Weak coupling chambers in N=2 BPS quiver theory

Energy Technology Data Exchange (ETDEWEB)

Saidi, El Hassan, E-mail: h-saidi@fsr.ac.ma [Lab of High Energy Physics, Modeling and Simulations, Faculty of Science, University Mohammed V-Agdal, 4 Avenue Ibn Battota, Rabat (Morocco); Centre of Physics and Mathematics, CPM-CNESTEN, Rabat (Morocco)

2012-11-01

Using recent results on BPS quiver theory, we develop a group theoretical method to describe the quiver mutations encoding the quantum mechanical duality relating the spectra of distinct quivers. We illustrate the method by computing the BPS spectrum of the infinite weak chamber of some examples of N=2 supersymmetric gauge models without and with quark hypermultiplets.

Homozygous EEF1A2 mutation causes dilated cardiomyopathy, failure to thrive, global developmental delay, epilepsy and early death.

Science.gov (United States)

Cao, Siqi; Smith, Laura L; Padilla-Lopez, Sergio R; Guida, Brandon S; Blume, Elizabeth; Shi, Jiahai; Morton, Sarah U; Brownstein, Catherine A; Beggs, Alan H; Kruer, Michael C; Agrawal, Pankaj B

2017-09-15

Eukaryotic elongation factor 1A (EEF1A), is encoded by two distinct isoforms, EEF1A1 and EEF1A2; whereas EEF1A1 is expressed almost ubiquitously, EEF1A2 expression is limited such that it is only detectable in skeletal muscle, heart, brain and spinal cord. Currently, the role of EEF1A2 in normal cardiac development and function is unclear. There have been several reports linking de novo dominant EEF1A2 mutations to neurological issues in humans. We report a pair of siblings carrying a homozygous missense mutation p.P333L in EEF1A2 who exhibited global developmental delay, failure to thrive, dilated cardiomyopathy and epilepsy, ultimately leading to death in early childhood. A third sibling also died of a similar presentation, but DNA was unavailable to confirm the mutation. Functional genomic analysis was performed in S. cerevisiae and zebrafish. In S. cerevisiae, there was no evidence for a dominant-negative effect. Previously identified putative de novo mutations failed to complement yeast strains lacking the EEF1A ortholog showing a major growth defect. In contrast, the introduction of the mutation seen in our family led to a milder growth defect. To evaluate its function in zebrafish, we knocked down eef1a2 expression using translation blocking and splice-site interfering morpholinos. EEF1A2-deficient zebrafish had skeletal muscle weakness, cardiac failure and small heads. Human EEF1A2 wild-type mRNA successfully rescued the morphant phenotype, but mutant RNA did not. Overall, EEF1A2 appears to be critical for normal heart function in humans, and its deficiency results in clinical abnormalities in neurologic function as well as in skeletal and cardiac muscle defects. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

A novel missense HGD gene mutation, K57N, in a patient with alkaptonuria.

Science.gov (United States)

Grasko, Jonathan M; Hooper, Amanda J; Brown, Jeffrey W; McKnight, C James; Burnett, John R

2009-05-01

Alkaptonuria is a rare recessive disorder of phenylalanine/tyrosine metabolism due to a defect in the enzyme homogentisate 1,2-dioxygenase (HGD) caused by mutations in the HGD gene. We report the case of a 38 year-old male with known alkaptonuria who was referred to an adult metabolic clinic after initially presenting to an emergency department with renal colic and subsequently passing black ureteric calculi. He complained of severe debilitating lower back pain, worsening over the last few years. A CT scan revealed marked degenerative changes and severe narrowing of the disc spaces along the entire lumbar spine. Sequencing of the HGD gene revealed that he was a compound heterozygote for a previously described missense mutation in exon 13 (G360R) and a novel missense mutation in exon 3 (K57N). Lys(57) is conserved among species and mutation of this residue is predicted to affect HGD protein function by interfering with substrate traffic at the active site. In summary, we describe an alkaptonuric patient and report a novel missense HGD mutation, K57N.

Recessive Mutations in ACPT, Encoding Testicular Acid Phosphatase, Cause Hypoplastic Amelogenesis Imperfecta.

Science.gov (United States)

Seymen, Figen; Kim, Youn Jung; Lee, Ye Ji; Kang, Jenny; Kim, Tak-Heun; Choi, Hwajung; Koruyucu, Mine; Kasimoglu, Yelda; Tuna, Elif Bahar; Gencay, Koray; Shin, Teo Jeon; Hyun, Hong-Keun; Kim, Young-Jae; Lee, Sang-Hoon; Lee, Zang Hee; Zhang, Hong; Hu, Jan C-C; Simmer, James P; Cho, Eui-Sic; Kim, Jung-Wook

2016-11-03

Amelogenesis imperfecta (AI) is a heterogeneous group of genetic disorders affecting tooth enamel. The affected enamel can be hypoplastic and/or hypomineralized. In this study, we identified ACPT (testicular acid phosphatase) biallelic mutations causing non-syndromic, generalized hypoplastic autosomal-recessive amelogenesis imperfecta (AI) in individuals from six apparently unrelated Turkish families. Families 1, 4, and 5 were affected by the homozygous ACPT mutation c.713C>T (p.Ser238Leu), family 2 by the homozygous ACPT mutation c.331C>T (p.Arg111Cys), family 3 by the homozygous ACPT mutation c.226C>T (p.Arg76Cys), and family 6 by the compound heterozygous ACPT mutations c.382G>C (p.Ala128Pro) and 397G>A (p.Glu133Lys). Analysis of the ACPT crystal structure suggests that these mutations damaged the activity of ACPT by altering the sizes and charges of key amino acid side chains, limiting accessibility of the catalytic core, and interfering with homodimerization. Immunohistochemical analysis confirmed localization of ACPT in secretory-stage ameloblasts. The study results provide evidence for the crucial function of ACPT during amelogenesis. Copyright © 2016 American Society of Human Genetics. Published by Elsevier Inc. All rights reserved.

Interfering Satellite RNAs of Bamboo mosaic virus

Directory of Open Access Journals (Sweden)

Kuan-Yu Lin

2017-05-01

Full Text Available Satellite RNAs (satRNAs are sub-viral agents that may interact with their cognate helper virus (HV and host plant synergistically and/or antagonistically. SatRNAs totally depend on the HV for replication, so satRNAs and HV usually evolve similar secondary or tertiary RNA structures that are recognized by a replication complex, although satRNAs and HV do not share an appreciable sequence homology. The satRNAs of Bamboo mosaic virus (satBaMV, the only satRNAs of the genus Potexvirus, have become one of the models of how satRNAs can modulate HV replication and virus-induced symptoms. In this review, we summarize the molecular mechanisms underlying the interaction of interfering satBaMV and BaMV. Like other satRNAs, satBaMV mimics the secondary structures of 5′- and 3′-untranslated regions (UTRs of BaMV as a molecular pretender. However, a conserved apical hairpin stem loop (AHSL in the 5′-UTR of satBaMV was found as the key determinant for downregulating BaMV replication. In particular, two unique nucleotides (C60 and C83 in the AHSL of satBaMVs determine the satBaMV interference ability by competing for the replication machinery. Thus, transgenic plants expressing interfering satBaMV could confer resistance to BaMV, and interfering satBaMV could be used as biological-control agent. Unlike two major anti-viral mechanisms, RNA silencing and salicylic acid-mediated immunity, our findings in plants by in vivo competition assay and RNA deep sequencing suggested replication competition is involved in this transgenic satBaMV-mediated BaMV interference. We propose how a single nucleotide of satBaMV can make a great change in BaMV pathogenicity and the underlying mechanism.

Effects of Point Mutations in the Major Capsid Protein of Beet Western Yellows Virus on Capsid Formation, Virus Accumulation, and Aphid Transmission

Science.gov (United States)

Brault, V.; Bergdoll, M.; Mutterer, J.; Prasad, V.; Pfeffer, S.; Erdinger, M.; Richards, K. E.; Ziegler-Graff, V.

2003-01-01

Point mutations were introduced into the major capsid protein (P3) of cloned infectious cDNA of the polerovirus beet western yellows virus (BWYV) by manipulation of cloned infectious cDNA. Seven mutations targeted sites on the S domain predicted to lie on the capsid surface. An eighth mutation eliminated two arginine residues in the R domain, which is thought to extend into the capsid interior. The effects of the mutations on virus capsid formation, virus accumulation in protoplasts and plants, and aphid transmission were tested. All of the mutants replicated in protoplasts. The S-domain mutant W166R failed to protect viral RNA from RNase attack, suggesting that this particular mutation interfered with stable capsid formation. The R-domain mutant R7A/R8A protected ∼90% of the viral RNA strand from RNase, suggesting that lower positive-charge density in the mutant capsid interior interfered with stable packaging of the complete strand into virions. Neither of these mutants systemically infected plants. The six remaining mutants properly packaged viral RNA and could invade Nicotiana clevelandii systemically following agroinfection. Mutant Q121E/N122D was poorly transmitted by aphids, implicating one or both targeted residues in virus-vector interactions. Successful transmission of mutant D172N was accompanied either by reversion to the wild type or by appearance of a second-site mutation, N137D. This finding indicates that D172 is also important for transmission but that the D172N transmission defect can be compensated for by a “reverse” substitution at another site. The results have been used to evaluate possible structural models for the BWYV capsid. PMID:12584348

Detection of EGFR mutations with mutation-specific antibodies in stage IV non-small-cell lung cancer

Directory of Open Access Journals (Sweden)

Viteri Santiago

2010-12-01

Full Text Available Abstract Background Immunohistochemistry (IHC with mutation-specific antibodies may be an ancillary method of detecting EGFR mutations in lung cancer patients. Methods EGFR mutation status was analyzed by DNA assays, and compared with IHC results in five non-small-cell lung cancer (NSCLC cell lines and tumor samples from 78 stage IV NSCLC patients. Results IHC correctly identified del 19 in the H1650 and PC9 cell lines, L858R in H1975, and wild-type EGFR in H460 and A549, as well as wild-type EGFR in tumor samples from 22 patients. IHC with the mAb against EGFR with del 19 was highly positive for the protein in all 17 patients with a 15-bp (ELREA deletion in exon 19, whereas in patients with other deletions, IHC was weakly positive in 3 cases and negative in 9 cases. IHC with the mAb against the L858R mutation showed high positivity for the protein in 25/27 (93% patients with exon 21 EGFR mutations (all with L858R but did not identify the L861Q mutation in the remaining two patients. Conclusions IHC with mutation-specific mAbs against EGFR is a promising method for detecting EGFR mutations in NSCLC patients. However these mAbs should be validated with additional studies to clarify their possible role in routine clinical practice for screening EGFR mutations in NSCLC patients.

IARS mutation causes prenatal death in Japanese Black cattle.

Science.gov (United States)

Hirano, Takashi; Matsuhashi, Tamako; Takeda, Kenji; Hara, Hiromi; Kobayashi, Naohiko; Kita, Kazuo; Sugimoto, Yoshikazu; Hanzawa, Kei

2016-09-01

Isoleucyl-tRNA synthetase (IARS) c.235G > C (p.V79L) is a causative mutation for a recessive disease called IARS disorder in Japanese black cattle. The disease is involved in weak calf syndrome and is characterized by low birth weight, weakness and poor suckling. The gestation period is often slightly extended, implying that intrauterine growth is retarded. In a previous analysis of 2597 artificial insemination (AI) procedures, we suggested that the IARS mutation might contribute toward an increase in the incidence of prenatal death. In this study, we extended this analysis to better clarify the association between the IARS mutation and prenatal death. The IARS genotypes of 92 animals resulting from crosses between carrier (G/C) × G/C were 27 normal (G/G), 55 G/C and 10 affected animals (C/C) (expected numbers: 23, 46 and 23, respectively). Compared to the expected numbers, there were significantly fewer affected animals in this population (P causes calf death, but also embryonic or fetal death. © 2016 Japanese Society of Animal Science.

Exome sequencing identifies a novel SMCHD1 mutation in facioscapulohumeral muscular dystrophy 2.

Science.gov (United States)

Mitsuhashi, Satomi; Boyden, Steven E; Estrella, Elicia A; Jones, Takako I; Rahimov, Fedik; Yu, Timothy W; Darras, Basil T; Amato, Anthony A; Folkerth, Rebecca D; Jones, Peter L; Kunkel, Louis M; Kang, Peter B

2013-12-01

FSHD2 is a rare form of facioscapulohumeral muscular dystrophy (FSHD) characterized by the absence of a contraction in the D4Z4 macrosatellite repeat region on chromosome 4q35 that is the hallmark of FSHD1. However, hypomethylation of this region is common to both subtypes. Recently, mutations in SMCHD1 combined with a permissive 4q35 allele were reported to cause FSHD2. We identified a novel p.Lys275del SMCHD1 mutation in a family affected with FSHD2 using whole-exome sequencing and linkage analysis. This mutation alters a highly conserved amino acid in the ATPase domain of SMCHD1. Subject III-11 is a male who developed asymmetrical muscle weakness characteristic of FSHD at 13 years. Physical examination revealed marked bilateral atrophy at biceps brachii, bilateral scapular winging, some asymmetrical weakness at tibialis anterior and peroneal muscles, and mild lower facial weakness. Biopsy of biceps brachii in subject II-5, the father of III-11, demonstrated lobulated fibers and dystrophic changes. Endomysial and perivascular inflammation was found, which has been reported in FSHD1 but not FSHD2. Given the previous report of SMCHD1 mutations in FSHD2 and the clinical presentations consistent with the FSHD phenotype, we conclude that the SMCHD1 mutation is the likely cause of the disease in this family. Copyright © 2013 Elsevier B.V. All rights reserved.

Efficient inhibition of the formation of joint adhesions by ERK2 small interfering RNAs

International Nuclear Information System (INIS)

Li, Fengfeng; Ruan, Hongjiang; Fan, Cunyi; Zeng, Bingfang; Wang, Chunyang; Wang, Xiang

2010-01-01

Transforming growth factor-β1 and fibroblast growth factor-2 play very important roles in fibroblast proliferation and collagen expression. These processes lead to the formation of joint adhesions through the SMAD and MAPK pathways, in which extracellular signal-regulated kinase (ERK)2 is considered to be crucial. Based on these theories, we examined the effects of a lentivirus-mediated small interfering RNA (siRNA) targeting ERK2 on the suppression of joint adhesion formation in vivo. The effects were assessed in vivo from different aspects including the adhesion score, histology and joint contracture angle. We found that the adhesions in the ERK2 siRNA group became soft and weak, and were easily stretched. Accordingly, the flexion contracture angles in the ERK2 siRNA group were also reduced (P < 0.05 compared with the control group). The animals appeared healthy, with no signs of impaired wound healing. In conclusion, local delivery of a lentivirus-mediated siRNA targeting ERK2 can ameliorate joint adhesion formation effectively and safely.

The myopathy-causing mutation DNM2-S619L leads to defective tubulation in vitro and in developing zebrafish

Directory of Open Access Journals (Sweden)

Elizabeth M. Gibbs

2014-01-01

Full Text Available DNM2 is a ubiquitously expressed GTPase that regulates multiple subcellular processes. Mutations in DNM2 are a common cause of centronuclear myopathy, a severe disorder characterized by altered skeletal muscle structure and function. The precise mechanisms underlying disease-associated DNM2 mutations are unresolved. We examined the common DNM2-S619L mutation using both in vitro and in vivo approaches. Expression of DNM2-S619L in zebrafish led to the accumulation of aberrant vesicular structures and to defective excitation-contraction coupling. Expression of DNM2-S619L in COS7 cells resulted in defective BIN1-dependent tubule formation. These data suggest that DNM2-S619L causes disease, in part, by interfering with membrane tubulation.

Progesterone receptor membrane component-1 (PGRMC1) is the mediator of progesterone's antiapoptotic action in spontaneously immortalized granulosa cells as revealed by PGRMC1 small interfering ribonucleic acid treatment and functional analysis of PGRMC1 mutations.

Science.gov (United States)

Peluso, John J; Romak, Jonathan; Liu, Xiufang

2008-02-01

Progesterone (P4) receptor membrane component-1 (PGRMC1) and its binding partner, plasminogen activator inhibitor 1 RNA binding protein (PAIRBP1) are thought to form a complex that functions as membrane receptor for P4. The present investigations confirm PGRMC1's role in this membrane receptor complex by demonstrating that depleting PGMRC1 with PGRMC1 small interfering RNA results in a 60% decline in [(3)H]P4 binding and the loss of P4's antiapoptotic action. Studies conducted on partially purified GFP-PGRMC1 fusion protein indicate that [(3)H]P4 specifically binds to PGRMC1 at a single site with an apparent K(d) of about 35 nm. In addition, experiments using various deletion mutations reveal that the entire PGRMC1 molecule is required for maximal [(3)H]P4 binding and P4 responsiveness. Analysis of the binding data also suggests that the P4 binding site is within a segment of PGRMC1 that is composed of the transmembrane domain and the initial segment of the C terminus. Interestingly, PAIRBP1 appears to bind to the C terminus between amino acids 70-130, which is distal to the putative P4 binding site. Taken together, these data provide compelling evidence that PGRMC1 is the P4 binding protein that mediates P4's antiapoptotic action. Moreover, the deletion mutation studies indicate that each domain of PGRMC1 plays an essential role in modulating PGRMC1's capacity to both bind and respond to P4. Additional studies are required to more precisely delineate the role of each PGRMC1 domain in transducing P4's antiapoptotic action.

The role of weak selection and high mutation rates in nearly neutral evolution.

Science.gov (United States)

Lawson, Daniel John; Jensen, Henrik Jeldtoft

2009-04-21

Neutral dynamics occur in evolution if all types are 'effectively equal' in their reproductive success, where the definition of 'effectively equal' depends on the population size and the details of mutations. Empirically observed neutral genetic evolution in extremely large clonal populations can only be explained under current models if selection is completely absent. Such models typically consider the case where population dynamics occurs on a different timescale to evolution. However, this assumption is invalid when mutations are not rare in a whole population. We show that this has important consequences for the occurrence of neutral evolution in clonal populations. In highly connected type spaces, neutral dynamics can occur for all population sizes despite significant selective differences, via the forming of effectively neutral networks connecting rare neutral types. Biological implications include an explanation for the high diversity of rare types that survive in large clonal populations, and a theoretical justification for the use of neutral null models.

A novel mutation in PNPLA2 leading to neutral lipid storage disease with myopathy.

Science.gov (United States)

Ash, Daniel B; Papadimitriou, Dimitra; Hays, Arthur P; Dimauro, Salvatore; Hirano, Michio

2012-09-01

Mutations in PNPLA2, a gene encoding adipose triglyceride lipase, lead to neutral lipid storage disease with myopathy. To report the clinical and molecular features of a case of neutral lipid storage disease with myopathy resulting from a novel mutation in PNPLA2. Case report. University hospital. A 65-year-old man with progressive muscle weakness and high serum creatine kinase levels. Direct sequencing of the PNPLA2 gene. Identification of a novel homozygous mutation in the patient's PNPLA2 gene confirmed the suspected diagnosis of neutral lipid storage disease with myopathy. Screening of the PNPLA2 gene should be considered for patients presenting with high levels of creatine kinase, progressive muscle weakness, and systemic lipid accumulation. The presence of Jordans anomaly can be a strong diagnostic clue.

Control over interfering memories in eating disorders.

Science.gov (United States)

Stramaccia, Davide Francesco; Penolazzi, Barbara; Libardi, Arianna; Genovese, Aldo; Castelli, Luigi; Palomba, Daniela; Galfano, Giovanni

2018-02-01

Recent studies have suggested that patients suffering from either anorexia nervosa (AN) or bulimia nervosa (BN) exhibit abnormal performance in the ability to control cognitive interference in response selection. We assessed the status of cognitive control in episodic memory by addressing the ability to inhibit interfering memories. To this end, we used the retrieval-practice paradigm, which allows for measuring both the beneficial and the detrimental effects of memory practice. The latter phenomenon, known as retrieval-induced forgetting (RIF), is thought to reflect an adaptive inhibitory mechanism aimed at reducing competition in memory retrieval. Twenty-seven healthy controls and 27 patients suffering from eating disorders (either AN or BN) performed a retrieval-practice paradigm and a control task addressing general reactivity and filled a self-report questionnaire on impulsivity. No differences between patients and healthy controls were observed for the beneficial effects of practice. The same pattern also emerged for RIF. However, when patients with AN and BN were analyzed separately, a clear dissociation emerged: patients with AN displayed no hint of RIF, whereas patients with BN showed an intact memory suppression performance. No group differences emerged in the control task. Our findings suggest a specific impairment in the ability to suppress interfering memories in patients with AN, thus extending current evidence of cognitive control deficits in AN to episodic memory.

P2. A fused silica Cherenkov detector for the high precision determination of the weak mixing angle

Energy Technology Data Exchange (ETDEWEB)

Gerz, Kathrin; Becker, Dominik; Jennewein, Thomas; Baunack, Sebastian [Johannes Gutenberg Universitaet Mainz (Germany); Kumar, Krishna [Department of Physics and Astronomy, Stony Brook University, Stony Brook (United States); Maas, Frank [Johannes Gutenberg Universitaet Mainz (Germany); Helmholtz Institut Mainz (Germany)

2016-07-01

The weak mixing angle is a central parameter of the standard model and its high precision determination is tantamount to probing for new physics effects. The P2 experiment at the MESA accelerator in Mainz will perform such a measurement of the weak mixing angle via parity violating electron-proton scattering. We aim to determine sin{sup 2}(Θ{sub W}) to a relative precision of 0.13%. Since the weak charge of the proton is small compared to its electric charge, the measurable asymmetry is only 33 ppb, requiring a challenging measurement to a precision of only 0.44 ppb. In order to achieve this precision we need to collect very high statistics and carefully minimize interfering effects like apparatus induced false asymmetries. We present the status of the development of an integrating fused-silica Cherenkov detector, which is suitable for a high precision and high intensity experiment like P2. The contribution will focus on the investigation of the detector's response to incoming signal and background particles both by simulations and by beam tests at the MAMI accelerator.

Functional Trade-Offs in Promiscuous Enzymes Cannot Be Explained by Intrinsic Mutational Robustness of the Native Activity.

Directory of Open Access Journals (Sweden)

Miriam Kaltenbach

2016-10-01

Full Text Available The extent to which an emerging new function trades off with the original function is a key characteristic of the dynamics of enzyme evolution. Various cases of laboratory evolution have unveiled a characteristic trend; a large increase in a new, promiscuous activity is often accompanied by only a mild reduction of the native, original activity. A model that associates weak trade-offs with "evolvability" was put forward, which proposed that enzymes possess mutational robustness in the native activity and plasticity in promiscuous activities. This would enable the acquisition of a new function without compromising the original one, reducing the benefit of early gene duplication and therefore the selection pressure thereon. Yet, to date, no experimental study has examined this hypothesis directly. Here, we investigate the causes of weak trade-offs by systematically characterizing adaptive mutations that occurred in two cases of evolutionary transitions in enzyme function: (1 from phosphotriesterase to arylesterase, and (2 from atrazine chlorohydrolase to melamine deaminase. Mutational analyses in various genetic backgrounds revealed that, in contrast to the prevailing model, the native activity is less robust to mutations than the promiscuous activity. For example, in phosphotriesterase, the deleterious effect of individual mutations on the native phosphotriesterase activity is much larger than their positive effect on the promiscuous arylesterase activity. Our observations suggest a revision of the established model: weak trade-offs are not caused by an intrinsic robustness of the native activity and plasticity of the promiscuous activity. We propose that upon strong adaptive pressure for the new activity without selection against the original one, selected mutations will lead to the largest possible increases in the new function, but whether and to what extent they decrease the old function is irrelevant, creating a bias towards initially weak

Una aproximació ontològica de la interfície d’Internet i les implicacions en el disseny.

Directory of Open Access Journals (Sweden)

Francesc Morera Vidal

2015-07-01

Full Text Available La seva estructura d'Internet no és uniforme ni ordenada en el sentit de “prevista”, sinó que més aviat és adaptable i caòtica. El punt de contacte entre l’emissor i el receptor final de la informació digital és la interfície. La forma habitual de la interfície és la de pantalla.La interfície no ofereix una connexió neutre en cap de les dues direccions de la comunicació a la xarxa. El control de l’aparença de la interfície condicionarà aquesta comunicació. En un mitjà sincrètic com Internet, el disseny de la interfície té influència en el desplaçament dels centres de poder.

The rate of beneficial mutations surfing on the wave of a range expansion.

Directory of Open Access Journals (Sweden)

Rémi Lehe

Full Text Available Many theoretical and experimental studies suggest that range expansions can have severe consequences for the gene pool of the expanding population. Due to strongly enhanced genetic drift at the advancing frontier, neutral and weakly deleterious mutations can reach large frequencies in the newly colonized regions, as if they were surfing the front of the range expansion. These findings raise the question of how frequently beneficial mutations successfully surf at shifting range margins, thereby promoting adaptation towards a range-expansion phenotype. Here, we use individual-based simulations to study the surfing statistics of recurrent beneficial mutations on wave-like range expansions in linear habitats. We show that the rate of surfing depends on two strongly antagonistic factors, the probability of surfing given the spatial location of a novel mutation and the rate of occurrence of mutations at that location. The surfing probability strongly increases towards the tip of the wave. Novel mutations are unlikely to surf unless they enjoy a spatial head start compared to the bulk of the population. The needed head start is shown to be proportional to the inverse fitness of the mutant type, and only weakly dependent on the carrying capacity. The precise location dependence of surfing probabilities is derived from the non-extinction probability of a branching process within a moving field of growth rates. The second factor is the mutation occurrence which strongly decreases towards the tip of the wave. Thus, most successful mutations arise at an intermediate position in the front of the wave. We present an analytic theory for the tradeoff between these factors that allows to predict how frequently substitutions by beneficial mutations occur at invasion fronts. We find that small amounts of genetic drift increase the fixation rate of beneficial mutations at the advancing front, and thus could be important for adaptation during species invasions.

A Novel Homozygous MYO7A Mutation: Case Report

Directory of Open Access Journals (Sweden)

Mahsa Ahmadi

2018-05-01

Full Text Available MYO7A is an unconventional myosin that is essential for ordinary hearing and vision; mutations in the MYO7A gene result in Usher syndrome type 1B and other disorders. In this manuscript, we reported a mutation (c.4705delA in exon 35, causing the alteration of a Ser amino acid to Ala at codon 1569 (p.H2027del located within the first FERMdomain of the human protein myosin VIIA. This mutation involved in the pathogenesis of hearing loss, congenital night blindness, muscular weakness, skin problem, and difficulty in keeping balance in the 13-year-old female. After checkup the patient’s DNA was extracted from peripheral blood and amplification was performed by PCR. Sequencing method was performed for identification of the mutation. The c.4705delA mutation in exon 35 was found in the patient in heterozygosis form; this means that her mother and father were carriers. This mutation is located on the tail of the myosinVIIA protein and is associated with several disorders.

Pulmonary administration of small interfering RNA : The route to go?

NARCIS (Netherlands)

Ruigrok, Mitchel; Frijlink, Henderik W.; Hinrichs, Wouter

2016-01-01

Ever since the discovery of RNA interference (RNAi), which is a post-transcriptional gene silencing mechanism, researchers have been studying the therapeutic potential of using small interfering RNA (siRNA) to treat diseases that are characterized by excessive gene expression. Excessive gene

Reconstructing weak values without weak measurements

International Nuclear Information System (INIS)

Johansen, Lars M.

2007-01-01

I propose a scheme for reconstructing the weak value of an observable without the need for weak measurements. The post-selection in weak measurements is replaced by an initial projector measurement. The observable can be measured using any form of interaction, including projective measurements. The reconstruction is effected by measuring the change in the expectation value of the observable due to the projector measurement. The weak value may take nonclassical values if the projector measurement disturbs the expectation value of the observable

Selection of peptides interfering with protein-protein interaction.

Science.gov (United States)

Gaida, Annette; Hagemann, Urs B; Mattay, Dinah; Räuber, Christina; Müller, Kristian M; Arndt, Katja M

2009-01-01

Cell physiology depends on a fine-tuned network of protein-protein interactions, and misguided interactions are often associated with various diseases. Consequently, peptides, which are able to specifically interfere with such adventitious interactions, are of high interest for analytical as well as medical purposes. One of the most abundant protein interaction domains is the coiled-coil motif, and thus provides a premier target. Coiled coils, which consist of two or more alpha-helices wrapped around each other, have one of the simplest interaction interfaces, yet they are able to confer highly specific homo- and heterotypic interactions involved in virtually any cellular process. While there are several ways to generate interfering peptides, the combination of library design with a powerful selection system seems to be one of the most effective and promising approaches. This chapter guides through all steps of such a process, starting with library options and cloning, detailing suitable selection techniques and ending with purification for further down-stream characterization. Such generated peptides will function as versatile tools to interfere with the natural function of their targets thereby illuminating their down-stream signaling and, in general, promoting understanding of factors leading to specificity and stability in protein-protein interactions. Furthermore, peptides interfering with medically relevant proteins might become important diagnostics and therapeutics.

MAP Detector for Flash Memory Without Accessing the Interfering Cells

DEFF Research Database (Denmark)

Yassine, Hachem; Badiu, Mihai Alin; Coon, Justin P.

2018-01-01

the latency cost of accessing the interfering cells. Specifically, we exploit the fact that adjacent cells have common interferers by modeling the system as an appropriate hidden Markov model. Then we use the sum-product (message-passing) algorithm to compute the marginal posterior probabilities of the stored...

Which Depressive Symptoms and Medication Side Effects Are Perceived by Patients as Interfering Most with Occupational Functioning?

Directory of Open Access Journals (Sweden)

Raymond W. Lam

2012-01-01

Full Text Available Background. Major depressive disorder (MDD is associated with significant impairment in occupational functioning. This study sought to determine which depressive symptoms and medication side effects were perceived by patients with MDD to have the greatest interference on work functioning. Methods. 164 consecutive patients with MDD by DSM-IV criteria completed a standard assessment that included a self-rated questionnaire about the degree to which symptoms and side effects interfered with work functioning. Results. The symptoms perceived by patients as interfering most with work functioning were fatigue and low energy, insomnia, concentration and memory problems, anxiety, and irritability. The medication side effects rated as interfering most with work functioning were daytime sedation, insomnia, headache, and agitation/anxiety. There were no differences between men and women in symptoms or side effects that were perceived as interfering with work functioning. Limitations. This was a cross-sectional study; only subjective assessments of work functioning were obtained; the fact that patients were using varied medications acts as a potential confound. Conclusions. Specific depressive symptoms and medication side effects were perceived by patients as interfering more with occupational functioning than others. These factors should be considered in treatment selection (e.g., in the choice of antidepressant in working patients with MDD.

GNE Myopathy in Turkish Sisters with a Novel Homozygous Mutation

Science.gov (United States)

Diniz, Gulden; Secil, Yaprak; Ceylaner, Serdar; Tokucoglu, Figen; Türe, Sabiha; Celebisoy, Mehmet; İncesu, Tülay Kurt; Akhan, Galip

2016-01-01

Background. Hereditary inclusion body myopathy is caused by biallelic defects in the GNE gene located on chromosome 9p13. It generally affects adults older than 20 years of age. Methods and Results. In this study, we present two Turkish sisters with progressive myopathy and describe a novel mutation in the GNE gene. Both sisters had slightly higher levels of creatine kinase (CK) and muscle weakness. The older sister presented at 38 years of age with an inability to climb steps, weakness, and a steppage gait. Her younger sister was 36 years old and had similar symptoms. The first symptoms of the disorder were seen when the sisters were 30 and 34 years old, respectively. The muscle biopsy showed primary myopathic features and presence of rimmed vacuoles. DNA analysis demonstrated the presence of previously unknown homozygous mutations [c.2152 G>A (p.A718T)] in the GNE genes. Conclusion. Based on our literature survey, we believe that ours is the first confirmed case of primary GNE myopathy with a novel missense mutation in Turkey. These patients illustrate that the muscle biopsy is still an important method for the differential diagnosis of vacuolar myopathies in that the detection of inclusions is required for the definitive diagnosis. PMID:27298745

36 CFR 261.3 - Interfering with a Forest officer, volunteer, or human resource program enrollee or giving false...

Science.gov (United States)

2010-07-01

... officer, volunteer, or human resource program enrollee or giving false report to a Forest officer. 261.3... General Prohibitions § 261.3 Interfering with a Forest officer, volunteer, or human resource program..., intimidating, or intentionally interfering with any Forest officer, volunteer, or human resource program...

Inhibition of Axl improves the targeted therapy against ALK-mutated neuroblastoma

Energy Technology Data Exchange (ETDEWEB)

Xu, Fei [Department of Neurology, Sichuan Medical Science Institute and Sichuan Provincial Hospital, Chengdu 610072 (China); Li, Hongling [Department of Radiotherapy, Shanghai First People’s Hospital, Shanghai Jiao Tong University, Shanghai 201620 (China); Sun, Yong, E-mail: sunfanqi2010@163.com [Department of Burn and Plastic Surgery, Huai’an First People’s Hospital, Nanjing Medical University, Huai’an 223300 (China)

2014-11-28

Highlights: • First reported Axl is co-expressed with ALK in neuroblastoma tissues and cell lines. • Axl activation promotes cell growth and impairs the efficiency of ALK inhibitor. • Further found silence of Axl leads to increased sensitivity to ALK inhibitors. • Axl inhibitor promotes the efficiency of targeted therapy in vitro and in vivo. • Axl activation should be considered in the clinical application of ALK inhibitors. - Abstract: Neuroblastoma (NB) patients harboring mutated ALK can be expected to potentially benefit from targeted therapy based on ALK tyrosine kinase inhibitor (TKI), such as crizotinib and ceritinib. However, the effect of the treatment varies with different individuals, although with the same genic changes. Axl receptor tyrosine kinase is expressed in a variety of human cancers, but little data are reported in NB, particularly in which carrying mutated ALK. In this study, we focus on the roles of Axl in ALK-mutated NB for investigating rational therapeutic strategy. We found that Axl is expressed in ALK-positive NB tissues and cell lines, and could be effectively activated by its ligand GAS6. Ligand-dependent Axl activation obviously rescued crizotinib-mediated suppression of cell proliferation in ALK-mutated NB cells. Genetic inhibition of Axl with specific small interfering RNA markedly increased the sensitivity of cells to ALK-TKIs. Furthermore, a small-molecule inhibitor of Axl significantly enhanced ALK-targeted therapy, as an increased frequency of apoptosis was observed in NB cells co-expressing ALK and Axl. Taken together, our results demonstrated that activation of Axl could lead to insensitivity to ALK inhibitors, and dual inhibition of ALK and Axl might be a potential therapeutic strategy against ALK-mutated NB.

The meaning of “anomalous weak values” in quantum and classical theories

International Nuclear Information System (INIS)

Sokolovski, D.

2015-01-01

The readings of a highly inaccurate “weak” quantum meter, employed to determine the value of a dichotomous variable S without destroying the interference between the alternatives, may take arbitrary values. We show that the expected values of its readings may take any real value, depending on the choice of the states in which the system is pre- and post-selected. Some of these values must fall outside the range of eigenvalues of S, in which case they may be expressed as “anomalous” averages obtained with negative probability weights, constructed from available probability amplitudes. This behaviour is a natural consequence of the Uncertainty Principle. The phenomenon of “anomalous weak values” has no non-trivial analogue in classical statistics. - Highlights: • Average reading of a weak meter can take any value, depending on the transition. • No information about intrinsic properties of the measured system, e.g., the size of a spin. • This is a direct consequence of the Uncertainty Principle, which forbids distinguishing between interfering alternatives. • Some of the average have to lie outside the spectrum of the measured operator, i.e., be “anomalous”. • There can be no anomalous averages in a purely classical theory

Interfering Waves of Adaptation Promote Spatial Mixing

DEFF Research Database (Denmark)

Martens, Erik Andreas; Hallatschek, Oskar

2011-01-01

A fundamental problem of asexual adaptation is that beneficial substitutions are not efficiently accumulated in large populations: Beneficial mutations often go extinct because they compete with one another in going to fixation. It has been argued that such clonal interference may have led...... to the evolution of sex and recombination in well-mixed populations. Here, we study clonal interference, and mechanisms of its mitigation, in an evolutionary model of spatially structured populations with uniform selection pressure. Clonal interference is much more prevalent with spatial structure than without......, due to the slow wave-like spread of beneficial mutations through space. We find that the adaptation speed of asexuals saturates when the linear habitat size exceeds a characteristic interference length, which becomes shorter with smaller migration and larger mutation rate. The limiting speed...

Creation of transgenic rice plants producing small interfering RNA of Rice tungro spherical virus.

Science.gov (United States)

Le, Dung Tien; Chu, Ha Duc; Sasaya, Takahide

2015-01-01

Rice tungro spherical virus (RTSV), also known as Rice waika virus, does not cause visible symptoms in infected rice plants. However, the virus plays a critical role in spreading Rice tungro bacilliform virus (RTBV), which is the major cause of severe symptoms of rice tungro disease. Recent studies showed that RNA interference (RNAi) can be used to develop virus-resistance transgenic rice plants. In this report, we presented simple procedures and protocols needed for the creation of transgenic rice plants capable of producing small interfering RNA specific against RTSV sequences. Notably, our study showed that 60 out of 64 individual hygromycin-resistant lines (putative transgenic lines) obtained through transformation carried transgenes designed for producing hairpin double-stranded RNA. Northern blot analyses revealed the presence of small interfering RNA of 21- to 24-mer in 46 out of 56 confirmed transgenic lines. Taken together, our study indicated that transgenic rice plants carrying an inverted repeat of 500-bp fragments encoding various proteins of RTSV can produce small interfering RNA from the hairpin RNA transcribed from that transgene. In light of recent studies with other viruses, it is possible that some of these transgenic rice lines might be resistant to RTSV.

Myopathic mtDNA Depletion Syndrome Due to Mutation in TK2 Gene.

Science.gov (United States)

Martín-Hernández, Elena; García-Silva, María Teresa; Quijada-Fraile, Pilar; Rodríguez-García, María Elena; Rivera, Henry; Hernández-Laín, Aurelio; Coca-Robinot, David; Fernández-Toral, Joaquín; Arenas, Joaquín; Martín, Miguel A; Martínez-Azorín, Francisco

2017-01-01

Whole-exome sequencing was used to identify the disease gene(s) in a Spanish girl with failure to thrive, muscle weakness, mild facial weakness, elevated creatine kinase, deficiency of mitochondrial complex III and depletion of mtDNA. With whole-exome sequencing data, it was possible to get the whole mtDNA sequencing and discard any pathogenic variant in this genome. The analysis of whole exome uncovered a homozygous pathogenic mutation in thymidine kinase 2 gene ( TK2; NM_004614.4:c.323 C>T, p.T108M). TK2 mutations have been identified mainly in patients with the myopathic form of mtDNA depletion syndromes. This patient presents an atypical TK2-related myopathic form of mtDNA depletion syndromes, because despite having a very low content of mtDNA (TK2 gene in mtDNA depletion syndromes and expanded the phenotypic spectrum.

Next Generation Sequencing approach to molecular diagnosis of Duchenne muscular dystrophy; identification of a novel mutation.

Science.gov (United States)

Ebrahimzadeh-Vesal, Reza; Teymoori, Atieh; Azimi-Nezhad, Mohsen; Hosseini, Forough Sadat

2018-02-20

Duchenne Muscular Dystrophy (DMD; MIM 310200) is one of the most common and severe type of hereditary muscular dystrophies. The disease is caused by mutations in the dystrophin gene. The dystrophin gene is associated with X-linked recessive Duchenne and Becker muscular dystrophy. This disease occurs almost exclusively in males. The clinical symptoms of muscle weakness usually begin at childhood. The main symptoms of this disorder are gradually muscular weakness. The affected patients have inability to standing up and walking. Death is usually due to respiratory infection or cardiomyopathy. In this article, we have reported the discovery of a new nonsense mutation that creates abnormal stop codon in the dystrophin gene. This mutation was detected using Next Generation Sequencing (NGS) technique. The subject was a 17-year-old male with muscular dystrophy that who was suspected of having DMD. He was referred to Hakim medical genetics center of Neyshabur, IRAN. Copyright © 2017. Published by Elsevier B.V.

Monotonicity of fitness landscapes and mutation rate control.

Science.gov (United States)

Belavkin, Roman V; Channon, Alastair; Aston, Elizabeth; Aston, John; Krašovec, Rok; Knight, Christopher G

2016-12-01

A common view in evolutionary biology is that mutation rates are minimised. However, studies in combinatorial optimisation and search have shown a clear advantage of using variable mutation rates as a control parameter to optimise the performance of evolutionary algorithms. Much biological theory in this area is based on Ronald Fisher's work, who used Euclidean geometry to study the relation between mutation size and expected fitness of the offspring in infinite phenotypic spaces. Here we reconsider this theory based on the alternative geometry of discrete and finite spaces of DNA sequences. First, we consider the geometric case of fitness being isomorphic to distance from an optimum, and show how problems of optimal mutation rate control can be solved exactly or approximately depending on additional constraints of the problem. Then we consider the general case of fitness communicating only partial information about the distance. We define weak monotonicity of fitness landscapes and prove that this property holds in all landscapes that are continuous and open at the optimum. This theoretical result motivates our hypothesis that optimal mutation rate functions in such landscapes will increase when fitness decreases in some neighbourhood of an optimum, resembling the control functions derived in the geometric case. We test this hypothesis experimentally by analysing approximately optimal mutation rate control functions in 115 complete landscapes of binding scores between DNA sequences and transcription factors. Our findings support the hypothesis and find that the increase of mutation rate is more rapid in landscapes that are less monotonic (more rugged). We discuss the relevance of these findings to living organisms.

Weak measurements and quantum weak values for NOON states

Science.gov (United States)

Rosales-Zárate, L.; Opanchuk, B.; Reid, M. D.

2018-03-01

Quantum weak values arise when the mean outcome of a weak measurement made on certain preselected and postselected quantum systems goes beyond the eigenvalue range for a quantum observable. Here, we propose how to determine quantum weak values for superpositions of states with a macroscopically or mesoscopically distinct mode number, that might be realized as two-mode Bose-Einstein condensate or photonic NOON states. Specifically, we give a model for a weak measurement of the Schwinger spin of a two-mode NOON state, for arbitrary N . The weak measurement arises from a nondestructive measurement of the two-mode occupation number difference, which for atomic NOON states might be realized via phase contrast imaging and the ac Stark effect using an optical meter prepared in a coherent state. The meter-system coupling results in an entangled cat-state. By subsequently evolving the system under the action of a nonlinear Josephson Hamiltonian, we show how postselection leads to quantum weak values, for arbitrary N . Since the weak measurement can be shown to be minimally invasive, the weak values provide a useful strategy for a Leggett-Garg test of N -scopic realism.

Mutations to Less-Preferred Synonymous Codons in a Highly Expressed Gene of Escherichia coli: Fitness and Epistatic Interactions.

Directory of Open Access Journals (Sweden)

David J Hauber

Full Text Available Codon-tRNA coevolution to maximize protein production has been, until recently, the dominant hypothesis to explain codon-usage bias in highly expressed bacterial genes. Two predictions of this hypothesis are 1 selection is weak; and 2 similar silent replacements at different codons should have similar fitness consequence. We used an allele-replacement strategy to change five specific 3rd-codon-position (silent sites in the highly expressed Escherichia coli ribosomal protein gene rplQ from the wild type to a less-preferred alternative. We introduced the five mutations within a 10-codon region. Four of the silent sites were chosen to test the second prediction, with a CTG to CTA mutation being introduced at two closely linked leucine codons and an AAA to AAG mutation being introduced at two closely linked lysine codons. We also introduced a fifth silent mutation, a GTG to GTA mutation at a valine codon in the same genic region. We measured the fitness effect of the individual mutations by competing each single-mutant strain against the parental wild-type strain, using a disrupted form of the araA gene as a selectively neutral phenotypic marker to distinguish between strains in direct competition experiments. Three of the silent mutations had a fitness effect of |s| > 0.02, which is contradictory to the prediction that selection will be weak. The two leucine mutations had significantly different fitness effects, as did the two lysine mutations, contradictory to the prediction that similar mutations at different codons should have similar fitness effects. We also constructed a strain carrying all five silent mutations in combination. Its fitness effect was greater than that predicted from the individual fitness values, suggesting that negative synergistic epistasis acts on the combination allele.

A COLQ missense mutation in Labrador Retrievers having congenital myasthenic syndrome.

Directory of Open Access Journals (Sweden)

Caitlin J Rinz

Full Text Available Congenital myasthenic syndromes (CMSs are heterogeneous neuromuscular disorders characterized by skeletal muscle weakness caused by disruption of signal transmission across the neuromuscular junction (NMJ. CMSs are rarely encountered in veterinary medicine, and causative mutations have only been identified in Old Danish Pointing Dogs and Brahman cattle to date. Herein, we characterize a novel CMS in 2 Labrador Retriever littermates with an early onset of marked generalized muscle weakness. Because the sire and dam share 2 recent common ancestors, CMS is likely the result of recessive alleles inherited identical by descent (IBD. Genome-wide SNP profiles generated from the Illumina HD array for 9 nuclear family members were used to determine genomic inheritance patterns in chromosomal regions encompassing 18 functional candidate genes. SNP haplotypes spanning 3 genes were consistent with autosomal recessive transmission, and microsatellite data showed that only the segment encompassing COLQ was inherited IBD. COLQ encodes the collagenous tail of acetylcholinesterase, the enzyme responsible for termination of signal transduction in the NMJ. Sequences from COLQ revealed a variant in exon 14 (c.1010T>C that results in the substitution of a conserved amino acid (I337T within the C-terminal domain. Both affected puppies were homozygous for this variant, and 16 relatives were heterozygous, while 288 unrelated Labrador Retrievers and 112 dogs of other breeds were wild-type. A recent study in which 2 human CMS patients were found to be homozygous for an identical COLQ mutation (c.1010T>C; I337T provides further evidence that this mutation is pathogenic. This report describes the first COLQ mutation in canine CMS and demonstrates the utility of SNP profiles from nuclear family members for the identification of private mutations.

Mutation-selection models of codon substitution and their use to estimate selective strengths on codon usage

DEFF Research Database (Denmark)

Yang, Ziheng; Nielsen, Rasmus

2008-01-01

Current models of codon substitution are formulated at the levels of nucleotide substitution and do not explicitly consider the separate effects of mutation and selection. They are thus incapable of inferring whether mutation or selection is responsible for evolution at silent sites. Here we impl...... codon usage in mammals. Estimates of selection coefficients nevertheless suggest that selection on codon usage is weak and most mutations are nearly neutral. The sensitivity of the analysis on the assumed mutation model is discussed.......Current models of codon substitution are formulated at the levels of nucleotide substitution and do not explicitly consider the separate effects of mutation and selection. They are thus incapable of inferring whether mutation or selection is responsible for evolution at silent sites. Here we...... implement a few population genetics models of codon substitution that explicitly consider mutation bias and natural selection at the DNA level. Selection on codon usage is modeled by introducing codon-fitness parameters, which together with mutation-bias parameters, predict optimal codon frequencies...

The Influence of Interfering Substances on the Antimicrobial Activity of Selected Quaternary Ammonium Compounds

Directory of Open Access Journals (Sweden)

Paula A. Araújo

2013-01-01

Full Text Available Standard cleaning processes may not remove all the soiling typically found in food industry, such as carbohydrates, fats, or proteins. Contaminants have a high impact in disinfection as their presence may reduce the activity of disinfectants. The influence of alginic acid, bovine serum albumin, yeast extract, and humic acids was assessed on the antimicrobial activities of benzalkonium chloride and cetyltrimethyl ammonium bromide against Bacillus cereus vegetative cells and Pseudomonas fluorescens. The bacteria (single and consortium were exposed to surfactants (single and combined in the absence and presence of potential disinfection interfering substances. The antimicrobial effects of the surfactants were assessed based on the bacterial respiratory activity measured by oxygen uptake rate due to glucose oxidation. The tested surfactants were efficient against both bacteria (single and consortium with minimum bactericidal concentrations ranging from 3 to 35 mg·L−1. The strongest effect was caused by humic acids that severely quenched antimicrobial action, increasing the minimum bactericidal concentration of the surfactants on P. fluorescens and the consortium. The inclusion of the other interfering substances resulted in mild interferences in the antibacterial activity. This study clearly demonstrates that humic acids should be considered as an antimicrobial interfering substance in the development of disinfection strategies.

Occurrence of weak mutators among avian pathogenic Escherichia coli (APEC) isolates causing salpingitis and peritonitis in broiler breeders

DEFF Research Database (Denmark)

Pires dos Santos, Teresa M S; Bisgaard, Magne; Kyvsgaard, Niels Christian

2014-01-01

A collection of 46 avian pathogenic Escherichia coli (APEC) isolates was examined for the presence of mutators by determining the rate of mutation to rifampicin resistance. The collection included 34 E. coli isolates obtained in pure culture from chronic lesions of salpingitis and peritonitis in 34...... broiler breeders, of which 12 were associated with the development of secondary septicemia. Twelve additional isolates were obtained from a clonal outbreak (ST95) of E. coli peritonitis syndrome (EPS), the lesions of which changed gradually over time into a subacute/chronic form. The hypothesis...

A new mutation of the fukutin gene causing late-onset limb girdle muscular dystrophy

DEFF Research Database (Denmark)

Riisager, Maria; Duno, M; Hansen, Flemming Juul

2013-01-01

to aberrations of FKTN is rare, with only eight reported cases of limb girdle phenotype (LGMD2M). We describe the mildest affected patient outside Japan with genetically confirmed LGMD2M and onset of symptoms at age 14. She was brought to medical attention at age 12, not because of muscle weakness, but due...... to episodes of tachycardia caused by Wolff-Parkinson-White syndrome. On examination, she had rigid spine syndrome, a typical limb girdle dystrophy pattern of muscle weakness, cardiomyopathy, and serum CK levels >2000 IU/L (normal G; p.Y306C mutation in the FKTN gene was found. The case confirms FKTN mutations...... as a cause of LGMD2M without mental retardation and expands the phenotypic spectrum for LGMD2M to include cardiomyopathy and rigid spine syndrome in the mildest affected non-Japanese patient reported so far....

Detecting and Eliminating Interfering Organic Compounds in Waters Analyzed for Isotopic Composition by Crds

Science.gov (United States)

Richman, B. A.; Hsiao, G. S.; Rella, C.

2010-12-01

Optical spectroscopy based CRDS technology for isotopic analysis of δD and δ18O directly from liquid water has greatly increased the number and type of liquid samples analyzed. This increase has also revealed a previously unrecognized sample contamination problem. Recently West[1] and Brand[2] identified samples containing ethanol, methanol, plant extracts and other organic compounds analyzed by CRDS and other spectroscopy based techniques as yielding erroneous results for δD and δ18O (especially δD) due to spectroscopic interference. Not all organic compounds generate interference. Thus, identifying which samples are contaminated by which organic compounds is of key importance for data credibility and correction. To address this problem a new approach in the form of a software suite, ChemCorrect™, has been developed. A chemometrics component uses a spectral library of water isotopologues and interfering organic compounds to best fit the measured spectra. The best fit values provide a quantitative assay of the actual concentrations of the various species and are then evaluated to generate a visual flag indicating samples affected by organic contamination. Laboratory testing of samples spiked with known quantities of interfering organic compounds such as methanol, ethanol, and terpenes was performed. The software correctly flagged and identified type of contamination for all the spiked samples without any false positives. Furthermore the reported values were a linear function of actual concentration with an R^2>0.99 even for samples which contained multiple organic compounds. Further testing was carried out against a range of industrial chemical compounds which can contaminate ground water as well as a variety of plant derived waters and juices which were also analyzed by IRMS. The excellent results obtained give good insight into which organic compounds cause interference and which classes of plants are likely to contain interfering compounds. Finally

Negative psychosocial and heavy physical workloads associated with musculoskeletal pain interfering with normal life in older adults: cross-sectional analysis.

Science.gov (United States)

Lilje, Stina C; Skillgate, Eva; Anderberg, Peter; Berglund, Johan

2015-07-01

Pain is one of the most frequent reasons for seeking health care, and is thus a public health problem. Although there is a progressive increase in pain and impaired physical function with age, few studies are performed on older adults. The aim of this study was to investigate if there are associations between musculoskeletal pain interfering with normal life in older adults and physical and psychosocial workloads through life. The association of heavy physical workload and negative psychosocial workload and musculoskeletal pain interfering with normal life (SF 12) was analyzed by multiple logistic regression. The model was adjusted for eight background covariates: age, gender, growing-up environment, educational level, if living alone or not, obesity, smoking, and leisure physical activity. Negative psychosocial and heavy physical workloads were independently associated with musculoskeletal pain interfering with normal life (adjusted OR: 4.44, 95% CI: 2.84-6.92), and (adjusted OR: 1.88, 95% CI: 1.20-2.93), respectively. The background covariates female gender and higher education were also associated with musculoskeletal pain interfering with normal life, and physical leisure activity was inversely associated. The findings suggest that negative psychosocial and heavy physical workloads are strongly associated with musculoskeletal pain interfering with normal life in older adults. © 2015 the Nordic Societies of Public Health.

Interferência de plantas daninhas na cultura do feijão-caupi Weed interference in cowpea

Directory of Open Access Journals (Sweden)

F.C.L. Freitas

2009-06-01

Full Text Available Objetivou-se com este trabalho determinar os períodos de interferência das plantas daninhas na cultura do feijão-caupi (Vigna unguiculata. A semeadura do feijão-caupi cultivar BR 16 foi realizada em julho de 2007, no sistema de plantio convencional. O delineamento experimental foi em blocos casualizados, com os tratamentos constituídos de períodos de controle ou convivência das plantas daninhas com a cultura. No primeiro grupo, a cultura permaneceu livre da interferência das plantas daninhas, por meio de capinas, nos períodos de: 0-09, 0-18, 0-27, 0-36, 0-45 e 0-60 (colheita. No segundo grupo, a cultura permaneceu sob a interferência desde a emergência até os mesmos períodos descritos anteriormente. O período crítico de prevenção à interferência (PCPI foi de 11 a 35 dias após a emergência da cultura. A interferência das plantas daninhas reduziu o estande final, o número de vagens por planta e o rendimento de grãos do feijão-caupi em até 90%.This work aimed to determine the periods of weed interference in cowpea (Vigna unguiculata, sown under the conventional system in July 2007. The experiment was arranged in randomized blocks, with the treatments consisting of periods of control or intercropping of the weeds with the crop. In the first group, the bean crop remained free of weed interference in the periods 0-09, 0-18, 0-27, 0-36, 0-45 and 0-60 (harvest. .In the second group, the bean crop remained under interference from the time of emergence up to the same periods previously described. The critical period of weed interference prevention (CPIP was from 11 to 35 days after crop emergence. Weed interference reduced the final stand, number of pods per plant, and grain yield up to 90%.

An evolutionary reduction principle for mutation rates at multiple Loci.

Science.gov (United States)

Altenberg, Lee

2011-06-01

A model of mutation rate evolution for multiple loci under arbitrary selection is analyzed. Results are obtained using techniques from Karlin (Evolutionary Biology, vol. 14, pp. 61-204, 1982) that overcome the weak selection constraints needed for tractability in prior studies of multilocus event models.A multivariate form of the reduction principle is found: reduction results at individual loci combine topologically to produce a surface of mutation rate alterations that are neutral for a new modifier allele. New mutation rates survive if and only if they fall below this surface-a generalization of the hyperplane found by Zhivotovsky et al. (Proc. Natl. Acad. Sci. USA 91, 1079-1083, 1994) for a multilocus recombination modifier. Increases in mutation rates at some loci may evolve if compensated for by decreases at other loci. The strength of selection on the modifier scales in proportion to the number of germline cell divisions, and increases with the number of loci affected. Loci that do not make a difference to marginal fitnesses at equilibrium are not subject to the reduction principle, and under fine tuning of mutation rates would be expected to have higher mutation rates than loci in mutation-selection balance.Other results include the nonexistence of 'viability analogous, Hardy-Weinberg' modifier polymorphisms under multiplicative mutation, and the sufficiency of average transmission rates to encapsulate the effect of modifier polymorphisms on the transmission of loci under selection. A conjecture is offered regarding situations, like recombination in the presence of mutation, that exhibit departures from the reduction principle. Constraints for tractability are: tight linkage of all loci, initial fixation at the modifier locus, and mutation distributions comprising transition probabilities of reversible Markov chains.

Yeast as a model host to study replication and recombination of defective interfering RNA of Tomato bushy stunt virus

International Nuclear Information System (INIS)

Panavas, Tadas; Nagy, Peter D.

2003-01-01

Defective interfering (DI) RNA associated with Tomato bushy stunt virus (TBSV), which is a plus-strand RNA virus, requires p33 and p92 proteins of TBSV or the related Cucumber necrosis virus (CNV), for replication in plants. To test if DI RNA can replicate in a model host, we coexpressed TBSV DI RNA and p33/p92 of CNV in yeast. We show evidence for replication of DI RNA in yeast, including (i) dependence on p33 and p92 for DI replication; (ii) presence of active CNV RNA-dependent RNA polymerase in isolated membrane-containing preparations; (iii) increasing amount of DI RNA(+) over time; (iv) accumulation of (-)stranded DI RNA; (v) presence of correct 5' and 3' ends in DI RNA; (vi) inhibition of replication by mutations in the replication enhancer; and (vii) evolution of DI RNA over time, as shown by sequence heterogeneity. We also produced evidence supporting the occurrence of DI RNA recombinants in yeast. In summary, development of yeast as a host for replication of TBSV DI RNA will facilitate studies on the roles of viral and host proteins in replication/recombination

Study of criterion for assuring the effectiveness of cathodic protection of buried steel pipelines being interfered with alternative current

Energy Technology Data Exchange (ETDEWEB)

He, X.; Jiang, G.; Qiu, Y.; Tang, H. [College of Chemistry and Chemical Engineering, Huazhong University of Science and Technology, Wuhan (China); Zhang, G.; Jin, X.; Xiang, Z. [Huazhong Natural Gas Subsidiary of PetroChina Pipeline Company, Wuhan (China); Zhang, Z. [Dwell Company Limited, PetroChina Engineering Company, Ltd, Beijing (China)

2012-06-15

Interference of alternative current (AC) on corrosion of X65 steel was investigated in soil. It was observed that the unfavorable effect of interfering AC was able to be effectively inhibited by increasing the direct current density of the cathodic protection (CP) system. A clear correlation was established between the CP current density and the tolerable AC current density. This led to a new criterion for assuring the effectiveness of CP of buried pipelines being interfered with AC. Field experimental results on a buried pipeline running below a 500 kV transmission line showed that the criterion could satisfactorily predict the risk of AC interfering on the CP system. (Copyright copyright 2012 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim)

Effects of interfering constituents on tritium smears

International Nuclear Information System (INIS)

Levi, G.D. Jr.; Cheeks, K.E.

1993-01-01

Tritium smears are performed by Health Protection Operations (HPO) to assess transferable contamination on work place surfaces, materials for movement outside Radiologically Controlled Areas (RCA), and product containers being shipped between facilities. Historically, gas proportional counters were used to detect transferable tritium contamination collected by smearing. Because tritium is a low-energy beta emitter, gas proportional counters do not provide the sensitivity or the counting efficiency to accurately measure the tritium activity on the smear. Liquid Scintillation Counters (LSC) provide greater counting efficiency for the low-energy beta particles along with greater reliability and reproducibility compared to gas flow proportional counters. The purpose of this technical evaluation was to determine the effects of interfering constituents such as filters, dirt and oil on the counting efficiency and tritium recoveries of tritium smears by LSC

Weak interactions

International Nuclear Information System (INIS)

Ogava, S.; Savada, S.; Nakagava, M.

1983-01-01

The problem of the use of weak interaction laws to study models of elementary particles is discussed. The most typical examples of weak interaction is beta-decay of nucleons and muons. Beta-interaction is presented by quark currents in the form of universal interaction of the V-A type. Universality of weak interactions is well confirmed using as examples e- and μ-channels of pion decay. Hypothesis on partial preservation of axial current is applicable to the analysis of processes with pion participation. In the framework of the model with four flavours lepton decays of hadrons are considered. Weak interaction without lepton participation are also considered. Properties of neutral currents are described briefly

Weakly clopen functions

International Nuclear Information System (INIS)

Son, Mi Jung; Park, Jin Han; Lim, Ki Moon

2007-01-01

We introduce a new class of functions called weakly clopen function which includes the class of almost clopen functions due to Ekici [Ekici E. Generalization of perfectly continuous, regular set-connected and clopen functions. Acta Math Hungar 2005;107:193-206] and is included in the class of weakly continuous functions due to Levine [Levine N. A decomposition of continuity in topological spaces. Am Math Mon 1961;68:44-6]. Some characterizations and several properties concerning weakly clopenness are obtained. Furthermore, relationships among weak clopenness, almost clopenness, clopenness and weak continuity are investigated

Heterophilic antibodies interfering with radioimmunoassay. A false-positive pregnancy test

Energy Technology Data Exchange (ETDEWEB)

Vladutiu, A.O.; Sulewski, J.M.; Pudlak, K.A.; Stull, C.G.

1982-11-19

A young woman with amenorrhea had a consistently positive pregnancy test result (serum radioimmunoassay measurement of ..beta..-human chorionic gonadotropin hormone). No fetal or placental tissue was found after uterine curettage and exploratory laparotomy. The false-positive pregnancy test result was due to heterophilic antibovine and antigoat antibodies in the patient's serum. These antibodies interfered with radioimmunoassays using goat antibodies. This case shows that serum heterophilic antibodies can interfere with immunoassays and result in unnecessary diagnostic procedures and/or unnecessary treatment.

Heterophilic antibodies interfering with radioimmunoassay. A false-positive pregnancy test

International Nuclear Information System (INIS)

Vladutiu, A.O.; Sulewski, J.M.; Pudlak, K.A.; Stull, C.G.

1982-01-01

A young woman with amenorrhea had a consistently positive pregnancy test result (serum radioimmunoassay measurement of #betta#-human chorionic gonadotropin hormone). No fetal or placental tissue was found after uterine curettage and exploratory laparotomy. The false-positive pregnancy test result was due to heterophilic antibovine and antigoat antibodies in the patient's serum. These antibodies interfered with radioimmunoassays using goat antibodies. This case shows that serum heterophilic antibodies can interfere with immunoassays and result in unnecessary diagnostic procedures and/or unnecessary treatment

Intronic PAH gene mutations cause a splicing defect by a novel mechanism involving U1snRNP binding downstream of the 5' splice site

DEFF Research Database (Denmark)

Martínez-Pizarro, Ainhoa; Dembic, Maja; Pérez, Belén

2018-01-01

Phenylketonuria (PKU), one of the most common inherited diseases of amino acid metabolism, is caused by mutations in the phenylalanine hydroxylase (PAH) gene. Recently, PAH exon 11 was identified as a vulnerable exon due to a weak 3' splice site, with different exonic mutations affecting exon 11 ...

Thiophenone Attenuates Enteropathogenic Escherichia coli O103:H2 Virulence by Interfering with AI-2 Signaling.

Science.gov (United States)

Witsø, Ingun Lund; Valen Rukke, Håkon; Benneche, Tore; Aamdal Scheie, Anne

2016-01-01

Interference with bacterial quorum sensing communication provides an anti-virulence strategy to control pathogenic bacteria. Here, using the Enteropathogenic E. coli (EPEC) O103:H2, we showed for the first time that thiophenone TF101 reduced expression of lsrB; the gene encoding the AI-2 receptor. Combined results of transcriptional and phenotypic analyses suggested that TF101 interfere with AI-2 signalling, possibly by competing with AI-2 for binding to LsrB. This is supported by in silico docking prediction of thiophenone TF101 in the LsrB pocket. Transcriptional analyses furthermore showed that thiophenone TF101 interfered with expression of the virulence genes eae and fimH. In addition, TF101 reduced AI-2 induced E. coli adhesion to colorectal adenocarcinoma cells. TF101, on the other hand, did not affect epinephrine or norepinephrine enhanced E. coli adhesion. Overall, our results showed that thiophenone TF101 interfered with virulence expression in E. coli O103:H2, suggestedly by interfering with AI-2 mediated quorum sensing. We thus conclude that thiophenone TF101 might represent a promising future anti-virulence agent in the fight against pathogenic E. coli.

Presence of atypical thrombopoietin receptor (MPL) mutations in triple-negative essential thrombocythemia patients.

Science.gov (United States)

Cabagnols, Xénia; Favale, Fabrizia; Pasquier, Florence; Messaoudi, Kahia; Defour, Jean Philippe; Ianotto, Jean Christophe; Marzac, Christophe; Le Couédic, Jean Pierre; Droin, Nathalie; Chachoua, Ilyas; Favier, Remi; Diop, M'boyba Khadija; Ugo, Valérie; Casadevall, Nicole; Debili, Najet; Raslova, Hana; Bellanné-Chantelot, Christine; Constantinescu, Stefan N; Bluteau, Olivier; Plo, Isabelle; Vainchenker, William

2016-01-21

Mutations in signaling molecules of the cytokine receptor axis play a central role in myeloproliferative neoplasm (MPN) pathogenesis. Polycythemia vera is mainly related to JAK2 mutations, whereas a wider mutational spectrum is detected in essential thrombocythemia (ET) with mutations in JAK2, the thrombopoietin (TPO) receptor (MPL), and the calreticulin (CALR) genes. Here, we studied the mutational profile of 17 ET patients negative for JAK2V617F, MPLW515K/L, and CALR mutations, using whole-exome sequencing and next-generation sequencing (NGS) targeted on JAK2 and MPL. We found several signaling mutations including JAK2V617F at very low allele frequency, 1 homozygous SH2B3 mutation, 1 MPLS505N, 1 MPLW515R, and 2 MPLS204P mutations. In the remaining patients, 4 presented a clonal and 7 a polyclonal hematopoiesis, suggesting that certain triple-negative ETs are not MPNs. NGS on 26 additional triple-negative ETs detected only 1 MPLY591N mutation. Functional studies on MPLS204P and MPLY591N revealed that they are weak gain-of-function mutants increasing MPL signaling and conferring either TPO hypersensitivity or independence to expressing cells, but with a low efficiency. Further studies should be performed to precisely determine the frequency of MPLS204 and MPLY591 mutants in a bigger cohort of MPN. © 2016 by The American Society of Hematology.

Identification of Germline Genetic Mutations in Pancreatic Cancer Patients

Science.gov (United States)

Salo-Mullen, Erin E.; O’Reilly, Eileen; Kelsen, David; Ashraf, Asad M.; Lowery, Maeve; Yu, Kenneth; Reidy, Diane; Epstein, Andrew S.; Lincoln, Anne; Saldia, Amethyst; Jacobs, Lauren M.; Rau-Murthy, Rohini; Zhang, Liying; Kurtz, Robert; Saltz, Leonard; Offit, Kenneth; Robson, Mark; Stadler, Zsofia K.

2016-01-01

Background Pancreatic adenocarcinoma (PAC) is part of several cancer predisposition syndromes; however, indications for genetic counseling/testing are not well-defined. We sought to determine mutation prevalence and characteristics that predict for inherited predisposition to PAC. Methods We identified 175 consecutive PAC patients who underwent clinical genetics assessment at Memorial Sloan Kettering between 2011–2014. Clinical data, family history, and germline results were evaluated. Results Among 159 PAC patients who pursued genetic testing, 24 pathogenic mutations were identified (15.1%; 95%CI, 9.5%–20.7%), including BRCA2(n=13), BRCA1(n=4), p16(n=2), PALB2(n=1), and Lynch syndrome(n=4). BRCA1/BRCA2 prevalence was 13.7% in Ashkenazi Jewish(AJ) (n=95) and 7.1% in non-AJ(n=56) patients. In AJ patients with strong, weak, or absent family history of BRCA-associated cancers, mutation prevalence was 16.7%, 15.8%, and 7.4%, respectively. Mean age at diagnosis in all mutation carriers was 58.5y(range 45–75y) compared to 64y(range 27–87y) in non-mutation carriers(P=0.02). Although BRCA2 was the most common mutation identified, no patients with early-onset PAC(≤50y) harbored a BRCA2 mutation and the mean age at diagnosis in BRCA2 carriers was equivalent to non-mutation carriers(P=0.34). Mutation prevalence in early-onset patients(n=21) was 28.6%, including BRCA1(n=2), p16(n=2), MSH2(n=1) and MLH1(n=1). Conclusion Mutations in BRCA2 account for over 50% of PAC patients with an identified susceptibility syndrome. AJ patients had high BRCA1/BRCA2 prevalence regardless of personal/family history, suggesting that ancestry alone indicates a need for genetic evaluation. With the exception of BRCA2-associated PAC, inherited predisposition to PAC is associated with earlier age at PAC diagnosis suggesting that this subset of patients may also represent a population warranting further evaluation. PMID:26440929

Weak value controversy

Science.gov (United States)

Vaidman, L.

2017-10-01

Recent controversy regarding the meaning and usefulness of weak values is reviewed. It is argued that in spite of recent statistical arguments by Ferrie and Combes, experiments with anomalous weak values provide useful amplification techniques for precision measurements of small effects in many realistic situations. The statistical nature of weak values is questioned. Although measuring weak values requires an ensemble, it is argued that the weak value, similarly to an eigenvalue, is a property of a single pre- and post-selected quantum system. This article is part of the themed issue `Second quantum revolution: foundational questions'.

Becker muscular dystrophy with widespread muscle hypertrophy and a non-sense mutation of exon 2.

Science.gov (United States)

Witting, N; Duno, M; Vissing, J

2013-01-01

Becker muscular dystrophy features progressive proximal weakness, wasting and often focal hypertrophy. We present a patient with pain and cramps from adolescence. Widespread muscle hypertrophy, preserved muscle strength and a 10-20-fold raised CPK were noted. Muscle biopsy was dystrophic, and Western blot showed a 95% reduction of dystrophin levels. Genetic analyses revealed a non-sense mutation in exon 2 of the dystrophin gene. This mutation is predicted to result in a Duchenne phenotype, but resulted in a mild Becker muscular dystrophy with widespread muscle hypertrophy. We suggest that this unusual phenotype is caused by translation re-initiation downstream from the mutation site. Copyright © 2012 Elsevier B.V. All rights reserved.

Why mutualist partners vary in quality: mutation-selection balance and incentives to cheat in the fig tree-fig wasp mutualism.

Science.gov (United States)

Jandér, K Charlotte; Steidinger, Brian S

2017-07-01

Mutualisms between species are ecologically ubiquitous but evolutionarily puzzling. Host discrimination mechanisms that reduce the fitness of uncooperative symbionts can stabilise mutualism against collapse, but also present a paradox - if discrimination is effective, why do uncooperative symbionts persist? Here, we test whether mutations or fitness benefits of cheating best explain the prevalence of uncooperative wasps in the fig tree-fig wasp mutualism. By combining theory with field-collected data we demonstrate that the proportions of pollen-free wasps of strongly discriminating hosts are reached with reasonable mutation rates. In contrast, in weakly discriminating hosts, the required mutation rates, assuming a single locus, are untenably high, but the required cheater advantages fall within expected ranges. We propose that when discrimination is weak, uncooperative symbionts proliferate until they reach the equilibrium proportion that balances costs and benefits of cheating. Our results suggest that mechanisms that resolve the paradox of uncooperative symbionts differ among host species. © 2017 John Wiley & Sons Ltd/CNRS.

Novel autosomal dominant TNNT1 mutation causing nemaline myopathy.

Science.gov (United States)

Konersman, Chamindra G; Freyermuth, Fernande; Winder, Thomas L; Lawlor, Michael W; Lagier-Tourenne, Clotilde; Patel, Shailendra B

2017-11-01

Nemaline myopathy (NEM) is one of the three major forms of congenital myopathy and is characterized by diffuse muscle weakness, hypotonia, respiratory insufficiency, and the presence of nemaline rod structures on muscle biopsy. Mutations in troponin T1 (TNNT1) is 1 of 10 genes known to cause NEM. To date, only homozygous nonsense mutations or compound heterozygous truncating or internal deletion mutations in TNNT1 gene have been identified in NEM. This extended family is of historical importance as some members were reported in the 1960s as initial evidence that NEM is a hereditary disorder. Proband and extended family underwent Sanger sequencing for TNNT1. We performed RT-PCR and immunoblot on muscle to assess TNNT1 RNA expression and protein levels in proband and father. We report a novel heterozygous missense mutation of TNNT1 c.311A>T (p.E104V) that segregated in an autosomal dominant fashion in a large family residing in the United States. Extensive sequencing of the other known genes for NEM failed to identify any other mutant alleles. Muscle biopsies revealed a characteristic pattern of nemaline rods and severe myofiber hypotrophy that was almost entirely restricted to the type 1 fiber population. This novel mutation alters a residue that is highly conserved among vertebrates. This report highlights not only a family with autosomal dominant inheritance of NEM, but that this novel mutation likely acts via a dominant negative mechanism. © 2017 The Authors. Molecular Genetics & Genomic Medicine published by Wiley Periodicals, Inc.

Gamma ray induced somatic mutations in rose

International Nuclear Information System (INIS)

Datta, S.K.

1989-01-01

Budwood of 32 rose cultivars (Rosa spp.) was exposed to 3-4 krad of gamma rays and eyes were grafted on Rosa indica var. odorata root stock. Radiosensitivity with respect to sprouting, survival and plant height, and mutation frequency varied with the cultivar and dose of gamma rays. Somatic mutations in flower colour/shape were detected as chimera in 21 cultivars. The size of the mutant sector varied from a narrow streak on a petal to a whole flower and from a portion of a branch to an entire branch. 14 mutants were detected in M 1 V 1 , four in M 1 V 2 and three in M 1 V 3 . Maximum number of mutations was detected following 3 krad treatment. Eyes from mutant branches were grafted again on root stock and non-chimeric mutants were aimed at by vegetative propagation. Mutants from 11 cultivars only could be isolated in pure form. Isolation of non-chimeric mutants sometimes is difficult due to weak growth of a mutant branch. In such a case, all normal looking branches are removed to force a better growth of the mutant branch. It is advisable to maintain irradiated plants at least for four years with drastic pruning in each year. Nine mutants viz. 'Sharada', 'Sukumari', 'Tangerine Contempo', 'Yellow Contempo', 'Pink Contempo', 'Striped Contempo', 'Twinkle', 'Curio' and 'Light Pink Prize' have already been released as new cultivars for commercialization [ref. MBNL No. 23 and 31] and others are being multiplied and assessed. The mutation spectrum appears to be wider for the cultivars 'Contempo' and 'Imperator'. Pigment composition of the original variety is relevant for the kind of flower colour mutations that can be induced

Desarrollo de panuveítis por tuberculosis en paciente con esclerosis múltiple tratado con interferón beta

Directory of Open Access Journals (Sweden)

Lucía Echevarría Lucas

2016-09-01

Los linfocitos CD4+ T, leucocitos, macrófagos y granulocitos, con la producción de sus mediadores interferón gamma, IL-12 o TNF-α son fundamentales para controlar al Mycobacterium tuberculosis. Por ello, antes de introducir Interferón beta 1b, convendría realizar técnicas de screening, como la prueba de Mantoux o el interferon gamma release assay–(quantiferon-TB para detectar posibles tuberculosis latentes potencialmente activables.

Weak Acid Ionization Constants and the Determination of Weak Acid-Weak Base Reaction Equilibrium Constants in the General Chemistry Laboratory

Science.gov (United States)

Nyasulu, Frazier; McMills, Lauren; Barlag, Rebecca

2013-01-01

A laboratory to determine the equilibrium constants of weak acid negative weak base reactions is described. The equilibrium constants of component reactions when multiplied together equal the numerical value of the equilibrium constant of the summative reaction. The component reactions are weak acid ionization reactions, weak base hydrolysis…

Períodos de interferência de plantas daninhas na cultura do quiabo Periods of weed interference in okra crop

Directory of Open Access Journals (Sweden)

L.P.S Bachega

2013-03-01

Full Text Available Poucas pesquisas têm sido realizadas sobre interferência de plantas daninhas na cultura do quiabo. Objetivou-se com este trabalho estimar os períodos de interferência da comunidade infestante no quiabeiro. Um experimento de campo foi conduzido sob dois grupos de tratamentos, mantendo períodos crescentes de 0 (testemunha, 7, 21, 28, 35, 42, 49, 63, 77, 91 e 105 dias após a emergência da cultura (DAE, com e sem controle das plantas daninhas. As plantas daninhas com maior importância relativa foram Portulaca oleracea, Nicandra physaloides e Eleusine indica. A convivência do quiabeiro com as plantas daninhas por todo o ciclo de cultivo reduziu a produtividade da cultura em 95%. O período anterior à interferência foi de 57 DAE, enquanto o período total de prevenção à interferência foi de 14 DAE. Não houve período crítico de prevenção à interferência, sendo um único controle das plantas daninhas entre 14 e 57 DAE suficiente para prevenir a interferência na cultura do quiabo.Few research works have been carried out on weed interference in okra crop. The aim of this study was to estimate the periods of weed interference in okra crop. Thus, a field trial was carried out under two groups of treatments, using increased periods of 0 (check, 7, 21, 28, 35, 42, 49, 63, 77, 91, and 105 days after crop emergence (DAE with weed control and without weed control. Weeds with highest relative importance were Portulaca oleracea, Nicandra physaloides, and Eleusine indica. Coexistence of okra crop and weeds throughout the season reduced crop yield by 95%. The period before interference was 57 DAE, while total period of interference prevention was 14 DAE. There was no critical period of interference prevention, with a single weed control between 14 and 57 DAE being sufficient for interference prevention in okra crop.

The Problem of Weak Governments and Weak Societies in Eastern Europe

Directory of Open Access Journals (Sweden)

Marko Grdešić

2008-01-01

Full Text Available This paper argues that, for Eastern Europe, the simultaneous presence of weak governments and weak societies is a crucial obstacle which must be faced by analysts and reformers. The understanding of other normatively significant processes will be deficient without a consciousness-raising deliberation on this problem and its implications. This paper seeks to articulate the “relational” approach to state and society. In addition, the paper lays out a typology of possible patterns of relationship between state and society, dependent on whether the state is weak or strong and whether society is weak or strong. Comparative data are presented in order to provide an empirical support for the theses. Finally, the paper outlines two reform approaches which could enable breaking the vicious circle emerging in the context of weak governments and weak societies.

Incorporation of osteogenic and angiogenic small interfering RNAs into chitosan sponge for bone tissue engineering

Directory of Open Access Journals (Sweden)

Jia S

2014-11-01

Full Text Available Sen Jia,1,* Xinjie Yang,1,* Wen Song,2,* Lei Wang,1 Kaixiu Fang,3 Zhiqiang Hu,1,4 Zihui Yang,1 Chun Shan,1 Delin Lei,1 Bin Lu1 1Department of Oral and Maxillofacial Surgery, 2Department of Prosthetic Dentistry, 3Department of Implant Dentistry, School of Stomatology, State Key Laboratory of Military Stomatology, Fourth Military Medical University, Xi’an People’s Republic of China; 4Department of Otorhinolaryngology, No 113 Hospital of People’s Liberation Army, Ningbo, People’s Republic of China *These authors contributed to this paper equally and are considered to be joint first authors Abstract: Engineered bone substitutes are being extensively explored in response to growing demand. However, the angiogenesis that occurs during bone formation is often overlooked in scaffold design. In this novel study, we incorporated two small interfering RNAs (siRNAs, ie, small interfering RNA targets casein kinase 2 interaction protein 1 (siCkip-1 and small interfering RNA targets soluble VEGF receptor 1 (siFlt-1, which can promote osteogenesis and angiogenesis, into a chitosan sponge. This scaffold could maintain siRNAs for over 2 weeks in neutral phosphate-buffered saline and degraded rapidly in the presence of lysozyme. The chitosan sponge with siCkip-1 and siFlt-1 in vitro bioactivity was investigated using mesenchymal stem cells. Target genes were significantly suppressed, and osteocalcin, alkaline phosphatase, and vascular endothelial growth factor were significantly upregulated. Alizarin Red staining revealed that mineralization of the extracellular matrix was markedly enhanced by dual transfection. Further analysis by immunofluorescence confirmed that the siRNA-modified scaffold simultaneously improved the expression of osteocalcin and von Willebrand factor. In vivo testing in a skull critical-size defect model showed marked bone regeneration in rats treated with siCkip-1 and siFlt-1. In conclusion, chitosan sponge containing osteogenic and

Electro-weak theory

International Nuclear Information System (INIS)

Deshpande, N.G.

1980-01-01

By electro-weak theory is meant the unified field theory that describes both weak and electro-magnetic interactions. The development of a unified electro-weak theory is certainly the most dramatic achievement in theoretical physics to occur in the second half of this century. It puts weak interactions on the same sound theoretical footing as quantum elecrodynamics. Many theorists have contributed to this development, which culminated in the works of Glashow, Weinberg and Salam, who were jointly awarded the 1979 Nobel Prize in physics. Some of the important ideas that contributed to this development are the theory of beta decay formulated by Fermi, Parity violation suggested by Lee and Yang, and incorporated into immensely successful V-A theory of weak interactions by Sudarshan and Marshak. At the same time ideas of gauge invariance were applied to weak interaction by Schwinger, Bludman and Glashow. Weinberg and Salam then went one step further and wrote a theory that is renormalizable, i.e., all higher order corrections are finite, no mean feat for a quantum field theory. The theory had to await the development of the quark model of hadrons for its completion. A description of the electro-weak theory is given

Weak decays

International Nuclear Information System (INIS)

Wojcicki, S.

1978-11-01

Lectures are given on weak decays from a phenomenological point of view, emphasizing new results and ideas and the relation of recent results to the new standard theoretical model. The general framework within which the weak decay is viewed and relevant fundamental questions, weak decays of noncharmed hadrons, decays of muons and the tau, and the decays of charmed particles are covered. Limitation is made to the discussion of those topics that either have received recent experimental attention or are relevant to the new physics. (JFP) 178 references

Becker muscular dystrophy with widespread muscle hypertrophy and a non-sense mutation of exon 2

DEFF Research Database (Denmark)

Witting, Nanna; Duno, M; Vissing, J

2013-01-01

Becker muscular dystrophy features progressive proximal weakness, wasting and often focal hypertrophy. We present a patient with pain and cramps from adolescence. Widespread muscle hypertrophy, preserved muscle strength and a 10-20-fold raised CPK were noted. Muscle biopsy was dystrophic......, and Western blot showed a 95% reduction of dystrophin levels. Genetic analyses revealed a non-sense mutation in exon 2 of the dystrophin gene. This mutation is predicted to result in a Duchenne phenotype, but resulted in a mild Becker muscular dystrophy with widespread muscle hypertrophy. We suggest...

Weak currents

International Nuclear Information System (INIS)

Leite Lopes, J.

1976-01-01

A survey of the fundamental ideas on weak currents such as CVC and PCAC and a presentation of the Cabibbo current and the neutral weak currents according to the Salam-Weinberg model and the Glashow-Iliopoulos-Miami model are given [fr

Homological properties of modules with finite weak injective and weak flat dimensions

OpenAIRE

Zhao, Tiwei

2017-01-01

In this paper, we define a class of relative derived functors in terms of left or right weak flat resolutions to compute the weak flat dimension of modules. Moreover, we investigate two classes of modules larger than that of weak injective and weak flat modules, study the existence of covers and preenvelopes, and give some applications.

[Hereditary motor and sensory neuropathy with proximal dominant involvement (HMSN-P) is caused by a mutation in TFG].

Science.gov (United States)

Ishiura, Hiroyuki; Tsuji, Shoji

2013-01-01

Hereditary motor and sensory neuropathy with proximal dominant involvement (HMSN-P) is an autosomal dominant neurodegenerative disease characterized by proximal predominant weakness and muscle atrophy accompanied by distal sensory disturbance. Linkage analysis using 4 families identified a region on chromosome 3 showing a LOD score exceeding 4. Further refinement of candidate region was performed by haplotype analysis using high-density SNP data, resulting in a minimum candidate region spanning 3.3 Mb. Exome analysis of an HMSN-P patient revealed a mutation (c.854C>T, p.Pro285Leu) in TRK-fused gene (TFG). The identical mutation was found in the four families, which cosegregated with the disease. The mutation was neither found in Japanese control subjects nor public databases. Detailed haplotype analysis suggested two independent origins of the mutation. These findings indicate that the mutation in TFG causes HMSN-P.

High molecular somatostatin, an interfering factor in radioimmunoassay

International Nuclear Information System (INIS)

Diel, F.; Schneider, E.; Baumann, H.

1977-01-01

Cyclic Tyr 1 -somatostatin (Tyr 1 -SRIF) is radioiodinated by the lactoperoxidase method. Purification is achieved by Sephadex G-25 adsorption chromatography. Specific anti-SRIF serum (FA1) has been raised in rabbits. A dose response curve is obtained in the range of 5 - 5,000 pg per tube using an antiserum dilution of 1:2,000. There is little cross-reaction with linear somatostatin and none with ocytocin, (lys-, arg-) vasopressin, valinomycin, polymyxin, insulin, glucagon, human growth hormone (hGH), and thyrotropin-releasing hormone (TRH). For recovery tests, extraction procedures are necessary. Thin-layer chromatography (TLC) and polyacrylamide-disc-electrophoresis (Disc-PAGE) are performed to identify the presumed high molecular 125 I-Tyr 1 -SRIF associate. This high molecular associate may represent an interfering factor in the radioimmunoassay for cyclic SRIF. (orig./AJ) [de

Combinatorial delivery of small interfering RNAs reduces RNAi efficacy by selective incorporation into RISC

Science.gov (United States)

Castanotto, Daniela; Sakurai, Kumi; Lingeman, Robert; Li, Haitang; Shively, Louise; Aagaard, Lars; Soifer, Harris; Gatignol, Anne; Riggs, Arthur; Rossi, John J.

2007-01-01

Despite the great potential of RNAi, ectopic expression of shRNA or siRNAs holds the inherent risk of competition for critical RNAi components, thus altering the regulatory functions of some cellular microRNAs. In addition, specific siRNA sequences can potentially hinder incorporation of other siRNAs when used in a combinatorial approach. We show that both synthetic siRNAs and expressed shRNAs compete against each other and with the endogenous microRNAs for transport and for incorporation into the RNA induced silencing complex (RISC). The same siRNA sequences do not display competition when expressed from a microRNA backbone. We also show that TAR RNA binding protein (TRBP) is one of the sensors for selection and incorporation of the guide sequence of interfering RNAs. These findings reveal that combinatorial siRNA approaches can be problematic and have important implications for the methodology of expression and use of therapeutic interfering RNAs. PMID:17660190

Newly identified CHO ERCC3/XPB mutations and phenotype characterization

Science.gov (United States)

Rybanská, Ivana; Gurský, Ján; Fašková, Miriam; Salazar, Edmund P.; Kimlíčková-Polakovičová, Erika; Kleibl, Karol; Thompson, Larry H.; Piršel, Miroslav

2010-01-01

Nucleotide excision repair (NER) is a complex multistage process involving many interacting gene products to repair a wide range of DNA lesions. Genetic defects in NER cause human hereditary diseases including xeroderma pigmentosum (XP), Cockayne syndrome (CS), trichothiodystrophy and a combined XP/CS overlapping symptom. One key gene product associated with all these disorders is the excision repair cross-complementing 3/xeroderma pigmentosum B (ERCC3/XPB) DNA helicase, a subunit of the transcription factor IIH complex. ERCC3 is involved in initiation of basal transcription and global genome repair as well as in transcription-coupled repair (TCR). The hamster ERCC3 gene shows high degree of homology with the human ERCC3/XPB gene. We identified new mutations in the Chinese hamster ovary cell ERCC3 gene and characterized the role of hamster ERCC3 protein in DNA repair of ultraviolet (UV)-induced and oxidative DNA damage. All but one newly described mutations are located in the protein C-terminal region around the last intron–exon boundary. Due to protein truncations or frameshifts, they lack amino acid Ser751, phosphorylation of which prevents the 5′ incision of the UV-induced lesion during NER. Thus, despite the various locations of the mutations, their phenotypes are similar. All ercc3 mutants are extremely sensitive to UV-C light and lack recovery of RNA synthesis (RRS), confirming a defect in TCR of UV-induced damage. Their limited global genome NER capacity averages ∼8%. We detected modest sensitivity of ercc3 mutants to the photosensitizer Ro19-8022, which primarily introduces 8-oxoguanine lesions into DNA. Ro19-8022-induced damage interfered with RRS, and some of the ercc3 mutants had delayed kinetics. All ercc3 mutants showed efficient base excision repair (BER). Thus, the positions of the mutations have no effect on the sensitivity to, and repair of, Ro19-8022-induced DNA damage, suggesting that the ERCC3 protein is not involved in BER. PMID:19942596

Protótipo do primeiro interferômetro brasileiro - BDA

Science.gov (United States)

Cecatto, J. R.; Fernandes, F. C. R.; Neri, J. A. C. F.; Bethi, N.; Felipini, N. S.; Madsen, F. R. H.; Andrade, M. C.; Soares, A. C.; Alonso, E. M. B., Sawant, H. S.

2004-04-01

A interferometria é uma poderosa ferramenta usada para investigar estruturas espaciais de fontes astrofísicas fornecendo uma riqueza de detalhes inatingível pelas técnicas convencionais de imageamento. Em particular, a interferometria com ondas de rádio abre o horizonte de conhecimento do Universo nesta ampla banda do espectro eletromagnético, que vai de cerca de 20 kHz até centenas de GHz já próximo ao infravermelho, e que está acessível a partir de instrumentos instalados em solo. Neste trabalho, apresentamos o interferômetro designado por Arranjo Decimétrico Brasileiro (BDA). Trata-se do primeiro interferômetro a ser desenvolvido no Brasil e América Latina que já está em operação na fase de protótipo. Apresentamos o desenvolvimento realizado até o momento, o sítio de instalação do instrumento, o protótipo e os principais resultados dos testes de sua operação, as perspectivas futuras e a ciência a ser desenvolvida com o instrumento nas fases II e III. Neste trabalho é dada ênfase ao desenvolvimento, testes de operação e principais resultados do protótipo. É discutida brevemente a ciência que pode ser feita com o instrumento. Tanto os detalhes técnicos quanto os principais parâmetros estimados para o instrumento nas próximas fases de desenvolvimento e o desempenho do protótipo serão publicados em breve.

Mutation spectrum in the large GTPase dynamin 2, and genotype-phenotype correlation in autosomal dominant centronuclear myopathy

DEFF Research Database (Denmark)

Böhm, Johann; Biancalana, Valérie; Dechene, Elizabeth T

2012-01-01

Centronuclear myopathy (CNM) is a genetically heterogeneous disorder associated with general skeletal muscle weakness, type I fiber predominance and atrophy, and abnormally centralized nuclei. Autosomal dominant CNM is due to mutations in the large GTPase dynamin 2 (DNM2), a mechanochemical enzym...

The rate and effects of spontaneous mutation on fitness traits in the social amoeba, Dictyostelium discoideum.

Science.gov (United States)

Hall, David W; Fox, Sara; Kuzdzal-Fick, Jennie J; Strassmann, Joan E; Queller, David C

2013-07-08

We performed a mutation accumulation (MA) experiment in the social amoeba Dictyostelium discoideum to estimate the rate and distribution of effects of spontaneous mutations affecting eight putative fitness traits. We found that the per-generation mutation rate for most fitness components is 0.0019 mutations per haploid genome per generation or larger. This rate is an order of magnitude higher than estimates for fitness components in the unicellular eukaryote Saccharomyces cerevisiae, even though the base-pair substitution rate is two orders of magnitude lower. The high rate of fitness-altering mutations observed in this species may be partially explained by a large mutational target relative to S. cerevisiae. Fitness-altering mutations also may occur primarily at simple sequence repeats, which are common throughout the genome, including in coding regions, and may represent a target that is particularly likely to give fitness effects upon mutation. The majority of mutations had deleterious effects on fitness, but there was evidence for a substantial fraction, up to 40%, being beneficial for some of the putative fitness traits. Competitive ability within the multicellular slug appears to be under weak directional selection, perhaps reflecting the fact that slugs are sometimes, but not often, comprised of multiple clones in nature. Evidence for pleiotropy among fitness components across MA lines was absent, suggesting that mutations tend to act on single fitness components.

Evaluation of locked nucleic acid-modified small interfering RNA in vitro and in vivo

NARCIS (Netherlands)

Mook, Olaf R.; Baas, Frank; de Wissel, Marit B.; Fluiter, Kees

2007-01-01

RNA interference has become widely used as an experimental tool to study gene function. In addition, small interfering RNA (siRNA) may have great potential for the treatment of diseases. Recently, it was shown that siRNA can be used to mediate gene silencing in mouse models. Locally administered

Evaluation of point mutations in dystrophin gene in Iranian Duchenne and Becker muscular dystrophy patients: introducing three novel variants.

Science.gov (United States)

Haghshenas, Maryam; Akbari, Mohammad Taghi; Karizi, Shohreh Zare; Deilamani, Faravareh Khordadpoor; Nafissi, Shahriar; Salehi, Zivar

2016-06-01

Duchenne and Becker muscular dystrophies (DMD and BMD) are X-linked neuromuscular diseases characterized by progressive muscular weakness and degeneration of skeletal muscles. Approximately two-thirds of the patients have large deletions or duplications in the dystrophin gene and the remaining one-third have point mutations. This study was performed to evaluate point mutations in Iranian DMD/BMD male patients. A total of 29 DNA samples from patients who did not show any large deletion/duplication mutations following multiplex polymerase chain reaction (PCR) and multiplex ligation-dependent probe amplification (MLPA) screening were sequenced for detection of point mutations in exons 50-79. Also exon 44 was sequenced in one sample in which a false positive deletion was detected by MLPA method. Cycle sequencing revealed four nonsense, one frameshift and two splice site mutations as well as two missense variants.

Mutation Spectrum in the Large GTPase Dynamin 2, and Genotype–Phenotype Correlation in Autosomal Dominant Centronuclear Myopathy

Science.gov (United States)

Böhm, Johann; Biancalana, Valérie; DeChene, Elizabeth T.; Bitoun, Marc; Pierson, Christopher R.; Schaefer, Elise; Karasoy, Hatice; Dempsey, Melissa A.; Klein, Fabrice; Dondaine, Nicolas; Kretz, Christine; Haumesser, Nicolas; Poirson, Claire; Toussaint, Anne; Greenleaf, Rebecca S.; Barger, Melissa A.; Mahoney, Lane J.; Kang, Peter B.; Zanoteli, Edmar; Vissing, John; Witting, Nanna; Echaniz-Laguna, Andoni; Wallgren-Pettersson, Carina; Dowling, James; Merlini, Luciano; Oldfors, Anders; Ousager, Lilian Bomme; Melki, Judith; Krause, Amanda; Jern, Christina; Oliveira, Acary S. B.; Petit, Florence; Jacquette, Aurélia; Chaussenot, Annabelle; Mowat, David; Leheup, Bruno; Cristofano, Michele; Aldea, Juan José Poza; Michel, Fabrice; Furby, Alain; Llona, Jose E. Barcena; Van Coster, Rudy; Bertini, Enrico; Urtizberea, Jon Andoni; Drouin-Garraud, Valérie; Béroud, Christophe; Prudhon, Bernard; Bedford, Melanie; Mathews, Katherine; Erby, Lori A. H.; Smith, Stephen A.; Roggenbuck, Jennifer; Crowe, Carol A.; Spitale, Allison Brennan; Johal, Sheila C.; Amato, Anthony A.; Demmer, Laurie A.; Jonas, Jessica; Darras, Basil T.; Bird, Thomas D.; Laurino, Mercy; Welt, Selman I.; Trotter, Cynthia; Guicheney, Pascale; Das, Soma; Mandel, Jean-Louis; Beggs, Alan H.; Laporte, Jocelyn

2012-01-01

Centronuclear myopathy (CNM) is a genetically heterogeneous disorder associated with general skeletal muscle weakness, type I fiber predominance and atrophy, and abnormally centralized nuclei. Autosomal dominant CNM is due to mutations in the large GTPase dynamin 2 (DNM2), a mechanochemical enzyme regulating cytoskeleton and membrane trafficking in cells. To date, 40 families with CNM-related DNM2 mutations have been described, and here we report 60 additional families encompassing a broad genotypic and phenotypic spectrum. In total, 18 different mutations are reported in 100 families and our cohort harbors nine known and four new mutations, including the first splice-site mutation. Genotype–phenotype correlation hypotheses are drawn from the published and new data, and allow an efficient screening strategy for molecular diagnosis. In addition to CNM, dissimilar DNM2 mutations are associated with Charcot–Marie–Tooth (CMT) peripheral neuropathy (CMTD1B and CMT2M), suggesting a tissue-specific impact of the mutations. In this study, we discuss the possible clinical overlap of CNM and CMT, and the biological significance of the respective mutations based on the known functions of dynamin 2 and its protein structure. Defects in membrane trafficking due to DNM2 mutations potentially represent a common pathological mechanism in CNM and CMT. PMID:22396310

Prevalence and phenotypes of congenital myopathy due to α-actin 1 gene mutations

DEFF Research Database (Denmark)

Witting, Nanna; Werlauff, Ulla; Duno, Morten

2016-01-01

airway pressure. Limb flexor/extensor muscles and upper and lower extremities were affected equally. Pronounced neck flexor weakness was noted. CONCLUSIONS: Congenital myopathy caused by ACTA1 mutations is fatal in infancy in most cases. This study shows that the prevalence of α-actin myopathy in older...... patients with congenital myopathy is not negligible and that phenotypes can be quite mild....

Hartman effect and weak measurements that are not really weak

International Nuclear Information System (INIS)

Sokolovski, D.; Akhmatskaya, E.

2011-01-01

We show that in wave packet tunneling, localization of the transmitted particle amounts to a quantum measurement of the delay it experiences in the barrier. With no external degree of freedom involved, the envelope of the wave packet plays the role of the initial pointer state. Under tunneling conditions such ''self-measurement'' is necessarily weak, and the Hartman effect just reflects the general tendency of weak values to diverge, as postselection in the final state becomes improbable. We also demonstrate that it is a good precision, or a 'not really weak' quantum measurement: no matter how wide the barrier d, it is possible to transmit a wave packet with a width σ small compared to the observed advancement. As is the case with all weak measurements, the probability of transmission rapidly decreases with the ratio σ/d.

An unusual cysteine VL87 affects the antibody fragment conformations without interfering with the disulfide bond formation.

Science.gov (United States)

Attallah, Carolina; Aguilar, María Fernanda; Garay, A Sergio; Herrera, Fernando E; Etcheverrigaray, Marina; Oggero, Marcos; Rodrigues, Daniel E

2017-10-01

The Cys residues are almost perfectly conserved in all antibodies. They contribute significantly to the antibody fragment stability. The relevance of two natural contiguous Cys residues of an anti-recombinant human-follicle stimulation hormone (rhFSH) in a format of single-chain variable fragment (scFv) was studied. This scFv contains 5 Cys residues: V H 22 and V H 92 in the variable heavy chain (V H ) and V L 23, V L 87 and V L 88 in the variable light chain (V L ). The influence of two unusual contiguous Cys at positions V L 87 and V L 88 was studied by considering the wild type fragment and mutant variants: V L -C88S, V L -C87S, V L -C87Y. The analysis was carried out using antigen-binding ability measurement by indirect specific ELISA and a detailed molecular modeling that comprises homology methods, long molecular dynamics simulations and docking. We found that V L -C87 affected the antibody fragment stability without interfering with the disulfide bond formation. The effect of mutating the V L -C87 by a usual residue at this position like Tyr caused distant structural changes at the V H region that confers a higher mobility to the V H -CDR2 and V H -CDR3 loops improving the scFv binding to the antigen. Copyright © 2017 Elsevier Ltd. All rights reserved.

(Sub-)Optimality of Treating Interference as Noise in the Cellular Uplink With Weak Interference

KAUST Repository

Gherekhloo, Soheil; Chaaban, Anas; Di, Chen; Sezgin, Aydin

2015-01-01

Despite the simplicity of the scheme of treating interference as noise (TIN), it was shown to be sum-capacity optimal in the Gaussian interference channel (IC) with very-weak (noisy) interference. In this paper, the two-user IC is altered by introducing an additional transmitter that wants to communicate with one of the receivers of the IC. The resulting network thus consists of a point-to-point channel interfering with a multiple access channel (MAC) and is denoted by PIMAC. The sum-capacity of the PIMAC is studied with main focus on the optimality of TIN. It turns out that TIN in its naive variant, where all transmitters are active and both receivers use TIN for decoding, is not the best choice for the PIMAC. In fact, a scheme that combines both time division multiple access and TIN (TDMA-TIN) strictly outperforms the naive-TIN scheme. Furthermore, it is shown that in some regimes, TDMA-TIN achieves the sum-capacity for the deterministic PIMAC and the sum-capacity within a constant gap for the Gaussian PIMAC. In addition, it is shown that, even for very-weak interference, there are some regimes where a combination of interference alignment with power control and TIN at the receiver side outperforms TDMA-TIN. As a consequence, on the one hand, TIN in a cellular uplink is approximately optimal in certain regimes. On the other hand, those regimes cannot be simply described by the strength of interference.

(Sub-)Optimality of Treating Interference as Noise in the Cellular Uplink With Weak Interference

KAUST Repository

Gherekhloo, Soheil

2015-11-09

Despite the simplicity of the scheme of treating interference as noise (TIN), it was shown to be sum-capacity optimal in the Gaussian interference channel (IC) with very-weak (noisy) interference. In this paper, the two-user IC is altered by introducing an additional transmitter that wants to communicate with one of the receivers of the IC. The resulting network thus consists of a point-to-point channel interfering with a multiple access channel (MAC) and is denoted by PIMAC. The sum-capacity of the PIMAC is studied with main focus on the optimality of TIN. It turns out that TIN in its naive variant, where all transmitters are active and both receivers use TIN for decoding, is not the best choice for the PIMAC. In fact, a scheme that combines both time division multiple access and TIN (TDMA-TIN) strictly outperforms the naive-TIN scheme. Furthermore, it is shown that in some regimes, TDMA-TIN achieves the sum-capacity for the deterministic PIMAC and the sum-capacity within a constant gap for the Gaussian PIMAC. In addition, it is shown that, even for very-weak interference, there are some regimes where a combination of interference alignment with power control and TIN at the receiver side outperforms TDMA-TIN. As a consequence, on the one hand, TIN in a cellular uplink is approximately optimal in certain regimes. On the other hand, those regimes cannot be simply described by the strength of interference.

Defective interfering particles in monolayer-propagated Newcastle disease virus

International Nuclear Information System (INIS)

Roman, J.M.; Simon, E.H.

1976-01-01

Newcastle disease virus (NDV) serially passaged in chick embryo fibroblasts (M-NDV) gives rise to defective interfering (NDV-DI) particles, while NDV passaged in embryonated eggs (E-NDV) does not. Co-infection with these particles and infectious virions results in a 99 percent reduction in yield. Interference is not due to interferon or to prevention of absorption of infectious virions and is specific for NDV. The particles mediating interference sediment at the same velocity as infectious virions. The accumulation of NDV-DI particles in monolayers but not in eggs may be a consequence of the fact that M-NDV virions are larger and probably contain more RNA, or it may reflect differences in NDV replicative processes in eggs and monolayers, or both

Weak KAM theory for a weakly coupled system of Hamilton–Jacobi equations

KAUST Repository

Figalli, Alessio; Gomes, Diogo A.; Marcon, Diego

2016-01-01

Here, we extend the weak KAM and Aubry–Mather theories to optimal switching problems. We consider three issues: the analysis of the calculus of variations problem, the study of a generalized weak KAM theorem for solutions of weakly coupled systems of Hamilton–Jacobi equations, and the long-time behavior of time-dependent systems. We prove the existence and regularity of action minimizers, obtain necessary conditions for minimality, extend Fathi’s weak KAM theorem, and describe the asymptotic limit of the generalized Lax–Oleinik semigroup. © 2016, Springer-Verlag Berlin Heidelberg.

Weak KAM theory for a weakly coupled system of Hamilton–Jacobi equations

KAUST Repository

Figalli, Alessio

2016-06-23

Here, we extend the weak KAM and Aubry–Mather theories to optimal switching problems. We consider three issues: the analysis of the calculus of variations problem, the study of a generalized weak KAM theorem for solutions of weakly coupled systems of Hamilton–Jacobi equations, and the long-time behavior of time-dependent systems. We prove the existence and regularity of action minimizers, obtain necessary conditions for minimality, extend Fathi’s weak KAM theorem, and describe the asymptotic limit of the generalized Lax–Oleinik semigroup. © 2016, Springer-Verlag Berlin Heidelberg.

Sensitivity of human cells expressing low-fidelity or weak-catalytic-activity variants of DNA polymerase ζ to genotoxic stresses.

Science.gov (United States)

Suzuki, Tetsuya; Grúz, Petr; Honma, Masamitsu; Adachi, Noritaka; Nohmi, Takehiko

2016-09-01

Translesion DNA polymerases (TLS pols) play critical roles in defense mechanisms against genotoxic agents. The defects or mutations of TLS pols are predicted to result in hypersensitivity of cells to environmental mutagens. In this study, human cells expressing DNA polymerase ζ (Pol ζ) variants with low fidelity or weak catalytic activity have been established with Nalm-6-MSH+ cells and their sensitivity to mutagenicity and cytotoxicity of benzo[a]pyrene diol epoxide (BPDE) and ultraviolet-C light (UV-C) was examined. The low-fidelity mutants were engineered by knocking-in DNA sequences that direct changes of leucine 2618 to either phenylalanine (L2618F) or methionine (L2618M) of Pol ζ. The weak-catalytic-activity mutants were generated by knocking-in DNA sequences that direct changes of either tyrosine 2779 to phenylalanine (Y2779F) or aspartate 2781 to asparagine (D2781N). In addition, a +1 frameshift mutation, i.e., CCC to CCCC, was introduced in the coding region of the TK1 gene to measure the mutant frequencies. Doubling time and spontaneous TK mutant frequencies of the established cell lines were similar to those of the wild-type cells. The low-fidelity mutants displayed, however, higher sensitivity to the mutagenicity of BPDE and UV-C than the wild-type cells although their cytotoxic sensitivity was not changed. In contrast, the weak-catalytic-activity mutants were more sensitive to the cytotoxicity of BPDE and UV-C than the wild-type cells, and displayed much higher sensitivity to the clastogenicity of BPDE than the wild-type cells in an in vitro micronucleus assay. These results indicate that human Pol ζ is involved in TLS across DNA lesions induced by BPDE and UV-C and also that the TLS plays important roles in induction of mutations, clastogenicity and in cellular survival of the damaged human cells. Similarities and differences in in vivo roles of yeast and human Pol ζ in genome integrity are discussed. Copyright © 2016 Elsevier B.V. All rights

Dark-Matter Particles without Weak-Scale Masses or Weak Interactions

International Nuclear Information System (INIS)

Feng, Jonathan L.; Kumar, Jason

2008-01-01

We propose that dark matter is composed of particles that naturally have the correct thermal relic density, but have neither weak-scale masses nor weak interactions. These models emerge naturally from gauge-mediated supersymmetry breaking, where they elegantly solve the dark-matter problem. The framework accommodates single or multiple component dark matter, dark-matter masses from 10 MeV to 10 TeV, and interaction strengths from gravitational to strong. These candidates enhance many direct and indirect signals relative to weakly interacting massive particles and have qualitatively new implications for dark-matter searches and cosmological implications for colliders

Sarcomeric gene mutations in sudden infant death syndrome (SIDS).

Science.gov (United States)

Brion, Maria; Allegue, Catarina; Santori, Montserrat; Gil, Rocio; Blanco-Verea, Alejandro; Haas, Cordula; Bartsch, Christine; Poster, Simone; Madea, Burkhard; Campuzano, Oscar; Brugada, Ramon; Carracedo, Angel

2012-06-10

In developed countries, sudden infant death syndrome (SIDS) represents the most prevalent cause of death in children between 1 month and 1 year of age. SIDS is a diagnosis of exclusion, a negative autopsy which requires the absence of structural organ disease. Although investigators have confirmed that a significant percentage of SIDS cases are actually channelopathies, no data have been made available as to whether other sudden cardiac death-associated diseases, such as hypertrophic cardiomyopathy (HCM), could be responsible for some cases of SIDS. The presence of a genetic mutation in the sarcomeric protein usually affects the force of contraction of the myocyte, whose weakness is compensated with progressive hypertrophy and disarray. However, it is unclear whether in the most incipient forms, that is, first years of life, the lack of these phenotypes still confers a risk of arrhythmogenesis. The main goal of the present study is to wonder whether genetic defects in the sarcomeric proteins, previously associated with HCM, could be responsible for SIDS. We have analysed 286 SIDS cases for the most common genes implicated in HCM in adults. A total of 680 mutations localised in 16 genes were analysed by semi-automated matrix-assisted laser desorption/ionisation time-of-flight mass spectrometry (MALDITOF-MS) using the Sequenom MassARRAY(®) System. Ten subjects with completely normal hearts showed mutated alleles at nine of the genetic variants analysed, and one additional novel mutation was detected by conventional sequencing. Therefore, a genetic mutation associated with HCM may cause sudden cardiac death in the absence of an identifiable phenotype. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.

Analysis of factors affecting the development of food crop varieties bred by mutation method in China

International Nuclear Information System (INIS)

Wang Zhidong; Hu Ruifa

2002-01-01

The research developed a production function on crop varieties developed by mutation method in order to explore factors affecting the development of new varieties. It is found that the research investment, human capital and radiation facilities were the most important factors that affected the development and cultivation area of new varieties through the mutation method. It is concluded that not all institutions involved in the breeding activities using mutation method must have radiation facilities and the national government only needed to invest in those key research institutes, which had strong research capacities. The saved research budgets can be used in the entrusting the institutes that have stronger research capacities with irradiating more breeding materials developed by the institutes that have weak research capacities, by which more opportunities to breed better varieties can be created

PoPMuSiC 2.1: a web server for the estimation of protein stability changes upon mutation and sequence optimality

Directory of Open Access Journals (Sweden)

Rooman Marianne

2011-05-01

Full Text Available Abstract Background The rational design of modified proteins with controlled stability is of extreme importance in a whole range of applications, notably in the biotechnological and environmental areas, where proteins are used for their catalytic or other functional activities. Future breakthroughs in medical research may also be expected from an improved understanding of the effect of naturally occurring disease-causing mutations on the molecular level. Results PoPMuSiC-2.1 is a web server that predicts the thermodynamic stability changes caused by single site mutations in proteins, using a linear combination of statistical potentials whose coefficients depend on the solvent accessibility of the mutated residue. PoPMuSiC presents good prediction performances (correlation coefficient of 0.8 between predicted and measured stability changes, in cross validation, after exclusion of 10% outliers. It is moreover very fast, allowing the prediction of the stability changes resulting from all possible mutations in a medium size protein in less than a minute. This unique functionality is user-friendly implemented in PoPMuSiC and is particularly easy to exploit. Another new functionality of our server concerns the estimation of the optimality of each amino acid in the sequence, with respect to the stability of the structure. It may be used to detect structural weaknesses, i.e. clusters of non-optimal residues, which represent particularly interesting sites for introducing targeted mutations. This sequence optimality data is also expected to have significant implications in the prediction and the analysis of particular structural or functional protein regions. To illustrate the interest of this new functionality, we apply it to a dataset of known catalytic sites, and show that a much larger than average concentration of structural weaknesses is detected, quantifying how these sites have been optimized for function rather than stability. Conclusion The

A Middle Eastern Founder Mutation Expands the Genotypic and Phenotypic Spectrum of Mitochondrial MICU1 Deficiency: A Report of 13 Patients.

Science.gov (United States)

Musa, Sara; Eyaid, Wafaa; Kamer, Kimberli; Ali, Rehab; Al-Mureikhi, Mariam; Shahbeck, Noora; Al Mesaifri, Fatma; Makhseed, Nawal; Mohamed, Zakkiriah; AlShehhi, Wafaa Ali; Mootha, Vamsi K; Juusola, Jane; Ben-Omran, Tawfeg

2018-05-03

MICU1 encodes a Ca 2+ sensing, regulatory subunit of the mitochondrial uniporter, a selective calcium channel within the organelle's inner membrane. Ca 2+ entry into mitochondria helps to buffer cytosolic Ca 2+ transients and also activates ATP production within the organelle. Mutations in MICU1 have previously been reported in 17 children from nine families with muscle weakness, fatigue, normal lactate, and persistently elevated creatine kinase, as well as variable features that include progressive extrapyramidal signs, learning disabilities, nystagmus, and cataracts. In this study, we report the clinical features of an additional 13 patients from consanguineous Middle Eastern families with recessive mutations in MICU1. Of these patients, 12/13 are homozygous for a novel founder mutation c.553C>T (p.Q185*) that is predicted to lead to a complete loss of function of MICU1, while one patient is compound heterozygous for this mutation and an intragenic duplication of exons 9 and 10. The founder mutation occurs with a minor allele frequency of 1:60,000 in the ExAC database, but in ~1:500 individual in the Middle East. All 13 of these patients presented with developmental delay, learning disability, muscle weakness and easy fatigability, and failure to thrive, as well as additional variable features we tabulate. Consistent with previous cases, all of these patients had persistently elevated serum creatine kinase with normal lactate levels, but they also exhibited elevated transaminase enzymes. Our work helps to better define the clinical sequelae of MICU1 deficiency. Furthermore, our work suggests that targeted analysis of the MICU1 founder mutation in Middle Eastern patients may be warranted.

Experimental quantum teleportation and multiphoton entanglement via interfering narrowband photon sources

International Nuclear Information System (INIS)

Yang Jian; Zhang Han; Peng Chengzhi; Chen Zengbing; Bao Xiaohui; Chen Shuai; Pan Jianwei

2009-01-01

In this paper, we report a realization of synchronization-free quantum teleportation and narrowband three-photon entanglement through interfering narrowband photon sources. Since both the single-photon and the entangled photon pair utilized are completely autonomous, it removes the requirement of high-demanding synchronization techniques in long-distance quantum communication with pulsed spontaneous parametric down-conversion sources. The frequency linewidth of the three-photon entanglement realized is on the order of several MHz, which matches the requirement of atomic ensemble based quantum memories. Such a narrowband multiphoton source will have applications in some advanced quantum communication protocols and linear optical quantum computation.

Weak mixing below the weak scale in dark-matter direct detection

Science.gov (United States)

Brod, Joachim; Grinstein, Benjamin; Stamou, Emmanuel; Zupan, Jure

2018-02-01

If dark matter couples predominantly to the axial-vector currents with heavy quarks, the leading contribution to dark-matter scattering on nuclei is either due to one-loop weak corrections or due to the heavy-quark axial charges of the nucleons. We calculate the effects of Higgs and weak gauge-boson exchanges for dark matter coupling to heavy-quark axial-vector currents in an effective theory below the weak scale. By explicit computation, we show that the leading-logarithmic QCD corrections are important, and thus resum them to all orders using the renormalization group.

SPG20 mutation in three siblings with familial hereditary spastic paraplegia.

Science.gov (United States)

Dardour, Leila; Roelens, Filip; Race, Valerie; Souche, Erika; Holvoet, Maureen; Devriendt, Koen

2017-07-01

Troyer syndrome (MIM#275900) is an autosomal recessive form of complicated hereditary spastic paraplegia. It is characterized by progressive lower extremity spasticity and weakness, dysarthria, distal amyotrophy, developmental delay, short stature, and subtle skeletal abnormalities. It is caused by deleterious mutations in the SPG20 gene, encoding spartin, on Chromosome 13q13. Until now, six unrelated families with a genetically confirmed diagnosis have been reported. Here we report the clinical findings in three brothers of a consanguineous Moroccan family, aged 24, 17, and 7 yr old, with spastic paraplegia, short stature, motor and cognitive delay, and severe intellectual disability. Targeted exon capture and sequencing showed a homozygous nonsense mutation in the SPG20 gene, c.1369C>T (p.Arg457*), in the three affected boys. © 2017 Dardour et al.; Published by Cold Spring Harbor Laboratory Press.

Bagging Weak Predictors

DEFF Research Database (Denmark)

Lukas, Manuel; Hillebrand, Eric

Relations between economic variables can often not be exploited for forecasting, suggesting that predictors are weak in the sense that estimation uncertainty is larger than bias from ignoring the relation. In this paper, we propose a novel bagging predictor designed for such weak predictor variab...

Consequences of a novel caveolin-3 mutation in a large German family.

Science.gov (United States)

Fischer, Dirk; Schroers, Anja; Blümcke, Ingmar; Urbach, Horst; Zerres, Klaus; Mortier, Wilhelm; Vorgerd, Matthias; Schröder, Rolf

2003-02-01

Mutations in the human caveolin-3 gene (cav-3) on chromosome 3p25 have been described in limb girdle muscular dystrophy, rippling muscle disease, hyperCKemia, and distal myopathy. Here, we describe the genetic, myopathological, and clinical findings in a large German family harboring a novel heterozygous mutation (GAC-->GAA) in codon 27 of the cav-3 gene. This missense mutation causes an amino acid change from asparagine to glutamate (Asp27Glu) in the N-terminal region of the Cav-3 protein, which leads to a drastic decrease of Cav-3 protein expression in skeletal muscle tissue. In keeping with an autosomal dominant mode of inheritance, this novel cav-3 mutation was found to cosegregate with neuromuscular involvement in the reported family. Ultrastructural analysis of Cav-3-deficient muscle showed an abnormal folding of the plasma membrane as well as multiple vesicular structures in the subsarcolemmal region. Neurological examination of all nine subjects from three generations harboring the novel cav-3 mutation showed clear evidence of rippling muscle disease. However, only two of these nine patients showed isolated signs of rippling muscle disease without muscle weakness or atrophy, whereas five had additional signs of a distal myopathy and two fulfilled the diagnostic criteria of a coexisting limb girdle muscular dystrophy. These findings indicate that mutations in the human cav-3 gene can lead to different and overlapping clinical phenotypes even within the same family. Different clinical phenotypes in caveolinopathies may be attributed to so far unidentified modifying factors/genes in the individual genetic background of affected patients.

Reconstituted influenza virus envelopes as an efficient carrier system for cellular delivery of small-interfering RNAs

NARCIS (Netherlands)

de Jonge, J; Holtrop, M; Wilschut, J; Huckriede, A

Application of RNA interference for in vivo evaluation of gene function or for therapeutic interventions has been hampered by a lack of suitable delivery methods for small interfering RNA ( siRNA). Here, we present reconstituted viral envelopes (virosomes) derived from influenza virus as suitable

A novel mutation of the adrenocorticotropin receptor (ACTH-R) gene in a family with the syndrome of isolated glucocorticoid deficiency, but no ACTH-R abnormalities in two families with the triple A syndrome

Energy Technology Data Exchange (ETDEWEB)

Tsigos, C.; Arai, K.; Latronico, A.C. [National Inst. of Child Health and Human Development, Bethesda, MD (United States)]|[Temple Univ. School of Medicine, Philadelphia, PA (United States)]|[Children`s Hospital of New Jersey, Newark, NJ (United States)] [and others

1995-07-01

Isolated glucocorticoid deficiency (IGD) is an autosomal recessive disorder characterized by primary adrenocortical insufficiency, usually without mineralocorticoid deficiency. Occasionally, the disorder is associated with alacrima and achalasia of the esophagus (triple A syndrome), suggesting potential heterogeneity in its etiology. Mutations in the ACTH receptor gene have been reported in several families with IGD. We have amplified and directly sequenced the entire intronless ACTH receptor gene in 1 other family with IGD and 2 famlies with triple A syndrome. The proband with IGD was a homozygote for an A {r_arrow}G substitution, changing tyrosine 254 to cysteine in the third extracellular loop of the receptor protein, probably interfering with ligand binding. Both of her parents were heterozygotes for this mutation, which was not detected in 100 normal alleles. No mutations were identified in the entire coding area of the ACTH receptor in the 2 families with triple A syndrome, supporting the idea of a developmental or postreceptor defect in this syndrome. 19 refs., 1 fig.

Atypical presentation of GNE myopathy with asymmetric hand weakness

Science.gov (United States)

de Dios, John Karl L.; Shrader, Joseph A.; Joe, Galen O.; McClean, Jeffrey C.; Williams, Kayla; Evers, Robert; Malicdan, May Christine V.; Ciccone, Carla; Mankodi, Ami; Huizing, Marjan; McKew, John C.; Bluemke, David A.; Gahl, William A.; Carrillo-Carrasco, Nuria

2014-01-01

GNE myopathy is a rare autosomal recessive muscle disease caused by mutations in GNE, the gene encoding the rate-limiting enzyme in sialic acid biosynthesis. GNE myopathy usually manifests in early adulthood with distal myopathy that progresses slowly and symmetrically, first involving distal muscles of the lower extremities, followed by proximal muscles with relative sparing of the quadriceps. Upper extremities are typically affected later in the disease. We report a patient with GNE myopathy who presented with asymmetric hand weakness. He had considerably decreased left grip strength, atrophy of the left anterior forearm and fibro-fatty tissue replacement of left forearm flexor muscles on T1-weighted magnetic resonance imaging. The patient was an endoscopist and thus the asymmetric hand involvement may be associated with left hand overuse in daily repetitive pinching and gripping movements, highlighting the possible impact of environmental factors on the progression of genetic muscle conditions. PMID:25182749

Isolation of mutations affecting the development of freezing tolerance in Arabidopsis thaliana (L.) Heynh.

Science.gov (United States)

Warren, G; McKown, R; Marin, A L; Teutonico, R

1996-08-01

We screened for mutations deleterious to the freezing tolerance of Arabidopsis thaliana (L.) Heynh. ecotype Columbia. Tolerance was assayed by the vigor and regrowth of intact plants after cold acclimation and freezing. From a chemically mutagenized population, we obtained 13 lines of mutants with highly penetrant phenotypes. In 5 of these, freezing sensitivity was attributable to chilling injury sustained during cold acclimation, but in the remaining 8 lines, the absence of injury prior to freezing suggested that they were affected specifically in the development of freezing tolerance. In backcrosses, freezing sensitivity from each line segregated as a single nuclear mutation. Complementation tests indicated that the 8 lines contained mutations in 7 different genes. The mutants' freezing sensitivity was also detectable in the leakage of electrolytes from frozen leaves. However, 1 mutant line that displayed a strong phenotype at the whole-plant level showed a relatively weak phenotype by the electrolyte leakage assay.

Interfície gràfica per WPKG - distribució de programari

OpenAIRE

Garcia Morant, Josep

2012-01-01

Interfície gràfica per a la gestió del programari de lliure accés per a la distribució de programari WPKG (wpkg.org). Arquitectura MVC en un entorn J2EE6 utilitzant JSF2, JPA2 i EJB 3.1. Interfaz gráfica para la gestión del software de libre acceso para la distribución de software WPKG (wpkg.org). Arquitectura MVC en un entorno J2EE6 utilizando JSF2, JPA2 y EJB 3.1.

Compatibility between weak gel and microorganisms in weak gel-assisted microbial enhanced oil recovery.

Science.gov (United States)

Qi, Yi-Bin; Zheng, Cheng-Gang; Lv, Cheng-Yuan; Lun, Zeng-Min; Ma, Tao

2018-03-20

To investigate weak gel-assisted microbial flooding in Block Wang Long Zhuang in the Jiangsu Oilfield, the compatibility of weak gel and microbe was evaluated using laboratory experiments. Bacillus sp. W5 was isolated from the formation water in Block Wang Long Zhuang. The rate of oil degradation reached 178 mg/day, and the rate of viscosity reduction reached 75.3%. Strain W5 could produce lipopeptide with a yield of 1254 mg/L. Emulsified crude oil was dispersed in the microbial degradation system, and the average diameter of the emulsified oil particles was 18.54 μm. Bacillus sp. W5 did not affect the rheological properties of the weak gel, and the presence of the weak gel did not significantly affect bacterial reproduction (as indicated by an unchanged microbial biomass), emulsification (surface tension is 35.56 mN/m and average oil particles size is 21.38 μm), oil degradation (162 mg/day) and oil viscosity reduction (72.7%). Core-flooding experiments indicated oil recovery of 23.6% when both weak gel and Bacillus sp. W5 were injected into the system, 14.76% when only the weak gel was injected, and 9.78% with strain W5 was injected without the weak gel. The results demonstrate good compatibility between strains W5 and the weak gel and highlight the application potential of weak gel-assisted microbial flooding. Copyright © 2018 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

Xeroderma Pigmentosum-Trichothiodystrophy overlap patient with novel XPD/ERCC2 mutation

Science.gov (United States)

Kralund, Henrik H.; Ousager, Lilian; Jaspers, Nicolaas G.; Raams, Anja; Pedersen, Erling B.; Gade, Else; Bygum, Anette

2013-01-01

Xeroderma Pigmentosum (XP), Trichothiodystrophy (TTD) and Cockayne Syndrome (CS) are rare, recessive disorders caused by mutational defects in the Nucleotide Excision Repair (NER) pathway and/or disruption of basic cellular DNA transcription. To date, a multitude of mutations in the XPD/ERCC2 gene have been described, many of which give rise to NER- and DNA transcription related diseases, which share certain diagnostic features and few overlap patients have been described. Despite increasing understanding of the roles of XPD/ERCC2 in mammalian cells, there is still weak predictability of somatic outcome from many of these mutations. We demonstrate a patient, believed to represent an overlap between XP and TTD/CS. In addition to other organ dysfunctions, the young man presented with Photosensitivity, Ichthyosis, Brittle hair, Impaired physical and mental development, Decreased fertility and Short stature (PIBIDS) suggestive of TTD, but lacking the almost patognomonic “tiger tail” banding of the hair under polarized light. Additionally, he developed basal cell carcinoma aged 28, as well as adult onset kidney failure, features normally not associated with TTD but rather XP/CS. His freckled appearance also suggested XP, but fibroblast cultures only demonstrated x2 UV-sensitivity with expected NER and TFIIH-activity decrease. Genetic sequencing of the XPD/ERCC2 gene established the patient as heterozygote compound with a novel, N-terminal Y18H mutation and a known C-terminal (TTD) mutation, A725P. The possible interplay between gene products and the patient phenotype is discussed. PMID:25002996

Alanyl-tRNA synthetase mutation in a family with dominant distal hereditary motor neuropathy

Science.gov (United States)

Zhao, Z.; Hashiguchi, A.; Sakiyama, Y.; Okamoto, Y.; Tokunaga, S.; Zhu, L.; Shen, H.; Takashima, H.

2012-01-01

Objective: To identify a new genetic cause of distal hereditary motor neuropathy (dHMN), which is also known as a variant of Charcot-Marie-Tooth disease (CMT), in a Chinese family. Methods: We investigated a Chinese family with dHMN clinically, electrophysiologically, and genetically. We screened for the mutations of 28 CMT or related pathogenic genes using an originally designed microarray resequencing DNA chip. Results: Investigation of the family history revealed an autosomal dominant transmission pattern. The clinical features of the family included mild weakness and wasting of the distal muscles of the lower limb and foot deformity, without clinical sensory involvement. Electrophysiologic studies revealed motor neuropathy. MRI of the lower limbs showed accentuated fatty infiltration of the gastrocnemius and vastus lateralis muscles. All 4 affected family members had a heterozygous missense mutation c.2677G>A (p.D893N) of alanyl-tRNA synthetase (AARS), which was not found in the 4 unaffected members and control subjects. Conclusion: An AARS mutation caused dHMN in a Chinese family. AARS mutations result in not only a CMT phenotype but also a dHMN phenotype. PMID:22573628

Molecular Basis for the Immunostimulatory Potency of Small Interfering RNAs

Directory of Open Access Journals (Sweden)

Mouldy Sioud

2006-01-01

Full Text Available Small interfering RNAs (siRNAs represent a new class of antigene agents, which has emerged as a powerful tool for functional genomics and might serve as a potent therapeutic approach. However, several studies have showed that they could trigger several bystander effects, including immune activation and inhibition of unintended target genes. Although activation of innate immunity by siRNAs might be beneficial for therapy in some instances, uncontrolled activation can be toxic, and is therefore a major challenging problem. Interestingly, replacement of uridines in siRNA sequences with their 2′-modified counterparts abrogated siRNA bystander effects. Here we highlight these important findings that are expected to facilitate the rational design of siRNAs that avoid the induction of bystander effects.

History of Weak Interactions

Science.gov (United States)

Lee, T. D.

1970-07-01

While the phenomenon of beta-decay was discovered near the end of the last century, the notion that the weak interaction forms a separate field of physical forces evolved rather gradually. This became clear only after the experimental discoveries of other weak reactions such as muon-decay, muon-capture, etc., and the theoretical observation that all these reactions can be described by approximately the same coupling constant, thus giving rise to the notion of a universal weak interaction. Only then did one slowly recognize that the weak interaction force forms an independent field, perhaps on the same footing as the gravitational force, the electromagnetic force, and the strong nuclear and sub-nuclear forces.

Weakly nonlocal symplectic structures, Whitham method and weakly nonlocal symplectic structures of hydrodynamic type

International Nuclear Information System (INIS)

Maltsev, A Ya

2005-01-01

We consider the special type of field-theoretical symplectic structures called weakly nonlocal. The structures of this type are, in particular, very common for integrable systems such as KdV or NLS. We introduce here the special class of weakly nonlocal symplectic structures which we call weakly nonlocal symplectic structures of hydrodynamic type. We investigate then the connection of such structures with the Whitham averaging method and propose the procedure of 'averaging' the weakly nonlocal symplectic structures. The averaging procedure gives the weakly nonlocal symplectic structure of hydrodynamic type for the corresponding Whitham system. The procedure also gives 'action variables' corresponding to the wave numbers of m-phase solutions of the initial system which give the additional conservation laws for the Whitham system

Treatable childhood neuronopathy caused by mutations in riboflavin transporter RFVT2

Science.gov (United States)

Foley, A. Reghan; Menezes, Manoj P.; Pandraud, Amelie; Gonzalez, Michael A.; Al-Odaib, Ahmad; Abrams, Alexander J.; Sugano, Kumiko; Yonezawa, Atsushi; Manzur, Adnan Y.; Burns, Joshua; Hughes, Imelda; McCullagh, B. Gary; Jungbluth, Heinz; Lim, Ming J.; Lin, Jean-Pierre; Megarbane, Andre; Urtizberea, J. Andoni; Shah, Ayaz H.; Antony, Jayne; Webster, Richard; Broomfield, Alexander; Ng, Joanne; Mathew, Ann A.; O’Byrne, James J.; Forman, Eva; Scoto, Mariacristina; Prasad, Manish; O’Brien, Katherine; Olpin, Simon; Oppenheim, Marcus; Hargreaves, Iain; Land, John M.; Wang, Min X.; Carpenter, Kevin; Horvath, Rita; Straub, Volker; Lek, Monkol; Gold, Wendy; Farrell, Michael O.; Brandner, Sebastian; Phadke, Rahul; Matsubara, Kazuo; McGarvey, Michael L.; Scherer, Steven S.; Baxter, Peter S.; King, Mary D.; Clayton, Peter; Rahman, Shamima; Reilly, Mary M.; Ouvrier, Robert A.; Christodoulou, John; Züchner, Stephan; Muntoni, Francesco

2014-01-01

Childhood onset motor neuron diseases or neuronopathies are a clinically heterogeneous group of disorders. A particularly severe subgroup first described in 1894, and subsequently called Brown-Vialetto-Van Laere syndrome, is characterized by progressive pontobulbar palsy, sensorineural hearing loss and respiratory insufficiency. There has been no treatment for this progressive neurodegenerative disorder, which leads to respiratory failure and usually death during childhood. We recently reported the identification of SLC52A2, encoding riboflavin transporter RFVT2, as a new causative gene for Brown-Vialetto-Van Laere syndrome. We used both exome and Sanger sequencing to identify SLC52A2 mutations in patients presenting with cranial neuropathies and sensorimotor neuropathy with or without respiratory insufficiency. We undertook clinical, neurophysiological and biochemical characterization of patients with mutations in SLC52A2, functionally analysed the most prevalent mutations and initiated a regimen of high-dose oral riboflavin. We identified 18 patients from 13 families with compound heterozygous or homozygous mutations in SLC52A2. Affected individuals share a core phenotype of rapidly progressive axonal sensorimotor neuropathy (manifesting with sensory ataxia, severe weakness of the upper limbs and axial muscles with distinctly preserved strength of the lower limbs), hearing loss, optic atrophy and respiratory insufficiency. We demonstrate that SLC52A2 mutations cause reduced riboflavin uptake and reduced riboflavin transporter protein expression, and we report the response to high-dose oral riboflavin therapy in patients with SLC52A2 mutations, including significant and sustained clinical and biochemical improvements in two patients and preliminary clinical response data in 13 patients with associated biochemical improvements in 10 patients. The clinical and biochemical responses of this SLC52A2-specific cohort suggest that riboflavin supplementation can

Contribution of novel ATGL missense mutations to the clinical phenotype of NLSD-M: a strikingly low amount of lipase activity may preserve cardiac function.

Science.gov (United States)

Tavian, Daniela; Missaglia, Sara; Redaelli, Chiara; Pennisi, Elena M; Invernici, Gloria; Wessalowski, Ruediger; Maiwald, Robert; Arca, Marcello; Coleman, Rosalind A

2012-12-15

The lack of adipose triglyceride lipase (ATGL), a patatin-like phospholipase domain-containing enzyme that hydrolyzes fatty acids from triacylglycerol (TAG) stored in multiple tissues, causes the autosomal recessive disorder neutral lipid storage disease with myopathy (NLSD-M). In two families of Lebanese and Italian origin presenting with NLSD-M, we identified two new missense mutations in highly conserved regions of ATGL (p.Arg221Pro and p.Asn172Lys) and a novel nonsense mutation (p.Trp8X). The Lebanese patients harbor homozygous p.Arg221Pro, whereas the Italian patients are heterozygotes for p.Asn172Lys and the p.Trp8X mutation. The p.Trp8X mutation results in a complete absence of ATGL protein, while the p.Arg221Pro and p.Asn172Lys mutations result in proteins with minimal lipolytic activity. Although these mutations did not affect putative catalytic residues or the lipid droplet (LD)-binding domain of ATGL, cytosolic LDs accumulated in cultured skin fibroblasts from the patients. The missense mutations might destabilize a random coil (p.Asn172Lys) or a helix (p.Arg221Pro) structure within or proximal to the patatin domain of the lipase, thereby interfering with the enzyme activity, while leaving intact the residues required to localize the protein to LDs. Overexpressing wild-type ATGL in one patient's fibroblasts corrected the metabolic defect and effectively reduced the number and area of cellular LDs. Despite the poor lipase activity in vitro, the Lebanese siblings have a mild myopathy and not clinically evident myocardial dysfunction. The patients of Italian origin show a late-onset and slowly progressive skeletal myopathy. These findings suggest that a small amount of correctly localized lipase activity preserves cardiac function in NLSD-M.

Mitochondrial DNA depletion syndrome due to mutations in the RRM2B gene.

Science.gov (United States)

Bornstein, Belén; Area, Estela; Flanigan, Kevin M; Ganesh, Jaya; Jayakar, Parul; Swoboda, Kathryn J; Coku, Jorida; Naini, Ali; Shanske, Sara; Tanji, Kurenai; Hirano, Michio; DiMauro, Salvatore

2008-06-01

Mitochondrial DNA depletion syndrome (MDS) is characterized by a reduction in mtDNA copy number and has been associated with mutations in eight nuclear genes, including enzymes involved in mitochondrial nucleotide metabolism (POLG, TK2, DGUOK, SUCLA2, SUCLG1, PEO1) and MPV17. Recently, mutations in the RRM2B gene, encoding the p53-controlled ribonucleotide reductase subunit, have been described in seven infants from four families, who presented with various combinations of hypotonia, tubulopathy, seizures, respiratory distress, diarrhea, and lactic acidosis. All children died before 4 months of age. We sequenced the RRM2B gene in three unrelated cases with unexplained severe mtDNA depletion. The first patient developed intractable diarrhea, profound weakness, respiratory distress, and died at 3 months. The other two unrelated patients had a much milder phenotype and are still alive at ages 27 and 36 months. All three patients had lactic acidosis and severe depletion of mtDNA in muscle. Muscle histochemistry showed RRF and COX deficiency. Sequencing the RRM2B gene revealed three missense mutations and two single nucleotide deletions in exons 6, 8, and 9, confirming that RRM2B mutations are important causes of MDS and that the clinical phenotype is heterogeneous and not invariably fatal in infancy.

Weak interactions

International Nuclear Information System (INIS)

Bjorken, J.D.

1978-01-01

Weak interactions are studied from a phenomenological point of view, by using a minimal number of theoretical hypotheses. Charged-current phenomenology, and then neutral-current phenomenology are discussed. This all is described in terms of a global SU(2) symmetry plus an electromagnetic correction. The intermediate-boson hypothesis is introduced and lower bounds on the range of the weak force are inferred. This phenomenology does not yet reconstruct all the predictions of the conventional SU(2)xU(1) gauge theory. To do that requires an additional assumption of restoration of SU(2) symmetry at asymptotic energies

Mutation Spectrum and Phenotypic Features in Noonan Syndrome with PTPN11 Mutations: Definition of Two Novel Mutations.

Science.gov (United States)

Atik, Tahir; Aykut, Ayca; Hazan, Filiz; Onay, Huseyin; Goksen, Damla; Darcan, Sukran; Tukun, Ajlan; Ozkinay, Ferda

2016-06-01

To evaluate the spectrum of PTPN11 gene mutations in Noonan syndrome patients and to study the genotype-phenotype associations. In this study, twenty Noonan syndrome patients with PTPN11 mutations were included. The patients underwent a detailed clinical and physical evaluation. To identify inherited cases, parents of all mutation positive patients were analyzed. Thirteen different PTPN11 mutations, two of them being novel, were detected in the study group. These mutations included eleven missense mutations: p.G60A, p.D61N, p.Y62D, p.Y63C, p.E69Q, p.Q79R, p.Y279C,p.N308D, p.N308S, p.M504V, p.Q510R and two novel missense mutations: p.I56V and p.I282M. The frequency of cardiac abnormalities and short stature were found to be 80 % and 80 %, respectively. Mental retardation was not observed in patients having exon 8 mutations. No significant correlations were detected between other phenotypic features and genotypes. By identifying genotype-phenotype correlations, this study provides information on phenotypes observed in NS patients with different PTPN11 mutations.

Systematic review: role of acid, weakly acidic and weakly alkaline reflux in gastro-oesophageal reflux disease

NARCIS (Netherlands)

Boeckxstaens, G. E.; Smout, A.

2010-01-01

The importance of weakly acidic and weakly alkaline reflux in gastro-oesophageal reflux disease (GERD) is gaining recognition. To quantify the proportions of reflux episodes that are acidic (pH <4), weakly acidic (pH 4-7) and weakly alkaline (pH >7) in adult patients with GERD, and to evaluate their

Weakly infinite-dimensional spaces

International Nuclear Information System (INIS)

Fedorchuk, Vitalii V

2007-01-01

In this survey article two new classes of spaces are considered: m-C-spaces and w-m-C-spaces, m=2,3,...,∞. They are intermediate between the class of weakly infinite-dimensional spaces in the Alexandroff sense and the class of C-spaces. The classes of 2-C-spaces and w-2-C-spaces coincide with the class of weakly infinite-dimensional spaces, while the compact ∞-C-spaces are exactly the C-compact spaces of Haver. The main results of the theory of weakly infinite-dimensional spaces, including classification via transfinite Lebesgue dimensions and Luzin-Sierpinsky indices, extend to these new classes of spaces. Weak m-C-spaces are characterised by means of essential maps to Henderson's m-compacta. The existence of hereditarily m-strongly infinite-dimensional spaces is proved.

Alcohol dysregulates corticotropin-releasing-hormone (CRH promoter activity by interfering with the negative glucocorticoid response element (nGRE.

Directory of Open Access Journals (Sweden)

Magdalena M Przybycien-Szymanska

Full Text Available EtOH exposure in male rats increases corticotropin-releasing hormone (CRH mRNA in the paraventricular nucleus of the hypothalamus (PVN, a brain region responsible for coordinating stress and anxiety responses. In this study we identified the molecular mechanisms involved in mediating these effects by examining the direct effects of EtOH on CRH promoter activity in a neuronal cell line derived from the PVN (IVB. In addition, we investigated the potential interactions of EtOH and glucocorticoids on the CRH promoter by concomitantly treating cells with EtOH and the glucocorticoid receptor (GR antagonist RU486, and by sequentially deleting GR binding sites within glucocorticoid response element (GRE on the CRH promoter. Cells were transiently transfected with a firefly luciferase reporter construct containing 2.5 kb of the rat wild type (WT or mutated CRH promoter. Our results showed that EtOH treatment induced a biphasic response in CRH promoter activity. EtOH exposure for 0.5 h significantly decreased promoter activity compared to vehicle treated controls, whereas promoter activity was significantly increased after 2.0 h of EtOH exposure. Treatment with RU486, or deletion of the GR binding sites 1 and 2 within the GRE, abolished the EtOH-induced increase in the promoter activity, however did not affect EtOH-induced decrease in CRH promoter activity at an earlier time point. Overall, our data suggest that alcohol exposure directly regulates CRH promoter activity by interfering with the normal feedback mechanisms of glucocorticoids mediated by GR signaling at the GRE site of the CRH promoter.

Acute muscular weakness in children

Directory of Open Access Journals (Sweden)

Ricardo Pablo Javier Erazo Torricelli

Full Text Available ABSTRACT Acute muscle weakness in children is a pediatric emergency. During the diagnostic approach, it is crucial to obtain a detailed case history, including: onset of weakness, history of associated febrile states, ingestion of toxic substances/toxins, immunizations, and family history. Neurological examination must be meticulous as well. In this review, we describe the most common diseases related to acute muscle weakness, grouped into the site of origin (from the upper motor neuron to the motor unit. Early detection of hyperCKemia may lead to a myositis diagnosis, and hypokalemia points to the diagnosis of periodic paralysis. Ophthalmoparesis, ptosis and bulbar signs are suggestive of myasthenia gravis or botulism. Distal weakness and hyporeflexia are clinical features of Guillain-Barré syndrome, the most frequent cause of acute muscle weakness. If all studies are normal, a psychogenic cause should be considered. Finding the etiology of acute muscle weakness is essential to execute treatment in a timely manner, improving the prognosis of affected children.

MPL mutation profile in JAK2 mutation-negative patients with myeloproliferative disorders.

Science.gov (United States)

Ma, Wanlong; Zhang, Xi; Wang, Xiuqiang; Zhang, Zhong; Yeh, Chen-Hsiung; Uyeji, Jennifer; Albitar, Maher

2011-03-01

Mutations in the thrombopoietin receptor gene (myeloproliferative leukemia, MPL) have been reported in patients with JAK2 V617F-negative chronic myeloproliferative disorders (MPDs). We evaluated the prevalence of MPL mutations relative to JAK2 mutations in patients with suspected MPDs. A total of 2790 patient samples submitted for JAK2 mutation analysis were tested using real-time polymerase chain reaction and bidirectional sequencing of plasma RNA. JAK2 V617F-negative samples were tested for JAK2 exons 12 to 14 mutations, and those with negative results were then tested for mutations in MPL exons 10 and 11. Of the 2790 patients, 529 (18.96%) had V617F, 12 (0.43%) had small insertions or deletions in exon 12, and 7 (0.25%) had other JAK2 mutations in exons 12 to 14. Of the 2242 JAK2 mutation-negative patients, 68 (3.03%) had MPL mutations. W515L was the predominant MPL mutation (n=46; 68%), and 10 (15%) patients had other W515 variants. The remaining MPL mutations (n=12, 17%) were detected at other locations in exons 10 and 11 and included 3 insertion/deletion mutations. The S505N mutation, associated with familial MPD, was detected in 3 patients. Overall, for every 100 V617F mutations in patients with suspected MPDs, there were 12.9 MPL mutations, 2.3 JAK2 exon 12 mutations, and 1.3 JAK2 exons 13 to 14 mutations. These findings suggest that MPL mutation screening should be performed before JAK2 exons 12 to 14 testing in JAK2 V617F-negative patients with suspected MPDs.

The limits of weak selection and large population size in evolutionary game theory.

Science.gov (United States)

Sample, Christine; Allen, Benjamin

2017-11-01

Evolutionary game theory is a mathematical approach to studying how social behaviors evolve. In many recent works, evolutionary competition between strategies is modeled as a stochastic process in a finite population. In this context, two limits are both mathematically convenient and biologically relevant: weak selection and large population size. These limits can be combined in different ways, leading to potentially different results. We consider two orderings: the [Formula: see text] limit, in which weak selection is applied before the large population limit, and the [Formula: see text] limit, in which the order is reversed. Formal mathematical definitions of the [Formula: see text] and [Formula: see text] limits are provided. Applying these definitions to the Moran process of evolutionary game theory, we obtain asymptotic expressions for fixation probability and conditions for success in these limits. We find that the asymptotic expressions for fixation probability, and the conditions for a strategy to be favored over a neutral mutation, are different in the [Formula: see text] and [Formula: see text] limits. However, the ordering of limits does not affect the conditions for one strategy to be favored over another.

Weak openness and almost openness

Directory of Open Access Journals (Sweden)

David A. Rose

1984-01-01

Full Text Available Weak openness and almost openness for arbitrary functions between topological spaces are defined as duals to the weak continuity of Levine and the almost continuity of Husain respectively. Independence of these two openness conditions is noted and comparison is made between these and the almost openness of Singal and Singal. Some results dual to those known for weak continuity and almost continuity are obtained. Nearly almost openness is defined and used to obtain an improved link from weak continuity to almost continuity.

Weak values in collision theory

Science.gov (United States)

de Castro, Leonardo Andreta; Brasil, Carlos Alexandre; Napolitano, Reginaldo de Jesus

2018-05-01

Weak measurements have an increasing number of applications in contemporary quantum mechanics. They were originally described as a weak interaction that slightly entangled the translational degrees of freedom of a particle to its spin, yielding surprising results after post-selection. That description often ignores the kinetic energy of the particle and its movement in three dimensions. Here, we include these elements and re-obtain the weak values within the context of collision theory by two different approaches, and prove that the results are compatible with each other and with the results from the traditional approach. To provide a more complete description, we generalize weak values into weak tensors and use them to provide a more realistic description of the Stern-Gerlach apparatus.

Electromagnetic current in weak interactions

International Nuclear Information System (INIS)

Ma, E.

1983-01-01

In gauge models which unify weak and electromagnetic interactions, the weak neutral-current interaction also involves the electromagnetic current. The exact nature of such a component can be explored using e + e - experimental data. In recent years, the existence of a new component of the weak interaction has become firmly established, i.e., the neutral-current interaction. As such, it competes with the electromagnetic interaction whenever the particles involved are also charged, but at a very much lower rate because its effective strength is so small. Hence neutrino processes are best for the detection of the neutral-current interaction. However, in any gauge model which unifies weak and electromagnetic interactions, the weak neutral-current interaction also involves the electromagnetic current

Bacterial Expression of Mouse Argonaute 2 for Functional and Mutational Studies

Directory of Open Access Journals (Sweden)

Aniello Russo

2010-02-01

Full Text Available RNA interference (RNAi is a post-transcriptional gene-silencing process that occurs in many eukaryotic organisms upon intracellular exposure to double-stranded RNA. Argonaute 2 (Ago2 protein is the catalytic engine of mammalian RNAi. It contains a PIWI domain that is structurally related to RNases H and possibly shares with them a two-metal-ion catalysis mechanism. Here we describe the expression in E. coli of mouse Ago2 and testing of its enzymatic activity in a RISC assay, i.e., for the ability to cleave a target RNA in a single position specified by a complementary small interfering RNA (siRNA. The results show that the enzyme can load the siRNA and cleave the complementary RNA in absence of other cellular factors, as described for human Ago2. It was also found that mutation of Arg669, a residue previously proposed to be involved in substrate and/or B metal ion binding, doesn’t affect the enzymatic activity, suggesting that this residue doesn’t belong to the active site.

p53 expression and mutation analysis of odontogenic cysts with and without dysplasia.

Science.gov (United States)

Cox, Darren P

2012-01-01

Overexpression of p53 protein is well described in odontogenic cystic lesions (OCLs), including those with epithelial dysplasia; however, most p53 antibodies stain both wild-type and mutated p53 protein and may not reflect genotype. Direct sequencing of the p53 gene has not identified mutations in OCLs with dysplasia. The purpose of this study was to determine the molecular basis of p53 expression in several types of OCLs with and without dysplasia. The study material comprised 13 OCLs: odontogenic keratocyst (n = 5), orthokeratinized odontogenic cyst (n = 5), dentigerous cyst (n = 2), lateral periodontal cyst (n = 1), and unspecified developmental odontogenic cyst (UDOC) (n = 1). Five of these had features of mild or moderate epithelial dysplasia. One intraosseous squamous cell carcinoma (SCC) that was believed to have arisen from an antecedent dysplastic orthokeratinized OC was also included. Immunohistochemistry was performed using the DO7 monoclonal antibody that recognizes wild-type and mutated p53. DNA was extracted from microdissected tissue for all samples and exons 4 to 8 of the p53 gene direct sequenced. In 4 of 5 OCLs with dysplasia there was strong nuclear staining of basal and suprabasal cells. In all cases without dysplasia, nuclear expression in basal cells was either negative or weak and was absent in suprabasal cell nuclei. A mutation in exon 6 of the p53 gene (E224D) was identified in both the dysplastic orthokeratinized OC and the subsequent intraosseous SCC. OCLs with features of dysplasia show increased expression of p53 protein that does not reflect p53 mutational status. One dysplastic OC shared the same p53 mutation with a subsequent intraosseous SCC, indicating that p53 mutation may be associated with malignant transformation in this case. Copyright © 2012 Elsevier Inc. All rights reserved.

Interferência de plantas daninhas na cultura do quiabo Weed interference in okra crop

Directory of Open Access Journals (Sweden)

J.B. Santos

2010-06-01

Full Text Available Objetivou-se com este trabalho avaliar os períodos de interferência das plantas daninhas na cultura do quiabo (Abelmoschus esculentus na região do Médio Vale do Rio Doce, em Minas Gerais. O experimento foi conduzido em campo, entre maio e outubro de 2007. Utilizaram-se sementes do quiabo Santa Cruz-47, semeadas no espaçamento de 0,25 x 1 m. Foram estabelecidos diferentes períodos de controle das plantas daninhas na cultura, variando entre zero e 120 dias após a emergência (DAE. Foram avaliados 12 tratamentos, correspondendo a diferentes períodos de controle das plantas daninhas na cultura: capina após a emergência a partir dos 20, 40, 60, 80 e 100 dias; capina após a emergência até os 20, 40, 60, 80 e 100 dias; além de duas testemunhas com capina, ou não capinadas, ambas por 120 dias. Determinou-se o número de frutos por planta e o rendimento (produtividade, bem como os valores em dias para período anterior à interferência (PAI, período crítico de prevenção da interferência (PCPI e período total de prevenção da interferência (PTPI, considerando 5% de perdas. A partir das espécies encontradas na área experimental, avaliou-se também, em vasos, isoladamente ou em competição com o quiabeiro, a capacidade competitiva das principais plantas daninhas. Com base nos resultados, verificou-se que o PAI estimado foi de 25 DAE, indicando a época de início das capinas. Para o PCPI, o período observado foi de 75 dias, indicando PTPI de 100 DAE. Entre as plantas daninhas presentes, Eleusine indica apresentou maior capacidade competitiva sobre a cultura.An experiment was carried out under field conditions in Médio Vale do Rio Doce-MG, from May to October, 2007, to establish periods of weed interference in Abelmoschus esculentus crop. 'Santa Cruz-47' seeds were sown in a 0.25 x 1.0 m spacing, and weed control times varied from 0 to 120 days after emergence (DAE. Number of fruit per plant and yield as well as values in days

Staying green postharvest: how three mutations in the Arabidopsis chlorophyll b reductase gene NYC1 delay degreening by distinct mechanisms.

Science.gov (United States)

Jibran, Rubina; Sullivan, Kerry L; Crowhurst, Ross; Erridge, Zoe A; Chagné, David; McLachlan, Andrew R G; Brummell, David A; Dijkwel, Paul P; Hunter, Donald A

2015-11-01

Stresses such as energy deprivation, wounding and water-supply disruption often contribute to rapid deterioration of harvested tissues. To uncover the genetic regulation behind such stresses, a simple assessment system was used to detect senescence mutants in conjunction with two rapid mapping techniques to identify the causal mutations. To demonstrate the power of this approach, immature inflorescences of Arabidopsis plants that contained ethyl methanesulfonate-induced lesions were detached and screened for altered timing of dark-induced senescence. Numerous mutant lines displaying accelerated or delayed timing of senescence relative to wild type were discovered. The underlying mutations in three of these were identified using High Resolution Melting analysis to map to a chromosomal arm followed by a whole-genome sequencing-based mapping method, termed 'Needle in the K-Stack', to identify the causal lesions. All three mutations were single base pair changes and occurred in the same gene, NON-YELLOW COLORING1 (NYC1), a chlorophyll b reductase of the short-chain dehydrogenase/reductase (SDR) superfamily. This was consistent with the mutants preferentially retaining chlorophyll b, although substantial amounts of chlorophyll b were still lost. The single base pair mutations disrupted NYC1 function by three distinct mechanisms, one by producing a termination codon, the second by interfering with correct intron splicing and the third by replacing a highly conserved proline with a non-equivalent serine residue. This non-synonymous amino acid change, which occurred in the NADPH binding domain of NYC1, is the first example of such a mutation in an SDR protein inhibiting a physiological response in plants. © The Author 2015. Published by Oxford University Press on behalf of the Society for Experimental Biology. All rights reserved. For permissions, please email: journals.permissions@oup.com.

Weak interactions with nuclei

International Nuclear Information System (INIS)

Walecka, J.D.

1983-01-01

Nuclei provide systems where the strong, electomagnetic, and weak interactions are all present. The current picture of the strong interactions is based on quarks and quantum chromodynamics (QCD). The symmetry structure of this theory is SU(3)/sub C/ x SU(2)/sub W/ x U(1)/sub W/. The electroweak interactions in nuclei can be used to probe this structure. Semileptonic weak interactions are considered. The processes under consideration include beta decay, neutrino scattering and weak neutral-current interactions. The starting point in the analysis is the effective Lagrangian of the Standard Model

Bayesian Markov Chain Monte Carlo inversion for weak anisotropy parameters and fracture weaknesses using azimuthal elastic impedance

Science.gov (United States)

Chen, Huaizhen; Pan, Xinpeng; Ji, Yuxin; Zhang, Guangzhi

2017-08-01

A system of aligned vertical fractures and fine horizontal shale layers combine to form equivalent orthorhombic media. Weak anisotropy parameters and fracture weaknesses play an important role in the description of orthorhombic anisotropy (OA). We propose a novel approach of utilizing seismic reflection amplitudes to estimate weak anisotropy parameters and fracture weaknesses from observed seismic data, based on azimuthal elastic impedance (EI). We first propose perturbation in stiffness matrix in terms of weak anisotropy parameters and fracture weaknesses, and using the perturbation and scattering function, we derive PP-wave reflection coefficient and azimuthal EI for the case of an interface separating two OA media. Then we demonstrate an approach to first use a model constrained damped least-squares algorithm to estimate azimuthal EI from partially incidence-phase-angle-stack seismic reflection data at different azimuths, and then extract weak anisotropy parameters and fracture weaknesses from the estimated azimuthal EI using a Bayesian Markov Chain Monte Carlo inversion method. In addition, a new procedure to construct rock physics effective model is presented to estimate weak anisotropy parameters and fracture weaknesses from well log interpretation results (minerals and their volumes, porosity, saturation, fracture density, etc.). Tests on synthetic and real data indicate that unknown parameters including elastic properties (P- and S-wave impedances and density), weak anisotropy parameters and fracture weaknesses can be estimated stably in the case of seismic data containing a moderate noise, and our approach can make a reasonable estimation of anisotropy in a fractured shale reservoir.

A self-interfering clock as a "which path" witness.

Science.gov (United States)

Margalit, Yair; Zhou, Zhifan; Machluf, Shimon; Rohrlich, Daniel; Japha, Yonathan; Folman, Ron

2015-09-11

In Einstein's general theory of relativity, time depends locally on gravity; in standard quantum theory, time is global-all clocks "tick" uniformly. We demonstrate a new tool for investigating time in the overlap of these two theories: a self-interfering clock, comprising two atomic spin states. We prepare the clock in a spatial superposition of quantum wave packets, which evolve coherently along two paths into a stable interference pattern. If we make the clock wave packets "tick" at different rates, to simulate a gravitational time lag, the clock time along each path yields "which path" information, degrading the pattern's visibility. In contrast, in standard interferometry, time cannot yield "which path" information. This proof-of-principle experiment may have implications for the study of time and general relativity and their impact on fundamental effects such as decoherence and the emergence of a classical world. Copyright © 2015, American Association for the Advancement of Science.

Weak C* Hopf Symmetry

OpenAIRE

Rehren, K. -H.

1996-01-01

Weak C* Hopf algebras can act as global symmetries in low-dimensional quantum field theories, when braid group statistics prevents group symmetries. Possibilities to construct field algebras with weak C* Hopf symmetry from a given theory of local observables are discussed.

The CDC Hemophilia B mutation project mutation list: a new online resource.

Science.gov (United States)

Li, Tengguo; Miller, Connie H; Payne, Amanda B; Craig Hooper, W

2013-11-01

Hemophilia B (HB) is caused by mutations in the human gene F9. The mutation type plays a pivotal role in genetic counseling and prediction of inhibitor development. To help the HB community understand the molecular etiology of HB, we have developed a listing of all F9 mutations that are reported to cause HB based on the literature and existing databases. The Centers for Disease Control and Prevention (CDC) Hemophilia B Mutation Project (CHBMP) mutation list is compiled in an easily accessible format of Microsoft Excel and contains 1083 unique mutations that are reported to cause HB. Each mutation is identified using Human Genome Variation Society (HGVS) nomenclature standards. The mutation types and the predicted changes in amino acids, if applicable, are also provided. Related information including the location of mutation, severity of HB, the presence of inhibitor, and original publication reference are listed as well. Therefore, our mutation list provides an easily accessible resource for genetic counselors and HB researchers to predict inhibitors. The CHBMP mutation list is freely accessible at http://www.cdc.gov/hemophiliamutations.

Evolutionary dynamics on graphs: Efficient method for weak selection

Science.gov (United States)

Fu, Feng; Wang, Long; Nowak, Martin A.; Hauert, Christoph

2009-04-01

Investigating the evolutionary dynamics of game theoretical interactions in populations where individuals are arranged on a graph can be challenging in terms of computation time. Here, we propose an efficient method to study any type of game on arbitrary graph structures for weak selection. In this limit, evolutionary game dynamics represents a first-order correction to neutral evolution. Spatial correlations can be empirically determined under neutral evolution and provide the basis for formulating the game dynamics as a discrete Markov process by incorporating a detailed description of the microscopic dynamics based on the neutral correlations. This framework is then applied to one of the most intriguing questions in evolutionary biology: the evolution of cooperation. We demonstrate that the degree heterogeneity of a graph impedes cooperation and that the success of tit for tat depends not only on the number of rounds but also on the degree of the graph. Moreover, considering the mutation-selection equilibrium shows that the symmetry of the stationary distribution of states under weak selection is skewed in favor of defectors for larger selection strengths. In particular, degree heterogeneity—a prominent feature of scale-free networks—generally results in a more pronounced increase in the critical benefit-to-cost ratio required for evolution to favor cooperation as compared to regular graphs. This conclusion is corroborated by an analysis of the effects of population structures on the fixation probabilities of strategies in general 2×2 games for different types of graphs. Computer simulations confirm the predictive power of our method and illustrate the improved accuracy as compared to previous studies.

Efectos adversos del tratamiento con interferón alfa-2b humano recombinante y rivabirina en pacientes con hepatitis crónica C

OpenAIRE

Mulet Pérez, Agustín; Pullés Labadié, Menelio; Gámez Escalona, Martha; Mulet Gámez, Agustín; Díaz Santos, Oscar; Infante Velázquez, Mirtha

2011-01-01

INTRODUCCIÓN: el tratamiento de la hepatitis crónica C continúa siendo un reto. La combinación que mejores resultados ha demostrado, es la de interferón con ribavirina, pero puede originar efectos adversos con dificultades para la adherencia al tratamiento que en ocasiones, incluso, obligan a suspenderlo. OBJETIVO: identificar las reacciones adversas del tratamiento de la combinación de interferón con ribavirina. MÉTODOS: se realizó un estudio de una serie de 13 pacientes con hepatitis crónic...

A Bioinformatic Pipeline for Monitoring of the Mutational Stability of Viral Drug Targets with Deep-Sequencing Technology.

Science.gov (United States)

Kravatsky, Yuri; Chechetkin, Vladimir; Fedoseeva, Daria; Gorbacheva, Maria; Kravatskaya, Galina; Kretova, Olga; Tchurikov, Nickolai

2017-11-23

The efficient development of antiviral drugs, including efficient antiviral small interfering RNAs (siRNAs), requires continuous monitoring of the strict correspondence between a drug and the related highly variable viral DNA/RNA target(s). Deep sequencing is able to provide an assessment of both the general target conservation and the frequency of particular mutations in the different target sites. The aim of this study was to develop a reliable bioinformatic pipeline for the analysis of millions of short, deep sequencing reads corresponding to selected highly variable viral sequences that are drug target(s). The suggested bioinformatic pipeline combines the available programs and the ad hoc scripts based on an original algorithm of the search for the conserved targets in the deep sequencing data. We also present the statistical criteria for the threshold of reliable mutation detection and for the assessment of variations between corresponding data sets. These criteria are robust against the possible sequencing errors in the reads. As an example, the bioinformatic pipeline is applied to the study of the conservation of RNA interference (RNAi) targets in human immunodeficiency virus 1 (HIV-1) subtype A. The developed pipeline is freely available to download at the website http://virmut.eimb.ru/. Brief comments and comparisons between VirMut and other pipelines are also presented.

In silico analysis of conformational changes induced by mutation of aromatic binding residues: consequences for drug binding in the hERG K+ channel.

Directory of Open Access Journals (Sweden)

Kirsten Knape

Full Text Available Pharmacological inhibition of cardiac hERG K(+ channels is associated with increased risk of lethal arrhythmias. Many drugs reduce hERG current by directly binding to the channel, thereby blocking ion conduction. Mutation of two aromatic residues (F656 and Y652 substantially decreases the potency of numerous structurally diverse compounds. Nevertheless, some drugs are only weakly affected by mutation Y652A. In this study we utilize molecular dynamics simulations and docking studies to analyze the different effects of mutation Y652A on a selected number of hERG blockers. MD simulations reveal conformational changes in the binding site induced by mutation Y652A. Loss of π-π-stacking between the two aromatic residues induces a conformational change of the F656 side chain from a cavity facing to cavity lining orientation. Docking studies and MD simulations qualitatively reproduce the diverse experimentally observed modulatory effects of mutation Y652A and provide a new structural interpretation for the sensitivity differences.

Weak Solution and Weakly Uniformly Bounded Solution of Impulsive Heat Equations Containing “Maximum” Temperature

Directory of Open Access Journals (Sweden)

Oyelami, Benjamin Oyediran

2013-09-01

Full Text Available In this paper, criteria for the existence of weak solutions and uniformly weak bounded solution of impulsive heat equation containing maximum temperature are investigated and results obtained. An example is given for heat flow system with impulsive temperature using maximum temperature simulator and criteria for the uniformly weak bounded of solutions of the system are obtained.

Photodynamic antisense regulation of mRNA having a point mutation with psoralen-conjugated oligonucleotide.

Science.gov (United States)

Higuchi, Maiko; Yamayoshi, Asako; Kobori, Akio; Murakami, Akira

2008-01-01

Nucleic acid-based drugs, such as antisense oligonucleotide, ribozyme, and small interfering RNA, are specific compounds that inhibit gene expression at the post-transcriptional level. To develop more effective nucleic acid-based drugs, we focused on photo-reactive antisense oligonucleotides. We have optimized the structure of psoralen-conjugated oligonucleotide to improve their sequence selectivity and photo-crosslinking efficiency. Previously, we reported that photo reactive oligonucleotides containing 2'-O-psoralenyl-methoxyethyl adenosine (2'-Ps-eom) showed drastic photo-reactivity with a strictly sequence specific manner in vitro. In this report, we evaluated the binding ability toward intracellular target mRNA. The 2'-Ps-eom selectively photo-cross-linked to the target mRNA extracted from cells. The 2'-Ps-eom also cross-linked to target mRNA in cells. Furthermore, 2'-Ps-eom did not cross-link to mRNA having a mismatch base. These results suggest that 2'-Ps-eom is a powerful antisense molecule to inhibit the expression of mRNA having a point mutation.

Phenotypic silencing of cytoplasmic genes using sequence-specific double-stranded short interfering RNA and its application in the reverse genetics of wild type negative-strand RNA viruses

Directory of Open Access Journals (Sweden)

Barik Sailen

2001-12-01

Full Text Available Abstract Background Post-transcriptional gene silencing (PTGS by short interfering RNA has opened up new directions in the phenotypic mutation of cellular genes. However, its efficacy on non-nuclear genes and its effect on the interferon pathway remain unexplored. Since directed mutation of RNA genomes is not possible through conventional mutagenesis, we have tested sequence-specific 21-nucleotide long double-stranded RNAs (dsRNAs for their ability to silence cytoplasmic RNA genomes. Results Short dsRNAs were generated against specific mRNAs of respiratory syncytial virus, a nonsegmented negative-stranded RNA virus with a cytoplasmic life cycle. At nanomolar concentrations, the dsRNAs specifically abrogated expression of the corresponding viral proteins, and produced the expected mutant phenotype ex vivo. The dsRNAs did not induce an interferon response, and did not inhibit cellular gene expression. The ablation of the viral proteins correlated with the loss of the specific mRNAs. In contrast, viral genomic and antigenomic RNA, which are encapsidated, were not directly affected. Conclusions Synthetic inhibitory dsRNAs are effective in specific silencing of RNA genomes that are exclusively cytoplasmic and transcribed by RNA-dependent RNA polymerases. RNA-directed RNA gene silencing does not require cloning, expression, and mutagenesis of viral cDNA, and thus, will allow the generation of phenotypic null mutants of specific RNA viral genes under normal infection conditions and at any point in the infection cycle. This will, for the first time, permit functional genomic studies, attenuated infections, reverse genetic analysis, and studies of host-virus signaling pathways using a wild type RNA virus, unencumbered by any superinfecting virus.

R-matrix study of ionization in barium via two-photon interfering routes

International Nuclear Information System (INIS)

Aymar, M.; Luc-Koenig, E.; Lecomte, J. M.; Millet, M.; Lyras, A.

2000-01-01

A quantitative analysis of part of the experimental data reported by Wang, Chen and Elliott [1,3] who studied in barium coherent control through two-color resonant interfering paths is reported. Dynamics of the two-color photoionization process, described as an adiabatic process in the rotating wave approximation, is governed by the coherent excitation of the 6s6p and 6s7p 1 P 1 intermediate states. Interference effects are found to play a minor role. The required atomic parameters are obtained from a theoretical approach based on a combination of jj-coupled eigenchannel R-matrix and Multichannel Quantum Defect Theory

Determination of mutually interfering elements in activation analysis

International Nuclear Information System (INIS)

Figueiredo, A.M.G.

1979-01-01

The determination of the elements present in the groups scandium-zinc, mercury-selenium and arsenic-antimony-bromine represents a classical problem in thermal neutron activation analysis because the gamma-ray peaks of the radioisotopes produced from these elements by activation appear very close in the spectrum. A study is made of the possibility of simultaneous instrumental determination of these elements by means of the spectrum stripping technique, using a 400-channel analyser coupled to a Nal(Tl) detector and a 4096-channel analyser coupled to a Ge(Li) detector. Artificial mixtures of the interfering elements in varying proportions are prepared, so as to reproduce possible real samples, where the elements may be present at several concentrations. Radiochemical separation techniques for the cited elements are studied with the use of tracers. For the separation of scadium and zinc, the technique of extraction chromatography is applied. The separation of mercury and selenium is accomplished by means of ion exchange. The technique of coprecipitation is used to separate bromine from arsenic and antimony followed by ion exchange to isolate these two elements from each other. The precision and the accuracy of the results are discussed. (Author) [pt

New prognostic factor telomerase reverse transcriptase promotor mutation presents without MR imaging biomarkers in primary glioblastoma

Energy Technology Data Exchange (ETDEWEB)

Ersoy, Tunc F.; Simon, Matthias [University Hospital Bonn, Department of Neurosurgery and Stereotaxy, Bonn (Germany); Ev. Krankenhaus Bielefeld, Department of Neurosurgery, Bielefeld (Germany); Keil, Vera C.; Hadizadeh, Dariusch R.; Schild, Hans H. [University Hospital Bonn, Department of Radiology, Bonn (Germany); Gielen, Gerrit H.; Waha, Andreas [University Hospital Bonn, Institute of Neuropathology, Bonn (Germany); Fimmers, Rolf [IMBIE, University Hospital Bonn, Bonn (Germany); Heidenreich, Barbara; Kumar, Rajiv [DFKZ, Department of Molecular Genetic Epidemiology, Heidelberg (Germany)

2017-12-15

Magnetic resonance (MR) imaging biomarkers can assist in the non-invasive assessment of the genetic status in glioblastomas (GBMs). Telomerase reverse transcriptase (TERT) promoter mutations are associated with a negative prognosis. This study was performed to identify MR imaging biomarkers to forecast the TERT mutation status. Pre-operative MRIs of 64/67 genetically confirmed primary GBM patients (51/67 TERT-mutated with rs2853669 polymorphism) were analyzed according to Visually AcceSAble Rembrandt Images (VASARI) (https: //wiki.cancerimagingarchive.net/display/Public/VASARI+Research+Project) imaging criteria by three radiological raters. TERT mutation and O{sup 6}-methylguanine-DNA methyltransferase (MGMT) hypermethylation data were obtained through direct and pyrosequencing as described in a previous study. Clinical data were derived from a prospectively maintained electronic database. Associations of potential imaging biomarkers and genetic status were assessed by Fisher and Mann-Whitney U tests and stepwise linear regression. No imaging biomarkers could be identified to predict TERT mutational status (alone or in conjunction with TERT promoter polymorphism rs2853669 AA-allele). TERT promoter mutations were more common in patients with tumor-associated seizures as first symptom (26/30 vs. 25/37, p = 0.07); these showed significantly smaller tumors [13.1 (9.0-19.0) vs. 24.0 (16.6-37.5) all cm{sup 3}; p = 0.007] and prolonged median overall survival [17.0 (11.5-28.0) vs. 9.0 (4.0-12.0) all months; p = 0.02]. TERT-mutated GBMs were underrepresented in the extended angularis region (p = 0.03), whereas MGMT-methylated GBMs were overrepresented in the corpus callosum (p = 0.03) and underrepresented temporomesially (p = 0.01). Imaging biomarkers for prediction of TERT mutation status remain weak and cannot be derived from the VASARI protocol. Tumor-associated seizures are less common in TERT mutated glioblastomas. (orig.)

Mutations in the RNA-binding domains of tombusvirus replicase proteins affect RNA recombination in vivo

International Nuclear Information System (INIS)

Panaviene, Zivile; Nagy, Peter D.

2003-01-01

RNA recombination, which is thought to occur due to replicase errors during viral replication, is one of the major driving forces of virus evolution. In this article, we show evidence that the replicase proteins of Cucumber necrosis virus, a tombusvirus, are directly involved in RNA recombination in vivo. Mutations within the RNA-binding domains of the replicase proteins affected the frequency of recombination observed with a prototypical defective-interfering (DI) RNA, a model template for recombination studies. Five of the 17 replicase mutants tested showed delay in the formation of recombinants when compared to the wild-type helper virus. Interestingly, two replicase mutants accelerated recombinant formation and, in addition, these mutants also increased the level of subgenomic RNA synthesis (Virology 308 (2003), 191-205). A trans-complementation system was used to demonstrate that mutation in the p33 replicase protein resulted in altered recombination rate. Isolated recombinants were mostly imprecise (nonhomologous), with the recombination sites clustered around a replication enhancer region and a putative cis-acting element, respectively. These RNA elements might facilitate the proposed template switching events by the tombusvirus replicase. Together with data in the article cited above, results presented here firmly establish that the conserved RNA-binding motif of the replicase proteins is involved in RNA replication, subgenomic RNA synthesis, and RNA recombination

Weak hard X-ray emission from broad absorption line quasars: evidence for intrinsic X-ray weakness

International Nuclear Information System (INIS)

Luo, B.; Brandt, W. N.; Scott, A. E.; Alexander, D. M.; Gandhi, P.; Stern, D.; Teng, S. H.; Arévalo, P.; Bauer, F. E.; Boggs, S. E.; Craig, W. W.; Christensen, F. E.; Comastri, A.; Farrah, D.; Hailey, C. J.; Harrison, F. A.; Koss, M.; Ogle, P.; Puccetti, S.; Saez, C.

2014-01-01

We report NuSTAR observations of a sample of six X-ray weak broad absorption line (BAL) quasars. These targets, at z = 0.148-1.223, are among the optically brightest and most luminous BAL quasars known at z < 1.3. However, their rest-frame ≈2 keV luminosities are 14 to >330 times weaker than expected for typical quasars. Our results from a pilot NuSTAR study of two low-redshift BAL quasars, a Chandra stacking analysis of a sample of high-redshift BAL quasars, and a NuSTAR spectral analysis of the local BAL quasar Mrk 231 have already suggested the existence of intrinsically X-ray weak BAL quasars, i.e., quasars not emitting X-rays at the level expected from their optical/UV emission. The aim of the current program is to extend the search for such extraordinary objects. Three of the six new targets are weakly detected by NuSTAR with ≲ 45 counts in the 3-24 keV band, and the other three are not detected. The hard X-ray (8-24 keV) weakness observed by NuSTAR requires Compton-thick absorption if these objects have nominal underlying X-ray emission. However, a soft stacked effective photon index (Γ eff ≈ 1.8) for this sample disfavors Compton-thick absorption in general. The uniform hard X-ray weakness observed by NuSTAR for this and the pilot samples selected with <10 keV weakness also suggests that the X-ray weakness is intrinsic in at least some of the targets. We conclude that the NuSTAR observations have likely discovered a significant population (≳ 33%) of intrinsically X-ray weak objects among the BAL quasars with significantly weak <10 keV emission. We suggest that intrinsically X-ray weak quasars might be preferentially observed as BAL quasars.

A weak balance: the contribution of muscle weakness to postural instability and falls.

NARCIS (Netherlands)

Horlings, G.C.; Engelen, B.G.M. van; Allum, J.H.J.; Bloem, B.R.

2008-01-01

Muscle strength is a potentially important factor contributing to postural control. In this article, we consider the influence of muscle weakness on postural instability and falling. We searched the literature for research evaluating muscle weakness as a risk factor for falls in community-dwelling

Mutation in TWINKLE in a Large Iranian Family with Progressive External Ophthalmoplegia, Myopathy, Dysphagia and Dysphonia, and Behavior Change.

Science.gov (United States)

Tafakhori, Abbas; Yu Jin Ng, Alvin; Tohari, Sumanty; Venkatesh, Byrappa; Lee, Hane; Eskin, Ascia; Nelson, Stanley F; Bonnard, Carine; Reversade, Bruno; Kariminejad, Ariana

2016-02-01

TWINKLE (c10orf2) gene is responsible for autosomal dominant progressive external ophthalmoplegia (PEO). In rare cases, additional features such as muscle weakness, peripheral neuropathy, ataxia, cardiomyopathy, dysphagia, dysphonia, cataracts, depression, dementia, parkinsonism, and hearing loss have been reported in association with heterozygous mutations of the TWINKLE gene. We have studied a large Iranian family with myopathy, dysphonia, dysphagia, and behavior change in addition to PEO in affected members. We identified a missense mutation c.1121G > A in the c10orf2 gene in all affected members. Early death is a novel feature seen in affected members of this family that has not been reported to date. The association of PEO, myopathy, dysphonia, dysphagia, behavior change and early death has not been previously reported in the literature or other patients with this mutation.

siRNA-mediated Allele-specific Silencing of a COL6A3 Mutation in a Cellular Model of Dominant Ullrich Muscular Dystrophy

Directory of Open Access Journals (Sweden)

Véronique Bolduc

2014-01-01

Full Text Available Congenital muscular dystrophy type Ullrich (UCMD is a severe disorder of early childhood onset for which currently there is no effective treatment. UCMD commonly is caused by dominant-negative mutations in the genes coding for collagen type VI, a major microfibrillar component of the extracellular matrix surrounding the muscle fibers. To explore RNA interference (RNAi as a potential therapy for UCMD, we designed a series of small interfering RNA (siRNA oligos that specifically target the most common mutations resulting in skipping of exon 16 in the COL6A3 gene and tested them in UCMD-derived dermal fibroblasts. Transcript analysis by semiquantitative and quantitative reverse transcriptase PCR showed that two of these siRNAs were the most allele-specific, i.e., they efficiently knocked down the expression from the mutant allele, without affecting the normal allele. In HEK293T cells, these siRNAs selectively suppressed protein expression from a reporter construct carrying the mutation, with no or minimal suppression of the wild-type (WT construct, suggesting that collagen VI protein levels are as also reduced in an allele-specific manner. Furthermore, we found that treating UCMD fibroblasts with these siRNAs considerably improved the quantity and quality of the collagen VI matrix, as assessed by confocal microscopy. Our current study establishes RNAi as a promising molecular approach for treating dominant COL6-related dystrophies.

Charged weak currents

International Nuclear Information System (INIS)

Turlay, R.

1979-01-01

In this review of charged weak currents I shall concentrate on inclusive high energy neutrino physics. There are surely still things to learn from the low energy weak interaction but I will not discuss it here. Furthermore B. Tallini will discuss the hadronic final state of neutrino interactions. Since the Tokyo conference a few experimental results have appeared on charged current interaction, I will present them and will also comment on important topics which have been published during the last past year. (orig.)

Weak-interacting holographic QCD

International Nuclear Information System (INIS)

Gazit, D.; Yee, H.-U.

2008-06-01

We propose a simple prescription for including low-energy weak-interactions into the frame- work of holographic QCD, based on the standard AdS/CFT dictionary of double-trace deformations. As our proposal enables us to calculate various electro-weak observables involving strongly coupled QCD, it opens a new perspective on phenomenological applications of holographic QCD. We illustrate efficiency and usefulness of our method by performing a few exemplar calculations; neutron beta decay, charged pion weak decay, and meson-nucleon parity non-conserving (PNC) couplings. The idea is general enough to be implemented in both Sakai-Sugimoto as well as Hard/Soft Wall models. (author)

Second class weak currents

International Nuclear Information System (INIS)

Delorme, J.

1978-01-01

The definition and general properties of weak second class currents are recalled and various detection possibilities briefly reviewed. It is shown that the existing data on nuclear beta decay can be consistently analysed in terms of a phenomenological model. Their implication on the fundamental structure of weak interactions is discussed [fr

Mild myopathy is associated with COMP but not MATN3 mutations in mouse models of genetic skeletal diseases.

Directory of Open Access Journals (Sweden)

Katarzyna A Piróg

Full Text Available Pseudoachondroplasia (PSACH and multiple epiphyseal dysplasia (MED are skeletal disorders resulting from mutations in COMP, matrilin-3 or collagen IX and are characterised by short-limbed dwarfism and premature osteoarthritis. Interestingly, recent reports suggest patients can also manifest with muscle weakness. Here we present a detailed analysis of two mouse models of the PSACH/MED disease spectrum; ΔD469 T3-COMP (PSACH and V194D matrilin-3 (MED. In grip test experiments T3-COMP mice were weaker than wild-type littermates, whereas V194D mice behaved as controls, confirming that short-limbed dwarfism alone does not contribute to PSACH/MED-related muscle weakness. Muscles from T3-COMP mice showed an increase in centronuclear fibers at the myotendinous junction. T3-COMP tendons became more lax in cyclic testing and showed thicker collagen fibers when compared with wild-type tissue; matrilin-3 mutant tissues were indistinguishable from controls. This comprehensive study of the myopathy associated with PSACH/MED mutations enables a better understanding of the disease progression, confirms that it is genotype specific and that the limb weakness originates from muscle and tendon pathology rather than short-limbed dwarfism itself. Since some patients are primarily diagnosed with neuromuscular symptoms, this study will facilitate better awareness of the differential diagnoses that might be associated with the PSACH/MED spectrum and subsequent care of PSACH/MED patients.

Frequency and phenotype of patients carrying TPM2 and TPM3 gene mutations in a cohort of 94 patients with congenital myopathy

DEFF Research Database (Denmark)

Citirak, Gülsenay; Witting, Nanna; Duno, Morten

2014-01-01

, two related female patients and two sporadic, male patients were found to carry mutations in the tropomyosin 2 (TPM2) and tropomyosin 3 (TPM3) genes, respectively. This indicates a low (4.3%) frequency of TPM2 and TPM3 mutations as a cause of congenital myopathy. Compared to previously described...... patients carrying the same mutations as found in our study (c.503G>A, and c.502C>T in TPM3, and c.415_417delGAG in TPM2), clinical presentation and muscle morphological findings differed in our patients. Differences included variation in distribution of muscle weakness, presence of scoliosis and ptosis...... had nemaline myopathy and fiber size disproportion, while three patients had congenital fiber type disproportion (CFTD) on muscle biopsies. TPM2-related CFTD has only been described in two cases, indicating that mutations in TPM2 are rare causes of CFTD....

Standard and Null Weak Values

OpenAIRE

Zilberberg, Oded; Romito, Alessandro; Gefen, Yuval

2013-01-01

Weak value (WV) is a quantum mechanical measurement protocol, proposed by Aharonov, Albert, and Vaidman. It consists of a weak measurement, which is weighed in, conditional on the outcome of a later, strong measurement. Here we define another two-step measurement protocol, null weak value (NVW), and point out its advantages as compared to WV. We present two alternative derivations of NWVs and compare them to the corresponding derivations of WVs.

Clinical and neuropathological features of ALS/FTD with TIA1 mutations.

Science.gov (United States)

Hirsch-Reinshagen, Veronica; Pottier, Cyril; Nicholson, Alexandra M; Baker, Matt; Hsiung, Ging-Yuek R; Krieger, Charles; Sengdy, Pheth; Boylan, Kevin B; Dickson, Dennis W; Mesulam, Marsel; Weintraub, Sandra; Bigio, Eileen; Zinman, Lorne; Keith, Julia; Rogaeva, Ekaterina; Zivkovic, Sasha A; Lacomis, David; Taylor, J Paul; Rademakers, Rosa; Mackenzie, Ian R A

2017-12-07

Mutations in the stress granule protein T-cell restricted intracellular antigen 1 (TIA1) were recently shown to cause amyotrophic lateral sclerosis (ALS) with or without frontotemporal dementia (FTD). Here, we provide detailed clinical and neuropathological descriptions of nine cases with TIA1 mutations, together with comparisons to sporadic ALS (sALS) and ALS due to repeat expansions in C9orf72 (C9orf72+). All nine patients with confirmed mutations in TIA1 were female. The clinical phenotype was heterogeneous with a range in the age at onset from late twenties to the eighth decade (mean = 60 years) and disease duration from one to 6 years (mean = 3 years). Initial presentation was either focal weakness or language impairment. All affected individuals received a final diagnosis of ALS with or without FTD. No psychosis or parkinsonism was described. Neuropathological examination on five patients found typical features of ALS and frontotemporal lobar degeneration (FTLD-TDP, type B) with anatomically widespread TDP-43 proteinopathy. In contrast to C9orf72+ cases, caudate atrophy and hippocampal sclerosis were not prominent. Detailed evaluation of the pyramidal motor system found a similar degree of neurodegeneration and TDP-43 pathology as in sALS and C9orf72+ cases; however, cases with TIA1 mutations had increased numbers of lower motor neurons containing round eosinophilic and Lewy body-like inclusions on HE stain and round compact cytoplasmic inclusions with TDP-43 immunohistochemistry. Immunohistochemistry and immunofluorescence failed to demonstrate any labeling of inclusions with antibodies against TIA1. In summary, our TIA1 mutation carriers developed ALS with or without FTD, with a wide range in age at onset, but without other neurological or psychiatric features. The neuropathology was characterized by widespread TDP-43 pathology, but a more restricted pattern of neurodegeneration than C9orf72+ cases. Increased numbers of round eosinophilic and Lewy

Weak interactions

International Nuclear Information System (INIS)

Chanda, R.

1981-01-01

The theoretical and experimental evidences to form a basis for Lagrangian Quantum field theory for Weak Interactions are discussed. In this context, gauge invariance aspects of such interactions are showed. (L.C.) [pt

CHARGE syndrome: a recurrent hotspot of mutations in CHD7 IVS25 analyzed by bioinformatic tools and minigene assays.

Science.gov (United States)

Legendre, Marine; Rodriguez-Ballesteros, Montserrat; Rossi, Massimiliano; Abadie, Véronique; Amiel, Jeanne; Revencu, Nicole; Blanchet, Patricia; Brioude, Frédéric; Delrue, Marie-Ange; Doubaj, Yassamine; Sefiani, Abdelaziz; Francannet, Christine; Holder-Espinasse, Muriel; Jouk, Pierre-Simon; Julia, Sophie; Melki, Judith; Mur, Sébastien; Naudion, Sophie; Fabre-Teste, Jennifer; Busa, Tiffany; Stamm, Stephen; Lyonnet, Stanislas; Attie-Bitach, Tania; Kitzis, Alain; Gilbert-Dussardier, Brigitte; Bilan, Frédéric

2018-02-01

CHARGE syndrome is a rare genetic disorder mainly due to de novo and private truncating mutations of CHD7 gene. Here we report an intriguing hot spot of intronic mutations (c.5405-7G > A, c.5405-13G > A, c.5405-17G > A and c.5405-18C > A) located in CHD7 IVS25. Combining computational in silico analysis, experimental branch-point determination and in vitro minigene assays, our study explains this mutation hot spot by a particular genomic context, including the weakness of the IVS25 natural acceptor-site and an unconventional lariat sequence localized outside the common 40 bp upstream the acceptor splice site. For each of the mutations reported here, bioinformatic tools indicated a newly created 3' splice site, of which the existence was confirmed using pSpliceExpress, an easy-to-use and reliable splicing reporter tool. Our study emphasizes the idea that combining these two complementary approaches could increase the efficiency of routine molecular diagnosis.

Cosmology with weak lensing surveys

International Nuclear Information System (INIS)

Munshi, Dipak; Valageas, Patrick; Waerbeke, Ludovic van; Heavens, Alan

2008-01-01

Weak gravitational lensing is responsible for the shearing and magnification of the images of high-redshift sources due to the presence of intervening matter. The distortions are due to fluctuations in the gravitational potential, and are directly related to the distribution of matter and to the geometry and dynamics of the Universe. As a consequence, weak gravitational lensing offers unique possibilities for probing the Dark Matter and Dark Energy in the Universe. In this review, we summarise the theoretical and observational state of the subject, focussing on the statistical aspects of weak lensing, and consider the prospects for weak lensing surveys in the future. Weak gravitational lensing surveys are complementary to both galaxy surveys and cosmic microwave background (CMB) observations as they probe the unbiased non-linear matter power spectrum at modest redshifts. Most of the cosmological parameters are accurately estimated from CMB and large-scale galaxy surveys, so the focus of attention is shifting to understanding the nature of Dark Matter and Dark Energy. On the theoretical side, recent advances in the use of 3D information of the sources from photometric redshifts promise greater statistical power, and these are further enhanced by the use of statistics beyond two-point quantities such as the power spectrum. The use of 3D information also alleviates difficulties arising from physical effects such as the intrinsic alignment of galaxies, which can mimic weak lensing to some extent. On the observational side, in the next few years weak lensing surveys such as CFHTLS, VST-KIDS and Pan-STARRS, and the planned Dark Energy Survey, will provide the first weak lensing surveys covering very large sky areas and depth. In the long run even more ambitious programmes such as DUNE, the Supernova Anisotropy Probe (SNAP) and Large-aperture Synoptic Survey Telescope (LSST) are planned. Weak lensing of diffuse components such as the CMB and 21 cm emission can also

Cosmology with weak lensing surveys

Energy Technology Data Exchange (ETDEWEB)

Munshi, Dipak [Institute of Astronomy, Madingley Road, Cambridge, CB3 OHA (United Kingdom); Astrophysics Group, Cavendish Laboratory, Madingley Road, Cambridge CB3 OHE (United Kingdom)], E-mail: munshi@ast.cam.ac.uk; Valageas, Patrick [Service de Physique Theorique, CEA Saclay, 91191 Gif-sur-Yvette (France); Waerbeke, Ludovic van [University of British Columbia, Department of Physics and Astronomy, 6224 Agricultural Road, Vancouver, BC V6T 1Z1 (Canada); Heavens, Alan [SUPA - Scottish Universities Physics Alliance, Institute for Astronomy, University of Edinburgh, Blackford Hill, Edinburgh EH9 3HJ (United Kingdom)

2008-06-15

Weak gravitational lensing is responsible for the shearing and magnification of the images of high-redshift sources due to the presence of intervening matter. The distortions are due to fluctuations in the gravitational potential, and are directly related to the distribution of matter and to the geometry and dynamics of the Universe. As a consequence, weak gravitational lensing offers unique possibilities for probing the Dark Matter and Dark Energy in the Universe. In this review, we summarise the theoretical and observational state of the subject, focussing on the statistical aspects of weak lensing, and consider the prospects for weak lensing surveys in the future. Weak gravitational lensing surveys are complementary to both galaxy surveys and cosmic microwave background (CMB) observations as they probe the unbiased non-linear matter power spectrum at modest redshifts. Most of the cosmological parameters are accurately estimated from CMB and large-scale galaxy surveys, so the focus of attention is shifting to understanding the nature of Dark Matter and Dark Energy. On the theoretical side, recent advances in the use of 3D information of the sources from photometric redshifts promise greater statistical power, and these are further enhanced by the use of statistics beyond two-point quantities such as the power spectrum. The use of 3D information also alleviates difficulties arising from physical effects such as the intrinsic alignment of galaxies, which can mimic weak lensing to some extent. On the observational side, in the next few years weak lensing surveys such as CFHTLS, VST-KIDS and Pan-STARRS, and the planned Dark Energy Survey, will provide the first weak lensing surveys covering very large sky areas and depth. In the long run even more ambitious programmes such as DUNE, the Supernova Anisotropy Probe (SNAP) and Large-aperture Synoptic Survey Telescope (LSST) are planned. Weak lensing of diffuse components such as the CMB and 21 cm emission can also

ROW (Right-of-Way) interfering construction activities management program

Energy Technology Data Exchange (ETDEWEB)

Rosito, Roberta; Oliveira, Marisa; Lima, Shirley [TRANSPETRO - PETROBRAS Transporte S.A., Rio de Janeiro, RJ (Brazil)

2009-07-01

A significant portion of pipeline failures occurs due to external damage. This includes third party right of way (ROW) encroachment, which shall be identified and avoided. However, injuries caused by known and planned activities do happen. Construction of crossing or sharing ROW pipelines, crossing roads and bridges, neighboring buildings and excavations of any kind might put existing pipelines in risk. This paper presents how the TRANSPETRO ROW Interfering Construction Activities Management Program is implemented by a regional ROW maintenance department responsible for more than 3,000 km of pipelines, mostly in Rio de Janeiro and Minas Gerais states. This program is based on a TRANSPETRO procedure that was written after the publication of the Official Order number 125 of ANP (Oil, Gas and Biofuel Brazilian National Agency). Tasks from design review and approval to field construction supervision are performed by the staff responsible for the routine patrols and maintenance management. The ability of foreseeing risky activities is improved by expertise gained from day-to-day work on site. (author)

Mutations in new cell cycle genes that fail to complement a multiply mutant third chromosome of Drosophila.

Science.gov (United States)

White-Cooper, H; Carmena, M; Gonzalez, C; Glover, D M

1996-11-01

We have simultaneously screened for new alleles and second site mutations that fail to complement five cell cycle mutations of Drosphila carried on a single third chromosome (gnu, polo, mgr, asp, stg). Females that are either transheterozygous for scott of the antartic (scant) and polo, or homozygous for scant produce embryos that show mitotic defects. A maternal effect upon embryonic mitoses is also seen in embryos derived from females transheterozygous with helter skelter (hsk) and either mgr or asp. cleopatra (cleo), fails to complement asp but is not uncovered by a deficiency for asp. The mitotic phenotype of larvae heterozygous for cleo and the multiple mutant chromosome is similar to weak alleles of asp, but there are no defects in male meiosis. Mutations that failed to complement stg fell into two complementation groups corresponding to stg and a new gene noose. Three of the new stg alleles are early zygotic lethals, whereas the fourth is a pharate adult lethal allele that affects both mitosis and meiosis. Mutations in noose fully complement a small deficiency that removes stg, but when placed in trans to certain stg alleles, result in late lethality and mitotic abnormalities in larval brains.

Synergistic interaction of gamma rays and some metallic salts in the induction of chlorophyll mutations in rice

International Nuclear Information System (INIS)

Reddy, T.P.; Vaidyanath, K.

1978-01-01

In this study the mutagenic activity of 9 metallic salts was tested in comparison and conjunction with gamma rays on rice seed. In M 2 , barium and cadmium produced chlorophyll mutation and mutant frequencies on a par with those of 20 kR gamma rays. Similarly, copper and mercury induced moderately high mutation and mutant frequencies. Salts of strontium, iron and lead showed rather weak mutagenic effects. On the other hand, two metals - manganese anc calcium - failed to provoke chlorophyll mutations in rice seed. Sequential treatments of gamma rays + 5 metals, namely Sr, Cd, Hg, Pb and Cu, produced synergistic yields of chlorophyll mutants in the M 2 generation. Two genetically active metals, Ba and Fe, showed less than additive effects when post-treated after gamma irradiation. Manganese, which failed to induce chlorophyll mutations in independent treatment, potentiated the mutagenic activity of gamma radiation in sequential treatment. On the other hand, sequential treatment with calcium seemed to confer a substantial protection against gamma-ray-induced genetic lesions. The probable mechanisms of synergistic interaction, mutagenic potentiation and protection, observed in sequential treatments, are discussed. (Auth.)

Two narrow bandwidth photons interfering in an electromagnetically induced transparency (EIT) system

International Nuclear Information System (INIS)

Wang Fuyuan; Shi Baosen; Lu Xiaosong; Guo Guangcan

2008-01-01

In this paper, we have analysed in detail the quantum interference of the degenerate narrowband two-photon state by using a Mach–Zehnder interferometer, in which an electromagnetically induced transparency (EIT) medium is placed in one of two interfering beams. Our results clearly show that it is possible to coherently keep the quantum state at a single photon level in the EIT process, especially when the transparent window of the EIT medium is much larger than the bandwidth of the single photon. This shows that the EIT medium is possibly a kind of memory or repeater for the narrowband photons in the areas of quantum communication and quantum computer. This kind of experiment is feasible within the current technology

Spectrum of mutations in homozygous familial hypercholesterolemia in India, with four novel mutations.

Science.gov (United States)

Setia, Nitika; Saxena, Renu; Arora, Anjali; Verma, Ishwar C

2016-12-01

Homozygous familial hypercholesterolemia (FH) is a rare but serious, inherited disorder of lipid metabolism characterized by very high total and LDL cholesterol levels from birth. It presents as cutaneous and tendon xanthomas since childhood, with or without cardiac involvement. FH is commonly caused by mutations in three genes, i.e. LDL receptor (LDLR), apolipoprotein B (ApoB) and PCSK9. We aimed to determine the spectrum of mutations in cases of homozygous FH in Asian Indians and evaluate if there was any similarity to the mutations observed in Caucasians. Sixteen homozygous FH subjects from eleven families were analyzed for mutations by Sanger sequencing. Large rearrangements in LDLR gene were evaluated by multiplex ligation probe dependent amplification (MLPA) technique. Ten mutations were observed in LDLR gene, of which four mutations were novel. No mutation was detected in ApoB gene and common PCSK9 mutation (p.D374Y). Fourteen cases had homozygous mutations; one had compound heterozygous mutation, while no mutation was detected in one clinically homozygous case. We report an interesting "Triple hit" case with features of homozygous FH. The spectrum of mutations in the Asian Indian population is quite heterogeneous. Of the mutations identified, 40% were novel. No mutation was observed in exons 3, 9 and 14 of LDLR gene, which are considered to be hot spots in studies done on Asian Indians in South Africa. Early detection followed by aggressive therapy, and cascade screening of extended families has been initiated to reduce the morbidity and mortality in these patients. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

Feasibility of isotachochromatography as a method for the preparative separation of weak acids and weak bases. I. Theoretical considerations

NARCIS (Netherlands)

Kooistra, C.; Sluyterman, L.A.A.E.

1988-01-01

The fundamental equation of isotachochromatography, i.e., isotachophoresis translated into ion-exchange chromatography, has been derived for weak acids and weak bases. Weak acids are separated on strong cation exchangers and weak bases on strong anion exchangers. According to theory, the elution

RAC1 Missense Mutations in Developmental Disorders with Diverse Phenotypes.

Science.gov (United States)

Reijnders, Margot R F; Ansor, Nurhuda M; Kousi, Maria; Yue, Wyatt W; Tan, Perciliz L; Clarkson, Katie; Clayton-Smith, Jill; Corning, Ken; Jones, Julie R; Lam, Wayne W K; Mancini, Grazia M S; Marcelis, Carlo; Mohammed, Shehla; Pfundt, Rolph; Roifman, Maian; Cohn, Ronald; Chitayat, David; Millard, Tom H; Katsanis, Nicholas; Brunner, Han G; Banka, Siddharth

2017-09-07

RAC1 is a widely studied Rho GTPase, a class of molecules that modulate numerous cellular functions essential for normal development. RAC1 is highly conserved across species and is under strict mutational constraint. We report seven individuals with distinct de novo missense RAC1 mutations and varying degrees of developmental delay, brain malformations, and additional phenotypes. Four individuals, each harboring one of c.53G>A (p.Cys18Tyr), c.116A>G (p.Asn39Ser), c.218C>T (p.Pro73Leu), and c.470G>A (p.Cys157Tyr) variants, were microcephalic, with head circumferences between -2.5 to -5 SD. In contrast, two individuals with c.151G>A (p.Val51Met) and c.151G>C (p.Val51Leu) alleles were macrocephalic with head circumferences of +4.16 and +4.5 SD. One individual harboring a c.190T>G (p.Tyr64Asp) allele had head circumference in the normal range. Collectively, we observed an extraordinary spread of ∼10 SD of head circumferences orchestrated by distinct mutations in the same gene. In silico modeling, mouse fibroblasts spreading assays, and in vivo overexpression assays using zebrafish as a surrogate model demonstrated that the p.Cys18Tyr and p.Asn39Ser RAC1 variants function as dominant-negative alleles and result in microcephaly, reduced neuronal proliferation, and cerebellar abnormalities in vivo. Conversely, the p.Tyr64Asp substitution is constitutively active. The remaining mutations are probably weakly dominant negative or their effects are context dependent. These findings highlight the importance of RAC1 in neuronal development. Along with TRIO and HACE1, a sub-category of rare developmental disorders is emerging with RAC1 as the central player. We show that ultra-rare disorders caused by private, non-recurrent missense mutations that result in varying phenotypes are challenging to dissect, but can be delineated through focused international collaboration. Copyright © 2017 American Society of Human Genetics. Published by Elsevier Inc. All rights reserved.

Association of Early-Onset Spasticity and Risk for Cognitive Impairment With Mutations at Amino Acid 499 in SPAST.

Science.gov (United States)

Gillespie, Meredith K; Humphreys, Peter; McMillan, Hugh J; Boycott, Kym M

2018-04-01

Hereditary spastic paraplegia is a phenotypically and genetically heterogeneous group of neurodegenerative disorders characterized by lower extremity weakness and spasticity. Spastic paraplegia 4 (SPG4), caused by heterozygous mutations in the gene SPAST, typically causes a late-onset, uncomplicated form of hereditary spastic paraplegia in affected individuals. Additional clinical features in SPG4 have been reported on occasion, but no genotype-phenotype correlation has been established. Through targeted clinical testing, we identified 2 unrelated female patients with the same de novo p.Arg499His mutation in SPAST. Both patients presented with early-onset spasticity resulting in delayed motor milestones, which led to a diagnosis of cerebral palsy in one child and tethered cord in the other. Review of the literature identified several patients with mutations at amino acid 499 and early-onset symptoms associated with a risk of cognitive impairment. Early and accurate diagnosis of children with early-onset spasticity is important for informed prognosis and genetic counselling.

A Taiwanese Boy With Congenital Generalized Lipodystrophy Caused by Homozygous Ile262fs Mutation in the BSCL2 Gene

Directory of Open Access Journals (Sweden)

Hsiu-Hui Huang

2010-11-01

Full Text Available Congenital generalized lipodystrophy (CGL is a rare autosomal recessive disease that is characterized by a near-complete absence of adipose tissue from birth or early infancy. Mutations in the BSCL2 gene are known to result in CGL2, a more severe phenotype than CGL1, with earlier onset, more extensive fat loss and biochemical changes, more severe intellectual impairment, and more severe cardiomyopathy. We report a 3-month-old Taiwanese boy with initial presentation of a lack of subcutaneous fat, prominent musculature, generalized eruptive xanthomas, and extreme hypertriglyceridemia. Absence of mechanical adipose tissue in the orbits and scalp was revealed by head magnetic resonance imaging. Hepatomegaly was noticed, and histological examination of a liver biopsy specimen suggested severe hepatic steatosis and periportal necrosis. However, echocardiography indicated no sign of cardiomyopathy and he showed no distinct intellectual impairment that interfered with daily life. About 1 year later, abdominal computed tomography revealed enlargement of kidneys. He had a homozygous insertion of a nucleotide, 783insG (Ile262fs mutation, in exon 7 of the BSCL2 gene. We reviewed the genotype of CGL cases from Japan, India, China and Taiwan, and found that BSCL2 is a major causative gene for CGL in Asian.

Riemann Geometric Color-Weak Compensationfor Individual Observers

OpenAIRE

Kojima, Takanori; Mochizuki, Rika; Lenz, Reiner; Chao, Jinhui

2014-01-01

We extend a method for color weak compensation based on the criterion of preservation of subjective color differences between color normal and color weak observers presented in [2]. We introduce a new algorithm for color weak compensation using local affine maps between color spaces of color normal and color weak observers. We show howto estimate the local affine map and how to determine correspondences between the origins of local coordinates in color spaces of color normal and color weak ob...

Spastic paraplegia and OXPHOS impairment caused by mutations in paraplegin, a nuclear-encoded mitochondrial metalloprotease.

Science.gov (United States)

Casari, G; De Fusco, M; Ciarmatori, S; Zeviani, M; Mora, M; Fernandez, P; De Michele, G; Filla, A; Cocozza, S; Marconi, R; Dürr, A; Fontaine, B; Ballabio, A

1998-06-12

Hereditary spastic paraplegia (HSP) is characterized by progressive weakness and spasticity of the lower limbs due to degeneration of corticospinal axons. We found that patients from a chromosome 16q24.3-linked HSP family are homozygous for a 9.5 kb deletion involving a gene encoding a novel protein, named Paraplegin. Two additional Paraplegin mutations, both resulting in a frameshift, were found in a complicated and in a pure form of HSP. Paraplegin is highly homologous to the yeast mitochondrial ATPases, AFG3, RCA1, and YME1, which have both proteolytic and chaperon-like activities at the inner mitochondrial membrane. Immunofluorescence analysis and import experiments showed that Paraplegin localizes to mitochondria. Analysis of muscle biopsies from two patients carrying Paraplegin mutations showed typical signs of mitochondrial OXPHOS defects, thus suggesting a mechanism for neurodegeneration in HSP-type disorders.

PAR-2 activation enhances weak acid-induced ATP release through TRPV1 and ASIC sensitization in human esophageal epithelial cells.

Science.gov (United States)

Wu, Liping; Oshima, Tadayuki; Shan, Jing; Sei, Hiroo; Tomita, Toshihiko; Ohda, Yoshio; Fukui, Hirokazu; Watari, Jiro; Miwa, Hiroto

2015-10-15

Esophageal visceral hypersensitivity has been proposed to be the pathogenesis of heartburn sensation in nonerosive reflux disease. Protease-activated receptor-2 (PAR-2) is expressed in human esophageal epithelial cells and is believed to play a role in inflammation and sensation. PAR-2 activation may modulate these responses through adenosine triphosphate (ATP) release, which is involved in transduction of sensation and pain. The transient receptor potential vanilloid receptor 1 (TRPV1) and acid-sensing ion channels (ASICs) are both acid-sensitive nociceptors. However, the interaction among these molecules and the mechanisms of heartburn sensation are still not clear. We therefore examined whether ATP release in human esophageal epithelial cells in response to acid is modulated by TRPV1 and ASICs and whether PAR-2 activation influences the sensitivity of TRPV1 and ASICs. Weak acid (pH 5) stimulated the release of ATP from primary human esophageal epithelial cells (HEECs). This effect was significantly reduced after pretreatment with 5-iodoresiniferatoxin (IRTX), a TRPV1-specific antagonist, or with amiloride, a nonselective ASIC blocker. TRPV1 and ASIC3 small interfering RNA (siRNA) transfection also decreased weak acid-induced ATP release. Pretreatment of HEECs with trypsin, tryptase, or a PAR-2 agonist enhanced weak acid-induced ATP release. Trypsin treatment led to the phosphorylation of TRPV1. Acid-induced ATP release enhancement by trypsin was partially blocked by IRTX, amiloride, or a PAR-2 antagonist. Conversely, acid-induced ATP release was augmented by PAR-2 activation through TRPV1 and ASICs. These findings suggested that the pathophysiology of heartburn sensation or esophageal hypersensitivity may be associated with the activation of PAR-2, TRPV1, and ASICs. Copyright © 2015 the American Physiological Society.

Characterization of a mutation commonly associated with persistent stuttering: evidence for a founder mutation

Science.gov (United States)

Fedyna, Alison; Drayna, Dennis; Kang, Changsoo

2010-01-01

Stuttering is a disorder which affects the fluency of speech. It has been shown to have high heritability, and has recently been linked to mutations in the GNPTAB gene. One such mutation, Glu1200Lys, has been repeatedly observed in unrelated families and individual cases. Eight unrelated individuals carrying this mutation were analyzed in an effort to distinguish whether these arise from repeated mutation at the same site, or whether they represent a founder mutation with a single origin. Results show that all 12 chromosomes carrying this mutation share a common haplotype in this region, indicating it is a founder mutation. Further analysis estimated the age of this allele to be ~572 generations. Construction of a cladogram tracing the mutation through our study sample also supports the founder mutation hypothesis. PMID:20944643

Weak boson emission in hadron collider processes

International Nuclear Information System (INIS)

Baur, U.

2007-01-01

The O(α) virtual weak radiative corrections to many hadron collider processes are known to become large and negative at high energies, due to the appearance of Sudakov-like logarithms. At the same order in perturbation theory, weak boson emission diagrams contribute. Since the W and Z bosons are massive, the O(α) virtual weak radiative corrections and the contributions from weak boson emission are separately finite. Thus, unlike in QED or QCD calculations, there is no technical reason for including gauge boson emission diagrams in calculations of electroweak radiative corrections. In most calculations of the O(α) electroweak radiative corrections, weak boson emission diagrams are therefore not taken into account. Another reason for not including these diagrams is that they lead to final states which differ from that of the original process. However, in experiment, one usually considers partially inclusive final states. Weak boson emission diagrams thus should be included in calculations of electroweak radiative corrections. In this paper, I examine the role of weak boson emission in those processes at the Fermilab Tevatron and the CERN LHC for which the one-loop electroweak radiative corrections are known to become large at high energies (inclusive jet, isolated photon, Z+1 jet, Drell-Yan, di-boson, tt, and single top production). In general, I find that the cross section for weak boson emission is substantial at high energies and that weak boson emission and the O(α) virtual weak radiative corrections partially cancel

Autosomal dominant distal myopathy due to a novel ACTA1 mutation.

Science.gov (United States)

Liewluck, Teerin; Sorenson, Eric J; Walkiewicz, Magdalena A; Rumilla, Kandelaria M; Milone, Margherita

2017-08-01

Mutations in skeletal muscle α-actin 1-encoding gene (ACTA1) cause autosomal dominant or recessive myopathies with marked clinical and pathological heterogeneity. Patients typically develop generalized or limb-girdle pattern of weakness, but recently a family with scapuloperoneal myopathy was reported. We describe a father and 2 children with childhood-to-juvenile onset distal myopathy, carrying a novel dominant ACTA1 variant, c.757G>C (p.Gly253Arg). Father had delayed motor development and developed significant proximal weakness later in life; he was initially misdiagnosed as having spinal muscular atrophy based on electromyographic findings. His children had predominant anterior distal leg and finger extensor involvement. Nemaline rods were abundant on the daughter's biopsy, absent on the father's initial biopsy, and extremely rare on the father's subsequent biopsy a decade later. The father's second biopsy also showed myofibrillar pathology and rare fibers with actin filament aggregates. The present family expands the spectrum of actinopathy to include a distal myopathy. Copyright © 2017 Elsevier B.V. All rights reserved.

A Bioinformatic Pipeline for Monitoring of the Mutational Stability of Viral Drug Targets with Deep-Sequencing Technology

Directory of Open Access Journals (Sweden)

Yuri Kravatsky

2017-11-01

Full Text Available The efficient development of antiviral drugs, including efficient antiviral small interfering RNAs (siRNAs, requires continuous monitoring of the strict correspondence between a drug and the related highly variable viral DNA/RNA target(s. Deep sequencing is able to provide an assessment of both the general target conservation and the frequency of particular mutations in the different target sites. The aim of this study was to develop a reliable bioinformatic pipeline for the analysis of millions of short, deep sequencing reads corresponding to selected highly variable viral sequences that are drug target(s. The suggested bioinformatic pipeline combines the available programs and the ad hoc scripts based on an original algorithm of the search for the conserved targets in the deep sequencing data. We also present the statistical criteria for the threshold of reliable mutation detection and for the assessment of variations between corresponding data sets. These criteria are robust against the possible sequencing errors in the reads. As an example, the bioinformatic pipeline is applied to the study of the conservation of RNA interference (RNAi targets in human immunodeficiency virus 1 (HIV-1 subtype A. The developed pipeline is freely available to download at the website http://virmut.eimb.ru/. Brief comments and comparisons between VirMut and other pipelines are also presented.

Classical field approach to quantum weak measurements.

Science.gov (United States)

Dressel, Justin; Bliokh, Konstantin Y; Nori, Franco

2014-03-21

By generalizing the quantum weak measurement protocol to the case of quantum fields, we show that weak measurements probe an effective classical background field that describes the average field configuration in the spacetime region between pre- and postselection boundary conditions. The classical field is itself a weak value of the corresponding quantum field operator and satisfies equations of motion that extremize an effective action. Weak measurements perturb this effective action, producing measurable changes to the classical field dynamics. As such, weakly measured effects always correspond to an effective classical field. This general result explains why these effects appear to be robust for pre- and postselected ensembles, and why they can also be measured using classical field techniques that are not weak for individual excitations of the field.

Associative Interference in Pavlovian Conditioning: A Function of Similarity Between the Interfering and Target Associative Structures

OpenAIRE

Amundson, Jeffrey C.; Miller, Ralph R.

2008-01-01

Three lever-press suppression studies were conducted with water-deprived rats to investigate the role of similarity in proactive interference within first-order Pavlovian conditioning. Experiments 1a and 1b assessed the influence of stimulus complexity in proactive interference. Both experiments found greater interference when the interfering cue and target cue were composed of the same number of elements. Experiment 2 assessed the influence of context similarity in proactive interference and...

[Hot spot mutation screening of RYR1 gene in diagnosis of congenital myopathies].

Science.gov (United States)

Chang, Xing-zhi; Jin, Yi-wen; Wang, Jing-min; Yuan, Yun; Xiong, Hui; Wang, Shuang; Qin, Jiong

2014-10-18

To detect hot spot mutation of RYR1 gene in 15 cases of congenital myopathy with different subtypes, and to discuss the value of RYR1 gene hot spot mutation detection in the diagnosis of the disease. Clinical data were collected in all the patients, including clinical manifestations and signs, serum creatine kinase, electromyography. Fourteen of the patients accepted the muscle biopsy. Hot spot mutation in the C-terminal of RYR1 gene (extron 96-106) had been detected in all the 15 patients. All the patients presented with motor development delay, and they could walk at the age of 1 to 3.5 years,but were always easy to fall and could not run or jump. There were no progressive deteriorations. Physical examination showed different degrees of muscle weakness and hypotonia.High arched palates were noted in 3 patients. The serum levels of creatine kinase were mildly elevated in 3 cases, and normal in 12 cases. Electromyography showed "myogenic" features in 11 patients, being normal in the other 4 patients. Muscle biopsy pathologic diagnosis was the central core disease in 3 patients, the central nuclei in 2 patients, the congenital fiber type disproportion in 2 patients, the nameline myopathy in 3 patient, the multiminicore disease in 1 patient, and nonspecific minimal changes in the other 3 patients; one patient was diagnosed with central core disease according to positive family history and gene mutation. In the family case (Patient 2) of central core disease, the c.14678G>A (p.Arg4893Gln) mutation in 102 extron of RYR1 was identified in three members of the family, which had been reported to be a pathogenic mutation. The c.14596A>G(p.Lys4866Gln) mutation in 101 extron was found in one patient with central core disease(Patient 1), and the c.14719G>A(p.Gly4907Ser) mutation in 102 extron was found in another case of the central core disease(Patient 3).The same novel mutation was verified in one of the patients' (Patient 3) asymptomatic father. Congenital myopathies in

Peripheral facial weakness (Bell's palsy).

Science.gov (United States)

Basić-Kes, Vanja; Dobrota, Vesna Dermanović; Cesarik, Marijan; Matovina, Lucija Zadro; Madzar, Zrinko; Zavoreo, Iris; Demarin, Vida

2013-06-01

Peripheral facial weakness is a facial nerve damage that results in muscle weakness on one side of the face. It may be idiopathic (Bell's palsy) or may have a detectable cause. Almost 80% of peripheral facial weakness cases are primary and the rest of them are secondary. The most frequent causes of secondary peripheral facial weakness are systemic viral infections, trauma, surgery, diabetes, local infections, tumor, immune disorders, drugs, degenerative diseases of the central nervous system, etc. The diagnosis relies upon the presence of typical signs and symptoms, blood chemistry tests, cerebrospinal fluid investigations, nerve conduction studies and neuroimaging methods (cerebral MRI, x-ray of the skull and mastoid). Treatment of secondary peripheral facial weakness is based on therapy for the underlying disorder, unlike the treatment of Bell's palsy that is controversial due to the lack of large, randomized, controlled, prospective studies. There are some indications that steroids or antiviral agents are beneficial but there are also studies that show no beneficial effect. Additional treatments include eye protection, physiotherapy, acupuncture, botulinum toxin, or surgery. Bell's palsy has a benign prognosis with complete recovery in about 80% of patients, 15% experience some mode of permanent nerve damage and severe consequences remain in 5% of patients.

Weakly oval electron lense

International Nuclear Information System (INIS)

Daumenov, T.D.; Alizarovskaya, I.M.; Khizirova, M.A.

2001-01-01

The method of the weakly oval electrical field getting generated by the axially-symmetrical field is shown. Such system may be designed with help of the cylindric form coaxial electrodes with the built-in quadrupole duplet. The singularity of the indicated weakly oval lense consists of that it provides the conducting both mechanical and electronic adjustment. Such lense can be useful for elimination of the near-axis astigmatism in the electron-optical system

An ABC transporter mutation is correlated with insect resistance to Bacillus thuringiensis Cry1Ac toxin.

Directory of Open Access Journals (Sweden)

Linda J Gahan

2010-12-01

Full Text Available Transgenic crops producing insecticidal toxins from Bacillus thuringiensis (Bt are commercially successful in reducing pest damage, yet knowledge of resistance mechanisms that threaten their sustainability is incomplete. Insect resistance to the pore-forming Cry1Ac toxin is correlated with the loss of high-affinity, irreversible binding to the mid-gut membrane, but the genetic factors responsible for this change have been elusive. Mutations in a 12-cadherin-domain protein confer some Cry1Ac resistance but do not block this toxin binding in in vitro assays. We sought to identify mutations in other genes that might be responsible for the loss of binding. We employed a map-based cloning approach using a series of backcrosses with 1,060 progeny to identify a resistance gene in the cotton pest Heliothis virescens that segregated independently from the cadherin mutation. We found an inactivating mutation of the ABC transporter ABCC2 that is genetically linked to Cry1Ac resistance and is correlated with loss of Cry1Ac binding to membrane vesicles. ABC proteins are integral membrane proteins with many functions, including export of toxic molecules from the cell, but have not been implicated in the mode of action of Bt toxins before. The reduction in toxin binding due to the inactivating mutation suggests that ABCC2 is involved in membrane integration of the toxin pore. Our findings suggest that ABC proteins may play a key role in the mode of action of Bt toxins and that ABC protein mutations can confer high levels of resistance that could threaten the continued utilization of Bt-expressing crops. However, such mutations may impose a physiological cost on resistant insects, by reducing export of other toxins such as plant secondary compounds from the cell. This weakness could be exploited to manage this mechanism of Bt resistance in the field.

An ABC transporter mutation is correlated with insect resistance to Bacillus thuringiensis Cry1Ac toxin.

Science.gov (United States)

Gahan, Linda J; Pauchet, Yannick; Vogel, Heiko; Heckel, David G

2010-12-16

Transgenic crops producing insecticidal toxins from Bacillus thuringiensis (Bt) are commercially successful in reducing pest damage, yet knowledge of resistance mechanisms that threaten their sustainability is incomplete. Insect resistance to the pore-forming Cry1Ac toxin is correlated with the loss of high-affinity, irreversible binding to the mid-gut membrane, but the genetic factors responsible for this change have been elusive. Mutations in a 12-cadherin-domain protein confer some Cry1Ac resistance but do not block this toxin binding in in vitro assays. We sought to identify mutations in other genes that might be responsible for the loss of binding. We employed a map-based cloning approach using a series of backcrosses with 1,060 progeny to identify a resistance gene in the cotton pest Heliothis virescens that segregated independently from the cadherin mutation. We found an inactivating mutation of the ABC transporter ABCC2 that is genetically linked to Cry1Ac resistance and is correlated with loss of Cry1Ac binding to membrane vesicles. ABC proteins are integral membrane proteins with many functions, including export of toxic molecules from the cell, but have not been implicated in the mode of action of Bt toxins before. The reduction in toxin binding due to the inactivating mutation suggests that ABCC2 is involved in membrane integration of the toxin pore. Our findings suggest that ABC proteins may play a key role in the mode of action of Bt toxins and that ABC protein mutations can confer high levels of resistance that could threaten the continued utilization of Bt-expressing crops. However, such mutations may impose a physiological cost on resistant insects, by reducing export of other toxins such as plant secondary compounds from the cell. This weakness could be exploited to manage this mechanism of Bt resistance in the field.

A novel mouse model carrying a human cytoplasmic dynein mutation shows motor behavior deficits consistent with Charcot-Marie-Tooth type 2O disease.

Science.gov (United States)

Sabblah, Thywill T; Nandini, Swaran; Ledray, Aaron P; Pasos, Julio; Calderon, Jami L Conley; Love, Rachal; King, Linda E; King, Stephen J

2018-01-29

Charcot-Marie-Tooth disease (CMT) is a peripheral neuromuscular disorder in which axonal degeneration causes progressive loss of motor and sensory nerve function. The loss of motor nerve function leads to distal muscle weakness and atrophy, resulting in gait problems and difficulties with walking, running, and balance. A mutation in the cytoplasmic dynein heavy chain (DHC) gene was discovered to cause an autosomal dominant form of the disease designated Charcot-Marie-Tooth type 2 O disease (CMT2O) in 2011. The mutation is a single amino acid change of histidine into arginine at amino acid 306 (H306R) in DHC. In order to understand the onset and progression of CMT2, we generated a knock-in mouse carrying the corresponding CMT2O mutation (H304R/+). We examined H304R/+ mouse cohorts in a 12-month longitudinal study of grip strength, tail suspension, and rotarod assays. H304R/+ mice displayed distal muscle weakness and loss of motor coordination phenotypes consistent with those of individuals with CMT2. Analysis of the gastrocnemius of H304R/+ male mice showed prominent defects in neuromuscular junction (NMJ) morphology including reduced size, branching, and complexity. Based on these results, the H304R/+ mouse will be an important model for uncovering functions of dynein in complex organisms, especially related to CMT onset and progression.

Small interfering RNA delivery through positively charged polymer nanoparticles

International Nuclear Information System (INIS)

Dragoni, Luca; Cesana, Alberto; Moscatelli, Davide; Ferrari, Raffaele; Morbidelli, Massimo; Lupi, Monica; Falcetta, Francesca; Ubezio, Paolo; D’Incalci, Maurizio

2016-01-01

Small interfering RNA (siRNA) is receiving increasing attention with regard to the treatment of many genetic diseases, both acquired and hereditary, such as cancer and diabetes. Being a high molecular weight (MW) polyanion, siRNA is not able to cross a cell membrane, and in addition it is unstable in physiological conditions. Accordingly, a biocompatible nanocarrier able to deliver siRNA into cells is needed. In this work, we synthesized biocompatible positively charged nanoparticles (NPs) following a two-step process that involves ring opening polymerization (ROP) and emulsion free radical polymerization (EFRP). Firstly, we proved the possibility of fine tuning the NPs’ characteristics (e.g. size and surface charge) by changing the synthetic process parameters. Then the capability in loading and delivering undamaged siRNA into a cancer cell cytoplasm has been shown. This latter process occurs through the biodegradation of the polymer constituting the NPs, whose kinetics can be tuned by adjusting the polymer’s MW. Finally, the ability of NPs to carry siRNA inside the cells in order to inhibit their target gene has been demonstrated using green flourescent protein positive cells. (paper)

Weak decays of stable particles

International Nuclear Information System (INIS)

Brown, R.M.

1988-09-01

In this article we review recent advances in the field of weak decays and consider their implications for quantum chromodynamics (the theory of strong interactions) and electroweak theory (the combined theory of electromagnetic and weak interactions), which together form the ''Standard Model'' of elementary particles. (author)

Weak lensing and dark energy

International Nuclear Information System (INIS)

Huterer, Dragan

2002-01-01

We study the power of upcoming weak lensing surveys to probe dark energy. Dark energy modifies the distance-redshift relation as well as the matter power spectrum, both of which affect the weak lensing convergence power spectrum. Some dark-energy models predict additional clustering on very large scales, but this probably cannot be detected by weak lensing alone due to cosmic variance. With reasonable prior information on other cosmological parameters, we find that a survey covering 1000 sq deg down to a limiting magnitude of R=27 can impose constraints comparable to those expected from upcoming type Ia supernova and number-count surveys. This result, however, is contingent on the control of both observational and theoretical systematics. Concentrating on the latter, we find that the nonlinear power spectrum of matter perturbations and the redshift distribution of source galaxies both need to be determined accurately in order for weak lensing to achieve its full potential. Finally, we discuss the sensitivity of the three-point statistics to dark energy

Early-onset severe hereditary sensory and autonomic neuropathy type 1 with S331F SPTLC1 mutation.

Science.gov (United States)

Suh, Bum Chun; Hong, Young Bin; Nakhro, Khriezhanuo; Nam, Soo Hyun; Chung, Ki Wha; Choi, Byung-Ok

2014-02-01

Hereditary sensory and autonomic neuropathy type I (HSAN I) is an autosomal dominant disease characterized by prominent sensory impairment, resulting in foot ulcers or amputations and has a juvenile to adult onset. The major underlying causes of HSAN I are mutations in SPTLC1, which encodes the first subunit of serine palmitoyltransferase (SPT). To date, there have been no reports with regard to an HSAN patient of Korean origin. In this report we discussed an HSAN I patient with a missense mutation in SPTLC1 (c.992C>T: p.S331F). The patient had noticed frequent falls, lower leg weakness and hand tremors at age five. The patient also presented with foot ulcers, muscle hypotrophy, cataracts, hoarseness, vocal cord palsy and respiratory difficulties and succumbed to the condition at the age of 28 years. In accordance with previous reports, a mutation in Ser331 in the present patient was associated with early-onset and a severe phenotype. Therefore, Ser331 in SPTLC1 is a crucial amino acid, which characterizes the HSAN I phenotype.

Novel duplication mutation of the DYSF gene in a Pakistani family with Miyoshi Myopathy

Directory of Open Access Journals (Sweden)

Muhammad I. Ullah

2017-12-01

Full Text Available Objectives: To identify the underlying gene mutation in a large consanguineous Pakistani family. Methods: This is an observational descriptive study carried out at the Department of Biochemistry, Shifa International Hospital, Quaid-i-Azam University, and Atta-ur-Rahman School of Applied Biosciences, National University of Sciences and Technology, Islamabad, Pakistan from 2013-2016. Genomic DNA of all recruited family members was extracted and the Trusight one sequencing panel was used to assess genes associated with a neuro-muscular phenotype. Comparative modeling of mutated and wild-type protein was carried out by PyMOL tool. Results: Clinical investigations of an affected individual showed typical features of Miyoshi myopathy (MM like elevated serum creatine kinase (CK levels, distal muscle weakness, myopathic changes in electromyography (EMG and muscle histopathology. Sequencing with the Ilumina Trusight one sequencing panel revealed a novel 22 nucleotide duplication (CTTCAACTTGTTTGACTCTCCT in the DYSF gene (NM_001130987.1_c.897-918dup; p.Gly307Leufs5X, which results in a truncating frameshift mutation and perfectly segregated with the disease in this family. Protein modeling studies suggested a disruption in spatial configuration of the putative mutant protein. Conclusion: A novel duplication of 22 bases (c.897_918dup; p.Gly307Leufs5X in the DYSF gene was identified in a family suffering from Miyoshi myopathy. Protein homology analysis proposes a disruptive impact of this mutation on protein function.

Weak self-adjoint differential equations

International Nuclear Information System (INIS)

Gandarias, M L

2011-01-01

The concepts of self-adjoint and quasi self-adjoint equations were introduced by Ibragimov (2006 J. Math. Anal. Appl. 318 742-57; 2007 Arch. ALGA 4 55-60). In Ibragimov (2007 J. Math. Anal. Appl. 333 311-28), a general theorem on conservation laws was proved. In this paper, we generalize the concept of self-adjoint and quasi self-adjoint equations by introducing the definition of weak self-adjoint equations. We find a class of weak self-adjoint quasi-linear parabolic equations. The property of a differential equation to be weak self-adjoint is important for constructing conservation laws associated with symmetries of the differential equation. (fast track communication)

Advances in targeted delivery of small interfering RNA using simple bioconjugates

DEFF Research Database (Denmark)

Nielsen, Christoffer; Kjems, Jørgen; Sorensen, Kristine Rothaus

2014-01-01

with a targeting moiety, in a simple bioconjugate construct. We discuss the use of different types of targeting moieties, as well as the different conjugation strategies employed for preparing these bioconjugate constructs that deliver the siRNA to target cells. We focus especially on the in-built or passive......Introduction: Development of drugs based on RNA interference by small interfering RNA (siRNA) has been progressing slowly due to a number of challenges associated with the in vivo behavior of siRNA. A central problem is controlling siRNA delivery to specific cell types. Here, we review existing...... literature on one type of strategy for solving the issue of cell-specific delivery of siRNA, namely delivering the siRNA as part of simple bioconjugate constructs. Areas covered: This review presents current experience from strategies aimed at targeting siRNA to specific cell types, by associating the siRNA...

Deletion mutations of bacteriophage

International Nuclear Information System (INIS)

Ryo, Yeikou

1975-01-01

Resolution of mutation mechanism with structural changes of DNA was discussed through the studies using bacteriophage lambda. One of deletion mutations inductions of phage lambda is the irradiation of ultraviolet ray. It is not clear if the inductions are caused by errors in reparation of ultraviolet-induced damage or by the activation of int gene. Because the effective site of int gene lies within the regions unnecessary for existing, it is considered that int gene is connected to deletion mutations induction. A certain system using prophage complementarity enables to detect deletion mutations at essential hereditary sites and to solve the relations of deletion mutations with other recombination system, DNA reproduction and repairment system. Duplication and multiplication of hereditary elements were discussed. If lambda deletion mutations of the system, which can control recombination, reproduction and repairment of added DNA, are constructed, mutations mechanism with great changes of DNA structure can be solved by phage lambda. (Ichikawa, K.)

Quantum discord with weak measurements

International Nuclear Information System (INIS)

Singh, Uttam; Pati, Arun Kumar

2014-01-01

Weak measurements cause small change to quantum states, thereby opening up the possibility of new ways of manipulating and controlling quantum systems. We ask, can weak measurements reveal more quantum correlation in a composite quantum state? We prove that the weak measurement induced quantum discord, called as the “super quantum discord”, is always larger than the quantum discord captured by the strong measurement. Moreover, we prove the monotonicity of the super quantum discord as a function of the measurement strength and in the limit of strong projective measurement the super quantum discord becomes the normal quantum discord. We find that unlike the normal discord, for pure entangled states, the super quantum discord can exceed the quantum entanglement. Our results provide new insights on the nature of quantum correlation and suggest that the notion of quantum correlation is not only observer dependent but also depends on how weakly one perturbs the composite system. We illustrate the key results for pure as well as mixed entangled states. -- Highlights: •Introduced the role of weak measurements in quantifying quantum correlation. •We have introduced the notion of the super quantum discord (SQD). •For pure entangled state, we show that the SQD exceeds the entanglement entropy. •This shows that quantum correlation depends not only on observer but also on measurement strength

Calreticulin Mutations in Myeloproliferative Neoplasms

Directory of Open Access Journals (Sweden)

Noa Lavi

2014-10-01

Full Text Available With the discovery of the JAK2V617F mutation in patients with Philadelphia chromosome-negative (Ph− myeloproliferative neoplasms (MPNs in 2005, major advances have been made in the diagnosis of MPNs, in understanding of their pathogenesis involving the JAK/STAT pathway, and finally in the development of novel therapies targeting this pathway. Nevertheless, it remains unknown which mutations exist in approximately one-third of patients with non-mutated JAK2 or MPL essential thrombocythemia (ET and primary myelofibrosis (PMF. At the end of 2013, two studies identified recurrent mutations in the gene encoding calreticulin (CALR using whole-exome sequencing. These mutations were revealed in the majority of ET and PMF patients with non-mutated JAK2 or MPL but not in polycythemia vera patients. Somatic 52-bp deletions (type 1 mutations and recurrent 5-bp insertions (type 2 mutations in exon 9 of the CALR gene (the last exon encoding the C-terminal amino acids of the protein calreticulin were detected and found always to generate frameshift mutations. All detected mutant calreticulin proteins shared a novel amino acid sequence at the C-terminal. Mutations in CALR are acquired early in the clonal history of the disease, and they cause activation of JAK/STAT signaling. The CALR mutations are the second most frequent mutations in Ph− MPN patients after the JAK2V617F mutation, and their detection has significantly improved the diagnostic approach for ET and PMF. The characteristics of the CALR mutations as well as their diagnostic, clinical, and pathogenesis implications are discussed in this review.

Mutations in the satellite cell gene MEGF10 cause a recessive congenital myopathy with minicores.

Science.gov (United States)

Boyden, Steven E; Mahoney, Lane J; Kawahara, Genri; Myers, Jennifer A; Mitsuhashi, Satomi; Estrella, Elicia A; Duncan, Anna R; Dey, Friederike; DeChene, Elizabeth T; Blasko-Goehringer, Jessica M; Bönnemann, Carsten G; Darras, Basil T; Mendell, Jerry R; Lidov, Hart G W; Nishino, Ichizo; Beggs, Alan H; Kunkel, Louis M; Kang, Peter B

2012-05-01

We ascertained a nuclear family in which three of four siblings were affected with an unclassified autosomal recessive myopathy characterized by severe weakness, respiratory impairment, scoliosis, joint contractures, and an unusual combination of dystrophic and myopathic features on muscle biopsy. Whole genome sequence from one affected subject was filtered using linkage data and variant databases. A single gene, MEGF10, contained nonsynonymous mutations that co-segregated with the phenotype. Affected subjects were compound heterozygous for missense mutations c.976T > C (p.C326R) and c.2320T > C (p.C774R). Screening the MEGF10 open reading frame in 190 patients with genetically unexplained myopathies revealed a heterozygous mutation, c.211C > T (p.R71W), in one additional subject with a similar clinical and histological presentation as the discovery family. All three mutations were absent from at least 645 genotyped unaffected control subjects. MEGF10 contains 17 atypical epidermal growth factor-like domains, each of which contains eight cysteine residues that likely form disulfide bonds. Both the p.C326R and p.C774R mutations alter one of these residues, which are completely conserved in vertebrates. Previous work showed that murine Megf10 is required for preserving the undifferentiated, proliferative potential of satellite cells, myogenic precursors that regenerate skeletal muscle in response to injury or disease. Here, knockdown of megf10 in zebrafish by four different morpholinos resulted in abnormal phenotypes including unhatched eggs, curved tails, impaired motility, and disorganized muscle tissue, corroborating the pathogenicity of the human mutations. Our data establish the importance of MEGF10 in human skeletal muscle and suggest satellite cell dysfunction as a novel myopathic mechanism.

Spin effects in the weak interaction

International Nuclear Information System (INIS)

Freedman, S.J.; Chicago Univ., IL; Chicago Univ., IL

1990-01-01

Modern experiments investigating the beta decay of the neutron and light nuclei are still providing important constraints on the theory of the weak interaction. Beta decay experiments are yielding more precise values for allowed and induced weak coupling constants and putting constraints on possible extensions to the standard electroweak model. Here we emphasize the implications of recent experiments to pin down the strengths of the weak vector and axial vector couplings of the nucleon

Weak interactions in astrophysics and cosmology

International Nuclear Information System (INIS)

Taylor, R.J.

1977-01-01

There ar many problems in astrophysics and cosmology in which the form of the weak interactions, their strength or the number of weakly interacting particles, is very important. It is possible that astronomical observations may give some information about the weak interactions. In the conventional hot big bang cosmological theory the number of leptons with associated neutrinos influences the speed of expansion of the Universe and the chemical composition of pre-galactic matter. The strength of the weak interaction, as exemplified by the half-life of the neutron, has a similar effect. In addition, the form of the weak interactions will determine how effectively neutrino viscosity can smooth out irregularities in the early Universe. Because neutrinos have a very long mean free path, they can escape from the central region of stars whereas photons can only escape from the surface. In late stages of stellar evolution, neutrino luminosity is often believed to be much greater than photon luminosity. This can both accelerate the cooling of dying stars and influence the stages of stellar evolution leading to the onset of supernova explosions. In pre-super-novae it is even possible that very dense stellar cores can be opaque to neutrinos and that the absorption or scattering of neutrinos can cause the explosion. These results depend crucially on the form of the weak interactions, with the discovery of neutral currents being very important. Until the solar neutrino experiment has been reconciled with theory, the possible role of uncertainties in the weak interactions cannot be ignored. (author)

Acute optic neuropathy associated with a novel MFN2 mutation.

Science.gov (United States)

Leonardi, Luca; Marcotulli, Christian; Storti, Eugenia; Tessa, Alessandra; Serrao, Mariano; Parisi, Vincenzo; Santorelli, F M; Pierelli, Francesco; Casali, Carlo

2015-07-01

Mutations in the mitofusin 2 (MFN2) gene cause CMT2A the most common form of autosomal dominant axonal Charcot-Marie-Tooth (CMT). In addition, mutations in MFN2 have been shown to be responsible for Hereditary Motor Sensory Neuropathy type VI (HSMN VI), a rare early-onset axonal CMT associated with optic neuropathy. Most reports of HMSN VI presented with a sub-acute form of optic neuropathy. Herein, we report a CMT2A patient, who developed very rapidly progressing severe optic neuropathy. A 40-year-old Caucasian man was evaluated for gait disturbance and lower limbs weakness, slowly progressed over the last 2 years. Due to clinical data and family history, a diagnosis of CMT2 was made. The novel heterozygous c.775C > T (p.Arg259Cys) mutation in MFN2 was detected in the patient and his clinical affected mother. Interestingly, the patient developed a severe sudden bilateral visual deterioration few years early, with clinical and instrumental picture suggestive of acute bilateral optic neuropathy. Our report expands the spectrum of MFN2-related manifestation because it indicates that visual symptoms of HMSN VI may enter in the differential with acquired or hereditary acute optic neuropathies, and that severe optic neuropathy is not invariably an early manifestation of the disease but may occur as disease progressed. This report could have an impact on clinicians who evaluate patients with otherwise unexplainable bilateral acute-onset optic neuropathy, especially if associated with a motor and sensory axonal neuropathy.

Potential of mutation breeding in improving Indonesian local rice varieties

International Nuclear Information System (INIS)

Sobrizal

2016-01-01

Rice (Oryza sativa L.) is an important cereal crops for human nutrition, this species can be divided into sub-species i.e. Indica and Japonica. Japonica sub-species consists of Temprate and Tropical Japonica (it is called as Javanica) groups. Mostly Javanica group originated from Indonesia, the people mentioned as Indonesian local varieties, it was covering more than 8000 varieties. This paper aims is to discuss the potential of mutation breeding, success stories and on going activities improved genetically the local rice varieties. Indonesian local varieties have been tested naturally for resistance to biotic and abiotic stresses so that they become useful collections of genetic resources. They usually adapted well toa specific environment where they grow largely, having good aroma and eating quality, but they have some weakness such very long growth duration, susceptible to lodging, unresponsive to fertilizer, and low yield. Seed multiplication is usually conducted by collecting seeds from farmer's fields so that the seed quality, especially for seeds purity level is very low. Improvements of seed quality is usually conducted through purification of exciting varieties, then, the result is released as a new variety. Other ways, some new varieties were improved through mutation breeding, for example, an early maturing mutant variety of Pandan Putri derived from irradiated Pandan Wangi variety from Cianjur area. The success story to reduce harvest age of Pandan Wangi variety through mutation breeding, it was triggers other local governments to use nuclear technology in improving agronomic traits of their local rice varieties, without altered another good characters. (author)

A mathematical solution for the parameters of three interfering resonances

Science.gov (United States)

Han, X.; Shen, C. P.

2018-04-01

The multiple-solution problem in determining the parameters of three interfering resonances from a fit to an experimentally measured distribution is considered from a mathematical viewpoint. It is shown that there are four numerical solutions for a fit with three coherent Breit-Wigner functions. Although explicit analytical formulae cannot be derived in this case, we provide some constraint equations between the four solutions. For the cases of nonrelativistic and relativistic Breit-Wigner forms of amplitude functions, a numerical method is provided to derive the other solutions from that already obtained, based on the obtained constraint equations. In real experimental measurements with more complicated amplitude forms similar to Breit-Wigner functions, the same method can be deduced and performed to get numerical solutions. The good agreement between the solutions found using this mathematical method and those directly from the fit verifies the correctness of the constraint equations and mathematical methodology used. Supported by National Natural Science Foundation of China (NSFC) (11575017, 11761141009), the Ministry of Science and Technology of China (2015CB856701) and the CAS Center for Excellence in Particle Physics (CCEPP)

Low-energy Electro-weak Reactions

International Nuclear Information System (INIS)

Gazit, Doron

2012-01-01

Chiral effective field theory (EFT) provides a systematic and controlled approach to low-energy nuclear physics. Here, we use chiral EFT to calculate low-energy weak Gamow-Teller transitions. We put special emphasis on the role of two-body (2b) weak currents within the nucleus and discuss their applications in predicting physical observables.

Instrumental systematics and weak gravitational lensing

International Nuclear Information System (INIS)

Mandelbaum, R.

2015-01-01

We present a pedagogical review of the weak gravitational lensing measurement process and its connection to major scientific questions such as dark matter and dark energy. Then we describe common ways of parametrizing systematic errors and understanding how they affect weak lensing measurements. Finally, we discuss several instrumental systematics and how they fit into this context, and conclude with some future perspective on how progress can be made in understanding the impact of instrumental systematics on weak lensing measurements

Robust weak measurements on finite samples

International Nuclear Information System (INIS)

Tollaksen, Jeff

2007-01-01

A new weak measurement procedure is introduced for finite samples which yields accurate weak values that are outside the range of eigenvalues and which do not require an exponentially rare ensemble. This procedure provides a unique advantage in the amplification of small nonrandom signals by minimizing uncertainties in determining the weak value and by minimizing sample size. This procedure can also extend the strength of the coupling between the system and measuring device to a new regime

Estudo de revisão sobre a interferência de hipoglicemiantes orais no exame químico de urina

Directory of Open Access Journals (Sweden)

Carolina Machado Ramos

2016-07-01

Full Text Available A diabetes mellitus (DM é uma doença que vem aumentando exponencialmente nos últimos anos de vida dos indivíduos, e uma opção de tratamento farmacológico é feito através dos hipoglicemiantes orais (HO. Em virtude de serem substâncias amplamente utilizadas e terem como principal via de excreção a urinária, este tratamento pode provocar variações nos resultados dos parâmetros urinários. Portanto, este estudo tem a finalidade de avaliar a interferência causada pelo uso de hipoglicemiantes no exame de urina. Para esta investigação, foi feita uma pesquisa bibliográfica em diferentes bases de dados, selecionando os artigos pertinentes ao tema: diabetes, interferências laboratoriais e tratamento farmacológico. Os HO podem ser classificados em três grupos de acordo com o mecanismo de ação: estimuladores de insulinas pelo pâncreas, como sulfoniluréias e metiglinidas; as sensibilizadoras de insulina, são as biguanidas, as tiazolidinedionas e as redutoras da absorção de carboidratos, que são as inibidoras da alfa-glicosidase. O exame de urina é uma ferramenta complementar no controle da DM devido a sua fácil coleta e baixo custo. As classes de hipoglicemiantes orais identificados como potencialmente interferentes no exame de urina foram as biguanidas (metformina e as sulfoniluréias (tobultamida, tolazamida, glicazida, clorpropramida. Resultam em interferência nos parâmetros densidade, proteínas, glicose, cetonas e bilirrubinas, levando a um diagnóstico inadequado e um tratamento insatisfatório gerando prejuízos ao bem estar do paciente.

On weakly D-differentiable operators

DEFF Research Database (Denmark)

Christensen, Erik

2016-01-01

Let DD be a self-adjoint operator on a Hilbert space HH and aa a bounded operator on HH. We say that aa is weakly DD-differentiable, if for any pair of vectors ξ,ηξ,η from HH the function 〈eitDae−itDξ,η〉〈eitDae−itDξ,η〉 is differentiable. We give an elementary example of a bounded operator aa......, such that aa is weakly DD-differentiable, but the function eitDae−itDeitDae−itD is not uniformly differentiable. We show that weak  DD-differentiability   may be characterized by several other properties, some of which are related to the commutator (Da−aD)...

Weakly distributive modules. Applications to supplement submodules

Indian Academy of Sciences (India)

Abstract. In this paper, we define and study weakly distributive modules as a proper generalization of distributive modules. We prove that, weakly distributive supplemented modules are amply supplemented. In a weakly distributive supplemented module every submodule has a unique coclosure. This generalizes a result of ...

Bulkiness or aromatic nature of tyrosine-143 of actin is important for the weak binding between F-actin and myosin-ADP-phosphate

Energy Technology Data Exchange (ETDEWEB)

Gomibuchi, Yuki [Graduate School of Science and Engineering, Teikyo University, Toyosatodai 1-1, Utsunomiya 320-8551 (Japan); Uyeda, Taro Q.P. [Biomedical Research Institute, National Institute of Advanced Industrial Science and Technology, AIST Tsukuba Central 4, 1-1-1 Higashi, Tsukuba, Ibaraki 305-8562 (Japan); Wakabayashi, Takeyuki, E-mail: tw007@nasu.bio.teikyo-u.ac.jp [Graduate School of Science and Engineering, Teikyo University, Toyosatodai 1-1, Utsunomiya 320-8551 (Japan); Department of Judo Therapy, Faculty of Medical Technology, Teikyo University, Toyosatodai 1-1, Utsunomiya 320-8551 (Japan)

2013-11-29

Highlights: •The effect of mutation of Tyr143 that becomes more exposed on assembly was examined. •Mutation of tyrosine-143 of Dictyostelium actin changed actin polymerizability. •The bulkiness or aromatic nature of Tyr143 is important for the weak binding. •The weak interaction between myosin and actin strengthened by Tyr143Trp mutation. -- Abstract: Actin filaments (F-actin) interact with myosin and activate its ATPase to support force generation. By comparing crystal structures of G-actin and the quasi-atomic model of F-actin based on high-resolution cryo-electron microscopy, the tyrosine-143 was found to be exposed more than 60 Å{sup 2} to the solvent in F-actin. Because tyrosine-143 flanks the hydrophobic cleft near the hydrophobic helix that binds to myosin, the mutant actins, of which the tyrosine-143 was replaced with tryptophan, phenylalanine, or isoleucine, were generated using the Dictyostelium expression system. It polymerized significantly poorly when induced by NaCl, but almost normally by KCl. In the presence of phalloidin and KCl, the extents of the polymerization of all the mutant actins were comparable to that of the wild-type actin so that the actin-activated myosin ATPase activity could be reliably compared. The affinity of skeletal heavy meromyosin to F-actin and the maximum ATPase activity (V{sub max}) were estimated by a double reciprocal plot. The Tyr143Trp-actin showed the higher affinity (smaller K{sub app}) than that of the wild-type actin, with the V{sub max} being almost unchanged. The K{sub app} and V{sub max} of the Tyr143Phe-actin were similar to those of the wild-type actin. However, the activation by Tyr143Ile-actin was much smaller than the wild-type actin and the accurate determination of K{sub app} was difficult. Comparison of the myosin ATPase activated by the various mutant actins at the same concentration of F-actin showed that the extent of activation correlates well with the solvent-accessible surface areas (ASA

Geometric phase topology in weak measurement

Science.gov (United States)

Samlan, C. T.; Viswanathan, Nirmal K.

2017-12-01

The geometric phase visualization proposed by Bhandari (R Bhandari 1997 Phys. Rep. 281 1-64) in the ellipticity-ellipse orientation basis of the polarization ellipse of light is implemented to understand the geometric aspects of weak measurement. The weak interaction of a pre-selected state, acheived via spin-Hall effect of light (SHEL), results in a spread in the polarization ellipticity (η) or ellipse orientation (χ) depending on the resulting spatial or angular shift, respectively. The post-selection leads to the projection of the η spread in the complementary χ basis results in the appearance of a geometric phase with helical phase topology in the η - χ parameter space. By representing the weak measurement on the Poincaré sphere and using Jones calculus, the complex weak value and the geometric phase topology are obtained. This deeper understanding of the weak measurement process enabled us to explore the techniques’ capabilities maximally, as demonstrated via SHEL in two examples—external reflection at glass-air interface and transmission through a tilted half-wave plate.

KRAS mutation testing in colorectal cancer: comparison of the results obtained using 3 different methods for the analysis of codons G12 and G13.

Science.gov (United States)

Bihl, Michel P; Hoeller, Sylvia; Andreozzi, Maria Carla; Foerster, Anja; Rufle, Alexander; Tornillo, Luigi; Terracciano, Luigi

2012-03-01

Targeting the epidermal growth factor receptor (EGFR) is a new therapeutic option for patients with metastatic colorectal or lung carcinoma. However, the therapy efficiency highly depends on the KRAS mutation status in the given tumour. Therefore a reliable and secure KRAS mutation testing is crucial. Here we investigated 100 colorectal carcinoma samples with known KRAS mutation status (62 mutated cases and 38 wild type cases) in a comparative manner with three different KRAS mutation testing techniques (Pyrosequencing, Dideoxysequencing and INFINITI) in order to test their reliability and sensitivity. For the large majority of samples (96/100, 96%), the KRAS mutation status obtained by all three methods was the same. Only two cases with clear discrepancies were observed. One case was reported as wild type by the INFINITI method while the two other methods detected a G13C mutation. In the second case the mutation could be detected by the Pyrosequencing and INFINITI method (15% and 15%), while no signal for mutation could be observed with the Dideoxysequencing method. Additional two unclear results were due to a detection of a G12V with the INFINITI method, which was below cut-off when repeated and which was not detectable by the other two methods and very weak signals in a G12V mutated case with the Dideoxy- and Pyroseqencing method compared to the INFINITI method, respectively. In summary all three methods are reliable and robust methods in detecting KRAS mutations. INFINITI, however seems to be slightly more sensitive compared to Dideoxy- and Pyrosequencing.

Inherited and Acquired Muscle Weakness: A Moving Target for Diagnostic Muscle Biopsy.

Science.gov (United States)

Stenzel, Werner; Schoser, Benedikt

2017-08-01

Inherited and acquired muscular weakness is caused by multiple conditions. While the inherited ones are mostly caused by mutations in genes coding for myopathic or neurogenic diseases, the acquired ones occur due to inflammatory, endocrine, or toxic etiologies. Precise diagnosis of a specific disease may be challenging and may require a multidisciplinary approach. What is the current place for a diagnostic biopsy of skeletal muscle? Diagnostic muscle biopsy lost in this context its first-tier place in the primary diagnostic workup for some diseases, but it is still mandatory for others. We here summarize conditions in which we believe a diagnostic sample is most relevant and mention those in which a biopsy may be secondary or can even be left out. We would like to stress that muscle biopsy nowadays has a new important place in description and definition of new diseases, for example, discovered by modern genetic approaches. Georg Thieme Verlag KG Stuttgart, New York.

Weak radiative hyperon decays

International Nuclear Information System (INIS)

Roberts, B.L.; Booth, E.C.; Gall, K.P.; McIntyre, E.K.; Miller, J.P.; Whitehouse, D.A.; Bassalleck, B.; Hall, J.R.; Larson, K.D.; Wolfe, D.M.; Fickinger, W.J.; Robinson, D.K.; Hallin, A.L.; Hasinoff, M.D.; Measday, D.F.; Noble, A.J.; Waltham, C.E.; Hessey, N.P.; Lowe, J.; Horvath, D.; Salomon, M.

1990-01-01

New measurements of the Σ + and Λ weak radiative decays are discussed. The hyperons were produced at rest by the reaction K - p → Yπ where Y = Σ + or Λ. The monoenergetic pion was used to tag the hyperon production, and the branching ratios were determined from the relative amplitudes of Σ + → pγ to Σ + → pπ 0 and Λ → nγ to Λ → nπ 0 . The photons from weak radiative decays and from π 0 decays were detected with modular NaI arrays. (orig.)

Weak strange particle production: advantages and difficulties

International Nuclear Information System (INIS)

Angelescu, Tatiana; Baker, O.K.

2002-01-01

Electromagnetic strange particle production developed at Jefferson Laboratory was an important source of information on strange particle electromagnetic formfactors and induced and transferred polarization. The high quality of the beam and the detection techniques involved could be an argument for detecting strange particles in weak interactions and answer questions about cross sections, weak formfactors, neutrino properties, which have not been investigated yet. The paper analyses some aspects related to the weak lambda production and detection with the Hall C facilities at Jefferson Laboratory and the limitations in measuring the weak interaction quantities. (authors)

Proactive Routing Mutation Against Stealthy Distributed Denial of Service Attacks – Metrics, Modeling and Analysis

Energy Technology Data Exchange (ETDEWEB)

Duan, Qi; Al-Shaer, Ehab; Chatterjee, Samrat; Halappanavar, Mahantesh; Oehmen, Christopher S.

2018-04-01

The Infrastructure Distributed Denial of Service (IDDoS) attacks continue to be one of the most devastating challenges facing cyber systems. The new generation of IDDoS attacks exploit the inherent weakness of cyber infrastructure including deterministic nature of routes, skew distribution of flows, and Internet ossification to discover the network critical links and launch highly stealthy flooding attacks that are not observable at the victim end. In this paper, first, we propose a new metric to quantitatively measure the potential susceptibility of any arbitrary target server or domain to stealthy IDDoS attacks, and es- timate the impact of such susceptibility on enterprises. Second, we develop a proactive route mutation technique to minimize the susceptibility to these attacks by dynamically changing the flow paths periodically to invalidate the adversary knowledge about the network and avoid targeted critical links. Our proposed approach actively changes these network paths while satisfying security and qualify of service requirements. We present an integrated approach of proactive route mutation that combines both infrastructure-based mutation that is based on reconfiguration of switches and routers, and middle-box approach that uses an overlay of end-point proxies to construct a virtual network path free of critical links to reach a destination. We implemented the proactive path mutation technique on a Software Defined Network using the OpendDaylight controller to demonstrate a feasible deployment of this approach. Our evaluation validates the correctness, effectiveness, and scalability of the proposed approaches.

Study of weak interaction with p-p colliding beam

International Nuclear Information System (INIS)

Arafune, Jiro; Sugawara, Hirotaka

1975-01-01

Weak interaction in the energy range of TRISTAN project is discussed. The cross-section of production of weak boson in p-p reaction was calculated with the parton model. The observation of weak boson may be possible. The production rate of neutral weak boson was also estimated on the basis of the Weinberg model, and was almost same as that of weak boson. The method of observation of weak boson is suggested. The direct method is the observation of lepton pair due to the decay of neutral weak boson. It is expected that the spectrum of decay products (+ -) in the decay of weak boson shows a characteristic feature, and it shows the existence of weak boson. Weak interaction makes larger contribution in case of large momentum transfer than electromagnetic interaction. When the momentum transfer is larger than 60 GeV/c, the contribution of weak interaction is dominant over the others. Therefore, the experiments at high energy will give informations concerning the relations among the interactions of elementary particles. Possibility of study on the Higgs scalar meson is also discussed. (Kato, T.)

Repair-resistant mutation in Neurospora

International Nuclear Information System (INIS)

Stadler, D.; Macleod, H.; Loo, M.

1987-01-01

Chronic UV treatment produces severalfold fewer mutations in Neurospora conidia than does the same total dose of acute UV. Experiments were designed to determine the conditions required for chronic UV mutagenesis. Measurement of the coincidence frequency for two independent mutations revealed the existence of a subset of cells which are mutable by chronic UV. Analysis of forward mutation at the mtr locus showed that the genetic alterations produced by chronic UV were virtually all point mutants, even though the assay system could detect alterations or deletions extending into neighboring genes. A significant fraction of the mutants produced by acute UV were multigenic deletions. The size of the dose-rate effect (acute UV mutation frequency divided by chronic UV mutation frequency) was compared for several different mutation assay systems. Forward mutations (recessive lethals and mtr) gave values ranging from four to nine. For events which were restricted to specific molecular sites (specific reversions and nonsense suppressor mutations), there was a wider range of dose-rate ratios. This suggests that chronic UV mutation may be restricted to certain molecular sequences or configurations

Mutation Analysis in Classical Phenylketonuria Patients Followed by Detecting Haplotypes Linked to Some PAH Mutations.

Science.gov (United States)

Dehghanian, Fatemeh; Silawi, Mohammad; Tabei, Seyed M B

2017-02-01

Deficiency of phenylalanine hydroxylase (PAH) enzyme and elevation of phenylalanine in body fluids cause phenylketonuria (PKU). The gold standard for confirming PKU and PAH deficiency is detecting causal mutations by direct sequencing of the coding exons and splicing involved sequences of the PAH gene. Furthermore, haplotype analysis could be considered as an auxiliary approach for detecting PKU causative mutations before direct sequencing of the PAH gene by making comparisons between prior detected mutation linked-haplotypes and new PKU case haplotypes with undetermined mutations. In this study, 13 unrelated classical PKU patients took part in the study detecting causative mutations. Mutations were identified by polymerase chain reaction (PCR) and direct sequencing in all patients. After that, haplotype analysis was performed by studying VNTR and PAHSTR markers (linked genetic markers of the PAH gene) through application of PCR and capillary electrophoresis (CE). Mutation analysis was performed successfully and the detected mutations were as follows: c.782G>A, c.754C>T, c.842C>G, c.113-115delTCT, c.688G>A, and c.696A>G. Additionally, PAHSTR/VNTR haplotypes were detected to discover haplotypes linked to each mutation. Mutation detection is the best approach for confirming PAH enzyme deficiency in PKU patients. Due to the relatively large size of the PAH gene and high cost of the direct sequencing in developing countries, haplotype analysis could be used before DNA sequencing and mutation detection for a faster and cheaper way via identifying probable mutated exons.

Mutations in the collagen XII gene define a new form of extracellular matrix-related myopathy.

Science.gov (United States)

Hicks, Debbie; Farsani, Golara Torabi; Laval, Steven; Collins, James; Sarkozy, Anna; Martoni, Elena; Shah, Ashoke; Zou, Yaqun; Koch, Manuel; Bönnemann, Carsten G; Roberts, Mark; Lochmüller, Hanns; Bushby, Kate; Straub, Volker

2014-05-01

Bethlem myopathy (BM) [MIM 158810] is a slowly progressive muscle disease characterized by contractures and proximal weakness, which can be caused by mutations in one of the collagen VI genes (COL6A1, COL6A2 and COL6A3). However, there may be additional causal genes to identify as in ∼50% of BM cases no mutations in the COL6 genes are identified. In a cohort of -24 patients with a BM-like phenotype, we first sequenced 12 candidate genes based on their function, including genes for known binding partners of collagen VI, and those enzymes involved in its correct post-translational modification, assembly and secretion. Proceeding to whole-exome sequencing (WES), we identified mutations in the COL12A1 gene, a member of the FACIT collagens (fibril-associated collagens with interrupted triple helices) in five individuals from two families. Both families showed dominant inheritance with a clinical phenotype resembling classical BM. Family 1 had a single-base substitution that led to the replacement of one glycine residue in the triple-helical domain, breaking the Gly-X-Y repeating pattern, and Family 2 had a missense mutation, which created a mutant protein with an unpaired cysteine residue. Abnormality at the protein level was confirmed in both families by the intracellular retention of collagen XII in patient dermal fibroblasts. The mutation in Family 2 leads to the up-regulation of genes associated with the unfolded protein response (UPR) pathway and swollen, dysmorphic rough-ER. We conclude that the spectrum of causative genes in extracellular matrix (ECM)-related myopathies be extended to include COL12A1.

Population data and mutation rates of 19 STR loci in seven provinces from China based on Goldeneye™ DNA ID System 20A.

Science.gov (United States)

Liu, Qiu-Ling; Chen, Ye-Fei; Huang, Xiao-Ling; Liu, Kai-Yan; Zhao, Hu; Lu, De-Jian

2017-05-01

Short tandem repeat (STR) analysis is a primary tool in forensic casework. Population data and mutation rates of STRs are very important for paternity testing and forensic genetics. However, the population data and mutation rates of STRs in Han nationality based on large samples have still not been fully described in China. In this study, the allelic frequencies, forensic parameters, and mutation rate of 19 STR loci (D19S433, D5S818, D21S11, D18S51, D6S1043, D3S1358, D13S317, D7S820, D16S539, CSFIPO, PentaD, vWA, D8S1179, TPOX, Penta E, TH01, D12S391, D2S1338, and FGA) based on the Goldeneye™ DNA ID System 20A in Southern China Han nationality among seven provinces were investigated. Furthermore, population stratification of Southern China Han nationality among seven provinces was established. The multidimensional scaling (MDS) plot based on genetic distances (Fst) showed that the studied populations can be clustered into two major groups. However, relationships among populations were weak (Fst < 0.0043). A total of 376 cases of mutation were detected from the 19 selected loci in 15,396 meioses. The average mutation rate for the 19 loci was estimated to be 1.3 × 10 -3 per meiosis. The mutation was mainly single step; the paternal mutation rate was higher than the maternal; and paternal mutation rate increases with paternal age.

Bm-muted, orthologous to mouse muted and encoding a subunit of the BLOC-1 complex, is responsible for the otm translucent mutation of the silkworm Bombyx mori.

Science.gov (United States)

Zhang, Haokun; Kiuchi, Takashi; Wang, Lingyan; Kawamoto, Munetaka; Suzuki, Yutaka; Sugano, Sumio; Banno, Yutaka; Katsuma, Susumu; Shimada, Toru

2017-09-20

"Tanaka's mottled translucent" (otm) is a mutation of the silkworm Bombyx mori that exhibits translucent skin during larval stages. We performed positional cloning of the gene responsible for otm and mapped it to a 364-kb region on chromosome 5 that contains 22 hypothetical protein-coding genes. We performed RNA-seq analysis of the epidermis and fat body of otm larvae and determined that the gene BGIBMGA002619 may be responsible for the otm mutation. BGIBMGA002619 encodes the biosynthesis of lysosome-related organelles complex 1 (BLOC-1) subunit 5, whose ortholog is responsible for the Muted mutant in mouse. Accordingly, we named this gene Bm-muted. We discovered that the expression of Bm-muted in the epidermis and fat body of otm mutants was dramatically suppressed compared with the wild type. We determined the nucleotide sequences of the full-length cDNA and genomic region corresponding to Bm-muted and found that a 538-bp long DNA sequence similar to B. mori transposon Organdy was inserted into the 3' end of the first intron of Bm-muted in two otm strains. The Bm-muted cDNA of otm mutants lacked exon 2, and accordingly generated a premature stop codon in exon 3. In addition, short interfering RNA (siRNA)-mediated knockdown of this gene caused localized partial translucency of larval skin. These data indicate that the mutation in Bm-muted caused the otm-mutant phenotype. We propose that the insertion of Organdy caused a splicing disorder in Bm-muted in the otm mutant, resulting in a null mutation of Bm-muted. This mutation is likely to cause deficiencies in urate granule formation in epidermal cells that result in translucent larval skin. Copyright © 2017 Elsevier B.V. All rights reserved.

Weak convergence and uniform normalization in infinitary rewriting

DEFF Research Database (Denmark)

Simonsen, Jakob Grue

2010-01-01

the starkly surprising result that for any orthogonal system with finitely many rules, the system is weakly normalizing under weak convergence if{f} it is strongly normalizing under weak convergence if{f} it is weakly normalizing under strong convergence if{f} it is strongly normalizing under strong...... convergence. As further corollaries, we derive a number of new results for weakly convergent rewriting: Systems with finitely many rules enjoy unique normal forms, and acyclic orthogonal systems are confluent. Our results suggest that it may be possible to recover some of the positive results for strongly...

The Oenothera plastome mutator: effect of UV irradiation and nitroso-methyl urea on mutation frequencies

International Nuclear Information System (INIS)

Sears, B.B.; Sokalski, M.B.

1991-01-01

Oenothera plants homozygous for a recessive plastome mutator allele (pm) showed spontaneous mutation frequencies for plastome genes that are 200-fold higher than spontaneous levels. Mutations occurred at high frequencies in plants grown in the field, in a glasshouse, or as leaf tip cultures under fluorescent light, indicating that the plastome mutator activity is UV-independent. However, the chlorotic sectors became visible at an earlier stage of development when seedlings were irradiated, compared to seedlings that were not exposed to UV. These results imply that the rate of sorting-out was increased by the irradiation treatment, possibly due to a decrease in the effective number of multiplication-competent plastids, or a reduction in the extent of cytoplasmic mixing. Nitroso-methyl urea treatment of seeds had a dramatic effect on mutation frequency in both wild-type and plastome mutator samples. When the background mutation rates were low, the combination of the plastome mutator nucleus and the chemical mutagenesis treatment resulted in a synergistic effect, suggesting that the plastome mutator may involve a cpDNA repair pathway. (author)

Mutations causative of familial hypercholesterolaemia

DEFF Research Database (Denmark)

Benn, Marianne; Watts, Gerald F; Tybjærg-Hansen, Anne

2016-01-01

causing mutations in 98 098 participants from the general population, the Copenhagen General Population Study. METHODS AND RESULTS: We genotyped for LDLR[W23X;W66G;W556S] and APOB[R3500Q] accounting for 38.7% of pathogenic FH mutations in Copenhagen. Clinical FH assessment excluded mutation information......-cholesterol concentration to discriminate between mutation carriers and non-carriers was 4.4 mmol/L. CONCLUSION: Familial hypercholesterolaemia-causing mutations are estimated to occur in 1:217 in the general population and are best identified by a definite or probable phenotypic diagnosis of FH based on the DLCN criteria....... The prevalence of the four FH mutations was 0.18% (1:565), suggesting a total prevalence of FH mutations of 0.46% (1:217). Using the Dutch Lipid Clinic Network (DLCN) criteria, odds ratios for an FH mutation were 439 (95% CI: 170-1 138) for definite FH, 90 (53-152) for probable FH, and 18 (13-25) for possible FH...

Divergence times in Caenorhabditis and Drosophila inferred from direct estimates of the neutral mutation rate.

Science.gov (United States)

Cutter, Asher D

2008-04-01

Accurate inference of the dates of common ancestry among species forms a central problem in understanding the evolutionary history of organisms. Molecular estimates of divergence time rely on the molecular evolutionary prediction that neutral mutations and substitutions occur at the same constant rate in genomes of related species. This underlies the notion of a molecular clock. Most implementations of this idea depend on paleontological calibration to infer dates of common ancestry, but taxa with poor fossil records must rely on external, potentially inappropriate, calibration with distantly related species. The classic biological models Caenorhabditis and Drosophila are examples of such problem taxa. Here, I illustrate internal calibration in these groups with direct estimates of the mutation rate from contemporary populations that are corrected for interfering effects of selection on the assumption of neutrality of substitutions. Divergence times are inferred among 6 species each of Caenorhabditis and Drosophila, based on thousands of orthologous groups of genes. I propose that the 2 closest known species of Caenorhabditis shared a common ancestor <24 MYA (Caenorhabditis briggsae and Caenorhabditis sp. 5) and that Caenorhabditis elegans diverged from its closest known relatives <30 MYA, assuming that these species pass through at least 6 generations per year; these estimates are much more recent than reported previously with molecular clock calibrations from non-nematode phyla. Dates inferred for the common ancestor of Drosophila melanogaster and Drosophila simulans are roughly concordant with previous studies. These revised dates have important implications for rates of genome evolution and the origin of self-fertilization in Caenorhabditis.

Microwave-assisted Weak Acid Hydrolysis of Proteins

Directory of Open Access Journals (Sweden)

Miyeong Seo

2012-06-01

Full Text Available Myoglobin was hydrolyzed by microwave-assisted weak acid hydrolysis with 2% formic acid at 37 oC, 50 oC, and100 oC for 1 h. The most effective hydrolysis was observed at 100 oC. Hydrolysis products were investigated using matrixassistedlaser desorption/ionization time-of-flight mass spectrometry. Most cleavages predominantly occurred at the C-termini ofaspartyl residues. For comparison, weak acid hydrolysis was also performed in boiling water for 20, 40, 60, and 120 min. A 60-min weak acid hydrolysis in boiling water yielded similar results as a 60-min microwave-assisted weak acid hydrolysis at100 oC. These results strongly suggest that microwave irradiation has no notable enhancement effect on acid hydrolysis of proteinsand that temperature is the major factor that determines the effectiveness of weak acid hydrolysis.

Mutator activity in Schizophyllum commune

Energy Technology Data Exchange (ETDEWEB)

Shneyour, Y.; Koltin, Y. (Tel Aviv Univ. (Israel). Dept. of Microbiology)

1983-01-01

A strain with an elevated level of spontaneous mutations and an especially high rate of reversion at a specific locus (pab/sup -/) was identified. The mutator trait is recessive. UV sensitivity and the absence of a UV-specific endonucleolytic activity were associated with the enhancement of the mutation rate in mutator strains. The endonuclease associated with the regulation of the mutation rate also acted on single-stranded DNA. The molecular weight of this enzyme is about 38,000 daltons.

Mutation and premating isolation

Science.gov (United States)

Woodruff, R. C.; Thompson, J. N. Jr

2002-01-01

While premating isolation might be traceable to different genetic mechanisms in different species, evidence supports the idea that as few as one or two genes may often be sufficient to initiate isolation. Thus, new mutation can theoretically play a key role in the process. But it has long been thought that a new isolation mutation would fail, because there would be no other individuals for the isolation-mutation-carrier to mate with. We now realize that premeiotic mutations are very common and will yield a cluster of progeny carrying the same new mutant allele. In this paper, we discuss the evidence for genetically simple premating isolation barriers and the role that clusters of an isolation mutation may play in initiating allopatric, and even sympatric, species divisions.

Diagnosis of functional (psychogenic paresis and weakness

Directory of Open Access Journals (Sweden)

Savkov V.S.

2018-03-01

Full Text Available Functional (conversion neurological symptoms represent one of the most common situations faced by neurologists in their everyday practice. Among them, acute or subacute functional weakness may mimic very prevalent conditions such as stroke or traumatic injury. In the diagnosis of functional weakness, although elements of the history are helpful, physical signs are often of crucial importance in the diagnosis and positive signs are as important as absence of signs of disease. Hence, accurate and reliable positive signs of functional weakness are valuable for obtaining timely diagnosis and treatment, making it possible to avoid unnecessary or invasive tests and procedures up to thrombolysis. Functional weakness commonly presents as weakness of an entire limb, paraparesis, or hemiparesis, with observable or demonstrable inconsistencies and non-anatomic accompaniments. Documentation of limb movements during sleep, the arm drop test, the Babinski’s trunk-thigh test, Hoover tests, the Sonoo abductor test, and various dynamometer tests can provide useful bedside diagnostic information on functional weakness. We therefore present here a brief overview of the positive neurological signs of functional weakness available, both in the lower and in the upper limbs; but none should be used in isolation and must be interpreted in the overall context of the presentation. It should be borne in mind that a patient may have both a functional and an organic disorder.

Mutation profiles of phenylketonuria in Quebec populations: Evidence of stratification and novel mutations

Energy Technology Data Exchange (ETDEWEB)

Rozen, R.; Mascisch, A.; Scriver, C.R. (McGill Univ., Montreal (Canada)); Lambert, M. (Hopital Ste-Justine, Montreal (Canada)); Laframboise, R. (Centre Hospitalier Universite Laval, Quebec (Canada))

1994-08-01

Independent phenylketonuria (PKU) chromosomes (n=109) representing 80% of a proband cohort in Quebec province carry 18 different identified mutations in 20 different mutation/haplotype combinations. The study reported here, the third in a series on Quebec populations, was done in the Montreal region and predominantly on French Canadians. It has identified three novel mutations (A309D, D338Y, and 1054/1055delG [352fs]) and one unusual mutation/RFLP haplotype combination (E280K on Hp 2). The relative frequencies and distribution of PKU mutations were then compared in three regions and population subsets (eastern Quebec, French Canadian; western Quebec, French Canadian; and Montreal, non-French Canadian). The distributions of the prevalent and rare mutations are nonrandom and provide evidence for genetic stratification. The latter and the presence of eight unusual mutation/haplotype combinations in Quebec families with European ancestries (the aforementioned four and M1V, 165T, S349P, and R408W on Hp 1) corroborate demographic and anthropologic evidence, from elsewhere, for different origins of French Canadians in eastern and western Quebec. 29 refs., 1 fig., 1 tab.

Reassessment of the putative role of BLK-p.A71T loss-of-function mutation in MODY and type 2 diabetes.

Science.gov (United States)

Bonnefond, A; Yengo, L; Philippe, J; Dechaume, A; Ezzidi, I; Vaillant, E; Gjesing, A P; Andersson, E A; Czernichow, S; Hercberg, S; Hadjadj, S; Charpentier, G; Lantieri, O; Balkau, B; Marre, M; Pedersen, O; Hansen, T; Froguel, P; Vaxillaire, M

2013-03-01

MODY is believed to be caused by at least 13 different genes. Five rare mutations at the BLK locus, including only one non-synonymous p.A71T variant, were reported to segregate with diabetes in three MODY families. The p.A71T mutation was shown to abolish the enhancing effect of BLK on insulin content and secretion from pancreatic beta cell lines. Here, we reassessed the contribution of BLK to MODY and tested the effect of BLK-p.A71T on type 2 diabetes risk and variations in related traits. BLK was sequenced in 64 unelucidated MODY samples. The BLK-p.A71T variant was genotyped in a French type 2 diabetes case-control study including 4,901 cases and 4,280 controls, and in the DESIR (Data from an Epidemiological Study on the Insulin Resistance Syndrome) and SUVIMAX (Supplementation en Vitamines et Mineraux Antioxydants) population-based cohorts (n = 6,905). The variant effects were assessed by logistic and linear regression models. No rare non-synonymous BLK mutations were found in the MODY patients. The BLK p.A71T mutation was present in 52 normoglycaemic individuals, making it very unlikely that this loss-of-function mutation causes highly penetrant MODY. We found a nominal association between this variant and increased type 2 diabetes risk, with an enrichment of the mutation in the obese diabetic patients, although no significant association with BMI was identified. No mutation in BLK was found in our MODY cohort. From our findings, the BLK-p.A71T mutation may weakly influence type 2 diabetes risk in the context of obesity; however, this will require further validation.

KRAS mutation is a predictor of oxaliplatin sensitivity in colon cancer cells.

Directory of Open Access Journals (Sweden)

Yu-Lin Lin

Full Text Available Molecular biomarkers to determine the effectiveness of targeted therapies in cancer treatment have been widely adopted in colorectal cancer (CRC, but those to predict chemotherapy sensitivity remain poorly defined. We tested our hypothesis that KRAS mutation may be a predictor of oxaliplatin sensitivity in CRC. KRAS was knocked-down in KRAS-mutant CRC cells (DLD-1(G13D and SW480(G12V by small interfering RNAs (siRNA and overexpressed in KRAS-wild-type CRC cells (COLO320DM by KRAS-mutant vectors to generate paired CRC cells. These paired CRC cells were tested by oxaliplatin, irinotecan and 5FU to determine the change in drug sensitivity by MTT assay and flow cytometry. Reasons for sensitivity alteration were further determined by western blot and real-time quantitative reverse transcriptase polymerase chain reaction (qRT -PCR. In KRAS-wild-type CRC cells (COLO320DM, KRAS overexpression by mutant vectors caused excision repair cross-complementation group 1 (ERCC1 downregulation in protein and mRNA levels, and enhanced oxaliplatin sensitivity. In contrast, in KRAS-mutant CRC cells (DLD-1(G13D and SW480(G12V, KRAS knocked-down by KRAS-siRNA led to ERCC1 upregulation and increased oxaliplatin resistance. The sensitivity of irinotecan and 5FU had not changed in the paired CRC cells. To validate ERCC1 as a predictor of sensitivity for oxaliplatin, ERCC1 was knocked-down by siRNA in KRAS-wild-type CRC cells, which restored oxaliplatin sensitivity. In contrast, ERCC1 was overexpressed by ERCC1-expressing vectors in KRAS-mutant CRC cells, and caused oxaliplatin resistance. Overall, our findings suggest that KRAS mutation is a predictor of oxaliplatin sensitivity in colon cancer cells by the mechanism of ERCC1 downregulation.

Variable myopathic presentation in a single family with novel skeletal RYR1 mutation.

Directory of Open Access Journals (Sweden)

Ruben Attali

Full Text Available We describe an autosomal recessive heterogeneous congenital myopathy in a large consanguineous family. The disease is characterized by variable severity, progressive course in 3 of 4 patients, myopathic face without ophthalmoplegia and proximal muscle weakness. Absence of cores was noted in all patients. Genome wide linkage analysis revealed a single locus on chromosome 19q13 with Zmax = 3.86 at θ = 0.0 and homozygosity of the polymorphic markers at this locus in patients. Direct sequencing of the main candidate gene within the candidate region, RYR1, was performed. A novel homozygous A to G nucleotide substitution (p.Y3016C within exon 60 of the RYR1 gene was found in patients. ARMS PCR was used to screen for the mutation in all available family members and in an additional 150 healthy individuals. This procedure confirmed sequence analysis and did not reveal the A to G mutation (p.Y3016C in 300 chromosomes from healthy individuals. Functional analysis on EBV immortalized cell lines showed no effect of the mutation on RyR1 pharmacological activation or the content of intracellular Ca(2+ stores. Western blot analysis demonstrated a significant reduction of the RyR1 protein in the patient's muscle concomitant with a reduction of the DHPRα1.1 protein. This novel mutation resulting in RyR1 protein decrease causes heterogeneous clinical presentation, including slow progression course and absence of centrally localized cores on muscle biopsy. We suggest that RYR1 related myopathy should be considered in a wide variety of clinical and pathological presentation in childhood myopathies.

Mutation-specific effects on thin filament length in thin filament myopathy.

Science.gov (United States)

Winter, Josine M de; Joureau, Barbara; Lee, Eun-Jeong; Kiss, Balázs; Yuen, Michaela; Gupta, Vandana A; Pappas, Christopher T; Gregorio, Carol C; Stienen, Ger J M; Edvardson, Simon; Wallgren-Pettersson, Carina; Lehtokari, Vilma-Lotta; Pelin, Katarina; Malfatti, Edoardo; Romero, Norma B; Engelen, Baziel G van; Voermans, Nicol C; Donkervoort, Sandra; Bönnemann, C G; Clarke, Nigel F; Beggs, Alan H; Granzier, Henk; Ottenheijm, Coen A C

2016-06-01

Thin filament myopathies are among the most common nondystrophic congenital muscular disorders, and are caused by mutations in genes encoding proteins that are associated with the skeletal muscle thin filament. Mechanisms underlying muscle weakness are poorly understood, but might involve the length of the thin filament, an important determinant of force generation. We investigated the sarcomere length-dependence of force, a functional assay that provides insights into the contractile strength of muscle fibers as well as the length of the thin filaments, in muscle fibers from 51 patients with thin filament myopathy caused by mutations in NEB, ACTA1, TPM2, TPM3, TNNT1, KBTBD13, KLHL40, and KLHL41. Lower force generation was observed in muscle fibers from patients of all genotypes. In a subset of patients who harbor mutations in NEB and ACTA1, the lower force was associated with downward shifted force-sarcomere length relations, indicative of shorter thin filaments. Confocal microscopy confirmed shorter thin filaments in muscle fibers of these patients. A conditional Neb knockout mouse model, which recapitulates thin filament myopathy, revealed a compensatory mechanism; the lower force generation that was associated with shorter thin filaments was compensated for by increasing the number of sarcomeres in series. This allowed muscle fibers to operate at a shorter sarcomere length and maintain optimal thin-thick filament overlap. These findings might provide a novel direction for the development of therapeutic strategies for thin filament myopathy patients with shortened thin filament lengths. Ann Neurol 2016;79:959-969. © 2016 American Neurological Association.

Relative entropies, suitable weak solutions, and weak-strong uniqueness for the compressible Navier–Stokes system

Czech Academy of Sciences Publication Activity Database

Feireisl, Eduard; Jin, B.J.; Novotný, A.

2012-01-01

Roč. 14, č. 4 (2012), s. 717-730 ISSN 1422-6928 R&D Projects: GA ČR GA201/09/0917 Institutional research plan: CEZ:AV0Z10190503 Keywords : suitable weak solution * weak-strong uniqueness * compressible Navier-Stokes system Subject RIV: BA - General Mathematics Impact factor: 1.415, year: 2012 http://link.springer.com/article/10.1007%2Fs00021-011-0091-9

Better plants through mutations

International Nuclear Information System (INIS)

1988-01-01

This is a public relations film describing problems associated with the genetic improvement of crop plants through induced mutations. Mutations are the ultimate source of genetic variation in plants. Mutation induction is now established as a practical tool in plant breeding. The Joint FAO/IAEA Division and the IAEA's laboratory at Seibersdorf have supported research and practical implementation of mutation breeding of both seed propagated and vegetatively propagated plants. Plant biotechnology based on in vitro culture and recombinant DNA technology will make a further significant contribution to plant breeding

Attending to weak signals: the leader's challenge.

Science.gov (United States)

Kerfoot, Karlene

2005-12-01

Halverson and Isham (2003) quote sources that report the accidental death rate of simply being in a hospital is " ... four hundred times more likely than your risk of death from traveling by train, forty times higher than driving a car, and twenty times higher than flying in a commercial aircraft" (p. 13). High-reliability organizations such as nuclear power plants and aircraft carriers have been pioneers in the business of recognizing weak signals. Weike and Sutcliffe (2001) note that high-reliability organizations distinguish themselves from others because of their mindfulness which enables them to see the significance of weak signals and to give strong interventions to weak signals. To act mindfully, these organizations have an underlying mental model of continually updating, anticipating, and focusing the possibility of failure using the intelligence that weak signals provides. Much of what happens is unexpected in health care. However, with a culture that is continually looking for weak signals, and intervenes and rescues when these signals are detected, the unexpected happens less often. This is the epitome of how leaders can build a culture of safety that focuses on recognizing the weak signals to manage the unforeseen.

Extrapolating Weak Selection in Evolutionary Games

Science.gov (United States)

Wu, Bin; García, Julián; Hauert, Christoph; Traulsen, Arne

2013-01-01

In evolutionary games, reproductive success is determined by payoffs. Weak selection means that even large differences in game outcomes translate into small fitness differences. Many results have been derived using weak selection approximations, in which perturbation analysis facilitates the derivation of analytical results. Here, we ask whether results derived under weak selection are also qualitatively valid for intermediate and strong selection. By “qualitatively valid” we mean that the ranking of strategies induced by an evolutionary process does not change when the intensity of selection increases. For two-strategy games, we show that the ranking obtained under weak selection cannot be carried over to higher selection intensity if the number of players exceeds two. For games with three (or more) strategies, previous examples for multiplayer games have shown that the ranking of strategies can change with the intensity of selection. In particular, rank changes imply that the most abundant strategy at one intensity of selection can become the least abundant for another. We show that this applies already to pairwise interactions for a broad class of evolutionary processes. Even when both weak and strong selection limits lead to consistent predictions, rank changes can occur for intermediate intensities of selection. To analyze how common such games are, we show numerically that for randomly drawn two-player games with three or more strategies, rank changes frequently occur and their likelihood increases rapidly with the number of strategies . In particular, rank changes are almost certain for , which jeopardizes the predictive power of results derived for weak selection. PMID:24339769

Predictable Phenotypes of Antibiotic Resistance Mutations.

Science.gov (United States)

Knopp, M; Andersson, D I

2018-05-15

Antibiotic-resistant bacteria represent a major threat to our ability to treat bacterial infections. Two factors that determine the evolutionary success of antibiotic resistance mutations are their impact on resistance level and the fitness cost. Recent studies suggest that resistance mutations commonly show epistatic interactions, which would complicate predictions of their stability in bacterial populations. We analyzed 13 different chromosomal resistance mutations and 10 host strains of Salmonella enterica and Escherichia coli to address two main questions. (i) Are there epistatic interactions between different chromosomal resistance mutations? (ii) How does the strain background and genetic distance influence the effect of chromosomal resistance mutations on resistance and fitness? Our results show that the effects of combined resistance mutations on resistance and fitness are largely predictable and that epistasis remains rare even when up to four mutations were combined. Furthermore, a majority of the mutations, especially target alteration mutations, demonstrate strain-independent phenotypes across different species. This study extends our understanding of epistasis among resistance mutations and shows that interactions between different resistance mutations are often predictable from the characteristics of the individual mutations. IMPORTANCE The spread of antibiotic-resistant bacteria imposes an urgent threat to public health. The ability to forecast the evolutionary success of resistant mutants would help to combat dissemination of antibiotic resistance. Previous studies have shown that the phenotypic effects (fitness and resistance level) of resistance mutations can vary substantially depending on the genetic context in which they occur. We conducted a broad screen using many different resistance mutations and host strains to identify potential epistatic interactions between various types of resistance mutations and to determine the effect of strain

Revertant mutation releases confined lethal mutation, opening Pandora's box: a novel genetic pathogenesis.

Directory of Open Access Journals (Sweden)

Yasushi Ogawa

2014-05-01

Full Text Available When two mutations, one dominant pathogenic and the other "confining" nonsense, coexist in the same allele, theoretically, reversion of the latter may elicit a disease, like the opening of Pandora's box. However, cases of this hypothetical pathogenic mechanism have never been reported. We describe a lethal form of keratitis-ichthyosis-deafness (KID syndrome caused by the reversion of the GJB2 nonsense mutation p.Tyr136X that would otherwise have confined the effect of another dominant lethal mutation, p.Gly45Glu, in the same allele. The patient's mother had the identical misssense mutation which was confined by the nonsense mutation. The biological relationship between the parents and the child was confirmed by genotyping of 15 short tandem repeat loci. Haplotype analysis using 40 SNPs spanning the >39 kbp region surrounding the GJB2 gene and an extended SNP microarray analysis spanning 83,483 SNPs throughout chromosome 13 in the family showed that an allelic recombination event involving the maternal allele carrying the mutations generated the pathogenic allele unique to the patient, although the possibility of coincidental accumulation of spontaneous point mutations cannot be completely excluded. Previous reports and our mutation screening support that p.Gly45Glu is in complete linkage disequilibrium with p.Tyr136X in the Japanese population. Estimated from statisitics in the literature, there may be approximately 11,000 p.Gly45Glu carriers in the Japanese population who have this second-site confining mutation, which acts as natural genetic protection from the lethal disease. The reversion-triggered onset of the disesase shown in this study is a previously unreported genetic pathogenesis based on Mendelian inheritance.

Weak value distributions for spin 1/2

Science.gov (United States)

Berry, M. V.; Dennis, M. R.; McRoberts, B.; Shukla, P.

2011-05-01

The simplest weak measurement is of a component of spin 1/2. For this observable, the probability distributions of the real and imaginary parts of the weak value, and their joint probability distribution, are calculated exactly for pre- and postselected states uniformly distributed over the surface of the Poincaré-Bloch sphere. The superweak probability, that the real part of the weak value lies outside the spectral range, is 1/3. This case, with just two eigenvalues, complements our previous calculation (Berry and Shukla 2010 J. Phys. A: Math. Theor. 43 354024) of the universal form of the weak value probability distribution for an operator with many eigenvalues.

Weak value distributions for spin 1/2

International Nuclear Information System (INIS)

Berry, M V; Dennis, M R; McRoberts, B; Shukla, P

2011-01-01

The simplest weak measurement is of a component of spin 1/2. For this observable, the probability distributions of the real and imaginary parts of the weak value, and their joint probability distribution, are calculated exactly for pre- and postselected states uniformly distributed over the surface of the Poincare-Bloch sphere. The superweak probability, that the real part of the weak value lies outside the spectral range, is 1/3. This case, with just two eigenvalues, complements our previous calculation (Berry and Shukla 2010 J. Phys. A: Math. Theor. 43 354024) of the universal form of the weak value probability distribution for an operator with many eigenvalues.

Interferência de ferro na dosagem de boro no solo com azometina-H em soluções extratoras ácidas

Directory of Open Access Journals (Sweden)

Ferreira Gilvan Barbosa

2002-01-01

Full Text Available A busca de métodos que permitam a extração do boro para avaliação da fertilidade do solo para a recomendação de adubação é importante, devido aos baixos teores de boro e aos altos teores de Fe na maioria dos solos brasileiros. A extração com água quente, método-referência, é trabalhosa e apresenta dificuldades operacionais. Por outro lado, soluções de CaCl2 5 mmol/L e BaCl2.2H2O 5 mmol/L são usadas com sucesso. O objetivo deste trabalho foi testar a eficiência do ácido tioglicólico na eliminação da interferência do Fe na dosagem de B do solo com azometina-H, após extrações com soluções ácidas de Mehlich-1 e HCl (50 e 100 mmol/L. Dosagem com azometina-H, com e sem ácido tioglicólico, foram feitas para oito solos de Minas Gerais e dois solos do Mato Grosso do Sul. Foi utilizada como referência, a extração com BaCl2.2H2O 5 mmol/L, com aquecimento em forno de microondas e dosagem com azometina-H; a determinação de B com azometina-H em extratos originados de soluções ácidas sofre forte interferência do Fe. A adição do ácido tioglicólico não remove esta interferência. A coloração do complexo B-azometina-H fica menos estável com a adição do ácido tioglicólico na dosagem do boro.

A case report: Becker muscular dystrophy presenting with epilepsy and dysgnosia induced by duplication mutation of Dystrophin gene.

Science.gov (United States)

Miao, Jing; Feng, Jia-Chun; Zhu, Dan; Yu, Xue-Fan

2016-12-12

Becker muscular dystrophy (BMD), a genetic disorder of X-linked recessive inheritance, typically presents with gradually progressive muscle weakness. The condition is caused by mutations of Dystrophin gene located at Xp21.2. Epilepsy is an infrequent manifestation of BMD, while cases of BMD with dysgnosia are extremely rare. We describe a 9-year-old boy with BMD, who presented with epilepsy and dysgnosia. Serum creatine kinase level was markedly elevated (3665 U/L). Wechsler intelligence tests showed a low intelligence quotient (IQ = 65). Electromyogram showed slight myogenic changes and skeletal muscle biopsy revealed muscular dystrophy. Immunohistochemical staining showed partial positivity of sarcolemma for dystrophin-N. Multiplex ligation-dependent probe amplification revealed a duplication mutation in exons 37-44 in the Dystrophin gene. The present case report helps to better understand the clinical and genetic features of BMD.

Optimization of strong and weak coordinates

NARCIS (Netherlands)

Swart, M.; Bickelhaupt, F.M.

2006-01-01

We present a new scheme for the geometry optimization of equilibrium and transition state structures that can be used for both strong and weak coordinates. We use a screening function that depends on atom-pair distances to differentiate strong coordinates from weak coordinates. This differentiation

The Q{sup p}{sub Weak} experiment

Energy Technology Data Exchange (ETDEWEB)

Androic, D. [University of Zagreb (Croatia); Armstrong, D. S. [The College of William and Mary (United States); Asaturyan, A. [Yerevan Physics Institute (Armenia); Averett, T. [The College of William and Mary (United States); Balewski, J. [Massachusetts Institute of Technology (United States); Beaufait, J. [Thomas Jefferson National Accelerator Facility (United States); Beminiwattha, R. S. [Ohio University (United States); Benesch, J. [Thomas Jefferson National Accelerator Facility (United States); Benmokhtar, F. [Duquesne University (United States); Birchall, J. [University of Manitoba (Canada); Carlini, R. D.; Cornejo, J. C. [The College of William and Mary (United States); Covrig, S. [Thomas Jefferson National Accelerator Facility (United States); Dalton, M. M. [University of Virginia (United States); Davis, C. A. [TRIUMF (United States); Deconinck, W. [The College of William and Mary (United States); Diefenbach, J. [Hampton University (United States); Dow, K. [Massachusetts Institute of Technology (United States); Dowd, J. F. [The College of William and Mary (United States); Dunne, J. A. [Mississippi State University (United States); and others

2013-03-15

In May 2012, the Q{sup p}{sub Weak} collaboration completed a two year measurement program to determine the weak charge of the proton Q{sub W}{sup p} = ( 1 - 4sin{sup 2}{theta}{sub W}) at the Thomas Jefferson National Accelerator Facility (TJNAF). The experiment was designed to produce a 4.0 % measurement of the weak charge, via a 2.5 % measurement of the parity violating asymmetry in the number of elastically scattered 1.165 GeV electrons from protons, at forward angles. At the proposed precision, the experiment would produce a 0.3 % measurement of the weak mixing angle at a momentum transfer of Q{sup 2} = 0.026 GeV{sup 2}, making it the most precise stand alone measurement of the weak mixing angle at low momentum transfer. In combination with other parity measurements, Q{sup p}{sub Weak} will also provide a high precision determination of the weak charges of the up and down quarks. At the proposed precision, a significant deviation from the Standard Model prediction could be a signal of new physics at mass scales up to Asymptotically-Equal-To 6 TeV, whereas agreement would place new and significant constraints on possible Standard Model extensions at mass scales up to Asymptotically-Equal-To 2 TeV. This paper provides an overview of the physics and the experiment, as well as a brief look at some preliminary diagnostic and analysis data.

Weakly Coretractable Modules

Science.gov (United States)

Hadi, Inaam M. A.; Al-aeashi, Shukur N.

2018-05-01

If R is a ring with identity and M is a unitary right R-module. Here we introduce the class of weakly coretractable module. Some basic properties are investigated and some relationships between these modules and other related one are introduced.

S-parameters for weakly excited slots

DEFF Research Database (Denmark)

Albertsen, Niels Christian

1999-01-01

A simple approach to account for parasitic effects in weakly excited slots cut in the broad wall of a rectangular waveguide is proposed......A simple approach to account for parasitic effects in weakly excited slots cut in the broad wall of a rectangular waveguide is proposed...

Targeted next-generation sequencing extends the phenotypic and mutational spectrums for EYS mutations.

Science.gov (United States)

Gu, Shun; Tian, Yuanyuan; Chen, Xue; Zhao, Chen

2016-01-01

We aim to determine genetic lesions with a phenotypic correlation in four Chinese families with autosomal recessive retinitis pigmentosa (RP). Medical histories were carefully reviewed. All patients received comprehensive ophthalmic evaluations. The next-generation sequencing (NGS) approach targeting a panel of 205 retinal disease-relevant genes and 15 candidate genes was selectively performed on probands from the four recruited families for mutation detection. Online predictive software and crystal structure modeling were also applied to test the potential pathogenic effects of identified mutations. Of the four families, two were diagnosed with RP sino pigmento (RPSP). Patients with RPSP claimed to have earlier RP age of onset but slower disease progression. Five mutations in the eyes shut homolog (EYS) gene, involving two novel (c.7228+1G>A and c.9248G>A) and three recurrent mutations (c.4957dupA, c.6416G>A and c.6557G>A), were found as RP causative in the four families. The missense variant c.5093T>C was determined to be a variant of unknown significance (VUS) due to the variant's colocalization in the same allele with the reported pathogenic mutation c.6416G>A. The two novel variants were further confirmed absent in 100 unrelated healthy controls. Online predictive software indicated potential pathogenicity of the three missense mutations. Further, crystal structural modeling suggested generation of two abnormal hydrogen bonds by the missense mutation p.G2186E (c.6557G>A) and elongation of its neighboring β-sheet induced by p.G3083D (c.9248G>A), which could alter the tertiary structure of the eys protein and thus interrupt its physicochemical properties. Taken together, with the targeted NGS approach, we reveal novel EYS mutations and prove the efficiency of targeted NGS in the genetic diagnoses of RP. We also first report the correlation between EYS mutations and RPSP. The genotypic-phenotypic relationship in all Chinese patients carrying mutations in the EYS

Survival and weak chaos.

Science.gov (United States)

Nee, Sean

2018-05-01

Survival analysis in biology and reliability theory in engineering concern the dynamical functioning of bio/electro/mechanical units. Here we incorporate effects of chaotic dynamics into the classical theory. Dynamical systems theory now distinguishes strong and weak chaos. Strong chaos generates Type II survivorship curves entirely as a result of the internal operation of the system, without any age-independent, external, random forces of mortality. Weak chaos exhibits (a) intermittency and (b) Type III survivorship, defined as a decreasing per capita mortality rate: engineering explicitly defines this pattern of decreasing hazard as 'infant mortality'. Weak chaos generates two phenomena from the normal functioning of the same system. First, infant mortality- sensu engineering-without any external explanatory factors, such as manufacturing defects, which is followed by increased average longevity of survivors. Second, sudden failure of units during their normal period of operation, before the onset of age-dependent mortality arising from senescence. The relevance of these phenomena encompasses, for example: no-fault-found failure of electronic devices; high rates of human early spontaneous miscarriage/abortion; runaway pacemakers; sudden cardiac death in young adults; bipolar disorder; and epilepsy.

The Splicing Efficiency of Activating HRAS Mutations Can Determine Costello Syndrome Phenotype and Frequency in Cancer.

Directory of Open Access Journals (Sweden)

Anne-Mette Hartung

2016-05-01

Full Text Available Costello syndrome (CS may be caused by activating mutations in codon 12/13 of the HRAS proto-oncogene. HRAS p.Gly12Val mutations have the highest transforming activity, are very frequent in cancers, but very rare in CS, where they are reported to cause a severe, early lethal, phenotype. We identified an unusual, new germline p.Gly12Val mutation, c.35_36GC>TG, in a 12-year-old boy with attenuated CS. Analysis of his HRAS cDNA showed high levels of exon 2 skipping. Using wild type and mutant HRAS minigenes, we confirmed that c.35_36GC>TG results in exon 2 skipping by simultaneously disrupting the function of a critical Exonic Splicing Enhancer (ESE and creation of an Exonic Splicing Silencer (ESS. We show that this vulnerability of HRAS exon 2 is caused by a weak 3' splice site, which makes exon 2 inclusion dependent on binding of splicing stimulatory proteins, like SRSF2, to the critical ESE. Because the majority of cancer- and CS- causing mutations are located here, they affect splicing differently. Therefore, our results also demonstrate that the phenotype in CS and somatic cancers is not only determined by the different transforming potentials of mutant HRAS proteins, but also by the efficiency of exon 2 inclusion resulting from the different HRAS mutations. Finally, we show that a splice switching oligonucleotide (SSO that blocks access to the critical ESE causes exon 2 skipping and halts proliferation of cancer cells. This unravels a potential for development of new anti-cancer therapies based on SSO-mediated HRAS exon 2 skipping.

Enhancing QKD security with weak measurements

Science.gov (United States)

Farinholt, Jacob M.; Troupe, James E.

2016-10-01

Publisher's Note: This paper, originally published on 10/24/2016, was replaced with a corrected/revised version on 11/8/2016. If you downloaded the original PDF but are unable to access the revision, please contact SPIE Digital Library Customer Service for assistance. In the late 1980s, Aharonov and colleagues developed the notion of a weak measurement of a quantum observable that does not appreciably disturb the system.1, 2 The measurement results are conditioned on both the pre-selected and post-selected state of the quantum system. While any one measurement reveals very little information, by making the same measurement on a large ensemble of identically prepared pre- and post-selected (PPS) states and averaging the results, one may obtain what is known as the weak value of the observable with respect to that PPS ensemble. Recently, weak measurements have been proposed as a method of assessing the security of QKD in the well-known BB84 protocol.3 This weak value augmented QKD protocol (WV-QKD) works by additionally requiring the receiver, Bob, to make a weak measurement of a particular observable prior to his strong measurement. For the subset of measurement results in which Alice and Bob's measurement bases do not agree, the weak measurement results can be used to detect any attempt by an eavesdropper, Eve, to correlate her measurement results with Bob's. Furthermore, the well-known detector blinding attacks, which are known to perfectly correlate Eve's results with Bob's without being caught by conventional BB84 implementations, actually make the eavesdropper more visible in the new WV-QKD protocol. In this paper, we will introduce the WV-QKD protocol and discuss its generalization to the 6-state single qubit protocol. We will discuss the types of weak measurements that are optimal for this protocol, and compare the predicted performance of the 6- and 4-state WV-QKD protocols.

Mutation risk associated with paternal and maternal age in a cohort of retinoblastoma survivors.

Science.gov (United States)

Mills, Melissa B; Hudgins, Louanne; Balise, Raymond R; Abramson, David H; Kleinerman, Ruth A

2012-07-01

paternal age, but these findings were not statistically significant (de novo vs. sporadic ORs 30-34 = 1.7 [0.7-4], ≥ 35 = 1.3 [0.5-3.3]; de novo vs. familial ORs 30-34 = 2.8 [1.0-8.4], ≥ 35 = 1.6 [0.6-4.6]). Our study suggests a weak paternal age effect for Rb resulting from de novo germline mutations consistent with the paternal origin of most of these mutations.

Identification of Four New agr Quorum Sensing-Interfering Cyclodepsipeptides from a Marine Photobacterium

Directory of Open Access Journals (Sweden)

Louise Kjaerulff

2013-12-01

Full Text Available During our search for new natural products from the marine environment, we discovered a wide range of cyclic peptides from a marine Photobacterium, closely related to P. halotolerans. The chemical fingerprint of the bacterium showed primarily non-ribosomal peptide synthetase (NRPS-like compounds, including the known pyrrothine antibiotic holomycin and a wide range of peptides, from diketopiperazines to cyclodepsipeptides of 500–900 Da. Purification of components from the pellet fraction led to the isolation and structure elucidation of four new cyclodepsipeptides, ngercheumicin F, G, H, and I. The ngercheumicins interfered with expression of virulence genes known to be controlled by the agr quorum sensing system of Staphylococcus aureus, although to a lesser extent than the previously described solonamides from the same strain of Photobacterium.

Exploring the common molecular basis for the universal DNA mutation bias: Revival of Loewdin mutation model

International Nuclear Information System (INIS)

Fu, Liang-Yu; Wang, Guang-Zhong; Ma, Bin-Guang; Zhang, Hong-Yu

2011-01-01

Highlights: → There exists a universal G:C → A:T mutation bias in three domains of life. → This universal mutation bias has not been sufficiently explained. → A DNA mutation model proposed by Loewdin 40 years ago offers a common explanation. -- Abstract: Recently, numerous genome analyses revealed the existence of a universal G:C → A:T mutation bias in bacteria, fungi, plants and animals. To explore the molecular basis for this mutation bias, we examined the three well-known DNA mutation models, i.e., oxidative damage model, UV-radiation damage model and CpG hypermutation model. It was revealed that these models cannot provide a sufficient explanation to the universal mutation bias. Therefore, we resorted to a DNA mutation model proposed by Loewdin 40 years ago, which was based on inter-base double proton transfers (DPT). Since DPT is a fundamental and spontaneous chemical process and occurs much more frequently within GC pairs than AT pairs, Loewdin model offers a common explanation for the observed universal mutation bias and thus has broad biological implications.

Mutations near the cleavage site of enterocin NKR-5-3B prepeptide reveal new insights into its biosynthesis.

Science.gov (United States)

Perez, Rodney H; Sugino, Haruki; Ishibashi, Naoki; Zendo, Takeshi; Wilaipun, Pongtep; Leelawatcharamas, Vichien; Nakayama, Jiro; Sonomoto, Kenji

2017-04-01

Enterocin NKR-5-3B (Ent53B) is a 64-residue novel circular bacteriocin synthesized from an 87-residue prepeptide. Albeit through a still unknown mechanism, the EnkB1234 biosynthetic enzyme complex processes the prepeptide to yield its mature active, circular form. To gain insights into the key region/residue that plays a role in Ent53 maturation, several mutations near the cleavage site on the precursor peptide were generated. The interaction of the precursor peptide and EnkB1234 appeared to be hydrophobic in nature. At the Leu1 position, only mutations with helix structure-promoting hydrophobic residues (Ala, Ile, Val or Phe) were able to yield the mature Ent53B derivative. In this study, we also highlight the possible conformation-stabilizing role of the Ent53B leader peptide on the precursor peptide for its interaction with its biosynthetic enzyme complex. Any truncations of the leader peptide moiety interfered in the processing of the prepeptide. However, when propeptides of other circular bacteriocins (circularin A, leucocyclicin Q or lactocyclicin Q) were cloned at the C-terminus of the leader peptide, EnkB1234 could not process them to yield a mature bacteriocin. Taken together, these findings offer new perspectives in our understanding of the possible molecular mechanism of the biosynthesis of this circular bacteriocin. These new perspectives will help advance our current understanding to eventually elucidate circular bacteriocin biosynthesis. Understanding the biosynthetic mechanism of circular bacteriocins will materialize their application potential.

Vascular-type Ehlers-Danlos syndrome caused by a hitherto unknown genetic mutation: a case report

Directory of Open Access Journals (Sweden)

Kashizaki Fumihiro

2013-02-01

Full Text Available Abstract Introduction Vascular-type Ehlers-Danlos syndrome is an autosomal dominant disease that causes arterial spurting, intestinal perforation, uterine rupture and hemopneumothorax due to decreased production of type III collagen. The average age at death is 48 years old, and it is considered to be the most severe form of Ehlers-Danlos syndrome. We report the case of a 64-year-old Japanese woman and her 38-year-old daughter who were diagnosed with this disease. Case presentation A 64-year-old Japanese woman was referred to our hospital because of right anterior chest pain following cough and pharyngeal discomfort. Pleurisy was suspected due to the presence of right pleural effusion, so the next day she was referred to our department, where a detailed examination led to the diagnosis of hemothorax. The bleeding that caused the right hemothorax was difficult to control, so our patient was transferred to the Department of Thoracic Surgery for hemostasis control. Our patient’s personal history of uterine hemorrhage and skin ulcers, as well as the finding of skin fragility during surgery, were indicative of a weak connective tissue disease; therefore, after improvement of the hemothorax, a genetic analysis was performed. This revealed a heterozygous missense mutation in COL3A1, c.2411 G>T p.Gly804Val (exon 36. A detailed investigation conducted at a later date revealed that her daughter also had the same genetic mutation. This led to the diagnosis of vascular-type Ehlers-Danlos syndrome characterized by a new gene mutation. Conclusion We report a new genetic mutation associated with vascular-type Ehlers-Danlos syndrome. We present the clinical and imaging findings, and the disease and treatment course in this patient. We believe this information will be important in treating future cases of vascular-type Ehlers-Danlos syndrome in patients with this mutation.

Mitochondrial DNA mutations in mutator mice confer respiration defects and B-cell lymphoma development.

Directory of Open Access Journals (Sweden)

Takayuki Mito

Full Text Available Mitochondrial DNA (mtDNA mutator mice are proposed to express premature aging phenotypes including kyphosis and hair loss (alopecia due to their carrying a nuclear-encoded mtDNA polymerase with a defective proofreading function, which causes accelerated accumulation of random mutations in mtDNA, resulting in expression of respiration defects. On the contrary, transmitochondrial mito-miceΔ carrying mtDNA with a large-scale deletion mutation (ΔmtDNA also express respiration defects, but not express premature aging phenotypes. Here, we resolved this discrepancy by generating mtDNA mutator mice sharing the same C57BL/6J (B6J nuclear background with that of mito-miceΔ. Expression patterns of premature aging phenotypes are very close, when we compared between homozygous mtDNA mutator mice carrying a B6J nuclear background and selected mito-miceΔ only carrying predominant amounts of ΔmtDNA, in their expression of significant respiration defects, kyphosis, and a short lifespan, but not the alopecia. Therefore, the apparent discrepancy in the presence and absence of premature aging phenotypes in mtDNA mutator mice and mito-miceΔ, respectively, is partly the result of differences in the nuclear background of mtDNA mutator mice and of the broad range of ΔmtDNA proportions of mito-miceΔ used in previous studies. We also provided direct evidence that mtDNA abnormalities in homozygous mtDNA mutator mice are responsible for respiration defects by demonstrating the co-transfer of mtDNA and respiration defects from mtDNA mutator mice into mtDNA-less (ρ(0 mouse cells. Moreover, heterozygous mtDNA mutator mice had a normal lifespan, but frequently developed B-cell lymphoma, suggesting that the mtDNA abnormalities in heterozygous mutator mice are not sufficient to induce a short lifespan and aging phenotypes, but are able to contribute to the B-cell lymphoma development during their prolonged lifespan.

Weak Deeply Virtual Compton Scattering

International Nuclear Information System (INIS)

Ales Psaker; Wolodymyr Melnitchouk; Anatoly Radyushkin

2006-01-01

We extend the analysis of the deeply virtual Compton scattering process to the weak interaction sector in the generalized Bjorken limit. The virtual Compton scattering amplitudes for the weak neutral and charged currents are calculated at the leading twist within the framework of the nonlocal light-cone expansion via coordinate space QCD string operators. Using a simple model, we estimate cross sections for neutrino scattering off the nucleon, relevant for future high intensity neutrino beam facilities

Weakly Idempotent Lattices and Bilattices, Non-Idempotent Plonka Functions

Directory of Open Access Journals (Sweden)

Davidova D. S.

2015-12-01

Full Text Available In this paper, we study weakly idempotent lattices with an additional interlaced operation. We characterize interlacity of a weakly idempotent semilattice operation, using the concept of hyperidentity and prove that a weakly idempotent bilattice with an interlaced operation is epimorphic to the superproduct with negation of two equal lattices. In the last part of the paper, we introduce the concepts of a non-idempotent Plonka function and the weakly Plonka sum and extend the main result for algebras with the well known Plonka function to the algebras with the non-idempotent Plonka function. As a consequence, we characterize the hyperidentities of the variety of weakly idempotent lattices, using non-idempotent Plonka functions, weakly Plonka sums and characterization of cardinality of the sets of operations of subdirectly irreducible algebras with hyperidentities of the variety of weakly idempotent lattices. Applications of weakly idempotent bilattices in multi-valued logic is to appear.

Mutations induced by ultraviolet light

International Nuclear Information System (INIS)

Pfeifer, Gerd P.; You, Young-Hyun; Besaratinia, Ahmad

2005-01-01

The different ultraviolet (UV) wavelength components, UVA (320-400 nm), UVB (280-320 nm), and UVC (200-280 nm), have distinct mutagenic properties. A hallmark of UVC and UVB mutagenesis is the high frequency of transition mutations at dipyrimidine sequences containing cytosine. In human skin cancers, about 35% of all mutations in the p53 gene are transitions at dipyrimidines within the sequence 5'-TCG and 5'-CCG, and these are localized at several mutational hotspots. Since 5'-CG sequences are methylated along the p53 coding sequence in human cells, these mutations may be derived from sunlight-induced pyrimidine dimers forming at sequences that contain 5-methylcytosine. Cyclobutane pyrimidine dimers (CPDs) form preferentially at dipyrimidines containing 5-methylcytosine when cells are irradiated with UVB or sunlight. In order to define the contribution of 5-methylcytosine to sunlight-induced mutations, the lacI and cII transgenes in mouse fibroblasts were used as mutational targets. After 254 nm UVC irradiation, only 6-9% of the base substitutions were at dipyrimidines containing 5-methylcytosine. However, 24-32% of the solar light-induced mutations were at dipyrimidines that contain 5-methylcytosine and most of these mutations were transitions. Thus, CPDs forming preferentially at dipyrimidines with 5-methylcytosine are responsible for a considerable fraction of the mutations induced by sunlight in mammalian cells. Using mouse cell lines harboring photoproduct-specific photolyases and mutational reporter genes, we showed that CPDs (rather than 6-4 photoproducts or other lesions) are responsible for the great majority of UVB-induced mutations. An important component of UVB mutagenesis is the deamination of cytosine and 5-methylcytosine within CPDs. The mutational specificity of long-wave UVA (340-400 nm) is distinct from that of the shorter wavelength UV and is characterized mainly by G to T transversions presumably arising through mechanisms involving oxidized DNA

Plane waves with weak singularities

International Nuclear Information System (INIS)

David, Justin R.

2003-03-01

We study a class of time dependent solutions of the vacuum Einstein equations which are plane waves with weak null singularities. This singularity is weak in the sense that though the tidal forces diverge at the singularity, the rate of divergence is such that the distortion suffered by a freely falling observer remains finite. Among such weak singular plane waves there is a sub-class which does not exhibit large back reaction in the presence of test scalar probes. String propagation in these backgrounds is smooth and there is a natural way to continue the metric beyond the singularity. This continued metric admits string propagation without the string becoming infinitely excited. We construct a one parameter family of smooth metrics which are at a finite distance in the space of metrics from the extended metric and a well defined operator in the string sigma model which resolves the singularity. (author)

Chiral perturbation theory approach to hadronic weak amplitudes

International Nuclear Information System (INIS)

Rafael, E. de

1989-01-01

We are concerned with applications to the non-leptonic weak interactions in the sector of light quark flavors: u, d and s. Both strangeness changing ΔS=1 and ΔS=2 non-leptonic transitions can be described as weak perturbations to the strong effective chiral Lagrangian; the chiral structure of the weak effective Lagrangian being dictated by the transformation properties of the weak non-leptonic Hamiltonian of the Standard Model under global SU(3) Left xSU(3) Right rotations of the quark-fields. These lectures are organized as follows. Section 2 gives a review of the basic properties of chiral symmetry. Section 3 explains the effective chiral realization of the non-leptonic weak Hamiltonian of the Standard Model to lowest order in derivatives and masses. Section 4 deals with non-leptonic weak transitions in the presence of electromagnetism. Some recent applications to radiative kaon decays are reviewed and the effect of the so called electromagnetic penguin like diagrams is also discussed. Section 5 explains the basic ideas of the QCD-hadronic duality approach to the evaluation of coupling constants of the non-leptonic chiral weak Lagrangian. (orig./HSI)

Mutation direction by irradiation in rice

International Nuclear Information System (INIS)

Wang Cailian; Chen Qiufang; Jin Wei; Lu Yimei

2001-01-01

The mutation directions of rice were studied. The results indicated that the mutation directions of rice induced by 14 C were invert correlation to their genetic backgrounds of tested rice varieties, i.e. early mature and short stem varieties produced later mature and higher stem mutation; late mature and high stem varieties produced earlier mature and shorter stem mutation; the varieties of middle maturity and height produced both direction mutations of earlier and later maturity or shorter and higher stem. The mutation directions induced by 14 C were also related to treated doses and stages. Frequency of earlier maturity mutation by protons treatment were higher than those induced by other mutagens. Frequency of later maturity by γ-rays were higher than those induced by other mutagens. Frequency of short stem mutation by synchronous irradiation (soft X-rays) were higher than those induced by other mutagens. Frequency of beneficial mutation induced by proton treatment were higher than those induced by γ-rays

Competition at the Wireless Sensor Network MAC Layer: Low Power Probing interfering with X-MAC

International Nuclear Information System (INIS)

Zacharias, Sven; Newe, Thomas

2011-01-01

Wireless Sensor Networks (WSNs) combine sensors with computer networks and enable very dense, in-situ and live measurements of data over a large area. Since this emerging technology has the potential to be embedded almost everywhere for numberless applications, interference between different networks can become a serious issue. For most WSNs, it is assumed today that the network medium access is non-competitive. On the basis of X-MAC interfered by Low Power Probing, this paper shows the danger and the effects of different sensor networks communicating on a single wireless channel of the 2.4 GHz band, which is used by the IEEE 802.15.4 standard.

Competition at the Wireless Sensor Network MAC Layer: Low Power Probing interfering with X-MAC

Energy Technology Data Exchange (ETDEWEB)

Zacharias, Sven; Newe, Thomas, E-mail: Sven.Zacharias@ul.ie [University of Limerick (Ireland)

2011-08-17

Wireless Sensor Networks (WSNs) combine sensors with computer networks and enable very dense, in-situ and live measurements of data over a large area. Since this emerging technology has the potential to be embedded almost everywhere for numberless applications, interference between different networks can become a serious issue. For most WSNs, it is assumed today that the network medium access is non-competitive. On the basis of X-MAC interfered by Low Power Probing, this paper shows the danger and the effects of different sensor networks communicating on a single wireless channel of the 2.4 GHz band, which is used by the IEEE 802.15.4 standard.

Competition at the Wireless Sensor Network MAC Layer: Low Power Probing interfering with X-MAC

Science.gov (United States)

Zacharias, Sven; Newe, Thomas

2011-08-01

Wireless Sensor Networks (WSNs) combine sensors with computer networks and enable very dense, in-situ and live measurements of data over a large area. Since this emerging technology has the potential to be embedded almost everywhere for numberless applications, interference between different networks can become a serious issue. For most WSNs, it is assumed today that the network medium access is non-competitive. On the basis of X-MAC interfered by Low Power Probing, this paper shows the danger and the effects of different sensor networks communicating on a single wireless channel of the 2.4 GHz band, which is used by the IEEE 802.15.4 standard.

Weak interaction: past answers, present questions

International Nuclear Information System (INIS)

Ne'eman, Y.

1977-02-01

A historical sketch of the weak interaction is presented. From beta ray to pion decay, the V-A theory of Marshak and Sudarshan, CVC principle of equivalence, universality as an algebraic condition, PCAC, renormalized weak Hamiltonian in the rehabilitation of field theory, and some current issues are considered in this review. 47 references

Weak measurements with a qubit meter

DEFF Research Database (Denmark)

Wu, Shengjun; Mølmer, Klaus

2009-01-01

We derive schemes to measure the so-called weak values of quantum system observables by coupling of the system to a qubit meter system. We highlight, in particular, the meaning of the imaginary part of the weak values, and show how it can be measured directly on equal footing with the real part...

On (weakly precious rings associated to central polynomials

Directory of Open Access Journals (Sweden)

Hani A. Khashan

2018-04-01

Full Text Available Let R be an associative ring with identity and let g(x be a fixed polynomial over the center of R. We define R to be (weakly g(x-precious if for every element a∈R, there are a zero s of g(x, a unit u and a nilpotent b such that (a=±s+u+b a=s+u+b. In this paper, we investigate many examples and properties of (weakly g(x-precious rings. If a and b are in the center of R with b-a is a unit, we give a characterizations for (weakly (x-a(x-b-precious rings in terms of (weakly precious rings. In particular, we prove that if 2 is a unit, then a ring is precious if and only it is weakly precious. Finally, for n∈ℕ, we study (weakly (xⁿ-x-precious rings and clarify some of their properties.

PIK3CA mutations frequently coexist with RAS and BRAF mutations in patients with advanced cancers.

Directory of Open Access Journals (Sweden)

Filip Janku

Full Text Available Oncogenic mutations of PIK3CA, RAS (KRAS, NRAS, and BRAF have been identified in various malignancies, and activate the PI3K/AKT/mTOR and RAS/RAF/MEK pathways, respectively. Both pathways are critical drivers of tumorigenesis.Tumor tissues from 504 patients with diverse cancers referred to the Clinical Center for Targeted Therapy at MD Anderson Cancer Center starting in October 2008 were analyzed for PIK3CA, RAS (KRAS, NRAS, and BRAF mutations using polymerase chain reaction-based DNA sequencing.PIK3CA mutations were found in 54 (11% of 504 patients tested; KRAS in 69 (19% of 367; NRAS in 19 (8% of 225; and BRAF in 31 (9% of 361 patients. PIK3CA mutations were most frequent in squamous cervical (5/14, 36%, uterine (7/28, 25%, breast (6/29, 21%, and colorectal cancers (18/105, 17%; KRAS in pancreatic (5/9, 56%, colorectal (49/97, 51%, and uterine cancers (3/20, 15%; NRAS in melanoma (12/40, 30%, and uterine cancer (2/11, 18%; BRAF in melanoma (23/52, 44%, and colorectal cancer (5/88, 6%. Regardless of histology, KRAS mutations were found in 38% of patients with PIK3CA mutations compared to 16% of patients with wild-type (wtPIK3CA (p = 0.001. In total, RAS (KRAS, NRAS or BRAF mutations were found in 47% of patients with PIK3CA mutations vs. 24% of patients wtPIK3CA (p = 0.001. PIK3CA mutations were found in 28% of patients with KRAS mutations compared to 10% with wtKRAS (p = 0.001 and in 20% of patients with RAS (KRAS, NRAS or BRAF mutations compared to 8% with wtRAS (KRAS, NRAS or wtBRAF (p = 0.001.PIK3CA, RAS (KRAS, NRAS, and BRAF mutations are frequent in diverse tumors. In a wide variety of tumors, PIK3CA mutations coexist with RAS (KRAS, NRAS and BRAF mutations.

Impact of Fluoroquinolone Resistance Mutations on Gonococcal Fitness and In Vivo Selection for Compensatory Mutations

Science.gov (United States)

Kunz, Anjali N.; Begum, Afrin A.; Wu, Hong; D'Ambrozio, Jonathan A.; Robinson, James M.; Shafer, William M.; Bash, Margaret C.; Jerse, Ann E.

2012-01-01

Background. Quinolone-resistant Neisseria gonorrhoeae (QRNG) arise from mutations in gyrA (intermediate resistance) or gyrA and parC (resistance). Here we tested the consequence of commonly isolated gyrA91/95 and parC86 mutations on gonococcal fitness. Methods. Mutant gyrA91/95 and parC86 alleles were introduced into wild-type gonococci or an isogenic mutant that is resistant to macrolides due to an mtrR−79 mutation. Wild-type and mutant bacteria were compared for growth in vitro and in competitive murine infection. Results. In vitro growth was reduced with increasing numbers of mutations. Interestingly, the gyrA91/95 mutation conferred an in vivo fitness benefit to wild-type and mtrR−79 mutant gonococci. The gyrA91/95, parC86 mutant, in contrast, showed a slight fitness defect in vivo, and the gyrA91/95, parC86, mtrR−79 mutant was markedly less fit relative to the parent strains. A ciprofloxacin-resistant (CipR) mutant was selected during infection with the gyrA91/95, parC86, mtrR−79 mutant in which the mtrR−79 mutation was repaired and the gyrA91 mutation was altered. This in vivo–selected mutant grew as well as the wild-type strain in vitro. Conclusions. gyrA91/95 mutations may contribute to the spread of QRNG. Further acquisition of a parC86 mutation abrogates this fitness advantage; however, compensatory mutations can occur that restore in vivo fitness and maintain CipR. PMID:22492860

Fixed points of occasionally weakly biased mappings

OpenAIRE

Y. Mahendra Singh, M. R. Singh

2012-01-01

Common fixed point results due to Pant et al. [Pant et al., Weak reciprocal continuity and fixed point theorems, Ann Univ Ferrara, 57(1), 181-190 (2011)] are extended to a class of non commuting operators called occasionally weakly biased pair[ N. Hussain, M. A. Khamsi A. Latif, Commonfixed points for JH-operators and occasionally weakly biased pairs under relaxed conditions, Nonlinear Analysis, 74, 2133-2140 (2011)]. We also provideillustrative examples to justify the improvements. Abstract....

Oncogene mutational profile in nasopharyngeal carcinoma

Directory of Open Access Journals (Sweden)

Zhang ZC

2014-03-01

Full Text Available Zi-Chen Zhang,1,* Sha Fu,1,* Fang Wang,1 Hai-Yun Wang,1 Yi-Xin Zeng,2 Jian-Yong Shao11Department of Molecular Diagnostics, 2Department of Experimental Research, Sun Yat-sen University Cancer Center, State Key Laboratory of Oncology in South China, Collaborative Innovation Center of Cancer Medicine, Guangzhou, People's Republic of China *These authors contributed equally to this work Abstract: Nasopharyngeal carcinoma (NPC is a common tumor in Southern China, but the oncogene mutational status of NPC patients has not been clarified. Using time-of-flight mass spectrometry, 238 mutation hotspots in 19 oncogenes were examined in 123 NPC patients. The relationships between mutational status and clinical data were assessed with a χ2 or Fisher's exact test. Survival analysis was performed using the Kaplan–Meier method with the log-rank test. In 123 patients, 21 (17.1% NPC tumors were positive for mutations in eight oncogenes: six patients had PIK3CA mutations (4.9%, five NRAS mutations (4.1%, four KIT mutations (3.3%, two PDGFRA mutations (1.6%, two ABL mutations (1.6%, and one with simultaneous mutations in HRAS, EGFR, and BRAF (1%. Patients with mutations were more likely to relapse or develop metastasis than those with wild-type alleles (P=0.019. No differences or correlations were found in other clinical characteristics or in patient survival. No mutations were detected in oncogenes AKT1, AKT2, CDK, ERBB2, FGFR1, FGFR3, FLT3, JAK2, KRAS, MET, and RET. These results demonstrate an association between NPC and mutations in NRAS, KIT, PIK3CA, PDGFRA, and ABL, which are associated with patient relapse and metastasis. Keywords: NPC, oncogene, mutation

Weakly compact operators and interpolation

OpenAIRE

Maligranda, Lech

1992-01-01

The class of weakly compact operators is, as well as the class of compact operators, a fundamental operator ideal. They were investigated strongly in the last twenty years. In this survey, we have collected and ordered some of this (partly very new) knowledge. We have also included some comments, remarks and examples. The class of weakly compact operators is, as well as the class of compact operators, a fundamental operator ideal. They were investigated strongly in the last twenty years. I...

Policy-based benchmarking of weak heaps and their relatives

DEFF Research Database (Denmark)

Bruun, Asger; Edelkamp, Stefan; Katajainen, Jyrki

2010-01-01

In this paper we describe an experimental study where we evaluated the practical efficiency of three worst-case efficient priority queues: 1) a weak heap that is a binary tree fulfilling half-heap ordering, 2) a weak queue that is a forest of perfect weak heaps, and 3) a runrelaxed weak queue tha...

Weak-interaction rates in stellar conditions

Science.gov (United States)

Sarriguren, Pedro

2018-05-01

Weak-interaction rates, including β-decay and electron captures, are studied in several mass regions at various densities and temperatures of astrophysical interest. In particular, we study odd-A nuclei in the pf-shell region, which are involved in presupernova formations. Weak rates are relevant to understand the late stages of the stellar evolution, as well as the nucleosynthesis of heavy nuclei. The nuclear structure involved in the weak processes is studied within a quasiparticle proton-neutron random-phase approximation with residual interactions in both particle-hole and particle-particle channels on top of a deformed Skyrme Hartree-Fock mean field with pairing correlations. First, the energy distributions of the Gamow-Teller strength are discussed and compared with the available experimental information, measured under terrestrial conditions from charge-exchange reactions. Then, the sensitivity of the weak-interaction rates to both astrophysical densities and temperatures is studied. Special attention is paid to the relative contribution to these rates of thermally populated excited states in the decaying nucleus and to the electron captures from the degenerate electron plasma.

Mutation Breeding Newsletter. No. 39

International Nuclear Information System (INIS)

1992-01-01

This newsletter contains brief articles on the use of radiation to induce mutations in plants; radiation-induced mutants in Chrysanthemum; disrupting the association between oil and protein content in soybean seeds; mutation studies on bougainvillea; a new pepper cultivar; and the use of mutation induction to improve the quality of yam beans. A short review of the seminar on the use of mutation and related biotechnology for crop improvement in the Middle East and Mediterranean regions, and a description of a Co-ordinated Research Programme on the application of DNA-based marker mutations for the improvement of cereals and other sexually reproduced crop species are also included. Two tables are given: these are based on the ''FAO/IAEA Mutant Varieties Database'' and show the number of mutated varieties and the number of officially released mutant varieties in particular crops/species. Refs and tabs

Screening for duplications, deletions and a common intronic mutation detects 35% of second mutations in patients with USH2A monoallelic mutations on Sanger sequencing.

Science.gov (United States)

Steele-Stallard, Heather B; Le Quesne Stabej, Polona; Lenassi, Eva; Luxon, Linda M; Claustres, Mireille; Roux, Anne-Francoise; Webster, Andrew R; Bitner-Glindzicz, Maria

2013-08-08

Usher Syndrome is the leading cause of inherited deaf-blindness. It is divided into three subtypes, of which the most common is Usher type 2, and the USH2A gene accounts for 75-80% of cases. Despite recent sequencing strategies, in our cohort a significant proportion of individuals with Usher type 2 have just one heterozygous disease-causing mutation in USH2A, or no convincing disease-causing mutations across nine Usher genes. The purpose of this study was to improve the molecular diagnosis in these families by screening USH2A for duplications, heterozygous deletions and a common pathogenic deep intronic variant USH2A: c.7595-2144A>G. Forty-nine Usher type 2 or atypical Usher families who had missing mutations (mono-allelic USH2A or no mutations following Sanger sequencing of nine Usher genes) were screened for duplications/deletions using the USH2A SALSA MLPA reagent kit (MRC-Holland). Identification of USH2A: c.7595-2144A>G was achieved by Sanger sequencing. Mutations were confirmed by a combination of reverse transcription PCR using RNA extracted from nasal epithelial cells or fibroblasts, and by array comparative genomic hybridisation with sequencing across the genomic breakpoints. Eight mutations were identified in 23 Usher type 2 families (35%) with one previously identified heterozygous disease-causing mutation in USH2A. These consisted of five heterozygous deletions, one duplication, and two heterozygous instances of the pathogenic variant USH2A: c.7595-2144A>G. No variants were found in the 15 Usher type 2 families with no previously identified disease-causing mutations. In 11 atypical families, none of whom had any previously identified convincing disease-causing mutations, the mutation USH2A: c.7595-2144A>G was identified in a heterozygous state in one family. All five deletions and the heterozygous duplication we report here are novel. This is the first time that a duplication in USH2A has been reported as a cause of Usher syndrome. We found that 8 of

Interferência de plantas daninhas na cultura da cenoura (Daucus carota Weed interference on carrot crop (Daucus carota

Directory of Open Access Journals (Sweden)

M Coelho

2009-12-01

Full Text Available A cenoura é uma importante hortaliça no Brasil, cuja produtividade pode ser muito reduzida devido à interferência de plantas daninhas. O objetivo desta pesquisa foi avaliar efeitos de períodos de convivência das plantas daninhas na produtividade da cenoura cultivar "Brasília" e na comunidade de plantas daninhas. Os tratamentos foram constituídos de períodos crescentes de convivência ou controle das plantas daninhas. A comunidade de plantas daninhas foi avaliada quanto a número de indivíduos, matéria seca acumulada e frequência de ocorrência das espécies, e a cultura, quanto à produtividade comercial. As principais plantas daninhas foram Ageratum conyzoides, Digitaria nuda, Eleusine indica e Lepidium virginicum. A presença da comunidade de plantas daninhas durante todo o ciclo da cultura pode acarretar perdas de 94% na produtividade, evidenciando alta suscetibilidade da cenoura à interferência das plantas daninhas. Contudo, não houve período crítico de prevenção à interferência, e um único controle das plantas daninhas, entre 22 e 31 dias após a semeadura, foi suficiente para garantir a produção da cultura.Carrot is an important horticultural crop in Brazil, and its productivity may be highly reduced due to weed interference. This study evaluated the effects of weed coexistence periods on carrot cultivar 'Brasilia' yield and on the weed community. The treatments were constituted of increasing weed coexistence periods or weed-free periods. The weed community was evaluated based on number of individuals, dry matter accumulation, and frequency of occurrence; while the crop was evaluated based on marketable productivity. The main weeds were Ageratum conyzoides, Digitaria nuda, Eleusine indica, and Lepidium virginicum. The presence of the weed community throughout the crop season can cause yield losses of 94%, showing high susceptibility of the carrot crop to weed interference. However, there was no critical period for

Efficient quantum computing with weak measurements

International Nuclear Information System (INIS)

Lund, A P

2011-01-01

Projective measurements with high quantum efficiency are often assumed to be required for efficient circuit-based quantum computing. We argue that this is not the case and show that the fact that they are not required was actually known previously but was not deeply explored. We examine this issue by giving an example of how to perform the quantum-ordering-finding algorithm efficiently using non-local weak measurements considering that the measurements used are of bounded weakness and some fixed but arbitrary probability of success less than unity is required. We also show that it is possible to perform the same computation with only local weak measurements, but this must necessarily introduce an exponential overhead.

Radiation in relation to mutation rate, mutational damage and human ill-health

International Nuclear Information System (INIS)

Roberts, P.B.

1976-09-01

The effect of radiation in increasing the frequency of gene mutations is now reasonably understood. We discuss first how an increase in the mutation rate is reflected in the mutational damage expressed in populations. It is shown that the mutational damage, assessed by the loss of fitness in a population or the number of eventual gene extinctions, is equal to the number of new mutations arising per generation or the mutation rate. In a population of stable size, a dose of 1 rem given to 10 6 people leads to roughly 600 gene extinctions when summed over all ensuing generations if the dose is applied to only one generation; this number of extinctions will occur in each succeeding generation if the dose is given to every generation. However, the concept of genetic extinction, although quantifiable, is of limited value in assessing radiation risks since its impact on human ill-health is very speculative. In particular, no estimate can be made of the total cost of effects which are minor in each individual in which they arise, but which, because they are so minor, persist in the population for many generations. The best current estimate is for 14-140 obvious defects in the first few generations following exposure of 10 6 people to a dose of 1 rem. (auth.)

Ligand-targeted delivery of small interfering RNAs to malignant cells and tissues.

Science.gov (United States)

Thomas, Mini; Kularatne, Sumith A; Qi, Longwu; Kleindl, Paul; Leamon, Christopher P; Hansen, Michael J; Low, Philip S

2009-09-01

Potential clinical applications of small interfering RNA (siRNA) are hampered primarily by delivery issues. We have successfully addressed the delivery problems associated with off-site targeting of highly toxic chemotherapeutic agents by attaching the drugs to tumor-specific ligands that will carry the attached cargo into the desired cancer cell. Indeed, several such tumor-targeted drugs are currently undergoing human clinical trials. We now show that efficient targeting of siRNA to malignant cells and tissues can be achieved by covalent conjugation of small-molecular-weight, high-affinity ligands, such as folic acid and DUPA (2-[3-(1, 3-dicarboxy propyl)-ureido] pentanedioic acid), to siRNA. The former ligand binds a folate receptor that is overexpressed on a variety of cancers, whereas the latter ligand binds to prostate-specific membrane antigen that is overexpressed specifically on prostate cancers and the neovasculature of all solid tumors. Using these ligands, we show remarkable receptor-mediated targeting of siRNA to cancer tissues in vitro and in vivo.

Nuclear beta decay and the weak interaction

International Nuclear Information System (INIS)

Kean, D.C.

1975-11-01

Short notes are presented on various aspects of nuclear beta decay and weak interactions including: super-allowed transitions, parity violation, interaction strengths, coupling constants, and the current-current formalism of weak interaction. (R.L.)

Radiation-induced mutation at minisatellite loci

International Nuclear Information System (INIS)

Dubrova, Y.E.; Nesterov, V.N.; Krouchinsky, N.G.

1997-01-01

We are studying the radiation-induced increase of mutation rate in minisatellite loci in mice and humans. Minisatellite mutations were scored by multilocus DNA fingerprint analysis in the progeny of γ-irradiated and non-irradiated mice. The frequency of mutation in offspring of irradiated males was 1.7 higher that in the control group. Germline mutation at human minisatellite loci was studied among children born in heavily polluted areas of the Mogilev district of Belarus after the Chernobyl accident and in a control population. The frequency of mutation assayed both by DNA fingerprinting and by eight single locus probes was found to be two times higher in the exposed families than in the control group. Furthermore, mutation rate was correlated with the parental radiation dose for chronic exposure 137 Cs, consistent with radiation-induction of germline mutation. The potential use of minisatellites in monitoring germline mutation in humans will be discussed

AIP mutations and gigantism.

Science.gov (United States)

Rostomyan, Liliya; Potorac, Iulia; Beckers, Pablo; Daly, Adrian F; Beckers, Albert

2017-06-01

AIP mutations are rare in sporadic acromegaly but they are seen at a higher frequency among certain specific populations of pituitary adenoma patients (pituitary gigantism cases, familial isolated pituitary adenoma (FIPA) kindreds, and patients with macroadenomas who are diagnosed ≤30 years). AIP mutations are most prevalent in patients with pituitary gigantism (29% of this group were found to have mutations in AIP gene). These data support targeted genetic screening for AIP mutations/deletions in these groups of pituitary adenoma patients. Earlier diagnosis of AIP-related acromegaly-gigantism cases enables timely clinical evaluation and treatment, thereby improving outcomes in terms of excessive linear growth and acromegaly comorbidities. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

Mutational specificity of γ-rays

International Nuclear Information System (INIS)

Hoebee, Barbara.

1990-01-01

The aim of the study described in this thesis was to get more information on the mutagenic properties of radiation-induced DNA modifications and the possible mechanisms involved in radiation-induced mutagenesis, principally by investigating the kinds of mutations by DNA sequence analysis. The mutations were analyzed after γ-irradiation of recombinant bacteriophage M13 and plasmide pUC DNA in diluted aqueous solutions, followed by transfection or transformation to E. coli cells, in which the damaged DNA molecules are repaired and replicated. Error-prone repair, misrepair or bypass of lesions during replication may lead to the introduction of mutations. Both the M13 and the plasmid DNA used in our mutation studies contain a mutation target sequence, which makes an easy selection and sequence analysis of mutant DNA molecules possible. Under the radiation conditions used, e.g. irradiation of diluted aqueous DNA solutions, only DNA damage occurs introduced by the water derived OH* and H* radicals and the hydrated electrons. By using different gas conditions during irradiation the relative yields of these reaction species can be manipulated, which opens up the opportunity to determine their effects separately. The mutation spectrum obtained in double-stranded (ds) M13DNA after irradiation under oxic conditions and the mutation spectrum obtained under the same conditions and in the same mutation target but cloned in plasmid DNA, are described. The mutation specificity under anoxic conditions in ds M13DNA is given. Results obtained after irradiation of ds M13DNA under N 2 conditions are discussed together with experiments with single-stranded DNA. Similarities and differences between radiation-induced mutation spectra obtained by other groups and those presented in this thesis are discussed. (author). 155 refs.; 134 figs.; 16 tabs

Calreticulin Mutations in Bulgarian MPN Patients.

Science.gov (United States)

Pavlov, Ivan; Hadjiev, Evgueniy; Alaikov, Tzvetan; Spassova, Sylva; Stoimenov, Angel; Naumova, Elissaveta; Shivarov, Velizar; Ivanova, Milena

2018-01-01

Somatic mutations in JAK2, MPL and CALR are recurrently identified in most of the cases with Philadelphia chromosome negative myeloproliferative neoplasms (MPNs). We applied four molecular genetic methods for identification of CALR exon 9 mutations, including high resolution melt (HRM) analysis, Sanger sequencing, semiconductor target genes sequencing and whole exome sequencing. A total of 78 patients with myeloid malignancies were included in the study. We identified 14 CALR exon 9 mutated cases out of 78 studied patients with myeloid malignancies. All mutated patients were diagnosed with MPN being either PMF (n = 7) or ET (n = 7). Nine cases had type 1 mutations and 5 cases had type 2 mutations. CALR exon 9, MPL exon 10 and JAK2 p. V617F were mutually exclusive. There were no statistically significant differences in the hematological parameters between the cases with CALR and JAK2 or MPL mutations. Notably, all four techniques were fully concordant in the detection of CALR mutations. This is one of the few reports on the CALR mutations frequency in South-eastern populations. Our study shows that the frequency and patterns of these mutations is identical to those in the patients' cohorts from Western countries. Besides we demonstrated the utility of four different methods for their detection.

Nanoparticle-based delivery of small interfering RNA: challenges for cancer therapy

Directory of Open Access Journals (Sweden)

Miele E

2012-07-01

Full Text Available Evelina Miele,1,* Gian Paolo Spinelli,2,* Ermanno Miele,3 Enzo Di Fabrizio,3,6 Elisabetta Ferretti,4 Silverio Tomao,2 Alberto Gulino,1,5 1Department of Molecular Medicine, 2Department of Medico-Surgical Sciences and Biotechnologies, Sapienza University of Rome, Rome, 3Nanostructures, Istituto Italiano di Tecnologia, via Morego, 30, 16163 Genova, 4Department of Experimental Medicine, Sapienza University of Rome, Rome, 5Center for Life Nanoscience, Istituto Italiano di Tecnologia, Rome, Italy, 6BIONEM lab, University of Magna Graecia, Campus S. Venuta, Viale Europa 88100 Catanzaro, Italy *These authors contributed equally to this workAbstract: During recent decades there have been remarkable advances and profound changes in cancer therapy. Many therapeutic strategies learned at the bench, including monoclonal antibodies and small molecule inhibitors, have been used at the bedside, leading to important successes. One of the most important advances in biology has been the discovery that small interfering RNA (siRNA is able to regulate the expression of genes, by a phenomenon known as RNA interference (RNAi. RNAi is one of the most rapidly growing fields of research in biology and therapeutics. Much research effort has gone into the application of this new discovery in the treatment of various diseases, including cancer. However, even though these molecules may have potential and strong utility, some limitations make their clinical application difficult, including delivery problems, side effects due to off-target actions, disturbance of physiological functions of the cellular machinery involved in gene silencing, and induction of the innate immune response. Many researchers have attempted to overcome these limitations and to improve the safety of potential RNAi-based therapeutics. Nanoparticles, which are nanostructured entities with tunable size, shape, and surface, as well as biological behavior, provide an ideal opportunity to modify current

New allelic variant of autosomal recessive hereditary motor and sensory neuropathy type 2S resulted from mutations in gene IGHMBP2

Directory of Open Access Journals (Sweden)

E. L. Dadali

2016-01-01

Full Text Available Hereditary motor and sensory neuropathy (HMSN, Charcot–Marie–Tooth disease is a group of genetically heterogeneous disorders with more than 80 genes linked to different phenotypes, including IGHMBP2 gene responsible for HMSN type 2S (OMIM 616155. Until recently, mutations in IGHMBP2 were exclusively associated with neonatal distal spinal muscular atrophy with respiratory distress (SMARD1, OMIM 604320. A case report presents a boy with infant onset decreased distal muscle tone and weakness, distal wasting and deformation in legs and hands, areflexia and decreased sensation without respiratory involvement; at age seven he had severe fixed kypho-scoliosis. EMG revealed signs distal axonal neuropathy. The exsome sequencing confirmed the allelic variant of two compound heterozygous mutations in gene IGHMBP2: known missens mutation с.1616С>Т (р.Ser539Leu in exone 11 and a novel deletion с.2601_2602delGA in exone 13. The diagnosis of infant HMSN type 2S was confirmed. The phenotype of HMSN type 2S and its diagnostics differences between SMARD1 are discussed.

Manual on mutation breeding. 2. ed.

International Nuclear Information System (INIS)

1977-01-01

The manual is a compilation of work done on the use of induced mutations in plant breeding, and presents general methods and techniques in this field. The use of chemical mutagens and ionizing radiations (X-rays, gamma rays, α- and β-particles, protons, neutrons) are described as well as the effects of these mutagens. The different types of mutations achieved can be divided into genome mutations, chromosome mutations and extra nuclear mutations. Separate chapters deal with mutation techniques in breeding seed-propagated species and asexually propagated plants (examples of development of cultivars given). Plant characters which can be improved by mutation breeding include yield, ripening time, growth habit, disease resistance and tolerance to environmental factors (temperature, salinity etc.). The use of mutagens for some specific plant breeding problems is discussed and attention is also paid to somatic cell genetics in connection with induced mutations. The manual contains a comprehensive bibliography (60 p. references) and a subject index

Fermi and the Theory of Weak Interactions

Indian Academy of Sciences (India)

IAS Admin

Quantum Field Theory created by Dirac and used by Fermi to describe weak ... of classical electrodynamics (from which the electric field and magnetic field can be obtained .... Universe. However, thanks to weak interactions, this can be done.

Minisequencing mitochondrial DNA pathogenic mutations

Directory of Open Access Journals (Sweden)

Carracedo Ángel

2008-04-01

Full Text Available Abstract Background There are a number of well-known mutations responsible of common mitochondrial DNA (mtDNA diseases. In order to overcome technical problems related to the analysis of complete mtDNA genomes, a variety of different techniques have been proposed that allow the screening of coding region pathogenic mutations. Methods We here propose a minisequencing assay for the analysis of mtDNA mutations. In a single reaction, we interrogate a total of 25 pathogenic mutations distributed all around the whole mtDNA genome in a sample of patients suspected for mtDNA disease. Results We have detected 11 causal homoplasmic mutations in patients suspected for Leber disease, which were further confirmed by standard automatic sequencing. Mutations m.11778G>A and m.14484T>C occur at higher frequency than expected by change in the Galician (northwest Spain patients carrying haplogroup J lineages (Fisher's Exact test, P-value Conclusion We here developed a minisequencing genotyping method for the screening of the most common pathogenic mtDNA mutations which is simple, fast, and low-cost. The technique is robust and reproducible and can easily be implemented in standard clinical laboratories.

SIMULATION OF SUBGRADE EMBANKMENT ON WEAK BASE

Directory of Open Access Journals (Sweden)

V. D. Petrenko

2015-08-01

Full Text Available Purpose. This article provides: the question of the sustainability of the subgrade on a weak base is considered in the paper. It is proposed to use the method of jet grouting. Investigation of the possibility of a weak base has an effect on the overall deformation of the subgrade; the identification and optimization of the parameters of subgrade based on studies using numerical simulation. Methodology. The theoretical studies of the stress-strain state of the base and subgrade embankment by modeling in the software package LIRA have been conducted to achieve this goal. Findings. After making the necessary calculations perform building fields of a subsidence, borders cramped thickness, bed’s coefficients of Pasternak and Winkler. The diagrams construction of vertical stress performs at any point of load application. Also, using the software system may perform peer review subsidence, rolls railroad tracks in natural and consolidated basis. Originality. For weak soils is the most appropriate nonlinear model of the base with the existing areas of both elastic and limit equilibrium, mixed problem of the theory of elasticity and plasticity. Practical value. By increasing the load on the weak base as a result of the second track construction, adds embankment or increasing axial load when changing the rolling stock process of sedimentation and consolidation may continue again. Therefore, one of the feasible and promising options for the design and reconstruction of embankments on weak bases is to strengthen the bases with the help of jet grouting. With the expansion of the railway infrastructure, increasing speed and weight of the rolling stock is necessary to ensure the stability of the subgrade on weak bases. LIRA software package allows you to perform all the necessary calculations for the selection of a proper way of strengthening weak bases.

(Weakly) three-dimensional caseology

International Nuclear Information System (INIS)

Pomraning, G.C.

1996-01-01

The singular eigenfunction technique of Case for solving one-dimensional planar symmetry linear transport problems is extended to a restricted class of three-dimensional problems. This class involves planar geometry, but with forcing terms (either boundary conditions or internal sources) which are weakly dependent upon the transverse spatial variables. Our analysis involves a singular perturbation about the classic planar analysis, and leads to the usual Case discrete and continuum modes, but modulated by weakly dependent three-dimensional spatial functions. These functions satisfy parabolic differential equations, with a different diffusion coefficient for each mode. Representative one-speed time-independent transport problems are solved in terms of these generalised Case eigenfunctions. Our treatment is very heuristic, but may provide an impetus for more rigorous analysis. (author)

Characterization of a defective interfering RNA that contains a mosaic of a plant viral genome

Energy Technology Data Exchange (ETDEWEB)

Morris, T.J.; Jackson, A.O.

1991-01-01

Our lab was the first to describe and characterize a defective interfering RNA (DI RNAs or DIs) in association with a small RNA plant virus. The features of the DIs that we discovered in infections of tomato bushy stunt virus were compatible with the properties of DIs identified in many animal virus infections. Animal virologists have generally recognized the importance of studying DIs because they are invaluable tools for identifying cis-acting sequences important in virus multiplication and because they offer the opportunity to elucidate mechanisms involved in viral persistence and disease attenuation. Hence our discovery offered a comparably valuable tool for use in plant virus studies for the first time. Since then, we have also discovered the second example of plant viral DI RNAs associated with turnip crinkle virus (TCV), a virus structurally related to TBSV. We proposed a thorough characterization of this unique class of symptom modulating RNAs with the overall objective of identifying viral RNA nucleotide, sequences involved in such fundamental processes as virus replication and encapsidation as well as the degree of symptom expression resulting from the viral-DI-host interaction. The proposed research focused on the molecular characterization of the DI RNAs and the helper virus. We had demonstrated that the DIs were collinear deletion mutants of the genome of a cherry strain of tomato bushy stunt virus (TBSV). We had also shown that these low molecular weight RNAs interfered with the helper plant virus and modulated disease expression by preventing the development of a lethal necrotic disease in susceptible host plants. We also suggested that by exploring the mechanisms associated with the symptom attenuation effect, we might be able to devise novel strategies useful for engineering viral disease resistance.

Nonlinear waves and weak turbulence

CERN Document Server

Zakharov, V E

1997-01-01

This book is a collection of papers on dynamical and statistical theory of nonlinear wave propagation in dispersive conservative media. Emphasis is on waves on the surface of an ideal fluid and on Rossby waves in the atmosphere. Although the book deals mainly with weakly nonlinear waves, it is more than simply a description of standard perturbation techniques. The goal is to show that the theory of weakly interacting waves is naturally related to such areas of mathematics as Diophantine equations, differential geometry of waves, Poincaré normal forms, and the inverse scattering method.

A Case of Brown-Vialetto-Van Laere Syndrome Due To a Novel Mutation in Gene

Directory of Open Access Journals (Sweden)

Venkatraman Thulasi BA

2017-08-01

Full Text Available Brown-Vialetto-Van Laere syndrome is a rare disorder characterized by motor, sensory, and cranial neuronopathies, associated with mutations in SLC52A2 and SLC52A3 genes that code for human riboflavin transporters RFVT2 and RFVT3, respectively. The authors describe the clinical course of a 6-year-old girl with Brown-Vialetto-Van Laere syndrome and a novel homozygous mutation c.1156T>C in the SLC52A3 gene, who presented at the age of 2.5 years with progressive brain stem dysfunction including ptosis, facial weakness, hearing loss, dysphagia, anarthria with bilateral vocal cord paralysis, and ataxic gait. She subsequently developed respiratory failure requiring tracheostomy and worsening dysphagia necessitating a gastrostomy. Following riboflavin supplementation, resolution of facial diplegia and ataxia, improvements in ptosis, and bulbar function including vocalization and respiration were noted. However, her sensorineural hearing loss remained unchanged. Similar to other cases of Brown-Vialetto-Van Laere syndrome, our patient responded favorably to early riboflavin supplementation with significant but not complete neurologic recovery.

A hereditary spastic paraplegia mutation in kinesin-1A/KIF5A disrupts neurofilament transport

Directory of Open Access Journals (Sweden)

Brown Anthony

2010-11-01

Full Text Available Abstract Background Hereditary spastic paraplegias are a group of neurological disorders characterized by progressive distal degeneration of the longest ascending and descending axons in the spinal cord, leading to lower limb spasticity and weakness. One of the dominantly inherited forms of this disease (spastic gait type 10, or SPG10 is caused by point mutations in kinesin-1A (also known as KIF5A, which is thought to be an anterograde motor for neurofilaments. Results We investigated the effect of an SPG10 mutation in kinesin-1A (N256S-kinesin-1A on neurofilament transport in cultured mouse cortical neurons using live-cell fluorescent imaging. N256S-kinesin-1A decreased both anterograde and retrograde neurofilament transport flux by decreasing the frequency of anterograde and retrograde movements. Anterograde velocity was not affected, whereas retrograde velocity actually increased. Conclusions These data reveal subtle complexities to the functional interdependence of the anterograde and retrograde neurofilament motors and they also raise the possibility that anterograde and retrograde neurofilament transport may be disrupted in patients with SPG10.

Patterns of mutation and selection at synonymous sites in Drosophila

DEFF Research Database (Denmark)

Singh, Nadia D; Bauer DuMont, Vanessa L; Hubisz, Melissa J

2007-01-01

, when applied to 18 coding sequences in 3 species of Drosophila, confirmed an earlier report that the Notch gene in Drosophila melanogaster was evolving under selection in favor of those codons defined as unpreferred in this species. This finding opened the possibility that synonymous sites may...... be subject to a variety of selective pressures beyond weak selection for increased frequencies of the codons currently defined as "preferred" in D. melanogaster. To further explore patterns of synonymous site evolution in Drosophila in a lineage-specific manner, we expanded the application of the maximum...... likelihood framework to 8,452 protein coding sequences with well-defined orthology in D. melanogaster, Drosophila sechellia, and Drosophila yakuba. Our analyses reveal intragenomic and interspecific variation in mutational patterns as well as in patterns and intensity of selection on synonymous sites. In D...

Testing the weak gravity-cosmic censorship connection

Science.gov (United States)

Crisford, Toby; Horowitz, Gary T.; Santos, Jorge E.

2018-03-01

A surprising connection between the weak gravity conjecture and cosmic censorship has recently been proposed. In particular, it was argued that a promising class of counterexamples to cosmic censorship in four-dimensional Einstein-Maxwell-Λ theory would be removed if charged particles (with sufficient charge) were present. We test this idea and find that indeed if the weak gravity conjecture is true, one cannot violate cosmic censorship this way. Remarkably, the minimum value of charge required to preserve cosmic censorship appears to agree precisely with that proposed by the weak gravity conjecture.

PHKA2 mutation spectrum in Korean patients with glycogen storage disease type IX: prevalence of deletion mutations.

Science.gov (United States)

Choi, Rihwa; Park, Hyung-Doo; Kang, Ben; Choi, So Yoon; Ki, Chang-Seok; Lee, Soo-Youn; Kim, Jong-Won; Song, Junghan; Choe, Yon Ho

2016-04-21

Molecular diagnosis of glycogen storage diseases (GSDs) is important to enable accurate diagnoses and make appropriate therapeutic plans. The aim of this study was to evaluate the PHKA2 mutation spectrum in Korean patients with GSD type IX. Thirteen Korean patients were tested for PHKA2 mutations using direct sequencing and a multiplex polymerase chain reaction method. A comprehensive review of the literature on previously reported PHKA2 mutations in other ethnic populations was conducted for comparison. Among 13 patients tested, six unrelated male patients with GSD IX aged 2 to 6 years at the first diagnostic work-up for hepatomegaly with elevated aspartate transaminase (AST) and alanine transaminase (ALT) were found to have PHKA2 mutations. These patients had different PHKA2 mutations: five were known mutations (c.537 + 5G > A, c.884G > A [p.Arg295His], c.3210_3212delGAG [p.Arg1072del], exon 8 deletion, and exons 27-33 deletion) and one was a novel mutation (exons 18-33 deletion). Notably, the most common type of mutation was gross deletion, in contrast to other ethnic populations in which the most common mutation type was sequence variant. This study expands our knowledge of the PHKA2 mutation spectrum of GSD IX. Considering the PHKA2 mutation spectrum in Korean patients with GSD IX, molecular diagnostic methods for deletions should be conducted in conjunction with direct sequence analysis to enable accurate molecular diagnosis of this disease in the Korean population.

Peptides Interfering 3A Protein Dimerization Decrease FMDV Multiplication.

Directory of Open Access Journals (Sweden)

Mónica González-Magaldi

Full Text Available Nonstructural protein 3A is involved in relevant functions in foot-and-mouth disease virus (FMDV replication. FMDV 3A can form homodimers and preservation of the two hydrophobic α-helices (α1 and α2 that stabilize the dimer interface is essential for virus replication. In this work, small peptides mimicking residues involved in the dimer interface were used to interfere with dimerization and thus gain insight on its biological function. The dimer interface peptides α1, α2 and that spanning the two hydrophobic α-helices, α12, impaired in vitro dimer formation of a peptide containing the two α-helices, this effect being higher with peptide α12. To assess the effect of dimer inhibition in cultured cells, the interfering peptides were N-terminally fused to a heptaarginine (R7 sequence to favor their intracellular translocation. Thus, when fused to R7, interference peptides (100 μM were able to inhibit dimerization of transiently expressed 3A, the higher inhibitions being found with peptides α1 and α12. The 3A dimerization impairment exerted by the peptides correlated with significant, specific reductions in the viral yield recovered from peptide-treated FMDV infected cells. In this case, α2 was the only peptide producing significant reductions at concentrations lower than 100 μM. Thus, dimer interface peptides constitute a tool to understand the structure-function relationship of this viral protein and point to 3A dimerization as a potential antiviral target.

HNPCC: Six new pathogenic mutations

Directory of Open Access Journals (Sweden)

Epplen Joerg T

2004-06-01

Full Text Available Abstract Background Hereditary non-polyposis colorectal cancer (HNPCC is an autosomal dominant disease with a high risk for colorectal and endometrial cancer caused by germline mutations in DNA mismatch-repair genes (MMR. HNPCC accounts for approximately 2 to 5% of all colorectal cancers. Here we present 6 novel mutations in the DNA mismatch-repair genes MLH1, MSH2 and MSH6. Methods Patients with clinical diagnosis of HNPCC were counselled. Tumor specimen were analysed for microsatellite instability and immunohistochemistry for MLH1, MSH2 and MSH6 protein was performed. If one of these proteins was not detectable in the tumor mutation analysis of the corresponding gene was carried out. Results We identified 6 frameshift mutations (2 in MLH1, 3 in MSH2, 1 in MSH6 resulting in a premature stop: two mutations in MLH1 (c.2198_2199insAACA [p.N733fsX745], c.2076_2077delTG [p.G693fsX702], three mutations in MSH2 (c.810_811delGT [p.C271fsX282], c.763_766delAGTGinsTT [p.F255fsX282], c.873_876delGACT [p.L292fsX298] and one mutation in MSH6 (c.1421_1422dupTG [p.C475fsX480]. All six tumors tested for microsatellite instability showed high levels of microsatellite instability (MSI-H. Conclusions HNPCC in families with MSH6 germline mutations may show an age of onset that is comparable to this of patients with MLH1 and MSH2 mutations.

Mutational spectrum in a worldwide study of 29,700 families with BRCA1 or BRCA2 mutations.

Science.gov (United States)

Rebbeck, Timothy R; Friebel, Tara M; Friedman, Eitan; Hamann, Ute; Huo, Dezheng; Kwong, Ava; Olah, Edith; Olopade, Olufunmilayo I; Solano, Angela R; Teo, Soo-Hwang; Thomassen, Mads; Weitzel, Jeffrey N; Chan, T L; Couch, Fergus J; Goldgar, David E; Kruse, Torben A; Palmero, Edenir Inêz; Park, Sue Kyung; Torres, Diana; van Rensburg, Elizabeth J; McGuffog, Lesley; Parsons, Michael T; Leslie, Goska; Aalfs, Cora M; Abugattas, Julio; Adlard, Julian; Agata, Simona; Aittomäki, Kristiina; Andrews, Lesley; Andrulis, Irene L; Arason, Adalgeir; Arnold, Norbert; Arun, Banu K; Asseryanis, Ella; Auerbach, Leo; Azzollini, Jacopo; Balmaña, Judith; Barile, Monica; Barkardottir, Rosa B; Barrowdale, Daniel; Benitez, Javier; Berger, Andreas; Berger, Raanan; Blanco, Amie M; Blazer, Kathleen R; Blok, Marinus J; Bonadona, Valérie; Bonanni, Bernardo; Bradbury, Angela R; Brewer, Carole; Buecher, Bruno; Buys, Saundra S; Caldes, Trinidad; Caliebe, Almuth; Caligo, Maria A; Campbell, Ian; Caputo, Sandrine M; Chiquette, Jocelyne; Chung, Wendy K; Claes, Kathleen B M; Collée, J Margriet; Cook, Jackie; Davidson, Rosemarie; de la Hoya, Miguel; De Leeneer, Kim; de Pauw, Antoine; Delnatte, Capucine; Diez, Orland; Ding, Yuan Chun; Ditsch, Nina; Domchek, Susan M; Dorfling, Cecilia M; Velazquez, Carolina; Dworniczak, Bernd; Eason, Jacqueline; Easton, Douglas F; Eeles, Ros; Ehrencrona, Hans; Ejlertsen, Bent; Engel, Christoph; Engert, Stefanie; Evans, D Gareth; Faivre, Laurence; Feliubadaló, Lidia; Ferrer, Sandra Fert; Foretova, Lenka; Fowler, Jeffrey; Frost, Debra; Galvão, Henrique C R; Ganz, Patricia A; Garber, Judy; Gauthier-Villars, Marion; Gehrig, Andrea; Gerdes, Anne-Marie; Gesta, Paul; Giannini, Giuseppe; Giraud, Sophie; Glendon, Gord; Godwin, Andrew K; Greene, Mark H; Gronwald, Jacek; Gutierrez-Barrera, Angelica; Hahnen, Eric; Hauke, Jan; Henderson, Alex; Hentschel, Julia; Hogervorst, Frans B L; Honisch, Ellen; Imyanitov, Evgeny N; Isaacs, Claudine; Izatt, Louise; Izquierdo, Angel; Jakubowska, Anna; James, Paul; Janavicius, Ramunas; Jensen, Uffe Birk; John, Esther M; Vijai, Joseph; Kaczmarek, Katarzyna; Karlan, Beth Y; Kast, Karin; Investigators, KConFab; Kim, Sung-Won; Konstantopoulou, Irene; Korach, Jacob; Laitman, Yael; Lasa, Adriana; Lasset, Christine; Lázaro, Conxi; Lee, Annette; Lee, Min Hyuk; Lester, Jenny; Lesueur, Fabienne; Liljegren, Annelie; Lindor, Noralane M; Longy, Michel; Loud, Jennifer T; Lu, Karen H; Lubinski, Jan; Machackova, Eva; Manoukian, Siranoush; Mari, Véronique; Martínez-Bouzas, Cristina; Matrai, Zoltan; Mebirouk, Noura; Meijers-Heijboer, Hanne E J; Meindl, Alfons; Mensenkamp, Arjen R; Mickys, Ugnius; Miller, Austin; Montagna, Marco; Moysich, Kirsten B; Mulligan, Anna Marie; Musinsky, Jacob; Neuhausen, Susan L; Nevanlinna, Heli; Ngeow, Joanne; Nguyen, Huu Phuc; Niederacher, Dieter; Nielsen, Henriette Roed; Nielsen, Finn Cilius; Nussbaum, Robert L; Offit, Kenneth; Öfverholm, Anna; Ong, Kai-Ren; Osorio, Ana; Papi, Laura; Papp, Janos; Pasini, Barbara; Pedersen, Inge Sokilde; Peixoto, Ana; Peruga, Nina; Peterlongo, Paolo; Pohl, Esther; Pradhan, Nisha; Prajzendanc, Karolina; Prieur, Fabienne; Pujol, Pascal; Radice, Paolo; Ramus, Susan J; Rantala, Johanna; Rashid, Muhammad Usman; Rhiem, Kerstin; Robson, Mark; Rodriguez, Gustavo C; Rogers, Mark T; Rudaitis, Vilius; Schmidt, Ane Y; Schmutzler, Rita Katharina; Senter, Leigha; Shah, Payal D; Sharma, Priyanka; Side, Lucy E; Simard, Jacques; Singer, Christian F; Skytte, Anne-Bine; Slavin, Thomas P; Snape, Katie; Sobol, Hagay; Southey, Melissa; Steele, Linda; Steinemann, Doris; Sukiennicki, Grzegorz; Sutter, Christian; Szabo, Csilla I; Tan, Yen Y; Teixeira, Manuel R; Terry, Mary Beth; Teulé, Alex; Thomas, Abigail; Thull, Darcy L; Tischkowitz, Marc; Tognazzo, Silvia; Toland, Amanda Ewart; Topka, Sabine; Trainer, Alison H; Tung, Nadine; van Asperen, Christi J; van der Hout, Annemieke H; van der Kolk, Lizet E; van der Luijt, Rob B; Van Heetvelde, Mattias; Varesco, Liliana; Varon-Mateeva, Raymonda; Vega, Ana; Villarreal-Garza, Cynthia; von Wachenfeldt, Anna; Walker, Lisa; Wang-Gohrke, Shan; Wappenschmidt, Barbara; Weber, Bernhard H F; Yannoukakos, Drakoulis; Yoon, Sook-Yee; Zanzottera, Cristina; Zidan, Jamal; Zorn, Kristin K; Hutten Selkirk, Christina G; Hulick, Peter J; Chenevix-Trench, Georgia; Spurdle, Amanda B; Antoniou, Antonis C; Nathanson, Katherine L

2018-05-01

The prevalence and spectrum of germline mutations in BRCA1 and BRCA2 have been reported in single populations, with the majority of reports focused on White in Europe and North America. The Consortium of Investigators of Modifiers of BRCA1/2 (CIMBA) has assembled data on 18,435 families with BRCA1 mutations and 11,351 families with BRCA2 mutations ascertained from 69 centers in 49 countries on six continents. This study comprehensively describes the characteristics of the 1,650 unique BRCA1 and 1,731 unique BRCA2 deleterious (disease-associated) mutations identified in the CIMBA database. We observed substantial variation in mutation type and frequency by geographical region and race/ethnicity. In addition to known founder mutations, mutations of relatively high frequency were identified in specific racial/ethnic or geographic groups that may reflect founder mutations and which could be used in targeted (panel) first pass genotyping for specific populations. Knowledge of the population-specific mutational spectrum in BRCA1 and BRCA2 could inform efficient strategies for genetic testing and may justify a more broad-based oncogenetic testing in some populations. © 2018 Wiley Periodicals, Inc.

Precision cosmology with weak gravitational lensing

Science.gov (United States)

Hearin, Andrew P.

In recent years, cosmological science has developed a highly predictive model for the universe on large scales that is in quantitative agreement with a wide range of astronomical observations. While the number and diversity of successes of this model provide great confidence that our general picture of cosmology is correct, numerous puzzles remain. In this dissertation, I analyze the potential of planned and near future galaxy surveys to provide new understanding of several unanswered questions in cosmology, and address some of the leading challenges to this observational program. In particular, I study an emerging technique called cosmic shear, the weak gravitational lensing produced by large scale structure. I focus on developing strategies to optimally use the cosmic shear signal observed in galaxy imaging surveys to uncover the physics of dark energy and the early universe. In chapter 1 I give an overview of a few unsolved mysteries in cosmology and I motivate weak lensing as a cosmological probe. I discuss the use of weak lensing as a test of general relativity in chapter 2 and assess the threat to such tests presented by our uncertainty in the physics of galaxy formation. Interpreting the cosmic shear signal requires knowledge of the redshift distribution of the lensed galaxies. This redshift distribution will be significantly uncertain since it must be determined photometrically. In chapter 3 I investigate the influence of photometric redshift errors on our ability to constrain dark energy models with weak lensing. The ability to study dark energy with cosmic shear is also limited by the imprecision in our understanding of the physics of gravitational collapse. In chapter 4 I present the stringent calibration requirements on this source of uncertainty. I study the potential of weak lensing to resolve a debate over a long-standing anomaly in CMB measurements in chapter 5. Finally, in chapter 6 I summarize my findings and conclude with a brief discussion of my

New weak keys in simplified IDEA

Science.gov (United States)

Hafman, Sari Agustini; Muhafidzah, Arini

2016-02-01

Simplified IDEA (S-IDEA) is simplified version of International Data Encryption Algorithm (IDEA) and useful teaching tool to help students to understand IDEA. In 2012, Muryanto and Hafman have found a weak key class in the S-IDEA by used differential characteristics in one-round (0, ν, 0, ν) → (0,0, ν, ν) on the first round to produce input difference (0,0, ν, ν) on the fifth round. Because Muryanto and Hafman only use three differential characteristics in one-round, we conducted a research to find new differential characteristics in one-round and used it to produce new weak key classes of S-IDEA. To find new differential characteristics in one-round of S-IDEA, we applied a multiplication mod 216+1 on input difference and combination of active sub key Z1, Z4, Z5, Z6. New classes of weak keys are obtained by combining all of these characteristics and use them to construct two new differential characteristics in full-round of S-IDEA with or without the 4th round sub key. In this research, we found six new differential characteristics in one round and combined them to construct two new differential characteristics in full-round of S-IDEA. When two new differential characteristics in full-round of S-IDEA are used and the 4th round sub key required, we obtain 2 new classes of weak keys, 213 and 28. When two new differential characteristics in full-round of S-IDEA are used, yet the 4th round sub key is not required, the weak key class of 213 will be 221 and 28 will be 210. Membership test can not be applied to recover the key bits in those weak key classes. The recovery of those unknown key bits can only be done by using brute force attack. The simulation result indicates that the bit of the key can be recovered by the longest computation time of 0,031 ms.

Dominant mutations in S. cerevisiae PMS1 identify the Mlh1-Pms1 endonuclease active site and an exonuclease 1-independent mismatch repair pathway.

Science.gov (United States)

Smith, Catherine E; Mendillo, Marc L; Bowen, Nikki; Hombauer, Hans; Campbell, Christopher S; Desai, Arshad; Putnam, Christopher D; Kolodner, Richard D

2013-10-01

Lynch syndrome (hereditary nonpolypsis colorectal cancer or HNPCC) is a common cancer predisposition syndrome. Predisposition to cancer in this syndrome results from increased accumulation of mutations due to defective mismatch repair (MMR) caused by a mutation in one of the mismatch repair genes MLH1, MSH2, MSH6 or PMS2/scPMS1. To better understand the function of Mlh1-Pms1 in MMR, we used Saccharomyces cerevisiae to identify six pms1 mutations (pms1-G683E, pms1-C817R, pms1-C848S, pms1-H850R, pms1-H703A and pms1-E707A) that were weakly dominant in wild-type cells, which surprisingly caused a strong MMR defect when present on low copy plasmids in an exo1Δ mutant. Molecular modeling showed these mutations caused amino acid substitutions in the metal coordination pocket of the Pms1 endonuclease active site and biochemical studies showed that they inactivated the endonuclease activity. This model of Mlh1-Pms1 suggested that the Mlh1-FERC motif contributes to the endonuclease active site. Consistent with this, the mlh1-E767stp mutation caused both MMR and endonuclease defects similar to those caused by the dominant pms1 mutations whereas mutations affecting the predicted metal coordinating residue Mlh1-C769 had no effect. These studies establish that the Mlh1-Pms1 endonuclease is required for MMR in a previously uncharacterized Exo1-independent MMR pathway.

Dominant mutations in S. cerevisiae PMS1 identify the Mlh1-Pms1 endonuclease active site and an exonuclease 1-independent mismatch repair pathway.

Directory of Open Access Journals (Sweden)

Catherine E Smith

2013-10-01

Full Text Available Lynch syndrome (hereditary nonpolypsis colorectal cancer or HNPCC is a common cancer predisposition syndrome. Predisposition to cancer in this syndrome results from increased accumulation of mutations due to defective mismatch repair (MMR caused by a mutation in one of the mismatch repair genes MLH1, MSH2, MSH6 or PMS2/scPMS1. To better understand the function of Mlh1-Pms1 in MMR, we used Saccharomyces cerevisiae to identify six pms1 mutations (pms1-G683E, pms1-C817R, pms1-C848S, pms1-H850R, pms1-H703A and pms1-E707A that were weakly dominant in wild-type cells, which surprisingly caused a strong MMR defect when present on low copy plasmids in an exo1Δ mutant. Molecular modeling showed these mutations caused amino acid substitutions in the metal coordination pocket of the Pms1 endonuclease active site and biochemical studies showed that they inactivated the endonuclease activity. This model of Mlh1-Pms1 suggested that the Mlh1-FERC motif contributes to the endonuclease active site. Consistent with this, the mlh1-E767stp mutation caused both MMR and endonuclease defects similar to those caused by the dominant pms1 mutations whereas mutations affecting the predicted metal coordinating residue Mlh1-C769 had no effect. These studies establish that the Mlh1-Pms1 endonuclease is required for MMR in a previously uncharacterized Exo1-independent MMR pathway.

Gossip and Distributed Kalman Filtering: Weak Consensus Under Weak Detectability

Science.gov (United States)

Kar, Soummya; Moura, José M. F.

2011-04-01

The paper presents the gossip interactive Kalman filter (GIKF) for distributed Kalman filtering for networked systems and sensor networks, where inter-sensor communication and observations occur at the same time-scale. The communication among sensors is random; each sensor occasionally exchanges its filtering state information with a neighbor depending on the availability of the appropriate network link. We show that under a weak distributed detectability condition: 1. the GIKF error process remains stochastically bounded, irrespective of the instability properties of the random process dynamics; and 2. the network achieves \\emph{weak consensus}, i.e., the conditional estimation error covariance at a (uniformly) randomly selected sensor converges in distribution to a unique invariant measure on the space of positive semi-definite matrices (independent of the initial state.) To prove these results, we interpret the filtered states (estimates and error covariances) at each node in the GIKF as stochastic particles with local interactions. We analyze the asymptotic properties of the error process by studying as a random dynamical system the associated switched (random) Riccati equation, the switching being dictated by a non-stationary Markov chain on the network graph.

A ferromagnetic chain in a random weak field

Science.gov (United States)

Avgin, I.

1996-10-01

The harmonic magnon modes in a Heisenberg ferromagnetic chain in a random weak field are studied. The Lyapunov exponent for the uniform ( k = 0) mode is computed using the coherent potential approximation (CPA) in the weak-disorder limit. The CPA results are compared with the numerical and weak-disorder expansions of various random systems. We have found that the inverse localization length and the integrated density of states have anomalous power law behaviour as reported earlier. The CPA also reproduces the dispersion law for the same system, calculated by Pimentel and Stinchcombe using the real space renormalization scaling technique. A brief comment is also made for the uniform weak-field case.

Radiation induced chlorophyll mutations in rice

International Nuclear Information System (INIS)

Bari, G.; Mustafa, G.; Soomro, A.M.; Baloch, A.W.

1985-01-01

Air dried grains of four local varieties of rice were treated with gamma-rays and fast neutrons for determining their mutagenic effectiveness through the occurence of chlorophyll mutations. Fast neutrons were more effective in inducing chlorophyll mutations and the rice variety Basmati 370 produced maximum number of mutations followed by varieties Sonahri Sugdasi, Jajai 77 and Sada Gulab. The highest frequency of chlorophyll mutations was that of albina types followed by striata types. The xantha, viridis and tigrina types of mutations were less frequent. (authors)

Induced mutations in chickpea (Cicer arietinum L.) II. frequency and spectrum of chlorophyll mutations

International Nuclear Information System (INIS)

Kharkwal, M.C.

1998-01-01

A comparative study of frequency and spectrum of chlorophyll mutations induced by two physical (gamma rays, fast neutrons) and two chemical mutagens (NMU, EMS) in relation to the effects in M1 plants and induction of mutations in M2 was made in four chickpea (Cicer arietinum L.) varieties, two desi (G 130 & H 214) one Kabuli (C 104) and one green seeded (L 345). The treatments included three doses each of gamma rays (400, 500 & 600 Gy) and fast neutrons (5, 10 & 15 Gy) and two concentrations with two different durations of two chemical mutagens, NMU [0.01% (20h), & 0.02% (8h)] and EMS [0.1% (20h) & 0.2% (8h)]. The frequencies and spectrum of three different kinds of induced chlorophyll mutations in the order albina (43.5%), chlorina (27.3%) and xantha (24.2%) were recorded. Chemical mutagens were found to be efficient in inducing chlorophyll mutations in chickpea. Highest frequency of mutations was observed in green seeded var. L 345 (83% of M1 families and 19.9/1000 M2 plants). Kabuli var. C 104 was least responsive for chlorophyll mutations

Mutation spectrum analysis of Duchenne/Becker muscular dystrophy in 68 families in Kuwait: The era of personalized medicine.

Directory of Open Access Journals (Sweden)

Fawziah Mohammed

Full Text Available Duchenne and Becker muscular dystrophies (DMD/BMD are X-linked recessive neuromuscular disorders characterized by progressive irreversible muscle weakness and atrophy that affect both skeletal and cardiac muscles. DMD/BMD is caused by mutations in the Dystrophin gene on the X chromosome, leading to the absence of the essential muscle protein Dystrophin in DMD. In BMD, Dystrophin is partially functioning with a shorter protein product. Recent advances in molecular therapies for DMD require precise genetic diagnoses because most therapeutic strategies are mutation-specific. Hence, early diagnosis is crucial to allow appropriate planning for patient care and treatment. In this study, data from DMD/BMD patients who attended the Kuwait Medical Genetic Center during the last 20 years was retrieved from a Kuwait neuromuscular registry and analyzed. We combined multiplex PCR and multiplex ligation-dependent probe amplification (MLPA with Sanger sequencing to detect Dystrophin gene mutations. A total of 35 different large rearrangements, 2 deletion-insertions (Indels and 4 substitution mutations were identified in the 68 unrelated families. The deletion and duplication rates were 66.2% and 4.4%, respectively. The analyzed data from our registry revealed that 11 (16% of the DMD families will benefit from newly introduced therapies (Ataluren and exon 51 skipping. At the time of submitting this paper, two cases have already enrolled in Ataluren (Tranlsarna™ therapy, and one case has been enrolled in exon 51 skipping therapy.

Spectrum of mutations in RARS-T patients includes TET2 and ASXL1 mutations.

Science.gov (United States)

Szpurka, Hadrian; Jankowska, Anna M; Makishima, Hideki; Bodo, Juraj; Bejanyan, Nelli; Hsi, Eric D; Sekeres, Mikkael A; Maciejewski, Jaroslaw P

2010-08-01

While a majority of patients with refractory anemia with ring sideroblasts and thrombocytosis harbor JAK2V617F and rarely MPLW515L, JAK2/MPL-negative cases constitute a diagnostic problem. 23 RARS-T cases were investigated applying immunohistochemical phospho-STAT5, sequencing and SNP-A-based karyotyping. Based on the association of TET2/ASXL1 mutations with MDS/MPN we studied molecular pattern of these genes. Two patients harbored ASXL1 and another 2 TET2 mutations. Phospho-STAT5 activation was present in one mutated TET2 and ASXL1 case. JAK2V617F/MPLW515L mutations were absent in TET2/ASXL1 mutants, indicating that similar clinical phenotype can be produced by various MPN-associated mutations and that additional unifying lesions may be present in RARS-T. Copyright (c) 2010 Elsevier Ltd. All rights reserved.

Weak-interaction contributions to hyperfine splitting and Lamb shift

International Nuclear Information System (INIS)

Eides, M.I.

1996-01-01

Weak-interaction contributions to hyperfine splitting and the Lamb shift in hydrogen and muonium are discussed. The problem of sign of the weak-interaction contribution to HFS is clarified, and simple physical arguments that make this sign evident are presented. It is shown that weak-interaction contributions to HFS in hydrogen and muonium have opposite signs. A weak-interaction contribution to the Lamb shift is obtained. copyright 1996 The American Physical Society

Prevalence of H63D, S65C and C282Y hereditary hemochromatosis gene mutations in Slovenian population by an improved high-throughput genotyping assay

Directory of Open Access Journals (Sweden)

Rupreht Ruth

2007-11-01

Full Text Available Abstract Background Hereditary hemochromatosis (HH is a common genetic disease characterized by excessive iron overload that leads to multi-organ failure. Although the most prevalent genotype in HH is homozygosity for C282Y mutation of the HFE gene, two additional mutations, H63D and S65C, appear to be associated with a milder form of HH. The aim of this study was to develop a high-throughput assay for HFE mutations screening based on TaqMan technology and to determine the frequencies of HFE mutations in the Slovenian population. Methods Altogether, 1282 randomly selected blood donors from different Slovenian regions and 21 HH patients were analyzed for the presence of HFE mutations by an in-house developed real-time PCR assay based on TaqMan technology using shorter non-interfering fluorescent single nucleotide polymorphism (SNP-specific MGB probes. The assay was validated by RFLP analysis and DNA sequencing. Results The genotyping assay of the H63D, S65C and C282Y mutations in the HFE gene, based on TaqMan technology proved to be fast, reliable, with a high-throughput capability and 100% concordant with genotypes obtained by RFLP and DNA sequencing. The observed frequency of C282Y homozygotes in the group of HH patients was only 48%, others were of the heterogeneous HFE genotype. Among 1282 blood donors tested, the observed H63D, S65C and C282Y allele frequency were 12.8% (95% confidence interval (CI 11.5 – 14.2%, 1.8% (95% CI 1.4 – 2.5% and 3.6% (95% CI 3.0 – 4.5%, respectively. Approximately 33% of the tested subjects had at least one of the three HH mutations, and 1% of them were C282Y homozygotes or compound heterozygotes C282Y/H63D or C282Y/S65C, presenting an increased risk for iron overload disease. A significant variation in H63D allele frequency was observed for one of the Slovenian regions. Conclusion The improved real-time PCR assay for H63D, S65C and C282Y mutations detection is accurate, fast, cost-efficient and ready for

Costo-efectividad del tratamiento con interferón beta en pacientes con síndrome clínico aislado de alto riesgo en Colombia

Directory of Open Access Journals (Sweden)

Luis Alfonso Zarco

2014-03-01

Full Text Available Introducción. En 85 % de los pacientes con esclerosis múltiple se presenta como manifestación inicial un primer evento desmielinizante o síndrome clínico aislado. En estos casos, el tratamiento con interferón beta retrasa hasta dos años la progresión a esclerosis múltiple. Sin embargo, en Colombia este medicamento es costoso. Objetivo. Determinar si el tratamiento del síndrome clínico aislado con interferón beta es costo-efectivo al retrasar la esclerosis múltiple en dos años. Materiales y métodos. Se realizó un análisis de costo-efectividad empleando un árbol de decisiones basado en la perspectiva del paciente y la sociedad. A partir de una revisión sistemática de la literatura y de conceptos de expertos se definieron las diversas probabilidades. Los costos de la enfermedad se calcularon por medio de la revisión de historias y la aplicación de encuestas a los pacientes atendidos en el Hospital Universitario San Ignacio. Para controlar la incertidumbre se realizó un análisis de sensibilidad mediante una simulación de Monte Carlo con mil pacientes. Resultados. El costo del tratamiento con interferón sobrepasa los Col$ 95’000.000 (US$ 50.000 por paciente durante los dos años. Aproximadamente, 80 % corresponde a los costos del medicamento. El costo de la recaída se acerca a Col$ 39’139.200 (US$ 21.744, y los costos indirectos corresponden a Col$ 10’958.400 (US$ 6.088. La tasa representativa del mercado fue de Col$ 1.800. Con el tratamiento se ganan sólo 0,06 años de vida ajustados por discapacidad (AVAD adicionales. La razón de costo-efectividad ‘incremental’ (sic. supera el umbral, incluso en el análisis de sensibilidad. Conclusión. La administración de interferón beta en pacientes con síndrome clínico aislado de alto riesgo en los primeros dos años no es costo-efectiva en Colombia.

Cosmology and the weak interaction

International Nuclear Information System (INIS)

Schramm, D.N.

1989-12-01

The weak interaction plays a critical role in modern Big Bang cosmology. This review will emphasize two of its most publicized cosmological connections: Big Bang nucleosynthesis and Dark Matter. The first of these is connected to the cosmological prediction of Neutrino Flavours, N ν ∼ 3 which is now being confirmed at SLC and LEP. The second is interrelated to the whole problem of galaxy and structure formation in the universe. This review will demonstrate the role of the weak interaction both for dark matter candidates and for the problem of generating seeds to form structure. 87 refs., 3 figs., 5 tabs

Cosmology and the weak interaction

Energy Technology Data Exchange (ETDEWEB)

Schramm, D.N. (Fermi National Accelerator Lab., Batavia, IL (USA)):(Chicago Univ., IL (USA))

1989-12-01

The weak interaction plays a critical role in modern Big Bang cosmology. This review will emphasize two of its most publicized cosmological connections: Big Bang nucleosynthesis and Dark Matter. The first of these is connected to the cosmological prediction of Neutrino Flavours, N{sub {nu}} {approximately} 3 which is now being confirmed at SLC and LEP. The second is interrelated to the whole problem of galaxy and structure formation in the universe. This review will demonstrate the role of the weak interaction both for dark matter candidates and for the problem of generating seeds to form structure. 87 refs., 3 figs., 5 tabs.

Weak disorder in Fibonacci sequences

Energy Technology Data Exchange (ETDEWEB)

Ben-Naim, E [Theoretical Division and Center for Nonlinear Studies, Los Alamos National Laboratory, Los Alamos, NM 87545 (United States); Krapivsky, P L [Department of Physics and Center for Molecular Cybernetics, Boston University, Boston, MA 02215 (United States)

2006-05-19

We study how weak disorder affects the growth of the Fibonacci series. We introduce a family of stochastic sequences that grow by the normal Fibonacci recursion with probability 1 - {epsilon}, but follow a different recursion rule with a small probability {epsilon}. We focus on the weak disorder limit and obtain the Lyapunov exponent that characterizes the typical growth of the sequence elements, using perturbation theory. The limiting distribution for the ratio of consecutive sequence elements is obtained as well. A number of variations to the basic Fibonacci recursion including shift, doubling and copying are considered. (letter to the editor)

Nonperturbative theory of weak pre- and post-selected measurements

Energy Technology Data Exchange (ETDEWEB)

Kofman, Abraham G., E-mail: kofmana@gmail.com; Ashhab, Sahel; Nori, Franco

2012-11-01

This paper starts with a brief review of the topic of strong and weak pre- and post-selected (PPS) quantum measurements, as well as weak values, and afterwards presents original work. In particular, we develop a nonperturbative theory of weak PPS measurements of an arbitrary system with an arbitrary meter, for arbitrary initial states of the system and the meter. New and simple analytical formulas are obtained for the average and the distribution of the meter pointer variable. These formulas hold to all orders in the weak value. In the case of a mixed preselected state, in addition to the standard weak value, an associated weak value is required to describe weak PPS measurements. In the linear regime, the theory provides the generalized Aharonov–Albert–Vaidman formula. Moreover, we reveal two new regimes of weak PPS measurements: the strongly-nonlinear regime and the inverted region (the regime with a very large weak value), where the system-dependent contribution to the pointer deflection decreases with increasing the measurement strength. The optimal conditions for weak PPS measurements are obtained in the strongly-nonlinear regime, where the magnitude of the average pointer deflection is equal or close to the maximum. This maximum is independent of the measurement strength, being typically of the order of the pointer uncertainty. In the optimal regime, the small parameter of the theory is comparable to the overlap of the pre- and post-selected states. We show that the amplification coefficient in the weak PPS measurements is generally a product of two qualitatively different factors. The effects of the free system and meter Hamiltonians are discussed. We also estimate the size of the ensemble required for a measurement and identify optimal and efficient meters for weak measurements. Exact solutions are obtained for a certain class of the measured observables. These solutions are used for numerical calculations, the results of which agree with the theory

Nonperturbative theory of weak pre- and post-selected measurements

International Nuclear Information System (INIS)

Kofman, Abraham G.; Ashhab, Sahel; Nori, Franco

2012-01-01

This paper starts with a brief review of the topic of strong and weak pre- and post-selected (PPS) quantum measurements, as well as weak values, and afterwards presents original work. In particular, we develop a nonperturbative theory of weak PPS measurements of an arbitrary system with an arbitrary meter, for arbitrary initial states of the system and the meter. New and simple analytical formulas are obtained for the average and the distribution of the meter pointer variable. These formulas hold to all orders in the weak value. In the case of a mixed preselected state, in addition to the standard weak value, an associated weak value is required to describe weak PPS measurements. In the linear regime, the theory provides the generalized Aharonov–Albert–Vaidman formula. Moreover, we reveal two new regimes of weak PPS measurements: the strongly-nonlinear regime and the inverted region (the regime with a very large weak value), where the system-dependent contribution to the pointer deflection decreases with increasing the measurement strength. The optimal conditions for weak PPS measurements are obtained in the strongly-nonlinear regime, where the magnitude of the average pointer deflection is equal or close to the maximum. This maximum is independent of the measurement strength, being typically of the order of the pointer uncertainty. In the optimal regime, the small parameter of the theory is comparable to the overlap of the pre- and post-selected states. We show that the amplification coefficient in the weak PPS measurements is generally a product of two qualitatively different factors. The effects of the free system and meter Hamiltonians are discussed. We also estimate the size of the ensemble required for a measurement and identify optimal and efficient meters for weak measurements. Exact solutions are obtained for a certain class of the measured observables. These solutions are used for numerical calculations, the results of which agree with the theory

Extraction of a Weak Co-Channel Interfering Communication Signal Using Complex Independent Component Analysis

Science.gov (United States)

2013-06-01

zarzoso/ biblio /tnn10.pdf"> % "Robust independent component analysis by iterative maximization</a> % <a href = "http://www.i3s.unice.fr/~zarzoso... biblio /tnn10.pdf"> % of the kurtosis contrast with algebraic optimal step size"</a>, % IEEE Transactions on Neural Networks, vol. 21, no. 2, % pp

On Hardy's paradox, weak measurements, and multitasking diagrams

International Nuclear Information System (INIS)

Meglicki, Zdzislaw

2011-01-01

We discuss Hardy's paradox and weak measurements by using multitasking diagrams, which are introduced to illustrate the progress of quantum probabilities through the double interferometer system. We explain how Hardy's paradox is avoided and elaborate on the outcome of weak measurements in this context. -- Highlights: → Hardy's paradox explained and eliminated. → Weak measurements: what is really measured? → Multitasking diagrams: introduced and used to discuss quantum mechanical processes.

Hunting the weak bosons

International Nuclear Information System (INIS)

Anon.

1979-01-01

The possibility of the production of weak bosons in the proton-antiproton colliding beam facilities which are currently being developed, is discussed. The production, decay and predicted properties of these particles are described. (W.D.L.).

Measures of weak noncompactness, nonlinear Leray-Schauder ...

African Journals Online (AJOL)

In this paper, we establish some new nonlinear Leray-Schauder alternatives for the sum and the product of weakly sequentially continuous operators in Banach algebras satisfying certain sequential condition (P). The main condition in our results is formulated in terms of axiomatic measures of weak noncompactness.

Weak localization in few-layer black phosphorus

International Nuclear Information System (INIS)

Du, Yuchen; Neal, Adam T; Zhou, Hong; Ye, Peide D

2016-01-01

We have conducted a comprehensive investigation into the magneto-transport properties of few-layer black phosphorus in terms of phase coherence length, phase coherence time, and mobility via weak localization measurement and Hall-effect measurement. We present magnetoresistance data showing the weak localization effect in bare p-type few-layer black phosphorus and reveal its strong dependence on temperature and carrier concentration. The measured weak localization agrees well with the Hikami–Larkin–Nagaoka model and the extracted phase coherence length of 104 nm at 350 mK, decreasing as ∼T −0.513+−0.053 with increased temperature. Weak localization measurement allows us to qualitatively probe the temperature-dependent phase coherence time τ ϕ , which is in agreement with the theory of carrier interaction in the diffusive regime. We also observe the universal conductance fluctuation phenomenon in few-layer black phosphorus within moderate magnetic field and low temperature regime. (paper)

Late-Onset Glycogen Storage Disease Type II (Pompe's Disease) with a Novel Mutation: A Malaysian Experience.

Science.gov (United States)

Fu Liong, Hiew; Abdul Wahab, Siti Aishah; Yakob, Yusnita; Lock Hock, Ngu; Thong, Wong Kum; Viswanathan, Shanthi

2014-01-01

Pompe's disease (acid maltase deficiency, glycogen storage disease type II) is an autosomal recessive disorder caused by a deficiency of lysosomal acid α-1,4-glucosidase, resulting in excessive accumulation of glycogen in the lysosomes and cytoplasm of all tissues, most notably in skeletal muscles. We present a case of adult-onset Pompe's disease with progressive proximal muscles weakness over 5 years and respiratory failure on admission, requiring prolonged mechanical ventilation. Electromyography showed evidence of myopathic process with small amplitudes, polyphasic motor unit action potentials, and presence of pseudomyotonic discharges. Muscle biopsy showed glycogen-containing vacuoles in the muscle fibers consistent with glycogen storage disease. Genetic analysis revealed two compound heterozygous mutations at c.444C>G (p.Tyr148∗) in exon 2 and c.2238G>C (p.Trp746Cys) in exon 16, with the former being a novel mutation. This mutation has not been reported before, to our knowledge. The patient was treated with high protein diet during the admission and subsequently showed good clinical response to enzyme replacement therapy with survival now to the eighth year. Conclusion. In patients with late-onset adult Pompe's disease, careful evaluation and early identification of the disease and its treatment with high protein diet and enzyme replacement therapy improve muscle function and have beneficial impact on long term survival.

Importance of weak minerals on earthquake mechanics

Science.gov (United States)

Kaneki, S.; Hirono, T.

2017-12-01

The role of weak minerals such as smectite and talc on earthquake mechanics is one of the important issues, and has been debated for recent several decades. Traditionally weak minerals in fault have been reported to weaken fault strength causing from its low frictional resistance. Furthermore, velocity-strengthening behavior of such weak mineral (talc) is considered to responsible for fault creep (aseismic slip) in the San Andreas fault. In contrast, recent studies reported that large amount of weak smectite in the Japan Trench could facilitate gigantic seismic slip during the 2011 Tohoku-oki earthquake. To investigate the role of weak minerals on rupture propagation process and magnitude of slip, we focus on the frictional properties of carbonaceous materials (CMs), which is the representative weak materials widely distributed in and around the convergent boundaries. Field observation and geochemical analyses revealed that graphitized CMs-layer is distributed along the slip surface of a fossil plate-subduction fault. Laboratory friction experiments demonstrated that pure quartz, bulk mixtures with bituminous coal (1 wt.%), and quartz with layered coal samples exhibited almost similar frictional properties (initial, yield, and dynamic friction). However, mixtures of quartz (99 wt.%) and layered graphite (1 wt.%) showed significantly lower initial and yield friction coefficient (0.31 and 0.50, respectively). Furthermore, the stress ratio S, defined as (yield stress-initial stress)/(initial stress-dynamic stress), increased in layered graphite samples (1.97) compared to quartz samples (0.14). Similar trend was observed in smectite-rich fault gouge. By referring the reported results of dynamic rupture propagation simulation using S ratio of 1.4 (typical value for the Japan Trench) and 2.0 (this study), we confirmed that higher S ratio results in smaller slip distance by approximately 20 %. On the basis of these results, we could conclude that weak minerals have lower

The prognostic values of EGFR expression and KRAS mutation in patients with synchronous or metachronous metastatic colorectal cancer

International Nuclear Information System (INIS)

Huang, Ching-Wen; Wang, Jaw-Yuan; Tsai, Hsiang-Lin; Chen, Yi-Ting; Huang, Chun-Ming; Ma, Cheng-Jen; Lu, Chien-Yu; Kuo, Chao-Hung; Wu, Deng-Chyang; Chai, Chee-Yin

2013-01-01

The epidermal growth factor receptor (EGFR)/RAS/RAF/MEK/MAPK pathway is an important pathway in the carcinogenesis, invasion and metastasis of colorectal cancers (CRCs). We conducted a retrospective study to determine the prognostic values of EGFR expression and KRAS mutation in patients with metastatic CRC (mCRC) based on synchronous or metachronous status. From October 2002 to March 2012, 205 patients with mCRC were retrospectively analyzed; 98 were found to have metachronous mCRC while 107 were found to have synchronous mCRC. The EGFR expressions were determinate by IHC (immunohistochemistry) analysis and categorized 1+ (weak intensity), 2+ (moderate intensity), and 3+ (strong intensity). Genomic DNA was isolated from frozen primary CRC tissues and direct sequencing of KRAS was performed. The clinicopathological features of these mCRC patients were retrospectively investigated according to EGFR expression and KRAS mutation status. Moreover, we analyzed the prognostic values of EGFR expression and KRAS mutation among these patients. Of the 205 patients with mCRC, EGFR expression was analyzed in 167 patients, and positive EGFR expression was noted in 140 of those patients (83.8%). KRAS mutation was investigated in 205 patients and mutations were noted in 88 of those patients (42.9%). In patients with metachronous mCRC, positive EGFR expression was significantly correlated with well-and moderately-differentiated tumors (P = 0.028), poorer disease-free survival (DFS) (P < 0.001), and overall survival (OS) (P < 0.001). Furthermore, positive EGFR expression was a significant independent prognostic factor of DFS (P = 0.006, HR: 4.012, 95% CI: 1.130–8.445) and OS (P = 0.028, HR: 3.090, 95% CI: 1.477–10.900) in metachronous mCRC patients. KRAS mutation status was not significantly related to DFS and OS of patients with metachronous mCRC; likewise, KRAS mutation status was not significantly different in the progression-free survival (PFS) and OS of patients with

Epilepsy caused by CDKL5 mutations.

Science.gov (United States)

Castrén, Maija; Gaily, Eija; Tengström, Carola; Lähdetie, Jaana; Archer, Hayley; Ala-Mello, Sirpa

2011-01-01

Mutations in the cyclin-dependent kinase-like 5 gene (CDKL5) have been identified in female patients with early onset epileptic encephalopathy and severe mental retardation with a Rett-like phenotype. Subsequently CDKL5 mutations were shown to be associated with more diverse phenotypes including mild epilepsy and autism without epilepsy. Furthermore, CDKL5 mutations were found in patients with Angelman-like phenotype. The severity of epilepsy associated with CDKL5 mutations was recently shown to correlate with the type of CDKL5 mutations and epilepsy was identified to involve three distinct sequential stages. Here, we describe the phenotype of a severe form of neurodevelopmental disease in a female patient with a de novo nonsense mutation of the CDKL5 gene c.175C > T (p.R59X) affecting the catalytic domain of CDKL5 protein. Mutations in the CDKL5 gene are less common in males and can be associated with a genomic deletion as found in our male patient with a deletion of 0.3 Mb at Xp22.13 including the CDKL5 gene. We review phenotypes associated with CDKL5 mutations and examine putative relationships between the clinical epilepsy phenotype and the type of the mutation in the CDKL5 gene. © 2010 European Paediatric Neurology Society. Published by Elsevier Ltd. All rights reserved.

Strong effects in weak nonleptonic decays

International Nuclear Information System (INIS)

Wise, M.B.

1980-04-01

In this report the weak nonleptonic decays of kaons and hyperons are examined with the hope of gaining insight into a recently proposed mechanism for the ΔI = 1/2 rule. The effective Hamiltonian for ΔS = 1 weak nonleptonic decays and that for K 0 -anti K 0 mixing are calculated in the six-quark model using the leading logarithmic approximation. These are used to examine the CP violation parameters of the kaon system. It is found that if Penguin-type diagrams make important contributions to K → ππ decay amplitudes then upcoming experiments may be able to distinguish the six-quark model for CP violation from the superweak model. The weak radiative decays of hyperons are discussed with an emphasis on what they can teach us about hyperon nonleptonic decays and the ΔI = 1/2 rule

Mutation induction by heavy ions

Science.gov (United States)

Kiefer, J.; Stoll, U.; Schneider, E.

1994-10-01

Mutation induction by heavy ions is compared in yeast and mammalian cells. Since mutants can only be recovered in survivors the influence of inactivation cross sections has to be taken into account. It is shown that both the size of the sensitive cellular site as well as track structure play an important role. Another parameter which influences the probability of mutation induction is repair: Contrary to naive assumptions primary radiation damage does not directly lead to mutations but requires modification to reconstitute the genetic machinery so that mutants can survive. The molecular structure of mutations was analyzed after exposure to deuterons by amplification with the aid of polymerase chain reaction. The results-although preliminary-demonstrate that even with densely ionizing particles a large fraction does not carry big deletions which suggests that point mutations may also be induced by heavy ions.

Weak Hard X-Ray Emission from Broad Absorption Line Quasars: Evidence for Intrinsic X-Ray Weakness

DEFF Research Database (Denmark)

Luo, B.; Brandt, W. N.; Alexander, D. M.

2014-01-01

We report NuSTAR observations of a sample of six X-ray weak broad absorption line (BAL) quasars. These targets, at z = 0.148-1.223, are among the optically brightest and most luminous BAL quasars known at z 330 times weaker than...... expected for typical quasars. Our results from a pilot NuSTAR study of two low-redshift BAL quasars, a Chandra stacking analysis of a sample of high-redshift BAL quasars, and a NuSTAR spectral analysis of the local BAL quasar Mrk 231 have already suggested the existence of intrinsically X-ray weak BAL...... quasars, i.e., quasars not emitting X-rays at the level expected from their optical/UV emission. The aim of the current program is to extend the search for such extraordinary objects. Three of the six new targets are weakly detected by NuSTAR with ≲ 45 counts in the 3-24 keV band, and the other three...

Volatility of Mutator Phenotypes at Single Cell Resolution.

Directory of Open Access Journals (Sweden)

Scott R Kennedy

2015-04-01

Full Text Available Mutator phenotypes accelerate the evolutionary process of neoplastic transformation. Historically, the measurement of mutation rates has relied on scoring the occurrence of rare mutations in target genes in large populations of cells. Averaging mutation rates over large cell populations assumes that new mutations arise at a constant rate during each cell division. If the mutation rate is not constant, an expanding mutator population may contain subclones with widely divergent rates of evolution. Here, we report mutation rate measurements of individual cell divisions of mutator yeast deficient in DNA polymerase ε proofreading and base-base mismatch repair. Our data are best fit by a model in which cells can assume one of two distinct mutator states, with mutation rates that differ by an order of magnitude. In error-prone cell divisions, mutations occurred on the same chromosome more frequently than expected by chance, often in DNA with similar predicted replication timing, consistent with a spatiotemporal dimension to the hypermutator state. Mapping of mutations onto predicted replicons revealed that mutations were enriched in the first half of the replicon as well as near termination zones. Taken together, our findings show that individual genome replication events exhibit an unexpected volatility that may deepen our understanding of the evolution of mutator-driven malignancies.

Mutation breeding in malting barley

Energy Technology Data Exchange (ETDEWEB)

Hiraki, Makoto; Sanada, Matsuyoshi

1984-03-01

The released varieties of malting barley through mutation breeding is more than ten in number, including foreign varieties. In Japan four varieties has been released so far. We started mutation breeding in 1956 together with cross breeding that we employed before. Until now, Gamma 4, Amagi Nijo 1 and Fuji Nijo 2 have been produced from the direct use of induced mutations and Nirasaki Nijo 8 from the indirect use of them. Mutation breeding has been used mainly in the partial improvement of agronomic characteristics since the selection for malting quality was very complicated. As the variety bred by induced mutation is usually equivalent to the original variety in malting quality, both this new variety and the original one could be cultivated in the same area without any problem on later malt production. Particularly when one farmer cultivates barley in an extensive acreage, he can harvest at the best time according to the different maturing time of each variety. From these points of view, mutation breeding is an efficient tool in malting barley breeding. Mutagens we have used so far are X-rays, ..gamma..-rays, neutron and chemicals such as dES. From our experience in selection, the low dose of radiation and chemical mutagens are more effective in selection of point mutation than the high dose of radiation which tends to produce many abnormal but few practical mutants. (author).

Studies on mutation techniques in rice breeding

International Nuclear Information System (INIS)

Wang Cailian; Chen Qiufang; Jin Wei

2001-01-01

Synthetical techniques for improving rice mutation breeding efficiency were studied. The techniques consist of corresponding relationship between radiosensitivity and mutation frequency, choosing appropriate materials, combination of physical and chemical mutagens, mutagenic effects of the new mutagenic agents as proton, ions, synchronous irradiation and space mutation. These techniques and methods for inducing mutations are very valuable to increase inducing mutation efficiency and breeding level

Mutation, Witten index, and quiver invariant

Energy Technology Data Exchange (ETDEWEB)

Kim, Heeyeon [Perimeter Institute for Theoretical Physics,31 Caroline Street North, Waterloo, N2L 2Y5, Ontario (Canada); Lee, Seung-Joo [Department of Physics, Robeson Hall, Virginia Tech,Blacksburg, VA 24061 (United States); Yi, Piljin [School of Physics, Korea Institute for Advanced Study,Seoul 130-722 (Korea, Republic of)

2015-07-20

We explore Seiberg-like dualities, or mutations, for N=4 quiver quantum mechanics in the context of wall-crossing. In contrast to higher dimensions, the 1d Seiberg-duality must be performed with much care. With fixed Fayet-Iliopoulos constants, at most two nodes can be mutated, one left and the other right, mapping a chamber of a quiver into a chamber of a mutated quiver. We delineate this complex pattern for triangle quivers and show how the Witten indices are preserved under such finely chosen mutations. On the other hand, the quiver invariants, or wall-crossing-safe part of supersymmetric spectra, mutate more straightforwardly, whereby a quiver is mapped to a quiver. The mutation rule that preserves the quiver invariant is different from the usual one, however, which we explore and confirm numerically.

Mutation, Witten index, and quiver invariant

International Nuclear Information System (INIS)

Kim, Heeyeon; Lee, Seung-Joo; Yi, Piljin

2015-01-01

We explore Seiberg-like dualities, or mutations, for N=4 quiver quantum mechanics in the context of wall-crossing. In contrast to higher dimensions, the 1d Seiberg-duality must be performed with much care. With fixed Fayet-Iliopoulos constants, at most two nodes can be mutated, one left and the other right, mapping a chamber of a quiver into a chamber of a mutated quiver. We delineate this complex pattern for triangle quivers and show how the Witten indices are preserved under such finely chosen mutations. On the other hand, the quiver invariants, or wall-crossing-safe part of supersymmetric spectra, mutate more straightforwardly, whereby a quiver is mapped to a quiver. The mutation rule that preserves the quiver invariant is different from the usual one, however, which we explore and confirm numerically.

Mutation spectrum of RB1 mutations in retinoblastoma cases from Singapore with implications for genetic management and counselling.

Directory of Open Access Journals (Sweden)

Swati Tomar

Full Text Available Retinoblastoma (RB is a rare childhood malignant disorder caused by the biallelic inactivation of RB1 gene. Early diagnosis and identification of carriers of heritable RB1 mutations can improve disease outcome and management. In this study, mutational analysis was conducted on fifty-nine matched tumor and peripheral blood samples from 18 bilateral and 41 unilateral unrelated RB cases by a combinatorial approach of Multiplex Ligation-dependent Probe Amplification (MLPA assay, deletion screening, direct sequencing, copy number gene dosage analysis and methylation assays. Screening of both blood and tumor samples yielded a mutation detection rate of 94.9% (56/59 while only 42.4% (25/59 of mutations were detected if blood samples alone were analyzed. Biallelic mutations were observed in 43/59 (72.9% of tumors screened. There were 3 cases (5.1% in which no mutations could be detected and germline mutations were detected in 19.5% (8/41 of unilateral cases. A total of 61 point mutations were identified, of which 10 were novel. There was a high incidence of previously reported recurrent mutations, occurring at 38.98% (23/59 of all cases. Of interest were three cases of mosaic RB1 mutations detected in the blood from patients with unilateral retinoblastoma. Additionally, two germline mutations previously reported to be associated with low-penetrance phenotypes: missense-c.1981C>T and splice variant-c.607+1G>T, were observed in a bilateral and a unilateral proband, respectively. These findings have implications for genetic counselling and risk prediction for the affected families. This is the first published report on the spectrum of mutations in RB patients from Singapore and shows that further improved mutation screening strategies are required in order to provide a definitive molecular diagnosis for every case of RB. Our findings also underscore the importance of genetic testing in supporting individualized disease management plans for patients and

Normosmic congenital hypogonadotropic hypogonadism due to TAC3/TACR3 mutations: characterization of neuroendocrine phenotypes and novel mutations.

Directory of Open Access Journals (Sweden)

Bruno Francou

Full Text Available CONTEXT: TAC3/TACR3 mutations have been reported in normosmic congenital hypogonadotropic hypogonadism (nCHH (OMIM #146110. In the absence of animal models, studies of human neuroendocrine phenotypes associated with neurokinin B and NK3R receptor dysfunction can help to decipher the pathophysiology of this signaling pathway. OBJECTIVE: To evaluate the prevalence of TAC3/TACR3 mutations, characterize novel TACR3 mutations and to analyze neuroendocrine profiles in nCHH caused by deleterious TAC3/TACR3 biallelic mutations. RESULTS: From a cohort of 352 CHH, we selected 173 nCHH patients and identified nine patients carrying TAC3 or TACR3 variants (5.2%. We describe here 7 of these TACR3 variants (1 frameshift and 2 nonsense deleterious mutations and 4 missense variants found in 5 subjects. Modeling and functional studies of the latter demonstrated the deleterious consequence of one missense mutation (Tyr267Asn probably caused by the misfolding of the mutated NK3R protein. We found a statistically significant (p<0.0001 higher mean FSH/LH ratio in 11 nCHH patients with TAC3/TACR3 biallelic mutations than in 47 nCHH patients with either biallelic mutations in KISS1R, GNRHR, or with no identified mutations and than in 50 Kallmann patients with mutations in KAL1, FGFR1 or PROK2/PROKR2. Three patients with TAC3/TACR3 biallelic mutations had an apulsatile LH profile but low-frequency alpha-subunit pulses. Pulsatile GnRH administration increased alpha-subunit pulsatile frequency and reduced the FSH/LH ratio. CONCLUSION: The gonadotropin axis dysfunction associated with nCHH due to TAC3/TACR3 mutations is related to a low GnRH pulsatile frequency leading to a low frequency of alpha-subunit pulses and to an elevated FSH/LH ratio. This ratio might be useful for pre-screening nCHH patients for TAC3/TACR3 mutations.

Introduction to weak interactions

International Nuclear Information System (INIS)

Leite Lopes, J.

An account is first given of the electromagnetic interactions of complex, scalar, vector and spinor fields. It is shown that the electromagnetic field may be considered as a gauge field. Yang-Mills fields and the field theory invariant with respect to the non-Abelian gauge transformation group are then described. The construction, owing to this invariance principle, of conserved isospin currents associated with gauge fields is also demonstrated. This is followed by a historical survey of the development of the weak interaction theory, established at first to describe beta disintegration processes by analogy with electrodynamics. The various stages are mentioned from the discovery of principles and rules and violation of principles, such as those of invariance with respect to spatial reflection and charge conjugation to the formulation of the effective current-current Lagrangian and research on the structure of weak currents [fr

Efficient and specific gene knockdown by small interfering RNAs produced in bacteria

Science.gov (United States)

Huang, Linfeng; Jin, Jingmin; Deighan, Padraig; Kiner, Evgeny; McReynolds, Larry; Lieberman, Judy

2013-01-01

Synthetic small interfering RNAs (siRNAs) are an indispensable tool to investigate gene function in eukaryotic cells1,2 and may be used for therapeutic purposes to knockdown genes implicated in disease3. Thus far, most synthetic siRNAs have been produced by chemical synthesis. Here we present a method to produce highly potent siRNAs in E. coli. This method relies on ectopic expression of p19, a siRNA-binding protein found in a plant RNA virus4, 5. When expressed in E. coli, p19 stabilizes ~21 nt siRNA-like species produced by bacterial RNase III. Transfection of mammalian cells with siRNAs, generated in bacteria expressing p19 and a hairpin RNA encoding 200 or more nucleotides of a target gene, at low nanomolar concentrations reproducibly knocks down gene expression by ~90% without immunogenicity or off-target effects. Because bacterially produced siRNAs contain multiple sequences against a target gene, they may be especially useful for suppressing polymorphic cellular or viral genes. PMID:23475073

Rare and unexpected beta thalassemic mutations in Qazvin ...

African Journals Online (AJOL)

About 13 beta-globin mutations encompass 70 - 90% of mutation spectrum in Iran. These mutations are called common beta-globin mutations. The rest are rare or unknown mutations. The objective of this study was to identify and describe rare or unknown beta-globin mutations in Qazvin province. EDTAcontaining venous ...

Rare and unexpected beta thalassemic mutations in Qazvin ...

African Journals Online (AJOL)

STORAGESEVER

2010-01-04

Jan 4, 2010 ... About 13 beta-globin mutations encompass 70 - 90% of mutation spectrum in Iran. These mutations are called common beta-globin mutations. The rest are rare or unknown mutations. The objective of this study was to identify and describe rare or unknown beta-globin mutations in Qazvin province. EDTA-.

Molecular evaluation of a novel missense mutation & an insertional truncating mutation in SUMF1 gene

Directory of Open Access Journals (Sweden)

Udhaya H Kotecha

2014-01-01

Full Text Available Background & objectives: Multiple suphphatase deficiency (MSD is an autosomal recessive disorder affecting the post translational activation of all enzymes of the sulphatase family. To date, approximately 30 different mutations have been identified in the causative gene, sulfatase modifying factor 1 (SUMF1. We describe here the mutation analysis of a case of MSD. Methods: The proband was a four year old boy with developmental delay followed by neuroregression. He had coarse facies, appendicular hypertonia, truncal ataxia and ichthyosis limited to both lower limbs. Radiographs showed dysostosis multiplex. Clinical suspicion of MSD was confirmed by enzyme analysis of four enzymes of the sulphatase group. Results: The patient was compound heterozygote for a c.451A>G (p.K151E substitution in exon 3 and a single base insertion mutation (c.690_691 InsT in exon 5 in the SUMF1 gene. The bioinformatic analysis of the missense mutation revealed no apparent effect on the overall structure. However, the mutated 151-amino acid residue was found to be adjacent to the substrate binding and the active site residues, thereby affecting the substrate binding and/or catalytic activity, resulting in almost complete loss of enzyme function. Conclusions: The two mutations identified in the present case were novel. This is perhaps the first report of an insertion mutation in SUMF1 causing premature truncation of the protein.

Memory interfering effects of chlordiazepoxide on consummatory successive negative contrast.

Science.gov (United States)

Ortega, Leonardo A; Glueck, Amanda C; Daniel, Alan M; Prado-Rivera, Mayerli A; White, Michelle M; Papini, Mauricio R

2014-01-01

Long-Evans rats downshifted from 32% to 4% sucrose solution exhibit lower consummatory behavior during downshift trials than rats exposed only to 4% sucrose. In Experiment 1, this effect, called consummatory successive negative contrast (cSNC), was attenuated by administration of the benzodiazepine anxiolytic chlordiazepoxide (CDP, 5mg/kg, ip) before the second downshift trial (Trial 12), but was not affected when CDP was administered before the first downshift trial (Trial 11). In Experiment 2, CDP administered after Trial 11 actually enhanced the cSNC effect on Trial 12. This posttrial effect of CDP was reduced by delayed administration (Experiment 3). This CDP effect was not present in the absence of incentive downshift (Experiments 4-5), or when animals were tested with the preshift incentive (Experiment 6) or after complete recovery from cSNC (Experiment 7). The posttrial CDP effect was observed after an 8-day interval between Trials 11 and 12 (Experiment 8) and when administered after Trial 12, rather than Trial 11 (Experiment 9). Experiment 10 extended the effect to Wistar rats. Because CDP is a memory interfering drug, it was hypothesized that its posttrial administration interferes with the consolidation of the memory of the downshifted incentive, thus prolonging the mismatch between expected (32% sucrose) and obtained (4% sucrose) incentives that leads to the cSNC effect. Copyright © 2013 Elsevier Inc. All rights reserved.

Asymptotics of steady states of a selection–mutation equation for small mutation rate

KAUST Repository

Calsina, Àngel

2013-12-01

We consider a selection-mutation equation for the density of individuals with respect to a continuous phenotypic evolutionary trait. We assume that the competition term for an individual with a given trait depends on the traits of all the other individuals, therefore giving an infinite-dimensional nonlinearity. Mutations are modelled by means of an integral operator. We prove existence of steady states and show that, when the mutation rate goes to zero, the asymptotic profile of the population is a Cauchy distribution. © Royal Society of Edinburgh 2013.

Asymptotics of steady states of a selection–mutation equation for small mutation rate

KAUST Repository

Calsina, À ngel; Cuadrado, Sí lvia; Desvillettes, Laurent; Raoul, Gaë l

2013-01-01

We consider a selection-mutation equation for the density of individuals with respect to a continuous phenotypic evolutionary trait. We assume that the competition term for an individual with a given trait depends on the traits of all the other individuals, therefore giving an infinite-dimensional nonlinearity. Mutations are modelled by means of an integral operator. We prove existence of steady states and show that, when the mutation rate goes to zero, the asymptotic profile of the population is a Cauchy distribution. © Royal Society of Edinburgh 2013.

Mutation breeding in ornamental plants

International Nuclear Information System (INIS)

Datta, S.K.

1990-01-01

Full text: Mutation induction produced a large number of new promising varieties in ornamental species. 37 new mutants of Chrysanthemum and 14 of rose have been developed by mutations and released for commercialisation. The mutations in flower colour/shape were detected as chimeras in M 1 V 1 , M 1 V 2 , M 1 V 3 generations. The mutation frequency varied with the cultivar and exposure to gamma rays. Comparative analysis of original cultivars and their respective induced mutants on cytomorphological, anatomical and biochemical characters are being carried out for better understanding of the mechanism involved in the origin and evolution of somatic flower colour/shape mutations. Cytological analysis with reference to chromosomal aberrations, chromosome number, ICV, INV and DNA content gave no differences between the original and mutant cultivars. Analysis of florets/petal pigments by TLC and spectrophotometric methods indicated both qualitative and quantitative changes. (author)

Weak interactions at high energies

International Nuclear Information System (INIS)

Ellis, J.

1978-08-01

Review lectures are presented on the phenomenological implications of the modern spontaneously broken gauge theories of the weak and electromagnetic interactions, and some observations are made about which high energy experiments probe what aspects of gauge theories. Basic quantum chromodynamics phenomenology is covered including momentum dependent effective quark distributions, the transverse momentum cutoff, search for gluons as sources of hadron jets, the status and prospects for the spectroscopy of fundamental fermions and how fermions may be used to probe aspects of the weak and electromagnetic gauge theory, studies of intermediate vector bosons, and miscellaneous possibilities suggested by gauge theories from the Higgs bosons to speculations about proton decay. 187 references

BRAF mutations in conjunctival melanoma

DEFF Research Database (Denmark)

Larsen, Ann-Cathrine; Dahl, Christina; Dahmcke, Christina M.

2016-01-01

with atypia. BRAF mutations were identified in 39 of 111 (35%) cases. The rate ratio of BRAF-mutated versus BRAF-wild-type melanoma did not change over time. BRAF mutations were associated with T1 stage (p = 0.007), young age (p = 0.001), male gender (p = 0.02), sun-exposed location (p = 0.01), mixed....../non-pigmented tumour colour (p = 0.02) and nevus origin (p = 0.005), but did not associate with prognosis. BRAF status in conjunctival melanoma and paired premalignant lesions corresponded in 19 of 20 cases. Immunohistochemistry detected BRAF V600E mutations with a sensitivity of 0.94 and a specificity of 1...

quasi hyperrigidity and weak peak points for non-commutative ...

Indian Academy of Sciences (India)

7

Abstract. In this article, we introduce the notions of weak boundary repre- sentation, quasi hyperrigidity and weak peak points in the non-commutative setting for operator systems in C∗-algebras. An analogue of Saskin's theorem relating quasi hyperrigidity and weak Choquet boundary for particular classes of C∗-algebras is ...

Mutational meltdown in laboratory yeast populations

NARCIS (Netherlands)

Zeyl, C.; Mizesko, M.; Visser, de J.A.G.M.

2001-01-01

In small or repeatedly bottlenecked populations, mutations are expected to accumulate by genetic drift, causing fitness declines. In mutational meltdown models, such fitness declines further reduce population size, thus accelerating additional mutation accumulation and leading to extinction. Because

Mutational robustness of gene regulatory networks.

Directory of Open Access Journals (Sweden)

Aalt D J van Dijk

Full Text Available Mutational robustness of gene regulatory networks refers to their ability to generate constant biological output upon mutations that change network structure. Such networks contain regulatory interactions (transcription factor-target gene interactions but often also protein-protein interactions between transcription factors. Using computational modeling, we study factors that influence robustness and we infer several network properties governing it. These include the type of mutation, i.e. whether a regulatory interaction or a protein-protein interaction is mutated, and in the case of mutation of a regulatory interaction, the sign of the interaction (activating vs. repressive. In addition, we analyze the effect of combinations of mutations and we compare networks containing monomeric with those containing dimeric transcription factors. Our results are consistent with available data on biological networks, for example based on evolutionary conservation of network features. As a novel and remarkable property, we predict that networks are more robust against mutations in monomer than in dimer transcription factors, a prediction for which analysis of conservation of DNA binding residues in monomeric vs. dimeric transcription factors provides indirect evidence.

The first USH2A mutation analysis of Japanese autosomal recessive retinitis pigmentosa patients: a totally different mutation profile with the lack of frequent mutations found in Caucasian patients.

Science.gov (United States)

Zhao, Yang; Hosono, Katsuhiro; Suto, Kimiko; Ishigami, Chie; Arai, Yuuki; Hikoya, Akiko; Hirami, Yasuhiko; Ohtsubo, Masafumi; Ueno, Shinji; Terasaki, Hiroko; Sato, Miho; Nakanishi, Hiroshi; Endo, Shiori; Mizuta, Kunihiro; Mineta, Hiroyuki; Kondo, Mineo; Takahashi, Masayo; Minoshima, Shinsei; Hotta, Yoshihiro

2014-09-01

Retinitis pigmentosa (RP) is a highly heterogeneous genetic disease. The USH2A gene, which accounts for approximately 74-90% of Usher syndrome type 2 (USH2) cases, is also one of the major autosomal recessive RP (arRP) causative genes among Caucasian populations. To identify disease-causing USH2A gene mutations in Japanese RP patients, all 73 exons were screened for mutations by direct sequencing. In total, 100 unrelated Japanese RP patients with no systemic manifestations were identified, excluding families with obvious autosomal dominant inheritance. Of these 100 patients, 82 were included in this present study after 18 RP patients with very likely pathogenic EYS (eyes shut homolog) mutations were excluded. The mutation analysis of the USH2A revealed five very likely pathogenic mutations in four patients. A patient had only one very likely pathogenic mutation and the others had two of them. Caucasian frequent mutations p.C759F in arRP and p.E767fs in USH2 were not found. All the four patients exhibited typical clinical features of RP. The observed prevalence of USH2A gene mutations was approximately 4% among Japanese arRP patients, and the profile of the USH2A gene mutations differed largely between Japanese patients and previously reported Caucasian populations.

Adaptive mutation: has the unicorn landed?

Science.gov (United States)

Foster, P L

1998-04-01

Reversion of an episomal Lac- allele during lactose selection has been studied as a model for adaptive mutation. Although recent results show that the mutations that arise during selection are not "adaptive" in the original sense, the mutagenic mechanism that produces these mutations may nonetheless be of evolutionary significance. In addition, a transient mutational state induced in a subpopulation of starving cells could provide a species with a mechanism for adaptive evolution.

Adaptive mutation: has the unicorn landed?

Science.gov (United States)

Foster, P L

1998-01-01

Reversion of an episomal Lac- allele during lactose selection has been studied as a model for adaptive mutation. Although recent results show that the mutations that arise during selection are not "adaptive" in the original sense, the mutagenic mechanism that produces these mutations may nonetheless be of evolutionary significance. In addition, a transient mutational state induced in a subpopulation of starving cells could provide a species with a mechanism for adaptive evolution. PMID:9560365

SETBP1 mutations drive leukemic transformation in ASXL1-mutated MDS.

Science.gov (United States)

Inoue, D; Kitaura, J; Matsui, H; Hou, H-A; Chou, W-C; Nagamachi, A; Kawabata, K C; Togami, K; Nagase, R; Horikawa, S; Saika, M; Micol, J-B; Hayashi, Y; Harada, Y; Harada, H; Inaba, T; Tien, H-F; Abdel-Wahab, O; Kitamura, T

2015-04-01

Mutations in ASXL1 are frequent in patients with myelodysplastic syndrome (MDS) and are associated with adverse survival, yet the molecular pathogenesis of ASXL1 mutations (ASXL1-MT) is not fully understood. Recently, it has been found that deletion of Asxl1 or expression of C-terminal-truncating ASXL1-MTs inhibit myeloid differentiation and induce MDS-like disease in mice. Here, we find that SET-binding protein 1 (SETBP1) mutations (SETBP1-MT) are enriched among ASXL1-mutated MDS patients and associated with increased incidence of leukemic transformation, as well as shorter survival, suggesting that SETBP1-MT play a critical role in leukemic transformation of MDS. We identify that SETBP1-MT inhibit ubiquitination and subsequent degradation of SETBP1, resulting in increased expression. Expression of SETBP1-MT, in turn, inhibited protein phosphatase 2A activity, leading to Akt activation and enhanced expression of posterior Hoxa genes in ASXL1-mutant cells. Biologically, SETBP1-MT augmented ASXL1-MT-induced differentiation block, inhibited apoptosis and enhanced myeloid colony output. SETBP1-MT collaborated with ASXL1-MT in inducing acute myeloid leukemia in vivo. The combination of ASXL1-MT and SETBP1-MT activated a stem cell signature and repressed the tumor growth factor-β signaling pathway, in contrast to the ASXL1-MT-induced MDS model. These data reveal that SETBP1-MT are critical drivers of ASXL1-mutated MDS and identify several deregulated pathways as potential therapeutic targets in high-risk MDS.

Mutations of Profilin-1 Associated with Amyotrophic Lateral Sclerosis Promote Aggregation Due to Structural Changes of Its Native State.

Science.gov (United States)

Del Poggetto, Edoardo; Bemporad, Francesco; Tatini, Francesca; Chiti, Fabrizio

2015-11-20

The PFN1 gene, coding for profilin-1, has recently been associated with familial amyotrophic lateral sclerosis (fALS), as three mutations, namely C71G, M114T, and G118V, have been found in patients with familial forms of the disease and another, E117G, has been proposed to be a moderate risk factor for disease onset. In this work, we have purified the four profilin-1 variants along with the wild-type protein. The resulting aggregates appear to be fibrillar, to have a weak binding to ThT, and to possess a significant amount of intermolecular β-sheet structure. Using ThT fluorescence assays, far-UV circular dichroism, and dynamic light scattering, we found that all four variants have an aggregation propensity higher than that of the wild-type counterpart. In particular, the C71G mutation was found to induce the most dramatic change in aggregation, followed by the G118V and M114T substitutions and then the E117G mutation. Such a propensity was found not to strictly correlate with the conformational stability in this group of profilin-1 variants, determined using both urea-induced denaturation at equilibrium and folding/unfolding kinetics. However, it correlated with structural changes of the folded states, as monitored with far-UV circular dichroism, intrinsic fluorescence spectroscopy, ANS binding, acrylamide quenching, and dynamic light scattering. Overall, the results suggest that all four mutations increase the tendency of profilin-1 to aggregate and that such aggregation behavior is largely determined by the mutation-induced structural changes occurring in the folded state of the protein.

Leukemia-Associated Mutations in Nucleophosmin Alter Recognition by CRM1: Molecular Basis of Aberrant Transport.

Directory of Open Access Journals (Sweden)

Igor Arregi

Full Text Available Nucleophosmin (NPM is a nucleocytoplasmic shuttling protein, normally enriched in nucleoli, that performs several activities related to cell growth. NPM mutations are characteristic of a subtype of acute myeloid leukemia (AML, where mutant NPM seems to play an oncogenic role. AML-associated NPM mutants exhibit altered subcellular traffic, being aberrantly located in the cytoplasm of leukoblasts. Exacerbated export of AML variants of NPM is mediated by the nuclear export receptor CRM1, and due, in part, to a mutationally acquired novel nuclear export signal (NES. To gain insight on the molecular basis of NPM transport in physiological and pathological conditions, we have evaluated the export efficiency of NPM in cells, and present new data indicating that, in normal conditions, wild type NPM is weakly exported by CRM1. On the other hand, we have found that AML-associated NPM mutants efficiently form complexes with CRM1HA (a mutant CRM1 with higher affinity for NESs, and we have quantitatively analyzed CRM1HA interaction with the NES motifs of these mutants, using fluorescence anisotropy and isothermal titration calorimetry. We have observed that the affinity of CRM1HA for these NESs is similar, which may help to explain the transport properties of the mutants. We also describe NPM recognition by the import machinery. Our combined cellular and biophysical studies shed further light on the determinants of NPM traffic, and how it is dramatically altered by AML-related mutations.

Diversity of ARSACS mutations in French-Canadians.

Science.gov (United States)

Thiffault, I; Dicaire, M J; Tetreault, M; Huang, K N; Demers-Lamarche, J; Bernard, G; Duquette, A; Larivière, R; Gehring, K; Montpetit, A; McPherson, P S; Richter, A; Montermini, L; Mercier, J; Mitchell, G A; Dupré, N; Prévost, C; Bouchard, J P; Mathieu, J; Brais, B

2013-01-01

The growing number of spastic ataxia of Charlevoix-Saguenay (SACS) gene mutations reported worldwide has broadened the clinical phenotype of autosomal recessive spastic ataxia of Charlevoix-Saguenay (ARSACS). The identification of Quebec ARSACS cases without two known SACS mutation led to the development of a multi-modal genomic strategy to uncover mutations in this large gene and explore phenotype variability. Search for SACS mutations by combining various methods on 20 cases with a classical French-Canadian ARSACS phenotype without two mutations and a group of 104 sporadic or recessive spastic ataxia cases of unknown cause. Western blot on lymphoblast protein from cases with different genotypes was probed to establish if they still expressed sacsin. A total of 12 mutations, including 7 novels, were uncovered in Quebec ARSACS cases. The screening of 104 spastic ataxia cases of unknown cause for 98 SACS mutations did not uncover carriers of two mutations. Compounds heterozygotes for one missense SACS mutation were found to minimally express sacsin. The large number of SACS mutations present even in Quebec suggests that the size of the gene alone may explain the great genotypic diversity. This study does not support an expanding ARSACS phenotype in the French-Canadian population. Most mutations lead to loss of function, though phenotypic variability in other populations may reflect partial loss of function with preservation of some sacsin expression. Our results also highlight the challenge of SACS mutation screening and the necessity to develop new generation sequencing methods to ensure low cost complete gene sequencing.

Chloroplast mutations induced by 9-aminoacridine hydrochloride are independent of the plastome mutator in Oenothera.

Science.gov (United States)

GuhaMajumdar, M; Baldwin, S; Sears, B B

2004-02-01

Oenothera plants homozygous for the recessive plastome mutator allele ( pm) show chloroplast DNA (cpDNA) mutation frequencies that are about 1,000-fold higher than spontaneous levels. The pm-encoded gene product has been hypothesized to have a function in cpDNA replication, repair and/or mutation avoidance. Previous chemical mutagenesis experiments with the alkylating agent nitroso-methyl urea (NMU) showed a synergistic effect of NMU on the induction of mutations in the pm line, suggesting an interaction between the pm-encoded gene product and one of the repair systems that corrects alkylation damage. The goal of the experiments described here was to examine whether the pm activity extends to the repair of damage caused by non-alkylating mutagens. To this end, the intercalating mutagen, 9-aminoacridine hydrochloride (9AA) was tested for synergism with the plastome mutator. A statistical analysis of the data reported here indicates that the pm-encoded gene product is not involved in the repair of the 9AA-induced mutations. However, the recovery of chlorotic sectors in plants derived from the mutagenized seeds shows that 9AA can act as a mutagen of the chloroplast genome.

Signatures of mutational processes in human cancer

NARCIS (Netherlands)

Alexandrov, L.B.; Nik-Zainal, S.; Wedge, D.C.; Aparicio, S.A.; Behjati, S.; Biankin, A.V.; Bignell, G.R.; Bolli, N.; Borg, A.; Borresen-Dale, A.L.; Boyault, S.; Burkhardt, B.; Butler, A.P.; Caldas, C.; Davies, H.R.; Desmedt, C.; Eils, R.; Eyfjord, J.E.; Foekens, J.A.; Greaves, M.; Hosoda, F.; Hutter, B.; Ilicic, T.; Imbeaud, S.; Imielinsk, M.; Jager, N.; Jones, D.T.; Knappskog, S.; Kool, M.; Lakhani, S.R.; Lopez-Otin, C.; Martin, S.; Munshi, N.C.; Nakamura, H.; Northcott, P.A.; Pajic, M.; Papaemmanuil, E.; Paradiso, A.; Pearson, J.V.; Puente, X.S.; Raine, K.; Ramakrishna, M.; Richardson, A.L.; Richter, J.; Rosenstiel, P.; Schlesner, M.; Schumacher, T.N.; Span, P.N.; Teague, J.W.; Totoki, Y.; Tutt, A.N.; Valdes-Mas, R.; Buuren, M.M. van; Veer, L. van 't; Vincent-Salomon, A.; Waddell, N.; Yates, L.R.; Zucman-Rossi, J.; Futreal, P.A.; McDermott, U.; Lichter, P.; Meyerson, M.; Grimmond, S.M.; Siebert, R.; Campo, E.; Shibata, T.; Pfister, S.M.; Campbell, P.J.; Stratton, M.R.; Schlooz-Vries, M.S.; Tol, J.J. van; Laarhoven, H.W. van; Sweep, F.C.; Bult, P.; et al.,

2013-01-01

All cancers are caused by somatic mutations; however, understanding of the biological processes generating these mutations is limited. The catalogue of somatic mutations from a cancer genome bears the signatures of the mutational processes that have been operative. Here we analysed 4,938,362

Simulation of weak and strong Langmuir collapse regimes

International Nuclear Information System (INIS)

Hadzievski, L.R.; Skoric, M.M.; Kono, M.; Sato, T.

1998-01-01

In order to check the validity of the self-similar solutions and the existence of weak and strong collapse regimes, direct two dimensional simulation of the time evolution of a Langmuir soliton instability is performed. Simulation is based on the Zakharov model of strong Langmuir turbulence in a weakly magnetized plasma accounting for the full ion dynamics. For parameters considered, agreement with self-similar dynamics of the weak collapse type is found with no evidence of the strong Langmuir collapse. (author)

The slicer activity of ARGONAUTE1 is required specifically for the phasing, not production, of trans-acting short interfering RNAs in Arabidopsis

DEFF Research Database (Denmark)

Arribas Hernandez, Laura; Marchais, Antonin; Poulsen, Christian

2016-01-01

ARGONAUTE1 (AGO1) mediates posttranscriptional silencing by microRNAs (miRNAs) and short interfering RNAS (siRNAs). AGO1-catalyzed RNA cleavage (slicing) represses miRNA targets, but current models also highlight the roles of slicing in formation of siRNAs and siRNA-AGO1 complexes. miRNA-guided s......ARGONAUTE1 (AGO1) mediates posttranscriptional silencing by microRNAs (miRNAs) and short interfering RNAS (siRNAs). AGO1-catalyzed RNA cleavage (slicing) represses miRNA targets, but current models also highlight the roles of slicing in formation of siRNAs and siRNA-AGO1 complexes. mi...... is required for assembly of active AGO1-siRNA complexes in vivo, and many AGO1-bound siRNAs are trimmed in the absence of slicer activity. Remarkably, seedlings defective in AGO1 slicer activity produce abundant siRNAs from tasiRNA loci in vivo. These siRNAs depend on RDR6 and SUPPRESSOR OF GENE SILENCING3...

Prevalence of Weak D Antigen In Western Indian Population

Directory of Open Access Journals (Sweden)

Tanvi Sadaria

2015-12-01

Full Text Available Introduction: Discovery of Rh antigens in 1939 by Landsteiner and Weiner was the revolutionary stage in blood banking. Of these antigens, D, which decides Rh positivity or negativity, is the most antigenic. A problem is encountered when an individual has a weakened expression of D (Du, i.e., fewer numbers of D antigens on red cell membrane. Aims and Objectives: To know the prevalence of weak D in Indian population because incidence varies in different population. To determine the risk of alloimmunization among Rh D negative patients who receives the blood of weak D positive donors. Material and Methods: Rh grouping of 38,962 donors who came to The Department of Immunohematology and Blood Transfusion of Civil Hospital, Ahmedabad from 1st January 2013 to 30th September 2014 was done using the DIAGAST (Automated Grouping. The samples that tested negative for D antigen were further analysed for weak D (Du by indirect antiglobulin test using blend of Ig G and Ig M Anti D. This was done using Column agglutination method in ID card (gel card. Results: The total number of donors studied was 38,962. Out of these 3360(8.6% were tested Rh D negative. All Rh D negative donors were tested for weak D (Du. 22 (0.056% of total donors and 0.65% of Rh negative donors turned out to be weak D (Du positive. Conclusion: The prevalence of weak D (Du in Western Indian population is 0.056 %, So the risk of alloimmunization in our setting due to weak D (Du antigen is marginal. But, testing of weak D antigen is necessary in blood bank because weak D antigen is immunogenic and can produce alloimmunization if transfused to Rh D negative subjects.

MPL mutations in myeloproliferative disorders

DEFF Research Database (Denmark)

Beer, Philip A.; Campbell, Peter J.; Scott, Linda M.

2008-01-01

Activating mutations of MPL exon 10 have been described in a minority of patients with idiopathic myelofibrosis (IMF) or essential thrombocythemia (ET), but their prevalence and clinical significance are unclear. Here we demonstrate that MPL mutations outside exon 10 are uncommon in platelet c......DNA and identify 4 different exon 10 mutations in granulocyte DNA from a retrospective cohort of 200 patients with ET or IMF. Allele-specific polymerase chain reaction was then used to genotype 776 samples from patients with ET entered into the PT-1 studies. MPL mutations were identified in 8.5% of JAK2 V617F......(-) patients and a single V617F(+) patient. Patients carrying the W515K allele had a significantly higher allele burden than did those with the W515L allele, suggesting a functional difference between the 2 variants. Compared with V617F(+) ET patients, those with MPL mutations displayed lower hemoglobin...

Effects of the umuC36 mutation on ultraviolet-radiation-induced base-change and frameshift mutations in Escherichia coli

International Nuclear Information System (INIS)

Kato, T.; Nakano, E.

1981-01-01

The effects of the umuC36 mutation on the induction of base-change and frameshift mutations were studied. An active umuC gene was necessary in either the uvr + or uvr - strains of Escherichia coli K12 for UV- and X-ray-induced mutations to His + , ColE and Spc, which are presumably base-change mutations, but it was not essential for ethyl methanesulphonate or N-methyl-N'-nitro-N-nitrosoguanidine-induced His + mutations. In contrast, only 1 out of 13 trp - frameshift mutations examined was UV reversible, and the process of mutagenesis was umuC + -dependent, whereas a potent frameshift mutagen, ICR191, effectively induced Trp + mutations in most of the strains regardless of the umu + or umuC genetic background. These results suggest that base substitutions are a major mutational type derived from the umuC + -dependent pathway of error-prone repair. (orig.)

Interferência e estudo fitossociológico da comunidade infestante na cultura da beterraba transplantada = Interference and phytosociological study of weed communities on transplanted beets

Directory of Open Access Journals (Sweden)

Leonardo Bianco de Carvalho

2008-07-01

Full Text Available O trabalho teve como objetivo o estudo fitossociológico e a determinação dos períodos críticos de interferência da comunidade infestante na cultura da beterraba transplantada. Os tratamentos consistiram em períodos semanais crescentes de convivênciae de controle da comunidade infestante, a partir da segunda semana após o transplante das mudas. A comunidade infestante foi avaliada por meio do número de indivíduos e da massa seca acumulada correspondente, para cada população de planta daninha e período avaliado. A cultura foi colhida 91 dias após o transplante das mudas, quando se avaliou o diâmetro transversal e a produtividade comercial das raízes. As principais plantas daninhas encontradas foram Amaranthus viridis, Coronopus didymus, Galinsoga parviflora, Nicandraphysaloides e Solanum americanum. As populações encontradas apresentaram alta similaridade entre si. O período anterior à interferência e o período total de prevenção à interferência foram 51 e 35 dias após o transplante das mudas, respectivamente. A produção da beterraba mantida no limpo foi 44,92 t ha-1, e a redução devido à interferência das plantas daninhas por todo o ciclo foi mais de 70%.The objective of this research was to study the phytosociological andcritical interference periods of weed communities on transplanted beets. The treatments consisted of increasing weekly weedy/weed-free periods, starting at the second week after seedling transplanting. The weed community was evaluated based on the number ofindividuals and their corresponding accumulated dry mass, for each weed population and evaluated period. The beets were harvested 91 days after transplanting, followed by evaluation of the cross-sectional diameter and marketable yield. The weed communitieswere composed mainly of Amaranthus viridis, Coronopus didymus, Galinsoga parviflora, Nicandra physaloides and Solanum americanum, and the populations were very similar. The period before weed

Mutations induced in plant breeding

International Nuclear Information System (INIS)

Barriga B, P.

1984-01-01

The most significant aspects of the use of ionizing radiations in plant breeding are reviewed. Aspects such as basic principles of mutation, expression and selection in obtention of mutants, methods for using induced mutations and sucess achieved with this methodology in plant breeding are reviewed. Results obtained in a program of induced mutation on wheat for high content of protein and lysine at the Universidad Austral de Chile are presented. (Author)

Mutations induced in plant breeding

Energy Technology Data Exchange (ETDEWEB)

Barriga B, P. (Universidad Austral de Chile, Valdivia. Inst. de Produccion y Sanidad Vegetal)

1984-10-01

The most significant aspects of the use of ionizing radiations in plant breeding are reviewed. Aspects such as basic principles of mutation, expression and selection in obtention of mutants, methods for using induced mutations and sucess achieved with this methodology in plant breeding are reviewed. Results obtained in a program of induced mutation on wheat for high content of protein and lysine at the Universidad Austral de Chile are presented.

Weak limits for quantum random walks

International Nuclear Information System (INIS)

Grimmett, Geoffrey; Janson, Svante; Scudo, Petra F.

2004-01-01

We formulate and prove a general weak limit theorem for quantum random walks in one and more dimensions. With X n denoting position at time n, we show that X n /n converges weakly as n→∞ to a certain distribution which is absolutely continuous and of bounded support. The proof is rigorous and makes use of Fourier transform methods. This approach simplifies and extends certain preceding derivations valid in one dimension that make use of combinatorial and path integral methods

Weak values in a classical theory with an epistemic restriction

International Nuclear Information System (INIS)

Karanjai, Angela; Cavalcanti, Eric G; Bartlett, Stephen D; Rudolph, Terry

2015-01-01

Weak measurement of a quantum system followed by postselection based on a subsequent strong measurement gives rise to a quantity called the weak value: a complex number for which the interpretation has long been debated. We analyse the procedure of weak measurement and postselection, and the interpretation of the associated weak value, using a theory of classical mechanics supplemented by an epistemic restriction that is known to be operationally equivalent to a subtheory of quantum mechanics. Both the real and imaginary components of the weak value appear as phase space displacements in the postselected expectation values of the measurement device's position and momentum distributions, and we recover the same displacements as in the quantum case by studying the corresponding evolution in our theory of classical mechanics with an epistemic restriction. By using this epistemically restricted theory, we gain insight into the appearance of the weak value as a result of the statistical effects of post selection, and this provides us with an operational interpretation of the weak value, both its real and imaginary parts. We find that the imaginary part of the weak value is a measure of how much postselection biases the mean phase space distribution for a given amount of measurement disturbance. All such biases proportional to the imaginary part of the weak value vanish in the limit where disturbance due to measurement goes to zero. Our analysis also offers intuitive insight into how measurement disturbance can be minimized and the limits of weak measurement. (paper)

Elimination of eight interfering radioisotopes in the determination of uranium by activation analysis with epithermic neutrons

International Nuclear Information System (INIS)

Requejo, C.S.

1977-01-01

The total or parcial elimination interfering radioisotopes in activation analysis of uranium by epithermic neutrons, has been made. It was possible to determine uranium, after chemical separation, from samples of organic and mineral matrixes, which had mercury, selenium, bromine, antimony, gold, barium, molybden and tungsten. Mineral samples were analysed giving results between 0.2 to 5.0 ppm of uranium. The same mineral were ground in agate mortar and in tungsten carbide mill. In the first sample is has been found 0.2277 +- -+ 0.0474 ppm U. The second which had tungsten, at level of 150 ppm, after radiochemical separation, it has been found 0.2465+- -+0.0326 ppm U. These results are considered statistically the same [pt

Late-Onset Glycogen Storage Disease Type II (Pompe’s Disease with a Novel Mutation: A Malaysian Experience

Directory of Open Access Journals (Sweden)

Hiew Fu Liong

2014-01-01

Full Text Available Pompe’s disease (acid maltase deficiency, glycogen storage disease type II is an autosomal recessive disorder caused by a deficiency of lysosomal acid α-1,4-glucosidase, resulting in excessive accumulation of glycogen in the lysosomes and cytoplasm of all tissues, most notably in skeletal muscles. We present a case of adult-onset Pompe’s disease with progressive proximal muscles weakness over 5 years and respiratory failure on admission, requiring prolonged mechanical ventilation. Electromyography showed evidence of myopathic process with small amplitudes, polyphasic motor unit action potentials, and presence of pseudomyotonic discharges. Muscle biopsy showed glycogen-containing vacuoles in the muscle fibers consistent with glycogen storage disease. Genetic analysis revealed two compound heterozygous mutations at c.444C>G (p.Tyr148* in exon 2 and c.2238G>C (p.Trp746Cys in exon 16, with the former being a novel mutation. This mutation has not been reported before, to our knowledge. The patient was treated with high protein diet during the admission and subsequently showed good clinical response to enzyme replacement therapy with survival now to the eighth year. Conclusion. In patients with late-onset adult Pompe’s disease, careful evaluation and early identification of the disease and its treatment with high protein diet and enzyme replacement therapy improve muscle function and have beneficial impact on long term survival.

Novel mutations in DNAJB6 gene cause a very severe early-onset limb-girdle muscular dystrophy 1D disease.

Science.gov (United States)

Palmio, Johanna; Jonson, Per Harald; Evilä, Anni; Auranen, Mari; Straub, Volker; Bushby, Kate; Sarkozy, Anna; Kiuru-Enari, Sari; Sandell, Satu; Pihko, Helena; Hackman, Peter; Udd, Bjarne

2015-11-01

DNAJB6 is the causative gene for limb-girdle muscular dystrophy 1D (LGMD1D). Four different coding missense mutations, p.F89I, p.F93I, p.F93L, and p.P96R, have been reported in families from Europe, North America and Asia. The previously known mutations cause mainly adult-onset proximal muscle weakness with moderate progression and without respiratory involvement. A Finnish family and a British patient have been studied extensively due to a severe muscular dystrophy. The patients had childhood-onset LGMD, loss of ambulation in early adulthood and respiratory involvement; one patient died of respiratory failure aged 32. Two novel mutations, c.271T > A (p.F91I) and c.271T > C (p.F91L), in DNAJB6 were identified by whole exome sequencing as a cause of this severe form of LGMD1D. The results were confirmed by Sanger sequencing. The anti-aggregation effect of the mutant DNAJB6 was investigated in a filter-trap based system using transient transfection of mammalian cell lines and polyQ-huntingtin as a model for an aggregation-prone protein. Both novel mutant proteins show a significant loss of ability to prevent aggregation. Copyright © 2015 Elsevier B.V. All rights reserved.

BRCA2, EGFR, and NTRK mutations in mismatch repair-deficient colorectal cancers with MSH2 or MLH1 mutations.

Science.gov (United States)

Deihimi, Safoora; Lev, Avital; Slifker, Michael; Shagisultanova, Elena; Xu, Qifang; Jung, Kyungsuk; Vijayvergia, Namrata; Ross, Eric A; Xiu, Joanne; Swensen, Jeffrey; Gatalica, Zoran; Andrake, Mark; Dunbrack, Roland L; El-Deiry, Wafik S

2017-06-20

Deficient mismatch repair (MMR) and microsatellite instability (MSI) contribute to ~15% of colorectal cancer (CRCs). We hypothesized MSI leads to mutations in DNA repair proteins including BRCA2 and cancer drivers including EGFR. We analyzed mutations among a discovery cohort of 26 MSI-High (MSI-H) and 558 non-MSI-H CRCs profiled at Caris Life Sciences. Caris-profiled MSI-H CRCs had high mutation rates (50% vs 14% in non-MSI-H, P MLH1-mutant CRCs showed higher mutation rates in BRCA2 compared to non-MSH2/MLH1-mutant tumors (38% vs 6%, P MLH1-mutant CRCs included 75 unique mutations not known to occur in breast or pancreatic cancer per COSMIC v73. Only 5 deleterious BRCA2 mutations in CRC were previously reported in the BIC database as germ-line mutations in breast cancer. Some BRCA2 mutations were predicted to disrupt interactions with partner proteins DSS1 and RAD51. Some CRCs harbored multiple BRCA2 mutations. EGFR was mutated in 45.5% of MSH2/MLH1-mutant and 6.5% of non-MSH2/MLH1-mutant tumors (P MLH1-mutant CRC including NTRK1 I699V, NTRK2 P716S, and NTRK3 R745L. Our findings have clinical relevance regarding therapeutic targeting of BRCA2 vulnerabilities, EGFR mutations or other identified oncogenic drivers such as NTRK in MSH2/MLH1-mutant CRCs or other tumors with mismatch repair deficiency.

TOX3 mutations in breast cancer.

Directory of Open Access Journals (Sweden)

James Owain Jones

Full Text Available TOX3 maps to 16q12, a region commonly lost in breast cancers and recently implicated in the risk of developing breast cancer. However, not much is known of the role of TOX3 itself in breast cancer biology. This is the first study to determine the importance of TOX3 mutations in breast cancers. We screened TOX3 for mutations in 133 breast tumours and identified four mutations (three missense, one in-frame deletion of 30 base pairs in six primary tumours, corresponding to an overall mutation frequency of 4.5%. One potentially deleterious missense mutation in exon 3 (Leu129Phe was identified in one tumour (genomic DNA and cDNA. Whilst copy number changes of 16q12 are common in breast cancer, our data show that mutations of TOX3 are present at low frequency in tumours. Our results support that TOX3 should be further investigated to elucidate its role in breast cancer biology.

Constrained Deep Weak Supervision for Histopathology Image Segmentation.

Science.gov (United States)

Jia, Zhipeng; Huang, Xingyi; Chang, Eric I-Chao; Xu, Yan

2017-11-01

In this paper, we develop a new weakly supervised learning algorithm to learn to segment cancerous regions in histopathology images. This paper is under a multiple instance learning (MIL) framework with a new formulation, deep weak supervision (DWS); we also propose an effective way to introduce constraints to our neural networks to assist the learning process. The contributions of our algorithm are threefold: 1) we build an end-to-end learning system that segments cancerous regions with fully convolutional networks (FCNs) in which image-to-image weakly-supervised learning is performed; 2) we develop a DWS formulation to exploit multi-scale learning under weak supervision within FCNs; and 3) constraints about positive instances are introduced in our approach to effectively explore additional weakly supervised information that is easy to obtain and enjoy a significant boost to the learning process. The proposed algorithm, abbreviated as DWS-MIL, is easy to implement and can be trained efficiently. Our system demonstrates the state-of-the-art results on large-scale histopathology image data sets and can be applied to various applications in medical imaging beyond histopathology images, such as MRI, CT, and ultrasound images.

Weak hadronic currents in compensation theory

International Nuclear Information System (INIS)

Pappas, R.C.

1975-01-01

Working within the framework of a compensation theory of strong and weak interactions, it is shown that: (1) an axial vector baryon number current can be included in the weak current algebra if certain restrictions on the K-meson strong couplings are relaxed; (2) the theory does not permit the introduction of strange currents of the chiral form V + A; and (3) the assumption that the superweak currents of the theory cannot contain certain CP conserving terms can be justified on the basis of compensation requirements

Weak interactions of the b quark

International Nuclear Information System (INIS)

Branco, G.C.; Mohapatra, R.N.

1978-01-01

In weak-interaction models with two charged W bosons of comparable mass, there exists a novel possibility for the weak interactions of the b quark, in which the (u-barb)/sub R/ current occurs with maximal strength. It is noted that multimuon production in e + e - annihilation at above Q 2 > or approx. = (12 GeV) 2 will distinguish this scheme from the conventional one. We also present a Higgs system that leads naturally to this type of coupling, in a class of gauge models

CPT non-invariance and weak interactions

International Nuclear Information System (INIS)

Hsu, J.P.

1973-01-01

In this talk, I will describe a possible violation of CPT invariance in the domain of weak interactions. One can construct a model of weak interactions which, in order to be consistent with all experimental data, must violate CPT maximally. The model predicts many specific results for decay processes which could be tested in the planned neutral hyperon beam or neutrino beam at NAL. The motivations and the physical idea in the model are explained and the implications of the model are discussed. (U.S.)

Germ-line origins of mutation in families with hemophilia B: The sex ratio varies with the type of mutation

Energy Technology Data Exchange (ETDEWEB)

Ketterling, R.P.; Vielhaber, E.; Bottema, C.D.K.; Schaid, D.J.; Sommer, S.S. (Mayo Clinic/Foundation, Rochester, MN (United States)); Cohen, M.P. (Vanderbilt Univ., Nashville, TN (United States)); Sexauer, C.L. (Children' s Hospital, Oklahoma City, OK (United States))

1993-01-01

Previous epidemiological and biochemical studies have generated conflicting estimates of the sex ratio of mutation. Direct genomic sequencing in combination with haplotype analysis extends previous analyses by allowing the precise mutation to be determined in a given family. From analysis of the factor IX gene of 260 consecutive families with hemophilia B, the authors report the germ-line origin of mutation in 25 families. When combined with 14 origins of mutation reported by others and with 4 origins previously reported by them, a total of 25 occur in the female germ line, and 18 occur in the male germ line. The excess of germ-line origins in females does not imply an overall excess mutation rate per base pair in the female germ line. Bayesian analysis of the data indicates that the sex ratio varies with the type of mutation. The aggregate of single-base substitutions shows a male predominance of germ-line mutations (P < .002). The maximum-likelihood estimate of the male predominance is 3.5-fold. Of the single-base substitutions, deletions display a sex ratio of unity. Analysis of the parental age at transmission of a new mutation suggests that germ-line mutations are associated with a small increase in parental age in females but little, if any, increase in males. Although direct genomic sequencing offers a general method for defining the origin of mutation in specific families, accurate estimates of the sex ratios of different mutational classes require large sample sizes and careful correction for multiple biases of ascertainment. The biases in the present data result in an underestimate of the enhancement of mutation in males. 62 refs., 1 fig., 5 tabs.

The weak interaction in nuclear, particle and astrophysics

International Nuclear Information System (INIS)

Grotz, K.; Klapdor, H.V.

1989-01-01

This book is an introduction to the concepts of weak interactions and their importance and consequences for nuclear physics, particle physics, neutrino physics, astrophysics and cosmology. After a general introduction to elementary particles and interactions the Fermi theory of weak interactions is described together with its connection with nuclear structure and beta decay including the double beta decay. Then, after a general description of gauge theories the Weinberg-Salam theory of the electroweak interactions is introduced. Thereafter the weak interactions are considered in the framework of grand unification. Then the physics of neutrinos is discussed. Thereafter connections of weak interactions with astrophysics are considered with special regards to the gravitational collapse and the synthesis of heavy elements in the r-process. Finally, the connections of grand unified theories and cosmology are considered. (HSI) With 141 figs., 39 tabs

Weak relativity

CERN Document Server

Selleri, Franco

2015-01-01

Weak Relativity is an equivalent theory to Special Relativity according to Reichenbach’s definition, where the parameter epsilon equals to 0. It formulates a Neo-Lorentzian approach by replacing the Lorentz transformations with a new set named “Inertial Transformations”, thus explaining the Sagnac effect, the twin paradox and the trip from the future to the past in an easy and elegant way. The cosmic microwave background is suggested as a possible privileged reference system. Most importantly, being a theory based on experimental proofs, rather than mutual consensus, it offers a physical description of reality independent of the human observation.

Mutation induction by ion beams in plants

International Nuclear Information System (INIS)

Tanaka, Atsushi

2001-01-01

The effect of ion beams such as C, He, and Ne ions was investigated on the mutation induction in plants with the expectation that ion beams of high linear energy transfer (LET) can frequently produce large DNA alternation such as inversion, translocation and large deletion rather than point mutation. Mutation frequency was investigated using Arabidopsis visible phenotype loci and was 8 to 33 fold higher for 220 MeV carbon ions than for electrons. Mutation spectrum was investigated on the flower color of chrysanthemum cv to find that flower mutants induced by ion beams show complex and stripe types rather than single color. Polymerase chain reaction analysis was performed to investigate DNA alteration of mutations. In conclusion, the characteristics of ion beams for the mutation induction are 1) high frequency, 2) broad mutation spectrum, and 3) novel mutants. (S. Ohno)

Mutation induction by ion beams in plants

Energy Technology Data Exchange (ETDEWEB)

Tanaka, Atsushi [Japan Atomic Energy Research Inst., Takasaki, Gunma (Japan). Takasaki Radiation Chemistry Research Establishment

2001-03-01

The effect of ion beams such as C, He, and Ne ions was investigated on the mutation induction in plants with the expectation that ion beams of high linear energy transfer (LET) can frequently produce large DNA alternation such as inversion, translocation and large deletion rather than point mutation. Mutation frequency was investigated using Arabidopsis visible phenotype loci and was 8 to 33 fold higher for 220 MeV carbon ions than for electrons. Mutation spectrum was investigated on the flower color of chrysanthemum cv to find that flower mutants induced by ion beams show complex and stripe types rather than single color. Polymerase chain reaction analysis was performed to investigate DNA alteration of mutations. In conclusion, the characteristics of ion beams for the mutation induction are 1) high frequency, 2) broad mutation spectrum, and 3) novel mutants. (S. Ohno)

The Role of Tumor Protein 53 Mutations in Common Human Cancers and Targeting the Murine Double Minute 2–P53 Interaction for Cancer Therapy

Directory of Open Access Journals (Sweden)

Tayebeh Hamzehloie

2012-03-01

Full Text Available The gene TP53 (also known as protein 53 or tumor protein 53, encoding transcription factor P53, is mutated or deleted in half of human cancers, demonstrating the crucial role of P53 in tumor suppression. There are reports of nearly 250 independent germ line TP53 mutations in over 100 publications. The P53 protein has the structure of a transcription factor and, is made up of several domains. The main function of P53 is to organize cell defense against cancerous transformation. P53 is a potent transcription factor that is activated in response to diverse stresses, leading to the induction of cell cycle arrest, apoptosis or senescence. The P53 tumor suppressor is negatively regulated in cells by the murine double minute 2 (MDM2 protein. Murine double minute 2 favors its nuclear export, and stimulates its degradation. Inhibitors of the P53-MDM2 interaction might be attractive new anticancer agents that could be used to activate wild-type P53 in tumors. Down regulation of MDM2 using an small interfering RNA (siRNA approach has recently provided evidence for a new role of MDM2 in the P53 response, by modulating the inhibition of the cyclin dependent kinase 2 (cdk2 by P21/WAF1 (also known as cyclin-dependent kinase inhibitor 1 or CDK-interacting protein 1.

Staggering towards a calculation of weak amplitudes

Energy Technology Data Exchange (ETDEWEB)

Sharpe, S.R.

1988-09-01

An explanation is given of the methods required to calculate hadronic matrix elements of the weak Hamiltonians using lattice QCD with staggered fermions. New results are presented for the 1-loop perturbative mixing of the weak interaction operators. New numerical techniques designed for staggered fermions are described. A preliminary result for the kaon B parameter is presented. 24 refs., 3 figs.

Precision phase estimation based on weak-value amplification

Science.gov (United States)

Qiu, Xiaodong; Xie, Linguo; Liu, Xiong; Luo, Lan; Li, Zhaoxue; Zhang, Zhiyou; Du, Jinglei

2017-02-01

In this letter, we propose a precision method for phase estimation based on the weak-value amplification (WVA) technique using a monochromatic light source. The anomalous WVA significantly suppresses the technical noise with respect to the intensity difference signal induced by the phase delay when the post-selection procedure comes into play. The phase measured precision of this method is proportional to the weak-value of a polarization operator in the experimental range. Our results compete well with the wide spectrum light phase weak measurements and outperform the standard homodyne phase detection technique.

Whole genome sequencing of mutation accumulation lines reveals a low mutation rate in the social amoeba Dictyostelium discoideum.

Directory of Open Access Journals (Sweden)

Gerda Saxer

Full Text Available Spontaneous mutations play a central role in evolution. Despite their importance, mutation rates are some of the most elusive parameters to measure in evolutionary biology. The combination of mutation accumulation (MA experiments and whole-genome sequencing now makes it possible to estimate mutation rates by directly observing new mutations at the molecular level across the whole genome. We performed an MA experiment with the social amoeba Dictyostelium discoideum and sequenced the genomes of three randomly chosen lines using high-throughput sequencing to estimate the spontaneous mutation rate in this model organism. The mitochondrial mutation rate of 6.76×10(-9, with a Poisson confidence interval of 4.1×10(-9 - 9.5×10(-9, per nucleotide per generation is slightly lower than estimates for other taxa. The mutation rate estimate for the nuclear DNA of 2.9×10(-11, with a Poisson confidence interval ranging from 7.4×10(-13 to 1.6×10(-10, is the lowest reported for any eukaryote. These results are consistent with low microsatellite mutation rates previously observed in D. discoideum and low levels of genetic variation observed in wild D. discoideum populations. In addition, D. discoideum has been shown to be quite resistant to DNA damage, which suggests an efficient DNA-repair mechanism that could be an adaptation to life in soil and frequent exposure to intracellular and extracellular mutagenic compounds. The social aspect of the life cycle of D. discoideum and a large portion of the genome under relaxed selection during vegetative growth could also select for a low mutation rate. This hypothesis is supported by a significantly lower mutation rate per cell division in multicellular eukaryotes compared with unicellular eukaryotes.

Novel mutations and mutation combinations of ryanodine receptor in a chlorantraniliprole resistant population of Plutella xylostella (L.)

Science.gov (United States)

Guo, Lei; Liang, Pei; Zhou, Xuguo; Gao, Xiwu

2014-01-01

A previous study documented a glycine to glutamic acid mutation (G4946E) in ryanodine receptor (RyR) was highly correlated to diamide insecticide resistance in field populations of Plutella xylostella (Lepidoptera: Plutellidae). In this study, a field population collected in Yunnan province, China, exhibited a 2128-fold resistance to chlorantraniliprole. Sequence comparison between resistant and susceptible P. xylostella revealed three novel mutations including a glutamic acid to valine substitution (E1338D), a glutamine to leucine substitution (Q4594L) and an isoleucine to methionine substitution (I4790M) in highly conserved regions of RyR. Frequency analysis of all four mutations in this field population showed that the three new mutations showed a high frequency of 100%, while the G4946E had a frequency of 20%. Furthermore, the florescent ligand binding assay revealed that the RyR containing multiple mutations displayed a significantly lower affinity to the chlorantraniliprole. The combined results suggested that the co-existence of different combinations of the four mutations was involved in the chlorantraniliprole resistance. An allele-specific PCR based method was developed for the diagnosis of the four mutations in the field populations of P. xylostella. PMID:25377064

The Mutational Robustness of Influenza A Virus.

Directory of Open Access Journals (Sweden)

Elisa Visher

2016-08-01

Full Text Available A virus' mutational robustness is described in terms of the strength and distribution of the mutational fitness effects, or MFE. The distribution of MFE is central to many questions in evolutionary theory and is a key parameter in models of molecular evolution. Here we define the mutational fitness effects in influenza A virus by generating 128 viruses, each with a single nucleotide mutation. In contrast to mutational scanning approaches, this strategy allowed us to unambiguously assign fitness values to individual mutations. The presence of each desired mutation and the absence of additional mutations were verified by next generation sequencing of each stock. A mutation was considered lethal only after we failed to rescue virus in three independent transfections. We measured the fitness of each viable mutant relative to the wild type by quantitative RT-PCR following direct competition on A549 cells. We found that 31.6% of the mutations in the genome-wide dataset were lethal and that the lethal fraction did not differ appreciably between the HA- and NA-encoding segments and the rest of the genome. Of the viable mutants, the fitness mean and standard deviation were 0.80 and 0.22 in the genome-wide dataset and best modeled as a beta distribution. The fitness impact of mutation was marginally lower in the segments coding for HA and NA (0.88 ± 0.16 than in the other 6 segments (0.78 ± 0.24, and their respective beta distributions had slightly different shape parameters. The results for influenza A virus are remarkably similar to our own analysis of CirSeq-derived fitness values from poliovirus and previously published data from other small, single stranded DNA and RNA viruses. These data suggest that genome size, and not nucleic acid type or mode of replication, is the main determinant of viral mutational fitness effects.

Survival of mutations arising during invasions.

Science.gov (United States)

Miller, Judith R

2010-03-01

When a neutral mutation arises in an invading population, it quickly either dies out or 'surfs', i.e. it comes to occupy almost all the habitat available at its time of origin. Beneficial mutations can also surf, as can deleterious mutations over finite time spans. We develop descriptive statistical models that quantify the relationship between the probability that a mutation will surf and demographic parameters for a cellular automaton model of surfing. We also provide a simple analytic model that performs well at predicting the probability of surfing for neutral and beneficial mutations in one dimension. The results suggest that factors - possibly including even abiotic factors - that promote invasion success may also increase the probability of surfing and associated adaptive genetic change, conditioned on such success.

Mutations in the Norrie disease gene.

Science.gov (United States)

Schuback, D E; Chen, Z Y; Craig, I W; Breakefield, X O; Sims, K B

1995-01-01

We report our experience to date in mutation identification in the Norrie disease (ND) gene. We carried out mutational analysis in 26 kindreds in an attempt to identify regions presumed critical to protein function and potentially correlated with generation of the disease phenotype. All coding exons, as well as noncoding regions of exons 1 and 2, 636 nucleotides in the noncoding region of exon 3, and 197 nucleotides of 5' flanking sequence, were analyzed for single-strand conformation polymorphisms (SSCP) by polymerase chain reaction (PCR) amplification of genomic DNA. DNA fragments that showed altered SSCP band mobilities were sequenced to locate the specific mutations. In addition to three previously described submicroscopic deletions encompassing the entire ND gene, we have now identified 6 intragenic deletions, 8 missense (seven point mutations, one 9-bp deletion), 6 nonsense (three point mutations, three single bp deletions/frameshift) and one 10-bp insertion, creating an expanded repeat in the 5' noncoding region of exon 1. Thus, mutations have been identified in a total of 24 of 26 (92%) of the kindreds we have studied to date. With the exception of two different mutations, each found in two apparently unrelated kindreds, these mutations are unique and expand the genotype database. Localization of the majority of point mutations at or near cysteine residues, potentially critical in protein tertiary structure, supports a previous protein model for norrin as member of a cystine knot growth factor family (Meitinger et al., 1993). Genotype-phenotype correlations were not evident with the limited clinical data available, except in the cases of larger submicroscopic deletions associated with a more severe neurologic syndrome.(ABSTRACT TRUNCATED AT 250 WORDS)

Radiation-induced mutations in mammals

International Nuclear Information System (INIS)

Ehling, U.H.

1993-01-01

The aims of the proposed project are to provide a better basis for extrapolation of animal data to man. Genetic endpoint, strain and species comparisons are made, which will provide critical experimental data regarding strategies in extrapolating laboratory animal data to man. Experiments were conducted to systematically compare the spontaneous and radiation-induced mutation rates for recessive specific-locus, dominant cataract and enzyme activity alleles in the mouse as well as a comparison of the mutation rate in the mouse and hamster for dominant cataract and enzyme activity alleles. The comparison of the radiation-dose response for recessive specific-locus and dominant cataract mutations are extended. Selected mutations are characterized at the genetic, biochemical and molecular levels. (R.P.) 5 refs., 3 tabs

Common Β- Thalassaemia Mutations in

Directory of Open Access Journals (Sweden)

P Azarfam

2005-01-01

Full Text Available Introduction: β –Thalassaemia was first explained by Thomas Cooly as Cooly’s anaemia in 1925. The β- thalassaemias are hereditary autosomal disorders with decreased or absent β-globin chain synthesis. The most common genetic defects in β-thalassaemias are caused by point mutations, micro deletions or insertions within the β-globin gene. Material and Methods: In this research , 142 blood samples (64 from childrens hospital of Tabriz , 15 samples from Shahid Gazi hospital of Tabriz , 18 from Urumia and 45 samples from Aliasghar hospital of Ardebil were taken from thalassaemic patients (who were previously diagnosed .Then 117 non-familial samples were selected . The DNA of the lymphocytes of blood samples was extracted by boiling and Proteinase K- SDS procedure, and mutations were detected by ARMS-PCR methods. Results: From the results obtained, eleven most common mutations,most of which were Mediterranean mutations were detected as follows; IVS-I-110(G-A, IVS-I-1(G-A ،IVS-I-5(G-C ,Frameshift Codon 44 (-C,( codon5(-CT,IVS-1-6(T-C, IVS-I-25(-25bp del ,Frameshift 8.9 (+G ,IVS-II-1(G-A ,Codon 39(C-T, Codon 30(G-C the mutations of the samples were defined. The results showed that Frameshift 8.9 (+G, IVS-I-110 (G-A ,IVS-II-I(G-A, IVS-I-5(G-C, IVS-I-1(G-A , Frameshift Codon 44(-C , codon5(-CT , IVS-1-6(T-C , IVS-I-25(-25bp del with a frequency of 29.9%, 25.47%,17.83%, 7.00%, 6.36% , 6.63% , 3.8% , 2.5% , 0.63% represented the most common mutations in North - west Iran. No mutations in Codon 39(C-T and Codon 30(G-C were detected. Cunclusion: The frequency of the same mutations in patients from North - West of Iran seems to be different as compared to other regions like Turkey, Pakistan, Lebanon and Fars province of Iran. The pattern of mutations in this region is more or less the same as in the Mediterranean region, but different from South west Asia and East Asia.

Weak lensing probes of modified gravity

International Nuclear Information System (INIS)

Schmidt, Fabian

2008-01-01

We study the effect of modifications to general relativity on large-scale weak lensing observables. In particular, we consider three modified gravity scenarios: f(R) gravity, the Dvali-Gabadadze-Porrati model, and tensor-vector-scalar theory. Weak lensing is sensitive to the growth of structure and the relation between matter and gravitational potentials, both of which will in general be affected by modified gravity. Restricting ourselves to linear scales, we compare the predictions for galaxy-shear and shear-shear correlations of each modified gravity cosmology to those of an effective dark energy cosmology with the same expansion history. In this way, the effects of modified gravity on the growth of perturbations are separated from the expansion history. We also propose a test which isolates the matter-potential relation from the growth factor and matter power spectrum. For all three modified gravity models, the predictions for galaxy and shear correlations will be discernible from those of dark energy with very high significance in future weak lensing surveys. Furthermore, each model predicts a measurably distinct scale dependence and redshift evolution of galaxy and shear correlations, which can be traced back to the physical foundations of each model. We show that the signal-to-noise for detecting signatures of modified gravity is much higher for weak lensing observables as compared to the integrated Sachs-Wolfe effect, measured via the galaxy-cosmic microwave background cross-correlation.

Interfering Effect of Black Tea Consumption on Diagnosis of Pancreatic Cancer by CA 19-9.

Science.gov (United States)

Al-Janabi, Ali Abdul Hussein S; Tawfeeq, Ekhlas F

2017-06-01

The study aims to determine the possible effects of black tea consumption on the level of CA 19-9 antigen in the human body. The level of CA 19-9 was measured in 270 healthy individuals who consumed heavy amounts of black tea. About 43.3 % of involved individuals were revealed to have elevated levels of CA 19-9. Males with high values of CA 19-9 represented the greatest number of involved individuals. The cutoff value of high levels of CA 19-9 in all individuals was ranged 69-105 U/ml. Consuming heavy amounts of black tea could be considered an important interfering factor that affects the levels of CA 19-9. The cutoff or predictive value of CA 19-9 in heavy-consuming people of black tea was determined.

Weak interaction potentials of nucleons in the Weinberg-Salam model

International Nuclear Information System (INIS)

Lobov, G.A.

1979-01-01

Weak interaction potentials of nucleons due to the nonet vector meson exchange are obtained in the Weinberg-Salam model using the vector-meson dominance. Contribution from the hadronic neutral currents to the weak interaction potential due to the charged pion exchange is obtained. The isotopic structure of the obtained potentials, that is unambiguous in the Weinberg-Salam model, is investigated. Enhancement of the nucleon weak interaction in nuclei resulting from the hadronic neutral currents is discussed. A nuclear one-particle weak interaction potential is presented that is a result of averaging of the two-particle potential over the states of the nuclear core. An approach to the nucleon weak interaction based on the quark model, is discussed. Effects of the nucleon weak interaction in the radiative capture of a thermal neutron by a proton, are considered

Proximal Limb Weakness Reverting After CSF Diversion In Intracranial Hypertension

Directory of Open Access Journals (Sweden)

Sinha S

2005-01-01

Full Text Available We report about two young girls who developed progressive visual failure secondary to increased intracranial pressure and had significant proximal muscle weakness of limbs. Patients with elevated intracranial pressure (ICP may present with "false localizing signs", besides having headache, vomiting and papilledema. Radicular pain as a manifestation of raised ICP is rare and motor weakness attributable to polyradiculopathy is exceptional. Two patients with increased intracranial pressure without lateralizing signs′ had singnificant muscle weakness. Clinical evaluation and laboratory tests did not disclose any other cause for weakness. Following theco-peritoneal shunt, in both patients, there was variable recovery of vision but the proximal weakness and symptoms of elevated ICP improved rapidly. Recognition of this uncommon manifestation of raised ICP may obviate the need for unnecessary investigation and reduce morbidity due to weakness by CSF diversion procedure.

OBSCN Mutations Associated with Dilated Cardiomyopathy and Haploinsufficiency.

Directory of Open Access Journals (Sweden)

Steven Marston

Full Text Available Studies of the functional consequences of DCM-causing mutations have been limited to a few cases where patients with known mutations had heart transplants. To increase the number of potential tissue samples for direct investigation we performed whole exon sequencing of explanted heart muscle samples from 30 patients that had a diagnosis of familial dilated cardiomyopathy and screened for potentially disease-causing mutations in 58 HCM or DCM-related genes.We identified 5 potentially disease-causing OBSCN mutations in 4 samples; one sample had two OBSCN mutations and one mutation was judged to be not disease-related. Also identified were 6 truncating mutations in TTN, 3 mutations in MYH7, 2 in DSP and one each in TNNC1, TNNI3, MYOM1, VCL, GLA, PLB, TCAP, PKP2 and LAMA4. The mean level of obscurin mRNA was significantly greater and more variable in healthy donor samples than the DCM samples but did not correlate with OBSCN mutations. A single obscurin protein band was observed in human heart myofibrils with apparent mass 960 ± 60 kDa. The three samples with OBSCN mutations had significantly lower levels of obscurin immunoreactive material than DCM samples without OBSCN mutations (45±7, 48±3, and 72±6% of control level.Obscurin levels in DCM controls, donor heart and myectomy samples were the same.OBSCN mutations may result in the development of a DCM phenotype via haploinsufficiency. Mutations in the obscurin gene should be considered as a significant causal factor of DCM, alone or in concert with other mutations.

In Vivo Predictive Dissolution: Comparing the Effect of Bicarbonate and Phosphate Buffer on the Dissolution of Weak Acids and Weak Bases.

Science.gov (United States)

Krieg, Brian J; Taghavi, Seyed Mohammad; Amidon, Gordon L; Amidon, Gregory E

2015-09-01

Bicarbonate is the main buffer in the small intestine and it is well known that buffer properties such as pKa can affect the dissolution rate of ionizable drugs. However, bicarbonate buffer is complicated to work with experimentally. Finding a suitable substitute for bicarbonate buffer may provide a way to perform more physiologically relevant dissolution tests. The dissolution of weak acid and weak base drugs was conducted in bicarbonate and phosphate buffer using rotating disk dissolution methodology. Experimental results were compared with the predicted results using the film model approach of (Mooney K, Mintun M, Himmelstein K, Stella V. 1981. J Pharm Sci 70(1):22-32) based on equilibrium assumptions as well as a model accounting for the slow hydration reaction, CO2 + H2 O → H2 CO3 . Assuming carbonic acid is irreversible in the dehydration direction: CO2 + H2 O ← H2 CO3 , the transport analysis can accurately predict rotating disk dissolution of weak acid and weak base drugs in bicarbonate buffer. The predictions show that matching the dissolution of weak acid and weak base drugs in phosphate and bicarbonate buffer is possible. The phosphate buffer concentration necessary to match physiologically relevant bicarbonate buffer [e.g., 10.5 mM (HCO3 (-) ), pH = 6.5] is typically in the range of 1-25 mM and is very dependent upon drug solubility and pKa . © 2015 Wiley Periodicals, Inc. and the American Pharmacists Association.

Molecular mechanisms of induced-mutations

International Nuclear Information System (INIS)

Kato, Takeshi

1985-01-01

The outcome of recent studies on mechanisms of induced-mutations is outlined with particular emphasis on the dependence of recA gene function in Escherichia coli. Genes involved in spontaneous mutation and x-ray- and chemical-induced mutation and genes involved in adaptive response are presented. As for SOS mutagenesis, SOS-induced regulation mechanisms and mutagenic routes are described. Furthermore, specificity of mutagens themselves are discussed in relation to mechanisms of base substitution, frameshift, and deletion mutagenesis. (Namekawa, K.)

Mutation breeding newsletter. No. 33

Energy Technology Data Exchange (ETDEWEB)

NONE

1989-01-01

This issue of the newsletter reports a number of research news and research abstracts on application of radiation induced mutation techniques to increase mutagenesis and mutation frequency in plant breeding projects.

Mutation breeding newsletter. No. 33

International Nuclear Information System (INIS)

1989-01-01

This issue of the newsletter reports a number of research news and research abstracts on application of radiation induced mutation techniques to increase mutagenesis and mutation frequency in plant breeding projects

Screening of three Mediterranean phenylketonuria mutations in ...

Indian Academy of Sciences (India)

as the most frequent mutation (Dahri et al. 2010). The. E280K mutation was also reported in Mediterranean popu- lations (Guldberg et al. 1993). Since Tunisia is a Mediter- ranean country, patients with PKU are presumed to have these mutations. The aim of this study was to assess prevalence of the three above mutations ...

Mutations in galactosemia

Energy Technology Data Exchange (ETDEWEB)

Reichardt, J.K.V. [Univ. of Southern California School of Medicine, Los Angeles, CA (United States)

1995-10-01

This Letter raises four issues concerning two papers on galactosemia published in the March 1995 of the Journal. First, table 2 in the paper by Elsas et al. incorrectly attributes seven galactose-l-phosphate uridyl transferase (GALT) mutations (S135L, L195P, K285N, N314D, R333W, R333G, and K334R). The table also fails to mention that others have reported the same two findings attributed to {open_quotes}Leslie et al.; Elsas et al. and in press{close_quotes} and {open_quotes}Leslie et al.; Elsas et al.{close_quotes} The first finding on the prevalence of the Q188R galactosemia mutation in the G/G Caucasian population has also been described by Ng et al., and the second finding on the correlation of the N314D GALT mutation with the Duarte variant was reported by Lin et al. Second, Elsas et al. suggest that the E203K and N314D mutations may {open_quotes}produce intra-allelic complementation when in cis{close_quotes}. This speculation is supported by the activity data of individual III-2 but is inconsistent with the activities of three other individuals I-1, II-1, and III-1 of the same pedigree. The GALT activity measured in these three individuals suggests a dominant negative effect of E203K in E203K-N314D chromosomes, since they all have less than normal activity. Thus, the preponderance of the data in this paper is at odds with the authors speculation. It is worth recalling that Lin et al. also identified four N314D GALT mutations on 95 galactosemic chromosomes examined. A similar situation also appears to be the case in proband III-1 (with genotype E203K-N314D/IVSC) in the Elsas et al. paper. 9 refs.

Reducing Weak to Strong Bisimilarity in CCP

Directory of Open Access Journals (Sweden)

Andrés Aristizábal

2012-12-01

Full Text Available Concurrent constraint programming (ccp is a well-established model for concurrency that singles out the fundamental aspects of asynchronous systems whose agents (or processes evolve by posting and querying (partial information in a global medium. Bisimilarity is a standard behavioural equivalence in concurrency theory. However, only recently a well-behaved notion of bisimilarity for ccp, and a ccp partition refinement algorithm for deciding the strong version of this equivalence have been proposed. Weak bisimiliarity is a central behavioural equivalence in process calculi and it is obtained from the strong case by taking into account only the actions that are observable in the system. Typically, the standard partition refinement can also be used for deciding weak bisimilarity simply by using Milner's reduction from weak to strong bisimilarity; a technique referred to as saturation. In this paper we demonstrate that, because of its involved labeled transitions, the above-mentioned saturation technique does not work for ccp. We give an alternative reduction from weak ccp bisimilarity to the strong one that allows us to use the ccp partition refinement algorithm for deciding this equivalence.

SQSTM1 Mutations and Glaucoma.

Directory of Open Access Journals (Sweden)

Todd E Scheetz

Full Text Available Glaucoma is the most common cause of irreversible blindness worldwide. One subset of glaucoma, normal tension glaucoma (NTG occurs in the absence of high intraocular pressure. Mutations in two genes, optineurin (OPTN and TANK binding kinase 1 (TBK1, cause familial NTG and have known roles in the catabolic cellular process autophagy. TKB1 encodes a kinase that phosphorylates OPTN, an autophagy receptor, which ultimately activates autophagy. The sequestosome (SQSTM1 gene also encodes an autophagy receptor and also is a target of TBK1 phosphorylation. Consequently, we hypothesized that mutations in SQSTM1 may also cause NTG. We tested this hypothesis by searching for glaucoma-causing mutations in a cohort of NTG patients (n = 308 and matched controls (n = 157 using Sanger sequencing. An additional 1098 population control samples were also analyzed using whole exome sequencing. A total of 17 non-synonymous mutations were detected which were not significantly skewed between cases and controls when analyzed separately, or as a group (p > 0.05. These data suggest that SQSTM1 mutations are not a common cause of NTG.

Weak form factors of beauty baryons

International Nuclear Information System (INIS)

Ivanov, M.A.; Lyubovitskij, V.E.

1992-01-01

Full analysis of semileptonic decays of beauty baryons with J p =1/2 2 and J p =3/2 2 into charmed ones within the Quark Confinement Model is reported. Weak form factors and decay rates are calculated. Also the heavy quark limit m Q →∞ (Isgur-Wise symmetry) is examined. The weak heavy-baryon form factors in the Isgur-Wise limit and 1/m Q -corrections to them are computered. The Ademollo-Gatto theorem is spin-flavour symmetry of heavy quarks is checked. 33 refs.; 1 fig.; 9 tabs

A novel PNPLA2 mutation causes neutral lipid storage disease with myopathy (NLSDM) presenting muscular dystrophic features with lipid storage and rimmed vacuoles.

Science.gov (United States)

Chen, J; Hong, D; Wang, Z; Yuan, Y

2010-01-01

Neutral lipid storage disease with myopathy (NLSDM) is a type of lipid storage myopathy arising due to a mutation in the PNPLA2 gene encoding an adipose triglyceride lipase responsible for the degradation of intracellular triglycerides. Herein, we report the cases of two siblings manifesting slowly progressive proximal and distal limb weakness in adulthood. One of the patients had dilated cardiomyopathy, hearing loss and short stature. Muscle specimens of the 2 patients revealed muscular dystrophic features with massive lipid droplets and numerous rimmed vacuoles in the fibers. A novel homozygous mutation IVS2+1G > A in the PNPLA2 gene was identified in the 2 cases, but not in the healthy familial individuals. The presence of massive lipid droplets with muscular dystrophic changes and rimmed vacuoles in muscle fibers might be one of the characteristic pathological changes of NLSDM.

On Weak-BCC-Algebras

Science.gov (United States)

Thomys, Janus; Zhang, Xiaohong

2013-01-01

We describe weak-BCC-algebras (also called BZ-algebras) in which the condition (x∗y)∗z = (x∗z)∗y is satisfied only in the case when elements x, y belong to the same branch. We also characterize ideals, nilradicals, and nilpotent elements of such algebras. PMID:24311983

Sexual selection, germline mutation rate and sperm competition

Directory of Open Access Journals (Sweden)

Møller AP

2003-04-01

Full Text Available Abstract Background An important component of sexual selection arises because females obtain viability benefits for their offspring from their mate choice. Females choosing extra-pair fertilization generally favor males with exaggerated secondary sexual characters, and extra-pair paternity increases the variance in male reproductive success. Furthermore, females are assumed to benefit from 'good genes' from extra-pair sires. How additive genetic variance in such viability genes is maintained despite strong directional selection remains an evolutionary enigma. We propose that sexual selection is associated with elevated mutation rates, changing the balance between mutation and selection, thereby increasing variance in fitness and hence the benefits to be obtained from good genes sexual selection. Two hypotheses may account for such elevated mutation: (1 Increased sperm production associated with sperm competition may increase mutation rate. (2 Mutator alleles increase mutation rates that are revealed by the expression of condition-dependent secondary sexual characters used by choosy females during their mate choice. M Petrie has independently developed the idea that mutator alleles may account for the maintenance of genetic variation in viability despite strong directional selection. Results A comparative study of birds revealed a positive correlation between mutation rate at minisatellite loci and extra-pair paternity, but not between mutation rate and relative testes mass which is a measure of relative sperm production. Minisatellite mutation rates were not related to longevity, suggesting a meiotic rather than a mitotic origin of mutations. Conclusion We found evidence of increased mutation rate in species with more intense sexual selection. Increased mutation was not associated with increased sperm production, and we suggest that species with intense sexual selection may maintain elevated mutation rates because sexual selection continuously

Drift waves in a weakly ionized plasma

DEFF Research Database (Denmark)

Popovic, M.; Melchior, H.

1968-01-01

A dispersion relation for low frequency drift waves in a weakly ionized plasma has been derived, and through numerical calculations the effect of collisions between the charged and the neutral particles is estimated.......A dispersion relation for low frequency drift waves in a weakly ionized plasma has been derived, and through numerical calculations the effect of collisions between the charged and the neutral particles is estimated....

Hypernuclear weak decay puzzle

International Nuclear Information System (INIS)

Barbero, C.; Horvat, D.; Narancic, Z.; Krmpotic, F.; Kuo, T.T.S.; Tadic, D.

2002-01-01

A general shell model formalism for the nonmesonic weak decay of the hypernuclei has been developed. It involves a partial wave expansion of the emitted nucleon waves, preserves naturally the antisymmetrization between the escaping particles and the residual core, and contains as a particular case the weak Λ-core coupling formalism. The extreme particle-hole model and the quasiparticle Tamm-Dancoff approximation are explicitly worked out. It is shown that the nuclear structure manifests itself basically through the Pauli principle, and a very simple expression is derived for the neutron- and proton-induced decays rates Γ n and Γ p , which does not involve the spectroscopic factors. We use the standard strangeness-changing weak ΛN→NN transition potential which comprises the exchange of the complete pseudoscalar and vector meson octets (π,η,K,ρ,ω,K * ), taking into account some important parity-violating transition operators that are systematically omitted in the literature. The interplay between different mesons in the decay of Λ 12 C is carefully analyzed. With the commonly used parametrization in the one-meson-exchange model (OMEM), the calculated rate Γ NM =Γ n +Γ p is of the order of the free Λ decay rate Γ 0 (Γ NM th congruent with Γ 0 ) and is consistent with experiments. Yet the measurements of Γ n/p =Γ n /Γ p and of Γ p are not well accounted for by the theory (Γ n/p th p th > or approx. 0.60Γ 0 ). It is suggested that, unless additional degrees of freedom are incorporated, the OMEM parameters should be radically modified

p53 gene mutation hotspots in skin cancer and ultraviolet induced mutation

International Nuclear Information System (INIS)

Ikehata, Hironobu

1998-01-01

Presence of certain hotspots is known in the mutation of p53 gene in skin cancer, which are codons 177, 196, 245, 248, 278 and 282 located in the exon 5-8. In these regions, mutations like C to T and CC to TT are frequent and thereby suggest that they are resulted from pyrimidine-dimers produced by ultraviolet light (UV). In cyclobutane pyrimidine dimerization (CPD), conversion of cytosine to thymine by deamination is suggested to be the primary reaction. Although studies using UVC (254 nm) suggesting that the mutation hotspots are low repair efficiency regions could not completely explain the all hotspots, those using UVB and sunlight (UVB and UVA) revealed that CPD was efficiently produced even in such regions as not explained by studies with UVC alone. Therefore, the latter studies are conceivably reasonable since the skin cancer is induced by natural sunlight. Exon 5-8 DNA is completely methylated and the absorption coefficient of 5-methylcytosine is 5-6 times as large as that of cytosine at wavelength around 290 nm. These indicate the importance of UVB in mutation of mammalian cells possessing the ability to methylate DNA. (K.H.)

Light weakly interacting massive particles

Science.gov (United States)

Gelmini, Graciela B.

2017-08-01

Light weakly interacting massive particles (WIMPs) are dark matter particle candidates with weak scale interaction with the known particles, and mass in the GeV to tens of GeV range. Hints of light WIMPs have appeared in several dark matter searches in the last decade. The unprecedented possible coincidence into tantalizingly close regions of mass and cross section of four separate direct detection experimental hints and a potential indirect detection signal in gamma rays from the galactic center, aroused considerable interest in our field. Even if these hints did not so far result in a discovery, they have had a significant impact in our field. Here we review the evidence for and against light WIMPs as dark matter candidates and discuss future relevant experiments and observations.

Qubit state tomography in a superconducting circuit via weak measurements

Science.gov (United States)

Qin, Lupei; Xu, Luting; Feng, Wei; Li, Xin-Qi

2017-03-01

In this work we present a study on a new scheme for measuring the qubit state in a circuit quantum electrodynamics (QED) system, based on weak measurement and the concept of weak value. To be applicable under generic parameter conditions, our formulation and analysis are carried out for finite-strength weak measurement, and in particular beyond the bad-cavity and weak-response limits. The proposed study is accessible to present state-of-the-art circuit QED experiments.

L’anàlisi de mediació a través de la macro/interfície Process per a SPSS

Directory of Open Access Journals (Sweden)

Juan José Fernández Muñoz

2017-05-01

Full Text Available El procediment de mediació simple, o també anomenat anàlisi d’efectes directes i indirectes, està dissenyat per analitzar l’efecte d’una variable mediadora en la relació entre una variable independent o explicativa i una altra de dependent o explicada. Process és una interfície aplicada a SPSS que permet fer aquests procediments d’una manera senzilla i ràpida. L’objectiu d’aquest article és explicar de forma clara i amena com es fa una anàlisi de mediació simple amb Process, interfície/macro per a SPSS, que permeti a qualsevol investigador iniciar-se en els procediments de mediació, àmpliament estesos sobretot en ciències socials. Els resultats obtinguts mostren clarament l’existència d’un efecte indirecte sobre la satisfacció amb la formació en línia mediat a través de les actituds cap a la formació. L’ús d'aquesta eina permet de manera ràpida i amb una fàcil interpretació l’aplicació de models de mediació i la comprovació de diferents proves un cop han estat recollides les dades.

Composite weak bosons

Energy Technology Data Exchange (ETDEWEB)

Suzuki, M.

1988-04-01

Dynamical mechanism of composite W and Z is studied in a 1/N field theory model with four-fermion interactions in which global weak SU(2) symmetry is broken explicitly by electromagnetic interaction. Issues involved in such a model are discussed in detail. Deviation from gauge coupling due to compositeness and higher order loop corrections are examined to show that this class of models are consistent not only theoretically but also experimentally.

A NEW MUTATION OPERATOR IN GENETIC PROGRAMMING

Directory of Open Access Journals (Sweden)

Anuradha Purohit

2013-01-01

Full Text Available This paper proposes a new type of mutation operator, FEDS (Fitness, Elitism, Depth, and Size mutation in genetic programming. The concept behind the new mutation operator is inspired from already introduced FEDS crossover operator to handle the problem of code bloating. FEDS mutation operates by using local elitism replacement in combination with depth limit and size of the trees to reduce bloat with a subsequent improvement in the performance of trees (program structures. We have designed a multiclass classifier for some benchmark datasets to test the performance of proposed mutation. The results show that when the initial run uses FEDS crossover and the concluding run uses FEDS mutation, then not only is the final result significantly improved but there is reduction in bloat also.

Preleukemic and second-hit mutational events in an acute myeloid leukemia patient with a novel germline RUNX1 mutation.

Science.gov (United States)

Ng, Isaac Ks; Lee, Joanne; Ng, Christopher; Kosmo, Bustamin; Chiu, Lily; Seah, Elaine; Mok, Michelle Meng Huang; Tan, Karen; Osato, Motomi; Chng, Wee-Joo; Yan, Benedict; Tan, Lip Kun

2018-01-01

Germline mutations in the RUNX1 transcription factor give rise to a rare autosomal dominant genetic condition classified under the entity: Familial Platelet Disorders with predisposition to Acute Myeloid Leukaemia (FPD/AML). While several studies have identified a myriad of germline RUNX1 mutations implicated in this disorder, second-hit mutational events are necessary for patients with hereditary thrombocytopenia to develop full-blown AML. The molecular picture behind this process remains unclear. We describe a patient of Malay descent with an unreported 7-bp germline RUNX1 frameshift deletion, who developed second-hit mutations that could have brought about the leukaemic transformation from a pre-leukaemic state. These mutations were charted through the course of the treatment and stem cell transplant, showing a clear correlation between her clinical presentation and the mutations present. The patient was a 27-year-old Malay woman who presented with AML on the background of hereditary thrombocytopenia affecting her father and 3 brothers. Initial molecular testing revealed the same novel RUNX1 mutation in all 5 individuals. The patient received standard induction, consolidation chemotherapy, and a haploidentical stem cell transplant from her mother with normal RUNX1 profile. Comprehensive genomic analyses were performed at diagnosis, post-chemotherapy and post-transplant. A total of 8 mutations ( RUNX1 , GATA2 , DNMT3A , BCORL1 , BCOR , 2 PHF6 and CDKN2A ) were identified in the pre-induction sample, of which 5 remained ( RUNX1 , DNMT3A , BCORL1 , BCOR and 1 out of 2 PHF6 ) in the post-treatment sample and none were present post-transplant. In brief, the 3 mutations which were lost along with the leukemic cells at complete morphological remission were most likely acquired leukemic driver mutations that were responsible for the AML transformation from a pre-leukemic germline RUNX1 -mutated state. On the contrary, the 5 mutations that persisted post

Weakly supervised classification in high energy physics

Energy Technology Data Exchange (ETDEWEB)

Dery, Lucio Mwinmaarong [Physics Department, Stanford University,Stanford, CA, 94305 (United States); Nachman, Benjamin [Physics Division, Lawrence Berkeley National Laboratory,1 Cyclotron Rd, Berkeley, CA, 94720 (United States); Rubbo, Francesco; Schwartzman, Ariel [SLAC National Accelerator Laboratory, Stanford University,2575 Sand Hill Rd, Menlo Park, CA, 94025 (United States)

2017-05-29

As machine learning algorithms become increasingly sophisticated to exploit subtle features of the data, they often become more dependent on simulations. This paper presents a new approach called weakly supervised classification in which class proportions are the only input into the machine learning algorithm. Using one of the most challenging binary classification tasks in high energy physics — quark versus gluon tagging — we show that weakly supervised classification can match the performance of fully supervised algorithms. Furthermore, by design, the new algorithm is insensitive to any mis-modeling of discriminating features in the data by the simulation. Weakly supervised classification is a general procedure that can be applied to a wide variety of learning problems to boost performance and robustness when detailed simulations are not reliable or not available.

Weakly supervised classification in high energy physics

International Nuclear Information System (INIS)

Dery, Lucio Mwinmaarong; Nachman, Benjamin; Rubbo, Francesco; Schwartzman, Ariel

2017-01-01

As machine learning algorithms become increasingly sophisticated to exploit subtle features of the data, they often become more dependent on simulations. This paper presents a new approach called weakly supervised classification in which class proportions are the only input into the machine learning algorithm. Using one of the most challenging binary classification tasks in high energy physics — quark versus gluon tagging — we show that weakly supervised classification can match the performance of fully supervised algorithms. Furthermore, by design, the new algorithm is insensitive to any mis-modeling of discriminating features in the data by the simulation. Weakly supervised classification is a general procedure that can be applied to a wide variety of learning problems to boost performance and robustness when detailed simulations are not reliable or not available.

Weak lensing in the Dark Energy Survey

Science.gov (United States)

Troxel, Michael

2016-03-01

I will present the current status of weak lensing results from the Dark Energy Survey (DES). DES will survey 5000 square degrees in five photometric bands (grizY), and has already provided a competitive weak lensing catalog from Science Verification data covering just 3% of the final survey footprint. I will summarize the status of shear catalog production using observations from the first year of the survey and discuss recent weak lensing science results from DES. Finally, I will report on the outlook for future cosmological analyses in DES including the two-point cosmic shear correlation function and discuss challenges that DES and future surveys will face in achieving a control of systematics that allows us to take full advantage of the available statistical power of our shear catalogs.

Weak layer fracture: facets and depth hoar

Directory of Open Access Journals (Sweden)

I. Reiweger

2013-09-01

Full Text Available Understanding failure initiation within weak snow layers is essential for modeling and predicting dry-snow slab avalanches. We therefore performed laboratory experiments with snow samples containing a weak layer consisting of either faceted crystals or depth hoar. During these experiments the samples were loaded with different loading rates and at various tilt angles until fracture. The strength of the samples decreased with increasing loading rate and increasing tilt angle. Additionally, we took pictures of the side of four samples with a high-speed video camera and calculated the displacement using a particle image velocimetry (PIV algorithm. The fracture process within the weak layer could thus be observed in detail. Catastrophic failure started due to a shear fracture just above the interface between the depth hoar layer and the underlying crust.

The Maslov index in weak symplectic functional analysis

DEFF Research Database (Denmark)

Booss-Bavnbek, Bernhelm; Zhu, Chaofeng

2013-01-01

We recall the Chernoff-Marsden definition of weak symplectic structure and give a rigorous treatment of the functional analysis and geometry of weak symplectic Banach spaces. We define the Maslov index of a continuous path of Fredholm pairs of Lagrangian subspaces in continuously varying Banach...

Information flow between weakly interacting lattices of coupled maps

Energy Technology Data Exchange (ETDEWEB)

Dobyns, York [PEAR, Princeton University, Princeton, NJ 08544-5263 (United States); Atmanspacher, Harald [Institut fuer Grenzgebiete der Psychologie und Psychohygiene, Wilhelmstr. 3a, 79098 Freiburg (Germany)]. E-mail: haa@igpp.de

2006-05-15

Weakly interacting lattices of coupled maps can be modeled as ordinary coupled map lattices separated from each other by boundary regions with small coupling parameters. We demonstrate that such weakly interacting lattices can nevertheless have unexpected and striking effects on each other. Under specific conditions, particular stability properties of the lattices are significantly influenced by their weak mutual interaction. This observation is tantamount to an efficacious information flow across the boundary.

Information flow between weakly interacting lattices of coupled maps

International Nuclear Information System (INIS)

Dobyns, York; Atmanspacher, Harald

2006-01-01

Weakly interacting lattices of coupled maps can be modeled as ordinary coupled map lattices separated from each other by boundary regions with small coupling parameters. We demonstrate that such weakly interacting lattices can nevertheless have unexpected and striking effects on each other. Under specific conditions, particular stability properties of the lattices are significantly influenced by their weak mutual interaction. This observation is tantamount to an efficacious information flow across the boundary

The Mutations Associated with Dilated Cardiomyopathy

Directory of Open Access Journals (Sweden)

Ruti Parvari

2012-01-01

Full Text Available Cardiomyopathy is an important cause of heart failure and a major indication for heart transplantation in children and adults. This paper describes the state of the genetic knowledge of dilated cardiomyopathy (DCM. The identification of the causing mutation is important since presymptomatic interventions of DCM have proven value in preventing morbidity and mortality. Additionally, as in general in genetic studies, the identification of the mutated genes has a direct clinical impact for the families and population involved. Identifying causative mutations immediately amplifies the possibilities for disease prevention through carrier screening and prenatal testing. This often lifts a burden of social isolation from affected families, since healthy family members can be assured of having healthy children. Identification of the mutated genes holds the potential to lead to the understanding of disease etiology, pathophysiology, and therefore potential therapy. This paper presents the genetic variations, or disease-causing mutations, contributing to the pathogenesis of hereditary DCM, and tries to relate these to the functions of the mutated genes.

Weak interaction and nucleus: the relationship keeps on

International Nuclear Information System (INIS)

Martino, J.; Frere, J.M.; Naviliat-Cuncic, O.; Volpe, C.; Marteau, J.; Lhuillier, D.; Vignaud, D.; Legac, R.; Marteau, J.; Legac, R.

2003-01-01

This document gathers the lectures made at the Joliot-Curie international summer school in 2003 whose theme, that year, was the relationship between weak interaction and nucleus. There were 8 contributions whose titles are: 1) before the standard model: from beta decay to neutral currents; 2) the electro-weak theory and beyond; 3) testing of the standard model at low energies; 4) description of weak processes in nuclei; 5) 20.000 tonnes underground, an approach to the neutrino-nucleus interaction; 6) parity violation from atom to nucleon; 7) how neutrinos got their masses; and 8) CP symmetry

Tight Bell Inequalities and Nonlocality in Weak Measurement

Science.gov (United States)

Waegell, Mordecai

A general class of Bell inequalities is derived based on strict adherence to probabilistic entanglement correlations observed in nature. This derivation gives significantly tighter bounds on local hidden variable theories for the well-known Clauser-Horne-Shimony-Holt (CHSH) inequality, and also leads to new proofs of the Greenberger-Horne-Zeilinger (GHZ) theorem. This method is applied to weak measurements and reveals nonlocal correlations between the weak value and the post-selection, which rules out various classical models of weak measurement. Implications of these results are discussed. Fetzer-Franklin Fund of the John E. Fetzer Memorial Trust.

Hypernuclear weak decay and the ΔI = 1/2 rule

International Nuclear Information System (INIS)

Barnes, P.D.

1987-01-01

Recent measurements of the weak decay of Λ hypernuclei are reported and discussed in the context of the weak hyperon-baryon effective Hamiltonian. The results are compared to predictions of both meson exchange and quark-quark weak interaction models. 14 refs., 4 figs., 2 tabs

[Optimization and assessment of a reverse hybridization system for the detection of HBV drug-resistant mutations].

Science.gov (United States)

Liu, Yan-chen; Huang, Ai-long; Hu, Yuan; Hu, Jie-li; Lai, Guo-qi; Zhang, Wen-lu

2011-12-01

To establish a detection method for HBV drug-resistant mutations related to lamivudine, adefovir and entecavir by optimization and assessment of reverse hybridization system. 26 degenerated probes covering 10 drug-resistant hotspots of 3 drugs were synthesized and immobilized on the same positively charged nylon membrane. PCR products labeled with digoxigenin were hybridized with corresponding probes. To improve the sensitivity and specificity, 4 reaction steps of reverse hybridization were optimized including the number of labeled digoxigenin, the energy intensity of UV cross-linking, hybridization and stringency wash conditions. To prove the feasibility, the specificity, sensitivity and accuracy of this system were assessed respectively. Sensitive and specific results are obtained by the optimization of the following 4 reaction steps: the primers labeled with 3 digoxigenin, energy intensity of UV cross-linking for 1500 x 0.1 mJ/cm², hybridization at 42 degrees C and stringency wash with 0.5 x SSC and 0.1% SDS solution at 44 degrees C for 30 min. In the assessment of system, the majority of probes have high specificity. The quantity of PCR product with a concentration of 10 ng/μl or above can be detected by this method. The concordant rate between reverse hybridization and direct sequencing is 93.9% in the clinical sample test. Though the specificity of several probes needs to be improved further, it is a simple, rapid and sensitive method which can detect HBV resistant mutations related to lamivudine, adefovir and entecavir simultaneously. Due to the short distance between 180 and 181, likewise 202 and 204, the sequence of the same probe covers two codon positions, and hybridization will be interfered by each other. To avoid such interference, the possible solution is that probes are designed by arranging and combining various forms of two near codons.

[Study of gene mutation in 62 hemophilia A children].

Science.gov (United States)

Hu, Q; Liu, A G; Zhang, L Q; Zhang, A; Wang, Y Q; Wang, S M; Lu, Y J; Wang, X

2017-11-02

Objective: To analyze the mutation type of FⅧ gene in children with hemophilia A and to explore the relationship among hemophilia gene mutation spectrum, gene mutation and clinical phenotype. Method: Sixty-two children with hemophilia A from Department of Pediatric Hematology, Tongji Hospital of Tongji Medical College, Huazhong University of Science and Technology between January 2015 and March 2017 were enrolled. All patients were male, aged from 4 months to 7 years and F Ⅷ activity ranged 0.2%-11.0%. Fifty cases had severe, 10 cases had moderate and 2 cases had mild hemophilia A. DNA was isolated from peripheral blood in hemophilia A children and the target gene fragment was amplified by PCR, in combination with the second generation sequencing, 22 and 1 introns were detected. Negative cases were detected by the second generation sequencing and results were compared with those of the international FⅧ gene mutation database. Result: There were 20 cases (32%) of intron 22 inversion, 2 cases (3%) of intron 1 inversion, 18 cases (29%) of missense mutation, 5 cases (8%) of nonsense mutation, 7 cases (11%) of deletion mutation, 1 case(2%)of splice site mutation, 2 cases (3%) of large fragment deletion and 1 case of insertion mutation (2%). No mutation was detected in 2 cases (3%), and 4 cases (7%) failed to amplify. The correlation between phenotype and genotype showed that the most common gene mutation in severe hemophilia A was intron 22 inversion (20 cases), accounting for 40% of severe patients, followed by 11 cases of missense mutation (22%). The most common mutation in moderate hemophilia A was missense mutation (6 cases), accounting for 60% of moderate patients. Conclusion: The most frequent mutation type in hemophilia A was intron 22 inversion, followed by missense mutation, again for missing mutation. The relationship between phenotype and genotype: the most frequent gene mutation in severe hemophilia A is intron 22 inversion, followed by missense

Calreticulin mutation analysis in non-mutated Janus kinase 2 essential thrombocythemia patients in Chiang Mai University: analysis of three methods and clinical correlations.

Science.gov (United States)

Rattarittamrong, Ekarat; Tantiworawit, Adisak; Kumpunya, Noppamas; Wongtagan, Ornkamon; Tongphung, Ratchanoo; Phusua, Arunee; Chai-Adisaksopha, Chatree; Hantrakool, Sasinee; Rattanathammethee, Thanawat; Norasetthada, Lalita; Charoenkwan, Pimlak; Lekawanvijit, Suree

2018-03-09

The primary objective was to determine the prevalence of calreticulin (CALR) mutation in patients with non-JAK2V617F mutated essential thrombocythemia (ET). The secondary objectives were to evaluate the accuracy of CALR mutation analysis by high-resolution melting (HRM) analysis and real-time polymerase chain reaction (PCR) compared with DNA sequencing and to compare clinical characteristics of CALR mutated and JAK2V617F mutated ET. This was a prospective cohort study involving ET patients registered at Chiang Mai University in the period September 2015-September 2017 who were aged more than 2 years, and did not harbor JAK2V617F mutation. The presence of CALR mutation was established by DNA sequencing, HRM, and real-time PCR for type 1 and type 2 mutation. Clinical data were compared with that from ET patients with mutated JAK2V617F. Twenty-eight patients were enrolled onto the study. CALR mutations were found in 10 patients (35.7%). Three patients had type 1 mutation, 5 patients had type 2 mutation, 1 patient had type 18 mutation, and 1 patients had novel mutations (c.1093 C-G, c.1098_1131 del, c.1135 G-A). HRM could differentiate between the types of mutation in complete agreement with DNA sequencing. Patients with a CALR mutation showed a significantly greater male predominance and had a higher platelet count when compared with 42 JAK2V617F patients. The prevalence of CALR mutation in JAK2V617F-negative ET in this study is 35.7%. HRM is an effective method of detecting CALR mutation and is a more advantageous method of screening for CALR mutation.

MSH6 and PMS2 mutation positive Australian Lynch syndrome families: novel mutations, cancer risk and age of diagnosis of colorectal cancer.

Science.gov (United States)

Talseth-Palmer, Bente A; McPhillips, Mary; Groombridge, Claire; Spigelman, Allan; Scott, Rodney J

2010-05-21

Approximately 10% of Lynch syndrome families have a mutation in MSH6 and fewer families have a mutation in PMS2. It is assumed that the cancer incidence is the same in families with mutations in MSH6 as in families with mutations in MLH1/MSH2 but that the disease tends to occur later in life, little is known about families with PMS2 mutations. This study reports on our findings on mutation type, cancer risk and age of diagnosis in MSH6 and PMS2 families. A total of 78 participants (from 29 families) with a mutation in MSH6 and 7 participants (from 6 families) with a mutation in PMS2 were included in the current study. A database of de-identified patient information was analysed to extract all relevant information such as mutation type, cancer incidence, age of diagnosis and cancer type in this Lynch syndrome cohort. Cumulative lifetime risk was calculated utilising Kaplan-Meier survival analysis. MSH6 and PMS2 mutations represent 10.3% and 1.9%, respectively, of the pathogenic mutations in our Australian Lynch syndrome families. We identified 26 different MSH6 and 4 different PMS2 mutations in the 35 families studied. We report 15 novel MSH6 and 1 novel PMS2 mutations. The estimated cumulative risk of CRC at age 70 years was 61% (similar in males and females) and 65% for endometrial cancer in MSH6 mutation carriers. The risk of developing CRC is different between males and females at age 50 years, which is 34% for males and 21% for females. Novel MSH6 and PMS2 mutations are being reported and submitted to the current databases for identified Lynch syndrome mutations. Our data provides additional information to add to the genotype-phenotype spectrum for both MSH6 and PMS2 mutations.

The functional importance of disease-associated mutation

Directory of Open Access Journals (Sweden)

Klein Teri E

2002-09-01

Full Text Available Abstract Background For many years, scientists believed that point mutations in genes are the genetic switches for somatic and inherited diseases such as cystic fibrosis, phenylketonuria and cancer. Some of these mutations likely alter a protein's function in a manner that is deleterious, and they should occur in functionally important regions of the protein products of genes. Here we show that disease-associated mutations occur in regions of genes that are conserved, and can identify likely disease-causing mutations. Results To show this, we have determined conservation patterns for 6185 non-synonymous and heritable disease-associated mutations in 231 genes. We define a parameter, the conservation ratio, as the ratio of average negative entropy of analyzable positions with reported mutations to that of every analyzable position in the gene sequence. We found that 84.0% of the 231 genes have conservation ratios less than one. 139 genes had eleven or more analyzable mutations and 88.0% of those had conservation ratios less than one. Conclusions These results indicate that phylogenetic information is a powerful tool for the study of disease-associated mutations. Our alignments and analysis has been made available as part of the database at http://cancer.stanford.edu/mut-paper/. Within this dataset, each position is annotated with the analysis, so the most likely disease-causing mutations can be identified.

POLE somatic mutations in advanced colorectal cancer.

Science.gov (United States)

Guerra, Joana; Pinto, Carla; Pinto, Diana; Pinheiro, Manuela; Silva, Romina; Peixoto, Ana; Rocha, Patrícia; Veiga, Isabel; Santos, Catarina; Santos, Rui; Cabreira, Verónica; Lopes, Paula; Henrique, Rui; Teixeira, Manuel R

2017-12-01

Despite all the knowledge already gathered, the picture of somatic genetic changes in colorectal tumorigenesis is far from complete. Recently, germline and somatic mutations in the exonuclease domain of polymerase epsilon, catalytic subunit (POLE) gene have been reported in a small subset of microsatellite-stable and hypermutated colorectal carcinomas (CRCs), affecting the proofreading activity of the enzyme and leading to misincorporation of bases during DNA replication. To evaluate the role of POLE mutations in colorectal carcinogenesis, namely in advanced CRC, we searched for somatic mutations by Sanger sequencing in tumor DNA samples from 307 cases. Microsatellite instability and mutation analyses of a panel of oncogenes were performed in the tumors harboring POLE mutations. Three heterozygous mutations were found in two tumors, the c.857C>G, p.Pro286Arg, the c.901G>A, p.Asp301Asn, and the c.1376C>T, p.Ser459Phe. Of the POLE-mutated CRCs, one tumor was microsatellite-stable and the other had low microsatellite instability, whereas KRAS and PIK3CA mutations were found in one tumor each. We conclude that POLE somatic mutations exist but are rare in advanced CRC, with further larger studies being necessary to evaluate its biological and clinical implications. © 2017 The Authors. Cancer Medicine published by John Wiley & Sons Ltd.

Haploid rice plants in mutation studies

Energy Technology Data Exchange (ETDEWEB)

Tanaka, S [Institute of Radiation Breeding, Ministry of Agriculture and Forestry, Ohmiya, Ibaraki-ken (Japan)

1970-03-01

Studies were made on chlorophyll-deficient sectors and diploid-like sectors in haploid rice plants exposed to chronic gamma irradiation, and on germinal mutations in diploid strains derived from the haploid plants. The induction and elimination of somatic mutations in haploid plants and the occurrence of drastic germinal mutations in diploid strains from haploid plants are discussed. (author)

Mitochondrial mutations drive prostate cancer aggression

DEFF Research Database (Denmark)

Hopkins, Julia F.; Sabelnykova, Veronica Y.; Weischenfeldt, Joachim

2017-01-01

Nuclear mutations are well known to drive tumor incidence, aggression and response to therapy. By contrast, the frequency and roles of mutations in the maternally inherited mitochondrial genome are poorly understood. Here we sequence the mitochondrial genomes of 384 localized prostate cancer...... in prostate cancer, and suggest interplay between nuclear and mitochondrial mutational profiles in prostate cancer....

Effects of Germline Mutations in the Ras/MAPK Signaling Pathway on Adaptive Behavior: Cardiofaciocutaneous Syndrome and Noonan Syndrome

Science.gov (United States)

Pierpont, Elizabeth I.; Pierpont, Mary Ella; Mendelsohn, Nancy J.; Roberts, Amy E.; Tworog-Dube, Erica; Rauen, Katherine A.; Seidenberg, Mark S.

2011-01-01

Cardiofaciocutaneous syndrome (CFC) and Noonan syndrome (NS) are two phenotypically overlapping genetic disorders whose underlying molecular etiologies affect a common signaling pathway. Mutations in the BRAF, MEK1 and MEK2 genes cause most cases of CFC and mutations in PTPN11, SOS1, KRAS and RAF1 typically cause NS. Although both syndromes are associated with developmental delays of varying severity, the extent to which the behavioral profiles differ may shed light on the different roles these respective genes play in development of skills necessary for everyday functioning. In this study, profiles of adaptive behavior of individuals with CFC and NS who had confirmed pathogenic mutations in Ras/MAPK pathway genes were investigated. Patterns of strengths and weaknesses, age-related differences, and risk factors for difficulties in adaptive skills were assessed. Although genes acting more downstream in the Ras/MAPK pathway were associated with more difficulties in adaptive functioning than genes more upstream in the pathway, several inconsistencies highlight the wide spectrum of possible developmental courses in CFC and NS. Along with clinical and genetic factors, variables such as chronological age, gestational age at birth and parental education levels accounted for significant variance in adaptive skills. Results indicate that there is wide heterogeneity in adaptive ability in CFC and NS, but that these abilities are correlated to some extent with the specific disease-causing genes. PMID:20186801

More than 40% of those not taking antiseizure medication with recent seizures reported that epilepsy or its treatment interfered with their recent activities, 2010 and 2013 US National Health Interview Surveys.

Science.gov (United States)

Kobau, Rosemarie; Cui, Wanjun; Zack, Matthew M

2016-09-01

From the combined 2010 and 2013 National Health Interview Surveys, we estimated US national age-standardized prevalence of adults with active epilepsy who reported that a nervous system/sensory organ condition caused a limitation (e.g., walking; memory; or physical, mental, or emotional problems) and, separately, that epilepsy interfered with their activities (e.g., working, schooling, or socializing) during the 30days preceding the survey. Sixty-one percent of adults who took antiseizure medication and had recent seizures and 51% of those who took medication and had no seizures reported having limitations caused by a nervous system/sensory organ condition. Sixty-two percent of adults who took antiseizure medication and had recent seizures and 20% of those who took medication and had no seizures reported that epilepsy or its treatment interfered with their recent activities. Forty-one percent of those who did not take medication and had recent seizures also reported that epilepsy interfered with their activities. To reduce activity limitations in people with epilepsy, health and social service providers can ensure that adequate policies and practices that promote access to high quality care and social participation are in effect in organizations and communities. Published by Elsevier Inc.

Parkinson's disease-related LRRK2 G2019S mutation results from independent mutational events in humans.

Science.gov (United States)

Lesage, Suzanne; Patin, Etienne; Condroyer, Christel; Leutenegger, Anne-Louise; Lohmann, Ebba; Giladi, Nir; Bar-Shira, Anat; Belarbi, Soraya; Hecham, Nassima; Pollak, Pierre; Ouvrard-Hernandez, Anne-Marie; Bardien, Soraya; Carr, Jonathan; Benhassine, Traki; Tomiyama, Hiroyuki; Pirkevi, Caroline; Hamadouche, Tarik; Cazeneuve, Cécile; Basak, A Nazli; Hattori, Nobutaka; Dürr, Alexandra; Tazir, Meriem; Orr-Urtreger, Avi; Quintana-Murci, Lluis; Brice, Alexis

2010-05-15

Mutations in the leucine-rich-repeat kinase 2 (LRRK2) gene have been identified in families with autosomal dominant Parkinson's disease (PD) and in sporadic cases; the G2019S mutation is the single most frequent. Intriguingly, the frequency of this mutation in PD patients varies greatly among ethnic groups and geographic origins: it is present at <0.1% in East Asia, approximately 2% in European-descent patients and can reach frequencies of up to 15-40% in PD Ashkenazi Jews and North African Arabs. To ascertain the evolutionary dynamics of the G2019S mutation in different populations, we genotyped 74 markers spanning a 16 Mb genomic region around G2019S, in 191 individuals carrying the mutation from 126 families of different origins. Sixty-seven families were of North-African Arab origin, 18 were of North/Western European descent, 37 were of Jewish origin, mostly from Eastern Europe, one was from Japan, one from Turkey and two were of mixed origins. We found the G2019S mutation on three different haplotypes. Network analyses of the three carrier haplotypes showed that G2019S arose independently at least twice in humans. In addition, the population distribution of the intra-allelic diversity of the most widespread carrier haplotype, together with estimations of the age of G2019S determined by two different methods, suggests that one of the founding G2019S mutational events occurred in the Near East at least 4000 years ago.