Yavaros "S" x Gediz "S"] x Tropic Bird and L19 {{[61150 x Leeds x Gallo "S"}x Garza "S"} x Mexicali "S"} x S15 presented resistance to stem and leaf rusts, susceptibility to powdery mildew and leaf spot, short stature (with exception of

  17. Cytosolic activation of cell death and stem rust resistance by cereal MLA-family CC-NLR proteins.

    Science.gov (United States)

    Cesari, Stella; Moore, John; Chen, Chunhong; Webb, Daryl; Periyannan, Sambasivam; Mago, Rohit; Bernoux, Maud; Lagudah, Evans S; Dodds, Peter N

    2016-09-06

    Plants possess intracellular immune receptors designated "nucleotide-binding domain and leucine-rich repeat" (NLR) proteins that translate pathogen-specific recognition into disease-resistance signaling. The wheat immune receptors Sr33 and Sr50 belong to the class of coiled-coil (CC) NLRs. They confer resistance against a broad spectrum of field isolates of Puccinia graminis f. sp. tritici, including the Ug99 lineage, and are homologs of the barley powdery mildew-resistance protein MLA10. Here, we show that, similarly to MLA10, the Sr33 and Sr50 CC domains are sufficient to induce cell death in Nicotiana benthamiana Autoactive CC domains and full-length Sr33 and Sr50 proteins self-associate in planta In contrast, truncated CC domains equivalent in size to an MLA10 fragment for which a crystal structure was previously determined fail to induce cell death and do not self-associate. Mutations in the truncated region also abolish self-association and cell-death signaling. Analysis of Sr33 and Sr50 CC domains fused to YFP and either nuclear localization or nuclear export signals in N benthamiana showed that cell-death induction occurs in the cytosol. In stable transgenic wheat plants, full-length Sr33 proteins targeted to the cytosol provided rust resistance, whereas nuclear-targeted Sr33 was not functional. These data are consistent with CC-mediated induction of both cell-death signaling and stem rust resistance in the cytosolic compartment, whereas previous research had suggested that MLA10-mediated cell-death and disease resistance signaling occur independently, in the cytosol and nucleus, respectively.

  18. Proteomics of wheat flour

    Science.gov (United States)

    Wheat is a major food crop grown on more than 215 million hectares of land throughout the world. Wheat flour provides an important source of protein for human nutrition and is used as a principal ingredient in a wide range of food products, largely because wheat flour, when mixed with water, has un...

  19. Wheat and gluten intolerance

    NARCIS (Netherlands)

    Busink-van den Broeck, Hetty; Gilissen, L.J.W.J.; Brouns, F.

    2016-01-01

    With this White Paper, the current state of scientific knowledge on human disorders related to gluten and wheat is presented, with reference to other grains such as spelt, barley, rye, and oats. Backgrounds are described of coeliac disease (gluten intolerance), wheat allergies and any kind of wheat

  20. Use of some chemical inducers to improve wheat resistance to Puccinia striiformis f. Sp. Tritici

    Directory of Open Access Journals (Sweden)

    Al-Maaroof Emad

    2014-01-01

    Full Text Available The effect of DL-β-aminobutyric acid (BABA, benzothiadiazole (BTH, indoleacetic acid (IAA and salicylic acid (SA on induced systemic resistance was investigated in moderately susceptible and susceptible wheat genotypes Tamuz-2 and AL-8/70 against Puccinia striiformis f. sp. tritici. Resistance was characterized by reduced infection of yellow rust disease (Yrd. Changes in peroxidase, phenylalanine ammonia-lyase activities and in total phenolic compound content demonstrated that the resistance to Puccinia striiformis can be induced by BABA, BTH, IAA and SA in these two wheat genotypes. Further studies are needed before a practical method using many analogue compounds, such as potassium phosphate and biotic agent for Yrd resistance in wheat is developed.

  1. use of' disease assessment methods in predicting

    African Journals Online (AJOL)

    A multip1e œgœssion model to esfimaæ the contribution of leaves and the effect of leaf rust on yie1d of winter wheat. Phylopathalogy 79: 1233»1238. Seck, M.. Roelfs, A.P. and Teng, P.S. 1991. Influence of leaf position on yield loss caused by wheat leaf rust in single tillers. Cmp. Protection 10:222—228. Uüsüup, A.J. 1970.

  2. Quantification and Gene Expression Analysis of Histone Deacetylases in Common Bean during Rust Fungal Inoculation.

    Science.gov (United States)

    Melmaiee, Kalpalatha; Kalavacharla, Venu Kal; Brown, Adrianne; Todd, Antonette; Thurston, Yaqoob; Elavarthi, Sathya

    2015-01-01

    Histone deacetylases (HDACs) play an important role in plant growth, development, and defense processes and are one of the primary causes of epigenetic modifications in a genome. There was only one study reported on epigenetic modifications of the important legume crop, common bean, and its interaction with the fungal rust pathogen Uromyces appendiculatus prior to this project. We measured the total active HDACs levels in leaf tissues and observed expression patterns for the selected HDAC genes at 0, 12, and 84 hours after inoculation in mock inoculated and inoculated plants. Colorimetric analysis showed that the total amount of HDACs present in the leaf tissue decreased at 12 hours in inoculated plants compared to mock inoculated control plants. Gene expression analyses indicated that the expression pattern of gene PvSRT1 is similar to the trend of total active HDACs in this time course experiment. Gene PvHDA6 showed increased expression in the inoculated plants during the time points measured. This is one of the first attempts to study expression levels of HDACs in economically important legumes in the context of plant pathogen interactions. Findings from our study will be helpful to understand trends of total active HDACs and expression patterns of these genes under study during biotic stress.

  3. Quantification and Gene Expression Analysis of Histone Deacetylases in Common Bean during Rust Fungal Inoculation

    Directory of Open Access Journals (Sweden)

    Kalpalatha Melmaiee

    2015-01-01

    Full Text Available Histone deacetylases (HDACs play an important role in plant growth, development, and defense processes and are one of the primary causes of epigenetic modifications in a genome. There was only one study reported on epigenetic modifications of the important legume crop, common bean, and its interaction with the fungal rust pathogen Uromyces appendiculatus prior to this project. We measured the total active HDACs levels in leaf tissues and observed expression patterns for the selected HDAC genes at 0, 12, and 84 hours after inoculation in mock inoculated and inoculated plants. Colorimetric analysis showed that the total amount of HDACs present in the leaf tissue decreased at 12 hours in inoculated plants compared to mock inoculated control plants. Gene expression analyses indicated that the expression pattern of gene PvSRT1 is similar to the trend of total active HDACs in this time course experiment. Gene PvHDA6 showed increased expression in the inoculated plants during the time points measured. This is one of the first attempts to study expression levels of HDACs in economically important legumes in the context of plant pathogen interactions. Findings from our study will be helpful to understand trends of total active HDACs and expression patterns of these genes under study during biotic stress.

  4. Sources of sulphur in rain collected below a wheat canopy

    Energy Technology Data Exchange (ETDEWEB)

    Raybould, C.C.; Unsworth, M.H.; Gregory, P.J.

    1977-05-12

    The quantity of sulfur in rain collected below a maturing wheat canopy was measured. The measurement and calculations show that leaching of plant sulfur by rain was the main source of additional sulfur in throughfall and that most sulfur dry-deposited on leaf surfaces remained fixed there.

  5. Weather and Climate Indicators for Coffee Rust Disease

    Science.gov (United States)

    Georgiou, S.; Imbach, P. A.; Avelino, J.; Anzueto, F.; del Carmen Calderón, G.

    2014-12-01

    Coffee rust is a disease that has significant impacts on the livelihoods of those who are dependent on the Central American coffee sector. Our investigation has focussed on the weather and climate indicators that favoured the high incidence of coffee rust disease in Central America in 2012 by assessing daily temperature and precipitation data available from 81 weather stations in the INSIVUMEH and ANACAFE networks located in Guatemala. The temperature data were interpolated to determine the corresponding daily data at 1250 farms located across Guatemala, between 400 and 1800 m elevation. Additionally, CHIRPS five day (pentad) data has been used to assess the anomalies between the 2012 and the climatological average precipitation data at farm locations. The weather conditions in 2012 displayed considerable variations from the climatological data. In general the minimum daily temperatures were higher than the corresponding climatology while the maximum temperatures were lower. As a result, the daily diurnal temperature range was generally lower than the corresponding climatological range, leading to an increased number of days where the temperatures fell within the optimal range for either influencing the susceptibility of the coffee plants to coffee rust development during the dry season, or for the development of lesions on the coffee leaves during the wet season. The coffee rust latency period was probably shortened as a result, and farms at high altitudes were impacted due to these increases in minimum temperature. Factors taken into consideration in developing indicators for coffee rust development include: the diurnal temperature range, altitude, the environmental lapse rate and the phenology. We will present the results of our study and discuss the potential for each of the derived weather and climatological indicators to be used within risk assessments and to eventually be considered for use within an early warning system for coffee rust disease.

  6. The development of quick, robust, quantitative phenotypic assays for describing the host-nonhost landscape to stripe rust.

    Science.gov (United States)

    Dawson, Andrew M; Bettgenhaeuser, Jan; Gardiner, Matthew; Green, Phon; Hernández-Pinzón, Inmaculada; Hubbard, Amelia; Moscou, Matthew J

    2015-01-01

    Nonhost resistance is often conceptualized as a qualitative separation from host resistance. Classification into these two states is generally facile, as they fail to fully describe the range of states that exist in the transition from host to nonhost. This poses a problem when studying pathosystems that cannot be classified as either host or nonhost due to their intermediate status relative to these two extremes. In this study, we investigate the efficacy of the Poaceae-stripe rust (Puccinia striiformis Westend.) interaction for describing the host-nonhost landscape. First, using barley (Hordeum vulgare L.) and Brachypodium distachyon (L.) P. Beauv. We observed that macroscopic symptoms of chlorosis and leaf browning were associated with hyphal colonization by P. striiformis f. sp. tritici, respectively. This prompted us to adapt a protocol for visualizing fungal structures into a phenotypic assay that estimates the percent of leaf colonized. Use of this assay in intermediate host and intermediate nonhost systems found the frequency of infection decreases with evolutionary divergence from the host species. Similarly, we observed that the pathogen's ability to complete its life cycle decreased faster than its ability to colonize leaf tissue, with no incidence of pustules observed in the intermediate nonhost system and significantly reduced pustule formation in the intermediate host system as compared to the host system, barley-P. striiformis f. sp. hordei. By leveraging the stripe rust pathosystem in conjunction with macroscopic and microscopic phenotypic assays, we now hope to dissect the genetic architecture of intermediate host and intermediate nonhost resistance using structured populations in barley and B. distachyon.

  7. Variation in chromosome constitution of the Xiaoyan series partial amphiploids and its relations to stripe rust and stem rust resistance

    Science.gov (United States)

    In the tertiary gene pool of wheat, tall wheatgrass Thinopyrum ponticum (2n = 10x = 70) is an excellent source of resistance genes against numerous wheat diseases. The creation of wheat-Th. ponticum partial amphiploids is an intermediate step for transferring the useful genes from Th. ponticum to w...

  8. Maracaí (IAC 17 e Xavantes (IAC 18: cultivares de trigo para o estado de São Paulo Maracaí (IAC 17 and Xavantes (IAC 18: wheat cultivars (Triticum aestivum L. For the State of São Paulo, Brazil

    Directory of Open Access Journals (Sweden)

    João Carlos Felício

    1983-01-01

    Full Text Available Foram analisados em experimentos localizados nas principais regiões tritícolas do Estado de São Paulo, a produtividade e as reações aos agentes da ferrugem-do-colmo(³ e ferrugem-da-folha, bem como as qualidades de panificação de dois novos cultivares de trigo, Maracaí (IAC 17 e Xavantes (IAC 18, provenientes de cruzamentos artificiais realizados no Instituto Agronômico e obtidos por seleção através do método de genealogia, comparados com os cultivares BH-1146 e IAC 5. Considerando a média de produção de grãos nos anos estudados, o 'Xavantes' foi superior estatisticamente 10 e 14% pelo teste de Duncan a 5% em relação, respectivamente, aos cultivares BH 1146 e IAC 5, utilizados como controles. O 'Maracaí' não apresentou diferença estatística significativa com relação as testemunhas: Relativamente à ferrugem-do-colmo (Puccinia graminis f. sp. tritici, os cultivares apresentaram, nos anos estudados, graus de infecção inferiores aos registrados sobre a testemunha BH 1146. O 'Maracaí' apresentou resistência a um maior número de raças do patógeno ocorrentes em nossas condições. O comportamento desses cultivares com relação à ferrugem-da-folha (P. recondita assemelhou-se às testemunhas com infecções de campo consideradas médias. Nos ensaios de panificação, os dois cultivares evidenciarem valores próximos, apresentando o Xavantes leve superioridade em algumas características, porém ambos demonstraram fraca capacidade panificadora quando comparados ao cultivar padrão Tobari 66.The new cultivars Maracaí (IAC 17 and Xavantes (IAC 18 were selected in the wheat breeding program conducted at Instituto Agronômico. They were studied in the main wheat area of the State of São Paulo, compared with the commercial cultivars BH-1146 and IAC 5, in relation to yield, reactions to stem and leaf rusts and to bread quality. The results showed that the cultivar Xavantes yielded 10% and 14% more than BH-1146 and IAC 5

  9. Towards a generic architectural model of tillering in Gramineae, as exemplified by spring wheat (Triticum aestivum L.)

    NARCIS (Netherlands)

    Evers, J.B.; Vos, J.; Fournier, C.; Andrieu, B.; Chelle, M.; Struik, P.C.

    2005-01-01

    This paper presents an architectural model of wheat (Triticum aestivum), designed to explain effects of light conditions at the individual leaf level on tillering kinetics. Various model variables, including blade length and curvature, were parameterized for spring wheat, and compared with winter

  10. The influence of nitrogen supply on the ability of wheat and potato to suppress Stellaria media growth and reproduction

    NARCIS (Netherlands)

    Delden, van A.; Lotz, L.A.P.; Bastiaans, L.; Franke, A.C.; Smid, H.G.; Groeneveld, R.M.W.; Kropff, M.J.

    2002-01-01

    This paper tests the hypothesis that increased soil nitrogen supply reduces the growth of late-emerging weeds in wheat and potato by enhancing canopy leaf area development and thereby reducing the availability of light for weed growth. Two series of experiments were conducted: one in spring wheat

  11. The effect of neem ( Azadirachta indica ) leaf meal on the growth ...

    African Journals Online (AJOL)

    Azadirachta indica) leaf meal on the growth performance and carcass traits of broiler chickens. The neem leaf meal was used in replacing parts of wheat offal in the diets of 192 day-old broiler chickens fed ad libitum at 0.1, 0.2 and 0.3% levels of ...

  12. Melhoramento do trigo: XXI. Avaliação de linhagens em diferentes regiões paulistas Wheat breeding: XXI. Evaluation of inbred lines in different regions of the state of São Paulo, Brazil

    Directory of Open Access Journals (Sweden)

    Carlos Eduardo de Oliveira Camargo

    1989-01-01

    the Instituto Agronômico from the wheat breeding program plus the cultivars BH-1146 and Alondra-S-46 were evaluated in field experiments carried out at Campinas Experiment Center, Capão Bonito and Tietê Experiment Stations, and at two farms located in the Paranapanema Valley, during the period 1984-86. Grain yield, plant height, number of days from emergence to flowering and from emergence to maturation, percentage of lodged plants, head length, number of grain per spike and per spikelet, number of spikelets per spike, weight of 100 grains, and resistance to stem and leaf rusts were evaluated under field conditions. The resistance to stem and leaf rusts was tested in the greenhouse, and tolerance to aluminum toxicity was tested in the laboratory. Considering the experiments carried out at Capão Bonito the line 19 presented good productivity showing moderate resistance to Helminthosporium sp. and high tolerance to aluminum toxicity. This line was early in maturity and exhibited tall type of plant but it was resistant to lodging. The cultivars BH-1146 and the line 16 showed high grain yield at the Paranapanema Valley. The line 16 presented a semidwarf type, early maturity, field resistance to leaf rust, resistance to lodging and tolerance to Al toxicity. At Tietê the line 16 showed high productivity. There were no differences among the lines at Campinas. The lines 1, 3, 9, 10, 11, 15, 16, 22, 23 and the cultivars Alondra-S-46 exhibited semidwarf type when compared to the tall cultivars BH-1146. The lines 9, 10, 11 and the cultivars Alondra-S-46 were resistant to stem rust, presenting at seedling stage, resistance to six races under greenhouse conditions. The lines 11, 16, 18 and the cultivars BH-1146 presented low levels of the leaf rust from natural infection out in the field. The line 7 with long heads, the lines 7 and 8 with large number of spikelets per spike, the line 2 presenting high head fertility and the line 21 exhibiting heavy grains were considered as

  13. White pines, Ribes, and blister rust: a review and synthesis

    Science.gov (United States)

    Brian W. Geils; Kim E. Hummer; Richard S. Hunt

    2010-01-01

    For over a century, white pine blister rust (Cronartium ribicola) has linked white pines (Strobus) with currants and gooseberries (Ribes) in a complex and serious disease epidemic in Asia, Europe, and North America. Because of ongoing changes in climate, societal demands for forests and their amenities, and scientific advances in genetics and proteomics, our current...

  14. Resistance of three interspecific white pine hybrids to blister rust

    Science.gov (United States)

    R. Z. Callaham

    1962-01-01

    Three white pine hybrids exposed to infection by white pine blister rust (Cronartium ribicola Fischer) since 1946 have inherited the relative resistance of their parental species. The hybrids were produced from controlled pollinations in 1940 and 1941 at the Institute of Forest Genetics, Placerville, Calif. Twelve seedlings of each hybrid were...

  15. Control of Bean Rust using Antibiotics Produced by Bacillus and ...

    African Journals Online (AJOL)

    Antibiotic culture filtrates produced by Bacillus (CA5) and Streptomyces spp. were tested for translocation and persistence when applied on snap beans inoculated with rust (Uromyces appendiculatus) in greenhouse pot experiments. The antibiotics were applied on the first trifoliate leaves and translocation was assessed as ...

  16. Identification of pathogen avirulencegenes in the fusiform rust pathosystem

    Science.gov (United States)

    John M. Davis; Katherine E. Smith; Amanda Pendleton; Jason A. Smith; C. Dana Nelson

    2012-01-01

    The Cronartium quercuum f.sp. fusiforme (Cqf) whole genome sequencing project will enable identification of avirulence genes in the most devastating pine fungal pathogen in the southeastern United States. Amerson and colleagues (unpublished) have mapped nine fusiform rust resistance genes in loblolly pine,...

  17. Control of Bean Rust using Antibiotics Produced by Bacillus and ...

    African Journals Online (AJOL)

    MICHAEL

    ABSTRACT: Antibiotic culture filtrates produced by Bacillus (CA5) and Streptomyces spp. were tested for translocation and persistence when applied on snap beans inoculated with rust (Uromyces appendiculatus) in greenhouse pot experiments. The antibiotics were applied on the first trifoliate leaves and translocation was ...

  18. Reductive and sorptive properties of sulfate green rust (GRSO4)

    DEFF Research Database (Denmark)

    Nedel, Sorin

    The Fe(II), Fe(III) hydroxide containing sulfate in its structure, called sulfate green rust (GRSO4), can effectively reduce and convert contaminants to less mobile and less toxic forms. However, the ability of GRSO4 to remove positively charged species from solution, via sorption, is very limited...

  19. Association of Faba Bean Rust ( Uromyces viciae-fabae ) with ...

    African Journals Online (AJOL)

    ... stage and field management practices. The mean incidence of the disease varied from 44.6% in Bedeno to 98% in Tullo, while severity of the disease varied from 12.7% in Bedeno to 65% in Gorogutu and Kurfachale districts. Logistic regression analysis for the association of rust incidence and severity with environmental ...

  20. Blister rust control in the management of western white pine

    Science.gov (United States)

    Kenneth P. Davis; Virgil D. Moss

    1940-01-01

    The forest industry of the western white pine region depends on the production of white pine as a major species on about 2,670,000 acres of commercial forest land. Continued production of this species and maintenance of the forest industry at anything approaching its present level is impossible unless the white pine blister rust is controlled. Existing merchantable...