WorldWideScience

Sample records for wave-induced water motion

  1. Wave-induced mass transport affects daily Escherichia coli fluctuations in nearshore water

    Science.gov (United States)

    Ge, Zhongfu; Whitman, Richard L.; Nevers, Meredith B.; Phanikumar, Mantha S.

    2012-01-01

    Characterization of diel variability of fecal indicator bacteria concentration in nearshore waters is of particular importance for development of water sampling standards and protection of public health. Significant nighttime increase in Escherichia coli (E. coli) concentration in beach water, previously observed at marine sites, has also been identified in summer 2000 from fixed locations in waist- and knee-deep waters at Chicago 63rd Street Beach, an embayed, tideless, freshwater beach with low currents at night (approximately 0.015 m s–1). A theoretical model using wave-induced mass transport velocity for advection was developed to assess the contribution of surface waves to the observed nighttime E. coli replenishment in the nearshore water. Using average wave conditions for the summer season of year 2000, the model predicted an amount of E. coli transported from water of intermediate depth, where sediment resuspension occurred intermittently, that would be sufficient to have elevated E. coli concentration in the surf and swash zones as observed. The nighttime replenishment of E. coli in the surf and swash zones revealed here is an important phase in the cycle of diel variations of E. coli concentration in nearshore water. According to previous findings in Ge et al. (Environ. Sci. Technol. 2010, 44, 6731–6737), enhanced current circulation in the embayment during the day tends to displace and deposit material offshore, which partially sets up the system by the early evening for a new period of nighttime onshore movement. This wave-induced mass transport effect, although facilitating a significant base supply of material shoreward, can be perturbed or significantly influenced by high currents (orders of magnitude larger than a typical wave-induced mass transport velocity), current-induced turbulence, and tidal forcing.

  2. Wave-induced extreme water levels in the Puerto Morelos fringing reef lagoon

    Directory of Open Access Journals (Sweden)

    A. Torres-Freyermuth

    2012-12-01

    Full Text Available Wave-induced extreme water levels in the Puerto Morelos fringing reef lagoon are investigated by means of a phase-resolving non-hydrostatic wave model (SWASH. This model solves the nonlinear shallow water equations including non-hydrostatic pressure. The one-dimensional version of the model is implemented in order to investigate wave transformation in fringing reefs. Firstly, the numerical model is validated with (i laboratory experiments conducted on a physical model (Demirbilek et al., 2007and (ii field observations (Coronado et al., 2007. Numerical results show good agreement with both experimental and field data. The comparison against the physical model results, for energetic wave conditions, indicates that high- and low-frequency wave transformation is well reproduced. Moreover, extreme water-level conditions measured during the passage of Hurricane Ivan in Puerto Morelos are also estimated by the numerical tool. Subsequently, the model is implemented at different along-reef locations in Puerto Morelos. Extreme water levels, wave-induced setup, and infragravity wave energy are estimated inside the reef lagoon for different storm wave conditions (Hs >2 m. The numerical results revealed a strong correlation between the offshore sea-swell wave energy and the setup. In contrast, infragravity waves are shown to be the result of a more complex pattern which heavily relies on the reef geometry. Indeed, the southern end of the reef lagoon provides evidence of resonance excitation, suggesting that the reef barrier may act as either a natural flood protection morphological feature, or as an inundation hazard enhancer depending on the incident wave conditions.

  3. Aeroelastic impact of above-rated wave-induced structural motions on the near-wake stability of a floating offshore wind turbine rotor

    Science.gov (United States)

    Rodriguez, Steven; Jaworski, Justin

    2017-11-01

    The impact of above-rated wave-induced motions on the stability of floating offshore wind turbine near-wakes is studied numerically. The rotor near-wake is generated using a lifting-line free vortex wake method, which is strongly coupled to a finite element solver for kinematically nonlinear blade deformations. A synthetic time series of relatively high-amplitude/high-frequency representative of above-rated conditions of the NREL 5MW referece wind turbine is imposed on the rotor structure. To evaluate the impact of these above-rated conditions, a linear stability analysis is first performed on the near wake generated by a fixed-tower wind turbine configuration at above-rated inflow conditions. The platform motion is then introduced via synthetic time series, and a stability analysis is performed on the wake generated by the floating offshore wind turbine at the same above-rated inflow conditions. The stability trends (disturbance modes versus the divergence rate of vortex structures) of the two analyses are compared to identify the impact that above-rated wave-induced structural motions have on the stability of the floating offshore wind turbine wake.

  4. Compensation of Wave-Induced Motion and Force Phenomena for Ship-Based High Performance Robotic and Human Amplifying Systems

    Energy Technology Data Exchange (ETDEWEB)

    Love, LJL

    2003-09-24

    The decrease in manpower and increase in material handling needs on many Naval vessels provides the motivation to explore the modeling and control of Naval robotic and robotic assistive devices. This report addresses the design, modeling, control and analysis of position and force controlled robotic systems operating on the deck of a moving ship. First we provide background information that quantifies the motion of the ship, both in terms of frequency and amplitude. We then formulate the motion of the ship in terms of homogeneous transforms. This transformation provides a link between the motion of the ship and the base of a manipulator. We model the kinematics of a manipulator as a serial extension of the ship motion. We then show how to use these transforms to formulate the kinetic and potential energy of a general, multi-degree of freedom manipulator moving on a ship. As a demonstration, we consider two examples: a one degree-of-freedom system experiencing three sea states operating in a plane to verify the methodology and a 3 degree of freedom system experiencing all six degrees of ship motion to illustrate the ease of computation and complexity of the solution. The first series of simulations explore the impact wave motion has on tracking performance of a position controlled robot. We provide a preliminary comparison between conventional linear control and Repetitive Learning Control (RLC) and show how fixed time delay RLC breaks down due to the varying nature wave disturbance frequency. Next, we explore the impact wave motion disturbances have on Human Amplification Technology (HAT). We begin with a description of the traditional HAT control methodology. Simulations show that the motion of the base of the robot, due to ship motion, generates disturbances forces reflected to the operator that significantly degrade the positioning accuracy and resolution at higher sea states. As with position-controlled manipulators, augmenting the control with a Repetitive

  5. Estimation of the Effect of Green Water and Bow Flare Slamming on the Wave-Induced Vertical Bending Moment Using Closed-Form Ex-pressions

    DEFF Research Database (Denmark)

    Jensen, Jørgen Juncher; Mansour, A. E.

    2003-01-01

    (1993) and for green water loads the results from Buchner (1995) and Wang et al .(1998) are applied. The phase lag relative to the wave-induced peak and the decay rate are derived mainly from published experimental results, Sikora, (1998). The results are given in closed-form expressions...

  6. Simulation of Irregular Waves and Wave Induced Loads on Wind Power Plants in Shallow Water

    Energy Technology Data Exchange (ETDEWEB)

    Trumars, Jenny [Chalmers Univ. of Technology, Goeteborg (Sweden). Dept. of Water Environment Transport

    2004-05-01

    The essay gives a short introduction to waves and discusses the problem with non-linear waves in shallow water and how they effect an offshore wind energy converter. The focus is on the realisation of non-linear waves in the time domain from short-term statistics in the form of a variance density spectrum of the wave elevation. For this purpose the wave transformation from deep water to the near to shore site of a wind energy farm at Bockstigen has been calculated with the use of SWAN (Simulating Waves Near Shore). The result is a wave spectrum, which can be used as input to the realisation. The realisation of waves is done by perturbation theory to the first and second-order. The properties calculated are the wave elevation, water particle velocity and acceleration. The wave heights from the second order perturbation equations are higher than those from the first order perturbation equations. This is also the case for the water particle kinematics. The increase of variance is significant between the first order and the second order realisation. The calculated wave elevation exhibits non-linear features as the peaks become sharper and the troughs flatter. The resulting forces are calculated using Morison's equation. For second order force and base moment there is an increase in the maximum values. The force and base moment are largest approximately at the zero up and down crossing of the wave elevation. This indicates an inertia dominated wave load. So far the flexibility and the response of the structure have not been taken into account. They are, however, of vital importance. For verification of the wave model the results will later on be compared with measurements at Bockstigen off the coast of Gotland in the Baltic Sea.

  7. Wind-wave induced dynamic response analysis for motions and mooring loads of a spar-type offshore floating wind turbine

    Institute of Scientific and Technical Information of China (English)

    马钰; 肖龙飞; 胡志强

    2014-01-01

    Due to the energy crisis and the environmental issues like pollution and global warming, the exploration for renewable and clean energies becomes crucial. The offshore floating wind turbines (OFWTs) draw a great deal of attention recently as a means to exploit the steadier and stronger wind resources available in deep water seas. This paper studies the hydrodynamic characteristics of a spar-type wind turbine known as the OC3-Hywind concept and the dynamic responses of the turbine. Response characteristics of motions and mooring loads of the system under different sea states are evaluated and the effects of the loads induced by the wind and the wave on the system are discussed. The calculations are carried out with the numerical simulation code FAST in the time domain and the frequency analysis is made by using the FFT method. The results and the conclusions from this paper might help better understand the behavior characteristics of the floating wind turbine system under actual ocean environments and provide valuable data in design and engineering practice.

  8. Estimation of Impulsive Wave-induced Loads on a FPSO

    DEFF Research Database (Denmark)

    Jensen, Jørgen Juncher; Mansour, Alaa E.

    2005-01-01

    ) and for green water loads from the results of Buchner (1995) and Wang et al. (1998) are applied. The phase lag relative to the wave-induced peak and the decay rate are derived mainly from published experimental results, Sikora, (1998). The results are given in closed-form expressions and the required input...

  9. On helicon wave induced radial plasma transport

    International Nuclear Information System (INIS)

    Petrzilka, V.

    1993-04-01

    Estimates of helicon wave induced radial plasma transport are presented. The wave induced transport grows or decreases in dependence on the sign of the azimuthal wave number; these changes in transport may play an important role in helicon wave plasma sources. (author) 5 figs., 18 refs

  10. Brownian motion probe for water-ethanol inhomogeneous mixtures

    Science.gov (United States)

    Furukawa, Kazuki; Judai, Ken

    2017-12-01

    Brownian motion provides information regarding the microscopic geometry and motion of molecules, insofar as it occurs as a result of molecular collisions with a colloid particle. We found that the mobility of polystyrene beads from the Brownian motion in a water-ethanol mixture is larger than that predicted from the liquid shear viscosity. This indicates that mixing water and ethanol is inhomogeneous in micron-sized probe beads. The discrepancy between the mobility of Brownian motion and liquid mobility can be explained by the way the rotation of the beads in an inhomogeneous viscous solvent converts the translational movement.

  11. Wave-induced Ship Hull Vibrations in Stochastic Seaways

    DEFF Research Database (Denmark)

    Jensen, Jørgen Juncher; Dogliani, M.

    1996-01-01

    A theoretical Study is undertaken on the determination of wave-induced loads in flexible ship hulls. The calculations are performed within the framework of a non-linear, quadratic strip theory formulated in the frequency domain. Included are non-linear effects due to changes in added mass......, hydrodynamic damping and water line breadth with sectional immersion in waves. The study is limited to continuous excitations from the waves and thus transient so-called whipping vibrations due to slamming loads are not considered.Because of the non-linearities the ship hull responses become non...... to the large separation between dominating wave frequencies and the lowest two-node frequency of the hull beam. Both extreme value predictions and fatigue damage are considered.For a fast container ship the rigid body and two-node (springing) vertical wave-induced bending moments amidship are calculated...

  12. Context analysis : sky, water and motion

    NARCIS (Netherlands)

    Javanbakhti, S.; Zinger, S.; With, de P.H.N.

    2011-01-01

    Interpreting the events present in the video is a complex task, and the same gesture or motion can be understood in several ways depending on the context of the event and/or the scene. Therefore the context of the scene can contribute to the semantic understanding of the video. In this paper, we

  13. Thermophoretic Motion of Water Nanodroplets confined inside Carbon Nanotubes

    DEFF Research Database (Denmark)

    Zambrano, Harvey A; Walther, Jens Honore; Koumoutsakos, Petros

    2009-01-01

    We study the thermophoretic motion of water nanodroplets confined inside carbon nanotubes using molecular dynamics simulations. We find that the nanodroplets move in the direction opposite the imposed thermal gradient with a terminal velocity that is linearly proportional to the gradient....... The translational motion is associated with a solid body rotation of the water nanodroplet coinciding with the helical symmetry of the carbon nanotube. The thermal diffusion displays a weak dependence on the wetting of the water-carbon nanotube interface. We introduce the use of the Moment Scaling Spectrum (MSS......) in order to determine the characteristics of the motion of the nanoparticles inside the carbon nanotube. The MSS indicates that affinity of the nanodroplet with the walls of the carbon nanotubes is important for the isothermal diffusion, and hence for the Soret coefficient of the system....

  14. Wave-induced stress and breaking of sea ice in a coupled hydrodynamic discrete-element wave-ice model

    Science.gov (United States)

    Herman, Agnieszka

    2017-11-01

    In this paper, a coupled sea ice-wave model is developed and used to analyze wave-induced stress and breaking in sea ice for a range of wave and ice conditions. The sea ice module is a discrete-element bonded-particle model, in which ice is represented as cuboid grains floating on the water surface that can be connected to their neighbors by elastic joints. The joints may break if instantaneous stresses acting on them exceed their strength. The wave module is based on an open-source version of the Non-Hydrostatic WAVE model (NHWAVE). The two modules are coupled with proper boundary conditions for pressure and velocity, exchanged at every wave model time step. In the present version, the model operates in two dimensions (one vertical and one horizontal) and is suitable for simulating compact ice in which heave and pitch motion dominates over surge. In a series of simulations with varying sea ice properties and incoming wavelength it is shown that wave-induced stress reaches maximum values at a certain distance from the ice edge. The value of maximum stress depends on both ice properties and characteristics of incoming waves, but, crucially for ice breaking, the location at which the maximum occurs does not change with the incoming wavelength. Consequently, both regular and random (Jonswap spectrum) waves break the ice into floes with almost identical sizes. The width of the zone of broken ice depends on ice strength and wave attenuation rates in the ice.

  15. Laser spectroscopic visualization of hydrogen bond motions in liquid water

    Science.gov (United States)

    Bratos, S.; Leicknam, J.-Cl.; Pommeret, S.; Gallot, G.

    2004-12-01

    Ultrafast pump-probe experiments are described permitting a visualization of molecular motions in diluted HDO/D 2O solutions. The experiments were realized in the mid-infrared spectral region with a time resolution of 150 fs. They were interpreted by a careful theoretical analysis, based on the correlation function approach of statistical mechanics. Combining experiment and theory, stretching motions of the OH⋯O bonds as well as HDO rotations were 'filmed' in real time. It was found that molecular rotations are the principal agent of hydrogen bond breaking and making in water. Recent literatures covering the subject, including molecular dynamics simulations, are reviewed in detail.

  16. Motion of air bubbles in stagnant water condition

    International Nuclear Information System (INIS)

    Bezdegumeli, U.; Ozdemir, S.; Yesin, O.

    2004-01-01

    Full text: In this study, air bubble motion in stagnant water condition in a vertical pipe is investigated experimentally. For this purpose, a test set-up was designed and constructed. Motions of single bubbles, having different diameters in the range of 3.0-4.8 mm, were recorded by using a monochrome camera, an image capture card and a PC. Recorded video images were processed to analyse bubble motion and to obtain the necessary data. The purpose of the study is to determine the variation of bubble axial velocity and bubble drag coefficient as a function of equivalent bubble diameter and bubble Reynolds number, Re b . Therefore, detailed information for this range of bubble diameters was obtained. The results have shown good consistency with the previous studies found in the literature

  17. Motion of air bubbles in stagnant water condition

    International Nuclear Information System (INIS)

    Bezdegumeli, U.; Ozdemir, S.; Yesin, O.

    2004-01-01

    In this study, air bubble motion in stagnant water condition in a vertical pipe of 4.6 cm diameter is investigated experimentally. For this purpose, a test set-up was designed and constructed. Motions of single bubbles, having different diameters in the range of 3.0-4.8 mm, were recorded by using a monochrome camera, an image capture card and a PC. Recorded video images were processed to analyse bubble motion and to obtain the necessary data. The purpose of the study is to determine the variation of bubble axial velocity and bubble drag coefficient as a function of equivalent bubble diameter and bubble Reynolds number, Re b . Therefore, detailed information for this range of bubble diameters was obtained. The results have shown good consistency with the previous studies found in the literature. (author)

  18. Motion behavior of water droplets driven by triboelectric nanogenerator

    Science.gov (United States)

    Nie, Jinhui; Jiang, Tao; Shao, Jiajia; Ren, Zewei; Bai, Yu; Iwamoto, Mitsumasa; Chen, Xiangyu; Wang, Zhong Lin

    2018-04-01

    By integrating a triboelectric nanogenerator (TENG) and a simple circuit board, the motion of water droplets can be controlled by the output of the TENG, which demonstrates a self-powered microfluidic system toward various practical applications in the fields of microfluidic system and soft robotics. This paper describes a method to construct a physical model for this self-powered system on the basis of electrostatic induction theory. The model can precisely simulate the detailed motion behavior of the droplet under driving of TENG, and it can also reveal the influences of surface hydrophobicity on the motion of the droplet, which can help us to better understand the key parameters that decide the performance of the system. The experimental observation of the dynamic performance of the droplet has also been done with a high speed camera system. A comparison between simulation results and real measurements confirms that the proposed model can predict the velocity and position of the water droplet driven by high voltage source as well as TENG. Hence, the proposed model in this work could serve as a guidance for optimizing the self-powered systems in future studies.

  19. On radio frequency wave induced radial transport and wave helicity

    International Nuclear Information System (INIS)

    Petrzilka, V.

    1992-09-01

    Expressions for wave induced radial transport are derived allowing simple estimates. The transport is enhanced due to the presence of poloidal magnetostatic field and in the vicinity of the ion cyclotron resonance. The direction of the wave induced transport depends also on the wave polarization. (author) 19 refs

  20. Wave-induced stresses and pore pressures near a mudline

    Directory of Open Access Journals (Sweden)

    Andrzej Sawicki

    2008-12-01

    Full Text Available Conventional methods for the determination of water-wave induced stresses inseabeds composed of granular soils are based on Biot-type models, in which the soilskeleton is treated as an elastic medium. Such methods predict effective stressesin the soil that are unacceptable from the physical point of view, as they permittensile stresses to occur near the upper surface of the seabed. Therefore, in thispaper the granular soil is assumed to behave as an elastic-ideally plastic material,with the Coulomb-Mohr yield criterion adopted to bound admissible stress states inthe seabed. The governing equations are solved numerically by a~finite differencemethod. The results of simulations, carried out for the case of time-harmonicwater waves, illustrate the depth distributions of the excess pore pressures and theeffective stresses in the seabed, and show the shapes of zones of soil in the plastic state.~In particular, the effects on the seabed behaviour of suchparameters as the degree of pore water saturation, the soil permeability, and theearth pressure coefficient, are illustrated.

  1. Water confinement effects on fuel assembly motion and damping

    International Nuclear Information System (INIS)

    Brenneman, B.; Shah, S.J.; Williams, G.T.; Strumpell, J.H.

    2003-01-01

    It has been established by other authors that the accelerations of the water confined by the reactor core baffle plates has a significant effect on the responses of all the fuel assemblies during LOCA or seismic transients. This particular effect is a consequence of the water being essentially incompressible, and thus experiencing the same horizontal accelerations as the imposed baffle plate motions. These horizontal accelerations of the fluid induce lateral pressure gradients that cause horizontal buoyancy forces on any submerged structures. These forces are in the same direction as the baffle accelerations and, for certain frequencies at least, tend to reduce the relative displacements between the fuel and baffle plates. But there is another confinement effect - the imposed baffle plate velocities must also be transmitted to the water. If the fuel assembly grid strips are treated as simple hydro-foils, these horizontal velocity components change the fluid angle of attack on each strip, and thus may induce large horizontal lift forces on each grid in the same direction as the baffle plate velocity. There is a similar horizontal lift due to inclined flow over the rods when axial flow is present. These combined forces appear to always reduce the relative displacements between the fuel and baffle plates for any significant axial flow velocity. Modeling this effect is very simple. It was shown in previous papers that the mechanism for the large fuel assembly damping due to axial flow may be the hydrodynamic forces on the grid strips, and that this is very well represented by discrete viscous dampers at each grid elevation. To include the imposed horizontal water velocity effects, on both the grids and rods, these dampers are simply attached to the baffle plate rather than 'ground'. The large flow-induced damping really acts in a relative reference frame rather than an absolute or inertial reference frame, and thus it becomes a flow-induced coupling between the fuel

  2. Motion detection and correction for dynamic 15O-water myocardial perfusion PET studies

    International Nuclear Information System (INIS)

    Naum, Alexandru; Laaksonen, Marko S.; Oikonen, Vesa; Teraes, Mika; Jaervisalo, Mikko J.; Knuuti, Juhani; Tuunanen, Helena; Nuutila, Pirjo; Kemppainen, Jukka

    2005-01-01

    Patient motion during dynamic PET studies is a well-documented source of errors. The purpose of this study was to investigate the incidence of frame-to-frame motion in dynamic 15 O-water myocardial perfusion PET studies, to test the efficacy of motion correction methods and to study whether implementation of motion correction would have an impact on the perfusion results. We developed a motion detection procedure using external radioactive skin markers and frame-to-frame alignment. To evaluate motion, marker coordinates inside the field of view were determined in each frame for each study. The highest number of frames with identical spatial coordinates during the study were defined as ''non-moved''. Movement was considered present if even one marker changed position, by one pixel/frame compared with reference, in one axis, and such frames were defined as ''moved''. We tested manual, in-house-developed motion correction software and an automatic motion correction using a rigid body point model implemented in MIPAV (Medical Image Processing, Analysis and Visualisation) software. After motion correction, remaining motion was re-analysed. Myocardial blood flow (MBF) values were calculated for both non-corrected and motion-corrected datasets. At rest, patient motion was found in 18% of the frames, but during pharmacological stress the fraction increased to 45% and during physical exercise it rose to 80%. Both motion correction algorithms significantly decreased (p<0.006) the number of moved frames and the amplitude of motion (p<0.04). Motion correction significantly increased MBF results during bicycle exercise (p<0.02). At rest or during adenosine infusion, the motion correction had no significant effects on MBF values. Significant motion is a common phenomenon in dynamic cardiac studies during adenosine infusion but especially during exercise. Applying motion correction for the data acquired during exercise clearly changed the MBF results, indicating that motion

  3. Communication: Isotopic effects on tunneling motions in the water trimer

    International Nuclear Information System (INIS)

    Videla, Pablo E.; Rossky, Peter J.; Laria, D.

    2016-01-01

    We present results of ring polymer molecular dynamics simulations that shed light on the effects of nuclear quantum fluctuations on tunneling motions in cyclic [H 2 O] 3 and [D 2 O] 3 , at the representative temperature of T = 75 K. In particular, we focus attention on free energies associated with two key isomerization processes: The first one corresponds to flipping transitions of dangling OH bonds, between up and down positions with respect to the O–O–O plane of the cluster; the second involves the interchange between connecting and dangling hydrogen bond character of the H-atoms in a tagged water molecule. Zero point energy and tunneling effects lead to sensible reductions of the free energy barriers. Due to the lighter nature of the H nuclei, these modifications are more marked in [H 2 O] 3 than in [D 2 O] 3 . Estimates of the characteristic time scales describing the flipping transitions are consistent with those predicted based on standard transition-state-approximation arguments

  4. Communication: Isotopic effects on tunneling motions in the water trimer

    Energy Technology Data Exchange (ETDEWEB)

    Videla, Pablo E. [Departamento de Química Inorgánica Analítica y Química-Física e INQUIMAE, Facultad de Ciencias Exactas y Naturales, Universidad de Buenos Aires, Ciudad Universitaria, Pabellón II, 1428 Buenos Aires (Argentina); Rossky, Peter J. [Department of Chemistry, Rice University, Houston, Texas 77251-1892 (United States); Laria, D., E-mail: dhlaria@cnea.gov.ar [Departamento de Química Inorgánica Analítica y Química-Física e INQUIMAE, Facultad de Ciencias Exactas y Naturales, Universidad de Buenos Aires, Ciudad Universitaria, Pabellón II, 1428 Buenos Aires (Argentina); Departamento de Física de la Materia Condensada, Comisión Nacional de Energía Atómica, Avenida Libertador 8250, 1429 Buenos Aires (Argentina)

    2016-02-14

    We present results of ring polymer molecular dynamics simulations that shed light on the effects of nuclear quantum fluctuations on tunneling motions in cyclic [H{sub 2}O]{sub 3} and [D{sub 2}O]{sub 3}, at the representative temperature of T = 75 K. In particular, we focus attention on free energies associated with two key isomerization processes: The first one corresponds to flipping transitions of dangling OH bonds, between up and down positions with respect to the O–O–O plane of the cluster; the second involves the interchange between connecting and dangling hydrogen bond character of the H-atoms in a tagged water molecule. Zero point energy and tunneling effects lead to sensible reductions of the free energy barriers. Due to the lighter nature of the H nuclei, these modifications are more marked in [H{sub 2}O]{sub 3} than in [D{sub 2}O]{sub 3}. Estimates of the characteristic time scales describing the flipping transitions are consistent with those predicted based on standard transition-state-approximation arguments.

  5. The sequence of sediment behaviour during wave-induced liquefaction

    DEFF Research Database (Denmark)

    Sumer, B. Mutlu; Hatipoglu, Figen; Fredsøe, Jørgen

    2006-01-01

    to be in agreement with recent centrifuge wave-tank experiments. As for the final stage of the sequence of processes (formation of ripples), the ripple steepness (normalized with the angle of repose) for sediment with liquefaction history is found to be the same as that in sediment with no liquefaction history.......This paper presents the results of an experimental investigation of the complete sequence of sediment behaviour beneath progressive waves. The sediment was silty with d(50) = 0.060 mm. Two kinds of measurements were carried out: pore-water pressure measurements (across the sediment depth...... of liquefaction and compaction fronts in the sediment and (iii) the characteristics of the orbital motion of the liquefied sediment including the motion of the interface between the water body and the sediment. The ranges of the various quantities in the tests were: wave height, H = 9-17 cm, wave period, T = 1...

  6. Wetting and motion behaviors of water droplet on graphene under thermal-electric coupling field

    Science.gov (United States)

    Zhang, Zhong-Qiang; Dong, Xin; Ye, Hong-Fei; Cheng, Guang-Gui; Ding, Jian-Ning; Ling, Zhi-Yong

    2015-02-01

    Wetting dynamics and motion behaviors of a water droplet on graphene are characterized under the electric-thermal coupling field using classical molecular dynamics simulation method. The water droplet on graphene can be driven by the temperature gradient, while the moving direction is dependent on the electric field intensity. Concretely, the water droplet on graphene moves from the low temperature region to the high temperature region for the relatively weak electric field intensity. The motion acceleration increases with the electric field intensity on graphene, whereas the moving direction switches when the electric field intensity increases up to a threshold. The essence is the change from hydrophilic to hydrophobic for the water droplet on graphene at a threshold of the electric field intensity. Moreover, the driven force of the water droplet caused by the overall oscillation of graphene has important influence on the motion behaviors. The results are helpful to control the wettability of graphene and further develop the graphene-based fluidic nanodevices.

  7. Wave Induced Loading and Stability of Rubble Mound Breakwaters

    DEFF Research Database (Denmark)

    Hald, Tue

    conducting model tests very large variability in e.g. the degree of stability is observed. This background motivated the investigations conducted in the present study. The objective was to investigate and clarify which wave parameters are important for the hydraulic stability of the armour layer on typical...... rubble mound breakwaters. Furthermore, it was intended to quantify the influence on the stability of each parameter. Focus was put on the wave induced loading on single armour stones and the relation to the stability. Based on existing literature the state of physical understanding of the processes...... and the stability were investigated. At Aalborg University model tests with an idealized model of a rubble mound breakwater were conducted and formed the basis for a detailed parametric investigation of the wave induced loading. Based on analyses of the experimental data wave-force models were derived containing...

  8. Wave Induced Loads on the LEANCON Wave Energy Converter

    DEFF Research Database (Denmark)

    Frigaard, Peter; Kofoed, Jens Peter; Beserra, Eliab Ricarte

    This report is a product of the co-operation agreement between Aalborg University and LEANCON (by Kurt Due Rasmussen) on the evaluation and development of the LEANCON wave energy converter (WEC). The work reported here has focused on evaluation of the wave induced loads on the device, based...... in the laboratory, all under the supervision of the personnel of the Wave Energy Research Group at Department of Civil Engineering, Aalborg University....

  9. Water uptake and motion in highly densified bentonite

    International Nuclear Information System (INIS)

    Kahr, G.; Mueller-Vonmoos, F.; Kraehenbuehl, F.; Stoeckli, H.F.

    1986-07-01

    Water uptake by the bentonites MX-80 and Montigel was investigated according to the classical method of determination of the heat immersion and the adsorption-desorption isotherms. In addition, the layer expansion of the montmorillonite was measured as a function of the water content. The evaluation of the adsorption isotherms according to Dubinin-Radushkevich and the stratification distances determined by x-ray confirmed gradual water uptake. Up to 10% water content, the water is adsorbed as a monolayer, up to 20%, as a bimolecular layer around the interlayer cations. The partial specific entropy could be determined from the approximative calculation of the partial specific enthalpy from the heats of immersion and the free enthalpy from the adsorption isotherms. From this it is evident that the interlayer water shows a high degree of order. In this condition, the mobility of the water molecules is considerably lower than in free water. From the adsorption isotherm and the layer expansion observed, it can be assumed that water can appear in the pore space only from approximately 25% water content. The spaces outwith the interlayer space and the surfaces of the montmorillonite particles are considered as pore space. If free swelling is prevented and with dry densities greater than 1.8 Mg/m/sup 3/ for the highly compacted bentonites, water uptake causes a drastic reduction of the original pore space so that practically all the water is in the interlayer space. Calculation of the swelling pressure from the adsorption isotherms gives a good approximation of the measured swelling pressures. A montmorillonite surface of ca. 750 m/sup 2//g for both bentonites can be derived from a Dubinin-Radushkevich analysis of the adsorption isotherm. Water uptake into the compacted unsaturated bentonites can be described as diffusion with a diffusion coefficient of the order of magnitude of 3.10/sup -10/ m/sup 2//s. (author)

  10. Wave-induced current considering wave-tide interaction in Haeundae

    Science.gov (United States)

    Lim, Hak Soo

    2017-04-01

    The Haeundae, located at the south eastern end of the Korean Peninsula, is a famous beach, which has an approximately 1.6 km long and 70 m wide coastline. The beach has been repeatedly eroded by the swell waves caused by typhoons in summer and high waves originating in the East Sea in winter. The Korean government conducted beach restoration projects including beach nourishment (620,000 m3) and construction of two submerged breakwaters near both ends of the beach. To prevent the beach erosion and to support the beach restoration project, the Korean government initiated a R&D project, the development of coastal erosion control technology since 2013. As a part of the project, we have been measuring waves and currents at a water depth of 22 m, 1.8 km away from the beach using an acoustic wave and current meter (AWAC) continuously for more than three years; we have also measured waves and currents intensively near the surf-zone in summer and winter. In this study, a numerical simulation using a wave and current coupled model (ROMS-SWAN) was conducted for determining the wave-induced current considering seasonal swell waves (Hs : 2.5 m, Tp: 12 s) and for better understanding of the coastal process near the surf-zone in Haeundae. By comparing the measured and simulated results, we found that cross-shore current during summer is mainly caused by the eddy produced by the wave-induced current near the beach, which in turn, is generated by the strong waves coming from the SSW and S directions. During other seasons, longshore wave-induced current is produced by the swell waves coming from the E and ESE directions. The longshore current heading west toward Dong-Back Island, west end of the beach, during all the seasons and eddy current toward Mipo-Port, east end of the beach, in summer which is well matched with the observed residual current. The wave-induced current with long-term measurement data is incorporated in simulation of sediment transport modeling for developing

  11. The effect of the earth's rotation on ground water motion.

    Science.gov (United States)

    Loáiciga, Hugo A

    2007-01-01

    The average pore velocity of ground water according to Darcy's law is a function of the fluid pressure gradient and the gravitational force (per unit volume of ground water) and of aquifer properties. There is also an acceleration exerted on ground water that arises from the Earth's rotation. The magnitude and direction of this rotation-induced force are determined in exact mathematical form in this article. It is calculated that the gravitational force is at least 300 times larger than the largest rotation-induced force anywhere on Earth, the latter force being maximal along the equator and approximately equal to 34 N/m(3) there. This compares with a gravitational force of approximately 10(4) N/m(3).

  12. Water droplets' internal fluidity during horizontal motion on a superhydrophobic surface with an external electric field.

    Science.gov (United States)

    Sakai, Munetoshi; Kono, Hiroki; Nakajima, Akira; Sakai, Hideki; Abe, Masahiko; Fujishima, Akira

    2010-02-02

    On a superhydrophobic surface, the internal fluidity of water droplets with different volumes (15, 30 microL) and their horizontal motion in an external electric field were evaluated using particle image velocimetry (PIV). For driving of water droplets on a superhydrophobic coating between parallel electrodes, it was important to place them at appropriate positions. Droplets moved with slipping. Small droplets showed deformation that is more remarkable. Results show that the dielectrophoretic force induced the initial droplet motion and that the surface potential gradient drove the droplets after reaching the middle point between electrodes.

  13. Hydrophobic Collapse of Ubiquitin Generates Rapid Protein-Water Motions.

    Science.gov (United States)

    Wirtz, Hanna; Schäfer, Sarah; Hoberg, Claudius; Reid, Korey M; Leitner, David M; Havenith, Martina

    2018-06-04

    We report time-resolved measurements of the coupled protein-water modes of solvated ubiquitin during protein folding. Kinetic terahertz absorption (KITA) spectroscopy serves as a label-free technique for monitoring large scale conformational changes and folding of proteins subsequent to a sudden T-jump. We report here KITA measurements at an unprecedented time resolution of 500 ns, a resolution 2 orders of magnitude better than those of any previous KITA measurements, which reveal the coupled ubiquitin-solvent dynamics even in the initial phase of hydrophobic collapse. Complementary equilibrium experiments and molecular simulations of ubiquitin solutions are performed to clarify non-equilibrium contributions and reveal the molecular picture upon a change in structure, respectively. On the basis of our results, we propose that in the case of ubiquitin a rapid (<500 ns) initial phase of the hydrophobic collapse from the elongated protein to a molten globule structure precedes secondary structure formation. We find that these very first steps, including large-amplitude changes within the unfolded manifold, are accompanied by a rapid (<500 ns) pronounced change of the coupled protein-solvent response. The KITA response upon secondary structure formation exhibits an opposite sign, which indicates a distinct effect on the solvent-exposed surface.

  14. Experimental investigation of single small bubble motion in linear shear flow in water

    International Nuclear Information System (INIS)

    Li, Zhongchun; Zhao, Yang; Song, Xiaoming; Yu, Hongxing; Jiang, Shengyao; Ishii, Mamoru

    2016-01-01

    Highlights: • The bubble motion in simple linear shear flow was experimentally investigated. • The bubble trajectories, bubble velocity and drag and lift force were obtained using image process routine. • The bubble trajectory was coupled with a zigzag motion and incline path. • The lift force was kept negative and it decreased when bubble diameter and shear flow magnitude increased. - Abstract: The motion of small bubble in a simple shear flow in water was experimental studied. Stable shear flow with low turbulence level was achieved with curved screen and measured using LDV. The bubbles were captured by high speed camera and the captured images were processed with digital image routine. The bubble was released from a capillary tube. The instantaneous bubble position, bubble velocity and forces were obtained based on the captured parameters. The quasi-steady lift coefficient was determined by the linear fitting of the bubble trajectory of several cycles. The results indicated that the lateral migration was coupled with the zigzag motion of bubble in the present experiment. The bubble migrated to the left side and its quasi-steady lift coefficient was negative. Good repeatable results were observed by measurements of 18 bubbles. The bubble motion in shear flow in water was first experimental studied and negative lift force was observed in the present study condition. The lift coefficient decreased when shear stress magnitude or bubble diameter increased in the present experiment condition.

  15. Forced wave induced by an atmospheric pressure disturbance moving towards shore

    Science.gov (United States)

    Chen, Yixiang; Niu, Xiaojing

    2018-05-01

    Atmospheric pressure disturbances moving over a vast expanse of water can induce different wave patterns, which can be determined by the Froude number Fr. Generally, Fr = 1 is a critical value for the transformation of the wave pattern and the well-known Proudman resonance happens when Fr = 1. In this study, the forced wave induced by an atmospheric pressure disturbance moving over a constant slope from deep sea to shore is numerically investigated. The wave pattern evolves from a concentric-circle type into a triangular type with the increase of the Froude number, as the local water depth decreases, which is in accord with the analysis in the unbounded flat-bottom cases. However, a hysteresis effect has been observed, which implies the obvious amplification of the forced wave induced by a pressure disturbance can not be simply predicted by Fr = 1. The effects of the characteristic parameters of pressure disturbances and slope gradient have been discussed. The results show that it is not always possible to observe significant peak of the maximum water elevation before the landing of pressure disturbances, and a significant peak can be generated by a pressure disturbance with small spatial scale and fast moving velocity over a milder slope. Besides, an extremely high run-up occurs when the forced wave hits the shore, which is an essential threat to coastal security. The results also show that the maximum run-up is not monotonously varying with the increase of disturbance moving speed and spatial scale. There exists a most dangerous speed and scale which may cause disastrous nearshore surge.

  16. Understanding the Origins of Dipolar Couplings and Correlated Motion in the Vibrational Spectrum of Water.

    Science.gov (United States)

    Heyden, Matthias; Sun, Jian; Forbert, Harald; Mathias, Gerald; Havenith, Martina; Marx, Dominik

    2012-08-16

    The combination of vibrational spectroscopy and molecular dynamics simulations provides a powerful tool to obtain insights into the molecular details of water structure and dynamics in the bulk and in aqueous solutions. Applying newly developed approaches to analyze correlations of charge currents, molecular dipole fluctuations, and vibrational motion in real and k-space, we compare results from nonpolarizable water models, widely used in biomolecular modeling, to ab initio molecular dynamics. For the first time, we unfold the infrared response of bulk water into contributions from correlated fluctuations in the three-dimensional, anisotropic environment of an average water molecule, from the OH-stretching region down to the THz regime. Our findings show that the absence of electronic polarizability in the force field model not only results in differences in dipolar couplings and infrared absorption but also induces artifacts into the correlated vibrational motion between hydrogen-bonded water molecules, specifically at the intramolecular bending frequency. Consequently, vibrational motion is partially ill-described with implications for the accuracy of non-self-consistent, a posteriori methods to add polarizability.

  17. Vertical motion and elastic light-scattering of a laser-levitated water droplet

    International Nuclear Information System (INIS)

    Chan, C. W.; Lee, W. K.

    2001-01-01

    We report the vertical motion and elastic scattered light of a single laser-levitated water microdroplet as it slowly evaporated. The vertical displacement as a function of time exhibited peaks of a variety of widths. Morphology-dependent resonances (MDRs) that induced the displacement peaks were identified. We found that the Stokes equation is adequate to describe the vertical motions driven by broad MDRs. For motions driven by relatively narrow MDRs, significant deviations from results predicted by the Stokes equation were found. The elastic scattered light intensity as a function of the size of the droplet showed sudden increases attributable to deformations of the droplet as its size parameter scanned through narrow MDRs. Copyright 2001 Optical Society of America

  18. Molecular dynamics simulation of nonlinear spectroscopies of intermolecular motions in liquid water.

    Science.gov (United States)

    Yagasaki, Takuma; Saito, Shinji

    2009-09-15

    Water is the most extensively studied of liquids because of both its ubiquity and its anomalous thermodynamic and dynamic properties. The properties of water are dominated by hydrogen bonds and hydrogen bond network rearrangements. Fundamental information on the dynamics of liquid water has been provided by linear infrared (IR), Raman, and neutron-scattering experiments; molecular dynamics simulations have also provided insights. Recently developed higher-order nonlinear spectroscopies open new windows into the study of the hydrogen bond dynamics of liquid water. For example, the vibrational lifetimes of stretches and a bend, intramolecular features of water dynamics, can be accurately measured and are found to be on the femtosecond time scale at room temperature. Higher-order nonlinear spectroscopy is expressed by a multitime correlation function, whereas traditional linear spectroscopy is given by a one-time correlation function. Thus, nonlinear spectroscopy yields more detailed information on the dynamics of condensed media than linear spectroscopy. In this Account, we describe the theoretical background and methods for calculating higher order nonlinear spectroscopy; equilibrium and nonequilibrium molecular dynamics simulations, and a combination of both, are used. We also present the intermolecular dynamics of liquid water revealed by fifth-order two-dimensional (2D) Raman spectroscopy and third-order IR spectroscopy. 2D Raman spectroscopy is sensitive to couplings between modes; the calculated 2D Raman signal of liquid water shows large anharmonicity in the translational motion and strong coupling between the translational and librational motions. Third-order IR spectroscopy makes it possible to examine the time-dependent couplings. The 2D IR spectra and three-pulse photon echo peak shift show the fast frequency modulation of the librational motion. A significant effect of the translational motion on the fast frequency modulation of the librational motion is

  19. Particle transport model sensitivity on wave-induced processes

    Science.gov (United States)

    Staneva, Joanna; Ricker, Marcel; Krüger, Oliver; Breivik, Oyvind; Stanev, Emil; Schrum, Corinna

    2017-04-01

    Different effects of wind waves on the hydrodynamics in the North Sea are investigated using a coupled wave (WAM) and circulation (NEMO) model system. The terms accounting for the wave-current interaction are: the Stokes-Coriolis force, the sea-state dependent momentum and energy flux. The role of the different Stokes drift parameterizations is investigated using a particle-drift model. Those particles can be considered as simple representations of either oil fractions, or fish larvae. In the ocean circulation models the momentum flux from the atmosphere, which is related to the wind speed, is passed directly to the ocean and this is controlled by the drag coefficient. However, in the real ocean, the waves play also the role of a reservoir for momentum and energy because different amounts of the momentum flux from the atmosphere is taken up by the waves. In the coupled model system the momentum transferred into the ocean model is estimated as the fraction of the total flux that goes directly to the currents plus the momentum lost from wave dissipation. Additionally, we demonstrate that the wave-induced Stokes-Coriolis force leads to a deflection of the current. During the extreme events the Stokes velocity is comparable in magnitude to the current velocity. The resulting wave-induced drift is crucial for the transport of particles in the upper ocean. The performed sensitivity analyses demonstrate that the model skill depends on the chosen processes. The results are validated using surface drifters, ADCP, HF radar data and other in-situ measurements in different regions of the North Sea with a focus on the coastal areas. The using of a coupled model system reveals that the newly introduced wave effects are important for the drift-model performance, especially during extremes. Those effects cannot be neglected by search and rescue, oil-spill, transport of biological material, or larva drift modelling.

  20. Effect of a transverse plasma jet on a shock wave induced by a ramp

    Directory of Open Access Journals (Sweden)

    Hongyu WANG

    2017-12-01

    Full Text Available We conducted experiments in a wind tunnel with Mach number 2 to explore the evolution of a transverse plasma jet and its modification effect on a shock wave induced by a ramp with an angle of 24°. The transverse plasma jet was created by arc discharge in a small cylindrical cavity with a 2 mm diameter orifice. Three group tests with different actuator arrangements in the spanwise or streamwise direction upstream from the ramp were respectively studied to compare their disturbances to the shock wave. As shown by a time-resolved schlieren system, an unsteady motion of the shock wave by actuation was found: the shock wave was significantly modified by the plasma jet with an upstream motion and a reduced angle. Compared to spanwise actuation, a more intensive impact was obtained with two or three streamwise actuators working together. From shock wave structures, the control effect of the plasma jet on the shock motion based on a thermal effect, a potential cause of shock modification, was discussed. Furthermore, we performed a numerical simulation by using the Improved Delayed Detached Eddy Simulation (IDDES method to simulate the evolution of the transverse plasma jet plume produced by two streamwise actuators. The results show that flow structures are similar to those identified in schlieren images. Two streamwise vortices were recognized, which indicates that the higher jet plume is the result of the overlap of two streamwise jets. Keywords: Flow control, Improved delayed detached eddy simulation (IDDES method, Plasma synthetic jet, Shock wave/boundary layer interaction, Time resolved schlieren system

  1. Sloshing of water in annular pressure-suppression pool of boiling water reactors under earthquake ground motions

    International Nuclear Information System (INIS)

    Aslam, M.; Godden, W.G.; Scalise, D.T.

    1979-10-01

    This report presents an analytical investigation of the sloshing response of water in annular-circular as well as simple-circular tanks under horizontal earthquake ground motions, and the results are verified with tests. This study was motivated because of the use of annular tanks for pressure-suppression pools in Boiling Water Reactors. Such a pressure-suppression pool would typically have 80 ft and 120 ft inside and outside diameters and a water depth of 20 ft. The analysis was based upon potential flow theory and a computer program was written to obtain time-history plots of sloshing displacements of water and the dynamic pressures. Tests were carried out on 1/80th and 1/15th scale models under sinusoidal as well as simulated earthquake ground motions. Tests and analytical results regarding the natural frequencies, surface water displacements, and dynamic pressures were compared and a good agreement was found for relatively small displacements. The computer program gave satisfactory results as long as the maximum water surface displacements were less than 30 in., which is roughly the value obtained under full intensity of El Centro earthquake

  2. Determination of capillary motion of water in bricks using neutron radiography

    International Nuclear Information System (INIS)

    Czachor, A.; Abd El-Ghany El-Abd; Milczarek, J.J.

    2002-01-01

    Vertical migration of water in several porous materials has been directly observed and recorded with the recently installed neutron and gamma radiography facility at Maria reactor of Institute of Atomic Energy, Swierk. The density profiles of water in samples were obtained from the optical density of digitalised images. A simple model (representing the porous material as a collection of capillary tubes of various radii) has been introduced to describe the liquid transport in porous materials in terms of capillary motion. The equation for viscous movement of water in porous material in presence of the gravitation is proposed. A good agreement of the calculated density profiles for vertical water migration with the data collected for siliceous bricks suggests that the thinnest capillary tubes determine the upper edge of the water density profile. (author)

  3. Sloshing of water in torus pressure-suppression pool of boiling water reactors under earthquake ground motions

    International Nuclear Information System (INIS)

    Aslam, M.; Godden, W.G.; Scalise, D.T.

    1978-08-01

    This report presents an analytical and experimental investigation into the sloshing of water in torus tanks under horizontal earthquake ground motions. This study was motivated because of the use of torus tanks for pressure-suppression pools in Boiling Water Reactors. Such a pressure-suppression pool would typically have 80 ft and 140 ft inside and outside diameters, a 30 ft diameter section, and a water depth of 15 ft. A general finite element analysis was developed for all axisymmetric tanks and a computer program was written to obtain time-history plots of sloshing displacements of water and dynamic pressures. Tests were carried out on a 1/60th scale model under sinusoidal as well as simulated earthquake ground motions. Tests and analytical results regarding natural frequencies, surface water displacements, and dynamic pressures were compared and a good agreement was found within the range of displacements studied. The computer program gave satisfactory results within a maximum range of sloshing displacements in the full-size prototype of 30 in. which is greater than the value obtained under the full intensity of the El Centro earthquake (N-S component 1940). The range of linear behavior was studied experimentally by subjecting the torus model to increasing intensities of the El Centro earthquake

  4. Contact angle hysteresis and motion behaviors of a water nano-droplet on suspended graphene under temperature gradient

    Science.gov (United States)

    Foroutan, Masumeh; Fatemi, S. Mahmood; Esmaeilian, Farshad; Fadaei Naeini, Vahid; Baniassadi, Majid

    2018-05-01

    In the present work, the effect of temperature gradient on the behavior of a water nano-droplet resting on a suspended graphene was studied based on a non-equilibrium molecular dynamics simulation. The acquired results indicate that the applied temperature gradient to the suspended graphene drives the water nano-droplet to the colder region. The droplet accelerates its motion toward the cold reservoir as the temperature gradient is increased. In addition to the translational motion of the nano-droplet, the vortical motion of the water molecules was also observed. Contact angle analysis was also utilized to describe the directional motion of the nano-droplet. The translational motion of the droplet leads to the estimation of contact angle hysteresis through advancing and receding contact angles while the rotational motion resulted in the advancing and receding fronts being switched with one another through the simulation. The average displacement vector of the water molecules shows that parts of the droplet seem to stagnate while other parts rotate around them. The reason behind this particular behavior was studied based on interaction energy contours between a water molecule and the suspended graphene. The obtained data indicate that the rotational motion is in agreement with the migration of the water molecules to low interaction energy regions in order to avoid high interaction energy areas.

  5. Visualization of the collective vortex-like motions in liquid argon and water: Molecular dynamics simulation

    Science.gov (United States)

    Anikeenko, A. V.; Malenkov, G. G.; Naberukhin, Yu. I.

    2018-03-01

    We propose a new measure of collectivity of molecular motion in the liquid: the average vector of displacement of the particles, ⟨ΔR⟩, which initially have been localized within a sphere of radius Rsph and then have executed the diffusive motion during a time interval Δt. The more correlated the motion of the particles is, the longer will be the vector ⟨ΔR⟩. We visualize the picture of collective motions in molecular dynamics (MD) models of liquids by constructing the ⟨ΔR⟩ vectors and pinning them to the sites of the uniform grid which divides each of the edges of the model box into equal parts. MD models of liquid argon and water have been studied by this method. Qualitatively, the patterns of ⟨ΔR⟩ vectors are similar for these two liquids but differ in minor details. The most important result of our research is the revealing of the aggregates of ⟨ΔR⟩ vectors which have the form of extended flows which sometimes look like the parts of vortices. These vortex-like clusters of ⟨ΔR⟩ vectors have the mesoscopic size (of the order of 10 nm) and persist for tens of picoseconds. Dependence of the ⟨ΔR⟩ vector field on parameters Rsph, Δt, and on the model size has been investigated. This field in the models of liquids differs essentially from that in a random-walk model.

  6. Theoretical and experimental investigation into structural and fluid motions at low frequencies in water distribution pipes

    Science.gov (United States)

    Gao, Yan; Liu, Yuyou

    2017-06-01

    Vibrational energy is transmitted in buried fluid-filled pipes in a variety of wave types. Axisymmetric (n = 0) waves are of practical interest in the application of acoustic techniques for the detection of leaks in underground pipelines. At low frequencies n = 0 waves propagate longitudinally as fluid-dominated (s = 1) and shell-dominated (s = 2) waves. Whilst sensors such as hydrophones and accelerometers are commonly used to detect leaks in water distribution pipes, the mechanism governing the structural and fluid motions is not well documented. In this paper, the low-frequency behaviour of the pipe wall and the contained fluid is investigated. For most practical pipework systems, these two waves are strongly coupled; in this circumstance the ratios of the radial pipe wall displacements along with the internal pressures associated with these two wave types are obtained. Numerical examples show the relative insensitivity of the structural and fluid motions to the s = 2 wave for both metallic and plastic pipes buried in two typical soils. It is also demonstrated that although both acoustic and vibration sensors at the same location provide the identical phase information of the transmitted signals, pressure responses have significantly higher levels than acceleration responses, and thus hydrophones are better suited in a low signal-to-noise ratio (SNR) environment. This is supported by experimental work carried out at a leak detection facility. Additional pressure measurements involved excitation of the fluid and the pipe fitting (hydrant) on a dedicated water pipe. This work demonstrates that the s = 1 wave is mainly responsible for the structural and fluid motions at low frequencies in water distribution pipes as a result of water leakage and direct pipe excitation.

  7. A Fast Algorithm to Simulate Droplet Motions in Oil/Water Two Phase Flow

    KAUST Repository

    Zhang, Tao

    2017-06-09

    To improve the research methods in petroleum industry, we develop a fast algorithm to simulate droplet motions in oil and water two phase flow, using phase field model to describe the phase distribution in the flow process. An efficient partial difference equation solver—Shift-Matrix method is applied here, to speed up the calculation coding in high-level language, i.e. Matlab and R. An analytical solution of order parameter is derived, to define the initial condition of phase distribution. The upwind scheme is applied in our algorithm, to make it energy decay stable, which results in the fast speed of calculation. To make it more clear and understandable, we provide the specific code for forming the coefficient matrix used in Shift-Matrix Method. Our algorithm is compared with other methods in different scales, including Front Tracking and VOSET method in macroscopic and LBM method using RK model in mesoscopic scale. In addition, we compare the result of droplet motion under gravity using our algorithm with the empirical formula common used in industry. The result proves the high efficiency and robustness of our algorithm and it’s then used to simulate the motions of multiple droplets under gravity and cross-direction forces, which is more practical in industry and can be extended to wider application.

  8. Water motion and movement without sticking, weight loss and cross-contaminant in superhydrophobic glass tube.

    Science.gov (United States)

    Yuan, Jian-Jun; Jin, Ren-Hua

    2010-02-10

    We report that a simple fabrication of a superhydrophobic nanosurface consisted of a grass-like silica thin film on the inner wall of a glass tube and its feature in water motion and water movement. The glass tube with a superhydrophobic inner wall can make the water flow with friction-drag reduction and completely preventing water sticking. Transferring water by this tube did not cause weight loss at all. Therefore, aqueous solutions containing high content metal ions were cross-moved without washing the tube used and no cross-contamination occurred after cross-movement. Furthermore, in an inside diameter of 6.0 mm glass tube where the half-length of the inner surface is covered by superhydrophobic nanograss and the other half is an unmodified hydrophilic surface, the water droplets flowing down from the hydrophilic side can be stopped spontaneously at the hydrophilic-superhydrophobic boundary as if there is an invisible flow-stopping fence built inside the glass tube.

  9. Wave-induced nearshore circulation along the Calangute-Candolim beach, Goa, West coast of India

    Digital Repository Service at National Institute of Oceanography (India)

    Krishnakumar, V.; Murty, C.S.; Heblekar, A.K.

    The wave-induced nearshore circulation model suggested by Noda has been modified and applied for three small segments along the coast of Goa. The present model incorporates the prevailing bottom topography and considers its variation along...

  10. Variations of helicon wave induced radial plasma transport in different experimental conditions

    International Nuclear Information System (INIS)

    Petrzilka, V.

    1993-08-01

    Variations of the helicon wave induced radial plasma transport are presented in dependence on values of the plasma radius, magnetostatic field, plasma density, frequency of the helicon wave and on the ion charge. 22 refs., 14 figs

  11. MERLIN observations of water maser proper motions in VY Canis Majoris

    Science.gov (United States)

    Richards, A. M. S.; Yates, J. A.; Cohen, R. J.

    1998-09-01

    MERLIN observations of the 22-GHz water masers in the circumstellar envelope of the supergiant VY CMa show an ellipsoidal distribution with a maximum extent of 700 mas east-west and 400 mas north-south. Comparison with observations made nine years earlier shows that the majority of maser features have survived and show proper motions throughout the region. The mean change in position is 28 mas and the proper motions are generally directed away from the assumed stellar position, and tend to be larger for features at greater projected distances. If the H_2O maser region is modelled as a partially filled thick spherical shell, and VY CMa is at a distance of 1.5 kpc, then the proper motion velocities in the direction of expansion are between 8kms^-1 at a distance of 75 mas from the assumed stellar position and 32kms^-1 at 360 mas. These velocities are consistent with the H_2O maser spectral line velocities which correspond to a maximum expansion velocity of 36kms^-1 at 400 mas from the assumed stellar position. These observations are consistent with radiation pressure on dust providing the force to accelerate the stellar wind as it passes through the H_2O maser shell. The H_2O maser region is elongated in the same direction as the dusty nebula around VY CMa. The water masers illuminate the small-scale dynamics and clumpiness which show the role of dust in driving the outflow. The overall ellipsoidal shape may be due to properties of the dust, such as its behaviour in the stellar magnetic field, or to interaction between the wind and circumstellar material. Maser monitoring also shows the difference between changes on the time-scale of stellar variability (a few years) and possible stages in the evolution of VY CMa to its likely fate as a supernova.

  12. Altered Gravity Simulated by Parabolic Flight and Water Immersion Leads to Decreased Trunk Motion.

    Directory of Open Access Journals (Sweden)

    Peiliang Wang

    Full Text Available Gravity is one of the important environmental factors that influence the physiologies and behaviors of animals and humans, and changes in gravity elicit a variety of physiological and behavioral alterations that include impaired movement coordination, vertigo, spatial disorientation, and perceptual illusions. To elucidate the effects of gravity on human physiology and behavior, we examined changes in wrist and trunk activities and heart rate during parabolic flight and the activity of wrist and trunk in water immersion experiments. Data from 195 person-time parabolas performed by eight subjects revealed that the trunk motion counts decreased by approximately half during ascending legs (hypergravity, relative to the data acquired before the parabolic flights. In contrast, the wrist activity remained unchanged. The results from the water immersion experiments demonstrated that in the underwater condition, both the wrist and trunk activities were significantly decreased but the latter decreased to a much lower level. Together, these data suggest that gravitational alterations can result in differential influences on the motions of the wrist and the trunk. These findings might be important for understanding the degeneration of skeleton and muscular system and performance of astronauts in microgravity.

  13. Altered Gravity Simulated by Parabolic Flight and Water Immersion Leads to Decreased Trunk Motion

    Science.gov (United States)

    Tian, Yu; Li, Fan; Zhang, Shaoyao; Zhang, Lin; Guo, Yaoyu; Liu, Weibo; Wang, Chunhui; Chen, Shanguang; Guo, Jinhu

    2015-01-01

    Gravity is one of the important environmental factors that influence the physiologies and behaviors of animals and humans, and changes in gravity elicit a variety of physiological and behavioral alterations that include impaired movement coordination, vertigo, spatial disorientation, and perceptual illusions. To elucidate the effects of gravity on human physiology and behavior, we examined changes in wrist and trunk activities and heart rate during parabolic flight and the activity of wrist and trunk in water immersion experiments. Data from 195 person-time parabolas performed by eight subjects revealed that the trunk motion counts decreased by approximately half during ascending legs (hypergravity), relative to the data acquired before the parabolic flights. In contrast, the wrist activity remained unchanged. The results from the water immersion experiments demonstrated that in the underwater condition, both the wrist and trunk activities were significantly decreased but the latter decreased to a much lower level. Together, these data suggest that gravitational alterations can result in differential influences on the motions of the wrist and the trunk. These findings might be important for understanding the degeneration of skeleton and muscular system and performance of astronauts in microgravity. PMID:26208253

  14. On the Detectability of Acoustic Waves Induced Following Irradiation by a Radiotherapy Linear Accelerator.

    Science.gov (United States)

    Hickling, Susannah; Leger, Pierre; El Naqa, Issam

    2016-02-11

    Irradiating an object with a megavoltage photon beam generated by a clinical radiotherapy linear accelerator (linac) induces acoustic waves through the photoacoustic effect. The detection and characterization of such acoustic waves has potential applications in radiation therapy dosimetry. The purpose of this work was to gain insight into the properties of such acoustic waves by simulating and experimentally detecting them in a well-defined system consisting of a metal block suspended in a water tank. A novel simulation workflow was developed by combining radiotherapy Monte Carlo and acoustic wave transport simulation techniques. Different set-up parameters such as photon beam energy, metal block depth, metal block width, and metal block material were varied, and the simulated and experimental acoustic waveforms showed the same relative amplitude trends and frequency variations for such setup changes. The simulation platform developed in this work can easily be extended to other irradiation situations, and will be an invaluable tool for developing a radiotherapy dosimetry system based on the detection of the acoustic waves induced following linear accelerator irradiation.

  15. Contribution of wave-induced liquefaction in triggering hyperpycnal flows in Yellow River Estuary

    Science.gov (United States)

    Liu, X.; Jia, Y.

    2017-12-01

    Hyperpycnal flows, driven mainly by the gravity of near-bed negatively buoyant layers, are one of the most important processes for moving marine sediment across the earth. The issue of hyperpycnal flows existing in marine environment has drawn increasing scholars' attention since that was observed in situ off the Yellow River estuary in the 1980s. Most researches maintain that hyperpycnal flows in the Yellow River estuary are caused by the high-concentration sediments discharged from the Yellow River into sea, however, other mechanisms have been discounted since the sediment input from the river has been significantly changed due to climate and anthropogenic change. Here we demonstrate that wave-seabed interactions can generate hyperpycnal flows, without river input, by sediment flux convergence above an originally consolidated seabed. Using physical model experiments and multi-sensor field measurements, we characterize the composition-dependent liquefaction properties of the sediment due to wave-induced pore water pressure accumulation. This allows quantification of attenuation of sediment threshold velocity and critical shear stress (predominant variables in transport mechanics) during the liquefaction under waves. Parameterising the wave-seabed interactions in a new concept model shows that high waves propagating over the seabed sediment can act as a scarifier plough remoulding the seabed sediment. This contributes to marine hyperpycnal flows as the sediment is quickly resuspended under accumulating attenuation in strength. Therefore, the development of more integrative numerical models could supply realistic predictions of marine record in response to rising magnitude and frequency of storms.

  16. Angry Birds realized: water balloon launcher for teaching projectile motion with drag

    International Nuclear Information System (INIS)

    Edwards, Boyd F; Sam, David D; Christiansen, Michael A; Booth, William A; Jessup, Leslie O

    2014-01-01

    A simple, collapsible design for a large water balloon slingshot launcher features a fully adjustable initial velocity vector and a balanced launch platform. The design facilitates quantitative explorations of the dependence of the balloon range and time of flight on the initial speed, launch angle, and projectile mass, in an environment where quadratic air drag is important. Presented are theory and experiments that characterize this drag, and theory and experiments that characterize the nonlinear elastic energy and hysteresis of the latex tubing used in the slingshot. The experiments can be carried out with inexpensive and readily available tools and materials. The launcher provides an engaging way to teach projectile motion and elastic energy to students of a wide variety of ages. (paper)

  17. Effects of wave-induced forcing on a circulation model of the North Sea

    Science.gov (United States)

    Staneva, Joanna; Alari, Victor; Breivik, Øyvind; Bidlot, Jean-Raymond; Mogensen, Kristian

    2017-04-01

    The effect of wind waves on water level and currents during two storms in the North Sea is investigated using a high-resolution NEMO model forced with fluxes and fields from a high-resolution wave model. The additional terms accounting for wave-current interaction that are considered in this study are the Stokes-Coriolis force and the sea-state dependent energy and momentum fluxes. The individual and collective role of these processes is quantified and the results are compared with a control run without wave effects as well as against current and water level measurements from coastal stations. We find a better agreement with observations when the circulation model is forced by sea-state dependent fluxes, especially in extreme events. The two extreme events, the storm Christian (25-27 October 2013), and about a month later, the storm Xaver (5-7 December 2013), induce different wave and surge conditions over the North Sea. Including the wave effects in the circulation model for the storm Xaver raises the modelled surge by more than 40 cm compared with the control run in the German Bight area. For the storm Christian, a difference of 20-30 cm in the surge level between the wave-forced and the stand-alone ocean model is found over the whole southern part of the North Sea. Moreover, the modelled vertical velocity profile fits the observations very well when the wave forcing is accounted for. The contribution of wave-induced forcing has been quantified indicating that this represents an important mechanism for improving water level and current predictions.

  18. Motion-based, high-yielding, and fast separation of different charged organics in water.

    Science.gov (United States)

    Xuan, Mingjun; Lin, Xiankun; Shao, Jingxin; Dai, Luru; He, Qiang

    2015-01-12

    We report a self-propelled Janus silica micromotor as a motion-based analytical method for achieving fast target separation of polyelectrolyte microcapsules, enriching different charged organics with low molecular weights in water. The self-propelled Janus silica micromotor catalytically decomposes a hydrogen peroxide fuel and moves along the direction of the catalyst face at a speed of 126.3 μm s(-1) . Biotin-functionalized Janus micromotors can specifically capture and rapidly transport streptavidin-modified polyelectrolyte multilayer capsules, which could effectively enrich and separate different charged organics in water. The interior of the polyelectrolyte multilayer microcapsules were filled with a strong charged polyelectrolyte, and thus a Donnan equilibrium is favorable between the inner solution within the capsules and the bulk solution to entrap oppositely charged organics in water. The integration of these self-propelled Janus silica micromotors and polyelectrolyte multilayer capsules into a lab-on-chip device that enables the separation and analysis of charged organics could be attractive for a diverse range of applications. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  19. Simulation and experimental research on trans-media vehicle water-entry motion characteristics at low speed.

    Science.gov (United States)

    Yang, Jian; Li, Yongli; Feng, Jinfu; Hu, Junhua; Liu, An

    2017-01-01

    The motion characteristics of trans-media vehicles during the water-entry process were explored in this study in an effort to obtain the optimal water-entry condition of the vehicle for developing a novel, single control strategy integrating underwater non-control and in-air control. A water-entry dynamics model is established by combining the water-entry motion characteristics of the vehicle in uncontrolled conditions at low speed with time-varying parameters (e.g. buoyancy, added mass). A water-entry experiment is designed to confirm the effectiveness of the established model. After that, by comparing the experimental results with the simulated results, the model is further modified to more accurately reflect water-entry motion. The change laws of the vehicle's attitude and position during the water-entry process are also obtained by analyzing the simulation of the modified model under different velocity, angle, and angle of attack conditions. The results presented here have guiding significance for the future realization of reaching the stable underwater navigation state of the vehicle after water-entry process.

  20. Simulation and experimental research on trans-media vehicle water-entry motion characteristics at low speed.

    Directory of Open Access Journals (Sweden)

    Jian Yang

    Full Text Available The motion characteristics of trans-media vehicles during the water-entry process were explored in this study in an effort to obtain the optimal water-entry condition of the vehicle for developing a novel, single control strategy integrating underwater non-control and in-air control. A water-entry dynamics model is established by combining the water-entry motion characteristics of the vehicle in uncontrolled conditions at low speed with time-varying parameters (e.g. buoyancy, added mass. A water-entry experiment is designed to confirm the effectiveness of the established model. After that, by comparing the experimental results with the simulated results, the model is further modified to more accurately reflect water-entry motion. The change laws of the vehicle's attitude and position during the water-entry process are also obtained by analyzing the simulation of the modified model under different velocity, angle, and angle of attack conditions. The results presented here have guiding significance for the future realization of reaching the stable underwater navigation state of the vehicle after water-entry process.

  1. Impacts of wave-induced circulation in the surf zone on wave setup

    Science.gov (United States)

    Guérin, Thomas; Bertin, Xavier; Coulombier, Thibault; de Bakker, Anouk

    2018-03-01

    Wave setup corresponds to the increase in mean water level along the coast associated with the breaking of short-waves and is of key importance for coastal dynamics, as it contributes to storm surges and the generation of undertows. Although overall well explained by the divergence of the momentum flux associated with short waves in the surf zone, several studies reported substantial underestimations along the coastline. This paper investigates the impacts of the wave-induced circulation that takes place in the surf zone on wave setup, based on the analysis of 3D modelling results. A 3D phase-averaged modelling system using a vortex force formalism is applied to hindcast an unpublished field experiment, carried out at a dissipative beach under moderate to very energetic wave conditions (Hm 0 = 6m at breaking and Tp = 22s). When using an adaptive wave breaking parameterisation based on the beach slope, model predictions for water levels, short waves and undertows improved by about 30%, with errors reducing to 0.10 m, 0.10 m and 0.09 m/s, respectively. The analysis of model results suggests a very limited impact of the vertical circulation on wave setup at this dissipative beach. When extending this analysis to idealized simulations for different beach slopes ranging from 0.01 to 0.05, it shows that the contribution of the vertical circulation (horizontal and vertical advection and vertical viscosity terms) becomes more and more relevant as the beach slope increases. In contrast, for a given beach slope, the wave height at the breaking point has a limited impact on the relative contribution of the vertical circulation on the wave setup. For a slope of 0.05, the contribution of the terms associated with the vertical circulation accounts for up to 17% (i.e. a 20% increase) of the total setup at the shoreline, which provides a new explanation for the underestimations reported in previously published studies.

  2. The Analysis of Motion Dynamics and Resistance of the Multipurpose Boat Operating in Shallow Water

    Directory of Open Access Journals (Sweden)

    Jan Kulczyk

    2014-09-01

    Full Text Available Polish market of small boats has been developed very dynamically in recent years. Market competition forces the shipyards to build new more efficient hull forms and to cut the cost of production as well. This is why modern computer simulation programs are used more often by naval architects. Another trend is to design more universal ships that may be used by larger number of diversified customers. This paper presents project proposal of multipurpose boat hull form. The boat was design to fulfil the requirements imposed by public services like water police, fire brigades, and border guards. It is supposed to be operated on unexplored floodplains and other type shallow waters. The analysis of boat’s motion was based on computer simulations. The resistance curve was evaluated with two methods: comparison study of model test results of similar ships and CFD methods. The results obtained from Ansys Fluent and FINE/Marine systems were compared in this paper. It was shown that taking into consideration dynamic trim and sinkage has a significant impact on free surface capture and resistance values.

  3. Rotational Spectrum of the Methyl Salicylate-Water Complex: the Missing Conformer and the Tunneling Motions

    Science.gov (United States)

    Ghosh, Supriya; Thomas, Javix; Xu, Yunjie; Jäger, Wolfgang

    2015-06-01

    Methyl salicylate is a naturally occurring organic ester produced by wintergreen and other plants. It is also found in many over-the-counter remedies, such as muscle ache creams. The rotational spectrum of the methyl salicylate monomer was reported previously, where the most stable, dominant conformer was identified. The methyl salicylate-water complex was first studied using fluorescence-detected infrared spectroscopy; only one monohydrate conformer was found in that work. In the present study, we employed both broadband chirped and cavity based Fourier transform microwave spectroscopy to examine the competition between intra- and intermolecular hydrogen-bonding interactions and possible large amplitude motions associated with the methyl group and the water subunit. In contrast to the previous infrared study, two monohydrate conformers were identified, with carbonyl O or hydroxyl O as the hydrogen bond acceptors. Detailed analyses of the observed hyperfine structures will be presented, as well as our efforts to extend the study to larger methyl salicylate hydration clusters. S. Melandri, B. M. Giuliano, A. Maris, L. B. Favero, P. Ottaviani, B. Velino, W. Caminati, J. Phys. Chem. A. 2007, 111, 9076. A. Mitsuzuka, A. Fujii, T. Ebata, N. Mikami, J. Phys. Chem. A 1998, 102, 9779.

  4. Estimation of Ship Long-term Wave-induced Bending Moment using Closed-Form Expressions

    DEFF Research Database (Denmark)

    Jensen, Jørgen Juncher; Mansour, A. E.

    2002-01-01

    A semi-analytical approach is used to derive frequency response functions and standard deviations for the wave-induced bending moment amidships for mono-hull ships. The results are given as closed-form expressions and the required input information for the procedure is restricted to the main......-empirical closed-form expression for the skewness. The effect of whipping is included by assuming that whipping and wave-induced responses are conditionally independent given Hs. The procedure is simple and can be used to make quick estimates of the design wave bending moment at the conceptual design phase...

  5. Influence of clay content on wave-induced liquefaction

    DEFF Research Database (Denmark)

    Kirca, V.S. Ozgur; Sumer, B. Mutlu; Fredsøe, Jørgen

    2014-01-01

    of measurements were carried out: (1) pore-water pressure measurements across the soil depth and (2) water-surface elevation measurements. These measurements were synchronized with video recordings of the liquefaction process from the side. The ranges of the various quantities in the experiments were wave height...... of silt and clay was not liquefied. Sand may become prone to liquefaction with the introduction of clay, contrary to the general perception that this type of sediment is normally liquefaction-resistant under waves. For instance, sand with d50 50:4 mmwas liquefied with CC510:8%, whereas sand with d50 50...

  6. Character, distribution, and ecological significance of storm wave-induced scour in Rhode Island Sound, USA

    Science.gov (United States)

    McMullen, Katherine Y.; Poppe, Lawrence J.; Parker, Castle E.

    2015-01-01

    Multibeam bathymetry, collected during NOAA hydrographic surveys in 2008 and 2009, is coupled with USGS data from sampling and photographic stations to map the seabed morphology and composition of Rhode Island Sound along the US Atlantic coast, and to provide information on sediment transport and benthic habitats. Patchworks of scour depressions cover large areas on seaward-facing slopes and bathymetric highs in the sound. These depressions average 0.5-0.8 m deep and occur in water depths reaching as much as 42 m. They have relatively steep well-defined sides and coarser-grained floors, and vary strongly in shape, size, and configuration. Some individual scour depressions have apparently expanded to combine with adjacent depressions, forming larger eroded areas that commonly contain outliers of the original seafloor sediments. Where cobbles and scattered boulders are present on the depression floors, the muddy Holocene sands have been completely removed and the winnowed relict Pleistocene deposits exposed. Low tidal-current velocities and the lack of obstacle marks suggest that bidirectional tidal currents alone are not capable of forming these features. These depressions are formed and maintained under high-energy shelf conditions owing to repetitive cyclic loading imposed by high-amplitude, long-period, storm-driven waves that reduce the effective shear strength of the sediment, cause resuspension, and expose the suspended sediments to erosion by wind-driven and tidal currents. Because epifauna dominate on gravel floors of the depressions and infauna are prevalent in the finer-grained Holocene deposits, it is concluded that the resultant close juxtaposition of silty sand-, sand-, and gravel-dependent communities promotes regional faunal complexity. These findings expand on earlier interpretations, documenting how storm wave-induced scour produces sorted bedforms that control much of the benthic geologic and biologic diversity in Rhode Island Sound.

  7. Numerical simulation of travelling wave induced electrothermal fluid flow

    International Nuclear Information System (INIS)

    Perch-Nielsen, Ivan R; Green, Nicolas G; Wolff, Anders

    2004-01-01

    Many microdevices for manipulating particles and cells use electric fields to produce a motive force on the particles. The movement of particles in non-uniform electric fields is called dielectrophoresis, and the usual method of applying this effect is to pass the particle suspension over a microelectrode structure. If the suspension has a noticeable conductivity, one important side effect is that the electric field drives a substantial conduction current through the fluid, causing localized Joule-heating. The resulting thermal gradient produces local conductivity and permittivity changes in the fluid. Dielectrophoretic forces acting upon these pockets of fluid will then produce motion of both the fluid and the particles. This paper presents a numerical solution of the electrical force and the resulting electrothermal driven fluid flow on a travelling wave structure. This common electrode geometry consists of interdigitated electrodes laid down in a long array, with the phase of the applied potential shifted by 90 0 on each subsequent electrode. The resulting travelling electric field was simulated and the thermal field and electrical body force on the fluid calculated, for devices constructed from two typical materials: silicon and glass. The electrothermal fluid flow in the electrolyte over the electrode array was then numerically simulated. The model predicts that the thermal field depends on the conductivity and applied voltage, but more importantly on the geometry of the system and the material used in the construction of the device. The velocity of the fluid flow depends critically on the same parameters, with slight differences in the thermal field for glass and silicon leading to diametrically opposite flow direction with respect to the travelling field for the two materials. In addition, the imposition of slight external temperature gradients is shown to have a large effect on the fluid flow in the device, under certain conditions leading to a reversal of

  8. Dry deposition of submicron atmospheric aerosol over water surfaces in motion

    International Nuclear Information System (INIS)

    Nevenick, Calec

    2013-01-01

    Whether by chronic or accidental releases, the impact of a nuclear installation on the environment mainly depends on atmospheric transfers; and as the accidents at Chernobyl and Fukushima show, affect the contamination of surfaces and impacts in the medium and long-term on the environment and the population. In this context, this work focuses on the characterization and modeling of dry deposition of submicron aerosols on liquid surfaces in motion such as rivers. Unlike wet deposition which is conditioned by washout and rainout (rain and clouds), dry deposition is a phenomenon that depends entirely on the characteristics of aerosols, receiving surfaces, and air flow. In practice, the evaluation of dry deposition is based on the estimation of flux modeling as the product of particle concentration and deposition velocity which can vary over several orders of magnitude depending on the receiving surfaces (forest, snow, urban, grassland...). This topic is motivated by the virtual non-existence of studies on the mechanisms of dry deposition on continental water systems such as rivers; and respect for submicron aerosols. They have the lowest deposition efficiencies and filtration and the longer residence time in the atmosphere. In addition, they are potentially the most dangerous to living beings because they can penetrate deeper into the airway. Due to the lack of data on the dry deposition of submicron aerosols on a liquid surface in motion, the approach was based on two axes: 1) the acquisition of experimental deposition velocities and 2) the analysis and interpretation of results through modeling. The experiments were performed with uranine aerosols released into the IOA wind tunnel (Interface Ocean Atmosphere) of the Institute for Research on Non Equilibrium Phenomena which is configured to study the coupling between the air flow and water. These experiments have given many dry deposition velocities for different configurations characterized according to wind

  9. Dry deposition of submicron atmospheric aerosol over water surfaces in motion

    International Nuclear Information System (INIS)

    Calec, Nevenick

    2013-01-01

    Whether by chronic or accidental releases, the impact of a nuclear installation on the environment mainly depends on atmospheric transfers; and as the accidents at Chernobyl and Fukushima show, affect the contamination of surfaces and impacts in the medium and long-term on the environment and the population. In this context, this work focuses on the characterization and modeling of dry deposition of submicron aerosols on liquid surfaces in motion such as rivers. Unlike wet deposition which is conditioned by washout and rainout (rain and clouds), dry deposition is a phenomenon that depends entirely on the characteristics of aerosols, receiving surfaces, and air flow. In practice, the evaluation of dry deposition is based on the estimation of flux modeling as the product of particle concentration and deposition velocity which can vary over several orders of magnitude depending on the receiving surfaces (forest, snow, urban, grassland..). This topic is motivated by the virtual non-existence of studies on the mechanisms of dry deposition on continental water systems such as rivers; and respect for submicron aerosols. They have the lowest deposition efficiencies and filtration and the longer residence time in the atmosphere. In addition, they are potentially the most dangerous to living beings because they can penetrate deeper into the airway. Due to the lack of data on the dry deposition of submicron aerosols on a liquid surface in motion, the approach was based on two axes: 1) the acquisition of experimental deposition velocities and 2) the analysis and interpretation of results through modeling. The experiments were performed with uranine aerosols released into the IOA wind tunnel (Interface Ocean Atmosphere) of the Institute for Research on Non Equilibrium Phenomena which is configured to study the coupling between the air flow and water. These experiments have given many dry deposition velocities for different configurations characterized according to wind

  10. Enhanced Chondrocyte Proliferation in a Prototyped Culture System with Wave-Induced Agitation

    Directory of Open Access Journals (Sweden)

    Pilarek Maciej

    2017-06-01

    Full Text Available One of the actual challenges in tissue engineering applications is to efficiently produce as high of number of cells as it is only possible, in the shortest time. In static cultures, the production of animal cell biomass in integrated forms (i.e. aggregates, inoculated scaffolds is limited due to inefficient diffusion of culture medium components observed in such non-mixed culture systems, especially in the case of cell-inoculated fiber-based dense 3D scaffolds, inside which the intensification of mass transfer is particularly important. The applicability of a prototyped, small-scale, continuously wave-induced agitated system for intensification of anchorage-dependent CP5 chondrocytes proliferation outside and inside three-dimensional poly(lactic acid (PLA scaffolds has been discussed. Fibrous PLA-based constructs have been inoculated with CP5 cells and then maintained in two independent incubation systems: (i non-agitated conditions and (ii culture with wave-induced agitation. Significantly higher values of the volumetric glucose consumption rate have been noted for the system with the wave-induced agitation. The advantage of the presented wave-induced agitation culture system has been confirmed by lower activity of lactate dehydrogenase (LDH released from the cells in the samples of culture medium harvested from the agitated cultures, in contrast to rather high values of LDH activity measured for static conditions. Results of the proceeded experiments and their analysis clearly exhibited the feasibility of the culture system supported with continuously wave-induced agitation for robust proliferation of the CP5 chondrocytes on PLA-based structures. Aside from the practicability of the prototyped system, we believe that it could also be applied as a standard method offering advantages for all types of the daily routine laboratory-scale animal cell cultures utilizing various fiber-based biomaterials, with the use of only regular laboratory

  11. Investigating the significance of zero-point motion in small molecular clusters of sulphuric acid and water

    International Nuclear Information System (INIS)

    Stinson, Jake L.; Ford, Ian J.; Kathmann, Shawn M.

    2014-01-01

    The nucleation of particles from trace gases in the atmosphere is an important source of cloud condensation nuclei, and these are vital for the formation of clouds in view of the high supersaturations required for homogeneous water droplet nucleation. The methods of quantum chemistry have increasingly been employed to model nucleation due to their high accuracy and efficiency in calculating configurational energies; and nucleation rates can be obtained from the associated free energies of particle formation. However, even in such advanced approaches, it is typically assumed that the nuclei have a classical nature, which is questionable for some systems. The importance of zero-point motion (also known as quantum nuclear dynamics) in modelling small clusters of sulphuric acid and water is tested here using the path integral molecular dynamics method at the density functional level of theory. The general effect of zero-point motion is to distort the mean structure slightly, and to promote the extent of proton transfer with respect to classical behaviour. In a particular configuration of one sulphuric acid molecule with three waters, the range of positions explored by a proton between a sulphuric acid and a water molecule at 300 K (a broad range in contrast to the confinement suggested by geometry optimisation at 0 K) is clearly affected by the inclusion of zero point motion, and similar effects are observed for other configurations

  12. Agradient velocity, vortical motion and gravity waves in a rotating shallow-water model

    Science.gov (United States)

    Sutyrin Georgi, G.

    2004-07-01

    A new approach to modelling slow vortical motion and fast inertia-gravity waves is suggested within the rotating shallow-water primitive equations with arbitrary topography. The velocity is exactly expressed as a sum of the gradient wind, described by the Bernoulli function,B, and the remaining agradient part, proportional to the velocity tendency. Then the equation for inverse potential vorticity,Q, as well as momentum equations for agradient velocity include the same source of intrinsic flow evolution expressed as a single term J (B, Q), where J is the Jacobian operator (for any steady state J (B, Q) = 0). Two components of agradient velocity are responsible for the fast inertia-gravity wave propagation similar to the traditionally used divergence and ageostrophic vorticity. This approach allows for the construction of balance relations for vortical dynamics and potential vorticity inversion schemes even for moderate Rossby and Froude numbers assuming the characteristic value of |J(B, Q)| = to be small. The components of agradient velocity are used as the fast variables slaved to potential vorticity that allows for diagnostic estimates of the velocity tendency, the direct potential vorticity inversion with the accuracy of 2 and the corresponding potential vorticity-conserving agradient velocity balance model (AVBM). The ultimate limitations of constructing the balance are revealed in the form of the ellipticity condition for balanced tendency of the Bernoulli function which incorporates both known criteria of the formal stability: the gradient wind modified by the characteristic vortical Rossby wave phase speed should be subcritical. The accuracy of the AVBM is illustrated by considering the linear normal modes and coastal Kelvin waves in the f-plane channel with topography.

  13. Finite element analysis of the shock waves induced in the liquid wall of a pellet fusion reactor

    International Nuclear Information System (INIS)

    Miya, K.; Iizuka, T.; Silverman, J.

    1985-01-01

    A shock wave induced in liquid metal is analyzed numerically by application of the finite element method. Since the governing equations of motion of the fluid are nonlinear, an incremental method is combined with the finite element method to obtain a convergent solution of the shock wave without an interaction technique. To demonstrate the validity of the method developed, shock wave problems in an inertial confinement spherical reactor with a liquid lithium ''waterfall'' are solved for two cases of surface heating due to soft x-ray absorption and bulk heating due to 14-MeV neutron absorption. The solution is based on a combination of the conservation equations for mass, energy, and momentum along with the following equation of state for liquid metals: p = P /sub b/ ((/rho///rho/ 0 ) /sup n/ - 1). Numerical results show that peak pressure induced in the liquid lithium is very high even for a comparatively small energy release E /sub TAU/ = 100 MJ/microexplosion of a pellet. Dynamic stress induced in a 5-cm-thick stainless steel pressure vessel is 1.14 x 10 3 MPa for the surface heating. The results show that the dynamic stress induced by bulk heating is superimposed on that due to surface heating within the same period. Two appropriate ways to reduce the high stress are application of two-phase flow of liquid lithium or an increase in the thickness of the pressure vessel

  14. Estimation of Ship Motions Using Closed-Form Expressions

    DEFF Research Database (Denmark)

    Jensen, Jørgen Juncher; Mansour, A.E.; Olsen, Anders Smærup

    2004-01-01

    A semi-analytical approach is used to derive frequency response functions for the wave-induced motions for monohull ships. The results are given as closed-form expressions and the required input information for the procedure is restricted to the main dimensions: Length, breadth, draught, block...

  15. Ship motion-based wave estimation using a spectral residual-calculation

    DEFF Research Database (Denmark)

    Nielsen, Ulrik D.; H. Brodtkorb, Astrid

    2018-01-01

    This paper presents a study focused on a newly developed procedure for wave spectrum estimation using wave-induced motion recordings from a ship. The particular procedure stands out from other existing, similar ship motion-based pro-cedures by its computational efficiency and - at the same time- ...

  16. Numerical simulation of wave-induced scour and backfilling processes beneath submarine pipelines

    DEFF Research Database (Denmark)

    Fuhrman, David R.; Baykal, Cüneyt; Sumer, B. Mutlu

    2014-01-01

    A fully-coupled hydrodynamic/morphodynamic numerical model is presented and utilized for the simulation of wave-induced scour and backfilling processes beneath submarine pipelines. The model is based on solutions to Reynolds-averaged Navier–Stokes equations, coupled with k−ω turbulence closure......≤30 demonstrate reasonable match with previous experiments, both in terms of the equilibrium scour depth as well as the scour time scale. Wave-induced backfilling processes are additionally studied by subjecting initial conditions taken from scour simulations with larger KC to new wave climates...... characterized by lower KC values. The simulations considered demonstrate the ability of the model to predict backfilling toward expected equilibrium scour depths based on the new wave climate, in line with experimental expectations. The simulated backfilling process is characterized by two stages: (1...

  17. Wave-induced release of methane : littoral zones as a source of methane in lakes

    OpenAIRE

    Hofmann, Hilmar; Federwisch, Luisa; Peeters, Frank

    2010-01-01

    This study investigates the role of surface waves and the associated disturbance of littoral sediments for the release and later distribution of dissolved methane in lakes. Surface wave field, wave-induced currents, acoustic backscatter strength, and the concentration and distribution of dissolved methane were measured simultaneously in Lake Constance, Germany. The data indicate that surface waves enhance the release of dissolved methane in the shallow littoral zone via burst-like releases of...

  18. Wave excited motion of a body floating on water confined between two semi-infinite ice sheets

    Science.gov (United States)

    Ren, K.; Wu, G. X.; Thomas, G. A.

    2016-12-01

    The wave excited motion of a body floating on water confined between two semi-infinite ice sheets is investigated. The ice sheet is treated as an elastic thin plate and water is treated as an ideal and incompressible fluid. The linearized velocity potential theory is adopted in the frequency domain and problems are solved by the method of matched eigenfunctions expansion. The fluid domain is divided into sub-regions and in each sub-region the velocity potential is expanded into a series of eigenfunctions satisfying the governing equation and the boundary conditions on horizontal planes including the free surface and ice sheets. Matching is conducted at the interfaces of two neighbouring regions to ensure the continuity of the pressure and velocity, and the unknown coefficients in the expressions are obtained as a result. The behaviour of the added mass and damping coefficients of the floating body with the effect of the ice sheets and the excitation force are analysed. They are found to vary oscillatorily with the wave number, which is different from that for a floating body in the open sea. The motion of the body confined between ice sheets is investigated, in particular its resonant behaviour with extremely large motion found to be possible under certain conditions. Standing waves within the polynya are also observed.

  19. Anisotropic and sub-diffusive water motion at the surface of DNA and of an anionic micelle CsPFO

    International Nuclear Information System (INIS)

    Pal, Subrata; Maiti, Prabal K; Bagchi, Biman

    2005-01-01

    We use long atomistic molecular dynamics simulations to address certain fundamental issues regarding water dynamics in the hydration layer of a 38 base long (GCCGCGAGGTGTCAGGGATTGCAGCCAGCATCTCGTCG) negatively charged hydrated DNA duplex. The rotational time correlation function of surface water dipoles is found to be markedly non-exponential, with a slow component at long time, whose magnitude depends on the initial (t = 0) residence of the water in the major or minor groove of the DNA. The surface water molecules are also found to exhibit anisotropic diffusion in both the major and minor grooves: diffusion in the direction parallel to the DNA surface exhibits a crossover from higher to lower than that in the direction normal to the surface at short-to-intermediate times. In the same time window, translational motion of water molecules in the minor groove is sub-diffusive, with mean square displacement (MSD) growing as t α with α ∼ 0.43. In general, water molecules in the major group exhibit faster dynamics than those in the minor groove, in agreement with earlier results (Bonvin et al 1998 J. Mol. Biol. 282 859-73). We compare these results with dynamics of water molecules at the surface of an anionic micelle, cesium perfluorooctanoate (CsPFO). Water molecules on the surface of CsPFO also exhibit slow translation and non-exponential orientational dynamics

  20. Alfvén Wave Turbulence as a Coronal Heating Mechanism: Simultaneously Predicting the Heating Rate and the Wave-induced Emission Line Broadening

    Energy Technology Data Exchange (ETDEWEB)

    Oran, R. [Department of Earth, Atmospheric, and Planetary Sciences, Massachusetts Institute of Technology, 77 Massachusetts Avenue, Cambridge, MA, 02139 (United States); Landi, E.; Holst, B. van der; Sokolov, I. V.; Gombosi, T. I., E-mail: roran@mit.edu [Atmospheric, Oceanic and Atmospheric Sciences, University of Michigan, 2455 Hayward, Ann Arbor, MI, 48109 (United States)

    2017-08-20

    We test the predictions of the Alfvén Wave Solar Model (AWSoM), a global wave-driven magnetohydrodynamic (MHD) model of the solar atmosphere, against high-resolution spectra emitted by the quiescent off-disk solar corona. AWSoM incorporates Alfvén wave propagation and dissipation in both closed and open magnetic field lines; turbulent dissipation is the only heating mechanism. We examine whether this mechanism is consistent with observations of coronal EUV emission by combining model results with the CHIANTI atomic database to create synthetic line-of-sight spectra, where spectral line widths depend on thermal and wave-related ion motions. This is the first time wave-induced line broadening is calculated from a global model with a realistic magnetic field. We used high-resolution SUMER observations above the solar west limb between 1.04 and 1.34 R {sub ⊙} at the equator, taken in 1996 November. We obtained an AWSoM steady-state solution for the corresponding period using a synoptic magnetogram. The 3D solution revealed a pseudo-streamer structure transversing the SUMER line of sight, which contributes significantly to the emission; the modeled electron temperature and density in the pseudo-streamer are consistent with those observed. The synthetic line widths and the total line fluxes are consistent with the observations for five different ions. Further, line widths that include the contribution from the wave-induced ion motions improve the correspondence with observed spectra for all ions. We conclude that the turbulent dissipation assumed in the AWSoM model is a viable candidate for explaining coronal heating, as it is consistent with several independent measured quantities.

  1. Wave energy conversion utilizing vertical motion of water in the array of water chambers aligned in the direction of wave propagation

    Directory of Open Access Journals (Sweden)

    Kesayoshi Hadano

    2017-05-01

    Full Text Available As a new technical approach, wave energy converter by using vertical motion of water in the multiple water chambers were developed to realize actual wave power generation as eco-environmental renewable energy. And practical use of wave energy converter was actually to require the following conditions: (1 setting up of the relevant device and its application to wave power generation in case that severe wave loading is avoided; (2 workability in installation and maintenance operations; (3 high energy conversion potential; and (4 low cost. In this system, neither the wall(s of the chambers nor the energy conversion device(s are exposed to the impulsive load due to water wave. Also since this system is profitable when set along the jetty or along a long floating body, installation and maintenance are done without difficulty and the cost is reduced. In this paper, we describe the system which consists of a float, a shaft connected with another shaft, a rack and pinion arrangement, a ratchet mechanism, and rotary type generator(s. Then, we present the dynamics model for evaluating the output electric power, and the results of numerical calculation including the effect of the phase shift of up/down motion of the water in the array of water chambers aligned along the direction of wave propagation.

  2. Operational wave now- and forecast in the German Bight as a basis for the assessment of wave-induced hydrodynamic loads on coastal dikes

    Science.gov (United States)

    Dreier, Norman; Fröhle, Peter

    2017-12-01

    The knowledge of the wave-induced hydrodynamic loads on coastal dikes including their temporal and spatial resolution on the dike in combination with actual water levels is of crucial importance of any risk-based early warning system. As a basis for the assessment of the wave-induced hydrodynamic loads, an operational wave now- and forecast system is set up that consists of i) available field measurements from the federal and local authorities and ii) data from numerical simulation of waves in the German Bight using the SWAN wave model. In this study, results of the hindcast of deep water wave conditions during the winter storm on 5-6 December, 2013 (German name `Xaver') are shown and compared with available measurements. Moreover field measurements of wave run-up from the local authorities at a sea dike on the German North Sea Island of Pellworm are presented and compared against calculated wave run-up using the EurOtop (2016) approach.

  3. Modeling Water Motion near Seismic Waves Propagating across a Graded Seabed, as Generated by Man-Made Impacts

    Directory of Open Access Journals (Sweden)

    Richard A. Hazelwood

    2016-08-01

    Full Text Available Seismic interface waves generated by seabed impacts are believed to have biological importance. Various wave types are of interest to seismologists, who can minimize the unwanted, but often dominant, ground roll waves with suitable instrumentation. Waves made by dredging and piling have been measured using geophones and found to be of this interface type, which propagate much more slowly than the pressure waves in the water column above. Short interface wavelets of a few cycles were modeled using transient finite element analysis (FEA. Wavelets with low losses have been modeled using graded sediment data from the literature. They do not radiate energy away from the interface because the evanescent acoustic pressures they generate decay rapidly with distance from the seabed. Associated water particle velocities are much greater than would be expected from similar acoustic pressure measurements in a free field. This motion is significant to aquatic life which is dependent on inertial sensors (otoliths, etc. to respond to the environment. Additional amplification of the horizontal seabed motion of the adjacent water is predicted for a short seismic wavelet modeled in a graded solid seabed. Further recent analysis studied the distribution of the energy flux within the sediment layers.

  4. Wave Induced Stresses Measured at the Wave Dragon Nissum Bredning Prototype

    DEFF Research Database (Denmark)

    Corona, L.; Kofoed, Jens Peter

    2006-01-01

    The paper describes the wave induced loading on the overtopping based wave energy converter Wave Dragon. Focus is put on the junction between the main body and the reflector, also called the "shoulder part", where large cross sectional forces and bending moments acts. There are two main objectives...... for this paper, first to verify the FEM results obtained by Niras, Danish society in charge of the finite element modelling and structural design, and then to make a first experimental fatigue analysis of a particular part of the Wave Dragon. This last part shall be considered as an exercise for the further work...

  5. Shear wave induced resonance elastography of spherical masses with polarized torsional waves

    Science.gov (United States)

    Hadj Henni, Anis; Schmitt, Cédric; Trop, Isabelle; Cloutier, Guy

    2012-03-01

    Shear wave induced resonance (SWIR) is a technique for dynamic ultrasound elastography of confined mechanical inclusions. It was developed for breast tumor imaging and tissue characterization. This method relies on the polarization of torsional shear waves modeled with the Helmholtz equation in spherical coordinates. To validate modeling, an invitro set-up was used to measure and image the first three eigenfrequencies and eigenmodes of a soft sphere. A preliminary invivo SWIR measurement on a breast fibroadenoma is also reported. Results revealed the potential of SWIR elastography to detect and mechanically characterize breast lesions for early cancer detection.

  6. Experimental investigation of the sloshing motion of the water free surface in the draft tube of a Francis turbine operating in synchronous condenser mode

    Science.gov (United States)

    Vagnoni, Elena; Favrel, Arthur; Andolfatto, Loïc; Avellan, François

    2018-06-01

    Hydropower units may be required to operate in condenser mode to supply reactive power. In this operating mode, the water level in the turbine or pump-turbine is decreased below the runner by closing the guide vanes and injecting pressurized air. While operating in condenser mode the machine experiences power losses due to several air-water interaction phenomena which cause air losses. One of such phenomena is the sloshing motion of the water free surface below the runner in the draft tube cone of a Francis turbine. The objective of the present work is to experimentally investigate the sloshing motion of the water free surface in the draft tube cone of a reduced scale physical model of a Francis turbine operating in condenser mode. Images acquisition and simultaneous pressure fluctuation measurements are performed and an image processing method is developed to investigate amplitude and frequency of the sloshing motion of the free surface. It is found that this motion is excited at the natural frequency of the water volume and corresponds to the azimuthal wavenumber m = 1 of a rotating gravity wave. The amplitude of the motion is perturbed by wave breaking and it decreases by increasing the densimetric Froude number. The sloshing frequency slightly increases with respect to the natural frequency of the water volume by increasing the densimetric Froude number. Moreover, it results that this resonant phenomenon is not related to the torque perturbation.

  7. Molecular motion of water molecules in lyotropic mesophases formed from fatty acid soaps

    International Nuclear Information System (INIS)

    Olszewski, K.J.; Pislewski, N.

    1980-01-01

    The results of study of self-diffusion coefficients and relaxation times for the mesophases formed from water mixtures of potassium laurate (denoted by C 12 K), myristate (C 14 K), and palmitate (C 16 K), are presented. The samples containing by weight 70% of soaps and 30% of water as well as samples containing 30% of soaps and 70% of water were examined. It allowed to obtain lamellar and middle phase respectively. (author)

  8. Molecular dynamics test of the Brownian description of Na+ motion in water

    International Nuclear Information System (INIS)

    Wilson, M.A.; Pohorille, A.; Pratt, L.R.

    1985-01-01

    The autocorrelation function of the velocity of an infinitely dilute Na + ion in aqueous solution, and the autocorrelation function of the force exerted on a stationary Na + under the same conditions are evaluated by molecular dynamics calculations. The results are used to test the accuracy of Brownian motion assumptions which are basic to hydrodynamic models of ion dynamics in solution. The self-diffusion coefficient of the Na + ion predicted by Brownian motion theory is (0.65 +- 0.1) x 10 -5 cm 2 /s. This value is about 60% greater than the one obtained for the proper dynamics of the finite mass ion, (0.4 +- 0.1) x 10 -5 cm 2 /s. The numerically correct velocity autocorrelation function is nonexponential, and the autocorrelation of the force on the stationary ion does not decay faster than the ion velocity autocorrelation function. Motivated by previous hydrodynamic modeling of friction kernels, we examine the approximation in which the memory function for the velocity autocorrelation function is identified with the autocorrelation function of the force on the stationary ion. The overall agreement between this approximation for the velocity autocorrelation function and the numerically correct answer is quite good

  9. IT-Tools Concept for Simulation and Design of Water Hydraulic Mechatronic Test Facilities for Motion Control and Operation in Environmentally Sensitive Application Areas

    DEFF Research Database (Denmark)

    Conrad, Finn; Pobedza, J.; Sobczyk, A.

    2004-01-01

    This paper presents a proposed IT-Tools concept for modeling, simulation, analysis and design of water hydraulic actuators for motion control of machines, lifts, cranes and robots. The designed test rigs have tap water hydraulic components of the Danfoss Nessie® product family and equipped...... with a measurement and data acquisition system. Results of the mathematical modeling, simulation and design of the motion control test rigs are presented. Furthermore, the paper presents selected experimental and identifying test results for the water hydraulic test rigs....

  10. Experimental-based Modelling and Simulation of Water Hydraulic Mechatronics Test Facilities for Motion Control and Operation in Environmental Sensitive Applications` Areas

    DEFF Research Database (Denmark)

    Conrad, Finn; Pobedza, J.; Sobczyk, A.

    2003-01-01

    The paper presents experimental-based modelling, simulation, analysis and design of water hydraulic actuators for motion control of machines, lifts, cranes and robots. The contributions includes results from on-going research projects on fluid power and mechatronics based on tap water hydraulic...

  11. Experimental and numerical study on coupled motion responses of a floating crane vessel and a lifted subsea manifold in deep water

    Directory of Open Access Journals (Sweden)

    B.W. Nam

    2017-09-01

    Full Text Available The floating crane vessel in waves gives rise to the motion of the lifted object which is connected to the hoisting wire. The dynamic tension induced by the lifted object also affects the motion responses of the floating crane vessel in return. In this study, coupled motion responses of a floating crane vessel and a lifted subsea manifold during deep-water installation operations were investigated by both experiments and numerical calculations. A series of model tests for the deep-water lifting operation were performed at Ocean Engineering Basin of KRISO. For the model test, the vessel with a crane control system and a typical subsea manifold were examined. To validate the experimental results, a frequency-domain motion analysis method is applied. The coupled motion equations of the crane vessel and the lifted object are solved in the frequency domain with an additional linear stiffness matrix due to the hoisting wire. The hydrodynamic coefficients of the lifted object, which is a significant factor to affect the coupled dynamics, are estimated based on the perforation value of the structure and the CFD results. The discussions were made on three main points. First, the motion characteristics of the lifted object as well as the crane vessel were studied by comparing the calculation results. Second, the dynamic tension of the hoisting wire were evaluated under the various wave conditions. Final discussion was made on the effect of passive heave compensator on the motion and tension responses.

  12. On Current Drive and Wave Induced Bootstrap Current in Toroidal Plasmas

    International Nuclear Information System (INIS)

    Hellsten, T.; Johnson, T.

    2008-01-01

    A comprehensive treatment of wave-particle interactions in toroidal plasmas including collisional relaxation, applicable to heating or anomalous wave induced transport, has been obtained by using Monte Carlo operators satisfying quasi-neutrality. This approach enables a self-consistent treatment of wave-particle interactions applicable to the banana regime in the neoclassical theory. It allows an extension into a regime with large temperature and density gradients, losses and transport of particles by wave-particle interactions making the method applicable to transport barriers. It is found that at large gradients the relationship between radial electric field, parallel velocity, temperature and density gradient in the neoclassical theory is modified such that coefficient in front of the logarithmic ion temperature gradient, which in the standard neoclassical theory is small and counteracts the electric field caused by the density gradient, now changes sign and contributes to the built up of the radial electric field. The possibility to drive current by absorbing the waves on trapped particles has been studied and how the wave-particle interactions affect the bootstrap current. Two new current drive mechanisms are studied: current drive by wave induced bootstrap current and selective detrapping into passing orbits by directed waves.

  13. Three-dimensional wave-induced current model equations and radiation stresses

    Science.gov (United States)

    Xia, Hua-yong

    2017-08-01

    After the approach by Mellor (2003, 2008), the present paper reports on a repeated effort to derive the equations for three-dimensional wave-induced current. Via the vertical momentum equation and a proper coordinate transformation, the phase-averaged wave dynamic pressure is well treated, and a continuous and depth-dependent radiation stress tensor, rather than the controversial delta Dirac function at the surface shown in Mellor (2008), is provided. Besides, a phase-averaged vertical momentum flux over a sloping bottom is introduced. All the inconsistencies in Mellor (2003, 2008), pointed out by Ardhuin et al. (2008) and Bennis and Ardhuin (2011), are overcome in the presently revised equations. In a test case with a sloping sea bed, as shown in Ardhuin et al. (2008), the wave-driving forces derived in the present equations are in good balance, and no spurious vertical circulation occurs outside the surf zone, indicating that Airy's wave theory and the approach of Mellor (2003, 2008) are applicable for the derivation of the wave-induced current model.

  14. Shock wave-induced evaporation of water droplets in a gas-droplet mixture 646

    NARCIS (Netherlands)

    Goossens, H.W.J.; Cleijne, J.W.; Smolders, H.J.; Dongen, van M.E.H.

    1988-01-01

    A model is presented for the droplet evaporation process induced by a shock wave propagating in a fog. The model is based on the existence of a quasi-steady wet bulb state of the droplets during evaporation. It is shown that for moderate shock strength, Ma = <2,=" and=" droplet=" radii=" in=" the="

  15. Water droplet accumulation and motion in PEM (Proton Exchange Membrane) fuel cell mini-channels

    International Nuclear Information System (INIS)

    Carton, J.G.; Lawlor, V.; Olabi, A.G.; Hochenauer, C.; Zauner, G.

    2012-01-01

    Effective water management is one of the key strategies for improving low temperature PEM (Proton Exchange Membrane) fuel cell performance and durability. Phenomena such as membrane dehydration, catalyst layer flooding, mass transport and fluid flow regimes can be affected by the interaction, distribution and movement of water in flow plate channels. In this paper a literature review is completed in relation to PEM fuel cell water flooding. It is clear that droplet formation, movement and interaction with the GDL (Gas Diffusion Layer) have been studied extensively. However slug formation and droplet accumulation in the flow channels has not been analysed in detail. In this study, a CFD (Computational Fluid Dynamic) model and VOF (Volume of Fluid) method is used to simulate water droplet movement and slug formation in PEM fuel cell mini-channels. In addition, water slug visualisation is recorded in ex situ PEM fuel cell mini-channels. Observation and simulation results are discussed with relation to slug formation and the implications to PEM fuel cell performance. -- Highlights: ► Excess water in mini-channels from the collision and coalescence of droplets can directly form slugs in PEM fuel cells. ► Slugs can form at low flow rates so increasing the flow rate can reduce the size and frequency of slugs. ► One channel of a double serpentine mini-channel may become blocked due to the redistribution of airflow and pressure caused by slug formation. ► Correct GDL and mini-channel surface coatings are essential to reduce slug formation and stagnation. ► Having geometry changes (bends and steps) in the flow fields can disrupt slug movement and avoid channel blockages.

  16. Mathematical Model and Analysis of the Water-Lubricated Hydrostatic Journal Bearings considering the Translational and Tilting Motions

    Directory of Open Access Journals (Sweden)

    Hui-Hui Feng

    2014-01-01

    Full Text Available The water-lubricated bearings have been paid attention for their advantages to reduce the power loss and temperature rise and increase load capacity at high speed. To fully study the complete dynamic coefficients of two water-lubricated, hydrostatic journal bearings used to support a rigid rotor, a four-degree-of-freedom model considering the translational and tilting motion is presented. The effects of tilting ratio, rotary speed, and eccentricity ratio on the static and dynamic performances of the bearings are investigated. The bulk turbulent Reynolds equation is adopted. The finite difference method and a linear perturbation method are used to calculate the zeroth- and first-order pressure fields to obtain the static and dynamic coefficients. The results suggest that when the tilting ratio is smaller than 0.4 or the eccentricity ratio is smaller than 0.1, the static and dynamic characteristics are relatively insensitive to the tilting and eccentricity ratios; however, for larger tilting or eccentricity ratios, the tilting and eccentric effects should be fully considered. Meanwhile, the rotary speed significantly affects the performance of the hydrostatic, water-lubricated bearings.

  17. 76 FR 34690 - Placer County Water Agency; Notice of Application Accepted for Filing, Soliciting Motions To...

    Science.gov (United States)

    2011-06-14

    ... electronic filing, documents may also be paper-filed. To paper-file, mail an original and seven copies to... (project) has two principal water storage reservoirs, French Meadows and Hell Hole. These reservoirs are...-Middle Fork tunnel into French Meadows reservoir (134,993 ac-ft of gross storage). Flows in the Middle...

  18. Ship motion effects in CTD-data from weakly stratified waters of the Puerto Rico trench

    NARCIS (Netherlands)

    van Haren, H.

    2015-01-01

    Shipborne SBE 911plus Conductivity Temperature Depth (CTD)-casts have been made to maximum 7220 m in the Puerto Rico Trench (PRT). In PRT-waters from 5500 m and deeper and specifically below the 6500 m transition to the hadal-zone, the vertical density stratification is found very weak, with

  19. Application of gis - technology for modelling motion water in the open channels

    OpenAIRE

    Venherskyi, Petro; Kokovska, Yaryna

    2012-01-01

    In this paper technology that would be allowed to use ArcGIS-Extension, that is GIS-components for Webapplications based on ArcGIS Server'a. Such technologies provide simple and easy integration and use of GIS-component on the WEB-site, where a separate layer provided opportunities modeling and solving applied problems of moving water flow in rivers.

  20. Probing water motion in heterogenous systems : a multi-parameter NMR approach

    NARCIS (Netherlands)

    Dusschoten, van D.

    1996-01-01


    In this Thesis a practical approach is presented to study water mobility in heterogeneous systems by a number of novel NMR sequences. The major part of this Thesis describes how the reliability of diffusion measurements can be improved using some of the novel NMR sequences. The

  1. Motion of water droplets in the counter flow of high-temperature combustion products

    Science.gov (United States)

    Volkov, R. S.; Strizhak, P. A.

    2018-01-01

    This paper presents the experimental studies of the deceleration, reversal, and entrainment of water droplets sprayed in counter current flow to a rising stream of high-temperature (1100 K) combustion gases. The initial droplets velocities 0.5-2.5 m/s, radii 10-230 μm, relative volume concentrations 0.2·10-4-1.8·10-4 (m3 of water)/(m3 of gas) vary in the ranges corresponding to promising high-temperature (over 1000 K) gas-vapor-droplet applications (for example, polydisperse fire extinguishing using water mist, fog, or appropriate water vapor-droplet veils, thermal or flame treatment of liquids in the flow of combustion products or high-temperature air; creating coolants based on flue gas, vapor and water droplets; unfreezing of granular media and processing of the drossed surfaces of thermal-power equipment; ignition of liquid and slurry fuel droplets). A hardware-software cross-correlation complex, high-speed (up to 105 fps) video recording tools, panoramic optical techniques (Particle Image Velocimetry, Particle Tracking Velocimetry, Interferometric Particle Imagine, Shadow Photography), and the Tema Automotive software with the function of continuous monitoring have been applied to examine the characteristics of the processes under study. The scale of the influence of initial droplets concentration in the gas flow on the conditions and features of their entrainment by high-temperature gases has been specified. The dependencies Red = f(Reg) and Red' = f(Reg) have been obtained to predict the characteristics of the deceleration of droplets by gases at different droplets concentrations.

  2. Measurements in a container ship of wave-induced hull girder stresses in excess of design values

    DEFF Research Database (Denmark)

    Andersen, Ingrid Marie Vincent; Jensen, Jørgen Juncher

    2014-01-01

    This paper describes full-scale measurements of the wave-induced vertical bending moment amidships a 9400 TEU container carrier and focuses on the effect of the hydro-elastic high-frequency vibration on the extreme hogging wave bending moment. One extreme event, where the vertical wave-induced ho...... is quite significant. Finally, the hydro-elastic behaviour of the hull girder is assessed by simple approximations using the measured statistical properties and closed-form expressions and the agreement with the actual measurements is found to be good. © 2014 Elsevier Ltd....

  3. Rotation-Infall Motion around the Protostar IRAS 16293-2422 Traced by Water Maser Emission

    Science.gov (United States)

    Imai, Hiroshi; Iwata, Takahiro; Miyoshi, Makoto

    1999-08-01

    We made VLBI observations of the water maser emission associated with a protostar, IRAS 16293-2422, using the Kashima-Nobeyama Interferometer (KNIFE) and the Japanese domestic VLBI network (J-Net).\\footnote[2]. These distributions of water maser features showed the blue-shifted and red-shifted components separated in the north-south direction among three epochs spanning three years. The direction of the separation was perpendicular to the molecular outflow and parallel to the elongation of the molecular disk. These steady distributions were successfully modeled by a rotating-infalling disk with an outer radius of 100 AU around a central object with a mass of 0.3 MO . The local specific angular momentum of the disk was calculated to be 0.2-1.0times 10-3 km s-1 pc at a radius of 20-100 AU. This value is roughly equal to that of the disk of IRAS 00338+6312 in L1287 and those of the molecular disks around the protostars in the Taurus molecular cloud. The relatively large disk radius of about 100 AU traced by water maser emission suggests that impinging clumps onto the disk should be hotter than 200 K to excite the water maser emission. Mizusawa, Nobeyama, and Kagoshima stations are operated by staff members of National Astronomical Observatory of the Ministry of Education, Science, Sports and Culture. Kashima station is operated by staff members of Communications Research Laboratory of the Ministry of Posts and Telecomunications. The recent status of J-Net is seen in the WWW home page: http://www.nro.nao.ac.jp/\\ \\ miyaji/Jnet.

  4. Extreme Wave-Induced Oscillation in Paradip Port Under the Resonance Conditions

    Science.gov (United States)

    Kumar, Prashant; Gulshan

    2017-12-01

    A mathematical model is constructed to analyze the long wave-induced oscillation in Paradip Port, Odisha, India under the resonance conditions to avert any extreme wave hazards. Boundary element method (BEM) with corner contribution is utilized to solve the Helmholtz equation under the partial reflection boundary conditions. Furthermore, convergence analysis is also performed for the boundary element scheme with uniform and non-uniform discretization of the boundary. The numerical scheme is also validated with analytic approximation and existing studies based on harbor resonance. Then, the amplification factor is estimated at six key record stations in the Paradip Port with multidirectional incident waves and resonance modes are also estimated at the boundary of the port. Ocean surface wave field is predicted in the interior of Paradip Port for the different directional incident wave at various resonance modes. Moreover, the safe locations in the port have been identified for loading and unloading of moored ship with different resonance modes and directional incident waves.

  5. Extreme value prediction of the wave-induced vertical bending moment in large container ships

    DEFF Research Database (Denmark)

    Andersen, Ingrid Marie Vincent; Jensen, Jørgen Juncher

    2015-01-01

    increase the extreme hull girder response significantly. Focus in the present paper is on the influence of the hull girder flexibility on the extreme response amidships, namely the wave-induced vertical bending moment (VBM) in hogging, and the prediction of the extreme value of the same. The analysis...... in the present paper is based on time series of full scale measurements from three large container ships of 8600, 9400 and 14000 TEU. When carrying out the extreme value estimation the peak-over-threshold (POT) method combined with an appropriate extreme value distribution is applied. The choice of a proper...... threshold level as well as the statistical correlation between clustered peaks influence the extreme value prediction and are taken into consideration in the present paper....

  6. A miniaturized oxygen sensor integrated on fiber surface based on evanescent-wave induced fluorescence quenching

    Energy Technology Data Exchange (ETDEWEB)

    Xiong, Yan [School of Chemistry and Chemical Engineering, Southwest Petroleum University, Chengdu 610500 (China); Oil and Gas Field Applied Chemistry Key Laboratory of Sichuan Province, Southwest Petroleum University, Chengdu, 610500 (China); Tan, Jun; Wang, Chengjie; Zhu, Ying [School of Chemistry and Chemical Engineering, Southwest Petroleum University, Chengdu 610500 (China); Fang, Shenwen [School of Chemistry and Chemical Engineering, Southwest Petroleum University, Chengdu 610500 (China); Oil and Gas Field Applied Chemistry Key Laboratory of Sichuan Province, Southwest Petroleum University, Chengdu, 610500 (China); Wu, Jiayi; Wang, Qing [School of Chemistry and Chemical Engineering, Southwest Petroleum University, Chengdu 610500 (China); Duan, Ming, E-mail: swpua124@126.com [State Key Laboratory of Oil and Gas Reservoir Geology and Exploitation, Southwest Petroleum University, Chengdu 610500 (China); School of Chemistry and Chemical Engineering, Southwest Petroleum University, Chengdu 610500 (China); Oil and Gas Field Applied Chemistry Key Laboratory of Sichuan Province, Southwest Petroleum University, Chengdu, 610500 (China)

    2016-11-15

    In this work, a miniaturized sensor was integrated on fiber surface and developed for oxygen determination through evanescent-wave induced fluorescence quenching. The sensor was designed by using light emitting diode (LED) as light source and optical fiber as light transmission element. Tris(2,2′-bipyridyl) ruthenium ([Ru(bpy){sub 3}]{sup 2+}) fluorophore was immobilized in the organically modified silicates (ORMOSILs) film and coated onto the fiber surface. When light propagated by total internal reflection (TIR) in the fiber core, evanescent wave could be produced on the fiber surface and excite [Ru(bpy){sub 3}]{sup 2+} fluorophore to produce fluorescence emission. Then oxygen could be determinated by its quenching effect on the fluorescence and its concentration could be evaluated according to Stern–Volumer model. Through integrating evanescent wave excitation and fluorescence quenching on fiber surface, the sensor was successfully miniaturized and exhibit improved performances of high sensitivity (1.4), excellent repeatability (1.2%) and fast analysis (12 s) for oxygen determination. The sensor provided a newly portable method for in-situ and real-time measurement of oxygen and showed potential for practical oxygen analysis in different application fields. Furthermore, the fabrication of this sensor provides a miniaturized and portable detection platform for species monitoring by simple modular design. - Highlights: • ORMOSILs sensing film immobilized with [Ru(bpy){sub 3}]{sup 2+} fluorophore was coated on fiber surface. • Evanescent wave on the fiber surface was utilized as excitation source to produce fluorescence. • Oxygen was measured based on its quenching effect on evanescent wave-induce fluorescence. • Sensor fabrication was miniaturized by integrating detection and sensing elements on the fiber. • The modular design sensor provides a detection platform for other species monitoring.

  7. Water droplet deformation under the motion in gas area with subsonic velocities

    Directory of Open Access Journals (Sweden)

    Kuibin Pavel A.

    2015-01-01

    Full Text Available The experimental investigation of water droplet deformation (characteristic dimensions 3 ÷ 6 mm when moving through the gas area (air with 1÷ 5 m/s velocities was carried out. The high-speed (delay time between the frames is less than 100 ns tools of cross-correlation videorecording were used. A cyclic change nature of the droplet shapes (from close to spherical to conditionally ellipsoidal was found. The characteristic times of “deformation cycles” and the maximal deviations of droplet dimensions relative to initial dimensions were determined. The influence of droplet velocities and its dimensions on the deformation characteristics was determined.

  8. Static and Dynamic Water Motion-Induced Instability in Oxide Thin-Film Transistors and Its Suppression by Using Low-k Fluoropolymer Passivation.

    Science.gov (United States)

    Choi, Seungbeom; Jo, Jeong-Wan; Kim, Jaeyoung; Song, Seungho; Kim, Jaekyun; Park, Sung Kyu; Kim, Yong-Hoon

    2017-08-09

    Here, we report static and dynamic water motion-induced instability in indium-gallium-zinc-oxide (IGZO) thin-film transistors (TFTs) and its effective suppression with the use of a simple, solution-processed low-k (ε ∼ 1.9) fluoroplastic resin (FPR) passivation layer. The liquid-contact electrification effect, in which an undesirable drain current modulation is induced by a dynamic motion of a charged liquid such as water, can cause a significant instability in IGZO TFTs. It was found that by adopting a thin (∼44 nm) FPR passivation layer for IGZO TFTs, the current modulation induced by the water-contact electrification was greatly reduced in both off- and on-states of the device. In addition, the FPR-passivated IGZO TFTs exhibited an excellent stability to static water exposure (a threshold voltage shift of +0.8 V upon 3600 s of water soaking), which is attributed to the hydrophobicity of the FPR passivation layer. Here, we discuss the origin of the current instability caused by the liquid-contact electrification as well as various static and dynamic stability tests for IGZO TFTs. On the basis of our findings, we believe that the use of a thin, solution-processed FPR passivation layer is effective in suppressing the static and dynamic water motion-induced instabilities, which may enable the realization of high-performance and environment-stable oxide TFTs for emerging wearable and skin-like electronics.

  9. The instability of the spiral wave induced by the deformation of elastic excitable media

    International Nuclear Information System (INIS)

    Ma Jun; Jia Ya; Wang Chunni; Li Shirong

    2008-01-01

    There are some similarities between the spiral wave in excitable media and in cardiac tissue. Much evidence shows that the appearance and instability of the spiral wave in cardiac tissue can be linked to one kind of heart disease. There are many models that can be used to investigate the formation and instability of the spiral wave. Cardiac tissue is excitable and elastic, and it is interesting to simulate the transition and instability of the spiral wave induced by media deformation. For simplicity, a class of the modified Fitzhugh-Nagumo (MFHN) model, which can generate a stable rotating spiral wave, meandering spiral wave and turbulence within appropriate parameter regions, will be used to simulate the instability of the spiral wave induced by the periodical deformation of media. In the two-dimensional case, the total acreage of elastic media is supposed to be invariable in the presence of deformation, and the problem is described with L x x L y = N x ΔxN x Δy = L' x L' y = N x Δx'N x Δy'. In our studies, elastic media are decentralized into N x N sites and the space of the adjacent sites is changed to simulate the deformation of elastic media. Based on the nonlinear dynamics theory, the deformation effect on media is simplified and simulated by perturbing the diffusion coefficients D x and D y with different periodical signals, but the perturbed diffusion coefficients are compensatory. The snapshots of our numerical results find that the spiral wave can coexist with the spiral turbulence, instability of the spiral wave and weak deformation of the spiral wave in different conditions. The ratio parameter ε and the frequency of deformation forcing play a deterministic role in inducing instability of the spiral wave. Extensive studies confirm that the instability of the spiral wave can be induced and developed only if an appropriate frequency for deformation is used. We analyze the power spectrum for the time series of the mean activator of four sampled sites

  10. The instability of the spiral wave induced by the deformation of elastic excitable media

    Science.gov (United States)

    Ma, Jun; Jia, Ya; Wang, Chun-Ni; Li, Shi-Rong

    2008-09-01

    There are some similarities between the spiral wave in excitable media and in cardiac tissue. Much evidence shows that the appearance and instability of the spiral wave in cardiac tissue can be linked to one kind of heart disease. There are many models that can be used to investigate the formation and instability of the spiral wave. Cardiac tissue is excitable and elastic, and it is interesting to simulate the transition and instability of the spiral wave induced by media deformation. For simplicity, a class of the modified Fitzhugh-Nagumo (MFHN) model, which can generate a stable rotating spiral wave, meandering spiral wave and turbulence within appropriate parameter regions, will be used to simulate the instability of the spiral wave induced by the periodical deformation of media. In the two-dimensional case, the total acreage of elastic media is supposed to be invariable in the presence of deformation, and the problem is described with Lx × Ly = N × ΔxN × Δy = L'xL'y = N × Δx'N × Δy'. In our studies, elastic media are decentralized into N × N sites and the space of the adjacent sites is changed to simulate the deformation of elastic media. Based on the nonlinear dynamics theory, the deformation effect on media is simplified and simulated by perturbing the diffusion coefficients Dx and Dy with different periodical signals, but the perturbed diffusion coefficients are compensatory. The snapshots of our numerical results find that the spiral wave can coexist with the spiral turbulence, instability of the spiral wave and weak deformation of the spiral wave in different conditions. The ratio parameter ɛ and the frequency of deformation forcing play a deterministic role in inducing instability of the spiral wave. Extensive studies confirm that the instability of the spiral wave can be induced and developed only if an appropriate frequency for deformation is used. We analyze the power spectrum for the time series of the mean activator of four sampled sites

  11. Development of a wave-induced forcing threshold for nearshore impact of Wave Energy Converter arrays

    Science.gov (United States)

    O'Dea, A.; Haller, M. C.; Ozkan-Haller, H. T.

    2016-02-01

    Wave-induced forcing is a function of spatial gradients in the wave radiation stresses and is the main driver of alongshore currents, rip currents, and nearshore sediment transport. The installation of nearshore Wave Energy Converter (WEC) arrays may cause significant changes in the surf zone radiation stresses and could therefore impact nearshore littoral processes. In the first part of this study, a new threshold for nearshore hydrodynamic impact due to the presence of WEC devices is established based on changes in the alongshore radiation stress gradients shoreward of WEC arrays. The threshold is defined based on the relationship between nearshore radiation stresses and alongshore currents as observed in field data. Next, we perform a parametric study of the nearshore impact of WEC arrays using the SWAN wave model. Trials are conducted on an idealized, alongshore-uniform beach with a range of WEC array configurations, locations, and incident wave conditions, and conditions that generate radiation stress gradients above the impact threshold are identified. Finally, the same methodology is applied to two wave energy test sites off the coast of Newport, OR with more complicated bathymetries. Although the trends at the field sites are similar to those seen in the parametric study, the location and extent of the changes in the alongshore radiation stress gradients appear to be heavily influenced by the local bathymetry.

  12. Formation and damping of a shock wave induced by laser in a metallic target

    International Nuclear Information System (INIS)

    Cottet, F.

    1981-01-01

    In the first part of this work, a numerical simulation of the formation and of the damping of the shock wave induced in a solid target by a laser impulse is developed. It allows to interpret the experimental obtained in the second part of the study. Two series of experiments have been realized. An iron target metallographic study is intended to verify if laser shocks produce effects comparable with conventional shocks, particularly a deformation by albite twinning the existence of which is related to the shock amplitude and its evolution during the propagation in the target. Macles observation become a possible mean to estimate the value of the induced pressures. Another experiment series has been realized to determine more directly the shock parameters. Piezoelectric cermets have been used to detect a shock-wave passage and to measure the time taken to go through targets of variable thickness. The numerical solution allows, afterwards, to deduce the maximum pressure of the induced shock. The most part of the tests have been done on copper targets, the behaviour of which is well known in a large pressure domain. Some tests have been realized on aluminium and iron targets [fr

  13. Investigation of the radiation properties of magnetospheric ELF waves induced by modulated ionospheric heating

    Science.gov (United States)

    Wang, Feng; Ni, Binbin; Zhao, Zhengyu; Zhao, Shufan; Zhao, Guangxin; Wang, Min

    2017-05-01

    Electromagnetic extremely low frequency (ELF) waves play an important role in modulating the Earth's radiation belt electron dynamics. High-frequency (HF) modulated heating of the ionosphere acts as a viable means to generate artificial ELF waves. The artificial ELF waves can reside in two different plasma regions in geo-space by propagating in the ionosphere and penetrating into the magnetosphere. As a consequence, the entire trajectory of ELF wave propagation should be considered to carefully analyze the wave radiation properties resulting from modulated ionospheric heating. We adopt a model of full wave solution to evaluate the Poynting vector of the ELF radiation field in the ionosphere, which can reflect the propagation characteristics of the radiated ELF waves along the background magnetic field and provide the initial condition of waves for ray tracing in the magnetosphere. The results indicate that the induced ELF wave energy forms a collimated beam and the center of the ELF radiation shifts obviously with respect to the ambient magnetic field with the radiation power inversely proportional to the wave frequency. The intensity of ELF wave radiation also shows a weak correlation with the size of the radiation source or its geographical location. Furthermore, the combination of ELF propagation in the ionosphere and magnetosphere is proposed on basis of the characteristics of the ELF radiation field from the upper ionospheric boundary and ray tracing simulations are implemented to reasonably calculate magnetospheric ray paths of ELF waves induced by modulated ionospheric heating.

  14. Confinement - assisted shock-wave-induced thin-film delamination (SWIFD) of copper indium gallium diselenide (CIGS) on a flexible substrate

    Science.gov (United States)

    Lorenz, Pierre; Zagoranskiy, Igor; Ehrhardt, Martin; Han, Bing; Bayer, Lukas; Zimmer, Klaus

    2017-12-01

    The laser structuring of CIGS (copper indium gallium (di)selenide) solar cell material without influence and damaging the functionality of the active layer is a challenge for laser methods The shock-wave-induced thin-film delamination (SWIFD) process allows structuring without thermal modifications due to a spatial separation of the laser absorption from the functional layer removal process. In the present study, SWIFD structuring of CIGS solar cell stacks was investigated. The rear side of the polyimide was irradiated with a KrF-Excimer laser. The laser-induced ablation process generates a traverse shock wave, and the interaction of the shock wave with the layer-substrate interface results in a delamination process. The effect of a water confinement on the SWIFD process was studied where the rear side of the substrate was covered with a ∼2 mm thick water layer. The resultant surface morphology was analysed and discussed. At a sufficient number of laser pulses N and laser fluences Φ, the CIGS layer can be selectively removed from the Mo back contact. The water confinement, as well as the increasing laser beam size A0 and N, results in the reduction of the necessary minimal laser fluence Φth. Further, the delaminated CIGS area increased with increasing Φ, N, and A0.

  15. Modification of the ionosphere by VLF wave-induced electron precipitation

    International Nuclear Information System (INIS)

    Doolittle, J.H.

    1982-01-01

    Very low frequency (VLF) waves propagating in the whistler mode in the magnetosphere are known to cause precipitation of energetic electrons at middle latitudes. The interactions between the waves and electrons trapped in the magnetic field are believed to occur through cyclotron resonance. As a monochromatic wave propagates along a field line, the condition for resonance can be satisfied by electrons of a minimum energy at the equator and higher energies at increasing latitudes. Resonant interactions occurring in a field aligned region extending several thousand kilometers on both sides of the equator can therefore result in a precipitation flux with a wide range of energies. Electrons which are scattered into the loss cone will collide with the constituents of the ionosphere, causing additional ionization optical emissions, x-rays and heating. A computational technique is introduced which allows the temporal shape of pulse of precipitation to be modeled. A realistic energy distribution is used to weigh the contribution to the total precipitation energy flux resulting from resonant interactions in each segment of the duct. Wave growth along the path is found to affect the shape of the pulse. In its simplest application, the model sets limits on the time window in which a precipitation event can occur. The model arrival times are shown to agree with experimental correlations of VLF waves and effects of precipitation occurring on three occasions, thus supporting the assumption, that the precipitation results from cyclotron resonant scattering. Various techniques that have been employed for detecting wave-induced precipitation are compared. A quantitative analysis of the use of an HF radar for this purpose is introduced, based on the changes in the phase and group paths of the radar signals that are reflected from the perturbed ionosphere

  16. Experimental Investigation of the Self-Propelled Motion of a Sodium Oleate Tablet and Boat at an Oil-Water Interface.

    Science.gov (United States)

    Watahiki, Yasuhito; Nomoto, Tomonori; Chiari, Luca; Toyota, Taro; Fujinami, Masanori

    2018-05-15

    The self-propelled behaviors of macroscopic inanimate objects at surfaces and interfaces are ubiquitous phenomena of fundamental interest in interface science. However, given the existence of a large variety of systems with their own inherent chemical properties, the kinematics of the self-propelled motion and the dynamics of the forces driving these systems often remain largely unknown. Here, we experimentally investigate the spontaneous motion of a sodium oleate tablet at a water-nitrobenzene interface, under nonequilibrium and global isothermal conditions, through measurements of the interfacial tension with the noninvasive, quasi-elastic laser scattering method. The sodium oleate tablet was self-propelled due to an imbalance in the interfacial tension induced by the inhomogeneous adsorption of oleate/oleic acid molecules. The kinetics of the self-propelled motion of a boat-shaped plastic sheet bearing sodium oleate tablets at a sodium oleate aqueous solution-nitrobenzene interface was also studied. The interfacial tension difference between the front and rear of the boat was quantitatively identified as the force pushing the boat forward, although the Marangoni flow due to the uneven distribution of the interfacial tension behind the boat tended to decelerate the motion.

  17. Energy-imbalance mechanism of domain wall motion induced by propagation spin waves in finite magnetic nanostripe

    International Nuclear Information System (INIS)

    Zhu, Jinrong; Han, Zhaoyan; Su, Yuanchang; Hu, Jingguo

    2014-01-01

    The mechanism of the domain wall (DW) motions induced by spin wave in finite magnetic nanostripe is studied by micromagnetic simulations. We find that the spin-wave induced DM motions are always accompanied by an energy imbalance between two sides of the DW. The DW motion can be attributed to the expansion of the low-energy-density area and the contraction of the high-energy-density area. The energy imbalance strongly depends on whether the spin wave passes through the DW or is reflected by the DW. In the area of the spin wave propagation, the energy density increases with the time. However, in the superposition area of the incident spin wave and the reflected spin wave, the energy density decreases with the increasing of the time. It shows that this energy imbalance can be controlled by tuning the frequency of the spin wave. Finally, the effect of the damping parameter value is discussed. - Highlights: • The mechanism of the spin-wave induced DW motions is studied. • The spin-wave induced DW motions and the energy imbalance mechanism are given. • The DW motion with the same direction to that of SW is explained. • The DW motion with the opposite direction to that of SW is explained

  18. Trends in Modelling, Simulation and Design of Water Hydraulic Systems – Motion Control and Open-Ended Solutions

    DEFF Research Database (Denmark)

    Conrad, Finn

    2006-01-01

    is on the advantages using ordinary tap water and the range of application areas are illustrated with examples, in particular within the food processing industry, humidification operations, water mist systems for fire fighting, high water pressure cleaners, water moisturising systems for wood processing, lumber drying...... is that the components operate with pure water from the tap without additives of any kind. Hence water hydraulics takes the benefit of pure water as fluid being environmentally friendly, easy to clean sanitary design, non-toxic, non-flammable, inexpensive, readily available and easily disposable. The low-pressure tap......, dedicated pumps and accessories running with sea-water as fluid are available. A unique solution is to use reverse osmosis to generate drinking water from sea-water, and furthermore for several off-shore applications. Furthermore, tap water hydraulic components of the Nessie® family and examples of measured...

  19. The influence of large-amplitude librational motion on the hydrogen bond energy for alcohol–water complexes

    DEFF Research Database (Denmark)

    Andersen, Jonas; Heimdal, J.; Larsen, René Wugt

    2015-01-01

    is a superior hydrogen bond acceptor. The class of large-amplitude donor OH librational motion is shown to account for up to 5.1 kJ mol-1 of the destabilizing change of vibrational zero-point energy upon intermolecular OH...O hydrogen bond formation. The experimental findings are supported by complementary...

  20. THE ESSENTIAL DYNAMICS OF THERMOLYSIN - CONFIRMATION OF THE HINGE-BENDING MOTION AND COMPARISON OF SIMULATIONS IN VACUUM AND WATER

    NARCIS (Netherlands)

    van Aalten, D.M.F.; Amadei, A; Linssen, A.B M; Eijsink, V.G.H.; Vriend, G.; Berendsen, H.J.C.

    Comparisons of the crystal structures of thermolysin and the thermolysin-like protease produced by B. cereus have recently led to the hypothesis that neutral proteases undergo a hinge-bending motion. We have investigated this hypothesis by analyzing molecular dynamics simulations of thermolysin in

  1. Transformation of a Water Slug in Free Fall Under the Conditions of Exposure to an Air Flow Orthogonal to the Direction of the Slug Motion

    Science.gov (United States)

    Volkov, R. S.; Zabelin, M. V.; Kuznetsov, G. V.; Strizhak, P. A.

    2016-07-01

    An experimental study has been made of the influence of an orthogonal (side) air flow propagating with a velocity to 5 m/s on the phases of transformation of a water slug with an initial volume of 0.05-0.5 liter in free fall from a height of 3 m. Use was made of Phantom V411 and Phantom Miro M310 high-speed video cameras and a Tema Automotive software system with the function of continuous tracking. The laws of retardation of the phases of transformation of the water slug from the instant of formation to that of formation of a droplet cloud under the action of the air flow orthogonal to the direction of the slug motion, and also of the deceleration, removal, and destruction of the droplets and fragments of water separating from the slug surface, have been established.

  2. Functionalization of embedded thiol-ene waveguides for evanescent wave induced fluorescence detection in a microfluidic device

    DEFF Research Database (Denmark)

    Feidenhans'l, Nikolaj Agentoft; Jensen, Thomas Glasdam; Lafleur, Josiane P.

    2013-01-01

    We demonstrate the use of functional surface groups inherently present on off-stoichiometric thiol−ene polymers, for site-specific immobilization of biomolecules and detection by evanescent wave-induced fluorescence. An optofluidic chip featuring an embedded thiol−ene waveguide was selectively...... functionalized with biotin using photografting. The biotin was used for immobilization of fluorescently labelled streptavidin, and experiments revealed a linear correlation between streptavidin concentration and fluorescent intensity. To further demonstrate the attractiveness of using thiol−ene for optofluidic...

  3. Molecular water motions of skim milk powder solutions during acidification studied by 17O and 1H nuclear magnetic resonance and rheology

    DEFF Research Database (Denmark)

    Møller, S M; Whittaker, A. K.; Stokes, J. R.

    2011-01-01

    The molecular motion of water was studied in glucono-δ-lactone-acidified skim milk powder (SMP) solutions with various pH values and dry matter contents. NMR relaxometry measurements revealed that lowering the pH in SMP solutions affected 17O and 1HT2 relaxation rates almost identically. Conseque......The molecular motion of water was studied in glucono-δ-lactone-acidified skim milk powder (SMP) solutions with various pH values and dry matter contents. NMR relaxometry measurements revealed that lowering the pH in SMP solutions affected 17O and 1HT2 relaxation rates almost identically...... could contribute to the initial decrease in 17O and 1Hrelaxation rate in the pH range between 6.6 and 5.5 for 15% SMP and in the pH range between 6.6 and 5.9 for 25% SMP. However, below pH 5.5 the viscosity and 17Oand 1HNMRrelaxation rates did not correlate, revealing that the aggregation of casein...... micelles, which increases viscosity below pH 5.5, does not involve major repartitioning of water....

  4. Tsunami generation and associated waves in the water column and seabed due to an asymmetric earthquake motion within an anisotropic substratum

    Science.gov (United States)

    Bagheri, Amirhossein; Greenhalgh, Stewart; Khojasteh, Ali; Rahimian, Mohammad; Attarnejad, Reza

    2016-10-01

    In this paper, closed-form integral expressions are derived to describe how surface gravity waves (tsunamis) are generated when general asymmetric ground displacement (due to earthquake rupturing), involving both horizontal and vertical components of motion, occurs at arbitrary depth within the interior of an anisotropic subsea solid beneath the ocean. In addition, we compute the resultant hydrodynamic pressure within the seawater and the elastic wavefield within the seabed at any position. The method of potential functions and an integral transform approach, accompanied by a special contour integration scheme, are adopted to handle the equations of motion and produce the numerical results. The formulation accounts for any number of possible acoustic-gravity modes and is valid for both shallow and deep water situations as well as for any focal depth of the earthquake source. Phase and group velocity dispersion curves are developed for surface gravity (tsunami mode), acoustic-gravity, Rayleigh, and Scholte waves. Several asymptotic cases which arise from the general analysis are discussed and compared to existing solutions. The role of effective parameters such as hypocenter location and frequency of excitation is examined and illustrated through several figures which show the propagation pattern in the vertical and horizontal directions. Attention is directed to the unexpected contribution from the horizontal ground motion. The results have important application in several fields such as tsunami hazard prediction, marine seismology, and offshore and coastal engineering. In a companion paper, we examine the effect of ocean stratification on the appearance and character of internal and surface gravity waves.

  5. Invasion-wave-induced first-order phase transition in systems of active particles.

    Science.gov (United States)

    Ihle, Thomas

    2013-10-01

    An instability near the transition to collective motion of self-propelled particles is studied numerically by Enskog-like kinetic theory. While hydrodynamics breaks down, the kinetic approach leads to steep solitonlike waves. These supersonic waves show hysteresis and lead to an abrupt jump of the global order parameter if the noise level is changed. Thus they provide a mean-field mechanism to change the second-order character of the phase transition to first order. The shape of the wave is shown to follow a scaling law and to quantitatively agree with agent-based simulations.

  6. Effect of motion-induced PET-CT misalignment on cardiac function and myocardial blood flow measured using dynamic 15O-water PET

    DEFF Research Database (Denmark)

    Lubberink, Mark; Ebrahimi, M; Harms, Hans

    -CT misalignment on MBF, transmural MBF (MBFt), perfusable tissue fraction (PTF), cardiac output (CO), stroke volume (SV) and left-ventricular ejection fraction (LVEF) based on dynamic 15O-water scans. Methods: 10 patients underwent 6 min PET scans after injection of 400 MBq 15O-water at rest and during adenosine......Aim: Motion-induced PET-CT misalignment artifacts are common in myocardial blood flow (MBF) measurements with 82Rb and 13N-ammonia. For 15O-water, MBF is based on the clearance rate rather than uptake of the tracer. The clearance rate is determined by the shape of the time-activity curve, not its...... amplitude, and is thus not affected by attenuation correction errors. Hence, misalignment is hypothesized not to affect 15O-water-based MBF to any large extent, but it may affect cardiac function measures derived from 15O-water scans. The aim of the present work was to assess the effect of PET...

  7. Rainfall simulation and Structure-from-Motion photogrammetry for the analysis of soil water erosion in Mediterranean vineyards

    NARCIS (Netherlands)

    Prosdocimi, Massimo; Burguet, Maria; Prima, Di Simone; Sofia, Giulia; Terol, Enric; Rodrigo Comino, Jesús; Cerda Bolinches, Artemio; Tarolli, Paolo

    2017-01-01

    Soil water erosion is a serious problem, especially in agricultural lands. Among these, vineyards deserve attention, because they constitute for the Mediterranean areas a type of land use affected by high soil losses. A significant problem related to the study of soil water erosion in these areas

  8. Oblique Wave-Induced Responses of A VLFS Edged with A Pair of Inclined Perforated Plates

    Science.gov (United States)

    Cheng, Yong; Ji, Chun-yan; Zhai, Gang-jun; Oleg, Gaidai

    2018-03-01

    This paper is concerned with the hydroelastic responses of a mat-like, rectangular very large floating structure (VLFS) edged with a pair of horizontal/inclined perforated anti-motion plates in the context of the direct coupling method. The updated Lagrangian formulae are applied to establish the equilibrium equations of the VLFS and the total potential formula is employed for fluids in the numerical model including the viscous effect of the perforated plates through the Darcy's law. The hybrid finite element-boundary element (FE-BE) method is implemented to determine the response reduction of VLFS with attached perforated plates under various oblique incident waves. Also, the numerical solutions are validated against a series of experimental tests. The effectiveness of the attached perforated plates in reducing the deflections of the VLFS can be significantly improved by selecting the proper design parameters such as the porous parameter, submergence depth, plate width and inclination angle for the given sea conditions.

  9. Estimating Wind and Wave Induced Forces On a Floating Wind Turbine

    DEFF Research Database (Denmark)

    Henriksen, Lars Christian; Natarajan, Anand; Kim, Taeseong

    2013-01-01

    -principles derived state space model of the floating wind turbine. The ability to estimate aero- and hydrodynamic states could prove crucial for the performance of model-based control methods applied on floating wind turbines. Furthermore, two types of water kinematics have been compared two determine whether......In this work, the basic model for a spar buoy floating wind turbine [1], used by an extended Kalman filter, is presented and results concerning wind speed and wave force estimations are shown. The wind speed and aerodynamic forces are estimated using an extended Kalman filter based on a first...... or not linear and nonlinear water kinematics lead to significantly different loads....

  10. MODELING WAVE-INDUCED ENTRAINMENT OF MUD IN NEWNANS LAKE, FLORIDA

    Science.gov (United States)

    Many shallow lakes in the southeastern US are eutrophic, and as such, the water quality in these lakes is of concern to state and federal environmental regulatory agencies. Some of these lakes have been classified as impaired with one or more nutrients being the stressor. For the...

  11. In situ-observation of the vertical motion of soil waters by means of deuterated water using the gamma/neutron method: Laboratory and field

    International Nuclear Information System (INIS)

    Moutonnet, P.; Couchat, P.; Brissaud, F.; Puard, M.; Pappalardo, A.

    1978-01-01

    In order to study water movements in the field, the gamma/neutron method for measuring deuterated water was investigated. A laboratory device is presented which supplies measurements on 5 ml soil solution samples. A probe for in situ experiments is studied in all its performances: Background, calibration (count rate versus volumetric deuterated water content) and resolution. A dispersive transport of D 2 O pulses on soil column is presented and checked with a numerical simulation model. Then simultaneous measurement of soil water content and D 2 O concentration by neutron moisture gauge and gamma/neutron probe enable us to interpret the evolution of D 2 O pulse with an experimental field irrigation. (orig.) [de

  12. Auditory Motion Elicits a Visual Motion Aftereffect

    Directory of Open Access Journals (Sweden)

    Christopher C. Berger

    2016-12-01

    Full Text Available The visual motion aftereffect is a visual illusion in which exposure to continuous motion in one direction leads to a subsequent illusion of visual motion in the opposite direction. Previous findings have been mixed with regard to whether this visual illusion can be induced cross-modally by auditory stimuli. Based on research on multisensory perception demonstrating the profound influence auditory perception can have on the interpretation and perceived motion of visual stimuli, we hypothesized that exposure to auditory stimuli with strong directional motion cues should induce a visual motion aftereffect. Here, we demonstrate that horizontally moving auditory stimuli induced a significant visual motion aftereffect—an effect that was driven primarily by a change in visual motion perception following exposure to leftward moving auditory stimuli. This finding is consistent with the notion that visual and auditory motion perception rely on at least partially overlapping neural substrates.

  13. Auditory Motion Elicits a Visual Motion Aftereffect.

    Science.gov (United States)

    Berger, Christopher C; Ehrsson, H Henrik

    2016-01-01

    The visual motion aftereffect is a visual illusion in which exposure to continuous motion in one direction leads to a subsequent illusion of visual motion in the opposite direction. Previous findings have been mixed with regard to whether this visual illusion can be induced cross-modally by auditory stimuli. Based on research on multisensory perception demonstrating the profound influence auditory perception can have on the interpretation and perceived motion of visual stimuli, we hypothesized that exposure to auditory stimuli with strong directional motion cues should induce a visual motion aftereffect. Here, we demonstrate that horizontally moving auditory stimuli induced a significant visual motion aftereffect-an effect that was driven primarily by a change in visual motion perception following exposure to leftward moving auditory stimuli. This finding is consistent with the notion that visual and auditory motion perception rely on at least partially overlapping neural substrates.

  14. Auditory motion capturing ambiguous visual motion

    Directory of Open Access Journals (Sweden)

    Arjen eAlink

    2012-01-01

    Full Text Available In this study, it is demonstrated that moving sounds have an effect on the direction in which one sees visual stimuli move. During the main experiment sounds were presented consecutively at four speaker locations inducing left- or rightwards auditory apparent motion. On the path of auditory apparent motion, visual apparent motion stimuli were presented with a high degree of directional ambiguity. The main outcome of this experiment is that our participants perceived visual apparent motion stimuli that were ambiguous (equally likely to be perceived as moving left- or rightwards more often as moving in the same direction than in the opposite direction of auditory apparent motion. During the control experiment we replicated this finding and found no effect of sound motion direction on eye movements. This indicates that auditory motion can capture our visual motion percept when visual motion direction is insufficiently determinate without affecting eye movements.

  15. Motion Sickness

    Science.gov (United States)

    ... potatoes. Don’t eat greasy, spicy, or acidic foods just before or during travel. Drink plenty of water. Avoid alcohol. Get a ... Conditions Prevention and Wellness Staying Healthy Healthy Living Travel ... myhealthfinder Food and Nutrition Healthy Food Choices Weight Loss and ...

  16. Motion control report

    CERN Document Server

    2013-01-01

    Please note this is a short discount publication. In today's manufacturing environment, Motion Control plays a major role in virtually every project.The Motion Control Report provides a comprehensive overview of the technology of Motion Control:* Design Considerations* Technologies* Methods to Control Motion* Examples of Motion Control in Systems* A Detailed Vendors List

  17. Wave Loads on Ships Sailing in Restricted Water Depth

    DEFF Research Database (Denmark)

    Vidic-Perunovic, Jelena; Jensen, Jørgen Juncher

    2003-01-01

    depth for a container vessel. The results show that if the water depth is less than two times the draft of the vessel, the wave-induced bending moment becomes significant larger than in deep water with the same sea state description. The peak in the frequency response function for the wave bending......The wave-induced bending moment in ships is the most important sea load parameter for ships larger than 100m in length. Hence, any rational ship design procedure must include a reasonable accurate determination of this load and a large amount of various hydrodynamic formulations have been published......, ranging from semi-empirical formulas to three-dimensional non-linear procedures. A review of the state-of-the art can be found in ISSC.VI.1 (2000). These procedures must be combined with operational and sea state information to predict the probability distribution of the maximum wave-induced bending...

  18. Interferometric investigation of shock waves induced by a TEA-CO2 laser produced plasma in air in front of a solid target

    International Nuclear Information System (INIS)

    Apostol, D.; Apostol, I.; Cojocaru, E.; Draganescu, V.; Mihailescu, N.I.; Morjan, I.; Konov, I.V.

    1979-06-01

    The shock waves induced in the surrounding atmosphere by an air plasma were investigated by laser interferometry. The air breakdown plasma was produced by a TEA-CO 2 laser in front of a solid target. The results were compared to the predictions of theory of intense explosions in gases and a good agreement was inferred. It was also determined that the symmetry of the expansion of the initial shock wave is determined by the plasma source shape and, accordingly, depends on the laser power density incident on the target surface. However, for further stages all the shock waves expand spherically. (author)

  19. Motion in radiotherapy

    DEFF Research Database (Denmark)

    Korreman, Stine Sofia

    2012-01-01

    This review considers the management of motion in photon radiation therapy. An overview is given of magnitudes and variability of motion of various structures and organs, and how the motion affects images by producing artifacts and blurring. Imaging of motion is described, including 4DCT and 4DPE...

  20. Wave-induced coherent turbulence structures and sediment resuspension in the nearshore of a prototype-scale sandy barrier beach

    Science.gov (United States)

    Kassem, Hachem; Thompson, Charlotte E. L.; Amos, Carl L.; Townend, Ian H.

    2015-10-01

    The suspension of sediments by oscillatory flows is a complex case of fluid-particle interaction. The aim of this study is to provide insight into the spatial (time) and scale (frequency) relationships between wave-generated boundary layer turbulence and event-driven sediment transport beneath irregular shoaling and breaking waves in the nearshore of a prototype sandy barrier beach, using data collected through the Barrier Dynamics Experiment II (BARDEX II). Statistical, quadrant and spectral analyses reveal the anisotropic and intermittent nature of Reynolds' stresses (momentum exchange) in the wave boundary layer, in all three orthogonal planes of motion. The fractional contribution of coherent turbulence structures appears to be dictated by the structural form of eddies beneath plunging and spilling breakers, which in turn define the net sediment mobilisation towards or away from the barrier, and hence ensuing erosion and accretion trends. A standing transverse wave is also observed in the flume, contributing to the substantial skewness of spanwise turbulence. Observed low frequency suspensions are closely linked to the mean flow (wave) properties. Wavelet analysis reveals that the entrainment and maintenance of sediment in suspension through a cluster of bursting sequence is associated with the passage of intermittent slowly-evolving large structures, which can modulate the frequency of smaller motions. Outside the boundary layer, small scale, higher frequency turbulence drives the suspension. The extent to which these spatially varied perturbation clusters persist is associated with suspension events in the high frequency scales, decaying as the turbulent motion ceases to supply momentum, with an observed hysteresis effect.

  1. Water

    Science.gov (United States)

    ... www.girlshealth.gov/ Home Nutrition Nutrition basics Water Water Did you know that water makes up more ... to drink more water Other drinks How much water do you need? top Water is very important, ...

  2. Motion Transplantation Techniques: A Survey

    NARCIS (Netherlands)

    van Basten, Ben; Egges, Arjan

    2012-01-01

    During the past decade, researchers have developed several techniques for transplanting motions. These techniques transplant a partial auxiliary motion, possibly defined for a small set of degrees of freedom, on a base motion. Motion transplantation improves motion databases' expressiveness and

  3. Vertical pressure gradient and particle motions in wave boundary layers

    DEFF Research Database (Denmark)

    Jensen, Karsten Lindegård

    . The experiment is conducted in a oscillating water tunnel, for both smooth bed and rough bed. The particle motion is determined by utilizing particle tracking base on a video recording of the particle motion in the flow. In the oscillatory flow, in contrast to steady current, the particle motion is a function...

  4. A 2D fluid motion model of the estuarine water circulation: Physical analysis of the salinity stratification in the Sebou estuary

    Science.gov (United States)

    Haddout, Soufiane; Maslouhi, Abdellatif; Magrane, Bouchaib

    2018-02-01

    Estuaries, which are coastal bodies of water connecting the riverine and marine environment, are among the most important ecosystems in the world. Saltwater intrusion is the movement of coastal saline water into an estuary, which makes up-estuary water, that becomes salty due to the mixing of freshwater with saltwater. It has become a serious environmental problem in the Sebou estuary (Morocco) during wet and dry seasons, which have a considerable impact on residential water supply, agricultural water supply as well as urban industrial production. The variations of salt intrusion, and the vertical stratification under different river flow conditions in the Sebou estuary were investigated in this paper using a two-dimensional numerical model. The model was calibrated and verified against water level variation, and salinity variation during 2016, respectively. Additionally, the model validation process showed that the model results fit the observed data fairly well ( R2 > 0.85, NSC > 0.89 and RMSE = 0.26 m). Model results show that freshwater is a dominant influencing factor to the saltwater intrusion and controlled salinity structure, vertical stratification and length of the saltwater intrusion. Additionally, the extent of salinity intrusion depends on the balance between fresh water discharges and saltwater flow from the sea. This phenomenon can be reasonably predicted recurring to mathematical models supported by monitored data. These tools can be used to quantify how much fresh water is required to counterbalance salinity intrusion at the upstream water intakes.

  5. Shadowgraph studies of laser-assisted non-thermal structuring of thin layers on flexible substrates by shock-wave-induced delamination processes

    Energy Technology Data Exchange (ETDEWEB)

    Lorenz, Pierre, E-mail: pierre.lorenz@iom-leipzig.de [Leibniz-Institut für Oberflächenmodifizierung e. V., Permoserstraße 15, 04318 Leipzig (Germany); Smausz, Tomi [Department of Optics and Quantum Electronics, University of Szeged, H-6720 Szeged, Dóm tér 9 (Hungary); MTA-SZTE Research Group on Photoacoustic Spectroscopy, University of Szeged, H-6720 Szeged, Dóm tér 9 (Hungary); Csizmadia, Tamas [Department of Optics and Quantum Electronics, University of Szeged, H-6720 Szeged, Dóm tér 9 (Hungary); Ehrhardt, Martin; Zimmer, Klaus [Leibniz-Institut für Oberflächenmodifizierung e. V., Permoserstraße 15, 04318 Leipzig (Germany); Hopp, Bela [Department of Optics and Quantum Electronics, University of Szeged, H-6720 Szeged, Dóm tér 9 (Hungary)

    2015-05-01

    Highlights: • The shock-wave-induced film delamination (SWIFD) is a laser patterning process. • The SWIFD process of CIGS solar cells was studied by shadowgraph measurements. • The study presented that SWIFD allows the structuring of CIGS solar cells. • The dynamics of the delamination process was analyzed. - Abstract: The laser-assisted microstructuring of thin films especially for electronic applications without damaging the layers or the substrates is a challenge for the laser micromachining techniques. The laser-induced thin-film patterning by ablation of the polymer substrate at the rear side that is called ‘SWIFD’ – shock-wave-induced film delamination patterning has been demonstrated. This study focuses on the temporal sequence of processes that characterize the mechanism of this SWIFD process on a copper indium gallium selenide (CIGS) solar cell stacks on polyimide. For this purpose high-speed shadowgraph experiments were performed in a pump probe experimental set-up using a KrF excimer laser for ablating the rear side of the polyimide substrate and measuring the shock wave generation at laser ablation of the polymer substrate as well as the thin-film delamination. The morphology and size of the thin-film structures were studied by scanning electron microscopy (SEM). Furthermore, the composition after the laser treatment was analyzed by energy dispersive X-ray (EDX) spectroscopy. The shadowgraph experiments allow the time-dependent identification and evaluation of the shock wave formation, substrate bending, and delamination of the thin film in dependence on the laser parameters. These results will contribute to improve the physical understanding of the laser-induced delamination effect for thin-film patterning.

  6. Neuro-fuzzy control strategy for an offshore steel jacket platform subjected to wave-induced forces using magneto rheological dampers

    International Nuclear Information System (INIS)

    Sarrafan, Atabak; Zareh, Seiyed Hamid; Khayyat, Amir Ali Akbar; Zabihollah, Abolghassem

    2012-01-01

    Magnetorheological (MR) damper is a prominent semi-active control device to vibrate mitigation of structures. Due to the inherent non-linear nature of MR damper, an intelligent non-linear neuro-fuzzy control strategy is designed to control wave-induced vibration of an offshore steel jacket platform equipped with MR dampers. In the proposed control system, a dynamic-feedback neural network is adapted to model non-linear dynamic system, and the fuzzy logic controller is used to determine the control forces of MR dampers. By use of two feed forward neural networks required voltages and actual MR damper forces are obtained, in which the first neural network and the second one acts as the inverse dynamics model, and the forward dynamics model of the MR dampers, respectively. The most important characteristic of the proposed intelligent control strategy is its inherent robustness and its ability to handle the non-linear behavior of the system. Besides, no mathematical model needed to calculate forces produced by MR dampers. According to linearized Morison equation, wave-induced forces are determined. The performance of the proposed neuro-fuzzy control system is compared with that of a traditional semi-active control strategy, i.e., clipped optimal control system with LQG-target controller, through computer simulations, while the uncontrolled system response is used as the baseline. It is demonstrated that the design of proposed control system framework is more effective than that of the clipped optimal control scheme with LQG-target controller to reduce the vibration of offshore structure. Furthermore, the control strategy is very important for semi-active control

  7. Attention and apparent motion.

    Science.gov (United States)

    Horowitz, T; Treisman, A

    1994-01-01

    Two dissociations between short- and long-range motion in visual search are reported. Previous research has shown parallel processing for short-range motion and apparently serial processing for long-range motion. This finding has been replicated and it has also been found that search for short-range targets can be impaired both by using bicontrast stimuli, and by prior adaptation to the target direction of motion. Neither factor impaired search in long-range motion displays. Adaptation actually facilitated search with long-range displays, which is attributed to response-level effects. A feature-integration account of apparent motion is proposed. In this theory, short-range motion depends on specialized motion feature detectors operating in parallel across the display, but subject to selective adaptation, whereas attention is needed to link successive elements when they appear at greater separations, or across opposite contrasts.

  8. Objects in Motion

    Science.gov (United States)

    Damonte, Kathleen

    2004-01-01

    One thing scientists study is how objects move. A famous scientist named Sir Isaac Newton (1642-1727) spent a lot of time observing objects in motion and came up with three laws that describe how things move. This explanation only deals with the first of his three laws of motion. Newton's First Law of Motion says that moving objects will continue…

  9. Motion compensated digital tomosynthesis

    NARCIS (Netherlands)

    van der Reijden, Anneke; van Herk, Marcel; Sonke, Jan-Jakob

    2013-01-01

    Digital tomosynthesis (DTS) is a limited angle image reconstruction method for cone beam projections that offers patient surveillance capabilities during VMAT based SBRT delivery. Motion compensation (MC) has the potential to mitigate motion artifacts caused by respiratory motion, such as blur. The

  10. Rolling Shutter Motion Deblurring

    KAUST Repository

    Su, Shuochen

    2015-06-07

    Although motion blur and rolling shutter deformations are closely coupled artifacts in images taken with CMOS image sensors, the two phenomena have so far mostly been treated separately, with deblurring algorithms being unable to handle rolling shutter wobble, and rolling shutter algorithms being incapable of dealing with motion blur. We propose an approach that delivers sharp and undis torted output given a single rolling shutter motion blurred image. The key to achieving this is a global modeling of the camera motion trajectory, which enables each scanline of the image to be deblurred with the corresponding motion segment. We show the results of the proposed framework through experiments on synthetic and real data.

  11. Smoothing Motion Estimates for Radar Motion Compensation.

    Energy Technology Data Exchange (ETDEWEB)

    Doerry, Armin W. [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States)

    2017-07-01

    Simple motion models for complex motion environments are often not adequate for keeping radar data coherent. Eve n perfect motion samples appli ed to imperfect models may lead to interim calculations e xhibiting errors that lead to degraded processing results. Herein we discuss a specific i ssue involving calculating motion for groups of pulses, with measurements only available at pulse-group boundaries. - 4 - Acknowledgements This report was funded by General A tomics Aeronautical Systems, Inc. (GA-ASI) Mission Systems under Cooperative Re search and Development Agre ement (CRADA) SC08/01749 between Sandia National Laboratories and GA-ASI. General Atomics Aeronautical Systems, Inc. (GA-ASI), an affilia te of privately-held General Atomics, is a leading manufacturer of Remotely Piloted Aircraft (RPA) systems, radars, and electro-optic and rel ated mission systems, includin g the Predator(r)/Gray Eagle(r)-series and Lynx(r) Multi-mode Radar.

  12. Curves from Motion, Motion from Curves

    Science.gov (United States)

    2000-01-01

    De linearum curvarum cum lineis rectis comparatione dissertatio geometrica - an appendix to a treatise by de Lalouv~re (this was the only publication... correct solution to the problem of motion in the gravity of a permeable rotating Earth, considered by Torricelli (see §3). If the Earth is a homogeneous...in 1686, which contains the correct solution as part of a remarkably comprehensive theory of orbital motions under centripetal forces. It is a

  13. Structural motion engineering

    CERN Document Server

    Connor, Jerome

    2014-01-01

    This innovative volume provides a systematic treatment of the basic concepts and computational procedures for structural motion design and engineering for civil installations. The authors illustrate the application of motion control to a wide spectrum of buildings through many examples. Topics covered include optimal stiffness distributions for building-type structures, the role of damping in controlling motion, tuned mass dampers, base isolation systems, linear control, and nonlinear control. The book's primary objective is the satisfaction of motion-related design requirements, such as restrictions on displacement and acceleration. The book is ideal for practicing engineers and graduate students. This book also: ·         Broadens practitioners' understanding of structural motion control, the enabling technology for motion-based design ·         Provides readers the tools to satisfy requirements of modern, ultra-high strength materials that lack corresponding stiffness, where the motion re...

  14. Hydraulic paths and estimation of the real residence time of the water in Lago Maggiore (N. Italy: application of massless markers transported in 3D motion fields

    Directory of Open Access Journals (Sweden)

    Nicoletta Sala

    2012-01-01

    Full Text Available This study, conducted using the TRIM_LM model, is a continuation of work on the movement of the water mass at different depths in Lago Maggiore, and thus on the estimation of the real residence time of the water in the lake. Three-dimensional CFD numerical simulations were extended to a 4-year period, focusing on the movements of 202 (two hundred and two massless markers inserted at different points in Lago Maggiore and at the mouths of 11 of its tributaries, enabling us to establish more realistic water renewal times for Lago Maggiore. By crossing the data of the horizontal trajectories of the environmental markers with those of their vertical variations, we reconstructed their movements over the four years of the simulation programme. An analysis of the results shows that the water mass in the layers of the upper 100 m has residence times between a minimum of 1 y and a maximum of 4-5 y. The water from the tributaries has residence times between 250 and 1000 days, depending on the distance of the tributaries from the closing section of the lake. The water in the layers below 100 m has residence times that still cannot be quantified with precision, but that can certainly be estimated at a number of years in two figures. These times are strongly conditioned by the depth of the late winter mixing, which in the last 40 y has not exceeded 200 m.

  15. Observations of wave-induced pore pressure gradients and bed level response on a surf zone sandbar

    Science.gov (United States)

    Anderson, Dylan; Cox, Dan; Mieras, Ryan; Puleo, Jack A.; Hsu, Tian-Jian

    2017-06-01

    Horizontal and vertical pressure gradients may be important physical mechanisms contributing to onshore sediment transport beneath steep, near-breaking waves in the surf zone. A barred beach was constructed in a large-scale laboratory wave flume with a fixed profile containing a mobile sediment layer on the crest of the sandbar. Horizontal and vertical pore pressure gradients were obtained by finite differences of measurements from an array of pressure transducers buried within the upper several centimeters of the bed. Colocated observations of erosion depth were made during asymmetric wave trials with wave heights between 0.10 and 0.98 m, consistently resulting in onshore sheet flow sediment transport. The pore pressure gradient vector within the bed exhibited temporal rotations during each wave cycle, directed predominantly upward under the trough and then rapidly rotating onshore and downward as the wavefront passed. The magnitude of the pore pressure gradient during each phase of rotation was correlated with local wave steepness and relative depth. Momentary bed failures as deep as 20 grain diameters were coincident with sharp increases in the onshore-directed pore pressure gradients, but occurred at horizontal pressure gradients less than theoretical critical values for initiation of the motion for compact beds. An expression combining the effects of both horizontal and vertical pore pressure gradients with bed shear stress and soil stability is used to determine that failure of the bed is initiated at nonnegligible values of both forces.type="synopsis">type="main">Plain Language SummaryThe pressure gradient present within the seabed beneath breaking waves may be an important physical mechanism transporting sediment. A large-scale laboratory was used to replicate realistic surfzone conditions in controlled tests, allowing for horizontal and vertical pressure gradient magnitudes and the resulting sediment bed response to be observed with precise instruments

  16. Brownian motion using video capture

    International Nuclear Information System (INIS)

    Salmon, Reese; Robbins, Candace; Forinash, Kyle

    2002-01-01

    Although other researchers had previously observed the random motion of pollen grains suspended in water through a microscope, Robert Brown's name is associated with this behaviour based on observations he made in 1828. It was not until Einstein's work in the early 1900s however, that the origin of this irregular motion was established to be the result of collisions with molecules which were so small as to be invisible in a light microscope (Einstein A 1965 Investigations on the Theory of the Brownian Movement ed R Furth (New York: Dover) (transl. Cowper A D) (5 papers)). Jean Perrin in 1908 (Perrin J 1923 Atoms (New York: Van Nostrand-Reinhold) (transl. Hammick D)) was able, through a series of painstaking experiments, to establish the validity of Einstein's equation. We describe here the details of a junior level undergraduate physics laboratory experiment where students used a microscope, a video camera and video capture software to verify Einstein's famous calculation of 1905. (author)

  17. Motion and relativity

    CERN Document Server

    Infeld, Leopold

    1960-01-01

    Motion and Relativity focuses on the methodologies, solutions, and approaches involved in the study of motion and relativity, including the general relativity theory, gravitation, and approximation.The publication first offers information on notation and gravitational interaction and the general theory of motion. Discussions focus on the notation of the general relativity theory, field values on the world-lines, general statement of the physical problem, Newton's theory of gravitation, and forms for the equation of motion of the second kind. The text then takes a look at the approximation meth

  18. Brain Image Motion Correction

    DEFF Research Database (Denmark)

    Jensen, Rasmus Ramsbøl; Benjaminsen, Claus; Larsen, Rasmus

    2015-01-01

    The application of motion tracking is wide, including: industrial production lines, motion interaction in gaming, computer-aided surgery and motion correction in medical brain imaging. Several devices for motion tracking exist using a variety of different methodologies. In order to use such devices...... offset and tracking noise in medical brain imaging. The data are generated from a phantom mounted on a rotary stage and have been collected using a Siemens High Resolution Research Tomograph for positron emission tomography. During acquisition the phantom was tracked with our latest tracking prototype...

  19. The effect of a jet stream on the generation of mountain wave-induced mean flows and turbulence near the tropopause

    Science.gov (United States)

    Dörnbrack, Andreas; Sharman, Robert

    2015-04-01

    Observational evidence indicates a higher incidence of turbulence near the tropopause, especially over mountainous terrain. Previous work by McHugh and Sharman (2013) indicate this may be due to nonlinear amplification of topographically-induced gravity waves as they impinge on the tropopause. However, that study did not consider nonlinear topography amplification effects, nor did it consider the more realistic case of a jet stream in the vicinity of the tropopause. This study extends the McHugh and Sharman study by considering these effects using fully nonlinear simulations with the jet modeled as a sech**2 profile. Sensitivity studies are performed to study such effects as the location of the nose of the jet relative to the tropopause height, the jet width, the height of the tropopause, and the size and shape of the obstacle. Momentum and energy flux profiles are used to deduce those configurations most conducive to gravity wave amplification, breakdown and turbulence near the tropopause. McHugh J., Sharman R., 2013: Generation of mountain wave-induced mean flows and turbulence near the tropopause. Q. J. R. Meteorol. Soc. 139: 1632-1642. DOI:10.1002/qj.2035

  20. Wave-induced Maintenance of Suspended Sediment Concentration during Slack in a Tidal Channel on a Sheltered Macro-tidal Flat, Gangwha Island, Korea

    Science.gov (United States)

    Lee, Guan-hong; Kang, KiRyong

    2018-05-01

    A field campaign was conducted to better understand the influence of wave action, in terms of turbulence and bed shear stress, on sediment resuspension and transport processes on a protected tidal flat. An H-frame was deployed in a tidal channel south of Gangwha Island for 6 tidal cycles during November 2006 with instrumentation including an Acoustic Doppler Velocimeter, an Acoustic Backscatter System, and an Optical Backscatter Sensor. During calm conditions, the current-induced shear was dominant and responsible for suspending sediments during the accelerating phases of flood and ebb. During the high-tide slack, both bed shear stress and suspended sediment concentration were reduced. The sediment flux was directed landward due to the scour-lag effect over a tidal cycle. On the other hand, when waves were stronger, the wave-induced turbulence appeared to keep sediments in suspension even during the high-tide slack, while the current-induced shear remained dominant during the accelerating phases of flood and ebb. The sediment flux under strong waves was directed offshore due to the sustained high suspended sediment concentration during the high-tide slack. Although strong waves can induce offshore sediment flux, infrequent events with strong waves are unlikely to alter the long-term accretion of the protected southern Gangwha tidal flats.

  1. Characteristics of storms driving wave-induced seafloor mobility on the U.S. East Coast continental shelf

    Science.gov (United States)

    Dalyander, P. Soupy; Butman, Bradford

    2015-01-01

    This study investigates the relationship between spatial and temporal patterns of wave-driven sediment mobility events on the U.S. East Coast continental shelf and the characteristics of the storms responsible for them. Mobility events, defined as seafloor wave stress exceedance of the critical stress of 0.35 mm diameter sand (0.2160 Pa) for 12 or more hours, were identified from surface wave observations at National Data Buoy Center buoys in the Middle Atlantic Bight (MAB) and South Atlantic Bight (SAB) over the period of 1997-2007. In water depths ranging from 36-48 m, there were 4-9 mobility events/year of 1-2 days duration. Integrated wave stress during events (IWAVES) was used as a combined metric of wave-driven mobility intensity and duration. In the MAB, over 67% of IWAVES was caused by extratropical storms, while in the SAB, greater than 66% of IWAVES was caused by tropical storms. On average, mobility events were caused by waves generated by storms located 800+ km away. Far-field hurricanes generated swell 2-4 days before the waves caused mobility on the shelf. Throughout most of the SAB, mobility events were driven by storms to the south, east, and west. In the MAB and near Cape Hatteras, winds from more northerly storms and low-pressure extratropical systems in the mid-western U.S. also drove mobility events. Waves generated by storms off the SAB generated mobility events along the entire U.S. East Coast shelf north to Cape Cod, while Cape Hatteras shielded the SAB area from swell originating to the north offshore of the MAB.

  2. Water

    Science.gov (United States)

    ... drink and water in food (like fruits and vegetables). 6. Of all the earth’s water, how much is ocean or seas? 97 percent of the earth’s water is ocean or seas. 7. How much of the world’s water is frozen? Of all the water on earth, about 2 percent is frozen. 8. How much ...

  3. Projectile Motion Hoop Challenge

    Science.gov (United States)

    Jordan, Connor; Dunn, Amy; Armstrong, Zachary; Adams, Wendy K.

    2018-01-01

    Projectile motion is a common phenomenon that is used in introductory physics courses to help students understand motion in two dimensions. Authors have shared a range of ideas for teaching this concept and the associated kinematics in "The Physics Teacher" ("TPT"); however, the "Hoop Challenge" is a new setup not…

  4. Temporal logic motion planning

    CSIR Research Space (South Africa)

    Seotsanyana, M

    2010-01-01

    Full Text Available In this paper, a critical review on temporal logic motion planning is presented. The review paper aims to address the following problems: (a) In a realistic situation, the motion planning problem is carried out in real-time, in a dynamic, uncertain...

  5. Aristotle, Motion, and Rhetoric.

    Science.gov (United States)

    Sutton, Jane

    Aristotle rejects a world vision of changing reality as neither useful nor beneficial to human life, and instead he reaffirms both change and eternal reality, fuses motion and rest, and ends up with "well-behaved" changes. This concept of motion is foundational to his world view, and from it emerges his theory of knowledge, philosophy of…

  6. Stochastic ground motion simulation

    Science.gov (United States)

    Rezaeian, Sanaz; Xiaodan, Sun; Beer, Michael; Kougioumtzoglou, Ioannis A.; Patelli, Edoardo; Siu-Kui Au, Ivan

    2014-01-01

    Strong earthquake ground motion records are fundamental in engineering applications. Ground motion time series are used in response-history dynamic analysis of structural or geotechnical systems. In such analysis, the validity of predicted responses depends on the validity of the input excitations. Ground motion records are also used to develop ground motion prediction equations(GMPEs) for intensity measures such as spectral accelerations that are used in response-spectrum dynamic analysis. Despite the thousands of available strong ground motion records, there remains a shortage of records for large-magnitude earthquakes at short distances or in specific regions, as well as records that sample specific combinations of source, path, and site characteristics.

  7. Water

    International Nuclear Information System (INIS)

    Chovanec, A.; Grath, J.; Kralik, M.; Vogel, W.

    2002-01-01

    An up-date overview of the situation of the Austrian waters is given by analyzing the status of the water quality (groundwater, surface waters) and water protection measures. Maps containing information of nitrate and atrazine in groundwaters (analyses at monitoring stations), nitrate contents and biological water quality of running waters are included. Finally, pollutants (nitrate, orthophosphate, ammonium, nitrite, atrazine etc.) trends in annual mean values and median values for the whole country for the years 1992-1999 are presented in tables. Figs. 5. (nevyjel)

  8. Water

    Science.gov (United States)

    ... can be found in some metal water taps, interior water pipes, or pipes connecting a house to ... reduce or eliminate lead. See resources below. 5. Children and pregnant women are especially vulnerable to the ...

  9. Toying with Motion.

    Science.gov (United States)

    Galus, Pamela J.

    2002-01-01

    Presents a variety of activities that support the development of an understanding of Newton's laws of motion. Activities use toy cars, mobile roads, and a seat-of-nails. Includes a scoring rubric. (DDR)

  10. Projectile Motion Hoop Challenge

    Science.gov (United States)

    Jordan, Connor; Dunn, Amy; Armstrong, Zachary; Adams, Wendy K.

    2018-04-01

    Projectile motion is a common phenomenon that is used in introductory physics courses to help students understand motion in two dimensions. Authors have shared a range of ideas for teaching this concept and the associated kinematics in The Physics Teacher; however, the "Hoop Challenge" is a new setup not before described in TPT. In this article an experiment is illustrated to explore projectile motion in a fun and challenging manner that has been used with both high school and university students. With a few simple materials, students have a vested interest in being able to calculate the height of the projectile at a given distance from its launch site. They also have an exciting visual demonstration of projectile motion when the lab is over.

  11. Travelers' Health: Motion Sickness

    Science.gov (United States)

    ... sickness, especially when pregnant, menstruating, or on hormones. Race/ethnicity—Asians may be more susceptible to motion ... it, sitting in the front seat of a car or bus, sitting over the wing of an ...

  12. Dizziness and Motion Sickness

    Science.gov (United States)

    ... that extends into the inner ear can completely destroy both the hearing and equilibrium function of that ... motion sickness: •Do not read while traveling •Avoid sitting in the rear seat •Do not sit in ...

  13. Motion Sickness: First Aid

    Science.gov (United States)

    ... com. Accessed July 29, 2017. Priesol AJ. Motion sickness. https://www.uptodate.com/content/search. Accessed July 29, 2017. Brunette GW, et al. CDC Health Information for International Travel 2018. New York, N. ...

  14. Visual Motion Perception

    Science.gov (United States)

    1991-08-15

    displace- ment limit for motion in random dots," Vision Res., 24, 293-300. Pantie , A. & K. Turano (1986) "Direct comparisons of apparent motions...Hicks & AJ, Pantie (1978) "Apparent movement of successively generated subjec. uve figures," Perception, 7, 371-383. Ramachandran. V.S. & S.M. Anstis...thanks think deaf girl until world uncle flag home talk finish short thee our screwdiver sonry flower wrCstlir~g plan week wait accident guilty tree

  15. Coupled transverse motion

    International Nuclear Information System (INIS)

    Teng, L.C.

    1989-01-01

    The magnetic field in an accelerator or a storage ring is usually so designed that the horizontal (x) and the vertical (y) motions of an ion are uncoupled. However, because of imperfections in construction and alignment, some small coupling is unavoidable. In this lecture, we discuss in a general way what is known about the behaviors of coupled motions in two degrees-of-freedom. 11 refs., 6 figs

  16. A Comparison between heat transfer performance of rectangular and semicircular tubes considering boundary effects on Brownian motions in the presence of Ag / water nanofluids: Applicable in the design of cooling system of photovoltaic cells.

    Science.gov (United States)

    Jafarimoghaddam, Amin; Aberoumand, Sadegh

    2017-01-01

    The present study aims to experimentally investigate heat transfer performance of rectangular and semicircular tubes in the presence of Ag / water nanofluids. The nanoparticles of Ag (silver) were used in seven different volume concentrations of 0.03%, 0.07%, 0.1%, 0.2%, 0.4%, 1% and 2%. The experiment was conducted in relatively low Reynolds numbers of 301 to 740. A heater with the power of 200 W was used to keep the outer surface of the tubes under a constant heat flux condition. In addition, the rectangular tube has been designed within the same length as the semicircular one and also within the same hydraulic diameter. Moreover, the average nanoparticles size was 20 nm. The outcome results of the present empirical work indicate that, for all the examined Reynolds numbers, the semicircular tube has higher convective heat transfer coefficient for all the utilized volume concentrations of Ag nanoparticles. The possible reasons behind this advantage are discussed through the present work mainly by taking the boundary effect on Brownian motions into account. Coming to this point that the conventional design for cooling system of photovoltaic cells is a heat sink with the rectangular graves, it is discussed that using a semicircular design may have the advantage over the rectangular one in convective heat transfer coefficient enhancement and hence a better cooling performance for these solar cells.

  17. A Comparison between heat transfer performance of rectangular and semicircular tubes considering boundary effects on Brownian motions in the presence of Ag / water nanofluids: Applicable in the design of cooling system of photovoltaic cells.

    Directory of Open Access Journals (Sweden)

    Amin Jafarimoghaddam

    Full Text Available The present study aims to experimentally investigate heat transfer performance of rectangular and semicircular tubes in the presence of Ag / water nanofluids. The nanoparticles of Ag (silver were used in seven different volume concentrations of 0.03%, 0.07%, 0.1%, 0.2%, 0.4%, 1% and 2%. The experiment was conducted in relatively low Reynolds numbers of 301 to 740. A heater with the power of 200 W was used to keep the outer surface of the tubes under a constant heat flux condition. In addition, the rectangular tube has been designed within the same length as the semicircular one and also within the same hydraulic diameter. Moreover, the average nanoparticles size was 20 nm. The outcome results of the present empirical work indicate that, for all the examined Reynolds numbers, the semicircular tube has higher convective heat transfer coefficient for all the utilized volume concentrations of Ag nanoparticles. The possible reasons behind this advantage are discussed through the present work mainly by taking the boundary effect on Brownian motions into account. Coming to this point that the conventional design for cooling system of photovoltaic cells is a heat sink with the rectangular graves, it is discussed that using a semicircular design may have the advantage over the rectangular one in convective heat transfer coefficient enhancement and hence a better cooling performance for these solar cells.

  18. Effect of higher order nonlinearity, directionality and finite water depth on wave statistics: Comparison of field data and numerical simulations

    Science.gov (United States)

    Fernández, Leandro; Monbaliu, Jaak; Onorato, Miguel; Toffoli, Alessandro

    2014-05-01

    This research is focused on the study of nonlinear evolution of irregular wave fields in water of arbitrary depth by comparing field measurements and numerical simulations.It is now well accepted that modulational instability, known as one of the main mechanisms for the formation of rogue waves, induces strong departures from Gaussian statistics. However, whereas non-Gaussian properties are remarkable when wave fields follow one direction of propagation over an infinite water depth, wave statistics only weakly deviate from Gaussianity when waves spread over a range of different directions. Over finite water depth, furthermore, wave instability attenuates overall and eventually vanishes for relative water depths as low as kh=1.36 (where k is the wavenumber of the dominant waves and h the water depth). Recent experimental results, nonetheless, seem to indicate that oblique perturbations are capable of triggering and sustaining modulational instability even if khthe aim of this research is to understand whether the combined effect of directionality and finite water depth has a significant effect on wave statistics and particularly on the occurrence of extremes. For this purpose, numerical experiments have been performed solving the Euler equation of motion with the Higher Order Spectral Method (HOSM) and compared with data of short crested wave fields for different sea states observed at the Lake George (Australia). A comparative analysis of the statistical properties (i.e. density function of the surface elevation and its statistical moments skewness and kurtosis) between simulations and in-situ data provides a confrontation between the numerical developments and real observations in field conditions.

  19. Water

    CSIR Research Space (South Africa)

    Van Wyk, Llewellyn V

    2010-08-01

    Full Text Available Water scarcity is without a doubt on of the greatest threats to the human species and has all the potential to destabilise world peace. Falling water tables are a new phenomenon. Up until the development of steam and electric motors, deep groudwater...

  20. Water

    OpenAIRE

    Hertie School of Governance

    2010-01-01

    All human life depends on water and air. The sustainable management of both is a major challenge for today's public policy makers. This issue of Schlossplatz³ taps the streams and flows of the current debate on the right water governance.

  1. Simulated earthquake ground motions

    International Nuclear Information System (INIS)

    Vanmarcke, E.H.; Gasparini, D.A.

    1977-01-01

    The paper reviews current methods for generating synthetic earthquake ground motions. Emphasis is on the special requirements demanded of procedures to generate motions for use in nuclear power plant seismic response analysis. Specifically, very close agreement is usually sought between the response spectra of the simulated motions and prescribed, smooth design response spectra. The features and capabilities of the computer program SIMQKE, which has been widely used in power plant seismic work are described. Problems and pitfalls associated with the use of synthetic ground motions in seismic safety assessment are also pointed out. The limitations and paucity of recorded accelerograms together with the widespread use of time-history dynamic analysis for obtaining structural and secondary systems' response have motivated the development of earthquake simulation capabilities. A common model for synthesizing earthquakes is that of superposing sinusoidal components with random phase angles. The input parameters for such a model are, then, the amplitudes and phase angles of the contributing sinusoids as well as the characteristics of the variation of motion intensity with time, especially the duration of the motion. The amplitudes are determined from estimates of the Fourier spectrum or the spectral density function of the ground motion. These amplitudes may be assumed to be varying in time or constant for the duration of the earthquake. In the nuclear industry, the common procedure is to specify a set of smooth response spectra for use in aseismic design. This development and the need for time histories have generated much practical interest in synthesizing earthquakes whose response spectra 'match', or are compatible with a set of specified smooth response spectra

  2. Communication: Mode bifurcation of droplet motion under stationary laser irradiation

    Energy Technology Data Exchange (ETDEWEB)

    Takabatake, Fumi [Department of Physics, Graduate School of Science, Kyoto University, Kyoto 606-8502 (Japan); Department of Bioengineering and Robotics, Graduate School of Engineering, Tohoku University, Sendai, Miyagi 980-8579 (Japan); Yoshikawa, Kenichi [Faculty of Life and Medical Sciences, Doshisha University, Kyotanabe, Kyoto 610-0394 (Japan); Ichikawa, Masatoshi, E-mail: ichi@scphys.kyoto-u.ac.jp [Department of Physics, Graduate School of Science, Kyoto University, Kyoto 606-8502 (Japan)

    2014-08-07

    The self-propelled motion of a mm-sized oil droplet floating on water, induced by a local temperature gradient generated by CW laser irradiation is reported. The circular droplet exhibits two types of regular periodic motion, reciprocal and circular, around the laser spot under suitable laser power. With an increase in laser power, a mode bifurcation from rectilinear reciprocal motion to circular motion is caused. The essential aspects of this mode bifurcation are discussed in terms of spontaneous symmetry-breaking under temperature-induced interfacial instability, and are theoretically reproduced with simple coupled differential equations.

  3. Ground motion predictions

    Energy Technology Data Exchange (ETDEWEB)

    Loux, P C [Environmental Research Corporation, Alexandria, VA (United States)

    1969-07-01

    Nuclear generated ground motion is defined and then related to the physical parameters that cause it. Techniques employed for prediction of ground motion peak amplitude, frequency spectra and response spectra are explored, with initial emphasis on the analysis of data collected at the Nevada Test Site (NTS). NTS postshot measurements are compared with pre-shot predictions. Applicability of these techniques to new areas, for example, Plowshare sites, must be questioned. Fortunately, the Atomic Energy Commission is sponsoring complementary studies to improve prediction capabilities primarily in new locations outside the NTS region. Some of these are discussed in the light of anomalous seismic behavior, and comparisons are given showing theoretical versus experimental results. In conclusion, current ground motion prediction techniques are applied to events off the NTS. Predictions are compared with measurements for the event Faultless and for the Plowshare events, Gasbuggy, Cabriolet, and Buggy I. (author)

  4. Method through motion

    DEFF Research Database (Denmark)

    Steijn, Arthur

    2016-01-01

    Contemporary scenography often consists of video-projected motion graphics. The field is lacking in academic methods and rigour: descriptions and models relevant for the creation as well as in the analysis of existing works. In order to understand the phenomenon of motion graphics in a scenographic...... construction as a support to working systematically practice-led research project. The design model is being developed through design laboratories and workshops with students and professionals who provide feedback that lead to incremental improvements. Working with this model construction-as-method reveals...... context, I have been conducting a practice-led research project. Central to the project is construction of a design model describing sets of procedures, concepts and terminology relevant for design and studies of motion graphics in spatial contexts. The focus of this paper is the role of model...

  5. Ground motion predictions

    International Nuclear Information System (INIS)

    Loux, P.C.

    1969-01-01

    Nuclear generated ground motion is defined and then related to the physical parameters that cause it. Techniques employed for prediction of ground motion peak amplitude, frequency spectra and response spectra are explored, with initial emphasis on the analysis of data collected at the Nevada Test Site (NTS). NTS postshot measurements are compared with pre-shot predictions. Applicability of these techniques to new areas, for example, Plowshare sites, must be questioned. Fortunately, the Atomic Energy Commission is sponsoring complementary studies to improve prediction capabilities primarily in new locations outside the NTS region. Some of these are discussed in the light of anomalous seismic behavior, and comparisons are given showing theoretical versus experimental results. In conclusion, current ground motion prediction techniques are applied to events off the NTS. Predictions are compared with measurements for the event Faultless and for the Plowshare events, Gasbuggy, Cabriolet, and Buggy I. (author)

  6. Water

    Directory of Open Access Journals (Sweden)

    E. Sanmuga Priya

    2017-05-01

    Full Text Available Phytoremediation through aquatic macrophytes treatment system (AMATS for the removal of pollutants and contaminants from various natural sources is a well established environmental protection technique. Water hyacinth (Eichhornia crassipes, a worst invasive aquatic weed has been utilised for various research activities over the last few decades. The biosorption capacity of the water hyacinth in minimising various contaminants present in the industrial wastewater is well studied. The present review quotes the literatures related to the biosorption capacity of the water hyacinth in reducing the concentration of dyestuffs, heavy metals and minimising certain other physiochemical parameters like TSS (total suspended solids, TDS (total dissolved solids, COD (chemical oxygen demand and BOD (biological oxygen demand in textile wastewater. Sorption kinetics through various models, factors influencing the biosorption capacity, and role of physical and chemical modifications in the water hyacinth are also discussed.

  7. Leap Motion development essentials

    CERN Document Server

    Spiegelmock, Mischa

    2013-01-01

    This book is a fast-paced guide with practical examples that aims to help you understand and master the Leap Motion SDK.This book is for developers who are either involved in game development or who are looking to utilize Leap Motion technology in order to create brand new user interaction experiences to distinguish their products from the mass market. You should be comfortable with high-level languages and object-oriented development concepts in order to get the most out of this book.

  8. CRDM motion analysis using machine learning technique

    International Nuclear Information System (INIS)

    Nishimura, Takuya; Nakayama, Hiroyuki; Saitoh, Mayumi; Yaguchi, Seiji

    2017-01-01

    Magnetic jack type Control Rod Drive Mechanism (CRDM) for pressurized water reactor (PWR) plant operates control rods in response to electrical signals from a reactor control system. CRDM operability is evaluated by quantifying armature's response of closed/opened time which means interval time between coil energizing/de-energizing points and armature closed/opened points. MHI has already developed an automatic CRDM motion analysis and applied it to actual plants so far. However, CRDM operational data has wide variation depending on their characteristics such as plant condition, plant, etc. In the existing motion analysis, there is an issue of analysis accuracy for applying a single analysis technique to all plant conditions, plants, etc. In this study, MHI investigated motion analysis using machine learning (Random Forests) which is flexibly accommodated to CRDM operational data with wide variation, and is improved analysis accuracy. (author)

  9. Wiimote Experiments: Circular Motion

    Science.gov (United States)

    Kouh, Minjoon; Holz, Danielle; Kawam, Alae; Lamont, Mary

    2013-01-01

    The advent of new sensor technologies can provide new ways of exploring fundamental physics. In this paper, we show how a Wiimote, which is a handheld remote controller for the Nintendo Wii video game system with an accelerometer, can be used to study the dynamics of circular motion with a very simple setup such as an old record player or a…

  10. Ship Roll Motion Control

    DEFF Research Database (Denmark)

    Perez, Tristan; Blanke, Mogens

    2010-01-01

    . This tutorial paper presents an account of the development of various ship roll motion control systems and the challenges associated with their design. The paper discusses how to assess performance, the applicability of dierent models, and control methods that have been applied in the past....

  11. Motion of magnetotactic microorganisms

    International Nuclear Information System (INIS)

    Esquivel, D.M.S.; Barros, H.G. de P.L. de.

    1985-01-01

    Magnetic moments for different magnetotactic microorganisms are obtained by electron microscopy analyses and studies of motion by optical microscopy. The results are analysed in terms of a model due to C.Bean. The considerations presented suggest that magnetotaxy is an efficient mechanism for orientation only if the time for reorientation is smaller than the cycles of environmental perturbations. (Author) [pt

  12. Stochastic Blind Motion Deblurring

    KAUST Repository

    Xiao, Lei; Gregson, James; Heide, Felix; Heidrich, Wolfgang

    2015-01-01

    Blind motion deblurring from a single image is a highly under-constrained problem with many degenerate solutions. A good approximation of the intrinsic image can therefore only be obtained with the help of prior information in the form of (often non

  13. Markerless Motion Tracking

    DEFF Research Database (Denmark)

    Brooks, Anthony Lewis; Czarowicz, Alex

    2012-01-01

    This contribution focuses on the Associated Technologies aspect of the ICDVRAT event. Two industry leading markerless motion capture systems are examined that offer advancement in the field of rehabilitation. Residing at each end of the cost continuum, technical differences such as 3D versus 360 ...

  14. Motion sensing energy controller

    International Nuclear Information System (INIS)

    Saphir, M.E.; Reed, M.A.

    1984-01-01

    A moving object sensing processor responsive to slowly varying motions of a human being or other moving object in a zone of interest employs high frequency pulse modulated non-visible radiation generated by a radiation generating source, such as an LED, and detected by a detector sensitive to radiation of a preselected wavelength which generates electrical signals representative of the reflected radiation received from the zone of interest. The detectorsignals are processed to normalize the base level and remove variations due to background level changes, and slowly varying changes in the signals are detected by a bi-polar threshold detector. The control signals generated by the threshold detector in response to slowly varying motion are used to control the application of power to a utilization device, such as a set of fluoroescent lights in a room, the power being applied in response to detection of such motion and being automatically terminated in the absence of such motion after a predetermined time period established by a settable incrementable counter

  15. Algebraic Description of Motion

    Science.gov (United States)

    Davidon, William C.

    1974-01-01

    An algebraic definition of time differentiation is presented and used to relate independent measurements of position and velocity. With this, students can grasp certain essential physical, geometric, and algebraic properties of motion and differentiation before undertaking the study of limits. (Author)

  16. Rotational motion in nuclei

    International Nuclear Information System (INIS)

    Bohr, A.

    1977-01-01

    History is surveyed of the development of the theory of rotational states in nuclei. The situation in the 40's when ideas formed of the collective states of a nucleus is evoked. The general rotation theory and the relation between the single-particle and rotational motion are briefly discussed. Future prospects of the rotation theory development are indicated. (I.W.)

  17. Motion Control with Vision

    NARCIS (Netherlands)

    Ir. Dick van Schenk Brill; Ir Peter Boots

    2001-01-01

    This paper describes the work that is done by a group of I3 students at Philips CFT in Eindhoven, Netherlands. I3 is an initiative of Fontys University of Professional Education also located in Eindhoven. The work focuses on the use of computer vision in motion control. Experiments are done with

  18. Superluminal motion (review)

    Science.gov (United States)

    Malykin, G. B.; Romanets, E. A.

    2012-06-01

    Prior to the development of Special Relativity, no restrictions were imposed on the velocity of the motion of particles and material bodies, as well as on energy transfer and signal propagation. At the end of the 19th century and the beginning of the 20th century, it was shown that a charge that moves at a velocity faster than the speed of light in an optical medium, in particular, in vacuum, gives rise to impact radiation, which later was termed the Vavilov-Cherenkov radiation. Shortly after the development of Special Relativity, some researchers considered the possibility of superluminal motion. In 1923, the Soviet physicist L.Ya. Strum suggested the existence of tachyons, which, however, have not been discovered yet. Superluminal motions can occur only for images, e.g., for so-called "light spots," which were considered in 1972 by V.L. Ginzburg and B.M. Bolotovskii. These spots can move with a superluminal phase velocity but are incapable of transferring energy and information. Nevertheless, these light spots may induce quite real generation of microwave radiation in closed waveguides and create the Vavilov-Cherenkov radiation in vacuum. In this work, we consider various paradoxes, illusions, and artifacts associated with superluminal motion.

  19. A Harmonic Motion Experiment

    Science.gov (United States)

    Gluck, P.; Krakower, Zeev

    2010-01-01

    We present a unit comprising theory, simulation and experiment for a body oscillating on a vertical spring, in which the simultaneous use of a force probe and an ultrasonic range finder enables one to explore quantitatively and understand many aspects of simple and damped harmonic motions. (Contains 14 figures.)

  20. Choosing a Motion Detector.

    Science.gov (United States)

    Ballard, David M.

    1990-01-01

    Examines the characteristics of three types of motion detectors: Doppler radar, infrared, and ultrasonic wave, and how they are used on school buses to prevent students from being killed by their own school bus. Other safety devices cited are bus crossing arms and a camera monitor system. (MLF)

  1. Solid state engine with alternating motion

    Science.gov (United States)

    Golestaneh, Ahmad A.

    1982-01-01

    Heat energy is converted to mechanical motion utilizing apparatus including a cylinder, a piston having openings therein reciprocable in the cylinder, inlet and outlet ports for warm water at one end of the cylinder, inlet and outlet ports for cool water at the other end of the cylinder, gates movable with the piston and slidably engaging the cylinder wall to alternately open and close the warm and cool water ports, a spring bearing against the warm water side of the piston and a double helix of a thermal shape memory material attached to the cool end of the cylinder and to the piston. The piston is caused to reciprocate by alternately admitting cool water and warm water to the cylinder.

  2. PET motion correction using PRESTO with ITK motion estimation

    Energy Technology Data Exchange (ETDEWEB)

    Botelho, Melissa [Institute of Biophysics and Biomedical Engineering, Science Faculty of University of Lisbon (Portugal); Caldeira, Liliana; Scheins, Juergen [Institute of Neuroscience and Medicine (INM-4), Forschungszentrum Jülich (Germany); Matela, Nuno [Institute of Biophysics and Biomedical Engineering, Science Faculty of University of Lisbon (Portugal); Kops, Elena Rota; Shah, N Jon [Institute of Neuroscience and Medicine (INM-4), Forschungszentrum Jülich (Germany)

    2014-07-29

    The Siemens BrainPET scanner is a hybrid MRI/PET system. PET images are prone to motion artefacts which degrade the image quality. Therefore, motion correction is essential. The library PRESTO converts motion-corrected LORs into highly accurate generic projection data [1], providing high-resolution PET images. ITK is an open-source software used for registering multidimensional data []. ITK provides motion estimation necessary to PRESTO.

  3. PET motion correction using PRESTO with ITK motion estimation

    International Nuclear Information System (INIS)

    Botelho, Melissa; Caldeira, Liliana; Scheins, Juergen; Matela, Nuno; Kops, Elena Rota; Shah, N Jon

    2014-01-01

    The Siemens BrainPET scanner is a hybrid MRI/PET system. PET images are prone to motion artefacts which degrade the image quality. Therefore, motion correction is essential. The library PRESTO converts motion-corrected LORs into highly accurate generic projection data [1], providing high-resolution PET images. ITK is an open-source software used for registering multidimensional data []. ITK provides motion estimation necessary to PRESTO.

  4. Ground motion effects

    Energy Technology Data Exchange (ETDEWEB)

    Blume, J A [John A. Blume and Associates, San Francisco, CA (United States)

    1969-07-01

    Ground motion caused by natural earthquakes or by nuclear explosion causes buildings and other structures to respond in such manner as possibly to have high unit stresses and to be subject to damage or-in some cases-collapse. Even minor damage may constitute a hazard to persons within or adjacent to buildings. The risk of damage may well be the governing restraint on the uses of nuclear energy for peaceful purposes. Theory is advanced regarding structural-dynamic response but real buildings and structures are complex, highly variable, and often difficult to model realistically. This paper discusses the state of knowledge, the art of damage prediction and safety precautions, and shows ground motion effects from explosions of underground nuclear devices in the continental United States including events Salmon, Gasbuggy, Boxcar, Faultless and Benham. (author)

  5. Ground motion effects

    International Nuclear Information System (INIS)

    Blume, J.A.

    1969-01-01

    Ground motion caused by natural earthquakes or by nuclear explosion causes buildings and other structures to respond in such manner as possibly to have high unit stresses and to be subject to damage or-in some cases-collapse. Even minor damage may constitute a hazard to persons within or adjacent to buildings. The risk of damage may well be the governing restraint on the uses of nuclear energy for peaceful purposes. Theory is advanced regarding structural-dynamic response but real buildings and structures are complex, highly variable, and often difficult to model realistically. This paper discusses the state of knowledge, the art of damage prediction and safety precautions, and shows ground motion effects from explosions of underground nuclear devices in the continental United States including events Salmon, Gasbuggy, Boxcar, Faultless and Benham. (author)

  6. Motion of the esophagus due to cardiac motion.

    Directory of Open Access Journals (Sweden)

    Jacob Palmer

    Full Text Available When imaging studies (e.g. CT are used to quantify morphological changes in an anatomical structure, it is necessary to understand the extent and source of motion which can give imaging artifacts (e.g. blurring or local distortion. The objective of this study was to assess the magnitude of esophageal motion due to cardiac motion. We used retrospective electrocardiogram-gated contrast-enhanced computed tomography angiography images for this study. The anatomic region from the carina to the bottom of the heart was taken at deep-inspiration breath hold with the patients' arms raised above their shoulders, in a position similar to that used for radiation therapy. The esophagus was delineated on the diastolic phase of cardiac motion, and deformable registration was used to sequentially deform the images in nearest-neighbor phases among the 10 cardiac phases, starting from the diastolic phase. Using the 10 deformation fields generated from the deformable registration, the magnitude of the extreme displacements was then calculated for each voxel, and the mean and maximum displacement was calculated for each computed tomography slice for each patient. The average maximum esophageal displacement due to cardiac motion for all patients was 5.8 mm (standard deviation: 1.6 mm, maximum: 10.0 mm in the transverse direction. For 21 of 26 patients, the largest esophageal motion was found in the inferior region of the heart; for the other patients, esophageal motion was approximately independent of superior-inferior position. The esophagus motion was larger at cardiac phases where the electrocardiogram R-wave occurs. In conclusion, the magnitude of esophageal motion near the heart due to cardiac motion is similar to that due to other sources of motion, including respiratory motion and intra-fraction motion. A larger cardiac motion will result into larger esophagus motion in a cardiac cycle.

  7. Experimental motion behavior of submerged fuel racks

    International Nuclear Information System (INIS)

    Ellingson, F.J.; Wachter, W.; Moscardini, R.L.

    1989-01-01

    The design of submerged nuclear storage racks for light water reactor nuclear fuel has undergone a change from fixed position to a free-standing arrangement. Seismic analysis of the motion of the free-standing racks requires three-dimensional computer modeling that uses past studies of hydrodynamic mass and hydraulic coupling for rigid flat plates. This paper describes the results of experiments that show a reduced value for hydrodynamic mass and coupling forces when flexible elements are involved. To support this work, experiments were run with two full-scale welded box sections submerged in a water tank. The preliminary results indicate reduction in hydrodynamic mass due to box wall flexibility, a lack of impacting of box wall to box wall over the entire frequency range, and large hydrodynamic coupling forces under all test conditions. It is hypothesized that the coupling forces are sufficiently strong to prevent rotational motion of one rack when surrounded by adjacent racks

  8. Force and motion

    CERN Document Server

    Robertson, William C

    2002-01-01

    Intimidated by inertia? Frightened by forces? Mystified by Newton s law of motion? You re not alone and help is at hand. The stop Faking It! Series is perfect for science teachers, home-schoolers, parents wanting to help with homework all of you who need a jargon-free way to learn the background for teaching middle school physical science with confidence. With Bill Roberton as your friendly, able but somewhat irreverent guide, you will discover you CAN come to grips with the basics of force and motion. Combining easy-to-understand explanations with activities using commonly found equipment, this book will lead you through Newton s laws to the physics of space travel. The book is as entertaining as it is informative. Best of all, the author understands the needs of adults who want concrete examples, hands-on activities, clear language, diagrams and yes, a certain amount of empathy. Ideas For Use Newton's laws, and all of the other motion principles presented in this book, do a good job of helping us to underst...

  9. EDITORIAL: Nanotechnology in motion Nanotechnology in motion

    Science.gov (United States)

    Demming, Anna

    2012-02-01

    , Toshio Ando from the University of Kanazawa provides an overview of developments that have allowed atomic force microscopy to move from rates of the order of one frame a minute to over a thousand frames per second in constant height mode, as reported by Mervyn Miles and colleagues at Bristol University and University College London [8]. Among the pioneers in the field, Ando's group demonstrated the ability to record the Brownian motion of myosin V molecules on mica with image capture rates of 100 x 100 pixels in 80 ms over a decade ago [9]. The developments unleash the potential of atomic force microscopy to observe the dynamics of biological and materials systems. If seeing is believing, the ability to present real motion pictures of the nanoworld cannot fail to capture the public imagination and stimulate burgeoning new avenues of scientific endeavour. Nearly 350 years on from the publication Micrographia, images in microscopy have moved from the page to the movies. References [1] Binnig G, Quate C F, and Gerber Ch 1986 Phys. Rev. Lett. 56 930-3 [2] Ando T 2012 Nanotechnology 23 062001 [3] J G 1934 Nature 134 635-6 [4] Bharadwaj P, Anger P and Novotny L 2007 Nanotechnology 18 044017 [5] The Nobel Prize in Physics 1986 Nobelprize.org [6] Kim K K, Reina A, Shi Y, Park H, Li L-J, Lee Y H and Kong J 2010 Nanotechnology 21 285205 [7] Phillips D B, Grieve J A, Olof S N, Kocher S J, Bowman R, Padgett M J, Miles M J and Carberry D M 2011 Nanotechnology 22 285503 [8] Picco L M, Bozec L, Ulcinas A, Engledew D J, Antognozzi M, Horton M A and Miles M J 2007 Nanotechnology 18 044030 [9] Ando T, Kodera N, Takai E, Maruyama D, Saito K and Toda A 2001 Proc. Natl. Acad. Sci. 98 12468

  10. Human motion simulation predictive dynamics

    CERN Document Server

    Abdel-Malek, Karim

    2013-01-01

    Simulate realistic human motion in a virtual world with an optimization-based approach to motion prediction. With this approach, motion is governed by human performance measures, such as speed and energy, which act as objective functions to be optimized. Constraints on joint torques and angles are imposed quite easily. Predicting motion in this way allows one to use avatars to study how and why humans move the way they do, given specific scenarios. It also enables avatars to react to infinitely many scenarios with substantial autonomy. With this approach it is possible to predict dynamic motion without having to integrate equations of motion -- rather than solving equations of motion, this approach solves for a continuous time-dependent curve characterizing joint variables (also called joint profiles) for every degree of freedom. Introduces rigorous mathematical methods for digital human modelling and simulation Focuses on understanding and representing spatial relationships (3D) of biomechanics Develops an i...

  11. WORKSHOP: Stable particle motion

    International Nuclear Information System (INIS)

    Ruggiero, Alessandro G.

    1993-01-01

    Full text: Particle beam stability is crucial to any accelerator or collider, particularly big ones, such as Brookhaven's RHIC heavy ion collider and the larger SSC and LHC proton collider schemes. A workshop on the Stability of Particle Motion in Storage Rings held at Brookhaven in October dealt with the important issue of determining the short- and long-term stability of single particle motion in hadron storage rings and colliders, and explored new methods for ensuring it. In the quest for realistic environments, the imperfections of superconducting magnets and the effects of field modulation and noise were taken into account. The workshop was divided into three study groups: Short-Term Stability in storage rings, including chromatic and geometric effects and correction strategies; Long-Term Stability, including modulation and random noise effects and slow varying effects; and Methods for determining the stability of particle motion. The first two were run in parallel, but the third was attended by everyone. Each group considered analytical, computational and experimental methods, reviewing work done so far, comparing results and approaches and underlining outstanding issues. By resolving conflicts, it was possible to identify problems of common interest. The workshop reaffirmed the validity of methods proposed several years ago. Major breakthroughs have been in the rapid improvement of computer capacity and speed, in the development of more sophisticated mathematical packages, and in the introduction of more powerful analytic approaches. In a typical storage ring, a particle may be required to circulate for about a billion revolutions. While ten years ago it was only possible to predict accurately stability over about a thousand revolutions, it is now possible to predict over as many as one million turns. If this trend continues, in ten years it could become feasible to predict particle stability over the entire storage period. About ninety participants

  12. Temporomandibular joint motion

    International Nuclear Information System (INIS)

    Maeda, M.; Kawamura, Y.; Matsuda, T.; Itou, S.; Odori, T.; Ishii, Y.; Torizuka, K.

    1990-01-01

    This paper evaluates MR imaging with the therapeutic effect after splint therapy in internal derangement of the temporomandibular joint (TMJ). Fifteen patients (19 TMJs) with internal derangement of the TMJ and five normal volunteers (10 TMJs) were examined with sagittal T1-weighted spin-echo and gradient recalled acquisition in a steady state (GRASS) MR imaging. MR studies of the patients undergoing splint therapy were performed with an without splints. Pseudodynamic images of TMJ motion provide information that was not available from spin-echo T1-weighted images

  13. Motion Capturing Emotions

    OpenAIRE

    Wood Karen; Cisneros Rosemary E.; Whatley Sarah

    2017-01-01

    The paper explores the activities conducted as part of WhoLoDancE: Whole Body Interaction Learning for Dance Education which is an EU-funded Horizon 2020 project. In particular, we discuss the motion capture sessions that took place at Motek, Amsterdam as well as the dancers’ experience of being captured and watching themselves or others as varying visual representations through the HoloLens. HoloLens is Microsoft’s first holographic computer that you wear as you would a pair of glasses. The ...

  14. Electromechanical motion devices

    CERN Document Server

    Krause, Paul C; Pekarek, Steven D

    2012-01-01

    This text provides a basic treatment of modern electric machine analysis that gives readers the necessary background for comprehending the traditional applications and operating characteristics of electric machines-as well as their emerging applications in modern power systems and electric drives, such as those used in hybrid and electric vehicles. Through the appropriate use of reference frame theory, Electromagnetic Motion Devices, Second Edition introduces readers to field-oriented control of induction machines, constant-torque, and constant-power control of dc, permanent-magnet ac

  15. Patellofemoral joint motion

    International Nuclear Information System (INIS)

    Stanford, W.; Phelan, J.; Albright, J.; Kathol, M.; Rooholamini, S.A.; El-Khoury, G.Y.; Palutsis, G.R.

    1988-01-01

    This paper describes the use of ultrafast computed tomography (CT) to obtain dynamic images of the patellofemoral joint during active motion. Thirty-eight patients underwent measurements of tangent offset, bisect offset, congruence angle, patellar tilt angle, lateral patellofemoral angle, sulcus angle, and sulcus depth made during leg movement. Selected parameters were compared with Merchant views. Significant correlations were obtained between Merchant views and comparable ultrafast CT views for all parameters except sulcus angle. Correlations between the other parameters were poor. Cine strips showed two patterns of movement; the patella remained centered either throughout excursion or until the last 20 0 of full extension, when it would sublux laterally

  16. Infrasonic induced ground motions

    Science.gov (United States)

    Lin, Ting-Li

    On January 28, 2004, the CERI seismic network recorded seismic signals generated by an unknown source. Our conclusion is that the acoustic waves were initiated by an explosive source near the ground surface. The meteorological temperature and effective sound speed profiles suggested existence of an efficient near-surface waveguide that allowed the acoustic disturbance to propagate to large distances. An explosion occurring in an area of forest and farms would have limited the number of eyewitnesses. Resolution of the source might be possible by experiment or by detailed analysis of the ground motion data. A seismo-acoustic array was built to investigate thunder-induced ground motions. Two thunder events with similar N-wave waveforms but different horizontal slownesses are chosen to evaluate the credibility of using thunder as a seismic source. These impulsive acoustic waves excited P and S reverberations in the near surface that depend on both the incident wave horizontal slowness and the velocity structure in the upper 30 meters. Nineteen thunder events were chosen to further investigate the seismo-acoustic coupling. The consistent incident slowness differences between acoustic pressure and ground motions suggest that ground reverberations were first initiated somewhat away from the array. Acoustic and seismic signals were used to generate the time-domain transfer function through the deconvolution technique. Possible non-linear interaction for acoustic propagation into the soil at the surface was observed. The reverse radial initial motions suggest a low Poisson's ratio for the near-surface layer. The acoustic-to-seismic transfer functions show a consistent reverberation series of the Rayleigh wave type, which has a systematic dispersion relation to incident slownesses inferred from the seismic ground velocity. Air-coupled Rayleigh wave dispersion was used to quantitatively constrain the near-surface site structure with constraints afforded by near-surface body

  17. Rotational motion in nuclei

    International Nuclear Information System (INIS)

    Bohr, A.

    1976-01-01

    Nuclear structure theories are reviewed concerned with nuclei rotational motion. The development of the deformed nucleus model facilitated a discovery of rotational spectra of nuclei. Comprehensive verification of the rotational scheme and a successful classification of corresponding spectra stimulated investigations of the rotational movement dynamics. Values of nuclear moments of inertia proved to fall between two marginal values corresponding to rotation of a solid and hydrodynamic pattern of an unrotating flow, respectively. The discovery of governing role of the deformation and a degree of a symmetry violence for determining rotational degrees of freedon is pointed out to pave the way for generalization of the rotational spectra

  18. Motion-dependent excitation mechanisms in a square in-line tube bundle subject to water cross flow: an experimental modal analysis; Mecanismes d`excitation dependant du mouvement de la structure dans un faisceau de tube soumis a un ecoulement: une analyse modale experimentale

    Energy Technology Data Exchange (ETDEWEB)

    Grangers, S.; Campistron, R.; Lebret, J.

    1994-09-01

    This paper deals with the physical mechanisms inducing motion-development dynamic fluid forces in a tube array subject to water cross-flow. Three configurations have been tested. In the first one, a single flexible tube was positioned in the middle of an array of rigid cylinders; in the second one, a single flexible tube was positioned in the first row of an array of rigid cylinders; in the third one, the first three rows of the array were flexible, the other cylinders being rigid. Tube response measurements were analyzed by the inverse methodology developed at EDF/R and D D/HTA and implemented into the IMENE and MEIDEE softwares. This methodology allows for studying the variation of the fluid-structure system eigenvalues with flow velocity. From the information, motion-dependent fluid forces can also be estimated. The results of these analyses are compared to previously published data and to the theoretical results obtained with a slightly extended version of the Lever and Weaver analytical model. The main conclusions which can be drawn are as follows: -for each configuration tested, dynamic instabilities occur which induce sudden large amplitude motions for certain flow velocities; -these instabilities seem to result from the interaction of various physical mechanisms; two of them have been clearly identified: they are (i) a single mode flutter phenomenon and (ii) a complex interaction between tube motion and a symmetric vortex shedding; in the last case, tube oscillations regenerate a flow periodicity which had been damped out by flow turbulence when the tube was motionless, then the shed vortices act in turn on tube motion and precipitate the dynamic instability; -in the configurations tested, the location of the flexible tube within the array has a major influence on the development of low-structure interaction; -the Lever and Weaver model gives interesting qualitative trends but the quantitative results are not good. (authors). 22 refs., 20 figs., 1 appendix.

  19. Numerical simulation of high Reynolds number bubble motion

    Energy Technology Data Exchange (ETDEWEB)

    McLaughlin, J.B. [Clarkson Univ., Potsdam, NY (United States)

    1995-12-31

    This paper presents the results of numerical simulations of bubble motion. All the results are for single bubbles in unbounded fluids. The liquid phase is quiescent except for the motion created by the bubble, which is axisymmetric. The main focus of the paper is on bubbles that are of order 1 mm in diameter in water. Of particular interest is the effect of surfactant molecules on bubble motion. Results for the {open_quotes}insoluble surfactant{close_quotes} model will be presented. These results extend research by other investigators to finite Reynolds numbers. The results indicate that, by assuming complete coverage of the bubble surface, one obtains good agreement with experimental observations of bubble motion in tap water. The effect of surfactant concentration on the separation angle is discussed.

  20. A synchronous surround increases the motion strength gain of motion.

    Science.gov (United States)

    Linares, Daniel; Nishida, Shin'ya

    2013-11-12

    Coherent motion detection is greatly enhanced by the synchronous presentation of a static surround (Linares, Motoyoshi, & Nishida, 2012). To further understand this contextual enhancement, here we measured the sensitivity to discriminate motion strength for several pedestal strengths with and without a surround. We found that the surround improved discrimination of low and medium motion strengths, but did not improve or even impaired discrimination of high motion strengths. We used motion strength discriminability to estimate the perceptual response function assuming additive noise and found that the surround increased the motion strength gain, rather than the response gain. Given that eye and body movements continuously introduce transients in the retinal image, it is possible that this strength gain occurs in natural vision.

  1. Stochastic Blind Motion Deblurring

    KAUST Repository

    Xiao, Lei

    2015-05-13

    Blind motion deblurring from a single image is a highly under-constrained problem with many degenerate solutions. A good approximation of the intrinsic image can therefore only be obtained with the help of prior information in the form of (often non-convex) regularization terms for both the intrinsic image and the kernel. While the best choice of image priors is still a topic of ongoing investigation, this research is made more complicated by the fact that historically each new prior requires the development of a custom optimization method. In this paper, we develop a stochastic optimization method for blind deconvolution. Since this stochastic solver does not require the explicit computation of the gradient of the objective function and uses only efficient local evaluation of the objective, new priors can be implemented and tested very quickly. We demonstrate that this framework, in combination with different image priors produces results with PSNR values that match or exceed the results obtained by much more complex state-of-the-art blind motion deblurring algorithms.

  2. Perceptually Uniform Motion Space.

    Science.gov (United States)

    Birkeland, Asmund; Turkay, Cagatay; Viola, Ivan

    2014-11-01

    Flow data is often visualized by animated particles inserted into a flow field. The velocity of a particle on the screen is typically linearly scaled by the velocities in the data. However, the perception of velocity magnitude in animated particles is not necessarily linear. We present a study on how different parameters affect relative motion perception. We have investigated the impact of four parameters. The parameters consist of speed multiplier, direction, contrast type and the global velocity scale. In addition, we investigated if multiple motion cues, and point distribution, affect the speed estimation. Several studies were executed to investigate the impact of each parameter. In the initial results, we noticed trends in scale and multiplier. Using the trends for the significant parameters, we designed a compensation model, which adjusts the particle speed to compensate for the effect of the parameters. We then performed a second study to investigate the performance of the compensation model. From the second study we detected a constant estimation error, which we adjusted for in the last study. In addition, we connect our work to established theories in psychophysics by comparing our model to a model based on Stevens' Power Law.

  3. Development of a Shipboard Remote Control and Telemetry Experimental System for Large-Scale Model’s Motions and Loads Measurement in Realistic Sea Waves

    Directory of Open Access Journals (Sweden)

    Jialong Jiao

    2017-10-01

    Full Text Available Wave-induced motion and load responses are important criteria for ship performance evaluation. Physical experiments have long been an indispensable tool in the predictions of ship’s navigation state, speed, motions, accelerations, sectional loads and wave impact pressure. Currently, majority of the experiments are conducted in laboratory tank environment, where the wave environments are different from the realistic sea waves. In this paper, a laboratory tank testing system for ship motions and loads measurement is reviewed and reported first. Then, a novel large-scale model measurement technique is developed based on the laboratory testing foundations to obtain accurate motion and load responses of ships in realistic sea conditions. For this purpose, a suite of advanced remote control and telemetry experimental system was developed in-house to allow for the implementation of large-scale model seakeeping measurement at sea. The experimental system includes a series of technique sensors, e.g., the Global Position System/Inertial Navigation System (GPS/INS module, course top, optical fiber sensors, strain gauges, pressure sensors and accelerometers. The developed measurement system was tested by field experiments in coastal seas, which indicates that the proposed large-scale model testing scheme is capable and feasible. Meaningful data including ocean environment parameters, ship navigation state, motions and loads were obtained through the sea trial campaign.

  4. Development of a Shipboard Remote Control and Telemetry Experimental System for Large-Scale Model's Motions and Loads Measurement in Realistic Sea Waves.

    Science.gov (United States)

    Jiao, Jialong; Ren, Huilong; Adenya, Christiaan Adika; Chen, Chaohe

    2017-10-29

    Wave-induced motion and load responses are important criteria for ship performance evaluation. Physical experiments have long been an indispensable tool in the predictions of ship's navigation state, speed, motions, accelerations, sectional loads and wave impact pressure. Currently, majority of the experiments are conducted in laboratory tank environment, where the wave environments are different from the realistic sea waves. In this paper, a laboratory tank testing system for ship motions and loads measurement is reviewed and reported first. Then, a novel large-scale model measurement technique is developed based on the laboratory testing foundations to obtain accurate motion and load responses of ships in realistic sea conditions. For this purpose, a suite of advanced remote control and telemetry experimental system was developed in-house to allow for the implementation of large-scale model seakeeping measurement at sea. The experimental system includes a series of technique sensors, e.g., the Global Position System/Inertial Navigation System (GPS/INS) module, course top, optical fiber sensors, strain gauges, pressure sensors and accelerometers. The developed measurement system was tested by field experiments in coastal seas, which indicates that the proposed large-scale model testing scheme is capable and feasible. Meaningful data including ocean environment parameters, ship navigation state, motions and loads were obtained through the sea trial campaign.

  5. Motion camouflage in three dimensions

    OpenAIRE

    Reddy, P. V.; Justh, E. W.; Krishnaprasad, P. S.

    2006-01-01

    We formulate and analyze a three-dimensional model of motion camouflage, a stealth strategy observed in nature. A high-gain feedback law for motion camouflage is formulated in which the pursuer and evader trajectories are described using natural Frenet frames (or relatively parallel adapted frames), and the corresponding natural curvatures serve as controls. The biological plausibility of the feedback law is discussed, as is its connection to missile guidance. Simulations illustrating motion ...

  6. Climate-driven polar motion

    Science.gov (United States)

    Celaya, Michael A.; Wahr, John M.; Bryan, Frank O.

    1999-06-01

    The output of a coupled climate system model provides a synthetic climate record with temporal and spatial coverage not attainable with observational data, allowing evaluation of climatic excitation of polar motion on timescales of months to decades. Analysis of the geodetically inferred Chandler excitation power shows that it has fluctuated by up to 90% since 1900 and that it has characteristics representative of a stationary Gaussian process. Our model-predicted climate excitation of the Chandler wobble also exhibits variable power comparable to the observed. Ocean currents and bottom pressure shifts acting together can alone drive the 14-month wobble. The same is true of the excitation generated by the combined effects of barometric pressure and winds. The oceanic and atmospheric contributions are this large because of a relatively high degree of constructive interference between seafloor pressure and currents and between atmospheric pressure and winds. In contrast, excitation by the redistribution of water on land appears largely insignificant. Not surprisingly, the full climate effect is even more capable of driving the wobble than the effects of the oceans or atmosphere alone are. Our match to the observed annual excitation is also improved, by about 17%, over previous estimates made with historical climate data. Efforts to explain the 30-year Markowitz wobble meet with less success. Even so, at periods ranging from months to decades, excitation generated by a model of a coupled climate system makes a close approximation to the amplitude of what is geodetically observed.

  7. Markerless motion estimation for motion-compensated clinical brain imaging

    Science.gov (United States)

    Kyme, Andre Z.; Se, Stephen; Meikle, Steven R.; Fulton, Roger R.

    2018-05-01

    Motion-compensated brain imaging can dramatically reduce the artifacts and quantitative degradation associated with voluntary and involuntary subject head motion during positron emission tomography (PET), single photon emission computed tomography (SPECT) and computed tomography (CT). However, motion-compensated imaging protocols are not in widespread clinical use for these modalities. A key reason for this seems to be the lack of a practical motion tracking technology that allows for smooth and reliable integration of motion-compensated imaging protocols in the clinical setting. We seek to address this problem by investigating the feasibility of a highly versatile optical motion tracking method for PET, SPECT and CT geometries. The method requires no attached markers, relying exclusively on the detection and matching of distinctive facial features. We studied the accuracy of this method in 16 volunteers in a mock imaging scenario by comparing the estimated motion with an accurate marker-based method used in applications such as image guided surgery. A range of techniques to optimize performance of the method were also studied. Our results show that the markerless motion tracking method is highly accurate (brain imaging and holds good promise for a practical implementation in clinical PET, SPECT and CT systems.

  8. Visual motion influences the contingent auditory motion aftereffect

    NARCIS (Netherlands)

    Vroomen, J.; de Gelder, B.

    2003-01-01

    In this study, we show that the contingent auditory motion aftereffect is strongly influenced by visual motion information. During an induction phase, participants listened to rightward-moving sounds with falling pitch alternated with leftward-moving sounds with rising pitch (or vice versa).

  9. Respiratory impact on motion sickness induced by linear motion

    NARCIS (Netherlands)

    Mert, A.; Klöpping-Ketelaars, I.; Bles, W.

    2009-01-01

    Motion sickness incidence (MSI) for vertical sinusoidal motion reaches a maximum at 0.167 Hz. Normal breathing frequency is close to this frequency. There is some evidence for synchronization of breathing with this stimulus frequency. If this enforced breathing takes place over a larger frequency

  10. 41 CFR 60-30.8 - Motions; disposition of motions.

    Science.gov (United States)

    2010-07-01

    ... a supporting memorandum. Within 10 days after a written motion is served, or such other time period... writing. If made at the hearing, motions may be stated orally; but the Administrative Law Judge may require that they be reduced to writing and filed and served on all parties in the same manner as a formal...

  11. Algorithmic Issues in Modeling Motion

    DEFF Research Database (Denmark)

    Agarwal, P. K; Guibas, L. J; Edelsbrunner, H.

    2003-01-01

    This article is a survey of research areas in which motion plays a pivotal role. The aim of the article is to review current approaches to modeling motion together with related data structures and algorithms, and to summarize the challenges that lie ahead in producing a more unified theory of mot...

  12. Rolling motion in moving droplets

    Indian Academy of Sciences (India)

    motions. The two limits of a thin sheet-like drop in sliding motion on a surface, and a spherical drop in roll, have been extensively .... rigid body rotation. The solid body rotation makes sense in the context of small Reynolds. (Re) number flows ...

  13. Commercially available video motion detectors

    International Nuclear Information System (INIS)

    1979-01-01

    A market survey of commercially available video motion detection systems was conducted by the Intrusion Detection Systems Technology Division of Sandia Laboratories. The information obtained from this survey is summarized in this report. The cutoff date for this information is May 1978. A list of commercially available video motion detection systems is appended

  14. Motion simulator with exchangeable unit

    NARCIS (Netherlands)

    Mulder, J.A.; Beukers, A.; Baarspul, M.; Van Tooren, M.J.; De Winter, S.E.E.

    2001-01-01

    A motion simulator provided with a movable housing, preferably carried by a number of length-adjustable legs, in which housing projection means are arranged for visual information supply, while in the housing a control environment of a motion apparatus to be simulated is situated, the control

  15. Nanoparticle mediated micromotor motion

    Science.gov (United States)

    Liu, Mei; Liu, Limei; Gao, Wenlong; Su, Miaoda; Ge, Ya; Shi, Lili; Zhang, Hui; Dong, Bin; Li, Christopher Y.

    2015-03-01

    In this paper, we report the utilization of nanoparticles to mediate the motion of a polymer single crystal catalytic micromotor. Micromotors have been fabricated by directly self-assembling functional nanoparticles (platinum and iron oxide nanoparticles) onto one or both sides of two-dimensional polymer single crystals. We show that the moving velocity of these micromotors in fluids can be readily tuned by controlling the nanoparticles' surface wettability and catalytic activity. A 3 times velocity increase has been achieved for a hydrophobic micromotor as opposed to the hydrophilic ones. Furthermore, we demonstrate that the catalytic activity of platinum nanoparticles inside the micromotor can be enhanced by their synergetic interactions with iron oxide nanoparticles and an electric field. Both strategies lead to dramatically increased moving velocities, with the highest value reaching ~200 μm s-1. By decreasing the nanoparticles' surface wettability and increasing their catalytic activity, a maximum of a ~10-fold increase in the moving speed of the nanoparticle based micromotor can be achieved. Our results demonstrate the advantages of using nanoparticles in micromotor systems.In this paper, we report the utilization of nanoparticles to mediate the motion of a polymer single crystal catalytic micromotor. Micromotors have been fabricated by directly self-assembling functional nanoparticles (platinum and iron oxide nanoparticles) onto one or both sides of two-dimensional polymer single crystals. We show that the moving velocity of these micromotors in fluids can be readily tuned by controlling the nanoparticles' surface wettability and catalytic activity. A 3 times velocity increase has been achieved for a hydrophobic micromotor as opposed to the hydrophilic ones. Furthermore, we demonstrate that the catalytic activity of platinum nanoparticles inside the micromotor can be enhanced by their synergetic interactions with iron oxide nanoparticles and an electric

  16. Climate-driven seasonal geocenter motion during the GRACE period

    Science.gov (United States)

    Zhang, Hongyue; Sun, Yu

    2018-03-01

    Annual cycles in the geocenter motion time series are primarily driven by mass changes in the Earth's hydrologic system, which includes land hydrology, atmosphere, and oceans. Seasonal variations of the geocenter motion have been reliably determined according to Sun et al. (J Geophys Res Solid Earth 121(11):8352-8370, 2016) by combining the Gravity Recovery And Climate Experiment (GRACE) data with an ocean model output. In this study, we reconstructed the observed seasonal geocenter motion with geophysical model predictions of mass variations in the polar ice sheets, continental glaciers, terrestrial water storage (TWS), and atmosphere and dynamic ocean (AO). The reconstructed geocenter motion time series is shown to be in close agreement with the solution based on GRACE data supporting with an ocean bottom pressure model. Over 85% of the observed geocenter motion time series, variance can be explained by the reconstructed solution, which allows a further investigation of the driving mechanisms. We then demonstrated that AO component accounts for 54, 62, and 25% of the observed geocenter motion variances in the X, Y, and Z directions, respectively. The TWS component alone explains 42, 32, and 39% of the observed variances. The net mass changes over oceans together with self-attraction and loading effects also contribute significantly (about 30%) to the seasonal geocenter motion in the X and Z directions. Other contributing sources, on the other hand, have marginal (less than 10%) impact on the seasonal variations but introduce a linear trend in the time series.

  17. Motion Capturing Emotions

    Directory of Open Access Journals (Sweden)

    Wood Karen

    2017-12-01

    Full Text Available The paper explores the activities conducted as part of WhoLoDancE: Whole Body Interaction Learning for Dance Education which is an EU-funded Horizon 2020 project. In particular, we discuss the motion capture sessions that took place at Motek, Amsterdam as well as the dancers’ experience of being captured and watching themselves or others as varying visual representations through the HoloLens. HoloLens is Microsoft’s first holographic computer that you wear as you would a pair of glasses. The study embraced four dance genres: Ballet, Contemporary, Flamenco and Greek Folk dance. We are specifically interested in the kinesthetic and emotional engagement with the moving body and what new corporeal awareness may be experienced. Positioning the moving, dancing body as fundamental to technological advancements, we discuss the importance of considering the dancer’s experience in the real and virtual space. Some of the artists involved in the project have offered their experiences, which are included, and they form the basis of the discussion. In addition, we discuss the affect of immersive environments, how these environments expand reality and what effect (emotionally and otherwise that has on the body. The research reveals insights into relationships between emotion, movement and technology and what new sensorial knowledge this evokes for the dancer.

  18. Measurement of shoulder motion fraction and motion ratio

    International Nuclear Information System (INIS)

    Kang, Yeong Han

    2006-01-01

    This study was to understand about the measurement of shoulder motion fraction and motion ratio. We proposed the radiological criterior of glenohumeral and scapulothoracic movement ratio. We measured the motion fraction of the glenohumeral and scapulothoracic movement using CR (computed radiological system) of arm elevation at neutral, 90 degree, full elevation. Central ray was 15 .deg., 19 .deg., 22 .deg. to the cephald for the parallel scapular spine, and the tilting of torso was external oblique 40 .deg., 36 .deg., 22 .deg. for perpendicular to glenohumeral surface. Healthful donor of 100 was divided 5 groups by age (20, 30, 40, 50, 60). The angle of glenohumeral motion and scapulothoracic motion could be taken from gross arm angle and radiological arm angle. We acquired 3 images at neutral, 90 .deg. and full elevation position and measured radiographic angle of glenoheumeral, scapulothoracic movement respectively. While the arm elevation was 90 .deg., the shoulder motion fraction was 1.22 (M), 1.70 (W) in right arm and 1.31, 1.54 in left. In full elevation, Right arm fraction was 1.63, 1.84 and left was 1.57, 1.32. In right dominant arm (78%), 90 .deg. and Full motion fraction was 1.58, 1.43, in left (22%) 1.82, 1.94. In generation 20, 90 .deg. and Full motion fraction was 1.56, 1.52, 30' was 1.82, 1.43, 40' was 1.23, 1.16, 50' was 1.80, 1.28,60' was 1.24, 1.75. There was not significantly by gender, dominant arm and age. The criteria of motion fraction was useful reference for clinical diagnosis the shoulder instability

  19. Marker-Free Human Motion Capture

    DEFF Research Database (Denmark)

    Grest, Daniel

    Human Motion Capture is a widely used technique to obtain motion data for animation of virtual characters. Commercial optical motion capture systems are marker-based. This book is about marker-free motion capture and its possibilities to acquire motion from a single viewing direction. The focus...

  20. Motion perception in motion : how we perceive object motion during smooth pursuit eye movements

    NARCIS (Netherlands)

    Souman, J.L.

    2005-01-01

    Eye movements change the retinal image motion of objects in the visual field. When we make an eye movement, the image of a stationary object will move across the retinae, while the retinal image of an object that we follow with the eyes is approximately stationary. To enable us to perceive motion in

  1. Estimating network effect in geocenter motion: Theory

    Science.gov (United States)

    Zannat, Umma Jamila; Tregoning, Paul

    2017-10-01

    Geophysical models and their interpretations of several processes of interest, such as sea level rise, postseismic relaxation, and glacial isostatic adjustment, are intertwined with the need to realize the International Terrestrial Reference Frame. However, this realization needs to take into account the geocenter motion, that is, the motion of the center of figure of the Earth surface, due to, for example, deformation of the surface by earthquakes or hydrological loading effects. Usually, there is also a discrepancy, known as the network effect, between the theoretically convenient center of figure and the physically accessible center of network frames, because of unavoidable factors such as uneven station distribution, lack of stations in the oceans, disparity in the coverage between the two hemispheres, and the existence of tectonically deforming zones. Here we develop a method to estimate the magnitude of the network effect, that is, the error introduced by the incomplete sampling of the Earth surface, in measuring the geocenter motion, for a network of space geodetic stations of a fixed size N. For this purpose, we use, as our proposed estimate, the standard deviations of the changes in Helmert parameters measured by a random network of the same size N. We show that our estimate scales as 1/√N and give an explicit formula for it in terms of the vector spherical harmonics expansion of the displacement field. In a complementary paper we apply this formalism to coseismic displacements and elastic deformations due to surface water movements.

  2. Analytical Analysis of Motion Separability

    Directory of Open Access Journals (Sweden)

    Marjan Hadian Jazi

    2013-01-01

    Full Text Available Motion segmentation is an important task in computer vision and several practical approaches have already been developed. A common approach to motion segmentation is to use the optical flow and formulate the segmentation problem using a linear approximation of the brightness constancy constraints. Although there are numerous solutions to solve this problem and their accuracies and reliabilities have been studied, the exact definition of the segmentation problem, its theoretical feasibility and the conditions for successful motion segmentation are yet to be derived. This paper presents a simplified theoretical framework for the prediction of feasibility, of segmentation of a two-dimensional linear equation system. A statistical definition of a separable motion (structure is presented and a relatively straightforward criterion for predicting the separability of two different motions in this framework is derived. The applicability of the proposed criterion for prediction of the existence of multiple motions in practice is examined using both synthetic and real image sequences. The prescribed separability criterion is useful in designing computer vision applications as it is solely based on the amount of relative motion and the scale of measurement noise.

  3. Cervical spine motion: radiographic study

    International Nuclear Information System (INIS)

    Morgan, J.P.; Miyabayashi, T.; Choy, S.

    1986-01-01

    Knowledge of the acceptable range of motion of the cervical spine of the dog is used in the radiographic diagnosis of both developmental and degenerative diseases. A series of radiographs of mature Beagle dogs was used to identify motion within sagittal and transverse planes. Positioning of the dog's head and neck was standardized, using a restraining board, and mimicked those thought to be of value in diagnostic radiology. The range of motion was greatest between C2 and C5. Reports of severe disk degeneration in the cervical spine of the Beagle describe the most severely involved disks to be C4 through C7. Thus, a high range of motion between vertebral segments does not seem to be the cause for the severe degenerative disk disease. Dorsoventral slippage between vertebral segments was seen, but was not accurately measured. Wedging of disks was clearly identified. At the atlantoaxio-occipital region, there was a high degree of motion within the sagittal plane at the atlantoaxial and atlanto-occipital joints; the measurement can be a guideline in the radiographic diagnosis of instability due to developmental anomalies in this region. Lateral motion within the transverse plane was detected at the 2 joints; however, motion was minimal, and the measurements seemed to be less accurate because of rotation of the cervical spine. Height of the vertebral canal was consistently noted to be greater at the caudal orifice, giving some warning to the possibility of overdiagnosis in suspected instances of cervical spondylopathy

  4. Fundamentals - longitudinal motion

    International Nuclear Information System (INIS)

    Weng, W.T.

    1989-01-01

    There are many ways to accelerate charged particles to high energy for physics research. Each has served its purpose but eventually has encountered fundamental limitations of one kind or another. Looking at the famous Livingston curve, the initial birth and final level-off of all types of accelerators is seen. In fact, in the mid-80s we personally witnessed the creation of a new type of collider - the Stanford Linear Collider. Also witnessed, was the resurgence of study into novel methods of acceleration. This paper will cover acceleration and longitudinal motion in a synchrotron. A synchrotron is a circular accelerator with the following three characteristics: (1) Magnetic guiding (dipole) and confinement (quadrupole) components are placed in a small neighborhood around the equilibrium orbit. (2) Particles are kept in resonance with the radio-frequency electric field indefinitely to achieve acceleration to higher energies. (3) Magnetic fields are varied adiabatically with the energy of the particle. D. Edwards described the transverse oscillations of particles in a synchrotron. Here the author talks about the longitudinal oscillations of particles. The phase stability principle was invented by V. Veksler and E. McMillan independently in 1945. The phase stability and strong focusing principle, invented by Courant and Livingston in 1952, enabled the steady energy gain of accelerators and storage rings witnessed during the past 30 years. This paper is a unified overview of the related rf subjects in an accelerator and a close coupling between accelerator physics and engineering practices, which is essential for the major progress in areas such as high intensity synchrotrons, a multistage accelerator complex, and anti-proton production and cooling, made possible in the past 20 years

  5. A Motion Planning Approach to Studying Molecular Motions

    KAUST Repository

    Amato, Nancy M.; Tapia, Lydia; Thomas, Shawna

    2010-01-01

    While structurally very different, protein and RNA molecules share an important attribute. The motions they undergo are strongly related to the function they perform. For example, many diseases such as Mad Cow disease or Alzheimer's disease

  6. What motion is: William Neile and the laws of motion.

    Science.gov (United States)

    Kemeny, Max

    2017-07-01

    In 1668-1669 William Neile and John Wallis engaged in a protracted correspondence regarding the nature of motion. Neile was unhappy with the laws of motion that had been established by the Royal Society in three papers published in 1668, deeming them not explanations of motion at all, but mere descriptions. Neile insisted that science could not be informative without a discussion of causes, meaning that Wallis's purely kinematic account of collision could not be complete. Wallis, however, did not consider Neile's objections to his work to be serious. Rather than engage in a discussion of the proper place of natural philosophy in science, Wallis decided to show how Neile's preferred treatment of motion lead to absurd conclusions. This dispute is offered as a case study of dispute resolution within the early Royal Society.

  7. Adaptive Motion Compensation in Radiotherapy

    CERN Document Server

    Murphy, Martin J

    2011-01-01

    External-beam radiotherapy has long been challenged by the simple fact that patients can (and do) move during the delivery of radiation. Recent advances in imaging and beam delivery technologies have made the solution--adapting delivery to natural movement--a practical reality. Adaptive Motion Compensation in Radiotherapy provides the first detailed treatment of online interventional techniques for motion compensation radiotherapy. This authoritative book discusses: Each of the contributing elements of a motion-adaptive system, including target detection and tracking, beam adaptation, and pati

  8. Robust motion estimation using connected operators

    OpenAIRE

    Salembier Clairon, Philippe Jean; Sanson, H

    1997-01-01

    This paper discusses the use of connected operators for robust motion estimation The proposed strategy involves a motion estimation step extracting the dominant motion and a ltering step relying on connected operators that remove objects that do not fol low the dominant motion. These two steps are iterated in order to obtain an accurate motion estimation and a precise de nition of the objects fol lowing this motion This strategy can be applied on the entire frame or on individual connected c...

  9. Dance notations and robot motion

    CERN Document Server

    Abe, Naoko

    2016-01-01

    How and why to write a movement? Who is the writer? Who is the reader? They may be choreographers working with dancers. They may be roboticists programming robots. They may be artists designing cartoons in computer animation. In all such fields the purpose is to express an intention about a dance, a specific motion or an action to perform, in terms of intelligible sequences of elementary movements, as a music score that would be devoted to motion representation. Unfortunately there is no universal language to write a motion. Motion languages live together in a Babel tower populated by biomechanists, dance notators, neuroscientists, computer scientists, choreographers, roboticists. Each community handles its own concepts and speaks its own language. The book accounts for this diversity. Its origin is a unique workshop held at LAAS-CNRS in Toulouse in 2014. Worldwide representatives of various communities met there. Their challenge was to reach a mutual understanding allowing a choreographer to access robotics ...

  10. Generalized quantal equation of motion

    International Nuclear Information System (INIS)

    Morsy, M.W.; Embaby, M.

    1986-07-01

    In the present paper, an attempt is made for establishing a generalized equation of motion for quantal objects, in which intrinsic self adjointness is naturally built in, independently of any prescribed representation. This is accomplished by adopting Hamilton's principle of least action, after incorporating, properly, the quantal features and employing the generalized calculus of variations, without being restricted to fixed end points representation. It turns out that our proposed equation of motion is an intrinsically self-adjoint Euler-Lagrange's differential equation that ensures extremization of the quantal action as required by Hamilton's principle. Time dependence is introduced and the corresponding equation of motion is derived, in which intrinsic self adjointness is also achieved. Reducibility of the proposed equation of motion to the conventional Schroedinger equation is examined. The corresponding continuity equation is established, and both of the probability density and the probability current density are identified. (author)

  11. On the equations of motion

    International Nuclear Information System (INIS)

    Jannussis, A.; Streclas, A.; Sourlas, D.; Vlachos, K.

    1977-01-01

    Using the theorem of the derivative of a function of operators with respect to any parameter, we can find the equation of motion of a system in classical mechanics, in canonical as well as in non-canonical mechanics

  12. Weigh-in-Motion Stations

    Data.gov (United States)

    Department of Homeland Security — The data included in the GIS Traffic Stations Version database have been assimilated from station description files provided by FHWA for Weigh-in-Motion (WIM), and...

  13. Physical chemistry: Molecular motion watched

    Science.gov (United States)

    Siwick, Bradley; Collet, Eric

    2013-04-01

    A laser pulse can switch certain crystals from an insulating phase to a highly conducting phase. The ultrafast molecular motions that drive the transition have been directly observed using electron diffraction. See Letter p.343

  14. Is Diaphragm Motion a Good Surrogate for Liver Tumor Motion?

    Energy Technology Data Exchange (ETDEWEB)

    Yang, Juan [Department of Radiation Oncology, Duke University Medical Center, Durham, North Carolina (United States); School of Information Science and Engineering, Shandong University, Jinan, Shandong (China); Cai, Jing [Department of Radiation Oncology, Duke University Medical Center, Durham, North Carolina (United States); Wang, Hongjun [School of Information Science and Engineering, Shandong University, Jinan, Shandong (China); Chang, Zheng; Czito, Brian G. [Department of Radiation Oncology, Duke University Medical Center, Durham, North Carolina (United States); Bashir, Mustafa R. [Department of Radiology, Duke University Medical Center, Durham, North Carolina (United States); Palta, Manisha [Department of Radiation Oncology, Duke University Medical Center, Durham, North Carolina (United States); Yin, Fang-Fang, E-mail: fangfang.yin@duke.edu [Department of Radiation Oncology, Duke University Medical Center, Durham, North Carolina (United States)

    2014-11-15

    Purpose: To evaluate the relationship between liver tumor motion and diaphragm motion. Methods and Materials: Fourteen patients with hepatocellular carcinoma (10 of 14) or liver metastases (4 of 14) undergoing radiation therapy were included in this study. All patients underwent single-slice cine–magnetic resonance imaging simulations across the center of the tumor in 3 orthogonal planes. Tumor and diaphragm motion trajectories in the superior–inferior (SI), anterior–posterior (AP), and medial–lateral (ML) directions were obtained using an in-house-developed normalized cross-correlation–based tracking technique. Agreement between the tumor and diaphragm motion was assessed by calculating phase difference percentage, intraclass correlation coefficient, and Bland-Altman analysis (Diff). The distance between the tumor and tracked diaphragm area was analyzed to understand its impact on the correlation between the 2 motions. Results: Of all patients, the mean (±standard deviation) phase difference percentage values were 7.1% ± 1.1%, 4.5% ± 0.5%, and 17.5% ± 4.5% in the SI, AP, and ML directions, respectively. The mean intraclass correlation coefficient values were 0.98 ± 0.02, 0.97 ± 0.02, and 0.08 ± 0.06 in the SI, AP, and ML directions, respectively. The mean Diff values were 2.8 ± 1.4 mm, 2.4 ± 1.1 mm, and 2.2 ± 0.5 mm in the SI, AP, and ML directions, respectively. Tumor and diaphragm motions had high concordance when the distance between the tumor and tracked diaphragm area was small. Conclusions: This study showed that liver tumor motion had good correlation with diaphragm motion in the SI and AP directions, indicating diaphragm motion in the SI and AP directions could potentially be used as a reliable surrogate for liver tumor motion.

  15. Storyboard dalam Pembuatan Motion Graphic

    OpenAIRE

    Satrya Mahardhika; A.F. Choiril Anam Fathoni

    2013-01-01

    Motion graphics is one category in the animation that makes animation with lots of design elements in each component. Motion graphics needs long process including preproduction, production, and postproduction. Preproduction has an important role so that the next stage may provide guidance or instructions for the production process or the animation process. Preproduction includes research, making the story, script, screenplay, character, environment design and storyboards. The storyboard will ...

  16. q-deformed Brownian motion

    CERN Document Server

    Man'ko, V I

    1993-01-01

    Brownian motion may be embedded in the Fock space of bosonic free field in one dimension.Extending this correspondence to a family of creation and annihilation operators satisfying a q-deformed algebra, the notion of q-deformation is carried from the algebra to the domain of stochastic processes.The properties of q-deformed Brownian motion, in particular its non-Gaussian nature and cumulant structure,are established.

  17. Spatial filtering precedes motion detection.

    Science.gov (United States)

    Morgan, M J

    1992-01-23

    When we perceive motion on a television or cinema screen, there must be some process that allows us to track moving objects over time: if not, the result would be a conflicting mass of motion signals in all directions. A possible mechanism, suggested by studies of motion displacement in spatially random patterns, is that low-level motion detectors have a limited spatial range, which ensures that they tend to be stimulated over time by the same object. This model predicts that the direction of displacement of random patterns cannot be detected reliably above a critical absolute displacement value (Dmax) that is independent of the size or density of elements in the display. It has been inferred that Dmax is a measure of the size of motion detectors in the visual pathway. Other studies, however, have shown that Dmax increases with element size, in which case the most likely interpretation is that Dmax depends on the probability of false matches between pattern elements following a displacement. These conflicting accounts are reconciled here by showing that Dmax is indeed determined by the spacing between the elements in the pattern, but only after fine detail has been removed by a physiological prefiltering stage: the filter required to explain the data has a similar size to the receptive field of neurons in the primate magnocellular pathway. The model explains why Dmax can be increased by removing high spatial frequencies from random patterns, and simplifies our view of early motion detection.

  18. Passive infrared motion sensing technology

    International Nuclear Information System (INIS)

    Doctor, A.P.

    1994-01-01

    In the last 10 years passive IR based (8--12 microns) motion sensing has matured to become the dominant method of volumetric space protection and surveillance. These systems currently cost less than $25 to produce and yet use traditionally expensive IR optics, filters, sensors and electronic circuitry. This IR application is quite interesting in that the volumes of systems produced and the costs and performance level required prove that there is potential for large scale commercial applications of IR technology. This paper will develop the basis and principles of operation of a staring motion sensor system using a technical approach. A model for the motion of the target is developed and compared to the background. The IR power difference between the target and the background as well as the optical requirements are determined from basic principles and used to determine the performance of the system. Low cost reflective and refractive IR optics and bandpass IR filters are discussed. The pyroelectric IR detector commonly used is fully discussed and characterized. Various schemes for ''false alarms'' have been developed and are also explained. This technology is also used in passive IR based motion sensors for other applications such as lighting control. These applications are also discussed. In addition the paper will discuss new developments in IR surveillance technology such as the use of linear motion sensing arrays. This presentation can be considered a ''primer'' on the art of Passive IR Motion Sensing as applied to Surveillance Technology

  19. Numerical simulation of ship motion in offshore and harbour areas

    DEFF Research Database (Denmark)

    Christensen, Erik Damgaard; Jensen, Bjarne; Mortensen, Simon Brandi

    2008-01-01

    A method for simulating the motions and mooring forces of a moored ship subject to wave forcing has been further developed and validated for both the open water case and inside harbour areas. The method was originally developed and reported in Bingham (2000). The simulation tool is named WAMSIM...

  20. Examination of faults active motion on buried pipelines | Parish ...

    African Journals Online (AJOL)

    ... lateral spreading, landslides and slope failures. Since the pipelines are widely spread, and in some areas necessarily cross through the areas with faults, therefore, improvement study of pipelines in areas with faults is very important. This article explores faults active motion on buried pipelines. Keywords: water utilities ...

  1. Use of offshore mooring platform for sea wave motion analysis

    International Nuclear Information System (INIS)

    Cicconi, G.; Dagnino, I.; Papa, L.

    1979-01-01

    An offshore mooring platform for supertankers may often turn out to be an ideal solution for the problem of installing a meteorological station. Its location may be particularly desirable for the purpose of recording and analysing sea wave motion in deep water or in the intermediate zone between shallow and deep water. The preliminary results obtained through the operation of a subsurface sensor at the mooring platform off the harbour of Genova are reported. (author)

  2. Use of offshore mooring platform for sea wave motion analysis

    Energy Technology Data Exchange (ETDEWEB)

    Cicconi, G.; Dagnino, I.; Papa, L. (Genova Univ. (Italy). Ist. Geofisica e Geodetico); Basano, L.; Ottonello, P. (Genoa Univ. (Italy))

    An offshore mooring platform for supertankers may often turn out to be an ideal solution for the problem of installing a meteorological station. Its location may be particularly desirable for the purpose of recording and analysing sea wave motion in deep water or in the intermediate zone between shallow and deep water. The preliminary results obtained through the operation of a subsurface sensor at the mooring platform off the harbour of Genova are reported.

  3. Designing a compact MRI motion phantom

    Directory of Open Access Journals (Sweden)

    Schmiedel Max

    2016-09-01

    Full Text Available Even today, dealing with motion artifacts in magnetic resonance imaging (MRI is a challenging task. Image corruption due to spontaneous body motion complicates diagnosis. In this work, an MRI phantom for rigid motion is presented. It is used to generate motion-corrupted data, which can serve for evaluation of blind motion compensation algorithms. In contrast to commercially available MRI motion phantoms, the presented setup works on small animal MRI systems. Furthermore, retrospective gating is performed on the data, which can be used as a reference for novel motion compensation approaches. The motion of the signal source can be reconstructed using motor trigger signals and be utilized as the ground truth for motion estimation. The proposed setup results in motion corrected images. Moreover, the importance of preprocessing the MRI raw data, e.g. phase-drift correction, is demonstrated. The gained knowledge can be used to design an MRI phantom for elastic motion.

  4. Drop detachment and motion on fuel cell electrode materials.

    Science.gov (United States)

    Gauthier, Eric; Hellstern, Thomas; Kevrekidis, Ioannis G; Benziger, Jay

    2012-02-01

    Liquid water is pushed through flow channels of fuel cells, where one surface is a porous carbon electrode made up of carbon fibers. Water drops grow on the fibrous carbon surface in the gas flow channel. The drops adhere to the superficial fiber surfaces but exhibit little penetration into the voids between the fibers. The fibrous surfaces are hydrophobic, but there is a substantial threshold force necessary to initiate water drop motion. Once the water drops begin to move, however, the adhesive force decreases and drops move with minimal friction, similar to motion on superhydrophobic materials. We report here studies of water wetting and water drop motion on typical porous carbon materials (carbon paper and carbon cloth) employed in fuel cells. The static coefficient of friction on these textured surfaces is comparable to that for smooth Teflon. But the dynamic coefficient of friction is several orders of magnitude smaller on the textured surfaces than on smooth Teflon. Carbon cloth displays a much smaller static contact angle hysteresis than carbon paper due to its two-scale roughness. The dynamic contact angle hysteresis for carbon paper is greatly reduced compared to the static contact angle hysteresis. Enhanced dynamic hydrophobicity is suggested to result from the extent to which a dynamic contact line can track topological heterogeneities of the liquid/solid interface.

  5. Wind-enhanced resuspension in the shallow waters of South San Francisco Bay: Mechanisms and potential implications for cohesive sediment transport

    Science.gov (United States)

    Brand, Andreas; Lacy, Jessica R.; Hsu, Kevin; Hoover, Daniel; Gladding, Steve; Stacey, Mark T.

    2010-01-01

    We investigated the driving forces of sediment dynamics at the shoals in South San Francisco Bay. Two stations were deployed along a line perpendicular to a 14 m deep channel, 1000 and 2000 m from the middle of the channel. Station depths were 2.59 and 2.19 m below mean lower low water, respectively. We used acoustic Doppler velocimeters for the simultaneous determination of current velocities, turbulence, sediment concentration and fluxes. Maximum current shear velocities were 0.015 m s−1 at the station further from the channel (closer to the shore) and 0.02 m s−1 at the station closer to the channel. Peak wave-induced shear velocities exceeded 0.015 m s−1 at both stations. Maximum sediment concentrations were around 30 g m−3 during calm periods (root mean square wave height −3 and sediment fluxes were 5 times higher than in calm conditions (0.02 g m−2 s−1 versus >0.10 g m−2 s−1) at the station further from the channel 0.36 m above the bed. Closer to the channel, sediment concentrations and vertical fluxes due to wind wave resuspension were persistently lower (maximum concentrations around 50 g m−3 and maximum fluxes around 0.04 g m−2 s−1). Most resuspension events occurred during flood tides that followed wave events during low water. Although wave motions are able to resuspend sediment into the wave boundary layer at low tide, the observed large increases in sediment fluxes are due to the nonlinear interaction of wind waves and the tidal currents.

  6. 19 CFR 210.26 - Other motions.

    Science.gov (United States)

    2010-04-01

    ... 19 Customs Duties 3 2010-04-01 2010-04-01 false Other motions. 210.26 Section 210.26 Customs Duties UNITED STATES INTERNATIONAL TRADE COMMISSION INVESTIGATIONS OF UNFAIR PRACTICES IN IMPORT TRADE ADJUDICATION AND ENFORCEMENT Motions § 210.26 Other motions. Motions pertaining to discovery shall be filed in...

  7. 6 CFR 13.28 - Motions.

    Science.gov (United States)

    2010-01-01

    ... 6 Domestic Security 1 2010-01-01 2010-01-01 false Motions. 13.28 Section 13.28 Domestic Security DEPARTMENT OF HOMELAND SECURITY, OFFICE OF THE SECRETARY PROGRAM FRAUD CIVIL REMEDIES § 13.28 Motions. (a) Any application to the ALJ for an order or ruling will be by motion. Motions will state the relief...

  8. Motion-compensated processing of image signals

    NARCIS (Netherlands)

    2010-01-01

    In a motion-compensated processing of images, input images are down-scaled (scl) to obtain down-scaled images, the down-scaled images are subjected to motion- compensated processing (ME UPC) to obtain motion-compensated images, the motion- compensated images are up-scaled (sc2) to obtain up-scaled

  9. 12 CFR 747.23 - Motions.

    Science.gov (United States)

    2010-01-01

    ... written motions except as otherwise directed by the administrative law judge. Written memorandum, briefs... Procedure § 747.23 Motions. (a) In writing. (1) Except as otherwise provided herein, an application or request for an order or ruling must be made by written motion. (2) All written motions must state with...

  10. 7 CFR 1.327 - Motions.

    Science.gov (United States)

    2010-01-01

    ... be in writing. The ALJ may require that oral motions be reduced to writing. (c) The ALJ may require written motions to be accompanied by supporting memorandums. (d) Within 15 days after a written motion is...) The ALJ may not grant a written motion prior to expiration of the time for filing responses thereto...

  11. Motion Learning Based on Bayesian Program Learning

    Directory of Open Access Journals (Sweden)

    Cheng Meng-Zhen

    2017-01-01

    Full Text Available The concept of virtual human has been highly anticipated since the 1980s. By using computer technology, Human motion simulation could generate authentic visual effect, which could cheat human eyes visually. Bayesian Program Learning train one or few motion data, generate new motion data by decomposing and combining. And the generated motion will be more realistic and natural than the traditional one.In this paper, Motion learning based on Bayesian program learning allows us to quickly generate new motion data, reduce workload, improve work efficiency, reduce the cost of motion capture, and improve the reusability of data.

  12. Finding viscosity of liquids from Brownian motion at students' laboratory

    International Nuclear Information System (INIS)

    Greczylo, Tomasz; Debowska, Ewa

    2005-01-01

    Brownian motion appears to be a good subject for investigation at advanced students' laboratory [1]. The paper presents such an investigation carried out in Physics Laboratory II at the Institute of Experimental Physics of Wroclaw University. The experiment has been designed to find viscosity of liquids from Brownian motion phenomenon. Authors use modern technology that helps to proceed with measurements and makes the procedure less time and effort consuming. Discussion of the process of setting up the experiment and the results obtained for three different solutions of glycerin in water are presented. Advantages and disadvantages of the apparatus are pointed out along with descriptions of possible future uses

  13. Robot Motion and Control 2011

    CERN Document Server

    2012-01-01

    Robot Motion Control 2011 presents very recent results in robot motion and control. Forty short papers have been chosen from those presented at the sixth International Workshop on Robot Motion and Control held in Poland in June 2011. The authors of these papers have been carefully selected and represent leading institutions in this field. The following recent developments are discussed: • Design of trajectory planning schemes for holonomic and nonholonomic systems with optimization of energy, torque limitations and other factors. • New control algorithms for industrial robots, nonholonomic systems and legged robots. • Different applications of robotic systems in industry and everyday life, like medicine, education, entertainment and others. • Multiagent systems consisting of mobile and flying robots with their applications The book is suitable for graduate students of automation and robotics, informatics and management, mechatronics, electronics and production engineering systems as well as scientists...

  14. Compensation for incoherent ground motion

    International Nuclear Information System (INIS)

    Shigeru, Takeda; Hiroshi, Matsumoto; Masakazu, Yoshioka; Yasunori, Takeuchi; Kikuo, Kudo; Tsuneya, Tsubokawa; Mitsuaki, Nozaki; Kiyotomo, Kawagoe

    1999-01-01

    The power spectrum density and coherence function for ground motions are studied for the construction of the next generation electron-positron linear collider. It should provide a center of mass energy between 500 GeV-1 TeV with luminosity as high as 10 33 to 10 34 cm -2 sec -1 . Since the linear collider has a relatively slow repetition rate, large number of particles and small sizes of the beam should be generated and preserved in the machine to obtain the required high luminosity. One of the most critical parameters is the extremely small vertical beam size at the interaction point, thus a proper alignment system for the focusing and accelerating elements of the machine is necessary to achieve the luminosity. We describe recent observed incoherent ground motions and an alignment system to compensate the distortion by the ground motions. (authors)

  15. Motion sensor technologies in education

    Directory of Open Access Journals (Sweden)

    T. Bratitsis

    2014-05-01

    Full Text Available This paper attempts to raise a discussion regarding motion sensor technologies, mainly seen as peripherals of contemporary video game consoles, by examining their exploitation within educational context. An overview of the existing literature is presented, while attempting to categorize the educational approaches which involve motion sensor technologies, in two parts. The first one concerns the education of people with special needs. The utilization of motion sensor technologies, incorporated by game consoles, in the education of such people is examined. The second one refers to various educational approaches in regular education, under which not so many research approaches, but many teaching ideas can be found. The aim of the paper is to serve as a reference point for every individual/group, willing to explore the Sensor-Based Games Based Learning (SBGBL research area, by providing a complete and structured literature review.

  16. Restoration of motion blurred images

    Science.gov (United States)

    Gaxiola, Leopoldo N.; Juarez-Salazar, Rigoberto; Diaz-Ramirez, Victor H.

    2017-08-01

    Image restoration is a classic problem in image processing. Image degradations can occur due to several reasons, for instance, imperfections of imaging systems, quantization errors, atmospheric turbulence, relative motion between camera or objects, among others. Motion blur is a typical degradation in dynamic imaging systems. In this work, we present a method to estimate the parameters of linear motion blur degradation from a captured blurred image. The proposed method is based on analyzing the frequency spectrum of a captured image in order to firstly estimate the degradation parameters, and then, to restore the image with a linear filter. The performance of the proposed method is evaluated by processing synthetic and real-life images. The obtained results are characterized in terms of accuracy of image restoration given by an objective criterion.

  17. Visualization system of swirl motion

    International Nuclear Information System (INIS)

    Nakayama, K.; Umeda, K.; Ichikawa, T.; Nagano, T.; Sakata, H.

    2004-01-01

    The instrumentation of a system composed of an experimental device and numerical analysis is presented to visualize flow and identify swirling motion. Experiment is performed with transparent material and PIV (Particle Image Velocimetry) instrumentation, by which velocity vector field is obtained. This vector field is then analyzed numerically by 'swirling flow analysis', which estimates its velocity gradient tensor and the corresponding eigenvalue (swirling function). Since an instantaneous flow field in steady/unsteady states is captured by PIV, the flow field is analyzed, and existence of vortices or swirling motions and their locations are identified in spite of their size. In addition, intensity of swirling is evaluated. The analysis enables swirling motion to emerge, even though it is hidden in uniform flow and velocity filed does not indicate any swirling. This visualization system can be applied to investigate condition to control flow or design flow. (authors)

  18. Alpha motion based on a motion detector, but not on the Müller-Lyer illusion

    Science.gov (United States)

    Suzuki, Masahiro

    2014-07-01

    This study examined the mechanism of alpha motion, the apparent motion of the Müller-Lyer figure's shaft that occurs when the arrowheads and arrow tails are alternately presented. The following facts were found: (a) reduced exposure duration decreased the amount of alpha motion, and this phenomenon was not explainable by the amount of the Müller-Lyer illusion; (b) the motion aftereffect occurred after adaptation to alpha motion; (c) occurrence of alpha motion became difficult when the temporal frequency increased, and this characteristic of alpha motion was similar to the characteristic of a motion detector that motion detection became difficult when the temporal frequency increased from the optimal frequency. These findings indicated that alpha motion occurs on the basis of a motion detector but not on the Müller-Lyer illusion, and that the mechanism of alpha motion is the same as that of general motion perception.

  19. Motion artifacts in computed tomography

    International Nuclear Information System (INIS)

    Yang, C.K.

    1979-01-01

    In the year 1972, the first Computed Tomography Scanner (or CT) was introduced and caused a revolution in the field of Diagnostic Radiology. A tomogram is a cross-sectional image of a three-dimensional object obtained through non-invasive measurements. The image that is presented is very similar to what would be seen if a thin cross-sectional slice of the patient was examined. In Computed Tomography, x-rays are passed through the body of a patient in many different directions and their attenuation is detected. By using some mathematical theorems, the attenuation information can be converted into the density of the patient along the x-ray path. Combined with modern sophisticated computer signal processing technology, a cross-sectional image can be generated and displayed on a TV monitor. Usually a good CT image relies on the patient not moving during the x-ray scanning. However, for some unconscious or severely ill patients, this is very difficult to achieve. Thus, the motion during the scan causes the so-called motion artifacts which distort the displayed image and sometimes these motion artifacts make diagnosis impossible. Today, to remove or avoid motion artifacts is one of the major efforts in developing new scanner systems. In this thesis, a better understanding of the motion artifacts problem in CT scaning is gained through computer simulations, real scanner experiments and theoretical analyses. The methods by which the distorted image can be improved are simulated also. In particular, it is assumed that perfect knowledge of the patient motion is known since this represents the theoretical limit on how well the distorted image can be improved

  20. Mental imagery of gravitational motion.

    Science.gov (United States)

    Gravano, Silvio; Zago, Myrka; Lacquaniti, Francesco

    2017-10-01

    There is considerable evidence that gravitational acceleration is taken into account in the interaction with falling targets through an internal model of Earth gravity. Here we asked whether this internal model is accessed also when target motion is imagined rather than real. In the main experiments, naïve participants grasped an imaginary ball, threw it against the ceiling, and caught it on rebound. In different blocks of trials, they had to imagine that the ball moved under terrestrial gravity (1g condition) or under microgravity (0g) as during a space flight. We measured the speed and timing of the throwing and catching actions, and plotted ball flight duration versus throwing speed. Best-fitting duration-speed curves estimate the laws of ball motion implicit in the participant's performance. Surprisingly, we found duration-speed curves compatible with 0g for both the imaginary 0g condition and the imaginary 1g condition, despite the familiarity with Earth gravity effects and the added realism of performing the throwing and catching actions. In a control experiment, naïve participants were asked to throw the imaginary ball vertically upwards at different heights, without hitting the ceiling, and to catch it on its way down. All participants overestimated ball flight durations relative to the durations predicted by the effects of Earth gravity. Overall, the results indicate that mental imagery of motion does not have access to the internal model of Earth gravity, but resorts to a simulation of visual motion. Because visual processing of accelerating/decelerating motion is poor, visual imagery of motion at constant speed or slowly varying speed appears to be the preferred mode to perform the tasks. Copyright © 2017 Elsevier Ltd. All rights reserved.

  1. Roll motion stimuli : sensory conflict, perceptual weighting and motion sickness

    NARCIS (Netherlands)

    Graaf, B. de; Bles, W.; Bos, J.E.

    1998-01-01

    In an experiment with seventeen subjects interactions of visual roll motion stimuli and vestibular body tilt stimuli were examined in determining the subjective vertical. Interindi-vidual differences in weighting the visual information were observed, but in general visual and vestibular responses

  2. Motion Model Employment using interacting Motion Model Algorithm

    DEFF Research Database (Denmark)

    Hussain, Dil Muhammad Akbar

    2006-01-01

    The paper presents a simulation study to track a maneuvering target using a selective approach in choosing Interacting Multiple Models (IMM) algorithm to provide a wider coverage to track such targets.  Initially, there are two motion models in the system to track a target.  Probability of each m...

  3. Wave motion in elastic solids

    CERN Document Server

    Graff, Karl F

    1991-01-01

    This highly useful textbook presents comprehensive intermediate-level coverage of nearly all major topics of elastic wave propagation in solids. The subjects range from the elementary theory of waves and vibrations in strings to the three-dimensional theory of waves in thick plates. The book is designed not only for a wide audience of engineering students, but also as a general reference for workers in vibrations and acoustics. Chapters 1-4 cover wave motion in the simple structural shapes, namely strings, longitudinal rod motion, beams and membranes, plates and (cylindrical) shells. Chapter

  4. Motion of rectangular prismatic bodies

    International Nuclear Information System (INIS)

    Poreh, M.; Wray, R.N.

    1979-01-01

    Rectangular prismatic bodies can assume either a translatory or an auto-rotating mode of motion during free motion in the atmosphere. The translatory mode is stable only when the dimensionless moment of inertia of the bodies is large, however, large perturbations will always start auto-rotation. The characteristics of the auto-rotational mode are shown to depend primarily on the aspect ratio of the bodies which determines the dimensionless rotational speed and the lift coefficient. Both the average drag and lift-coefficients of auto-rotating bodies are estimated, but it is shown that secondary effects make it impossible to determine their exact trajectories in atmospheric flows

  5. Estimation of strong ground motion

    International Nuclear Information System (INIS)

    Watabe, Makoto

    1993-01-01

    Fault model has been developed to estimate a strong ground motion in consideration of characteristics of seismic source and propagation path of seismic waves. There are two different approaches in the model. The first one is a theoretical approach, while the second approach is a semi-empirical approach. Though the latter is more practical than the former to be applied to the estimation of input motions, it needs at least the small-event records, the value of the seismic moment of the small event and the fault model of the large event

  6. Biological Motion Perception in Autism

    Directory of Open Access Journals (Sweden)

    J Cusack

    2011-04-01

    Full Text Available Typically developing adults can readily recognize human actions, even when conveyed to them via point-like markers placed on the body of the actor (Johansson, 1973. Previous research has suggested that children affected by autism spectrum disorder (ASD are not equally sensitive to this type of visual information (Blake et al, 2003, but it remains unknown why ASD would impact the ability to perceive biological motion. We present evidence which looks at how adolescents and adults with autism are affected by specific factors which are important in biological motion perception, such as (eg, inter-agent synchronicity, upright/inverted, etc.

  7. Example-based human motion denoising.

    Science.gov (United States)

    Lou, Hui; Chai, Jinxiang

    2010-01-01

    With the proliferation of motion capture data, interest in removing noise and outliers from motion capture data has increased. In this paper, we introduce an efficient human motion denoising technique for the simultaneous removal of noise and outliers from input human motion data. The key idea of our approach is to learn a series of filter bases from precaptured motion data and use them along with robust statistics techniques to filter noisy motion data. Mathematically, we formulate the motion denoising process in a nonlinear optimization framework. The objective function measures the distance between the noisy input and the filtered motion in addition to how well the filtered motion preserves spatial-temporal patterns embedded in captured human motion data. Optimizing the objective function produces an optimal filtered motion that keeps spatial-temporal patterns in captured motion data. We also extend the algorithm to fill in the missing values in input motion data. We demonstrate the effectiveness of our system by experimenting with both real and simulated motion data. We also show the superior performance of our algorithm by comparing it with three baseline algorithms and to those in state-of-art motion capture data processing software such as Vicon Blade.

  8. Manipulation and controlled amplification of Brownian motion of microcantilever sensors

    International Nuclear Information System (INIS)

    Mehta, Adosh; Cherian, Suman; Hedden, David; Thundat, Thomas

    2001-01-01

    Microcantilevers, such as those used in atomic force microscopy, undergo Brownian motion due to mechanical thermal noise. The root mean square amplitude of the Brownian motion of a cantilever typically ranges from 0.01--0.1 nm, which limits its use in practical applications. Here we describe a technique by which the Brownian amplitude and the Q factor in air and water can be amplified by three and two orders of magnitude, respectively. This technique is similar to a positive feedback oscillator, wherein the Brownian motion of the vibrating cantilever controls the frequency output of the oscillator. This technique can be exploited to improve sensitivity of microcantilever-based chemical and biological sensors, especially for sensors in liquid environments

  9. Measurements of ground motion and magnets vibrations at the APS

    International Nuclear Information System (INIS)

    Shil'tsev, V.D.

    1994-01-01

    This article presents results of ground motion and magnets vibrations measurements at the Advanced Photon Source. The experiments were done over wide frequency range 0.05-100 Hz with use of SM-3KV type seismic probes from Budker Institute of Nuclear Physics (Russia). Spectral power densities of vertical and horizontal motions of the APS hall floor and quadrupoles on regular supports were obtained. There were also investigated magnets vibrations induced by designed cooling water flow and spectral characteristics of spatial correlation of the quads vibration at different sectors of the ring. Influence of personnel activity in the hall and traffic under the ring on slow motion of storage ring elements were observed. Amplitudes of vibrations at the APS are compared with results of seismic measurements at some other accelerators. 9 refs.; 10 figs.; 1 tab

  10. Measurements of ground motion and magnet vibrations at the APS

    International Nuclear Information System (INIS)

    Shiltsev, V.

    1996-01-01

    This article presents results of ground motion and magnet vibrations measurements at the Advanced Photon Source. The experiments were done over a wide, frequency range (0-05-100 Hz) with the use of SM-3KV-type seismic probes from the Budker Institute of Nuclear Physics (Russia). Spectral power densities of vertical and horizontal motions of the APS hall floor and quadrupoles on regular supports were obtained. Also investigated were magnet vibrations induced by designed cooling water flow and spectral characteristics of spatial correlation of the quadrupole vibrations at different sectors of the ring. The influence of personnel activity in the hall and traffic under the ring on the slow motion of storage ring elements were observed. Amplitudes of vibrations at the APS are compared with results of seismic measurements at some other accelerators

  11. Effect of site conditions on ground motion and damage

    Science.gov (United States)

    Borcherdt, R.; Glassmoyer, G.; Andrews, M.; Cranswick, E.

    1989-01-01

    Results of seismologic studies conducted by the U.S. reconnaissance team in conjunction with Soviet colleagues following the tragic earthquakes of December 7, 1988, suggest that site conditions may have been a major factor in contributing to increased damage levels in Leninakan. As the potential severity of these effects in Leninakan had not been previously identified, this chapter presents results intended to provide a preliminary quantification of these effects on both damage and levels of ground motion observed in Leninakan. The article describes the damage distribution geologic setting, ground motion amplification in Leninakan, including analog amplifications and spectral amplifications. Preliminary model estimates for site response are presented. It is concluded that ground motion amplification in the 0.5-2.5-second period range was a major contributing factor to increased damage in Leninakan as compared with Kirovakan. Leninakan is located on thick water saturated alluvial deposits.

  12. Storyboard dalam Pembuatan Motion Graphic

    Directory of Open Access Journals (Sweden)

    Satrya Mahardhika

    2013-10-01

    Full Text Available Motion graphics is one category in the animation that makes animation with lots of design elements in each component. Motion graphics needs long process including preproduction, production, and postproduction. Preproduction has an important role so that the next stage may provide guidance or instructions for the production process or the animation process. Preproduction includes research, making the story, script, screenplay, character, environment design and storyboards. The storyboard will be determined through camera angles, blocking, sets, and many supporting roles involved in a scene. Storyboard is also useful as a production reference in recording or taping each scene in sequence or as an efficient priority. The example used is an ad creation using motion graphic animation storyboard which has an important role as a blueprint for every scene and giving instructions to make the transition movement, layout, blocking, and defining camera movement that everything should be done periodically in animation production. Planning before making the animation or motion graphic will make the job more organized, presentable, and more efficient in the process.  

  13. Estimation of Motion Vector Fields

    DEFF Research Database (Denmark)

    Larsen, Rasmus

    1993-01-01

    This paper presents an approach to the estimation of 2-D motion vector fields from time varying image sequences. We use a piecewise smooth model based on coupled vector/binary Markov random fields. We find the maximum a posteriori solution by simulated annealing. The algorithm generate sample...... fields by means of stochastic relaxation implemented via the Gibbs sampler....

  14. Rotational damping motion in nuclei

    International Nuclear Information System (INIS)

    Egido, J.L.; Faessler, A.

    1991-01-01

    The recently proposed model to explain the mechanism of the rotational motion damping in nuclei is exactly solved. When compared with the earlier approximative solution, we find significative differences in the low excitation energy limit (i.e. Γ μ 0 ). For the strength functions we find distributions going from the Wigner semicircle through gaussians to Breit-Wigner shapes. (orig.)

  15. Procedure to describe clavicular motion.

    Science.gov (United States)

    Gutierrez Delgado, Guivey; De Beule, Matthieu; Ortega Cardentey, Dolgis R; Segers, Patrick; Iznaga Benítez, Arsenio M; Rodríguez Moliner, Tania; Verhegghe, Benedict; Palmans, Tanneke; Van Hoof, Tom; Van Tongel, Alexander

    2017-03-01

    For many years, researchers have attempted to describe shoulder motions by using different mathematical methods. The aim of this study was to describe a procedure to quantify clavicular motion. The procedure proposed for the kinematic analysis consists of 4 main processes: 3 transcortical pins in the clavicle, motion capture, obtaining 3-dimensional bone models, and data processing. Clavicular motion by abduction (30° to 150°) and flexion (55° to 165°) were characterized by an increment of retraction of 27° to 33°, elevation of 25° to 28°, and posterior rotation of 14° to 15°, respectively. In circumduction, clavicular movement described an ellipse, which was reflected by retraction and elevation. Kinematic analysis shows that the articular surfaces move by simultaneously rolling and sliding on the convex surface of the sternum for the 3 movements of abduction, flexion, and circumduction. The use of 3 body landmarks in the clavicle and the direct measurement of bone allowed description of the osteokinematic and arthrokinematic movement of the clavicle. Copyright © 2017 Journal of Shoulder and Elbow Surgery Board of Trustees. Published by Elsevier Inc. All rights reserved.

  16. Pendulum Motion and Differential Equations

    Science.gov (United States)

    Reid, Thomas F.; King, Stephen C.

    2009-01-01

    A common example of real-world motion that can be modeled by a differential equation, and one easily understood by the student, is the simple pendulum. Simplifying assumptions are necessary for closed-form solutions to exist, and frequently there is little discussion of the impact if those assumptions are not met. This article presents a…

  17. Motion planning for multiple robots

    NARCIS (Netherlands)

    Aronov, B.; Berg, de M.; van der Stappen, A.F.; Svestka, P.; Vleugels, J.M.

    1999-01-01

    We study the motion-planning problem for pairs and triples of robots operating in a shared workspace containing n obstacles. A standard way to solve such problems is to view the collection of robots as one composite robot, whose number of degrees of freedom is d , the sum of the numbers of degrees

  18. Quantum equations from Brownian motions

    International Nuclear Information System (INIS)

    Rajput, B.S.

    2011-01-01

    Classical Schrodinger and Dirac equations have been derived from Brownian motions of a particle, it has been shown that the classical Schrodinger equation can be transformed to usual Schrodinger Quantum equation on applying Heisenberg uncertainty principle between position and momentum while Dirac Quantum equation follows it's classical counter part on applying Heisenberg uncertainly principle between energy and time without applying any analytical continuation. (author)

  19. Molecular motion in restricted geometries

    Indian Academy of Sciences (India)

    Molecular dynamics in restricted geometries is known to exhibit anomalous behaviour. Diffusion, translational or rotational, of molecules is altered significantly on confinement in restricted geometries. Quasielastic neutron scattering (QENS) offers a unique possibility of studying molecular motion in such systems. Both time ...

  20. Anharmonicity in nuclear wobbling motion

    International Nuclear Information System (INIS)

    Oi, M.

    2007-01-01

    An unexpected strong anharmonicity was observed in the wobbling spectrum in 163 Lu. In an attempt to understand what causes the deviation from the original wobbling model by Bohr and Mottelson, an analysis is presented using several different approaches, such as exact diagonalization, a semiclassical model to deal with anharmonic wobbling motion, and a microscopic method based on the self-consistent cranking calculation

  1. Genetics Home Reference: motion sickness

    Science.gov (United States)

    ... motion, particularly traveling in a car, bus, train, airplane, or boat. Amusement park rides, skiing, and virtual ... Association ClinicalTrials.gov (1 link) ClinicalTrials.gov Scientific Articles on PubMed (1 link) PubMed OMIM (1 link) ...

  2. Faraday's Law and Seawater Motion

    Science.gov (United States)

    De Luca, R.

    2010-01-01

    Using Faraday's law, one can illustrate how an electromotive force generator, directly utilizing seawater motion, works. The conceptual device proposed is rather simple in its components and can be built in any high school or college laboratory. The description of the way in which the device generates an electromotive force can be instructive not…

  3. Annotated Bibliography on Relative Motion

    Science.gov (United States)

    1992-03-01

    displace the sheave, and motive means operating the power ram. Preferably, the power run is subjected to i constant upward pneumatic force to provide...NCIEI- Report N- 1187 (Oct 1971). The theory is de\\ eloped for the swinging rmotion induced in a wire suspended load due to the hori7zontal motion of a

  4. Edge dependent motion blur reduction

    NARCIS (Netherlands)

    2010-01-01

    The invention relates to a method and a circuit arrangement to reduce motion blur of images shown in non-stroboscopic display devices, in particular Liquid Crystal Display Panels (LCDs). Thin Film Transistor Displays (TFTs), Color Sequential Displays. Plasma Display Panels (PDPs), Digital Micro

  5. Smoothing of respiratory motion traces for motion-compensated radiotherapy.

    Science.gov (United States)

    Ernst, Floris; Schlaefer, Alexander; Schweikard, Achim

    2010-01-01

    The CyberKnife system has been used successfully for several years to radiosurgically treat tumors without the need for stereotactic fixation or sedation of the patient. It has been shown that tumor motion in the lung, liver, and pancreas can be tracked with acceptable accuracy and repeatability. However, highly precise targeting for tumors in the lower abdomen, especially for tumors which exhibit strong motion, remains problematic. Reasons for this are manifold, like the slow tracking system operating at 26.5 Hz, and using the signal from the tracking camera "as is." Since the motion recorded with the camera is used to compensate for system latency by prediction and the predicted signal is subsequently used to infer the tumor position from a correlation model based on x-ray imaging of gold fiducials around the tumor, camera noise directly influences the targeting accuracy. The goal of this work is to establish the suitability of a new smoothing method for respiratory motion traces used in motion-compensated radiotherapy. The authors endeavor to show that better prediction--With a lower rms error of the predicted signal--and/or smoother prediction is possible using this method. The authors evaluated six commercially available tracking systems (NDI Aurora, PolarisClassic, Polaris Vicra, MicronTracker2 H40, FP5000, and accuTrack compact). The authors first tracked markers both stationary and while in motion to establish the systems' noise characteristics. Then the authors applied a smoothing method based on the a trous wavelet decomposition to reduce the devices' noise level. Additionally, the smoothed signal of the moving target and a motion trace from actual human respiratory motion were subjected to prediction using the MULIN and the nLMS2 algorithms. The authors established that the noise distribution for a static target is Gaussian and that when the probe is moved such as to mimic human respiration, it remains Gaussian with the exception of the FP5000 and the

  6. Smoothing of respiratory motion traces for motion-compensated radiotherapy

    International Nuclear Information System (INIS)

    Ernst, Floris; Schlaefer, Alexander; Schweikard, Achim

    2010-01-01

    Purpose: The CyberKnife system has been used successfully for several years to radiosurgically treat tumors without the need for stereotactic fixation or sedation of the patient. It has been shown that tumor motion in the lung, liver, and pancreas can be tracked with acceptable accuracy and repeatability. However, highly precise targeting for tumors in the lower abdomen, especially for tumors which exhibit strong motion, remains problematic. Reasons for this are manifold, like the slow tracking system operating at 26.5 Hz, and using the signal from the tracking camera ''as is''. Since the motion recorded with the camera is used to compensate for system latency by prediction and the predicted signal is subsequently used to infer the tumor position from a correlation model based on x-ray imaging of gold fiducials around the tumor, camera noise directly influences the targeting accuracy. The goal of this work is to establish the suitability of a new smoothing method for respiratory motion traces used in motion-compensated radiotherapy. The authors endeavor to show that better prediction--With a lower rms error of the predicted signal--and/or smoother prediction is possible using this method. Methods: The authors evaluated six commercially available tracking systems (NDI Aurora, PolarisClassic, Polaris Vicra, MicronTracker2 H40, FP5000, and accuTrack compact). The authors first tracked markers both stationary and while in motion to establish the systems' noise characteristics. Then the authors applied a smoothing method based on the a trous wavelet decomposition to reduce the devices' noise level. Additionally, the smoothed signal of the moving target and a motion trace from actual human respiratory motion were subjected to prediction using the MULIN and the nLMS 2 algorithms. Results: The authors established that the noise distribution for a static target is Gaussian and that when the probe is moved such as to mimic human respiration, it remains Gaussian with the

  7. Effects of ship's vibration and motion on plant parameters

    International Nuclear Information System (INIS)

    Kakuta, Tsunemi; Kitamura, Toshikatsu; Mizushima, Toshihiko; Yamazaki, Hiroshi; Nakahara, Takeshi; Kamiya, Eisei; Kudou, Takahiro; Naitoh, Akira; Tominaga, Mineo.

    1992-03-01

    Present report was written about the study of the effects of ship's vibration and motion on reactor plant performances measured and analyzed to confirm the total balance for control systems of reactor to propulsion. On July 10, 1990, or on the first day of the first voyage for the power up test, the sea trials of MUTSU, nuclear ship made first in Japan, started from the anchoring test. The trial tests had finished through the third voyage between October 30 and November 9 to the fourth voyage between 7 and 14 of December. The trial tests had been conducted over ten items or so containing in-house tests of the measurements of ship's vibration and motion in order to research the effects on reactor performance. We here call the in-house tests the plant correlation tests. In regard to the correlation with ship's vibration, we confirmed that the inherent vibrations of hull and reactor containment arisen from ship structure had precisely been measured and that the plant correlations due to the hull and local vibrations arising from propeller revolutions are very small. Concerning the correlation with ship's motion, it was shown that her rolling motion strongly had affected on the propulsion system such as shaft power and shaft revolutions. About the correlation with reactor systems it was found that her pitching motion had given effect on the water level in pressurizer, primary coolant average temperature, ε-signal of the auto-control of reactor power and primary coolant pressure etc, particularly, most-strongly on the water level in pressurizer; her rolling and pitching motions had given effect on nuclear characteristics such as reactivity and startup rate; in addition the fluctuation of 0.06 Hz, we think the response inherent in (MUTSU) reactor systems, had been observed on her reactor parameters like reactivity and startup rate, and her propulsion systems like shaft horse power. (author)

  8. Quantized motion of trapped ions

    International Nuclear Information System (INIS)

    Steinbach, J.

    1999-01-01

    This thesis is concerned with a theoretical and numerical study of the preparation and coherent manipulation of quantum states in the external and internal degrees of freedom of trapped ions. In its first part, this thesis proposes and investigates schemes for generating several nonclassical states for the quantized vibrational motion of a trapped ion. Based on dark state preparation specific laser excitation configurations are presented which, given appropriately chosen initial states, realize the desired motional states in the steady-state, indicated by the cessation of the fluorescence emitted by the ion. The focus is on the SU(1,1) intelligent states in both their single- and two-mode realization, corresponding to one- and two-dimensional motion of the ion. The presented schemes are also studied numerically using a Monte-Carlo state-vector method. The second part of the thesis describes how two vibrational degrees of freedom of a single trapped ion can be coupled through the action of suitably chosen laser excitation. Concentrating on a two-dimensional ion trap with dissimilar vibrational frequencies a variety of quantized two-mode couplings are derived. The focus is on a linear coupling that takes excitations from one mode to another. It is demonstrated how this can result in a state rotation, in which it is possible to coherently transfer the motional state of the ion between orthogonal directions without prior knowledge of that motional state. The third part of this thesis presents a new efficient method for generating maximally entangled internal states of a collection of trapped ions. The method is deterministic and independent of the number of ions in the trap. As the essential element of the scheme a mechanism for the realization of a controlled NOT operation that can operate on multiple ions is proposed. The potential application of the scheme for high-precision frequency standards is explored. (author)

  9. Influence of Visual Motion, Suggestion, and Illusory Motion on Self-Motion Perception in the Horizontal Plane.

    Science.gov (United States)

    Rosenblatt, Steven David; Crane, Benjamin Thomas

    2015-01-01

    A moving visual field can induce the feeling of self-motion or vection. Illusory motion from static repeated asymmetric patterns creates a compelling visual motion stimulus, but it is unclear if such illusory motion can induce a feeling of self-motion or alter self-motion perception. In these experiments, human subjects reported the perceived direction of self-motion for sway translation and yaw rotation at the end of a period of viewing set visual stimuli coordinated with varying inertial stimuli. This tested the hypothesis that illusory visual motion would influence self-motion perception in the horizontal plane. Trials were arranged into 5 blocks based on stimulus type: moving star field with yaw rotation, moving star field with sway translation, illusory motion with yaw, illusory motion with sway, and static arrows with sway. Static arrows were used to evaluate the effect of cognitive suggestion on self-motion perception. Each trial had a control condition; the illusory motion controls were altered versions of the experimental image, which removed the illusory motion effect. For the moving visual stimulus, controls were carried out in a dark room. With the arrow visual stimulus, controls were a gray screen. In blocks containing a visual stimulus there was an 8s viewing interval with the inertial stimulus occurring over the final 1s. This allowed measurement of the visual illusion perception using objective methods. When no visual stimulus was present, only the 1s motion stimulus was presented. Eight women and five men (mean age 37) participated. To assess for a shift in self-motion perception, the effect of each visual stimulus on the self-motion stimulus (cm/s) at which subjects were equally likely to report motion in either direction was measured. Significant effects were seen for moving star fields for both translation (p = 0.001) and rotation (pperception was shifted in the direction consistent with the visual stimulus. Arrows had a small effect on self-motion

  10. Structural Motion Grammar for Universal Use of Leap Motion: Amusement and Functional Contents Focused

    Directory of Open Access Journals (Sweden)

    Byungseok Lee

    2018-01-01

    Full Text Available Motions using Leap Motion controller are not standardized while the use of it is spreading in media contents. Each content defines its own motions, thereby creating confusion for users. Therefore, to alleviate user inconvenience, this study categorized the commonly used motion by Amusement and Functional Contents and defined the Structural Motion Grammar that can be universally used based on the classification. To this end, the Motion Lexicon was defined, which is a fundamental motion vocabulary, and an algorithm that enables real-time recognition of Structural Motion Grammar was developed. Moreover, the proposed method was verified by user evaluation and quantitative comparison tests.

  11. Millimeter Wave Induced BioEffects

    National Research Council Canada - National Science Library

    Blystone, Robert

    2006-01-01

    A baseline study determined the conditions of hemodynamic collapse in rats anesthetized with either ketamine plus xylazine or isoflurane alone and exposed to environmental heat at 42 or 43 degrees C...

  12. Wave Induced Saline Intrusion in Sea Outfalls

    DEFF Research Database (Denmark)

    Larsen, Torben; Burrows, Richard

    1989-01-01

    Experimental and numerical studies have shown that the influence of wave increases the tendency of saline intrusion in multi-riser sea outfalls. The flow field in the diffusor under such unsteady and inhomogeneous circumstances is in general very complex, but when sufficient wave energy is dissip...

  13. Shock wave induced sonoporation and gene transfer

    Science.gov (United States)

    Miller, Douglas L.

    2003-10-01

    During shockwave (SW) treatment, cavitation activity can be applied for cell killing. A bonus is that some surviving cells appear to be briefly permeabilized, or sonoporated, allowing them to take up large molecules including DNA. In vitro research has indicated that as the number of SW increased, survival declined exponentially but the number of sonoporated cells increased to better than 50% of survivors for 1000 SW. In vivo tests have demonstrated SW-induced tumor ablation could indeed be accompanied by the transfection of marker plasmids into mouse B16 melanoma tumors in vivo. With intratumor injection of plasmid DNA and air bubbles, significant results were obtained for only 400 SW. In a trial of cancer therapy, the effects of 500 SW combined with interleukin-12 immuno-gene therapy was observed on the progression of two mouse tumors, B16 melanoma and RENCA renal carcinoma. The combination of SW and IL-12 plasmid injection provided a statistically significant inhibition of tumor growth relative to SW alone for both tumor models, demonstrating feasibility for this treatment method. In the future, the development of intravenous gene delivery and improved transfection, together with image-guided ultrasound treatment, should lead to the clinical application of ultrasound enhanced gene therapy. [Work supported by NIH Grant No. EB002782.

  14. Wave induced supersonic rotation in mirrors

    Science.gov (United States)

    Fetterman, Abraham

    2010-11-01

    Wave-particle interactions in ExB supersonically rotating plasmas feature an unusual effect: particles are diffused by waves in both potential energy and kinetic energy [1]. This wave-particle interaction generalizes the alpha channeling effect, in which radio frequency waves are used to remove alpha particles collisionlessly at low energy. In rotating plasmas, the alpha particles may be removed at low energy through the loss cone, and the energy lost may be transferred to the radial electric field. This eliminates the need for electrodes in the mirror throat, which have presented serious technical issues in past rotating plasma devices. A particularly simple way to achieve this effect is to use a high azimuthal mode number perturbation on the magnetic field [2]. In the rotating frame, this perturbation is seen as a wave near the alpha particle cyclotron harmonic, and can break the azimuthal symmetry and magnetic moment conservation without changing the particle's total energy. The particle may exit if it reduces its kinetic energy and becomes more trapped if it gains kinetic energy, leading to a steady state current that maintains the field. Simulations of single particles in rotating mirrors show that a stationary wave can extract enough energy from alpha particles for a reactor to be self-sustaining. Rotation can also be sustained by waves in plasmas without a kinetic energy source. This type of wave has been considered for plasma centrifuges used for isotope separation [3]. [4pt] [1] A. J. Fetterman and N. J. Fisch, Phys Rev Lett 101, 205003 (2008). [0pt] [2] A. J. Fetterman and N. J. Fisch, Phys. Plasmas 17, 042112 (2010). [0pt] [3] A. J. Fetterman and N. J. Fisch, Plasma Sources Sci. Tech. 18, 045003 (2009).

  15. Vertical Motions of Oceanic Volcanoes

    Science.gov (United States)

    Clague, D. A.; Moore, J. G.

    2006-12-01

    Oceanic volcanoes offer abundant evidence of changes in their elevations through time. Their large-scale motions begin with a period of rapid subsidence lasting hundreds of thousands of years caused by isostatic compensation of the added mass of the volcano on the ocean lithosphere. The response is within thousands of years and lasts as long as the active volcano keeps adding mass on the ocean floor. Downward flexure caused by volcanic loading creates troughs around the growing volcanoes that eventually fill with sediment. Seismic surveys show that the overall depression of the old ocean floor beneath Hawaiian volcanoes such as Mauna Loa is about 10 km. This gross subsidence means that the drowned shorelines only record a small part of the total subsidence the islands experienced. In Hawaii, this history is recorded by long-term tide-gauge data, the depth in drill holes of subaerial lava flows and soil horizons, former shorelines presently located below sea level. Offshore Hawaii, a series of at least 7 drowned reefs and terraces record subsidence of about 1325 m during the last half million years. Older sequences of drowned reefs and terraces define the early rapid phase of subsidence of Maui, Molokai, Lanai, Oahu, Kauai, and Niihau. Volcanic islands, such as Maui, tip down toward the next younger volcano as it begins rapid growth and subsidence. Such tipping results in drowned reefs on Haleakala as deep as 2400 m where they are tipped towards Hawaii. Flat-topped volcanoes on submarine rift zones also record this tipping towards the next younger volcano. This early rapid subsidence phase is followed by a period of slow subsidence lasting for millions of years caused by thermal contraction of the aging ocean lithosphere beneath the volcano. The well-known evolution along the Hawaiian chain from high to low volcanic island, to coral island, and to guyot is due to this process. This history of rapid and then slow subsidence is interrupted by a period of minor uplift

  16. A Motion Planning Approach to Studying Molecular Motions

    KAUST Repository

    Amato, Nancy M.

    2010-01-01

    While structurally very different, protein and RNA molecules share an important attribute. The motions they undergo are strongly related to the function they perform. For example, many diseases such as Mad Cow disease or Alzheimer\\'s disease are associated with protein misfolding and aggregation. Similarly, RNA folding velocity may regulate the plasmid copy number, and RNA folding kinetics can regulate gene expression at the translational level. Knowledge of the stability, folding, kinetics and detailed mechanics of the folding process may help provide insight into how proteins and RNAs fold. In this paper, we present an overview of our work with a computational method we have adapted from robotic motion planning to study molecular motions. We have validated against experimental data and have demonstrated that our method can capture biological results such as stochastic folding pathways, population kinetics of various conformations, and relative folding rates. Thus, our method provides both a detailed view (e.g., individual pathways) and a global view (e.g., population kinetics, relative folding rates, and reaction coordinates) of energy landscapes of both proteins and RNAs. We have validated these techniques by showing that we observe the same relative folding rates as shown in experiments for structurally similar protein molecules that exhibit different folding behaviors. Our analysis has also been able to predict the same relative gene expression rate for wild-type MS2 phage RNA and three of its mutants.

  17. Deficient Biological Motion Perception in Schizophrenia: Results from a Motion Noise Paradigm

    Directory of Open Access Journals (Sweden)

    Jejoong eKim

    2013-07-01

    Full Text Available Background: Schizophrenia patients exhibit deficient processing of perceptual and cognitive information. However, it is not well understood how basic perceptual deficits contribute to higher level cognitive problems in this mental disorder. Perception of biological motion, a motion-based cognitive recognition task, relies on both basic visual motion processing and social cognitive processing, thus providing a useful paradigm to evaluate the potentially hierarchical relationship between these two levels of information processing. Methods: In this study, we designed a biological motion paradigm in which basic visual motion signals were manipulated systematically by incorporating different levels of motion noise. We measured the performances of schizophrenia patients (n=21 and healthy controls (n=22 in this biological motion perception task, as well as in coherent motion detection, theory of mind, and a widely used biological motion recognition task. Results: Schizophrenia patients performed the biological motion perception task with significantly lower accuracy than healthy controls when perceptual signals were moderately degraded by noise. A more substantial degradation of perceptual signals, through using additional noise, impaired biological motion perception in both groups. Performance levels on biological motion recognition, coherent motion detection and theory of mind tasks were also reduced in patients. Conclusion: The results from the motion-noise biological motion paradigm indicate that in the presence of visual motion noise, the processing of biological motion information in schizophrenia is deficient. Combined with the results of poor basic visual motion perception (coherent motion task and biological motion recognition, the association between basic motion signals and biological motion perception suggests a need to incorporate the improvement of visual motion perception in social cognitive remediation.

  18. A Dynamic Model for Roll Motion of Ships Due to Flooding

    DEFF Research Database (Denmark)

    Xia, Jinzhu; Jensen, Jørgen Juncher; Pedersen, Preben Terndrup

    1997-01-01

    A dynamic model is presented of the roll motion of damaged RoRo vessels which couples the internal cross-flooding flow and the air action in the equalizing compartment. The cross flooding flow and the air motion are modelled by a modified Bernoulli equation, where artificial damping is introduced...... to avoid modal instability based on the original Bernoulli equation. The fluid action of the flooded water on the ship is expressed by its influence on the moment of inertia of the ship and the heeling moment, which is a couple created by the gravitational force of the flooded water and the change...... of buoyancy of the ship.Two limiting flooding cases are examined in the present analysis: The sudden ingress of a certain amount of water to the damaged compartment with no further water exchange between the sea and the flooded compartment during the roll motion, and the continuous ingress of water through...

  19. Motion correction in thoracic positron emission tomography

    CERN Document Server

    Gigengack, Fabian; Dawood, Mohammad; Schäfers, Klaus P

    2015-01-01

    Respiratory and cardiac motion leads to image degradation in Positron Emission Tomography (PET), which impairs quantification. In this book, the authors present approaches to motion estimation and motion correction in thoracic PET. The approaches for motion estimation are based on dual gating and mass-preserving image registration (VAMPIRE) and mass-preserving optical flow (MPOF). With mass-preservation, image intensity modulations caused by highly non-rigid cardiac motion are accounted for. Within the image registration framework different data terms, different variants of regularization and parametric and non-parametric motion models are examined. Within the optical flow framework, different data terms and further non-quadratic penalization are also discussed. The approaches for motion correction particularly focus on pipelines in dual gated PET. A quantitative evaluation of the proposed approaches is performed on software phantom data with accompanied ground-truth motion information. Further, clinical appl...

  20. Layered Safe Motion Planning for Autonomous Vehicles.

    Science.gov (United States)

    1995-09-01

    The major problem addressed by this research is how to plan a safe motion for autonomous vehicles in a two dimensional, rectilinear world. With given start and goal configurations, the planner performs motion planning which

  1. Hyperventilation in a motion sickness desensitization program

    NARCIS (Netherlands)

    Mert, A.; Bles, W.; Nooij, S.A.E.

    2007-01-01

    Introduction: In motion sickness desensitization programs, the motion sickness provocative stimulus is often a forward bending of the trunk on a rotating chair, inducing Coriolis effects. Since respiratory relaxation techniques are applied successfully in these courses, we investigated whether these

  2. SU-E-J-115: Correlation of Displacement Vector Fields Calculated by Deformable Image Registration Algorithms with Motion Parameters of CT Images with Well-Defined Targets and Controlled-Motion

    Energy Technology Data Exchange (ETDEWEB)

    Jaskowiak, J; Ahmad, S; Ali, I [University of Oklahoma Health Sciences Center, Oklahoma City, OK (United States); Alsbou, N [Ohio Northern University, Ada, OH (United States)

    2015-06-15

    Purpose: To investigate correlation of displacement vector fields (DVF) calculated by deformable image registration algorithms with motion parameters in helical axial and cone-beam CT images with motion artifacts. Methods: A mobile thorax phantom with well-known targets with different sizes that were made from water-equivalent material and inserted in foam to simulate lung lesions. The thorax phantom was imaged with helical, axial and cone-beam CT. The phantom was moved with a cyclic motion with different motion amplitudes and frequencies along the superior-inferior direction. Different deformable image registration algorithms including demons, fast demons, Horn-Shunck and iterative-optical-flow from the DIRART software were used to deform CT images for the phantom with different motion patterns. The CT images of the mobile phantom were deformed to CT images of the stationary phantom. Results: The values of displacement vectors calculated by deformable image registration algorithm correlated strongly with motion amplitude where large displacement vectors were calculated for CT images with large motion amplitudes. For example, the maximal displacement vectors were nearly equal to the motion amplitudes (5mm, 10mm or 20mm) at interfaces between the mobile targets lung tissue, while the minimal displacement vectors were nearly equal to negative the motion amplitudes. The maximal and minimal displacement vectors matched with edges of the blurred targets along the Z-axis (motion-direction), while DVF’s were small in the other directions. This indicates that the blurred edges by phantom motion were shifted largely to match with the actual target edge. These shifts were nearly equal to the motion amplitude. Conclusions: The DVF from deformable-image registration algorithms correlated well with motion amplitude of well-defined mobile targets. This can be used to extract motion parameters such as amplitude. However, as motion amplitudes increased, image artifacts increased

  3. Observing electron motion in molecules

    International Nuclear Information System (INIS)

    Chelkowski, S; Yudin, G L; Bandrauk, A D

    2006-01-01

    We study analytically the possibility for monitoring electron motion in a molecule using two ultrashort laser pulses. The first prepares a coherent superposition of two electronic molecular states whereas the second (attosecond pulse) photoionizes the molecule. We show that interesting information about electron dynamics can be obtained from measurement of the photoelectron spectra as a function of the time delay between two pulses. In particular, asymmetries in photoelectron angular distribution provide a simple signature of the electron motion within the initial time-dependent coherently coupled two molecular states. Both asymmetries and electron spectra show very strong two-centre interference patterns. We illustrate these effects using as an example a dissociating hydrogen molecular ion probed by the attosecond pulses

  4. Dissipation and nuclear collective motion

    International Nuclear Information System (INIS)

    Hofmann, Helmut; Jensen, A.S.; Ngo, Christian; Siemens, P.J.; California Univ., Berkeley

    1979-01-01

    This contribution is intended to give a brief summary of a forthcoming paper which shall review extensively the linear response theory for dissipation and statistical fluctuations as well as its application to heavy-ion collisions. It shall contain new results on the following subjects: numerical computations of response functions and transport coefficients; dissipation in a self-consistent treatment of harmonic vibrations; introduction of collective variables within a quantum theory. The method used consists of an extended version of the Bohm and Pines treatment of the electron gas. It allows to deduce a quantum Hamiltonian for the collective and intrinsic motion including coupling terms; discussion and solution of a quantal Master equation for non-linear collective motion. Additionally, a somewhat elaborate discussion of the problems of irreversibility is given, especially in connection to a treatment within the moving basis

  5. Wheelchair control by head motion

    Directory of Open Access Journals (Sweden)

    Pajkanović Aleksandar

    2013-01-01

    Full Text Available Electric wheelchairs are designed to aid paraplegics. Unfortunately, these can not be used by persons with higher degree of impairment, such as quadriplegics, i.e. persons that, due to age or illness, can not move any of the body parts, except of the head. Medical devices designed to help them are very complicated, rare and expensive. In this paper a microcontroller system that enables standard electric wheelchair control by head motion is presented. The system comprises electronic and mechanic components. A novel head motion recognition technique based on accelerometer data processing is designed. The wheelchair joystick is controlled by the system’s mechanical actuator. The system can be used with several different types of standard electric wheelchairs. It is tested and verified through an experiment performed within this paper.

  6. Motions on a rotating planet

    Science.gov (United States)

    Schröer, H.

    In chapter 1 we want to describe the motion of a falling body on a rotating planet. The planet rotates with an arbitrary changable angular velocity and has a translational acceleration. We obtain 3 differential equations. For the general gravitational field an exact solution is possible, when the differential equation system is explicit solvable. Then we consider the case, if the angular velocity and the translational acceleration is constant. With a special transformation we get 3 partial differential equations of first order. Instead of a planet sphere we can choose a general body of rotation. Even general bodies are possible. Chapter 2 contains the motion in a local coordinate system on planet's surface. We have an inhomogeneous linear differential equation of first order. If the angular velocity is constant, we get a system with constant coefficients. There is an english and a german edition.

  7. Homothetic motions in general relativity

    International Nuclear Information System (INIS)

    McIntosh, C.B.G.

    1976-01-01

    Properties of homothetic or self-similar motions in general relativity are examined with particular reference to vacuum and perfect-fluid space-times. The role of the homothetic bivector with components Hsub((a;b)) formed from the homothetic vector H is discussed in some detail. It is proved that a vacuum space-time only admits a nontrivial homothetic motion if the homothetic vector field is non-null and is not hypersurface orthogonal. As a subcase of a more general result it is shown that a perfect-fluid space-time cannot admit a non-trivial homothetic vector which is orthogonal to the fluid velocity 4-vector. (author)

  8. 2010 Water & Aqueous Solutions

    Energy Technology Data Exchange (ETDEWEB)

    Dor Ben-Amotz

    2010-08-13

    Water covers more than two thirds of the surface of the Earth and about the same fraction of water forms the total mass of a human body. Since the early days of our civilization water has also been in the focus of technological developments, starting from converting it to wine to more modern achievements. The meeting will focus on recent advances in experimental, theoretical, and computational understanding of the behavior of the most important and fascinating liquid in a variety of situations and applications. The emphasis will be less on water properties per se than on water as a medium in which fundamental dynamic and reactive processes take place. In the following sessions, speakers will discuss the latest breakthroughs in unraveling these processes at the molecular level: Water in Solutions; Water in Motion I and II; Water in Biology I and II; Water in the Environment I and II; Water in Confined Geometries and Water in Discussion (keynote lecture and poster winners presentations).

  9. Evaluation Method of Collision Risk by Using True Motion

    Directory of Open Access Journals (Sweden)

    Hayama Imazu

    2017-03-01

    Full Text Available It is necessary to develop a useful application to use big data like as AIS for safety and efficiency of ship operation. AIS is very useful system to collect targets information, but this information is not effective use yet. The evaluation method of collision risk is one of the cause disturb. Usually the collision risk of ship is evaluated by the value of the Closest Point of Approach (CPA which is related to a relative motion. So, it becomes difficult to find out a safety pass in a congested water. Here, Line of Predicted Collision (LOPC and Obstacle Zone by Target (OZT for evaluation of collision risk are introduced, these values are related to a true motion and it became visible of dangerous place, so it will make easy to find out a safety pass in a congested water.

  10. Nuclear friction and chaotic motion

    International Nuclear Information System (INIS)

    Srokowski, T.; Szczurek, A.; Drozdz, S.

    1990-01-01

    The concept of nuclear friction is considered from the point of view of regular versus chaotic motion in an atomic nucleus. Using a realistic nuclear Hamiltonian it is explicitly shown that the frictional description of the gross features of nuclear collisions is adequate if the system behaves chaotically. Because of the core in the Hamiltonian, the three-body nuclear system already reveals a structure of the phase space rich enough for this concept to be applicable

  11. Dynamical Systems and Motion Vision.

    Science.gov (United States)

    1988-04-01

    TASK Artificial Inteligence Laboratory AREA I WORK UNIT NUMBERS 545 Technology Square . Cambridge, MA 02139 C\\ II. CONTROLLING OFFICE NAME ANO0 ADDRESS...INSTITUTE OF TECHNOLOGY ARTIFICIAL INTELLIGENCE LABORATORY A.I.Memo No. 1037 April, 1988 Dynamical Systems and Motion Vision Joachim Heel Abstract: In this... Artificial Intelligence L3 Laboratory of the Massachusetts Institute of Technology. Support for the Laboratory’s [1 Artificial Intelligence Research is

  12. Capillary waves in slow motion

    International Nuclear Information System (INIS)

    Seydel, Tilo; Tolan, Metin; Press, Werner; Madsen, Anders; Gruebel, Gerhard

    2001-01-01

    Capillary wave dynamics on glycerol surfaces has been investigated by means of x-ray photon correlation spectroscopy performed at grazing angles. The measurements show that thermally activated capillary wave motion is slowed down exponentially when the sample is cooled below 273 K. This finding directly reflects the freezing of the surface waves. The wave-number dependence of the measured time constants is in quantitative agreement with theoretical predictions for overdamped capillary waves

  13. Clustering Of Left Ventricular Wall Motion Patterns

    Science.gov (United States)

    Bjelogrlic, Z.; Jakopin, J.; Gyergyek, L.

    1982-11-01

    A method for detection of wall regions with similar motion was presented. A model based on local direction information was used to measure the left ventricular wall motion from cineangiographic sequence. Three time functions were used to define segmental motion patterns: distance of a ventricular contour segment from the mean contour, the velocity of a segment and its acceleration. Motion patterns were clustered by the UPGMA algorithm and by an algorithm based on K-nearest neighboor classification rule.

  14. Identification of resonant earthquake ground motion

    Indian Academy of Sciences (India)

    Resonant ground motion has been observed in earthquake records measured at several parts of the world. This class of ground motion is characterized by its energy being contained in a narrow frequency band. This paper develops measures to quantify the frequency content of the ground motion using the entropy ...

  15. Predicting articulated human motion from spatial processes

    DEFF Research Database (Denmark)

    Hauberg, Søren; Pedersen, Kim Steenstrup

    2011-01-01

    recent work where prior models are derived in terms of joint angles. This approach has several advantages. First of all, it allows us to construct motion models in low dimensional spaces, which makes motion estimation more robust. Secondly, as many types of motion are easily expressed in spatial...

  16. Teaching Motion with the Global Positioning System

    Science.gov (United States)

    Budisa, Marko; Planinsic, Gorazd

    2003-01-01

    We have used the GPS receiver and a PC interface to track different types of motion. Various hands-on experiments that enlighten the physics of motion at the secondary school level are suggested (visualization of 2D and 3D motion, measuring car drag coefficient and fuel consumption). (Contains 8 figures.)

  17. 19 CFR 210.15 - Motions.

    Science.gov (United States)

    2010-04-01

    ... 19 Customs Duties 3 2010-04-01 2010-04-01 false Motions. 210.15 Section 210.15 Customs Duties UNITED STATES INTERNATIONAL TRADE COMMISSION INVESTIGATIONS OF UNFAIR PRACTICES IN IMPORT TRADE ADJUDICATION AND ENFORCEMENT Motions § 210.15 Motions. (a) Presentation and disposition. (1) During the period...

  18. Visualization of Kepler's Laws of Planetary Motion

    Science.gov (United States)

    Lu, Meishu; Su, Jun; Wang, Weiguo; Lu, Jianlong

    2017-01-01

    For this article, we use a 3D printer to print a surface similar to universal gravitation for demonstrating and investigating Kepler's laws of planetary motion describing the motion of a small ball on the surface. This novel experimental method allows Kepler's laws of planetary motion to be visualized and will contribute to improving the…

  19. Symmetries and conserved quantities in geodesic motion

    International Nuclear Information System (INIS)

    Hojman, S.; Nunez, L.; Patino, A.; Rago, H.

    1986-01-01

    Recently obtained results linking several constants of motion to one (non-Noetherian) symmetry to the problem of geodesic motion in Riemannian space-times are applied. The construction of conserved quantities in geodesic motion as well as the deduction of geometrical statements about Riemannian space-times are achieved

  20. Motion sickness: a negative reinforcement model.

    Science.gov (United States)

    Bowins, Brad

    2010-01-15

    Theories pertaining to the "why" of motion sickness are in short supply relative to those detailing the "how." Considering the profoundly disturbing and dysfunctional symptoms of motion sickness, it is difficult to conceive of why this condition is so strongly biologically based in humans and most other mammalian and primate species. It is posited that motion sickness evolved as a potent negative reinforcement system designed to terminate motion involving sensory conflict or postural instability. During our evolution and that of many other species, motion of this type would have impaired evolutionary fitness via injury and/or signaling weakness and vulnerability to predators. The symptoms of motion sickness strongly motivate the individual to terminate the offending motion by early avoidance, cessation of movement, or removal of oneself from the source. The motion sickness negative reinforcement mechanism functions much like pain to strongly motivate evolutionary fitness preserving behavior. Alternative why theories focusing on the elimination of neurotoxins and the discouragement of motion programs yielding vestibular conflict suffer from several problems, foremost that neither can account for the rarity of motion sickness in infants and toddlers. The negative reinforcement model proposed here readily accounts for the absence of motion sickness in infants and toddlers, in that providing strong motivation to terminate aberrant motion does not make sense until a child is old enough to act on this motivation.

  1. Ground motion input in seismic evaluation studies

    International Nuclear Information System (INIS)

    Sewell, R.T.; Wu, S.C.

    1996-07-01

    This report documents research pertaining to conservatism and variability in seismic risk estimates. Specifically, it examines whether or not artificial motions produce unrealistic evaluation demands, i.e., demands significantly inconsistent with those expected from real earthquake motions. To study these issues, two types of artificial motions are considered: (a) motions with smooth response spectra, and (b) motions with realistic variations in spectral amplitude across vibration frequency. For both types of artificial motion, time histories are generated to match target spectral shapes. For comparison, empirical motions representative of those that might result from strong earthquakes in the Eastern U.S. are also considered. The study findings suggest that artificial motions resulting from typical simulation approaches (aimed at matching a given target spectrum) are generally adequate and appropriate in representing the peak-response demands that may be induced in linear structures and equipment responding to real earthquake motions. Also, given similar input Fourier energies at high-frequencies, levels of input Fourier energy at low frequencies observed for artificial motions are substantially similar to those levels noted in real earthquake motions. In addition, the study reveals specific problems resulting from the application of Western U.S. type motions for seismic evaluation of Eastern U.S. nuclear power plants

  2. Rotational Motion Control of a Spacecraft

    DEFF Research Database (Denmark)

    Wisniewski, Rafal; Kulczycki, P.

    2001-01-01

    The paper adopts the energy shaping method to control of rotational motion. A global representation of the rigid body motion is given in the canonical form by a quaternion and its conjugate momenta. A general method for motion control on a cotangent bundle to the 3-sphere is suggested. The design...... algorithm is validated for three-axis spacecraft attitude control...

  3. Rotational motion control of a spacecraft

    DEFF Research Database (Denmark)

    Wisniewski, Rafal; Kulczycki, P.

    2003-01-01

    The paper adopts the energy shaping method to control of rotational motion. A global representation of the rigid body motion is given in the canonical form by a quaternion and its conjugate momenta. A general method for motion control on a cotangent bundle to the 3-sphere is suggested. The design...... algorithm is validated for three-axis spacecraft attitude control. Udgivelsesdato: APR...

  4. Ion Motion in the Adiabatic Focuser

    International Nuclear Information System (INIS)

    Henestroza, E.; Sessler, A.M.; Yu, S.S.

    2006-01-01

    In this paper we numerically study the effect of ion motion in an adiabatic focuser, motivated by a recent suggestion that ion motion in an adiabatic focuser might be significant and even preclude operation of the focuser as previously envisioned. It is shown that despite ion motion the adiabatic focuser should work as well as originally envisioned

  5. Improved motion description for action classification

    NARCIS (Netherlands)

    Jain, M.; Jégou, H.; Bouthemy, P.

    2016-01-01

    Even though the importance of explicitly integrating motion characteristics in video descriptions has been demonstrated by several recent papers on action classification, our current work concludes that adequately decomposing visual motion into dominant and residual motions, i.e., camera and scene

  6. Influence of Visual Motion, Suggestion, and Illusory Motion on Self-Motion Perception in the Horizontal Plane.

    Directory of Open Access Journals (Sweden)

    Steven David Rosenblatt

    Full Text Available A moving visual field can induce the feeling of self-motion or vection. Illusory motion from static repeated asymmetric patterns creates a compelling visual motion stimulus, but it is unclear if such illusory motion can induce a feeling of self-motion or alter self-motion perception. In these experiments, human subjects reported the perceived direction of self-motion for sway translation and yaw rotation at the end of a period of viewing set visual stimuli coordinated with varying inertial stimuli. This tested the hypothesis that illusory visual motion would influence self-motion perception in the horizontal plane. Trials were arranged into 5 blocks based on stimulus type: moving star field with yaw rotation, moving star field with sway translation, illusory motion with yaw, illusory motion with sway, and static arrows with sway. Static arrows were used to evaluate the effect of cognitive suggestion on self-motion perception. Each trial had a control condition; the illusory motion controls were altered versions of the experimental image, which removed the illusory motion effect. For the moving visual stimulus, controls were carried out in a dark room. With the arrow visual stimulus, controls were a gray screen. In blocks containing a visual stimulus there was an 8s viewing interval with the inertial stimulus occurring over the final 1s. This allowed measurement of the visual illusion perception using objective methods. When no visual stimulus was present, only the 1s motion stimulus was presented. Eight women and five men (mean age 37 participated. To assess for a shift in self-motion perception, the effect of each visual stimulus on the self-motion stimulus (cm/s at which subjects were equally likely to report motion in either direction was measured. Significant effects were seen for moving star fields for both translation (p = 0.001 and rotation (p0.1 for both. Thus, although a true moving visual field can induce self-motion, results of this

  7. Heeling Moment Acting on a River Cruiser in Manoeuvring Motion

    Directory of Open Access Journals (Sweden)

    Tabaczek Tomasz

    2016-01-01

    Full Text Available By using fully theoretical method the heeling moment due to centrifugal forces has been determined for a small river cruiser in turning manoeuvre. The authors applied CFD software for determination of hull hydrodynamic forces, and open water characteristics of ducted propeller for estimation of thrust of rudder-propellers. Numerical integration of equations of 3DOF motion was used for prediction of ship trajectory and time histories of velocities, forces and heeling moment.

  8. Motion of an Oil Droplet Through a Water-Filled Uneven Pore Déplacement d'une gouttelette d'huile à travers un pore irrégulier rempli d'eau

    Directory of Open Access Journals (Sweden)

    Singhal A. K.

    2006-11-01

    Full Text Available The need to understand various mechanisms governing fluid-fluid displacements associated with enhanced oil recovery provides the motivation for this study. The observation of apparently linear dependence of flow rates upon pressure gradients during multiphase flow through porous media conceals the true nature of displacement phenomena such as Haine's jumps, droplet break-up, coalescence, etc. Most of these phenomena are understood only qualitatively. This study is on attempt to quantitatively describe them for a specific idealized pore geometry using approximate quasi steady-state calculations. The progress of a non-wetting oil droplet down a periodically convergent-divergent pore, the basic unit of which is a truncated bicone, shows a fluctuating, piecewise continuous track that resembles Haine's jumps. In addition to Haine's jumps, variations in the motion of droplets may also occur due to their break-up, coolescence or the instability of their interfacial configurations. Different parts of a droplet may be required to adjust to different curvatures and sometimes it may fail to maintain a constant mean curvature throughout its interface. Consequently, while flowing through constrictions, a droplet may break-up. Some portions of broken droplets may then travel in the middle of the pore and sometimes may coalesce with each other in different portions of the pore. The droplets become immobilized whevener the pressure gradients available across them are insufficient to overcome the threshold pressure offered by their interfaces. Possible implications of these phenomena in the entrapment of residual oil, hystereses in capillary pressure and relative permeability curves, and fluctuations in the multiphase flovv of fluids through porous media are discussed. Le besoin de comprendre les divers mécanismes régissant les déplacements de certains fluides par d'autres, déplacements rencontrés dans la récupération assistée du pétrole, constitue la

  9. Motion in images is essential to cause motion sickness symptoms, but not to increase postural sway

    NARCIS (Netherlands)

    Lubeck, A.J.A.; Bos, J.E.; Stins, J.F.

    2015-01-01

    Abstract Objective It is generally assumed that motion in motion images is responsible for increased postural sway as well as for visually induced motion sickness (VIMS). However, this has not yet been tested. To that end, we studied postural sway and VIMS induced by motion and still images. Method

  10. Sarjakuvan uudet muodot : Motion Comic ja Motion Novel

    OpenAIRE

    Lassila, Ilkka

    2011-01-01

    Sarjakuva on kehittynyt sen ensimmäisestä julkaisusta 1800-luvun lopusta huimasti vuoteen 2011. Tutkielmassa haluan tuoda esille, miten sarjakuva on viimeisen kahdenkymmenen vuoden aikana muuttanut muotoaan printatusta taiteesta digitaaliseen muotoon sekä miten se on löytänyt viimevuosien aikana myös uuden muodon, Motion Comicin, joka on eräänlainen elävä sarjakuva. Pohdin myös tämän uuden tekniikan tulevaisuuden näkymiä sekä ongelmia joita tämä uusi tekniikka joutuu kohtaamaan. Vaikka s...

  11. Extreme ground motions and Yucca Mountain

    Science.gov (United States)

    Hanks, Thomas C.; Abrahamson, Norman A.; Baker, Jack W.; Boore, David M.; Board, Mark; Brune, James N.; Cornell, C. Allin; Whitney, John W.

    2013-01-01

    Yucca Mountain is the designated site of the underground repository for the United States' high-level radioactive waste (HLW), consisting of commercial and military spent nuclear fuel, HLW derived from reprocessing of uranium and plutonium, surplus plutonium, and other nuclear-weapons materials. Yucca Mountain straddles the western boundary of the Nevada Test Site, where the United States has tested nuclear devices since the 1950s, and is situated in an arid, remote, and thinly populated region of Nevada, ~100 miles northwest of Las Vegas. Yucca Mountain was originally considered as a potential underground repository of HLW because of its thick units of unsaturated rocks, with the repository horizon being not only ~300 m above the water table but also ~300 m below the Yucca Mountain crest. The fundamental rationale for a geologic (underground) repository for HLW is to securely isolate these materials from the environment and its inhabitants to the greatest extent possible and for very long periods of time. Given the present climate conditions and what is known about the current hydrologic system and conditions around and in the mountain itself, one would anticipate that the rates of infiltration, corrosion, and transport would be very low—except for the possibility that repository integrity might be compromised by low-probability disruptive events, which include earthquakes, strong ground motion, and (or) a repository-piercing volcanic intrusion/eruption. Extreme ground motions (ExGM), as we use the phrase in this report, refer to the extremely large amplitudes of earthquake ground motion that arise at extremely low probabilities of exceedance (hazard). They first came to our attention when the 1998 probabilistic seismic hazard analysis for Yucca Mountain was extended to a hazard level of 10-8/yr (a 10-4/yr probability for a 104-year repository “lifetime”). The primary purpose of this report is to summarize the principal results of the ExGM research program

  12. Sensing Movement: Microsensors for Body Motion Measurement

    Directory of Open Access Journals (Sweden)

    Hansong Zeng

    2011-01-01

    Full Text Available Recognition of body posture and motion is an important physiological function that can keep the body in balance. Man-made motion sensors have also been widely applied for a broad array of biomedical applications including diagnosis of balance disorders and evaluation of energy expenditure. This paper reviews the state-of-the-art sensing components utilized for body motion measurement. The anatomy and working principles of a natural body motion sensor, the human vestibular system, are first described. Various man-made inertial sensors are then elaborated based on their distinctive sensing mechanisms. In particular, both the conventional solid-state motion sensors and the emerging non solid-state motion sensors are depicted. With their lower cost and increased intelligence, man-made motion sensors are expected to play an increasingly important role in biomedical systems for basic research as well as clinical diagnostics.

  13. Motion Analysis Based on Invertible Rapid Transform

    Directory of Open Access Journals (Sweden)

    J. Turan

    1999-06-01

    Full Text Available This paper presents the results of a study on the use of invertible rapid transform (IRT for the motion estimation in a sequence of images. Motion estimation algorithms based on the analysis of the matrix of states (produced in the IRT calculation are described. The new method was used experimentally to estimate crowd and traffic motion from the image data sequences captured at railway stations and at high ways in large cities. The motion vectors may be used to devise a polar plot (showing velocity magnitude and direction for moving objects where the dominant motion tendency can be seen. The experimental results of comparison of the new motion estimation methods with other well known block matching methods (full search, 2D-log, method based on conventional (cross correlation (CC function or phase correlation (PC function for application of crowd motion estimation are also presented.

  14. Surrogate-driven deformable motion model for organ motion tracking in particle radiation therapy

    Science.gov (United States)

    Fassi, Aurora; Seregni, Matteo; Riboldi, Marco; Cerveri, Pietro; Sarrut, David; Battista Ivaldi, Giovanni; Tabarelli de Fatis, Paola; Liotta, Marco; Baroni, Guido

    2015-02-01

    The aim of this study is the development and experimental testing of a tumor tracking method for particle radiation therapy, providing the daily respiratory dynamics of the patient’s thoraco-abdominal anatomy as a function of an external surface surrogate combined with an a priori motion model. The proposed tracking approach is based on a patient-specific breathing motion model, estimated from the four-dimensional (4D) planning computed tomography (CT) through deformable image registration. The model is adapted to the interfraction baseline variations in the patient’s anatomical configuration. The driving amplitude and phase parameters are obtained intrafractionally from a respiratory surrogate signal derived from the external surface displacement. The developed technique was assessed on a dataset of seven lung cancer patients, who underwent two repeated 4D CT scans. The first 4D CT was used to build the respiratory motion model, which was tested on the second scan. The geometric accuracy in localizing lung lesions, mediated over all breathing phases, ranged between 0.6 and 1.7 mm across all patients. Errors in tracking the surrounding organs at risk, such as lungs, trachea and esophagus, were lower than 1.3 mm on average. The median absolute variation in water equivalent path length (WEL) within the target volume did not exceed 1.9 mm-WEL for simulated particle beams. A significant improvement was achieved compared with error compensation based on standard rigid alignment. The present work can be regarded as a feasibility study for the potential extension of tumor tracking techniques in particle treatments. Differently from current tracking methods applied in conventional radiotherapy, the proposed approach allows for the dynamic localization of all anatomical structures scanned in the planning CT, thus providing complete information on density and WEL variations required for particle beam range adaptation.

  15. Motion correction options in PET/MRI.

    Science.gov (United States)

    Catana, Ciprian

    2015-05-01

    Subject motion is unavoidable in clinical and research imaging studies. Breathing is the most important source of motion in whole-body PET and MRI studies, affecting not only thoracic organs but also those in the upper and even lower abdomen. The motion related to the pumping action of the heart is obviously relevant in high-resolution cardiac studies. These two sources of motion are periodic and predictable, at least to a first approximation, which means certain techniques can be used to control the motion (eg, by acquiring the data when the organ of interest is relatively at rest). Additionally, nonperiodic and unpredictable motion can also occur during the scan. One obvious limitation of methods relying on external devices (eg, respiratory bellows or the electrocardiogram signal to monitor the respiratory or cardiac cycle, respectively) to trigger or gate the data acquisition is that the complex motion of internal organs cannot be fully characterized. However, detailed information can be obtained using either the PET or MRI data (or both) allowing the more complete characterization of the motion field so that a motion model can be built. Such a model and the information derived from simple external devices can be used to minimize the effects of motion on the collected data. In the ideal case, all the events recorded during the PET scan would be used to generate a motion-free or corrected PET image. The detailed motion field can be used for this purpose by applying it to the PET data before, during, or after the image reconstruction. Integrating all these methods for motion control, characterization, and correction into a workflow that can be used for routine clinical studies is challenging but could potentially be extremely valuable given the improvement in image quality and reduction of motion-related image artifacts. Copyright © 2015 Elsevier Inc. All rights reserved.

  16. Computing motion using resistive networks

    Science.gov (United States)

    Koch, Christof; Luo, Jin; Mead, Carver; Hutchinson, James

    1988-01-01

    Recent developments in the theory of early vision are described which lead from the formulation of the motion problem as an ill-posed one to its solution by minimizing certain 'cost' functions. These cost or energy functions can be mapped onto simple analog and digital resistive networks. It is shown how the optical flow can be computed by injecting currents into resistive networks and recording the resulting stationary voltage distribution at each node. These networks can be implemented in cMOS VLSI circuits and represent plausible candidates for biological vision systems.

  17. Motion sickness in ancient China: Seasickness and cart-sickness.

    Science.gov (United States)

    Brandt, Thomas; Bauer, Matthias; Benson, Judy; Huppert, Doreen

    2016-07-19

    To find and analyze descriptions of motion sickness in Chinese historical sources. Databases and dictionaries were searched for various terms for seasickness and travel sickness, which were then entered into databases of full texts allowing selection of relevant passages from about the third to the 19th century ad. Already in 300 ad the Chinese differentiated cart-sickness, particularly experienced by persons from the arid north of China, from a ship-illness experienced by persons from the south, where rivers were important for transportation and travel. In the Middle Ages, a third form of motion sickness was called litter-influence experienced by persons transported in a bed suspended between 2 long poles. The ancient Chinese recognized the particular susceptibility of children to motion sickness. Therapeutic recommendations include drinking the urine of young boys, swallowing white sand-syrup, collecting water drops from a bamboo stick, or hiding some earth from the middle of the kitchen hearth under the hair. The Chinese medical classics distinguished several forms of travel sickness, all of which had their own written characters. The pathophysiologic mechanism was explained by the medicine of correspondences, which was based on malfunctions within the body, its invasion by external pathogens like wind, or the deficit or surfeit of certain bodily substances such as the life force Qi. The concept of motion as the trigger of sickness initially appeared in a chapter on warding off the influence of demons and corpses, e.g., ancient magic and beliefs. © 2016 American Academy of Neurology.

  18. Random motion and Brownian rotation

    International Nuclear Information System (INIS)

    Wyllie, G.

    1980-01-01

    The course is centred on the Brownian motion - the random movement of molecules arising from thermal fluctuations of the surrounding medium - and starts with the classical theory of A. Einstein, M.v. Smoluchowski and P. Langevin. The first part of this article is quite elementary, and several of the questions raised in it have been instructively treated in a much more sophisticated way in recent reviews by Pomeau and Resibois and by Fox. This simple material may nevertheless be helpful to some readers whose main interest lies in approaching the work on Brownian rotation reviewed in the latter part of the present article. The simplest, and most brutally idealised, problem in our field of interest is that of the random walk in one dimension of space. Its solution leads on, through the diffusivity-mobility relation of Einstein, to Langevin's treatment of the Brownian motion. The application of these ideas to the movement of a molecule in a medium of similar molecules is clearly unrealistic, and much energy has been devoted to finding a suitable generalisation. We shall discuss in particular ideas due to Green, Zwanzig and Mori. (orig./WL)

  19. Quantization of Equations of Motion

    Directory of Open Access Journals (Sweden)

    D. Kochan

    2007-01-01

    Full Text Available The Classical Newton-Lagrange equations of motion represent the fundamental physical law of mechanics. Their traditional Lagrangian and/or Hamiltonian precursors when available are essential in the context of quantization. However, there are situations that lack Lagrangian and/or Hamiltonian settings. This paper discusses a description of classical dynamics and presents some irresponsible speculations about its quantization by introducing a certain canonical two-form ?. By its construction ? embodies kinetic energy and forces acting within the system (not their potential. A new type of variational principle employing differential two-form ? is introduced. Variation is performed over “umbilical surfaces“ instead of system histories. It provides correct Newton-Lagrange equations of motion. The quantization is inspired by the Feynman path integral approach. The quintessence is to rearrange it into an “umbilical world-sheet“ functional integral in accordance with the proposed variational principle. In the case of potential-generated forces, the new approach reduces to the standard quantum mechanics. As an example, Quantum Mechanics with friction is analyzed in detail. 

  20. Brownian motion of tethered nanowires.

    Science.gov (United States)

    Ota, Sadao; Li, Tongcang; Li, Yimin; Ye, Ziliang; Labno, Anna; Yin, Xiaobo; Alam, Mohammad-Reza; Zhang, Xiang

    2014-05-01

    Brownian motion of slender particles near a boundary is ubiquitous in biological systems and in nanomaterial assembly, but the complex hydrodynamic interaction in those systems is still poorly understood. Here, we report experimental and computational studies of the Brownian motion of silicon nanowires tethered on a substrate. An optical interference method enabled direct observation of microscopic rotations of the slender bodies in three dimensions with high angular and temporal resolutions. This quantitative observation revealed anisotropic and angle-dependent hydrodynamic wall effects: rotational diffusivity in inclined and azimuth directions follows different power laws as a function of the length, ∼ L(-2.5) and ∼ L(-3), respectively, and is more hindered for smaller inclined angles. In parallel, we developed an implicit simulation technique that takes the complex wire-wall hydrodynamic interactions into account efficiently, the result of which agreed well with the experimentally observed angle-dependent diffusion. The demonstrated techniques provide a platform for studying the microrheology of soft condensed matters, such as colloidal and biological systems near interfaces, and exploring the optimal self-assembly conditions of nanostructures.

  1. Wire Scanner Motion Control Card

    CERN Document Server

    Forde, S E

    2006-01-01

    Scientists require a certain beam quality produced by the accelerator rings at CERN. The discovery potential of LHC is given by the reachable luminosity at its interaction points. The luminosity is maximized by minimizing the beam size. Therefore an accurate beam size measurement is required for optimizing the luminosity. The wire scanner performs very accurate profile measurements, but as it can not be used at full intensity in the LHC ring, it is used for calibrating other profile monitors. As the current wire scanner system, which is used in the present CERN accelerators, has not been made for the required specification of the LHC, a new design of a wire scanner motion control card is part of the LHC wire scanner project. The main functions of this card are to control the wire scanner motion and to acquire the position of the wire. In case of further upgrades at a later stage, it is required to allow an easy update of the firmware, hence the programmable features of FPGAs will be used for this purpose. The...

  2. Attentional Networks and Biological Motion

    Directory of Open Access Journals (Sweden)

    Chandramouli Chandrasekaran

    2010-03-01

    Full Text Available Our ability to see meaningful actions when presented with pointlight traces of human movement is commonly referred to as the perception of biological motion. While traditionalexplanations have emphasized the spontaneous and automatic nature of this ability, morerecent findings suggest that attention may play a larger role than is typically assumed. Intwo studies we show that the speed and accuracy of responding to point-light stimuli is highly correlated with the ability to control selective attention. In our first experiment we measured thresholds for determining the walking direction of a masked point-light figure, and performance on a range of attention-related tasks in the same set of observers. Mask-density thresholds for the direction discrimination task varied quite considerably from observer to observer and this variation was highly correlated with performance on both Stroop and flanker interference tasks. Other components of attention, such as orienting, alerting and visual search efficiency, showed no such relationship. In a second experiment, we examined the relationship between the ability to determine the orientation of unmasked point-light actions and Stroop interference, again finding a strong correlation. Our results are consistent with previous research suggesting that biological motion processing may requite attention, and specifically implicate networks of attention related to executive control and selection.

  3. IGS polar motion measurement accuracy

    Directory of Open Access Journals (Sweden)

    Jim Ray

    2017-11-01

    Full Text Available We elaborate an error budget for the long-term accuracy of IGS (International Global Navigation Satellite System Service polar motion estimates, concluding that it is probably about 25–30 μas (1-sigma overall, although it is not possible to quantify possible contributions (mainly annual that might transfer directly from aliases of subdaily rotational tide errors. The leading sources are biases arising from the need to align daily, observed terrestrial frames, within which the pole coordinates are expressed and which are continuously deforming, to the secular, linear international reference frame. Such biases are largest over spans longer than about a year. Thanks to the very large number of IGS tracking stations, the formal covariance errors are much smaller, around 5 to 10 μas. Large networks also permit the systematic frame-related errors to be more effectively minimized but not eliminated. A number of periodic errors probably also influence polar motion results, mainly at annual, GPS (Global Positioning System draconitic, and fortnightly periods, but their impact on the overall error budget is unlikely to be significant except possibly for annual tidal aliases. Nevertheless, caution should be exercised in interpreting geophysical excitations near any of the suspect periods.

  4. Correlation of photon beam motion with vacuum chamber cooling on the NSLS x-ray ring

    International Nuclear Information System (INIS)

    Johnson, E.D.; Fauchet, A.M.; Zhang, Xiaohao.

    1991-01-01

    The NSLS X-ray ring exhibits a direct correlation between photon beam motion, and distortion of the ring vacuum chamber induced by fluctuations in the cooling system. We have made long term measurements of photon beam vertical position, accelerator vacuum chamber motion, process water temperatures, and angular motions of the magnets around one superperiod of the NSLS x-ray ring. Short term transients in water temperature cause deflection of the ring vacuum chamber which have in turn been shown to induce very small angular rotations of the magnets, on the order of 10 micro-radians. A larger and more difficult to correct effect is the drift in beam position over the course of a fill. This problem has been shown to be related to the thermal gradients that develop across the vacuum chamber which, as a consequence of the configuration of the chamber cooling, depend upon stored current. Orbit simulations based upon the measured rotations are in agreement with the observed beam motions, and reveal that certain patterns of correlated motions of the magnets can produce much larger errors than random motion or concerted motion of all the magnets. During the course of these measurements global orbit feedback was installed, and found to significantly reduce the orbit errors which could not be corrected at their source

  5. Method for the utilization of waste heat, especially from nuclear power plants, in connection with processing sewage water and industrial waste water and in connection with the generation of motional energy whilst continuous heat recovery takes place and a device for carrying out this method

    International Nuclear Information System (INIS)

    Borst, A.H.

    1977-01-01

    A method is proposed by which the waste heat for nuclear power plants is used for distilling waste water, thus creating drinking water. A pressure vessel with appropriate pipes and control elementes, in which this process is to be carried out, is described. (UWI) [de

  6. Blind retrospective motion correction of MR images.

    Science.gov (United States)

    Loktyushin, Alexander; Nickisch, Hannes; Pohmann, Rolf; Schölkopf, Bernhard

    2013-12-01

    Subject motion can severely degrade MR images. A retrospective motion correction algorithm, Gradient-based motion correction, which significantly reduces ghosting and blurring artifacts due to subject motion was proposed. The technique uses the raw data of standard imaging sequences; no sequence modifications or additional equipment such as tracking devices are required. Rigid motion is assumed. The approach iteratively searches for the motion trajectory yielding the sharpest image as measured by the entropy of spatial gradients. The vast space of motion parameters is efficiently explored by gradient-based optimization with a convergence guarantee. The method has been evaluated on both synthetic and real data in two and three dimensions using standard imaging techniques. MR images are consistently improved over different kinds of motion trajectories. Using a graphics processing unit implementation, computation times are in the order of a few minutes for a full three-dimensional volume. The presented technique can be an alternative or a complement to prospective motion correction methods and is able to improve images with strong motion artifacts from standard imaging sequences without requiring additional data. Copyright © 2013 Wiley Periodicals, Inc., a Wiley company.

  7. Helicopter flight simulation motion platform requirements

    Science.gov (United States)

    Schroeder, Jeffery Allyn

    Flight simulators attempt to reproduce in-flight pilot-vehicle behavior on the ground. This reproduction is challenging for helicopter simulators, as the pilot is often inextricably dependent on external cues for pilot-vehicle stabilization. One important simulator cue is platform motion; however, its required fidelity is unknown. To determine the required motion fidelity, several unique experiments were performed. A large displacement motion platform was used that allowed pilots to fly tasks with matched motion and visual cues. Then, the platform motion was modified to give cues varying from full motion to no motion. Several key results were found. First, lateral and vertical translational platform cues had significant effects on fidelity. Their presence improved performance and reduced pilot workload. Second, yaw and roll rotational platform cues were not as important as the translational platform cues. In particular, the yaw rotational motion platform cue did not appear at all useful in improving performance or reducing workload. Third, when the lateral translational platform cue was combined with visual yaw rotational cues, pilots believed the platform was rotating when it was not. Thus, simulator systems can be made more efficient by proper combination of platform and visual cues. Fourth, motion fidelity specifications were revised that now provide simulator users with a better prediction of motion fidelity based upon the frequency responses of their motion control laws. Fifth, vertical platform motion affected pilot estimates of steady-state altitude during altitude repositionings. This refutes the view that pilots estimate altitude and altitude rate in simulation solely from visual cues. Finally, the combined results led to a general method for configuring helicopter motion systems and for developing simulator tasks that more likely represent actual flight. The overall results can serve as a guide to future simulator designers and to today's operators.

  8. MotionFlow: Visual Abstraction and Aggregation of Sequential Patterns in Human Motion Tracking Data.

    Science.gov (United States)

    Jang, Sujin; Elmqvist, Niklas; Ramani, Karthik

    2016-01-01

    Pattern analysis of human motions, which is useful in many research areas, requires understanding and comparison of different styles of motion patterns. However, working with human motion tracking data to support such analysis poses great challenges. In this paper, we propose MotionFlow, a visual analytics system that provides an effective overview of various motion patterns based on an interactive flow visualization. This visualization formulates a motion sequence as transitions between static poses, and aggregates these sequences into a tree diagram to construct a set of motion patterns. The system also allows the users to directly reflect the context of data and their perception of pose similarities in generating representative pose states. We provide local and global controls over the partition-based clustering process. To support the users in organizing unstructured motion data into pattern groups, we designed a set of interactions that enables searching for similar motion sequences from the data, detailed exploration of data subsets, and creating and modifying the group of motion patterns. To evaluate the usability of MotionFlow, we conducted a user study with six researchers with expertise in gesture-based interaction design. They used MotionFlow to explore and organize unstructured motion tracking data. Results show that the researchers were able to easily learn how to use MotionFlow, and the system effectively supported their pattern analysis activities, including leveraging their perception and domain knowledge.

  9. Operator Fractional Brownian Motion and Martingale Differences

    Directory of Open Access Journals (Sweden)

    Hongshuai Dai

    2014-01-01

    Full Text Available It is well known that martingale difference sequences are very useful in applications and theory. On the other hand, the operator fractional Brownian motion as an extension of the well-known fractional Brownian motion also plays an important role in both applications and theory. In this paper, we study the relation between them. We construct an approximation sequence of operator fractional Brownian motion based on a martingale difference sequence.

  10. Robot motion control in mobile environment

    Institute of Scientific and Technical Information of China (English)

    Iliya V Miroshnik; HUANG Xian-lin(黄显林); HE Jie(贺杰)

    2003-01-01

    With the problem of robot motion control in dynamic environment represented by mobile obstacles,working pieces and external mechanisms considered, a relevant control actions design procedure has been pro-posed to provide coordination of robot motions with respect to the moving external objects so that an extension ofrobot spatial motion techniques and active robotic strategies based on approaches of nonlinear control theory canbe achieved.

  11. Dynamic signatures of driven vortex motion.

    Energy Technology Data Exchange (ETDEWEB)

    Crabtree, G. W.; Kwok, W. K.; Lopez, D.; Olsson, R. J.; Paulius, L. M.; Petrean, A. M.; Safar, H.

    1999-09-16

    We probe the dynamic nature of driven vortex motion in superconductors with a new type of transport experiment. An inhomogeneous Lorentz driving force is applied to the sample, inducing vortex velocity gradients that distinguish the hydrodynamic motion of the vortex liquid from the elastic and-plastic motion of the vortex solid. We observe elastic depinning of the vortex lattice at the critical current, and shear induced plastic slip of the lattice at high Lorentz force gradients.

  12. Hand Gesture Recognition with Leap Motion

    OpenAIRE

    Du, Youchen; Liu, Shenglan; Feng, Lin; Chen, Menghui; Wu, Jie

    2017-01-01

    The recent introduction of depth cameras like Leap Motion Controller allows researchers to exploit the depth information to recognize hand gesture more robustly. This paper proposes a novel hand gesture recognition system with Leap Motion Controller. A series of features are extracted from Leap Motion tracking data, we feed these features along with HOG feature extracted from sensor images into a multi-class SVM classifier to recognize performed gesture, dimension reduction and feature weight...

  13. MotionExplorer: exploratory search in human motion capture data based on hierarchical aggregation.

    Science.gov (United States)

    Bernard, Jürgen; Wilhelm, Nils; Krüger, Björn; May, Thorsten; Schreck, Tobias; Kohlhammer, Jörn

    2013-12-01

    We present MotionExplorer, an exploratory search and analysis system for sequences of human motion in large motion capture data collections. This special type of multivariate time series data is relevant in many research fields including medicine, sports and animation. Key tasks in working with motion data include analysis of motion states and transitions, and synthesis of motion vectors by interpolation and combination. In the practice of research and application of human motion data, challenges exist in providing visual summaries and drill-down functionality for handling large motion data collections. We find that this domain can benefit from appropriate visual retrieval and analysis support to handle these tasks in presence of large motion data. To address this need, we developed MotionExplorer together with domain experts as an exploratory search system based on interactive aggregation and visualization of motion states as a basis for data navigation, exploration, and search. Based on an overview-first type visualization, users are able to search for interesting sub-sequences of motion based on a query-by-example metaphor, and explore search results by details on demand. We developed MotionExplorer in close collaboration with the targeted users who are researchers working on human motion synthesis and analysis, including a summative field study. Additionally, we conducted a laboratory design study to substantially improve MotionExplorer towards an intuitive, usable and robust design. MotionExplorer enables the search in human motion capture data with only a few mouse clicks. The researchers unanimously confirm that the system can efficiently support their work.

  14. Observations of infragravity motions for reef fringed islands and atolls

    Science.gov (United States)

    Becker, J. M.; Merrifield, M. A.; Ford, M.

    2012-12-01

    The frequency of flooding events that affect low lying islands and atolls in the Pacific is expected to increase under current sea level rise projections. Infragravity (IG) motions, with periods ranging from approximately 25 to 400 seconds, are an important component of wave driven flooding events for reef fringed islands and atolls. The IG variability during wave events is analyzed and interpreted dynamically from pressure and current observations at four cross-reef transects in the North Pacific Ocean that include sites in the Republic of the Marshall Islands and Guam. The IG motions are shown to depend upon the spectral properties of the incident wave forcing and reef flat characteristics that include reef flat length (ranging from 100m to 450m at the four sites) and total water level due to setup and tides. A small inundation event at one of the sites is shown to occur due to large shoreline infragravity energy.

  15. Brownian motion and stochastic calculus

    CERN Document Server

    Karatzas, Ioannis

    1998-01-01

    This book is designed as a text for graduate courses in stochastic processes. It is written for readers familiar with measure-theoretic probability and discrete-time processes who wish to explore stochastic processes in continuous time. The vehicle chosen for this exposition is Brownian motion, which is presented as the canonical example of both a martingale and a Markov process with continuous paths. In this context, the theory of stochastic integration and stochastic calculus is developed. The power of this calculus is illustrated by results concerning representations of martingales and change of measure on Wiener space, and these in turn permit a presentation of recent advances in financial economics (option pricing and consumption/investment optimization). This book contains a detailed discussion of weak and strong solutions of stochastic differential equations and a study of local time for semimartingales, with special emphasis on the theory of Brownian local time. The text is complemented by a large num...

  16. Material motion capabilities for SAREF

    International Nuclear Information System (INIS)

    DeVolpi, A.

    1976-01-01

    The SAREF program requires a panoply of diagnostic techniques in order to obtain needed experimental information. After surveying various fuel motion monitoring techniques, the hodoscope has been chosen as the reference device because of its proven record and because data extrapolations and calculations indicate adequate response for small and large test sections. A hodoscope system for STF would be designed to perform both fuel and clad monitoring during transients. It would also provide distinctive fuel and clad radiographic information before and after transients. Large-test resolution of less than 100 gm and time resolution down to 0.1 msec are projected. Two orthogonal collimators for three-dimensional viewing would each cover 180 x 31 cm viewing area with a combined total of 6000 detectors

  17. Motion Primitives for Action Recognition

    DEFF Research Database (Denmark)

    Fihl, Preben; Holte, Michael Boelstoft; Moeslund, Thomas B.

    2007-01-01

    the actions as a sequence of temporal isolated instances, denoted primitives. These primitives are each defined by four features extracted from motion images. The primitives are recognized in each frame based on a trained classifier resulting in a sequence of primitives. From this sequence we recognize......The number of potential applications has made automatic recognition of human actions a very active research area. Different approaches have been followed based on trajectories through some state space. In this paper we also model an action as a trajectory through a state space, but we represent...... different temporal actions using a probabilistic Edit Distance method. The method is tested on different actions with and without noise and the results show recognition rates of 88.7% and 85.5%, respectively....

  18. Action Recognition using Motion Primitives

    DEFF Research Database (Denmark)

    Moeslund, Thomas B.; Fihl, Preben; Holte, Michael Boelstoft

    the actions as a sequence of temporal isolated instances, denoted primitives. These primitives are each defined by four features extracted from motion images. The primitives are recognized in each frame based on a trained classifier resulting in a sequence of primitives. From this sequence we recognize......The number of potential applications has made automatic recognition of human actions a very active research area. Different approaches have been followed based on trajectories through some state space. In this paper we also model an action as a trajectory through a state space, but we represent...... different temporal actions using a probabilistic Edit Distance method. The method is tested on different actions with and without noise and the results show recognizing rates of 88.7% and 85.5%, respectively....

  19. Superluminal motion of extragalactic objects

    Energy Technology Data Exchange (ETDEWEB)

    Matveenko, L.I. (AN SSSR, Moscow. Inst. Kosmicheskikh Issledovanij)

    1983-07-01

    Extragalactic objects with active nuclei are reviewed. Experimental data are obtained with the method of superfar radiointerferometry. The main peculiarities of the complex structure of Seyfert galaxies, quasars and lacertae objects are considered: the distribution of radiobrightness, spectra, alteration of the density of radiation flux and the distance between the components of sources. The superluminal velocities of component divergence observed are explained by different reasons: fast motion of components considerable difference of the Hubble component or non-cosmologic nature of the red shift of objects, effect of echoreflection of radiation, gravitation lens, systematic alteration of the optical thickness of the object, synchronouys radiation of electrons in the dipole magnetic field, as well as different kinematic illusions connected with the final time of signal propagation.

  20. Superluminal motion of extragalactic objects

    International Nuclear Information System (INIS)

    Matveenko, L.I.

    1983-01-01

    Extragalactic objects with active nuclei are reviewed. Experimental data are obtained with the method of superfar radiointerferometry. The main peculiarities of the complex strUcture of Seyfert galaxies quasars and lacertae ob ects are considered: the distribution of radiobrightness, spectra, alteration of the density of radiation flux and the distance between the components of sources. The superluminal velocities of component divergence observed are explained by different reasons: fast motion of components considerable difference of the Hubble component or non-cosmologic nature of the red shift of objects, effect of echoreflection of radiation, gravitation lens, systematic alteration of the optical thickness of the object, synchronoUs radiation of electrons in the dipole magnetic field, as well as different kinematic illusions connected with the final time of signal propagation

  1. Unconscious Local Motion Alters Global Image Speed

    Science.gov (United States)

    Khuu, Sieu K.; Chung, Charles Y. L.; Lord, Stephanie; Pearson, Joel

    2014-01-01

    Accurate motion perception of self and object speed is crucial for successful interaction in the world. The context in which we make such speed judgments has a profound effect on their accuracy. Misperceptions of motion speed caused by the context can have drastic consequences in real world situations, but they also reveal much about the underlying mechanisms of motion perception. Here we show that motion signals suppressed from awareness can warp simultaneous conscious speed perception. In Experiment 1, we measured global speed discrimination thresholds using an annulus of 8 local Gabor elements. We show that physically removing local elements from the array attenuated global speed discrimination. However, removing awareness of the local elements only had a small effect on speed discrimination. That is, unconscious local motion elements contributed to global conscious speed perception. In Experiment 2 we measured the global speed of the moving Gabor patterns, when half the elements moved at different speeds. We show that global speed averaging occurred regardless of whether local elements were removed from awareness, such that the speed of invisible elements continued to be averaged together with the visible elements to determine the global speed. These data suggest that contextual motion signals outside of awareness can both boost and affect our experience of motion speed, and suggest that such pooling of motion signals occurs before the conscious extraction of the surround motion speed. PMID:25503603

  2. An Integrated Approach to Motion and Sound

    National Research Council Canada - National Science Library

    Hahn, James K; Geigel, Joe; Lee, Jong W; Gritz, Larry; Takala, Tapio; Mishra, Suneil

    1995-01-01

    Until recently, sound has been given little attention in computer graphics and related domains of computer animation and virtual environments, although sounds which are properly synchronized to motion...

  3. Exoskeleton Motion Control for Children Walking Rehabilitation

    Directory of Open Access Journals (Sweden)

    Cristina Ploscaru

    2016-06-01

    Full Text Available This paper introduces a quick method for motion control of an exoskeleton used on children walking rehabilitation with ages between four to seven years old. The exoskeleton used on this purpose has six servomotors which work independently and actuates each human lower limb joints (hips, knees and ankles. For obtaining the desired motion laws, a high-speed motion analysis equipment was used. The experimental rough data were mathematically modeled in order to obtain the proper motion equations for controlling the exoskeleton servomotors.

  4. Ground Motion Models for Future Linear Colliders

    International Nuclear Information System (INIS)

    Seryi, Andrei

    2000-01-01

    Optimization of the parameters of a future linear collider requires comprehensive models of ground motion. Both general models of ground motion and specific models of the particular site and local conditions are essential. Existing models are not completely adequate, either because they are too general, or because they omit important peculiarities of ground motion. The model considered in this paper is based on recent ground motion measurements performed at SLAC and at other accelerator laboratories, as well as on historical data. The issues to be studied for the models to become more predictive are also discussed

  5. Perception of biological motion in visual agnosia

    Directory of Open Access Journals (Sweden)

    Elisabeth eHuberle

    2012-08-01

    Full Text Available Over the past twenty-five years, visual processing has been discussed in the context of the dual stream hypothesis consisting of a ventral (‘what' and a dorsal ('where' visual information processing pathway. Patients with brain damage of the ventral pathway typically present with signs of visual agnosia, the inability to identify and discriminate objects by visual exploration, but show normal perception of motion perception. A dissociation between the perception of biological motion and non-biological motion has been suggested: Perception of biological motion might be impaired when 'non-biological' motion perception is intact and vice versa. The impact of object recognition on the perception of biological motion remains unclear. We thus investigated this question in a patient with severe visual agnosia, who showed normal perception of non-biological motion. The data suggested that the patient's perception of biological motion remained largely intact. However, when tested with objects constructed of coherently moving dots (‘Shape-from-Motion’, recognition was severely impaired. The results are discussed in the context of possible mechanisms of biological motion perception.

  6. Motion video analysis using planar parallax

    Science.gov (United States)

    Sawhney, Harpreet S.

    1994-04-01

    Motion and structure analysis in video sequences can lead to efficient descriptions of objects and their motions. Interesting events in videos can be detected using such an analysis--for instance independent object motion when the camera itself is moving, figure-ground segregation based on the saliency of a structure compared to its surroundings. In this paper we present a method for 3D motion and structure analysis that uses a planar surface in the environment as a reference coordinate system to describe a video sequence. The motion in the video sequence is described as the motion of the reference plane, and the parallax motion of all the non-planar components of the scene. It is shown how this method simplifies the otherwise hard general 3D motion analysis problem. In addition, a natural coordinate system in the environment is used to describe the scene which can simplify motion based segmentation. This work is a part of an ongoing effort in our group towards video annotation and analysis for indexing and retrieval. Results from a demonstration system being developed are presented.

  7. Figure-ground segregation modulates apparent motion.

    Science.gov (United States)

    Ramachandran, V S; Anstis, S

    1986-01-01

    We explored the relationship between figure-ground segmentation and apparent motion. Results suggest that: static elements in the surround can eliminate apparent motion of a cluster of dots in the centre, but only if the cluster and surround have similar "grain" or texture; outlines that define occluding surfaces are taken into account by the motion mechanism; the brain uses a hierarchy of precedence rules in attributing motion to different segments of the visual scene. Being designated as "figure" confers a high rank in this scheme of priorities.

  8. The perception of object versus objectless motion.

    Science.gov (United States)

    Hock, Howard S; Nichols, David F

    2013-05-01

    Wertheimer, M. (Zeitschrift für Psychologie und Physiologie der Sinnesorgane, 61:161-265, 1912) classical distinction between beta (object) and phi (objectless) motion is elaborated here in a series of experiments concerning competition between two qualitatively different motion percepts, induced by sequential changes in luminance for two-dimensional geometric objects composed of rectangular surfaces. One of these percepts is of spreading-luminance motion that continuously sweeps across the entire object; it exhibits shape invariance and is perceived most strongly for fast speeds. Significantly for the characterization of phi as objectless motion, the spreading luminance does not involve surface boundaries or any other feature; the percept is driven solely by spatiotemporal changes in luminance. Alternatively, and for relatively slow speeds, a discrete series of edge motions can be perceived in the direction opposite to spreading-luminance motion. Akin to beta motion, the edges appear to move through intermediate positions within the object's changing surfaces. Significantly for the characterization of beta as object motion, edge motion exhibits shape dependence and is based on the detection of oppositely signed changes in contrast (i.e., counterchange) for features essential to the determination of an object's shape, the boundaries separating its surfaces. These results are consistent with area MT neurons that differ with respect to speed preference Newsome et al (Journal of Neurophysiology, 55:1340-1351, 1986) and shape dependence Zeki (Journal of Physiology, 236:549-573, 1974).

  9. Modeling repetitive motions using structured light.

    Science.gov (United States)

    Xu, Yi; Aliaga, Daniel G

    2010-01-01

    Obtaining models of dynamic 3D objects is an important part of content generation for computer graphics. Numerous methods have been extended from static scenarios to model dynamic scenes. If the states or poses of the dynamic object repeat often during a sequence (but not necessarily periodically), we call such a repetitive motion. There are many objects, such as toys, machines, and humans, undergoing repetitive motions. Our key observation is that when a motion-state repeats, we can sample the scene under the same motion state again but using a different set of parameters; thus, providing more information of each motion state. This enables robustly acquiring dense 3D information difficult for objects with repetitive motions using only simple hardware. After the motion sequence, we group temporally disjoint observations of the same motion state together and produce a smooth space-time reconstruction of the scene. Effectively, the dynamic scene modeling problem is converted to a series of static scene reconstructions, which are easier to tackle. The varying sampling parameters can be, for example, structured-light patterns, illumination directions, and viewpoints resulting in different modeling techniques. Based on this observation, we present an image-based motion-state framework and demonstrate our paradigm using either a synchronized or an unsynchronized structured-light acquisition method.

  10. Model-Based Motion Tracking of Infants

    DEFF Research Database (Denmark)

    Olsen, Mikkel Damgaard; Herskind, Anna; Nielsen, Jens Bo

    2014-01-01

    Even though motion tracking is a widely used technique to analyze and measure human movements, only a few studies focus on motion tracking of infants. In recent years, a number of studies have emerged focusing on analyzing the motion pattern of infants, using computer vision. Most of these studies...... are based on 2D images, but few are based on 3D information. In this paper, we present a model-based approach for tracking infants in 3D. The study extends a novel study on graph-based motion tracking of infants and we show that the extension improves the tracking results. A 3D model is constructed...

  11. Excess water dynamics in hydrotalcite: QENS study

    Indian Academy of Sciences (India)

    dynamics of excess water in hydrotalcite sample with varied content of excess water are reported. Translational motion of excess water can be best described by random transla- tional jump diffusion model. The observed increase in translational diffusivity with increase in the amount of excess water is attributed to the ...

  12. The open quantum Brownian motions

    International Nuclear Information System (INIS)

    Bauer, Michel; Bernard, Denis; Tilloy, Antoine

    2014-01-01

    Using quantum parallelism on random walks as the original seed, we introduce new quantum stochastic processes, the open quantum Brownian motions. They describe the behaviors of quantum walkers—with internal degrees of freedom which serve as random gyroscopes—interacting with a series of probes which serve as quantum coins. These processes may also be viewed as the scaling limit of open quantum random walks and we develop this approach along three different lines: the quantum trajectory, the quantum dynamical map and the quantum stochastic differential equation. We also present a study of the simplest case, with a two level system as an internal gyroscope, illustrating the interplay between the ballistic and diffusive behaviors at work in these processes. Notation H z : orbital (walker) Hilbert space, C Z in the discrete, L 2 (R) in the continuum H c : internal spin (or gyroscope) Hilbert space H sys =H z ⊗H c : system Hilbert space H p : probe (or quantum coin) Hilbert space, H p =C 2 ρ t tot : density matrix for the total system (walker + internal spin + quantum coins) ρ-bar t : reduced density matrix on H sys : ρ-bar t =∫dxdy ρ-bar t (x,y)⊗|x〉 z 〈y| ρ-hat t : system density matrix in a quantum trajectory: ρ-hat t =∫dxdy ρ-hat t (x,y)⊗|x〉 z 〈y|. If diagonal and localized in position: ρ-hat t =ρ t ⊗|X t 〉 z 〈X t | ρ t : internal density matrix in a simple quantum trajectory X t : walker position in a simple quantum trajectory B t : normalized Brownian motion ξ t , ξ t † : quantum noises (paper)

  13. Estimating Vertical Land Motion in the Chesapeake Bay

    Science.gov (United States)

    Houttuijn Bloemendaal, L.; Hensel, P.

    2017-12-01

    This study aimed to provide a modern measurement of subsidence in the Chesapeake Bay region and establish a methodology for measuring vertical land motion using static GPS, a cheaper alternative to InSAR or classical leveling. Vertical land motion in this area is of particular concern because tide gages are showing up to 5 mm/yr of local, relative sea level rise. While a component of this rate is the actual eustatic sea level rise itself, part of the trend may also be vertical land motion, in which subsidence exacerbates the effects of actual changes in sea level. Parts of this region are already experiencing an increase in the frequency and magnitude of near-shore coastal flooding, but the last comprehensive study of vertical land motion in this area was conducted by NOAA in 1974 (Holdahl & Morrison) using repeat leveled lines. More recent measures of vertical land motion can help inform efforts on resilience to sea level rise, such as in the Hampton Roads area. This study used measured GPS-derived vertical heights in conjunction with legacy GPS data to calculate rates of vertical motion at several points in time for a selection of benchmarks scattered throughout the region. Seventeen marks in the stable Piedmont area and in the areas suspected of subsidence in the Coastal Plain were selected for the analysis. Results indicate a significant difference between the rates of vertical motion in the Piedmont and Coastal Plain, with a mean rate of -4.10 mm/yr in the Coastal Plain and 0.15 mm/yr in the Piedmont. The rates indicate particularly severe subsidence at the southern Delmarva Peninsula coast and the Hampton-Roads area, with a mean rate of -6.57 mm/yr in that region. By knowing local rates of subsidence as opposed to sea level change itself, coastal managers may make better informed decisions regarding natural resource use, such as deciding whether or not to reduce subsurface fluid withdrawals or to consider injecting treated water back into the aquifer to slow

  14. Water Hydraulic Systems

    DEFF Research Database (Denmark)

    Conrad, Finn

    2005-01-01

    The paper presents research results using IT-Tools for CAD and dynamic modelling, simulation, analysis, and design of water hydraulic actuators for motion control of machines, lifts, cranes and robots. Matlab/Simulink and CATIA are used as IT-Tools. The contributions include results from on......-going research projects on fluid power and mechatronics based on tap water hydraulic servovalves and linear servo actuators and rotary vane actuators for motion control and power transmission. Development and design a novel water hydraulic rotary vane actuator for robot manipulators. Proposed mathematical...... modelling, control and simulation of a water hydraulic rotary vane actuator applied to power and control a two-links manipulator and evaluate performance. The results include engineering design and test of the proposed simulation models compared with IHA Tampere University’s presentation of research...

  15. Neutronographic measurements of the motion of hydrogen and hydrogeneous substances in liquids and solids

    International Nuclear Information System (INIS)

    Zeilinger, A.; Pochman, W.A.; Rauch, H.; Suleiman, M.

    1976-01-01

    Earlier measurements of hydrogen motion in liquids by neutron radiography have been extended to obtain additional parameters of governing the mixing behavior of light and heavy water. Furthermore motion of water in concrete was measured leading to a determination of (1) the vapor diffusion coefficient of water in concrete, (2) the porosity of the concrete, and (3) the mass transfer coefficient of vapor from the concrete to the environment. Recently the ability of neutron radiography to measure the hydrogen motion in metals was demonstrated and the diffusion coefficients of hydrogen in V, Ta, Nb and beta-Ti was determined. In addition, some work on resolution measurements of neutron radiography will be reported. (author)

  16. A multistage motion vector processing method for motion-compensated frame interpolation.

    Science.gov (United States)

    Huang, Ai- Mei; Nguyen, Truong Q

    2008-05-01

    In this paper, a novel, low-complexity motion vector processing algorithm at the decoder is proposed for motion-compensated frame interpolation or frame rate up-conversion. We address the problems of having broken edges and deformed structures in an interpolated frame by hierarchically refining motion vectors on different block sizes. Our method explicitly considers the reliability of each received motion vector and has the capability of preserving the structure information. This is achieved by analyzing the distribution of residual energies and effectively merging blocks that have unreliable motion vectors. The motion vector reliability information is also used as a prior knowledge in motion vector refinement using a constrained vector median filter to avoid choosing identical unreliable one. We also propose using chrominance information in our method. Experimental results show that the proposed scheme has better visual quality and is also robust, even in video sequences with complex scenes and fast motion.

  17. Strong Motion Earthquake Data Values of Digitized Strong-Motion Accelerograms, 1933-1994

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — The Strong Motion Earthquake Data Values of Digitized Strong-Motion Accelerograms is a database of over 15,000 digitized and processed accelerograph records from...

  18. Direct Contribution of Auditory Motion Information to Sound-Induced Visual Motion Perception

    Directory of Open Access Journals (Sweden)

    Souta Hidaka

    2011-10-01

    Full Text Available We have recently demonstrated that alternating left-right sound sources induce motion perception to static visual stimuli along the horizontal plane (SIVM: sound-induced visual motion perception, Hidaka et al., 2009. The aim of the current study was to elucidate whether auditory motion signals, rather than auditory positional signals, can directly contribute to the SIVM. We presented static visual flashes at retinal locations outside the fovea together with a lateral auditory motion provided by a virtual stereo noise source smoothly shifting in the horizontal plane. The flashes appeared to move in the situation where auditory positional information would have little influence on the perceived position of visual stimuli; the spatiotemporal position of the flashes was in the middle of the auditory motion trajectory. Furthermore, the auditory motion altered visual motion perception in a global motion display; in this display, different localized motion signals of multiple visual stimuli were combined to produce a coherent visual motion perception so that there was no clear one-to-one correspondence between the auditory stimuli and each visual stimulus. These findings suggest the existence of direct interactions between the auditory and visual modalities in motion processing and motion perception.

  19. Motion sickness symptoms in a ship motion simulator: effects of inside, outside, and no view

    NARCIS (Netherlands)

    Bos, J.E.; MacKinnon, S.N.; Patterson, A.

    2005-01-01

    Vehicle motion characteristics differ between air, road, and sea environments, both vestibularly and visually. Effects of vision on motion sickness have been studied before, though less systematically in a naval setting. It is hypothesized that appropriate visual information on self-motion is

  20. The Role of Motion Concepts in Understanding Non-Motion Concepts

    Directory of Open Access Journals (Sweden)

    Omid Khatin-Zadeh

    2017-12-01

    Full Text Available This article discusses a specific type of metaphor in which an abstract non-motion domain is described in terms of a motion event. Abstract non-motion domains are inherently different from concrete motion domains. However, motion domains are used to describe abstract non-motion domains in many metaphors. Three main reasons are suggested for the suitability of motion events in such metaphorical descriptions. Firstly, motion events usually have high degrees of concreteness. Secondly, motion events are highly imageable. Thirdly, components of any motion event can be imagined almost simultaneously within a three-dimensional space. These three characteristics make motion events suitable domains for describing abstract non-motion domains, and facilitate the process of online comprehension throughout language processing. Extending the main point into the field of mathematics, this article discusses the process of transforming abstract mathematical problems into imageable geometric representations within the three-dimensional space. This strategy is widely used by mathematicians to solve highly abstract and complex problems.

  1. Motion adaptation leads to parsimonious encoding of natural optic flow by blowfly motion vision system

    NARCIS (Netherlands)

    Heitwerth, J.; Kern, R.; Hateren, J.H. van; Egelhaaf, M.

    Neurons sensitive to visual motion change their response properties during prolonged motion stimulation. These changes have been interpreted as adaptive and were concluded, for instance, to adjust the sensitivity of the visual motion pathway to velocity changes or to increase the reliability of

  2. Circular relativistic motion of two identical bodies

    International Nuclear Information System (INIS)

    Shavokhina, N.S.

    1983-01-01

    Circular relativistic motion of two bodies as a solution of the earlier obtained equations with a deflecting argument where the self-deflection of the argument is an unknown function of time is considered. In case of circular motion the argument deflection is independent from time and it is the root of the transcendental equation obtained in the paper

  3. Three scales of motions associated with tornadoes

    International Nuclear Information System (INIS)

    Forbes, G.S.

    1978-03-01

    This dissertation explores three scales of motion commonly associated with tornadoes, and the interaction of these scales: the tornado cyclone, the tornado, and the suction vortex. The goal of the research is to specify in detail the character and interaction of these scales of motion to explain tornadic phenomena

  4. Project Physics Tests 1, Concepts of Motion.

    Science.gov (United States)

    Harvard Univ., Cambridge, MA. Harvard Project Physics.

    Test items relating to Project Physics Unit 1 are presented in this booklet, consisting of 70 multiple-choice and 20 problem-and-essay questions. Concepts of motion are examined with respect to velocities, acceleration, forces, vectors, Newton's laws, and circular motion. Suggestions are made for time consumption in answering some items. Besides…

  5. Earthquake source model using strong motion displacement

    Indian Academy of Sciences (India)

    The strong motion displacement records available during an earthquake can be treated as the response of the earth as the a structural system to unknown forces acting at unknown locations. Thus, if the part of the earth participating in ground motion is modelled as a known finite elastic medium, one can attempt to model the ...

  6. Motion planning for gantry mounted manipulators

    DEFF Research Database (Denmark)

    Olsen, Anders Lau; Petersen, Henrik Gordon

    2007-01-01

    We present a roadmap based planner for finding robot motions for gantry mounted manipulators for a line welding application at Odense Steel Shipyard (OSS). The robot motions are planned subject to constraints on when the gantry may be moved. We show that random sampling of gantry configurations...

  7. Geodesic motion and confinement in Goedel's universe

    International Nuclear Information System (INIS)

    Novello, M.; Soares, I.D.; Tiomno, J.

    1982-01-01

    A complete study of geodesic motion in Goedel's universe, using the method of the Effective Potential is presented. It then emerges a clear physical picture of free motion and its stability in this universe. Geodesics of a large class have finite intervals in which the particle moves back in time (dt/ds [pt

  8. Unidirectional Motion of Vehicle on Sinusoidal Path

    Indian Academy of Sciences (India)

    Home; Journals; Resonance – Journal of Science Education; Volume 17; Issue 4. Unidirectional Motion of Vehicle on Sinusoidal Path: Can it Cause Illusory Forward and Backward Motion? Anuj Bhatnagar. Classroom Volume 17 Issue 4 April 2012 pp 387-392 ...

  9. Sound-contingent visual motion aftereffect

    Directory of Open Access Journals (Sweden)

    Kobayashi Maori

    2011-05-01

    Full Text Available Abstract Background After a prolonged exposure to a paired presentation of different types of signals (e.g., color and motion, one of the signals (color becomes a driver for the other signal (motion. This phenomenon, which is known as contingent motion aftereffect, indicates that the brain can establish new neural representations even in the adult's brain. However, contingent motion aftereffect has been reported only in visual or auditory domain. Here, we demonstrate that a visual motion aftereffect can be contingent on a specific sound. Results Dynamic random dots moving in an alternating right or left direction were presented to the participants. Each direction of motion was accompanied by an auditory tone of a unique and specific frequency. After a 3-minutes exposure, the tones began to exert marked influence on the visual motion perception, and the percentage of dots required to trigger motion perception systematically changed depending on the tones. Furthermore, this effect lasted for at least 2 days. Conclusions These results indicate that a new neural representation can be rapidly established between auditory and visual modalities.

  10. Adaptive motion of animals and machines

    National Research Council Canada - National Science Library

    Kimura, Hiroshi

    2006-01-01

    ... single function in a control system and mechanism. That is, adaptation in motion is induced at every level from the central nervous system to the musculoskeletal system. Thus, we organized the International Symposium on Adaptive Motion in Animals and Machines (AMAM) for scientists and engineers concerned with adaptation on various levels to be broug...

  11. Two-Dimensional Motions of Rockets

    Science.gov (United States)

    Kang, Yoonhwan; Bae, Saebyok

    2007-01-01

    We analyse the two-dimensional motions of the rockets for various types of rocket thrusts, the air friction and the gravitation by using a suitable representation of the rocket equation and the numerical calculation. The slope shapes of the rocket trajectories are discussed for the three types of rocket engines. Unlike the projectile motions, the…

  12. Large proper motions in the Orion nebula

    International Nuclear Information System (INIS)

    Cudworth, K.M.; Stone, R.C.

    1977-01-01

    Several nebular features, as well as one faint star, with large proper motions were identified within the Orion nebula. The measured proper motions correspond to tangential velocities of up to approximately 70 km sec -1 . One new probable variable star was also found

  13. Motion sensing using WLAN signal fluctuations

    NARCIS (Netherlands)

    Kavitha Muthukrishnan, K.; Lijding, M.E.M.; Meratnia, Nirvana; Havinga, Paul J.M.

    2006-01-01

    The ability to infer the motion of the user has previously been possible only with the usage of additional hardware. In this paper we show how motion sensing can be obtained just by observing the WLAN radio’s signal strength and its fluctuations. For the first time, we have analyzed the signal

  14. Using Phun to Study "Perpetual Motion" Machines

    Science.gov (United States)

    Kores, Jaroslav

    2012-01-01

    The concept of "perpetual motion" has a long history. The Indian astronomer and mathematician Bhaskara II (12th century) was the first person to describe a perpetual motion (PM) machine. An example of a 13th-century PM machine is shown in Fig. 1. Although the law of conservation of energy clearly implies the impossibility of PM construction, over…

  15. Passive containment system in high earthquake motion

    International Nuclear Information System (INIS)

    Kleimola, F.W.; Falls, O.B. Jr.

    1977-01-01

    High earthquake motion necessitates major design modifications in the complex of plant structures, systems and components in a nuclear power plant. Distinctive features imposed by seismic category, safety class and quality classification requirements for the high seismic ground acceleration loadings significantly reflect in plant costs. The design features in the Passive Containment System (PCS) responding to high earthquake ground motion are described

  16. Conditional shape models for cardiac motion estimation

    DEFF Research Database (Denmark)

    Metz, Coert; Baka, Nora; Kirisli, Hortense

    2010-01-01

    We propose a conditional statistical shape model to predict patient specific cardiac motion from the 3D end-diastolic CTA scan. The model is built from 4D CTA sequences by combining atlas based segmentation and 4D registration. Cardiac motion estimation is, for example, relevant in the dynamic...

  17. CNA-motion in a PS - Fn

    International Nuclear Information System (INIS)

    Singh, M.P.; Mishra, C.K.

    1989-12-01

    A Finsler space Fn (n > 2), throughout with the projective curvature tensor possessing vanishing covariant derivative, has been called a ''projectively symmetric Finsler space'' and such a space is denoted PS-Fn. The conditions in which an infinitesimal transformation defines non-affine motion with a contra-field, briefly called CNA-motion, are discussed. 7 refs

  18. 14 CFR 406.141 - Motions.

    Science.gov (United States)

    2010-01-01

    ... cause shown, a party must file any prehearing motion with the Federal Docket Management System and serve... for more definite statement. A respondent may file a motion requesting a more definite statement of... pleading and must submit the details that the party believes would make the allegation or response definite...

  19. Linearized motion estimation for articulated planes.

    Science.gov (United States)

    Datta, Ankur; Sheikh, Yaser; Kanade, Takeo

    2011-04-01

    In this paper, we describe the explicit application of articulation constraints for estimating the motion of a system of articulated planes. We relate articulations to the relative homography between planes and show that these articulations translate into linearized equality constraints on a linear least-squares system, which can be solved efficiently using a Karush-Kuhn-Tucker system. The articulation constraints can be applied for both gradient-based and feature-based motion estimation algorithms and to illustrate this, we describe a gradient-based motion estimation algorithm for an affine camera and a feature-based motion estimation algorithm for a projective camera that explicitly enforces articulation constraints. We show that explicit application of articulation constraints leads to numerically stable estimates of motion. The simultaneous computation of motion estimates for all of the articulated planes in a scene allows us to handle scene areas where there is limited texture information and areas that leave the field of view. Our results demonstrate the wide applicability of the algorithm in a variety of challenging real-world cases such as human body tracking, motion estimation of rigid, piecewise planar scenes, and motion estimation of triangulated meshes.

  20. Wobbling motion in high spin states

    International Nuclear Information System (INIS)

    Onishi, Naoki

    1982-01-01

    By generalizing the cranking model, interwoven motions of collective and non-collective rotation of nuclei are treated as three dimensional non-uniform rotations including precession and wobbling. Classical trajectories are obtained for the + j vector + = 30 h/2π sphere. A method of quantization for wobbling motions is discussed and is applied to estimate excitation energies. (author)

  1. Visual-vestibular interaction in motion perception

    NARCIS (Netherlands)

    Hosman, Ruud J A W; Cardullo, Frank M.; Bos, Jelte E.

    2011-01-01

    Correct perception of self motion is of vital importance for both the control of our position and posture when moving around in our environment. With the development of human controlled vehicles as bicycles, cars and aircraft motion perception became of interest for the understanding of vehicle

  2. Motion compensation for MRI-guided radiotherapy

    NARCIS (Netherlands)

    Glitzner, M.

    2017-01-01

    Radiotherapy aims to deliver a lethal radiation dose to cancer cells immersed in the body using a high energetic photon beam. Due to physiologic motion of the human anatomy (e.g. caused by filling of internal organs or breathing), the target volume is under permanent motion during irradiation,

  3. A system for learning statistical motion patterns.

    Science.gov (United States)

    Hu, Weiming; Xiao, Xuejuan; Fu, Zhouyu; Xie, Dan; Tan, Tieniu; Maybank, Steve

    2006-09-01

    Analysis of motion patterns is an effective approach for anomaly detection and behavior prediction. Current approaches for the analysis of motion patterns depend on known scenes, where objects move in predefined ways. It is highly desirable to automatically construct object motion patterns which reflect the knowledge of the scene. In this paper, we present a system for automatically learning motion patterns for anomaly detection and behavior prediction based on a proposed algorithm for robustly tracking multiple objects. In the tracking algorithm, foreground pixels are clustered using a fast accurate fuzzy K-means algorithm. Growing and prediction of the cluster centroids of foreground pixels ensure that each cluster centroid is associated with a moving object in the scene. In the algorithm for learning motion patterns, trajectories are clustered hierarchically using spatial and temporal information and then each motion pattern is represented with a chain of Gaussian distributions. Based on the learned statistical motion patterns, statistical methods are used to detect anomalies and predict behaviors. Our system is tested using image sequences acquired, respectively, from a crowded real traffic scene and a model traffic scene. Experimental results show the robustness of the tracking algorithm, the efficiency of the algorithm for learning motion patterns, and the encouraging performance of algorithms for anomaly detection and behavior prediction.

  4. Branner-Hubbard Motions and attracting dynamics

    DEFF Research Database (Denmark)

    Petersen, Carsten Lunde; Tan, Lei

    2006-01-01

    We introduce a new notion of attracting dynamics, which is related to polynomial-like mappings. Also we review the Branner-Hubbard Motion and study its action on attracting dynamics.......We introduce a new notion of attracting dynamics, which is related to polynomial-like mappings. Also we review the Branner-Hubbard Motion and study its action on attracting dynamics....

  5. Branner-Hubbard motions and attracting dynamics

    DEFF Research Database (Denmark)

    Petersen, Carsten Lunde; Tan, Lei

    We introduce the new notion an aatracting dynamics, which is related to polynomial-likke mappings. Also we review the Branner-Hubbard motion and study its action on attracting dynamics.......We introduce the new notion an aatracting dynamics, which is related to polynomial-likke mappings. Also we review the Branner-Hubbard motion and study its action on attracting dynamics....

  6. Motion discrimination under uncertainty and ambiguity.

    NARCIS (Netherlands)

    Kalisvaart, J.P.; Klaver, I.; Goossens, J.

    2011-01-01

    Speed and accuracy of visual motion discrimination depend systematically on motion strength. This behavior is traditionally explained by diffusion models that assume accumulation of sensory evidence over time to a decision bound. However, how does the brain decide when sensory evidence is ambiguous,

  7. Rehabilitering og 'motion på recept'

    DEFF Research Database (Denmark)

    Larsen, Niels Sandholm; Larsen, Kristian

    2008-01-01

    af disse forskningsarbejder er etablering af fænomenet 'motion på recept'. Konceptet om 'motion på recept' stammer oprindelig fra Sverige, hvor praktiserende læger i en periode har haft mulighed for at henvise visse typer af patienter til fysisk træning hos praktiserende fysioterapeuter. Ribe Amt...... 2007)....

  8. Motion in an Asymmetric Double Well

    OpenAIRE

    Brizard, Alain J.; Westland, Melissa C.

    2016-01-01

    The problem of the motion of a particle in an asymmetric double well is solved explicitly in terms of the Weierstrass and Jacobi elliptic functions. While the solution of the orbital motion is expressed simply in terms of the Weierstrass elliptic function, the period of oscillation is more directly expressed in terms of periods of the Jacobi elliptic functions.

  9. Technique for producing cardiac radionuclide motion images

    International Nuclear Information System (INIS)

    Reese, I.C.; Mishkin, F.S.

    1975-01-01

    Sequential frames of different portions of the cardiac cycle are gated into a minicomputer by using an EKG signal recorded onto digital tape simultaneously with imaging information. Serial display of these frames on the computer oscilloscope or projection of 35-mm half frames of these images provides a cardiac motion image with information content adequate for qualitatively assessing cardiac motion. (U.S.)

  10. 45 CFR 672.9 - Motions.

    Science.gov (United States)

    2010-10-01

    ... memorandum relied upon. (b) Response to motions. A party must file a response to any written motion within..., shall (1) be in writing; (2) state the basis or grounds with particularity; (3) set forth the relief or... response shall be accompanied by any affidavit, certificate, other evidence, or legal memorandum relied...

  11. 10 CFR 820.39 - Motions.

    Science.gov (United States)

    2010-01-01

    ... an enforcement adjudication except those made orally, shall be in writing, state the grounds therefor..., certificate, other evidence, or legal memorandum relied upon. (b) Answer to motions. Except as otherwise... to file a written answer to the motion of another party within 10 days after the filing of such...

  12. Kinesthetic information disambiguates visual motion signals.

    Science.gov (United States)

    Hu, Bo; Knill, David C

    2010-05-25

    Numerous studies have shown that extra-retinal signals can disambiguate motion information created by movements of the eye or head. We report a new form of cross-modal sensory integration in which the kinesthetic information generated by active hand movements essentially captures ambiguous visual motion information. Several previous studies have shown that active movement can bias observers' percepts of bi-stable stimuli; however, these effects seem to be best explained by attentional mechanisms. We show that kinesthetic information can change an otherwise stable perception of motion, providing evidence of genuine fusion between visual and kinesthetic information. The experiments take advantage of the aperture problem, in which the motion of a one-dimensional grating pattern behind an aperture, while geometrically ambiguous, appears to move stably in the grating normal direction. When actively moving the pattern, however, the observer sees the motion to be in the hand movement direction. Copyright 2010 Elsevier Ltd. All rights reserved.

  13. Centralized Networks to Generate Human Body Motions.

    Science.gov (United States)

    Vakulenko, Sergei; Radulescu, Ovidiu; Morozov, Ivan; Weber, Andres

    2017-12-14

    We consider continuous-time recurrent neural networks as dynamical models for the simulation of human body motions. These networks consist of a few centers and many satellites connected to them. The centers evolve in time as periodical oscillators with different frequencies. The center states define the satellite neurons' states by a radial basis function (RBF) network. To simulate different motions, we adjust the parameters of the RBF networks. Our network includes a switching module that allows for turning from one motion to another. Simulations show that this model allows us to simulate complicated motions consisting of many different dynamical primitives. We also use the model for learning human body motion from markers' trajectories. We find that center frequencies can be learned from a small number of markers and can be transferred to other markers, such that our technique seems to be capable of correcting for missing information resulting from sparse control marker settings.

  14. Contrast configuration influences grouping in apparent motion.

    Science.gov (United States)

    Ma-Wyatt, Anna; Clifford, Colin W G; Wenderoth, Peter

    2005-01-01

    We investigated whether the same principles that influence grouping in static displays also influence grouping in apparent motion. Using the Ternus display, we found that the proportion of group motion reports was influenced by changes in contrast configuration. Subjects made judgments of completion of these same configurations in a static display. Generally, contrast configurations that induced a high proportion of group motion responses were judged as more 'complete' in static displays. Using a stereo display, we then tested whether stereo information and T-junction information were critical for this increase in group motion. Perceived grouping was consistently higher for same contrast polarity configurations than for opposite contrast polarity configurations, regardless of the presence of stereo information or explicit T-junctions. Thus, while grouping in static and moving displays showed a similar dependence on contrast configuration, motion grouping showed little dependence on stereo or T-junction information.

  15. Proper motions and distances of quasars

    International Nuclear Information System (INIS)

    Varshni, Y.P.

    1982-01-01

    The author's theory that quasars are stars raises the question of their proper motions. From the evidence presented in a previous paper, it is hypothesised that planetary nuclei and quasars are related objects and that their distributions in the galaxy are not very different. Proper motions of 30 quasars, calculated from existing measurements, are discussed. It is shown that three of these, namely PHL 1033, LB 8956 and LB 8991, have proper motions comparable to the largest proper motion known amongst the planetary nuclei. From this it is estimated that these three quasars lie within a few hundred parsecs from the sun. The evidence presented in a previous paper and the present one clearly supports the theory that quasars are stars. The possibility of using the interstellar K and H lines as distance indicators of quasars is discussed and the available evidence summarised. The desirability of determining more accurate values of the proper motions of quasars is emphasised. (Auth.)

  16. Study on characteristics of vertical strong motions

    International Nuclear Information System (INIS)

    Akao, Y.; Katukura, H.; Fukushima, S.; Mizutani, M.

    1993-01-01

    Statistic properties of vertical strong ground motions from near-field earthquakes are discussed in comparison with that of horizontal motions. It is a feature of this analysis that time history of each observed record is divided into direct P- and S-wave segments from a seismological viewpoint. Following results are obtained. Vertical motion energy excited by direct S-waves is about 0.6 times of horizontal ones at deep underground, and it approaches to 1.0 at shallow place. Horizontal motion energy excited by direct P-waves becomes 0.2 times (at deep) or more (at shallow) of vertical one. These results can be available in modeling of input motions for aseismic design. (author)

  17. Seismic switch for strong motion measurement

    Science.gov (United States)

    Harben, P.E.; Rodgers, P.W.; Ewert, D.W.

    1995-05-30

    A seismic switching device is described that has an input signal from an existing microseismic station seismometer and a signal from a strong motion measuring instrument. The seismic switch monitors the signal level of the strong motion instrument and passes the seismometer signal to the station data telemetry and recording systems. When the strong motion instrument signal level exceeds a user set threshold level, the seismometer signal is switched out and the strong motion signal is passed to the telemetry system. The amount of time the strong motion signal is passed before switching back to the seismometer signal is user controlled between 1 and 15 seconds. If the threshold level is exceeded during a switch time period, the length of time is extended from that instant by one user set time period. 11 figs.

  18. Capturing Motion and Depth Before Cinematography.

    Science.gov (United States)

    Wade, Nicholas J

    2016-01-01

    Visual representations of biological states have traditionally faced two problems: they lacked motion and depth. Attempts were made to supply these wants over many centuries, but the major advances were made in the early-nineteenth century. Motion was synthesized by sequences of slightly different images presented in rapid succession and depth was added by presenting slightly different images to each eye. Apparent motion and depth were combined some years later, but they tended to be applied separately. The major figures in this early period were Wheatstone, Plateau, Horner, Duboscq, Claudet, and Purkinje. Others later in the century, like Marey and Muybridge, were stimulated to extend the uses to which apparent motion and photography could be applied to examining body movements. These developments occurred before the birth of cinematography, and significant insights were derived from attempts to combine motion and depth.

  19. Cervical motion testing: methodology and clinical implications.

    Science.gov (United States)

    Prushansky, Tamara; Dvir, Zeevi

    2008-09-01

    Measurement of cervical motion (CM) is probably the most commonly applied functional outcome measure in assessing the status of patients with cervical pathology. In general terms, CM refers to motion of the head relative to the trunk as well as conjunct motions within the cervical spine. Multiple techniques and instruments have been used for assessing CM. These were associated with a wide variety of parameters relating to accuracy, reproducibility, and validity. Modern measurement systems enable recording, processing, and documentation of CM with a high degree of precision. Cervical motion measures provide substantial information regarding the severity of motion limitation and level of effort in cervically involved patients. They may also be used for following up performance during and after conservative or invasive interventions.

  20. On the water lapping of felines and the water running of lizards: A unifying physical perspective

    OpenAIRE

    Aristoff, Jeffrey M; Stocker, Roman; Reis, Pedro M; Jung, Sunghwan

    2011-01-01

    We consider two biological phenomena taking place at the air-water interface: the water lapping of felines and the water running of lizards. Although seemingly disparate motions, we show that they are intimately linked by their underlying hydrodynamics and belong to a broader class of processes called Froude mechanisms. We describe how both felines and lizards exploit inertia to defeat gravity, and discuss water lapping and water running in the broader context of water exit and water entry, r...

  1. A programmable motion phantom for quality assurance of motion management in radiotherapy

    International Nuclear Information System (INIS)

    Dunn, L.; Franich, R.D.; Kron, T.; Taylor, M.L.; Johnston, P.N.; McDermott, L.N.; Callahan, J.

    2012-01-01

    A commercially available motion phantom (QUASAR, Modus Medical) was modified for programmable motion control with the aim of reproducing patient respiratory motion in one dimension in both the anterior–posterior and superior–inferior directions, as well as, providing controllable breath-hold and sinusoidal patterns for the testing of radiotherapy gating systems. In order to simulate realistic patient motion, the DC motor was replaced by a stepper motor. A separate 'chest-wall' motion platform was also designed to accommodate a variety of surrogate marker systems. The platform employs a second stepper motor that allows for the decoupling of the chest-wall and insert motion. The platform's accuracy was tested by replicating patient traces recorded with the Varian real-time position management (RPM) system and comparing the motion platform's recorded motion trace with the original patient data. Six lung cancer patient traces recorded with the RPM system were uploaded to the motion platform's in-house control software and subsequently replicated through the phantom motion platform. The phantom's motion profile was recorded with the RPM system and compared to the original patient data. Sinusoidal and breath-hold patterns were simulated with the motion platform and recorded with the RPM system to verify the systems potential for routine quality assurance of commercial radiotherapy gating systems. There was good correlation between replicated and actual patient data (P 0.003). Mean differences between the location of maxima in replicated and patient data-sets for six patients amounted to 0.034 cm with the corresponding minima mean equal to 0.010 cm. The upgraded motion phantom was found to replicate patient motion accurately as well as provide useful test patterns to aid in the quality assurance of motion management methods and technologies.

  2. Stability of fluid motions I

    CERN Document Server

    Joseph, Daniel D

    1976-01-01

    The study of stability aims at understanding the abrupt changes which are observed in fluid motions as the external parameters are varied. It is a demanding study, far from full grown"whose most interesting conclusions are recent. I have written a detailed account of those parts of the recent theory which I regard as established. Acknowledgements I started writing this book in 1967 at the invitation of Clifford Truesdell. It was to be a short work on the energy theory of stability and if I had stuck to that I would have finished the writing many years ago. The theory of stability has developed so rapidly since 1967 that the book I might then have written would now have a much too limited scope. I am grateful to Truesdell, not so much for the invitation to spend endless hours of writing and erasing, but for the generous way he has supported my efforts and encouraged me to higher standards of good work. I have tried to follow Truesdell's advice to write this work in a clear and uncomplicated style. This is not ...

  3. Collective motion of predictive swarms.

    Directory of Open Access Journals (Sweden)

    Nathaniel Rupprecht

    Full Text Available Theoretical models of populations and swarms typically start with the assumption that the motion of agents is governed by the local stimuli. However, an intelligent agent, with some understanding of the laws that govern its habitat, can anticipate the future, and make predictions to gather resources more efficiently. Here we study a specific model of this kind, where agents aim to maximize their consumption of a diffusing resource, by attempting to predict the future of a resource field and the actions of other agents. Once the agents make a prediction, they are attracted to move towards regions that have, and will have, denser resources. We find that the further the agents attempt to see into the future, the more their attempts at prediction fail, and the less resources they consume. We also study the case where predictive agents compete against non-predictive agents and find the predictors perform better than the non-predictors only when their relative numbers are very small. We conclude that predictivity pays off either when the predictors do not see too far into the future or the number of predictors is small.

  4. Strong seismic ground motion propagation

    International Nuclear Information System (INIS)

    Seale, S.; Archuleta, R.; Pecker, A.; Bouchon, M.; Mohammadioun, G.; Murphy, A.; Mohammadioun, B.

    1988-10-01

    At the McGee Creek, California, site, 3-component strong-motion accelerometers are located at depths of 166 m, 35 m and 0 m. The surface material is glacial moraine, to a depth of 30.5 m, overlying homfels. Accelerations were recorded from two California earthquakes: Round Valley, M L 5.8, November 23, 1984, 18:08 UTC and Chalfant Valley, M L 6.4, July 21, 1986, 14:42 UTC. By separating out the SH components of acceleration, we were able to determine the orientations of the downhole instruments. By separating out the SV component of acceleration, we were able to determine the approximate angle of incidence of the signal at 166 m. A constant phase velocity Haskell-Thomson model was applied to generate synthetic SH seismograms at the surface using the accelerations recorded at 166 m. In the frequency band 0.0 - 10.0 Hz, we compared the filtered synthetic records to the filtered surface data. The onset of the SH pulse is clearly seen, as are the reflections from the interface at 30.5 m. The synthetic record closely matches the data in amplitude and phase. The fit between the synthetic accelerogram and the data shows that the seismic amplification at the surface is a result of the contrast of the impedances (shear stiffnesses) of the near surface materials

  5. Relaxation processes in rotational motion

    International Nuclear Information System (INIS)

    Broglia, R.A.

    1986-01-01

    At few MeV above the yrast line the normally strong correlations among γ-ray energies in a rotational sequence become weaker. This observation can be interpreted as evidence for the damping of rotational motion in hot nuclei. It seems possible to relate the spreading width of the E2-rotational decay strength to the spread in frequency Δω 0 of rotational bands. The origin of these fluctuations is found in: (1) fluctuations in the occupation of special single-particle orbits which contribute a significant part of the total angular momentum; and (2) fluctuations in the moment of inertia induced by vibrations of the nuclear shape. Estimates of Δω 0 done making use of the hundred-odd known discrete rotational bands in the rare-earth region lead, for moderate spin and excitation energies (I ≅ 30 and U ≅ 3 to 4 MeV), to rotational spreading widths of the order of 60 to 160 keV in overall agreement with the data. 24 refs

  6. Self-motion effects on hydrodynamic pressure sensing: part I. Forward–backward motion

    International Nuclear Information System (INIS)

    Akanyeti, Otar; Chambers, Lily D; Brown, Jennifer; Megill, William M; Ježov, Jaas; Kruusmaa, Maarja; Venturelli, Roberto; Fiorini, Paolo

    2013-01-01

    In underwater locomotion, extracting meaningful information from local flows is as desirable as it is challenging, due to complex fluid-structure interaction. Sensing and motion are tightly interconnected; hydrodynamic signals generated by the external stimuli are modified by the self-generated flow signals. Given that very little is known about self-generated signals, we used onboard pressure sensors to measure the pressure profiles over the head of a fusiform-shape craft while moving forward and backward harmonically. From these measurements we obtained a second-order polynomial model which incorporates the velocity and acceleration of the craft to estimate the surface pressure within the swimming range up to one body length/second (L s −1 ). The analysis of the model reveals valuable insights into the temporal and spatial changes of the pressure intensity as a function of craft's velocity. At low swimming velocities ( −1 ) the pressure signals are more sensitive to the acceleration of the craft than its velocity. However, the inertial effects gradually become less important as the velocity increases. The sensors on the front part of the craft are more sensitive to its movements than the sensors on the sides. With respect to the hydrostatic pressure measured in still water, the pressure detected by the foremost sensor reaches values up to 300 Pa at 1 L s −1 swimming velocity, whereas the pressure difference between the foremost sensor and the next one is less than 50 Pa. Our results suggest that distributed pressure sensing can be used in a bimodal sensing strategy. The first mode detects external hydrodynamic events taking place around the craft, which requires minimal sensitivity to the self-motion of the craft. This can be accomplished by moving slowly with a constant velocity and by analyzing the pressure gradient as opposed to absolute pressure recordings. The second mode monitors the self-motion of the craft. It is shown here that distributed

  7. Correlation-based motion vector processing with adaptive interpolation scheme for motion-compensated frame interpolation.

    Science.gov (United States)

    Huang, Ai-Mei; Nguyen, Truong

    2009-04-01

    In this paper, we address the problems of unreliable motion vectors that cause visual artifacts but cannot be detected by high residual energy or bidirectional prediction difference in motion-compensated frame interpolation. A correlation-based motion vector processing method is proposed to detect and correct those unreliable motion vectors by explicitly considering motion vector correlation in the motion vector reliability classification, motion vector correction, and frame interpolation stages. Since our method gradually corrects unreliable motion vectors based on their reliability, we can effectively discover the areas where no motion is reliable to be used, such as occlusions and deformed structures. We also propose an adaptive frame interpolation scheme for the occlusion areas based on the analysis of their surrounding motion distribution. As a result, the interpolated frames using the proposed scheme have clearer structure edges and ghost artifacts are also greatly reduced. Experimental results show that our interpolated results have better visual quality than other methods. In addition, the proposed scheme is robust even for those video sequences that contain multiple and fast motions.

  8. Can walking motions improve visually induced rotational self-motion illusions in virtual reality?

    Science.gov (United States)

    Riecke, Bernhard E; Freiberg, Jacob B; Grechkin, Timofey Y

    2015-02-04

    Illusions of self-motion (vection) can provide compelling sensations of moving through virtual environments without the need for complex motion simulators or large tracked physical walking spaces. Here we explore the interaction between biomechanical cues (stepping along a rotating circular treadmill) and visual cues (viewing simulated self-rotation) for providing stationary users a compelling sensation of rotational self-motion (circular vection). When tested individually, biomechanical and visual cues were similarly effective in eliciting self-motion illusions. However, in combination they yielded significantly more intense self-motion illusions. These findings provide the first compelling evidence that walking motions can be used to significantly enhance visually induced rotational self-motion perception in virtual environments (and vice versa) without having to provide for physical self-motion or motion platforms. This is noteworthy, as linear treadmills have been found to actually impair visually induced translational self-motion perception (Ash, Palmisano, Apthorp, & Allison, 2013). Given the predominant focus on linear walking interfaces for virtual-reality locomotion, our findings suggest that investigating circular and curvilinear walking interfaces offers a promising direction for future research and development and can help to enhance self-motion illusions, presence and immersion in virtual-reality systems. © 2015 ARVO.

  9. Effects of auditory information on self-motion perception during simultaneous presentation of visual shearing motion

    Science.gov (United States)

    Tanahashi, Shigehito; Ashihara, Kaoru; Ujike, Hiroyasu

    2015-01-01

    Recent studies have found that self-motion perception induced by simultaneous presentation of visual and auditory motion is facilitated when the directions of visual and auditory motion stimuli are identical. They did not, however, examine possible contributions of auditory motion information for determining direction of self-motion perception. To examine this, a visual stimulus projected on a hemisphere screen and an auditory stimulus presented through headphones were presented separately or simultaneously, depending on experimental conditions. The participant continuously indicated the direction and strength of self-motion during the 130-s experimental trial. When the visual stimulus with a horizontal shearing rotation and the auditory stimulus with a horizontal one-directional rotation were presented simultaneously, the duration and strength of self-motion perceived in the opposite direction of the auditory rotation stimulus were significantly longer and stronger than those perceived in the same direction of the auditory rotation stimulus. However, the auditory stimulus alone could not sufficiently induce self-motion perception, and if it did, its direction was not consistent within each experimental trial. We concluded that auditory motion information can determine perceived direction of self-motion during simultaneous presentation of visual and auditory motion information, at least when visual stimuli moved in opposing directions (around the yaw-axis). We speculate that the contribution of auditory information depends on the plausibility and information balance of visual and auditory information. PMID:26113828

  10. A comparison of the different regulatory requirements of NPP in vertical ground motion

    International Nuclear Information System (INIS)

    Hou Chunlin; Pan Rong; Yang Yu; Wang Shuguo; Li Xiaojun

    2015-01-01

    Based on the importance of vertical motion in the nuclear power plants (NPPs) and equipment identification of seismic test, we summarize the existing laws and regulations cited by China's NPPs in the vertical seismic ground motion of the regulations. Then, according to the interpretation of various laws and regulations content, we may identified four vertical earthquake response spectrums. Finally, combined with the seismic safety requirements of China NPPs evaluation and the vertical seismic design of M310, EPR, AP1000 and CAP1400 pressurized water reactor, we explain that the vertical seismic ground motion selection should distinguish the effects between near field and far field earthquake, the existing regulations and specifications that China used are still required to further improve on the selection of vertical ground motion. The results of this study can provide reference for seismic design of China's nuclear power plant and nuclear safety review. (authors)

  11. Learning Motion Features for Example-Based Finger Motion Estimation for Virtual Characters

    Science.gov (United States)

    Mousas, Christos; Anagnostopoulos, Christos-Nikolaos

    2017-09-01

    This paper presents a methodology for estimating the motion of a character's fingers based on the use of motion features provided by a virtual character's hand. In the presented methodology, firstly, the motion data is segmented into discrete phases. Then, a number of motion features are computed for each motion segment of a character's hand. The motion features are pre-processed using restricted Boltzmann machines, and by using the different variations of semantically similar finger gestures in a support vector machine learning mechanism, the optimal weights for each feature assigned to a metric are computed. The advantages of the presented methodology in comparison to previous solutions are the following: First, we automate the computation of optimal weights that are assigned to each motion feature counted in our metric. Second, the presented methodology achieves an increase (about 17%) in correctly estimated finger gestures in comparison to a previous method.

  12. Mitigation of sliding motion of a cask-canister by fluid-structure interaction in an annular region - 59208

    International Nuclear Information System (INIS)

    Ito, Tomohiro; Fujiwara, Yoshihiro; Shintani, Atsuhiko; Nakagaw, Chihiro; Furuta, Kazuhisa

    2012-01-01

    The cask-canister system is a coaxial circular cylindrical structure in which several spent fuels are installed. This system is a free-standing structure thus, it is very important to reduce sliding motion for very large seismic excitations. In this study, we propose a mitigation method for sliding motion. Water is installed in an annular region between a cask and a canister. The equations of motion are derived taking fluid-structure interaction into consideration for nonlinear sliding motion analyses. Based on these equations, mitigation effects of sliding motions are studied analytically. Furthermore, a fundamental test model of a cask-canister system is fabricated and shaking table tests are conducted. From the analytical and test results, sliding motion mitigation effects are investigated. In this paper, the sliding motion of the cask-canister system subjected to a horizontal base excitation is studied and the effectiveness of water filled in the annular region between the cask and the canister is evaluated. This water brings inertia force coupling effect which is proportional to acceleration of the cask and the canister. Therefore, due to this fluid coupling, the cask and canister system couples through 3 types of forces, i.e., spring force, damping force and inertia force of the liquid. Equations of motion for the sliding motion are derived based on the fluid-structure coupling effects formulated by Fritz. Based on these equations of motion, nonlinear sliding motion of the cask-canister system is analyzed and the sliding suppression effects are investigated numerically. Furthermore, a fundamental test model of a cask-canister system is fabricated and the shaking table tests are conducted. From these analytical and test results, the sliding motion suppression effects due to fluid-structure coupling effects are investigated. As a result, it is confirmed that the inertia coupling effects due to water filled in the annular region are relatively large, and the

  13. On the wave induced responses for a high-speed hydrofoil catamaran. Part 2. Cabin connected to hull by spring and response to vibration; Suichuyokutsuki kosoku sodotei no harochu oto ni tsuite. 2. Dokuritsu kozogata cabin to yodo oto

    Energy Technology Data Exchange (ETDEWEB)

    Nobukawa, H; Kitamura, M; Kawamura, T [Hiroshima University, Hiroshima (Japan). Faculty of Engineering

    1996-04-10

    A high-speed hydrofoil catamaran under development has such a structure that an independent cabin is mounted on catamaran hulls, the cabin is connected with the hulls by using four soft springs, and hydrofoils are attached to the front and rear of the cabin. The structural design conception was as follows: the self-weight of the cabin is supported by lifting power of the hydrofoils while the boat is cruising; longitudinal motions of the catamaran hulls are absorbed by soft spring struts to make the motions more difficult to be transmitted into the cabin; and vibration excited by engines rotating at high speeds, attached to rear of the catamaran hulls, is not transmitted directly to the cabin structurally. A towing experiment was carried out by using divided models of about 1/10 scale in counter waves and regular waves to investigate their vibration response characteristics in waves. Furthermore, an experimental boat made of aluminum alloy with about 1/3 scale of the design boat was attached with composite structural struts made of springs and rubber parts to perform cruising experiments on an actual sea area. As a result, it was found that vibration excited by main engines in the catamaran hulls is transmitted very little to the cabin. 2 refs., 10 figs., 1 tab.

  14. Various anti-motion sickness drugs and core body temperature changes.

    Science.gov (United States)

    Cheung, Bob; Nakashima, Ann M; Hofer, Kevin D

    2011-04-01

    Blood flow changes and inactivity associated with motion sickness appear to exacerbate the rate of core temperature decrease during subsequent body cooling. We investigated the effects of various classes of anti-motion sickness drugs on core temperature changes. There were 12 healthy male and female subjects (20-35 yr old) who were given selected classes of anti-motion sickness drugs prior to vestibular Coriolis cross coupling induced by graded yaw rotation and periodic pitch-forward head movements in the sagittal plane. All subjects were then immersed in water at 18 degrees C for a maximum of 90 min or until their core temperature reached 35 degrees C. Double-blind randomized trials were administered, including a placebo, a non-immersion control with no drug, and six anti-motion sickness drugs: meclizine, dimenhydrinate, chlorpheniramine, promethazine + dexamphetamine, promethazine + caffeine, and scopolamine + dexamphetamine. A 7-d washout period was observed between trials. Core temperature and the severity of sickness were monitored throughout each trial. A repeated measures design was performed on the severity of sickness and core temperature changes prior to motion provocation, immediately after the motion sickness end point, and throughout the period of cold-water immersion. The most effective anti-motion sickness drugs, promethazine + dexamphetamine (with a sickness score/duration of 0.65 +/- 0.17) and scopolamine + dexamphetamine (with a sickness score/duration of 0.79 +/- 0.17), significantly attenuated the decrease in core temperature. The effect of this attenuation was lower in less effective drugs. Our results suggest that the two most effective anti-motion sickness drugs are also the most effective in attenuating the rate of core temperature decrease.

  15. Management of respiratory motion in radiation oncology

    International Nuclear Information System (INIS)

    Vedam, Subrahmanya Sastry

    2003-01-01

    Respiration affects the instantaneous position of almost all thoracic and abdominal structures (lung, breast, liver, pancreas, etc.), posing significant problems in the radiotherapy of tumors located at these sites. The diaphragm, for example, has been shown to move approximately 1.5 cm in the superior-inferior direction during normal breathing. During radiotherapy, margin expansion around the tumor, based on an estimate of the expected range of tumor motion, is commonly employed to ensure adequate dose coverage. Such a margin estimate may or may not encompass the 'current' extent of motion exhibited by the tumor, resulting in either a higher dose to the surrounding normal tissue or a cold spot in the tumor volume, leading to poor prognosis. Accounting for respiratory motion by active management during radiotherapy can, however, potentiate a reduction in the amount of high dose to normal tissue. Active management of respiratory motion forms the primary theme of this dissertation. Among the various techniques available to manage respiratory motion, our research focused on respiratory gated and respiration synchronized radiotherapy, with an external marker to monitor respiratory motion. Multiple session recordings of diaphragm and external marker motion revealed a consistent linear relationship, validating the use of external marker motion as a 'surrogate' for diaphragm motion. The predictability of diaphragm motion based on such external marker motion both within and between treatment sessions was also determined to be of the order of 0.1 cm. Gating during exhalation was found to be more reproducible than gating during inhalation. Although, a reduction in the 'gate' width achieved a modest reduction in the margins added around the tumor further reduction was limited by setup error. A motion phantom study of the potential gains from respiratory gating indicated margin reduction of 0.2-1.1 cm while employing gating. In addition, gating also improved the quality of

  16. 3D motion analysis via energy minimization

    Energy Technology Data Exchange (ETDEWEB)

    Wedel, Andreas

    2009-10-16

    This work deals with 3D motion analysis from stereo image sequences for driver assistance systems. It consists of two parts: the estimation of motion from the image data and the segmentation of moving objects in the input images. The content can be summarized with the technical term machine visual kinesthesia, the sensation or perception and cognition of motion. In the first three chapters, the importance of motion information is discussed for driver assistance systems, for machine vision in general, and for the estimation of ego motion. The next two chapters delineate on motion perception, analyzing the apparent movement of pixels in image sequences for both a monocular and binocular camera setup. Then, the obtained motion information is used to segment moving objects in the input video. Thus, one can clearly identify the thread from analyzing the input images to describing the input images by means of stationary and moving objects. Finally, I present possibilities for future applications based on the contents of this thesis. Previous work in each case is presented in the respective chapters. Although the overarching issue of motion estimation from image sequences is related to practice, there is nothing as practical as a good theory (Kurt Lewin). Several problems in computer vision are formulated as intricate energy minimization problems. In this thesis, motion analysis in image sequences is thoroughly investigated, showing that splitting an original complex problem into simplified sub-problems yields improved accuracy, increased robustness, and a clear and accessible approach to state-of-the-art motion estimation techniques. In Chapter 4, optical flow is considered. Optical flow is commonly estimated by minimizing the combined energy, consisting of a data term and a smoothness term. These two parts are decoupled, yielding a novel and iterative approach to optical flow. The derived Refinement Optical Flow framework is a clear and straight-forward approach to

  17. Applications of Phase-Based Motion Processing

    Science.gov (United States)

    Branch, Nicholas A.; Stewart, Eric C.

    2018-01-01

    Image pyramids provide useful information in determining structural response at low cost using commercially available cameras. The current effort applies previous work on the complex steerable pyramid to analyze and identify imperceptible linear motions in video. Instead of implicitly computing motion spectra through phase analysis of the complex steerable pyramid and magnifying the associated motions, instead present a visual technique and the necessary software to display the phase changes of high frequency signals within video. The present technique quickly identifies regions of largest motion within a video with a single phase visualization and without the artifacts of motion magnification, but requires use of the computationally intensive Fourier transform. While Riesz pyramids present an alternative to the computationally intensive complex steerable pyramid for motion magnification, the Riesz formulation contains significant noise, and motion magnification still presents large amounts of data that cannot be quickly assessed by the human eye. Thus, user-friendly software is presented for quickly identifying structural response through optical flow and phase visualization in both Python and MATLAB.

  18. Psychophysical evidence for auditory motion parallax.

    Science.gov (United States)

    Genzel, Daria; Schutte, Michael; Brimijoin, W Owen; MacNeilage, Paul R; Wiegrebe, Lutz

    2018-04-17

    Distance is important: From an ecological perspective, knowledge about the distance to either prey or predator is vital. However, the distance of an unknown sound source is particularly difficult to assess, especially in anechoic environments. In vision, changes in perspective resulting from observer motion produce a reliable, consistent, and unambiguous impression of depth known as motion parallax. Here we demonstrate with formal psychophysics that humans can exploit auditory motion parallax, i.e., the change in the dynamic binaural cues elicited by self-motion, to assess the relative depths of two sound sources. Our data show that sensitivity to relative depth is best when subjects move actively; performance deteriorates when subjects are moved by a motion platform or when the sound sources themselves move. This is true even though the dynamic binaural cues elicited by these three types of motion are identical. Our data demonstrate a perceptual strategy to segregate intermittent sound sources in depth and highlight the tight interaction between self-motion and binaural processing that allows assessment of the spatial layout of complex acoustic scenes.

  19. Programmable motion of DNA origami mechanisms.

    Science.gov (United States)

    Marras, Alexander E; Zhou, Lifeng; Su, Hai-Jun; Castro, Carlos E

    2015-01-20

    DNA origami enables the precise fabrication of nanoscale geometries. We demonstrate an approach to engineer complex and reversible motion of nanoscale DNA origami machine elements. We first design, fabricate, and characterize the mechanical behavior of flexible DNA origami rotational and linear joints that integrate stiff double-stranded DNA components and flexible single-stranded DNA components to constrain motion along a single degree of freedom and demonstrate the ability to tune the flexibility and range of motion. Multiple joints with simple 1D motion were then integrated into higher order mechanisms. One mechanism is a crank-slider that couples rotational and linear motion, and the other is a Bennett linkage that moves between a compacted bundle and an expanded frame configuration with a constrained 3D motion path. Finally, we demonstrate distributed actuation of the linkage using DNA input strands to achieve reversible conformational changes of the entire structure on ∼ minute timescales. Our results demonstrate programmable motion of 2D and 3D DNA origami mechanisms constructed following a macroscopic machine design approach.

  20. Programmable motion of DNA origami mechanisms

    Science.gov (United States)

    Marras, Alexander E.; Zhou, Lifeng; Su, Hai-Jun; Castro, Carlos E.

    2015-01-01

    DNA origami enables the precise fabrication of nanoscale geometries. We demonstrate an approach to engineer complex and reversible motion of nanoscale DNA origami machine elements. We first design, fabricate, and characterize the mechanical behavior of flexible DNA origami rotational and linear joints that integrate stiff double-stranded DNA components and flexible single-stranded DNA components to constrain motion along a single degree of freedom and demonstrate the ability to tune the flexibility and range of motion. Multiple joints with simple 1D motion were then integrated into higher order mechanisms. One mechanism is a crank–slider that couples rotational and linear motion, and the other is a Bennett linkage that moves between a compacted bundle and an expanded frame configuration with a constrained 3D motion path. Finally, we demonstrate distributed actuation of the linkage using DNA input strands to achieve reversible conformational changes of the entire structure on ∼minute timescales. Our results demonstrate programmable motion of 2D and 3D DNA origami mechanisms constructed following a macroscopic machine design approach. PMID:25561550

  1. Clinical significance of perceptible fetal motion.

    Science.gov (United States)

    Rayburn, W F

    1980-09-15

    The monitoring of fetal activity during the last trimester of pregnancy has been proposed to be useful in assessing fetal welfare. The maternal perception of fetal activity was tested among 82 patients using real-time ultrasonography. All perceived fetal movements were visualized on the scanner and involved motion of the lower limbs. Conversely, 82% of all visualized motions of fetal limbs were perceived by the patients. All combined motions of fetal trunk with limbs were preceived by the patients and described as strong movements, whereas clusters of isolated, weak motions of the fetal limbs were less accurately perceived (56% accuracy). The number of fetal movements perceived during the 15-minute test period was significantly (p fetal motion was present (44 of 45 cases) than when it was absent (five of 10 cases). These findings reveal that perceived fetal motion is: (1) reliable; (2) related to the strength of lower limb motion; (3) increased with ruptured amniotic membranes; and (4) reassuring if considered to be active.

  2. Individuality and togetherness in joint improvised motion.

    Directory of Open Access Journals (Sweden)

    Yuval Hart

    Full Text Available Actors, dancers and musicians that improvise together report special moments of togetherness: high performance and synchrony, seemingly without a leader and a follower. Togetherness seems to conflict with individuality- the idiosyncratic character of each person's performance. To understand the relation of individuality and togetherness, we employed the mirror game paradigm in which two players are asked to mirror each other and create interesting synchronized motion, with and without a designated leader. The mirror game enables quantitative characterization of moments of togetherness in which complex motion is generated with high synchrony. We find that each person as a leader does basic strokes of motion with a characteristic signature, in terms of the shape of their velocity profile between two stopping events. In moments of togetherness both players change their signature to a universal stroke shape. This universal velocity profile resembles a half-period of a sine wave, and is therefore symmetric and maximally smooth. Thus, instead of converging to an intermediate motion signature, or having one player dominate, players seem to shift their basic motion signatures to a shape that is altogether different from their individually preferred shapes; the resulting motion may be easier to predict and to agree on. The players then build complex motion by using such smooth elementary strokes.

  3. Analysis of motion in speed skating

    Science.gov (United States)

    Koga, Yuzo; Nishimura, Tetsu; Watanabe, Naoki; Okamoto, Kousuke; Wada, Yuhei

    1997-03-01

    A motion on sports has been studied by many researchers from the view of the medical, psychological and mechanical fields. Here, we try to analyze a speed skating motion dynamically for an aim of performing the best record. As an official competition of speed skating is performed on the round rink, the skating motion must be studied on the three phases, that is, starting phase, straight and curved course skating phase. It is indispensable to have a visual data of a skating motion in order to analyze kinematically. So we took a several subject's skating motion by 8 mm video cameras in order to obtain three dimensional data. As the first step, the movement of the center of gravity of skater (abbreviate to C. G.) is discussed in this paper, because a skating motion is very complicated. The movement of C. G. will give an information of the reaction force to a skate blade from the surface of ice. We discuss the discrepancy of several skating motion by studied subjects. Our final goal is to suggest the best skating form for getting the finest record.

  4. Improved motion description for action classification

    Directory of Open Access Journals (Sweden)

    Mihir eJain

    2016-01-01

    Full Text Available Even though the importance of explicitly integrating motion characteristics in video descriptions has been demonstrated by several recent papers on action classification, our current work concludes that adequately decomposing visual motion into dominant and residual motions, i.e.: camera and scene motion, significantly improves action recognition algorithms. This holds true both for the extraction of the space-time trajectories and for computation of descriptors.We designed a new motion descriptor – the DCS descriptor – that captures additional information on local motion patterns enhancing results based on differential motion scalar quantities, divergence, curl and shear features. Finally, applying the recent VLAD coding technique proposed in image retrieval provides a substantial improvement for action recognition. These findings are complementary to each other and they outperformed all previously reported results by a significant margin on three challenging datasets: Hollywood 2, HMDB51 and Olympic Sports as reported in (Jain et al. (2013. These results were further improved by (Oneata et al. (2013; Wang and Schmid (2013; Zhu et al. (2013 through the use of the Fisher vector encoding. We therefore also employ Fisher vector in this paper and we further enhance our approach by combining trajectories from both optical flow and compensated flow. We as well provide additional details of DCS descriptors, including visualization. For extending the evaluation, a novel dataset with 101 action classes, UCF101, was added.

  5. Individuality and togetherness in joint improvised motion.

    Science.gov (United States)

    Hart, Yuval; Noy, Lior; Feniger-Schaal, Rinat; Mayo, Avraham E; Alon, Uri

    2014-01-01

    Actors, dancers and musicians that improvise together report special moments of togetherness: high performance and synchrony, seemingly without a leader and a follower. Togetherness seems to conflict with individuality- the idiosyncratic character of each person's performance. To understand the relation of individuality and togetherness, we employed the mirror game paradigm in which two players are asked to mirror each other and create interesting synchronized motion, with and without a designated leader. The mirror game enables quantitative characterization of moments of togetherness in which complex motion is generated with high synchrony. We find that each person as a leader does basic strokes of motion with a characteristic signature, in terms of the shape of their velocity profile between two stopping events. In moments of togetherness both players change their signature to a universal stroke shape. This universal velocity profile resembles a half-period of a sine wave, and is therefore symmetric and maximally smooth. Thus, instead of converging to an intermediate motion signature, or having one player dominate, players seem to shift their basic motion signatures to a shape that is altogether different from their individually preferred shapes; the resulting motion may be easier to predict and to agree on. The players then build complex motion by using such smooth elementary strokes.

  6. Feasibility of Using Low-Cost Motion Capture for Automated Screening of Shoulder Motion Limitation after Breast Cancer Surgery.

    Directory of Open Access Journals (Sweden)

    Valeriya Gritsenko

    Full Text Available To determine if a low-cost, automated motion analysis system using Microsoft Kinect could accurately measure shoulder motion and detect motion impairments in women following breast cancer surgery.Descriptive study of motion measured via 2 methods.Academic cancer center oncology clinic.20 women (mean age = 60 yrs were assessed for active and passive shoulder motions during a routine post-operative clinic visit (mean = 18 days after surgery following mastectomy (n = 4 or lumpectomy (n = 16 for breast cancer.Participants performed 3 repetitions of active and passive shoulder motions on the side of the breast surgery. Arm motion was recorded using motion capture by Kinect for Windows sensor and on video. Goniometric values were determined from video recordings, while motion capture data were transformed to joint angles using 2 methods (body angle and projection angle.Correlation of motion capture with goniometry and detection of motion limitation.Active shoulder motion measured with low-cost motion capture agreed well with goniometry (r = 0.70-0.80, while passive shoulder motion measurements did not correlate well. Using motion capture, it was possible to reliably identify participants whose range of shoulder motion was reduced by 40% or more.Low-cost, automated motion analysis may be acceptable to screen for moderate to severe motion impairments in active shoulder motion. Automatic detection of motion limitation may allow quick screening to be performed in an oncologist's office and trigger timely referrals for rehabilitation.

  7. Feasibility of Using Low-Cost Motion Capture for Automated Screening of Shoulder Motion Limitation after Breast Cancer Surgery.

    Science.gov (United States)

    Gritsenko, Valeriya; Dailey, Eric; Kyle, Nicholas; Taylor, Matt; Whittacre, Sean; Swisher, Anne K

    2015-01-01

    To determine if a low-cost, automated motion analysis system using Microsoft Kinect could accurately measure shoulder motion and detect motion impairments in women following breast cancer surgery. Descriptive study of motion measured via 2 methods. Academic cancer center oncology clinic. 20 women (mean age = 60 yrs) were assessed for active and passive shoulder motions during a routine post-operative clinic visit (mean = 18 days after surgery) following mastectomy (n = 4) or lumpectomy (n = 16) for breast cancer. Participants performed 3 repetitions of active and passive shoulder motions on the side of the breast surgery. Arm motion was recorded using motion capture by Kinect for Windows sensor and on video. Goniometric values were determined from video recordings, while motion capture data were transformed to joint angles using 2 methods (body angle and projection angle). Correlation of motion capture with goniometry and detection of motion limitation. Active shoulder motion measured with low-cost motion capture agreed well with goniometry (r = 0.70-0.80), while passive shoulder motion measurements did not correlate well. Using motion capture, it was possible to reliably identify participants whose range of shoulder motion was reduced by 40% or more. Low-cost, automated motion analysis may be acceptable to screen for moderate to severe motion impairments in active shoulder motion. Automatic detection of motion limitation may allow quick screening to be performed in an oncologist's office and trigger timely referrals for rehabilitation.

  8. Geometrical theory of spin motion

    International Nuclear Information System (INIS)

    Halpern, L.

    1983-01-01

    A discussion of the fundamental interrelation of geometry and physical laws with Lie groups leads to a reformulation and heuristic modification of the principle of inertia and the principle of equivalence, which is based on the simple De Sitter group instead of the Poincare group. The resulting law of motion allows a unified formulation for structureless and spinning test particles. A metrical theory of gravitation is constructed with the modified principle, which is structured after the geometry of the manifold of the De Sitter group. The theory is equivalent to a particular Kaluza-Klein theory in ten dimensions with the Lorentz group as gauge group. A restricted version of this theory excludes torsion. It is shown by a reformulation of the energy momentum complex that this version is equivalent to general relativity with a cosmologic term quadratic in the curvature tensor and in which the existence of spinning particle fields is inherent from first principles. The equations of the general theory with torsion are presented and it is shown in a special case how the boundary conditions for the torsion degree of freedom have to be chosen such as to treat orbital and spin angular momenta on an equal footing. The possibility of verification of the resulting anomalous spin-spin interaction is mentioned and a model imposed by the group topology of SO(3, 2) is outlined in which the unexplained discrepancy between the magnitude of the discrete valued coupling constants and the gravitational constant in Kaluza-Klein theories is resolved by the identification of identical fermions as one orbit. The mathematical structure can be adapted to larger groups to include other degrees of freedom. 41 references

  9. Ambiguity in Tactile Apparent Motion Perception.

    Directory of Open Access Journals (Sweden)

    Emanuela Liaci

    Full Text Available In von Schiller's Stroboscopic Alternative Motion (SAM stimulus two visually presented diagonal dot pairs, located on the corners of an imaginary rectangle, alternate with each other and induce either horizontal, vertical or, rarely, rotational motion percepts. SAM motion perception can be described by a psychometric function of the dot aspect ratio ("AR", i.e. the relation between vertical and horizontal dot distances. Further, with equal horizontal and vertical dot distances (AR = 1 perception is biased towards vertical motion. In a series of five experiments, we presented tactile SAM versions and studied the role of AR and of different reference frames for the perception of tactile apparent motion.We presented tactile SAM stimuli and varied the ARs, while participants reported the perceived motion directions. Pairs of vibration stimulators were attached to the participants' forearms and stimulator distances were varied within and between forearms. We compared straight and rotated forearm conditions with each other in order to disentangle the roles of exogenous and endogenous reference frames.Increasing the tactile SAM's AR biased perception towards vertical motion, but the effect was weak compared to the visual modality. We found no horizontal disambiguation, even for very small tactile ARs. A forearm rotation by 90° kept the vertical bias, even though it was now coupled with small ARs. A 45° rotation condition with crossed forearms, however, evoked a strong horizontal motion bias.Existing approaches to explain the visual SAM bias fail to explain the current tactile results. Particularly puzzling is the strong horizontal bias in the crossed-forearm conditions. In the case of tactile apparent motion, there seem to be no fixed priority rule for perceptual disambiguation. Rather the weighting of available evidence seems to depend on the degree of stimulus ambiguity, the current situation and on the perceptual strategy of the individual

  10. Multi-frequency response of a cylinder subjected to vortex shedding and support motions

    Energy Technology Data Exchange (ETDEWEB)

    Vikestad, Kyrre

    1998-12-31

    This thesis deals with an experimental investigation of vortex induced vibrations of a circular cylinder. The purpose of the experiment was to identify the influence from a controlled disturbance of the cylinder motions on the response caused by vortex shedding. The cylinder investigated is 2 m long and the diameter is 10 cm. The cylinder is elastically mounted in an apparatus using springs, where the foundation of one of the springs can have a harmonic motion. The apparatus is placed on a carriage in a 25 m long towing tank. Towing velocities are varied between 0.140 m/s and 0.655 m/s corresponding to reduced velocity range from 2.8 to 13.2. The still water natural frequency is 0.497 Hz, and the natural frequency in air is 0.634 Hz. The cylinder is only able to oscillate in the cross-flow direction. The support motion frequency was varied between 0.26 Hz and 1.01 Hz, and the force motion amplitude was varied using 2, 4 and 6 cm support amplitudes. Three sets of experiments were carried out: (1) Still water oscillations due to harmonic support motion excitation, support amplitude and frequencies varied, (2) Towing tests with no support motion, the velocity is varied, (3) Combined excitation: Towing tests with support motion. All possible combinations of experiments (1) and (2) are carried out. The two first experiments provide reference values for the combined excitation experiments and for verification purposes. The results reveal the ability of the external disturbance to influence the vortex shedding process both regarding frequency and the resulting response amplitudes. Results for added mass, in-line drag and damping are also obtained. The work may be of use in deep water floating petroleum production. 81 refs., 73 figs., 6 tabs.

  11. Effect of fluid motion on colony formation in Microcystis aeruginosa

    Directory of Open Access Journals (Sweden)

    Lin Li

    2013-01-01

    Full Text Available Microcystis aeruginosa, generally occurring in large colonies under natural conditions, mainly exists as single cells in laboratory cultures. The mechanisms involved in colony formation in Microcystis aeruginosa and their roles in algal blooms remain unknown. In this study, based on previous research findings that fluid motion may stimulate the colony formation in green algae, culture experiments were conducted under axenic conditions in a circular water chamber where the flow rate, temperature, light, and nutrients were controlled. The number of cells of Microcystis aeruginosa, the number of cells per colony, and the colonial characteristics in various growth phases were observed and measured. The results indicated that the colony formation in Microcystis aeruginosa, which was not observed under stagnant conditions, was evident when there was fluid motion, with the number of cells per largest colony reaching 120 and the proportion of the number of cells in colonial form to the total number of cells and the mean number of cells per colony reaching their peak values at a flow rate of 35 cm/s. Based on the analysis of colony formation process, fluid motion stimulates the colony formation in Microcystis aeruginosa in the lag growth phase, while flushes and disaggregates the colonies in the exponential growth phase. The stimulation effect in the lag growth phase may be attributable to the involvement of fluid motion in a series of physiological processes, including the uptake of trace elements and the synthesis and secretion of polysaccharides. In addition, the experimental groups exhibiting typical colonial characteristics in the lag growth phase were found to have higher cell biomass in the later phase.

  12. Hydrological excitation of polar motion by different variables from the GLDAS models

    Science.gov (United States)

    Winska, Malgorzata; Nastula, Jolanta; Salstein, David

    2017-12-01

    Continental hydrological loading by land water, snow and ice is a process that is important for the full understanding of the excitation of polar motion. In this study, we compute different estimations of hydrological excitation functions of polar motion (as hydrological angular momentum, HAM) using various variables from the Global Land Data Assimilation System (GLDAS) models of the land-based hydrosphere. The main aim of this study is to show the influence of variables from different hydrological processes including evapotranspiration, runoff, snowmelt and soil moisture, on polar motion excitations at annual and short-term timescales. Hydrological excitation functions of polar motion are determined using selected variables of these GLDAS realizations. Furthermore, we use time-variable gravity field solutions from the Gravity Recovery and Climate Experiment (GRACE) to determine the hydrological mass effects on polar motion excitation. We first conduct an intercomparison of the maps of variations of regional hydrological excitation functions, timing and phase diagrams of different regional and global HAMs. Next, we estimate the hydrological signal in geodetically observed polar motion excitation as a residual by subtracting the contributions of atmospheric angular momentum and oceanic angular momentum. Finally, the hydrological excitations are compared with those hydrological signals determined from residuals of the observed polar motion excitation series. The results will help us understand the relative importance of polar motion excitation within the individual hydrological processes, based on hydrological modeling. This method will allow us to estimate how well the polar motion excitation budget in the seasonal and inter-annual spectral ranges can be closed.

  13. The eigenmode analysis of human motion

    International Nuclear Information System (INIS)

    Park, Juyong; Lee, Deok-Sun; González, Marta C

    2010-01-01

    Rapid advances in modern communication technology are enabling the accumulation of large-scale, high-resolution observational data of the spatiotemporal movements of humans. Classification and prediction of human mobility based on the analysis of such data has great potential in applications such as urban planning in addition to being a subject of theoretical interest. A robust theoretical framework is therefore required to study and properly understand human motion. Here we perform the eigenmode analysis of human motion data gathered from mobile communication records, which allows us to explore the scaling properties and characteristics of human motion

  14. Features of librational motions around L4

    International Nuclear Information System (INIS)

    Rajnai, Renata; Erdi, Balint; Nagy, Imre

    2010-01-01

    Trojan bodies are present in the Solar system in great number, as Trojan asteroids and also as Trojan moons. Thus it is possible that their presence is similar in extrasolar planetary systems too. We investigated features of librational motions around L 4 with numerical methods on the mass parameter - eccentricity plane in the elliptic restricted three-body problem. We determined the lifetime of Trojan bodies, until they remained in the librational domain around L 4 , also illustrated the distribution of the three possible endgames of trojan motion. Finally we determined the frequences and resonances of the librational motion in the stable region.

  15. Application of inertial sensors for motion analysis

    Directory of Open Access Journals (Sweden)

    Ferenc Soha

    2012-06-01

    Full Text Available This paper presents our results on the application of various inertial sensors for motion analysis. After the introduction of different sensor types (accelerometer, gyroscope, magnetic field sensor, we discuss the possible data collection and transfer techniques using embedded signal processing and wireless data communication methods [1,2]. Special consideration is given to the interpretation of accelerometer readings, which contains both the static and dynamic components, and is affected by the orientation and rotation of the sensor. We will demonstrate the possibility to decompose these components for quasiperiodic motions. Finally we will demonstrate the application of commercially available devices (Wii sensor, Kinect sensor, mobile phone for motion analysis applications.

  16. Understanding Motion Capture for Computer Animation

    CERN Document Server

    Menache, Alberto

    2010-01-01

    The power of today's motion capture technology has taken animated characters and special effects to amazing new levels of reality. And with the release of blockbusters like Avatar and Tin-Tin, audiences continually expect more from each new release. To live up to these expectations, film and game makers, particularly technical animators and directors, need to be at the forefront of motion capture technology. In this extensively updated edition of Understanding Motion Capture for Computer Animation and Video Games, an industry insider explains the latest research developments in digital design

  17. University Students Alternative Conceptions On Circular Motion

    Directory of Open Access Journals (Sweden)

    Ian Phil Canlas

    2015-08-01

    Full Text Available This study attempted to find out university students alternative conceptions on circular motion. An 18-item researcher-compiled and content-validated questionnaire was administered to twenty-six 26 students taking up a program in Bachelor in Secondary Education-Physical Science in their second year enrolled in a course on mechanics. Results revealed that majority of the students possess alternative conceptions on circular motion specifically along velocity acceleration and force. Moreover results showed the inconsistencies in the students understanding of circular motion concepts.

  18. Future of motion graphics and particle systems

    OpenAIRE

    Warambo, Bryan

    2012-01-01

    The purpose of this research is to study the use of particle systems in motion graphics, which is known to be the most popular graphics tool for multiple animated elements. It is known to be a procedural animation because as the emitter builds up more particles are formed to create a motion effect. At the same time exploring the future of motion graphics and Particle systems connection and the relevance it has in terms of longevity in being a major post-production element in digital media. Th...

  19. Adaptive vehicle motion estimation and prediction

    Science.gov (United States)

    Zhao, Liang; Thorpe, Chuck E.

    1999-01-01

    Accurate motion estimation and reliable maneuver prediction enable an automated car to react quickly and correctly to the rapid maneuvers of the other vehicles, and so allow safe and efficient navigation. In this paper, we present a car tracking system which provides motion estimation, maneuver prediction and detection of the tracked car. The three strategies employed - adaptive motion modeling, adaptive data sampling, and adaptive model switching probabilities - result in an adaptive interacting multiple model algorithm (AIMM). The experimental results on simulated and real data demonstrate that our tracking system is reliable, flexible, and robust. The adaptive tracking makes the system intelligent and useful in various autonomous driving tasks.

  20. Stock price prediction using geometric Brownian motion

    Science.gov (United States)

    Farida Agustini, W.; Restu Affianti, Ika; Putri, Endah RM

    2018-03-01

    Geometric Brownian motion is a mathematical model for predicting the future price of stock. The phase that done before stock price prediction is determine stock expected price formulation and determine the confidence level of 95%. On stock price prediction using geometric Brownian Motion model, the algorithm starts from calculating the value of return, followed by estimating value of volatility and drift, obtain the stock price forecast, calculating the forecast MAPE, calculating the stock expected price and calculating the confidence level of 95%. Based on the research, the output analysis shows that geometric Brownian motion model is the prediction technique with high rate of accuracy. It is proven with forecast MAPE value ≤ 20%.

  1. Lossless Compression of Video using Motion Compensation

    DEFF Research Database (Denmark)

    Martins, Bo; Forchhammer, Søren

    1998-01-01

    We investigate lossless coding of video using predictive coding andmotion compensation. The methods incorporate state-of-the-art lossless techniques such ascontext based prediction and bias cancellation, Golomb coding, high resolution motion field estimation,3d-dimensional predictors, prediction...... using one or multiple previous images, predictor dependent error modelling, and selection of motion field by code length. For slow pan or slow zoom sequences, coding methods that use multiple previous images are up to 20% better than motion compensation using a single previous image and up to 40% better...

  2. Interactive inverse kinematics for human motion estimation

    DEFF Research Database (Denmark)

    Engell-Nørregård, Morten Pol; Hauberg, Søren; Lapuyade, Jerome

    2009-01-01

    We present an application of a fast interactive inverse kinematics method as a dimensionality reduction for monocular human motion estimation. The inverse kinematics solver deals efficiently and robustly with box constraints and does not suffer from shaking artifacts. The presented motion...... to significantly speed up the particle filtering. It should be stressed that the observation part of the system has not been our focus, and as such is described only from a sense of completeness. With our approach it is possible to construct a robust and computationally efficient system for human motion estimation....

  3. Qué es Motion Graphics

    OpenAIRE

    Alonso Valdivieso, Concepción

    2016-01-01

    [EN] What exactly are ‘Motion Graphics’? Many people still aren’t entirely sure. Taken literally they are just graphics in motion, but they also mean much more than that. Motion graphics use incredibly expressive techniques and as a result are often found in advertising, corporate videos, credit sequences, etc. They can translate a complex idea into a clear message with just a few seconds of animation.At the same time they have a very particular, simple and stylish aesthetic. But, if any anim...

  4. Early Improper Motion Detection in Golf Swings Using Wearable Motion Sensors: The First Approach

    Science.gov (United States)

    Stančin, Sara; Tomažič, Sašo

    2013-01-01

    This paper presents an analysis of a golf swing to detect improper motion in the early phase of the swing. Led by the desire to achieve a consistent shot outcome, a particular golfer would (in multiple trials) prefer to perform completely identical golf swings. In reality, some deviations from the desired motion are always present due to the comprehensive nature of the swing motion. Swing motion deviations that are not detrimental to performance are acceptable. This analysis is conducted using a golfer's leading arm kinematic data, which are obtained from a golfer wearing a motion sensor that is comprised of gyroscopes and accelerometers. Applying the principal component analysis (PCA) to the reference observations of properly performed swings, the PCA components of acceptable swing motion deviations are established. Using these components, the motion deviations in the observations of other swings are examined. Any unacceptable deviations that are detected indicate an improper swing motion. Arbitrarily long observations of an individual player's swing sequences can be included in the analysis. The results obtained for the considered example show an improper swing motion in early phase of the swing, i.e., the first part of the backswing. An early detection method for improper swing motions that is conducted on an individual basis provides assistance for performance improvement. PMID:23752563

  5. 37 CFR 41.121 - Motions.

    Science.gov (United States)

    2010-07-01

    ...) Types of motions—(1) Substantive motions. Consistent with the notice of requested relief, if any, and to.... Claim charts are not a substitute for appropriate argument and explanation in the paper. (f) The Board...

  6. Particle motion in the ELF wiggler

    International Nuclear Information System (INIS)

    Wurtele, J.S.; Sessler, A.M.

    1982-06-01

    Particle motion in the ELF wiggler was investigated numerically and analytically. A transport system was designed using continuous quadrupole focusing in the wiggle plane and natural wiggle focusing in the non-wiggle plane

  7. 19 CFR 207.107 - Motions.

    Science.gov (United States)

    2010-04-01

    ... INJURY TO DOMESTIC INDUSTRIES RESULTS FROM IMPORTS SOLD AT LESS THAN FAIR VALUE OR FROM SUBSIDIZED... and Committee Proceedings § 207.107 Motions. (a) Presentation and disposition. (1) After issuance of...

  8. Jerk derivative feedforward control for motion systems

    NARCIS (Netherlands)

    Boerlage, M.L.G.; Tousain, R.L.; Steinbuch, M.

    2004-01-01

    This work discusses reference trajectory relevant model based feedforward design. For motion systems which contain at least one rigid body mode and which are subject to reference trajectories with mostly low frequency energy, the proposed feedforward controller improves tracking performance

  9. Modeling and synthesis of strong ground motion

    Indian Academy of Sciences (India)

    There have been many developments in modeling techniques, and ... damage life and property in a city or region. How- ... quake of 26 January 2001 as a case study. 2. ...... quake derived from a dense strong-motion network; Bull. Seismol.

  10. MagneMotion urban maglev : final report

    Science.gov (United States)

    2004-11-01

    The MagneMotion Urban Maglev System, called M3, is designed as an alternative to all conventional guided transportation systems. Advantages include major reductions in travel time, operating cost, capital cost, noise, and energy consumption. Small ve...

  11. VERY SLOW SPEED AXIAL MOTION RELUCTANCE MOTOR

    African Journals Online (AJOL)

    Dr Obe

    1984-09-01

    Sep 1, 1984 ... VERY SLOW SPEED AXIAL MOTION RELUCTANCE MOTOR by. L. A. Agu ... order as that of the screw-thread motor can be obtained. LIST OF .... The n stator have equal non- magnetic spacers .... induction motor. An.

  12. Canonoid transformations and constants of motion

    International Nuclear Information System (INIS)

    Negri, L.J.; Oliveira, L.C.; Teixeira, J.M.

    1986-01-01

    The necessary and sufficient conditions for a canonoid transformation with respect to a given Hamiltonian are obtained in terms of the Lagrange brackets of the trasformation. The relation of these conditions with the constants of motion is discussed. (Author) [pt

  13. Time-delay equation governing electron motion

    International Nuclear Information System (INIS)

    Cohn, J.

    1976-01-01

    A previously proposed differential-difference equation governing the motion of the classical radiating electron is considered further. A set of three assumptions is offered, under which the proposed equation yields asymptotically stable acceleration

  14. Relighting Character Motion for Photoreal Simulations

    National Research Council Canada - National Science Library

    Lamond, Bruce; Chabert, Charles-Felix; Einarsson, Per; Jones, Andrew; Ma, Wan-Chun; Hawkins, Tim; Bolas, Mark; Sylwan, Sebastian; Debevec, Paul

    2006-01-01

    .... The known rotation of the treadmill, repeatability of the actor's motion, timing of the lighting pattern and capture rate of the cameras are all carefully synchronized so that the actor is imaged in (approximately...

  15. Generating Concise Rules for Human Motion Retrieval

    Science.gov (United States)

    Mukai, Tomohiko; Wakisaka, Ken-Ichi; Kuriyama, Shigeru

    This paper proposes a method for retrieving human motion data with concise retrieval rules based on the spatio-temporal features of motion appearance. Our method first converts motion clip into a form of clausal language that represents geometrical relations between body parts and their temporal relationship. A retrieval rule is then learned from the set of manually classified examples using inductive logic programming (ILP). ILP automatically discovers the essential rule in the same clausal form with a user-defined hypothesis-testing procedure. All motions are indexed using this clausal language, and the desired clips are retrieved by subsequence matching using the rule. Such rule-based retrieval offers reasonable performance and the rule can be intuitively edited in the same language form. Consequently, our method enables efficient and flexible search from a large dataset with simple query language.

  16. Parametric modelling of nonstationary platform deck motions

    Digital Repository Service at National Institute of Oceanography (India)

    Mandal, S.

    with fast Fourier transform spectra and show good agreement. However, the higher order maximum entropy model can be used for better representation of nonstationary motions. This method also reduces long time series of nonstationary offshore data into a few...

  17. Brownian motion in a flowing fluid revisited

    International Nuclear Information System (INIS)

    Ramshaw, J.D.

    1981-01-01

    It is shown how the phenomenon of osmosis may be treated using the phenomenological theory of Brownian motion in a flowing fluid. The theory is also generalized to include viscous stresses in the particle and mixture momentum equations

  18. General Automatic Components of Motion Sickness

    Science.gov (United States)

    Suter, S.; Toscano, W. B.; Kamiya, J.; Naifeh, K.

    1985-01-01

    A body of investigations performed in support of experiments aboard the space shuttle, and designed to counteract the symptoms of Space Adaptation Syndrome, which resemble those of motion sickness on Earth is reviewed. For these supporting studies, the automatic manifestations of earth-based motion sickness was examined. Heart rate, respiration rate, finger pulse volume and basal skin resistance were measured on 127 men and women before, during and after exposure to nauseogenic rotating chair tests. Significant changes in all autonomic responses were observed across the tests. Significant differences in autonomic responses among groups divided according to motion sickness susceptibility were also observed. Results suggest that the examination of autonomic responses as an objective indicator of motion sickness malaise is warranted and may contribute to the overall understanding of the syndrome on Earth and in Space.

  19. MOTION MODELLINGUSINGCONCEPTS OF FUZZY ARTIFICIAL POTENTIAL FIELDS

    Directory of Open Access Journals (Sweden)

    O. Motlagh

    2010-12-01

    Full Text Available Artificial potential fields (APF are well established for reactive navigation of mobile robots. This paper describes a fast and robust fuzzy-APF on an ActivMedia AmigoBot. Obstacle-related information is fuzzified by using sensory fusion, which results in a shorter runtime. In addition, the membership functions of obstacle direction and range have been merged into one function, obtaining a smaller block of rules. The system is tested in virtual environments with non-concave obstacles. Then, the paper describes a new approach to motion modelling where the motion of intelligent travellers is modelled by consecutive path segments. In previous work, the authors described a reliable motion modelling technique using causal inference of fuzzy cognitive maps (FCM which has been efficiently modified for the purpose of this contribution. Results and analysis are given to demonstrate the efficiency and accuracy of the proposed motion modelling algorithm.

  20. Motion sickness, stress and the endocannabinoid system.

    Directory of Open Access Journals (Sweden)

    Alexander Choukèr

    Full Text Available BACKGROUND: A substantial number of individuals are at risk for the development of motion sickness induced nausea and vomiting (N&V during road, air or sea travel. Motion sickness can be extremely stressful but the neurobiologic mechanisms leading to motion sickness are not clear. The endocannabinoid system (ECS represents an important neuromodulator of stress and N&V. Inhibitory effects of the ECS on N&V are mediated by endocannabinoid-receptor activation. METHODOLOGY/PRINCIPAL FINDINGS: We studied the activity of the ECS in human volunteers (n = 21 during parabolic flight maneuvers (PFs. During PFs, microgravity conditions (<10(-2 g are generated for approximately 22 s which results in a profound kinetic stimulus. Blood endocannabinoids (anandamide and 2-arachidonoylglycerol, 2-AG were measured from blood samples taken in-flight before start of the parabolic maneuvers, after 10, 20, and 30 parabolas, in-flight after termination of PFs and 24 h later. Volunteers who developed acute motion sickness (n = 7 showed significantly higher stress scores but lower endocannabinoid levels during PFs. After 20 parabolas, blood anandamide levels had dropped significantly in volunteers with motion sickness (from 0.39+/-0.40 to 0.22+/-0.25 ng/ml but increased in participants without the condition (from 0.43+/-0.23 to 0.60+/-0.38 ng/ml resulting in significantly higher anandamide levels in participants without motion sickness (p = 0.02. 2-AG levels in individuals with motion sickness were low and almost unchanged throughout the experiment but showed a robust increase in participants without motion sickness. Cannabinoid-receptor 1 (CB1 but not cannabinoid-receptor 2 (CB2 mRNA expression in leucocytes 4 h after the experiment was significantly lower in volunteers with motion sickness than in participants without N&V. CONCLUSIONS/SIGNIFICANCE: These findings demonstrate that stress and motion sickness in humans are associated with impaired endocannabinoid