Dietary beta-1,3 glucan potentiates innate immunity and disease resistance of Asian catfish, Clarias batrachus (L.).

Science.gov (United States)

Kumari, J; Sahoo, P K

2006-02-01

This study investigated the effects of short and prolonged administration of a yeast beta-glucan on non-specific immune parameters, growth rate and the disease resistance of Asian catfish, Clarias batrachus. Fish fed with a basal diet (control) and test diet (basal diet supplemented with 0.1% glucan) for 1, 2 and 3 weeks were assayed for superoxide production, serum myeloperoxidase (MPO) content, natural haemagglutinin level, complement and lysozyme activities. Fish were weighed at weekly intervals and specific growth rate (SGR, % increase in body weight per day) was determined. After each week, fish were challenged with Aeromonas hydrophila to measure the level of protection. Results showed that glucan administration at 0.1% in feed, significantly (Pcomplement activity and SGR were not affected by the dietary supplementation of yeast glucan. As glucan feeding at 0.1% for 1 week is able to enhance the non-specific immunity and disease resistance of catfish efficiently, short-term feeding might be used in farmed catfish diets to enhance disease resistance.

beta. -1,4-glucan occurring in homogenate of Phaseolus aureus seedlings. Possible nascent stage of cellulose biosynthesis in vivo

Energy Technology Data Exchange (ETDEWEB)

Satoh, S; Matsuda, K; Tamari, K

1976-12-01

A small amount of cytoplasmic ..beta..-1,4-glucan, which might be involved in the synthesis of cellulose in the cell wall, was found in the homogenate prepared from the hypocotyls of seedlings of Phaseolus aureus. Upon hydrolysis by cellulase of the 20,000xg pellet from the cytoplasmic fraction of segments incubated in a (/sup 14/C)-glucose solution, (/sup 14/C)-cellobiose was produced, with specific radioactivities 3 to 10 times greater than those of the cellobiose from cellulose in the cell wall at various incubation periods. The incoporation of radioactivity from (/sup 14/C)-glucose into this cytoplasmic ..beta..-1,4-glucan was therefore faster than that into cellulose constituting the cell wall. Hence, it seemed that the former ..beta..-1,4-glucan could be turned over. To examine whether the cytoplasmic ..beta..-1,4-glucan is carried by some subcellular components, cytoplasmic ..beta..-1,4-glucan in the cell was fractionated by differential centrifugation, two enzyme activities being measured as the markers of subcellular components. The distribution of ..beta..-1,4-glucan was similar to that of UDPG-glucosyl-transferase activity but not to that of IDP-ase activity. The result suggests that the cytoplasmic ..beta..-1,4-glucan has some relation to plasma membranes. Coumarin, known as a specific inhibitor for the biosynthesis of cellulose in plant cells, was shown to inhibit the incorporation of radio-carbon from (/sup 14/C)-glucose into cytoplasmic ..beta..-1,4-glucan to the same extent as that into cellulose in the cell wall of the hypocotyls.

Beta Glucan Production from Two Strains of Agrobacterium sp in Medium Containing of Molases and Uracil Combine

Directory of Open Access Journals (Sweden)

KUSMIATI

2007-04-01

Full Text Available Production of β-glucan by Agrobacterium sp is influenced by the composition of nutrition in the fermentation media. Molases has been used successfully by others in the fermentation media of S. cerevisiae to increase the yield of -glucan, and similarly, uracil has been used in the fermentation media of Agrobacterium sp to increase the yield of -glucan. Investigations to increase the yield of -glucan by two strains of Agrobacterium sp, i.e. A1.5 (reference and B4.4 (local strain, have been carried out by addition of various combination of molases and uracil into fermentation media, i.e. 5%(v/v molase-0,05%(b/v uracil; 5% molase-0,025% uracil; 10% molase-0,05% uracil; and 10% molase-0,025% uracil. The β-1,3-glucan and β-1,2-glucan fractions were separated by extraction method. Beta-glucan concentration was determined as the glucose monomer using the phenol-sulphate spectrophotometric method at 490 nm. The protein content was determined by a modified Lowry-spectrophotometric method at 750 nm. The results showed that all combination of molases and uracil in the fermentation media of Agrobacterium sp A1.5 and B4.4 strains have increased both the dry-weight yield of β-glucan (crude and the β¬glucan content, with the highest was in a medium containing 10% molases-0,025% uracil combination. In the above medium, the A1.5 strain produced the highest β-glucan (7,5% with the lowest protein content ( 8,4% in the β-1,3-glucan fraction, while the β-glucan content in the β-1,2-glucan fraction were all lower than in the control media, while the protein content were all higher than in the control media. In the above media, the B4.4 strain produced the highest β-glucan, 7,2% in the β-1,3-glucan fraction, and 13,1% in β-1,2-glucan fraction, while the lowest protein content ( 8,4% was in the β-1,3-glucan fraction. In conclusion, fermentation media of Agrobacterium sp A1.5 strain or B4.4 strain containing molase and uracil combination have increased both

Combined effects of added beta glucan and black tea in breads on starch functionality.

Science.gov (United States)

Jalil, Abbe Maleyki M; Edwards, Christine A; Combet, Emilie; Ibrahim, Muhammad; Garcia, Ada L

2015-03-01

Bread and tea are usually consumed separately, but there may be different food-matrix interactions and changes in starch characteristics when they are combined in bread. This study developed breads (white bread, WF; black tea, BT; beta glucan, βG; beta glucan plus black tea, βGBT) and determined their starch functionalities. Breads were developed using a standard baking recipe and determined their starch characteristics. There was no significant difference in starch hydrolysis between BT and WF but βGBT reduced early (10 min) starch hydrolysis compared with βG. The starch granules in βG and βGBT were elliptical and closely packed together. These results suggest that the addition of beta glucan and black tea to bread preserved the elliptical starch granules and lowered short-term starch hydrolysis.

Dietary (1-->3), (1-->4)-beta-D-glucans from oat activate nuclear factor-kappaB in intestinal leukocytes and enterocytes from mice

NARCIS (Netherlands)

Volman, Julia J.; Mensink, Ronald P.; Ramakers, Julian D.; de Winther, Menno P.; Carlsen, Harald; Blomhoff, Rune; Buurman, Wim A.; Plat, Jogchum

2010-01-01

Dietary components, like beta-glucans, can modulate the intestinal immune response. We previously showed that fecal water enriched with oat beta-glucan stimulated the cytokine-induced immune response of enterocytes. It is, however, unclear whether beta-glucans activate nuclear factor-kappaB

Monitoring total endotoxin and (1 --> 3)-beta-D-glucan at the air exhaust of concentrated animal feeding operations.

Science.gov (United States)

Yang, Xufei; Wang, Xinlei; Zhang, Yuanhui; Lee, Jongmin; Su, Jingwei; Gates, Richard S

2013-10-01

Mitigation of bioaerosol emissions from concentrated animal feeding operations (CAFOs) demands knowledge of bioaerosol concentrations feeding into an end-of-pipe air treatment process. The aim of this preliminary study was to measure total endotoxin and (1 --> 3)-beta-glucan concentrations at the air exhaust of 18 commercial CAFOs and to examine their variability with animal operation type (swine farrowing, swine gestation, swine weaning, swine finishing, manure belt laying hen, and tom turkey) and season (cold, mild, and hot). The measured airborne concentrations of total endotoxin ranged from 98 to 23,157 endotoxin units (EU)/m3, and the airborne concentrations of total (1 --> 3)-beta-D-glucan ranged from 2.4 to 537.9 ng/m3. Animal operation type in this study had a significant effect on airborne concentrations of total endotoxin and (1 --> 3)-beta-D-glucan but no significant effect on their concentrations in total suspended particulate (TSP). Both endotoxin and (1 --> 3)-beta-D-glucan attained their highest airborne concentrations in visited tom turkey buildings. Comparatively, season had no significant effect on airborne concentrations of total endotoxin or (1 --> 3)-beta-D-glucan. Endotoxin and (1 --> 3)-beta-glucan concentrations in TSP dust appeared to increase as the weather became warmer, and this seasonal effect was significant in swine buildings. Elevated indoor temperatures in the hot season were considered to facilitate the growth and propagation of bacteria and fungi, thus leading to higher biocomponent concentrations in TSP.

Composição centesimal e teor de beta-glucanas em cereais e derivados Nutrient profile and beta-glucans content in cereal seeds and foodstuffs contain them

Directory of Open Access Journals (Sweden)

Alexandre H. Fujita

2003-08-01

Full Text Available Foi utilizado o método enzimático recomendado pela AOAC para determinação de beta-glucanas em cereais e alimentos que os contém. O método, utiliza liquenase (EC 3.2.1.73 e beta-glucosidase (EC 3.2.1.21 para hidrólise debeta-glucanas, é rápido, fácil de executar e específico para beta-glucanas com ligações beta(1->3 e beta(1->4. As sementes analisadas foram subministradas pelo Instituto Agronômico de Campinas (IAC e os alimentos adquiridos nos supermercados. Aveia e cevada são os grãos com maior conteúdo de beta-glucanas. Na aveia os teores determinados foram 6,48 e 5,94%. Nos 10 cultivares de cevada os teores de beta-glucanas oscilaram entre 2,04 e 9,68%. Trigo e triticale apresentaram teores de b-glucanas menores que 1%. Nos produtos comerciais o teor de beta-glucanas estava relacionado ao tipo de cereal da fórmula. O produto comercial de maior conteúdo de beta-glucanas é o farelo de aveia. As beta-glucanas são ingredientes funcionais em potencial e a conveniência ou não de estimular sua incorporação em alimentos deve ser mais estudada. Quanto à composição centesimal dos grãos de cereais, o teor de proteínas foi o que apresentou a maior variação e isso se reflete na composição dos produtos comerciais.The method employed was the enzymatic one recommended by de AOAC for the determination of beta-glucans in cereals and in foodstuffs containing cereals in their formulation. The method, using lichenase (EC 3.2.1.73 and beta-glucosidase (EC 3.2.1.21 for the hydrolysis of beta-glucans, is quick and easy to execute, but is specific for beta-glucans with beta(1->3 and beta(1->4 bonds. The Agronomic Institute of Campinas (IAC supplied the seeds analyzed, and the foodstuffs were acquired in supermarkets. Oat and barley are the grains with the highest content of beta-glucans. In the oats, the determined values were 6.48 and 5.94%. In the 10 cultivars of barley, the content of beta-glucans varied between 2.04 and 9

Beta 1,3/1,6-glucan and vitamin C immunostimulate the non-specific immune response of white shrimp (Litopenaeus vannamei).

Science.gov (United States)

Wu, Yu-Sheng; Liau, Shu-Yu; Huang, Cheng-Ting; Nan, Fan-Hua

2016-10-01

This study mainly evaluated the effects of orally administered beta 1,3/1,6-glucan and vitamin C on the nonspecific immune responses of white shrimp (Litopenaeus vannamei). In this study, we found that the white shrimp oral administration with 1 g/kg of beta 1,3/1,6-glucan effectively enhanced O2(-) production and phenoloxidase and superoxide dismutase activity. Shrimp were oral administration with 0.2 g/kg of vitamin C presented beneficial nonspecific immune responses and enzyme activity and also observed in the beta 1,3/1,6-glucan treatment groups. Consequently, we compared the alterations in the immune activity between the beta 1,3/1,6-glucan and vitamin C groups and the evidence illustrated that combination of beta 1,3/1,6-glucan and vitamin C presented an additive effect on inducing the nonspecific immune responses of white shrimp. Copyright © 2016 Elsevier Ltd. All rights reserved.

High plasma concentration of beta-D-glucan after administration of sizofiran for cervical cancer

Directory of Open Access Journals (Sweden)

Hirokazu Tokuyasu

2010-09-01

Full Text Available Hirokazu Tokuyasu1, Kenichi Takeda1, Yuji Kawasaki1, Yasuto Sakaguchi2, Noritaka Isowa2, Eiji Shimizu3, Yasuto Ueda31Divisions of Respiratory Medicine, 2Thoracic Surgery, Matsue Red Cross Hospital, 200 Horomachi, Matsue, Shimane; 3Division of Medical Oncology and Molecular Respirology, Department of Multidisciplinary Internal Medicine, Faculty of Medicine, Tottori University, Yonago, JapanAbstract: A 69-year-old woman with a history of cervical cancer was admitted to our hospital for further investigation of abnormal shadows on her chest roentgenogram. Histologic examination of transbronchial lung biopsy specimens revealed epithelioid cell granuloma, and Mycobacterium intracellulare was detected in the bronchial lavage fluid. The plasma level of (1→3-beta-D-glucan was very high, and this elevated level was attributed to administration of sizofiran for treatment of cervical cancer 18 years previously. Therefore, in patients with cervical cancer, it is important to confirm whether or not sizofiran has been administered before measuring (1→3-beta-D-glucan levels.Keywords: (1→3-beta-D-glucan, cervical cancer, Mycobacterium intracellulare, sizofiran

Quantitative assessment of the effects of beta-glucan consumption on serum lipid profile and glucose level in hypercholesterolemic subjects.

Science.gov (United States)

Zhu, X; Sun, X; Wang, M; Zhang, C; Cao, Y; Mo, G; Liang, J; Zhu, S

2015-08-01

A growing body of evidence suggests that beta-glucan derived from oats or barley can reduce cardiovascular disease risk through reductions in serum lipids. However, the effects of beta-glucan on lipid changes in hypercholesterolemic patient groups are inconsistent. The objective of this study was to identify and quantify the effect of beta-glucan, a marker of water-soluble fiber, on various lipid parameters and glucose level in hypercholesterolemic subjects. We performed a comprehensive literature search to identify the relevant randomized controlled trials (RCTs) that investigated the effects of beta-glucan consumption in hypercholesterolemic subjects. Mean differences (MDs) and 95% confidence intervals (CIs) were calculated for net changes in lipid concentrations by using fixed-effects or random-effects models according to heterogeneity. Publication bias, sensitivity analysis and subgroup analyses were also performed. Seventeen eligible RCTs with 916 subjects were included in the meta-analysis. The pooled result showed that beta-glucan consumption in hypercholesterolemic population significantly lowered the total cholesterol (TC) (MD, -0.26 mmol/L; 95% CI, -0.33 to -0.18; P consumption significantly decreased TC and LDL-cholesterol concentrations but did not affect TG, HDL-cholesterol, and glucose concentrations in hypercholesterolemic subjects. Copyright © 2015 Elsevier B.V. All rights reserved.

A Multifunctional Bread Rich in Beta Glucans and Low in Starch Improves Metabolic Control in Type 2 Diabetes: A Controlled Trial.

Science.gov (United States)

Tessari, Paolo; Lante, Anna

2017-03-17

Functional foods may be useful for people with diabetes. The soluble fibers beta glucans can modify starch digestion and improve postprandial glucose response. We analyzed the metabolic effects of a specifically designed 'functional' bread, low in starch, rich in fibers (7 g/100 g), with a beta glucan/starch ratio of (7.6:100, g/g), in people with type 2 diabetes mellitus. Methods : Clinical and metabolic data from two groups of age-, sex- and glycated hemoglobin-matched diabetic subjects, taking either the functional bread or regular white bread, over a roughly six-month observation period, were retrieved. Bread intake did not change during the trial. The functional bread reduced glycated hemoglobin by ~0.5% (absolute units) vs. pre-treatment values ( p = 0.028), and by ~0.6% vs. the control group ( p = 0.027). Post-prandial and mean plasma glucose was decreased in the treatment group too. Body weight, blood pressure and plasma lipids did not change. The acceptance of the functional bread was good in the majority of subjects, except for taste. A starch-restricted, fiber-rich functional bread, with an increased beta glucan/starch ratio, improved long term metabolic control, and may be indicated in the dietary treatment of type 2 diabetes.

A Multifunctional Bread Rich in Beta Glucans and Low in Starch Improves Metabolic Control in Type 2 Diabetes: A Controlled Trial

Science.gov (United States)

Tessari, Paolo; Lante, Anna

2017-01-01

Design: Functional foods may be useful for people with diabetes. The soluble fibers beta glucans can modify starch digestion and improve postprandial glucose response. We analyzed the metabolic effects of a specifically designed ‘functional’ bread, low in starch, rich in fibers (7 g/100 g), with a beta glucan/starch ratio of (7.6:100, g/g), in people with type 2 diabetes mellitus. Methods: Clinical and metabolic data from two groups of age-, sex- and glycated hemoglobin-matched diabetic subjects, taking either the functional bread or regular white bread, over a roughly six-month observation period, were retrieved. Results: Bread intake did not change during the trial. The functional bread reduced glycated hemoglobin by ~0.5% (absolute units) vs. pre-treatment values (p = 0.028), and by ~0.6% vs. the control group (p = 0.027). Post-prandial and mean plasma glucose was decreased in the treatment group too. Body weight, blood pressure and plasma lipids did not change. The acceptance of the functional bread was good in the majority of subjects, except for taste. Conclusions: A starch-restricted, fiber-rich functional bread, with an increased beta glucan/starch ratio, improved long term metabolic control, and may be indicated in the dietary treatment of type 2 diabetes. PMID:28304350

Oral beta-glucan adjuvant therapy converts nonprotective Th2 response to protective Th1 cell-mediated immune response in mammary tumor-bearing mice.

Directory of Open Access Journals (Sweden)

Gordon D Ross

2007-06-01

Full Text Available Beta (1-3-D-glucans were identified almost 40 years ago as biological response modifiers that stimulated tumor rejection. In vitro studies have shown that beta-glucans bind to a lectin domain within complement receptor type 3 (CR3, or to, more recently described dectin-1 a beta-glucan specific receptor, acting mainly on phagocytic cells. In this study, we assessed the intracellular cytokine profiles of peripheral blood lymphocytes from mice bearing mammary tumors receiving i.v. anti-tumor mAbs combined or not with whole glucan particle suspension given orally (WGP, 400 microg every 24 hours. The proportions of T cells producing IL-4 and IFNgamma were determined by flow cytometry. The proportion of T cells producing IL-4 was significantly higher in tumor-bearing mice not receiving beta-glucan-enhanced therapy. Conversely, T cells from mice undergoing beta-glucan-enhanced therapy showed increased production of the Th1 cytokine IFNgamma. The switch from a Th2 to a Th1 response after WGP therapy was possibly mediated by intestinal mucosal macrophages releasing IL-12.

Exercise and Beta-Glucan Consumption (Saccharomyces cerevisiae) Improve the Metabolic Profile and Reduce the Atherogenic Index in Type 2 Diabetic Rats (HFD/STZ).

Science.gov (United States)

Andrade, Eric Francelino; Lima, Andressa Ribeiro Veiga; Nunes, Ingrid Edwiges; Orlando, Débora Ribeiro; Gondim, Paula Novato; Zangeronimo, Márcio Gilberto; Alves, Fernando Henrique Ferrari; Pereira, Luciano José

2016-12-17

Physical activity and the ingestion of dietary fiber are non-drug alternatives commonly used as adjuvants to glycemic control in diabetic individuals. Among these fibers, we can highlight beta-glucans. However, few studies have compared isolated and synergic effects of physical exercise and beta-glucan ingestion, especially in type 2 diabetic rats. Therefore, we evaluated the effects beta-glucan ( Saccharomyces cerevisiae ) consumption, associated or not to exercise, on metabolic parameters of diabetic Wistar rats. The diabetes mellitus (DM) was induced by high-fat diet (HFD) associated with a low dose of streptozotocin (STZ-35 mg/kg). Trained groups were submitted to eight weeks of exercise in aquatic environment. In the last 28 days of experiment, animals received 30 mg/kg/day of beta-glucan by gavage. Isolated use of beta-glucan decreased glucose levels in fasting, Glycated hemoglobin (HbA1c), triglycerides (TAG), total cholesterol (TC), low-density lipoprotein (LDL-C), the atherogenic index of plasma. Exercise alone also decreased blood glucose levels, HbA1c, and renal lesions. An additive effect for reducing the atherogenic index of plasma and renal lesions was observed when both treatments were combined. It was concluded that both beta-glucan and exercise improved metabolic parameters in type 2 (HFD/STZ) diabetic rats.

Phase behaviour of oat β-glucan/sodium caseinate mixtures varying in molecular weight.

Science.gov (United States)

Agbenorhevi, Jacob K; Kontogiorgos, Vassilis; Kasapis, Stefan

2013-05-01

The isothermal phase behaviour at 5 °C of mixtures of sodium caseinate and oat β-glucan isolates varying in molecular weight (MW) was investigated by means of phase diagram construction, rheometry, fluorescence microscopy and electrophoresis. Phase diagrams indicated that the compatibility of the β-glucan/sodium caseinate system increases as β-glucan MW decreases. Images of mixtures taken at various biopolymer concentrations revealed phase separated domains. Results also revealed that at the state of thermodynamic equilibrium, lower MW samples yielded considerable viscosity in the mixture. At equivalent hydrodynamic volume of β-glucan in the mixtures, samples varying in molecular weight exhibited similar flow behaviour. A deviation dependent on the protein concentration was observed for the high MW sample in the concentrated regime due to the size of β-glucan aggregates formed. Results demonstrate that by controlling the structural features of β-glucan in mixtures with sodium caseinate, informed manipulation of rheological properties in these systems can be achieved. Copyright © 2012 Elsevier Ltd. All rights reserved.

Antitumour and immunological activity of a beta 1----3/1----6 glucan from Glomerella cingulata.

Science.gov (United States)

Gomaa, K; Kraus, J; Rosskopf, F; Röper, H; Franz, G

1992-01-01

The in vivo antitumour activity of a beta 1----3/1----6 glucan from the fungus Glomerella cingulata was investigated in vivo. The glucan exhibited a strong inhibition of tumour growth of the allogeneic Sarcoma-180 as well as the syngeneic DBA/2-MC.SC-1 fibrosarcoma with inhibition ratios up to 100%. Against the hormone sensitive Noble-Nb-R prostate carcinoma the glucan alone showed a moderate antitumour effect, whereas in combination with diethylstilbestrol an almost complete regression of the tumour could be achieved. It could be demonstrated that a highly ordered structure of the glucan is not essential for the antitumour activity. Since the glucan expressed no direct cytotoxic effects, the immunomodulating activity was investigated in vitro in order to get an indication for a possible mode of action. In the lymphocyte transformation assay the glucan at a dose of 100 micrograms/ml caused a fourfold increase in the proliferation of murine spleen lymphocytes. Moreover, the glucan stimulated the phagocytosis of zymosan by bone marrow macrophages up to 100%. However, the glucan was not able to render macrophages cytotoxic against P-815 mastocytoma cells.

Exposure to biohazards in wood dust: bacteria, fungi, endotoxins, and (1-->3)-beta-D-glucans.

Science.gov (United States)

Alwis, K U; Mandryk, J; Hocking, A D

1999-09-01

Personal exposure to fungi, bacteria, endotoxin, and (1-->3)-beta-D-glucan was determined at different woodworking sites--logging sites, sawmills, woodchipping sites, and joineries. Exposure levels to fungi at logging sites and sawmills were in the range of 10(3)-10(4) cfu/m3, at the woodchipping mill, 10(3)-10(5) cfu/m3, and at joineries, 10(2)-10(4) cfu/m3. Although mean endotoxin levels were lower than the suggested threshold value of 20 ng/m3, some personal exposures at sawmills and a joinery exceeded the standard. The geometric mean personal (1-->3)-beta-D-glucan exposure level at the woodchipping mill was 2.32 ng/m3, at sawmills, 1.37 ng/m3, at logging sites, 2.02 ng/m3, and at joineries, 0.43 ng/m3. Highly significant associations were found between mean personal inhalable endotoxin exposures and Gram-negative bacteria levels (p 3)-beta-D-glucan exposures and fungi levels (p = 0.0003). The prevalence of cough, phlegm, chronic bronchitis, nasal symptoms, frequent headaches, and eye and throat irritations was significantly higher among woodworkers than controls. Dose-response relationships were found between personal exposures and work-related symptoms among joinery workers and sawmill and chip mill workers.

Effects of β-glucan and Vitamin D Supplementation on Inflammatory Parameters in Patients with Diabetic Retinopathy.

Science.gov (United States)

Richter, Josef; Závorková, Martina; Vetvicka, Vaclav; Liehneová, Ivana; Kral, Vlastimil; Rajnohova Dobiasova, Lucie

2018-06-19

The objective of this article is to evaluate the potential effects of beta-glucan and vitamin D supplementation in patients with diabetic retinopathy. We evaluated the levels of several parameters of inflammatory reactions (C-reactive protein [CRP], serum amyloid A [SAA], and interleukin- [IL-] 6), leptin, and vitamin D. Using a 3-month interval, we divided the patients into three groups: (1) supplemented with beta-glucan and vitamin D, (2) supplemented with vitamin D and placebo, and (3) supplemented with vitamin D alone. By this division, we aim not only to observe whether beta-glucan can increase the effects of vitamin D, but also to eliminate the potential effects of placebo. The doses of vitamin D corresponded to phototype, weight, age, and sex of the individual. Fifty-two diabetic retinopathy patients were selected for our study. We found significant vitamin D deficits in all cases, even after three months of supplementation with vitamin D. Significant changes in levels of CRP were observed in the beta-glucan-supplemented group; levels of SAA and IL-6 were not changed. Leptin levels were significantly lowered in the beta-glucan-supplemented group and increased in the other groups. More detailed studies and/or longer supplementation is necessary.

Variação no conteúdo de beta-glucanas em cultivares brasileiros de aveia Beta-glucan content variation in brasilian oat cultivars

Directory of Open Access Journals (Sweden)

Roberta M. de SÁ

2000-04-01

Full Text Available Com o crescente interesse em alimentos funcionais e nutracêuticos, a aveia (Avena sativa L. tem se destacado, devido ao seu teor de fibras alimentares e principalmente às beta-glucanas. As (1,3(1,4-beta-D-glucanas, fibras alimentares na maioria solúveis, atuam na redução do colesterol em indivíduos com hipercolesterolemia. Existem estudos para determinar as causas de variação do teor desta fibra em aveia, porém, pouco se sabe sobre a aveia cultivada no Brasil. O objetivo deste trabalho foi verificar se existem diferenças no conteúdo de beta-glucanas entre cultivares brasileiros e se há variação na porcentagem desta fibra devido ao ano de cultivo. Os cultivares IAC7, UFRGS14, UPF16 e UPF17 (3 amostras de cada, e ainda três amostras do cultivar IAC7 para cada ano de cultivo (97 e 98, foram analisados segundo os métodos da AACC (American Association of Cereal Chemists. Os teores médios (peso seco de beta-glucanas foram 6,50% (IAC7, 4,30% (UFRGS14, 3,51% (UPF16 e 3,78% (UPF17, com erro padrão de ±0,084 e coeficiente de variação de 7,89 %. Observou-se efeito significativo dos cultivares (p=0,03 e grande variabilidade entre as amostras (p=0,0001. O cultivar IAC7 apresentou média de beta-glucanas de 5,11% em 97 e 6,50 % em 98 (erro padrão ±0,14; CV=10,53% e observou-se efeito significativo do ano de cultivo.With the increasing interest in functional foods and nutraceuticals, oats (Avena sativa L. have received special attention because of their dietary fiber contents, and specially of their beta-glucans. The mostly soluble dietary fibers (1,3(1,4-beta-D-glucans, reduce serum cholesterol in individuals with hypercholesterolemia. There are studies about the causes of variation in the contents of this fiber in oats, however, very little is known about Brazilian cultivars. The objective of this work was to verify if there were differences in the beta-glucan contents among brazilian cultivars and if there was variation in the

Isolation and characterization of beta-glucan synthase: A potential biochemical regulator of gravistimulated differential cell wall loosening

Science.gov (United States)

Kuzmanoff, K. M.

1984-01-01

In plants, gravity stimulates differential growth in the upper and lower halves of horizontally oriented organs. Auxin regulation of cell wall loosening and elongation is the basis for most models of this phenomenon. Auxin treatment of pea stem tissue rapidly increases the activity of Golgi-localized Beta-1,4-glucan synthase, an enzyme involved in biosynthesis of wall xyloglucan which apparently constitutes the substrate for the wall loosening process. The primary objective is to determine if auxin induces de novo formation of Golgi glucan synthase and increases the level of this glucan synthase mRNA. This shall be accomplished by (a) preparation of a monoclonal antibody to the synthase, (b) isolation, and characterization of the glucan synthase, and (c) examination for cross reactivity between the antibody and translation products of auxin induced mRNAs in pea tissue. The antibody will also be used to localize the glucan synthase in upper and lower halves of pea stem tissue before, during and after the response to gravity.

Structural characterization and evaluation of antioxidant, anticancer and hypoglycemic activity of radiation degraded oat (Avena sativa) β- glucan

Science.gov (United States)

Hussain, Peerzada R.; Rather, Sarver A.; Suradkar, Prashant P.

2018-03-01

Oat β-D-glucan after extraction was degraded at doses of 3, 6, 9, 12 and 15 kGy. The average molecular weight decreased to 45 kDa at dose of 15 kGy from an initial value of 200 kDa in native sample. XRD analysis revealed no significant change in diffraction pattern of irradiated samples when compared with control, except a decrease in intensity of x-ray diffraction. The results of the antioxidant activity revealed decrease in EC50 values and corresponding increase in antioxidant activity of radiation degraded oat β-D-glucan. Results of the anticancer studies indicated that cytotoxicity of gamma irradiated oat β-D-glucan in cancer cell lines was highest against colo-205 and MCF7 cancer cells compared to T47D cell and no cytotoxicity was observed in normal cell lines at all concentrations used. Evaluation of hypoglycemic activity showed highest inhibition in α-glucosidase activity compared to α-amylase activity due to gamma irradiation of oat β-D-glucan. Comparison of the EC50 values of known standards and gamma irradiated oat beta-glucan samples indicates that radiation treatment significantly modified the biological activity of the beta-glucan samples. Therefore, it is suggested that gamma irradiation can be used for producing low molecular weight oat β-D-glucan; which can help in modifying the biological activities.

Near infrared spectra indicate specific mutant endosperm genes and reveal a new mechanism for substituting starch with (1-->3,1-->4)-[beta]-glucan in barley

DEFF Research Database (Denmark)

Munck, L.; Møller, B.; Jacobsen, Susanne

2004-01-01

-->3,1-->4)-[beta]-glucan (up to 15-20%), thus, maintaining a constant production of polysaccharides at 50-55%, within the range of normal barley.The spectral tool was tested by an independent data set with six mutants with unknown polysaccharide composition. Spectral data from four of these were classified within...... the high (1-->3,1-->4)-[beta]-glucan BG lys5 cluster in a PCA. Their high (1-->3,1-->4)-[beta]-glucan and low starch content was verified. It is concluded that genetic diversity such as from gene regulated polysaccharide and storage protein pathways in the endosperm tissue can be discovered directly from...... the phenotype by chemometric classification of a spectral library, representing the digitised phenome from a barley gene bank....

Characterization and partial purification of beta-1,3-D-glucan (callose) synthase from barley (Hordeum vulgare) leaves

DEFF Research Database (Denmark)

Pedersen, L.H.; Jacobsen, S.; Hejgaard, J.

1993-01-01

The plasma membrane bound beta-1,3-D-glucan (callose) synthase. assumed to be involved in the resistance to the powdery mildew fungus (Erysiphe graminis f.sp. hordei), was partially purified from a microsomal fraction of green barley leaves (Hordeum vulgare L.). Plasma membranes were enriched...

Respiratory health in children, and indoor exposure to (1,3)-beta-D-glucan, EPS mould components and endotoxin

NARCIS (Netherlands)

Tischer, C.; Gehring, U.; Chen, C-M; Kerkhof, M.; Koppelman, G.; Sausenthaler, S.; Herbarth, O.; Schaaf, B.; Lehmann, I.; Kraemer, U.; Berdel, D.; von Berg, A.; Bauer, C. P.; Koletzko, S.; Wichmann, H-E; Brunekreef, B.; Heinrich, J.

For a long time, exposure to mould and dampness-derived microbial components was considered a risk factor for the development of respiratory diseases and symptoms. Some recent studies suggested that early childhood exposure to mould components, such as (1,3)-beta-D-glucan and extracellular

Structural investigations of glucans from cultures of Glomerella cingulata Spaulding & von Schrenck.

Science.gov (United States)

Gomaa, K; Kraus, J; Franz, G; Röper, H

1991-09-18

Methylation analysis, enzymic digestion, n.m.r. spectroscopy, and Smith degradation showed that the major extracellular polysaccharide, isolated from cultures of the fungus Glomerella cingulata, was a (1----3)-beta-D-glucan with side chains of 1-4 (1----3)-linked beta-D-glucose residues attached to position 6. A (1----6)-beta-D-glucan was produced by the fungus in small proportions. Treatment of the (1----3,1----6)-beta-D-glucan (890,315) with greater than 0.05M NaOH at greater than 150 degrees, or Me2SO-H2O with a concentration of dimethyl sulfoxide of greater than 80%, irreversibly destroyed the highly ordered structure responsible for the high viscosity of aqueous solutions. The strong shift of the lambda max of aqueous solutions of Congo Red by the degraded glucan, the fact that the mol. wt. of the original glucan was approximately 4 times higher than that of the degraded polymer, and the suppression of the n.m.r. signals for C-3 indicated that the original glucan had a highly ordered structure, probably built up from single helices.

Structural Characterization and Antioxidative Activity of Low-Molecular-Weights Beta-1,3-Glucan from the Residue of Extracted Ganoderma lucidum Fruiting Bodies

Directory of Open Access Journals (Sweden)

Pai-Feng Kao

2012-01-01

Full Text Available The major cell wall constituent of Ganoderma lucidum (G. lucidum is β-1,3-glucan. This study examined the polysaccharide from the residues of alkaline-extracted fruiting bodies using high-performance anion-exchange chromatography (HPAEC, and it employed nuclear magnetic resonance (NMR and mass spectrometry (MS to confirm the structures. We have successfully isolated low-molecular-weight β-1,3-glucan (LMG, in high yields, from the waste residue of extracted fruiting bodies of G. lucidum. The 3-(4,5-dimethylthiazol-2-yl-2,5-diphenyl tetrazolium bromide (MTT assay evaluated the capability of LMG to suppress H2O2-induced cell death in RAW264.7 cells, identifying that LMG protected cells from H2O2-induced damage. LMG treatment decreased H2O2-induced intracellular reactive oxygen species (ROS production. LMG also influenced sphingomyelinase (SMase activity, stimulated by cell death to induce ceramide formation, and then increase cell ROS production. Estimation of the activities of neutral and acid SMases in vitro showed that LMG suppressed the activities of both neutral and acid SMases in a concentration-dependent manner. These results suggest that LMG, a water-soluble β-1,3-glucan recycled from extracted residue of G. lucidum, possesses antioxidant capability against H2O2-induced cell death by attenuating intracellular ROS and inhibiting SMase activity.

Kinetics and Thermodynamics of Ultrasound-Assisted Depolymerization of κ-Carrageenan

Directory of Open Access Journals (Sweden)

Ratnawati Ratnawati

2016-03-01

Full Text Available The ultrasound-assisted depolymerization of κ-carrageenan has been studied at various temperatures and times. The κ-carrageenan with initial molecular weight of 545 kDa was dispersed in water to form a 5 g/L solution, which was then depolymerized in an ultrasound device at various temperatures and times. The viscosity of the solution was measured using Brookfield viscometer, which was then used to find the number-average molecular weight by Mark-Houwink equation. To obtain the kinetics of κ-carrageenan depolymerization, the number-average molecular weight data was treated using midpoint-chain scission kinetics model. The pre-exponential factor and activation energies for the reaction are 2.683×10-7 mol g-1 min-1 and 6.43 kJ mol-1, respectively. The limiting molecular weight varies from 160 kDa to 240 kDa, and it is linearly correlated to temperature. The results are compared to the result of thermal depolymerization by calculating the half life. It is revealed that ultrasound assisted depolymerization of κ-carrageenan is faster than thermal depolymerization at temperatures below 72.2°C. Compared to thermal depolymerization, the ultrasound-assisted process has lower values of Ea, ΔG‡, ΔH‡, and ΔS‡, which can be attributed to the ultrasonically induced breakage of non-covalent bonds in κ-carrageenan molecules. Copyright © 2016 BCREC GROUP. All rights reserved Received: 10th November 2015; Revised: 18th January 2016; Accepted: 19th January 2016 How to Cite: Ratnawati, R., Prasetyaningrum, A., Wardhani, D.H. (2016. Kinetics and Thermodynamics of Ultrasound-Assisted Depolymerization of κ-Carrageenan. Bulletin of Chemical Reaction Engineering & Catalysis, 11(1: 48-58. (doi:10.9767/bcrec.11.1.415.48-58 Permalink/DOI: http://dx.doi.org/10.9767/bcrec.11.1.415.48-58

Diagnostic potential of nested PCR, galactomannan EIA, and beta-D-glucan for invasive aspergillosis in pediatric patients.

Science.gov (United States)

Badiee, Parisa; Alborzi, Abdolvahab; Karimi, Mahammad; Pourabbas, Bahman; Haddadi, Pedram; Mardaneh, Jalal; Moieni, Mahsa

2012-04-13

Limited specific data and investigations are available for invasive aspergillosis (IA) in pediatric patients. We evaluated the diagnostic potential of three noninvasive tests including the Platelia Aspergillus EIA kit for using galactomannan antigen, (1,3)-β-D-glucan Detection Reagent Kit, and nested-PCR for Aspergillus DNA in sera. We evaluated the diagnostic potential of three noninvasive tests including EIA for galactomannan antigen  (Platelia Aspergillus), nested  PCR assay for Aspergillus DNA and test for (1→3)-β-D-glucan (Glucatell assay Kit). All pediatric patients treated at the hematology/oncology unit who were at increased risk of developing invasive aspergillosis were enrolled. Clinical samples were examined for Aspergillus infections by mycological methods. Serial blood samples were collected twice weekly and evaluated by noninvasive tests. We analyzed 230 consecutive blood samples from 62 pediatric patients. The incidence rate of invasive aspergillosis in the patients was found to be 27.4%, and the etiologic agents were Aspergillus flavus, Aspergillus fumigatus, and Aspergillus spp.  The sensitivity, specificity, positive and negative predictive values, and likelihood ratios for positive and negative results of galactomannan in patients with proven and probable IA were 90%, 92%, 81.8%, 96%, 11.25, and 0.1; for beta-D-glucan they were 50%, 46%, 26%, 70.6%, 0.9, 0.9; and for nested-PCR they were 80%, 96.2%, 88.9%, 92.6%, 21, and 0.2, respectively. The conventional methods are not able to detect IA, due to the lack of valid and proper sampling. Galactomannan and nested-PCR tests in serum, with enough accuracy and reliability, can serve as noninvasive methods for the detection of IA in pediatric patients. However, the beta-D-glucan test cannot serve as an efficient diagnostic tool in those with hematologic disorders. 

Post radiation protection and enhancement of DNA repair of beta glucan isolated from Ganoderma lucidum

International Nuclear Information System (INIS)

Pillai, Thulasi G.; Nair, C.K.K.; Uma Devi, P.

2013-01-01

Ganoderma lucidum (Fr) P. Karst, commonly known as Reishi in Japan and Ling Zhi in China, is well known for its medicinal properties. G. lucidum contains a number of components among which the polysaccharides, particularly beta-glucan, and triterpenoids are the major active components. Radioprotective effect of a beta glucan (BG) isolated from the mushroom G. lucidum against radiation induced damage was investigated taking mouse survival and chromosomal aberrations as end points. DNA repair enhancing property of BG was determined by comet assay in human peripheral blood leucocytes. Young Swiss albino mice were exposed to whole body γ-irradiation. For mouse survival study, BG was administered orally 5 min after 8 Gy radiation exposures and at 4 Gy exposure for chromosomal aberrations. BG at 500 ug/kg body wt produced 66% mouse survival at 30 days given post irradiation. In chromosomal aberrations significant reduction in number of aberrant cells and different types of aberrations was observed in BG administered group compared to RT along treated group. For DNA repair, the comet parameters were studied at 2 Gy γ-irradiation with 15 min intervals. The comet parameters were reduced to normal levels after 120 min of exposure. The DNA repairing ability of BG contributes to the post radio protective effect of BG. (author)

Determinação da concentração de beta-glucano em cogumelo Agaricus blazei Murill por método enzimático Determination of beta-glucan concentration in Agaricus blazei Murill mushroom by enzymatic method

Directory of Open Access Journals (Sweden)

Yong K. Park

2003-12-01

Full Text Available Cogumelos comestíveis contêm importantes propriedades funcionais. Em particular, beta-glucanos, homo- e hetero-glucanos com ligações glicosídicas beta(1->3, beta(1->4 e beta(1->6, supostamente responsáveis por algumas propriedades benéficas à saúde humana, como atividade imunomodulatória, antioxidante, antiinflamatória e anticancerígena. Neste trabalho, a quantidade de beta-glucano presente em cogumelo Agaricus blazei Murill, coletados de três diferentes locais, foi analisada utilizando-se método enzimático. As amostras (em base seca foram tratadas com alfa-amilase, protease bacteriana e com glicoamilase fúngica. beta-glucano foi quantificado após hidrólise ácida e determinação da glicose liberada. Foi verificado que amostras de A. blazei Murill cultivadas em estufas apresentaram menor concentração de b-glucano (8,4±0,9 e 7,6±2,8g/100g quando comparado com amostras cultivadas em campo aberto (10,1±2,1g/100g. Observou-se ainda que, mesmo sendo cultivado em condições semelhantes, porém em locais diferentes, as amostras apresentaram diferenças significativas (7,6±2,8 e 8,4±0,9g/100g.Edible mushrooms contains a very interesting functional properties. Among them, the beta-glucans, polysaccharides with beta-1,3; b-1,4 and beta-1,6glucosidic linkages, they are responsible to a series of properties to human health, such as immunomodulatory, antioxidant, antiinflammatory and, antitumoral activities. In the present work, the Agaricus blazei Murill beta-glucan concentrations from three locations, were determined through the enzymatic method. Samples were treated with alpha-amylase, bacterial protease and fungal glucoamylase. beta-glucans were quantified after acid hydrolysis and, the glucose determined for spectrophotometric method. It was verified that samples cultivated inside stoves presented smaller beta-glucan concentration (8.4±0.9 and 7.6±2.8g/100g, when compared with samples cultivated in open field (10.1±2.1g/100

Thermoresponsive .beta.-glucan-based polymers for bimodal immunoradiotherapy - Are they able to promote the immune system?

Czech Academy of Sciences Publication Activity Database

Loukotová, Lenka; Kučka, Jan; Rabyk, Mariia; Höcherl, Anita; Venclíková, Kristýna; Janoušková, Olga; Páral, P.; Kolářová, V.; Heizer, T.; Šefc, L.; Štěpánek, Petr; Hrubý, Martin

2017-01-01

Roč. 268, 28 December (2017), s. 78-91 ISSN 0168-3659 R&D Projects: GA ČR(CZ) GA16-02870S; GA ČR(CZ) GA16-03156S; GA MZd(CZ) NV15-25781A; GA MŠk(CZ) 7AMB16FR042 Institutional support: RVO:61389013 Keywords : beta-glucan * polyoxazoline * multimodal cancer therapy Subject RIV: CF - Physical ; Theoretical Chemistry OBOR OECD: Physical chemistry Impact factor: 7.786, year: 2016

Characterization of oat beta-glucan and coenzyme Q10-loaded beta-glucan powders generated by the pressurized gas-expanded liquid (PGX) technology.

Science.gov (United States)

Liu, Nian; Couto, Ricardo; Seifried, Bernhard; Moquin, Paul; Delgado, Luis; Temelli, Feral

2018-04-01

The physicochemical properties of the oat beta-glucan powder (BG) and coenzyme Q10 (CoQ10)-loaded BG powder (L-BG) produced by the pressurized gas-expanded liquid (PGX) technology were studied. Helium ion microscope, differential scanning calorimeter, X-ray diffractometer, AutoSorb iQ and rheometer were used to determine the particle morphology, thermal properties, crystallinity, surface area and viscosity, respectively. Both BG (7.7μm) and L-BG (6.1μm) were produced as micrometer-scale particles, while CoQ10 nanoparticles (92nm) were adsorbed on the porous structure of L-BG. CoQ10 was successfully loaded onto BG using the PGX process via adsorptive precipitation mainly in its amorphous form. Viscosity of BG and L-BG solutions (0.15%, 0.2%, 0.3% w/v) displayed Newtonian behavior with increasing shear rate but decreased with temperature. Detailed characterization of the physicochemical properties of combination ingredients like L-BG will lead to the development of novel functional food and natural health product applications. Copyright © 2017 Elsevier Ltd. All rights reserved.

Lignin depolymerization by fungal secretomes and a microbial sink

Energy Technology Data Exchange (ETDEWEB)

Salvachúa, Davinia; Katahira, Rui; Cleveland, Nicholas S.; Khanna, Payal; Resch, Michael G.; Black, Brenna A.; Purvine, Samuel O.; Zink, Erika M.; Prieto, Alicia; Martínez, María J.; Martínez, Angel T.; Simmons, Blake A.; Gladden, John M.; Beckham, Gregg T.

2016-08-25

In Nature, powerful oxidative enzymes secreted by white rot fungi and some bacteria catalyze lignin depolymerization and some microbes are able to catabolize the resulting aromatic compounds as carbon and energy sources. Taken together, these two processes offer a potential route for microbial valorization of lignin. However, many challenges remain in realizing this concept, including that oxidative enzymes responsible for lignin depolymerization also catalyze polymerization of low molecular weight (LMW) lignin. Here, multiple basidiomycete secretomes were screened for ligninolytic enzyme activities in the presence of a residual lignin solid stream from a corn stover biorefinery, dubbed DMR-EH (Deacetylation, Mechanical Refining, and Enzymatic Hydrolysis) lignin. Two selected fungal secretomes, with high levels of laccases and peroxidases, were utilized for DMR-EH lignin depolymerization assays. The secretome from Pleurotus eryngii, which exhibited the highest laccase activity, reduced the lignin average molecular weight by 63% and 75% at pH 7 compared to the Mw of the control treated at the same conditions and the initial DMR-EH lignin, respectively, and was applied in further depolymerization assays as a function of time. As repolymerization was observed after 3 days of incubation, an aromatic-catabolic microbe (Pseudomonas putida KT2440) was incubated with the fungal secretome and DMR-EH lignin. These experiments demonstrated that the presence of the bacterium enhances lignin depolymerization, likely due to bacterial catabolism of LMW lignin, which may partially prevent repolymerization. In addition, proteomics was also applied to the P. eryngii secretome to identify the enzymes present in the fungal cocktail utilized for the depolymerization assays, which highlighted a significant number of glucose/ methanol/choline (GMC) oxidoreductases and laccases. Overall, this study demonstrates that ligninolytic enzymes can be used to partially depolymerize a solid, high

Water-soluble low-molecular-weight -(1, 3–1, 6 D-Glucan inhibit cedar pollinosis

Directory of Open Access Journals (Sweden)

Tomoko Jippo

2015-02-01

Full Text Available Background: The incidence of allergic diseases such as allergic rhinitis, atopic dermatitis, asthma, and food allergies has increased in several countries. Mast cells have critical roles in various biologic processes related to allergic diseases. Mast cells express the high-affinity receptor for immunoglobulin (Ig E on their surface. The interaction of multivalent antigens with surface-bound IgE causes the secretion of granule-stored mediators, as well as the de novosynthesis of cytokines. Those mediators and cytokines proceed the allergic diseases. We investigated the effects of water-soluble, low-molecular-weight -(1, 3–1, 6 D-glucan isolated from Aureobasidium pullulans 1A1 strain black yeast (LMW--glucan on mast cell-mediated anaphylactic reactions. We reported that LMW--glucan dose-dependently inhibited the degranulation of mast cells. Furthermore, we found that orally administered LMW--glucan inhibited the IgE-mediated passive cutaneous anaphylaxis (PCA reaction in mice. Here, we examined if LMW--glucan had effects on Japanese cedar pollinosis. Findings: In a clinical study, a randomized, single-blind, placebo-controlled, parallel group study in 65 subjects (aged 2262 was performed. This study was undertaken 3 weeks before and until the end of the cedar pollen season. During the study, all subjects consumed one bottle of placebo or LMW--glucan daily and all subjects were required to record allergic symptoms in a diary. The LMW--glucan group had a significantly lower prevalence of sneezing, nose-blowing, tears, and hindrance to the activities of daily living than the placebo group. Conclusions: These results suggested that LMW--glucan could be an effective treatment for allergic diseases

Chitosan-guar gum-silver nanoparticles hybrid matrix with immobilized enzymes for fabrication of beta-glucan and glucose sensing photometric flow injection system.

Science.gov (United States)

Bagal-Kestwal, Dipali R; Kestwal, Rakesh Mohan; Hsieh, Wen-Ting; Chiang, Been-Huang

2014-01-01

Simple and fast photometric flow injection analysis system was developed for sensing of β-1,3-glucan from medicinal mushroom Ganoderma lucidum during fermentation. For this purpose, the chitosan-guar gum-silver nanoparticle-beta glucanase (Ch-GG-AgNPs-βG) beads and Ch-GG-AgNPs-GOD (glucose oxidase) beads were prepared. The bead packed mini-columns were then used to assemble a flow injection analysis (FIA) system for the detection of β-(1→3)-d-glucan biomarker or glucose. This colorimetric flow system can detect glucose and glucan with detection limits as low as 50ngmL(-1) and 100ngmL(-1) (S/N=3), respectively. The analysis time of this FIA was approximately 40s, which is faster than the previously reported glucan sensors. The glucose and glucan calibration curves were obtained in the range of 0.25-1.25μgmL(-1) (R(2)=0.988) and 0.2-1.0μgmL(-1)(R(2)=0.979), respectively. The applicability of the nano-bio-composite FIA sensor system for spiked and real β-(1→3)-d-glucan samples were tested, and the accuracy of the results were greater than 95%. Thus, the designed FIA provides a simple, interference free and rapid tool for monitoring glucose and β-glucan content, which can be used for various food samples with a little modification. Copyright © 2013 Elsevier B.V. All rights reserved.

Various roles of beta-glucan in invertebrates

Czech Academy of Sciences Publication Activity Database

Větvička, V.; Šíma, Petr

2017-01-01

Roč. 14, č. 1 (2017), s. 488-493 ISSN 1824-307X Institutional support: RVO:61388971 Keywords : invertebrates * glucan * receptors Subject RIV: EC - Immunology OBOR OECD: Immunology Impact factor: 0.824, year: 2016

Beta-1,3-1,6-glucan modulate the non-specific immune response to enhance the survival in the Vibrio alginolyticus infection of Taiwan abalone (Haliotis diversicolor supertexta).

Science.gov (United States)

Wu, Yu-Sheng; Tseng, Tzu-Yu; Nan, Fan-Hua

2016-07-01

This research aims to investigate the non-specific immune response of Taiwan abalone (Haliotis diversicolor supertexta) which was treated with the beta-1,3-1,6-glucan to be observed in the survival impact after the Vibrio alginolyticus infection. The non-specific immune and physiological response of superoxide anion radical (O2(-)), phenoloxidase (PO), phagocytic index (PI), phagocytic rate (PR) and lucigenin-chemiluminescence for reactive oxygen intermediates (ROIs) were enhanced via in-vitro experiment. In the in-vivo experiment, the observed data presented that the haemolymph lysate supernatant (HLS), superoxide dismutase (SOD), glutamate oxalacetate transaminase (GOT) and glutamate pyruvate transaminase (GPT) were not significant enhanced, but the total haemocyte count (THC), O2(-), PO, phagocytic index (PI), phagocytic ratio (PR) and other parameters of immune were significantly promoted after treated with beta-1,3-1,6-glucan. In the challenge experiment, the survival rates of abalone in the 40 and 80 μl/ml groups of beta-1,3-1,6-glucan were observed from 6.67% up to 33.33% and 36.67% after injection with Vibrio alginolyticus, respectively. Copyright © 2016 Elsevier Ltd. All rights reserved.

The structure of cell wall alpha-glucan from fission yeast

NARCIS (Netherlands)

Grün, Christian H.; Hochstenbach, Frans; Humbel, Bruno M.; Verkleij, Arie J.; Sietsma, J. Hans; Klis, Frans M.; Kamerling, Johannis P.; Vliegenthart, Johannes F. G.

2005-01-01

Morphology and structural integrity of fungal cells depend on cell wall polysaccharides. The chemical structure and biosynthesis of two types of these polysaccharides, chitin and (1-->3)-beta-glucan, have been studied extensively, whereas little is known about alpha-glucan. Here we describe the

The structure of cell wall alpha-glucan from fission yeast.

NARCIS (Netherlands)

Grün, C.H.; Hochstenbach, F.; Humbel, B.M.; Verkleij, A.J.; Sietsma, J.H.; Klis, F.M.; Kamerling, J.P.; Vliegenthart, J.F.G.

2005-01-01

Morphology and structural integrity of fungal cells depend on cell wall polysaccharides. The chemical structure and biosynthesis of two types of these polysaccharides, chitin and (1rarr3)-beta-glucan, have been studied extensively, whereas little is known about alpha-glucan. Here we describe the

High Molecular Weight Glucan of the Culinary Medicinal Mushroom Agaricus bisporus is an α-Glucan that Forms Complexes with Low Molecular Weight Galactan

Directory of Open Access Journals (Sweden)

Harry J. Wichers

2010-08-01

Full Text Available An a-glucan was isolated from the culinary medicinal mushroom A. bisporus by hot water extraction, ethanol precipitation and DEAE-cellulose chromatography. The resulting material showed a single HMW peak excluded from a Sephadex G50 column that could completely be degraded by α-amylase treatment. After heating in 1% SDS a small additional peak of low MW eluted from the G50 column. The monosaccharide composition of the main peak was evaluated by HPLC, and was found to consist of a majority of glucose (97.6%, and a minor proportion of galactose (2.4%. Methylation analysis and degradation by a-amylase indicated the presence of an a-glucan with a main chain consisting of (1®4-linked units, substituted at O-6 by α-D-glucopyranose single-units in the relation 1:8. Mono- (13C-, 1H-NMR and bidimensional [1H (obs.,13C-HSQC] spectroscopy analysis confirmed the a-configuration of the Glcp residues by low frequency resonances of C-1 at d 100.6, 100.2, and 98.8 ppm and H-1 high field ones at d 5.06, 5.11, and 4.74 ppm. The DEPT-13C-NMR allowed assigning the non-substituted and O-substituted –CH2 signals at d 60.3/60.8 and 66.2 ppm, respectively. Other assignments were attributed to C-2, C-3, C-4, C-5 and C-6 of the non-reducing ends at d 71.8; 72.8; 70.0; 71.3 and 60.3/60.8 ppm, respectively. The minor proportion of galactose that was demonstrated was probably derived from a complex between the a-glucan and a low molecular weight galactan.

Integration of the sensory experience and post-ingestive measures for understanding food satisfaction. A case study on sucrose replacement by Stevia rebaudiana and addition of beta glucan in fruit drinks

DEFF Research Database (Denmark)

Andersen, Barbara Vad; Mielby, Line H.; Viemose, Ida

2017-01-01

apple-cherry fruit drinks with different levels of beta-glucans and different sweeteners, sucrose or Stevia rebaudiana. The aims were: 1) to study the hedonic sensory experience, 2) to study time and product effects on post-ingestive sensations and satisfaction, and 3) to study main drivers....... Satisfaction with sensory attributes was found to be the main driver of food satisfaction, while post-ingestive sensations drove satisfaction as well. While replacing sucrose with Stevia rebaudiana did not affect the hedonic and post-ingestive sensations, addition of beta glucan resulted in both positive...

Characterization of anaerobic consortia coupled lignin depolymerization with biomethane generation.

Science.gov (United States)

Wu, Yi-Rui; He, Jianzhong

2013-07-01

Two sediment-free microbial consortia (LI3 and LP3) were established to depolymerize lignin under anaerobic conditions. During depolymerizing high molecular weight lignin to low molecular weight molecules, the two cultures produced biomethane up to 151.7 and 113.0 mL g(-1) total lignin. Furthermore, LI3 and LP3 could also utilize the biomass - oil palm empty fruit bunch fiber (OPEFB) to produce 190.6 and 195.6 mL methaneg(-1) total lignin in OPEFB, and at the same time improve the bioavailability of lignocellulosic matters for further enzymatic hydrolysis. The microbial community analysis by denature gradient gel electrophoresis (DGGE) and the high-density 16S rDNA gene microarray (PhyloChip) exhibited that Methanomethylovorans sp. (LI3) and Methanoculleus sp. (LP3) were the main methanogens present, and phylum Firmicutes and Bacteroidetes were mainly involved in the lignin depolymerization. The established microbial consortia with both lignin depolymerization and biomethane production provide profound application on the environmental friendly pretreatment of lignocellulosic materials. Copyright © 2013 Elsevier Ltd. All rights reserved.

Beta Instability and Stochastic Market Weights

OpenAIRE

David H. Goldenberg

1985-01-01

An argument is given for individual firm beta instability based upon the stochastic character of the market weights defining the market portfolio and the constancy of its beta. This argument is generalized to market weighted portfolios and the form of the stochastic process generating betas is linked to that of the market return process. The implications of this analysis for adequacy of models of beta nonstationarity and estimation of betas are considered in light of the available empirical e...

Radiation depolymerization of chitosan to prepare oligomers

International Nuclear Information System (INIS)

Hai, Le; Bang Diep, Tran; Nagasawa, Naotsugu; Yoshii, Fumio; Kume, Tamikazu

2003-01-01

Radiation depolymerization of chitosan was carried out by gamma irradiation in the solid state. The radiation-chemical depolymerization yield of chitosan in the solid state, Gd, determined by gel permeation chromatography, is 0.9 for chitosan 10B and 1.8 for chitosan 8B. Low molecular weight chitosan/or oligochitosans were separated from a chitosan depolymerized by gamma radiation, using mixtures of methanol-water and acetone as the solvents. Due to the differences in solubility revealed upon radiolysis, extracts became subdivided into precipitates and soluble fractions. The biological effect of oligochitosan in each fraction was evaluated; the preliminary results indicated that the oligochitosan with M w -bar=2x10 4 inhibited the growth of fungi at 100 ppm and that with M w -bar=800 only enhanced the growth of the same typical fungi

Fungal beta glucan protects radiation induced DNA damage in human lymphocytes.

Science.gov (United States)

Pillai, Thulasi G; Maurya, Dharmendra K; Salvi, Veena P; Janardhanan, Krishnankutty K; Nair, Cherupally K K

2014-02-01

Ganoderma lucidum (Ling Zhi), a basidiomycete white rot macrofungus has been used extensively for therapeutic use in China, Japan, Korea and other Asian countries for 2,000 years. The present study is an attempt to investigate its DNA protecting property in human lymphocytes. Beta glucan (BG) was isolated by standard procedure and the structure and composition were studied by infrared radiation (IR) and nuclear magnetic resonance (NMR) spectroscopy, gel filtration chromatography and paper chromatography. The radioprotective properties of BG isolated from the macro fungi Ganoderma lucidum was assessed by single cell gel electrophoresis (comet assay). Human lymphocytes were exposed to 0, 1, 2 and 4 Gy gamma radiation in the presence and absence of BG. The comet parameters were reduced by BG. The results indicate that the BG of G. lucidum possessed significant radioprotective activity with DNA repairing ability and antioxidant activity as the suggestive mechanism. The findings suggest the potential use of this mushroom for the prevention of radiation induced cellular damages.

Elevated Serum Beta-D-Glucan with Pseudomonas, Aspergillus, and a Partially Acid-Fast Organism in Respiratory Cultures: A Case of Hickam's Dictum Over Occam's Razor.

Science.gov (United States)

Khan, Salman; Hamula, Camille; Rana, Meenakshi; Sullivan, Timothy; Dunn, Dallas; Patel, Pinki; Mishkin, Aaron; Huprikar, Shirish

2017-10-01

We describe a case of a man with ectopic Cushing's syndrome, elevated serum beta-D-glucan, and respiratory cultures with Pseudomonas, Aspergillus, and a partially acid-fast organism. Our case highlights challenges in diagnosis and management of coinfection in an immunocompromised host.

β-1,3-glucan in developing cotton fibers

International Nuclear Information System (INIS)

Maltby, D.; Carpita, N.C.; Montezinos, D.; Kulow, C.; Delmer, D.P.

1979-01-01

Evidence is presented for the existence of a noncellulosic β-1,3-glucan in cotton fibers. The glucan can be isolated as distinct fractions of varying solubility. When fibers are homogenized rigorously in aqueous buffer, part of the total β-1,3-glucan is found as a soluble polymer in homogenates freed of cell walls. The proportion of total β-1,3-glucan which is found as the soluble polymer varies somewhat as a function of fiber age. The insoluble fraction of the BETA-1,3-glucan remains associated with the cell wall fraction. The glucan fraction which can be isolated as a soluble polymer in homogenates freed of cell walls is not associated with membranous material, and we propose that it represents glucan which is also extracellular but not tightly associated with the cell wall. Enzyme digestion studies indicate that all of the cotton fiber glucan is β-linked, and methylation analyses and enzyme studies both show that the predominant linkage in the glucan is 1 → 3. The possibility of some minor branching at C-6 can also be deduced from the methylation analyses. The timing of deposition of the β-1,3-glucan during fiber development coincides closely with the onset of secondary wall cellulose synthesis. Kinetic studies performed with ovules and fibers cultured in vitro show that incorporation of radioactivity from [ 14 C/glucose into β-1,3-glucan is linear with respect to time almost from the start of the labeling period; however, a lag is observed before incorporation into cellulose becomes linear with time, suggesting that these two different glucans are not polymerized directly from the same substrate pool. Pulse-chase experiments indicate that neither the β-1,3-glucan nor cellulose exhibits significant turnover after synthesis

Catalytic Oxidation and Depolymerization of Lignin in Aqueous Ionic Liquid

Energy Technology Data Exchange (ETDEWEB)

Das, Lalitendu [Biosystems and Agricultural Engineering, University of Kentucky, Lexington, KY (United States); Xu, Siquan [Biosystems and Agricultural Engineering, University of Kentucky, Lexington, KY (United States); College of Chemical Engineering, Nanjing Forestry University, Nanjing (China); Shi, Jian, E-mail: j.shi@uky.edu [Biosystems and Agricultural Engineering, University of Kentucky, Lexington, KY (United States)

2017-08-10

Lignin is an integral part of the plant cell wall, which provides rigidity to plants, also contributes to the recalcitrance of the lignocellulosic biomass to biochemical and biological deconstruction. Lignin is a promising renewable feedstock for aromatic chemicals; however, an efficient and economic lignin depolymerization method needs to be developed to enable the conversion. In this study, we investigated the depolymerization of alkaline lignin in aqueous 1-ethyl-3-methylimidazolium acetate [C{sub 2}C{sub 1}Im][OAc] under oxidizing conditions. Seven different transition metal catalysts were screened in presence of H{sub 2}O{sub 2} as oxidizing agent in a batch reactor. CoCl{sub 2} and Nb{sub 2}O{sub 5} proved to be the most effective catalysts in degrading lignin to aromatic compounds. A central composite design was used to optimize the catalyst loading, H{sub 2}O{sub 2} concentration, and temperature for product formation. Results show that lignin was depolymerized, and the major degradation products found in the extracted oil were guaiacol, syringol, vanillin, acetovanillone, and homovanillic acid. Lignin streams were characterized by Fourier transform infrared spectroscopy and gel permeation chromatography to determine effects of the experimental parameters on lignin depolymerization. The weight-average molecular weight (M{sub w}) of liquid stream lignin after oxidation, for CoCl{sub 2} and Nb{sub 2}O{sub 5} catalysts were 1,202 and 1,520 g mol{sup −1}, respectively, lower than that of Kraft lignin. Polydispersity index of the liquid stream lignin increased as compared with Kraft lignin, indicating wide span of the molecular weight distribution as a result of lignin depolymerization. Results from this study provide insights into the role of oxidant and transition metal catalysts and the oxidative degradation reaction sequence of lignin toward product formation in presence of aqueous ionic liquid.

Catalytic Oxidation and Depolymerization of Lignin in Aqueous Ionic Liquid

International Nuclear Information System (INIS)

Das, Lalitendu; Xu, Siquan; Shi, Jian

2017-01-01

Lignin is an integral part of the plant cell wall, which provides rigidity to plants, also contributes to the recalcitrance of the lignocellulosic biomass to biochemical and biological deconstruction. Lignin is a promising renewable feedstock for aromatic chemicals; however, an efficient and economic lignin depolymerization method needs to be developed to enable the conversion. In this study, we investigated the depolymerization of alkaline lignin in aqueous 1-ethyl-3-methylimidazolium acetate [C 2 C 1 Im][OAc] under oxidizing conditions. Seven different transition metal catalysts were screened in presence of H 2 O 2 as oxidizing agent in a batch reactor. CoCl 2 and Nb 2 O 5 proved to be the most effective catalysts in degrading lignin to aromatic compounds. A central composite design was used to optimize the catalyst loading, H 2 O 2 concentration, and temperature for product formation. Results show that lignin was depolymerized, and the major degradation products found in the extracted oil were guaiacol, syringol, vanillin, acetovanillone, and homovanillic acid. Lignin streams were characterized by Fourier transform infrared spectroscopy and gel permeation chromatography to determine effects of the experimental parameters on lignin depolymerization. The weight-average molecular weight (M w ) of liquid stream lignin after oxidation, for CoCl 2 and Nb 2 O 5 catalysts were 1,202 and 1,520 g mol −1 , respectively, lower than that of Kraft lignin. Polydispersity index of the liquid stream lignin increased as compared with Kraft lignin, indicating wide span of the molecular weight distribution as a result of lignin depolymerization. Results from this study provide insights into the role of oxidant and transition metal catalysts and the oxidative degradation reaction sequence of lignin toward product formation in presence of aqueous ionic liquid.

[Cellulose acetate membrane electrophoresis CAE and Raman spectroscopy as a method identification of beta-glucans, used as biologically and therapeutically active biomaterials].

Science.gov (United States)

Pielesz, Anna; Biniaś, Włodzimierz; Paluch, Jadwiga

2012-01-01

The formation of AGEs progressively increases with normal aging, even in the absence of disease (the pathogenesis of diabetes associated vascular disorders and neurodegenerative diseases, including Alzheimer's disease, Parkinson's disease). However, they are formed at accelerated rates in age-related diseases. The polysaccharides might play a role in wound healing, both internally and externally, and also that they could play a role against inflammation and may lead to the production of better medicines to be used as supplements in cancer treatment. The acid hydrolysis was studied with H2SO4 at 80% concentration to determine the most effective procedure for total hydrolysis of beta-glucan. The standard of beta-glucans acid hydrolysate were compared for commercial oat and oatmeal, mushrooms: Pleurotus ostreatus, Fungus and yeast Saccharomyces cerevisiae. The following materials and reagents were used in the examination: reference beta-(1 --> 3)-(1 --> 6)-glucan, oat and oatmeal, mushrooms: Pleurotus ostreatus, Fungus and yeast Saccharomyces cerevisiae. The Raman spectra of the sample solutions (beta-glucan acid hydrolysates) were recorded on a MAGNA-IR 860 with FT-Raman accessory. Sample was irradiated with a 1064 nm line of the T10-8S Nd spectra-physics model: YAG laser and scattered radiation were collected at 180 degrees, using 4 cm(-1) resolution. The polysaccharide was hydrolyzed into component monosaccharides with 80% H2SO4 at 0 degrees C for 30 minutes and monosaccharide derivatives were subjected to electrophoresis, as in a ealier authors study, on a strip of cellulose acetate membrane (CA-SYS-MINI Cellulose Acetate Systems) in 0.2 M Ca(OAc)2 (pH 7.5) at 10 mA, max. 240 V for 1.5 h. The strips were stained with 0.5% toluidine blue in 3% HOAc solution and then rinsed in distilled water and air-dried. A part of the hexoses (for example glucose) are converted, to products such as 5-hydroxymethylfurfural. Various coloured substances, through the Maillard

Enhancement of the immunity and body weight gain in broiler by feeding with the brewer yeast β-glucan degraded by gamma Co-60 radiation

International Nuclear Information System (INIS)

Le Quang Luan; Nguyen Thanh Long

2015-01-01

The insoluble β-glucan extracted from the cell wall of brewer’s yeast was dispersed in deionized water for swelling, then irradiated in order to degrade into water-soluble β-glucan. The results revealed that the water-soluble β-glucan contents in the irradiated samples were increased with radiation dose to 25.89, 49.07 and 66.71%; whereas their molecular weight (Mw) decreased to 48.1, 23.0 and 10.8 kDa by gamma irradiation at 100, 200 and 300 kGy, respectively. The supplementation of poultry feed with the radiation degraded β-glucan enhanced both non-specific (total white blood cells, lymphocytes, neutrocytes) and specific immune components (anti-Newcastle disease, antiGumboro disease virus and anti-infectious bronchitis virus antibodies) in the broilers. In comparison with the control, broiler fed normal poultry foodstuff without β-glucan, the supplementation of radiation degraded β-glucan not only increased the survival rate of the testing broiler about 33.3% and their average body weight of about 24.4%, but also reduced the feed conversion rate from 4.8 to 3.1 kg. The β-glucan oligosaccharides that having Mw of about 25 kDa produced by gamma irradiation at 200 kGy showed the highest effect on the growth performance and immunomodulatory capability in the immune system of the testing broilers. This product is promising to be applied for production of the safe stimulator of immunity for broiler chickens. (author)

Beta-glucan bath promote wound healing in common carp (Cyprinus carpio L.)

DEFF Research Database (Denmark)

Przybylska, Dominika Alicja; Schmidt, Jacob; Nielsen, Michael Engelbrecht

β-glucans are well known for their ability to modulate the immune system. These polysaccharides, derived from fungi, plants and bacteria cell wall [1] potently trigger inflammatory response in infected host [2]. The effects of β-glucans depend on the origins, route of administration, molecular we...

Chemoselective Methylation of Phenolic Hydroxyl Group Prevents Quinone Methide Formation and Repolymerization During Lignin Depolymerization

Energy Technology Data Exchange (ETDEWEB)

Kim, Kwang Ho; Dutta, Tanmoy; Walter, Eric D.; Isern, Nancy G.; Cort, John R.; Simmons, Blake A.; Singh, Seema

2017-03-30

Chemoselective blocking of the phenolic hydroxyl (Ar-OH) group by methylation was found to suppress secondary repolymerization and charring during lignin depolymerization. Methylation of Ar-OH prevents formation of reactive quinone methide intermediates, which are partly responsible for undesirable secondary repolymerization reactions. Instead, this structurally modified lignin produces more relatively low molecular weight products from lignin depolymerization compared to unmodified lignin. This result demonstrates that structural modification of lignin is desirable for production of low molecular weight phenolic products. This approach could be directed toward alteration of natural lignification processes to produce biomass more amenable to chemical depolymerization.

A density functional theory study of a silica-supported zirconium monohydride catalyst for depolymerization of polyethylene

Energy Technology Data Exchange (ETDEWEB)

Mortensen, J.J.; Parrinello, M.

2000-04-06

A silica-supported zirconium hydride catalyst for depolymerization of polyethylene is studied using density functional theory (DFT) together with a generalized gradient approximation (GGA) for the exchange and correlation energy. The (100) and (111) surfaces of {beta}-cristobalite are used as two possible models of a silica surface. Based on the experimental surface structure determined by J. Corker et al., they propose a detailed atomic model of the zirconium monohydride that is believed to be the active site for depolymerization of polyolefins. The model of the zirconium monohydride on the (100) surface is found to be very stable and the structure is in good agreement with extended X-ray absorption fine structure (EXAFS) measurements. Depolymerization of a small polyolefin chain (C{sub 3}H{sub 8}) was carried out to give CH{sub 4} and C{sub 2}H{sub 6} by addition of H{sub 2}. The rate-limiting step is a {beta}-methyl transfer to the zirconium atom, and the activation energy is 29 kcal/mol on the (100) surface.

Role of the synthase domain of Ags1p in cell wall alpha-glucan biosynthesis in fission yeast

NARCIS (Netherlands)

Vos, Alina; Dekker, Nick; Distel, Ben; Leunissen, Jack A. M.; Hochstenbach, Frans

2007-01-01

The cell wall is important for maintenance of the structural integrity and morphology of fungal cells. Besides beta-glucan and chitin, alpha-glucan is a major polysaccharide in the cell wall of many fungi. In the fission yeast Schizosaccharomyces pombe, cell wall alpha-glucan is an essential

Immunostimulatory properties and antitumor activities of glucans (Review)

Czech Academy of Sciences Publication Activity Database

Vannucci, Luca; Křižan, Jiří; Šíma, Petr; Stakheev, Dmitry; Čaja, Fabian; Rajsiglová, Lenka; Horák, Vratislav; Saieh, M.

2013-01-01

Roč. 43, č. 2 (2013), s. 357-364 ISSN 1019-6439 Institutional support: RVO:61388971 ; RVO:67985904 Keywords : beta-glucans * polysaccharides * immunity Subject RIV: EE - Microbiology, Virology; FD - Oncology ; Hematology (UZFG-Y) Impact factor: 2.773, year: 2013

Avaliação dos teores de fibra alimentar e de beta-glicanas em cultivares de aveia (Avena sativa L Evaluation of dietary fiber and beta-glucan levels in oat (Avena sativa L cultivars

Directory of Open Access Journals (Sweden)

Luiz C. GUTKOSKI

1999-12-01

Full Text Available A fibra alimentar é composta por celulose, hemiceluloses, gomas, pectinas e mucilagens sendo classificada em solúvel e insolúvel, quanto a sua solubilidade em água. As beta-glicanas são componentes da fibra alimentar solúvel presentes na aveia e sua importância é devido às propriedades funcionais e aos efeitos hipocolesterolêmicos e hipoglicêmicos apresentados. O presente trabalho tem como objetivo avaliar os teores de fibra alimentar solúvel, insolúvel e total e de beta-glicanas de cultivares de aveia recomendados pela Comissão Brasileira de Pesquisa de Aveia. Grãos de aveia (Avena sativa, L foram descascados, as cariopses moídas e as amostras acondicionadas e armazenadas à temperatura de -20° C. Para a análise de fibra alimentar foi adotada a metodologia da AOAC (1997. Entre os cultivares analisados, UPF 7, UPF 13, UPF 14 e UPF 16 apresentaram os maiores teores de fibra alimentar insolúvel. Os maiores teores de fibra alimentar solúvel foram verificados nos cultivares UFRGS 7, CTC 13, UPF 16 e CTC 2. O cultivar UPF 16 apresentou o maior teor de fibra alimentar total, seguido de UFRGS 7, CTC 13 e UFRGS 18. Para a determinação de beta-glicanas foi adotada a metodologia da AOAC (1997. Os maiores teores de beta-glicanas foram verificados nos cultivares UFRGS 7, UPF 14 e UFRGS 18.The dietary fiber is composed by cellulose, hemi-celluloses, gums, pectins, and mucilages, being classified as soluble or insoluble depending on its solubility in water. Beta-glucans are a fraction of the soluble dietary fiber, being important due to its functional properties and effects in reducing cholesterol and glucose. This work aimed at evaluating the levels of soluble, insoluble, and total dietary fiber, as well as the amount of beta-glucans, present in grains of oat cultivars recommended by the Brazilian Commission for Oat Research. Oat grains were hulled, the caryopses were ground and the samples packaged and stored at temperature of -20º

Depolymerization and hydrodeoxygenation of switchgrass lignin with formic acid.

Science.gov (United States)

Xu, Weiyin; Miller, Stephen J; Agrawal, Pradeep K; Jones, Christopher W

2012-04-01

Organosolv switchgrass lignin is depolymerized and hydrodeoxygenated with a formic acid hydrogen source, 20 wt % Pt/C catalyst, and ethanol solvent. The combination of formic acid and Pt/C is found to promote production of higher fractions of lower molecular weight compounds in the liquid products. After 4 h of reaction, all of the switchgrass lignin is solubilized and 21 wt % of the biomass is shown to be converted into seven prominent molecular species that are identified and quantified. Reaction time is shown to be an important variable in affecting changes in product distributions and bulk liquid product properties. At 20 h of reaction, the lignin is significantly depolymerized to form liquid products with a 76 % reduction in the weighted average molecular weight. Elemental analysis also shows that the resultant liquid products have a 50 % reduction in O/C and 10 % increase in H/C molar ratios compared to the switchgrass lignin after 20 h. Copyright © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

The Effects of Beta-Glucan Rich Oat Bread on Serum Nitric Oxide and Vascular Endothelial Function in Patients with Hypercholesterolemia

Directory of Open Access Journals (Sweden)

Faezeh Tabesh

2014-01-01

Full Text Available Introduction. Oats are high in soluble fibers and effective in reducing the risk of cardiovascular diseases (CVD. We assessed the effects of beta-glucan from oat bran on serum nitric oxide (NO endothelial function in patients with hypercholesterolemia. Method. Sixty hypercholesterolemic patients were randomly divided to receive an experimental bread rich in beta-glucan from oat bran (intervention or bread rich in wheat fiber (control for four weeks. All subjects had the same diet for two-week baseline period and hypocaloric diet for four weeks of intervention. Serum NO concentration and flow-mediated dilation (FMD were determined before and after the experiment. Results. Mean age of the participants was 51.1 ± 9.3 years and 65% (n=39 were female. After intervention, serum NO concentration increased by 50.2 ± 19.8 μmol/lit in the intervention group (P=0.017, but no change was observed in the control group (17.5 ± 27.5 μmol/lit; P=0.530. No change of FMD was observed in the intervention (0.48 ± 0.78%; P=0.546 or in the control group (0.59 ± 0.92%; P=0.533. Conclusion. Consumption of oat bread for four weeks increases serum NO concentration but has no effect on FMD. Further studies are warranted in this regard.

Can Beta Blockers Cause Weight Gain?

Science.gov (United States)

... cause weight gain? Can beta blockers cause weight gain? Answers from Sheldon G. Sheps, M.D. Yes. Weight gain can occur as a side effect of some ... and metoprolol (Lopressor, Toprol-XL). The average weight gain is about 2.6 pounds (about 1.2 ...

Beta-Glucans Improve Growth, Viability and Colonization of Probiotic Microorganisms

Directory of Open Access Journals (Sweden)

Daniela Fiocco

2012-05-01

Full Text Available Probiotics, prebiotics and synbiotics are frequently-used components for the elaboration of functional food. Currently, most of the commercialized probiotics are limited to a few strains of the genera Bifidobacteria, Lactobacillus and Streptococcus, most of which produce exopolysaccharides (EPS. This suggests that the beneficial properties of these microorganisms may be related to the biological activities of these biopolymers. In this work we report that a 2-substituted-(1,3-β-D-glucan of non-dairy bacterial origin has a prebiotic effect on three probiotic strains. Moreover, the presence of this β-D-glucan potentiates in vitro adhesion of the probiotic Lactobacillus plantarum WCFS1 to human intestinal epithelial cells.

Improved postharvest quality in patagonian squash (Cucurbita moschata) coated with radiation depolymerized chitosan

Energy Technology Data Exchange (ETDEWEB)

Pugliese, Maria Alicia; Goitia, Maria Teresa [Laboratorio de Investigaciones Basicas Aplicadas en Quitina, Departamento de Quimica, Universidad Nacional del Sur. Avenida Alem 1253, B8000CPB Bahia Blanca (Argentina); Yossen, Mariana [Instituto de Desarrollo Tecnologico para la Industria Quimica (INTEC), CONICET-Universidad Nacional del Litoral, Ruta Nacional 168-Paraje ' El Pozo' , 3000 Santa Fe (Argentina); Cifone, Norma; Agullo, Enrique [Laboratorio de Investigaciones Basicas Aplicadas en Quitina, Departamento de Quimica, Universidad Nacional del Sur. Avenida Alem 1253, B8000CPB Bahia Blanca (Argentina); Andreucetti, Noemi, E-mail: andreuce@criba.edu.ar [Laboratorio de Radioisotopos, Departamento de Quimica, Universidad Nacional del Sur, Avenida Alem 1253, B8000CPB Bahia Blanca (Argentina)

2011-12-15

Different molecular weight chitosans were evaluated on the decay of coated Anquito squashes (Cucurbita moschata) as well as the maintenance of the fruit quality along five storage months. The original chitosan (Mw=391 kDa, 83% DD), was depolymerized by gamma radiation. Apart from chain scission, other chemical changes were not detected by FTIR or UV-vis analyses. The molecular weight characterization of chitosans was done by size exclusion chromatography with dual light scattering and concentration detection (SEC-MALLS-RI). The coating effectiveness was evaluated on the following parameters: fungal decay incidence, weight loss, firmness, total reducing sugar, soluble solid, flesh color, carotene content, pH and titratable acidity. No sign of fungal decay was observed in squashes coated with 122 and 56 kDa chitosans, which were also the most effective treatments in reducing the weight loss. The chitosan with Mw=122 kDa was also the best treatment considering firmness, internal aspect, sugar and carotene content. Then, radiation degraded chitosan was better in C. moschata preservation than the original chitosan. - Highlights: > Original Chitosan was radiation depolymerized producing chitosans with lower molecular weights. > Gamma-irradiated chitosans only exhibit chain scission. > SEC-MALLS-RI chromatography is a useful tool in molecular weight analysis. > Depolymerized chitosans were the best in maintaining the quality and the storage life of coated squashes.

Improved postharvest quality in patagonian squash (Cucurbita moschata) coated with radiation depolymerized chitosan

International Nuclear Information System (INIS)

Pugliese, Maria Alicia; Goitia, Maria Teresa; Yossen, Mariana; Cifone, Norma; Agullo, Enrique; Andreucetti, Noemi

2011-01-01

Different molecular weight chitosans were evaluated on the decay of coated Anquito squashes (Cucurbita moschata) as well as the maintenance of the fruit quality along five storage months. The original chitosan (Mw=391 kDa, 83% DD), was depolymerized by gamma radiation. Apart from chain scission, other chemical changes were not detected by FTIR or UV-vis analyses. The molecular weight characterization of chitosans was done by size exclusion chromatography with dual light scattering and concentration detection (SEC-MALLS-RI). The coating effectiveness was evaluated on the following parameters: fungal decay incidence, weight loss, firmness, total reducing sugar, soluble solid, flesh color, carotene content, pH and titratable acidity. No sign of fungal decay was observed in squashes coated with 122 and 56 kDa chitosans, which were also the most effective treatments in reducing the weight loss. The chitosan with Mw=122 kDa was also the best treatment considering firmness, internal aspect, sugar and carotene content. Then, radiation degraded chitosan was better in C. moschata preservation than the original chitosan. - Highlights: → Original Chitosan was radiation depolymerized producing chitosans with lower molecular weights. → Gamma-irradiated chitosans only exhibit chain scission. → SEC-MALLS-RI chromatography is a useful tool in molecular weight analysis. → Depolymerized chitosans were the best in maintaining the quality and the storage life of coated squashes.

Improved resistance of chemically-modified nanocellulose against thermally-induced depolymerization.

Science.gov (United States)

Agustin, Melissa B; Nakatsubo, Fumiaki; Yano, Hiroyuki

2017-05-15

The study demonstrated the improvement in the resistance of nanocellulose against thermally-induced depolymerization by esterification with benzoyl (BNZ) and pivaloyl (PIV). The change in the degree of polymerization (DP) and molecular weight distribution (MWD) after thermal treatment in nitrogen and in air was investigated using viscometry and gel permeation chromatography. BNZ and PIV nanocellulose esters without α-hydrogens gave higher DP and narrower MWD than pure bacterial cellulose; and the acetyl and myristoyl esters, which possess α-hydrogens. Results also showed that when depolymerization is suppressed, thermal discoloration is also reduced. Resistance against depolymerization inhibits the formation of reducing ends which can be active sites for thermal discoloration. Finally, the findings suggest that benzoylation and pivaloylation can be an excellent modification technique to improve the thermal stability of nanocellulose. Copyright © 2017 Elsevier Ltd. All rights reserved.

Geophysical and Geotechnical Characterization of Beta-1,3/1,6-glucan Biopolymer treated Soil

Science.gov (United States)

Chang, I.; Cho, G.

2012-12-01

Bacteria or microbes in soil excrete hydrocarbon (e.g. polysaccharide) by-products which are called biopolymers. These biopolymers (or sometime biofilms) recently begun to make a mark on soil erosion control, aggregate stabilization, and drilling enhancement. However, the biological effect on soil behavior (e.g. bio-clogging or bio-cementation) has been poorly understood. In this study, the bio-cementation and bio-clogging effect induced by the existence of β-1,3/1,6-glucan biopolymers in soil were evaluated through a series of geophysical and geotechnical characterization tests in laboratory. According to the experimental test results, as the β-1,3/1,6-glucan content in soil increases, the compressive strength and shear wave velocity increase (i.e., bio-cementation) while the hydraulic conductivity decreases (i.e., bio-clogging) but the electrical conductivity increases due to the high electrical conductivity characteristic of β-1,3/1,6-glucan fibers. Coefficient of consolidation variation with the increases of β-1,3/1,6-glucan content in soil. SEM image of β-1,3/1,6-glucan treated soil. Fibers are form matices with soil particles.

Microtubule protein ADP-ribosylation in vitro leads to assembly inhibition and rapid depolymerization

Energy Technology Data Exchange (ETDEWEB)

Scaife, R.M. (Fred Hutchinson Cancer Research Center, Seattle, WA (United States)); Wilson, L. (Univ. of California, Santa Barbara (United States)); Purich, D.L. (Univ. of Florida, Gainesville (United States))

1992-01-14

Bovine brain microtubule protein, containing both tubulin and microtubule-associated proteins, undergoes ADP-ribosylation in the presence of ({sup 14}C)NAD{sup +} and a turkey erythrocyte mono-ADP-ribosyltransferase in vitro. The modification reaction could be demonstrated in crude brain tissue extracts where selective ADP-ribosylation of both the {alpha} and {beta} chains of tubulin and of the high molecular weight microtubule-associated protein MAP-2 occurred. In experiments with purified microtubule protein, tubulin dimer, the high molecular weight microtubule-associated protein MAP-2, and another high molecular weight microtubule-associated protein which may be a MAP-1 species were heavily labeled. Tubulin and MAP-2 incorporated ({sup 14}C)ADP-ribose to an average extent of approximately 2.4 and 30 mol of ADP-ribose/mol of protein, respectively. Assembly of microtubule protein into microtubules in vitro was inhibited by ADP-ribosylation, and incubation of assembled steady-state microtubules with ADP-ribosyltransferase and NAD{sup +} resulted in rapid depolymerization of the microtubules. Thus, the eukaryotic enzyme can ADP-ribosylate tubulin and microtubule-associated proteins to much greater extents than previously observed with cholera and pertussis toxins, and the modification can significantly modulate microtubule assembly and disassembly.

Effect of electron beam-irradiation to b-glucan on its immunomodulating and antitumor activity

Energy Technology Data Exchange (ETDEWEB)

Jung, Yeon Hwan; Lee, Jung Lim; Yoo, Yung Choon [Konyand Univ., Daejeon (Korea, Republic of); Kim, Jae Hoon; Lee, Ju Woon [Korea Atomic Energy Research Institute, Daejeon (Korea, Republic of)

2010-07-01

In this study, in order investigated the effect of electron beam irradiation to b-glucan on its biological activities, we compared immunomodulating and antitumor activity between non-irradiated and electron beam-irradiated b-glucan. EB-glucan was irradiated by electron beam with 10, 30 and 50 kGy. Treatment with EB-glucan resulted in a slight increase of the proliferation of ConA-stimulated splenocytes, and the strongest activity was seen in 50 kGy-treated EB-glucan. EB-glucan teated with 50 kGy also showed increased secretion of cytokines such as IL-2 IFN-{gamma} and IL-6 from ConA-stimulated splenocytes. The activity of EB-glucan to enhance the proliferation of splenocytes and cytokine secretion from ConA-stimulated splenocytes was higher than that of NI-glucan. Furthermore, EB-glucan treated with 50 kGy showed higher activity to activate RAW 264.7 macrophages, comparing with that of NI-glucan. In experiments of antitumor activity, EB-glucan treated with 50 kGy prior to tumor inoculation inhibited an experimental lung metastasis produced by B16-BL6 melanoma cells in mice. But NI-glucan did show no effect. In addition, EB-glucan treated with 50 kGy induced a decrease a decrease of tumor growth in tumor-bearing mice. Collectivelt, these results indicates that electron beam irradiation {beta}-glucan leads its biological functions to enhance immunomodulating and antitumor activity.

Study on Effect of Immune Stimulation of γ-Ray Irradiated β-Glucan on Tilapia

International Nuclear Information System (INIS)

Nguyen Ngoc Duy; Nguyen Quoc Hien; Dang Van Phu

2013-01-01

Low molecular weight β-glucan (LMWβG) and oligoβ-glucan solution were prepared by the hydrothermal steaming combination with γ-irradiation method. The efficiency of the degradation process was demonstrated by gel permeation chromatography (GPC) analysis of the average molecular weight (Mw) of β-glucan. Results showed that the Mw decreased with increasing steaming time, concentration of H 2 O 2 and doses. For LMWβG, Mw reduces from 296,600 Da to 44,400 Da when concentration of H 2 O 2 raises from 2.5% to 10% and for oligoβ-glucan Mw reduces to 7,100 Da at 16 kGy. Tilapia fish was fed with LMWβ and oligoβ-glucan of 100 ppm for 45 days, was challenged with Strep. Agalactidae bacterial to investigate immune stimulation. The results indicated that oligoβ-glucan has higher immune stimulation effect compared to LMWβG. The effect of oligoβ-glucan various concentrations of 50, 100, and 150 ppm was investigated. Results showed that survival rate was the highest for oligoβ-glucan of 150 ppm. (author)

Randomized, double-blind, placebo-controlled, crossover study to evaluate the effects of beta-1,3/1,6 glucan on stress associated with daily lifestyle in healthy subjects

Directory of Open Access Journals (Sweden)

Yoshihiko Ojiri

2015-04-01

Full Text Available Background: Fatigue is attributable to physical and psychological stress. Fatigue is also a common symptom which occurs in both sick and healthy individuals. Although its mechanism of cause is complex, fatigue from stress is known to affect the existing equilibrium of the immune system. However, nutrition, such as beta-1,3/1,6 glucan, has been reported to play an important role in regulating stress and fatigue states, via modulating a weakened immune system. In this study, a popular and healthy beverage in Okinawa, Japan, containing a soluble baker’s yeast in black koji vinegar (Moromisu, was provided to healthy subjects with a non-strenuous daily lifestyle. Results: By performing statistical analysis on the results of the Profile of Mood States (POMS survey, we observed that overall study results (n=14 demonstrated significant differences in fatigue and confusion in the POMS factors. Conclusions: In this study we confirmed that beta-1,3/1,6 glucan improved some of the factors related to stress and fatigue, as indicated by evaluation of POMS survey results.

Beta-Glucan induced immune modulation of wound healing in common carp (Cyprinus carpio)

OpenAIRE

Jiménez, Natalia Ivonne Vera; Nielsen, Michael Engelbrecht; Lindenstrøm, Thomas

2012-01-01

Immune modulators are compounds capable to interact with the immune system and to modify the host response. This interaction enhances non-specific defense mechanisms, improving health and promoting survival. β-glucans are glucose polysaccharides present in sea weed, bacteria, fungi and cereal but not in animals. β-glucans are commonly used as immune modulators, but the mechanisms through which the modulation is achieved remains to be understood. Wound healing and tissue regeneration are essen...

A screening method for β-glucan hydrolase employing Trypan Blue-coupled β-glucan agar plate and β-glucan zymography.

Science.gov (United States)

Park, Chang-Su; Yang, Hee-Jong; Kim, Dong-Ho; Kang, Dae-Ook; Kim, Min-Soo; Choi, Nack-Shick

2012-06-01

A new screening method for β-(1,3-1,6) glucan hydrolase was developed using a pure β-glucan from Aureobaisidum pullulans by zymography and an LB-agar plate. Paenibacillus sp. was screened as a producer a β-glucan hydrolase on the Trypan Blue-coupled β-glucan LB-agar plate and the activity of the enzyme was analyzed by SDS-β-glucan zymography. The β-glucan was not hydrolyzed by Bacillus spp. strains, which exhibit cellulolytic activity on CMC zymography. The gene, obtaining by shotgun cloning and encoding the β-glucan hydrolase of Paenibacillus sp. was sequenced.

Survey of Lignin-Structure Changes and Depolymerization during Ionic Liquid Pretreatment

Energy Technology Data Exchange (ETDEWEB)

Dutta, Tanmoy; Isern, Nancy G.; Sun, Jian; Wang, Eileen; Hull, Sarah; Cort, John R.; Simmons, Blake A.; Singh, Seema

2017-09-26

A detailed study of chemical changes in lignin structure during the ionic liquid (IL) pretreatment process is not only pivotal for understanding and overcoming biomass recalcitrance during IL pretreatment, but also is necessary for designing new routes for lignin valorization. Chemical changes in lignin were systematically studied as a function of pretreatment temperature, time and type of IL used. Kraft lignin was used as the lignin source and common pretreatment conditions were employed using three different ILs of varying chemical structure in terms of acidic or basic character. The chemical changes in the lignin structure due to IL pretreatment processes were monitored using 1H-13C HSQC NMR, 31P NMR, elemental analysis, GPC, FT-IR, and the depolymerized products were analyzed using GC-MS. Although pretreatment in acidic IL, triethylammonium hydrogensulfate ([TEA][HSO4]) results in maximum decrease in β-aryl ether bond, maximum dehydration and recondensation pathways were also evident, with the net process showing a minimum decrease in the molecular weight of regenerated lignin. However, 1-ethyl-3-methylimidazolium acetate ([C2C1Im][OAc]) pretreatment yields a smaller decrease in the β-aryl ether content along with minimum evidence of recondensation, resulting in the maximum decrease in the molecular weight. Cholinium lysinate ([Ch][Lys]) pretreatment shows an intermediate result, with moderate depolymerization, dehydration and recondensation observed. The depolymerization products after IL pretreatment are found to be a function of the pretreatment temperature and the specific chemical nature of the IL used. At higher pretreatment temperature, [Ch][Lys] pretreatment yields guaiacol, [TEA][HSO4] yields guaiacylacetone, and [C2C1Im][OAc] yields both guaiacol and guaiacylacetone as major products. These results clearly indicate that the changes in lignin structure as well as the depolymerized product profile depend on the pretreatment conditions and the nature

Beta-Glucan induced immune modulation of wound healing in common carp (Cyprinus carpio)

DEFF Research Database (Denmark)

Jiménez, Natalia Ivonne Vera

by hydrogen peroxide. To determine the effect of hydrogen peroxide release in fibroblast proliferation during wound healing, scratch-wounded CCB fibroblasts were stimulated with different doses of hydrogen peroxide and the wound closure was followed by image analysis. Fibroblast stimulation with low doses...... suitable for tissue regeneration or oxidative stress. To conclude, β-glucan treatment enhanced wound closure in carp, probably due to the enhancement of a localized inflammatory response. The wound healing modulatory effect of β-glucan seems to be orchestrated by the immune system, since no direct effect...

High molecular weight glucan of the culinary medicinal mushroom Agaricus bisporus is an a-glucan that forms complexes with low molecular weight galactan

NARCIS (Netherlands)

Smiderle, F.; Sassaki, G.L.; Arkel, van J.; Lacomini, M.; Wichers, H.J.; Griensven, van L.J.L.D.

2010-01-01

An a-glucan was isolated from the culinary medicinal mushroom A. bisporus by hot water extraction, ethanol precipitation and DEAE-cellulose chromatography. The resulting material showed a single HMW peak excluded from a Sephadex G50 column that could completely be degraded by a-amylase treatment.

Preparation and characteristics of beta-glucan concentrate from brewer's yeast as the additive substance in foods

Directory of Open Access Journals (Sweden)

Ľubomír Mikuš

2013-02-01

Full Text Available Normal 0 21 false false false SK X-NONE X-NONE The brewer¢s yeast was used for preparation of concentrate with content of β-glucan. Hot water extraction (100°C, 5 hours and subsequently an alkaline extraction of sediment using 1 M NaOH at 90°C for 1 hour were used. β-glucan concentrate containing 59,15 % of β-glucan had good functional properties (water binding capacity 13,34 g water/1 g concentrate, fat binding capacity 6,86 g fat/1 g concentrate and indicated biological action too.  At concentration of 2 mg/ml DMSO (dimethylsulfoxid was viability of murine L1210 leukemic cells reduced to 76.15 %. When observing the antioxidant activity it was identified, that the lipid peroxidation in linoleic acid samples was decreased during the presence of β-glucan concentrate. These results and good sensory properties like a bright colour and the pleasant taste and smell indicate, that prepared β-glucan concentrate has a potential to be used to improve the health – beneficial substances in the foods.doi:10.5219/258

The effects of orally administered Beta-glucan on innate immune responses in humans, a randomized open-label intervention pilot-study.

Directory of Open Access Journals (Sweden)

Jenneke Leentjens

Full Text Available To prevent or combat infection, increasing the effectiveness of the immune response is highly desirable, especially in case of compromised immune system function. However, immunostimulatory therapies are scarce, expensive, and often have unwanted side-effects. β-glucans have been shown to exert immunostimulatory effects in vitro and in vivo in experimental animal models. Oral β-glucan is inexpensive and well-tolerated, and therefore may represent a promising immunostimulatory compound for human use.We performed a randomized open-label intervention pilot-study in 15 healthy male volunteers. Subjects were randomized to either the β -glucan (n = 10 or the control group (n = 5. Subjects in the β-glucan group ingested β-glucan 1000 mg once daily for 7 days. Blood was sampled at various time-points to determine β-glucan serum levels, perform ex vivo stimulation of leukocytes, and analyze microbicidal activity.β-glucan was barely detectable in serum of volunteers at all time-points. Furthermore, neither cytokine production nor microbicidal activity of leukocytes were affected by orally administered β-glucan.The present study does not support the use of oral β-glucan to enhance innate immune responses in humans.ClinicalTrials.gov NCT01727895.

Effect of Immune-Enhancing Enteral Nutrition Enriched with or without Beta-Glucan on Immunomodulation in Critically Ill Patients

Directory of Open Access Journals (Sweden)

Jae Gil Lee

2016-06-01

Full Text Available We investigated whether high-protein enteral nutrition with immune-modulating nutrients (IMHP enriched with β-glucan stimulates immune function in critically ill patients. In a randomized double-blind placebo-controlled study, 30 patients consumed one of three types of enteral nutrition: a control or IMHP with and without β-glucan. The IMHP with β-glucan group showed increases in natural killer (NK cell activities relative to the baseline, and greater increases were observed in NK cell activities relative to the control group after adjusting for age and gender. The IMHP groups with and without β-glucan had greater increases in serum prealbumin and decreases in high-sensitivity C-reactive protein (hs-CRP than the control group. The control group had a greater decrease in peripheral blood mononuclear cell (PBMC interleukin (IL-12 production than the IMHP with and without β-glucan groups. In all patients, the change (Δ in hs-CRP was correlated with Δ prealbumin and Δ PBMC IL-12, which were correlated with ΔNK cell activity and Δ prealbumin. This study showed beneficial effects of a combination treatment of β-glucan and IMHP on NK cell activity. Additionally, strong correlations among changes in NK cell activity, PBMC IL-12, and hs-CRP suggested that β-glucan could be an attractive candidate for stimulating protective immunity without enhanced inflammation (ClinicalTrials.gov: NCT02569203.

Kraft Lignin Depolymerization in an Ionic Liquid without a Catalyst

Directory of Open Access Journals (Sweden)

Amadou Diop

2015-06-01

Full Text Available In this paper, the depolymerization of lignin was successfully achieved by the thermal treatment of kraft lignin in butyl-1,8-diazabicyclo[5.4.0]undec-7-enium chloride ([DBUC4+][Cl-] without a catalyst. The thermal treatment experiments were performed in an oven at 150, 200, and 250 °C for 1 h. The changes in kraft lignin structure over the course of depolymerization were characterized by gel permeation chromatography (GPC, Fourier transform infrared (FTIR spectroscopy, and 1H / 31P NMR analyses. GPC chromatograms indicated that the retention time of the original kraft lignin had shifted toward higher values after the thermal treatment, which indicated lignin depolymerization. The average molecular weight of the lignin obtained after 1 h reaction time decreased by 23, 70, and 58 wt% for the treatment at 150, 200, and 250 °C, respectively. FTIR spectra indicated the cleavage of β-O-4 bonds of kraft lignin. The 1H NMR spectra showed demethylation of all treated kraft lignins. Moreover, the 31P NMR analysis demonstrated that the demethylation phenomenon of the treated kraft lignin contributed to the formation of catechol groups.

Method for hull-less barley transformation and manipulation of grain mixed-linkage beta-glucan.

Science.gov (United States)

Lim, Wai Li; Collins, Helen M; Singh, Rohan R; Kibble, Natalie A J; Yap, Kuok; Taylor, Jillian; Fincher, Geoffrey B; Burton, Rachel A

2018-05-01

Hull-less barley is increasingly offering scope for breeding grains with improved characteristics for human nutrition; however, recalcitrance of hull-less cultivars to transformation has limited the use of these varieties. To overcome this limitation, we sought to develop an effective transformation system for hull-less barley using the cultivar Torrens. Torrens yielded a transformation efficiency of 1.8%, using a modified Agrobacterium transformation method. This method was used to over-express genes encoding synthases for the important dietary fiber component, (1,3;1,4)-β-glucan (mixed-linkage glucan), primarily present in starchy endosperm cell walls. Over-expression of the HvCslF6 gene, driven by an endosperm-specific promoter, produced lines where mixed-linkage glucan content increased on average by 45%, peaking at 70% in some lines, with smaller increases in transgenic HvCslH1 grain. Transgenic HvCslF6 lines displayed alterations where grain had a darker color, were more easily crushed than wild type and were smaller. This was associated with an enlarged cavity in the central endosperm and changes in cell morphology, including aleurone and sub-aleurone cells. This work provides proof-of-concept evidence that mixed-linkage glucan content in hull-less barley grain can be increased by over-expression of the HvCslF6 gene, but also indicates that hull-less cultivars may be more sensitive to attempts to modify cell wall composition. © 2017 Institute of Botany, Chinese Academy of Sciences.

The Role of Yeast Beta Glucan on Blood Coagulation in Streptozotocin-Induced Diabetes and Irradiated Rats

International Nuclear Information System (INIS)

El-Kashoury, M.M.A.; Abdel Fattah, S.M.; Ramadan, L.A.; El-Denshary, E.S.

2016-01-01

Clotting abnormalities are observed after exposure to ionizing radiation as well as in diabetes melittus. The objective of this study is to elucidate the role of yeast beta glucan (YBG) in the modulation of some biochemical variations observed in γ-irradiated, diabetic and diabeticγγ-irradiated rats. Gamma-irradiation was performed through the whole body exposure of rats to 6 Gy administered in four fractions of 1.5 Gy two times per week for two weeks. Diabetes was induced by a single intraperitoneal injection of streptozotocin (55 mg/kg body weight). YBG was given orally to male albino rats (1 g/kg body weight) for two weeks post irradiation and/or induction of diabetes. Animals were divided into 4 main groups: 1- control, 2- γ-irradiated, 3- diabetic and 4- diabetic-γ-irradiated rats. Each group was subdivided into 2 subgroups (a) untreated and (b) treated. The 3rd and 14th day, after the last dose of radiation in the irradiated groups and after the induction of diabetes in diabetic groups, were chosen to evaluate the effect of oral YBG in irradiated and/or diabetic rats. The results revealed that the body weight decreased significantly in irradiated, diabetic and diabetic–irradiated rats. The loss of weight was accompanied by a reduction in the pancreas weight. Glucose concentration was significantly increased in diabetic group at the two time intervals. It is worth noting that, radiation ameliorated blood glucose level in diabetic-γ-irradiated group. Radiation exposure and/or diabetes caused an oxidative stress manifested by a significant increase of malondialdhyde (MDA) accompanied by a significant decrease in glutathione (GSH) level. This oxidative stress caused disturbances in the measured clotting parameters by enhancing platelet aggregation (PA) induced by arachidonic acid and increased thrombin level as concluded from the significant shortening of prothrombin time (PT) and activated partial thromboplastin time (APTT). Also, exposure to radiation

Effects of gamma irradiation on the physical and structural properties of β-glucan

International Nuclear Information System (INIS)

Byun, Eui-Hong; Kim, Jae-Hun; Sung, Nak-Yun; Choi, Jong-il; Lim, Seong-Taek; Kim, Kwang-Hoon; Yook, Hong-Sun; Byun, Myung-Woo; Lee, Ju-Woon

2008-01-01

This study was carried out to evaluate the effect of gamma irradiation on the physical and structural properties of β-glucan. β-Glucan solution (10%, w/v) was exposed to a cobalt-60 source (10, 30, and 50 kGy). Gel permeation chromatography data showed that the average molecular weight of irradiated β-glucan significantly decreased as the irradiation dose increased. In addition, gamma irradiation improved the solubility and decreased the viscosity of β-glucan by the radiolysis of the glycosidic bonds, and this effect was dependent upon the absorbed dose. Fourier transform infrared spectroscopy results showed that the functional groups of β-glucan were not significantly affected by gamma irradiation. Scanning electron microscopy results showed that the irradiated β-glucan was deformed into smaller granules. Therefore, gamma irradiation could be used in commercial processes as an effective method to resolve the physical problems involved in the use of β-glucan with high viscosity and low solubility

Fungi, beta-Glucan, and Bacteria in Nasal Lavage of Greenhouse Workers and Their Relation to Occupational Exposure

DEFF Research Database (Denmark)

Madsen, A. M.; Tendal, K.; Thilsing, T.

2013-01-01

occupational exposure to fungi, -glucan, and bacteria and contents of fungi, -glucan, and bacteria in nasal lavage (NAL) of greenhouse workers. We also studied whether contents of microorganisms in NAL were related to gender, time of the work week, and runny nose. NAL samples (n 135) were taken Monday morning....... The ratios of fungi in NAL between Thursday at noon and Monday morning were 14 (median value) for men and 3.5 for women. Gender had no effect on the exposure level but had a significant effect on the content of fungi, -glucan, and bacteria in NAL, with the highest contents in NAL of men. On Thursdays......, the median content of fungi in NAL samples of men without runny noses was 9408 cfu per NAL sample, whereas the same content for women was 595 cfu per NAL sample. Workers with runny noses had fewer fungi in NAL than workers without runny noses. A higher content of -glucan per fungal spore was found in NAL...

Polysaccharides and their depolymerized fragments from Costaria costata: Molecular weight and sulfation-dependent anticoagulant and FGF/FGFR signal activating activities.

Science.gov (United States)

Hou, Ningning; Zhang, Meng; Xu, Yingjie; Sun, Zhongmin; Wang, Jing; Zhang, Lijuan; Zhang, Quanbin

2017-12-01

Crude polysaccharides from Costaria costata were extracted by hot water and further fractionated by anion exchange chromatography into three polysaccharide fractions. Three low molecular weight fragments were then prepared by degradation of the polysaccharides with hydrogen peroxide and ascorbic acid. The structural features of the polysaccharides and their low molecular weight fragments were elucidated for the first time based on the HGPC, FT-IR, NMR, MS, monosaccharide composition, and other chemical analyses. Their anticoagulant and FGF-1, -2, -7, -8, -9, -10/FGFR1c signaling activation activities in BaF3 cells were also examined. Our studies showed that the polysaccharides were sulfated at different positions of galactose and fucose residues. The APTT-, PT- and TT-based anticoagulant assay results indicated that a high molecular weight and a higher degree of sulfation were essential for their anticoagulant activities. In contrast, not only the polysaccharides but also the depolymerized fragments showed significant FGF/FGFR signal activating activities in a FGF-, molecular weight-, and sulfation-dependent manner. The results presented in current study demonstrated the potential use of the polysaccharides and their fragments as anticoagulants and FGF signal regulators. Copyright © 2017 Elsevier B.V. All rights reserved.

Identifying the catalytic components of cellulose synthase and the maize mixed-linkage beta-glucan synthase

Energy Technology Data Exchange (ETDEWEB)

Nicholas C Carpita

2009-04-20

Five specific objectives of this project are to develop strategies to identify the genes that encode the catalytic components of "mixed-linkage" (1→3),(1→4)-beta-D-glucans in grasses, to determine the protein components of the synthase complex, and determine the biochemical mechanism of synthesis. We have used proteomic approaches to define intrinsic and extrinsic polypeptides of Golgi membranes that are associated with polysaccharide synthesis and trafficking. We were successful in producing recombinant catalytic domains of cellulose synthase genes and discovered that they dimerize upon concentration, indicating that two CesA proteins form the catalytic unit. We characterized a brittle stalk2 mutant as a defect in a COBRA-like protein that results in compromised lignin-cellulose interactions that decrease tissue flexibility. We used virus-induced gene silencing of barley cell wall polysaccharide synthesis by BSMV in an attempt to silence specific members of the cellulose synthase-like gene family. However, we unexpectedly found that regardless of the specificity of the target gene, whole gene interaction networks were silenced. We discovered the cause to be an antisense transcript of the cellulose synthase gene initiated small interfering RNAs that spread silencing to related genes.

Characterization of cereal β-glucan extracts from oat and barley and quantification of proteinaceous matter.

Directory of Open Access Journals (Sweden)

Claudia Zielke

Full Text Available An extraction method for mixed-linkage β-glucan from oat and barley was developed in order to minimize the effect of extraction on the β-glucan structure. β-Glucan were characterized in terms of molecular size and molar mass distributions using asymmetric flow field-flow fractionation (AF4 coupled to multiangle light scattering (MALS, differential refractive index (dRI and fluorescence (FL detection. The carbohydrate composition of the extracts was analysed using polysaccharide analysis by carbohydrate gel electrophoresis (PACE and high-performance anion-exchange chromatography (HPAEC. Whether there were any proteinaceous moieties linked to β-glucan was also examined. Purified extracts contained 65% and 53% β-glucan for oats and barley, respectively. The main impurities were degradation products of starch. The extracts contained high molecular weight β-glucan (105-108 g/mol and large sizes (root-mean-square radii from 20 to 140 nm. No proteins covalently bound to β-glucan were detected; therefore, any suggested functionality of proteins regarding the health benefits of β-glucan can be discounted.

Water mobility in the endosperm of high beta-glucan barley mutants as studied by nuclear magnetic resonance imaging

DEFF Research Database (Denmark)

Seefeldt, Helene Fast; van den Berg, Frans W.J.; Köckenberger, Walter

2007-01-01

1H NMR imaging (MRI) was used as a noninvasive technique to study water distribution and mobility in hydrated barley (Hordeum vulgare L.) seeds of accessions with varying content of beta glucan (BG), a highly hygroscopic cell wall component. High contents of BG in barley are unfavorable in malting...... where it leads to clotting of filters and hazing of beer as well as in animal feed where it hinders the rapid uptake of energy. However, a high content of BG has a positive nutritional effect, as it lowers the cholesterol and the glycaemic index. It was studied whether water distribution and mobility...... were related to content and location of BG. Water mobility was investigated by following the rate and mode of desiccation in hydrated single seeds. In order to determine the different water components, a multispin echo experiment was set up to reveal the T2 transverse relaxation rates of water within...

Cloning and expression of the Aspergillus oryzae glucan 1,3-beta-glucosidase A (exgA) in Pichia pastoris.

Science.gov (United States)

Boonvitthya, Nassapat; Tanapong, Phatrapan; Kanngan, Patcharaporn; Burapatana, Vorakan; Chulalaksananukul, Warawut

2012-10-01

The glucan 1,3-beta-glucosidase A gene (exgA) from Aspergillus oryzae and fused to the Saccharomyces cerevisiae signal peptide (α-factor) was expressed under the control of either a constitutive (GAP) or an inducible (AOX1) promoter in Pichia pastoris. A 1.4-fold higher extracellular enzyme activity (2 U/ml) was obtained using the AOX1 inducible expression system than with the GAP constitutive promoter (1.4 U/ml). The purified recombinant ExgA enzyme, with a yield of 10 mg protein/l culture supernatant, was about 40 kDa by SDS-PAGE analysis with a specific activity of 289 U/mg protein. The enzyme was optimally active at 35 °C and pH 5.0 and displayed a K(M) and V(max) of 0.56 mM and 10,042 μmol/(min mg protein), respectively, with p-nitrophenyl-β-D-glucopyranoside as the substrate. Moreover, it was tolerant to glucose inhibition with a K(i) of 365 mM.

Potential Effects of Nichi Glucan as a Food Supplement for Diabetes Mellitus and Hyperlipidemia: Preliminary Findings from the Study on Three Patients from India

Directory of Open Access Journals (Sweden)

Vidyasagar Devaprasad Dedeepiya

2012-01-01

Full Text Available Beta Glucan food supplements have been reported to be of benefit in diabetes and hyperlipidemia. We report a pilot study of the effects of Nichi Glucan, 1, 3-1, 6 Beta Glucan food supplement, in lowering the blood glucose and lipid levels in three patients with noninsulin-dependent diabetes mellitus (NIDDM from India. These patients had increased blood glucose and lipid levels inspite of routine antidiabetic and lipid level lowering medications. Each of the participants took 1.5 g of Nichi Glucan per day with food for two months along with their routine medications. The relevant parameters to assess glycemic status and lipid levels were calculated at the baseline and at the end of two months. After two months of continuous consumption, in one patient, the HbA1c decreased from 9.1% to 7.8%, and the glycemic target of HbA1c <6.5% laid down by the International Diabetes Federation was reached in two patients. Lipid levels also decreased significantly. Based on our findings, Nichi Glucan food supplement can be considered along with routine medications in patients with Type II diabetes with hyperlipidemia. Further studies are needed to validate the results.

Distribution and molecular characterization of β-glucans from hull-less barley bran, shorts and flour.

Science.gov (United States)

Zheng, Xueling; Li, Limin; Wang, Qi

2011-01-01

Six hull-less barley cultivars widely grown in China were roller-milled to produce bran, shorts and flour fractions. The distribution and molecular characteristics of β-glucans from the three roller-milled fractions were investigated. The β-glucan contents in the six hull-less barley cultivars varied from 4.96% to 7.62%. For all the six cultivars, the shorts fraction contained the highest concentration of β-glucan (8.12-13.01%), followed by bran (6.15-7.58%) and flour (2.48-2.95%). Crude β-glucans were prepared from the three roller-milled fractions using aqueous sodium carbonate (pH 10). These preparations contained 45.38-71.41% β-glucan, 10.81-17.26% arabinoxylan, 2.6-9.6% protein, 2.7-9.0% starch, and 5.23-9.68% ash. Purification using α-amylase and β-xylanase in combination with pH adjustment and dialysis produced high purity β-glucan preparations (91-95%). The molecular weight (Mw) of β-glucan preparations from roller-milled fractions ranged from 117,600 to 852,400 g/mol. β-Glucan from flour had higher Mw than those from shorts and bran within the same cultivar, and β-glucan preparations from bran had the lowest Mw.

Enzymatic depolymerization of gum tragacanth: bifidogenic potential of low molecular weight oligosaccharides.

Science.gov (United States)

Gavlighi, Hassan Ahmadi; Michalak, Malwina; Meyer, Anne S; Mikkelsen, J Dalgaard

2013-02-13

Gum tragacanth derived from the plant "goat's horn" (Astragalus sp.) has a long history of use as a stabilizing, viscosity-enhancing agent in food emulsions. The gum contains pectinaceous arabinogalactans and fucose-substituted xylogalacturonans. In this work, gum tragacanth from Astragalus gossypinus was enzymatically depolymerized using Aspergillus niger pectinases (Pectinex BE Color). The enzymatically degraded products were divided into three molecular weight fractions via membrane separation: HAG1 10 kDa. Compositional and linkage analyses showed that these three fractions also varied with respect to composition and structural elements: HAG1 and HAG2 were enriched in arabinose, galactose, and galacturonic acid, but low in fucose and xylose, whereas HAG3 was high in (terminal) xylose, fucose, and 1,4-bonded galacturonic acid, but low in arabinose and galactose content. The growth-stimulating potential of the three enzymatically produced gum tragacanth fractions was evaluated via growth assessment on seven different probiotic strains in single-culture fermentations on Bifidobacterium longum subsp. longum (two strains), B. longum subsp. infantis (three strains), Lactobacillus acidophilus , B. lactis, and on one pathogenic strain of Clostridium perfringens . The fractions HAG1 and HAG2 consistently promoted higher growth of the probiotic strains than HAG3, especially of the three B. longum subsp. infantis strains, and the growth promotion on HAG1 and HAG2 was better than that on galactan (control). HAG3 completely inhibited the growth of the C. perfringens strain. Tragacanth gum is thus a potential source of prebiotic carbohydrates that exert no viscosity effects and which may find use as natural functional food ingredients.

Barley β-glucan reduces blood cholesterol levels via interrupting bile acid metabolism.

Science.gov (United States)

Wang, Yanan; Harding, Scott V; Thandapilly, Sijo J; Tosh, Susan M; Jones, Peter J H; Ames, Nancy P

2017-11-01

Underlying mechanisms responsible for the cholesterol-lowering effect of β-glucan have been proposed, yet have not been fully demonstrated. The primary aim of this study was to determine whether the consumption of barley β-glucan lowers cholesterol by affecting the cholesterol absorption, cholesterol synthesis or bile acid synthesis. In addition, this study was aimed to assess whether the underlying mechanisms are related to cholesterol 7α hydroxylase (CYP7A1) SNP rs3808607 as proposed by us earlier. In a controlled, randomised, cross-over study, participants with mild hypercholesterolaemia (n 30) were randomly assigned to receive breakfast containing 3 g high-molecular weight (HMW), 5 g low-molecular weight (LMW), 3 g LMW barley β-glucan or a control diet, each for 5 weeks. Cholesterol absorption was determined by assessing the enrichment of circulating 13C-cholesterol over 96 h following oral administration; fractional rate of synthesis for cholesterol was assessed by measuring the incorporation rate of 2H derived from deuterium oxide within the body water pool into the erythrocyte cholesterol pool over 24 h; bile acid synthesis was determined by measuring serum 7α-hydroxy-4-cholesten-3-one concentrations. Consumption of 3 g HMW β-glucan decreased total cholesterol (TC) levels (P=0·029), but did not affect cholesterol absorption (P=0·25) or cholesterol synthesis (P=0·14). Increased bile acid synthesis after consumption of 3 g HMW β-glucan was observed in all participants (P=0·049), and more pronounced in individuals carrying homozygous G of rs3808607 (P=0·033). In addition, a linear relationship between log (viscosity) of β-glucan and serum 7α-HC concentration was observed in homozygous G allele carriers. Results indicate that increased bile acid synthesis rather than inhibition of cholesterol absorption or synthesis may be responsible for the cholesterol-lowering effect of barley β-glucan. The pronounced TC reduction in G allele carriers of rs

Effects of Low Molecular Weight Yeast β-Glucan on Antioxidant and Immunological Activities in Mice

Directory of Open Access Journals (Sweden)

Na Lei

2015-09-01

Full Text Available To evaluate the antioxidant and immune effects of low molecular yeast β-glucan on mice, three sulfated glucans from Saccharomyces cerevisiae (sGSCs with different molecular weight (MW and degrees of sulfation (DS were prepared. The structures of the sGSCs were analyzed through high performance liquid chromatography-gel permeation chromatography (HPLC-GPC and Fourier transform infrared spectroscopy (FTIR. sGSC1, sGSC2, and sGSC3 had MW of 12.9, 16.5 and 19.2 kDa, respectively, and DS of 0.16, 0.24 and 0.27, respectively. In vitro and in vivo experiments were conducted to evaluate the antioxidant and immunological activities of the sGSCs. In vitro experiment, the reactive oxygen species (ROS scavenging activities were determined. In vivo experiment, 50 male BALB/c mice were divided into five groups. The sGSC1, sGSC2 and sGSC3 treatment groups received the corresponding sGSCs at 50 mg/kg/day each. The GSC (glucans from Saccharomyces cerevisiae treatment group received 50 mg/kg/day GSC. The normal control group received equal volume of physiological saline solution. All treatments were administered intragastrically for 14 day. Results showed that sGSC1, sGSC2 and sGSC3 can scavenge 1,1-diphenyl-2-picryl-hydrazyl (DPPH, superoxide, and hydroxyl radicals in vitro. The strength of the radical scavenging effects of the sGSCs was in the order of sGSC1 > sGSC2 > sGSC3. Oral administration of sGSC1 significantly improved serum catalase (CAT and glutathione peroxidase (GSH-Px activities and decreased malondialdehyde (MDA level in mice. sGSC1 significantly improved the spleen and thymus indexes and the lymphocyte proliferation, effectively enhanced the percentage of CD4+ T cells, decreased the percentage of CD8+ T cells, and elevated the CD4+/CD8+ ratio. sGSC1 significantly promoted the secretion of IL-2 and IFN-γ. These results indicate that sGSC1 with low MW and DS has better antioxidant and immunological activities than the other sGSCs, and sGSC1 could

Study on the immuno stimulation of radiation degraded β-glucan in swiss mice

International Nuclear Information System (INIS)

Nguyen Thanh Long; Le Quang Luan

2015-01-01

The mixtures β-glucan extracted from the yeast cell wall were irradiated under gamma rays from a Co-60 source at doses of 100, 200 and 300 kGy in order to prepare water-soluble β-glucan. Yields of the water soluble β-glucan produced are 25.9, 49.1, 66.71%, and their molecular weights (Mw) are 30.5, 24.9 and 10.8 kDa, respectively. There are no any new peak in the IR spectra of the irradiated β-glucan samples, but the intensity ratio between the peaks at wavenumber of 1156 cm"-"1 (assigned to C-O-C bond) and of 1040 cm"-"1 (assigned to C-C bond) in glycosidic linkages was reduced with irradiation dose. These results revealed that gamma irradiation did not cause any change in the β-glucan structure except the scissions of glycosidic linkages. In this study, immuno stimulation of the irradiated β-glucan was also investigated for the Swiss mice. After 28 days supplying with the irradiated β-glucan, not only cellular indexes (white blood cell, neutrophils and lymphocytes counts), but also humoral immunity indexes (IgA and IgM) of the mice significantly increased and the highest effects was obtained for the mice supplied with the oligo β-glucan prepared by gamma irradiation at 200 kGy. Thus, the water soluble oligo β-glucan with Mw ~ 24.9 kDa prepared by gamma radiation much stimulated the natural immune system (non-specific immunity) in mice including both the cellular and humoral immunities. Particularly, the irradiated β-glucan is a very promising product for preparation of functional foods aiming at cancer prevention. (author)

Effect of supplementation of Manno-Oligosaccharide and b-glucans on maize based meal on commercial broilers

Directory of Open Access Journals (Sweden)

R.C.Shendare

2008-01-01

Full Text Available A study with 200 vencobb broilers was carried out to compare the effect of the use of Manno-Oligosaccharide and b-glucans of Saccharomyces cerevisiae cell wall or growth promoter ( AGRIMOS and reg; feed in the diet @ 1Kg /ton of feed to the broiler. Diets were based on maize meal. A completely randomized experimental design was used, and the obtained data were evaluated by analysis. The following parameters were measured: feed intake, daily weight gain, feed conversion ratio, and mortality. After 6 weeks of fattening, the average live weight of broilers in the experimental group was 1821.11g, while the average live weight of broilers in control group was 1712.22g (P<0.01. Supplementation of Manno-Oligosaccharide and b-glucans preparation influence the achievement of higher live weights of broilers from the experimental group ( 5.37% , compared to the control and enhanced feed conversion ( 8.45 % . It was concluded that the effect of the inclusion of Manno-Oligosaccharide and b-glucans in the diet shows significantly higher body weight gain and improvement in feed efficiency as compared to the control diet. [Vet World 2008; 1(1.000: 13-15

Protective effect of yeast β-glucan on immune system of mice irradiated by carbon ions

International Nuclear Information System (INIS)

Wang Ying; Lu Dong; Wei Wei; Jing Xigang; Wang Jufang; Li Wenjian

2012-01-01

Abstract. To detect Yeast β-glucan's protective effect on mice's immune system after C ion beam radiation, mice were used as the test model. We observed the weight, hair color and behavior of mice everyday within a 7 d period of time after irradiation. Meanwhile, the content of white blood cell, on the 2nd and 7th day after irradiation was detected. We detected the thymus and spleen SOD, GSH-PX activity and MDA content of the mice on the 8th day. The results showed that yeast β-glucan could reduce the rapid weight loss of mice, increase white blood cell content, increase thymus and spleen SOD, GSH-PX activity, decrease MDA content of thymus and spleen. These results indicate that yeast 13-glucan can protect mice's immune system against C ion beam radiation damage. (authors)

Alkaline Depolymerization of Polyethylene Terephthalate Plastic Waste

OpenAIRE

Ammar F. Abbas

2016-01-01

Depolymerization reaction is considered one of the most significant ways of converting waste polyethylene terephthalate in to terephthalic acid. The water polyethylene terephthalate bottle waste was collected from different places in Baghdad. The collection step shows that there is plenty amount of polyethylene terephthalate suitable to be an important source of terephthalic acid production.PET plastic waste conversion to terephthalic acid by depolymerization process was examined. The effect ...

Alkaline Depolymerization of Polyethylene Terephthalate Plastic Waste

Directory of Open Access Journals (Sweden)

Ammar F. Abbas

2016-02-01

Full Text Available Depolymerization reaction is considered one of the most significant ways of converting waste polyethylene terephthalate in to terephthalic acid. The water polyethylene terephthalate bottle waste was collected from different places in Baghdad. The collection step shows that there is plenty amount of polyethylene terephthalate suitable to be an important source of terephthalic acid production.PET plastic waste conversion to terephthalic acid by depolymerization process was examined. The effect of ethylene glycol amount, reaction time (up to 90 minutes and reaction temperature (from 70 to 170° C on the polyethylene terephthalate conversion was obtained.The kinetic study shows that the ordination of the depolymerization reaction of PET is first order irreversible reaction with 31103.5 J/mole activation energy.A 97.9 % terephthalic acid purity has been obtained by purification with N, N-dimethylformamide.

Alkaline Depolymerization of Polyethylene Terephthalate Plastic Waste

Directory of Open Access Journals (Sweden)

Ammar S. Abbas

2016-02-01

Full Text Available Depolymerization reaction is considered one of the most significant ways of converting waste polyethylene terephthalate in to terephthalic acid. The water polyethylene terephthalate bottle waste was collected from different places in Baghdad. The collection step shows that there is plenty amount of polyethylene terephthalate suitable to be an important source of terephthalic acid production. PET plastic waste converting to terephthalic acid by depolymerization process was examined. The effect of ethylene glycol amount, reaction time (up to 90 minutes and reaction temperature (from 70 to 170° C on the polyethylene terephthalate conversion was obtained. The kinetic study shows that the ordination of the depolymerization reaction of PET is first order irreversible reaction with 31103.5 J/mole activation energy. A 97.9 % terephthalic acid purity has been obtained by purification with N, N-dimethylformamide. Normal 0 false false false EN-US X-NONE AR-SA

Evaluation on prebiotic properties of β-glucan and oligo-β-glucan from mushrooms by human fecal microbiota in fecal batch culture

Directory of Open Access Journals (Sweden)

Chiraphon Chaikliang

2015-11-01

Full Text Available Background: β-glucan is dietary fiber, a structural polysaccharide, β-linked linear chains of D-glucose polymers with variable frequency of branches. β-glucan is isolated from different sources such as cell walls of baker’s yeast (Saccharomyces cerevisiae, cereals (oat and barley and various species of mushrooms. Among 8 mushrooms in the study, Schizophylum commune Fr and Auricularia auricula Judae had the highest in β-glucan contents and the cheapest cost of mushroom per content of β-glucan, respectively. Even the function of β-glucan on immune modulation has been known however no report on interaction between β-glucan and human gut microbiota. Gut microbiota is thought to have health effects by interaction with non-digestible component particular fermentable dietary fiber. It is important to correlate the specific groups of the microbial communities associated with β-glucan fermentation and the consequential SCFA profiles. β-glucan from mushroom may has potential prebiotic function similar to those from commercial yeast (Saccharomyces cerevisiae β-glucan. Objective: To evaluate on prebiotic properties of soluble β-glucans and oligo-β-glucans from Schizophylum commune Fr and Auricularia auricula Judae by fecal fermentation in batch culture. Methods: In vitro fecal fermentation in anaerobic batch cultures under simulated conditions similar to human colon with human faecal samples from three donors were performed. Comparison on 3 β-glucans and 2 oligo-β-glucans have been studied. Sample was taken at 0 h, 24 h and 48 h to analyze the numbers of bacterial changes by fluorescent in situ hybridization (FISH technique. Short chain fatty acids (SCFA were analyzed by HPLC. The prebiotic index (PI was calculated according to the change of 5 specific bacterial genus within 48 h fermentation. Results: Soluble β-glucan from Auricularia auricula Judae increased numbers of bifidobacteria and lactobacillus significantly (P<0.05. The PI of

Depolymerization of polysaccharides from Opuntia ficus indica: Antioxidant and antiglycated activities.

Science.gov (United States)

Chaouch, Mohamed Aymen; Hafsa, Jawhar; Rihouey, Christophe; Le Cerf, Didier; Majdoub, Hatem

2015-08-01

The extraction, purification and degradation of polysaccharides from Opuntia ficus indica cladodes, as well as the evaluation of their antioxidant and antiglycated activities in vitro were investigated. The optimization of the extraction showed that extraction by ultrasound at 40 °C presented the best carbohydrates yield. The degradation of the extracted polysaccharides was achieved by free radical depolymerization with H2O2 in the presence of copper(II) acetate for various reaction times. Sugar contents were determined by colorimetric assays. The macromolecular characteristics of the different isolated and degraded carbohydrates were carried by size exclusion chromatography (SEC/MALS/VD/DRI). These experiments showed that all samples are polysaccharides, which are probably pectins and that molecular weight (Mw) has decreased from 6,800,000 to 14,000 g/mol after 3 h of depolymerization without changing the structure. Preliminary antioxidant and antiglycated tests indicated that degraded polysaccharides for 2 and 3 h showed even better antioxidant and antiglycated activities. Copyright © 2015 Elsevier B.V. All rights reserved.

Defining Starch Binding by Glucan Phosphatases

DEFF Research Database (Denmark)

Auger, Kyle; Raththagala, Madushi; Wilkens, Casper

2015-01-01

Starch is a vital energy molecule in plants that has a wide variety of uses in industry, such as feedstock for biomaterial processing and biofuel production. Plants employ a three enzyme cyclic process utilizing kinases, amylases, and phosphatases to degrade starch in a diurnal manner. Starch...... is comprised of the branched glucan amylopectin and the more linear glucan amylose. Our lab has determined the first structures of these glucan phosphatases and we have defined their enzymatic action. Despite this progress, we lacked a means to quickly and efficiently quantify starch binding to glucan...

Ultrasonically extracted β-d-glucan from artificially cultivated mushroom, characteristic properties and antioxidant activity.

Science.gov (United States)

Alzorqi, Ibrahim; Sudheer, Surya; Lu, Ting-Jang; Manickam, Sivakumar

2017-03-01

Ganoderma mushroom cultivated recently in Malaysia to produce chemically different nutritional fibers has attracted the attention of the local market. The extraction methods, molecular weight and degree of branching of (1-3; 1-6)-β-d-glucan polysaccharides is of prime importance to determine its antioxidant bioactivity. Therefore three extraction methods i.e. hot water extraction (HWE), soxhlet extraction (SE) and ultrasound assisted extraction (US) were employed to study the total content of (1-3; 1-6)-β-d-glucans, degree of branching, structural characteristics, monosaccharides composition, as well as the total yield of polysaccharides that could be obtained from the artificially cultivated Ganoderma. The physical characteristics by HPAEC-PAD, HPGPC and FTIR, as well as the antioxidant in vitro assays of DPPH scavenging activity and ferric reducing power (FRAP) indicated that (1-3; 1-6)-β-d-glucans of Malaysian mushroom have better antioxidant activity, higher molecular weight and optimal degree of branching when extracted by US in comparison with conventional methods. Copyright © 2016 Elsevier B.V. All rights reserved.

Hydroxide catalysts for lignin depolymerization

Science.gov (United States)

Beckham, Gregg T; Biddy, Mary J.; Kruger, Jacob S.; Chmely, Stephen C.; Sturgeon, Matthew

2017-10-17

Solid base catalysts and their use for the base-catalyzed depolymerization (BCD) of lignin to compounds such as aromatics are presented herein. Exemplary catalysts include layered double hydroxides (LDHs) as recyclable, heterogeneous catalysts for BCD of lignin.

Hydroxide catalysts for lignin depolymerization

Energy Technology Data Exchange (ETDEWEB)

Beckham, Gregg T.; Biddy, Mary J.; Chmely, Stephen C.; Sturgeon, Matthew

2017-04-25

Solid base catalysts and their use for the base-catalyzed depolymerization (BCD) of lignin to compounds such as aromatics are presented herein. Exemplary catalysts include layered double hydroxides (LDHs) as recyclable, heterogeneous catalysts for BCD of lignin.

Growth and biomass production with enhanced {beta}-glucan and dietary fibre contents of Ganoderma australe ATHUM 4345 in a batch-stirred tank bioreactor

Energy Technology Data Exchange (ETDEWEB)

Papaspyridi, Lefki-Maria; Christakopoulos, Paul [BIOtechMASS Unit, Biotechnology Laboratory, School of Chemical Engineering, National Technical University of Athens, Athens (Greece); Katapodis, Petros [BIOtechMASS Unit, Biotechnology Laboratory, School of Chemical Engineering, National Technical University of Athens, Athens (Greece); Biotechnology Laboratory, Department of Biological Applications and Technologies, University of Ioannina, Ioannina (Greece); Gonou-Zagou, Zacharoula; Kapsanaki-Gotsi, Evangelia [Department of Ecology and Systematics, Faculty of Biology, National and Kapodistrian University of Athens, Athens (Greece)

2011-02-15

In this study we maximized biomass production by the basidiomycete Ganoderma australe ATHUM 4345, a species of pharmaceutical interest as it is a valuable source of nutraceuticals, including dietary fibers and glucans. We used the Biolog FF MicroPlate to screen 95 different carbon sources for growth monitoring. The pattern of substrate catabolism forms a substrate assimilation fingerprint, which is useful in selecting components for media optimization of maximum biomass production. Response surface methodology, based on the central composite design was applied to explore the optimum concentrations of carbon and nitrogen sources of culture medium in shake flask cultures. When the improved culture medium was tested in a 20-L stirred tank bioreactor, using 13.7 g/L glucose and 30.0 g/L yeast extract, high biomass yields (10.1{+-}0.4 g/L) and productivity of 0.09 g L{sup -1} h{sup -1} were obtained. The yield coefficients for total glucan and dietary fibers on biomass formed were 94.82{+-}6 and 341.15{+-}12.3 mg/g mycelium dry weight, respectively. (Copyright copyright 2011 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim)

Non-enzymatic depolymerization of cotton cellulose by fungal mimicking metabolites

DEFF Research Database (Denmark)

Hastrup, Anne Christine Steenkjær; Howell, Caitlin; Jensen, Bo

2011-01-01

peroxide, iron, and oxalic acid. The former two are involved in the Fenton reaction in which they react to form hydroxyl radicals, which cause an accelerated depolymerization in cotton cellulose. We found the same reaction to be caused by both iron Fe3+ and Fe2+. A 10 mM oxalic acid solution showed...... significant depolymerization effect on cotton cellulose. An oxalic acid/sodium oxalate buffered pH gradient had an inhibitory effect on the reduction of cellulose polymers at increased pH values. The organic iron chelator, EDTA, was found to promote depolymerization of cellulose in combination with Fenton......’s reagents, but inhibited the effect of oxalic acid in the absence of iron and hydrogen peroxide. Manganese was tested to see if metals other than iron could generate a significant impact on the degree of polymerization (DP) in cotton cellulose. Depolymerizing properties comparable to iron were seen...

Anti-infective properties of the melanin-glucan complex obtained from medicinal tinder bracket mushroom, Fomes fomentarius (L.: Fr.) Fr. (Aphyllophoromycetideae).

Science.gov (United States)

Seniuk, Olga F; Gorovoj, Leontiy F; Beketova, Galina V; Savichuk, Hatalia O; Rytik, Petr G; Kucherov, Igor I; Prilutskay, Alla B; Prilutsky, Alexandr I

2011-01-01

The goal of this investigation was to comparatively study the efficiency of traditionally used anti-infective drugs and biopolymer complexes originated from the medicinal mushroom Fomes fomentarius (L.:Fr.) Fr.: 1) water-soluble melanin-glucan complex (MGC; -80% melanins and -20% beta-glucans) and 2) insoluble chitin-glucan-melanin complex (ChGMC; -70% chitin, -20% beta-glucans, and -10% melanins). Infectious materials (Helicobacter pylori, Candida albicans, and Herpes vulgaris I and HIV-1(zmb) were used in pure cultures of in vitro and in vivo models on experimental animals. Comparison studies of fungal biopolymers and effective modern antifungal, antibacterial, and antiviral drugs were used in in vitro models. The comparative clinical efficiency of ChGMC and of etiotropic pharmaceuticals in models of H. pylori, C. albicans, and H. vulgaris I infection contamination were studied. Using in vitro models, it was established that MGC completely depresses growth of C. albicans. MGC had an antimicrobial effect on H. pylori identical to erythromycin in all concentrations, and had a stronger action on this bacterium than other tested antibiotics. Tested MGC possesses simultaneously weak toxicity and high anti-HIV-1 activity in comparison with zidovudine (Retrovir). The obtained results show that CLUDDT therapy in Wistar rats with the application of ChGMC is, on average, 1.35-1.43 times as effective as a traditional one. Considering the absence of MGC and ChGMC toxic properties on blood cells even in very high concentrations, these complexes may be used as a source of biopolymers for the creation of essentially new agents for wide application in infectious pathology.

Plants with elevated levels of glucan

Energy Technology Data Exchange (ETDEWEB)

Pauly, Markus; Kraemer, Florian J.; Hake, Sarah

2018-03-20

The present disclosure relates to mutations in licheninase genes encoding polypeptides with decreased licheninase activity, which when expressed in plants results in elevated levels of glucan in the plants. In particular, the disclosure relates to licheninase nucleic acids and polypeptides related to glucan accumulation in plants, plants with reduced expression of a licheninase nucleic acid, and methods related to the generation of plants with increased glucan content in the cell walls of leaf tissue.

Development of anti β glucan aptamers for use as radiopharmaceutical in the identification of fungal Infections

Energy Technology Data Exchange (ETDEWEB)

Lacerda, Camila Maria de Sousa; Reis, Mariana Flister; Correa, Cristiane Rodrigues; Andrade, Antero S.R., E-mail: cmsl@cdtn.br, E-mail: antero@cdtn.br [Centro de Desenvolvimento da Tecnologia Nuclear (CDTN/CNEM-MG), Belo Horizonte, MG (Brazil)

2013-07-01

Invasive fungal infections caused by Candida albicans, are recognized as a major cause of morbidity and mortality in immuno compromised individuals. Patients may not show obvious clinical signs or symptoms, making it difficult to detect its origin or new focus that developed through hematogenous spread. Nuclear medicine could contribute to an early diagnosis of fungal infections, since specific markers are available. The aim of this study was to develop, through SELEX technique (Systematic Evolution of Ligands by Exponential Enrichment), aptamers for beta glucan for subsequent labeling with {sup 99}mTc and evaluation of this radiopharmaceutical in the diagnosis of invasive fungal infections, scintigraphy. To obtain aptamers were performed 15 cycles of SELEX technique, using centrifugation as separation method of oligonuclotideos linked to the beta-glucan is not connected. The DNA bands were observed in all 15 cycles. The oligonucleotides obtained after cycles were cloned using the standard protocol kit-Topo TA vector (Invitrogen), and subjected to sequencing Megabase. Three aptamers for yeast cells were selected for this study. Further, other studies should be performed to assess the specificity and affinity thereof for later use in the diagnosis of fungal infections. (author)

Development of anti β glucan aptamers for use as radiopharmaceutical in the identification of fungal Infections

International Nuclear Information System (INIS)

Lacerda, Camila Maria de Sousa; Reis, Mariana Flister; Correa, Cristiane Rodrigues; Andrade, Antero S.R.

2013-01-01

Invasive fungal infections caused by Candida albicans, are recognized as a major cause of morbidity and mortality in immuno compromised individuals. Patients may not show obvious clinical signs or symptoms, making it difficult to detect its origin or new focus that developed through hematogenous spread. Nuclear medicine could contribute to an early diagnosis of fungal infections, since specific markers are available. The aim of this study was to develop, through SELEX technique (Systematic Evolution of Ligands by Exponential Enrichment), aptamers for beta glucan for subsequent labeling with 99 mTc and evaluation of this radiopharmaceutical in the diagnosis of invasive fungal infections, scintigraphy. To obtain aptamers were performed 15 cycles of SELEX technique, using centrifugation as separation method of oligonuclotideos linked to the beta-glucan is not connected. The DNA bands were observed in all 15 cycles. The oligonucleotides obtained after cycles were cloned using the standard protocol kit-Topo TA vector (Invitrogen), and subjected to sequencing Megabase. Three aptamers for yeast cells were selected for this study. Further, other studies should be performed to assess the specificity and affinity thereof for later use in the diagnosis of fungal infections. (author)

Baker's yeast beta glucan supplementation increases salivary IgA and decreases cold/flu symptomatic days after intense exercise.

Science.gov (United States)

McFarlin, Brian K; Carpenter, Katie C; Davidson, Tiffany; McFarlin, Meredith A

2013-09-01

Strenuous exercise, such as running a marathon, is known to suppress mucosal immunity for up to 24 hr, which can increase the risk of developing an upper respiratory tract infection (URTI) and reduced performance capacity (Allgrove JE, Geneen L, Latif S, Gleeson M. Influence of a fed or fasted state on the s-IgA response to prolonged cycling in active men and women. Int J Sport Nutr Exerc Metab. 2009;19(3):209-221; Barrett B, Locken K, Maberry R, Schwamman J, Brown R, Bobula J, Stauffacher EA. The Wisconsin Upper Respiratory Symptom Survey (WURSS): a new research instrument for assessing the common cold. J Fam Pract. 2002;51(3):265; Carpenter KC, Breslin WL, Davidson T, Adams A, McFarlin BK. Baker's yeast beta glucan supplementation increases monocytes and cytokines post-exercise: implications for infection risk? Br J Nutr. 2012;1-9). While many dietary interventions have been used to combat postexercise immune suppression, most have been ineffective. The key purpose of this study was to determine if baker's yeast β-glucan (BG) could positively affect the immune system of individuals undergoing intense exercise stress using two experiments. In the first (E1; N = 182 men and women), BG was compared to placebo supplementation for the incidence of URTI symptoms for 28 days postmarathon. In the second (E2; N = 60 men and women) changes in salivary immunoglobulin A (IgA) were evaluated after 50-min of strenuous cycling when participants had been supplemented for 10 days with either BG (250 mg/day) or placebo (rice flour). For E1, subjects reported URTI symptoms using a daily health log. For E2, saliva was collected prior to, immediately, and 2-hr postexercise using a salivette. Data for E1 and E2 were analyzed using separate analyses of variance (ANOVAs) with repeated measures (p flu symptom days postmarathon compared to placebo (p = .026). In E2, BG was associated with a 32% increase in salivary IgA (p = .048) at 2 hr after exercise compared to placebo. In summary

Glucan: mechanisms involved in its radioprotective effect

International Nuclear Information System (INIS)

Patchen, M.L.; D'Alesandro, M.M.; Brook, I.; Blakely, W.F.; MacVittie, T.J.

1987-01-01

It has generally been accepted that most biologically derived agents that are radioprotective in the hemopoietic-syndrome dose range (eg, endotoxin, Bacillus Calmette Guerin, Corynebacterium parvum, etc) exert their beneficial properties by enhancing hemopoietic recovery and hence, by regenerating the host's ability to resist life-threatening opportunistic infections. However, using glucan as a hemopoietic stimulant/radioprotectant, we have demonstrated that host resistance to opportunistic infection is enhanced in these mice even prior to the detection of significant hemopoietic regeneration. This early enhanced resistance to microbial invasion in glucan-treated irradiated mice could be correlated with enhanced and/or prolonged macrophage (but not granulocyte) function. These results suggest that early after irradiation glucan may mediate its radioprotection by enhancing resistance to microbial invasion via mechanisms not necessarily predicated on hemopoietic recovery. In addition, preliminary evidence suggests that glucan can also function as an effective free-radical scavenger. Because macrophages have been shown to selectively phagocytize and sequester glucan, the possibility that these specific cells may be protected by virtue of glucan's scavenging ability is also suggested

A phase I/II trial of beta-(1,3/(1,6 D-glucan in the treatment of patients with advanced malignancies receiving chemotherapy

Directory of Open Access Journals (Sweden)

Weitberg Alan B

2008-09-01

Full Text Available Abstract β-(1,3/(1,6 D-glucan, a component of the fungal cell wall, has been shown to stimulate the immune system, enhance hematopoiesis, amplify killing of opsonized tumor cells and increase neutrophil chemotaxis and adhesion. In view of these attributes, the β-glucans should be studied for both their therapeutic efficacy in patients with cancer as well as an adjunctive therapy in patients receiving chemotherapy as a maneuver to limit suppression of hematopoiesis. In this study, twenty patients with advanced malignancies receiving chemotherapy were given a β-(1,3/(1,6 D-glucan preparation (MacroForce plus IP6, ImmuDyne, Inc. and monitored for tolerability and effect on hematopoiesis. Our results lead us to conclude that β-glucan is well-tolerated in cancer patients receiving chemotherapy, may have a beneficial effect on hematopoiesis in these patients and should be studied further, especially in patients with chronic lymphocytic leukemia and lymphoma.

Presence of a large β(1-3)glucan linked to chitin at the Saccharomyces cerevisiae mother-bud neck suggests involvement in localized growth control.

Science.gov (United States)

Cabib, Enrico; Blanco, Noelia; Arroyo, Javier

2012-04-01

Previous results suggested that the chitin ring present at the yeast mother-bud neck, which is linked specifically to the nonreducing ends of β(1-3)glucan, may help to suppress cell wall growth at the neck by competing with β(1-6)glucan and thereby with mannoproteins for their attachment to the same sites. Here we explored whether the linkage of chitin to β(1-3)glucan may also prevent the remodeling of this polysaccharide that would be necessary for cell wall growth. By a novel mild procedure, β(1-3)glucan was isolated from cell walls, solubilized by carboxymethylation, and fractionated by size exclusion chromatography, giving rise to a very high-molecular-weight peak and to highly polydisperse material. The latter material, soluble in alkali, may correspond to glucan being remodeled, whereas the large-size fraction would be the final cross-linked structural product. In fact, the β(1-3)glucan of buds, where growth occurs, is solubilized by alkali. A gas1 mutant with an expected defect in glucan elongation showed a large increase in the polydisperse fraction. By a procedure involving sodium hydroxide treatment, carboxymethylation, fractionation by affinity chromatography on wheat germ agglutinin-agarose, and fractionation by size chromatography on Sephacryl columns, it was shown that the β(1-3)glucan attached to chitin consists mostly of high-molecular-weight material. Therefore, it appears that linkage to chitin results in a polysaccharide that cannot be further remodeled and does not contribute to growth at the neck. In the course of these experiments, the new finding was made that part of the chitin forms a noncovalent complex with β(1-3)glucan.

Separation and purification of lactic acid. Thermal catalytic depolymerization of poly-lactic acid into lactide; Hakkoho nyusan no bunri seisei ni kansuru kenkyu. Pori nyusan no rakuchido eno sesshokuteki netsukai jugo

Energy Technology Data Exchange (ETDEWEB)

Morita, M.; Hirama, Y.; Liew, M. [Hokkaido National Industrial Research Institute, Sapporo (Japan)

1996-05-10

A new separation and purification method for lactic acid from fermentation broth is proposed by which poly-lactic acid produced from unpurified lactic acid is catalytically depolymerized into lactide fractions then further purified into lactide. In the present study, thermal depolymerization catalysts were investigated for commercial use. Iron catalysts, especially metallic iron, and ferrous oxide and lactate, were found to provide almost the same catalytic activity and lactide composition in depolymerization products and those in tin octoate and antimony oxide catalysts. Ferrous oxide was also applied to depolymerize poly-lactic acid derived form unpurified lactic acid to compare catalytic activity and lactide composition and was confirmed to show results similar to those of pure polymer. Based on these findings, it is concluded that iron catalysts can be used commercially. Furthermore, catalytic depolymerization of poly-lactic acids with different molecular weights were studied. Polymers with Mw 5,000-10,000 were found to be better for production of lactide, based on the behavior of depolymerization and lactide content in the product. 5 refs., 9 figs., 1 tab.

Validation of a high-performance size-exclusion chromatography method to determine and characterize β-glucans in beer wort using a triple-detector array.

Science.gov (United States)

Tomasi, Ivan; Marconi, Ombretta; Sileoni, Valeria; Perretti, Giuseppe

2017-01-01

Beer wort β-glucans are high-molecular-weight non-starch polysaccharides of that are great interest to the brewing industries. Because glucans can increase the viscosity of the solutions and form gels, hazes, and precipitates, they are often related to poor lautering performance and beer filtration problems. In this work, a simple and suitable method was developed to determine and characterize β-glucans in beer wort using size exclusion chromatography coupled with a triple-detector array, which is composed of a light scatterer, a viscometer, and a refractive-index detector. The method performances are comparable to the commercial reference method as result from the statistical validation and enable one to obtain interesting parameters of β-glucan in beer wort, such as the molecular weight averages, fraction description, hydrodynamic radius, intrinsic viscosity, polydispersity and Mark-Houwink parameters. This characterization can be useful in brewing science to understand filtration problems, which are not always explained through conventional analysis. Copyright © 2016 Elsevier Ltd. All rights reserved.

Regeneration of cello-oligomers via selective depolymerization of cellulose fibers derived from printed paper wastes.

Science.gov (United States)

Voon, Lee Ken; Pang, Suh Cem; Chin, Suk Fun

2016-05-20

Cellulose extracted from printed paper wastes were selectively depolymerized under controlled conditions into cello-oligomers of controllable chain lengths via dissolution in an ionic liquid, 1-allyl-3-methylimidazolium chloride (AMIMCl), and in the presence of an acid catalyst, Amberlyst 15DRY. The depolymerization process was optimized against reaction temperature, concentration of acid catalyst, and reaction time. Despite rapid initial depolymerization process, the rate of cellulose depolymerization slowed down gradually upon prolonged reaction time, with 75.0 wt% yield of regenerated cello-oligomers (mean Viscosimetric Degree of Polymerization value of 81) obtained after 40 min. The depolymerization of cellulose fibers at 80 °C appeared to proceed via a second-order kinetic reaction with respect to the catalyst concentration of 0.23 mmol H3O(+). As such, the cellulose depolymerization process could afford some degree of control on the degree of polymerization or chain lengths of cello-oligomers formed. Copyright © 2016 Elsevier Ltd. All rights reserved.

Effect of Enzyme Supplementation and Irradiation of Barley on Broiler Chicks Performance

International Nuclear Information System (INIS)

Farag, D.H.M.; Abd El-Hakeim, N.F.

1999-01-01

The experiments were conducted to study the influence of irradiation treatment at dose levels of 0.20 and 60 kGy on barley beta-glucan and the effect of enzyme supplementation and irradiation of barley on broiler chicks performance. The amount of total and water-soluble beta-glucan in raw barley was 36 kg -1 , respectively. The effect of irradiation treatment on total beta-glucan was insignificant while the level of soluble beta-glucan was increased with increasing the dose levels of irradiation. The effect of irradiation treatment and enzyme supplementation of barley diets on growth and conversion performance of broiler chicks indicated that birds fed raw barley diet had lower body weight, body weight gain and feed conversion than those fed control diet throughout the experimental period. Irradiation of barley at dose of 20 kGy did not affect the chick performance (feed consumption, weight gain feed-gain ratio) that received the B 20 diet from 7 to 21 days of age, but when bird maintained on B 20 diet from 7 28 days of age, only feed-gain ratio was improved by 14.4%. The results indicate that there was a significant effect of irradiation of barley at 60 kGy (B 60) on feed -gain ratio of chicks when were fed B 60 diet from 7 to 21 days of age. The corresponding improvement in feed-gain ratio was 16.4%. When birds were fed B 60 diet from 7-28 days of age, the improvement in body weight and feed-gain ratio was 25.5 and 19.6%, respectively

The Inertia Weight Updating Strategies in Particle Swarm Optimisation Based on the Beta Distribution

Directory of Open Access Journals (Sweden)

Petr Maca

2015-01-01

Full Text Available The presented paper deals with the comparison of selected random updating strategies of inertia weight in particle swarm optimisation. Six versions of particle swarm optimization were analysed on 28 benchmark functions, prepared for the Special Session on Real-Parameter Single Objective Optimisation at CEC2013. The random components of tested inertia weight were generated from Beta distribution with different values of shape parameters. The best analysed PSO version is the multiswarm PSO, which combines two strategies of updating the inertia weight. The first is driven by the temporally varying shape parameters, while the second is based on random control of shape parameters of Beta distribution.

6-O-Branched Oligo-β-glucan-Based Antifungal Glycoconjugate Vaccines.

Science.gov (United States)

Liao, Guochao; Zhou, Zhifang; Liao, Jun; Zu, Luning; Wu, Qiuye; Guo, Zhongwu

2016-02-12

With the rapid growth in fungal infections and drug-resistant fungal strains, antifungal vaccines have become an especially attractive strategy to tackle this important health problem. β-Glucans, a class of extracellular carbohydrate antigens abundantly and consistently expressed on fungal cell surfaces, are intriguing epitopes for antifungal vaccine development. β-Glucans have a conserved β-1,3-glucan backbone with sporadic β-1,3- or β-1,6-linked short glucans as branches at the 6-O-positions, and the branches may play a critical role in their immunologic functions. To study the immunologic properties of branched β-glucans and develop β-glucan-based antifungal vaccines, three branched β-glucan oligosaccharides with 6-O-linked β-1,6-tetraglucose, β-1,3-diglucose, and β-1,3-tetraglucose branches on a β-1,3-nonaglucan backbone, which mimic the structural epitopes of natural β-glucans, were synthesized and coupled with keyhole limpet hemocyanin (KLH) to form novel synthetic conjugate vaccines. These glycoconjugates were proved to elicit strong IgG antibody responses in mice. It was also discovered that the number, size, and structure of branches linked to the β-glucan backbone had a significant impact on the immunologic property. Moreover, antibodies induced by the synthetic oligosaccharide-KLH conjugates were able to recognize and bind to natural β-glucans and fungal cells. Most importantly, these conjugates elicited effective protection against systemic Candida albicans infection in mice. Thus, branched oligo-β-glucans were identified as functional epitopes for antifungal vaccine design and the corresponding protein conjugates as promising antifungal vaccine candidates.

β-glucan extract from oat bran and its industrial importance

Science.gov (United States)

Ibrahim, M. N. G.; Selezneva, I. S.

2017-09-01

The β-Glucan exhibits a broad spectrum of biological activity, for example it is highly active against many chronic diseases such as diabetes millets, cancer and improper digestion. The β-Glucan is a polysaccharide of D-glucose. It has many different sources of extraction such as yeasts, cereals, fungus and some bacteria. The extraction of the β-Glucan has become so important in our days, because the β-Glucan is a natural substance which can be used in pharmaceutical products for prevention and treatment of many chronic diseases. As well, many food producers have interest to introduce the β-Glucan in many food products, like dairy, meat and bakery products. Taking into consideration the foregoing, we tried to isolate the β-Glucan from oat bran using the acid method of extraction. Some modifications were offered to increase the β-Glucan concentration in the final extract and increase the total extract yield. As a result, the extracts with two different concentrations 72 % and 90 % were obtained with the yields 3.14 % and 4.4 % respectively. It should be noted that the β-Glucan addition into food products can improve their quality and physical properties. Thus, the β-Glucan is now of great importance for maintaining the consumers health by functional food products.

Formic-acid-induced depolymerization of oxidized lignin to aromatics

Science.gov (United States)

Rahimi, Alireza; Ulbrich, Arne; Coon, Joshua J.; Stahl, Shannon S.

2014-11-01

Lignin is a heterogeneous aromatic biopolymer that accounts for nearly 30% of the organic carbon on Earth and is one of the few renewable sources of aromatic chemicals. As the most recalcitrant of the three components of lignocellulosic biomass (cellulose, hemicellulose and lignin), lignin has been treated as a waste product in the pulp and paper industry, where it is burned to supply energy and recover pulping chemicals in the operation of paper mills. Extraction of higher value from lignin is increasingly recognized as being crucial to the economic viability of integrated biorefineries. Depolymerization is an important starting point for many lignin valorization strategies, because it could generate valuable aromatic chemicals and/or provide a source of low-molecular-mass feedstocks suitable for downstream processing. Commercial precedents show that certain types of lignin (lignosulphonates) may be converted into vanillin and other marketable products, but new technologies are needed to enhance the lignin value chain. The complex, irregular structure of lignin complicates chemical conversion efforts, and known depolymerization methods typically afford ill-defined products in low yields (that is, less than 10-20wt%). Here we describe a method for the depolymerization of oxidized lignin under mild conditions in aqueous formic acid that results in more than 60wt% yield of low-molecular-mass aromatics. We present the discovery of this facile C-O cleavage method, its application to aspen lignin depolymerization, and mechanistic insights into the reaction. The broader implications of these results for lignin conversion and biomass refining are also considered.

NONSPECIFIC IMMUNE RESPONSE AND RESISTANCE OF Litopenaeus vannamei FED WITH NUCLEOTIDE, β-GLUCAN, AND PROTAGEN DIETS

Directory of Open Access Journals (Sweden)

Henky Manoppo

2010-06-01

Full Text Available The objective of this research was to evaluate the nonspecific immune response and resistance of Litopenaeus vannamei fed with nucleotide, β–glucan, and protagen diets. Shrimp juveniles with an average weight of 5.39±0.56 g were reared in glass aquaria at a density of 15 shrimps/aquarium. Shrimps were fed three times a day for four weeks at a feeding rate of 3%/bw/day. Treatment diets consisted of A: basal diet (without immunostimulant, B: β–glucan, C: protagen, and D: nucleotide, each with three replicates. At the end of feeding period, the shrimps were intramuscularly injected with Vibrio harveyi 0.1 x 106 cfu.shrimp-1. Total haemocyte count (THC of shrimp fed with nucleotide-diet was significantly different compared to that of control shrimp (p=0.01, but not different compared to shrimp fed with protagen-diet. PO activity also increased significantly in shrimp fed with nucleotide-diet (p=0.02. β–glucan diet could also increase THC and PO activity, but compared to the control, the increase was not significantly different. Overall, PO activity of shrimp fed with nucleotide, β–glucan, and protagen diets was high (>0.35. Oral administration of nucleotide, β–glucan, and protagen for four consecutive weeks significantly increased resistance of shrimp to disease (<0.01 where the highest resistance rate was observed on shrimp fed with nucleotide-diet. Growth of shrimp fed with nucleotide-diet was significantly different compared to that of control shrimp (p<0.01, as well as to β–glucan, and protagen-treated shrimp. As a conclusion, supplementation of nucleotide into shrimp pellet enhanced nonspecific immune response and growth performance better than β-glucan, and protagen.

Influence of insulin on beta-endorphin plasma levels in obese and normal weight subjects.

Science.gov (United States)

Brunani, A; Pincelli, A I; Pasqualinotto, L; Tibaldi, A; Baldi, G; Scacchi, M; Fatti, L M; Cavagnini, F

1996-08-01

To establish the possible role of hyperinsulinemia in the elevation of plasma beta-endorphin (beta-EP) levels observed in obese patients after an oral glucose load. Oral glucose tolerance test (OGTT) and euglycemic-hyperinsulinemic clamp. Two groups of six (age: 22-39 y, BMI: 30-48 kg/m2) and eight obese men (age: 18-37 y, BMI: 35-45 kg/m2), respectively, and five normal weight healthy men (age: 22-30 y, BMI 22-23 kg/m2). Glucose, insulin and beta-EP levels at baseline and every 30 min until 180 min during the OGTT; glucose, insulin, C-peptide and beta-EP concentrations at baseline and in steady state condition (i.e. during the last 30 min of insulin infusion) in the euglycemic-hyperinsulinemic clamp studies. In the six obese patients undergoing the OGTT a significant elevation of beta-EP plasma levels was observed between 60 and 90 min after glucose ingestion. In the clamp studies no significant differences in beta-EP plasma levels, blood glucose and serum insulin were observed between obese and normal weight subjects both at baseline and at steady state. A markedly diminished insulin sensitivity along with a lower inhibition of C-peptide during insulin infusion was observed in obese patients compared to control subjects. A rise in serum insulin levels unaccompanied by a concomitant increase in blood glucose concentration is unable to elicit a beta-EP response in obese patients.

Characterization of Polysaccharides from the Fruiting Bodies of Two Species of Genus Ganoderma (Agaricomycetes) and Determination of Water-Soluble β-D-Glucan Using High-Performance Liquid Chromatography.

Science.gov (United States)

Liu, Yanfang; Tang, Qingjiu; Yang, Yan; Zhou, Shuai; Wu, Di; Tang, Chuanhong; Zhang, Zhong; Yan, Mengqiu; Feng, Jie; Zhang, Jing-Song

2017-01-01

Molecular weight (Mw) distributions of polysaccharides from the fruiting bodies of different Ganoderma lucidum strains and G. sinense were investigated and compared using high-pressure size exclusion chromatography/multiangle laser light scattering/refractive index analysis. Results showed that there were big differences in the Mw distributions and characteristics of polysaccharides from 2 species of Ganoderma. All tested G. lucidum materials exhibited similar polysaccharide distributions and similar characteristics for each fraction. The fraction with highest Mw (peak 1) was identified as β-(1→3)-linked D-glucan with (1→6)-β-D-glucopyranosyl side branches. G. sinense fruiting bodies did not include the β-D-glucan when compared with G. lucidum. A high-pressure size exclusion chromatography method was developed and applied to determine the amount of high-Mw β-D-glucan in G. lucidum fruiting bodies. Results indicated that there was no obvious relationship between β-D-glucan content and the genetic similarity of G. lucidum. The strain labeled "Longzhi no. 2" was determined to possess the largest amount of β-D-glucan: 8.2 mg/mL based on the dry weight of fruiting bodies. The β-D-glucan content in the hot water extract of Longzhi no. 2 reached 17.05%. For the "Hunong no. 1" strain, the β-D-glucan content in log-cultivated fruiting bodies was much higher than that in bag-cultivated ones. This method could be used to improve quality control of polysaccharides in G. lucidum.

Improved synthesis with high yield and increased molecular weight of poly(alpha,beta-malic acid) by direct polycondensation.

Science.gov (United States)

Kajiyama, Tetsuto; Kobayashi, Hisatoshi; Taguchi, Tetsushi; Kataoka, Kazunori; Tanaka, Junzo

2004-01-01

The development of synthetic biodegradable polymers, such as poly(alpha-hydroxy acid), is particularly important for constructing medical devices, including scaffolds and sutures, and has attracted growing interest in the biomedical field. Here, we report a novel approach to preparing high molecular weight poly(malic acid) (HMW--PMA) as a biodegradable and bioabsorbable water-soluble polymer. We investigated in detail the reaction conditions for the simple direct polycondensation of l-malic acid, including the reaction times, temperatures, and catalysts. The molecular weight of synthesized alpha,beta-PMA is dependent on both the reaction temperature and time. The optimum reaction condition to obtain alpha,beta-PMA by direct polycondensation using tin(II) chloride as a catalyst was thus determined to be 110 degrees C for 45 h with a molecular weight of 5300. The method for alpha,beta-PMA synthesis established here will facilitate production of alpha,beta-PMA of various molecular weights, which may have a potential utility as biomaterials.

Feeding common carp Cyprinus carpio with b-glucan supplemented \\ud diet stimulates C-reactive protein and complement immune acute\\ud phase responses following PAMPs injection

OpenAIRE

Pionnier, Nicolas; Falco, Alberto; Miest, Joanna J.; Shrive, Annette K.; Hoole, Dave

2014-01-01

The effect of β-glucan as a feed additive on the serum and gene profile of C-reactive protein (CRP) and complement acute phase responses was ascertained in common carp Cyprinus carpio. In addition effects of subsequent intraperitoneal injections of pathogen-associated molecular patterns (PAMPs), i.e. LPS or poly(I:C), to mimic bacterial or viral infection respectively, were studied. Carp were first orally fed with β-glucan (MacroGard®) with a daily β-glucan intake of 6 mg per kg body weight o...

How does the preparation of rye porridge affect molecular weight distribution of extractable dietary fibers?

Science.gov (United States)

Rakha, Allah; Aman, Per; Andersson, Roger

2011-01-01

Extractable dietary fiber (DF) plays an important role in nutrition. This study on porridge making with whole grain rye investigated the effect of rest time of flour slurries at room temperature before cooking and amount of flour and salt in the recipe on the content of DF components and molecular weight distribution of extractable fructan, mixed linkage (1→3)(1→4)-β-d-glucan (β-glucan) and arabinoxylan (AX) in the porridge. The content of total DF was increased (from about 20% to 23% of dry matter) during porridge making due to formation of insoluble resistant starch. A small but significant increase in the extractability of β-glucan (P = 0.016) and AX (P = 0.002) due to rest time was also noted. The molecular weight of extractable fructan and AX remained stable during porridge making. However, incubation of the rye flour slurries at increased temperature resulted in a significant decrease in extractable AX molecular weight. The molecular weight of extractable β-glucan decreased greatly during a rest time before cooking, most likely by the action of endogenous enzymes. The amount of salt and flour used in the recipe had small but significant effects on the molecular weight of β-glucan. These results show that whole grain rye porridge made without a rest time before cooking contains extractable DF components maintaining high molecular weights. High molecular weight is most likely of nutritional importance.

How Does the Preparation of Rye Porridge Affect Molecular Weight Distribution of Extractable Dietary Fibers?

Directory of Open Access Journals (Sweden)

Roger Andersson

2011-05-01

Full Text Available Extractable dietary fiber (DF plays an important role in nutrition. This study on porridge making with whole grain rye investigated the effect of rest time of flour slurries at room temperature before cooking and amount of flour and salt in the recipe on the content of DF components and molecular weight distribution of extractable fructan, mixed linkage (1→3(1→4-β-D-glucan (β-glucan and arabinoxylan (AX in the porridge. The content of total DF was increased (from about 20% to 23% of dry matter during porridge making due to formation of insoluble resistant starch. A small but significant increase in the extractability of β-glucan (P = 0.016 and AX (P = 0.002 due to rest time was also noted. The molecular weight of extractable fructan and AX remained stable during porridge making. However, incubation of the rye flour slurries at increased temperature resulted in a significant decrease in extractable AX molecular weight. The molecular weight of extractable β-glucan decreased greatly during a rest time before cooking, most likely by the action of endogenous enzymes. The amount of salt and flour used in the recipe had small but significant effects on the molecular weight of β-glucan. These results show that whole grain rye porridge made without a rest time before cooking contains extractable DF components maintaining high molecular weights. High molecular weight is most likely of nutritional importance.

Improved postharvest quality in patagonian squash ( Cucurbita moschata) coated with radiation depolymerized chitosan

Science.gov (United States)

Pugliese, Maria Alicia; Goitia, Maria Teresa; Yossen, Mariana; Cifone, Norma; Agulló, Enrique; Andreucetti, Noemi

2011-12-01

Different molecular weight chitosans were evaluated on the decay of coated Anquito squashes ( Cucurbita moschata) as well as the maintenance of the fruit quality along five storage months. The original chitosan (Mw=391 kDa, 83% DD), was depolymerized by gamma radiation. Apart from chain scission, other chemical changes were not detected by FTIR or UV-vis analyses. The molecular weight characterization of chitosans was done by size exclusion chromatography with dual light scattering and concentration detection (SEC-MALLS-RI). The coating effectiveness was evaluated on the following parameters: fungal decay incidence, weight loss, firmness, total reducing sugar, soluble solid, flesh color, carotene content, pH and titratable acidity. No sign of fungal decay was observed in squashes coated with 122 and 56 kDa chitosans, which were also the most effective treatments in reducing the weight loss. The chitosan with Mw=122 kDa was also the best treatment considering firmness, internal aspect, sugar and carotene content. Then, radiation degraded chitosan was better in C. moschata preservation than the original chitosan.

Tissue-specific increases in 11beta-hydroxysteroid dehydrogenase type 1 in normal weight postmenopausal women.

Directory of Open Access Journals (Sweden)

Therése Andersson

Full Text Available With age and menopause there is a shift in adipose distribution from gluteo-femoral to abdominal depots in women. Associated with this redistribution of fat are increased risks of type 2 diabetes and cardiovascular disease. Glucocorticoids influence body composition, and 11beta-hydroxysteroid dehydrogenase type 1 (11betaHSD1 which converts inert cortisone to active cortisol is a putative key mediator of metabolic complications in obesity. Increased 11betaHSD1 in adipose tissue may contribute to postmenopausal central obesity. We hypothesized that tissue-specific 11betaHSD1 gene expression and activity are up-regulated in the older, postmenopausal women compared to young, premenopausal women. Twenty-three pre- and 23 postmenopausal, healthy, normal weight women were recruited. The participants underwent a urine collection, a subcutaneous adipose tissue biopsy and the hepatic 11betaHSD1 activity was estimated by the serum cortisol response after an oral dose of cortisone. Urinary (5alpha-tetrahydrocortisol+5beta-tetrahydrocortisol/tetrahydrocortisone ratios were higher in postmenopausal women versus premenopausal women in luteal phase (P<0.05, indicating an increased whole-body 11betaHSD1 activity. Postmenopausal women had higher 11betaHSD1 gene expression in subcutaneous fat (P<0.05. Hepatic first pass conversion of oral cortisone to cortisol was also increased in postmenopausal women versus premenopausal women in follicular phase of the menstrual cycle (P<0.01, at 30 min post cortisone ingestion, suggesting higher hepatic 11betaHSD1 activity. In conclusion, our results indicate that postmenopausal normal weight women have increased 11betaHSD1 activity in adipose tissue and liver. This may contribute to metabolic dysfunctions with menopause and ageing in women.

Variation in storage alpha-glucans of the Porphyridiales (Rhodophyta).

Science.gov (United States)

Shimonaga, Takahiro; Konishi, Mai; Oyama, Yasunori; Fujiwara, Shoko; Satoh, Aya; Fujita, Naoko; Colleoni, Christophe; Buléon, Alain; Putaux, Jean-Luc; Ball, Steven G; Yokoyama, Akiko; Hara, Yoshiaki; Nakamura, Yasunori; Tsuzuki, Mikio

2008-01-01

Storage glucans were analyzed in the Porphyridiales which include the most primitive and phylogenetically diverged species in the Rhodophyta, to understand early evolution of the glucan structure in the Rhodophyta. The storage glucans of both Galdieria sulphuraria and Cyanidium caldarium consisted of glycogen, while those of Rhodosorus marinus, Porphyridium purpureum, P. sordidum and Rhodella violacea could be defined as semi-amylopectin. X-ray diffraction analysis of the glucans demonstrated variation in the crystalline structure: the patterns in P. purpureum and R. violacea were of A- and B-types, respectively, while alpha-glucans of R. marinus and P. sordidum displayed structures with lower crystallinity. Electron microscopic observations indicated that the alpha-glucans of P. sordidum consisted of two kinds of granules; a minor component of more dense granules with crystalline leaflets and a major component of softer ones without crystalline structure. Gel permeation chromatography showed that all the species containing the semi-amylopectin-type glucans also contained amylose, although the relative amounts of this fraction were different depending on the species. Our results are consistent with two distinct evolution scenarios defined either by the independent acquisition of semi-crystalline starch-like structures in the different plant lineages or more probably by the loss of starch and reversion to glycogen synthesis in cyanidian algae growing in hot and acid environments.

OH radical induced depolymerization of poly(methacrylic acid)

Science.gov (United States)

Ulanski, Piotr; Bothe, Eberhard; von Sonntag, Clemens

1999-05-01

Hydroxyl radicals (generated pulse radiolytically in dilute N 2O-saturated aqueous solutions) react with poly(methacrylic acid) producing two kinds of radicals. The primary radical is converted into a secondary one by H-abstraction ( k=3.5 × 10 2 s -1) as monitored by changes in the UV spectrum. Subsequently, the secondary radicals undergo chain scission ( k=1.8 s -1 at pH 7-9). This process has been followed both by spectrophotometry as well as by conductometry. In competition with the bimolecular decay of the radicals the ensuing end-chain radicals undergo efficient depolymerization resulting in the release of monomer. Since the lifetime of the radicals is much longer at high pH, where the polymer attains a rod-like conformation, depolymerization is most efficient in basic solution.

Function and Biosynthesis of Cell Wall α-1,3-Glucan in Fungi

Directory of Open Access Journals (Sweden)

Akira Yoshimi

2017-11-01

Full Text Available Although α-1,3-glucan is a major cell wall polysaccharide in filamentous fungi, its biological functions remain unclear, except that it acts as a virulence factor in animal and plant pathogenic fungi: it conceals cell wall β-glucan on the fungal cell surface to circumvent recognition by hosts. However, cell wall α-1,3-glucan is also present in many of non-pathogenic fungi. Recently, the universal function of α-1,3-glucan as an aggregation factor has been demonstrated. Applications of fungi with modified cell wall α-1,3-glucan in the fermentation industry and of in vitro enzymatically-synthesized α-1,3-glucan in bio-plastics have been developed. This review focuses on the recent progress in our understanding of the biological functions and biosynthetic mechanism of cell wall α-1,3-glucan in fungi. We briefly consider the history of studies on α-1,3-glucan, overview its biological functions and biosynthesis, and finally consider the industrial applications of fungi deficient in α-1,3-glucan.

Advanced Model Compounds for Understanding Acid-Catalyzed Lignin Depolymerization: Identification of Renewable Aromatics and a Lignin-Derived Solvent.

Science.gov (United States)

Lahive, Ciaran W; Deuss, Peter J; Lancefield, Christopher S; Sun, Zhuohua; Cordes, David B; Young, Claire M; Tran, Fanny; Slawin, Alexandra M Z; de Vries, Johannes G; Kamer, Paul C J; Westwood, Nicholas J; Barta, Katalin

2016-07-20

The development of fundamentally new approaches for lignin depolymerization is challenged by the complexity of this aromatic biopolymer. While overly simplified model compounds often lack relevance to the chemistry of lignin, the direct use of lignin streams poses significant analytical challenges to methodology development. Ideally, new methods should be tested on model compounds that are complex enough to mirror the structural diversity in lignin but still of sufficiently low molecular weight to enable facile analysis. In this contribution, we present a new class of advanced (β-O-4)-(β-5) dilinkage models that are highly realistic representations of a lignin fragment. Together with selected β-O-4, β-5, and β-β structures, these compounds provide a detailed understanding of the reactivity of various types of lignin linkages in acid catalysis in conjunction with stabilization of reactive intermediates using ethylene glycol. The use of these new models has allowed for identification of novel reaction pathways and intermediates and led to the characterization of new dimeric products in subsequent lignin depolymerization studies. The excellent correlation between model and lignin experiments highlights the relevance of this new class of model compounds for broader use in catalysis studies. Only by understanding the reactivity of the linkages in lignin at this level of detail can fully optimized lignin depolymerization strategies be developed.

Weighted approximation by the q-Szász-Schurer-beta type operators

OpenAIRE

Yüksel, İsmet; Dinlemez, ülkü

2014-01-01

In this study, we investigate approximation properties of a Schurer type generalization of q-Szász-beta type operators. We estimate the rate of weighted approximation of these operators for functions of polynomial growth on the interval [0,∞).

Anti-tumor effects of (1→3)-β-d-glucan from Saccharomyces cerevisiae in S180 tumor-bearing mice.

Science.gov (United States)

Mo, Li; Chen, Yafei; Li, Wenjian; Guo, Shuai; Wang, Xuzhao; An, Hailong; Zhan, Yong

2017-02-01

(1→3)-β-d-Glucan from Saccharomyces cerevisiae is a typical polysaccharide with various biological effects and is considered a candidate for the prevention and treatment of cancer in vitro. Research into the function of (1→3)-β-d-glucan in tumor-bearing animals in vivo, however, is limited. Here, we investigated the effects of (1→3)-β-d-glucan from S. cerevisiae on S180 tumor-bearing mice and on the immunity of the tumor-bearing host. The molecular mechanisms underlying the observed effects were investigated. (1→3)-β-d-Glucan was shown to exert anti-tumor effects without toxicity in normal mouse cells. The volume and weight of S180 tumors decreased dramatically following treatment with (1→3)-β-d-glucan, and treatment with the polysaccharide was furthermore shown to increase the tumor inhibition rate in a dose-dependent manner. Spleen index, T lymphocyte subsets (CD 4 and CD 8 ), as well as interleukins (IL)-2, (IL-2, IL-6), and tumor necrosis factor-α were assayed to detect the immunoregulatory and anti-tumor effects after (1→3)-β-d-glucan intragastrical administration. (1→3)-β-d-Glucan was shown to significantly potentiate the mouse immune responses by, among other effects, decreasing the ratio of CD 4 to CD 8 . The expression levels of IL-2, IL-6, and TNF-α were also significantly increased by (1→3)-β-d-glucan. These results suggest that (1→3)-β-d-glucan enhances the host's immune function during the tumor inhibition process. S180 tumor cells treated with (1→3)-β-d-glucan also exhibited significant apoptotic characteristics. (1→3)-β-d-glucan increased the ratio of Bax to Bcl-2 at the translation level by up-regulating Bax expression and down-regulating Bcl-2 expression, resulting in the initiation of cell apoptosis in S180 tumor-bearing mice. Taken together, these results indicate that the anti-tumor effects exerted by (1→3)-β-d-glucan may be attributed to the polysaccharide's immunostimulating properties and apoptosis

Glucan synthesis in the genus Lactobacillus : isolation and characterization of glucansucrase genes, enzymes and glucan products from six different strains

NARCIS (Netherlands)

Kralj, S.; Geel-Schutten, G.H. van; Dondorff, M.M.G.; Kirsanovs, S.; Maarel, M.J.E.C. van der; Dijkhuizen, L.

2004-01-01

Members of the genera Streptococcus and Leuconostoc synthesize various α-glucans (dextran, alternan and mutan). In Lactobacillus, until now, the only glucosyltransferase (GTF) enzyme that has been characterized is gtfA of Lactobacillus reuteri 121, the first GTF enzyme synthesizing a glucan

Glucan synthesis in the genus Lactobacillus: Isolation and characterization of glucansucrase genes, enzymes and glucan products from six different strains

NARCIS (Netherlands)

Kralj, S.; Geel-Schutten, G.H. van; Dondorff, M.M.G.; Kirsanovs, S.; Maarel, M.J.E.C. van der; Dijkhuizen, L.

2004-01-01

Members of the genera Streptococcus and Leuconostoc synthesize various α-glucans (dextran, alternan and mutan). In Lactobacillus, until now, the only glucosyltransferase (GTF) enzyme that has been characterized is gtfA of Lactobacillus reuteri 121, the first GTF enzyme synthesizing a glucan

The Depolymerization of Poly(Ethylene Terephthalate) (PET) Using N-Heterocyclic Carbenes from Ionic Liquids

Science.gov (United States)

Kamber, Nahrain E.; Tsujii, Yasuhito; Keets, Kate; Waymouth, Robert M.; Pratt, Russell C.; Nyce, Gregory W.; Hedrick, James L.

2010-01-01

The depolymerization of the plastic polyethylene terephthalate (PET or PETE) is described in this laboratory procedure. The transesterification reaction used to depolymerize PET employs a highly efficient N-heterocyclic carbene catalyst derived from a commercially available imidazolium ionic liquid. N-heterocyclic carbenes are potent nucleophilic…

Preparation, characterization, and biological properties of β-glucans

Directory of Open Access Journals (Sweden)

Sandeep Rahar

2011-01-01

Full Text Available β-Glucans are soluble fibers with physiological functions, such as, interference with absorption of sugars and reduction of serum lipid levels. β-glucans are found in different species, such as, Rhynchelytrum repens, Lentinus edodes, Grifola frondosa, Tremella mesenterica, Tremella aurantia, Zea may, Agaricus blazei, Phellinus baummi, Saccharomyces cerevisae (yeast, and Agaricus blazei murell (mushroom. Analysis of the fractions reveals the presence of arabinose, glucose, xylose, and traces of rhamnose and galactose. The presence of β-glucan in these fractions is confirmed by hydrolyzing the polymers with endo-β-glucanase from Bacillus subtilis, followed by high-performance liquid chromatography (HPLC analysis of the characteristic oligosaccharides produced. The 4 M KOH fractions from different tissues are subjected to gel permeation chromatography on Sepharose 4B, with separation of polysaccharides, with different degrees of polymerization, the highest molecular mass (above 2000 kDa being found in young leaves. The molecular mass of the leaf blade polymers is similar (250 kDa to that of the maize coleoptiles β-glucan used for comparison. The 4 M KOH fraction injected into rats with streptozotocin-induced diabetes has shown hypoglycemic activity, reducing blood sugar to normal levels for approximately 24 hours. This performance is better than that obtained with pure β-glucan from barley, which decreases blood sugar levels for about four hours. These results suggest that the activity of β-glucans is responsible for the use of this plant extract as a hypoglycemic drug in folk medicine.

Chemical characterization and wound healing property of a β-D-glucan from edible mushroom Piptoporus betulinus.

Science.gov (United States)

de Jesus, Liana Inara; Smiderle, Fhernanda R; Ruthes, Andrea C; Vilaplana, Francisco; Dal'Lin, Fernando Tonholi; Maria-Ferreira, Daniele; Werner, Maria Fernanda; Van Griensven, Leo J L D; Iacomini, Marcello

2017-12-20

A water-soluble β-D-glucan was obtained from fruiting bodies of Piptoporus betulinus, by hot aqueous extraction followed by freeze-thawing procedure and dialysis. Its molar mass distribution and conformational behavior in solution was assessed by size-exclusion chromatography coupled with multiangle laser light scattering, showing a polysaccharide with an average molecular weight of 2.5 × 10 5  Da with a random coil conformation for molecular weights below 1 × 10 6  Da. Typical signals of β-(1 → 3)-linkages were observed in NMR spectrum (δ 102.7/4.76; 102.8/4.74; 102.9/4.52; and δ 85.1/3.78; 85.0/3.77) and also signals of O-6 substitution at δ 69.2/4.22 and 69.2/3.87. The analysis of partially O-methylated alditol acetates corroborates the NMR results, indicating the presence of a β-D-glucan with a main chain (1 → 3)-linked, substituted at O-6 by single-units of glucose. The β-D-glucan showed no toxicity on human colon carcinoma cell line (Caco-2) up to 1000 μg mL -1 and promoted cell migration on in vitro scratch assay, demonstrating a potential wound healing capacity. Copyright © 2017. Published by Elsevier B.V.

Amphiphilic polymeric micelles originating from 1,4-β-D-glucan-g-polyphenylene oxide as the carriers for delivery of docetaxel and the corresponding release behaviors.

Science.gov (United States)

Yang, Fang; Xiao, Dan; Han, Huaxin; Chen, Yuhuan; Li, Gang

2018-07-15

A novel amphiphilic polymeric drug carrier was synthesized through grafting polymerization of water-soluble 1,4-β-D-glucan from cotton cellulose tailored and polypropylene oxide (PPO), and then use thereof to synthesize graft copolymer 1,4-β-D-glucan-PPO-docetaxel (DTX). The products were characterized by FTIR, 1 H NMR, and 13 C NMR. The physicochemical characteristics of 1,4-β-D-glucan-PPO and 1,4-β-D-glucan-PPO-DTX such as molecular weight distribution (MWD), micro-morphology, size, critical micelle concentration (CMC), aggregation number of micelle (N), in vitro stability and drug pharmacokinetic study in vivo were investigated. The results reveal that the degree of polymerization (DP) of the water-soluble 1,4-β-D-glucan from cotton cellulose tailored is equal to 7; the 1,4-β-D-glucan-PPO surfactant possesses good surface activity while the adduct number of propylene oxide reaches appropriately to 20; the DTX is completely dispersed in water medium with 1,4-β-D-glucan-PPO-DTX micelle and the drug conjugated percent is up to 40.3%; In vitro study confirms that 1,4-β-D-glucan-PPO-DTX has the capacity for sustained drug release; In plasma, 1,4-β-D-glucan-PPO-DTX exhibits a significantly enhanced C max , AUC (0-t) and T 1/2 compared with DTX. These results demonstrate that 1,4-β-D-glucan-PPO has the potential to be used as a novel biocompatible biomaterial for drug delivery. Copyright © 2018 Elsevier B.V. All rights reserved.

Olive Mill Waste Enhances α-Glucan Content in the Edible Mushroom Pleurotus eryngii

Directory of Open Access Journals (Sweden)

Sharon Avni

2017-07-01

Full Text Available Mushroom polysaccharides are edible polymers that have numerous reported biological functions; the most common effects are attributed to β-glucans. In recent years, it became apparent that the less abundant α-glucans also possess potent effects in various health conditions. Here we explore several Pleurotus species for their total, β and α-glucan content. Pleurotus eryngii was found to have the highest total glucan concentrations and the highest α-glucans proportion. We also found that the stalks (stipe of the fruit body contained higher glucan content then the caps (pileus. Since mushrooms respond markedly to changes in environmental and growth conditions, we developed cultivation methods aiming to increase the levels of α and β-glucans. Using olive mill solid waste (OMSW from three-phase olive mills in the cultivation substrate. We were able to enrich the levels mainly of α-glucans. Maximal total glucan concentrations were enhanced up to twice when the growth substrate contained 80% of OMSW compared to no OMSW. Taking together this study demonstrate that Pleurotus eryngii can serve as a potential rich source of glucans for nutritional and medicinal applications and that glucan content in mushroom fruiting bodies can be further enriched by applying OMSW into the cultivation substrate.

Effect of enzymatic depolymerization on physicochemical and rheological properties of guar gum.

Science.gov (United States)

Mudgil, Deepak; Barak, Sheweta; Khatkar, B S

2012-09-01

Depolymerization of guar gum using enzymatic hydrolysis was performed to obtain depolymerized guar gum having functional application as soluble dietary fiber. Enzymatic hydrolysis of guar gum significantly affected the physicochemical and rheological characteristics of guar gum. The depolymerized guar gum showed a significant increase in crystallinity index from 3.86% to 13.2% and flow behavior index from 0.31 to 1.7 as compared to native guar gum. Remarkable decrease in intrinsic viscosity and consistency index was also observed from 9 to 0.28 and 4.04 to 0.07, respectively. Results revealed that enzymatic hydrolysis of guar gum resulted in a polysaccharide with low degree of polymerization, viscosity and consistency which could make it useful for incorporation in food products as dietary fiber without affecting the rheology, consistency and texture of the products. Copyright © 2012 Elsevier Ltd. All rights reserved.

Drying enhances immunoactivity of spent brewer's yeast cell wall β-D-glucans.

Science.gov (United States)

Liepins, Janis; Kovačova, Elena; Shvirksts, Karlis; Grube, Mara; Rapoport, Alexander; Kogan, Grigorij

2015-07-20

Due to immunological activity, microbial cell wall polysaccharides are defined as 'biological response modifiers' (BRM). Cell walls of spent brewer's yeast also have some BRM activity. However, up to date there is no consensus on the use of spent brewer's yeast D-glucan as specific BRM in humans or animals. The aim of this paper is to demonstrate the potential of spent brewer's yeast β-D-glucans as BRM, and drying as an efficient pretreatment to increase β-D-glucan's immunogenic activity. Our results revealed that drying does not change spent brewer's yeast biomass carbohydrate content as well as the chemical structure of purified β-D-glucan. However, drying increased purified β-D-glucan TNF-α induction activity in the murine macrophage model. We presume drying pretreatment enhances purity of extracted β-D-glucan. This is corroborated with FT-IR analyses of the β-D-glucan spectra. Based on our results, we suggest that dry spent brewer's yeast biomass can be used as a cheap source for high-quality β-D-glucan extraction. Drying in combination with carboxylmethylation (CM), endows spent brewer's yeast β-D-glucan with the immunoactivity similar or exceeding that of a well-characterized fungal BRM pleuran. Copyright © 2015 Elsevier B.V. All rights reserved.

Effect of electron beam-irradiation to b-glucan on its immunomodulating and antitumor activity

International Nuclear Information System (INIS)

Jung, Yeon Hwan; Lee, Jung Lim; Yoo, Yung Choon; Kim, Jae Hoon; Lee, Ju Woon

2010-01-01

In this study, in order investigated the effect of electron beam irradiation to b-glucan on its biological activities, we compared immunomodulating and antitumor activity between non-irradiated and electron beam-irradiated b-glucan. EB-glucan was irradiated by electron beam with 10, 30 and 50 kGy. Treatment with EB-glucan resulted in a slight increase of the proliferation of ConA-stimulated splenocytes, and the strongest activity was seen in 50 kGy-treated EB-glucan. EB-glucan teated with 50 kGy also showed increased secretion of cytokines such as IL-2 IFN-γ and IL-6 from ConA-stimulated splenocytes. The activity of EB-glucan to enhance the proliferation of splenocytes and cytokine secretion from ConA-stimulated splenocytes was higher than that of NI-glucan. Furthermore, EB-glucan treated with 50 kGy showed higher activity to activate RAW 264.7 macrophages, comparing with that of NI-glucan. In experiments of antitumor activity, EB-glucan treated with 50 kGy prior to tumor inoculation inhibited an experimental lung metastasis produced by B16-BL6 melanoma cells in mice. But NI-glucan did show no effect. In addition, EB-glucan treated with 50 kGy induced a decrease a decrease of tumor growth in tumor-bearing mice. Collectivelt, these results indicates that electron beam irradiation β-glucan leads its biological functions to enhance immunomodulating and antitumor activity

Disease resistance of pacu Piaractus mesopotamicus (Holmberg, 1887 fed with β-glucan

Directory of Open Access Journals (Sweden)

JD Biller-Takahashi

Full Text Available Effects of β-glucan on innate immune responses and survival were studied in pacu experimentally infected with Aeromonas hydrophila. Fish fed diets containing 0, 0.1% and 1% β-glucan were injected with A. hydrophila. β-glucan enhanced fish survival in both treated groups (26.7% and 21.2% of the control, respectively. Leukocyte respiratory burst and alternative complement pathway activities were elevated after bacterial challenge regardless the β-glucan concentration. Lysozyme activity was higher after infection and showed a gradual increase as β-glucan concentration increased. A significant elevation in WBC count was observed either after bacterial challenge or by influence of β-glucan separately. The same response was observed in the number of thrombocytes, lymphocytes, eosinophils, LG-PAS positive cell and monocytes. It can be concluded that feeding pacu with β-glucan can increase protection against A. hydrophila, due to changes in non-specific immune responses.

Suppressing effects of glucan on micronuclei induced by Co60 in mice

International Nuclear Information System (INIS)

Chorvatovicova, D.

1991-01-01

The effects of glucan on the frequency of micronuclei in polychromatic erythrocytes of A/Ph mouse bone marrow induced by Co 60 irradiation were examined. Suppressing effect of three glucan derivatives was statistically significant (P 3 substituent (DS 0.89). Intraperitoneal application of glucan has to be done earlier than one hour after irradiation. The suppressive effects of glucans can be explained by their ability to trap OH radicals and so decrease the clastogenic effect of irradiation. The results may be useful for therapeutic application of glucan with radiation therapy. (orig.) [de

Effect of low-molecular-weight beta-cyclodextrin polymer on release of drugs from mucoadhesive buccal film dosage forms.

Science.gov (United States)

Arakawa, Yotaro; Kawakami, Shigeru; Yamashita, Fumiyoshi; Hashida, Mitsuru

2005-09-01

We investigated the effect of low-molecular-weight beta-cyclodextrin (beta-CyD) polymer on in vitro release of two drugs with different lipophilicities (i.e., lidocaine and ketoprofen) from mucoadhesive buccal film dosage forms. When beta-CyD polymer was added to hydroxypropylcellulose (HPC) or polyvinylalcohol (PVA) film dosage forms, the release of lidocaine into artificial saliva (pH 5.7) was reduced by 40% of the control. In contrast, the release of ketoprofen from the polymer film was enhanced by addition of beta-CyD polymer to the vehicle. When lidocaine and ketoprofen was incubated with beta-CyD polymer in the artificial saliva, concentration of free lidocaine molecules decreased in a beta-CyD polymer concentration-dependent manner. The association constant with beta-CyD polymer was 6.9+/-0.6 and 520+/-90 M(-1) for lidocaine and ketoprofen, respectively. Retarded release of the hydrophilic lidocaine by beta-CyD polymer might be due to the decrease in thermodynamic activity by inclusion complex formation, whereas enhanced release of the lipophilic ketoprofen by the beta-CyD polymer might be due to prevention of recrystallization occurring after contacting the film with aqueous solution. Thus, effects of low-molecular-weight beta-CyD polymer to the drug release rate from film dosage forms would vary according to the strength of interaction with and the solubility of active ingredient.

Minor long-term changes in weight have beneficial effects on insulin sensitivity and beta-cell function in obese subjects

DEFF Research Database (Denmark)

Rosenfalck, A M; Hendel, Helle Westergren; Rasmussen, M H

2002-01-01

To evaluate the long-term effect of changes in body composition induced by weight loss on insulin sensitivity (SI), non-insulin mediated glucose disposal, glucose effectiveness (SG)and beta-cell function.......To evaluate the long-term effect of changes in body composition induced by weight loss on insulin sensitivity (SI), non-insulin mediated glucose disposal, glucose effectiveness (SG)and beta-cell function....

Unique base-initiated depolymerization of limonene-derived polycarbonates

NARCIS (Netherlands)

Li, C.; Sablong, R.J.; van Benthem, R.A.T.M.; Koning, C.E.

2017-01-01

The depolymerization of poly(limonene carbonate) (PLC) initiated by 1,5,7-triazabicyclo[4.4.0]dec-5-ene (TBD) was investigated. The strong organic base TBD was capable of deprotonating the OH-terminated PLC, leading to fast degradation via backbiting reactions at high temperature. An interesting

Localization of synthesis of β1,6-glucan in Saccharomyces cerevisiae

NARCIS (Netherlands)

Montijn, R.C.; Vink, E.; Müller, W.H.; Verkleij, A.J.; Ende, H. van den; Henrissat, B.; Klis, F.M.

1999-01-01

β1,6-Glucan is a key component of the yeast cell wall, interconnecting cell wall proteins, β1,3-glucan, and chitin. It has been postulated that the synthesis of β1,6-glucan begins in the endoplasmic reticulum with the formation of protein-bound primer structures and that these primer structures are

Suppressing effects of glucan on micronuclei induced by Co sup 60 in mice

Energy Technology Data Exchange (ETDEWEB)

Chorvatovicova, D. (Slovak Academy of Sciences, Bratislava (Czechoslovakia). Inst. of Ecobiology)

1991-10-01

The effects of glucan on the frequency of micronuclei in polychromatic erythrocytes of A/Ph mouse bone marrow induced by Co{sup 60} irradiation were examined. Suppressing effect of three glucan derivatives was statistically significant (P<0.01) by intravenous application of glucan one hour after irradiation. The most expressive effect was obvious by K{sub 3} substituent (DS 0.89). Intraperitoneal application of glucan has to be done earlier than one hour after irradiation. The suppressive effects of glucans can be explained by their ability to trap OH radicals and so decrease the clastogenic effect of irradiation. The results may be useful for therapeutic application of glucan with radiation therapy. (orig.).

Influence of the degree of crosslinking on the depolymerization of disulfide polymer

International Nuclear Information System (INIS)

Rekalicj, J.V.; Radosavljevicj, D.S.; Popovicj, E.M.; Stashicj, L.

1976-01-01

The action of nucleophilic reagents (hydrogen sulfide ion, dithionite ion and hydrazine) on disulfide polymers prepd. from bis-2-chloroethyl formal and 1,2,3-trichloropropane, taken in various mol rations is studied. The depolymerization efficiency is higher with hydrazine and dithionite than with a mixt. of sodium hydrogen sulfide and sodium sulfite. An interpretation of the results is given, attempting to correlate the content of SH-groups in the obtained product with the same quantity in some defined compds. which can be present after the depolymerization

Effective depolymerization of concentrated acid hydrolysis lignin using a carbon-supported ruthenium catalyst in ethanol/formic acid media.

Science.gov (United States)

Kristianto, Ivan; Limarta, Susan Olivia; Lee, Hyunjoo; Ha, Jeong-Myeong; Suh, Dong Jin; Jae, Jungho

2017-06-01

Lignin isolated by two-step concentrated acid hydrolysis of empty fruit bunch (EFB) was effectively depolymerized into a high-quality bio-oil using formic acid (FA) as an in-situ hydrogen source and Ru/C as a catalyst in supercritical ethanol. A bio-oil yield of 66.3wt% with an average molecular weight of 822g/mol and an aromatic monomer content of 6.1wt% was achieved at 350°C and a FA-to-lignin mass ratio of 3 after a reaction time of 60min. The combination of Ru/C and FA also resulted in a significant reduction in the oxygen content of the bio-oil by ∼60% and a corresponding increase in the higher heating value (HHV) to 32.7MJ/kg due to the enhanced hydrodeoxygenation activity. An examination of the FA decomposition characteristics revealed that Ru/C provides a greater increase in the rate of hydrogen production from FA, explaining the efficient depolymerization of lignin in a combined system. Copyright © 2017 Elsevier Ltd. All rights reserved.

Orally delivered β-glucans aggravate dextran sulfate sodium (DSS)-induced intestinal inflammation

NARCIS (Netherlands)

Heinsbroek, Sigrid E. M.; Williams, David L.; Welting, Olaf; Meijer, Sybren L.; Gordon, Siamon; de Jonge, Wouter J.

2015-01-01

β-Glucans have beneficial health effects due to their immune modulatory properties. Oral administration of β-glucans affects tumour growth, microbial infection, sepsis, and wound healing. We hypothesized that pre-treatment with orally delivered soluble and particulate β-glucans could ameliorate the

Recent insight in α-glucan metabolism in probiotic bacteria

DEFF Research Database (Denmark)

Møller, Marie Sofie; Goh, Yong Jun; Viborg, Alexander Holm

2014-01-01

α-Glucans from bacterial exo-polysaccharides or diet, e.g., resistant starch, legumes and honey are abundant in the human gut and fermentation of resistant fractions of these α-glucans by probiotic lactobacilli and bifidobacteria impacts human health positively. The ability to degrade polymeric α...

β-Glucans: Relationships between Modification, Conformation and Functional Activities

Directory of Open Access Journals (Sweden)

Qiang Wang

2017-02-01

Full Text Available β-glucan is a type of polysaccharide which widely exists in bacteria, fungi, algae, and plants, and has been well known for its biological activities such as enhancing immunity, antitumor, antibacterial, antiviral, and wound healing activities. The conformation of β-glucan plays a crucial role on its biological activities. Therefore, β-glucans obtained from different sources, while sharing the same basic structures, often show different bioactivities. The basic structure and inter-molecular forces of polysaccharides can be changed by modification, which leads to the conformational transformation in solution that can directly affect bioactivity. In this review, we will first determine different ways to modify β-glucan molecules including physical methods, chemical methods, and biological methods, and then reveal the relationship of the flexible helix form of the molecule chain and the helix conformation to their bioactivities. Last, we summarize the scientific challenges to modifying β-glucan’s conformation and functional activity, and discuss its potential future development.

Characterization and biocompatibility of glucan: a safe food additive from probiotic Lactobacillus plantarum DM5.

Science.gov (United States)

Das, Deeplina; Goyal, Arun

2014-03-15

Exopolysaccharide produced by lactic acid bacteria are the subject of an increasing number of studies for their potential applications in the food industry as stabilizing, bio-thickening and immunostimulating agents. In this regard, the authors isolated an exopolysaccharide producing probiotic lactic acid bacterium from fermented beverage Marcha of north eastern Himalayas. The isolate Lactobacillus plantarum DM5 showed extracellular glucansucrase activity of 0.48 U mg⁻¹ by synthesizing natural exopolysaccharide glucan (1.87 mg mL⁻¹) from sucrose. Zymogram analysis of purified enzyme confirms the presence of glucosyltransferase of approximately 148 kDa with optimal activity of 18.7 U mg⁻¹ at 30 °C and pH 5.4. The exopolysaccharide was purified by gel permeation chromatography and had an average molecular weight of 1.11 × 10⁶ Da. Acid hydrolysis and structural characterization of exopolysaccharide revealed that it was composed of d-glucose residues, containing 86.5% of α-(1→6) and 13.5% of α-(1→3) linkages. Rheological study exhibited a shear thinning effect of glucan appropriate for food additives. A cytotoxicity test of glucan on human embryonic kidney 293 (HEK 293) and human cervical cancer (HeLa) cell lines revealed its nontoxic biocompatible nature. This is the first report on the structure and biocompatibility of homopolysaccharide α-D-glucan (dextran) from probiotic Lactobacillus plantarum strain and its unique physical and rheological properties that facilitate its application in the food industry as viscosifying and gelling agent. © 2013 Society of Chemical Industry.

Feeding common carp Cyprinus carpio with β-glucan supplemented diet stimulates C-reactive protein and complement immune acute phase responses following PAMPs injection.

Science.gov (United States)

Pionnier, Nicolas; Falco, Alberto; Miest, Joanna J; Shrive, Annette K; Hoole, Dave

2014-08-01

The effect of β-glucan as a feed additive on the serum and gene profile of C-reactive protein (CRP) and complement acute phase responses was ascertained in common carp Cyprinus carpio. In addition effects of subsequent intraperitoneal injections of pathogen-associated molecular patterns (PAMPs), i.e. LPS or poly(I:C), to mimic bacterial or viral infection respectively, were studied. Carp were first orally fed with β-glucan (MacroGard®) with a daily β-glucan intake of 6 mg per kg body weight or with control food for 25 days and then injected with PBS containing either LPS (4 mg/kg) or poly(I:C) (5 mg/kg) or PBS alone. Fish were sampled during the 25 days of the feeding period and up to 7 days post-PAMPs injections for serum and liver, head kidney and mid-gut tissues. Oral administration of β-glucan for 25 days significantly increased serum CRP levels and alternative complement activity (ACP). In addition, the subsequent LPS and poly(I:C) challenges significantly affected CRP and complement related gene expression profiles (crp1, crp2, c1r/s, bf/c2, c3 and masp2), with the greatest effects observed in the β-glucan fed fish. However, in fish fed β-glucan the PAMPs injections had less effects on CRP levels and complement activity in the serum than in control fed fish, suggesting that the 25 days of β-glucan immunostimulation was sufficient enough to reduce the effects of LPS and poly(I:C) injections. Results suggest that MacroGard® stimulated CRP and complement responses to PAMPs immunological challenges in common carp thus highlighting the beneficial β-glucan immunostimulant properties. Copyright © 2014 Elsevier Ltd. All rights reserved.

Low temperature coal depolymerization-liquefaction: conversion of a North Dakota lignite to a light hydrocarbon oil

Energy Technology Data Exchange (ETDEWEB)

Shabtai, J.; Yuan Zhang (University of Utah, Salt Lake City, UT (USA). Dept. of Fuels Engineering)

1989-10-01

A new low temperature method of coal liquefaction is described which includes intercalation of the coal with FeCl{sub 3}, depolymerization under supercritical conditions, and hydroprocessing of the depolymerized product. Results indicate a high yield conversion of lignites to light hydrocarbon oils. 6 refs., 4 figs., 1 tab.

Molecular size estimation of plasma membrane β-glucan synthase from red beet root

International Nuclear Information System (INIS)

Sloan, M.E.; Eiberger, L.L.; Wasserman, B.P.

1986-01-01

Cellulose and cell wall β-D-glucans in higher plants are thought to be synthesized by the plasma membrane enzyme, β-glucan synthase. This enzyme has never been purified to homogeneity, hence its subunit composition is unknown. Partial purification of red beet root glucan synthase by glycerol density gradient centrifugation followed by SDS-PAGE yielded a highly enriched subunit of 68 kDa. Radiation inactivation of plasma membranes gave a molecular size the 450 kDa for the holoenzyme complex. This suggests that glucan synthase consists of 6 to 7 subunits and confirms electron microscope studies showing that glucan synthases exist as multi-subunit complexes embedded within the membrane

Effect of β-1.3/1.6-D-glucan derived from oyster mushroom Pleurotus ostreatus on biometrical, haematological, biochemical, and immunological indices in rainbow trout (Oncorhynchus mykiss).

Science.gov (United States)

Dobsikova, Radka; Blahova, Jana; Franc, Ales; Jakubik, Juraj; Mikulikova, Ivana; Modra, Helena; Novotna, Kamila; Svobodova, Zdenka

2012-01-01

Effect of long-term oral administration of three different concentrations (0.5, 1.0, and 2.0%) of micronized β-1.3/1.6-D-glucan derived from oyster mushroom (Pleurotus ostreatus, Hiratake) on biometrical, haematological, biochemical, and immunological indices of half-year-old rainbow trout (Oncorhynchus mykiss) was assessed in the study. Rainbow trout were feed commercial feed pellets containing β-1.3/1.6-D-glucan in the concentrations of 0.5, 1.0, and 2.0% for 85 days. Biometrical indices consisted in total and standard length, body and liver weight, from which derived somatic parameters such as Fulton´s condition factor and hepatosomatic index were calculated. Haematological parameters were evaluated according to unified methods for haematological examination in fish. Plasma biochemical profile was analysed using biochemical analyser Konelab 20i and Easy Lyte Analyzer. A phagocyte cells metabolic activity (induced chemiluminescence of phagocytes) was determined as an immunological parameter by a microplate luminometric method on Immunotech LM-01T. No clinical signs of behavioral, respiratory, or neurologic distress were observed in rainbow trout. Fish showed normal feeding behavior. As for biometric parameters, no significant changes in total and standard length, body weight, liver weight, as well as in condition factor and hepatosomatic index of experimental and control fish were found. In the course of the study, weight gains in rainbow trout were similar and continuous. Shifts in PCV (pglucose, lactate, total protein, cholesterol, calcium, natrium, potassium (all p<0.05), albumins and chlorides (both p<0.01), as well as catalytic activities of ALT and AST (both p<0.05) were changed in the course of the study. A phagocyte cells metabolic activity (luminol-induced chemiluminescence) in rainbow trout was not altered by oyster mushroom β-1.3/1.6-D-glucan administration. After long-term oral administration of three concentrations of micronized β-1.3/1.6-D-glucan

Structure and function of α-glucan debranching enzymes

DEFF Research Database (Denmark)

Møller, Marie Sofie; Henriksen, Anette; Svensson, Birte

2016-01-01

α-Glucan debranching enzymes hydrolyse α-1,6-linkages in starch/glycogen, thereby, playing a central role in energy metabolism in all living organisms. They belong to glycoside hydrolase families GH13 and GH57 and several of these enzymes are industrially important. Nine GH13 subfamilies include α......-glucan debranching enzymes; isoamylase and glycogen debranching enzymes (GH13_11); pullulanase type I/limit dextrinase (GH13_12–14); pullulan hydrolase (GH13_20); bifunctional glycogen debranching enzyme (GH13_25); oligo-1 and glucan-1,6-α-glucosidases (GH13_31); pullulanase type II (GH13_39); and α-amylase domains......_39 enzymes could represent a “missing link” between the strictly α-1,6-specific debranching enzymes and the enzymes with dual specificity and α-1,4-linkage preference....

11beta-hydroxysteroid dehydrogenase type 1 in adipose tissue and prospective changes in body weight and insulin resistance

DEFF Research Database (Denmark)

Koska, Juraj; de Courten, Barbora; Wake, Deborah J

2006-01-01

Increased mRNA and activity levels of 11beta-hydroxysteroid dehydrogenase type 1 (11betaHSD1) in human adipose tissue (AT) are associated with obesity and insulin resistance. The aim of our study was to investigate whether 11betaHSD1 expression or activity in abdominal subcutaneous AT of non-diab......-diabetic subjects are associated with subsequent changes in body weight and insulin resistance [homeostasis model assessment of insulin resistance (HOMA-IR)]....

Effect of purified oat β-glucan on fermentation of set-style yogurt mix.

Science.gov (United States)

Singh, Mukti; Kim, Sanghoon; Liu, Sean X

2012-08-01

Effect of oat β-glucan on the fermentation of set-style yogurt was investigated by incorporating 0%, 0.1%, 0.2%, 0.3%, 0.4%, and 0.5% of purified oat β-glucan into the yogurt mix. It was found that levels up to 0.3% resulted in yogurts with quality characteristics similar to the control yogurt. Higher levels of β-glucan however retarded the fermentation process with noticeable difference in the characteristics of the yogurt. Examination of the morphologies of yogurt with and without β-glucan revealed that β-glucan formed aggregates with casein micelle and did not form phase-separated domains. This research demonstrated that β-glucan could be added to yogurt up to 0.3%, which meets the nutrient guidelines, to have added nutritional benefits. Yogurt is known for its beneficial effects on human health and nutrition. Yogurt production and consumption is increasing in the United States every year. However, it is lacking in β-glucans, which are recognized for their nutritional importance as functional bioactive ingredients. The main objective was to develop and characterize low-fat yogurts with added β-glucan. This research demonstrated that β-glucan could be added to yogurt up to 0.3%, which meets the nutrient guidelines for added nutritional benefits, without affecting the characteristics of yogurt significantly. This study will benefit the dairy industry by generating new products offering healthy alternatives. Journal of Food Science © 2012 Institute of Food Technologists® No claim to original US government works.

Defining carbohydrate binding of glucan phosphatases via Affinity gel electrophoresis

DEFF Research Database (Denmark)

Auger, Kyle; Raththagala, Madushi; Wilkens, Casper

2016-01-01

was to determine a technique to measure carbohydrate binding quickly and efficiently. We established a protocol to reproducibly and quantitatively measure the binding of the enzymes to glucans utilizing Affinity Gel Electrophoresis (AGE). The results show that the various glucan phosphatases possess differing...

Comparison of Chain-Length Preferences and Glucan Specificities of Isoamylase-Type α-Glucan Debranching Enzymes from Rice, Cyanobacteria, and Bacteria.

Directory of Open Access Journals (Sweden)

Taiki Kobayashi

Full Text Available It has been believed that isoamylase (ISA-type α-glucan debranching enzymes (DBEs play crucial roles not only in α-glucan degradation but also in the biosynthesis by affecting the structure of glucans, although molecular basis on distinct roles of the individual DBEs has not fully understood. In an attempt to relate the roles of DBEs to their chain-length specificities, we analyzed the chain-length distribution of DBE enzymatic reaction products by using purified DBEs from various sources including rice, cyanobacteria, and bacteria. When DBEs were incubated with phytoglycogen, their chain-length specificities were divided into three groups. First, rice endosperm ISA3 (OsISA3 and Eschericia coli GlgX (EcoGlgX almost exclusively debranched chains having degree of polymerization (DP of 3 and 4. Second, OsISA1, Pseudomonas amyloderamosa ISA (PsaISA, and rice pullulanase (OsPUL could debranch a wide range of chains of DP≧3. Third, both cyanobacteria ISAs, Cyanothece ATCC 51142 ISA (CytISA and Synechococcus elongatus PCC7942 ISA (ScoISA, showed the intermediate chain-length preference, because they removed chains of mainly DP3-4 and DP3-6, respectively, while they could also react to chains of DP5-10 and 7-13 to some extent, respectively. In contrast, all these ISAs were reactive to various chains when incubated with amylopectin. In addition to a great variation in chain-length preferences among various ISAs, their activities greatly differed depending on a variety of glucans. Most strikingly, cyannobacteria ISAs could attack branch points of pullulan to a lesser extent although no such activity was found in OsISA1, OsISA3, EcoGlgX, and PsaISA. Thus, the present study shows the high possibility that varied chain-length specificities of ISA-type DBEs among sources and isozymes are responsible for their distinct functions in glucan metabolism.

Main: 1IEW [RPSD[Archive

Lifescience Database Archive (English)

Full Text Available m Vulgare Molecule: Beta-D-Glucan Glucohydrolase Isoenzyme Exo1; Chain: A; Synonym: Beta-D-Glucan Exohydrola...Beta-D-Glucan Glucohydrolase Structure V. 9 1005 2001 2-Domain Fold GB:AAD23382,4566505|EMBL; AF102868; AAD2

A Candida biofilm-induced pathway for matrix glucan delivery: implications for drug resistance.

Directory of Open Access Journals (Sweden)

Heather T Taff

Full Text Available Extracellular polysaccharides are key constituents of the biofilm matrix of many microorganisms. One critical carbohydrate component of Candida albicans biofilms, β-1,3 glucan, has been linked to biofilm protection from antifungal agents. In this study, we identify three glucan modification enzymes that function to deliver glucan from the cell to the extracellular matrix. These enzymes include two predicted glucan transferases and an exo-glucanase, encoded by BGL2, PHR1, and XOG1, respectively. We show that the enzymes are crucial for both delivery of β-1,3 glucan to the biofilm matrix and for accumulation of mature matrix biomass. The enzymes do not appear to impact cell wall glucan content of biofilm cells, nor are they necessary for filamentation or biofilm formation. We demonstrate that mutants lacking these genes exhibit enhanced susceptibility to the commonly used antifungal, fluconazole, during biofilm growth only. Transcriptional analysis and biofilm phenotypes of strains with multiple mutations suggest that these enzymes act in a complementary fashion to distribute matrix downstream of the primary β-1,3 glucan synthase encoded by FKS1. Furthermore, our observations suggest that this matrix delivery pathway works independently from the C. albicans ZAP1 matrix formation regulatory pathway. These glucan modification enzymes appear to play a biofilm-specific role in mediating the delivery and organization of mature biofilm matrix. We propose that the discovery of inhibitors for these enzymes would provide promising anti-biofilm therapeutics.

Characterization of ß-Glucans Isolated from Brewer’s Yeast and Dried by Different Methods

Directory of Open Access Journals (Sweden)

Vesna Zechner-Krpan

2010-01-01

Full Text Available Two different procedures have been used for isolation of water-insoluble ß-glucans from brewer’s yeast: alkaline-acidic isolation (AA and alkaline-acidic isolation with mannoprotein removal (AAM. The obtained ß-glucans were then dried by air-drying, lyophilization and combination of sonication and spray-drying. ß-Glucan preparations obtained by AA and AAM isolations had similar values of dry mass, total polysaccharides, proteins and organic elemental microanalysis. The mass fractions of ß-glucan in total polysaccharides were significantly affected by different isolation procedures. Fourier transform infrared (FTIR spectra of all preparations had the appearance typical for (1→3-ß-D-glucan. Lyophilization and especially air-drying caused a higher degree of agglomeration and changes in ß-glucan microstructure. Sonication followed by spray-drying resulted in minimal structural changes and negligible formation of agglomerates.

Main: 1IEX [RPSD[Archive

Lifescience Database Archive (English)

Full Text Available m Vulgare Molecule: Beta-D-Glucan Glucohydrolase Isoenzyme Exo1; Chain: A; Synonym: Beta-D-Glucan Exohydrola...Of A Plant Beta-D-Glucan Glucohydrolase Structure V. 9 1005 2001 2-Domain Fold GB:AAD23382,4566505|EMBL; AF1

Anti-glucan effects of propolis ethanol extract on Lactobacillus acidophillus

Directory of Open Access Journals (Sweden)

Ira Widjiastuti

2017-03-01

Full Text Available Background: In deep dentinal caries cases, bacteria mostly found are Lactobacillus acidophilus classified as gram positive bacteria and as facultative aerobes producing glucosyltransferase (GTF enzyme. GTF enzyme can alter sucrose into glucans. Glucan is sticky and insoluble in water. As a result, GTF enzyme can facilitate plaque formation and microorganism colonization on tooth surface. In addition, Lactobacillus acidophilus also can form acid leading to demineralization of organic and inorganic materials, resulting in dental caries. Multidrug-resistant phenomena, on the other hand, have led to the use of natural resources, one of which is propolis as an antimicrobial material and as a new anti-infective therapeutic strategy. Propolis is a resinous substances collected by worker bees (Apismellifera from barks and leaves of plants. Propolis has a complex chemical composition and biological properties, such as antibacterial, antiviral, antifungal, anti-inflammatory, and antitumor. Purpose: This research aimed to reveal anti-glucan effects of propolis ethanol extract generated from honey bee, Apis mellifera spp on Lactobacillus acidophilus bacteria. Method: Before antiglucan test was conducted, glucan-formation test was performed on Lactobacillus acidophilus bacteria using SDSpage. Meanwhile, anti-glucan adhesion test on Lactobacillus acidophilus bacteria was carried by culturing the bacteria at 37ºC temperature in a jar with 10% CO2. Test tubes were placed at an angle of 30º for 18 hours to review the attachment of bacteria at the glass surfaces. After the incubation, the culture of bacteria was vibrated using a mixer vortex for a few minutes, and then cultured in solid MRS A media. Bacteria grown were measured by using colony counter. Result: The ethanol extract of propolis with a concentration of 1.56% was the lowest concentration inhibiting the attachment of glucan to Lactobacillus acidophilus bacteria. Conclusion: The ethanol extract of

Base-catalyzed depolymerization of lignin : separation of monomers

Energy Technology Data Exchange (ETDEWEB)

Vigneault, A. [Sherbrooke Univ., PQ (Canada). Dept. of Chemical Engineering; Johnson, D.K. [National Renewable Energy Laboratory, Golden, CO (United States); Chornet, E. [Sherbrooke Univ., PQ (Canada). Dept. of Chemical Engineering; National Renewable Energy Laboratory, Golden, CO (United States)

2007-12-15

Biofuels produced from residual lignocellulosic biomass range from ethanol to biodiesel. The use of lignin for the production of alternate biofuels and green chemicals has been studied with particular emphasis on the structure of lignin and its oxyaromatic nature. In an effort to fractionate lignocellulosic biomass and valorize specific constitutive fractions, the authors developed a strategy for the separation of 12 added value monomers produced during the hydrolytic base catalyzed depolymerization (BCD) of a Steam Exploded Aspen Lignin. The separation strategy was similar to vanillin purification to obtain pure monomers, but combining more steps after the lignin depolymerization such as acidification, batch liquid-liquid-extraction (LLE), followed by vacuum distillation, liquid chromatography (LC) and crystallization. The purpose was to develop basic data for an industrial size process flow diagram, and to evaluate both the monomer losses during the separation and the energy requirements. Experimentally testing of LLE, vacuum distillation and flash LC in the laboratory showed that batch vacuum distillation produced up to 4 fractions. Process simulation revealed that a series of 4 vacuum distillation columns could produce 5 distinct monomer streams, of which 3 require further chromatography and crystallization operations for purification. 22 refs., 4 tabs., 8 figs.

The effect of yeast β-glucan on the amount of albumin, globulin, urea and total protein of broiler chickens

Directory of Open Access Journals (Sweden)

ali kargarirezapour

2013-08-01

Full Text Available Glucans derived from yeast cell wall are promising alternatives to antibiotics, as they have been shown to improve growth performance and stimulate the immune system of immature broilers. In this study we evaluated the effect of different levels of yeast beta-glucan (YBG on some blood parametrs of broiler chickens. In a factorial experiment based on completely randomized design (the first factor: YBG levels: 0, 0.04 and 0.08% of basal diet and sex as a second factor 144 day old chicks (72 male and 72 female were selected and allocated to different treatments (three replicates of each treatment. The overall experimental period was 34 days. At the end of study, two birds from each pen were randomly selected as a sample. The level of albumin, globulin, urea and total protein was measured on blood samples. Statistical analysis of the results showed that the YBG had no significant effect on albumin, globulin, urea and total protein level. But the amount of plasma albumin and total protein in female chicks was significantly higher than male chicks (p

Lactobacillus plantarum CIDCA 8327: An α-glucan producing-strain isolated from kefir grains.

Science.gov (United States)

Gangoiti, M V; Puertas, A I; Hamet, M F; Peruzzo, P J; Llamas, M G; Medrano, M; Prieto, A; Dueñas, M T; Abraham, A G

2017-08-15

Lactobacillus plantarum CIDCA 8327 is an exopolysaccharide (EPS)-producer strain isolated from kefir with promising properties for the development of functional foods. The aim of the present study was to characterize the structure of the EPS synthesized by this strain grown in skim milk or semidefined medium (SDM). Additionally, genes involved in EPS synthesis were detected by PCR. L. plantarum produces an EPS with a molecular weight of 10 4 Da in both media. When grown in SDM produce an heteropolysaccharide composed mainly of glucose, glucosamine and rhamnose meanwhile the EPS produced in milk was composed exclusively of glucose indicating the influence of the sugar source. FTIR spectra of this EPS showed signals attributable to an α-glucan. Both by 1 H NMR and methylation analysis it was possible to determine that this polysaccharide is a branched α-(1→4)-d-glucan composed of 80% linear α-(1→4)-d-glucopyranosyl units and 19% (1→4)-d-glucopyranosyl units substituted at O-3 by single α-d-glucopyranosil residues. Copyright © 2017 Elsevier Ltd. All rights reserved.

Structural characterization of a novel glucan from Achatina fulica and its antioxidant activity.

Science.gov (United States)

Liao, Ningbo; Chen, Shiguo; Ye, Xingqian; Zhong, Jianjun; Ye, Xuan; Yin, Xinzi; Tian, Jenny; Liu, Donghong

2014-03-19

A novel glucan designated AFPS-IB was purified from Achatina fulica (China white jade snail) by anion-exchange and gel-permeation chromatography. Chemical composition analysis indicated AFPS-IB was composed of glucose, fucose, rhamnose, mannose, and galactose in a molar ratio of 189:2:1:1:2 and with an average molecular weight of 128 kDa. Its structural characteristics were investigated by Fourier transform infrared spectroscopy (FTIR), high performance liquid chromatography (HPLC), gas chromatography mass spectrometry (GC-MS), methylation analysis, nuclear magnetic resonance (NMR) spectroscopy ((1)H,( 13)C, H-H COSY, HSQC, TOCSY, and NOESY), and atomic force microscopy (AFM). The glucan mainly consisted of a backbone of repeating (1→4)-α-d-glucose residues with (1→6)-β-d glucosyl branches at random points on the backbone glucose. Antioxidant studies revealed AFPS-IB showed significant DPPH (2,2-diphenyl-1-picrylhydrazyl) radical, superoxide anion (O2(-)) scavenging activities and high reduction potential. This study suggested that AFPS-IB could be a new source of dietary antioxidants.

Effects of β-glucan on colon anastomotic healing in rats given preoperative irradiation.

Science.gov (United States)

Seker, Ahmet; Deger, Kamuran Cumhur; Bostanci, Erdal Birol; Ozer, Ilter; Dalgic, Tahsin; Bilgihan, Ayse; Akmansu, Muge; Ekinci, Ozgur; Ercin, Ugur; Akoglu, Musa

2014-06-01

Radiation therapy is an essential therapeutic modality in the management of a wide variety of tumors. We aimed to investigate the short-term effects of pelvic irradiation on the healing of colon anastomoses and to determine the potential protective effects of β-glucan in this situation. Sixty Wistar albino rats were randomized into three experimental groups: a control group (n = 20), an irradiation (IR) group (n = 20), and an irradiation+β-glucan (IR+β-glucan) group (n = 20). Only segmental colonic resection and anastomosis were performed on the control group. The IR group underwent the same surgical procedure as the control group 5 days after pelvic irradiation. In the IR+β-glucan group, the same procedure was applied as in the IR group after β-glucan administration. The groups were subdivided into subgroups according to the date of euthanasia (third [n = 10] or seventh [n = 10] postoperative [PO] day), and anastomotic colonic segments were resected to evaluate bursting pressures and biochemical and histopathological parameters. Bursting pressure values were significantly lower in the IR group (p < .001). Malondialdehyde (MDA) levels were significantly higher in the IR group, whereas β-glucan significantly decreased MDA levels on the third PO day (p < .001). Granulation tissue formation scores were significantly lower in the IR+β-glucan group compared with the control group and the IR group (p < .001). The results of this study indicate that irradiation has negative effects on the early healing of colon anastomoses. The administration of β-glucan ameliorates these unfavorable effects by altering bursting pressures and biochemical parameters.

Depolymerized products of lambda-carrageenan as a potent angiogenesis inhibitor.

Science.gov (United States)

Chen, Haimin; Yan, Xiaojun; Lin, Jing; Wang, Feng; Xu, Weifeng

2007-08-22

Since angiogenesis is involved in initiating and promoting several diseases such as cancer and cardiovascular events, this study was designed to evaluate the anti-angiogenesis of low-molecular-weight (LMW), highly sulfated lambda-carrageenan oligosaccharides (lambda-CO) obtained by carrageenan depolymerization, by CAM (chick chorioallantoic membrane) model and human umbilical vein endothelial cells (HUVECs). Significant inhibition of vessel growth was observed at 200 microg/pellet. A histochemistry assay also revealed a decrease of capillary plexus and connective tissue in lambda-CO treated samples. lambda-CO inhibited the viability of cells at the high concentration of 1 mg/mL, whereas it affected the cell survival slightly (>95%) at a low concentration (lambda-CO among three kinds of cells. Furthermore, the inhibitory action of lambda-CO was also observed in the endothelial cell invasion and migration at relatively low concentration (150-300 microg/mL), through down-regulation of intracellular matrix metalloproteinases (MMP-2) expression on endothelial cells. Taken together, these findings demonstrate that lambda-CO is a potential angiogenesis inhibitor with combined effects of inhibiting invasion, migration, and proliferation.

β-Glucan as an encapsulating agent: Effect on probiotic survival in simulated gastrointestinal tract.

Science.gov (United States)

Shah, Asima; Gani, Adil; Ahmad, Mudasir; Ashwar, Bilal Ahmad; Masoodi, F A

2016-01-01

Three strains of probiotics Lactobacillus casei, Lactobacillus brevis, and Lactobacillus plantarum were encapsulated in β-glucan matrix using emulsion technique. Further the encapsulated cells were studied for their tolerance in simulated gastrointestinal conditions and its storage stability. The average encapsulation efficiency of β-glucan-probiotic beads was found to be 74.01%. The surface morphology of β-glucan containing bacteria was studied using SEM. The noteworthy absorptions in the FT-IR spectra between 1300-900 cm(-1) and 2918-2925 cm(-1) corresponds to the presence of bacteria into the glucan matrix. Also, the thermal stability of β-glucan was evaluated using Differential Scanning Calorimeter. The efficiency of β-glucan in protecting the surviability of probiotic cells under simulated gastrointestinal conditions was studied. Results revealed significant (p<0.05) improvement to tolerance when the encapsulated cells were subjected to stresses like low pH, heat treatment, simulated intestinal conditions and storage. Copyright © 2015 Elsevier B.V. All rights reserved.

Revisiting the structure of the anti-neoplastic glucans of Mycobacterium bovis Bacille Calmette-Guerin. Structural analysis of the extracellular and boiling water extract-derived glucans of the vaccine substrains.

Science.gov (United States)

Dinadayala, Premkumar; Lemassu, Anne; Granovski, Pierre; Cérantola, Stéphane; Winter, Nathalie; Daffé, Mamadou

2004-03-26

The attenuated strain of Mycobacterium bovis Bacille Calmette-Guérin (BCG), used worldwide to prevent tuberculosis and leprosy, is also clinically used as an immunotherapeutic agent against superficial bladder cancer. An anti-tumor polysaccharide has been isolated from the boiling water extract of the Tice substrain of BCG and tentatively characterized as consisting primarily of repeating units of 6-linked-glucosyl residues. Mycobacterium tuberculosis and other mycobacterial species produce a glycogen-like alpha-glucan composed of repeating units of 4-linked glucosyl residues substituted at some 6 positions by short oligoglucosyl units that also exhibits an anti-tumor activity. Therefore, the impression prevails that mycobacteria synthesize different types of anti-neoplastic glucans or, alternatively, the BCG substrains are singular in producing a unique type of glucan that may confer to them their immunotherapeutic property. The present study addresses this question through the comparative analysis of alpha-glucans purified from the extracellular materials and boiling water extracts of three vaccine substrains. The polysaccharides were purified, and their structural features were established by mono- and two-dimensional NMR spectroscopy and matrix-assisted laser desorption/ionization time-of-flight mass spectrometry of the enzymatic and chemical degradation products of the purified compounds. The glucans isolated by the two methods from the three substrains of BCG were shown to exhibit identical structural features shared with the glycogen-like alpha-glucan of M. tuberculosis and other mycobacteria. Incidentally, we observed an occasional release of dextrans from Sephadex columns that may explain the reported occurrence of 6-substituted alpha-glucans in mycobacteria.

Visual effects of β-­glucans on wound healing in fish

DEFF Research Database (Denmark)

Schmidt, Jacob; Ljungqvist, Martin Georg; Ersbøll, Bjarne Kjær

2011-01-01

Introduction B-glucans are diverse polysaccharides that occur naturally in plants, fungi and bacteria. B-glucans have been shown to have an immunostimulatory effect1. In addition, B-glucans have been found to increase wound tensile strength and collagen synthesis2. This is likely to affect...... the filet quality3. With multispectral imaging we investigate the effect of adding B-glucans to the water during healing of open wounds in fish. Multispectral imaging is used in human diagnostic medicine for evaluating fx proriasis and chronic diabetic wounds, but has not yet been applied to wounds in fish....... Experimental set-up. The fish (common carp, Cyprinus carpio and rainbow trout, Oncorhynchus mykiss) were wounded with a biopsy punch (Miltex, York, USA), thus removing a cylinder of tissue. The resulting wound exposed the muscle. Fish were then kept for 14 days in either pure tap water or tap water...

Plastic waste depolymerization as a source of energetic heating oils

Directory of Open Access Journals (Sweden)

Wołosiewicz-Głąb Marta

2017-01-01

Full Text Available In the past years there has been an increase in production and consumption of plastics, which are widely used in many areas of life. Waste generated from this material are a challenge for the whole of society, regardless of awareness of sustainable development and its technological progress. Still the method of disposal of plastic waste are focused mainly on their storage and incineration, not using energy contained there. In this paper technology for plastic waste depolymerization with characteristics of fuel oil resulting in the process, as an alternative to traditional energy carriers such as: coal, fine coal or coke used in households will be presented. Oil has a high calorific value and no doubt could replace traditional solutions which use conventional energy sources. Furthermore, the fuel resulting from this process is sulfur-free and chemically pure. The paper presents the installation for plastics waste depolymerization used in selected Polish Institute of Plastics Processing, along with the ability to use the main thermocatalytic transformation product.

Fermentation Process of Cocoa Based on Optimum Condition of Pulp PectinDepolymerization by Endogenous Pectolityc Enzymes

OpenAIRE

Ganda-Putra, G.P; Wrasiati, L.P; Wartini, N.M

2010-01-01

Pulp degradation during cocoa fermentation can be carried out by depolymerization process of pulp pectin using endogenous pectolytic enzymes at optimum condition. The objectives of this research were to study the effect of fermentation process based on optimum condition in terms of temperature and pH of pulp pectin depolymerization using endogenous pectolytic enzymes polygalakturonase (PG) and pectin metyl esterase (PME) and fermentation period in cocoa processing on quality characteristics o...

Low-molecular-weight chitosans: Preparation and characterization

Czech Academy of Sciences Publication Activity Database

Tishchenko, Galina; Šimůnek, Jiří; Brus, Jiří; Netopilík, Miloš; Pekárek, Michal; Walterová, Zuzana; Koppová, Ingrid; Lenfeld, Jiří

2011-01-01

Roč. 86, č. 2 (2011), s. 1077-1081 ISSN 0144-8617 R&D Projects: GA ČR(CZ) GA525/08/0803 Institutional research plan: CEZ:AV0Z40500505; CEZ:AV0Z50450515 Keywords : low-molecular-weight chitosans * chitooligosaccharides * oxidative depolymerization Subject RIV: ED - Physiology Impact factor: 3.628, year: 2011

Reductive de-polymerization of kraft lignin for chemicals and fuels using formic acid as an in-situ hydrogen source.

Science.gov (United States)

Huang, Shanhua; Mahmood, Nubla; Tymchyshyn, Matthew; Yuan, Zhongshun; Xu, Chunbao Charles

2014-11-01

In this study, formic acid (FA) was employed as an in-situ hydrogen donor for the reductive de-polymerization of kraft lignin (KL). Under the optimum operating conditions, i.e., 300 °C, 1 h, 18.6 wt.% substrate concentration, 50/50 (v/v) water-ethanol medium with FA at a FA-to-lignin mass ratio of 0.7, KL (Mw∼10,000 g/mol) was effectively de-polymerized, producing de-polymerized lignin (DL, Mw 1270 g/mol) at a yield of ∼90 wt.% and polymerization of KL. Copyright © 2014 Elsevier Ltd. All rights reserved.

Chemical Synthesis of Sulfated Yeast (Saccharomyces cerevisiae) Glucans and Their In Vivo Antioxidant Activity.

Science.gov (United States)

Zhang, Hua; Zhang, Jing; Fan, Ziluan; Zhou, Xintao; Geng, Lin; Wang, Zhenyu; Regenstein, Joe M; Xia, Zhiqiang

2017-07-28

The effects of sulfation of yeast glucans was optimized using response surface methodology. The degree of sulfation was evaluated from 0.11 to 0.75 using ion-chromatography. The structural characteristics of SYG (sulfation of yeast glucans) with a DS = 0.75 were determined using high-performance liquid chromatography/gel-permeation chromatography and finally by Fourier transform infrared spectrometry. The SYG had lower viscosity and greater solubility than the native yeast glucans, suggesting that the conformation of the SYG had significantly changed. The results also showed that SYG had a significantly greater antioxidant activity in vivo compared to native yeast glucans.

Mechanistic Study of Utilization of Water-Insoluble Saccharomyces cerevisiae Glucans by Bifidobacterium breve Strain JCM1192.

Science.gov (United States)

Keung, Hoi Yee; Li, Tsz Kai; Sham, Lok To; Cheung, Man Kit; Cheung, Peter Chi Keung; Kwan, Hoi Shan

2017-04-01

Bifidobacteria exert beneficial effects on hosts and are extensively used as probiotics. However, due to the genetic inaccessibility of these bacteria, little is known about their mechanisms of carbohydrate utilization and regulation. Bifidobacterium breve strain JCM1192 can grow on water-insoluble yeast ( Saccharomyces cerevisiae ) cell wall glucans (YCWG), which were recently considered as potential prebiotics. According to the results of 1 H nuclear magnetic resonance (NMR) spectrometry, the YCWG were composed of highly branched (1→3,1→6)-β-glucans and (1→4,1→6)-α-glucans. Although the YCWG were composed of 78.3% β-glucans and 21.7% α-glucans, only α-glucans were consumed by the B. breve strain. The ABC transporter ( malEFG1 ) and pullulanase ( aapA ) genes were transcriptionally upregulated in the metabolism of insoluble yeast glucans, suggesting their potential involvement in the process. A nonsense mutation identified in the gene encoding an ABC transporter ATP-binding protein (MalK) led to growth failure of an ethyl methanesulfonate-generated mutant with yeast glucans. Coculture of the wild-type strain and the mutant showed that this protein was responsible for the import of yeast glucans or their breakdown products, rather than the export of α-glucan-catabolizing enzymes. Further characterization of the carbohydrate utilization of the mutant and three of its revertants indicated that this mutation was pleiotropic: the mutant could not grow with maltose, glycogen, dextrin, raffinose, cellobiose, melibiose, or turanose. We propose that insoluble yeast α-glucans are hydrolyzed by extracellular pullulanase into maltose and/or maltooligosaccharides, which are then transported into the cell by the ABC transport system composed of MalEFG1 and MalK. The mechanism elucidated here will facilitate the development of B. breve and water-insoluble yeast glucans as novel synbiotics. IMPORTANCE In general, Bifidobacterium strains are genetically intractable

Glucan Particles for Macrophage Targeted Delivery of Nanoparticles

Directory of Open Access Journals (Sweden)

Ernesto R. Soto

2012-01-01

Full Text Available Glucan particles (GPs are hollow, porous 2–4 μm microspheres derived from the cell walls of Baker's yeast (Saccharomyces cerevisiae. The 1,3-β-glucan outer shell provides for receptor-mediated uptake by phagocytic cells expressing β-glucan receptors. GPs have been used for macrophage-targeted delivery of soluble payloads (DNA, siRNA, protein, and small molecules encapsulated inside the hollow GPs via core polyplex and layer-by-layer (LbL synthetic strategies. In this communication, we report the incorporation of nanoparticles as cores inside GPs (GP-NP or electrostatically bound to the surface of chemically derivatized GPs (NP-GP. GP nanoparticle formulations benefit from the drug encapsulation properties of NPs and the macrophage-targeting properties of GPs. GP nanoparticle formulations were synthesized using fluorescent anionic polystyrene nanoparticles allowing visualization and quantitation of NP binding and encapsulation. Mesoporous silica nanoparticles (MSNs containing the chemotherapeutic doxorubicin (Dox were bound to cationic GPs. Dox-MSN-GPs efficiently delivered Dox into GP phagocytic cells resulting in enhanced Dox-mediated growth arrest.

Structural insights into the {beta}-xylosidase from Trichoderma reesei

Energy Technology Data Exchange (ETDEWEB)

Rojas, Adriana L.; Fischer, Hannes; Polikarpov, Igor [Sao Paulo Univ. (USP), Sao Carlos, SP (Brazil). Inst. de Fisica; Eneiskaya, Elena V.; Kulminskaya, Anna A.; Shabalin, Konstantin A.; Neustroev, Kirill N.; Golubev, Alexander M. [Petersburg Nuclear Physics Inst., Moskow (Russian Federation); Craievich, Aldo Felix [Sao Paulo Univ. (USP), SP (Brazil). Inst. de Fisica

2005-07-01

Xylan is a major structural polysaccharide in plant cells, and is the second most abundant polysaccharide in nature, accounting for approximately one-third of all renewable organic carbon on earth. Xylan together with cellulose (1,4-{beta}-glucan) and lignin (a complex polyphenolic compound) make up the major polymeric constituents of plant cell walls, recently, there was a significant industrial interest in Xylan and its hydrolytic enzymatic complex, as a supplement in animal feed, for the manufacture of bread, food and drinks, textiles, bleaching of cellulose pulp, ethanol and xylitol production. (author)

Structure elucidation and immunomodulatory activity of a beta glucan from the fruiting bodies of Ganoderma sinense.

Directory of Open Access Journals (Sweden)

Xiao-Qiang Han

Full Text Available A polysaccharide named GSP-2 with a molecular size of 32 kDa was isolated from the fruiting bodies of Ganoderma sinense. Its structure was well elucidated, by a combined utilization of chemical and spectroscopic techniques, to be a β-glucan with a backbone of (1→4- and (1→6-Glcp, bearing terminal- and (1→3-Glcp side-chains at O-3 position of (1→6-Glcp. Immunological assay exhibited that GSP-2 significantly induced the proliferation of BALB/c mice splenocytes with target on only B cells, and enhanced the production of several cytokines in human peripheral blood mononuclear cells and derived dendritic cells. Besides, the fluorescent labeled GSP-2 was phagocytosed by the RAW 264.7 cells and induced the nitric oxide secretion from the cells.

Mechanochemical depolymerization of inulin.

Science.gov (United States)

Xing, Haoran; Yaylayan, Varoujan A

2018-05-02

Although chemical reactions driven by mechanical force is emerging as a promising tool in the field of physical sciences, its applications in the area of food sciences are not reported. In this paper, we propose ball milling as an efficient tool for the controlled generation of fructooligosaccharide (FOS) mixtures from inulin with a degree of polymerization (dp) ranging between 4 and 7. The addition of catalytic amounts of AlCl 3 together with ball milling (30 min, at 30 Hz) generated mixtures rich in dehydrated disaccharides such as di-D-fructose dianhydrides. Based on anion exchange chromatography in conjunction with ESI/qTOF/MS/MS analysis, catalysis increased the overall content of mono-, di-, and tri-saccharides by around 30 fold compared to un-catalyzed milling. In addition, dialysis results of the untreated and treated samples have indicated that under catalysis the percent of depolymerization (dp inulin to value-added food ingredients. Copyright © 2018 Elsevier Ltd. All rights reserved.

Effects of β-Glucan on the Release of Nitric Oxide by Macrophages Stimulated with Lipopolysaccharide

Directory of Open Access Journals (Sweden)

E. Y. Choi

2016-11-01

Full Text Available This research analyzed the effect of β-glucan that is expected to alleviate the production of the inflammatory mediator in macrophagocytes, which are processed by the lipopolysaccharide (LPS of Escherichia. The incubated layer was used for a nitric oxide (NO analysis. The DNA-binding activation of the small unit of nuclear factor-κB was measured using the enzyme-linked immunosorbent assay-based kit. In the RAW264.7 cells that were vitalized by Escherichia coli (E. coli LPS, the β-glucan inhibited both the combatant and rendering phases of the inducible NO synthase (iNOS-derived NO. β-Glucan increased the expression of the heme oxygenase-1 (HO-1 in the cells that were stimulated by E. coli LPS, and the HO-1 activation was inhibited by the tin protoporphyrin IX (SnPP. This shows that the NO production induced by LPS is related to the inhibition effect of β-glucan. The phosphorylation of c-Jun N-terminal kinases (JNK and the p38 induced by the LPS were not influenced by the β-glucan, and the inhibitory κB-α (IκB-α decomposition was not influenced either. Instead, β-glucan remarkably inhibited the phosphorylation of the signal transducer and activator of transcription-1 (STAT1 that was induced by the E. coli LPS. Overall, the β-glucan inhibited the production of NO in macrophagocytes that was vitalized by the E .coli LPS through the HO-1 induction and the STAT1 pathways inhibition in this research. As the host immune response control by β-glucan weakens the progress of the inflammatory disease, β-glucan can be used as an effective immunomodulator.

Antithrombotic activities of fucosylated chondroitin sulfates and their depolymerized fragments from two sea cucumbers.

Science.gov (United States)

Liu, Xiaoxiao; Hao, Jiejie; Shan, Xindi; Zhang, Xiao; Zhao, Xiaoliang; Li, Qinying; Wang, Xiaojiang; Cai, Chao; Li, Guoyun; Yu, Guangli

2016-11-05

Fucosylated chondroitin sulfate (FCS), a glycosaminoglycan extracted from the body wall of sea cucumber, is a promising antithrombotic agent. The chemical structures of FCSc isolated from sea cucumber Cucumaria frondosa and its depolymerized fragment (dFCSc) were characterized for the first time. Additionally, anticoagulant and antithrombotic activities were evaluated in vitro and in vivo. The results demonstrated that dFCSc exhibited better antithrombotic-hemorrhagic ratio than native FCSc on the electrical induced arterial thrombosis model in rats. Compared to FCSt obtained from Thelenota ananas, FCSc possessed different sulfation patterns but similar antithrombotic effects. Therefore, sulfation pattern of FCS might not affect anticoagulation and antithrombosis as much as molecular weight may. Our results proposed a new point of view to understand the structure-activity relationship of FCS as alternative agents. Copyright © 2016 Elsevier Ltd. All rights reserved.

Barley β-Glucans-Containing Food Enhances Probiotic Performances of Beneficial Bacteria

Directory of Open Access Journals (Sweden)

Mattia P. Arena

2014-02-01

Full Text Available Currently, the majority of prebiotics in the market are derived from non-digestible oligosaccharides. Very few studies have focused on non-digestible long chain complex polysaccharides in relation to their potential as novel prebiotics. Cereals β-glucans have been investigated for immune-modulating properties and beneficial effects on obesity, cardiovascular diseases, diabetes, and cholesterol levels. Moreover, β-glucans have been reported to be highly fermentable by the intestinal microbiota in the caecum and colon, and can enhance both growth rate and lactic acid production of microbes isolated from the human intestine. In this work, we report the effects of food matrices containing barley β-glucans on growth and probiotic features of four Lactobacillus strains. Such matrices were able to improve the growth rate of the tested bacteria both in unstressed conditions and, importantly, after exposure to in vitro simulation of the digestive tract. Moreover, the effect of β-glucans-containing food on bacterial adhesion to enterocyte-like cells was analyzed and a positive influence on probiotic-enterocyte interaction was observed.

Integration of β-glucan fibre rich fractions from barley and mushrooms to form healthy extruded snacks.

Science.gov (United States)

Brennan, Margaret A; Derbyshire, Emma; Tiwari, Brijesh K; Brennan, Charles S

2013-03-01

β-glucan is a commonly researched plant cell wall component that when incorporated into food products has been associated with cholesterol and glycaemic response reductions. This study focusses on β-glucan rich fractions from barley and mushroom used in the production of extruded ready to eat snacks. Inclusion of barley β-glucan rich fractions and mushroom β-glucan fractions at 10 % levels increased the total dietary fibre content of extrudates compared to the control (P extruded snack products.

Control of radio degradation of natural polymers by measurement of viscosity and molecular weight determination

International Nuclear Information System (INIS)

Nabinger Machado, Patricia; Cerchietti, Maria Luciana; Mondino, Angel V.; Smolko, Eduardo E.

2009-01-01

Applications are now being made in various fields of oligosaccharides obtained by the depolymerization of large molecules such as natural alginates, carrageenan, pectin and chitosan. Find use in various disciplines such as crop production, sanitation, pharmacy, cosmetics, etc. Given the diversity of origins of these materials, almost all of marine origin, was the need for universal methods for recognition and composition, then the possible ways to get processed. A centralized program by the IAEA is promoting the use of ionizing radiation for these changes. This paper resents the calculations used to obtain the molecular weight of polysaccharides from determinations of viscosity. It has been found the molecular weight of sodium alginate and kappa-carrageenan irradiated with cobalt-60 gamma rays at doses between 2 and 35 kGy in solid state. We used a capillary Cannon Viscometer Ubbelohde-type and a protocol for standardized calculation procedure for this purpose. Were obtained reading times for passage through the capillary Viscometer, with various concentrations of polymer solutions of virgin material and the irradiated and from there calculated the relative viscosities, specific, inherent, reduced and intrinsic and then using the ratio of Mark-Houwink-SAKURADA calculate the viscosity average molecular weight of the different polymers. The changes found in the molecular weights by radio-depolymerization reach two orders of magnitude in some cases giving oligosaccharides of 8-12 monomer units. It is considered that this depolymerization method is effective and inexpensive compared to enzymatic or chemical methods. (author)

Modulation of the immune response of porcine neutrophils by different β-glucan preparations

DEFF Research Database (Denmark)

Juul-Madsen, Helle Risdahl; Norup, Liselotte Rothmann; Lærke, Helle Nygaard

2010-01-01

β-glucans of bacterial and fungal origin are known immuno-modulators, but data in the literature also indicate that lichen and cereal-derived β-glucans may have immuno-modulatory functions. The aim of the current study was to test the effect of different sources of β-glucans on neutrophils in an ex......-vivo whole blood stimulation assay. Whole blood samples were either treated with curdlan, a linear β-(1 → 3)-D-glucan from the non-pathogenic Alcaligenes faecalis, lichenan, a mixed linked β-(1 → 3),(1 → 4)-D-glucan from Islandic moss (Cetraria islandica) or zymosan, prepared from yeast cell walls and being...... expression of Toll-like Receptor (TLR) 2 and 4, but not significantly on the signal regulatory protein SIRPα after a stimulation either alone or in combination with LPS. Thus, branching may appear to be important for the different effect, but an effect of impurities in the Zymosan preparation cannot be ruled...

Depolymerization of coal by oxidation and alkylation; Sanka bunkai to alkyl ka ni yoru sekitan kaijugo

Energy Technology Data Exchange (ETDEWEB)

Tomita, H.; Isoda, T.; Kusakabe, K.; Morooka, S. [Kyushu University, Fukuoka (Japan). Faculty of Engineering; Hayashi, J. [Hokkaido University, Sapporo (Japan). Center for Advanced Research of Energy Technology

1996-10-28

Change in depolymerization degree and coal structure was studied for depolymerization treatment of coal in various alcohol containing aqueous hydrogen peroxide. In experiment, the mixture of Yallourn coal, alcohol and aqueous hydrogen peroxide was agitated in nitrogen atmosphere of normal pressure at 70{degree}C for 12 hours. As the experimental result, the methanol solubility of only 5% of raw coal increased up to 35.2% by hydrogen peroxide treatment, while the yield of insoluble matters also decreased from 94% to 62%. Most of the gas produced during treatment was composed of inorganic gases such as CO and CO2, and its carbon loss was extremely decreased by adding alcohol. From the analytical result of carbon loss in hydrogen peroxide treatment, it was clarified that alkylation advances with introduction of alkyl group derived from alcohol into coal by hydrogen peroxide treatment under a coexistence of alcohol, and depolymerization reaction of coal itself is thus promoted by alcohol. 4 refs., 7 figs., 1 tab.

Βeta-glucans promote wound healing in common carp (Cyprinus carpio L.)

DEFF Research Database (Denmark)

Przybylska, Dominika Alicja; Schmidt, Jacob; Nielsen, Michael Engelbrecht

β-glucans are well known for their ability to modulate the immune system. These polysaccharides, derived from fungi, plants and bacteria cell wall [1] potently trigger inflammatory response in infected host [2]. The effects of β-glucans depend on the origins, route of administration, molecular we...

Structure Elucidation and Immunomodulatory Activity of A Beta Glucan from the Fruiting Bodies of Ganoderma sinense

Science.gov (United States)

Yue, Rui-Qi; Dong, Cai-Xia; Chan, Chung-Lap; Ko, Chun-Hay; Cheung, Wing-Shing; Luo, Ke-Wang; Dai, Hui; Wong, Chun-Kwok; Leung, Ping-Chung; Han, Quan-Bin

2014-01-01

A polysaccharide named GSP-2 with a molecular size of 32 kDa was isolated from the fruiting bodies of Ganoderma sinense. Its structure was well elucidated, by a combined utilization of chemical and spectroscopic techniques, to be a β-glucan with a backbone of (1→4)– and (1→6)–Glcp, bearing terminal- and (1→3)–Glcp side-chains at O-3 position of (1→6)–Glcp. Immunological assay exhibited that GSP-2 significantly induced the proliferation of BALB/c mice splenocytes with target on only B cells, and enhanced the production of several cytokines in human peripheral blood mononuclear cells and derived dendritic cells. Besides, the fluorescent labeled GSP-2 was phagocytosed by the RAW 264.7 cells and induced the nitric oxide secretion from the cells. PMID:25014571

THE EFFECT OF BETA GLUCAN OF SACCHAROMYCES CEREVISAE ON THE INCREASE OF THE NUMBER OF BRAIN CELLS IN SUBSTANTIA NIGRA BRAIN OF PARKINSON’S WISTAR STRAIN RAT (RATTUS NORVEGICUS MODEL INDUCED WITH ROTENONE

Directory of Open Access Journals (Sweden)

Masruroh Rahayu

2015-01-01

Full Text Available ackground and aims. One of many neurodegenerative diseases afflicting the elderly is Parkinson. Beta glucan from Saccharomyces cerevisae is very potential to be used as a regenerative therapy of Parkinson's disease. Beta glucan can increase the mobilization of hematopoietic stem cells (HSCs from the bone marrow into the damaged tissues. Hematopoietic stem cells (HSCs which have been mobilized can regenerate and differentiate into brain cells so that the symptoms of Parkinson would be reduced. This research aims to find out the effects of the addition of Saccharomyces cerevisae toward the number of brain cells in substantia nigra Parkinson’s rat model. Method. The research was experimental in vivo using the draft of randomized post test only controlled group design. There were five groups that become the sample in this research with 5 rats for each group, i.e. negative control group, positive control group, Treatment Group 1, 2 and 3 (Rotenone + Saccharomyces cerevisae 18 mg/kgBB, 36 mg/kgBB, 72 mg/kgBBfor 4 weeks. Variable measured in this study was the number of brain cells in substantia nigra. The results of this study showed that Treatment Group 3 (72 mg/kgBB was a group with the largest number of brain cells than the other treatment groups. Statistical data obtained showed that the average number of brain cells in negative control group was 192.00 cells; positive control amounted to 116.80 cells; Treatment 1 amounted to 135.40 cells; Treatment 2 amounted to 140.80 cells; and Treatment 3 amounted to 161.80 cells. Result. The result of ANOVA test showed a significant difference between groups (p< 0.05, while the correlation test result indicated a strong correlation between the dose of Saccharomyces cerevisae and the number of substantia nigra of rat’s brain cells (r = 0,818. Conclusion. From this research, it can be concluded that the addition of Saccharomyces cerevisae with a dose of 18mg/kgBB, 36mg/kgBBdan 72 mg/kgBB is able to increase

Dietary β-glucan stimulate complement and C-reactive protein acute phase responses in common carp (Cyprinus carpio) during an Aeromonas salmonicida infection.

Science.gov (United States)

Pionnier, Nicolas; Falco, Alberto; Miest, Joanna; Frost, Patrick; Irnazarow, Ilgiz; Shrive, Annette; Hoole, Dave

2013-03-01

The effect of β-glucans as feed additive on the profile of C-reactive protein (CRP) and complement acute phase responses was studied in common carp Cyprinus carpio after exposition to a bacterial infection with Aeromonas salmonicida. Carp were orally administered with β-glucan (MacroGard®) for 14 days with a daily β-glucan intake of 6 mg per kg body weight. Fish were then intraperitoneally injected with either PBS or 1 × 10⁸ bacteria per fish and sampled at time 0, 6, 12, 24, 48, 72, 96 and 120 h post-injection (p.i.) for serum and head kidney, liver and mid-gut tissues. CRP levels and complement activity were determined in the serum samples whilst the gene expression profiles of CRP and complement related genes (crp1, crp2, c1r/s, bf/c2, c3 and masp2) were analysed in the tissues by quantitative PCR. Results obtained showed that oral administration of β-glucan for 14 days significantly increased serum CRP levels up to 2 fold and serum alternative complement activity (ACP) up to 35 fold. The bacterial infection on its own (i.e. not combined with a β-glucan feeding) did have significant effects on complement response whilst CRP was not detectably induced during the carp acute phase reaction. However, the combination of the infection and the β-glucan feeding did show significant effects on both CRP and complement profiles with higher serum CRP levels and serum ACP activity in the β-glucan fed fish than in the control fed fish. In addition, a distinct organ and time dependent expression profile pattern was detected for all the selected genes: a peak of gene expression first occurred in the head kidney tissue (6 h p.i. or 12 h p.i.), then an up-regulation in the liver several hours later (24 h p.i.) and finally up- or down-regulations in the mid-gut at 24 h p.i. and 72 h p.i. In conclusion, the results of this study suggest that MacroGard® stimulated CRP and complement responses to A. salmonicida infection in common carp. Copyright © 2013 Elsevier Ltd. All

Dietary fibers as immunoregulatory compounds in health and disease

DEFF Research Database (Denmark)

Wismar, René; Brix, Susanne; Frøkiær, Hanne

2010-01-01

structures. In order to enhance our understanding of factors important for the immunoregulatory activities, this article addresses the importance of chemical structure, origin, and purity of fibers for their capacity to interact with key regulatory immune cells. Furthermore, we assess bioavailability...... important for the activity. Within beta-glucans the activity varies according to structure, molecular weight, and solubility. As many of the preparations tested constitute crude extracts or partly purified NSPs, the risk of contaminants holding immunoregulatory activities should not be ignored. To what...... a major challenge. Studies demonstrating in vivo effects of beta-glucans on microbial infections and cancer treatment strongly indicate an immunoregulatory mechanism behind the effects. However, the potential of NSPs as immunoregulatory food ingredients is still far from fully explored....

Intestinal microbiota and immune related genes in sea cucumber (Apostichopus japonicus) response to dietary β-glucan supplementation

International Nuclear Information System (INIS)

Yang, Gang; Xu, Zhenjiang; Tian, Xiangli; Dong, Shuanglin; Peng, Mo

2015-01-01

β-glucan is a prebiotic well known for its beneficial outcomes on sea cucumber health through modifying the host intestinal microbiota. High-throughput sequencing techniques provide an opportunity for the identification and characterization of microbes. In this study, we investigated the intestinal microbial community composition, interaction among species, and intestinal immune genes in sea cucumber fed with diet supplemented with or without β-glucan supplementation. The results show that the intestinal dominant classes in the control group are Flavobacteriia, Gammaproteobacteria, and Alphaproteobacteria, whereas Alphaproteobacteria, Flavobacteriia, and Verrucomicrobiae are enriched in the β-glucan group. Dietary β-glucan supplementation promoted the proliferation of the family Rhodobacteraceae of the Alphaproteobacteria class and the family Verrucomicrobiaceae of the Verrucomicrobiae class and reduced the relative abundance of the family Flavobacteriaceae of Flavobacteria class. The ecological network analysis suggests that dietary β-glucan supplementation can alter the network interactions among different microbial functional groups by changing the microbial community composition and topological roles of the OTUs in the ecological network. Dietary β-glucan supplementation has a positive impact on immune responses of the intestine of sea cucumber by activating NF-κB signaling pathway, probably through modulating the balance of intestinal microbiota. - Highlights: • Dietary β-glucan supplementation increases the abundance of Rhodobacteraceae and Verrucomicrobiaceae in the intestine. • Dietary β-glucan supplementation changes the topological roles of OTUs in the ecological network. • Dietary β-glucan supplementation has a positive impact on the immune response of intestine of sea cucumber

Intestinal microbiota and immune related genes in sea cucumber (Apostichopus japonicus) response to dietary β-glucan supplementation

Energy Technology Data Exchange (ETDEWEB)

Yang, Gang [The Key Laboratory of Mariculture, Ministry of Education, Fisheries College, Ocean University of China (China); Xu, Zhenjiang [Biofrontiers Institute, University of Colorado, Boulder, CO (United States); Tian, Xiangli, E-mail: xianglitian@ouc.edu.cn [The Key Laboratory of Mariculture, Ministry of Education, Fisheries College, Ocean University of China (China); Dong, Shuanglin [The Key Laboratory of Mariculture, Ministry of Education, Fisheries College, Ocean University of China (China); Peng, Mo [School of Animal Science and Technology, Jiangxi Agricultural University (China)

2015-02-27

β-glucan is a prebiotic well known for its beneficial outcomes on sea cucumber health through modifying the host intestinal microbiota. High-throughput sequencing techniques provide an opportunity for the identification and characterization of microbes. In this study, we investigated the intestinal microbial community composition, interaction among species, and intestinal immune genes in sea cucumber fed with diet supplemented with or without β-glucan supplementation. The results show that the intestinal dominant classes in the control group are Flavobacteriia, Gammaproteobacteria, and Alphaproteobacteria, whereas Alphaproteobacteria, Flavobacteriia, and Verrucomicrobiae are enriched in the β-glucan group. Dietary β-glucan supplementation promoted the proliferation of the family Rhodobacteraceae of the Alphaproteobacteria class and the family Verrucomicrobiaceae of the Verrucomicrobiae class and reduced the relative abundance of the family Flavobacteriaceae of Flavobacteria class. The ecological network analysis suggests that dietary β-glucan supplementation can alter the network interactions among different microbial functional groups by changing the microbial community composition and topological roles of the OTUs in the ecological network. Dietary β-glucan supplementation has a positive impact on immune responses of the intestine of sea cucumber by activating NF-κB signaling pathway, probably through modulating the balance of intestinal microbiota. - Highlights: • Dietary β-glucan supplementation increases the abundance of Rhodobacteraceae and Verrucomicrobiaceae in the intestine. • Dietary β-glucan supplementation changes the topological roles of OTUs in the ecological network. • Dietary β-glucan supplementation has a positive impact on the immune response of intestine of sea cucumber.

β-Glucan production of Saccharomyces cerevisiae in medium with different nitrogen sources in air-lift fermentor

Directory of Open Access Journals (Sweden)

AHMAD THONTOWI

2007-10-01

Full Text Available β-Glucan is one of the most abundant polysaccharides in yeast Saccharomyces cerevisiae cell wall. The aim of this research is to explore an alternative nitrogen sources for β-glucan production. S. cerevisiae were grown in fermentation medium with different nitrogen sources. Peptone 2%, glutamic acid 0,5%, urea 0,2%, and diammonium hydrogen phosphate (DAHP 0,02% were used for nitrogen source in the medium. A two liter air-lift fermentor was used in the fermentation process for 84 hours (T = 300C, pH 7, and 1.5 vvm for the aeration. During the fermentation, optical density, extraction of β-glucan, glucose and protein in hydrolisate cultured were determined. β-glucan production level is similar with the growth rate of yeast and followed by decreasing glucose and protein content in hydrolysis cultured. The highest and lowest β-glucan content were obtained from peptone (933.33 mg/L and glutamic acid (633.33 mg/L as a nitrogen source in cells cultured after fermentation completed respectively. Yeast cells cultured with urea and DAHP as a nitrogen source give the same content of β-glucan about 733.33 mg/L. β-glucan concentration produced in medium with urea was a higher than that produced using glutamic acid and DAHP as a nitrogen source. The result indicated that urea can be used as an alternative nitrogen source for the production of β-glucan. Urea is easily available and cheaper than peptone, glutamic acid and DAHP.

β-Glucan Size Controls Dectin-1-Mediated Immune Responses in Human Dendritic Cells by Regulating IL-1β Production

Directory of Open Access Journals (Sweden)

Matthew J. Elder

2017-07-01

Full Text Available Dectin-1/CLEC7A is a pattern recognition receptor that recognizes β-1,3 glucans, and its stimulation initiates signaling events characterized by the production of inflammatory cytokines from human dendritic cells (DCs required for antifungal immunity. β-glucans differ greatly in size, structure, and ability to activate effector immune responses from DC; as such, small particulate β-glucans are thought to be poor activators of innate immunity. We show that β-glucan particle size is a critical factor contributing to the secretion of cytokines from human DC; large β-glucan-stimulated DC generate significantly more IL-1β, IL-6, and IL-23 compared to those stimulated with the smaller β-glucans. In marked contrast, the secretion of TSLP and CCL22 were found to be insensitive to β-glucan particle size. Furthermore, we show that the capacity to induce phagocytosis, and the relative IL-1β production determined by β-glucan size, regulates the composition of the cytokine milieu generated from DC. This suggests that β-glucan particle size is critically important in orchestrating the nature of the immune response to fungi.

Novel structural features in Candida albicans hyphal glucan provide a basis for differential innate immune recognition of hyphae versus yeast.

Science.gov (United States)

Lowman, Douglas W; Greene, Rachel R; Bearden, Daniel W; Kruppa, Michael D; Pottier, Max; Monteiro, Mario A; Soldatov, Dmitriy V; Ensley, Harry E; Cheng, Shih-Chin; Netea, Mihai G; Williams, David L

2014-02-07

The innate immune system differentially recognizes Candida albicans yeast and hyphae. It is not clear how the innate immune system effectively discriminates between yeast and hyphal forms of C. albicans. Glucans are major components of the fungal cell wall and key fungal pathogen-associated molecular patterns. C. albicans yeast glucan has been characterized; however, little is known about glucan structure in C. albicans hyphae. Using an extraction procedure that minimizes degradation of the native structure, we extracted glucans from C. albicans hyphal cell walls. (1)H NMR data analysis revealed that, when compared with reference (1→3,1→6) β-linked glucans and C. albicans yeast glucan, hyphal glucan has a unique cyclical or "closed chain" structure that is not found in yeast glucan. GC/MS analyses showed a high abundance of 3- and 6-linked glucose units when compared with yeast β-glucan. In addition to the expected (1→3), (1→6), and 3,6 linkages, we also identified a 2,3 linkage that has not been reported previously in C. albicans. Hyphal glucan induced robust immune responses in human peripheral blood mononuclear cells and macrophages via a Dectin-1-dependent mechanism. In contrast, C. albicans yeast glucan was a much less potent stimulus. We also demonstrated the capacity of C. albicans hyphal glucan, but not yeast glucan, to induce IL-1β processing and secretion. This finding provides important evidence for understanding the immune discrimination between colonization and invasion at the mucosal level. When taken together, these data provide a structural basis for differential innate immune recognition of C. albicans yeast versus hyphae.

Azadirachtin(A) distinctively modulates subdomain 2 of actin - novel mechanism to induce depolymerization revealed by molecular dynamics study.

Science.gov (United States)

Pravin Kumar, R; Roopa, L; Sudheer Mohammed, M M; Kulkarni, Naveen

2016-12-01

Azadirachtin(A) (AZA), a potential insecticide from neem, binds to actin and induces depolymerization in Drosophila. AZA binds to the pocket same as that of Latrunculin A (LAT), but LAT inhibits actin polymerization by stiffening the actin structure and affects the ADP-ATP exchange. The mechanism by which AZA induces actin depolymerization is not clearly understood. Therefore, different computational experiments were conducted to delineate the precise mechanism of AZA-induced actin depolymerization. Molecular dynamics studies showed that AZA strongly interacted with subdomain 2 and destabilized the interactions between subdomain 2 of one actin and subdomains 1 and 4 of the adjacent actin, causing the separation of actin subunits. The separation was observed between subdomain 3 of subunit n and subdomain 4 of subunit n + 2. However, the specific triggering point for the separation of the subunits was the destabilization of direct interactions between subdomain 2 of subunit n (Arg39, Val45, Gly46 and Arg62) and subdomain 4 of subunit n + 2 (Asp286, Ile287, Asp288, Ile289, Asp244 and Lys291). These results reveal a unique mechanism of an actin filament modulator that induces depolymerization. This mechanism of AZA can be used to design similar molecules against mammalian actins for cancer therapy.

Lewis-acid catalyzed depolymerization of Protobind lignin in supercritical water and ethanol

NARCIS (Netherlands)

Guvenatam, Burcu; Heeres, Erik H.J.; Pidko, Evgeny A.; Hensen, Ernie J. M.

2016-01-01

The use of metal acetates, metal chlorides and metal triflates as Lewis acid catalysts for the depolymerization of soda lignin under supercritical conditions was investigated. The reactions were carried out at 400 degrees C in water and ethanol. Lignin conversion in supercritical water led to

Studies on Trans-Resveratrol/Carboxymethylated (1,3/1,6-β-d-Glucan Association for Aerosol Pharmaceutical Applications

Directory of Open Access Journals (Sweden)

Antonio Francioso

2017-05-01

Full Text Available A resveratrol/carboxymethylated glucan (CM-glucan combination is known to inhibit rhinovirus replication and expression of inflammatory mediators in nasal epithelia. The aim of this study was to develop an aerosol formulation containing an association of the two molecules which could reach the lower respiratory tract. Mass median aerodynamic diameter (MMAD of a resveratrol/CM-glucan combination was lower than that shown by resveratrol or CM-glucan alone (2.83 versus 3.28 and 2.96 µm, respectively. The resveratrol/CM-glucan association results in the finest and most monodispersed particles in comparison to the two single components. The association also evidenced lower values for all particle size distribution parameters, suggesting that the pharmacological synergy observed in previous studies may be accompanied by a pharmaceutical one. Moreover, we showed that the CM-glucan matrix did not exert an inhibitory effect on resveratrol nebulization, demonstrating the good suitability of these two molecules in association for simultaneous aerosol volatilization.

Evaluation of correlation between glucan conversion and degree of delignification depending on pretreatment strategies using Jabon Merah.

Science.gov (United States)

Jang, Soo-Kyeong; Jeong, Hanseob; Kim, Ho-Yong; Choi, June-Ho; Kim, Jong-Hwa; Koo, Bon-Wook; Choi, In-Gyu

2017-07-01

The main purpose of this study was to investigate the glucan conversion rate after enzymatic hydrolysis depending on the treatment methods and conditions with changes in the chemical composition of treated solid fraction of Jabon Merah. The glucan conversion rate (17.4%) was not significantly improved after liquid hot water treatment (1st step) even though most of the hemicellulose was dissolved into liquid hydrolysate. Subsequently, dilute acid, organosolv, and peracetic acid treatment (2nd step) was conducted under various conditions to enhance glucan conversion. Among the 2nd step treatment, the glucan conversion rate of organosolv (max. 46.0%) and peracetic acid treatment (max. 65.9%) was increased remarkably through decomposition of acid-insoluble lignin (AIL). Finally, the glucan conversion rate and AIL content were highly correlated, which was revealed by the R-squared value (0.84), but inhibitory factors including cellulose crystallinity must be considered for advanced glucan conversion from highly recalcitrant biomasses, such as Jabon Merah. Copyright © 2017 Elsevier Ltd. All rights reserved.

A drug-sensitive genetic network masks fungi from the immune system.

Directory of Open Access Journals (Sweden)

Robert T Wheeler

2006-04-01

Full Text Available Fungal pathogens can be recognized by the immune system via their beta-glucan, a potent proinflammatory molecule that is present at high levels but is predominantly buried beneath a mannoprotein coat and invisible to the host. To investigate the nature and significance of "masking" this molecule, we characterized the mechanism of masking and consequences of unmasking for immune recognition. We found that the underlying beta-glucan in the cell wall of Candida albicans is unmasked by subinhibitory doses of the antifungal drug caspofungin, causing the exposed fungi to elicit a stronger immune response. Using a library of bakers' yeast (Saccharomyces cerevisiae mutants, we uncovered a conserved genetic network that is required for concealing beta-glucan from the immune system and limiting the host response. Perturbation of parts of this network in the pathogen C. albicans caused unmasking of its beta-glucan, leading to increased beta-glucan receptor-dependent elicitation of key proinflammatory cytokines from primary mouse macrophages. By creating an anti-inflammatory barrier to mask beta-glucan, opportunistic fungi may promote commensal colonization and have an increased propensity for causing disease. Targeting the widely conserved gene network required for creating and maintaining this barrier may lead to novel broad-spectrum antimycotics.

Lewis-acid catalyzed depolymerization of Protobind lignin in supercritical water and ethanol

NARCIS (Netherlands)

Güvenatam, B.; Heeres, E.H.J.; Pidko, E.A.; Hensen, E.J.M.

2014-01-01

The use of metal acetates, metal chlorides and metal triflates as Lewis acid catalysts for the depolymerization of soda lignin under supercritical conditions was investigated. The reactions were carried out at 400°C in water and ethanol. Lignin conversion in supercritical water led to formation of

Capsular glucan and intracellular glycogen of Mycobacterium tuberculosis: biosynthesis and impact on the persistence in mice

DEFF Research Database (Denmark)

Sambou, Tounkang; Dinadayala, Premkumar; Stadthagen, Gustavo

2008-01-01

Mycobacterium tuberculosis and other pathogenic mycobacterial species produce large amounts of a glycogen-like alpha-glucan that represents the major polysaccharide of their outermost capsular layer. To determine the role of the surface-exposed glucan in the physiology and virulence of these bact......Mycobacterium tuberculosis and other pathogenic mycobacterial species produce large amounts of a glycogen-like alpha-glucan that represents the major polysaccharide of their outermost capsular layer. To determine the role of the surface-exposed glucan in the physiology and virulence...... of these bacteria, orthologues of the glg genes involved in the biosynthesis of glycogen in Escherichia coli were identified in M. tuberculosis H37Rv and inactivated by allelic replacement. Biochemical analyses of the mutants and complemented strains indicated that the synthesis of glucan and glycogen involves...... the alpha-1,4-glucosyltransferases Rv3032 and GlgA (Rv1212c), the ADP-glucose pyrophosphorylase GlgC (Rv1213) and the branching enzyme GlgB (Rv1326c). Disruption of glgC reduced by half the glucan and glycogen contents of M. tuberculosis, whereas the inactivation of glgA and Rv3032 affected the production...

Enhanced cortisol production rates, free cortisol, and 11beta-HSD-1 expression correlate with visceral fat and insulin resistance in men: effect of weight loss.

Science.gov (United States)

Purnell, Jonathan Q; Kahn, Steven E; Samuels, Mary H; Brandon, David; Loriaux, D Lynn; Brunzell, John D

2009-02-01

Controversy exists as to whether endogenous cortisol production is associated with visceral obesity and insulin resistance in humans. We therefore quantified cortisol production and clearance rates, abdominal fat depots, insulin sensitivity, and adipocyte gene expression in a cohort of 24 men. To test whether the relationships found are a consequence rather than a cause of obesity, eight men from this larger group were studied before and after weight loss. Daily cortisol production rates (CPR), free cortisol levels (FC), and metabolic clearance rates (MCR) were measured by stable isotope methodology and 24-h sampling; intra-abdominal fat (IAF) and subcutaneous fat (SQF) by computed tomography; insulin sensitivity (S(I)) by frequently sampled intravenous glucose tolerance test; and adipocyte 11beta-hydroxysteroid dehydrogenase-1 (11beta-HSD-1) gene expression by quantitative RT-PCR from subcutaneous biopsies. Increased CPR and FC correlated with increased IAF, but not SQF, and with decreased S(I). Increased 11beta-HSD-1 gene expression correlated with both IAF and SQF and with decreased S(I). With weight loss, CPR, FC, and MCR did not change compared with baseline; however, with greater loss in body fat than lean mass during weight loss, both CPR and FC increased proportionally to final fat mass and IAF and 11beta-HSD-1 decreased compared with baseline. These data support a model in which increased hypothalamic-pituitary-adrenal activity in men promotes selective visceral fat accumulation and insulin resistance and may promote weight regain after diet-induced weight loss, whereas 11beta-HSD-1 gene expression in SQF is a consequence rather than cause of adiposity.

Concentrated oat β-glucan, a fermentable fiber, lowers serum cholesterol in hypercholesterolemic adults in a randomized controlled trial

Directory of Open Access Journals (Sweden)

Fulcher R Gary

2007-03-01

Full Text Available Abstract Background Soluble fibers lower serum lipids, but are difficult to incorporate into products acceptable to consumers. We investigated the physiological effects of a concentrated oat β-glucan on cardiovascular disease (CVD endpoints in human subjects. We also compared the fermentability of concentrated oat β-glucan with inulin and guar gum in a model intestinal fermentation system. Methods Seventy-five hypercholesterolemic men and women were randomly assigned to one of two treatments: 6 grams/day concentrated oat β-glucan or 6 grams/day dextrose (control. Fasting blood samples were collected at baseline, week 3, and week 6 and analyzed for total cholesterol, HDL cholesterol, LDL cholesterol, triglycerides, glucose, insulin, homocysteine and C-reactive protein (CRP. To estimate colonic fermentability, 0.5 g concentrated oat β-glucan was incubated in a batch model intestinal fermentation system, using human fecal inoculum to provide representative microflora. Fecal donors were not involved with the β-glucan feeding trial. Inulin and guar gum were also incubated in separate serum bottles for comparison. Results Oat β-glucan produced significant reduction from baseline in total cholesterol (-0.3 ± 0.1 mmol/L and LDL cholesterol (-0.3 ± 0.1 mmol/L, and the reduction in LDL cholesterol were significantly greater than in the control group (p = 0.03. Concentrated oat β-glucan was a fermentable fiber and produced total SCFA and acetate concentrations similar to inulin and guar gum. Concentrated oat β-glucan produced the highest concentrations of butyrate at 4, 8, and 12 hours. Conclusion Six grams concentrated oat β-glucan per day for six weeks significantly reduced total and LDL cholesterol in subjects with elevated cholesterol, and the LDL cholesterol reduction was greater than the change in the control group. Based on a model intestinal fermentation, this oat β-glucan was fermentable, producing higher amounts of butyrate than other

Defects in rhizobial cyclic glucan and lipopolysaccharide synthesis alter legume gene expression during nodule development

DEFF Research Database (Denmark)

D'Antuono, Alejandra L; Ott, Thomas; Krusell, Lene

2008-01-01

cDNA array technology was used to compare transcriptome profiles of Lotus japonicus roots inoculated with a Mesorhizobium loti wild-type and two mutant strains affected in cyclic beta(1-2) glucan synthesis (cgs) and in lipopolysaccharide synthesis (lpsbeta2). Expression of genes associated...... with the development of a fully functional nodule was significantly affected in plants inoculated with the cgs mutant. Array results also revealed that induction of marker genes for nodule development was delayed when plants were inoculated with the lpsbeta2 mutant. Quantitative real-time reverse......-transcriptase polymerase chain reaction was used to quantify gene expression of a subset of genes involved in plant defense response, redox metabolism, or genes that encode for nodulins. The majority of the genes analyzed in this study were more highly expressed in roots inoculated with the wild type compared with those...

Specific binding of a fungal glucan phytoalexin elicitor to membrane fractions from soybean Glycine max

International Nuclear Information System (INIS)

Schmidt, W.E.; Ebel, J.

1987-01-01

Treatment of soybean tissues with elicitors results in the production of phytoalexins, one of a number of inducible plant defense reactions against microbial infections. The present study uses a β-1,3-[ 3 H] glucan elicitor fraction from Phytophthora megasperma f.sp. glycinea, a fungal pathogen of soybean, to identify putative elicitor targets in soybean tissues. Use of the radiolabeled elicitor disclosed saturable high-affinity elicitor binding site(s) in membrane fractions of soybean roots. Highest binding activity is associated with a plasma membrane-enriched fraction. The apparent K/sub d/ value for β-glucan elicitor binding is ≅ 0.2 x 10 -6 M and the maximum number of binding sites is 0.5 pmol per mg of protein. Competition studies the [ 3 H]glucan elicitor and a number of polysaccharides demonstrate that only polysaccharides of a branched β-glucan type effectively displace the radiolabeled ligand from membrane binding. Differential displacing activity of the glucans on P. megasperma elicitor binding corresponds closely to their respective ability to elicit phytoalexin production in a cotyledon bioassay

Purification and properties of a beta-galactosidase from carambola fruit with significant activity towards cell wall polysaccharides.

Science.gov (United States)

Balasubramaniam, Sumathi; Lee, Heng Chin; Lazan, Hamid; Othman, Roohaida; Ali, Zainon Mohd

2005-01-01

beta-Galactosidase (EC. 3.2.1.23) from ripe carambola (Averrhoa carambola L. cv. B10) fruit was fractionated through a combination of ion exchange and gel filtration chromatography into four isoforms, viz. beta-galactosidase I, II, III and IV. This beta-galactosidases had apparent native molecular masses of 84, 77, 58 and 130 kDa, respectively. beta-Galactosidase I, the predominant isoform, was purified to electrophoretic homogeneity; analysis of the protein by SDS-PAGE revealed two subunits with molecular masses of 48 and 36 kDa. N-terminal amino acid sequence of the respective polypeptides shared high similarities albeit at different domains, with the deduced amino acid sequence of certain plant beta-galactosidases, thus, explaining the observed low similarity between the two subunits. beta-Galactosidase I was probably a heterodimer that have glycoprotein properties and a pI value of 7.2, with one of the potential glycosylation sites appeared to reside within the 48-kDa-polypeptide. The purified beta-galactosidase I was substantially active in hydrolyzing (1-->4)beta-linked spruce and a mixture of (1-->3)beta- and (1-->6)beta-linked gum arabic galactans. This isoform also had the capability to solubilize and depolymerize structurally intact pectins as well as to modify alkaline-soluble hemicelluloses, reflecting in part changes that occur during ripening.

Distinction between infection and inflammation by a 99mTc-labeled anti (1→3) – β - D - glucans aptamer

International Nuclear Information System (INIS)

Lacerda, Camila M.S.; Ferreira, Ieda M.; Andrade, S.R.; Barros, Andre L.B.; Fernandes, Simone O.A.; Cardoso, Valbert N.

2015-01-01

The difficulty in the early diagnosis of infectious foci, whether caused by fungus or bacteria has raised the need to research new methods for this purpose. The distinction between inflammation and infection as well as the pathogen identification in cases of infection are of great relevance to decision-making in therapy and follow-up treatments. The aim of this study was to evaluate the anti (1→3) – β - D - glucans aptamer Seq6, labeled with 99m Tc , to distinguish between infection and inflammation. Firstly, in vitro studies were carried out by labeling the aptamer with 32 P to evaluate its binding capacity for (1→3) – β - D - glucans (main fungal cell wall polysaccharide), peptidoglycan (polysaccharide of bacterial cell wall) and also for Candida albicans and Staphylococcus aureus cells. The aptamers were labeled with 99m Tc by the direct labeling method. The stability of the 99m Tc -labeled aptamer was evaluated in saline, plasma, and cysteine excess. The biodistribution studies were approved by the Ethics Committee for Animal Experimentation of the Federal University of Minas Gerais (CETEA/UFMG), protocol. 143/2013. The aptamer labeled with 99m Tc was intravenously administered in three groups (n=6) of male Swiss mice (weight: 25-30g): infected with S. aureus or C. albicans, or with experimental inflammation induced by zymosan. The 32 P aptamer showed high binding affinity for beta-glucan and peptidoglycan. Binding to C. albicans and S. aureus cells also occurred. The radiolabel yield for the aptamer labeling with 99m Tc was higher than 90%. Stability tests in saline, plasma and excess of cysteine provided satisfactory results, since no significant variation in the radiolabel yield percentage was verified up to 24 hours, even increasing the cysteine concentration. In the biodistribution studies was analyzed the radiolabeled aptamer uptake by the animal infected thigh relative to the uninfected one. The animals infected with C. albicans presented a

A food additive with prebiotic properties of an α-d-glucan from lactobacillus plantarum DM5.

Science.gov (United States)

Das, Deeplina; Baruah, Rwivoo; Goyal, Arun

2014-08-01

An α-d-glucan produced by Lactobacillus plantarum DM5 was explored for in vitro prebiotic activities. Glucan-DM5 demonstrated 21.6% solubility, 316.9% water holding capacity, 86.2% flocculation activity, 71.4% emulsification activity and a degradation temperature (Td) of 292.2°C. Glucan-DM5 exhibited lowest digestibility of 0.54% by artificial gastric juice, 0.21% by intestinal fluid and 0.32% by α-amylase whereas the standard prebiotic inulin, showed 25.23%, 5.97% and 19.13%, hydrolysis, respectively. Prebiotic activity assay of glucan-DM5 displayed increased growth of probiotic bacteria such as Bifidobacterium infantis and Lactobacillus acidophilus, but did not support the growth of non-probiotic bacteria such as Escherichia coli and Enterobacter aerogenes. The overall findings indicated that glucan from L. plantarum DM5 can serve as a potential prebiotic additive for food products. Copyright © 2014 Elsevier B.V. All rights reserved.

Lewis acid-catalyzed depolymerization of soda lignin in supercritical ethanol/water mixtures

NARCIS (Netherlands)

Güvenatam, Burcu; Heeres, Erik H.J.; Pidko, Evgeny A.; Hensen, Emiel J M

2016-01-01

The depolymerization of lignin model compounds and soda lignin by super Lewis acidic metal triflates has been investigated in a mixture of ethanol and water at 400 °C. The strong Lewis acids convert representative model compounds for the structure-forming linkages in lignin, namely α-O-4, 5-O-4

Low-beta investment strategies

OpenAIRE

Korn, Olaf; Kuntz, Laura-Chloé

2015-01-01

This paper investigates investment strategies that exploit the low-beta anomaly. Although the notion of buying low-beta stocks and selling high-beta stocks is natural, a choice is necessary with respect to the relative weighting of high-beta stocks and low-beta stocks in the investment portfolio. Our empirical results for US large-cap stocks show that this choice is very important for the risk-return characteristics of the resulting portfolios and their sensitivities to common risk factors. W...

Selective Depolymerization and Effects of Homolysis of Poly(L-lactic acid) in a Blend with Polypropylene

International Nuclear Information System (INIS)

Nishida, H.; Tsukegi, T.; Shirai, Y.; Arazoe, Y.; Yan, W.; Shirai, Y.

2009-01-01

Blends of poly(L-lactic acid) (PLLA) and polypropylene (PP), which are candidates for the practical use of PLLA, were investigated for selective degradation of PLLA, resulting in quantitative conversion of PLLA components into cyclic monomers, lactide, using magnesium oxide (Mg O) as a depolymerization catalyst. Obviously, the catalyst Mg O selectively accelerated only the PLLA depolymerization in the blends, dominantly generating L,L-lactide as a volatile product and separating the PP component. Expected effects of homolysis in the blend system were also determined as slight changes in activation energy of degradation for both the components and through the suppression of degradation by an antioxidant.

Long-lived effects of administering β-glucans

NARCIS (Netherlands)

Petit, Jules; Wiegertjes, Geert F.

2016-01-01

Over the past decades, it has become evident that immune-modulation of fish with β-glucans, using injection, dietary or even immersion routes of administration, has stimulating but presumed short-lived effects on both intestinal and systemic immunity and can increase protection against a

Effect of purified oat ß-glucan on fermentation of set-style yogurt mix

Science.gov (United States)

Effect of ß-glucan on the fermentation of set-style yogurt was investigated by incorporating 0, 0.1, 0.2, 0.3, 0.4, and 0.5% of ß-glucan into the yogurt mix. It was found that levels up to 0.3% resulted in yogurts with quality characteristics similar to the control yogurt. Higher levels of ß-gluca...

Comparative analyses of two thermophilic enzymes exhibiting both beta-1,4 mannosidic and beta-1,4 glucosidic cleavage activities from Caldanaerobius polysaccharolyticus.

Science.gov (United States)

Han, Yejun; Dodd, Dylan; Hespen, Charles W; Ohene-Adjei, Samuel; Schroeder, Charles M; Mackie, Roderick I; Cann, Isaac K O

2010-08-01

The hydrolysis of polysaccharides containing mannan requires endo-1,4-beta-mannanase and 1,4-beta-mannosidase activities. In the current report, the biochemical properties of two endo-beta-1,4-mannanases (Man5A and Man5B) from Caldanaerobius polysaccharolyticus were studied. Man5A is composed of an N-terminal signal peptide (SP), a catalytic domain, two carbohydrate-binding modules (CBMs), and three surface layer homology (SLH) repeats, whereas Man5B lacks the SP, CBMs, and SLH repeats. To gain insights into how the two glycoside hydrolase family 5 (GH5) enzymes may aid the bacterium in energy acquisition and also the potential application of the two enzymes in the biofuel industry, two derivatives of Man5A (Man5A-TM1 [TM1 stands for truncational mutant 1], which lacks the SP and SLH repeats, and Man5A-TM2, which lacks the SP, CBMs, and SLH repeats) and the wild-type Man5B were biochemically analyzed. The Man5A derivatives displayed endo-1,4-beta-mannanase and endo-1,4-beta-glucanase activities and hydrolyzed oligosaccharides with a degree of polymerization (DP) of 4 or higher. Man5B exhibited endo-1,4-beta-mannanase activity and little endo-1,4-beta-glucanase activity; however, this enzyme also exhibited 1,4-beta-mannosidase and cellodextrinase activities. Man5A-TM1, compared to either Man5A-TM2 or Man5B, had higher catalytic activity with soluble and insoluble polysaccharides, indicating that the CBMs enhance catalysis of Man5A. Furthermore, Man5A-TM1 acted synergistically with Man5B in the hydrolysis of beta-mannan and carboxymethyl cellulose. The versatility of the two enzymes, therefore, makes them a resource for depolymerization of mannan-containing polysaccharides in the biofuel industry. Furthermore, on the basis of the biochemical and genomic data, a molecular mechanism for utilization of mannan-containing nutrients by C. polysaccharolyticus is proposed.

Effect of dietary supplements in American bullfrogs reared in low and high stocking densities

Directory of Open Access Journals (Sweden)

Jorgina Juliana Gradisse Freitas

2017-11-01

Full Text Available The aim of this study was to evaluate the effect of the probiotic Bacillus subtillis and beta-glucan from the fungus Agaricus blazei on survival, growth and immunological capacity in bullfrogs (Lithobates catesbeianus cultured in low and high stocking densities. Animals weighing 24.3 ± 2.38 g were randomly distributed into four treatments with four simultaneous replicates: D100: 100 frogs/m2 (control; D236: 236 frogs/m2; D236 + Prob.: 236 frogs/m2 supplemented with probiotic; and D236 + BG: 236 frogs/m2 supplemented with beta-glucan. The parameters evaluated were weight gain, survival, plasma corticosterone (CORT, phagocytic capacity (PC and phagocytic index (PI, at 24 h and 15 and 30 days. There is significant interaction between treatments and time for CORT levels. At 30 days, these values were very close for the D100 (control and D236 + BG groups. Meanwhile, no statistical differences were observed between treatments for PC and PI. These results indicate that beta-glucan reduced the effects of stress caused by high density in bullfrogs, but the probiotic did not reduce these effects. Both compounds are not efficient at increasing survival rates, weight gain and neither immune response of animals. Thus, the use of commercial food additives may not have the favorable impact desired by the farmer. Their use in aquaculture should be further studied in experiments involving a longer trial period and taking into account the cost of their use.

Dietary β-glucan enhances the contents of complement component 3 and factor B in eggs of zebrafish.

Science.gov (United States)

Jiang, Chengyan; Wang, Peng; Li, Mengyang; Liu, Shousheng; Zhang, Shicui

2016-12-01

β-glucan has been shown to increase non-specific immunity and resistance against infections or pathogenic bacteria in several fish species, but no information is available regarding its trans-generational effects to date. Here we clearly demonstrated that β-glucan enhanced the contents of immune-relevant molecules C3 and Bf in eggs of zebrafish, and the embryos derived from β-1,3 glucan-treated zebrafish were more resistant to bacterial challenge than control embryos. Moreover, the transferred C3 and Bf were directly associated with the antimicrobial defense of early embryos. In addition, feeding female zebrafish with β-glucan had little detrimental effects on the number of spawned eggs and their embryonic development. Collectively, these data show for the first time that β-glucan can be safely used to promote the non-specific immunity in offspring of fishes. Copyright © 2016 Elsevier Ltd. All rights reserved.

Barley genotypic β-glucan variation combined with enzymatic modifications direct its potential as a natural ingredient in a high fiber extract

DEFF Research Database (Denmark)

Mikkelsen, Mette S.; Meier, Sebastian; Jensen, Morten G.

2017-01-01

-glucan/l, providing European Food Safety Authority (EFSA) and U.S. Food and Drug Administration (FDA) recommended amounts (3 g β-glucan/day) from three portions. TAF extracts of Lys5f and KVL408 grains reached extraordinary high concentrations of 8- 9 g β-glucan/l. The β-glucan molecular mass decreased with enzyme...... robustness in Lys5f  and KVL408 raw materials favor these in a β-glucan rich extract with potential for EFSA and FDA health and Nutrition claims....

Distinction between infection and inflammation by a {sup 99m}Tc-labeled anti (1→3) – β - D - glucans aptamer

Energy Technology Data Exchange (ETDEWEB)

Lacerda, Camila M.S.; Ferreira, Ieda M.; Andrade, S.R., E-mail: cmslacerda@gmail.com.br [Centro de Desenvolvimento da Tecnologia Nuclear (CDTN/CNEN-MG), Belo Horizonte, MG (Brazil); Barros, Andre L.B.; Fernandes, Simone O.A.; Cardoso, Valbert N., E-mail: valbertcardoso@yahoo.com.br [Universidade Federal de Minas Gerais (UFMG), Belo Horizonte, MG (Brazil). Faculdade de Farmacia. Departamento de Analises Clinicas e Toxicologicas

2015-07-01

The difficulty in the early diagnosis of infectious foci, whether caused by fungus or bacteria has raised the need to research new methods for this purpose. The distinction between inflammation and infection as well as the pathogen identification in cases of infection are of great relevance to decision-making in therapy and follow-up treatments. The aim of this study was to evaluate the anti (1→3) – β - D - glucans aptamer Seq6, labeled with {sup 99m}Tc , to distinguish between infection and inflammation. Firstly, in vitro studies were carried out by labeling the aptamer with {sup 32}P to evaluate its binding capacity for (1→3) – β - D - glucans (main fungal cell wall polysaccharide), peptidoglycan (polysaccharide of bacterial cell wall) and also for Candida albicans and Staphylococcus aureus cells. The aptamers were labeled with {sup 99m}Tc by the direct labeling method. The stability of the {sup 99m}Tc -labeled aptamer was evaluated in saline, plasma, and cysteine excess. The biodistribution studies were approved by the Ethics Committee for Animal Experimentation of the Federal University of Minas Gerais (CETEA/UFMG), protocol. 143/2013. The aptamer labeled with {sup 99m}Tc was intravenously administered in three groups (n=6) of male Swiss mice (weight: 25-30g): infected with S. aureus or C. albicans, or with experimental inflammation induced by zymosan. The {sup 32}P aptamer showed high binding affinity for beta-glucan and peptidoglycan. Binding to C. albicans and S. aureus cells also occurred. The radiolabel yield for the aptamer labeling with {sup 99m}Tc was higher than 90%. Stability tests in saline, plasma and excess of cysteine provided satisfactory results, since no significant variation in the radiolabel yield percentage was verified up to 24 hours, even increasing the cysteine concentration. In the biodistribution studies was analyzed the radiolabeled aptamer uptake by the animal infected thigh relative to the uninfected one. The animals

Extracellular cell wall β(1,3)glucan is required to couple septation to actomyosin ring contraction

Science.gov (United States)

Muñoz, Javier; Cortés, Juan Carlos G.; Sipiczki, Matthias; Ramos, Mariona; Clemente-Ramos, José Angel; Moreno, M. Belén; Martins, Ivone M.; Pérez, Pilar

2013-01-01

Cytokinesis has been extensively studied in different models, but the role of the extracellular cell wall is less understood. Here we studied this process in fission yeast. The essential protein Bgs4 synthesizes the main cell wall β(1,3)glucan. We show that Bgs4-derived β(1,3)glucan is required for correct and stable actomyosin ring positioning in the cell middle, before the start of septum formation and anchorage to the cell wall. Consequently, β(1,3)glucan loss generated ring sliding, oblique positioned rings and septa, misdirected septum synthesis indicative of relaxed rings, and uncoupling between a fast ring and membrane ingression and slow septum synthesis, suggesting that cytokinesis can progress with defective septum pushing and/or ring pulling forces. Moreover, Bgs4-derived β(1,3)glucan is essential for secondary septum formation and correct primary septum completion. Therefore, our results show that extracellular β(1,3)glucan is required for cytokinesis to connect the cell wall with the plasma membrane and for contractile ring function, as proposed for the equivalent extracellular matrix in animal cells. PMID:24165938

Comparison of functional and nutritional characteristics of barley and oat mixed linkage ß-glucans

DEFF Research Database (Denmark)

Mikkelsen, Mette Skau

-functionality relationship of β-glucans, the exact functional principle remain elusive. The overall aim of this project was to provide new knowledge into the relation between β-glucan and health at a molecular level. For the first time two barley and one oat fractions of well-defined and structurally different β...

An extracellular cell-attached pullulanase confers branched α-glucan utilization in human gut Lactobacillus acidophilus

DEFF Research Database (Denmark)

Møller, Marie Sofie; Goh, Yong Jun; Rasmussen, Kasper Bøwig

2017-01-01

binding modules, a domain of unknown function, and a C-terminal surface layer association protein (SLAP) domain. Here we explore the specificity of a representative of this group of pullulanases, LaPul13_14 and its role in branched α-glucans metabolism in the well characterized Lactobacillus acidophilus...... in the presence of α-glucans but was repressed by glucose. The debranching activity is conferred exclusively by LaPul13_14 and is abolished in a mutant strain lacking a functional LaPul13_14 gene. Hydrolysis kinetics of recombinant LaPul13_14 confirmed the preference for short branched α-glucan oligomers....... Branched α-1,6-glucans in dietary starch and glycogen are non-degradable by human enzymes and constitute a metabolic resource for the gut microbiota. The role of health-beneficial lactobacilli prevalent in the human small intestine in starch metabolism remains unexplored in contrast to colonic bacterial...

Metabolic profiling of lymph from pigs fed with ß-glucan by high-resolution 1H NMR spectroscopy

DEFF Research Database (Denmark)

Larsen, Flemming Hofmann; Jørgensen, Henry Johs. Høgh; Engelsen, Søren Balling

2010-01-01

To gain information about the effect of ingesting different β-glucan sources on intestinal lymph metabolic profile, 10 growing pigs (30-36 kg) were fitted with a catheter in the jejunal lymphatic trunk, and lymph samples collected continuously -1 to 8 h postprandial and again at 24 h after feeding...... a diet containing either 0.4% added yeast or barley β-glucan and compared to a Control diet. The lymph samples were analysed by proton nuclear magnetic resonance (1H NMR) spectroscopy and subsequently subjected to chemometric analysis. The dominant resonances in the 1H NMR spectra of lymph arose...... of increased lymph viscosity induced by barley β-glucan compared to yeast β-glucan were observed...

A high throughput colorimetric assay of β-1,3-D-glucans by Congo red dye.

Science.gov (United States)

Semedo, Magda C; Karmali, Amin; Fonseca, Luís

2015-02-01

Mushroom strains contain complex nutritional biomolecules with a wide spectrum of therapeutic and prophylactic properties. Among these compounds, β-d-glucans play an important role in immuno-modulating and anti-tumor activities. The present work involves a novel colorimetric assay method for β-1,3-d-glucans with a triple helix tertiary structure by using Congo red. The specific interaction that occurs between Congo red and β-1,3-d-glucan was detected by bathochromic shift from 488 to 516 nm (>20 nm) in UV-Vis spectrophotometer. A micro- and high throughput method based on a 96-well microtiter plate was devised which presents several advantages over the published methods since it requires only 1.51 μg of polysaccharides in samples, greater sensitivity, speed, assay of many samples and very cheap. β-D-Glucans of several mushrooms (i.e., Coriolus versicolor, Ganoderma lucidum, Pleurotus ostreatus, Ganoderma carnosum, Hericium erinaceus, Lentinula edodes, Inonotus obliquus, Auricularia auricular, Polyporus umbellatus, Cordyseps sinensis, Agaricus blazei, Poria cocos) were isolated by using a sequence of several extractions with cold and boiling water, acidic and alkaline conditions and quantified by this microtiter plate method. FTIR spectroscopy was used to study the structural features of β-1,3-D-glucans in these mushroom samples as well as the specific interaction of these polysaccharides with Congo red. The effect of NaOH on triple helix conformation of β-1,3-D-glucans was investigated in several mushroom species. Copyright © 2014 Elsevier B.V. All rights reserved.

β-1,3-Glucan, Which Can Be Targeted by Drugs, Forms a Trabecular Scaffold in the Oocyst Walls of Toxoplasma and Eimeria

Science.gov (United States)

Bushkin, G. Guy; Motari, Edwin; Magnelli, Paula; Gubbels, Marc-Jan; Dubey, Jitender P.; Miska, Katarzyna B.; Bullitt, Esther; Costello, Catherine E.; Robbins, Phillips W.; Samuelson, John

2012-01-01

ABSTRACT The walls of infectious pathogens, which are essential for transmission, pathogenesis, and diagnosis, contain sugar polymers that are defining structural features, e.g., β-1,3-glucan and chitin in fungi, chitin in Entamoeba cysts, β-1,3-GalNAc in Giardia cysts, and peptidoglycans in bacteria. The goal here was to determine in which of three walled forms of Toxoplasma gondii (oocyst, sporocyst, or tissue cyst) is β-1,3-glucan, the product of glucan synthases and glucan hydrolases predicted by whole-genome sequences of the parasite. The three most important discoveries were as follows. (i) β-1,3-glucan is present in oocyst walls of Toxoplasma and Eimeria (a chicken parasite that is a model for intestinal stages of Toxoplasma) but is absent from sporocyst and tissue cyst walls. (ii) Fibrils of β-1,3-glucan are part of a trabecular scaffold in the inner layer of the oocyst wall, which also includes a glucan hydrolase that has a novel glucan-binding domain. (iii) Echinocandins, which target the glucan synthase and kill fungi, arrest development of the Eimeria oocyst wall and prevent release of the parasites into the intestinal lumen. In summary, β-1,3-glucan, which can be targeted by drugs, is an important component of oocyst walls of Toxoplasma but is not a component of sporocyst and tissue cyst walls. PMID:23015739

Molecular characterization and genetic diversity analysis β-glucan content variability in grain of oat (Avena sativa L.

Directory of Open Access Journals (Sweden)

Đukić Nevena H.

2014-01-01

Full Text Available In grain of ten genetically divergent oat cultivars (Merkur, Minor Abed, Flaming-Kurz, Nuptiele, Prode, Pellerva, Emperor, Astor, Osmo, Simo the variability β-glucan content were investigated. The different value of content of β-glucan was found. Among analyzed oat cultivars, the highest β- glucan contents had Pellerva (6.597%, while the least had Simo (2.971%. The contents of β-glucans were determined by ICC standard Method No 168. The value of β-glucans varied and indicated the differences and similarities between analysed cultivars. The degree of cultivar similarity was determined by dendrogram on which was discriminated two clusters of similar cultivars toward to contents of β-glucan . Within cluster 1, a small group of oats, are five cultivars with small distance (Merkur, Minor Abed, Flamings-Kurz, Nuptiele and Prode. The highest similarity in the range of 88 or the least distance in the range of 12. Within cluster 2 was four oat cultivars (Emperor, Astor, Osmo, Pellerva in which the least differences was between Emperor and Astor with average distance in range 27. Cluster 1 and cluster 2 differed with an average distance of 63. The cultivar Simo expressed the greatest distance to all analysed oat cultivars grouped in two clusters. [Projekat Ministarstva nauke Republike Srbije, br. TR 31092

Optimization of β-glucan synthase gene primers for molecular DNA fingerprinting in Pleurotus pulmonarious

Science.gov (United States)

Kadir, Zaiton Abdul; Daud, Fauzi; Mohamad, Azhar; Senafi, Sahidan; Jamaludin, Ferlynda Fazleen

2015-09-01

Pleurotus pulmonarius is an edible mushroom in Malaysia and commonly known as Oyster mushroom. The species are important not only for nutritional values but also for pharmaceutical importance related to bioactive compounds in polysaccharides such as β glucan. Hence, β-glucan synthase gene (BGS) pathways which are related to the production of the β-glucan might be useful as marker for molecular DNA fingerprinting in P. pulmonarius. Conserved regions of β-glucan gene were mined from public database and aligned. Consensus from the alignment was used to design the primers by using Primer 3 software. Eight primers were designed and a single primer pair (BGF3: 5' TCTTGGCGAGTTCGAAGAAT 3'; BGR3: 5' TTCCGATCTTGGTCTGGAAG 3') was optimized at Ta (annealing temperature) 57.1°C to produce PCR product ranging from 400-500 bp. Optimum components for PCR reactions were 5.0 µl of 10× PCR buffer, 1.5 µl of 25 mM MgCl2, 1 µl of 10 mM dNTP, 1 µl of β-glucan primers, 0.1 µl of 5 units/ml Taq polymerase and 2 µl DNA template. PCR program was set at 34 PCR cycles by using Bio-Rad T100 Thermal Cycler. Initial denaturation was set at 94°C for 2 min, denaturation at 94°C for 1 minute, primer annealing at 45°C to 60°C (gradient temperature) for 50 seconds, followed by elongation at 72°C for 1 minute and further extension 5 minutes for last cycle PCR prior to end the program cycle. Thus, this information revealed that the primer of β-glucan gene designed could be used as targeted markers in screening population strains of P. pulmonarius.

Novel Antihypertensive Prodrug from Grape Seed Proanthocyanidin Extract via Acid-Mediated Depolymerization in the Presence of Captopril: Synthesis, Process Optimization, and Metabolism in Rats.

Science.gov (United States)

Cui, Can; Shi, Ailong; Bai, Shuang; Yan, Pengyu; Li, Qing; Bi, Kaishun

2018-04-11

Grape seed extract contains a high content of proanthocyanidins that can be depolymerized into C-4-substituted (epi)catechin derivatives in the presence of nucleophiles. However, the biological and medicinal values of depolymerization products have been rarely investigated. Recently, we developed a novel depolymerization product (-)-epicatechin-4β- S-captopril methyl ester (ECC) derived from the reaction of grape seed proanthocyanidin extract with captopril in the presence of acidified methanol. A central composite design was employed to select the most appropriate depolymerization temperature and time to obtain the target product ECC with a high yield. A total of 16 metabolites of ECC in rat urine, feces, and plasma were identified using liquid chromatography quadrupole time-of-flight tandem mass spectrometry. The in vivo results suggested that ECC could release captopril methyl ester and epicatechin, followed by the generation of further metabolites captopril and epicatechin sulfate conjugates. Therefore, ECC may be used as a potential prodrug with synergistic or additive hypotensive effects.

Extracted oat and barley β-glucans do not affect cholesterol metabolism in young healthy adults

DEFF Research Database (Denmark)

Ibrügger, Sabine; Kristensen, Mette Bredal; Poulsen, Malene Wibe

2013-01-01

for β-glucan functionality. This study investigates the effects of 3 different β-glucan sources, incorporated into a beverage and yogurt, on blood lipids and fecal endpoints. Fourteen participants completed this randomized, crossover, single-blinded study with four 3-wk periods: control and 3.3 g/d oat...

Impact of flavouring substances on the aggregation behaviour of dissolved barley β-glucans in a model beer.

Science.gov (United States)

Kupetz, M; Sacher, B; Becker, T

2016-06-05

Structural polymers such as cereal β-glucan may cause various processing problems in beverage industry depending on concentration, molar size distribution and agglomeration behaviour. In this context, influences of the beer volatiles dodecanoic acid, octyl butanoate, ethyl decanoate and decyl acetate on molar mass and radii of barley β-glucan were investigated in ethanolic (4% w/w) model solution. After addition of 100mg/l ethyl decanoate and decyl acetate to the β-glucan solution, a wider-ranging molar mass distribution could be observed by means of asymmetric field-flow-fractionation. Due to agglomeration, average molar mass of β-glucan standard (MW=6.8×10(6)g/mol) increased by 2×10(6)g/mol (P<0.05) in solution containing decyl acetate. Furthermore, a significant growth (P<0.05) from 86 to 102 nm in gyration radius was measured. The obtained results elucidate the importance of fatty acid derived flavouring substance composition in beer regarding the aggregation behaviour of β-glucan. Copyright © 2016 Elsevier Ltd. All rights reserved.

Impact of the fouling mechanism on enzymatic depolymerization of xylan in different configurations of membrane reactors

DEFF Research Database (Denmark)

Mohd Sueb, Mohd Shafiq Bin; Luo, Jianquan; Meyer, Anne S.

2017-01-01

In order to maximize enzymatic xylan depolymerization while simultaneously purifying the resulting monosaccharide (xylose), different ultrafiltration (UF) membrane reactor configurations were evaluated. Initial results showed that the two hydrolytic enzymes required for complete depolymerization...... which hindered enzymatic attack in addition to fouling. Reaction with both enzymes followed by UF was found to be the optimal configuration, providing at least 40% higher xylan hydrolysis than the cascade configuration (involving sequential reaction with each of the enzymes separately......) and the simultaneous reaction-filtration with both enzymes, respectively. This study thus confirmed that the reactor configuration has a crucial impact on the performance of both the reaction and the separation process of xylose during enzymatic xylan degradation, and that the type of fouling mechanism varies...

The effect of aerobic exercise and barley β-glucan on blood glucose, body composition and blood pressure of diabetic women

Directory of Open Access Journals (Sweden)

Fatemeh Mokhtari

2018-04-01

Full Text Available Background: The incidence of type 2 diabetes increases with aging, unhealthy diets, obesity and sedentary lifestyles. The aim of this study was to investigate the combinational effect of a 12-week aerobic exercise and barley β-glucan (BBG on blood glucose, body composition and blood pressure in women with type 2 diabetes. Materials and Methods: In this semi-experimental study, 24 women with the mean age of 49 years and a blood glucose level of 110-280 mg/dl were purposefully selected and randomly divided into three groups: a group of aerobic exercise with diet (n=8, b diet group (n=8 c control group (n=8. The diet group consumed one barley bread, containing 4 g of β glucan, each day for 12 weeks. The group of aerobic exercise, who was on diet, participated in a progressive walking program with the intensity of %60-70% of maximal heart rate in addition to diet program (barley bread. Blood glucose, weight, fat percentage, and systolic and diastolic blood pressure levels were measured in pre-and post-training. Results: Results showed a significant decrease in the blood glucose level in the experimental groups compared to the control group, while no major changes were observed in body composition and blood pressure. Conclusion: It seems that the combined program (aerobic training with diet or consumption of β-glucan alone can decrease blood glucose in patients with diabetes.

Enzyme-Linked Immunosorbent Assay Specific for (1→6) Branched, (1→3)-β-d-Glucan Detection in Environmental Samples

OpenAIRE

Milton, Donald K.; Alwis, K. Udeni; Fisette, Leslie; Muilenberg, Michael

2001-01-01

(1→3)-β-d-Glucans have been recognized as a potential causative agent responsible for bioaerosol-induced respiratory symptoms observed in both indoor and occupational environments. A specific enzyme immunoassay was developed to quantify (1→6) branched, (1→3)-β-d-glucans in environmental samples. The assay was based on the use of a high-affinity receptor (galactosyl ceramide) specific for (1→3)-β-d-glucans as a capture reagent and a monoclonal antibody specific for fungal cell wall β-d-glucans...

Targeted Delivery of Glucan Particle Encapsulated Gallium Nanoparticles Inhibits HIV Growth in Human Macrophages

Directory of Open Access Journals (Sweden)

Ernesto R. Soto

2016-01-01

Full Text Available Glucan particles (GPs are hollow, porous 3–5 μm microspheres derived from the cell walls of Baker’s yeast (Saccharomyces cerevisiae. The 1,3-β-glucan outer shell provides for receptor-mediated uptake by phagocytic cells expressing β-glucan receptors. GPs have been used for macrophage-targeted delivery of a wide range of payloads (DNA, siRNA, protein, small molecules, and nanoparticles encapsulated inside the hollow GPs or bound to the surface of chemically derivatized GPs. Gallium nanoparticles have been proposed as an inhibitory agent against HIV infection. Here, macrophage targeting of gallium using GPs provides for more efficient delivery of gallium and inhibition of HIV infection in macrophages compared to free gallium nanoparticles.

Biotechnological potential of novel glycoside hydrolase family 70 enzymes synthesizing α-glucans from starch and sucrose

NARCIS (Netherlands)

Gangoiti, Joana; Pijning, Tjaard; Dijkhuizen, Lubbert

Transglucosidases belonging to the glycoside hydrolase (GH) family 70 are promising enzymatic tools for the synthesis of α-glucans with defined structures from renewable sucrose and starch substrates. Depending on the GH70 enzyme specificity, α-glucans with different structures and physicochemical

Characterization of oxidized tannins: comparison of depolymerization methods, asymmetric flow field-flow fractionation and small-angle X-ray scattering.

Science.gov (United States)

Vernhet, Aude; Dubascoux, Stéphane; Cabane, Bernard; Fulcrand, Hélène; Dubreucq, Eric; Poncet-Legrand, Céline

2011-09-01

Condensed tannins are a major class of plant polyphenols. They play an important part in the colour and taste of foods and beverages. Due to their chemical reactivity, tannins are not stable once extracted from plants. A number of chemical reactions can take place, leading to structural changes of the native structures to give so-called derived tannins and pigments. This paper compares results obtained on native and oxidized tannins with different techniques: depolymerization followed by high-performance liquid chromatography analysis, small-angle X-ray scattering (SAXS) and asymmetric flow field-flow fractionation (AF4). Upon oxidation, new macromolecules were formed. Thioglycolysis experiments showed no evidence of molecular weight increase, but thioglycolysis yields drastically decreased. When oxidation was performed at high concentration (e.g., 10 g L(-1)), the weight average degree of polymerization determined from SAXS increased, whereas it remained stable when oxidation was done at low concentration (0.1 g L(-1)), indicating that the reaction was intramolecular, yet the conformations were different. Differences in terms of solubility were observed; ethanol being a better solvent than water. We also separated soluble and non-water-soluble species of a much oxidized fraction. Thioglycolysis showed no big differences between the two fractions, whereas SAXS and AF4 showed that insoluble macromolecules have a weight average molecular weight ten times higher than the soluble ones.

A comparative study on the activity of fungal lytic polysaccharide monooxygenases for the depolymerization of cellulose in soybean spent flakes.

Science.gov (United States)

Pierce, Brian C; Agger, Jane Wittrup; Zhang, Zhenghong; Wichmann, Jesper; Meyer, Anne S

2017-09-08

Lytic polysaccharide monooxygenases (LPMOs) are copper-dependent enzymes capable of the oxidative breakdown of polysaccharides. They are of industrial interest due to their ability to enhance the enzymatic depolymerization of recalcitrant substrates by glycoside hydrolases. In this paper, twenty-four lytic polysaccharide monooxygenases (LPMOs) expressed in Trichoderma reesei were evaluated for their ability to oxidize the complex polysaccharides in soybean spent flakes, an abundant and industrially relevant substrate. TrCel61A, a soy-polysaccharide-active AA9 LPMO from T. reesei, was used as a benchmark in this evaluation. In total, seven LPMOs demonstrated activity on pretreated soy spent flakes, with the products from enzymatic treatments evaluated using mass spectrometry and high performance anion exchange chromatography. The hydrolytic boosting effect of the top-performing enzymes was evaluated in combination with endoglucanase and beta-glucosidase. Two enzymes (TrCel61A and Aspte6) showed the ability to release more than 36% of the pretreated soy spent flake glucose - a greater than 75% increase over the same treatment without LPMO addition. Copyright © 2017 Elsevier Ltd. All rights reserved.

Beta-Glucan-Rich Extract from Pleurotus sajor-caju (Fr. Singer Prevents Obesity and Oxidative Stress in C57BL/6J Mice Fed on a High-Fat Diet

Directory of Open Access Journals (Sweden)

G. Kanagasabapathy

2013-01-01

Full Text Available Mushrooms have been used in folk medicine for thousands of years. In this study, the effect of β-glucan-rich extract of P. sajor-caju (GE on lipid lowering and antioxidant potential was assessed in C57BL/6J mice fed on a high-fat diet. Obesity was induced in C57BL/6J mice by feeding a high-fat diet. The control groups in this study were ND (for normal diet and HFD (for high-fat diet. The treated groups were ND240 (for normal diet (240 mg/kg b.w and HFD60, HFD120, and HFD240 (for high-fat diet, where the mice were administrated with three dosages of GE (60, 120, and 240 mg GE/kg b.w. Metformin (2 mg/kg b.w served as positive control. GE-treated groups showed significantly reduced body weight, serum lipid, and liver enzymes levels. GE also attenuated protein carbonyl and lipid hydroperoxide levels by increasing the enzymic antioxidants (SOD, CAT, and GPx activities in the mice. GE-treated groups induced the expression of hormone sensitive lipase (HSL and adipose triglyceride lipase (ATGL while downregulated the expression of peroxisome proliferator-activated receptor gamma (PPAR-γ, sterol regulatory binding protein-1c (SREBP-1c, and lipoprotein lipase (LPL. Hence, GE prevented weight gain in the mice by inducing lipolysis and may be valuable in the formulation of adjuvant therapy for obesity.

Ethanol as capping agent and formaldehyde scavenger for efficient depolymerization of lignin to aromatics

NARCIS (Netherlands)

Huang, X.; Koranyi, T.I.; Boot, M.D.; Hensen, E.J.M.

2015-01-01

Obtaining renewable fuels and chemicals from lignin presents an important challenge to the use of lignocellulosic biomass in order to meet sustainability and energy goals. We report on a thermocatalytic process for the depolymerization of lignin in supercritical ethanol over a CuMgAlOx catalyst.

Peracetic Acid Depolymerization of Biorefinery Lignin for Production of Selective Monomeric Phenolic Compounds

Energy Technology Data Exchange (ETDEWEB)

Ma, Ruoshui [Voiland School of Chemical Engineering and Bioengineering, Bioproducts, Science & Engineering Laboratory, Washington State University, 2710 Crimson Way Richland WA 99354 USA; Guo, Mond [Voiland School of Chemical Engineering and Bioengineering, Bioproducts, Science & Engineering Laboratory, Washington State University, 2710 Crimson Way Richland WA 99354 USA; Lin, Kuan-ting [Voiland School of Chemical Engineering and Bioengineering, Bioproducts, Science & Engineering Laboratory, Washington State University, 2710 Crimson Way Richland WA 99354 USA; Hebert, Vincent R. [Food and Environmental Laboratory, Washington State, University-TriCities, 2710 Crimson Way Richland WA 99354 USA; Zhang, Jinwen [Wood Materials and Engineering Laboratory, Washington State University, Pullman WA 99164 USA; Wolcott, Michael P. [Wood Materials and Engineering Laboratory, Washington State University, Pullman WA 99164 USA; Quintero, Melissa [Voiland School of Chemical Engineering and Bioengineering, Bioproducts, Science & Engineering Laboratory, Washington State University, 2710 Crimson Way Richland WA 99354 USA; Ramasamy, Karthikeyan K. [Chemical and Biological Process Development Group, Pacific Northwest National Laboratory, Richland WA 99354 USA; Chen, Xiaowen [National Bioenergy Center, National Renewable Energy Lab, 1617 Cole Blvd Golden CO 80127 USA; Zhang, Xiao [Voiland School of Chemical Engineering and Bioengineering, Bioproducts, Science & Engineering Laboratory, Washington State University, 2710 Crimson Way Richland WA 99354 USA

2016-07-04

Lignin is the largest source of renewable material with an aromatic skeleton. However, due to the recalcitrant and heterogeneous nature of the lignin polymer, it has been a challenge to effectively depolymerize lignin and produce high-value chemicals with high selectivity. In this study, a highly efficient lignin-to-monomeric phenolic compounds (MPC) conversion method based on peracetic acid (PAA) treatment was reported. PAA treatment of two biorefinery lignin samples, diluted acid pretreated corn stover lignin (DACSL) and steam exploded spruce lignin (SESPL), led to complete solubilization and production of selective hydroxylated monomeric phenolic compounds (MPC-H) and monomeric phenolic acid compounds (MPC-A) including 4-hydroxy-2-methoxyphenol, p-hydroxybenzoic acid, vanillic acid, syringic acid, and 3,4-dihydroxybenzoic acid. The maximized MPC yields obtained were 18 and 22 % based on the initial weight of the lignin in SESPL and DACSL, respectively. However, we found that the addition of niobium pentoxide catalyst to PAA treatment of lignin can significantly improve the MPC yields up to 47 %. The key reaction steps and main mechanisms involved in this new lignin-to-MPC valorization pathway were investigated and elucidated.

Peracetic Acid Depolymerization of Biorefinery Lignin for Production of Selective Monomeric Phenolic Compounds

Energy Technology Data Exchange (ETDEWEB)

Ma, Ruoshui [Voiland School of Chemical Engineering and Bioengineering, Bioproducts, Science & Engineering Laboratory, Washington State University, 2710 Crimson Way Richland WA 99354 USA; Guo, Mond [Voiland School of Chemical Engineering and Bioengineering, Bioproducts, Science & Engineering Laboratory, Washington State University, 2710 Crimson Way Richland WA 99354 USA; Lin, Kuan-ting [Voiland School of Chemical Engineering and Bioengineering, Bioproducts, Science & Engineering Laboratory, Washington State University, 2710 Crimson Way Richland WA 99354 USA; Hebert, Vincent R. [Food and Environmental Laboratory, Washington State, University-TriCities, 2710 Crimson Way Richland WA 99354 USA; Zhang, Jinwen [Wood Materials and Engineering Laboratory, Washington State University, Pullman WA 99164 USA; Wolcott, Michael P. [Wood Materials and Engineering Laboratory, Washington State University, Pullman WA 99164 USA; Quintero, Melissa [Voiland School of Chemical Engineering and Bioengineering, Bioproducts, Science & Engineering Laboratory, Washington State University, 2710 Crimson Way Richland WA 99354 USA; Ramasamy, Karthikeyan K. [Chemical and Biological Process Development Group, Pacific Northwest National Laboratory, Richland WA 99354 USA; Chen, Xiaowen [National Bioenergy Center, National Renewable Energy Lab, 1617 Cole Blvd Golden CO 80127 USA; Zhang, Xiao [Voiland School of Chemical Engineering and Bioengineering, Bioproducts, Science & Engineering Laboratory, Washington State University, 2710 Crimson Way Richland WA 99354 USA

2016-07-04

Lignin is the largest source of renewable material with an aromatic skeleton. However, due to the recalcitrant and heterogeneous nature of the lignin polymer as well as its complex side chain structures, it has been a challenge to effectively depolymerize lignin and produce high value chemicals with high selectivity. In this study, a highly efficient lignin-to-monomeric phenolic compounds (MPC) conversion method based on peracetic acid (PAA) treatment was reported. PAA treatment of two biorefinery lignin samples, diluted acid pretreated corn stover lignin (DACSL) and steam exploded spruce lignin (SESPL), led to complete solubilization and production of selective hydroxylated monomeric phenolic compounds (MPC-H) and monomeric phenolic acid compounds (MPC-A) inclduing 4-hydroxy-2-methoxyphenol, p-hydroxybenzoic acid, vanillic acid, syringic acid, and 3,4-dihydroxybenzoic acid. The maximized MPCs yields obtained were 18% and 22% based on the initial weight of the lignin in SESPL and DACSL respectively. However, we found that the addition of niobium pentoxide catalyst to PAA treatment of lignin can significantly improve the MPC yields up to 47%. The key reaction steps and main mechanisms involved in this new lignin-to-MPC valorization pathway were investigated and elucidated.

Purification and properties of the cellulases from the thermophilic fungus Thermoascus aurantiacus

Energy Technology Data Exchange (ETDEWEB)

Tong, C C; Cole, A L; Shepherd, M G

1980-10-01

Three cellulases and a beta-glucosidase were purified from the culture filtrate of the thermophilic fungus Thermoascus aurantiacus. The isolated enzymes were all homogenous on polyacrylamide-disc-gel electrophoresis. Data from chromatography on Bio-Gel P-60 and solium dodecyl sulphate/polyacrylamide-gel electrophoresis indicated molecular weights of 87000 (beta-glucosidase), 78000 (cellulase I), 49000 (cellulase II) and 34000 (cellulase III); the carbohydrate contents of the enzymes were 33.0 5.5, 2.6 and 1.8% (w/w) respectively. Although the three purified cellulases were active toward filter paper, only cellulases I and III were active towards CM (Carboxymethyl)-cellulose. Cellulase I was also active towards yeast glucan. The Km and catalytic-centre-activity values for the enzymes were as follows; 0.52 mu mol/ml and 6.5 by 10 to the power of 4 for beta-glucosidase on p-nitrophenyl beta-d-glucoside, 3.9 mg/ml and 6.3 for cellulase I on CM-cellulose, 1.2 mg/ml and 1.1 for cellulase I on yeast glucan, 34.4 mg/ml and 0.34 for cellulase II on filter paper, and 1.9 mg/ml and 33 for cellulase III on CM-cellulose.

The influences of sugars and plant growth regulators on β-glucan synthesis of G. lucidum mycelium in submerged culture

Science.gov (United States)

Thao, Cao Phuong; Tien, Le Thi Thuy

2017-09-01

β - glucan is intracellular polysaccharide (IPS), extracted from Ganoderma lucidum mycelium that can enhance human immune respond. This study aimed to stimulate the production of β - glucan in G. lucidum mycelium through optimating the carbonhydrates and plant rowth regulators in submerged culture. The results showed that the stimulation or inhibition of IPS production as well as β - glucan biosynthesis could be adjusted depend on the type and concentration of carbonhydrates and plant growth regulators. The supplement of lactose 80 g/L and BA 1 mg/L in medium could cause the highest IPS production (644.478 mg/g DW) and β - glucan increased up to 0.15/DW, that raised twice as much as without plant growth regulators. Futhermore, the optimation of other environmental elements were figured out were completely dark and 150 rpm on rotary shaker. This result could be used as premise for production of β - glucan in pilot.

Host-Pathogen Interactions : XXXII. A Fungal Glucan Preparation Protects Nicotianae against Infection by Viruses.

Science.gov (United States)

Kopp, M; Rouster, J; Fritig, B; Darvill, A; Albersheim, P

1989-05-01

A glucan preparation obtained from the mycelial walls of the fungus Phytophthora megasperma f.sp. glycinea and known as an elicitor of phytoalexins in soybean was shown to be a very efficient inducer of resistance against viruses in tobacco. The glucan preparation protected against mechanically transmitted viral infections on the upper and lower leaf surfaces. Whether the glucan preparation was applied by injection, inoculation, or spraying, it protected the plants if applied before, at the same time as, or not later than 8 hours after virus inoculation. At concentrations ranging from 0.1 to 10 micrograms per milliliter, the glucan preparation induced protection ranging from 50 to 100% against both symptom production (necrotic local lesions, necrotic rings, or systemic mosaic) and virus accumulation in all Nicotiana-virus combinations examined. However, no significant protection against some of the same viruses was observed in bean or turnip. The host plants successfully protected included N. tabacum (9 different cultivars), N. sylvestris, N. glutinosa, and N. clevelandii. The viruses belonged to several taxonomic groups including tobacco mosaic virus, alfalfa mosaic virus, and tomato black ring virus. The glucan preparation did not act directly on the virus and did not interfere with virus disassembly; rather, it appeared to induce changes in the host plant that prevented infections from being initiated or recently established infections from enlarging. The induced resistance does not depend on induction of pathogenesis-related proteins, the phenylpropanoid pathway, lignin-like substances, or callose-like materials. We believe the induced resistance results from a mechanism that has yet to be described.

Actin depolymerization enhances adipogenic differentiation in human stromal stem cells

DEFF Research Database (Denmark)

Chen, Li; Hu, Huimin; Qiu, Weimin

2018-01-01

Human stromal stem cells (hMSCs) differentiate into adipocytes that play a role in skeletal tissue homeostasis and whole body energy metabolism. During adipocyte differentiation, hMSCs exhibit significant changes in cell morphology suggesting changes in cytoskeletal organization. Here, we examined...... the effect of direct modulation of actin microfilament dynamics on adipocyte differentiation. Stabilizing actin filaments in hMSCs by siRNA-mediated knock down of the two main actin depolymerizing factors (ADFs): Cofilin 1 (CFL1) and Destrin (DSTN) or treating the cells by Phalloidin reduced adipocyte...

The well-coordinated linkage between acidogenicity and aciduricity via insoluble glucans on the surface of Streptococcus mutans

Science.gov (United States)

Guo, Lihong; McLean, Jeffrey S.; Lux, Renate; He, Xuesong; Shi, Wenyuan

2015-01-01

Streptococcus mutans is considered the principal cariogenic bacterium for dental caries. Despite the recognition of their importance for cariogenesis, the possible coordination among S. mutans’ main virulence factors, including glucan production, acidogenicity and aciduricity, has been less well studied. In the present study, using S. mutans strains with surface-displayed pH-sensitive pHluorin, we revealed sucrose availability- and Gtf functionality-dependent proton accumulation on S. mutans surface. Consistent with this, using a pH-sensitive dye, we demonstrated that both in vivo cell-produced and in vitro enzymatically synthesized insoluble glucans displayed proton-concentrating ability. Global transcriptomics revealed proton accumulation triggers the up-regulation of genes encoding functions involved in acid tolerance response in a glucan-dependent manner. Our data suggested that this proton enrichment around S. mutans could pre-condition the bacterium for acid-stress. Consistent with this hypothesis, we found S. mutans strains defective in glucan production were more acid sensitive. Our study revealed for the first time that insoluble glucans is likely an essential factor linking acidogenicity with aciduricity. The coordination of these key virulence factors could provide new insights on how S. mutans may have become a major cariogenic pathogen. PMID:26657939

Slight respiratory irritation but not inflammation in mice exposed to (1→3-β-D-glucan aerosols

Directory of Open Access Journals (Sweden)

A. Korpi

2003-01-01

Full Text Available Airway irritation effects after single and repeated inhalation exposures to aerosols of β-glucan (grifolan were investigated in mice. In addition, the effects on serum total immunoglobulin E (IgE production and histopathological inflammation in the respiratory tract were studied. The β-glucan aerosols provoked slight sensory irritation in the airways, but the response was not concentration dependent at the levels studied. Slight pulmonary irritation was observed after repeated exposures. No effect was found on the serum total IgE levels, and no signs of inflammation were seen in the airways 6 h after the final exposure. The results suggest that, irrespective of previous fungal sensitization of the animals, inhaled β-glucan may cause symptoms of respiratory tract irritation but without apparent inflammation. Respiratory tract irritation reported after inhalation of fungi may not be entirely attributed to β-glucan.

The Preparation of Glucan-Fe3O4 Magnetic Nanoparticles and Its In Vivo Distribution in Mice

Directory of Open Access Journals (Sweden)

Fengdan Jin

2014-01-01

Full Text Available The glucan-Fe3O4 magnetic nanoparticles were prepared by hydrothermal method. The mixture of FeCl2 and glucan was stirred vigorously for half an hour under low temperature (15°C. KOH of 1 mol/L was dropwise added, slowly, into the solution until the pH to 12. Immediately, KNO3 was added and the temperature was raised to 75°C for an hour. All the processes of Fe3O4 crystal particles generation were under nitrogen. An atomic absorption spectrometry quantitative analysis method was built to determine the in vivo distribution of the glucan-Fe3O4 magnetic nanoparticles in mice. The diameter of glucan-Fe3O4 magnetic nanoparticles was about 25 nm and they were up taken by the liver primarily after intravenous administration via the tail.

Binding Interactions Between alpha-glucans from Lactobacillus reuteri and Milk Proteins Characterised by Surface Plasmon Resonance

NARCIS (Netherlands)

Diemer, Silja K.; Svensson, Birte; Babol, Linnea N.; Cockburn, Darrell; Grijpstra, Pieter; Dijkhuizen, Lubbert; Folkenberg, Ditte M.; Garrigues, Christel; Ipsen, Richard H.

Interactions between milk proteins and alpha-glucans at pH 4.0-5.5 were investigated by use of surface plasmon resonance. The alpha-glucans were synthesised with glucansucrase enzymes from Lactobacillus reuteri strains ATCC-55730, 180, ML1 and 121. Variations in the molecular characteristics of the

Symbiont-derived beta-1,3-glucanases in a social insect: mutualism beyond nutrition

Directory of Open Access Journals (Sweden)

Rebeca B Rosengaus

2014-11-01

Full Text Available Termites have had a long co-evolutionary history with prokaryotic and eukaryotic gut microbes. Historically, the role of these anaerobic obligate symbionts has been attributed to the nutritional welfare of the host. We provide evidence that protozoa (and/or their associated bacteria colonizing the hindgut of the dampwood termite Zootermopsis angusticollis, synthesize multiple functional beta-1,3-glucanases, enzymes known for breaking down beta-1,3-glucans, the main component of fungal cell walls. These enzymes, we propose, may help in both digestion of ingested fungal hyphae and protection against invasion by fungal pathogens. This research points to an additional novel role for the mutualistic hindgut microbial consortia of termites, an association that may extend beyond ligno-cellulolytic activity and nitrogen fixation to include a reduction in the risks of mycosis at both the individual- and colony-levels while nesting in and feeding on microbial-rich decayed wood.

Binding Interactions Between α-glucans from Lactobacillus reuteri and Milk Proteins Characterised by Surface Plasmon Resonance

DEFF Research Database (Denmark)

Diemer, Silja Kej; Svensson, Birte; Babol, Linnéa N.

2012-01-01

Interactions between milk proteins and α-glucans at pH 4.0–5.5 were investigated by use of surface plasmon resonance. The α-glucans were synthesised with glucansucrase enzymes from Lactobacillus reuteri strains ATCC-55730, 180, ML1 and 121. Variations in the molecular characteristics of the α...

Sbg1 Is a Novel Regulator for the Localization of the β-Glucan Synthase Bgs1 in Fission Yeast.

Directory of Open Access Journals (Sweden)

Reshma Davidson

Full Text Available Glucan synthases synthesize glucans, complex polysaccharides that are the major components in fungal cell walls and division septa. Studying regulation of glucan synthases is important as they are essential for fungal cell survival and thus popular targets for anti-fungal drugs. Linear 1,3-β-glucan is the main component of primary septum and is synthesized by the conserved β-glucan synthase Bgs1 in fission yeast cytokinesis. It is known that Rho1 GTPase regulates Bgs1 catalytic activity and the F-BAR protein Cdc15 plays a role in Bgs1 delivery to the plasma membrane. Here we characterize a novel protein Sbg1 that is present in a complex with Bgs1 and regulates its protein levels and localization. Sbg1 is essential for contractile-ring constriction and septum formation during cytokinesis. Sbg1 and Bgs1 physically interact and are interdependent for localization to the plasma membrane. Bgs1 is less stable and/or mis-targeted to vacuoles in sbg1 mutants. Moreover, Sbg1 plays an earlier and more important role in Bgs1 trafficking and localization than Cdc15. Together, our data reveal a new mode of regulation for the essential β-glucan synthase Bgs1 by the novel protein Sbg1.

The use of (1-3) β-glucan along with itraconazole against canine refractory sporotrichosis.

Science.gov (United States)

Guterres, Karina Affeldt; de Matos, Caroline Bohnen; Osório, Luiza Da Gama; Schuch, Isabel Duarte; Cleff, Marlete Brum

2014-04-01

Sporotrichosis, caused by the Sporothrix schenckii fungal complex, is a zoonotic mycosis distributed worldwide. Itraconazole is the treatment of choice for domestic animals although some fungal isolates have shown resistance to this drug. The objective of this study was to report, for the first time, the use of (1-3) β-glucan along with itraconazole in the treatment of a canine with sporotrichosis caused by Sporothrix brasiliensis. The animal had ulcerated and crusted lesions, especially on the nasal planum. Clinical samples were collected for a complete blood count, cytological analysis of the lesion, and fungal culture. Based on the results of the laboratory examination, and after the fungal culture, antibiotic therapy and treatment with itraconazole were initiated. Two additional fungal cultures were performed, which were positive. After 7 months of the animal treatment with itraconazole, the S. brasiliensis culture was still positive, so that the itraconazole was associated with (1-3) β-glucan. After four weekly applications of glucan, the complete elimination of the fungus was observed based on the fungal culture negative results. The results show, therefore, that (1-3) β-glucan with itraconazole promoted the case resolution, and it may be considered a promising alternative for the treatment of sporotrichosis in cases of resistance to conventional therapy.

Strain-dependent differences in sensitivity of rat beta-cells to interleukin 1 beta in vitro and in vivo

DEFF Research Database (Denmark)

Reimers, J I; Andersen, H U; Mauricio, D

1996-01-01

/kg) or vehicle for 5 days. All the strains investigated were susceptible to IL-1 beta-induced changes in body weight, food intake, temperature, and plasma glucagon and corticosterone. However, IL-1 beta induced hyperglycemia and impairment of beta-cell glucose responsiveness in WK/Mol and LS/Mol rats...

Actin depolymerization enhances adipogenic differentiation in human stromal stem cells

Directory of Open Access Journals (Sweden)

Li Chen

2018-05-01

Full Text Available Human stromal stem cells (hMSCs differentiate into adipocytes that play a role in skeletal tissue homeostasis and whole body energy metabolism. During adipocyte differentiation, hMSCs exhibit significant changes in cell morphology suggesting changes in cytoskeletal organization. Here, we examined the effect of direct modulation of actin microfilament dynamics on adipocyte differentiation. Stabilizing actin filaments in hMSCs by siRNA-mediated knock down of the two main actin depolymerizing factors (ADFs: Cofilin 1 (CFL1 and Destrin (DSTN or treating the cells by Phalloidin reduced adipocyte differentiation as evidenced by decreased number of mature adipocytes and decreased adipocyte specific gene expression (ADIPOQ, LPL, PPARG, FABP4. In contrast, disruption of actin cytoskeleton by Cytochalasin D enhanced adipocyte differentiation. Follow up studies revealed that the effects of CFL1 on adipocyte differentiation depended on the activity of LIM domain kinase 1 (LIMK1 which is the major upstream kinase of CFL1. Inhibiting LIMK by its specific chemical inhibitor LIMKi inhibited the phosphorylation of CFL1 and actin polymerization, and enhanced the adipocyte differentiation. Moreover, treating hMSCs by Cytochalasin D inhibited ERK and Smad2 signaling and this was associated with enhanced adipocyte differentiation. On the other hand, Phalloidin enhanced ERK and Smad2 signaling, but inhibited adipocyte differentiation which was rescued by ERK specific chemical inhibitor U0126. Our data provide a link between restructuring of hMSCs cytoskeleton and hMSCs lineage commitment and differentiation. Keywords: Actin cytoskeleton, Actin depolymerizing factors, Adipocyte differentiation, Human stromal stem cells

Tumour nuclear oestrogen receptor beta 1 correlates inversely with parathyroid tumour weight.

Science.gov (United States)

Haglund, Felix; Rosin, Gustaf; Nilsson, Inga-Lena; Juhlin, C Christofer; Pernow, Ylva; Norenstedt, Sophie; Dinets, Andrii; Larsson, Catharina; Hartman, Johan; Höög, Anders

2015-03-01

Primary hyperparathyroidism (PHPT) is a common endocrinopathy, frequently caused by a parathyroid adenoma, rarely by a parathyroid carcinoma that lacks effective oncological treatment. As the majority of cases are present in postmenopausal women, oestrogen signalling has been implicated in the tumourigenesis. Oestrogen receptor beta 1 (ERB1) and ERB2 have been recently identified in parathyroid adenomas, the former inducing genes coupled to tumour apoptosis. We applied immunohistochemistry and slide digitalisation to quantify nuclear ERB1 and ERB2 in 172 parathyroid adenomas, atypical adenomas and carcinomas, and ten normal parathyroid glands. All the normal parathyroid glands expressed ERB1 and ERB2. The majority of tumours expressed ERB1 (70.6%) at varying intensities, and ERB2 (96.5%) at strong intensities. Parathyroid carcinomas expressed ERB1 in three out of six cases and ERB2 in five out of six cases. The intensity of tumour nuclear ERB1 staining significantly correlated inversely with tumour weight (P=0.011), and patients whose tumours were classified as ERB1-negative had significantly greater tumour weight as well as higher serum calcium (P=0.002) and parathyroid hormone levels (P=0.003). Additionally, tumour nuclear ERB1 was not expressed differentially with respect to sex or age of the patient. Levels of tumour nuclear ERB2 did not correlate with clinical characteristics. In conclusion, decreased ERB1 immunoreactivity is associated with increased tumour weight in parathyroid adenomas. Given the previously reported correlation with tumour-suppressive signalling, selective oestrogen receptor modulation (SERMs) may play a role in the treatment of parathyroid carcinomas. Future studies of SERMs and oestrogen treatment in PHPT should consider tumour weight as a potential factor in pharmacological responsiveness. © 2015 The authors.

Immune Enhancing Activity of β-(1,3)-Glucan Isolated from Genus Agrobacterium in Bone-Marrow Derived Macrophages and Mice Splenocytes.

Science.gov (United States)

Byun, Eui-Baek; Jang, Beom-Su; Byun, Eui-Hong; Sung, Nak-Yun

2016-01-01

An effective method for activating macrophages and deriving a Th1 immune response could be used to improve the defenses of hosts. In this study, we investigated the immunomodulation effect and the related signaling mechanism of [Formula: see text]-(1,3)-glucan, isolated from the Agrobacterium species. Here, we found that [Formula: see text]-(1,3)-glucan predominantly induced the tumor necrosis factor (TNF)-[Formula: see text], interleukin (IL)-1[Formula: see text], IL-6, IL-12p70, and nitric oxide, which was dependent on mitogen-activated protein kinases (MAPK) and nuclear factor (NF)-[Formula: see text]B signaling. Additionally, [Formula: see text]-(1,3)-glucan treatment significantly up-regulated the expression of the co-stimulatory molecules CD80 and CD86, and also significantly increased the expression of iNOS and Dectin-1, which is a transmembrane protein that binds [Formula: see text]-glucan and associates with macrophage activation. Importantly, the splenic T cells co-cultured with [Formula: see text]-(1,3)-glucan-treated macrophages produced the a Th1 cytokine profile that includes high levels of IFN-[Formula: see text], but not IL-4 (Th2 cytokine), indicating that [Formula: see text]-(1,3)-glucan contributes to Th1 polarization of the immune response. Taken together, our results suggest that [Formula: see text]-(1,3)-glucan isolated from Agrobacterium species can induce macrophage activation through the MAPK and NF-[Formula: see text]B signaling pathway, as well as Th1 polarization.

Role of Cu-Mg-Al mixed oxide catalysts in lignin depolymerization in supercritical ethanol

NARCIS (Netherlands)

Huang, X.; Ceylanpinar, A.; Koranyi, T.I.; Boot, M.D.; Hensen, E.J.M.

2015-01-01

We investigate the role of Cu-Mg-Al mixed oxides in depolymerization of soda lignin in supercritical ethanol. A series of mixed oxides with varying Cu content and (Cu+Mg)/Al ratio were prepared. The optimum catalyst containing 20 wt% Cu and having a (Cu+Mg)/Al ratio of 4 yielded 36 wt% monomers

The Bistable Behaviour of Pseudomonas putida KT2440 during PHA Depolymerization under Carbon Limitation

Directory of Open Access Journals (Sweden)

Stephanie Karmann

2017-06-01

Full Text Available Poly(hydroxyalkanoates (PHAs are bacterial polyesters offering a biodegradable alternative to petrochemical plastics. The intracellular formation and degradation of PHAs is a dynamic process that strongly depends on the availability of carbon and other nutrients. Carbon excess and nitrogen limitation are considered to favor PHA accumulation, whereas carbon limitation triggers PHA depolymerization when all other essential nutrients are present in excess. We studied the population dynamics of Pseudomonas putida KT2440 at the single cell level during different physiological conditions, favoring first PHA polymerization during growth on octanoic acid, and then PHA depolymerization during carbon limitation. PHAs accumulate intracellularly in granules, and were proposed to separate preferentially together with nucleic acids, leading to two daughter cells containing approximately equal amounts of PHA. However, we could show that such P. putida KT2440 cells show bistable behavior when exposed to carbon limitation, and separate into two subpopulations: one with high and one with low PHA. This suggests an asymmetric PHA distribution during cell division under carbon limitation, which has a significant influence on our understanding of PHA mobilization.

Analysis of the levels of endotoxin and β-d-glucan in the synovial fluid of hemodialysis patients.

Science.gov (United States)

Shiota, E; Maekawa, M; Kono, T

2001-12-01

Abstract We analyzed the levels of endotoxin and β-d-glucan, which possibly induce cytokine production, in the synovial fluid of patients on long-term hemodialysis and compared the results to those in patients with osteoarthritis and rheumatoid arthritis. We studied 42 knees in 42 hemodialysis patients, 21 in 21 osteoarthritis patients, and 26 in 26 rheumatoid arthritis patients. The mean ages were 60.7, 63.2, and 59.7 years, respectively. The duration of hemodialysis in the long-term hemodialysis group averaged 14.0 years. The concentrations of endotoxin and β-d-glucan in the synovial fluid of these three groups were measured. The concentration of endotoxin was the same in the three groups. However, the concentration of β-d-glucan was significantly higher in long-term hemodialysis patients. This finding suggests that β-d-glucan may have some relation to the pathogenesis of the synovitis which exists in the hydrarthrosis of long-term hemodialysis patients.

Osmoregulated periplasmic glucans synthesis gene family of Shigella flexneri

Science.gov (United States)

Osmoregulated periplasmic glucans (OPGs) of foodborne enteropathogen Shigella flexneri were characterized. OPGs were composed of 100 percent glucose with 2-linked glucose as the most abundant residue with terminal glucose, 2-linked and 2,6-linked glucose also present in high quantities. Most dominan...

An Extracellular Cell-Attached Pullulanase Confers Branched α-Glucan Utilization in Human Gut Lactobacillus acidophilus.

Science.gov (United States)

Møller, Marie S; Goh, Yong Jun; Rasmussen, Kasper Bøwig; Cypryk, Wojciech; Celebioglu, Hasan Ufuk; Klaenhammer, Todd R; Svensson, Birte; Abou Hachem, Maher

2017-06-15

Of the few predicted extracellular glycan-active enzymes, glycoside hydrolase family 13 subfamily 14 (GH13_14) pullulanases are the most common in human gut lactobacilli. These enzymes share a unique modular organization, not observed in other bacteria, featuring a catalytic module, two starch binding modules, a domain of unknown function, and a C-terminal surface layer association protein (SLAP) domain. Here, we explore the specificity of a representative of this group of pullulanases, Lactobacillus acidophilus Pul13_14 ( La Pul13_14), and its role in branched α-glucan metabolism in the well-characterized Lactobacillus acidophilus NCFM, which is widely used as a probiotic. Growth experiments with L. acidophilus NCFM on starch-derived branched substrates revealed a preference for α-glucans with short branches of about two to three glucosyl moieties over amylopectin with longer branches. Cell-attached debranching activity was measurable in the presence of α-glucans but was repressed by glucose. The debranching activity is conferred exclusively by La Pul13_14 and is abolished in a mutant strain lacking a functional La Pul13_14 gene. Hydrolysis kinetics of recombinant La Pul13_14 confirmed the preference for short-branched α-glucan oligomers consistent with the growth data. Curiously, this enzyme displayed the highest catalytic efficiency and the lowest K m reported for a pullulanase. Inhibition kinetics revealed mixed inhibition by β-cyclodextrin, suggesting the presence of additional glucan binding sites besides the active site of the enzyme, which may contribute to the unprecedented substrate affinity. The enzyme also displays high thermostability and higher activity in the acidic pH range, reflecting adaptation to the physiologically challenging conditions in the human gut. IMPORTANCE Starch is one of the most abundant glycans in the human diet. Branched α-1,6-glucans in dietary starch and glycogen are nondegradable by human enzymes and constitute a

Probing interactions between B-glucan and bile salts at atomic detail by ¹H-¹³C NMR assays

DEFF Research Database (Denmark)

Mikkelsen, Mette Skau; Cornali, Sofia Bolvig; Jensen, Morten G

2014-01-01

Polysaccharides are prospective hosts for the delivery and sequestration of bioactive guest molecules. Polysaccharides of dietary fiber, specifically cereal (1 → 3)(1 → 4)-β-glucans, play a role in lowering the blood plasma cholesterol level in humans. Direct host-guest interactions between β...... salts and β-glucans. Experiments are consistent with stronger interactions at pH 5.3 than at pH 6.5 in this in vitro assay. The changes in bile salt and β-glucan signals suggest a stabilization of bile salt micelles and concomitant conformational changes in β-glucans....

Oral microbe-host interactions: influence of β-glucans on gene expression of inflammatory cytokines and metabolome profile.

Science.gov (United States)

Silva, Viviam de Oliveira; Pereira, Luciano José; Murata, Ramiro Mendonça

2017-03-07

The aim of this study was to evaluate the effects of β-glucan on the expression of inflammatory mediators and metabolomic profile of oral cells [keratinocytes (OBA-9) and fibroblasts (HGF-1) in a dual-chamber model] infected by Aggregatibacter actinomycetemcomitans. The periodontopathogen was applied and allowed to cross the top layer of cells (OBA-9) to reach the bottom layer of cells (HGF-1) and induce the synthesis of immune factors and cytokines in the host cells. β-glucan (10 μg/mL or 20 μg/mL) were added, and the transcriptional factors and metabolites produced were quantified in the remaining cell layers and supernatant. The relative expression of interleukin (IL)-1-α and IL-18 genes in HGF-1 decreased with 10 μg/mL or 20 μg/mL of β-glucan, where as the expression of PTGS-2 decreased only with 10 μg/mL. The expression of IL-1-α increased with 20 μg/mL and that of IL-18 increased with 10 μg/mL in OBA-9; the expression of BCL 2, EP 300, and PTGS-2 decreased with the higher dose of β-glucan. The production of the metabolite 4-aminobutyric acid presented lower concentrations under 20 μg/mL, whereas the concentrations of 2-deoxytetronic acid NIST and oxalic acid decreased at both concentrations used. Acetophenone, benzoic acid, and pinitol presented reduced concentrations only when treated with 10 μg/mL of β-glucan. Treatment with β-glucans positively modulated the immune response and production of metabolites.

Effects of dietary yeastβ-glucan on nutrient digestibility and serum proifles in pre-ruminant Holstein calves

Institute of Scientific and Technical Information of China (English)

MA Tao; TU Yan; ZHANG Nai-feng; GUO Jiang-peng; DENG Kai-dong; ZHOU Yi; YUN Qiang; DIAO Qi-yu

2015-01-01

This study aimed to investigate the effects of dietary supplementation of yeastβ-glucan on the nutrient digestibility and serum proifles in pre-ruminant Holstein calves. Forty-two neonatal Holstein calves ((39.6±4.2) kg) were randomly al otted to six groups, and each was offered one of the fol owing diets:a basal diet (control) or the basal diet supplemented with 25, 50, 75, 100 or 200 mg of yeastβ-glucan kg–1 feed (dry matter basis). The basal diet consisted of a milk replacer and a starter feed. The trial lasted for 56 d. Two digestibility trials were conducted from d 14 to 20 and from d 42 to 48. Blood samples were col ected on d 0, 14, 28 and 42 for serum proifle analyses. On d 56, three calves from each group were slaughtered, and intestinal samples were col ected to assess the vil ous height, crypt depth and mucosal thickness. Although feed intake was not affected by dietary treatment (P>0.05), the average daily gain (ADG) and gain-to-feed ratios were higher (P0.05). Compared with the control group, supplementation of yeastβ-glucan decreased (P0.05). The supplementation of yeastβ-glucan stimu-lated the enzymatic activity of alkaline phosphatase (ALP) (P<0.05) compared with the control group. The lysozyme (LYZ) concentration increased quadratical y (P<0.05) with increasing yeastβ-glucan levels. The results suggested that dietary supplementation of yeastβ-glucan at 75 mg kg–1 feed improved nutrient digestibility, enhanced immunity by increasing the immunoglobulin concentration and stimulating ALP, and exerted no adverse effects on metabolism in pre-ruminant calves.

Interactions of liposome carriers with infectious fungal hyphae reveals the role of β-glucans.

Science.gov (United States)

Chavan, Neelam L; Young, Joseph K; Drezek, Rebekah A; Lewis, Russell; Bikram, Malavosklish

2012-09-04

Relatively little is known about how liposomal formulations modulate drug delivery to fungal pathogens. We compared patterns of hyphal cell wall binding for empty rhodmine-labeled liposomes and the clinically available amphotericin B-containing liposomal formulation (AmBisome) in Aspergillus fumigatus and Candida albicans. Following 0.5 h of coincubation with A. fumigatus , empty liposomes concentrated primarily in fungal septae along at the surface of the cell wall, suggesting that liposome uptake is concentrated in areas of the cell wall where linear glucan is exposed on the cell surface, which was confirmed by aniline blue staining. Consistent with this hypothesis, pretreatment of liposomes with soluble linear glucan (laminarin) decreased liposome binding in both Aspergillus and Candida fungal hyphae, while growth of Aspergillus hyphae in the presence of an agent that increases fungal cell wall surface exposure of linear β-glucans without cell death (caspofungin) increased liposome uptake throughout the Aspergillus fungal cell wall. Increasing the polyethylene glycol (PEG) concentration in liposomes from 0 to 30% significantly increased fungal uptake of liposomes that was only modestly attenuated when fungal cells were incubated in serum concentrations ranging from 10 to 100%. The presence of β-glucans on the fungal hyphae cell walls of Aspergillus fumigatus is one of the factors responsible for mediating the binding of liposome carriers to the hyphae and could explain possible synergy reported between liposomal amphotericin B and echinocanins.

Lentinan: hematopoietic, immunological, and efficacy studies in a syngeneic model of acute myeloid leukemia.

Science.gov (United States)

McCormack, Emmet; Skavland, Jørn; Mujic, Maja; Bruserud, Øystein; Gjertsen, Bjørn Tore

2010-01-01

Lentinan, a beta-glucan nutritional supplement isolated from the shitake mushroom (Lentula edodes), is a biological response modifier with immunostimulatory properties. Concomitantly, the role of beta-glucans as chemoimmunotherapeutic in a number of solid cancers has been widely documented. We investigated the effects of nutritional grade lentinan upon BN rats and in a preclinical syngeneic model of acute myeloid leukemia. BN rats supplemented daily with lentinan exhibited weight gains, increased white blood cells, monocytes, and circulating cytotoxic T-cells; and had a reduction in anti-inflammatory cytokines IL-4, IL-10, and additionally IL-6. Lentinan treatment of BN rats with BNML leukemia resulted in improved cage-side health and reduced cachexia in the terminal stage of this aggressive disease. Combination of lentinan with standards of care in acute myeloid leukemia, idarubicin, and cytarabine increased average survival compared with monotherapy and reduced cachexia. These results indicate that nutritional supplementation of cancer patients with lentinan should be further investigated.

Towards a more versatile alpha-glucan biosynthesis in plants

NARCIS (Netherlands)

Kok-Jacon, G.A.; Qin, J.; Vincken, J.P.; Visser, R.G.F.

2003-01-01

Starch is an important storage polysaccharide in many plants. It is composed of densely packed alpha-glucans, consisting of 1,4- and 1,4,6-linked glucose residues. The starch polymers are used in many industrial applications. The biosynthetic machinery for assembling the granule has been manipulated

Peracetic Acid Depolymerization of Biorefinery Lignin for Production of Selective Monomeric Phenolic Compounds.

Science.gov (United States)

Ma, Ruoshui; Guo, Mond; Lin, Kuan-Ting; Hebert, Vincent R; Zhang, Jinwen; Wolcott, Michael P; Quintero, Melissa; Ramasamy, Karthikeyan K; Chen, Xiaowen; Zhang, Xiao

2016-07-25

Lignin is the largest source of renewable material with an aromatic skeleton. However, due to the recalcitrant and heterogeneous nature of the lignin polymer, it has been a challenge to effectively depolymerize lignin and produce high-value chemicals with high selectivity. In this study, a highly efficient lignin-to-monomeric phenolic compounds (MPC) conversion method based on peracetic acid (PAA) treatment was reported. PAA treatment of two biorefinery lignin samples, diluted acid pretreated corn stover lignin (DACSL) and steam exploded spruce lignin (SESPL), led to complete solubilization and production of selective hydroxylated monomeric phenolic compounds (MPC-H) and monomeric phenolic acid compounds (MPC-A) including 4-hydroxy-2-methoxyphenol, p-hydroxybenzoic acid, vanillic acid, syringic acid, and 3,4-dihydroxybenzoic acid. The maximized MPC yields obtained were 18 and 22 % based on the initial weight of the lignin in SESPL and DACSL, respectively. However, we found that the addition of niobium pentoxide catalyst to PAA treatment of lignin can significantly improve the MPC yields up to 47 %. The key reaction steps and main mechanisms involved in this new lignin-to-MPC valorization pathway were investigated and elucidated. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

(1→3)-β-D-Glucan Assay in Monitoring Response to Anti-Fungal Therapy in Fungal Endocarditis.

Science.gov (United States)

Slim, Jihad; Saling, Christopher; Szabela, Maria; Brown, Melinda; Johnson, Tamara; Goldfarb, Irvin

2017-03-01

A case is reported of Candida glabrata infective endocarditis (IE) treated without surgical intervention. The study aim was to: (i) briefly discuss the outcomes of other documented cases of fungal IE managed medically with fluconazole; (ii) discuss the (1→3)-β-D-glucan assay and its previously studied role in the diagnosis of invasive fungal infections; and (iii) examine a possible application of the (1→3)-β-D-glucan assay to monitor response to antifungal treatment in patients with Candida endocarditis. The serum Fungitell assay was used to trend (1→3)-β-D-glucan in a patient with Candida endocarditis to determine treatment effectiveness with fluconazole, to provide an appropriate end date for antifungal therapy, and to survey infection suppression while off treatment. The (1→03)-β-D-glucan assay began trending downwards at 197 days into treatment with oral fluconazole. After 16 months of therapy, fluconazole was stopped due to transaminitis. (1→3)-β-Dglucan levels were checked six weeks after the discontinuation of treatment and were negative. The patient has now been off therapy for 21 weeks with no signs of clinical disease, and values remain negative. The present case indicates that a trending (1→3)-β-D-glucan assay may have valuable application in monitoring treatment response and infection suppression for Candida endocarditis.

Hypoglycemic activity of polysaccharide fractions containing ß-glucans from extracts of Rhynchelytrum repens (Willd. C.E. Hubb., Poaceae

Directory of Open Access Journals (Sweden)

A.C.C.F.F. De Paula

2005-06-01

Full Text Available ß-Glucans are soluble fibers with physiological functions, such as interference with absorption of sugars and reduction of serum lipid levels. The objective of the present study was to analyze the distribution of ß-glucans in different tissues of the African grass species Rhynchelytrum repens and also to evaluate their hypoglycemic activity. Leaf blades, sheaths, stems, and young leaves of R. repens were submitted to extraction with 4 M KOH. Analysis of the fractions revealed the presence of arabinose, glucose, xylose, and traces of rhamnose and galactose. The presence of ß-glucan in these fractions was confirmed by hydrolyzing the polymers with endo-ß-glucanase from Bacillus subtilis, followed by HPLC analysis of the characteristic oligosaccharides produced. The 4 M KOH fractions from different tissues were subjected to gel permeation chromatography on Sepharose 4B, with separation of polysaccharides with different degrees of polymerization, the highest molecular mass (above 2000 kDa being found in young leaves. The molecular mass of the leaf blade polymers was similar (250 kDa to that of maize coleoptile ß-glucan used for comparison. The 4 M KOH fraction injected into rats with streptozotocin-induced diabetes showed hypoglycemic activity, reducing blood sugar to normal levels for approximately 24 h. This performance was better than that obtained with pure ß-glucan from barley, which decreased blood sugar levels for about 4 h. These results suggest that the activity of ß-glucans from R. repens is responsible for the use of this plant extract as a hypoglycemic drug in folk medicine.

Determinants of house dust, endotoxin, and β-(1→3)-d-glucan in homes of Danish children

DEFF Research Database (Denmark)

Holst, Gitte Juel; Høst, Arne; Doekes, G

2015-01-01

Little is known about the geographic variation and determinants of bacterial endotoxin and β -(1,3)-d-glucan in Danish house dust. In a population of 317 children, we: (i) described loads and concentrations of floor dust, endotoxin, and β-(1→3)-d-glucan and (ii) their correlations and (iii......) assessed their determinants; (iv) Finally, we compared our findings with previous European studies. Bedroom floor dust was analyzed for endotoxin content by the kinetic limulus amoebocyte lysate assay and for β-(1→3)-d-glucan by the inhibition enzyme immunoassay. The parents answered questions regarding...... potential determinants. We found: geometric means (geometric standard deviations) 186 mg/m(2) (4.3) for dust; 5.46 × 10(3) EU/m(2) (8.0) and 31.1 × 10(3) EU/g (2.6) for endotoxin; and 142 μg/m(2) (14.3) and 0.71 × 10(3) μg/g (7.3) for β-(1→3)-d-glucan. High correlations (r > 0.75) were found between floor...

[Biological contamination in office buildings related to ventilation/air conditioning system].

Science.gov (United States)

Bródka, Karolina; Sowiak, Małgorzata; Kozajda, Anna; Cyprowski, Marcin; Irena, Szadkowska-Stańczyk

2012-01-01

Indoor air is contaminated with microorganisms coming from both the atmospheric air and sources present in premises. The aim of this study was to analyze the concentrations of biological agents in office buildings, dependending on ventilation/air conditioning system and season. The study covered office buildings (different in the system of ventila-tion/air conditioning). Air samples for assessing the levels of inhalable dust, endotoxins and (1-->3)-beta-D-glucans, were taken at the selected stationary points of each building during summer and winter. The air was sampled for 6 h, using portable sets consisting of the GilAir 5 pump and the head filled with a filter of fiber glass. The samples for the presence of airborne bacteria and fungi were collected twice during the day using the impaction method. Average concentrations of inhalable dust, bacteria, fungi, endotoxins and (1-->3)-beta-D-glucans in office premises were 0.09 mg/m3, 6.00 x 10(2) cfu/m3, 4.59 x 10(1) cfu/m3, 0.42 ng/m3 and 3.91 ng/m3, respectively. Higher concentrations of the investigated agents were found in summer. In premises with air conditioning concentrations of airborne fungi, (1-->3)-beta-D-glucans and inhalable dust were significantly lower in winter. In summer the trend was reverse except for (1-->3)-beta-D-glucans. Concentrations of biological agents were affected by the season and the presence of air conditioning. Concentrations of inhalable dust, bacteria, fungi, endotoxins and (1-->3)-beta-D-glucans, observed inside the office buildings, were significantly higher in summer than in winter. The presence of the air conditioning system modified in various ways the levels of biological agents. Its influence was greater on the concentration of fungi and (1-->3)-beta-D-glucans than on that of bacteria and endotoxins.

Allergens and β-Glucans in Dutch Homes and Schools: Characterizing Airborne Levels

Science.gov (United States)

Krop, Esmeralda J. M.; Jacobs, José H.; Sander, Ingrid; Raulf-Heimsoth, Monika; Heederik, Dick J. J.

2014-01-01

Background Indoor air quality has an effect on respiratory health. Children are more vulnerable to a decreased indoor air quality as their lungs are still developing. We measured levels of allergens and β-(1,3)-glucans in 19 school buildings and determined whether measured levels could be reproduced. School levels were compared to those in 169 homes and the effect of building characteristics on both home and school exposure was explored. Methods Electrostatic Dust fall Collectors were placed in school buildings for 8 weeks and in homes for 2 weeks to collect settled airborne dust. Cat, dog, and mouse allergen levels, domestic mite antigen levels and β-(1,3)-glucans were measured in the extracts from the collectors. Results were corrected for sampling duration. Using questionnaire data, relations between measured levels and building and classroom characteristics were explored. Results In schools, exposure levels were highest in classrooms and were influenced by the socioeconomic status of the children, the season measurements were performed, moisture status of the building and pet ownership. Repeated measurements in different seasons and over the years showed significantly different levels. Home exposure was influenced by socioeconomic status, occupancy and pet ownership. Domestic mite antigen was found in higher levels in extracts from homes compared to schools while pet allergen levels were 13 times higher in schools compared to homes without pets. For mouse allergen overall levels of exposure were low but still two times higher in schools compared to homes. Levels of β-(1,3)-glucans were also approximately two times higher in schools than in homes. Conclusion Exposure levels of several allergens and β-(1,3)-glucans in schools differ over time and are higher than in homes. For children, exposure levels measured at school could contribute to their total exposure as especially animal allergen levels can be much higher in schools compared to homes. PMID:24551183

Plasma beta-endorphin levels in obese and non-obese patients with polycystic ovary disease.

Science.gov (United States)

Martínez-Guisasola, J; Guerrero, M; Alonso, F; Díaz, F; Cordero, J; Ferrer, J

2001-02-01

The aim of this study was to determine the influence of body weight on circulating plasma levels of beta-endorphin and insulin in women with polycystic ovary disease (PCOD), as well as the correlation between the plasma levels of beta-endorphin and insulin. One-hundred and sixty-seven consecutive subjects with PCOD were recruited, 117 of whom had normal weight (body mass index (BMI) 25). A venous blood sample was taken and plasma concentrations of beta-endorphin, insulin, gonadotropins, prolactin, progesterone, 17 beta-estradiol, estrone, androgens, dehydroepiandrosterone sulfate and sex hormone-binding globulin (SHBG) were measured. Mean beta-endorphin and insulin plasma levels were significantly higher (p PCOD women than in non-obese ones. Correlation analysis showed a positive association between insulin and beta-endorphin, beta-endorphin and BMI (and weight), insulin and BMI (and weight), and a negative correlation was found between insulin and SHBG. A weak association was found between beta-endorphin and luteinizing hormone (LH) in peripheral plasma. Stratified and linear regression analysis showed that plasma beta-endorphin concentrations correlate more with BMI than with insulinemia.

Structural analysis of bioengineered alpha-D-glucan produced by a triple mutant of the glucansucrase GTF180 enzyme from Lactobacillus reuteri strain 180 : Generation of (alpha 1 -> 4) linkages in a native (1 -> 3)(1 -> 6)-alpha-D-glucan

NARCIS (Netherlands)

van Leeuwen, Sander S.; Kralj, Slavko; Gerwig, Gerrit J.; Dijkhuizen, Lubbert; Kamerling, Johannis P.

Site-directed mutagenesis of the glucansucrase gtf180 gene from Lactobacillus reuteri strain 180 was used to transform the active site region. The alpha-D-glucan (mEPS-PNNS) produced by the triple mutant V1027P:S1137N: A1139S differed in structure from that of the wild-type alpha-D-glucan (EPS180).

Temperature effects on protein depolymerization and amino acid immobilization rates in soils.

Science.gov (United States)

Noll, Lisa; Hu, Yuntao; Zhang, Shasha; Zheng, Qing; Wanek, Wolfgang

2017-04-01

Increasing N deposition, land use change, elevated atmospheric CO2 concentrations and global warming have altered soil nitrogen (N) cycling during the last decades. Those changes affected ecosystem services, such as C and N sequestration in soils, which calls for a better understanding of soil N transformation processes. The cleavage of macromolecular organic N by extracellular enzymes maintains an ongoing flow of new bioavailable organic N into biotic systems and is considered to be the bottle neck of terrestrial N cycling in litter and soils. Recent studies showed that protein depolymerization is susceptible to changes in C and N availabilities. Based on general biological observations the temperature sensitivity of soil organic N processes is expected to depend on whether they are rather enzyme limited (i.e. Q10=2) or diffusion limited (i.e. Q10= 1.0 - 1.3). However, temperature sensitivities of protein depolymerization and amino acid immobilization are still unknown. We therefore here report short-term temperature effects on organic N transformation rates in soils differing in physicochemical parameters but not in climate. Soil samples were collected from two geologically distinct sites close to the LFZ Raumberg-Gumpenstein, Styria, Austria, each from three different management types (arable land, grassland, forest). Four replicates of mineral soil were taken from every site and management type. The area provides a unique opportunity to study geological and management controls in soils without confounding effects of climate and elevation. The soils differ in several soil chemical parameters, such as soil pH, base saturation, soil C: N ratio and SOM content as well as in soil physical parameters, such as soil texture, bulk density and water holding capacity. Soils were pre-incubated at 5, 15 and 25˚ C for one day. Protein depolymerization rates and amino acid immobilization rates were assessed by an isotope pool dilution assay with 15N labeled amino acids at

Computational Study of the Binding Mechanism of Actin-Depolymerizing Factor 1 with Actin in Arabidopsis thaliana.

Directory of Open Access Journals (Sweden)

Juan Du

Full Text Available Actin is a highly conserved protein. It plays important roles in cellular function and exists either in the monomeric (G-actin or polymeric form (F-actin. Members of the actin-depolymerizing factor (ADF/cofilin protein family bind to both G-actin and F-actin and play vital roles in actin dynamics by manipulating the rates of filament polymerization and depolymerization. It has been reported that the S6D and R98A/K100A mutants of actin-depolymerizing factor 1 (ADF1 in Arabidopsis thaliana decreased the binding affinity of ADF for the actin monomer. To investigate the binding mechanism and dynamic behavior of the ADF1-actin complex, we constructed a homology model of the AtADF1-actin complex based on the crystal structure of AtADF1 and the twinfilin C-terminal ADF-H domain in a complex with a mouse actin monomer. The model was then refined for subsequent molecular dynamics simulations. Increased binding energy of the mutated system was observed using the Molecular Mechanics Generalized Born Surface Area and Poisson-Boltzmann Surface Area (MM-GB/PBSA methods. To determine the residues that make decisive contributions to the ADF1 actin-binding affinity, per-residue decomposition and computational alanine scanning analyses were performed, which provided more detailed information on the binding mechanism. Root-mean-square fluctuation and principal component analyses confirmed that the S6D and R98A/K100A mutants induced an increased conformational flexibility. The comprehensive molecular insight gained from this study is of great importance for understanding the binding mechanism of ADF1 and G-actin.

Evaluation of follow-up of therapy with fenbendazole incorporated into stabilized liposomes and immunomodulator glucan in mice infected with Toxocara canis larvae.

Science.gov (United States)

Hrckova, G; Velebný, S; Obwaller, A; Auer, H; Kogan, G

2007-01-01

Anthelmintic activity of benzimidazole carbamate anthelmintics is low against dormant Toxocara canis larvae during late infections in paratenic hosts. The present study was conducted to examine the efficacy of pure fenbendazole, or drug incorporated into sterically stabilized liposomes (SL-FBZ) administered to T. canis-infected mice alone and after its co-administration with the immunomodulator (1-->3)-beta-D-glucan against larvae localized in muscles and brains. Therapy with either drug forms (in total 250 mg/kg in 10 doses) commenced on day 28 post-infection (p.i.) and the efficacy of treatment, examined on day 30 after the last dose of drug, was the highest in groups of mice treated with SL-FBZ in combination with glucan (89.5+/-5.8% in the muscles, 66.1+/-8.1% in brains). During 56 days of follow-up after termination of therapy, serum levels of anti-TES IgG antibodies, circulating IgG-TES immune complexes (CIC) as well as IgG antibodies to the most immunogenic part of recombinant myosin antigen of T. canis larvae were investigated. In contrast to anti-TES IgG antibodies, levels of CIC and anti-myosin antibodies were in the linear correlation with the efficacy of treatments beginning from day 38 post-therapy. We also showed that the serum levels of CIC as well as anti-myosin IgG antibodies seem to be the suitable serological markers for the monitoring of progress in larval destruction and TES resorption from the tissues.

Toxicological Assessment of β-(1à6-Glucan (Lasiodiplodan in Mice during a 28-Day Feeding Study by Gavage

Directory of Open Access Journals (Sweden)

Janaína A. Túrmina

2012-12-01

Full Text Available Studies evaluating the toxicity caused by fungal exopolysaccharides of the β-(1®6-D-glucan type are rare. In this study, the toxicological effects of sub-chronic treatments with lasiodiplodan (β-(1®6-D-glucan from Lasiodiplodia theobromae MMPI were evaluated in mice through the assessment of biochemical, hematological, and histopathological alterations. Thirty-two mice (16 male, 16 female were used in this study divided in two groups; one group received lasiodiplodan (50 mg/kg body weight daily for 28 days via gavage, and another (control group received saline during the same period. Blood samples were collected via cardiac puncture for hematological and biochemical analyses. Liver, heart, kidney, and spleen were collected for histopathological analysis. Statistical analysis was performed through one-way analysis of variance and only p < 0.05 F-values were presented. Significant reduction in blood glucose in the male group (35%; p < 0.01, transaminases activity in both sexes (AST and ALT; ~35%; p < 0.05, and urea (20%; p < 0.01 in the female group was observed with the lasiodiplodan treatment. The results showed that sub-chronic treatments with lasiodiplodan did not generate hematological and histopathological alterations leading to signs of toxicity in healthy mice, independent of gender.

Protein synthesis in skeletal muscle of neonatal pigs is enhanced by administration of Beta-hydroxy-Beta-methylbutyrate

Science.gov (United States)

Many low-birth-weight infants experience failure to thrive. The amino acid leucine stimulates protein synthesis in skeletal muscle of the neonate, but less is known about the effects of the leucine metabolite Beta-hydroxy-Beta-methylbutyrate (HMB). To determine the effects of HMB on protein synthesi...

Lactose in diet influences the degradation of mixed linked β(1-3;1-4)-D-glucan in the small intestine of pigs

DEFF Research Database (Denmark)

Knudsen, Knud Erik Bach

The objective of the current study was to investigate if lactose in diet would influence the degradation of mixed linked β(1–3;1–4)-D-glucan (β-glucan) in the small intestine. Β-glucan is an important cell wall (dietary fiber, DF) component of the endosperm of barley and oats. The digestibility...... of β-glucan in the small intestine from both cereals is among the highest of all DF components, but in one particular study with oat-based diets it was significantly lower than what was found in other studies. In this study whey protein containing lactose was used as protein supplement. Lactose...... is slowly digestible in the small intestine. To investigate if lactose could be causative for the lower digestibility of β-glucan in the study with whey protein, it was decided to quantify the content of lactose in the diets and to analyze for lactose in digesta samples from the small intestine (the small...

Dietary calcium phosphate content and oat β-glucan influence gastrointestinal microbiota, butyrate-producing bacteria and butyrate fermentation in weaned pigs.

Science.gov (United States)

Metzler-Zebeli, Barbara U; Zijlstra, Ruurd T; Mosenthin, Rainer; Gänzle, Michael G

2011-03-01

This study aimed to evaluate the effects of oat β-glucan in combination with low- and high-dietary calcium phosphate (CaP) content on gastrointestinal bacterial microbiota, prevalence of butyrate-production pathway genes and fermentation end-products in 32 weaned pigs allocated to four diets: a cornstarch-casein-based diet with low [65% of the calcium (Ca) and phosphorous (P) requirement] and high CaP content (125% and 115% of the Ca and P requirement, respectively); and low and high CaP diets supplemented with 8.95% of oat β-glucan concentrate. Pigs were slaughtered after 14 days, and digesta were collected for quantitative PCR analysis, and quantification of short-chain fatty acids and lactate. The high CaP content reduced gastric lactate and streptococci and propionate in the large intestine. Oat β-glucan distinctly raised gastric bacterial numbers, and colonic lactobacilli and bifidobacteria. Although not reflected by gene copies of butyrate-production pathway genes, oat β-glucan also increased gastric, caecal and colonic butyrate concentrations, which may be favourable for intestinal development in weaned pigs. Thus, a high CaP content negatively affected the intestinal abundance of certain fermentation end-products, whereas oat β-glucan generally enhanced bacterial numbers and activity. The results emphasize the importance of the stomach for bacterial metabolism of oat β-glucan in weaned pigs. © 2010 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.

Yeast β-1,6-glucan is a primary target for the Saccharomyces cerevisiae K2 toxin.

Science.gov (United States)

Lukša, Juliana; Podoliankaitė, Monika; Vepštaitė, Iglė; Strazdaitė-Žielienė, Živilė; Urbonavičius, Jaunius; Servienė, Elena

2015-04-01

Certain Saccharomyces cerevisiae strains secrete different killer proteins of double-stranded-RNA origin. These proteins confer a growth advantage to their host by increasing its survival. K2 toxin affects the target cell by binding to the cell surface, disrupting the plasma membrane integrity, and inducing ion leakage. In this study, we determined that K2 toxin saturates the yeast cell surface receptors in 10 min. The apparent amount of K2 toxin, bound to a single cell of wild type yeast under saturating conditions, was estimated to be 435 to 460 molecules. It was found that an increased level of β-1,6-glucan directly correlates with the number of toxin molecules bound, thereby impacting the morphology and determining the fate of the yeast cell. We observed that the binding of K2 toxin to the yeast surface receptors proceeds in a similar manner as in case of the related K1 killer protein. It was demonstrated that the externally supplied pustulan, a poly-β-1,6-glucan, but not the glucans bearing other linkage types (such as laminarin, chitin, and pullulan) efficiently inhibits the K2 toxin killing activity. In addition, the analysis of toxin binding to the intact cells and spheroplasts confirmed that majority of K2 protein molecules attach to the β-1,6-glucan, rather than the plasma membrane-localized receptors. Taken together, our results reveal that β-1,6-glucan is a primary target of K2 toxin and is important for the execution of its killing property. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

Microtubule disruption induced in vivo by alkylation of beta-tubulin by 1-aryl-3-(2-chloroethyl)ureas, a novel class of soft alkylating agents.

Science.gov (United States)

Legault, J; Gaulin, J F; Mounetou, E; Bolduc, S; Lacroix, J; Poyet, P; Gaudreault, R C

2000-02-15

We have previously reported that 4-tert-butyl-[3-(2-chloroethyl)ureido] benzene (4-tBCEU), a potent cytotoxic agent, modulates the synthesis of tubulins, suggesting that its cytotoxicity may be mediated through an antimicrotubule mechanism. Indeed, 4-tBCEU and its 4-iso-propyl (4-isopropyl [3-(2-chloroethyl)ureido] benzene) and 4-sec-butyl (4-sec-butyl [3-(2-chloroethyl)ureido] benzene) homologues induced disruption of the cytoskeleton and arrest of the cell cycle in G2 transition and mitosis. To better understand the mechanisms responsible for microtubule disruption by 1-aryl-3-(2-chloroethyl)ureas (CEU), we first examined their cytotoxicity on Chinese hamster ovary cells resistant to vinblastine and colchicine due to the expression of mutated tubulins (CHO-VV 3-2). These cells showed resistance to CEU, e.g., 4-tBCEU having an IC50 of 21.3+/-1.1 microM as compared with an IC50 of 11.6+/-0.7 microM for wild-type cells, suggesting a direct effect of the drugs on tubulins. Western blot analysis confirmed the disruption of microtubules and evidenced the formation of an additional immunoreactive beta-tubulin with an apparent lower molecular weight on SDS polyacrylamide gel. Incubation of MDA-MB-231 cells with [urea-14C]-4-tBCEU revealed the presence of a radioactive protein that coincided with the additional beta-tubulin band, indicating that CEU could covalently bind to the beta-tubulin. The 4-tBCEU-binding site on beta-tubulin was identified by competition of the CEU with colchicine, vinblastine, and iodoacetamide, a specific alkylating agent of sulfhydryl groups of cysteine residues. Colchicine, but not vinblastine, prevented the formation of the additional beta-tubulin band, suggesting that 4-tBCEU alkylates either Cys239 or Cys354 residues near the colchicine-binding site. To determine the cysteine residue alkylated by 4-tBCEU, we incubated the radiolabeled drug with human neuroblastoma cells (SK-N-SH) that overexpress the betaIII-tubulin, an isoform where Cys239

Synthesis of New Hyperbranched α-Glucans from Sucrose by Lactobacillus reuteri 180 Glucansucrase Mutants.

Science.gov (United States)

Meng, Xiangfeng; Dobruchowska, Justyna M; Pijning, Tjaard; Gerwig, Gerrit J; Dijkhuizen, Lubbert

2016-01-20

α-Glucans produced by glucansucrase enzymes of lactic acid bacteria attract strong attention as novel ingredients and functional biopolymers in the food industry. In the present study, α-helix 4 amino acid residues D1085, R1088, and N1089 of glucansucrase GTF180 of Lactobacillus reuteri 180 were targeted for mutagenesis both jointly and separately. Analysis of the mutational effects on enzyme function revealed that all D1085 and R1088 mutants catalyzed the synthesis of hyperbranched α-glucans with 15-22% branching (α1→3,6) linkages, compared to 13% in the wild-type GTF180. In addition, besides native (α1→6) and (α1→3) linkages, all of the mutations introduced a small amount of (α1→4) linkages (5% at most) in the polysaccharides produced. We conclude that α-helix 4 residues, especially D1085 and R1088, constituting part of the +2 acceptor binding subsite, are important determinants for the linkage specificity. The new hyperbranched α-glucans provide very interesting structural diversities and may find applications in the food industry.

Depolymerization of cellulose into high-value chemicals by using synergy of zinc chloride hydrate and sulfate ion promoted titania catalyst.

Science.gov (United States)

Wei, Weiqi; Wu, Shubin

2017-10-01

Experiments for cellulose depolymerization by synergy of zinc chloride hydrate (ZnCl 2 ·RH 2 O) and sulfated titania catalyst (SO 4 2- /TiO 2 ) were investigated in this study. The results showed the introduction of sulfate into the TiO 2 significantly enhanced the catalyst acid amount, especially for Brønsted acid site, which is beneficial for subsequent cellulose depolymerization. ZnCl 2 ·RH 2 O hydrate, only a narrow composition range of water, specifically 3.0≤R≤4.0, can dissolve cellulose, which finally resulted the cellulose with low crystallinity and weak intrachain and interchain hydrogen bond network. Coupling of ZnCl 2 ·RH 2 O hydrate and SO 4 2- /TiO 2 catalyst as a mixed reaction system promoted cellulose depolymerization, and the products can be adjusted by the control of reaction conditions, the low temperature (80-100°C) seemed beneficial for glucose formation (maximal yield 50.5%), and the high temperature (120-140°C) favored to produce levulinic acid (maximal yield 43.1%). Besides, the addition of organic co-solvent making HMF as the main product (maximal yield 38.3%). Copyright © 2017 Elsevier Ltd. All rights reserved.

In vivo evaluation of the antimutagenic and antigenotoxic effects of β-glucan extracted from Saccharomyces cerevisiae in acute treatment with multiple doses

Directory of Open Access Journals (Sweden)

Rodrigo Juliano Oliveira

2013-01-01

Full Text Available Ample evidence suggests that cancer is triggered by mutagenic damage and diets or supplements capable of reducing such incidences can be related to the prevention of neoplasy development or to an improvement in life quality of patients who undergo chemotherapy. This research aimed to evaluate the antimutagenic and antigenotoxic activity of β-glucan. We set up 8 experimental groups: control (Group 1, cyclophosphamide (Group 2, Groups 3-5 to assess the effect of β-glucan administration, and Groups 6-8 to evaluate the association between cyclophosphamide and β-glucan. The intraperitonial concentrations of β-glucan used were 100, 150 and 200 mg/kg. Micronucleus and comet assays showed that within the first week of treatment β-glucan presented a damage reduction rate between 100-62.04% and 94.34-59.52% for mutagenic and genotoxic damages, respectively. This activity decreased as the treatment was extended. During the sixth week of treatment antimutagenicity rates were reduced to 59.51-39.83% and antigenotoxicity was not effective. This leads to the conclusion that the efficacy of β-glucan in preventing DNA damage is limited when treatment is extended, and that its use as a chemotherapeutic adjuvant need to be better clarified.

β-1,6-glucan synthesis-associated genes are required for proper spore wall formation in Saccharomyces cerevisiae.

Science.gov (United States)

Pan, Hua-Ping; Wang, Ning; Tachikawa, Hiroyuki; Nakanishi, Hideki; Gao, Xiao-Dong

2017-11-01

The yeast spore wall is an excellent model to study the assembly of an extracellular macromolecule structure. In the present study, mutants defective in β-1,6-glucan synthesis, including kre1∆, kre6∆, kre9∆ and big1∆, were sporulated to analyse the effect of β-1,6-glucan defects on the spore wall. Except for kre6∆, these mutant spores were sensitive to treatment with ether, suggesting that the mutations perturb the integrity of the spore wall. Morphologically, the mutant spores were indistinguishable from wild-type spores. They lacked significant sporulation defects partly because the chitosan layer, which covers the glucan layer, compensated for the damage. The proof for this model was obtained from the effect of the additional deletion of CHS3 that resulted in the absence of the chitosan layer. Among the double mutants, the most severe spore wall deficiency was observed in big1∆ spores. The majority of the big1∆chs3∆ mutants failed to form visible spores at a higher temperature. Given that the big1∆ mutation caused a failure to attach a GPI-anchored reporter, Cwp2-GFP, to the spore wall, β-1,6-glucan is involved in tethering of GPI-anchored proteins in the spore wall as well as in the vegetative cell wall. Thus, β-1,6-glucan is required for proper organization of the spore wall. Copyright © 2017 John Wiley & Sons, Ltd. Copyright © 2017 John Wiley & Sons, Ltd.

Depolymerization of organosolv lignin using doped porous metal oxides in supercritical methanol

DEFF Research Database (Denmark)

Warner, Genoa; Hansen, Thomas Søndergaard; Riisager, Anders

2014-01-01

conversion to methanol-soluble products, without char formation, were based on copper in combination with other dopants based on relatively earth-abundant metals. Nearly complete conversion of lignin to bio-oil composed of monomers and low-mass oligomers with high aromatic content was obtained in 6. h at 310......An isolated, solvent-extracted lignin from candlenut (Aleurites moluccana) biomass was subjected to catalytic depolymerization in the presence of supercritical methanol, using a range of porous metal oxides derived from hydrotalcite-like precursors. The most effective catalysts in terms of lignin...

Identification of UDPG-binding polypeptides and purified (1,3)-β-glucan synthase by photoaffinity labelling with 5-azido-UDPG

International Nuclear Information System (INIS)

Frost, D.J.; Wu, A.; Read, S.M.; Wasserman, B.P.; Drake, R.R.; Haley, B.E.

1989-01-01

The photoaffinity probe 5-azido-uridine 5'-β-[ 32 P]-diphosphate glucose was used to identify the major UDPG-binding polypeptide of red beet (1,3)-β-glucan synthase. Glucan synthase was purified from plasma membranes by sequential solubilization with CHAPS followed by product entrapment. Two major polypeptides at 72 and 54 kD were labelled by probe. Labelling of both was abolished with increasing levels of cold UDPG. However, labelling of the 54 kD polypeptide was dependent upon the presence of divalent cations. These data suggest that the 54 kD polypeptide is a substrate-binding and cation-regulated component of the glucan synthase complex

Advanced Model Compounds for Understanding Acid-Catalyzed Lignin Depolymerization : Identification of Renewable Aromatics and a Lignin-Derived Solvent

NARCIS (Netherlands)

Lahive, Ciaran W; Deuss, Peter J; Lancefield, Christopher S; Sun, Zhuohua; Cordes, David B; Young, Claire; Tran, Fanny; Slawin, Alexandra M Z; de Vries, Johannes G; Kamer, Paul C J; Westwood, Nicholas J; Barta, Katalin

2016-01-01

The development of fundamentally new approaches for lignin depolymerization is challenged by the complexity of this aromatic biopolymer. While overly simplified model compounds often lack relevance to the chemistry of lignin, the direct use of lignin streams poses significant analytical challenges

Experimental and Kinetic Study on Lignin Depolymerization in Water/Formic Acid System

Directory of Open Access Journals (Sweden)

Qi Wang

2017-10-01

Full Text Available Microwave-assisted depolymerization of black-liquor lignin in formic acid was studied, concentrating on the yield of liquid fractions as bio-oil 1 (mainly aromatic monomers and bio-oil 2 (mainly aromatic oligomers and the distribution of the specific compositions. Bio-oil 1 (9.69% and bio-oil 2 (54.39% achieved their maximum yields under 160 °C with the reaction time of 30 min. The chemical compositions of bio-oil 1 and bio-oil 2 were respectively identified by means of Gas Chromatography-Mass Spectrometer (GC-MS and Matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS. Ethanone, 1-(4-hydroxy-3-methoxyphenyl and Ethanone, 1-(4-hydrox-3,5-dimethoxyphenyl were evidenced to be the two prominent compounds in bio-oil 1. Production of aromatic oligomers with the molecular weight of 328, 342, 358, 378, 394, 424 and 454 identified by MALDI-TOF MS was substantially tuned with the reaction temperature. A two-separate-stage kinetic model was proposed to describe the acidic solvolysis of lignin assisted by microwave heating, where the first stage is dominated by the depolyerization of lignin to monomers and oligomers with the activation energy of 40.27 kJ·mol−1, and the second stage with the activation energy of 49.18 kJ·mol−1 is mainly ascribed to the repolymerization of first-stage produced compounds.

Dunkl generalization of Szász beta-type operators

Science.gov (United States)

Çekim, Bayram; Dinlemez Kantar, Ülkü; Yüksel, İsmet

2017-12-01

The goal in the paper is to advertise Dunkl extension of Szasz beta type operators. We initiate approximation features via acknowledged Korovkin and weighted Korovkin theorem and obtain the convergence rate from the point of modulus of continuity, second order modulus of continuity, the Lipschitz class functions, Peetre's K-functional and modulus of weighted continuity by Dunkl generalization of Szasz beta type operators.

Extraction and chemical characterization of rye arabinoxylan and the effect of β-glucan on the mechanical and barrier properties of cast arabinoxylan films

DEFF Research Database (Denmark)

Sárossy, Zsuzsa; Tenkanen, Maija; Pitkänen, Leena

2013-01-01

.9 and 1.0 cm3 mm/m2 d kPa). However, the water vapor permeability increased with addition of increasing amounts of BG to WE-AX. To our knowledge, this is the first study on the effect of β-glucans on the material and permeability properties of arabinoxylan-based films. © 2012 Elsevier Ltd. All rights......Water-extractable hemicellulose (WEH) fractions, containing approximately 65% arabinoxylans (WE-AX) and 20% mixed-linkage b-glucans were isolated from rye bran. In addition, water-extractable mixedlinkage β-glucans (BG) were isolated from oat bran as a reference material. The β-glucan content....../mol. The material properties of films prepared from the rye hemicellulose isolate and WE-AX as such, or with varying amounts of added BG (20:80; 50:50; 80:20 ratios) were studied. Prior removal of β-glucan from the isolate decreased the tensile strength of the films significantly as well as the elongation at break...

Probing the structure of glucan lyases – the lytic members of GH31 - by sequence analysis, circular dichroism and proteolysis

DEFF Research Database (Denmark)

Ernst, Heidi; Lo Leggio, Leila; Yu, Shukun

2005-01-01

Glucan lyase (GL) is a polysaccharide lyase with unique characteristics. It is involved in an alternative pathway for the degradation of alpha-glucans, the anhydrofructose pathway. Sequence similarity suggests that this lytic enzyme belongs to glycoside hydrolase family 31, for which until very r...

Aspergillus fumigatus Cell Wall α-(1,3)-Glucan Stimulates Regulatory T-Cell Polarization by Inducing PD-L1 Expression on Human Dendritic Cells.

Science.gov (United States)

Stephen-Victor, Emmanuel; Karnam, Anupama; Fontaine, Thierry; Beauvais, Anne; Das, Mrinmoy; Hegde, Pushpa; Prakhar, Praveen; Holla, Sahana; Balaji, Kithiganahalli N; Kaveri, Srini V; Latgé, Jean-Paul; Aimanianda, Vishukumar; Bayry, Jagadeesh

2017-12-05

Human dendritic cell (DC) response to α-(1,3)-glucan polysaccharide of Aspergillus fumigatus and ensuing CD4+ T-cell polarization are poorly characterized. α-(1,3)-Glucan was isolated from A. fumigatus conidia and mycelia cell wall. For the analysis of polarization, DCs and autologous naive CD4+ T cells were cocultured. Phenotype of immune cells was analyzed by flow cytometry, and cytokines by enzyme-linked immunosorbent assay (ELISA). Blocking antibodies were used to dissect the role of Toll-like receptor 2 (TLR2) and programmed death-ligand 1 (PD-L1) in regulating α-(1,3)-glucan-mediated DC activation and T-cell responses. DCs from TLR2-deficient mice were additionally used to consolidate the findings. α-(1,3)-Glucan induced the maturation of DCs and was dependent in part on TLR2. "α-(1,3)-Glucan-educated" DCs stimulated the activation of naive T cells and polarized a subset of these cells into CD4+CD25+FoxP3+ regulatory T cells (Tregs). Mechanistically, Treg stimulation by α-(1,3)-glucan was dependent on the PD-L1 pathway that negatively regulated interferon-gamma (IFN-γ) secretion. Short α-(1,3)-oligosaccharides lacked the capacity to induce maturation of DCs but significantly blocked α-(1,3)-glucan-induced Treg polarization. PD-L1 dictates the balance between Treg and IFN-γ responses induced by α-(1,3)-glucan. Our data provide a rationale for the exploitation of immunotherapeutic approaches that target PD-1-PD-L1 to enhance protective immune responses to A. fumigatus infections. © The Author 2017. Published by Oxford University Press for the Infectious Diseases Society of America. All rights reserved. For permissions, e-mail: journals.permissions@oup.com.

Optimization and scale-up of fermentation of glucansucrase and branched glucan by Pediococcus pentosaceus CRAG3 using Taguchi methodology in bioreactor

Directory of Open Access Journals (Sweden)

RISHIKESH SHUKLA

2012-01-01

Full Text Available The present investigation focuses on screening and optimization of media components to enhance glucansucrase and glucan production by Pediococcus pentosaceus CRAG3 at shake-flask and bioreactor level using Taguchi orthogonal array design. A three-level Taguchi orthogonal array layout of L27 (33 was employed, in which six variables were studied for their influence on glucansucrase and glucan production. The results showed that sucrose, K2HPO4 and Tween-80 were the most significant factors to improve glucansucrase production while the glucan production was mostly affected by sucrose, peptone and K2HPO4. The optimized medium composition for maximum glucansucrase and glucan production were: sucrose 3.5% and 5%; yeast extract 0.2% and 2.0%; beef extract 0.5% and 0.5%; peptone 3.0% and 1.0%; K2HPO4 0.2% and 0.2%, and Tween-80 1.0 and 0.1%, respectively. The optimized medium gave 10.1 U/ml and 10.2 U/ml glucansucrase activity while glucan concentrations were 56 mg/ml and 80 mg/ml in shake flask and bioreactor level, respectively which were in good agreement with predicted values (10.1 U/ml and 54.5 mg/ml. The optimized medium gave 2 fold enhancement in enzyme activity and 4 fold increase in glucan concentration as compared to non-optimized medium (4.5 U/ml and 15 mg/ml, respectively at shake flask level.

Methodologies for conformational studies of oligo- and poly-glucans: crystallography and molecular mechanics

International Nuclear Information System (INIS)

Tran, Huu Vinh

1983-01-01

After some considerations on the conformational analysis of polysaccharides, this research thesis outlines the interest of molecular mechanics as a method to study these components. Technical aspects are presented. The author reports the prediction of the conformations of some specific cyclic oligomers (glucans, glucore), the use of X-ray diffraction to study glucides (and the limitations of this method). He reports the search for another investigation method: relationships between X rays and molecular mechanics, situation with respect to other crystallographic methods, presentation of principle of the 'Packing' method, and applications. He reports the study of regular conformations of polysaccharides, the study of the statistic configuration of polymer chains and the application to alpha-glucans

Analysis of adrenocortical secretory responses during acute an prolonged immune stimulation in inflammation-susceptible and -resistant rat strains.

Science.gov (United States)

Andersson, I M; Lorentzen, J C; Ericsson-Dahlstrand, A

2000-11-01

Endogenous corticosterone secreted during immune challenge restricts the inflammatory process and genetic variations in this neuroendocrine-immune dialogue have been suggested to influence an individuals sensitivity to develop chronic inflammatory disorders. We have tested inflammation-susceptible Dark Agouti (DA) rats and resistant, MHC-identical, PVG.1AV1 rats for their abilities to secrete corticosterone in response to acute challenge with bacterial lipopolysaccharide (LPS) or a prolonged activation of the nonspecific immune system with arthritogenic yeast beta-glucan. Intravenous injection of LPS triggered equipotent secretion of corticosterone in both rat strains. Interestingly, peak concentrations of corticosterone did not differ significantly between the strains. Intradermal injection of beta-glucan caused severe, monophasic, polyarthritis in DA rats while PVG.1AV1 responded with significantly milder joint inflammation. Importantly, serial sampling of plasma from glucan-injected DA and PVG.1AV1 rats did not reveal elevated concentrations of plasma corticosterone at any time from days 1-30 postinjection compared to preinjection values, in spite of the ongoing inflammatory process. Interestingly, adrenalectomized, beta-glucan-challenged DA rats responded with an aggravated arthritic process, indicating an anti-inflammatory role for the basal levels of corticosterone that were detected in intact DA rats challenged with beta-glucan. Moreover, substitution with subcutaneous corticosterone-secreting pellets, yielding moderate stress-levels, significantly attenuated the arthritic response. In contrast, adrenalectomized and glucan-challenged PVG.1AV1 rats did not respond with an elevated arthritic response, suggesting that these rats contain the arthritic process via corticosterone-independent mechanisms. In conclusion, the hypothalamic-pituitary-adrenal axis in both rat strains exhibited strong activation after challenge with LPS. This contrasted to the basal

Structural Analysis of a Family 81 Glycoside Hydrolase Implicates Its Recognition of β-1,3-Glucan Quaternary Structure.

Science.gov (United States)

Pluvinage, Benjamin; Fillo, Alexander; Massel, Patricia; Boraston, Alisdair B

2017-09-05

Family 81 glycoside hydrolases (GHs), which are known to cleave β-1,3-glucans, are found in archaea, bacteria, eukaryotes, and viruses. Here we examine the structural and functional features of the GH81 catalytic module, BhGH81, from the Bacillus halodurans protein BH0236 to probe the molecular basis of β-1,3-glucan recognition and cleavage. BhGH81 displayed activity on laminarin, curdlan, and pachyman, but not scleroglucan; the enzyme also cleaved β-1,3-glucooligosaccharides as small as β-1,3-glucotriose. The crystal structures of BhGH81 in complex with various β-1,3-glucooligosaccharides revealed distorted sugars in the -1 catalytic subsite and an arrangement consistent with an inverting catalytic mechanism having a proposed conformational itinerary of 2 S 0 → 2,5 B ‡ → 5 S 1 . Notably, the architecture of the catalytic site, location of an adjacent ancillary β-1,3-glucan binding site, and the surface properties of the enzyme indicate the likely ability to recognize the double and/or triple-helical quaternary structures adopted by β-1,3-glucans. Copyright © 2017 Elsevier Ltd. All rights reserved.

Study on preparation and effect of oligoβ-glucan and oligochitosan on immune stimulation white patches in the internal organs disease on Tra catfish (Pangasianodon hypophthalmus)

International Nuclear Information System (INIS)

Nguyen Ngoc Duy; Dang Van Phu; Nguyen Thi Kim Lan; Nguyen Quoc Hien; Pham Duy Hai

2015-01-01

Oligoβ-glucan and oligochitosan were prepared by gamma Co-60 irradiation of β-glucan/H_2O_2 and chitosan/H_2O_2 solution. The efficiency of the degradation process was determined by gel permeation chromatography (GPC) method. Results showed that the Mw decreased with increasing concentration of H_2O_2 and doses. For oligoβ-glucan, Mw reduced from 56.7 kDa to 7.1 kDa when β-glucan 10%/H_2O_2 1% solution was irradiated at 14 kGy. For oligochitosan, Mw reduced from 45.5 kDa to 5.0 kDa when chitosan 5%/H_2O_2 0.5% solution was irradiated at 21 kGy. Tra catfish (Pangasianodon hypophthalmus) was fed with oligoβ-glucan and oligochitosan in various concentrations of 0, 50, 100, and 200 mg/kg feed for 45 days and then was challenged with Edwardsiella ictaluri bacteria to investigate immune stimulation effect against white patches in the internal organs disease. The results indicated that oligoβ-glucan and oligochitosan exhibited good immune stimulation effect with optimum concentration of 100 mg/kg feed. Survival rate of Tra catfishes fed with oligochitosan and oligoβ-glucan is 47.62 ± 1.96% and 46.67 ± 2.58%, respectively. In addition, the mixture of oligochitosan 50 mg/kg + oligo?-glucan 50 mg/kg showed the highest survival rate (62.22 ± 1.96%). (author)

UDP-[14C]glucose-labelable polypeptides from pea: Possible components of glucan synthase I activity

International Nuclear Information System (INIS)

Ray, P.M.; Dhugga, K.S.; Gallaghar, S.R.

1989-01-01

A membrane-bound polypeptide doublet of about 40 kD can be rapidly labeled with UDP-[ 14 C]glucose under the assay conditions for glucan synthase I (GS-I). Label seems covalently bound, and chases when unlabeled UDPG is added; it might represent a covalent intermediate in polysaccharide synthesis. Labeling and GS-I activity show several common features: they co-sediment with Golgi membranes in sucrose gradients; they depend similarly on Mg 2+ or Mn 2+ (not Ca 2+ ); they decrease dramatically from stem apex to base, and are higher in epidermis than internal tissue; they show similar sensitivities to several inhibitors. But the doublet still labels after polysaccharide-synthesizing activity has been destroyed by Triton X-100. The doublet polypeptides might be glucosyl tranferases whose ability to transfer glucose units to a glucan chain is detergent-sensitive, but to accept glucose from UDPG is not; or they might be detergent-insensitive primary glucose acceptors, from which a distinct, detergent-sensitive transferase(s) move(s) these units to glucan chains

β-1,3/1,6-Glucan alleviated intestinal mucosal barrier impairment of broiler chickens challenged with Salmonella enterica serovar Typhimurium.

Science.gov (United States)

Shao, Yujing; Guo, Yuming; Wang, Zhong

2013-07-01

This study investigated the protective effect of β-1,3/1,6-glucan on gut morphology, intestinal epithelial tight junctions, and bacterial translocation of broiler chickens challenged with Salmonella enterica serovar Typhimurium. Ninety Salmonella-free Arbor Acre male broiler chickens were randomly divided into 3 groups: negative control group (NC), Salmonella Typhimurium-infected positive group (PC), and the Salmonella Typhimurium-infected group with dietary 100 mg/kg of β-1,3/1,6-glucan supplementation (T) to determine the effect of β-1,3/1,6-glucan on intestinal barrier function. Salmonella Typhimurium challenge alone significantly decreased villus height (P chickens challenged with Salmonella Typhimurium.

Effect of long-term oral administration of an immunostimulant diet on innate immunity in sea bass (Dicentrarchus labrax).

Science.gov (United States)

Bagni, M; Archetti, L; Amadori, M; Marino, G

2000-12-01

Immunostimulants represent a modern and promising tool in aquaculture, enhancing the resistance of cultured fish to disease and stress. This study investigated the effect of a combination of dietary glucans, alpha-tocopherol and ascorbic acid on the innate immune response of cultured sea bass (Dicentrarchus labrax). After 5 weeks of adaptation on a commercial diet containing 100 p.p.m. ascorbic acid and 200 p.p.m. alpha-tocopherol, sea bass were switched to a diet supplemented with 2% beta-1.3/beta-1.6 glucans and ascorbic acid and alpha-tocopherol at 500 p.p.m. The supplemented diet was given at 2% of body weight per day over a 2-week period, every 3 months. Plasma lysozyme concentration, content and distribution of major plasma proteins and complement activity were measured prior to feeding the supplemented diet and after 40 weeks. Alternative pathways of complement activation and lysozyme activity were both significantly enhanced in fish fed on glucans and elevated doses of vitamins. No significant differences were observed in protein content or in albumin/globulin ratio. Compared to lysozyme activity, which showed marked individual variation, complement-mediated haemolytic activity has been shown to be a more reliable indicator of sea bass immunocompetence. Further studies are in progress to clarify the effect of each dietary component on the innate immune response and disease resistance.

β-Glucans (Saccharomyces cereviseae) Reduce Glucose Levels and Attenuate Alveolar Bone Loss in Diabetic Rats with Periodontal Disease

Science.gov (United States)

2015-01-01

The objective of this study was to assess the effects of oral ingestion of β-glucans isolated from Saccharomyces cereviseae on the metabolic profile, expression of gingival inflammatory markers and amount of alveolar bone loss in diabetic rats with periodontal disease. Diabetes mellitus was induced in 48 Wistar rats by intraperitoneal injection of streptozotocin (80 mg/kg). After confirming the diabetes diagnosis, the animals were treated with β-glucans (by gavage) for 28 days. On the 14th day of this period, periodontal disease was induced using a ligature protocol. β-glucans reduced the amount of alveolar bone loss in animals with periodontal disease in both the diabetic and non-diabetic groups (p periodontal disease (p periodontal disease (p periodontal effects in diabetic rats with periodontal disease. PMID:26291983

Substantial decrease in cell wall α-1,3-glucan caused by disruption of the kexB gene encoding a subtilisin-like processing protease in Aspergillus oryzae.

Science.gov (United States)

Mizutani, Osamu; Shiina, Matsuko; Yoshimi, Akira; Sano, Motoaki; Watanabe, Takeshi; Yamagata, Youhei; Nakajima, Tasuku; Gomi, Katsuya; Abe, Keietsu

2016-09-01

Disruption of the kexB encoding a subtilisin-like processing protease in Aspergillus oryzae (ΔkexB) leads to substantial morphological defects when the cells are grown on Czapek-Dox agar plates. We previously found that the disruption of kexB causes a constitutive activation of the cell wall integrity pathway. To understand how the disruption of the kexB affects cell wall organization and components, we analyzed the cell wall of ΔkexB grown on the plates. The results revealed that both total N-acetylglucosamine content, which constitutes chitin, and chitin synthase activities were increased. Whereas total glucose content, which constitutes β-1,3-glucan and α-1,3-glucan, was decreased; this decrease was attributed to a remarkable decrease in α-1,3-glucan. Additionally, the β-1,3-glucan in the alkali-insoluble fraction of the ΔkexB showed a high degree of polymerization. These results suggested that the loss of α-1,3-glucan in the ΔkexB was compensated by increases in the chitin content and the average degree of β-1,3-glucan polymerization.

Preparation of Low Molecular Weight Gelatin Using Microwave Discharge Electrodeless Lamp/TiO2 Photocatalyst Hybrid System.

Science.gov (United States)

Lee, Do-Jin; Kim, Hangun; Park, Young-Kwon; Kim, Byung Hoon; Lee, Heon; Jungf, Sana-Chul

2016-02-01

In this study, an MDEL/TiO2 photocatalyst hybrid system was applied to the production of low molecular weight gelatin. The molecular weight of produed gelatin decreased with increasing microwave intensity and increasing treatment time. The abscission of the chemical bonds between the con- stituents of gelatin by photocatalytic reaction did not alter the characteristics of gelatin. Formation of any by-products due to side reaction was not observed. It is suggested that gelatin was depolymerized by hydroxyl radicals produced during the MDEL/TiO2 photochemical reaction.

Preparation of Low Molecular Weight Heparin by Microwave Discharge Electrodeless Lamp/TiO2 Photo-Catalytic Reaction.

Science.gov (United States)

Lee, Do-Jin; Kim, Byung Hoon; Kim, Sun-Jae; Kim, Jung-Sik; Lee, Heon; Jung, Sang-Chul

2015-01-01

An MDEL/TiO2 photo-catalyst hybrid system was applied, for the first time, for the production of low molecular weight heparin. The molecular weight of produed heparin decreased with increasing microwave intensity and treatment time. The abscission of the chemical bonds between the constituents of heparin by photo-catalytic reaction did not alter the characteristics of heparin. Formation of by-products due to side reaction was not observed. It is suggested that heparin was depolymerized by active oxygen radicals produced during the MDEL/TiO2 photo-chemical reaction.

Influence of chitosan and melanin-glucan complex onto gamma-exposure with low doses and acute stressful reaction

International Nuclear Information System (INIS)

Senyuk, O.F.; Tarasenko, P.D.; Pazukhin, Eh.M.; Gorovoj, L.F.; Varlamov, V.P.

2004-01-01

Possibilities of prevention and reduction of consequences of acute exposure on the background of immobilization stress with the help of chitosan preparations and of melanin - glucan complex of highest bazidiomicetes (fungi) were studied. Tested preparations were capable to protect hematological and immunological homeostasis of line BALB/c mice from stressful reaction provoked by acute exposure and two-hour immobilization. The most expressed normalizing and adapting effect had the mixture composed of chitosan and melanin-glucan complex

Infection Structure–Specific Expression of β-1,3-Glucan Synthase Is Essential for Pathogenicity of Colletotrichum graminicola and Evasion of β-Glucan–Triggered Immunity in Maize[W

Science.gov (United States)

Oliveira-Garcia, Ely; Deising, Holger B.

2013-01-01

β-1,3-Glucan and chitin are the most prominent polysaccharides of the fungal cell wall. Covalently linked, these polymers form a scaffold that determines the form and properties of vegetative and pathogenic hyphae. While the role of chitin in plant infection is well understood, the role of β-1,3-glucan is unknown. We functionally characterized the β-1,3-glucan synthase gene GLS1 of the maize (Zea mays) pathogen Colletotrichum graminicola, employing RNA interference (RNAi), GLS1 overexpression, live-cell imaging, and aniline blue fluorochrome staining. This hemibiotroph sequentially differentiates a melanized appressorium on the cuticle and biotrophic and necrotrophic hyphae in its host. Massive β-1,3-glucan contents were detected in cell walls of appressoria and necrotrophic hyphae. Unexpectedly, GLS1 expression and β-1,3-glucan contents were drastically reduced during biotrophic development. In appressoria of RNAi strains, downregulation of β-1,3-glucan synthesis increased cell wall elasticity, and the appressoria exploded. While the shape of biotrophic hyphae was unaffected in RNAi strains, necrotrophic hyphae showed severe distortions. Constitutive expression of GLS1 led to exposure of β-1,3-glucan on biotrophic hyphae, massive induction of broad-spectrum defense responses, and significantly reduced disease symptom severity. Thus, while β-1,3-glucan synthesis is required for cell wall rigidity in appressoria and fast-growing necrotrophic hyphae, its rigorous downregulation during biotrophic development represents a strategy for evading β-glucan–triggered immunity. PMID:23898035

Effects of β-Glucans Ingestion on Alveolar Bone Loss, Intestinal Morphology, Systemic Inflammatory Profile, and Pancreatic β-Cell Function in Rats with Periodontitis and Diabetes

Science.gov (United States)

Silva, Viviam de O.; Lobato, Raquel V.; Orlando, Débora R.; Borges, Bruno D.B.; de Sousa, Raimundo V.

2017-01-01

This study aimed to evaluate the effects of β-glucan ingestion (Saccharomyces cerevisiae) on the plasmatic levels of tumor necrosis factor-α (TNF-α) and interleukin-10 (IL-10), alveolar bone loss, and pancreatic β-cell function (HOMA-BF) in diabetic rats with periodontal disease (PD). Besides, intestinal morphology was determined by the villus/crypt ratio. A total of 48 Wistar rats weighing 203 ± 18 g were used. Diabetes was induced by the intraperitoneal injection of streptozotocin (80 mg/kg) and periodontal inflammation, by ligature. The design was completely randomized in a factorial scheme 2 × 2 × 2 (diabetic or not, with or without periodontitis, and ingesting β-glucan or not). The animals received β-glucan by gavage for 28 days. Alveolar bone loss was determined by scanning electron microscopy (distance between the cementoenamel junction and alveolar bone crest) and histometric analysis (bone area between tooth roots). β-glucan reduced plasmatic levels of TNF-α in diabetic animals with PD and of IL-10 in animals with PD (p < 0.05). β-glucan reduced bone loss in animals with PD (p < 0.05). In diabetic animals, β-glucan improved β-cell function (p < 0.05). Diabetic animals had a higher villus/crypt ratio (p < 0.05). In conclusion, β-glucan ingestion reduced the systemic inflammatory profile, prevented alveolar bone loss, and improved β-cell function in diabetic animals with PD. PMID:28906456

Oral administration of Lentinus edodes β-glucans ameliorates DSS-induced ulcerative colitis in mice via MAPK-Elk-1 and MAPK-PPARγ pathways.

Science.gov (United States)

Shi, Limin; Lin, Qinlu; Yang, Tao; Nie, Ying; Li, Xinhua; Liu, Bo; Shen, Junjun; Liang, Ying; Tang, Yiping; Luo, Feijun

2016-11-09

To evaluate the anti-inflammatory effect of β-glucans from Lentinus edodes, and its molecular mechanism, the dextran sulfate sodium salt (DSS) induced colitis model of mice and the LPS-stimulated RAW264.7 cell inflammation model were used in this study. 40 ICR male mice were randomly divided into 4 groups: Control, DSS (DSS treated only), DSS + low-βGs (500 mg kg -1 d -1 ) and DSS + high-βGs (1000 mg kg -1 d -1 ). The body weight of the mice with Lentinus edodes β-glucan supplementation increased significantly compared to the DSS group and the disease activity index (DAI) was improved in both βG-treated groups. Compared with the DSS group, histopathological analysis showed that the infiltration of inflammatory cells of both βG-treated groups decreased significantly in colonic tissues. Furthermore, oral administration of β-glucans decreases the concentration of malondialdehyde (MDA) and myeloperoxidase (MPO) and inhibits the expression of iNOS and several inflammatory factors: TNF-α, IL-1β and IL-6 as well as nitric oxide (NO) of the colonic tissues. The mitogen-activated protein kinase (MAPK) pathway is closely related to the expression of pro-inflammatory factors. In the DSS-induced colitis model and the LPS-stimulated RAW264.7 cell model, βGs inhibited the expression of pro-inflammatory factors and blocked the phosphorylation of JNK/ERK1/2 and p38; βGs also suppress the phosphorylation of Elk-1 at Ser84 and the phosphorylation of PPARγ at Ser112. Altogether, these results suggest that Lentinus edodes βGs could inhibit the DSS-induced ulcerative colitis and decrease inflammatory factor expressions. The molecular mechanism may be involved in suppressing MAPK signaling and inactivation of Elk-1 and activation of PPARγ.

Airborne fungal and bacterial components in PM1 dust from biofuel plants.

Science.gov (United States)

Madsen, Anne Mette; Schlünssen, Vivi; Olsen, Tina; Sigsgaard, Torben; Avci, Hediye

2009-10-01

Fungi grown in pure cultures produce DNA- or RNA-containing particles smaller than spore size ( 3)-beta-D-glucans. In the 29 PM(1) samples, cultivable fungi were found in six samples and with a median concentration below detection level. Using microscopy, fungal spores were identified in 22 samples. The components NAGase and (1 --> 3)-beta-D-glucans, which are mainly associated with fungi, were present in all PM(1) samples. Thermophilic actinomycetes were present in 23 of the 29 PM(1) samples [average = 739 colony-forming units (CFU) m(-3)]. Cultivable and 'total bacteria' were found in average concentrations of, respectively, 249 CFU m(-3) and 1.8 x 10(5) m(-3). DNA- and RNA-containing particles of different lengths were counted by microscopy and revealed a high concentration of particles with a length of 0.5-1.5 microm and only few particles >1.5 microm. The number of cultivable fungi and beta-glucan in the total dust correlated significantly with the number of DNA/RNA-containing particles with lengths of between 1.0 and 1.5 microm, with DNA/RNA-containing particles >1.5 microm, and with other fungal components in PM(1) dust. Airborne beta-glucan and NAGase were found in PM(1) samples where no cultivable fungi were present, and beta-glucan and NAGase were found in higher concentrations per fungal spore in PM(1) dust than in total dust. This indicates that fungal particles smaller than fungal spore size are present in the air at the plants. Furthermore, many bacteria, including actinomycetes, were present in PM(1) dust. Only 0.2% of the bacteria in PM(1) dust were cultivable.

Effects of extrusion variables on the properties of waxy hulless barley extrudates.

Science.gov (United States)

Köksel, Hamit; Ryu, Gy-Hyung; Başman, Arzu; Demiralp, Hande; Ng, Perry K W

2004-02-01

The objective of this research was to investigate the extrudability of waxy hulless barley flour under various extrusion conditions. Waxy hulless barley flour was processed in a laboratory-scale corotating twin-screw extruder with different levels of feed moisture content (22.3, 26.8, and 30.7%) and die temperature (130, 150, and 170 degrees C) to develop a snack food with high beta-glucan content. The effects of extrusion condition variables (screw configuration, moisture, and temperature) on the system variables (pressure and specific mechanical energy), the extrudate physical properties (sectional expansion index, bulk density), starch gelatinization, pasting properties (cold peak viscosity, trough viscosity, and final viscosity), and beta-glucan contents were determined. Results were evaluated by using response surface methodology. Increased extrusion temperature and feed moisture content resulted in decreases in exit die pressure and specific mechanical energy values. For extrudates extruded under low shear screw configuration (LS), increased barrel temperature decreased sectional expansion index (SEI) values at both low and high moisture contents. The feed moisture seems to have an inverse relationship with SEI over the range studied. Bulk density was higher at higher moisture contents, for both low and high barrel temperatures, for samples extruded under high shear screw configuration (HS) and LS. Cold peak viscosities (CV) were observed in all samples. The CV increased with the increase in extrusion temperature and feed moisture content. Although beta-glucan contents of the LS extrudates were comparable to that of barley flour sample, HS samples had generally lower beta-glucan contents. The extrusion cooking technique seems to be promising for the production of snack foods with high beta-glucan content, especially using LS conditions.

Glucan, Water Dikinase Activity Stimulates Breakdown of Starch Granules by Plastidial β-Amylases1[W][OA

Science.gov (United States)

Edner, Christoph; Li, Jing; Albrecht, Tanja; Mahlow, Sebastian; Hejazi, Mahdi; Hussain, Hasnain; Kaplan, Fatma; Guy, Charles; Smith, Steven M.; Steup, Martin; Ritte, Gerhard

2007-01-01

Glucan phosphorylating enzymes are required for normal mobilization of starch in leaves of Arabidopsis (Arabidopsis thaliana) and potato (Solanum tuberosum), but mechanisms underlying this dependency are unknown. Using two different activity assays, we aimed to identify starch degrading enzymes from Arabidopsis, whose activity is affected by glucan phosphorylation. Breakdown of granular starch by a protein fraction purified from leaf extracts increased approximately 2-fold if the granules were simultaneously phosphorylated by recombinant potato glucan, water dikinase (GWD). Using matrix-assisted laser-desorption ionization mass spectrometry several putative starch-related enzymes were identified in this fraction, among them β-AMYLASE1 (BAM1; At3g23920) and ISOAMYLASE3 (ISA3; At4g09020). Experiments using purified recombinant enzymes showed that BAM1 activity with granules similarly increased under conditions of simultaneous starch phosphorylation. Purified recombinant potato ISA3 (StISA3) did not attack the granular starch significantly with or without glucan phosphorylation. However, starch breakdown by a mixture of BAM1 and StISA3 was 2 times higher than that by BAM1 alone and was further enhanced in the presence of GWD and ATP. Similar to BAM1, maltose release from granular starch by purified recombinant BAM3 (At4g17090), another plastid-localized β-amylase isoform, increased 2- to 3-fold if the granules were simultaneously phosphorylated by GWD. BAM activity in turn strongly stimulated the GWD-catalyzed phosphorylation. The interdependence between the activities of GWD and BAMs offers an explanation for the severe starch excess phenotype of GWD-deficient mutants. PMID:17631522

Structure and conformation of α-glucan extracted from Agaricus blazei Murill by high-speed shearing homogenization.

Science.gov (United States)

Zhang, Anqiang; Deng, Jiaying; Liu, Xiaoqing; He, Pengfei; He, Liang; Zhang, Fuming; Linhardt, Robert J; Sun, Peilong

2018-07-01

Agaricus blazei Murill is an edible and medicinal mushroom favored in many countries, by virtue of both its delicious taste and its potential health benefits such as its purported anticancer activity. A neutral α-glucan (ABM40-1) with a carbohydrate content of 96% was purified from the high-speed shearing homogenization extracts of A. Blazei Murill by ethanol precipitation and column chromatography. Methylation analysis along with nuclear magnetic resonance spectroscopy revealed that ABM40-1 was an α-(1→4)-d-glucopyranan with O-6 position occasionally occupied with α-Glcp-(1→or α-Glcp-(1→6)-β-Glcp-(1→side chains. A weight-average molecular weight of 7.34×10 6 Da was determined for ABM40-1 and its chain in solution was revealed as a compact sphere by size exclusion chromatography (SEC) coupled with a laser light scattering. This spherical conformation was also further confirmed by Congo red test and using atom force microscopy. These results suggest it would be worthwhile to further study the potential bioactivities of ABM40-1. Copyright © 2018 Elsevier B.V. All rights reserved.

Evaluation of the Efficiency of Different Disruption Methods on Yeast Cell Wall Preparation for β-Glucan Isolation

Directory of Open Access Journals (Sweden)

Anna Bzducha-Wróbel

2014-12-01

Full Text Available Selected methods for yeast cell disruption were evaluated to establish their suitability for cell wall preparation in the process of β-glucan isolation. The effect of different disruption methods on contents of total saccharides, β-glucans and proteins in the produced cell walls preparations was analyzed. The degree of cell wall purification from intracellular components was established on the basis of the ratio of solubilised material. The investigated methods included: cell exposure to hot water (autoclaving, thermally-induced autolysis, homogenization in a bead mill, sonication and their combinations. Experimental systems were prepared in water (pH 5.0 and pH 7.0 and Tris-HCl buffer (pH 8.0. The Saccharomyces cerevisiae yeast cell wall preparations with the highest degree of cytosol component release and purification of β-glucans were produced by 30 min of cell homogenization with zirconium-glass beads (0.5 mm in diameter. This was confirmed by the highest ratio of solubilised material (approx. 64%–67%. The thus-produced preparations contained ca. 60% of total saccharides, 13%–14% of β(1,3/(1,6-glucans, and approx. 35% of crude proteins. Similar results were obtained after autolysis coupled with bead milling as well as with sonication, but the time required for these processes was more than 24 h. Homogenization in a bead mill could be valuable for general isolation procedures because allows one to eliminate the different autolytic activity of various yeast strains.

Depolymerization of post-consumer PET with multifunctional alcohol through melt processing

International Nuclear Information System (INIS)

Lessa, Tathiane C.R.F.; Mendes, Luis C.; Dias, Marcos L.

2009-01-01

The purpose of this study was to prepare oligomers from post-consumer PET with multifunctional alcohol, through melt processing, aiming to develop a new material, able to play a role as filler or property modifier. Maintaining constants the process conditions, content and kind of catalyst, the influence of the solvolysis agent on the PET depolymerization was investigated. The products were evaluated by wide-angle X-ray diffraction (WAXD) and thermogravimetry (TG/DTG). The changes in the WAXD curves and the shift of the maximum degradation temperature suggested that the ester linkages were broken being the ethylene glycol moieties replaced with hydroxyl-terminal groups of the multifunctional alcohol, as result of a transesterification reaction. The chemical structure of the new ester was named 'star-branching polymer'. (author)

The Dual Activity Responsible for the Elongation and Branching of β-(1,3-Glucan in the Fungal Cell Wall

Directory of Open Access Journals (Sweden)

Vishukumar Aimanianda

2017-06-01

Full Text Available β-(1,3-Glucan, the major fungal cell wall component, ramifies through β-(1,6-glycosidic linkages, which facilitates its binding with other cell wall components contributing to proper cell wall assembly. Using Saccharomyces cerevisiae as a model, we developed a protocol to quantify β-(1,6-branching on β-(1,3-glucan. Permeabilized S. cerevisiae and radiolabeled substrate UDP-(14Cglucose allowed us to determine branching kinetics. A screening aimed at identifying deletion mutants with reduced branching among them revealed only two, the bgl2Δ and gas1Δ mutants, showing 15% and 70% reductions in the branching, respectively, compared to the wild-type strain. Interestingly, a recombinant Gas1p introduced β-(1,6-branching on the β-(1,3-oligomers following its β-(1,3-elongase activity. Sequential elongation and branching activity of Gas1p occurred on linear β-(1,3-oligomers as well as Bgl2p-catalyzed products [short β-(1,3-oligomers linked by a linear β-(1,6-linkage]. The double S. cerevisiae gas1Δ bgl2Δ mutant showed a drastically sick phenotype. An ScGas1p ortholog, Gel4p from Aspergillus fumigatus, also showed dual β-(1,3-glucan elongating and branching activity. Both ScGas1p and A. fumigatus Gel4p sequences are endowed with a carbohydrate binding module (CBM, CBM43, which was required for the dual β-(1,3-glucan elongating and branching activity. Our report unravels the β-(1,3-glucan branching mechanism, a phenomenon occurring during construction of the cell wall which is essential for fungal life.

Only small fractions of soluble ß-glucan modulate the mucosal immune system in carp (Cyprinus carpio L.)

DEFF Research Database (Denmark)

Przybylska, Dominika Alicja; Nielsen, Michael Engelbrecht

For decades the ability of β-glucans to modulate immunity through activation of innate cellular components has been observed. However, toxicological effects associated with the systemic administration and dose-related immune-suppression has also been described. The superior aim of this study...... is to understand the effect of β-glucan induced modulation in carp in relation to tissue regeneration, mucosal immunity and host-pathogen interactions. Expression profiles of immune related genes will be measured in fresh water specie – common carp (Cyprinus carpio L.). The methodology of the project involves...

LIGNIN, STRUCTURE AND APPLICATIONS: DEPOLYMERIZATION METHODS FOR OBTAINING AROMATIC DERIVATIVES OF INDUSTRIAL INTEREST

Directory of Open Access Journals (Sweden)

Marvin Chávez-Sifontes

2013-12-01

Full Text Available In this article significant data related to the structural characteristics of lignin, the extraction and isolation processes from biomass, and also the characteristics of different types of commercial lignins are presented. The review focuses on the different depolymerization processes (hydrolysis, hydrogenolysis, hydrodeoxygenation, pyrolysis, among others up to now developed and investigated analyzing the different aromatic derivatives obtained in each case, as well as the interesting reactions some of them may undergo. Application possibilities for lignin and its derivatives in new industrial processes integrated into the bio-refinery of the future are finally assessed

Conservation and Divergence in the Candida Species Biofilm Matrix Mannan-Glucan Complex Structure, Function, and Genetic Control.

Science.gov (United States)

Dominguez, Eddie; Zarnowski, Robert; Sanchez, Hiram; Covelli, Antonio S; Westler, William M; Azadi, Parastoo; Nett, Jeniel; Mitchell, Aaron P; Andes, David R

2018-04-03

Candida biofilms resist the effects of available antifungal therapies. Prior studies with Candida albicans biofilms show that an extracellular matrix mannan-glucan complex (MGCx) contributes to antifungal sequestration, leading to drug resistance. Here we implement biochemical, pharmacological, and genetic approaches to explore a similar mechanism of resistance for the three most common clinically encountered non- albicans Candida species (NAC). Our findings reveal that each Candida species biofilm synthesizes a mannan-glucan complex and that the antifungal-protective function of this complex is conserved. Structural similarities extended primarily to the polysaccharide backbone (α-1,6-mannan and β-1,6-glucan). Surprisingly, biochemical analysis uncovered stark differences in the branching side chains of the MGCx among the species. Consistent with the structural analysis, similarities in the genetic control of MGCx production for each Candida species also appeared limited to the synthesis of the polysaccharide backbone. Each species appears to employ a unique subset of modification enzymes for MGCx synthesis, likely accounting for the observed side chain diversity. Our results argue for the conservation of matrix function among Candida spp. While biogenesis is preserved at the level of the mannan-glucan complex backbone, divergence emerges for construction of branching side chains. Thus, the MGCx backbone represents an ideal drug target for effective pan- Candida species biofilm therapy. IMPORTANCE Candida species, the most common fungal pathogens, frequently grow as a biofilm. These adherent communities tolerate extremely high concentrations of antifungal agents, due in large part, to a protective extracellular matrix. The present studies define the structural, functional, and genetic similarities and differences in the biofilm matrix from the four most common Candida species. Each species synthesizes an extracellular mannan-glucan complex (MGCx) which

Biochemical and structural characterization of the glucan and fructan exopolysaccharides synthesized by the Lactobacillus reuteri wild-type strain and by mutant strains

NARCIS (Netherlands)

Geel-Schutten, G.H. van; Faber, E.J.; Smit, E.; Bonting, K.; Smith, M.R.; Brink, B. ten; Kamerling, J.P.; Vliegenthart, J.F.G.; Dijkhuizen, L.

1999-01-01

Lactobacillus reuteri LB 121 cells growing on sucrose synthesize large amounts of a glucan (D-glucose) and a fructan (D-fructose) with molecular masses of 3,500 and 150 kDa, respectively. Methylation studies and 13C or 1H nuclear magnetic resonance analysis showed that the glucan has a unique

Biochemical and structural characterization of the glucan and fructan exopolysaccharides synthesized by the Lactobacillus reuteri wild-type strain and by mutant strains

NARCIS (Netherlands)

Geel-Schutten, G.H. van; Faber, E.J.; Smit, E.; Bonting, K.; Smith, M.R.; Brink, B. ten; Kamerling, J.P.; Vliegenthart, J.F.G.; Dijkhuizen, L.

Lactobacillus reuteri LB 121 cells growing on sucrose synthesize large amounts of a glucan (D-glucose) and a fructan (D-fructose) with molecular masses of 3,500 and 150 kDa, respectively. Methylation studies and (13)C or (1)H nuclear magnetic resonance analysis showed that the glucan has a unique

Modulation of intestinal inflammation by yeasts and cell wall extracts: strain dependence and unexpected anti-inflammatory role of glucan fractions.

Directory of Open Access Journals (Sweden)

Samir Jawhara

Full Text Available Yeasts and their glycan components can have a beneficial or adverse effect on intestinal inflammation. Previous research has shown that the presence of Saccharomyces cerevisiae var. boulardii (Sb reduces intestinal inflammation and colonization by Candida albicans. The aim of this study was to identify dietary yeasts, which have comparable effects to the anti-C. albicans and anti-inflammatory properties of Sb and to assess the capabilities of yeast cell wall components to modulate intestinal inflammation. Mice received a single oral challenge of C. albicans and were then given 1.5% dextran-sulphate-sodium (DSS for 2 weeks followed by a 3-day restitution period. S. cerevisiae strains (Sb, Sc1 to Sc4, as well as mannoprotein (MP and β-glucan crude fractions prepared from Sc2 and highly purified β-glucans prepared from C. albicans were used in this curative model, starting 3 days after C. albicans challenge. Mice were assessed for the clinical, histological and inflammatory responses related to DSS administration. Strain Sc1-1 gave the same level of protection against C. albicans as Sb when assessed by mortality, clinical scores, colonization levels, reduction of TNFα and increase in IL-10 transcription. When Sc1-1 was compared with the other S. cerevisiae strains, the preparation process had a strong influence on biological activity. Interestingly, some S. cerevisiae strains dramatically increased mortality and clinical scores. Strain Sc4 and MP fraction favoured C. albicans colonization and inflammation, whereas β-glucan fraction was protective against both. Surprisingly, purified β-glucans from C. albicans had the same protective effect. Thus, some yeasts appear to be strong modulators of intestinal inflammation. These effects are dependent on the strain, species, preparation process and cell wall fraction. It was striking that β-glucan fractions or pure β-glucans from C. albicans displayed the most potent anti-inflammatory effect in the

Pengaruh Variasi Kecepatan Agitasi pada Produksi Β-Glukan dari Saccharomyces cerevisiae

Directory of Open Access Journals (Sweden)

Laras Cempaka

2016-03-01

Full Text Available β-glucan is very interesting to study because of a variety of benefits that it provides. Saccharomyces cerevisiae is a unicellular yeast which has a β-glucan component of the biggest in the cell wall. This study aimed to describe the effect of agitation speed on the production of β-glucan from S. cerevisiae. Agitation speed plays an important role in cell growth. This research used agitation speed at 80 rpm, 120 rpm and 200 rpm. The research design used was a completely randomized design with three replications. During the fermentation in sixteen hours, several parameters were examined including cell number, pH, glucose and protein of the medium and the crude β-glucan. β-glucan extraction procedures done by adding NaOH 2% solution to the fermented product. Then, the supernatant was neutralized with acetic acid solution. To get the crude deposits of β-glucan, ethanol 96% was added in volume as three times of the supernatant. Production of β-glucan was increas along with the growth of the cell.Data analysis was performed using one way ANOVA test followed by LSD analysis. Production of β-glucan increases with cell growth. pH value, the concentration of carbon source and nitrogen source on the substrate decreased during the fermentation process. β-glucan production also increased as the rising of agitation speed from the 80 rpm until 200 rpm. Rate of β-glucan production in 80 rpm, 120 rpm and 200 rpm were 18.19 μgL-1/ hour, 40.42 μgL-1/ hour, 44.03 μgL-1/ hour, respectively. Based on the experiment results, the most optimum agitation speed for beta-glucan were respectively 200 rpm with beta-glucan content reached 1624.44 µg/L.

An enzyme family reunion - similarities, differences and eccentricities in actions on alpha-glucans

DEFF Research Database (Denmark)

Seo, Eun-Seong; Christiansen, Camilla; Abou Hachem, Maher

2008-01-01

alpha-Glucans in general, including starch, glycogen and their derived oligosaccharides are processed by a host of more or less closely related enzymes that represent wide diversity in structure, mechanism, specificity and biological role. Sophisticated three-dimensional structures continue to em...

Effect of nagilactone E on cell morphology and glucan biosynthesis in budding yeast Saccharomyces cerevisiae.

Science.gov (United States)

Hayashi, Kengo; Yamaguchi, Yoshihiro; Ogita, Akira; Tanaka, Toshio; Kubo, Isao; Fujita, Ken-Ichi

2018-05-14

Nagilactones are norditerpene dilactones isolated from the root bark of Podocarpus nagi. Although nagilactone E has been reported to show antifungal activities, its activity is weaker than that of antifungals on the market. Nagilactone E enhances the antifungal activity of phenylpropanoids such as anethole and isosafrole against nonpathogenic Saccharomyces cerevisiae and pathogenic Candida albicans. However, the detailed mechanisms underlying the antifungal activity of nagilactone E itself have not yet been elucidated. Therefore, we investigated the antifungal mechanisms of nagilactone E using S. cerevisiae. Although nagilactone E induced lethality in vegetatively growing cells, it did not affect cell viability in non-growing cells. Nagilactone E-induced morphological changes in the cells, such as inhomogeneous thickness of the glucan layer and leakage of cytoplasm. Furthermore, a dose-dependent decrease in the amount of newly synthesized (1, 3)-β-glucan was detected in the membrane fractions of the yeast incubated with nagilactone E. These results suggest that nagilactone E exhibits an antifungal activity against S. cerevisiae by depending on cell wall fragility via the inhibition of (1, 3)-β-glucan biosynthesis. Additionally, we confirmed nagilactone E-induced morphological changes of a human pathogenic fungus Aspergillus fumigatus. Therefore, nagilactone E is a potential antifungal drug candidate with fewer adverse effects. Copyright © 2018 Elsevier B.V. All rights reserved.

Dimerization of the Glucan Phosphatase Laforin Requires the Participation of Cysteine 329

Science.gov (United States)

Sánchez-Martín, Pablo; Raththagala, Madushi; Bridges, Travis M.; Husodo, Satrio; Gentry, Matthew S.; Sanz, Pascual; Romá-Mateo, Carlos

2013-01-01

Laforin, encoded by a gene that is mutated in Lafora Disease (LD, OMIM 254780), is a modular protein composed of a carbohydrate-binding module and a dual-specificity phosphatase domain. Laforin is the founding member of the glucan-phosphatase family and regulates the levels of phosphate present in glycogen. Multiple reports have described the capability of laforin to form dimers, although the function of these dimers and their relationship with LD remains unclear. Recent evidence suggests that laforin dimerization depends on redox conditions, suggesting that disulfide bonds are involved in laforin dimerization. Using site-directed mutagenesis we constructed laforin mutants in which individual cysteine residues were replaced by serine and then tested the ability of each protein to dimerize using recombinant protein as well as a mammalian cell culture assay. Laforin-Cys329Ser was the only Cys/Ser mutant unable to form dimers in both assays. We also generated a laforin truncation lacking the last three amino acids, laforin-Cys329X, and this truncation also failed to dimerize. Interestingly, laforin-Cys329Ser and laforin-Cys329X were able to bind glucans, and maintained wild type phosphatase activity against both exogenous and biologically relevant substrates. Furthermore, laforin-Cys329Ser was fully capable of participating in the ubiquitination process driven by a laforin-malin complex. These results suggest that dimerization is not required for laforin phosphatase activity, glucan binding, or for the formation of a functional laforin-malin complex. Cumulatively, these results suggest that cysteine 329 is specifically involved in the dimerization process of laforin. Therefore, the C329S mutant constitutes a valuable tool to analyze the physiological implications of laforin’s oligomerization. PMID:23922729

Formation and stability of .beta.-structure in biodegradable ultra-high-molecular-weight poly(3-hydroxybutyrate) by infrared, Raman, and quantum chemical calculation studies

Czech Academy of Sciences Publication Activity Database

Murakami, R.; Sato, H.; Dybal, Jiří; Iwata, T.; Ozaki, Y.

2007-01-01

Roč. 48, č. 9 (2007), s. 2672-2680 ISSN 0032-3861 R&D Projects: GA ČR GA203/05/0425 Grant - others:Ministry of Education, Culture, Sports, Science and Technology(JP) 18750107 Institutional research plan: CEZ:AV0Z40500505 Keywords : ultra-high-molecular-weight poly(hydroxybutyrate) * .beta.-form * Raman spectroscopy Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 3.065, year: 2007

Partitioning diversity into independent alpha and beta components.

Science.gov (United States)

Jost, Lou

2007-10-01

Existing general definitions of beta diversity often produce a beta with a hidden dependence on alpha. Such a beta cannot be used to compare regions that differ in alpha diversity. To avoid misinterpretation, existing definitions of alpha and beta must be replaced by a definition that partitions diversity into independent alpha and beta components. Such a unique definition is derived here. When these new alpha and beta components are transformed into their numbers equivalents (effective numbers of elements), Whittaker's multiplicative law (alpha x beta = gamma) is necessarily true for all indices. The new beta gives the effective number of distinct communities. The most popular similarity and overlap measures of ecology (Jaccard, Sorensen, Horn, and Morisita-Horn indices) are monotonic transformations of the new beta diversity. Shannon measures follow deductively from this formalism and do not need to be borrowed from information theory; they are shown to be the only standard diversity measures which can be decomposed into meaningful independent alpha and beta components when community weights are unequal.

Maternal breast milk transforming growth factor beta and feeding intolerance in preterm infants

Science.gov (United States)

Frost, Brandy L.; Jilling, Tamas; Lapin, Brittany; Maheshwari, Akhil; Caplan, Michael S.

2015-01-01

Background Feeding intolerance occurs commonly in the NICU. Breast milk contains a large pool of transforming growth factor-beta (TGF-beta). Few studies describe TGF-beta levels in preterm milk, and the relationship to feeding intolerance (FI) remains unexplored. We measured TGF-beta levels in preterm breast milk to investigate a correlation with FI in preterm infants. Methods Prospective observational trial of 100 mother-infant pairs, enrolling infants born below 32 weeks gestation and less than 1500 grams, and mothers who planned to provide breast milk. TGF-beta levels were measured using ELISA. Infant charts were reviewed for outcomes. Results TGF-beta declined postnatally, most elevated in colostrum (p<0.01). TGF-beta 2 levels were higher than TGF-beta 1 at all time points (p<0.01). Colostrum TGF-beta levels correlated inversely with birth weight (p<0.01) and gestational age (p<0.05). One week TGF-beta 2 levels were reduced in growth-restricted infants with FI (p<0.01). Of infants with NEC, TGF-beta 2 levels appeared low, but small sample size precluded meaningful statistical comparisons. Conclusions TGF-beta levels decline temporally in preterm milk. TGF-beta 1 colostrum levels correlate inversely with birth weight and gestational age. TGF-beta 2 may play a role in FI in growth-restricted infants. The relationship of TGF-beta 2 and NEC merits future investigation. PMID:24995914

Cell wall α-1,3-glucan prevents α-amylase adsorption onto fungal cell in submerged culture of Aspergillus oryzae.

Science.gov (United States)

Zhang, Silai; Sato, Hiroki; Ichinose, Sakurako; Tanaka, Mizuki; Miyazawa, Ken; Yoshimi, Akira; Abe, Keietsu; Shintani, Takahiro; Gomi, Katsuya

2017-07-01

We have previously reported that α-amylase (Taka-amylase A, TAA) activity disappears in the later stage of submerged Aspergillus oryzae culture as a result of TAA adsorption onto the cell wall. Chitin, one of the major components of the cell wall, was identified as a potential factor that facilitates TAA adsorption. However, TAA adsorption only occurred in the later stage of cultivation, although chitin was assumed to be sufficiently abundant in the cell wall regardless of the submerged culture period. This suggested the presence a factor that inhibits TAA adsorption to the cell wall in the early stage of cultivation. In the current study, we identified α-1,3-glucan as a potential inhibiting factor for TAA adsorption. We constructed single, double, and triple disruption mutants of three α-1,3-glucan synthase genes (agsA, agsB, and agsC) in A. oryzae. Growth characteristics and cell wall component analysis of these disruption strains showed that AgsB plays a major role in α-1,3-glucan synthesis. In the ΔagsB mutant, TAA was adsorbed onto the mycelium in all stages of cultivation (early and later), and the ΔagsB mutant cell walls had a significantly high capacity for TAA adsorption. Moreover, the α-1,3-glucan content of the cell wall prepared from the wild-type strain in the later stage of cultivation was markedly reduced compared with that in the early stage. These results suggest that α-1,3-glucan is a potential inhibiting factor for TAA adsorption onto the cell wall component, chitin, in the early stage of submerged culture in A. oryzae. Copyright © 2017 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

Catalytic Depolymerization and Upgrading of Lignin for Vanillin Production: Cooperative Research and Development Final Report, CRADA Number CRD-14-545

Energy Technology Data Exchange (ETDEWEB)

Beckham, Gregg [National Renewable Energy Lab. (NREL), Golden, CO (United States)

2017-03-31

Examine catalytic conversion of lignin using multifunctional catalysts that are able to depolymerize and oxidize lignin to a vanillin-rich stream. Examine separation processes for isolation of vanillin from product mixtures. Conduct preliminary experiments to determine if deconstructed lignin streams can be metabolized by Pseudomonas putida.

Soluble β-(1,3)-glucans enhance LPS-induced response in the monocyte activation test, but inhibit LPS-mediated febrile response in rabbits: Implications for pyrogenicity tests.

Science.gov (United States)

Pardo-Ruiz, Zenia; Menéndez-Sardiñas, Dalia E; Pacios-Michelena, Anabel; Gabilondo-Ramírez, Tatiana; Montero-Alejo, Vivian; Perdomo-Morales, Rolando

2016-01-01

In the present study, we aimed to determine the influence of β-(1,3)-d-glucans on the LPS-induced pro-inflammatory cytokine response in the Monocyte Activation Test (MAT) for pyrogens, and on the LPS-induced febrile response in the Rabbit Pyrogen Test (RPT), thus evaluating the resulting effect in the outcome of each test. It was found that β-(1,3)-d-glucans elicited the production of pro-inflammatory cytokines IL-1β, IL-6 and TNF-α, also known as endogenous pyrogens, but not enough to classify them as pyrogenic according to MAT. The same β-(1,3)-d-glucans samples were non-pyrogenic by RPT. However, β-(1,3)-d-glucans significantly enhanced the LPS-induced pro-inflammatory cytokines response in MAT, insomuch that samples containing non-pyrogenic concentrations of LPS become pyrogenic. On the other hand, β-(1,3)-d-glucans had no effect on sub-pyrogenic LPS doses in the RPT, but surprisingly, inhibited the LPS-induced febrile response of pyrogenic LPS concentrations. Thus, while β-(1,3)-d-glucans could mask the LPS pyrogenic activity in the RPT, they exerted an overstimulation of pro-inflammatory cytokines in the MAT. Hence, MAT provides higher safety since it evidences an unwanted biological response, which is not completely controlled and is overlooked by the RPT. Copyright © 2015 Elsevier B.V. All rights reserved.

Understanding the role of oat ß-glucan in oat-based dough systems

NARCIS (Netherlands)

Londono, D.M.; Gilissen, L.J.W.J.; Visser, R.G.F.; Smulders, M.J.M.; Hamer, R.J.

2015-01-01

B-glucan is one of the components that differentiate oats from other cereals and that contribute to the health-related value of oats. However, so far oats cannot easily be applied in bread-like products without loss of product quality. Here we have studied how the content and viscosity of oat

Preparation of hollow shell ICF targets using a depolymerizing model

International Nuclear Information System (INIS)

Letts, S.A.; Fearon, E.M.; Buckley, S.R.

1994-11-01

A new technique for producing hollow shell laser fusion capsules was developed that starts with a depolymerizable mandrel. In this technique we use poly(alpha-methylstyrene) (PAMS) beads or shells as mandrels which are overcoated with plasma polymer. The PAMS mandrel is thermally depolymerized to gas phase monomer, which diffuses through the permeable and thermally more stable plasma polymer coating, leaving a hollow shell. We have developed methods for controlling the size of the PAMS mandrel by either grinding to make smaller sizes or melt sintering to form larger mandrels. Sphericity and surface finish are improved by heating the PAMS mandrels in hot water using a surfactant to prevent aggregation. Using this technique we have made shells from 200 μm to 5 mm diameter with 15 to 100 μm wall thickness having sphericity better than 2 μm and surface finish better than 10 nm RMS

Rat beta-LPH, gamma-LPH and beta-endorphin biosynthesized by isolated cells of pars intermedia and pars distalis

International Nuclear Information System (INIS)

Gianoulakis, C.; Seidah, N.G.; Routhier, R.; Chretien, M.

1980-01-01

Rats pars intermedia cells were incubated for 3 h with the following amino-acids: a) 35 S-methionine and 3 H-phenylalamine; b) 3 H-valine; and c) 3 H-valine and 3 H-lysine. Radioactive gamma-lipotropin, beta-lipotropin and beta-endorphin were purified on carboxy- methyl-cellulose and characterized by polyacrylamide disc gel electrophoresis af pH 4.5, molecular weight estimation and microsequencing. Rat gamma-lipotropin was shown to differ slightly from ovine gamma-lipotropin in its NH 2 -terminal amino acid sequence, in containing no methionine and having phenylalanine at position 6, valine at positions 13 and 27, and lysine at position 20. The same variations were observed in the sequence of rat beta-lipotropin, while rat beta-endorphin was shown to be identical to the ovine beta-endorphin. Following a 3-h pulse of rat pars distalis, the cells were extracted with care to avoid beta-lipotropin degradation by proteolytic enzymes. A peptide was purified and identified to be rat beta-endorphin, thus demonstrating that beta-endorphin is biosynthesized in pars distalis and is not an extraction artifact. (author)

β-Glucan induces reactive oxygen species production in human neutrophils to improve the killing of Candida albicans and Candida glabrata isolates from vulvovaginal candidiasis.

Directory of Open Access Journals (Sweden)

Patricia de Souza Bonfim-Mendonça

Full Text Available Vulvovaginal candidiasis (VVC is among the most prevalent vaginal diseases. Candida albicans is still the most prevalent species associated with this pathology, however, the prevalence of other Candida species, such as C. glabrata, is increasing. The pathogenesis of these infections has been intensely studied, nevertheless, no consensus has been reached on the pathogenicity of VVC. In addition, inappropriate treatment or the presence of resistant strains can lead to RVVC (vulvovaginal candidiasis recurrent. Immunomodulation therapy studies have become increasingly promising, including with the β-glucans. Thus, in the present study, we evaluated microbicidal activity, phagocytosis, intracellular oxidant species production, oxygen consumption, myeloperoxidase (MPO activity, and the release of tumor necrosis factor α (TNF-α, interleukin-8 (IL-8, IL-1β, and IL-1Ra in neutrophils previously treated or not with β-glucan. In all of the assays, human neutrophils were challenged with C. albicans and C. glabrata isolated from vulvovaginal candidiasis. β-glucan significantly increased oxidant species production, suggesting that β-glucan may be an efficient immunomodulator that triggers an increase in the microbicidal response of neutrophils for both of the species isolated from vulvovaginal candidiasis. The effects of β-glucan appeared to be mainly related to the activation of reactive oxygen species and modulation of cytokine release.

Measuring (1,3)-β-D-glucan in tracheal aspirate, bronchoalveolar lavage fluid, and serum for detection of suspected Candida pneumonia in immunocompromised and critically ill patients: a prospective observational study.

Science.gov (United States)

Su, Kang-Cheng; Chou, Kun-Ta; Hsiao, Yi-Han; Tseng, Ching-Min; Su, Vincent Yi-Fong; Lee, Yu-Chin; Perng, Diahn-Warng; Kou, Yu Ru

2017-04-08

While Candida pneumonia is life-threatening, biomarker measurements to early detect suspected Candida pneumonia are lacking. This study compared the diagnostic values of measuring levels of (1, 3)-β-D-glucan in endotracheal aspirate, bronchoalveolar lavage fluid, and serum to detect suspected Candida pneumonia in immunocompromised and critically ill patients. This prospective, observational study enrolled immunocompromised, critically ill, and ventilated patients with suspected fungal pneumonia in mixed intensive care units from November 2010 to October 2011. Patients with D-glucan confounding factors or other fungal infection were excluded. Endotracheal aspirate, bronchoalveolar lavage fluid and serum were collected from each patient to perform a fungal smear, culture, and D-glucan assay. After screening 166 patients, 31 patients completed the study and were categorized into non-Candida pneumonia/non-candidemia (n = 18), suspected Candida pneumonia (n = 9), and non-Candida pneumonia/candidemia groups (n = 4). D-glucan levels in endotracheal aspirate or bronchoalveolar lavage were highest in suspected Candida pneumonia, while the serum D-glucan level was highest in non-Candida pneumonia/candidemia. In all patients, the D-glucan value in endotracheal aspirate was positively correlated with that in bronchoalveolar lavage fluid. For the detection of suspected Candida pneumonia, the predictive performance (sensitivity/specificity/D-glucan cutoff [pg/ml]) of D-glucan in endotracheal aspirate and bronchoalveolar lavage fluid was 67%/82%/120 and 89%/86%/130, respectively, accounting for areas under the receiver operating characteristic curve of 0.833 and 0.939 (both P pneumonia in the absence of concurrent candidemia. D-glucan levels in both endotracheal aspirate and bronchoalveolar lavage, but not in serum, provide good diagnostic values to detect suspected Candida pneumonia and to serve as potential biomarkers for early detection in this patient population.

Specific radioimmunoassay of human. beta. -endorphin in unextracted plasma

Energy Technology Data Exchange (ETDEWEB)

Wiedemann, E. (Univ. of California, Berkeley); Saito, T.; Linfoot, J.A.; Li, C.H.

1979-09-01

With an antiserum against human ..beta..-endorphin (..beta..-EP) crossreacting <2% with human ..beta..-lipotropin (..beta..-LPH) by weight we have developed a radioimmunoassay that can detect 1 pg ..beta..-EP in diluted raw plasma. In a.m. fasting plasma of 14 normal subjects ..beta..-EP ranged from <5 to 45 pg/ml. ..beta..-EP was elevated in untreated, but normal in successfully treated Cushing's disease; undetectable in a patient with adrenal adenoma; extremely high in Nelson's syndrome; and elevated in a patient with bronchogenic carcinoma before, but undetectable after tumor resection. In subjects with intact hypothalamic-pituitary-adrenal axis, ..beta..-EP was undectectable after dexamethasone and increased after metyrapone administration and insulin-induced hypoglycemia. ..beta..-EP concentration was considerably lower in serum than in simultaneously collected plasma, but increased in serum left unfrozen for several hours after clot removal. Thus, ..beta..-EP behaves like a hormone responding to the same stimuli as ACTH and ..beta..-LPH and blood appears to contain enzymes both generating and destroying immunoreactive ..beta..-EP.

Synthesis of cell wall xylans and glucans by golgi membranes

International Nuclear Information System (INIS)

Gibeaut, D.M.; Carpita, N.C.

1989-01-01

We investigated the biosynthesis of mixed-linkage β-D-glucan and glucuronoarabinoxylans which make up the hemicellulosic matrix of the primary cell walls of maize and other cereal grasses. The Golgi apparatus was enriched from plasma membrane and other organelles by flotation density gradient centrifugation. Glucan synthase I and II, which are established markers for Golgi and plasma membrane, respectively, displayed considerable overlap in conventional separations with sucrose density gradients. Flotation gradients improved separation of the membranes substantially, but the different synthases themselves also incorporated radioactivity from either 10 μM or 1 mM UDP-[ 14 C]-glucose into polymer. Relative incorporation of radioactivity into polymers from UDP-[ 14 C]-xylose by the various membrane fractions was nearly identical to relative IDPase activities, indicating that combined xylosyl transferase-xylan synthase represents a new, unequivocal marker for the Golgi apparatus. We also have developed techniques of gas-liquid chromatography and radiogas proportional counting to achieve capillary quality separation of partially methylated alditol acetates with simultaneous determination of radioactivity in the derivatives. Digestion of polymeric products by specific endo-glycanohydrolases to diagnostic oligosaccharides also reveal specific kinds of polysaccharides synthesized by the Golgi membranes. A combination of these techniques provides unequivocal determination of the linkage structure of specific polymers synthesized by the purified Golgi apparatus

β-Glucans and Resistant Starch Alter the Fermentation of Recalcitrant Fibers in Growing Pigs.

Directory of Open Access Journals (Sweden)

Sonja de Vries

Full Text Available Interactions among dietary ingredients are often assumed non-existent when evaluating the nutritive value and health effects of dietary fiber. Specific fibers can distinctly affect digestive processes; therefore, digestibility and fermentability of the complete diet may depend on fiber types present. This study aimed to evaluate the effects of readily fermentable fibers (β-glucans and resistant starch on the degradation of feed ingredients containing more persistent, recalcitrant, fibers. Six semi-synthetic diets with recalcitrant fibers from rapeseed meal (pectic polysaccharides, xyloglucans, and cellulose or corn distillers dried grain with solubles (DDGS; (glucuronoarabinoxylans and cellulose with or without inclusion of β-glucans (6% or retrograded tapioca (40% substituted for corn starch were formulated. Six ileal-cannulated pigs (BW 28±1.4 kg were assigned to the diets according to a 6×6 Latin square. β-glucan-extract increased apparent total tract digestibility (ATTD of non-glucosyl polysaccharides (accounting for ~40% of the fiber-fraction from rapeseed meal (6%-units, P10%-units, P<0.001, indicating that the large amount of resistant starch entering the hindgut was preferentially degraded over recalcitrant fibers from rapeseed meal and DDGS, possibly related to reduced hindgut-retention time following the increased intestinal bulk. Fermentation of fiber sources was not only dependent on fiber characteristics, but also on the presence of other fibers in the diet. Hence, interactions in the gastrointestinal tract among fibrous feed ingredients should be considered when evaluating their nutritive value.

Las β-(1®3-glucanas: moléculas inmunomoduladoras contaminantes de productos farmacéuticos β-(1®3-glucans as immunomodulating moléculas polluting pharmaceuticals

Directory of Open Access Journals (Sweden)

Zenia Pardo Ruiz

2012-03-01

Full Text Available Se realizó una búsqueda bibliográfica utilizando la base de datos Pubmed con énfasis en los artículos publicados en la última década. Como descriptores se utilizaron los siguientes: glucans, glucans recognition, glucans biological activitiy, glucans pharmaceuticals. Con la información disponible se realizó un análisis de los principales aspectos relacionados con el tema, que se exponen en el presente trabajo. Las b-(1®3-glucanas son polímeros de glucosa que se encuentran mayoritariamente en la pared celular de hongos, levaduras y plantas. Se consideran patrones moleculares asociados a patógenos y son reconocidas por varios receptores, siendo la dectina-1 el principal receptor de reconocimiento de estas estructuras. Sus propiedades inmunomoduladoras han sido informadas por varios autores. Se ha demostrado que potencian y sinergizan la acción de ligandos de Toll like receptors sobre la liberación de citoquinas proinflamatorias, aunque también han mostrado un perfil antiinflamatorio, cuestión que depende en gran medida de sus características estructurales. Las b-(1®3-glucanas son contaminantes importantes provenientes de los filtros de acetato de celulosa que se utilizan en la clarificación de parenterales hemoderivados, por tanto, es necesario estudiar las consecuencias de la presencia de estas moléculas inmunomoduladoras en inyectables. En esta revisión se resumen aspectos relacionados con el reconocimiento y actividad biológica de las b-(1®3-glucanas y se profundiza en estudios relacionados con su presencia en hemoderivados como principal contaminante. Finalmente se destaca la utilidad de la Prueba de Activación de Monocitos en la detección de las b-(1®3-glucanas en parenterales.A literature review was made in Pubmed database, making emphasis on papers published in the last decade. The subject headings for this search were glucans, glucans recognition, glucans biological activitiy, glucans pharmaceuticals. On the basis

Redox-dependent interaction between thaumatin-like protein and β-glucan influences malting quality of barley.

Science.gov (United States)

Singh, Surinder; Tripathi, Rajiv K; Lemaux, Peggy G; Buchanan, Bob B; Singh, Jaswinder

2017-07-18

Barley is the cornerstone of the malting and brewing industry. It is known that 250 quantitative trait loci (QTLs) of the grain are associated with 19 malting-quality phenotypes. However, only a few of the contributing genetic components have been identified. One of these, on chromosome 4H, contains a major malting QTL, QTL2, located near the telomeric region that accounts, respectively, for 28.9% and 37.6% of the variation in the β-glucan and extract fractions of malt. In the current study, we dissected the QTL2 region using an expression- and microsynteny-based approach. From a set of 22 expressed sequence tags expressed in seeds at the malting stage, we identified a candidate gene, TLP8 ( thaumatin-like protein 8 ), which was differentially expressed and influenced malting quality. Transcript abundance and protein profiles of TLP8 were studied in different malt and feed varieties using quantitative PCR, immunoblotting, and enzyme-linked immunosorbent assay (ELISA). The experiments demonstrated that TLP8 binds to insoluble (1, 3, 1, 4)-β-D glucan in grain extracts, thereby facilitating the removal of this undesirable polysaccharide during malting. Further, the binding of TLP8 to β-glucan was dependent on redox. These findings represent a stride forward in our understanding of the malting process and provide a foundation for future improvements in the final beer-making process.

Phosphorylated alpha(1 leads to 4) glucans as substrate for potato starch-branching enzyme I

International Nuclear Information System (INIS)

Vikso-Nielsen, A.; Blennow, A.; Nielsen, T.H.; Moller, B.L.

1998-01-01

The possible involvement of potato (Solanum tuberosum L.) starch-branching enzyme I (PSBE-I) in the in vivo synthesis of phosphorylated amylopectin was investigated in in vitro experiments with isolated PSBE-I using 33P-labeled phosphorylated and 3H end-labeled nonphosphorylated alpha(1 leads to 4) glucans as the substrates. From these radiolabeled substrates PSBE-I was shown to catalyze the formation of dual-labeled (3H/33P) phosphorylated branched polysaccharides with an average degree of polymerization of 80 to 85. The relatively high molecular mass indicated that the product was the result of multiple chain-transfer reactions. The presence of alpha(1 leads to 6) branch points was documented by isoamylase treatment and anion-exchange chromatography. Although the initial steps of the in vivo mechanism responsible for phosphorylation of potato starch remains elusive, the present study demonstrates that the enzyme machinery available in potato has the ability to incorporate phosphorylated alpha(1 leads to 4) glucans into neutral polysaccharides in an interchain catalytic reaction. Potato mini tubers synthesized phosphorylated starch from exogenously supplied 33PO4(3-) and [U-14C]Glc at rates 4 times higher than those previously obtained using tubers from fully grown potato plants. This system was more reproducible compared with soil-grown tubers and was therefore used for preparation of 33P-labeled phosphorylated alpha(1 leads to 4) glucan chains

Importance of Lipopolysaccharide and Cyclic β-1,2-Glucans in Brucella-Mammalian Infections

Directory of Open Access Journals (Sweden)

Andreas F. Haag

2010-01-01

Full Text Available Brucella species are the causative agents of one of the most prevalent zoonotic diseases: brucellosis. Infections by Brucella species cause major economic losses in agriculture, leading to abortions in infected animals and resulting in a severe, although rarely lethal, debilitating disease in humans. Brucella species persist as intracellular pathogens that manage to effectively evade recognition by the host's immune system. Sugar-modified components in the Brucella cell envelope play an important role in their host interaction. Brucella lipopolysaccharide (LPS, unlike Escherichia coli LPS, does not trigger the host's innate immune system. Brucella produces cyclic β-1,2-glucans, which are important for targeting them to their replicative niche in the endoplasmic reticulum within the host cell. This paper will focus on the role of LPS and cyclic β-1,2-glucans in Brucella-mammalian infections and discuss the use of mutants, within the biosynthesis pathway of these cell envelope structures, in vaccine development.

Role of anionic charges of periplasmic glucans of Shigella flexneri in overcoming detergent stress

Science.gov (United States)

Osmoregulated periplasmic glucans (OPGs) are synthesized by the members of the family Enterobacteriaceae when grown under low osmotic growth conditions. Enteropathogens such as Shigella flexneri spend considerable time outside the host environment such as irrigation waters where low nutrient low os...

Thermal stability and haemolytic effects of depolymerized guar gum derivatives.

Science.gov (United States)

Hussain, Majid; Zahoor, Tahir; Akhtar, Saeed; Ismail, Amir; Hameed, Aneela

2018-03-01

The purpose of current study was to purify and partially depolymerize guar gum by β-mannanase, HCl, Ba(OH) 2 actions and subjected to inspect compositional, thermogravimetric analysis (TGA) and haemolytic activity. Chemical composition revealed mannose and galactose ratio remained un-altered even after process of purification and hydrolysis. TGA thermograms affirmed initial and final decomposition temperature in various zones. Major decomposition stages apparently revealed partially hydrolyzed guar gum (PHGG) exhibited better heat stable properties having more zones of degradation than crude one. Furthermore, all guar fractions (2.5-250 mg/mL) were subjected to haemolysis to evaluate toxic effects during process of hydrolysis. The crude and hydrolyzed guar galactomannans exhibited minor haemolytic activity (1.9 ± 0.03-7.24 ± 0.02%) when compared to 0.1% Triton-X 100 (100% haemolysis) showing no toxic effects to human RBC's. Conclusively, hydrolyzed guar-galactomannans are safe and can be used in food products with improved heat stability.

Complementary sample preparation strategies for analysis of cereal β-glucan oxidation products by UPLC-MS/MS

Science.gov (United States)

Boulos, Samy; Nyström, Laura

2017-11-01

The oxidation of cereal (1→3,1→4)-β-D-glucan can influence the health promoting and technological properties of this linear, soluble homopolysaccharide by introduction of new functional groups or chain scission. Apart from deliberate oxidative modifications, oxidation of β-glucan can already occur during processing and storage, which is mediated by hydroxyl radicals (HO•) formed by the Fenton reaction. We present four complementary sample preparation strategies to investigate oat and barley β-glucan oxidation products by hydrophilic interaction ultra-performance liquid chromatography-tandem mass spectrometry (UPLC-MS/MS), employing selective enzymatic digestion, graphitized carbon solid phase extraction (SPE), and functional group labeling techniques. The combination of these methods allows for detection of both lytic (C1, C3/4, C5) and non-lytic (C2, C4/3, C6) oxidation products resulting from HO•-attack at different glucose-carbons. By treating oxidized β-glucan with lichenase and β-glucosidase, only oxidized parts of the polymer remained in oligomeric form, which could be separated by SPE from the vast majority of non-oxidized glucose units. This allowed for the detection of oligomers with mid-chain glucuronic acids (C6) and carbonyls, as well as carbonyls at the non-reducing end from lytic C3/C4 oxidation. Neutral reducing ends were detected by reductive amination with anthranilic acid/amide as labeled glucose and cross-ring cleaved units (arabinose, erythrose) after enzyme treatment and SPE. New acidic chain termini were observed by carbodiimide-mediated amidation of carboxylic acids as anilides of gluconic, arabinonic, and erythronic acids. Hence, a full characterization of all types of oxidation products was possible by combining complementary sample preparation strategies. Differences in fine structure depending on source (oat vs. barley) translates to the ratio of observed oxidized oligomers, with in-depth analysis corroborating a random HO�

A plasmodesmata-associated beta-1,3-glucanase in Arabidopsis.

Science.gov (United States)

Levy, Amit; Erlanger, Michael; Rosenthal, Michal; Epel, Bernard L

2007-02-01

Plasmodesmal conductivity is regulated in part by callose turnover, which is hypothesized to be determined by beta-1,3-glucan synthase versus glucanase activities. A proteomic analysis of an Arabidopsis thaliana plasmodesmata (Pd)-rich fraction identified a beta-1,3-glucanase as present in this fraction. The protein encoded by the putative plasmodesmal associated protein (ppap) gene, termed AtBG_ppap, had previously been found to be a post-translationally modified glycosylphosphatidylinositol (GPI) lipid-anchored protein. When fused to green fluorescent protein (GFP) and expressed in tobacco (Nicotiana tabacum) or Nicotiana benthamiana epidermal cells, this protein displays fluorescence patterns in the endoplasmic reticulum (ER) membrane system, along the cell periphery and in a punctate pattern that co-localizes with aniline blue-stained callose present around the Pd. Plasma membrane localization was verified by co-localization of AtBG_ppap:GFP together with a plasma membrane marker N-[3-triethylammoniumpropyl]-4-[p-diethylaminophenylhexatrienyl] pyridinium dibromide (FM4-64) in plasmolysed cells. In Arabidopsis T-DNA insertion mutants that do not transcribe AtBG_ppap, functional studies showed that GFP cell-to-cell movement between epidermal cells is reduced, and the conductivity coefficient of Pd is lower. Measurements of callose levels around Pd after wounding revealed that callose accumulation in the mutant plants was higher. Taken together, we suggest that AtBG_ppap is a Pd-associated membrane protein involved in plasmodesmal callose degradation, and functions in the gating of Pd.

Characterization and immunomodulatory effects of glucans from Pleurotus albidus, a promising species of mushroom for farming and biomass production.

Science.gov (United States)

Castro-Alves, Victor Costa; Gomes, Daniel; Menolli, Nelson; Sforça, Maurício Luís; Nascimento, João Roberto Oliveira do

2017-02-01

Polysaccharides from a number of mushroom species are recognized as functional food ingredients with potential health benefits, including immunomodulatory effects. In this study, polysaccharides extracted from the basidiome with cold water (BaCW), hot water (BaHW), and hot alkali (BaHA) solution, and exo- (MyEX) and endopolysaccharides (MyEN) from the submerged culture of Pleurotus albidus, a promising species for farming and biomass production, were analyzed for their chemical composition and structure and immunomodulatory effects on macrophages. Compositional (HPAEC-PAD and HPSEC-RID/MWD) and structural (FT-IR, 1D- and 2D-NMR) analyses identified BaCW and MyEX as β-(1,6)-branched β-(1,3)-glucans, BaHW and MyEN as α-(1,3)-(1,2)-branched α-(1,6)-glucans, and BaHA as a mixture of α-(1,6)- and β-(1,3)-glucans. BaCW and MyEX stimulated the production of tumor necrosis factor alpha (TNF-α) and nitric oxide (NO), but not interleukin-6 (IL-6), and decreased phagocytosis of zymosan particles. In contrast, BaHW and MyEN induced TNF-α, NO and IL-6 production, and increased zymosan phagocytosis, while BaHA displayed intermediary effects in comparison the other polysaccharides. In conclusion, the basidiome and the submerged culture of P. albidus are sources of easily extractable α- and β-glucans with potential immunomodulatory effects. Copyright © 2016 Elsevier B.V. All rights reserved.

(1-3)(1-6)-β-glucan-enriched materials from Lentinus edodes mushroom as a high-fibre and low-calorie flour substitute for baked foods.

Science.gov (United States)

Kim, Juyoung; Lee, Seung Mi; Bae, In Young; Park, Hyuk-Gu; Gyu Lee, Hyeon; Lee, Suyong

2011-08-15

Extensive physiological and biological emphasis has been placed on pharmaceutical and medicinal uses of mushrooms containing β-glucans, but their incorporation into processed functional foods is quite limited. Thus, low-grade Lentinus edodes mushrooms were utilised to produce β-glucan-enriched materials (BGEMs), which were evaluated as a high-fibre and low-calorie substitute for wheat flour. The fractions obtained from Lentinus edodes mushrooms contained 514 g kg⁻¹ of (1-3)-β-glucans with (1-6)-β-linked side chains and the chemical structure was confirmed by ¹³C NMR and FTIR spectroscopy. Replacement of a portion of the wheat flour with BGEMs resulted in the solutions with lower values of pasting parameters and also caused significant changes in starch gelatinisation. When BGEMs were incorporated into cake formulations, batter viscosity increased with more shear-thinning behaviours and elastic properties improved. Overall, the cakes containing more BGEMs showed decreased volume and increased hardness while no significant differences were observed between the control and BGEM cakes containing 1 g of β-glucan per serving. As a wheat flour substitute, the BGEMs that were prepared from low-grade Lentinus edodes mushrooms, could be successfully used to produce cakes containing 1 g of β-glucan per serving with quality attributes similar to those of the control. Copyright © 2011 Society of Chemical Industry.

Synthesis and evaluation of di- and trimeric hydroxylamine-based β-(1→3)-glucan mimetics.

Science.gov (United States)

Ferry, Angélique; Malik, Gaëlle; Guinchard, Xavier; Vĕtvička, Václav; Crich, David

2014-10-22

Di- and trimeric hydroxylamine-based mimetics of β-(1→3)-glucans have been accessed by an asymmetric synthesis route featuring an iterative double ring-closing reductive amination reaction. These oligomeric hydroxylamines are demonstrated to inhibit the staining of human neutrophils and of mouse macrophages by fluorescent anti-CR3 and anti-dectin-1 antibodies, respectively, and to stimulate phagocytosis, all in a linkage-dependent manner suggestive of binding to the lectin domains of complement receptor 3 (CR3) and dectin-1. The ability of these relatively short mimetics to bind to CR3 and dectin-1, as compared to the greater degree of polymerization required in β-(1→3)-glucans, is discussed in terms of the increased hydrophobicity of the α-face on replacement of the glycosidic bond by the hydroxylamine linkage.

Thyroid Hormone Receptor Beta in the Ventromedial Hypothalamus Is Essential for the Physiological Regulation of Food Intake and Body Weight

Directory of Open Access Journals (Sweden)

Saira Hameed

2017-06-01

Full Text Available The obesity epidemic is a significant global health issue. Improved understanding of the mechanisms that regulate appetite and body weight will provide the rationale for the design of anti-obesity therapies. Thyroid hormones play a key role in metabolic homeostasis through their interaction with thyroid hormone receptors (TRs, which function as ligand-inducible transcription factors. The TR-beta isoform (TRβ is expressed in the ventromedial hypothalamus (VMH, a brain area important for control of energy homeostasis. Here, we report that selective knockdown of TRβ in the VMH of adult mice results in severe obesity due to hyperphagia and reduced energy expenditure. The observed increase in body weight is of a similar magnitude to murine models of the most extreme forms of monogenic obesity. These data identify TRβ in the VMH as a major physiological regulator of food intake and energy homeostasis.

Enzymatic hydrolysis on protein and β-glucan content of Sang-yodrice bran hydrolysatesand their anti-inflammatory activityonRAW 264.7 cells

Directory of Open Access Journals (Sweden)

Natcha Phantuwong

2017-12-01

Full Text Available Background: Research focusing on the improvement of the utilization of rice bran is increasing due to its nutritional properties. Several biological activities of rice bran hydrolysates and its constituents have been reported. Sang-yod rice, a local rice variety in Southern of Thailand, is a pigmented rice. Furthermore, its bran has high nutritive value and health beneficial components. Accordingly, there is growing interest in transforming this by-product into a functional food ingredient. Objective: To investigate the effect of enzymatic hydrolysis processes on the digestion of protein and β-glucan and evaluate anti-proinflammatory properties of selected hydrolysates on RAW 264.7 macrophage cells. Method: Sang-yod rice bran hydrolysates were obtained using a single or co-enzymatic hydrolysis process and sequential hydrolysis process using amyloglucosidase and protease G6. Effects of enzyme concentration (3-5% v/w and hydrolysis duration (30, 60, and 120 min on soluble protein and β-glucan contents of obtained rice bran hydrolysates were evaluated. The selected rice bran hydrolysates were evaluated for their cell viability and inhibition against NO and pro-inflammatory cytokines generation on RAW 264.7 mouse macrophage cell lines. Results: Protein content (0.59-3.37 % of the rice bran hydrolysates (RBHs was increased by increasing of enzyme concentration (3-5% v/w and hydrolysis time (60-120 min. However, the β-glucan content (0.88-4.63% of RBHs decreased with the increase of those parameters. The RBHs derived by the sequential process using 5% v/w enzyme concentration and 60 min hydrolysis time gave high protein (3.23% and high β-glucan (4.02% contents. The hydrolysates with high amount of protein and/or β-glucan contents demonstrated no cytotoxicity against RAW 264.7 cells at concentration range of 100-2,000 μg/ml. Additionally, they demonstrated NO inhibition and pro-inflammatory inhibition ranges of 49.09-71.63% and 9

Nasal hyperresponders and atopic subjects report different symptom intensity to air quality: a climate chamber study

DEFF Research Database (Denmark)

Bodin, Lennart; Andersson, K.; Bønløkke, Jakob Hjort

2009-01-01

Short-term exposure to dust and dust added with beta-(1,3)-d-glucan or aldehydes may cause sensory reactions. In random order, we exposed 36 volunteers in a climate chamber to clean air, office dust, dust with glucan, and dust with aldehydes. Three groups of subjects were exposed, eleven were non......, significance mainly because of the nasal hyperreactive group). Exposure to dust, with or without glucan or aldehydes, showed increased discomfort measured by the index for Constant Indoor Climate, and dust with glucan had a similar effect for the index for Lower Respiratory Effects. For Psychological...

Escherichia coli Phosphoenolpyruvate Dependent Phosphotransferase System. Copurification of HPr and α1-6 Glucan

NARCIS (Netherlands)

Dooijewaard, G.; Roossien, F.F.; Robillard, G.T.

1979-01-01

A rapid, high-yield procedure has been developed for the purification of HPr from the Escherichia coli phosphoenolpyruvate dependent phosphotransferase system. During this procedure, the protein copurifies with a 2500-dalton homopolysaccharide which we have identified as α1-6 glucan. The results of

Effects of β-glucan polysaccharide revealed by the dominant lethal assay and micronucleus assays, and reproductive performance of male mice exposed to cyclophosphamide

Directory of Open Access Journals (Sweden)

Rodrigo Juliano Oliveira

2014-01-01

Full Text Available β-glucan is a well-known polysaccharide for its chemopreventive effect. This study aimed to evaluate the chemopreventive ability of β-glucan in somatic and germ cells through the dominant lethal and micronucleus assays, and its influence on the reproductive performance of male mice exposed to cyclophosphamide. The results indicate that β-glucan is capable of preventing changes in DNA in both germ cells and somatic ones. Changes in germ cells were evaluated by the dominant lethal assay and showed damage reduction percentages of 46.46% and 43.79% for the doses of 100 and 150 mg/kg. For the somatic changes, evaluated by micronucleus assay in peripheral blood cells in the first week of treatment, damage reduction percentages from 80.63-116.32% were found. In the fifth and sixth weeks, the percentage ranged from 10.20-52.54% and -0.95-62.35%, respectively. Besides the chemopreventive efficiency it appears that the β-glucan, when combined with cyclophosphamide, is able to improve the reproductive performance of males verified by the significant reduction in rates of post-implantation losses and reabsorption in the mating of nulliparous females with males treated with cyclophosphamide.

High molecular weight of polysaccharides from Hericium erinaceus against amyloid beta-induced neurotoxicity.

Science.gov (United States)

Cheng, Jai-Hong; Tsai, Chia-Ling; Lien, Yi-Yang; Lee, Meng-Shiou; Sheu, Shyang-Chwen

2016-06-07

Hericium erinaceus (HE) is a well-known mushroom in traditional Chinese food and medicine. HE extracts from the fruiting body and mycelia not only exhibit immunomodulatory, antimutagenic and antitumor activity but also have neuroprotective properties. Here, we purified HE polysaccharides (HEPS), composed of two high molecular weight polysaccharides (1.7 × 10(5) Da and 1.1 × 10(5) Da), and evaluated their protective effects on amyloid beta (Aβ)-induced neurotoxicity in rat pheochromocytoma PC12 cells. HEPS were prepared and purified using a 95 % ethanol extraction method. The components of HEPS were analyzed and the molecular weights of the polysaccharides were determined using high-pressure liquid chromatography (HPLC). The neuroprotective effects of the polysaccharides were evaluated through a 2,2-diphenyl-1-picrylhydrazyl (DPPH) radical scavenging assay and an MTT assay and by quantifying reactive oxygen species (ROS) and mitochondrial membrane potentials (MMP) of Aβ-induced neurotoxicity in cells. Our results showed that 250 μg/ml HEPS was harmless and promoted cell viability with 1.2 μM Aβ treatment. We observed that the free radical scavenging rate exceeded 90 % when the concentration of HEPS was higher than 1 mg/mL in cells. The HEPS decreased the production of ROS from 80 to 58 % in a dose-dependent manner. Cell pretreatment with 250 μg/mL HEPS significantly reduced Aβ-induced high MMPs from 74 to 51 % and 94 to 62 % at 24 and 48 h, respectively. Finally, 250 μg/mL of HEPS prevented Aβ-induced cell shrinkage and nuclear degradation of PC12 cells. Our results demonstrate that HEPS exhibit antioxidant and neuroprotective effects on Aβ-induced neurotoxicity in neurons.

The effect of oyster mushroom β-1.3/1.6-D-glucan and oxytetracycline antibiotic on biometrical, haematological, biochemical, and immunological indices, and histopathological changes in common carp (Cyprinus carpio L.).

Science.gov (United States)

Dobšíková, Radka; Blahová, Jana; Mikulíková, Ivana; Modrá, Helena; Prášková, Eva; Svobodová, Zdeňka; Skorič, Mišo; Jarkovský, Jiří; Siwicki, Andrzej-Krzysztof

2013-12-01

The aim of the study was to evaluate the effect of micronized β-1.3/1.6-D-glucan (BG) derived from the oyster mushroom Pleurotus ostreatus Hiratake and tetracycline antibiotic oxytetracycline (OTC) on biometrical, haematological, biochemical, and immunological indices, and histopathological changes in tissues of one- to two-year-old common carp (Cyprinus carpio L.). The fish tested were divided into five experimental groups and one control. Carp in the control group were fed commercial carp feed pellets. Fish in the five experimental groups were fed the same pellets supplemented with either OTC, a combination of OTC and BG, or BG as follows: 75 mg oxytetracycline kg(-1) bw (OTC group), 75 mg oxytetracycline kg(-1) bw and 0.5% β-glucan (OTC + 0.5% BG group), 75 mg oxytetracycline kg(-1) bw and 2.0% β-glucan (OTC + 2.0% BG group), 0.5% β-glucan (0.5% BG group), and 2.0% β-glucan (2.0% BG group). OTC- and BG-supplemented diets and the control diet were administered to experimental and control carp for 50 days (i.e. samplings 1-3, the exposure period); for the following 14 days, fish were fed only control feed pellets with no OTC or BG supplementation (i.e. sampling 4, the recovery period). Blood and tissue samples were collected both during, and at the end of the study. No significant changes in biometrical indices (i.e. total length, standard length, total weight, hepatosomatic and spleen somatic index, and Fulton's condition factor) were found in experimental carp compared to control in any sampling. In haematological indices, significant changes were found only in sampling 2, in which shifts in PCV (P < 0.01), Hb (P < 0.01), and WBC (P < 0.01), and in the counts of lymphocytes (P < 0.01), monocytes (P < 0.01), and neutrophil granulocytes-segments (P < 0.05) were revealed. As for biochemical profiling, plasma concentrations of glucose, albumins, cholesterol, natrium, and chlorides (all P < 0.01), and total proteins, lactate, phosphorus, and potassium (all P < 0

Dietary β-glucans differentially modulate immune and stress-related gene expression in lymphoid organs from healthy and Aeromonas hydrophila-infected rainbow trout (Oncorhynchus mykiss).

Science.gov (United States)

Douxfils, Jessica; Fierro-Castro, Camino; Mandiki, S N M; Emile, Wakson; Tort, Lluis; Kestemont, Patrick

2017-04-01

Although β-glucans stimulating effects have already been demonstrated on the immune system of numerous animal species, available data remain relatively variable and more research should be done regarding the complexity of underlying mechanisms. In this context, the present study aimed to evaluate the stress and immune-related effects of dietary β-glucans (i.e. Macrogard ® ) by considering a number of influencing factors such as the dose (0, 0.1, 0.2 and 0.5% in food), feeding duration (15 versus 30 days), tissue (blood, kidney, spleen, gills) and infection status (healthy or infected). Blood parameters (lysozyme, ACH50 activities, leucocyte populations) and mRNA expression level of several immune- and stress-related genes (TFN-α1, IL-1β, IL10, COX-2, TGF-β, MC2R, HSP70) were measured. Our results suggest that spleen may be a highly responsive organ to dietary β-glucans both in healthy or infected fish, and that this organ may therefore significantly contribute to the immune reinforcement induced by such immunostimulatory diet. Our study further reveals that overdoses of β-glucans and/or prolonged medication can lead to a non-reactive physiological status and, consequently, to a poor immune response. All in all, the current data emphasizes the need for further extensive research in the field of dietary β-glucans as a preventive method for farmed fish protection. Copyright © 2017 Elsevier Ltd. All rights reserved.

Natural products and biological activity of the pharmacologically active cauliflower mushroom Sparassis crispa.

Science.gov (United States)

Kimura, Takashi

2013-01-01

Sparassis crispa, also known as cauliflower mushroom, is an edible mushroom with medicinal properties. Its cultivation became popular in Japan about 10 years ago, a phenomenon that has been attributed not only to the quality of its taste, but also to its potential for therapeutic applications. Herein, I present a comprehensive summary of the pharmacological activities and mechanisms of action of its bioactive components, such as beta-glucan, and other physiologically active substances. In particular, the immunomodulatory mechanisms of the beta-glucan components are presented herein in detail.

Natural Products and Biological Activity of the Pharmacologically Active Cauliflower Mushroom Sparassis crispa

Directory of Open Access Journals (Sweden)

Takashi Kimura

2013-01-01

Full Text Available Sparassis crispa, also known as cauliflower mushroom, is an edible mushroom with medicinal properties. Its cultivation became popular in Japan about 10 years ago, a phenomenon that has been attributed not only to the quality of its taste, but also to its potential for therapeutic applications. Herein, I present a comprehensive summary of the pharmacological activities and mechanisms of action of its bioactive components, such as beta-glucan, and other physiologically active substances. In particular, the immunomodulatory mechanisms of the beta-glucan components are presented herein in detail.

β-Glucan and Dark Chocolate: A Randomized Crossover Study on Short-Term Satiety and Energy Intake

Directory of Open Access Journals (Sweden)

Asli Akyol

2014-09-01

Full Text Available Aim: The aims of this study were to adapt a traditional recipe into a healthier form by adding 3 g of oat β-glucan, substituting milk chocolate to dark chocolate with 70% cocoa, and to examine the effect of these alterations on short-term satiety and energy intake. Materials and Methods: Study subjects (n = 25 were tested in a randomized, crossover design with four products closely matched for energy content. Four different versions of a traditional recipe including milk chocolate-control (CON, oat β-glucan (B-GLU, dark chocolate (DARK or oat β-glucan and dark chocolate (B-GLU + DARK were given to subjects on different test days. After subjects were asked to report visual analog scale (VAS scores on sensory outcomes and related satiety for four hours ad libitum, lunch was served and energy intake of individuals was measured. Results: VAS scores indicated that none of the test foods exerted an improved effect on satiety feelings. However, energy intake of individuals during ad libitum lunch was significantly lower in dark chocolate groups (CON: 849.46 ± 47.45 kcal versus DARK: 677.69 ± 48.45 kcal and B-GLU + DARK: 691.08 ± 47.45 kcal, p = 0.014. Conclusion: The study demonstrated that substituting dark chocolate for milk chocolate is more effective in inducing satiety during subsequent food intake in healthy subjects.

β-Glucan and dark chocolate: a randomized crossover study on short-term satiety and energy intake.

Science.gov (United States)

Akyol, Asli; Dasgin, Halil; Ayaz, Aylin; Buyuktuncer, Zehra; Besler, H Tanju

2014-09-23

The aims of this study were to adapt a traditional recipe into a healthier form by adding 3 g of oat β-glucan, substituting milk chocolate to dark chocolate with 70% cocoa, and to examine the effect of these alterations on short-term satiety and energy intake. Study subjects (n = 25) were tested in a randomized, crossover design with four products closely matched for energy content. Four different versions of a traditional recipe including milk chocolate-control (CON), oat β-glucan (B-GLU), dark chocolate (DARK) or oat β-glucan and dark chocolate (B-GLU + DARK) were given to subjects on different test days. After subjects were asked to report visual analog scale (VAS) scores on sensory outcomes and related satiety for four hours ad libitum, lunch was served and energy intake of individuals was measured. VAS scores indicated that none of the test foods exerted an improved effect on satiety feelings. However, energy intake of individuals during ad libitum lunch was significantly lower in dark chocolate groups (CON: 849.46 ± 47.45 kcal versus DARK: 677.69 ± 48.45 kcal and B-GLU + DARK: 691.08 ± 47.45 kcal, p = 0.014). The study demonstrated that substituting dark chocolate for milk chocolate is more effective in inducing satiety during subsequent food intake in healthy subjects.

Prevention of Aflatoxin B1-Induced DNA Breaks by β-D-Glucan

Directory of Open Access Journals (Sweden)

Eduardo Madrigal-Bujaidar

2015-06-01

Full Text Available Aflatoxins are a group of naturally-occurring carcinogens that are known to contaminate different human and animal foodstuffs. Aflatoxin B1 (AFB1 is the most genotoxic hepatocarcinogenic compound of all of the aflatoxins. In this report, we explore the capacity of β-D-glucan (Glu to reduce the DNA damage induced by AFB1 in mouse hepatocytes. For this purpose, we applied the comet assay to groups of animals that were first administered Glu in three doses (100, 400 and 700 mg/kg bw, respectively and, 20 min later, 1.0 mg/kg of AFB1. Liver cells were obtained at 4, 10 and 16 h after the chemical administration and examined. The results showed no protection of the damage induced by AFB1 with the low dose of the polysaccharide, but they did reveal antigenotoxic activity exerted by the two high doses. In addition, we induced a co-crystallization between both compounds, determined their fusion points and analyzed the molecules by UV spectroscopy. The data suggested the formation of a supramolecular complex between AFB1 and β-D-glucan.

Novel chitin/chitosan-glucan wound dressing: Isolation, characterization, antibacterial activity and wound healing properties

Czech Academy of Sciences Publication Activity Database

Abdel-Mohsen, A. M.; Jancar, J.; Massoud, D.; Fohlerová, Z.; Elhadidy, Hassan; Spotz, Z.; Hebeish, A.

2016-01-01

Roč. 510, č. 1 (2016), s. 86-99 ISSN 0378-5173 R&D Projects: GA MŠk(CZ) LQ1601 Institutional support: RVO:68081723 Keywords : Chitin/chitosan-glucan complex * Nonwoven mat * Surgical wound healing Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 3.649, year: 2016

Secreted expression of Leuconostoc mesenteroides glucansucrase in Lactococcus lactis for the production of insoluble glucans

Science.gov (United States)

We expressed a glucansucrase, DsrI, from Leuconostoc mesenteroides that catalyzes formation of water-insoluble glucans from sucrose in Lactococcus lactis using a nisin-controlled gene expression system. Production of DsrI was optimized using several different background vectors, signal peptides, str...

Rational Design of Adjuvant for Skin Delivery: Conjugation of Synthetic β-Glucan Dectin-1 Agonist to Protein Antigen.

Science.gov (United States)

Donadei, Agnese; Gallorini, Simona; Berti, Francesco; O'Hagan, Derek T; Adamo, Roberto; Baudner, Barbara C

2015-05-04

The potential benefits of skin delivery of vaccines derive from the presence of a densely connected network of antigen presenting cells in the skin layer, most significantly represented by Langerhans cells and dermal dendritic cells. Targeting these cells by adjuvant conjugated to an antigen should result in enhanced immunogenicity of a vaccine. Since one of the most widely used adjuvants is an insoluble salt of aluminum (aluminum hydroxide) that cannot be used for skin delivery due to reactogenicity, we focused our attention on agonists of receptors present on skin dendritic cells, including the Dectin-1 receptor. β-(1-3)-glucans, which are the most abundant components of the fungal surface, are known to activate the innate immune response by interaction with the C-type lectin-like Dectin-1 receptor. In this work we identified by rational design a well-defined synthetic β-(1-3)-glucan hexasaccharide as a Dectin-1 agonist and chemically conjugated it to the genetically detoxified diphtheria toxin (CRM197) protein antigen, as a means to increase the binding to Dectin-1 receptor and to target to skin dendritic cells. We demonstrated that the in vitro activation of the receptor was significantly impacted by the presentation of the glucan on the protein carrier. In vivo results in mice showed that the conjugation of the synthetic β-(1-3)-glucan when delivered intradermally resulted in higher antibody titers in comparison to intramuscular (i.m.) immunization and was not different from subcutaneous (s.c.) delivery. These findings suggest that weak receptor binders can be turned into more potent agonists by the multivalent presentation of many ligands covalently conjugated to the protein core. Moreover, this approach is particularly valuable to increase the immunogenicity of antigens administered via skin delivery.

Attenuation of PAMP-triggered immunity in maize requires down-regulation of the key β-1,6-glucan synthesis genes KRE5 and KRE6 in biotrophic hyphae of Colletotrichum graminicola.

Science.gov (United States)

Oliveira-Garcia, Ely; Deising, Holger B

2016-08-01

In plants, pathogen defense is initiated by recognition of pathogen-associated molecular patterns (PAMPs) via plasma membrane-localized pattern-recognition receptors (PRRs). Fungal structural cell wall polymers such as branched β-glucans are essential for infection structure rigidity and pathogenicity, but at the same time represent PAMPs. Kre5 and Kre6 are key enzymes in β-1,6-glucan synthesis and formation of branch points of the β-glucan network. In spite of the importance of branched β-glucan for hyphal rigidity and plant-fungus interactions, neither the role of KRE5 and KRE6 in pathogenesis nor mechanisms allowing circumventing branched β-glucan-triggered immune responses are known. We functionally characterized KRE5 and KRE6 of the ascomycete Colletotrichum graminicola, a hemibiotroph that infects maize (Zea mays). After appressorial plant invasion, this fungus sequentially differentiates biotrophic and highly destructive necrotrophic hyphae. RNAi-mediated reduction of KRE5 and KRE6 transcript abundance caused appressoria to burst and swelling of necrotrophic hyphae, indicating that β-1,6-glucosidic bonds are essential in these cells. Live cell imaging employing KRE5:mCherry and KRE6:mCherry knock-in strains and probing of infection structures with a YFP-conjugated β-1,6-glucan-binding protein showed expression of these genes and exposure of β-1,6-glucan in conidia, appressoria and necrotrophic, but not in biotrophic hyphae. Overexpression of KRE5 and KRE6 in biotrophic hyphae led to activation of broad-spectrum plant defense responses, including papilla and H2 O2 formation, as well as transcriptional activation of several defense-related genes. Collectively, our results strongly suggest that down-regulation of synthesis and avoidance of exposure of branched β-1,3-β-1,6-glucan in biotrophic hyphae is required for attenuation of plant immune responses. © 2016 The Authors The Plant Journal © 2016 John Wiley & Sons Ltd.

Measurement of gross beta radioactivity in high-level liquid waste

International Nuclear Information System (INIS)

Lu Feng; Lin Cansheng; Zhang Xianzi; Chen Guoan; Zhang Chonghai

1992-01-01

Using beta plastic scintillation counter of low level background, gross beta radioactivity of twelve samples for high-level liquid waste is determined directly. Beta efficiency curves of plastic scintillation counter for four mass thickness are calibrated in advance. Determining gross beta radioactivity, gross efficiency of the scintillation counter for various energy beta ray is calculated via weighted mean method with the ratio of radioactivity for each nuclide. The ratio of radioactivity for nuclides which have gamma disintegration is determined in terms of the radioactivity measured by gamma spectrometer. The ratio of the radioactivity for 90 Sr which has purity beta disintegration is calculated in terms of half life time approximation. The ratio of the radioactivity for 147 Pm which also has purity disintegration is calculated by means of apparent cooling-time approximation. The uncertainty of results for the present work is about +-15%

Anti-inflammatory properties of the medicinal mushroom Cordyceps militaris might be related to its linear (1→3-β-D-glucan.

Directory of Open Access Journals (Sweden)

Fhernanda R Smiderle

Full Text Available The Ascomycete Cordyceps militaris, an entomopathogenic fungus, is one of the most important traditional Chinese medicines. Studies related to its pharmacological properties suggest that this mushroom can exert interesting biological activities. Aqueous (CW and HW and alkaline (K5 extracts containing polysaccharides were prepared from this mushroom, and a β-D-glucan was purified. This polymer was analysed by GC-MS and NMR spectrometry, showing a linear chain composed of β-D-Glcp (1→3-linked. The six main signals in the 13C-NMR spectrum were assigned by comparison to reported data. The aqueous (CW, HW extracts stimulated the expression of IL-1β, TNF-α, and COX-2 by THP-1 macrophages, while the alkaline (K5 extract did not show any effect. However, when the extracts were added to the cells in the presence of LPS, K5 showed the highest inhibition of the pro-inflammatory genes expression. This inhibitory effect was also observed for the purified β-(1→3-D-glucan, that seems to be the most potent anti-inflammatory compound present in the polysaccharide extracts of C. militaris. In vivo, β-(1→3-D-glucan also inhibited significantly the inflammatory phase of formalin-induced nociceptive response, and, in addition, it reduced the migration of total leukocytes but not the neutrophils induced by LPS. In conclusion, this study clearly demonstrates the anti-inflammatory effect of β-(1→3-D-glucan.

Characterization of Lentinus edodes β-glucan influencing the in vitro starch digestibility of wheat starch gel.

Science.gov (United States)

Zhuang, Haining; Chen, Zhongqiu; Feng, Tao; Yang, Yan; Zhang, Jingsong; Liu, Guodong; Li, Zhaofeng; Ye, Ran

2017-06-01

Lentinus edodes β-glucan (abbreviated LEBG) was prepared from fruiting bodies of Lentinus edodes. The average molecular weight (Mw) and polydispersity index (Mw/Mn) of LEBG were measured to be 1.868×10 6 g/mol and 1.007, respectively. In addition, the monosaccharide composition of LEBG was composed of arabinose, galactose, glucose, xylose, mannose with a molar ratio of 5:11:18:644:16. After adding LEBG, both G' and G″ of starch gel increased. This is mainly because the connecting points between the molecular chains of LEBG and starch formed so that gel network structures were enhanced. The peak temperature in the heat flow diagram shifted to a higher temperature and the peak area of the endothermic enthalpy increased. Furthermore, LEBG can significantly inhibit starch hydrolysis. The predicted glycemic index (pGI) values were reduced when starch was replaced with LEBG at 20% (w/w). It might indicate that LEBG was suitable to develop low GI noodle or bread. Copyright © 2016 Elsevier Ltd. All rights reserved.

Direct ethanol production from cassava pulp using a surface-engineered yeast strain co-displaying two amylases, two cellulases, and {beta}-glucosidase

Energy Technology Data Exchange (ETDEWEB)

Apiwatanapiwat, Waraporn; Rugthaworn, Prapassorn [Japan International Research Center for Agricultural Sciences (JIRCAS), Tsukuba, Ibaraki (Japan). Post-Harvest Science and Technology Div.; Kasetsart Univ., Bangkok (Thailand). Nanotechnology and Biotechnology Div.; Murata, Yoshinori; Kosugi, Akihiko; Arai, Takamitsu; Mori, Yutaka [Japan International Research Center for Agricultural Sciences (JIRCAS), Tsukuba, Ibaraki (Japan). Post-Harvest Science and Technology Div.; Yamada, Ryosuke; Kondo, Akihiko [Kobe Univ. (Japan). Dept. of Chemical Science and Engineering

2011-04-15

In order to develop a method for producing fuel ethanol from cassava pulp using cell surface engineering (arming) technology, an arming yeast co-displaying {alpha}-amylase ({alpha}-AM), glucoamylase, endoglucanase, cellobiohydrase, and {beta}-glucosidase on the surface of the yeast cells was constructed. The novel yeast strain, possessing the activities of all enzymes, was able to produce ethanol directly from soluble starch, barley {beta}-glucan, and acid-treated Avicel. Cassava is a major crop in Southeast Asia and used mainly for starch production. In the starch manufacturing process, large amounts of solid wastes, called cassava pulp, are produced. The major components of cassava pulp are starch (approximately 60%) and cellulose fiber (approximately 30%). We attempted simultaneous saccharification and ethanol fermentation of cassava pulp with this arming yeast. During fermentation, ethanol concentration increased as the starch and cellulose fiber substrates contained in the cassava pulp decreased. The results clearly showed that the arming yeast was able to produce ethanol directly from cassava pulp without addition of any hydrolytic enzymes. (orig.)

Relation between the 2{nu}{beta}{beta} and 0{nu}{beta}{beta} nuclear matrix elements

Energy Technology Data Exchange (ETDEWEB)

Vogel, Petr [Kellogg Radiation Laboratory, Caltech, Pasadena, CA 91125 (United States); Simkovic, Fedor [Department of Nuclear Physics and Biophysics, Comenius University, Mlynska dolina F1, SK-84248 Bratislava (Slovakia)

2011-12-16

A formal relation between the GT part of the nuclear matrix elements M{sub GT}{sup 0{nu}} of 0{nu}{beta}{beta} decay and the closure matrix elements M{sub cl}{sup 2{nu}} of 2{nu}{beta}{beta} decay is established. This relation is based on the integral representation of these quantities in terms of their dependence on the distance r between the two nucleons undergoing transformation. We also discuss the difficulties in determining the correct values of the closure 2{nu}{beta}{beta} decay matrix elements.

Enhancement of β-Glucan Content in the Cultivation of Cauliflower Mushroom (Sparassis latifolia) by Elicitation.

Science.gov (United States)

Park, Hyun; Ka, Kang-Hyeon; Ryu, Sung-Ryul

2014-03-01

The effectiveness of three kinds of enzymes (chitinase, β-glucuronidase, and lysing enzyme complex), employed as elicitors to enhance the β-glucan content in the sawdust-based cultivation of cauliflower mushroom (Sparassis latifolia), was examined. The elicitors were applied to the cauliflower mushroom after primordium formation, by spraying the enzyme solutions at three different levels on the sawdust-based medium. Mycelial growth was fully accomplished by the treatments, but the metabolic process during the growth of fruiting bodies was affected. The application of a lysing enzyme resulted in an increase in the β-glucan concentration by up to 31% compared to that of the control. However, the treatment resulted in a decrease in mushroom yield, which necessitated the need to evaluate its economic efficiency. Although we still need to develop a more efficient way for using elicitors to enhance functional metabolites in mushroom cultivation, the results indicate that the elicitation technique can be applied in the cultivation of medicinal/edible mushrooms.

Characterization of beta-adrenergic receptors in synaptic membranes from rat cerebral cortex and cerebellum

International Nuclear Information System (INIS)

Lautens, L.

1986-01-01

Beta-adrenergic receptor ligand binding sites have been characterized in synaptic membranes from rat cerebral cortex and cerebellum using radioligand binding techniques. The equilibrium and kinetic properties of binding were assessed. The binding sites were non-interacting and exhibited two states of agonist binding which were sensitive to guanyl nucleotide. Synaptic membranes from cerebral cortex contained an equal number of beta 1 - and beta 2 -receptors; membranes from cerebellum possessed more beta 2 -than beta 1 -receptors. Photoaffinity labeling experiments revealed two different beta-adrenergic receptor polypeptides, R 1 and R 2 (and possibly a third, R 3 ) in synaptic membranes. The ratios of incorporation of photoaffinity label into R 1 : 2 were approximately 1:1 (cerebral cortex) and 5:1 (cerebellum). Photoaffinity labeling of R 1 and R 2 was inhibited equally well by both agonist and antagonist in synaptic membranes from cerebellum; whereas agonist was a less potent inhibitor in membranes from cerebral cortex. Both subtypes of beta-adrenergic receptors exhibited the same apparent molecular weight in synaptic membranes from cerebral cortex. The beta-adrenergic receptors in synaptic membranes from cerebral cortex and cerebellum were glycoproteins which exhibited the same apparent molecular weight after exposure to endoglycosidase F. The partial proteolytic digest maps of photoaffinity labeled beta-adrenergic receptors from rat cerebral cortex, cerebellum, lung and heart were compared

Differential Effect of Auxin on Molecular Weight Distributions of Xyloglucans in Cell Walls of Outer and Inner Tissues from Segments of Dark Grown Squash (Cucurbita maxima Duch.) Hypocotyls.

Science.gov (United States)

Wakabayashi, K; Sakurai, N; Kuraishi, S

1991-04-01

Effects of indole-3-acetic acid (IAA) on the mechanical properties of cell walls and structures of cell wall polysaccharides in outer and inner tissues of segments of dark grown squash (Cucurbita maxima Duch.) hypocotyls were investigated. IAA induced the elongation of unpeeled, intact segments, but had no effect on the elongation of peeled segments. IAA induced the cell wall loosening in outer tissues as studied by the stress-relaxation analysis but not in inner tissues. IAA-induced changes in the net sugar content of cell wall fractions in outer and inner tissues were very small. Extracted hemicellulosic xyloglucans derived from outer tissues had a molecular weight about two times as large as in inner tissues, and the molecular weight of xyloglucans in both outer and inner tissues decreased during incubation. IAA substantially accelerated the depolymerization of xyloglucans in outer tissues, while it prevented that in inner tissues. These results suggest that IAA-induced growth in intact segments is due to the cell wall loosening in outer tissues, and that IAA-accelerated depolymerization of hemicellulosic xyloglucans in outer tissues is involved in the cell wall loosening processes.

Incorporation of UDPglucose into cell wall glucans and lipids by intact cotton fibers

International Nuclear Information System (INIS)

Dugger, W.M.; Palmer, R.L.

1986-01-01

The [ 14 C] moiety from [ 3 H]UDP[ 14 C]glucose was incorporated by intact cotton fibers into hot water soluble, acetic-nitric reagent soluble and insoluble components, and chloroform-methanol soluble lipids; the [ 3 H]UDP moiety was not incorporated. The 3 H-label can be exchanged rapidly with unlabeled substrate in a chase experiment. The cell wall apparent free space of cotton fibers was in the order of 30 picomoles per milligram of dry fibers; 25 picomoles per milligram easily exchanged and about 5 picomoles per milligram more tightly adsorbed. At 50 micromolar UDPglucose, 70% of the [ 14 C]glucose was found in the lipid fraction after both a short labeling period and chase. The percent of [ 14 C]glucose incorporated into total glucan increased within a 30-minute chase period. The data supports the concept that glucan synthesis, including cellulose, as well as the synthesis of steryl glucosides, acetylated steryl glucosides, and glucosyl-phosphoryl-polyprenol from externally supplied UDPglucose occurs at the plasma membrane-cell wall interface. The synthase enzymes for such synthesis must be part of this interfacial membrane system

Synthesis of New Hyper-Branched α-Glucans from Sucrose by Lactobacillus reuteri 180 Glucansucrase Mutants

NARCIS (Netherlands)

Meng, Xiangfeng; Dobruchowska, Justyna M; Pijning, Tjaard; Gerwig, Gerrit J; Dijkhuizen, Lubbert

2016-01-01

α-Glucans produced by glucansucrase enzymes of lactic acid bacteria attract strong attention as novel ingredients and functional biopolymers in the food industry. In the present study, α-helix 4 amino acid residues D1085, R1088 and N1089 of glucansucrase GTF180 of Lactobacillus reuteri 180 were

Use of β-glucan from spent brewer's yeast as a thickener in skimmed yogurt: Physicochemical, textural, and structural properties related to sensory perception.

Science.gov (United States)

Raikos, Vassilios; Grant, Shannon B; Hayes, Helen; Ranawana, Viren

2018-04-25

Powdered β-glucan extracted from brewer's yeast (Yestimun, Leiber GmbH, Bramsche, Germany) was incorporated into skimmed-milk yogurt at varying concentrations (0.2-0.8% wt/wt) to investigate its potential application as a thickener. The effect of β-glucan fortification on the nutritional profile, microstructure, physicochemical properties, and texture of freshly prepared yogurts was investigated. Sensory evaluation was also conducted and was correlated with instrumental analysis. The addition of Yestimun significantly reduced the fermentation time of the yogurt mix from 4 h to 3 h. Scanning electron microscopy revealed that β-glucan particles formed small spherical clusters within the yogurt matrix. The majority of the physicochemical properties (syneresis, viscosity, color, and titratable acidity) remained unaffected by the incorporation of Yestimun in the recipe. Textural properties showed a gradual increment with increasing β-glucan concentration. Hardness, total work done, adhesive force, and adhesiveness increased by 19.27, 23.3, 21.53, and 20.76%, respectively, when using the highest amount of Yestimun powder. Sensory analysis (n = 40) indicated that fortifying yogurt with Yestimun at 0.8% (wt/wt) concentration may affect overall acceptance ratings, which was attributed to adverse flavor and aftertaste effects. However, the overall liking score of the yogurt (5.0/9.0) shows potential for commercialization of the product. Copyright © 2018 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

Chemical characterization and wound healing property of a β-D-glucan from edible mushroom Piptoporus betulinus

NARCIS (Netherlands)

Jesus, de Liana Inara; Smiderle, Fhernanda R.; Ruthes, Andrea C.; Vilaplana, Francisco; Lin, Dal' Fernando Tonholi; Maria-Ferreira, Daniele; Werner, Maria Fernanda; Griensven, Van Leo J.L.D.; Iacomini, Marcello

2017-01-01

A water-soluble β-D-glucan was obtained from fruiting bodies of Piptoporus betulinus, by hot aqueous extraction followed by freeze-thawing procedure and dialysis. Its molar mass distribution and conformational behavior in solution was assessed by size-exclusion chromatography coupled with multiangle

Differential Effect of Auxin on Molecular Weight Distributions of Xyloglucans in Cell Walls of Outer and Inner Tissues from Segments of Dark Grown Squash (Cucurbita maxima Duch.) Hypocotyls 1

Science.gov (United States)

Wakabayashi, Kazuyuki; Sakurai, Naoki; Kuraishi, Susumu

1991-01-01

Effects of indole-3-acetic acid (IAA) on the mechanical properties of cell walls and structures of cell wall polysaccharides in outer and inner tissues of segments of dark grown squash (Cucurbita maxima Duch.) hypocotyls were investigated. IAA induced the elongation of unpeeled, intact segments, but had no effect on the elongation of peeled segments. IAA induced the cell wall loosening in outer tissues as studied by the stress-relaxation analysis but not in inner tissues. IAA-induced changes in the net sugar content of cell wall fractions in outer and inner tissues were very small. Extracted hemicellulosic xyloglucans derived from outer tissues had a molecular weight about two times as large as in inner tissues, and the molecular weight of xyloglucans in both outer and inner tissues decreased during incubation. IAA substantially accelerated the depolymerization of xyloglucans in outer tissues, while it prevented that in inner tissues. These results suggest that IAA-induced growth in intact segments is due to the cell wall loosening in outer tissues, and that IAA-accelerated depolymerization of hemicellulosic xyloglucans in outer tissues is involved in the cell wall loosening processes. PMID:16668092

Two-dimensional NMR data of a water-soluble β-(1→3, 1→6-glucan from Aureobasidium pullulans and schizophyllan from Schizophyllum commune

Directory of Open Access Journals (Sweden)

Hiroyuki Kono

2017-12-01

Full Text Available This article contains two-dimensional (2D NMR experimental data, obtained by the Bruker BioSpin 500 MHz NMR spectrometer (Germany which can used for the determination of primary structures of schizophyllan from Schizophyllum commune (SPG and a water-soluble β-(1→3, 1→6-glucan from Aureobasidium pullulans. Data include analyzed the 2D NMR spectra of these β-glucans, which are related to the subject of an article in Carbohydrate Polymers, entitled “NMR spectroscopic structural characterization of a water-soluble β-(1→3, 1→6-glucan from A. pullulans” (Kono et al., 2017 [1]. Data can help to assign the 1H and 13C chemical shifts of the structurally complex polysaccharides. Keywords: NMR, β-(1→3, 1→6-glucan, Aureobasidium pullulans, Schizophyllan, Spectral data

Effects of β-Glucans and resistant starch on fermentation of recalcitrant fibers in growing pigs

NARCIS (Netherlands)

Vries, de S.; Gerrits, W.J.J.; Kabel, M.A.; Zijlstra, Ruurd; Vasanthan, Thava

2017-01-01

Effects of the presence of β-glucans and resistant starch in diets on nutrient and fiber degradability of rapeseed meal [RSM] (Brassica napus) and Distillers Dried Grain with Solubles (DDGS) were tested in a 2 × 3 factorial arrangement. Two basal diets, containing either 500 g/kg RSM or DDGS and

Antitumor and radiation protection effects of β-1,3-D-glucan extracted from yeast (saccharomyces cerevisiae)

International Nuclear Information System (INIS)

Yoshimura, Akinobu; Hasegawa, Takeo; Monzen, Hajime; Takahashi, Tohru

2003-01-01

Various natural extracts are manufactured and on sale as health food products, which are raising popular consciousness of being fit, because they are considered effective or suppressible for cancer. In the current experiment, we measured the immunological activity, antitumor effects, and radioprotective effects of β-1,3-D-glucan (Macroglucan) extracted from bread yeast. Macroglucan of 0, 200, 400, and 800 mg/kg were administered intraperitoneally to C3H/HeJ mice, respectively. The antitumor effects of Macroglucan were examined by measuring natural killer (NK) and lymphokine activated killer (LAK) cell activity and tumor volume. Change in weight, survival, and microscopic manifestation of the intestine were evaluated in the C3H/HeJ mice received total body irradiation to measure radioprotective effect of Macroglucan. According to measurements of cellular cytotoxicity, levels of NK and LAK cell activity were significantly higher in the group administered Macroglucan than in the control group. Macroglucan's role in immunological activity was suggested by the observed suppression of tumor growth in the Macroglucan-administered group. That group also experienced suppression of weight loss after irradiation in the experiment for radioprotection, and a consequent increase in the survival rate compared with the control group. Protective effects appeared in photomicrographs of the intestinal cells. These results confirmed Macroglucan's radioprotective effects. These effects may be related to the suppression of infection accompanying immunological activation due to Macroglucan administration, antioxidant activity, and radical scavenging capacity. (author)

Effects of dietary β-glucan and glycyrrhizin on non-specific immunity and disease resistance of the sea cucumber ( Apostichopus japonicus Selenka) challenged with Vibrio splendidus

Science.gov (United States)

Chang, Jie; Zhang, Wenbing; Mai, Kangsen; Ma, Hongming; Xu, Wei

2010-12-01

Sea cucumbers, Apostichopus japonicus Selenka, were fed diets containing non-immunostimulant (basal diet), 0.2% β-glucan and 0.02% glycyrrhizin in a recirculatory water system for 45 days, and subsequently challenged with Vibrio splendidus by injection at 1.0×108 cfu / sea cucumber for 15 days. Phagocytic capacity (PC), intracellular superoxide anion production (ISAP), lysozyme (LSZ) activity and superoxide dismutase (SOD) activity in the coelomic fluid were analyzed on the 0th, 5th, 10th and 15th days after injection. Results showed that after the 45-day feeding period, PC, ISAP, LSZ activity and SOD activity in sea cucumbers fed with dietary β-glucan or glycyrrhizin were significantly higher than in those fed with the basal diet. On the 5th day after infection, all the immune parameters examined in the sea cucumbers injected with V. splendidus decreased in value significantly. On the 15th day, PC, ISAP and LSZ activity returned to levels similar to those on the 0th day. For the sea cucumbers injected with saline, there were no significant differences in all the immune parameters examined and in the cumulative morbidity during the 15-day challenging trial. After injecting with V. splendidus, the cumulative morbidity of sea cucumbers fed with the basal diet was significantly higher than those fed with dietary β-glucan or glycyrrhizin when challenged with V. splendidus challenged sea cucumber fed with the basal diet was significantly higher than those fed with dietary β-glucan or glycyrrhizin. There was no significant difference in cumulative morbidity between the dietary β-glucan and glycyrrhizin treatments over time.

Chemical modification as an approach for the identification of UDPG-binding polypeptides of UDPG-glucose: (1,3)-Beta-glucan synthase

International Nuclear Information System (INIS)

Mason, T.L.

1989-01-01

The lysine-reactive chemical modification reagents uridine diphosphate pyridoxal (UDP-pyridoxal) and formaldehyde (HCHO) were used to identify UDPG-binding polypeptides of UDP-glucose: (1,3)-β-D-glucan synthase (GS) from red beet storage tissue. Complete enzyme inactivation occurred after exposure to micromolar levels of UDP-pyridoxal and millimolar levels of HCHO. Divalent cations (Mg 2+ and Ca 2+ , particularly Ca 2+ ) were required by both for inactivation. Substrate (UDPG) and chelators (EDTA and EGTA) protected plasma membrane GS (PMGS) against UDP-pyridoxal and HCHO inhibition. UDPG protected CHAPS solubilized GS (CSGS) against UDP-pyridoxal inactivation, but not against HCHO. It was concluded that beet GS contains a lysine residue at the UDPG-binding site. When PMGS was directly labeled with UDP[ 3 H]-pyridoxal or [ 14 C]HCHO, random labeling occurred. Therefore, a multi-step labeling procedure was developed. Nonessential lysine residues were first blocked with HCHO while 5 mM UDPG protected the active site lysine. Background labeling was reduced 4-fold. Membranes were recovered by centrifugation and the active site lysine exposed to [ 14 C] HCHO. Major labeled polypeptides were at 200, 76, and 54 kD. Minor polypeptides were seen at 94, 82, 68, 60, and 20-25 kD. CSGS was labeled by a modified multi-step procedure. CSGS was blocked by reaction with UDP-pyridoxal in the presence of UDPG. CSGS was then recovered by product entrapment and labeled with [ 14 C]HCHO. Background labeling was reduced by 8-fold and potential UDPG-binding polypeptides narrowed to 68, 54, 25 and 22 kD

Dysfunctional C8 beta chain in patients with C8 deficiency.

Science.gov (United States)

Tschopp, J; Penea, F; Schifferli, J; Späth, P

1986-12-01

Two sera from unrelated individuals, each lacking C8 activity, were examined by Western blot analysis. Using antisera raised against whole C8, the two sera are shown to lack the C8 beta chain, indicating a C8 beta deficiency, which is frequently observed in cases of dysfunctional C8. In contrast, by means of a specific anti-C8-beta antiserum, a C8 beta-like polypeptide chain of apparently identical molecular weight compared to normal C8 beta was detected. Digestion of normal and dysfunctional C8 beta with Staphylococcus aureus V8 protease revealed distinct differences in the enzymatic digestion pattern. We conclude that the dysfunction in the C8 protein in these two patients resides in the dysfunctional C8 beta chain, and that this form of C8 deficiency is distinct from C8 deficiencies previously reported, in which one or both C8 subunits are lacking.

Children’s residential exposure to selected allergens and microbial indicators: endotoxins and (1→3-β-D-glucans

Directory of Open Access Journals (Sweden)

Anna Kozajda

2013-12-01

Full Text Available Objectives: The study was aimed at assessment of exposure to endotoxins, (1→3-β-D-glucans and mite, cockroach, cat, dog allergens present in settled dust in premises of children as agents which may be significantly correlated with the occurrence of allergic symptoms and diseases in children. Materials and Methods: The study covered 50 homes of one- or two-year-old children in Poland. Samples of settled dust were taken from the floor and the child's bed. The levels of (1→3-β-D-glucans (floor, endotoxins (floor and allergens of mite, cat, dog and cockroach (floor and bed were analyzed. Results: Average geometric concentrations (geometric standard deviation of endotoxins, (1→3-β-D-glucans, Der p1, Fel d1, Can f1 and Bla g1 in children homes were on the floor 42 166.0 EU/g (3.2, 20 478.4 ng/g (2.38, 93.9 ng/g (6.58, 119.8 ng/g (13.0, 288.9 ng/g (3.4, 0.72 U/g (4.4 and in their beds (only allergens 597.8 ng/g (14.2, 54.1 ng/g (4.4, 158.6 ng/g (3.1 0.6 U/g (2.9, respectively. When the floor was covered with the carpet, higher concentrations of endotoxins, (1→3-β-D-glucans and allergens (each type were found in the settled dust (p < 0.05. The trend was opposite in case of allergens (except dog analyzed from bed dust and significantly higher concentrations were found in the rooms with smooth floor (p < 0.05. Conclusions: Among the analyzed factors only the type of floor significantly modified both the level of biological indicators and allergens. The results of this study could be the base for verifying a hypothesis that carpeting may have a protective role against high levels of cockroach, dog and cat allergens.

Heterologous Expression of Aspergillus Niger --beta--D-Xylosidase (XInD): Characterization on Lignocellulosic Substrates

Energy Technology Data Exchange (ETDEWEB)

Selig, M. J.; Knoshaug, E. P.; Decker, S. R.; Baker, J. O.; Himmel, M. E.; Adney, W. S.

2008-01-01

The gene encoding a glycosyl hydrolase family 3 xylan 1,4-beta-xylosidase, xlnD, was successfully cloned from Aspergillus niger strain ATCC 10864. The recombinant product was expressed in Aspergillus awamori, purified by column chromatography, and verified by matrix-assisted laser desorption ionization, tandem time of flight (MALDI-TOF/TOF) mass spectroscopy of tryptic digests. The T{sub max} was determined using differential scanning microcalorimetry (DSC) to be 78.2 C; the K{sub m} and k{sub cat} were found to be 255 {micro}M and 13.7 s{sup -1}, respectively, using {rho}NP-{Beta}-d-xylopyranoside as substrate. End-product inhibition by d-xylose was also verified and shown to be competitive; the K{sub i} for this inhibition was estimated to be 3.3 mM. XlnD was shown to efficiently hydrolyze small xylo-oligomers to monomeric xylose, making it a critical hydrolytic activity in cases where xylose is to be recovered from biomass conversion processes. In addition, the presence of the XlnD was shown to synergistically enhance the ability of an endoxylanase, XynA from Thermomyces lanuginosus, to convert xylan present in selected pretreated lignocellulosic substrates. Furthermore, the addition of the XynA/XlnD complex was effective in enhancing the ability of a simplified cellulase complex to convert glucan present in the substrates.

Heterologous expression of Aspergillus niger beta-D-xylosidase (XlnD): characterization on lignocellulosic substrates.

Science.gov (United States)

Selig, Michael J; Knoshaug, Eric P; Decker, Stephen R; Baker, John O; Himmel, Michael E; Adney, William S

2008-03-01

The gene encoding a glycosyl hydrolase family 3 xylan 1,4-beta-xylosidase, xlnD, was successfully cloned from Aspergillus niger strain ATCC 10864. The recombinant product was expressed in Aspergillus awamori, purified by column chromatography, and verified by matrix-assisted laser desorption ionization, tandem time of flight (MALDI-TOF/TOF) mass spectroscopy of tryptic digests. The T (max) was determined using differential scanning microcalorimetry (DSC) to be 78.2 degrees C; the K (m) and k (cat) were found to be 255 microM and 13.7 s(-1), respectively, using pNP-beta-D-xylopyranoside as substrate. End-product inhibition by D-xylose was also verified and shown to be competitive; the K (i) for this inhibition was estimated to be 3.3 mM. XlnD was shown to efficiently hydrolyze small xylo-oligomers to monomeric xylose, making it a critical hydrolytic activity in cases where xylose is to be recovered from biomass conversion processes. In addition, the presence of the XlnD was shown to synergistically enhance the ability of an endoxylanase, XynA from Thermomyces lanuginosus, to convert xylan present in selected pretreated lignocellulosic substrates. Furthermore, the addition of the XynA/XlnD complex was effective in enhancing the ability of a simplified cellulase complex to convert glucan present in the substrates.

A pH-responsive carboxylic β-1,3-glucan polysaccharide for complexation with polymeric guests.

Science.gov (United States)

Lien, Le Thi Ngoc; Shiraki, Tomohiro; Dawn, Arnab; Tsuchiya, Youichi; Tokunaga, Daisuke; Tamaru, Shun-ichi; Enomoto, Naoya; Hojo, Junichi; Shinkai, Seiji

2011-06-07

The helix-forming nature of β-1,3-glucan polysaccharides is a characteristic that has potential for producing gene carriers, bio-nanomaterials and other chiral nanowires. Herein, carboxylic curdlan (CurCOOH) bearing the β-1,3-polyglucuronic acid structure was successfully prepared from β-1,3-glucan polysaccharide curdlan (Cur) by one-step oxidation using a 4-acetamido-TEMPO/NaClO/NaClO(2) system as the oxidant. The resulting high-molecular-weight CurCOOH was proved to bear the 6-COOH group in 100% purity. The optical rotatory dispersion (ORD) spectra indicated that the obtained CurCOOH behaves as a water-soluble single-strand in various pH aqueous media. This advantage has allowed us to use CurCOOH as a polymeric host to form various macromolecular complexes. For example, complexation of CurCOOH with single-walled carbon nanotubes (SWNTs) resulted in a water-soluble one-dimensional architecture, which formed a dispersion in aqueous solution that was stable for several months, and much more stable than SWNTs complexes of the similar negatively-charged polyacrylic acid (PAA) and polymethacrylic acid (PMAA). It was shown that in the complex, SWNTs are effectively wrapped by a small amount of CurCOOH, enabling them to avoid electrostatic repulsion. This pH-responsive CurCOOH formed a very stable complex with cationic water-soluble polythiophenes (PT-1), which was stabilized not only by the hydrophobic interaction but also by the electrostatic attraction between trimethylammonium cations in PT-1 and dissociated anionic COO(-) groups in CurCOOH. The included PT-1 became CD-active only in the neutral to basic pH region, and the positive Cotton effect suggested that the conjugated main chain is twisted in the right-handed direction. We also found that CurCOOH can interact with polycytidylic acid (poly(C)) only under high NaCl concentrations, the binding and release of which could be controlled by a change in the salt concentration. We believe, therefore, that Cur

Chemoradioprotection of the rat parotid gland by the beta-sympathomimetic agonist, terbutaline

International Nuclear Information System (INIS)

Sinesi, M.S.

1981-01-01

The present study demonstrates the effectiveness of the beta-adrenergic stimulator known as terbutaline in providing increased radioresistance to the normal, (i.e. nonmalignant) rat parotid salivary gland. Radiation damage was assessed by gland weight and microscopic examination of saline-treated and terbutaline-treated groups during days 1 to 10 and at 60 days post-irradiation. Terbutaline-treated groups exhibited both a sparing of gland weight loss as well as better preservation of glandular microstructure at all periods examined post-irradiation. Radioprotection of human parotid glands would provide relief from the xerostomia and its severe sequelae which often follow radiotherapy to the head and neck region in cancer patients. Terbutaline, with its preferential affinity for the beta-2 adrenergic receptor may provide a therapeutic advantage without the cardiac effects which normally accompany less specific (beta-1 + beta-2) adrenergic stimulation. In addition to providing a model for clinical protection of the salivary glands, this demonstration of protection of the rat parotid may also serve as a model for investigation of the mechanisms of action of terbutaline and other radioprotective compounds

The study on application of radiation for preparation of oligo-β-glucan extracted from brewer yeast cell and for gold and silver nano particles

International Nuclear Information System (INIS)

Le Quang Luan; Nguyen Huynh Phuong Uyen; Nguyen Thanh Vu; Nguyen Quoc Hien; Dang Van Phu; Vo Thi Thu Ha; To Van Loi; Le Dinh Don; Truong Phuoc Thien Hoang; Do Thi Phuong Linh

2015-01-01

The process for production of insoluble β-glucan product from brewer’s yeast cell wall collected from the discard waste of beer production was successfully established. Radiation was improved as a useful tool for preparation of low Mw β-glucan. The water soluble oligo-β-glucans with Mw ~ 18 - 25 kDa were found to have novel features for application as plant growth promoter, growth and immune stimulator additive for animals and functional food for prevention and therapy of diabetic, dyslipidemia, cancer, etc. The processes for large scale production of oligo-β-glucan as plant growth promoter. chicken additive and functional food by gamma Co-60 irradiation method have been set up for application. In addition, gold nanoparticles (AuNPs) with size of 10 - 50 nm stabilized in sericin and water soluble chitosan and silver nanoparticles (AgNPs) with size of 5-20 nm stabilized PVA, PVP, sericin and alginate were also successfully synthesized by gamma Co-60 irradiation method. While AuNPs product was found to be not toxic and can be used for bio-medicine and cosmetics, AgNPs exhibited highly antimicrobial activity for potentially use as new and safety antimicrobial agent. The processes for large scale production of AuNPs, AgNPs, cream/AgNPs and hand-wash solution/AgNPs products were also successfully developed within this project. (author)

Quantitative protein and fat metabolism in bull calves treated with beta-adrenergic agonist

DEFF Research Database (Denmark)

Chwalibog, André; Jensen, K; Thorbek, G

1996-01-01

Protein and energy utilization and quantitative retention of protein, fat and energy was investigated with 12 Red Danish bulls during two subsequent 6 weeks trials (Sections A and B) at a mean live weight of 195 and 335 kg respectively. Treatments were control (Group 1) and beta-agonist (L-644...... matter, metabolizable energy and digestible protein was of the same magnitude for all groups. The beta-agonist had no significant effect on protein digestibility and metabolizability of energy, but daily live weight gain was significantly higher in the treated bulls. The utilization of digested protein...

Smart Beta Equity Investing Through Calm and Storm

NARCIS (Netherlands)

Boudt, Kris; Darras, Joakim; Ha Nguyen, Giang; Peeters, Benedict

2015-01-01

Smart beta portfolios typically achieve a superior diversification than the benchmark market capitalization-weighted portfolio, but remain vulnerable to broad market downturns. We examine tactical investment decision rules to switch timely between equity and cash investments based on an underlying

Interactions of grape tannins and wine polyphenols with a yeast protein extract, mannoproteins and β-glucan.

Science.gov (United States)

Mekoue Nguela, J; Poncet-Legrand, C; Sieczkowski, N; Vernhet, A

2016-11-01

At present, there is a great interest in enology for yeast derived products to replace aging on lees in winemaking or as an alternative for wine fining. These are yeast protein extracts (YPE), cell walls and mannoproteins. Our aim was to further understand the mechanisms that drive interactions between these components and red wine polyphenols. To this end, interactions between grape skin tannins or wine polyphenols or tannins and a YPE, a mannoprotein fraction and a β-glucan were monitored by binding experiments, ITC and DLS. Depending on the tannin structure, a different affinity between the polyphenols and the YPE was observed, as well as differences in the stability of the aggregates. This was attributed to the mean degree of polymerization of tannins in the polyphenol fractions and to chemical changes that occur during winemaking. Much lower affinities were found between polyphenols and polysaccharides, with different behaviors between mannoproteins and β-glucans. Copyright © 2016 Elsevier Ltd. All rights reserved.

Aerosolization of fungi, (1→3)-β-D glucan, and endotoxin from flood-affected materials collected in New Orleans homes

Science.gov (United States)

Adhikari, Atin; Jung, Jaehee; Reponen, Tiina; Lewis, Jocelyn Suzanne; DeGrasse, Enjoli C.; Grimsley, L. Faye; Chew, Ginger L.; Grinshpun, Sergey A.

2015-01-01

Standing water and sediments remaining on flood-affected materials were the breeding ground for many microorganisms in flooded homes following Hurricane Katrina. The purpose of this laboratory study was to examine the aerosolization of culturable and total fungi, (1→3)-β-D glucan, and endotoxin from eight flood-affected floor and bedding materials collected in New Orleans homes, following Hurricane Katrina. Aerosolization was examined using the Fungal Spore Source Strength Tester (FSSST) connected to a BioSampler. Dust samples were collected by vacuuming. A two-stage cyclone sampler was used for size-selective analysis of aerosolized glucan and endotoxin. On average, levels of culturable fungi ranged from undetectable (lower limit = 8.3×104) to 2.6×105 CFU/m2; total fungi ranged from 2.07×105 to 1.6×106 spores/m2; (1→3)-β-D glucan and endotoxin were 2.0×103 – 2.9×104 ng/m2 and 7.0×102 – 9.3×104 EU/m2, respectively. The results showed that 5–15 min sampling is sufficient for detecting aerosolizable biocontaminants with the FSSST. Smaller particle size fractions (1.8 μm) fractions, which raises additional exposure concerns. Vacuuming was found to overestimate inhalation exposure risks by a factor of approximately 102 for (1→3)-β-D glucan and by 103 to 104 for endotoxin as detected by the FSSST. The information generated from this study is important with respect to restoration and rejuvenation of the flood-affected areas in New Orleans. We believe the findings will be significant during similar disasters in other regions of the world including major coastal floods from tsunamis. PMID:19201399

In vitro incorporation of 14C-hexose-6-phosphat in mannan, β-glucan and glycogen of Candida spec. H and their mutants

International Nuclear Information System (INIS)

Roeber, B.; Reuter, G.

1982-01-01

Mannose-6-P is an activator of 14 C-mannose incorporation from GDP- 14 C-mannose in mono- and oligosaccharides and in mannopolymers of the cell wall proteophosphomannan produced by the food protein yeast Candida spec. H. Moreover, mannose-6-P is a precursor of proteophosphomannan: 14 C-mannose-6-P has been incorporated in absence of GTP. Corresponding behavior shows glucose-6-P by synthesis of β-glucan and glycogen. Mutants of Candida spec. H with different efficiency in the biosynthesis of mannan, β-glucan and glycogen incorporate hexose-6-P in a different extent. (author)

Inhibiting actin depolymerization enhances osteoblast differentiation and bone formation in human stromal stem cells

DEFF Research Database (Denmark)

Chen, Li; Shi, Kaikai; Frary, Charles

2015-01-01

Remodeling of the actin cytoskeleton through actin dynamics is involved in a number of biological processes, but its role in human stromal (skeletal) stem cells (hMSCs) differentiation is poorly understood. In the present study, we demonstrated that stabilizing actin filaments by inhibiting gene...... expression of the two main actin depolymerizing factors (ADFs): Cofilin 1 (CFL1) and Destrin (DSTN) in hMSCs, enhanced cell viability and differentiation into osteoblastic cells (OB) in vitro, as well as heterotopic bone formation in vivo. Similarly, treating hMSC with Phalloidin, which is known to stabilize...... polymerized actin filaments, increased hMSCs viability and OB differentiation. Conversely, Cytocholasin D, an inhibitor of actin polymerization, reduced cell viability and inhibited OB differentiation of hMSC. At a molecular level, preventing Cofilin phosphorylation through inhibition of LIM domain kinase 1...

Design of a potentially prebiotic and responsive encapsulation material for probiotic bacteria based on chitosan and sulfated β-glucan.

Science.gov (United States)

Yucel Falco, Cigdem; Sotres, Javier; Rascón, Ana; Risbo, Jens; Cárdenas, Marité

2017-02-01

Chitosan and sulfated oat β-glucan are materials suitable to create a prebiotic coating for targeted delivery to gastrointestinal system, using the layer by layer technology. Quartz crystal microbalance with dissipation (QCM-D), spectroscopic ellipsometry (SE) and atomic force microscopy (AFM) were used to assess the multilayer formation capacity and characterize the resulting coatings in terms of morphology and material properties such as structure and rigidity. The coating of colloidal materials was proven, specifically on L. acidophilus bacteria as measured by changes in the bacterial suspension zeta potential. Viability of coated cells was shown using plate counting method. The coatings on solid surfaces were examined after exposure to mimics of gastrointestinal fluids and a commercially available β-glucanase. Successful build-up of multilayers was confirmed with QCM-D and SE. Zeta potential values proved the coating of cells. There was 2 log CFU/mL decrease after coating cells with four alternating layers of chitosan and sulfated β-glucan when compared to viability of uncoated cells. The coatings were partially degraded after exposure to simulated intestinal fluid and restructured as a result of β-glucanase treatment, mimicking enzymes present in the microflora of the human gut, but seemed to resist acidic gastric conditions. Therefore, coatings of chitosan and sulfated β-glucan can potentially be exploited as carriers for probiotics and delicate nutraceuticals. Copyright © 2016 Elsevier Inc. All rights reserved.

Weighted asymptotic behavior of solutions to semilinear integro-differential equations in Banach spaces

Directory of Open Access Journals (Sweden)

Yan-Tao Bian

2014-04-01

Full Text Available In this article, we study weighted asymptotic behavior of solutions to the semilinear integro-differential equation $$ u'(t=Au(t+\\alpha\\int_{-\\infty}^{t}e^{-\\beta(t-s}Au(sds+f(t,u(t, \\quad t\\in \\mathbb{R}, $$ where $\\alpha, \\beta \\in \\mathbb{R}$, with $\\beta > 0, \\alpha \

Plant α-glucan phosphatases SEX4 and LSF2 display different affinity for amylopectin and amylose

DEFF Research Database (Denmark)

Wilkens, Casper; Auger, Kyle D.; Anderson, Nolan T.

2016-01-01

The plant glucan phosphatases Starch EXcess 4 (SEX4) and Like Sex Four2 (LSF2) apply different starch binding mechanisms. SEX4 contains a carbohydrate binding module, and LSF2 has two surface binding sites (SBSs). We determined KDapp for amylopectin and amylose, and KD for β-cyclodextrin and vali...

Generic tools to assess genuine carbohydrate specific effects on in vitro immune modulation exemplified by β-glucans

DEFF Research Database (Denmark)

Rieder, Anne; Grimmer, Stine; Aachmann, Finn L.

2013-01-01

Even if carbohydrate preparations from plant/fungal sources have a high degree of purity, observed immune-stimulation may be caused by minute sample contaminations. Using the example of different β-glucans we present a range of analytical tools crucial for validation of possible immune-stimulator...

BETA digital beta radiometer

International Nuclear Information System (INIS)

Borovikov, N.V.; Kosinov, G.A.; Fedorov, Yu.N.

1989-01-01

Portable transportable digital beta radiometer providing for measuring beta-decay radionuclide specific activity in the range from 5x10 -9 up to 10 -6 Cu/kg (Cu/l) with error of ±25% is designed and introduced into commercial production for determination of volume and specific water and food radioactivity. The device specifications are given. Experience in the BETA radiometer application under conditions of the Chernobyl' NPP 30-km zone has shown that it is convenient for measuring specific activity of the order of 10 -8 Cu/kg, and application of a set of different beta detectors gives an opportunity to use it for surface contamination measurement in wide range of the measured value

LHCb: $2\\beta_s$ measurement at LHCb

CERN Multimedia

Conti, G

2009-01-01

A measurement of $2\\beta_s$, the phase of the $B_s-\\bar{B_s}$ oscillation amplitude with respect to that of the ${\\rm b} \\rightarrow {\\rm c^{+}}{\\rm W^{-}}$ tree decay amplitude, is one of the key goals of the LHCb experiment with first data. In the Standard Model (SM), $2\\beta_s$ is predicted to be $0.0360^{+0.0020}_{-0.0016} \\rm rad$. The current constraints from the Tevatron are: $2\\beta_{s}\\in[0.32 ; 2.82]$ at 68$\\%$CL from the CDF experiment and $2\\beta_{s}=0.57^{+0.24}_{-0.30}$ from the D$\\oslash$ experiment. Although the statistical uncertainties are large, these results hint at the possible contribution of New Physics in the $B_s-\\bar{B_s}$ box diagram. After one year of data taking at LHCb at an average luminosity of $\\mathcal{L}\\sim2\\cdot10^{32}\\rm cm^{-2} \\rm s^{-1}$ (integrated luminosity $\\mathcal{L}_{\\rm int}\\sim 2 \\rm fb^{-1}$), the expected statistical uncertainty on the measurement is $\\sigma(2\\beta_s)\\simeq 0.03$. This uncertainty is similar to the $2\\beta_s$ value predicted by the SM.

Dietary β-glucan (MacroGard®) enhances survival of first feeding turbot (Scophthalmus maximus) larvae by altering immunity, metabolism and microbiota.

Science.gov (United States)

Miest, Joanna J; Arndt, Carmen; Adamek, Mikolaj; Steinhagen, Dieter; Reusch, Thorsten B H

2016-01-01

Reflecting the natural biology of mass spawning fish aquaculture production of fish larvae is often hampered by high and unpredictable mortality rates. The present study aimed to enhance larval performance and immunity via the oral administration of an immunomodulator, β-glucan (MacroGard(®)) in turbot (Scophthalmus maximus). Rotifers (Brachionus plicatilis) were incubated with or without yeast β-1,3/1,6-glucan in form of MacroGard(®) at a concentration of 0.5 g/L. Rotifers were fed to first feeding turbot larvae once a day. From day 13 dph onwards all tanks were additionally fed untreated Artemia sp. nauplii (1 nauplius ml/L). Daily mortality was monitored and larvae were sampled at 11 and 24 dph for expression of 30 genes, microbiota analysis, trypsin activity and size measurements. Along with the feeding of β-glucan daily mortality was significantly reduced by ca. 15% and an alteration of the larval microbiota was observed. At 11 dph gene expression of trypsin and chymotrypsin was elevated in the MacroGard(®) fed fish, which resulted in heightened tryptic enzyme activity. No effect on genes encoding antioxidative proteins was observed, whilst the immune response was clearly modulated by β-glucan. At 11 dph complement component c3 was elevated whilst cytokines, antimicrobial peptides, toll like receptor 3 and heat shock protein 70 were not affected. At the later time point (24 dph) an anti-inflammatory effect in form of a down-regulation of hsp 70, tnf-α and il-1β was observed. We conclude that the administration of MacroGard(®) induced an immunomodulatory response and could be used as an effective measure to increase survival in rearing of turbot. Copyright © 2015 Elsevier Ltd. All rights reserved.

Glucans from fruit bodies of cultivated mushrooms Pleurotus ostreatus and Pleurotus eryngii: Structure and potential prebiotic activity

Czech Academy of Sciences Publication Activity Database

Synytsya, Andriy.; Míčková, K.; Synytsya, A.; Jablonský, I.; Spěváček, Jiří; Erban, V.; Kováříková, E.; Čopíková, J.

2009-01-01

Roč. 76, č. 4 (2009), s. 548-556 ISSN 0144-8617 R&D Projects: GA ČR GA525/05/0273 Institutional research plan: CEZ:AV0Z40500505 Keywords : glucans * oyster mushroom Pleurotus * isolation Subject RIV: CD - Macromolecular Chemistry Impact factor: 3.167, year: 2009

Protective Effects of Surfactant Protein D (SP-D) Treatment in 1,3-β-glucan-modulated Allergic Inflammation

DEFF Research Database (Denmark)

Fakih, Dalia; Pilecki, Bartosz; Schlosser, Anders

2015-01-01

SP-D is a pulmonary collectin important in lung immunity. SP-D-deficient mice (Sftpd(-/-)) are reported to be susceptible to ovalbumin (OVA)- and fungal allergen-induced pulmonary inflammation, while treatment with exogenous SP-D has therapeutic effects in such disease models. β-glucans are a div...

Transcriptional regulation of fksA, a β-1,3-glucan synthase gene, by the APSES protein StuA during Aspergillus nidulans development.

Science.gov (United States)

Park, Bum-Chan; Park, Yun-Hee; Yi, Soohyun; Choi, Yu Kyung; Kang, Eun-Hye; Park, Hee-Moon

2014-11-01

The temporal and spatial regulation of β-1,3-glucan synthesis plays an important role in morphogenesis during fungal growth and development. Northern blot analysis showed that the transcription of fksA, the gene encoding β-1,3-glucan synthase in Aspergillus nidulans, was cell-cycle-dependent and increased steadily over the duration of the vegetative period, but its overall expression during the asexual and sexual stages was fairly constant up until the time of transcription cessation. In an A. nidulans strain mutated in the eukaryotic bHLH-like APSES transcription factor stuA1, the transcriptional level of fksA, and consequently the content of alkali-insoluble cell wall β-glucan, significantly increased at the conidial chain formation and maturation stage. Electrophoretic mobility shift assays revealed that StuA was bound to StREs (StuA Response Elements) on the fksA promoter region. Promoter analysis with sGFP-fusion constructs also indicated the negative regulation of fksA expression by StuA, especially during asexual development. Taken together, these data suggest that StuA plays an important role in cell wall biogenesis during the development of A. nidulans, by controlling the transcription level of fksA.

Insulin-like growth factors and pancreas beta cells.

NARCIS (Netherlands)

Haeften, T.W. van; Twickler, M.

2004-01-01

Abstract Insulin-like growth factors (IGFs) have been implicated in normal growth, and especially foetal pancreas beta-cell development. As low birth weight has been implicated in the development of obesity and type 2 diabetes, much research has evolved into the importance of IGF and their

Insulin-like growth factors and pancreas beta cells

NARCIS (Netherlands)

van Haeften, T. W.; Twickler, TB

Insulin-like growth factors (IGFs) have been implicated in normal growth, and especially foetal pancreas beta-cell development. As low birth weight has been implicated in the development of obesity and type 2 diabetes, much research has evolved into the importance of IGF and their signalling

Insulin-like growth factors and pancreas beta cells

NARCIS (Netherlands)

van Haeften, T. W.; Twickler, Th B.

2004-01-01

Abstract Insulin-like growth factors (IGFs) have been implicated in normal growth, and especially foetal pancreas beta-cell development. As low birth weight has been implicated in the development of obesity and type 2 diabetes, much research has evolved into the importance of IGF and their

Liver volume in thalassaemia major: relationship with body weight, serum ferritin, and liver function

Energy Technology Data Exchange (ETDEWEB)

Chan Yuleung; Law Manyee; Howard, Robert [Chinese University of Hong Kong, Department of Diagnostic Radiology and Organ Imaging, Prince of Wales Hospital, Hong Kong (China); Li Chikong; Chik Kiwai [Chinese University of Hong Kong, Department of Paediatrics, Prince of Wales Hospital, Hong Kong (China)

2005-02-01

It is not known whether body weight alone can adjust for the volume of liver in the calculation of the chelating dose in {beta}-thalassaemia major patients, who frequently have iron overload and hepatitis. The hypothesis is that liver volume in children and adolescents suffering from {beta}-thalassaemia major is affected by ferritin level and liver function. Thirty-five {beta}-thalassaemia major patients aged 7-18 years and 35 age- and sex-matched controls had liver volume measured by MRI. Serum alanine aminotransferase (ALT) and ferritin levels were obtained in the thalassaemia major patients. Body weight explained 65 and 86% of the change in liver volume in {beta}-thalassaemia major patients and age-matched control subjects, respectively. Liver volume/kilogram body weight was significantly higher (P<0.001) in thalassaemia major patients than in control subjects. There was a significant correlation between ALT level and liver volume/kilogram body weight (r=0.55, P=0.001). Patients with elevated ALT had significantly higher liver volume/kilogram body weight (mean 42.9{+-}12 cm{sup 3}/kg) than control subjects (mean 23.4{+-}3.6 cm{sup 3}/kg) and patients with normal ALT levels (mean 27.4{+-}3.6 cm{sup 3}/kg). Body weight is the most important single factor for liver-volume changes in thalassaemia major patients, but elevated ALT also has a significant role. Direct liver volume measurement for chelation dose adjustment may be advantageous in patients with elevated ALT. (orig.)

Análise de polimorfismos do gene da beta-lactoglobulina em vacas da raça Nelore e efeitos sobre o peso à desmama de suas progênies Polimorphism analisys of beta-lactoglobulin gene on Nellore cows and effects on weaning weight of the calves

Directory of Open Access Journals (Sweden)

F.J.C. Faria

2000-06-01

Full Text Available Informações sobre peso à desmama de bezerros Nelore foram utilizadas após ajuste para idade padrão aos 205 dias, sexo, idade da mãe, touro e mês de desmama, para separar as reprodutrizes em dois grupos, segundo o peso de suas crias. As médias de peso dos bezerros ajustadas pelo método dos quadrados mínimos e erros-padrão (LSM± SE foram para os grupos pesados (P e leves (L 163,21± 2,18kg e 134,44± 2,18kg, respectivamente, com 41 animais em cada grupo. Essas reprodutrizes foram submetidas a coleta de sangue para estudo de polimorfismos do gene da beta-lactoglobulina, por meio da técnica de PCR-RFLP. A amplificação e a digestão de um fragmento do gene da beta-lactoglobulina entre o éxon II e III identificou os genótipos 1AA, 24AB e 56BB, com as freqüências de 0,16 e 0,84 para os alelos A e B, respectivamente. Os 24 animais com genótipo AB apresentaram LSM± SE de peso de seus produtos de 149,50± 4,17kg, e os 56 animais de genótipo BB tiveram média de 148,44± 2,73kg. O teste do qui-quadrado não apresentou significância (P>0,05, isto é, os grupos P e L não diferiram entre si quanto às freqüências alélicas apresentadas para esse gene. O genótipo das reprodutrizes não afetou o peso à desmama de suas crias, o que sugere haver outros fatores genéticos e não genéticos de maior magnitude que afetam o peso à desmama.Weaning weights from a Nelore herd were used after adjustment of means for 205 days of age, sex, age of dam, sire and weaning month, and resulted into two groups of cows that differed by the weaning weight of their calves. The least square means (LSM and standard error (SE were for heavy group 163.21± 2.18kg and for light group 134.44± 2.18kg, with 41 animals in each group. These animals were genotyped by DNA polymorphisms of beta -lactoglobulin gene, using PCR-RFLP. After amplification and digestion of a beta-lactoglobulin gene fragment between II and III exon, genotypes 1AA, 24AB and 56BB were

Echinocandin treatment of pneumocystis pneumonia in rodent models depletes cysts leaving trophic burdens that cannot transmit the infection.

Directory of Open Access Journals (Sweden)

Melanie T Cushion

2010-01-01

Full Text Available Fungi in the genus Pneumocystis cause pneumonia (PCP in hosts with debilitated immune systems and are emerging as co-morbidity factors associated with chronic diseases such as COPD. Limited therapeutic choices and poor understanding of the life cycle are a result of the inability of these fungi to grow outside the mammalian lung. Within the alveolar lumen, Pneumocystis spp., appear to have a bi-phasic life cycle consisting of an asexual phase characterized by binary fission of trophic forms and a sexual cycle resulting in formation of cysts, but the life cycle stage that transmits the infection is not known. The cysts, but not the trophic forms, express beta -1,3-D-glucan synthetase and contain abundant beta -1,3-D-glucan. Here we show that therapeutic and prophylactic treatment of PCP with echinocandins, compounds which inhibit the synthesis of beta -1,3-D-glucan, depleted cysts in rodent models of PCP, while sparing the trophic forms which remained in significant numbers. Survival was enhanced in the echincandin treated mice, likely due to the decreased beta -1,3-D-glucan content in the lungs of treated mice and rats which coincided with reductions of cyst numbers, and dramatic remodeling of organism morphology. Strong evidence for the cyst as the agent of transmission was provided by the failure of anidulafungin-treated mice to transmit the infection. We show for the first time that withdrawal of anidulafungin treatment with continued immunosuppression permitted the repopulation of cyst forms. Treatment of PCP with an echinocandin alone will not likely result in eradication of infection and cessation of echinocandin treatment while the patient remains immunosuppressed could result in relapse. Importantly, the echinocandins provide novel and powerful chemical tools to probe the still poorly understood bi-phasic life cycle of this genus of fungal pathogens.

Interactions between two beta-sheets. Energetics of beta/beta packing in proteins.

Science.gov (United States)

Chou, K C; Némethy, G; Rumsey, S; Tuttle, R W; Scheraga, H A

1986-04-20

The analysis of the interactions between regularly folded segments of the polypeptide chain contributes to an understanding of the energetics of protein folding. Conformational energy-minimization calculations have been carried out to determine the favorable ways of packing two right-twisted beta-sheets. The packing of two five-stranded beta-sheets was investigated, with the strands having the composition CH3CO-(L-Ile)6-NHCH3 in one beta-sheet and CH3CO-(L-Val)6-NHCH3 in the other. Two distinct classes of low-energy packing arrangements were found. In the class with lowest energies, the strands of the two beta-sheets are aligned nearly parallel (or antiparallel) with each other, with a preference for a negative orientation angle, because this arrangement corresponds to the best complementary packing of the two twisted saddle-shaped beta-sheets. In the second class, with higher interaction energies, the strands of the two beta-sheets are oriented nearly perpendicular to each other. While the surfaces of the two beta-sheets are not complementary in this arrangement, there is good packing between the corner of one beta-sheet and the interior part of the surface of the other, resulting in a favorable energy of packing. Both classes correspond to frequently observed orientations of beta-sheets in proteins. In proteins, the second class of packing is usually observed when the two beta-sheets are covalently linked, i.e. when a polypeptide strand passes from one beta-sheet to the other, but we have shown here that a large contribution to the stabilization of this packing arrangement arises from noncovalent interactions.

Interaction with beta-arrestin determines the difference in internalization behavor between beta1- and beta2-adrenergic receptors.

Science.gov (United States)

Shiina, T; Kawasaki, A; Nagao, T; Kurose, H

2000-09-15

The beta(1)-adrenergic receptor (beta(1)AR) shows the resistance to agonist-induced internalization. As beta-arrestin is important for internalization, we examine the interaction of beta-arrestin with beta(1)AR with three different methods: intracellular trafficking of beta-arrestin, binding of in vitro translated beta-arrestin to intracellular domains of beta(1)- and beta(2)ARs, and inhibition of betaAR-stimulated adenylyl cyclase activities by beta-arrestin. The green fluorescent protein-tagged beta-arrestin 2 translocates to and stays at the plasma membrane by beta(2)AR stimulation. Although green fluorescent protein-tagged beta-arrestin 2 also translocates to the plasma membrane, it returns to the cytoplasm 10-30 min after beta(1)AR stimulation. The binding of in vitro translated beta-arrestin 1 and beta-arrestin 2 to the third intracellular loop and the carboxyl tail of beta(1)AR is lower than that of beta(2)AR. The fusion protein of beta-arrestin 1 with glutathione S-transferase inhibits the beta(1)- and beta(2)AR-stimulated adenylyl cyclase activities, although inhibition of the beta(1)AR-stimulated activity requires a higher concentration of the fusion protein than that of the beta(2)AR-stimulated activity. These results suggest that weak interaction of beta(1)AR with beta-arrestins explains the resistance to agonist-induced internalization. This is further supported by the finding that beta-arrestin can induce internalization of beta(1)AR when beta-arrestin 1 does not dissociate from beta(1)AR by fusing to the carboxyl tail of beta(1)AR.

Commercial breakfast cereals available in Mexican markets and their contribution in dietary fiber, β-glucans and protein quality by rat bioassays.

Science.gov (United States)

Falcón-Villa, María R; Barrón-Hoyos, Jesús M; Cinco-Moroyoqui, Francisco J

2014-09-01

The beneficial effect of dietary fiber (DF) consumption has long been recognized. The global economy and open market trade policies have increased the availability of food products in Mexican markets, resulting in a wide variety of ready-to-eat commercial breakfast cereals classified as 'high fiber'. This research was aimed to evaluate the total dietary fiber contents, its fractions (soluble and insoluble) and β-glucan in 13 commercial 'high-fiber' breakfast cereals, as well as to evaluate their protein quality by rat bioassays. Commercial 'high-fiber' breakfast cereals had 7.42-39.82% insoluble dietary fiber, 2.53-12.85% soluble dietary fiber, and 0.45-4.96% β-glucan. These ready-to-eat commercial 'high-fiber' breakfast cereals differed significantly in their total dietary fiber, their soluble and insoluble DF fractions, and also in their β-glucan contents. When supplied as experimental diets, in 14-day rat feeding trials, the 'high-fiber' breakfast cereals showed an adverse effect on the % N digestibility but protein utilization, as measured as net protein ratio (NPR), was not significantly affected. The consumption of these commercial breakfast cereals, especially those made of oats as the basic ingredient, is highly recommended, since these products, being a concentrated source of dietary fiber, do not affect their protein quality.

Isoproterenol reduces ischemia-reperfusion lung injury despite beta-blockade.

Science.gov (United States)

Takashima, Seiki; Schlidt, Scott A; Koukoulis, Giovanna; Sevala, Mayura; Egan, Thomas M

2005-06-01

If lungs could be retrieved from non-heart-beating donors (NHBDs), the shortage of lungs for transplantation could be alleviated. The use of lungs from NHBDs is associated with a mandatory warm ischemic interval, which results in ischemia-reperfusion injury upon reperfusion. In an earlier study, rat lungs retrieved 2-h postmortem from NHBDs had reduced capillary leak measured by filtration coefficient (Kfc) when reperfused with isoproterenol (iso), associated with an increase in lung tissue levels of cyclic AMP (cAMP). The objective was to determine if this decrease in Kfc was because of beta-stimulation, or would persist despite beta-blockade. Donor rats were treated intraperitoneally with beta-blockade (propranolol or pindolol) or carrier, sacrificed, and lungs were retrieved immediately or 2 h postmortem. The lungs were reperfused with or without iso and the beta-blockers in the reperfusate. Outcome measures were Kfc, wet:dry weight ratio (W/D), lung levels of adenine nucleotides and cAMP. Lungs retrieved immediately after death had normal Kfc and W/D. After 2 h of ischemia, Kfc and W/D were markedly elevated in controls (no drug) and lungs reperfused with beta-blockers alone. Isoproterenol-reperfusion decreased Kfc and W/D significantly (P < 0.01) even in the presence of beta-blockade. Lung cAMP levels were increased only with iso in the absence of beta-blockade. The attenuation of ischemia-reperfusion injury because of iso occurs even in the presence of beta-blockade, and may not be a result of beta-stimulated increased cAMP.

The effect of oat β-glucan on LDL-cholesterol, non-HDL-cholesterol and apoB for CVD risk reduction: a systematic review and meta-analysis of randomised-controlled trials.

Science.gov (United States)

Ho, Hoang V T; Sievenpiper, John L; Zurbau, Andreea; Blanco Mejia, Sonia; Jovanovski, Elena; Au-Yeung, Fei; Jenkins, Alexandra L; Vuksan, Vladimir

2016-10-01

Oats are a rich source of β-glucan, a viscous, soluble fibre recognised for its cholesterol-lowering properties, and are associated with reduced risk of CVD. Our objective was to conduct a systematic review and meta-analysis of randomised-controlled trials (RCT) investigating the cholesterol-lowering potential of oat β-glucan on LDL-cholesterol, non-HDL-cholesterol and apoB for the risk reduction of CVD. MEDLINE, Embase, CINAHL and Cochrane CENTRAL were searched. We included RCT of ≥3 weeks of follow-up, assessing the effect of diets enriched with oat β-glucan compared with controlled diets on LDL-cholesterol, non-HDL-cholesterol or apoB. Two independent reviewers extracted data and assessed study quality and risk of bias. Data were pooled using the generic inverse-variance method with random effects models and expressed as mean differences with 95 % CI. Heterogeneity was assessed by the Cochran's Q statistic and quantified by the I 2-statistic. In total, fifty-eight trials (n 3974) were included. A median dose of 3·5 g/d of oat β-glucan significantly lowered LDL-cholesterol (-0·19; 95 % CI -0·23, -0·14 mmol/l, Pcholesterol (-0·20; 95 % CI -0·26, -0·15 mmol/l, PLDL-cholesterol (I 2=79 %) and non-HDL-cholesterol (I 2=99 %). Pooled analyses showed that oat β-glucan has a lowering effect on LDL-cholesterol, non-HDL-cholesterol and apoB. Inclusion of oat-containing foods may be a strategy for achieving targets in CVD reduction.

Plant villin, lily P-135-ABP, possesses G-actin binding activity and accelerates the polymerization and depolymerization of actin in a Ca2+-sensitive manner.

Science.gov (United States)

Yokota, Etsuo; Tominaga, Motoki; Mabuchi, Issei; Tsuji, Yasunori; Staiger, Christopher J; Oiwa, Kazuhiro; Shimmen, Teruo

2005-10-01

From germinating pollen of lily, two types of villins, P-115-ABP and P-135-ABP, have been identified biochemically. Ca(2+)-CaM-dependent actin-filament binding and bundling activities have been demonstrated for both villins previously. Here, we examined the effects of lily villins on the polymerization and depolymerization of actin. P-115-ABP and P-135-ABP present in a crude protein extract prepared from germinating pollen bound to a DNase I affinity column in a Ca(2+)-dependent manner. Purified P-135-ABP reduced the lag period that precedes actin filament polymerization from monomers in the presence of either Ca(2+) or Ca(2+)-CaM. These results indicated that P-135-ABP can form a complex with G-actin in the presence of Ca(2+) and this complex acts as a nucleus for polymerization of actin filaments. However, the nucleation activity of P-135-ABP is probably not relevant in vivo because the assembly of G-actin saturated with profilin, a situation that mimics conditions found in pollen, was not accelerated in the presence of P-135-ABP. P-135-ABP also enhanced the depolymerization of actin filaments during dilution-mediated disassembly. Growth from filament barbed ends in the presence of Ca(2+)-CaM was also prevented, consistent with filament capping activity. These results suggested that lily villin is involved not only in the arrangement of actin filaments into bundles in the basal and shank region of the pollen tube, but also in regulating and modulating actin dynamics through its capping and depolymerization (or fragmentation) activities in the apical region of the pollen tube, where there is a relatively high concentration of Ca(2+).

Crystal Structure of Full-length Mycobacterium tuberculosis H37Rv Glycogen Branching Enzyme; Insights of N-Terminal [beta]-Sandwich in Sustrate Specifity and Enzymatic Activity

Energy Technology Data Exchange (ETDEWEB)

Pal, Kuntal; Kumar, Shiva; Sharma, Shikha; Garg, Saurabh Kumar; Alam, Mohammad Suhail; Xu, H. Eric; Agrawal, Pushpa; Swaminathan, Kunchithapadam (NU Sinapore); (Van Andel); (IMT-India)

2010-07-13

The open reading frame Rv1326c of Mycobacterium tuberculosis (Mtb) H37Rv encodes for an {alpha}-1,4-glucan branching enzyme (MtbGlgB, EC 2.4.1.18, Uniprot entry Q10625). This enzyme belongs to glycoside hydrolase (GH) family 13 and catalyzes the branching of a linear glucose chain during glycogenesis by cleaving a 1 {yields} 4 bond and making a new 1 {yields} 6 bond. Here, we show the crystal structure of full-length MtbGlgB (MtbGlgBWT) at 2.33-{angstrom} resolution. MtbGlgBWT contains four domains: N1 {beta}-sandwich, N2 {beta}-sandwich, a central ({beta}/{alpha}){sub 8} domain that houses the catalytic site, and a C-terminal {beta}-sandwich. We have assayed the amylase activity with amylose and starch as substrates and the glycogen branching activity using amylose as a substrate for MtbGlgBWT and the N1 domain-deleted (the first 108 residues deleted) Mtb{Delta}108GlgB protein. The N1 {beta}-sandwich, which is formed by the first 105 amino acids and superimposes well with the N2 {beta}-sandwich, is shown to have an influence in substrate binding in the amylase assay. Also, we have checked and shown that several GH13 family inhibitors are ineffective against MtbGlgBWT and Mtb{Delta}108GlgB. We propose a two-step reaction mechanism, for the amylase activity (1 {yields} 4 bond breakage) and isomerization (1 {yields} 6 bond formation), which occurs in the same catalytic pocket. The structural and functional properties of MtbGlgB and Mtb{Delta}108GlgB are compared with those of the N-terminal 112-amino acid-deleted Escherichia coli GlgB (EC{Delta}112GlgB).

beta-Adrenergic and cholinergic receptors in hypertension-induced hypertrophy

International Nuclear Information System (INIS)

Vatner, D.E.; Kirby, D.A.; Homcy, C.J.; Vatner, S.F.

1985-01-01

Perinephritic hypertension was produced in dogs by wrapping one kidney with silk and removing the contralateral kidney 1 week later. Mean arterial pressure rose from 104 +/- 3 to 156 +/- 11 mm Hg, while left ventricular free wall weight, normalized for body weight, was increased by 49%. Muscarinic, cholinergic receptor density measured with [ 3 H]-quinuclidinyl benzilate, fell in hypertensive left ventricles (181 +/- 19 fmol/mg, n = 6; p less than 0.01) as compared with that found in normal left ventricles (272 +/- 16 fmol/mg, n = 8), while receptor affinity was not changed. The beta-adrenergic receptor density, measured by binding studies with [ 3 H]-dihydroalprenolol, rose in the hypertensive left ventricles (108 +/- 10 fmol/mg, n = 7; p less than 0.01) as compared with that found in normal left ventricles (68.6 +/- 5.2 fmol/mg, n = 15), while beta-adrenergic receptor affinity decreased in the hypertensive left ventricles (10.4 +/- 1.2 nM) compared with that found in the normal left ventricles (5.0 +/- 0.7 nM). Plasma norepinephrine levels were similar in the two groups, but myocardial norepinephrine levels were depressed (p less than 0.05) in dogs with hypertension. Moderate left ventricular hypertrophy induced by long-term aortic banding in dogs resulted in elevations in beta-adrenergic receptor density (115 +/- 14 fmol/mg) and decreases in affinity (10.4 +/- 2.2 nM) similar to those observed in the dogs with left ventricular hypertrophy induced by hypertension. Thus, these results suggest that perinephritic hypertension in the dog induces divergent effects on cholinergic and beta-adrenergic receptor density. The increased beta-adrenergic receptor density and decreased affinity may be a characteristic of left ventricular hypertrophy rather than hypertension

Fruiting bodies of Hericium erinaceus (Bull. Pers. – a new source of water-insoluble (1→3-α-d-glucan

Directory of Open Access Journals (Sweden)

Adrian Wiater

2016-09-01

Full Text Available A water-insoluble polysaccharide (WIP was isolated from the fruiting bodies of Hericium erinaceus HE01 by an alkaline solution with the yield of 5%. Structural and compositional analyses by total acid hydrolysis, methylation analysis, FT-IR, FT-Raman, and 1H NMR spectroscopy as well as other instrumental techniques showed predominantly glucose linked by α-glycosidic bonds and small amounts of mannose, xylose, rhamnose, galactose, and ribose. The methylation analysis showed that (1→3-linked Glcp is the major constituent (70.8% of the polymer, while the 3,4 substituted d-Glcp represents the main branching residue of the glucan. The presence of (1→3-α-d-glucan in the hyphae of H. erinaceus was additionally confirmed by the use of specific fluorophore-labeled antibodies.

Clinical studies of beta-thromboglobulin

OpenAIRE

Smith, Robert C.

1983-01-01

Beta-thromboglobulin is a platelet specific protein of molecular weight 35,000, stored in the alpha granules and released during aggregation. Its precise function is unknown but it may act as a 'packing protein' in the alpha granules. Radioimmuno¬ assays to measure it in plasma and urine have been developed. Meticulous techniques of processing and sampling are necessary to prevent artefactual release. In healthy subjects the upper limit of the normal range is 80 ng/ml in ...

1α,25(OH2D3 Induces Actin Depolymerization in Endometrial Carcinoma Cells by Targeting RAC1 and PAK1

Directory of Open Access Journals (Sweden)

Ni Zeng

2016-12-01

Full Text Available Background: Cell proliferation and motility require actin reorganization, which is under control of various signalling pathways including ras-related C3 botulinum toxin substrate 1 (RAC1, p21 protein-activated kinase 1 (PAK1 and actin related protein 2 (ARP2. Tumour cell proliferation is modified by 1α,25-Dihydroxy-Vitamin D3 (1α,25(OH2D3, a steroid hormone predominantly known for its role in calcium and phosphorus metabolism. The present study explored whether 1α,25(OH2D3 modifies actin cytoskeleton in Ishikawa cells, a well differentiated endometrial carcinoma cell line. Methods: To this end, actin cytoskeleton was visualized by confocal microscopy. Globular over filamentous actin ratio was determined utilizing Western blotting and flow cytometry, transcript levels by qRT-PCR and protein abundance by immunoblotting. Results: A 24 hour treatment with 1α,25(OH2D3 (100 nM significantly decreased RAC1 and PAK1 transcript levels and activity, decreased ARP2 protein levels and depolymerized actin. The effect of 1α,25(OH2D3 on actin polymerization was mimicked by pharmacological inhibition of RAC1 and PAK1. Conclusions: 1α,25(OH2D3 leads to disruption of RAC1 and PAK1 activity with subsequent actin depolymerization of endometrial carcinoma cells.

Depolymerization of coal by O2 oxidation followed by acid hydrolysis; Sanso sanka-kasui bunkai ni yoru sekitan no teionkai jugo

Energy Technology Data Exchange (ETDEWEB)

Aizawa, S.; Hayashi, J.; Kumagai, H.; Chiba, T. [Hokkaido University, Sapporo (Japan). Center for Advanced Research of Energy Technology; Morooka, S. [Kyushu University, Fukuoka (Japan). Faculty of Engineering

1996-10-28

With an objective to elucidate characteristics of oxygen addition to coal, and characteristics of solvent extraction by means of depolymerization, experiments were performed on oxygen oxidation and acid hydrolysis of brown coals. Coals used for the experiments are Morwell (MW), Yallourn (YL) , South Banko (SB) and Wyoming (WY) coals. Test samples were suspended in weak alkaline aqueous solution, and then oxygen was blown into them with pressure kept at atmospheric pressure. After a lapse of a predetermined time, the samples were cooled, and made as acidic as pH 1.3 in hydrochloric acid, followed by acid hydrolysis. Oxygen consumption increased with the reaction time, and with the MW coal, one mol oxygen reacted to 11 mols of coal. Spectral analysis on the YL and WY coal experiments revealed that aliphatic carbon combined with aromatic carbon or ether group has turned to peroxide, whose C-C or C-O bond was broken down as a result of acid hydrolysis of the peroxide, producing oxygen containing compounds. As a result of the depolymerization, the rate of extraction by using DMF, DMSO and methanol/THF mixed solvent increased to 90% or higher. Proportion of bond and cutting-off affects largely collapse of the cross-link structure. The carbon conversion to volatiles was at most 4%. 1 ref., 10 figs.

Morphology and Structural Properties of Novel Short Linear Glucan/Protein Hybrid Nanoparticles and Their Influence on the Rheological Properties of Starch Gel.

Science.gov (United States)

Li, Xiaojing; Ji, Na; Li, Man; Zhang, Shuangling; Xiong, Liu; Sun, Qingjie

2017-09-13

Starch nanoparticles were potential texture modifiers. However, they have strong tendency to aggregate and poor water dispersibility, which limited their application. The interaction between glucan (prepared from starch by enzymatic modification) and protein could significantly improve the dispersity of starch nanoparticles and, thus, enhance the rheological properties of food gels. In this work, glucan/protein hybrid nanoparticles were successfully developed for the first time using short linear glucan (SLG) and edible proteins [soy protein isolate (SPI), rice protein (RP), and whey protein isolate (WPI)]. The results showed that the SLG/SPI hybrid nanoparticles exhibited hollow structures, of which the smallest size was approximately 10-20 nm when the SLG/SPI ratio was 10:5. In contrast, SLG/RP nanoparticles displayed flower-like superstructures, and SLG/WPI nanoparticles presented stacked lamellar nanostructures with a width of 5-10 nm and a length of 50-70 nm. In comparison to bare SLG nanoparticles, SLG/SPI and SLG/WPI hybrid nanoparticles had higher melting temperatures. The addition of all nanoparticles greatly increased the storage modulus of corn starch gels and decreased loss tangent values. Importantly, the G' value of starch gels increased by 567% with the addition of flower-like SLG/RP superstructures.

The mother or the fetus? 11beta-hydroxysteroid dehydrogenase type 2 null mice provide evidence for direct fetal programming of behavior by endogenous glucocorticoids.

Science.gov (United States)

Holmes, Megan C; Abrahamsen, Christian T; French, Karen L; Paterson, Janice M; Mullins, John J; Seckl, Jonathan R

2006-04-05

Low birth weight associates with increased susceptibility to adult cardiometabolic and affective disorders spawning the notion of fetal "programming." Prenatal exposure to excess glucocorticoids may be causal. In support, maternal stress or treatment during pregnancy with dexamethasone (which crosses the placenta) or inhibitors of fetoplacental 11beta-hydroxysteroid dehydrogenase type 2 (11beta-HSD2), the physiological "barrier" to maternal glucocorticoids, reduces birth weight and programs permanent offspring hypertension, hyperglycemia, and anxiety behaviors. It remains uncertain whether such effects are mediated indirectly via altered maternal function or directly on the fetus and its placenta. To dissect this critical issue, we mated 11beta-HSD2(+/-) mice such that each pregnant female produces +/+, +/-, and -/- offspring and compared them with offspring of homozygous wild-type and -/- matings. We show that 11beta-HSD2(-/-) offspring of either +/- or -/- mothers have lower birth weight and exhibit greater anxiety than 11beta-HSD2(+/+) littermates. This provides clear evidence for the key role of fetoplacental 11beta-HSD2 in prenatal glucocorticoid programming.

Effect of Agave tequilana juice on cell wall polysaccharides of three Saccharomyces cerevisiae strains from different origins.

Science.gov (United States)