WorldWideScience

Sample records for watson-crick nucleoside-base pairs

  1. Tunnel conductance of Watson-Crick nucleoside-base pairs from telegraph noise

    International Nuclear Information System (INIS)

    Chang Shuai; He Jin; Lin Lisha; Zhang Peiming; Liang Feng; Huang Shuo; Lindsay, Stuart; Young, Michael

    2009-01-01

    The use of tunneling signals to sequence DNA is presently hampered by the small tunnel conductance of a junction spanning an entire DNA molecule. The design of a readout system that uses a shorter tunneling path requires knowledge of the absolute conductance across base pairs. We have exploited the stochastic switching of hydrogen-bonded DNA base-nucleoside pairs trapped in a tunnel junction to determine the conductance of individual molecular pairs. This conductance is found to be sensitive to the geometry of the junction, but a subset of the data appears to come from unstrained molecular pairs. The conductances determined from these pairs are within a factor of two of the predictions of density functional calculations. The experimental data reproduces the counterintuitive theoretical prediction that guanine-deoxycytidine pairs (3 H-bonds) have a smaller conductance than adenine-thymine pairs (2 H-bonds). A bimodal distribution of switching lifetimes shows that both H-bonds and molecule-metal contacts break.

  2. [Under what conditions does G.C Watson-Crick DNA base pair acquire all four configurations characteristic for A.T Watson-Crick DNA base pair?].

    Science.gov (United States)

    Brovarets', O O

    2013-01-01

    At the MP2/6-311++G(2df,pd)//B3LYP/6-311++G(d,p) level of theory it was established for the first time, that the Löwdin's G*.C* DNA base pair formed by the mutagenic tautomers can acquire, as the A-T Watson-Crick DNA base pair, four biologically important configurations, namely: Watson-Crick, reverse Watson-Crick, Hoogsteen and reverse Hoogsteen. This fact demonstrates rather unexpected role of the tautomerisation of the one of the Watson-Crick DNA base pairs, in particular, via double proton transfer: exactly the G.C-->G*.C* tautomerisation allows to overcome steric hindrances for the implementation of the above mentioned configurations. Geometric, electron-topological and energetic properties of the H-bonds that stabilise the studied pairs, as well as the energetic characteristics of the latters are presented.

  3. Predicting the Mechanism and Kinetics of the Watson-Crick to Hoogsteen Base Pairing Transition

    NARCIS (Netherlands)

    Vreede, J.; Bolhuis, P.G.; Swenson, D.W.H.

    2016-01-01

    DNA duplexes predominantly contain Watson-Crick (WC) base pairs. Yet, a non-negligible number of base pairs converts to the Hoogsteen (HG) hydrogen bonding pattern, involving a 180° rotation of the purine base relative to Watson-Crick. These WC to HG conversions alter the conformation of DNA, and

  4. Non-Watson Crick base pairs might stabilize RNA structural motifs in ...

    Indian Academy of Sciences (India)

    Watson Crick base pairs, internal loops and pseudoknots have been the highlighting feature of recent structural determination of RNAs. The recent crystal structure of group-I introns has demonstrated that these might constitute RNA structural ...

  5. Conformational analysis of a covalently cross-linked Watson-Crick base pair model.

    Science.gov (United States)

    Jensen, Erik A; Allen, Benjamin D; Kishi, Yoshito; O'Leary, Daniel J

    2008-11-15

    Low-temperature NMR experiments and molecular modeling have been used to characterize the conformational behavior of a covalently cross-linked DNA base pair model. The data suggest that Watson-Crick or reverse Watson-Crick hydrogen bonding geometries have similar energies and can interconvert at low temperatures. This low-temperature process involves rotation about the crosslink CH(2)C(5') (psi) carbon-carbon bond, which is energetically preferred over the alternate CH(2)N(3) (phi) carbon-nitrogen bond rotation.

  6. Conformational Analysis of a Covalently Cross-Linked Watson-Crick Base Pair Model

    OpenAIRE

    Jensen, Erik A.; Allen, Benjamin D.; Kishi, Yoshito; O'Leary, Daniel J.

    2008-01-01

    Low temperature NMR experiments and molecular modeling have been used to characterize the conformational behavior of a covalently cross-linked DNA base pair model. The data suggest that Watson-Crick or reverse Watson-Crick hydrogen bonding geometries have similar energies and can interconvert at low temperatures. This low-temperature process involves rotation about the crosslink CH2–C(5′) (ψ) carbon-carbon bond, which is energetically preferred over the alternate CH2–N(3) (ϕ) carbon-nitrogen ...

  7. AVE bond index in the H-bond of the Watson-Crick pairs

    International Nuclear Information System (INIS)

    Giambiagi, M.; Giambiagi, M.S. de; Barroso Filho, W.

    1981-01-01

    The normal Watson-Crick base pairs are treated as super-molecules. The properties of the electronic distribution along the N-H...Y bonds are studied in an all-valence-electrons calculation, through a bond index formula devised for non-orthogonal basis. Eletronic density diagrams of the adenine-uracil base pair are analysed. (Auhor) [pt

  8. Watson-Crick base pairs with thiocarbonyl groups: How sulfur changes the hydrogen bonds in DNA

    NARCIS (Netherlands)

    Fonseca Guerra, C.; Baerends, E.J.; Bickelhaupt, F.M.

    2008-01-01

    We have theoretically analyzed mimics of Watson-Crick AT and GC base pairs in which N-H•••O hydrogen bonds are replaced by N-H•••S, using the generalized gradient approximation (GGA) of density functional theory at BP86/TZ2P level. The general effect of the above substitutions is an elongation and a

  9. Substituent effif ects on hydrogen bonding in Watson-Crick base pairs. A theoretical study

    NARCIS (Netherlands)

    Fonseca Guerra, C.; van der Wijst, T.; Bickelhaupt, F.M.

    2005-01-01

    We have theoretically analyzed Watson-Crick AT and GC base pairs in which purine C8 and/or pyrimidine C6 positions carry a substituent X = H, F, Cl or Br, using the generalized gradient approximation (GGA) of density functional theory at BP86/TZ2P. The purpose is to study the effects on structure

  10. Comparable stability of Hoogsteen and Watson-Crick base pairs in ionic liquid choline dihydrogen phosphate.

    Science.gov (United States)

    Tateishi-Karimata, Hisae; Nakano, Miki; Sugimoto, Naoki

    2014-01-08

    The instability of Hoogsteen base pairs relative to Watson-Crick base pairs has limited biological applications of triplex-forming oligonucleotides. Hydrated ionic liquids (ILs) provide favourable environments for a wide range of chemical reactions and are known to impact the stabilities of Watson-Crick base pairs. We found that DNA triplex formation was significantly stabilized in hydrated choline dihydrogen phosphate as compared with an aqueous buffer at neutral pH. Interestingly, the stability of Hoogsteen base pairs was found to be comparable with that of Watson-Crick base pairs in the hydrated IL. Molecular dynamics simulations of a DNA triplex in the presence of choline ions revealed that the DNA triplex was stabilized because of the binding of choline ion around the third strand in the grooves. Our finding will facilitate the development of new DNA materials. Our data also indicate that triplex formation may be stabilized inside cells where choline ions and their derivatives are abundant in vivo.

  11. Watson-Crick base pairing controls excited-state decay in natural DNA.

    Science.gov (United States)

    Bucher, Dominik B; Schlueter, Alexander; Carell, Thomas; Zinth, Wolfgang

    2014-10-13

    Excited-state dynamics are essential to understanding the formation of DNA lesions induced by UV light. By using femtosecond IR spectroscopy, it was possible to determine the lifetimes of the excited states of all four bases in the double-stranded environment of natural DNA. After UV excitation of the DNA duplex, we detected a concerted decay of base pairs connected by Watson-Crick hydrogen bonds. A comparison of single- and double-stranded DNA showed that the reactive charge-transfer states formed in the single strands are suppressed by base pairing in the duplex. The strong influence of the Watson-Crick hydrogen bonds indicates that proton transfer opens an efficient decay path in the duplex that prohibits the formation or reduces the lifetime of reactive charge-transfer states. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  12. Complexes of DNA bases and Watson-Crick base pairs with small neutral gold clusters.

    Science.gov (United States)

    Kryachko, E S; Remacle, F

    2005-12-08

    The nature of the DNA-gold interaction determines and differentiates the affinity of the nucleobases (adenine, thymine, guanine, and cytosine) to gold. Our preliminary computational study [Kryachko, E. S.; Remacle, F. Nano Lett. 2005, 5, 735] demonstrates that two major bonding factors govern this interaction: the anchoring, either of the Au-N or Au-O type, and the nonconventional N-H...Au hydrogen bonding. In this paper, we offer insight into the nature of nucleobase-gold interactions and provide a detailed characterization of their different facets, i.e., geometrical, energetic, and spectroscopic aspects; the gold cluster size and gold coordination effects; proton affinity; and deprotonation energy. We then investigate how the Watson-Crick DNA pairing patterns are modulated by the nucleobase-gold interaction. We do so in terms of the proton affinities and deprotonation energies of those proton acceptors and proton donors which are involved in the interbase hydrogen bondings. A variety of properties of the most stable Watson-Crick [A x T]-Au3 and [G x C]-Au3 hybridized complexes are described and compared with the isolated Watson-Crick A x T and G x C ones. It is shown that enlarging the gold cluster size to Au6 results in a rather short gold-gold bond in the Watson-Crick interbase region of the [G x C]-Au6 complex that bridges the G x C pair and thus leads to a significant strengthening of G x C pairing.

  13. The extension of a DNA double helix by an additional Watson-Crick base pair on the same backbone

    DEFF Research Database (Denmark)

    Kumar, P.; Sharma, P. K.; Madsen, Charlotte S.

    2013-01-01

    Additional base pair: The DNA duplex can be extended with an additional Watson-Crick base pair on the same backbone by the use of double-headed nucleotides. These also work as compressed dinucleotides and form two base pairs with cognate nucleobases on the opposite strand.......Additional base pair: The DNA duplex can be extended with an additional Watson-Crick base pair on the same backbone by the use of double-headed nucleotides. These also work as compressed dinucleotides and form two base pairs with cognate nucleobases on the opposite strand....

  14. Enol tautomers of Watson-Crick base pair models are metastable because of nuclear quantum effects.

    Science.gov (United States)

    Pérez, Alejandro; Tuckerman, Mark E; Hjalmarson, Harold P; von Lilienfeld, O Anatole

    2010-08-25

    Intermolecular enol tautomers of Watson-Crick base pairs could emerge spontaneously via interbase double proton transfer. It has been hypothesized that their formation could be facilitated by thermal fluctuations and proton tunneling, and possibly be relevant to DNA damage. Theoretical and computational studies, assuming classical nuclei, have confirmed the dynamic stability of these rare tautomers. However, by accounting for nuclear quantum effects explicitly through Car-Parrinello path integral molecular dynamics calculations, we find the tautomeric enol form to be dynamically metastable, with lifetimes too insignificant to be implicated in DNA damage.

  15. Charge transport properties of DNA aperiodic molecule: The role of interbase hopping in Watson-Crick base pair

    Science.gov (United States)

    Sinurat, E. N.; Yudiarsah, E.

    2017-07-01

    The charge transport properties of DNA aperiodic molecule has been studied by considering various interbase hopping parameter on Watson-Crick base pair. 32 base pairs long double-stranded DNA aperiodic model with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. Transfer matrix method has been used to calculate transmission probabilities, for determining I-V characteristic using Landauer Büttiker formula. DNA molecule is modeled using tight binding hamiltonian combined with the theory of Slater-Koster. The result show, the increment of Watson-Crick hopping value leads to the transmission probabilities and current of DNA aperiodic molecule increases.

  16. Thermodynamic stability of Hoogsteen and Watson-Crick base pairs in the presence of histone H3-mimicking peptide.

    Science.gov (United States)

    Pramanik, Smritimoy; Nakamura, Kaori; Usui, Kenji; Nakano, Shu-ichi; Saxena, Sarika; Matsui, Jun; Miyoshi, Daisuke; Sugimoto, Naoki

    2011-03-14

    We found that Hoogsteen base pairs were stabilized by molecular crowding and a histone H3-mimicking peptide, which was not observed for Watson-Crick base pairs. Our findings demonstrate that the type of DNA base pair is critical for the interaction between DNA and histones.

  17. The extension of a DNA double helix by an additional Watson-Crick base pair on the same backbone.

    Science.gov (United States)

    Kumar, Pawan; Sharma, Pawan K; Madsen, Charlotte S; Petersen, Michael; Nielsen, Poul

    2013-06-17

    Additional base pair: The DNA duplex can be extended with an additional Watson-Crick base pair on the same backbone by the use of double-headed nucleotides. These also work as compressed dinucleotides and form two base pairs with cognate nucleobases on the opposite strand. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  18. Hydration of Watson-Crick base pairs and dehydration of Hoogsteen base pairs inducing structural polymorphism under molecular crowding conditions.

    Science.gov (United States)

    Miyoshi, Daisuke; Nakamura, Kaori; Tateishi-Karimata, Hisae; Ohmichi, Tatsuo; Sugimoto, Naoki

    2009-03-18

    It has been revealed recently that molecular crowding, which is one of the largest differences between in vivo and in vitro conditions, is a critical factor determining the structure, stability, and function of nucleic acids. However, the effects of molecular crowding on Watson-Crick and Hoogsteen base pairs remain unclear. In order to investigate directly and quantitatively the molecular crowding effects on base pair types in nucleic acids, we designed intramolecular parallel- and antiparallel-stranded DNA duplexes consisting of Hoogsteen and Watson-Crick base pairs, respectively, as well as an intramolecular parallel-stranded triplex containing both types of base pairs. Thermodynamic analyses demonstrated that the values of free energy change at 25 degrees C for Hoogsteen base-pair formations decreased from +1.45 +/- 0.15 to +1.09 +/- 0.13 kcal mol(-1), and from -1.89 +/- 0.13 to -2.71 +/- 0.11 kcal mol(-1) in the intramolecular duplex and triplex, respectively, when the concentration of PEG 200 (polyethylene glycol with average molecular weight 200) increased from 0 to 20 wt %. However, corresponding values for Watson-Crick formation in the duplex and triplex increased from -10.2 +/- 0.2 to -8.7 +/- 0.1 kcal mol(-1), and from -10.8 +/- 0.2 to -9.2 +/- 0.2 kcal mol(-1), respectively. Furthermore, it was revealed that the opposing effects of molecular crowding on the Hoogsteen and Watson-Crick base pairs were due to different behaviors of water molecules binding to the DNA strands.

  19. Photoinduced electron transfer in a Watson-Crick base-paired, 2-aminopurine:uracil-C60 hydrogen bonding conjugate.

    Science.gov (United States)

    D'Souza, Francis; Gadde, Suresh; Islam, D-M Shafiqul; Pang, Siew-Cheng; Schumacher, Amy Lea; Zandler, Melvin E; Horie, Rumiko; Araki, Yasuyaki; Ito, Osamu

    2007-02-07

    A fluorescent reporter molecule, 2-aminopurine was self-assembled via Watson-Crick base-pairing to a uracil appended fullerene to form a donor-acceptor conjugate; efficient photoinduced charge separation was confirmed by time-resolved emission and transient absorption spectral studies.

  20. Watson-Crick Base Pair Radical Cation as a Model for Oxidative Damage in DNA.

    Science.gov (United States)

    Feketeová, Linda; Chan, Bun; Khairallah, George N; Steinmetz, Vincent; Maitre, Philippe; Radom, Leo; O'Hair, Richard A J

    2017-07-06

    The deleterious cellular effects of ionizing radiation are well-known, but the mechanisms causing DNA damage are poorly understood. The accepted molecular events involve initial oxidation and deprotonation at guanine sites, triggering hydrogen atom abstraction reactions from the sugar moieties, causing DNA strand breaks. Probing the chemistry of the initially formed radical cation has been challenging. Here, we generate, spectroscopically characterize, and examine the reactivity of the Watson-Crick nucleobase pair radical cation in the gas phase. We observe rich chemistry, including proton transfer between the bases and propagation of the radical site in deoxyguanosine from the base to the sugar, thus rupturing the sugar. This first example of a gas-phase model system providing molecular-level details on the chemistry of an ionized DNA base pair paves the way toward a more complete understanding of molecular processes induced by radiation. It also highlights the role of radical propagation in chemistry, biology, and nanotechnology.

  1. Energy Landscape and Pathways for Transitions between Watson-Crick and Hoogsteen Base Pairing in DNA.

    Science.gov (United States)

    Chakraborty, Debayan; Wales, David J

    2018-01-04

    The recent discovery that Hoogsteen (HG) base pairs are widespread in DNA across diverse sequences and positional contexts could have important implications for understanding DNA replication and DNA-protein recognition. While evidence is emerging that the Hoogsteen conformation could be a thermodynamically accessible conformation of the DNA duplex and provide a means to expand its functionality, relatively little is known about the molecular mechanism underlying the Watson-Crick (WC) to HG transition. In this Perspective, we describe pathways and kinetics for this transition at an atomic level of detail, using the energy landscape perspective. We show that competition between the duplex conformations results in a double funnel landscape, which explains some recent experimental observations. The interconversion pathways feature a number of intermediates, with a variable number of WC and HG base pairs. The relatively slow kinetics, with possible deviations from two-state behavior, suggest that this conformational switch is likely to be a challenging target for both simulation and experiment.

  2. Metal-mediated DNA base pairing: alternatives to hydrogen-bonded Watson-Crick base pairs.

    Science.gov (United States)

    Takezawa, Yusuke; Shionoya, Mitsuhiko

    2012-12-18

    With its capacity to store and transfer the genetic information within a sequence of monomers, DNA forms its central role in chemical evolution through replication and amplification. This elegant behavior is largely based on highly specific molecular recognition between nucleobases through the specific hydrogen bonds in the Watson-Crick base pairing system. While the native base pairs have been amazingly sophisticated through the long history of evolution, synthetic chemists have devoted considerable efforts to create alternative base pairing systems in recent decades. Most of these new systems were designed based on the shape complementarity of the pairs or the rearrangement of hydrogen-bonding patterns. We wondered whether metal coordination could serve as an alternative driving force for DNA base pairing and why hydrogen bonding was selected on Earth in the course of molecular evolution. Therefore, we envisioned an alternative design strategy: we replaced hydrogen bonding with another important scheme in biological systems, metal-coordination bonding. In this Account, we provide an overview of the chemistry of metal-mediated base pairing including basic concepts, molecular design, characteristic structures and properties, and possible applications of DNA-based molecular systems. We describe several examples of artificial metal-mediated base pairs, such as Cu(2+)-mediated hydroxypyridone base pair, H-Cu(2+)-H (where H denotes a hydroxypyridone-bearing nucleoside), developed by us and other researchers. To design the metallo-base pairs we carefully chose appropriate combinations of ligand-bearing nucleosides and metal ions. As expected from their stronger bonding through metal coordination, DNA duplexes possessing metallo-base pairs exhibited higher thermal stability than natural hydrogen-bonded DNAs. Furthermore, we could also use metal-mediated base pairs to construct or induce other high-order structures. These features could lead to metal-responsive functional

  3. Mispairs with Watson-Crick base-pair geometry observed in ternary complexes of an RB69 DNA polymerase variant.

    Science.gov (United States)

    Xia, Shuangluo; Konigsberg, William H

    2014-04-01

    Recent structures of DNA polymerase complexes with dGMPCPP/dT and dCTP/dA mispairs at the insertion site have shown that they adopt Watson-Crick geometry in the presence of Mn(2+) indicating that the tautomeric or ionization state of the base has changed. To see whether the tautomeric or ionization state of base-pair could be affected by its microenvironment, we determined 10 structures of an RB69 DNA polymerase quadruple mutant with dG/dT or dT/dG mispairs at position n-1 to n-5 of the Primer/Template duplex. Different shapes of the mispairs, including Watson-Crick geometry, have been observed, strongly suggesting that the local environment of base-pairs plays an important role in their tautomeric or ionization states. © 2014 The Protein Society.

  4. Stability of non-Watson-Crick G-A/A-G base pair in synthetic DNA and RNA oligonucleotides.

    Science.gov (United States)

    Ito, Yuko; Sone, Yumiko; Mizutani, Takaharu

    2004-03-01

    A non-Watson-Crick G-A/A-G base pair is found in SECIS (selenocysteine-insertion sequence) element in the 3'-untranslated region of Se-protein mRNAs and in the functional site of the hammerhead ribozyme. We studied the stability of G-A/A-G base pair (bold) in 17mer GT(U)GACGGAAACCGGAAC synthetic DNA and RNA oligonucleotides by thermal melting experiments and gel electrophoresis. The measured Tm value of DNA oligonucleotide having G-A/A-G pair showed an intermediate value (58 degrees C) between that of Watson-Crick G-C/C-G base pair (75 degrees C) and that of G-G/A-A of non-base-pair (40 degrees C). Similar thermal melting patterns were obtained with RNA oligonucleotides. This result indicates that the secondary structure of oligonucleotide having G-A/A-G base pair is looser than that of the G-C type Watson-Crick base pair. In the comparison between RNA and DNA having G-A/A-G base pair, the Tm value of the RNA oligonucleotide was 11 degrees C lower than that of DNA, indicating that DNA has a more rigid structure than RNA. The stained pattern of oligonucleotide on polyacrylamide gel clarified that the mobility of the DNA oligonucleotide G-A/A-G base pair changed according to the urea concentration from the rigid state (near the mobility of G-C/C-G oligonucleotide) in the absence of urea to the random state (near the mobility of G-G/A-A oligonucleotide) in 7 M urea. However, the RNA oligonucleotide with G-A/A-G pair moved at an intermediate mobility between that of oligonucleotide with G-C/C-G and of the oligonucleotide with G-G/A-A, and the mobility pattern did not depend on urea concentration. Thus, DNA and RNA oligonucleotides with the G-A/A-G base pair showed a pattern indicating an intermediate structure between the rigid Watson-Crick base pair and the random structure of non-base pair. RNA with G-A/A-G base pair has the intermediate structure not influenced by urea concentration. Finally, this study indicated that the intermediate rigidity imparted by Non-Watson-Crick

  5. Ultraviolet Absorption Induces Hydrogen-Atom Transfer in G⋅C Watson-Crick DNA Base Pairs in Solution.

    Science.gov (United States)

    Röttger, Katharina; Marroux, Hugo J B; Grubb, Michael P; Coulter, Philip M; Böhnke, Hendrik; Henderson, Alexander S; Galan, M Carmen; Temps, Friedrich; Orr-Ewing, Andrew J; Roberts, Gareth M

    2015-12-01

    Ultrafast deactivation pathways bestow photostability on nucleobases and hence preserve the structural integrity of DNA following absorption of ultraviolet (UV) radiation. One controversial recovery mechanism proposed to account for this photostability involves electron-driven proton transfer (EDPT) in Watson-Crick base pairs. The first direct observation is reported of the EDPT process after UV excitation of individual guanine-cytosine (G⋅C) Watson-Crick base pairs by ultrafast time-resolved UV/visible and mid-infrared spectroscopy. The formation of an intermediate biradical species (G[-H]⋅C[+H]) with a lifetime of 2.9 ps was tracked. The majority of these biradicals return to the original G⋅C Watson-Crick pairs, but up to 10% of the initially excited molecules instead form a stable photoproduct G*⋅C* that has undergone double hydrogen-atom transfer. The observation of these sequential EDPT mechanisms across intermolecular hydrogen bonds confirms an important and long debated pathway for the deactivation of photoexcited base pairs, with possible implications for the UV photochemistry of DNA. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  6. DNA base dimers are stabilized by hydrogen-bonding interactions including non-Watson-Crick pairing near graphite surfaces.

    Science.gov (United States)

    Shankar, Akshaya; Jagota, Anand; Mittal, Jeetain

    2012-10-11

    Single- and double-stranded DNA are increasingly being paired with surfaces and nanoparticles for numerous applications, such as sensing, imaging, and drug delivery. Unlike the majority of DNA structures in bulk that are stabilized by canonical Watson-Crick pairing between Ade-Thy and Gua-Cyt, those adsorbed on surfaces are often stabilized by noncanonical base pairing, quartet formation, and base-surface stacking. Not much is known about these kinds of interactions. To build an understanding of the role of non-Watson-Crick pairing on DNA behavior near surfaces, one requires basic information on DNA base pair stacking and hydrogen-bonding interactions. All-atom molecular simulations of DNA bases in two cases--in bulk water and strongly adsorbed on a graphite surface--are conducted to study the relative strengths of stacking and hydrogen bond interactions for each of the 10 possible combinations of base pairs. The key information obtained from these simulations is the free energy as a function of distance between two bases in a pair. We find that stacking interactions exert the dominant influence on the stability of DNA base pairs in bulk water as expected. The strength of stability for these stacking interactions is found to decrease in the order Gua-Gua > Ade-Gua > Ade-Ade > Gua-Thy > Gua-Cyt > Ade-Thy > Ade-Cyt > Thy-Thy > Cyt-Thy > Cyt-Cyt. On the other hand, mutual interactions of surface-adsorbed base pairs are stabilized mostly by hydrogen-bonding interactions in the order Gua-Cyt > Ade-Gua > Ade-Thy > Ade-Ade > Cyt-Thy > Gua-Gua > Cyt-Cyt > Ade-Cyt > Thy-Thy > Gua-Thy. Interestingly, several non-Watson-Crick base pairings, which are commonly ignored, have similar stabilization free energies due to interbase hydrogen bonding as Watson-Crick pairs. This clearly highlights the importance of non-Watson-Crick base pairing in the development of secondary structures of oligonucleotides near surfaces.

  7. Benchmark studies on the building blocks of DNA. 3. Watson-Crick and stacked base pairs.

    Science.gov (United States)

    Szalay, Péter G; Watson, Thomas; Perera, Ajith; Lotrich, Victor; Bartlett, Rodney J

    2013-04-18

    Excited states of stacked adenine-thymine and guanine-cytosine pairs as well as the Watson-Crick pair of guanine-thymine have been investigated using the equation of motion coupled-cluster (EOM-CC) method with single and double as well as approximate triple excitations. Transitions have been assigned, and the form of the excitations has been analyzed. The majority of the excitations could be classified as localized on the nucleobases, but for all three studied systems, charge-transfer (CT) transitions could also be identified. The main aim of this study was to compare the performance of lower-level methods (ADC(2) and TDDFT) to the high-level EOM-CC ones. It was shown that both ADC(2) and TDDFT with long-range correction have nonsystematic error in excitation energies, causing alternation of the energetic ordering of the excitations. Considering the high costs of the EOM-CC calculations, there is a need for reliable new approximate methods.

  8. Detection of protonated non-Watson-Crick base pairs using electrospray ionization mass spectrometry.

    Science.gov (United States)

    Ishida, Riyoko; Iwahashi, Hideo

    2018-03-01

    Many studies have shown that protonated nucleic acid base pairs are involved in a wide variety of nucleic acid structures. However, little information is available on relative stability of hemiprotonated self- and non-self-dimers at monomer level. We used electrospray ionization mass spectrometry (ESI-MS) to evaluate the relative stability under various concentrations of hydrogen ion. These enable conjecture of the formation of protonated non-Watson-Crick base pairs based on DNA and RNA base sequence. In the present study, we observed that ESI-MS peaks corresponded to respective self-dimers for all examined nucleosides except for adenosine. Peak heights depended on the concentration of hydrogen ion. The ESI-MS peak heights of the hemiprotonated cytidine dimers and the hemiprotonated thymidine dimer sharply increased with increased concentration of hydrogen ion, suggesting direct participation of hydrogen ion in dimer formations. In ESI-MS measurements of the solutions containing adenosine, cytidine, thymidine and guanosine, we observed protonated cytidine-guanosine dimer (CH+-G) and protonated cytidine-thymidine dimer (CH+-T) in addition to hemiprotonated cytidine-cytidine dimer (CH+-C) with following relative peak height, (CH+-C) > (CH+-G) ≈ (CH+-T) > (CH+-A). Additionally, in the ESI-MS measurements of solutions containing adenosine, thymidine and guanosine, we observed a considerable amount of protonated adenosine-guanosine (AH+-G) and protonated adenosine-thymidine (AH+-T).

  9. Proton tunneling in the A∙T Watson-Crick DNA base pair: myth or reality?

    Science.gov (United States)

    Brovarets', Ol'ha O; Hovorun, Dmytro M

    2015-01-01

    The results and conclusions reached by Godbeer et al. in their recent work, that proton tunneling in the A∙T(WC) Watson-Crick (WC) DNA base pair occurs according to the Löwdin's (L) model, but with a small (~10(-9)) probability were critically analyzed. Here, it was shown that this finding overestimates the possibility of the proton tunneling at the A∙T(WC)↔A*∙T*(L) tautomerization, because this process cannot be implemented as a chemical reaction. Furthermore, it was outlined those biologically important nucleobase mispairs (A∙A*↔A*∙A, G∙G*↔G*∙G, T∙T*↔T*∙T, C∙C*↔C*∙C, H∙H*↔H*∙H (H - hypoxanthine)) - the players in the field of the spontaneous point mutagenesis - where the tunneling of protons is expected and for which the application of the model proposed by Godbeer et al. can be productive.

  10. Dissociation of single-strand DNA: single-walled carbon nanotube hybrids by Watson-Crick base-pairing.

    Science.gov (United States)

    Jung, Seungwon; Cha, Misun; Park, Jiyong; Jeong, Namjo; Kim, Gunn; Park, Changwon; Ihm, Jisoon; Lee, Junghoon

    2010-08-18

    It has been known that single-strand DNA wraps around a single-walled carbon nanotube (SWNT) by pi-stacking. In this paper it is demonstrated that such DNA is dissociated from the SWNT by Watson-Crick base-pairing with a complementary sequence. Measurement of field effect transistor characteristics indicates a shift of the electrical properties as a result of this "unwrapping" event. We further confirm the suggested process through Raman spectroscopy and gel electrophoresis. Experimental results are verified in view of atomistic mechanisms with molecular dynamics simulations and binding energy analyses.

  11. Silver(I)-Mediated Base Pairs in DNA Sequences Containing 7-Deazaguanine/Cytosine: towards DNA with Entirely Metallated Watson-Crick Base Pairs.

    Science.gov (United States)

    Méndez-Arriaga, José M; Maldonado, Carmen R; Dobado, José A; Galindo, Miguel A

    2018-03-26

    DNA sequences comprising noncanonical 7-deazaguanine ( 7C G) and canonical cytosine (C) are capable of forming Watson-Crick base pairs via hydrogen bonds as well as silver(I)-mediated base pairs by coordination to central silver(I) ions. Duplexes I and II containing 7C G and C have been synthesized and characterized. The incorporation of silver(I) ions into these duplexes has been studied by means of temperature-dependent UV spectroscopy, circular dichroism, and DFT calculations. The results suggest the formation of DNA molecules comprising contiguous metallated 7C G-Ag I -C Watson-Crick base pairs that preserve the original B-type conformation. Furthermore, additional studies performed on duplex III indicated that, in the presence of Ag I ions, 7C G-C and 7C A-T Watson-Crick base pairs ( 7C A, 7-deazadenine; T, thymine) can be converted to metallated 7C G-Ag I -C and 7C A-Ag I -T base pairs inside the same DNA molecule whilst maintaining its initial double helix conformation. These findings are very important for the development of customized silver-DNA nanostructures based on a Watson-Crick complementarity pattern. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  12. Principles of RNA base pairing: Structures and energies of cis and trans-Watson-Crick/Sugar Edge base pairs revealed by quantum chemical calculations

    Czech Academy of Sciences Publication Activity Database

    Šponer, Judit E.; Leszczynski, J.; Šponer, Jiří

    2005-01-01

    Roč. 22, č. 6 (2005), s. 826 ISSN 0739-1102. [Albany 2005. Conversation /14./. 14.06.2005-18.06.2005, Albany] Institutional research plan: CEZ:AV0Z50040507 Keywords : RNA base pairing * DNA * Watson-Crick/Sugar Edge Subject RIV: BO - Biophysics

  13. RNAHelix: computational modeling of nucleic acid structures with Watson-Crick and non-canonical base pairs.

    Science.gov (United States)

    Bhattacharyya, Dhananjay; Halder, Sukanya; Basu, Sankar; Mukherjee, Debasish; Kumar, Prasun; Bansal, Manju

    2017-02-01

    Comprehensive analyses of structural features of non-canonical base pairs within a nucleic acid double helix are limited by the availability of a small number of three dimensional structures. Therefore, a procedure for model building of double helices containing any given nucleotide sequence and base pairing information, either canonical or non-canonical, is seriously needed. Here we describe a program RNAHelix, which is an updated version of our widely used software, NUCGEN. The program can regenerate duplexes using the dinucleotide step and base pair orientation parameters for a given double helical DNA or RNA sequence with defined Watson-Crick or non-Watson-Crick base pairs. The original structure and the corresponding regenerated structure of double helices were found to be very close, as indicated by the small RMSD values between positions of the corresponding atoms. Structures of several usual and unusual double helices have been regenerated and compared with their original structures in terms of base pair RMSD, torsion angles and electrostatic potentials and very high agreements have been noted. RNAHelix can also be used to generate a structure with a sequence completely different from an experimentally determined one or to introduce single to multiple mutation, but with the same set of parameters and hence can also be an important tool in homology modeling and study of mutation induced structural changes.

  14. Direct NMR Evidence that Transient Tautomeric and Anionic States in dG·dT Form Watson-Crick-like Base Pairs.

    Science.gov (United States)

    Szymanski, Eric S; Kimsey, Isaac J; Al-Hashimi, Hashim M

    2017-03-29

    The replicative and translational machinery utilizes the unique geometry of canonical G·C and A·T/U Watson-Crick base pairs to discriminate against DNA and RNA mismatches in order to ensure high fidelity replication, transcription, and translation. There is growing evidence that spontaneous errors occur when mismatches adopt a Watson-Crick-like geometry through tautomerization and/or ionization of the bases. Studies employing NMR relaxation dispersion recently showed that wobble dG·dT and rG·rU mismatches in DNA and RNA duplexes transiently form tautomeric and anionic species with probabilities (≈0.01-0.40%) that are in concordance with replicative and translational errors. Although computational studies indicate that these exceptionally short-lived and low-abundance species form Watson-Crick-like base pairs, their conformation could not be directly deduced from the experimental data, and alternative pairing geometries could not be ruled out. Here, we report direct NMR evidence that the transient tautomeric and anionic species form hydrogen-bonded Watson-Crick-like base pairs. A guanine-to-inosine substitution, which selectively knocks out a Watson-Crick-type (G)N2H 2 ···O2(T) hydrogen bond, significantly destabilized the transient tautomeric and anionic species, as assessed by lack of any detectable chemical exchange by imino nitrogen rotating frame spin relaxation (R 1ρ ) experiments. An 15 N R 1ρ NMR experiment targeting the amino nitrogen of guanine (dG-N2) provides direct evidence for Watson-Crick (G)N2H 2 ···O2(T) hydrogen bonding in the transient tautomeric state. The strategy presented in this work can be generally applied to examine hydrogen-bonding patterns in nucleic acid transient states including in other tautomeric and anionic species that are postulated to play roles in replication and translational errors.

  15. Fingerprints of Both Watson-Crick and Hoogsteen Isomers of the Isolated (Cytosine-Guanine)H+ Pair.

    Science.gov (United States)

    Cruz-Ortiz, Andrés F; Rossa, Maximiliano; Berthias, Francis; Berdakin, Matías; Maitre, Philippe; Pino, Gustavo A

    2017-11-16

     Gas phase protonated guanine-cytosine (CGH + ) pair was generated using an electrospray ionization source from solutions at two different pH (5.8 and 3.2). Consistent evidence from MS/MS fragmentation patterns and differential ion mobility spectra (DIMS) point toward the presence of two isomers of the CGH + pair, whose relative populations depend strongly on the pH of the solution. Gas phase infrared multiphoton dissociation (IRMPD) spectroscopy in the 900-1900 cm -1 spectral range further confirms that the Watson-Crick isomer is preferentially produced (91%) at pH = 5.8, while the Hoogsteen isomer predominates (66%) at pH = 3.2). These fingerprint signatures are expected to be useful for the development of new analytical methodologies and to trigger isomer selective photochemical studies of protonated DNA base pairs.

  16. Structural variability and the nature of intermolecular interactions in Watson-Crick B-DNA base pairs.

    Science.gov (United States)

    Czyznikowska, Z; Góra, R W; Zaleśny, R; Lipkowski, P; Jarzembska, K N; Dominiak, P M; Leszczynski, J

    2010-07-29

    A set of nearly 100 crystallographic structures was analyzed using ab initio methods in order to verify the effect of the conformational variability of Watson-Crick guanine-cytosine and adenine-thymine base pairs on the intermolecular interaction energy and its components. Furthermore, for the representative structures, a potential energy scan of the structural parameters describing mutual orientation of the base pairs was carried out. The results were obtained using the hybrid variational-perturbational interaction energy decomposition scheme. The electron correlation effects were estimated by means of the second-order Møller-Plesset perturbation theory and coupled clusters with singles and doubles method adopting AUG-cc-pVDZ basis set. Moreover, the characteristics of hydrogen bonds in complexes, mimicking those appearing in B-DNA, were evaluated using topological analysis of the electron density. Although the first-order electrostatic energy is usually the largest stabilizing component, it is canceled out by the associated exchange repulsion in majority of the studied crystallographic structures. Therefore, the analyzed complexes of the nucleic acid bases appeared to be stabilized mainly by the delocalization component of the intermolecular interaction energy which, in terms of symmetry adapted perturbation theory, encompasses the second- and higher-order induction and exchange-induction terms. Furthermore, it was found that the dispersion contribution, albeit much smaller in terms of magnitude, is also a vital stabilizing factor. It was also revealed that the intermolecular interaction energy and its components are strongly influenced by four (out of six) structural parameters describing mutual orientation of bases in Watson-Crick pairs, namely shear, stagger, stretch, and opening. Finally, as a part of a model study, much of the effort was devoted to an extensive testing of the UBDB databank. It was shown that the databank quite successfully reproduces the

  17. Long-Range Vibrational Dynamics Are Directed by Watson-Crick Base Pairing in Duplex DNA.

    Science.gov (United States)

    Hithell, Gordon; Shaw, Daniel J; Donaldson, Paul M; Greetham, Gregory M; Towrie, Michael; Burley, Glenn A; Parker, Anthony W; Hunt, Neil T

    2016-05-05

    Ultrafast two-dimensional infrared (2D-IR) spectroscopy of a 15-mer A-T DNA duplex in solution has revealed structure-dependent vibrational coupling and energy transfer processes linking bases with the sugar-phosphate backbone. Duplex melting induces significant changes in the positions of off-diagonal peaks linking carbonyl and ring-stretching vibrational modes of the adenine and thymine bases with vibrations of the phosphate group and phosphodiester linkage. These indicate that Watson-Crick hydrogen bonding and helix formation lead to a unique vibrational coupling arrangement of base vibrational modes with those of the phosphate unit. On the basis of observations from time-resolved 2D-IR data, we conclude that rapid energy transfer processes occur between base and backbone, mediated by additional modes located on the deoxyribose moiety within the same nucleotide. These relaxation dynamics are insensitive to duplex melting, showing that efficient intramolecular energy relaxation to the solvent via the phosphate groups is the key to excess energy dissipation in both single- and double-stranded DNA.

  18. Effect of Watson-Crick and Hoogsteen base pairing on the conformational stability of C8-phenoxyl-2'-deoxyguanosine adducts.

    Science.gov (United States)

    Millen, Andrea L; Churchill, Cassandra D M; Manderville, Richard A; Wetmore, Stacey D

    2010-10-14

    Bulky DNA addition products (adducts) formed through attack at the C8 site of guanine can adopt the syn orientation about the glycosidic bond due to changes in conformational stability or hydrogen-bonding preferences directly arising from the bulky group. Indeed, the bulky substituent may improve the stability of (non-native) Hoogsteen pairs. Therefore, such adducts often result in mutations upon DNA replication. This work examines the hydrogen-bonded pairs between the Watson-Crick and Hoogsteen faces of the ortho or para C8-phenoxyl-2'-deoxyguanosine adduct and each natural (undamaged) nucleobase with the goal to clarify the conformational preference of this type of damage, as well as provide insight into the likelihood of subsequent mutation events. B3LYP/6-311+G(2df,p)//B3LYP/6-31G(d) hydrogen-bond strengths were determined using both nucleobase and nucleoside models for adduct pairs, as well as the corresponding complexes involving natural 2'-deoxyguanosine. In addition to the magnitude of the binding strengths, the R(C1'···C1') distances and ∠(N9C1'C1') angles, as well as the degree of propeller-twist and buckle distortions, were carefully compared to the values observed in natural DNA strands. Due to structural changes in the adduct monomer upon inclusion of the sugar moiety, the monomer deformation energy significantly affects the relative hydrogen-bond strengths calculated with the nucleobase and nucleoside models. Therefore, we recommend the use of at least a nucleoside model to accurately evaluate hydrogen-bond strengths of base pairs involving flexible, bulky nucleobase adducts. Our results also emphasize the importance of considering both the magnitude of the hydrogen-bond strength and the structure of the base pair when predicting the preferential binding patterns of nucleobases. Using our best models, we conclude that the Watson-Crick face of the ortho phenoxyl adduct forms significantly more stable complexes than the Hoogsteen face, which

  19. Kinetics and Thermodynamics of Watson-Crick Base Pairing Driven DNA Origami Dimerization.

    Science.gov (United States)

    Zenk, John; Tuntivate, Chanon; Schulman, Rebecca

    2016-03-16

    We investigate the kinetics and thermodynamics of DNA origami dimerization using flat rectangle origami components and different architectures of Watson-Crick complementary single-stranded DNA ("sticky end") linking strategies. We systematically vary the number of linkers, the length of the sticky ends on the linker, and linker architecture and measure the corresponding yields as well as forward and reverse reaction rate constants through fluorescence quenching assays. Yields were further verified using atomic force microscopy. We calculate values of H° and ΔS° for various interface designs and find nonlinear van't Hoff behavior, best described by two linear equations, suggesting distinct regimes of dimerization between those with and those without well-formed interfaces. We find that self-assembly reactions can be tuned by manipulating the interface architecture without suffering a loss in yield, even when yield is high, ∼75-80%. We show that the second-order forward reaction rate constant (k(on)) depends on both linker architecture and number of linkers used, with typical values on the order of 10(5)-10(6) (M·s)(-1), values that are similar to those of bimolecular association of small, complementary DNA strands. The k(on) values are generally non-Arrhenius, tending to increase with decreasing temperature. Finally, we use kinetic and thermodynamic information about the optimal linking architecture to extend the system to an infinite, two-component repeating lattice system and show that we can form micron-sized lattices, with well-formed structures up to 8 μm(2).

  20. Higher order structural effects stabilizing the reverse watson-crick guanine-cytosine base pair in functional RNAs

    KAUST Repository

    Chawla, Mohit

    2013-10-10

    The G:C reverse Watson-Crick (W:W trans) base pair, also known as Levitt base pair in the context of tRNAs, is a structurally and functionally important base pair that contributes to tertiary interactions joining distant domains in functional RNA molecules and also participates in metabolite binding in riboswitches. We previously indicated that the isolated G:C W:W trans base pair is a rather unstable geometry, and that dicationic metal binding to the Guanine base or posttranscriptional modification of the Guanine can increase its stability. Herein, we extend our survey and report on other H-bonding interactions that can increase the stability of this base pair. To this aim, we performed a bioinformatics search of the PDB to locate all the occurencies of G:C trans base pairs. Interestingly, 66% of the G:C trans base pairs in the PDB are engaged in additional H-bonding interactions with other bases, the RNA backbone or structured water molecules. High level quantum mechanical calculations on a data set of representative crystal structures were performed to shed light on the structural stability and energetics of the various crystallographic motifs. This analysis was extended to the binding of the preQ1 metabolite to a preQ1-II riboswitch. 2013 The Author(s).

  1. Accommodation of an N-(deoxyguanosin-8-yl)-2-acetylaminofluorene adduct in the active site of human DNA polymerase iota: Hoogsteen or Watson-Crick base pairing?

    Science.gov (United States)

    Donny-Clark, Kerry; Shapiro, Robert; Broyde, Suse

    2009-01-13

    Bypass across DNA lesions by specialized polymerases is essential for maintenance of genomic stability. Human DNA polymerase iota (poliota) is a bypass polymerase of the Y family. Crystal structures of poliota suggest that Hoogsteen base pairing is employed to bypass minor groove DNA lesions, placing them on the spacious major groove side of the enzyme. Primer extension studies have shown that poliota is also capable of error-free nucleotide incorporation opposite the bulky major groove adduct N-(deoxyguanosin-8-yl)-2-acetylaminofluorene (dG-AAF). We present molecular dynamics simulations and free energy calculations suggesting that Watson-Crick base pairing could be employed in poliota for bypass of dG-AAF. In poliota with Hoogsteen-paired dG-AAF the bulky AAF moiety would reside on the cramped minor groove side of the template. The Hoogsteen-capable conformation distorts the active site, disrupting interactions necessary for error-free incorporation of dC opposite the lesion. Watson-Crick pairing places the AAF rings on the spacious major groove side, similar to the position of minor groove adducts observed with Hoogsteen pairing. Watson-Crick-paired structures show a well-ordered active site, with a near reaction-ready ternary complex. Thus our results suggest that poliota would utilize the same spacious region for lesion bypass of both major and minor groove adducts. Therefore, purine adducts with bulk on the minor groove side would use Hoogsteen pairing, while adducts with the bulky lesion on the major groove side would utilize Watson-Crick base pairing as indicated by our MD simulations for dG-AAF. This suggests the possibility of an expanded role for poliota in lesion bypass.

  2. Silver (I) as DNA glue: Ag+-mediated guanine pairing revealed by removing Watson-Crick constraints

    Science.gov (United States)

    Swasey, Steven M.; Leal, Leonardo Espinosa; Lopez-Acevedo, Olga; Pavlovich, James; Gwinn, Elisabeth G.

    2015-01-01

    Metal ion interactions with DNA have far-reaching implications in biochemistry and DNA nanotechnology. Ag+ is uniquely interesting because it binds exclusively to the bases rather than the backbone of DNA, without the toxicity of Hg2+. In contrast to prior studies of Ag+ incorporation into double-stranded DNA, we remove the constraints of Watson-Crick pairing by focusing on homo-base DNA oligomers of the canonical bases. High resolution electro-spray ionization mass spectrometry reveals an unanticipated Ag+-mediated pairing of guanine homo-base strands, with higher stability than canonical guanine-cytosine pairing. By exploring unrestricted binding geometries, quantum chemical calculations find that Ag+ bridges between non-canonical sites on guanine bases. Circular dichroism spectroscopy shows that the Ag+-mediated structuring of guanine homobase strands persists to at least 90 °C under conditions for which canonical guanine-cytosine duplexes melt below 20 °C. These findings are promising for DNA nanotechnology and metal-ion based biomedical science. PMID:25973536

  3. Silver (I) as DNA glue: Ag(+)-mediated guanine pairing revealed by removing Watson-Crick constraints.

    Science.gov (United States)

    Swasey, Steven M; Leal, Leonardo Espinosa; Lopez-Acevedo, Olga; Pavlovich, James; Gwinn, Elisabeth G

    2015-05-14

    Metal ion interactions with DNA have far-reaching implications in biochemistry and DNA nanotechnology. Ag(+) is uniquely interesting because it binds exclusively to the bases rather than the backbone of DNA, without the toxicity of Hg(2+). In contrast to prior studies of Ag(+) incorporation into double-stranded DNA, we remove the constraints of Watson-Crick pairing by focusing on homo-base DNA oligomers of the canonical bases. High resolution electro-spray ionization mass spectrometry reveals an unanticipated Ag(+)-mediated pairing of guanine homo-base strands, with higher stability than canonical guanine-cytosine pairing. By exploring unrestricted binding geometries, quantum chemical calculations find that Ag(+) bridges between non-canonical sites on guanine bases. Circular dichroism spectroscopy shows that the Ag(+)-mediated structuring of guanine homobase strands persists to at least 90 °C under conditions for which canonical guanine-cytosine duplexes melt below 20 °C. These findings are promising for DNA nanotechnology and metal-ion based biomedical science.

  4. Free energy landscape and transition pathways from Watson-Crick to Hoogsteen base pairing in free duplex DNA.

    Science.gov (United States)

    Yang, Changwon; Kim, Eunae; Pak, Youngshang

    2015-09-18

    Houghton (HG) base pairing plays a central role in the DNA binding of proteins and small ligands. Probing detailed transition mechanism from Watson-Crick (WC) to HG base pair (bp) formation in duplex DNAs is of fundamental importance in terms of revealing intrinsic functions of double helical DNAs beyond their sequence determined functions. We investigated a free energy landscape of a free B-DNA with an adenosine-thymine (A-T) rich sequence to probe its conformational transition pathways from WC to HG base pairing. The free energy landscape was computed with a state-of-art two-dimensional umbrella molecular dynamics simulation at the all-atom level. The present simulation showed that in an isolated duplex DNA, the spontaneous transition from WC to HG bp takes place via multiple pathways. Notably, base flipping into the major and minor grooves was found to play an important role in forming these multiple transition pathways. This finding suggests that naked B-DNA under normal conditions has an inherent ability to form HG bps via spontaneous base opening events. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  5. [Quantum-chemical investigation of tautomerization ways of Watson-Crick DNA base pair guanine-cytosine].

    Science.gov (United States)

    Brovarets', O O; Hovorun, D M

    2010-01-01

    A novel physico-chemical mechanism of the Watson-Crick DNA base pair Gua.Cyt tautomerization Gua.Cyt*Gua.CytGua*.Cyt (mutagenic tautomers of bases are marked by asterisks) have been revealed and realized in a pathway of single proton transfer through two mutual isoenergetic transition states with Gibbs free energy of activation 30.4 and 30.6 kcal/mol and they are ion pairs stabilized by three (N2H...N3, N1H...N4- and O6+H...N4-) and five (N2H...O2, N1H...O2, N1H...N3, O6+H...N4- and 06+H...N4-) H-bonds accordingly. Stable base pairs Gua-Cyt* and Gua*.Cyt which dissociate comparably easy into monomers have acceptable relative Gibbs energies--12.9 and 14.3 kcal/mol--for the explanation of the nature of the spontaneous transitions of DNA replication. Results are obtained at the MP2/6-311++G(2df,pd)//B3LYP/6-31 1++G(d,p) level of theory in vacuum approach.

  6. Watson-Crick Base Pairing, Electronic and Photophysical Properties of Triazole Modified Adenine Analogues: A Computational Study

    KAUST Repository

    Das, Shubhajit

    2015-09-17

    We employ first-principles Density Functional Theory (DFT) and time-dependent DFT (TDDFT) to elucidate structural, electronic and optical properties of a few recently reported triazole adenine nucleobase analogues. The results are compared against the findings obtained for both natural adenine nucleobase and available experimental data. The optical absorption of these adenine analogues are calculated both in gas-phase and in solvent (methanol) using Polarized Continuum Model (PCM). We find that all the analogues show a red-shifted absorption profile as compared to adenine. Our simulated emission spectra in solvent compare fairly well with experimentally observed results. We investigate base paring ability of these adenine analogues with thymine. The calculations on the intrinsic stability of these base pairs ascertain that all the adenine analogues form the hydrogen bonded Watson-Crick base pair with similar H-bonding energy as obtained for natural adenine-thymine base pair. In our study, we provide a microscopic origin of the low-energy absorption and emission peaks, observed experimentally.

  7. Silver (I) as DNA glue: Ag+-mediated guanine pairing revealed by removing Watson-Crick constraints

    Science.gov (United States)

    Swasey, Steven M.; Leal, Leonardo Espinosa; Lopez-Acevedo, Olga; Pavlovich, James; Gwinn, Elisabeth G.

    2015-05-01

    Metal ion interactions with DNA have far-reaching implications in biochemistry and DNA nanotechnology. Ag+ is uniquely interesting because it binds exclusively to the bases rather than the backbone of DNA, without the toxicity of Hg2+. In contrast to prior studies of Ag+ incorporation into double-stranded DNA, we remove the constraints of Watson-Crick pairing by focusing on homo-base DNA oligomers of the canonical bases. High resolution electro-spray ionization mass spectrometry reveals an unanticipated Ag+-mediated pairing of guanine homo-base strands, with higher stability than canonical guanine-cytosine pairing. By exploring unrestricted binding geometries, quantum chemical calculations find that Ag+ bridges between non-canonical sites on guanine bases. Circular dichroism spectroscopy shows that the Ag+-mediated structuring of guanine homobase strands persists to at least 90 °C under conditions for which canonical guanine-cytosine duplexes melt below 20 °C. These findings are promising for DNA nanotechnology and metal-ion based biomedical science.

  8. Watson-Crick Base Pairing, Electronic and Photophysical Properties of Triazole Modified Adenine Analogues: A Computational Study

    KAUST Repository

    Das, Shubhajit; Samanta, Pralok Kumar; Pati, Swapan

    2015-01-01

    We employ first-principles Density Functional Theory (DFT) and time-dependent DFT (TDDFT) to elucidate structural, electronic and optical properties of a few recently reported triazole adenine nucleobase analogues. The results are compared against the findings obtained for both natural adenine nucleobase and available experimental data. The optical absorption of these adenine analogues are calculated both in gas-phase and in solvent (methanol) using Polarized Continuum Model (PCM). We find that all the analogues show a red-shifted absorption profile as compared to adenine. Our simulated emission spectra in solvent compare fairly well with experimentally observed results. We investigate base paring ability of these adenine analogues with thymine. The calculations on the intrinsic stability of these base pairs ascertain that all the adenine analogues form the hydrogen bonded Watson-Crick base pair with similar H-bonding energy as obtained for natural adenine-thymine base pair. In our study, we provide a microscopic origin of the low-energy absorption and emission peaks, observed experimentally.

  9. Light-emitting self-assembled peptide nucleic acids exhibit both stacking interactions and Watson-Crick base pairing.

    Science.gov (United States)

    Berger, Or; Adler-Abramovich, Lihi; Levy-Sakin, Michal; Grunwald, Assaf; Liebes-Peer, Yael; Bachar, Mor; Buzhansky, Ludmila; Mossou, Estelle; Forsyth, V Trevor; Schwartz, Tal; Ebenstein, Yuval; Frolow, Felix; Shimon, Linda J W; Patolsky, Fernando; Gazit, Ehud

    2015-04-01

    The two main branches of bionanotechnology involve the self-assembly of either peptides or DNA. Peptide scaffolds offer chemical versatility, architectural flexibility and structural complexity, but they lack the precise base pairing and molecular recognition available with nucleic acid assemblies. Here, inspired by the ability of aromatic dipeptides to form ordered nanostructures with unique physical properties, we explore the assembly of peptide nucleic acids (PNAs), which are short DNA mimics that have an amide backbone. All 16 combinations of the very short di-PNA building blocks were synthesized and assayed for their ability to self-associate. Only three guanine-containing di-PNAs-CG, GC and GG-could form ordered assemblies, as observed by electron microscopy, and these di-PNAs efficiently assembled into discrete architectures within a few minutes. The X-ray crystal structure of the GC di-PNA showed the occurrence of both stacking interactions and Watson-Crick base pairing. The assemblies were also found to exhibit optical properties including voltage-dependent electroluminescence and wide-range excitation-dependent fluorescence in the visible region.

  10. The influence of anharmonic and solvent effects on the theoretical vibrational spectra of the guanine-cytosine base pairs in Watson-Crick and Hoogsteen configurations.

    Science.gov (United States)

    Bende, Attila; Muntean, Cristina M

    2014-03-01

    The theoretical IR and Raman spectra of the guanine-cytosine DNA base pairs in Watson-Crick and Hoogsteen configurations were computed using DFT method with M06-2X meta-hybrid GGA exchange-correlation functional, including the anharmonic corrections and solvent effects. The results for harmonic frequencies and their anharmonic corrections were compared with our previously calculated values obtained with the B3PW91 hybrid GGA functional. Significant differences were obtained for the anharmonic corrections calculated with the two different DFT functionals, especially for the stretching modes, while the corresponding harmonic frequencies did not differ considerable. For the Hoogtseen case the H⁺ vibration between the G-C base pair can be characterized as an asymmetric Duffing oscillator and therefore unrealistic anharmonic corrections for normal modes where this proton vibration is involved have been obtained. The spectral modification due to the anharmonic corrections, solvent effects and the influence of sugar-phosphate group for the Watson-Crick and Hoogsteen base pair configurations, respectively, were also discussed. For the Watson-Crick case also the influence of the stacking interaction on the theoretical IR and Raman spectra was analyzed. Including the anharmonic correction in our normal mode analysis is essential if one wants to obtain correct assignments of the theoretical frequency values as compared with the experimental spectra.

  11. Determination of redox potentials for the Watson-Crick base pairs, DNA nucleosides, and relevant nucleoside analogues.

    Science.gov (United States)

    Crespo-Hernandez, Carlos E; Close, David M; Gorb, Leonid; Leszczynski, Jerzy

    2007-05-17

    Redox potentials for the DNA nucleobases and nucleosides, various relevant nucleoside analogues, Watson-Crick base pairs, and seven organic dyes are presented based on DFT/B3LYP/6-31++G(d,p) and B3YLP/6-311+G(2df,p)//B3LYP/6-31+G* levels of calculations. The values are determined from an experimentally calibrated set of equations that correlate the vertical ionization (electron affinity) energy of 20 organic molecules with their experimental reversible oxidation (reduction) potential. Our results are in good agreement with those estimated experimentally for the DNA nucleosides in acetonitrile solutions (Seidel et al. J. Phys. Chem. 1996, 100, 5541). We have found that nucleosides with anti conformation exhibit lower oxidation potentials than the corresponding syn conformers. The lowering in the oxidation potential is due to the formation of an intramolecular hydrogen bonding interaction between the 5'-OH group of the sugar and the N3 of the purine bases or C2=O of the pyrimidine bases in the syn conformation. Pairing of adenine or guanine with its complementary pyrimidine base decreases its oxidation potential by 0.15 or 0.28 V, respectively. The calculated energy difference between the oxidation potential for the G.C base pair and that of the guanine base is in good agreement with the experimental value estimated recently (0.34 V: Caruso, T.; et al. J. Am. Chem. Soc. 2005, 127, 15040). The complete and consistent set of reversible redox values determined in this work for the DNA constituents is expected to be of considerable value to those studying charge and electronic energy transfer in DNA.

  12. KlenTaq polymerase replicates unnatural base pairs by inducing a Watson-Crick geometry.

    Science.gov (United States)

    Betz, Karin; Malyshev, Denis A; Lavergne, Thomas; Welte, Wolfram; Diederichs, Kay; Dwyer, Tammy J; Ordoukhanian, Phillip; Romesberg, Floyd E; Marx, Andreas

    2012-07-01

    Many candidate unnatural DNA base pairs have been developed, but some of the best-replicated pairs adopt intercalated structures in free DNA that are difficult to reconcile with known mechanisms of polymerase recognition. Here we present crystal structures of KlenTaq DNA polymerase at different stages of replication for one such pair, dNaM-d5SICS, and show that efficient replication results from the polymerase itself, inducing the required natural-like structure.

  13. Solvent effects on hydrogen bonds in Watson-Crick, mismatched, and modified DNA base pairs

    NARCIS (Netherlands)

    Poater, Jordi; Swart, Marcel; Guerra, Celia Fonseca; Bickelhaupt, F. Matthias

    2012-01-01

    We have theoretically analyzed a complete series of Watson–Crick and mismatched DNA base pairs, both in gas phase and in solution. Solvation causes a weakening and lengthening of the hydrogen bonds between the DNA bases because of the stabilization of the lone pairs involved in these bonds. We have

  14. Closure properties of Watson-Crick grammars

    Science.gov (United States)

    Zulkufli, Nurul Liyana binti Mohamad; Turaev, Sherzod; Tamrin, Mohd Izzuddin Mohd; Azeddine, Messikh

    2015-12-01

    In this paper, we define Watson-Crick context-free grammars, as an extension of Watson-Crick regular grammars and Watson-Crick linear grammars with context-free grammar rules. We show the relation of Watson-Crick (regular and linear) grammars to the sticker systems, and study some of the important closure properties of the Watson-Crick grammars. We establish that the Watson-Crick regular grammars are closed under almost all of the main closure operations, while the differences between other Watson-Crick grammars with their corresponding Chomsky grammars depend on the computational power of the Watson-Crick grammars which still need to be studied.

  15. A rule of seven in Watson-Crick base-pairing of mismatched sequences.

    Science.gov (United States)

    Cisse, Ibrahim I; Kim, Hajin; Ha, Taekjip

    2012-05-13

    Sequence recognition through base-pairing is essential for DNA repair and gene regulation, but the basic rules governing this process remain elusive. In particular, the kinetics of annealing between two imperfectly matched strands is not well characterized, despite its potential importance in nucleic acid-based biotechnologies and gene silencing. Here we use single-molecule fluorescence to visualize the multiple annealing and melting reactions of two untethered strands inside a porous vesicle, allowing us to precisely quantify the annealing and melting rates. The data as a function of mismatch position suggest that seven contiguous base pairs are needed for rapid annealing of DNA and RNA. This phenomenological rule of seven may underlie the requirement for seven nucleotides of complementarity to seed gene silencing by small noncoding RNA and may help guide performance improvement in DNA- and RNA-based bio- and nanotechnologies, in which off-target effects can be detrimental.

  16. Weighted Watson-Crick automata

    Energy Technology Data Exchange (ETDEWEB)

    Tamrin, Mohd Izzuddin Mohd [Department of Information System, Kulliyyah of Information and Communication Technology, International Islamic University Malaysia, 50728 Gombak, Selangor (Malaysia); Turaev, Sherzod; Sembok, Tengku Mohd Tengku [Department of Computer Science, Kulliyyah of Information and Communication Technology, International Islamic University Malaysia, 50728 Gombak, Selangor (Malaysia)

    2014-07-10

    There are tremendous works in biotechnology especially in area of DNA molecules. The computer society is attempting to develop smaller computing devices through computational models which are based on the operations performed on the DNA molecules. A Watson-Crick automaton, a theoretical model for DNA based computation, has two reading heads, and works on double-stranded sequences of the input related by a complementarity relation similar with the Watson-Crick complementarity of DNA nucleotides. Over the time, several variants of Watson-Crick automata have been introduced and investigated. However, they cannot be used as suitable DNA based computational models for molecular stochastic processes and fuzzy processes that are related to important practical problems such as molecular parsing, gene disease detection, and food authentication. In this paper we define new variants of Watson-Crick automata, called weighted Watson-Crick automata, developing theoretical models for molecular stochastic and fuzzy processes. We define weighted Watson-Crick automata adapting weight restriction mechanisms associated with formal grammars and automata. We also study the generative capacities of weighted Watson-Crick automata, including probabilistic and fuzzy variants. We show that weighted variants of Watson-Crick automata increase their generative power.

  17. Weighted Watson-Crick automata

    International Nuclear Information System (INIS)

    Tamrin, Mohd Izzuddin Mohd; Turaev, Sherzod; Sembok, Tengku Mohd Tengku

    2014-01-01

    There are tremendous works in biotechnology especially in area of DNA molecules. The computer society is attempting to develop smaller computing devices through computational models which are based on the operations performed on the DNA molecules. A Watson-Crick automaton, a theoretical model for DNA based computation, has two reading heads, and works on double-stranded sequences of the input related by a complementarity relation similar with the Watson-Crick complementarity of DNA nucleotides. Over the time, several variants of Watson-Crick automata have been introduced and investigated. However, they cannot be used as suitable DNA based computational models for molecular stochastic processes and fuzzy processes that are related to important practical problems such as molecular parsing, gene disease detection, and food authentication. In this paper we define new variants of Watson-Crick automata, called weighted Watson-Crick automata, developing theoretical models for molecular stochastic and fuzzy processes. We define weighted Watson-Crick automata adapting weight restriction mechanisms associated with formal grammars and automata. We also study the generative capacities of weighted Watson-Crick automata, including probabilistic and fuzzy variants. We show that weighted variants of Watson-Crick automata increase their generative power

  18. Can tautomerization of the A·T Watson-Crick base pair via double proton transfer provoke point mutations during DNA replication? A comprehensive QM and QTAIM analysis.

    Science.gov (United States)

    Brovarets, Ol'ha O; Hovorun, Dmytro M

    2014-01-01

    Trying to answer the question posed in the title, we have carried out a detailed theoretical investigation of the biologically important mechanism of the tautomerization of the A·T Watson-Crick DNA base pair, information that is hard to establish experimentally. By combining theoretical investigations at the MP2 and density functional theory levels of QM theory with quantum theory of atoms in molecules analysis, the tautomerization of the A·T Watson-Crick base pair by the double proton transfer (DPT) was comprehensively studied in vacuo and in the continuum with a low dielectric constant (ϵ = 4) corresponding to a hydrophobic interfaces of protein-nucleic acid interactions. Based on the sweeps of the electron-topological, geometric, and energetic parameters, which describe the course of the tautomerization along its intrinsic reaction coordinate (IRC), it was proved that the A·T → A(∗)·T(∗) tautomerization through the DPT is a concerted (i.e. the pathway without an intermediate) and asynchronous (i.e. protons move with a time gap) process. The limiting stage of this phenomenon is the final PT along the N6H⋯O4 hydrogen bond (H-bond). The continuum with ϵ = 4 does not affect qualitatively the course of the tautomerization reaction: similar to that observed in vacuo, it proceeds via a concerted asynchronous process with the same structure of the transition state (TS). For the first time, the nine key points along the IRC of the A·T base pair tautomerization, which could be considered as electron-topological "fingerprints" of a concerted asynchronous process of the tautomerization via the DPT, have been identified and fully characterized. These nine key points have been used to define the reactant, TS, and product regions of the DPT in the A·T base pair. Considering the energy dependence of each of the three H-bonds, which stabilize the Watson-Crick and Löwdin's base pairs, along the IRC of the tautomerization, it was found that all these H

  19. Can an Excess Electron Localise on a Purine Moiety in the Adenine-thymine Watson-Crick Base Pair? A Computational Study

    International Nuclear Information System (INIS)

    Mazurkiewicz, Kamil; Haranczyk, Maciej; Gutowski, Maciej S.; Rak, Janusz

    2007-01-01

    The electron affinity and the propensity to electron-induced proton transfer (PT) of hydrogen-bonded complexes between the Watson-Crick adenine-thymine pair (AT) and simple organic acid (HX), attached to adenine in the Hoogsteen-type configuration, were studied at the B3LYP/6-31+G** level. Although the carboxyl group is deprotonated at physiological pH, its neutral form, COOH, resembles the peptide bond or the amide fragment in the side chain of asparagine (Asn) or glutamine (Gln). Thus, these complexes mimic the interaction between the DNA environment (e.g., proteins) and nucleobase pairs incorporated in the biopolymer. Electron attachment is thermodynamically feasible and adiabatic electron affinities range from 0.41 to 1.28 eV, while the vertical detachment energies of the resulting anions span the range of 0.39-2.88 eV. Low-energy activation barriers separate the anionic minima: aHX(AT) from the more stable single-PT anionic geometry, aHX(AT)-SPT, and aHX(AT)-SPT from the double-PT anionic geometry, aHX(AT)-DPT. Interaction between the adenine of the Watson-Crick AT base pair with an acidic proton donor probably counterbalances the larger EA of isolated thymine, as SOMO is almost evenly delocalized over both types of nucleic bases in the aHX(AT) anions. Moreover, as a result of PT the excess electron localizes entirely on adenine. Thus, in DNA interacting with its physiological environment, damage induced by low-energy electrons could begin, contrary to the current view, with the formation of purine anions, which are not formed in isolated DNA because of the greater stability of anionic pyrimidines.

  20. Determination of h2JNN and h1JHN coupling constants across Watson-Crick base pairs in the Antennapedia homeodomain-DNA complex using TROSY

    International Nuclear Information System (INIS)

    Pervushin, Konstantin; Fernandez, Cesar; Riek, Roland; Ono, Akira; Kainosho, Masatsune; Wuethrich, Kurt

    2000-01-01

    This paper describes NMR measurements of 15 N- 15 N and 1 H- 15 N scalar couplings across hydrogen bonds in Watson-Crick base pairs, h2 J NN and h1 J HN , in a 17 kDa Antennapedia homeodomain-DNA complex. A new NMR experiment is introduced which relies on zero-quantum coherence-based transverse relaxation-optimized spectroscopy (ZQ-TROSY) and enables measurements of h1 J HN couplings in larger molecules. The h2 J NN and h1 J HN couplings open a new avenue for comparative studies of DNA duplexes and other forms of nucleic acids free in solution and in complexes with proteins, drugs or possibly other classes of compounds

  1. High-Resolution Crystal Structure of a Silver(I)-RNA Hybrid Duplex Containing Watson-Crick-like C-Silver(I)-C Metallo-Base Pairs.

    Science.gov (United States)

    Kondo, Jiro; Tada, Yoshinari; Dairaku, Takenori; Saneyoshi, Hisao; Okamoto, Itaru; Tanaka, Yoshiyuki; Ono, Akira

    2015-11-02

    Metallo-base pairs have been extensively studied for applications in nucleic acid-based nanodevices and genetic code expansion. Metallo-base pairs composed of natural nucleobases are attractive because nanodevices containing natural metallo-base pairs can be easily prepared from commercially available sources. Previously, we have reported a crystal structure of a DNA duplex containing T-Hg(II)-T base pairs. Herein, we have determined a high-resolution crystal structure of the second natural metallo-base pair between pyrimidine bases C-Ag(I)-C formed in an RNA duplex. One Ag(I) occupies the center between two cytosines and forms a C-Ag(I)-C base pair through N3-Ag(I)-N3 linear coordination. The C-Ag(I)-C base pair formation does not disturb the standard A-form conformation of RNA. Since the C-Ag(I)-C base pair is structurally similar to the canonical Watson-Crick base pairs, it can be a useful building block for structure-based design and fabrication of nucleic acid-based nanodevices. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  2. Accommodation of an N-(deoxyguanosin-8-yl)-2-acetylaminofluorene adduct in the active site of human DNA polymerase ι: Hoogsteen or Watson-Crick base pairing?†

    Science.gov (United States)

    Donny-Clark, Kerry; Shapiro, Robert; Broyde, Suse

    2009-01-01

    Bypass across DNA lesions by specialized polymerases is essential for maintenance of genomic stability. Human DNA polymerase ι (polι) is a bypass polymerase of the Y family. Crystal structures of polι suggest that Hoogsteen base pairing is employed to bypass minor groove DNA lesions, placing them on the spacious major groove side of the enzyme. Primer extension studies have shown that polι is also capable of error-free nucleotide incorporation opposite the bulky major groove adduct N-(deoxyguanosin-8-yl)-2-acetyl-aminofluorene (dG-AAF). We present molecular dynamics simulations and free energy calculations suggesting that Watson-Crick base pairing could be employed in polι for bypass of dG-AAF. In polι with Hoogsteen paired dG-AAF the bulky AAF moiety would reside on the cramped minor groove side of the template. The Hoogsteen-capable conformation distorts the active site, disrupting interactions necessary for error-free incorporation of dC opposite the lesion. Watson-Crick pairing places the AAF rings on the spacious major groove side, similar to the position of minor groove adducts observed with Hoogsteen pairing. Watson-Crick paired structures show a well-ordered active site, with a near reaction-ready ternary complex. Thus our results suggest that polι would utilize the same spacious region for lesion bypass of both major and minor groove adducts. Therefore, purine adducts with bulk on the minor groove side would use Hoogsteen pairing, while adducts with the bulky lesion on the major groove side would utilize Watson-Crick base pairing as indicated by our MD simulations for dG-AAF. This suggests the possibility of an expanded role for polι in lesion bypass. PMID:19072536

  3. 2-Methoxypyridine as a Thymidine Mimic in Watson-Crick Base Pairs of DNA and PNA: Synthesis, Thermal Stability, and NMR Structural Studies.

    Science.gov (United States)

    Novosjolova, Irina; Kennedy, Scott D; Rozners, Eriks

    2017-11-02

    The development of nucleic acid base-pair analogues that use new modes of molecular recognition is important both for fundamental research and practical applications. The goal of this study was to evaluate 2-methoxypyridine as a cationic thymidine mimic in the A-T base pair. The hypothesis was that including protonation in the Watson-Crick base pairing scheme would enhance the thermal stability of the DNA double helix without compromising the sequence selectivity. DNA and peptide nucleic acid (PNA) sequences containing the new 2-methoxypyridine nucleobase (P) were synthesized and studied by using UV thermal melting and NMR spectroscopy. Introduction of P nucleobase caused a loss of thermal stability of ≈10 °C in DNA-DNA duplexes and ≈20 °C in PNA-DNA duplexes over a range of mildly acidic to neutral pH. Despite the decrease in thermal stability, the NMR structural studies showed that P-A formed the expected protonated base pair at pH 4.3. Our study demonstrates the feasibility of cationic unnatural base pairs; however, future optimization of such analogues will be required. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  4. Highly Stable Double-Stranded DNA Containing Sequential Silver(I)-Mediated 7-Deazaadenine/Thymine Watson-Crick Base Pairs.

    Science.gov (United States)

    Santamaría-Díaz, Noelia; Méndez-Arriaga, José M; Salas, Juan M; Galindo, Miguel A

    2016-05-17

    The oligonucleotide d(TX)9 , which consists of an octadecamer sequence with alternating non-canonical 7-deazaadenine (X) and canonical thymine (T) as the nucleobases, was synthesized and shown to hybridize into double-stranded DNA through the formation of hydrogen-bonded Watson-Crick base pairs. dsDNA with metal-mediated base pairs was then obtained by selectively replacing W-C hydrogen bonds by coordination bonds to central silver(I) ions. The oligonucleotide I adopts a duplex structure in the absence of Ag(+) ions, and its stability is significantly enhanced in the presence of Ag(+) ions while its double-helix structure is retained. Temperature-dependent UV spectroscopy, circular dichroism spectroscopy, and ESI mass spectrometry were used to confirm the selective formation of the silver(I)-mediated base pairs. This strategy could become useful for preparing stable metallo-DNA-based nanostructures. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  5. Differential stabilities and sequence-dependent base pair opening dynamics of Watson-Crick base pairs with 5-hydroxymethylcytosine, 5-formylcytosine, or 5-carboxylcytosine.

    Science.gov (United States)

    Szulik, Marta W; Pallan, Pradeep S; Nocek, Boguslaw; Voehler, Markus; Banerjee, Surajit; Brooks, Sonja; Joachimiak, Andrzej; Egli, Martin; Eichman, Brandt F; Stone, Michael P

    2015-02-10

    5-Hydroxymethylcytosine (5hmC), 5-formylcytosine (5fC), and 5-carboxylcytosine (5caC) form during active demethylation of 5-methylcytosine (5mC) and are implicated in epigenetic regulation of the genome. They are differentially processed by thymine DNA glycosylase (TDG), an enzyme involved in active demethylation of 5mC. Three modified Dickerson-Drew dodecamer (DDD) sequences, amenable to crystallographic and spectroscopic analyses and containing the 5'-CG-3' sequence associated with genomic cytosine methylation, containing 5hmC, 5fC, or 5caC placed site-specifically into the 5'-T(8)X(9)G(10)-3' sequence of the DDD, were compared. The presence of 5caC at the X(9) base increased the stability of the DDD, whereas 5hmC or 5fC did not. Both 5hmC and 5fC increased imino proton exchange rates and calculated rate constants for base pair opening at the neighboring base pair A(5):T(8), whereas 5caC did not. At the oxidized base pair G(4):X(9), 5fC exhibited an increase in the imino proton exchange rate and the calculated kop. In all cases, minimal effects to imino proton exchange rates occurred at the neighboring base pair C(3):G(10). No evidence was observed for imino tautomerization, accompanied by wobble base pairing, for 5hmC, 5fC, or 5caC when positioned at base pair G(4):X(9); each favored Watson-Crick base pairing. However, both 5fC and 5caC exhibited intranucleobase hydrogen bonding between their formyl or carboxyl oxygens, respectively, and the adjacent cytosine N(4) exocyclic amines. The lesion-specific differences observed in the DDD may be implicated in recognition of 5hmC, 5fC, or 5caC in DNA by TDG. However, they do not correlate with differential excision of 5hmC, 5fC, or 5caC by TDG, which may be mediated by differences in transition states of the enzyme-bound complexes.

  6. Complexes of DNA bases and Watson-Crick base pairs interaction with neutral silver Agn (n = 8, 10, 12) clusters: a DFT and TDDFT study.

    Science.gov (United States)

    Srivastava, Ruby

    2018-03-01

    We study the binding of the neutral Ag n (n = 8, 10, 12) to the DNA base-adenine (A), guanine (G) and Watson-Crick -adenine-thymine, guanine-cytosine pairs. Geometries of complexes were optimized at the DFT level using the hybrid B3LYP functional. LANL2DZ effective core potential was used for silver and 6-31 + G ** was used for all other atoms. NBO charges were analyzed using the Natural population analysis. The absorption properties of Ag n -A,G/WC complexes were also studied using time-dependent density functional theory. The absorption spectra for these complexes show wavelength in the visible region. It was revealed that silver clusters interact more strongly with WC pairs than with isolated DNA complexes. Furthermore, it was found that the electronic charge transferred from silver to isolated DNA clusters are less than the electronic charge transferred from silver to the Ag n -WC complexes. The vertical ionization potential, vertical electron affinity, hardness, and electrophilicity index of Ag n -DNA/WC complexes have also been discussed.

  7. DFT investigation of the vibrational properties of GC Watson-Crick and Hoogsteen base pairs in the presence of Mg²⁺, Ca²⁺, and Cu²⁺ ions.

    Science.gov (United States)

    Morari, Cristian; Muntean, Cristina M; Tripon, Carmen; Buimaga-Iarinca, Luiza; Calborean, Adrian

    2014-04-01

    The binding effects of Mg²⁺, Ca²⁺, and Cu²⁺ ions on the vibrational properties of guanine-cytosine base pairs have been performed using density functional theory investigations. Both Watson-Crick and Hoogsteen configurations of the base pairs were investigated. In Watson-Crick configuration, the metal was coordinated at N7 atom of guanine, while in the case of Hoogsteen configuration, the coordination is at N3 atom of guanine. We have pointed out the geometric properties of the metal-GC base pairs structure, as well as the vibrational bands that can be used to detect the presence of metallic ions in the Watson-Crick and Hoogsteen GC structures. For the geometric models used by us, the vibrational amplitudes of metallic atoms were stronger for wavenumbers lower than 500 cm⁻¹. This suggests that in the experimental studies on DNA the presence of the three metallic atoms (Mg, Ca, and Cu) can be explicitly detected at low frequencies.

  8. Evidence for Watson-Crick and not Hoogsteen or wobble base pairing in the selection of nucleotides for insertion opposite pyrimidines and a thymine dimer by yeast DNA pol eta.

    Science.gov (United States)

    Hwang, Hanshin; Taylor, John-Stephen

    2005-03-29

    We have recently reported that pyrene nucleotide is preferentially inserted opposite an abasic site, the 3'-T of a thymine dimer, and most undamaged bases by yeast DNA polymerase eta (pol eta). Because pyrene is a nonpolar molecule with no H-bonding ability, the unusually high efficiencies of dPMP insertion are ascribed to its superior base stacking ability, and underscore the importance of base stacking in the selection of nucleotides by pol eta. To investigate the role of H-bonding and base pair geometry in the selection of nucleotides by pol eta, we determined the insertion efficiencies of the base-modified nucleotides 2,6-diaminopurine, 2-aminopurine, 6-chloropurine, and inosine which would make a different number of H-bonds with the template base depending on base pair geometry. Watson-Crick base pairing appears to play an important role in the selection of nucleotide analogues for insertion opposite C and T as evidenced by the decrease in the relative insertion efficiencies with a decrease in the number of Watson-Crick H-bonds and an increase in the number of donor-donor and acceptor-acceptor interactions. The selectivity of nucleotide insertion is greater opposite the 5'-T than the 3'-T of the thymine dimer, in accord with previous work suggesting that the 5'-T is held more rigidly than the 3'-T. Furthermore, insertion of A opposite both Ts of the dimer appears to be mediated by Watson-Crick base pairing and not by Hoogsteen base pairing based on the almost identical insertion efficiencies of A and 7-deaza-A, the latter of which lacks H-bonding capability at N7. The relative efficiencies for insertion of nucleotides that can form Watson-Crick base pairs parallel those for the Klenow fragment, whereas the Klenow fragment more strongly discriminates against mismatches, in accord with its greater shape selectivity. These results underscore the importance of H-bonding and Watson-Crick base pair geometry in the selection of nucleotides by both pol eta and the

  9. Replication infidelity via a mismatch with Watson-Crick geometry.

    Science.gov (United States)

    Bebenek, Katarzyna; Pedersen, Lars C; Kunkel, Thomas A

    2011-02-01

    In describing the DNA double helix, Watson and Crick suggested that "spontaneous mutation may be due to a base occasionally occurring in one of its less likely tautomeric forms." Indeed, among many mispairing possibilities, either tautomerization or ionization of bases might allow a DNA polymerase to insert a mismatch with correct Watson-Crick geometry. However, despite substantial progress in understanding the structural basis of error prevention during polymerization, no DNA polymerase has yet been shown to form a natural base-base mismatch with Watson-Crick-like geometry. Here we provide such evidence, in the form of a crystal structure of a human DNA polymerase λ variant poised to misinsert dGTP opposite a template T. All atoms needed for catalysis are present at the active site and in positions that overlay with those for a correct base pair. The mismatch has Watson-Crick geometry consistent with a tautomeric or ionized base pair, with the pH dependence of misinsertion consistent with the latter. The results support the original idea that a base substitution can originate from a mismatch having Watson-Crick geometry, and they suggest a common catalytic mechanism for inserting a correct and an incorrect nucleotide. A second structure indicates that after misinsertion, the now primer-terminal G • T mismatch is also poised for catalysis but in the wobble conformation seen in other studies, indicating the dynamic nature of the pathway required to create a mismatch in fully duplex DNA.

  10. Observation of H-bond mediated 3hJH2H3coupling constants across Watson-Crick AU base pairs in RNA

    International Nuclear Information System (INIS)

    Luy, Burkhard; Richter, Uwe; DeJong, Eric S.; Sorensen, Ole W.; Marino, John P.

    2002-01-01

    3h J H2H3 trans-hydrogen bond scalar coupling constants have been observed for the first time in Watson-Crick AU base pairs in uniformly 15 N-labeled RNA oligonucleotides using a new 2h J NN -HNN-E. COSY experiment. The experiment utilizes adenosine H2 (AH2) for original polarization and detection, while employing 2h J NN couplings for coherence transfer across the hydrogen bonds (H-bonds). The H3 protons of uracil bases are unperturbed throughout the experiment so that these protons appear as passive spins in E. COSY patterns. 3h J H2H3 coupling constants can therefore be accurately measured in the acquisition dimension from the displacement of the E. COSY multiplet components, which are separated by the relatively large 1 J H3N3 coupling constants in the indirect dimension of the two-dimensional experiment. The 3h J H2H3 scalar coupling constants determined for AU base pairs in the two RNA hairpins examined here have been found to be positive and range in magnitude up to 1.8 Hz. Using a molecular fragment representation of an AU base pair, density functional theory/finite field perturbation theory (DFT/FPT) methods have been applied to attempt to predict the relative contributions of H-bond length and angular geometry to the magnitude of 3h J H2H3 coupling constants. Although the DFT/FPT calculations did not reproduce the full range of magnitude observed experimentally for the 3h J H2H3 coupling constants, the calculations do predict the correct sign and general trends in variation in size of these coupling constants. The calculations suggest that the magnitude of the coupling constants depends largely on H-bond length, but can also vary with differences in base pair geometry. The dependency of the 3h J H2H3 coupling constant on H-bond strength and geometry makes it a new probe for defining base pairs in NMR studies of nucleic acids

  11. How a low-fidelity DNA polymerase chooses non-Watson-Crick from Watson-Crick incorporation.

    Science.gov (United States)

    Wu, Wen-Jin; Su, Mei-I; Wu, Jian-Li; Kumar, Sandeep; Lim, Liang-Hin; Wang, Chun-Wei Eric; Nelissen, Frank H T; Chen, Ming-Chuan Chad; Doreleijers, Jurgen F; Wijmenga, Sybren S; Tsai, Ming-Daw

    2014-04-02

    A dogma for DNA polymerase catalysis is that the enzyme binds DNA first, followed by MgdNTP. This mechanism contributes to the selection of correct dNTP by Watson-Crick base pairing, but it cannot explain how low-fidelity DNA polymerases overcome Watson-Crick base pairing to catalyze non-Watson-Crick dNTP incorporation. DNA polymerase X from the deadly African swine fever virus (Pol X) is a half-sized repair polymerase that catalyzes efficient dG:dGTP incorporation in addition to correct repair. Here we report the use of solution structures of Pol X in the free, binary (Pol X:MgdGTP), and ternary (Pol X:DNA:MgdGTP with dG:dGTP non-Watson-Crick pairing) forms, along with functional analyses, to show that Pol X uses multiple unprecedented strategies to achieve the mutagenic dG:dGTP incorporation. Unlike high fidelity polymerases, Pol X can prebind purine MgdNTP tightly and undergo a specific conformational change in the absence of DNA. The prebound MgdGTP assumes an unusual syn conformation stabilized by partial ring stacking with His115. Upon binding of a gapped DNA, also with a unique mechanism involving primarily helix αE, the prebound syn-dGTP forms a Hoogsteen base pair with the template anti-dG. Interestingly, while Pol X prebinds MgdCTP weakly, the correct dG:dCTP ternary complex is readily formed in the presence of DNA. H115A mutation disrupted MgdGTP binding and dG:dGTP ternary complex formation but not dG:dCTP ternary complex formation. The results demonstrate the first solution structural view of DNA polymerase catalysis, a unique DNA binding mode, and a novel mechanism for non-Watson-Crick incorporation by a low-fidelity DNA polymerase.

  12. The influence of N-7 guanine modifications on the strength of Watson-Crick base pairing and guanine N-1 acidity: Comparison of gas-phase and condensed-phase trends

    Czech Academy of Sciences Publication Activity Database

    Burda, J. V.; Šponer, Jiří; Hrabáková, J.; Zeizinger, M.; Leszczynski, J.

    2003-01-01

    Roč. 107, č. 22 (2003), s. 5349-5356 ISSN 1520-6106 R&D Projects: GA MŠk ME 517; GA MŠk LN00A016 Grant - others:Wellcome Trust(GB) GR067507MF; ONR(US) N00034-03-1-0116; National Science Foundation(US) CREST 9805465 Institutional research plan: CEZ:AV0Z5004920 Keywords : Watson-Crick base pairing * guanines * gas-phase and condensed-phase trends Subject RIV: BO - Biophysics Impact factor: 3.679, year: 2003

  13. Higher order structural effects stabilizing the reverse watson-crick guanine-cytosine base pair in functional RNAs

    KAUST Repository

    Chawla, Mohit; Abdel-Azeim, Safwat; Oliva, Romina; Cavallo, Luigi

    2013-01-01

    of the Guanine can increase its stability. Herein, we extend our survey and report on other H-bonding interactions that can increase the stability of this base pair. To this aim, we performed a bioinformatics search of the PDB to locate all the occurencies of G

  14. Crystal structure of metallo DNA duplex containing consecutive Watson-Crick-like T-Hg(II)-T base pairs.

    Science.gov (United States)

    Kondo, Jiro; Yamada, Tom; Hirose, Chika; Okamoto, Itaru; Tanaka, Yoshiyuki; Ono, Akira

    2014-02-24

    The metallo DNA duplex containing mercury-mediated T-T base pairs is an attractive biomacromolecular nanomaterial which can be applied to nanodevices such as ion sensors. Reported herein is the first crystal structure of a B-form DNA duplex containing two consecutive T-Hg(II)-T base pairs. The Hg(II) ion occupies the center between two T residues. The N3-Hg(II) bond distance is 2.0 Å. The relatively short Hg(II)-Hg(II) distance (3.3 Å) observed in consecutive T-Hg(II)-T base pairs suggests that the metallophilic attraction could exist between them and may stabilize the B-form double helix. To support this, the DNA duplex is largely distorted and adopts an unusual nonhelical conformation in the absence of Hg(II). The structure of the metallo DNA duplex itself and the Hg(II)-induced structural switching from the nonhelical form to the B-form provide the basis for structure-based design of metal-conjugated nucleic acid nanomaterials. Copyright © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  15. Pyrrolo-dC Metal-Mediated Base Pairs in the Reverse Watson-Crick Double Helix: Enhanced Stability of Parallel DNA and Impact of 6-Pyridinyl Residues on Fluorescence and Silver-Ion Binding.

    Science.gov (United States)

    Yang, Haozhe; Mei, Hui; Seela, Frank

    2015-07-06

    Reverse Watson-Crick DNA with parallel-strand orientation (ps DNA) has been constructed. Pyrrolo-dC (PyrdC) nucleosides with phenyl and pyridinyl residues linked to the 6 position of the pyrrolo[2,3-d]pyrimidine base have been incorporated in 12- and 25-mer oligonucleotide duplexes and utilized as silver-ion binding sites. Thermal-stability studies on the parallel DNA strands demonstrated extremely strong silver-ion binding and strongly enhanced duplex stability. Stoichiometric UV and fluorescence titration experiments verified that a single (2py) PyrdC-(2py) PyrdC pair captures two silver ions in ps DNA. A structure for the PyrdC silver-ion base pair that aligns 7-deazapurine bases head-to-tail instead of head-to-head, as suggested for canonical DNA, is proposed. The silver DNA double helix represents the first example of a ps DNA structure built up of bidentate and tridentate reverse Watson-Crick base pairs stabilized by a dinuclear silver-mediated PyrdC pair. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  16. Multi-head Watson-Crick automata

    OpenAIRE

    Chatterjee, Kingshuk; Ray, Kumar Sankar

    2015-01-01

    Inspired by multi-head finite automata and Watson-Crick automata in this paper, we introduce new structure namely multi-head Watson-Crick automata where we replace the single tape of multi-head finite automaton by a DNA double strand. The content of the second tape is determined using a complementarity relation similar to Watson-Crick complementarity relation. We establish the superiority of our model over multi-head finite automata and also show that both the deterministic and non-determinis...

  17. pH-Modulated Watson-Crick duplex-quadruplex equilibria of guanine-rich and cytosine-rich DNA sequences 140 base pairs upstream of the c-kit transcription initiation site.

    Science.gov (United States)

    Bucek, Pavel; Jaumot, Joaquim; Aviñó, Anna; Eritja, Ramon; Gargallo, Raimundo

    2009-11-23

    Guanine-rich regions of DNA are sequences capable of forming G-quadruplex structures. The formation of a G-quadruplex structure in a region 140 base pairs (bp) upstream of the c-kit transcription initiation site was recently proposed (Fernando et al., Biochemistry, 2006, 45, 7854). In the present study, the acid-base equilibria and the thermally induced unfolding of the structures formed by a guanine-rich region and by its complementary cytosine-rich strand in c-kit were studied by means of circular dichroism and molecular absorption spectroscopies. In addition, competition between the Watson-Crick duplex and the isolated structures was studied as a function of pH value and temperature. Multivariate data analysis methods based on both hard and soft modeling were used to allow accurate quantification of the various acid-base species present in the mixtures. Results showed that the G-quadruplex and i-motif coexist with the Watson-Crick duplex over the pH range from 3.0 to 6.5, approximately, under the experimental conditions tested in this study. At pH 7.0, the duplex is practically the only species present.

  18. FT-IR and FT-Raman spectra of 5-chlorocytosine: Solid state simulation and tautomerism. Effect of the chlorine substitution in the Watson-Crick base pair 5-chlorodeoxycytidine-deoxyguanosine

    Science.gov (United States)

    Alcolea Palafox, M.; Rastogi, V. K.; Singh, S. P.

    2018-01-01

    The laser Raman and IR spectra of 5-chlorocytosine have been recorded and accurately assigned in the solid state using Density functional calculations (DFT) together with the linear scaling equation procedure (LSE) and the solid state simulation of the crystal unit cell through a tetramer form. These results remarkably improve those reported previously by other authors. Several new scaling equations were proposed to be used in related molecules. The six main tautomers of the biomolecule 5-chlorocytosine were determined and optimized at the MP2 and CCSD levels, using different basis sets. The relative stabilities were compared with those obtained in cytosine and their 5-halo derivatives. Several relationships between energies, geometric parameters and NBO atomic charges were established. The effect of the chlorine substitution in the fifth position was evaluated through the stability of the Watson-Crick (WC) base pair of 5-chlorodeoxycytidine with deoxyguanosine, and through their vibrational spectra.

  19. Intramolecular CH···O hydrogen bonds in the AI and BI DNA-like conformers of canonical nucleosides and their Watson-Crick pairs. Quantum chemical and AIM analysis.

    Science.gov (United States)

    Yurenko, Yevgen P; Zhurakivsky, Roman O; Samijlenko, Svitlana P; Hovorun, Dmytro M

    2011-08-01

    The aim of this work is to cast some light on the H-bonds in double-stranded DNA in its AI and BI forms. For this purpose, we have performed the MP2 and DFT quantum chemical calculations of the canonical nucleoside conformers, relative to the AI and BI DNA forms, and their Watson-Crick pairs, which were regarded as the simplest models of the double-stranded DNA. Based on the atoms-in-molecules analysis (AIM), five types of the CH···O hydrogen bonds, involving bases and sugar, were detected numerically from 1 to 3 per a conformer: C2'H···O5', C1'H···O2, C6H···O5', C8H···O5', and C6H···O4'. The energy values of H-bonds occupy the range of 2.3-5.6 kcal/mol, surely exceeding the kT value (0.62 kcal/mol). The nucleoside CH···O hydrogen bonds appeared to "survive" turns of bases against the sugar, sometimes in rather large ranges of the angle values, pertinent to certain conformations, which points out to the source of the DNA lability, necessary for the conformational adaptation in processes of its functioning. The calculation of the interactions in the dA·T nucleoside pair gives evidence, that additionally to the N6H···O4 and N1···N3H canonical H-bonds, between the bases adenine and thymine the third one (C2H···O2) is formed, which, though being rather weak (about 1 kcal/mol), satisfies the AIM criteria of H-bonding and may be classified as a true H-bond. The total energy of all the CH···O nontraditional intramolecular H-bonds in DNA nucleoside pairs appeared to be commensurable with the energy of H-bonds between the bases in Watson-Crick pairs, which implies their possible important role in the DNA shaping.

  20. How Mg2+ ion and water network affect the stability and structure of non-Watson-Crick base pairs in E. coli loop E of 5S rRNA: a molecular dynamics and reference interaction site model (RISM) study.

    Science.gov (United States)

    Shanker, Sudhanshu; Bandyopadhyay, Pradipta

    2017-08-01

    The non-Watson-Crick (non-WC) base pairs of Escherichia coli loop E of 5S rRNA are stabilized by Mg 2+ ions through water-mediated interaction. It is important to know the synergic role of Mg 2+ and the water network surrounding Mg 2+ in stabilizing the non-WC base pairs of RNA. For this purpose, free energy change of the system is calculated using molecular dynamics (MD) simulation as Mg 2+ is pulled from RNA, which causes disturbance of the water network. It was found that Mg 2+ remains hexahydrated unless it is close to or far from RNA. In the pentahydrated form, Mg 2+ interacts directly with RNA. Water network has been identified by two complimentary methods; MD followed by a density-based clustering algorithm and three-dimensional-reference interaction site model. These two methods gave similar results. Identification of water network around Mg 2+ and non-WC base pairs gives a clue to the strong effect of water network on the stability of this RNA. Based on sequence analysis of all Eubacteria 5s rRNA, we propose that hexahydrated Mg 2+ is an integral part of this RNA and geometry of base pairs surrounding it adjust to accommodate the [Formula: see text]. Overall the findings from this work can help in understanding the basis of the complex structure and stability of RNA with non-WC base pairs.

  1. NMR solution structure of an N2-guanine DNA adduct derived from the potent tumorigen dibenzo[a,l]pyrene: Intercalation from the minor groove with ruptured Watson-Crick base pairing

    Science.gov (United States)

    Tang, Yijin; Liu, Zhi; Ding, Shuang; Lin, Chin H.; Cai, Yuqin; Rodriguez, Fabian A.; Sayer, Jane M.; Jerina, Donald M.; Amin, Shantu; Broyde, Suse; Geacintov, Nicholas E.

    2012-01-01

    The most potent tumorigen identified among the polycyclic aromatic hydrocarbons (PAH) is the non-planar fjord region dibenzo[a,l]pyrene (DB[a,l]P). It is metabolically activated in vivo through the widely-studied diol epoxide (DE) pathway to form covalent adducts with DNA bases, predominantly guanine and adenine. The (+)-11S,12R,13R,14S DE enantiomer forms adducts via its C14-position with the exocyclic amino group of guanine. Here, we present the first NMR solution structure of a DB[a,l]P-derived adduct, the 14R (+)-trans-anti-DB[a,l]P–N2-dG (DB[a,l]P-dG) lesion in double-stranded DNA. In contrast to the stereochemically identical benzo[a]pyrene-derived N2-dG adduct (B[a]P-dG) in which the B[a]P rings reside in the B-DNA minor groove on the 3’-side of the modifed deoxyguanosine, in the DB[a,l]P-derived adduct the DB[a,l]P rings intercalate into the duplex on the 3’-side of the modified base from the sterically crowded minor groove. Watson-Crick base pairing of the modified guanine with the partner cytosine is broken, but these bases retain some stacking with the bulky DB[a,l]P ring system. This new theme in PAH DE - DNA adduct conformation differs from: (1) the classical intercalation motif where Watson-Crick base-pairing is intact at the lesion site, and (2) the base-displaced intercalation motif in which the damaged base and its partner are extruded from the helix . The structural considerations that lead to the intercalated conformation of the DB[a,l]P-dG lesion in contrast to the minor groove alignment of the B[a]P-dG adduct, and the implications of the DB[a,l]P-dG conformational motif for the recognition of such DNA lesions by the human nucleotide excision repair apparatus, are discussed. PMID:23121427

  2. Nuclear magnetic resonance solution structure of an N(2)-guanine DNA adduct derived from the potent tumorigen dibenzo[a,l]pyrene: intercalation from the minor groove with ruptured Watson-Crick base pairing.

    Science.gov (United States)

    Tang, Yijin; Liu, Zhi; Ding, Shuang; Lin, Chin H; Cai, Yuqin; Rodriguez, Fabian A; Sayer, Jane M; Jerina, Donald M; Amin, Shantu; Broyde, Suse; Geacintov, Nicholas E

    2012-12-04

    The most potent tumorigen identified among the polycyclic aromatic hydrocarbons (PAH) is the nonplanar fjord region dibenzo[a,l]pyrene (DB[a,l]P). It is metabolically activated in vivo through the widely studied diol epoxide (DE) pathway to form covalent adducts with DNA bases, predominantly guanine and adenine. The (+)-11S,12R,13R,14S DE enantiomer forms adducts via its C14 position with the exocyclic amino group of guanine. Here, we present the first nuclear magnetic resonance solution structure of a DB[a,l]P-derived adduct, the 14R-(+)-trans-anti-DB[a,l]P-N(2)-dG (DB[a,l]P-dG) lesion in double-stranded DNA. In contrast to the stereochemically identical benzo[a]pyrene-derived N(2)-dG adduct (B[a]P-dG) in which the B[a]P rings reside in the B-DNA minor groove on the 3'-side of the modifed deoxyguanosine, in the DB[a,l]P-derived adduct the DB[a,l]P rings intercalate into the duplex on the 3'-side of the modified base from the sterically crowded minor groove. Watson-Crick base pairing of the modified guanine with the partner cytosine is broken, but these bases retain some stacking with the bulky DB[a,l]P ring system. This new theme in PAH DE-DNA adduct conformation differs from (1) the classical intercalation motif in which Watson-Crick base pairing is intact at the lesion site and (2) the base-displaced intercalation motif in which the damaged base and its partner are extruded from the helix. The structural considerations that lead to the intercalated conformation of the DB[a,l]P-dG lesion in contrast to the minor groove alignment of the B[a]P-dG adduct, and the implications of the DB[a,l]P-dG conformational motif for the recognition of such DNA lesions by the human nucleotide excision repair apparatus, are discussed.

  3. Why the tautomerization of the G·C Watson-Crick base pair via the DPT does not cause point mutations during DNA replication? QM and QTAIM comprehensive analysis.

    Science.gov (United States)

    Brovarets', Ol'ha O; Hovorun, Dmytro M

    2014-01-01

    The ground-state tautomerization of the G·C Watson-Crick base pair by the double proton transfer (DPT) was comprehensively studied in vacuo and in the continuum with a low dielectric constant (ϵ = 4), corresponding to a hydrophobic interface of protein-nucleic acid interactions, using DFT and MP2 levels of quantum-mechanical (QM) theory and quantum theory "Atoms in molecules" (QTAIM). Based on the sweeps of the electron-topological, geometric, polar, and energetic parameters, which describe the course of the G·C ↔ G*·C* tautomerization (mutagenic tautomers of the G and C bases are marked with an asterisk) through the DPT along the intrinsic reaction coordinate (IRC), it was proved that it is, strictly speaking, a concerted asynchronous process both at the DFT and MP2 levels of theory, in which protons move with a small time gap in vacuum, while this time delay noticeably increases in the continuum with ϵ = 4. It was demonstrated using the conductor-like polarizable continuum model (CPCM) that the continuum with ϵ = 4 does not qualitatively affect the course of the tautomerization reaction. The DPT in the G·C Watson-Crick base pair occurs without any intermediates both in vacuum and in the continuum with ϵ = 4 at the DFT/MP2 levels of theory. The nine key points along the IRC of the G·C base pair tautomerization, which could be considered as electron-topological "fingerprints" of a concerted asynchronous process of the tautomerization via the DPT, have been identified and fully characterized. These key points have been used to define the reactant, transition state, and product regions of the DPT reaction in the G·C base pair. Analysis of the energetic characteristics of the H-bonds allows us to arrive at a definite conclusion that the middle N1H⋯N3/N3H⋯N1 and the lower N2H⋯O2/N2H⋯O2 parallel H-bonds in the G·C/G*·C* base pairs, respectively, are anticooperative, that is, the strengthening of the middle H-bond is accompanied

  4. The first example of a Hoogsteen base-paired DNA duplex in dynamic equilibrium with a Watson-Crick base-paired duplex--a structural (NMR), kinetic and thermodynamic study.

    Science.gov (United States)

    Isaksson, J; Zamaratski, E; Maltseva, T V; Agback, P; Kumar, A; Chattopadhyaya, J

    2001-06-01

    A single-point substitution of the O4' oxygen by a CH2 group at the sugar residue of A6 (i.e. 2'-deoxyaristeromycin moiety) in a self-complementary DNA duplex, 5'-d(C1G2C3G4A5A6T7T8C9G10C11G12)2(-3), has been shown to steer the fully Watson-Crick basepaired DNA duplex (1A), akin to the native counterpart, to a doubly A6:T7 Hoogsteen basepaired (1B) B-type DNA duplex, resulting in a dynamic equilibrium of (1A)(1B): Keq = k1/k(-1) = 0.56+/-0.08. The dynamic conversion of the fully Watson-Crick basepaired (1A) to the partly Hoogsteen basepaired (1B) structure is marginally kinetically and thermodynamically disfavoured [k1 (298K) = 3.9 0.8 sec(-1); deltaHdegrees++ = 164+/-14 kJ/mol; -TdeltaS degrees++ (298K) = -92 kJ/mol giving a deltaG degrees++ 298 of 72 kJ/mol. Ea (k1) = 167 14 kJ/mol] compared to the reverse conversion of the Hoogsteen (1B) to the Watson-Crick (1A) structure [k-1 (298K) = 7.0 0.6 sec-1, deltaH degrees++ = 153 13 kJ/mol; -TdeltaSdegrees++ (298K) = -82 kJ/mol giving a deltaGdegrees++(298) of 71 kJ/mol. Ea (k-1) = 155 13 kJ/mol]. Acomparison of deltaGdegrees++(298) of the forward (k1) and backward (k-1) conversions, (1A)(1B), shows that there is ca 1 kJ/mol preference for the Watson-Crick (1A) over the double Hoogsteen basepaired (1B) DNA duplex, thus giving an equilibrium ratio of almost 2:1 in favour of the fully Watson-Crick basepaired duplex. The chemical environments of the two interconverting DNA duplexes are very different as evident from their widely separated sets of chemical shifts connected by temperature-dependent exchange peaks in the NOESY and ROESY spectra. The fully Watson-Crick basepaired structure (1A) is based on a total of 127 intra, 97 inter and 17 cross-strand distance constraints per strand, whereas the double A6:T7 Hoogsteen basepaired (1B) structure is based on 114 intra, 92 inter and 15 cross-strand distance constraints, giving an average of 22 and 20 NOE distance constraints per residue and strand, respectively. In addition

  5. 1,8-Naphthyridine-2,7-diamine: a potential universal reader of Watson-Crick base pairs for DNA sequencing by electron tunneling.

    Science.gov (United States)

    Liang, Feng; Lindsay, Stuart; Zhang, Peiming

    2012-11-21

    With the aid of Density Functional Theory (DFT), we designed 1,8-naphthyridine-2,7-diamine as a recognition molecule to read DNA base pairs for genomic sequencing by electron tunneling. NMR studies show that it can form stable triplets with both A : T and G : C base pairs through hydrogen bonding. Our results suggest that the naphthyridine molecule should be able to function as a universal base pair reader in a tunneling gap, generating distinguishable signatures under electrical bias for each of DNA base pairs.

  6. Manipulative interplay of two adozelesin molecules with d(ATTAAT)₂achieving ligand-stacked Watson-Crick and Hoogsteen base-paired duplex adducts.

    Science.gov (United States)

    Hopton, Suzanne R; Thompson, Andrew S

    2011-05-17

    Previous structural studies of the cyclopropapyrroloindole (CPI) antitumor antibiotics have shown that these ligands bind covalently edge-on into the minor groove of double-stranded DNA. Reversible covalent modification of the DNA via N3 of adenine occurs in a sequence-specific fashion. Early nuclear magnetic resonance and molecular modeling studies with both mono- and bis-alkylating ligands indicated that the ligands fit tightly within the minor groove, causing little distortion of the helix. In this study, we propose a new binding model for several of the CPI-based analogues, in which the aromatic secondary rings form π-stacked complexes within the minor groove. One of the adducts, formed with adozelesin and the d(ATTAAT)(2) sequence, also demonstrates the ability of these ligands to manipulate the DNA of the binding site, resulting in a Hoogsteen base-paired adduct. Although this type of base pairing has been previously observed with the bisfunctional CPI analogue bizelesin, this is the first time that such an observation has been made with a monoalkylating nondimeric analogue. Together, these results provide a new model for the design of CPI-based antitumor antibiotics, which also has a significant bearing on other structurally related and structurally unrelated minor groove-binding ligands. They indicate the dynamic nature of ligand-DNA interactions, demonstrating both DNA conformational flexibility and the ability of two DNA-bound ligands to interact to form stable covalent modified complexes.

  7. Recognition by nonaromatic and stereochemical subunit-containing polyamides of the four Watson-Crick base pairs in the DNA minor groove.

    Science.gov (United States)

    Zhang, Hong-Fei; Wu, Yan-Ling; Jiang, Shi-Kun; Wang, Pu; Sugiyama, Hiroshi; Chen, Xing-Lai; Zhang, Wen; Ji, Yan-Juan; Guo, Chuan-Xin

    2012-06-18

    In order to develop an optimal subunit as a T-recognition element in hairpin polyamides, 15 novel chirality-modified polyamides containing (R)-α,β-diaminopropionic acid ((R) β α-NH 2), (S)-α,β-diaminopropionic acid ((S) β α-NH 2), (1R,3S)-3-aminocyclopentanecarboxylic acid ((RS) Cp), (1S,3R)-3-amino-cyclopentanecarboxylic acid ((RS) Cp), (1R,3R)-3-aminocyclopentanecarboxylic acid ((RR) Cp) and (1S,3S)-3-amino-cyclopentanecarboxylic acid ((SS) Cp) residues were synthesized. Their binding characteristics to DNA sequences 5'-TGCNCAT-3'/3'-ACGN'GTA-5' (N⋅N'=A⋅T, T⋅A, G⋅C and C⋅G) were systemically studied by surface plasmon resonance (SPR) and molecular simulation (MSim) techniques. SPR showed that polyamide 4, AcIm-(S) β α-NH 2-ImPy-γ-ImPy-β-Py-βDp (β/(S) β α-NH 2 pair), bound to a DNA sequence containing a core binding site of 5'-TGCACAT-3' with a dissociation equilibrium constant (K(D) ) of 4.5×10(-8)  m. This was a tenfold improvement in specificity over 5'-TGCTCAT-3' (K(D) =4.5×10(-7)  M). MSim studies supported the SPR results. More importantly, for the first time, we found that chiral 3-aminocyclopentanecarboxylic acids in polyamides can be employed as base readers with only a small decrease in binding affinity to DNA. In particular, SPR showed that polyamide 9 ((RR) Cp/β pair) had a 15-fold binding preference for 5'-TGCTCAT-3' over 5'-TGCACAT-3'. A large difference in standard free energy change for A⋅T over T⋅A was determined (ΔΔG(o) =5.9 kJ mol(-1) ), as was a twofold decrease in interaction energy by MSim. Moreover, a 1:1 stoichiometry (9 to 5'-TGCTCAT-3'/3'-ACGAGTA-5') was shown by MSim to be optimal for the chiral five-membered cycle to fit the minor groove. Collectively, the study suggests that the (S)-α-amino-β-aminopropionic acid and (1R,3R)-3-aminocyclopentanecarboxylic acid can serve as a T-recognition element, and the stereochemistry and the nature of these subunits significantly influence

  8. Formation of base triplets by non-Watson-Crick bonds mediates homologous recognition in RecA recombination filaments.

    OpenAIRE

    Rao, B J; Radding, C M

    1994-01-01

    Whereas complementary strands of DNA recognize one another by forming Watson-Crick base pairs, the way in which RecA protein enables a single strand to recognize homology in duplex DNA has remained unknown. Recent experiments, however, have shown that a single plus strand in the RecA filament can recognize an identical plus strand via bonds that, by definition, are non-Watson-Crick. In experiments reported here, base substitutions had the same qualitative and quantitative effects on the pairi...

  9. NMR studies of echinomycin bisintercalation complexes with d(A1-C2-G3-T4) and d(T1-C2-G3-A4) duplexes in aqueous solution: sequence-dependent formation of Hoogsteen A1 x T4 and Watson-Crick T1 x A4 base pairs flanking the bisintercalation site

    International Nuclear Information System (INIS)

    Gao, X.; Patel, D.J.

    1988-01-01

    The authors report on two-dimensional proton NMR studies of echinomycin complexes with the self-complementary d(A1-C2-G3-Tr) and d(T1-C2-G3-A4) duplexes in aqueous solution. The exchangeable and nonexchangeable antibiotic and nucleic acid protons in the 1 echinomycin per tetranucleotide duplex complexes have been assigned from analyses of scalar coupling and distance connectivities in two-dimensional data sets records in H 2 O and D 2 O solution. An analysis of the intermolecular NOE patterns for both complexes combined with large upfield imino proton and large downfield phosphorus complexation chemical shift changes demonstrates that the two quinoxaline chromophores of echinomycin bisintercalate into the minor groove surrounding the dC-dG step of each tetranucleotide duplex. Further, the quinoxaline rings selectively stack between A1 and C2 bases in the d(ACGT) complex and between T1 and C2 bases in the d(TCGA) complex. The intermolecular NOE patterns and the base and sugar proton chemical shifts for residues C2 and G3 are virtually identical for the d(ACGT) and d(TCGA) complexes. A large set of intermolecular contacts established from nuclear Overhauser effects (NOEs) between antibiotic and nucleic acid protons in the echinomycin-tetranucleotide complexes in solution are consistent with corresponding contacts reported for echinomycin-oligonucleotide complexes in the crystalline state. The authors demonstrate that the G x G base pairs adopt Watson-Crick pairing in both d(ACGT) and d(TCGA) complexes in solution. By contrast, the A1 x T4 base pairs adopt Hoogsteen pairing for the echinomycin-d(A1-C2-G3-Tr) complex while the T1 x A4 base pairs adopt Watson-Crick pairing for the echinomycin-d(T1-C2-G3-A4) complex in aqueous solution. These results emphasize the role of sequence in discriminating between Watson-Crick and Hoogsteen pairs at base pairs flanking the echinomycin bisintercalation site in solution

  10. Watson-Crick hydrogen bonding of unlocked nucleic acids

    DEFF Research Database (Denmark)

    Langkjær, Niels; Wengel, Jesper; Pasternak, Anna

    2015-01-01

    We herein describe the synthesis of two new unlocked nucleic acid building blocks containing hypoxanthine and 2,6-diaminopurine as nucleobase moieties and their incorporation into oligonucleotides. The modified oligonucleotides were used to examine the thermodynamic properties of UNA against unmo...... unmodified oligonucleotides and the resulting thermodynamic data support that the hydrogen bonding face of UNA is Watson-Crick like....

  11. Crystal structure of an intermolecular 2:1 complex between adenine and thymine. Evidence for both Hoogsteen and 'quasi-Watson-Crick' interactions.

    Science.gov (United States)

    Chandrasekhar, Sosale; Naik, Tangali R Ravikumar; Nayak, Susanta K; Row, Tayur N Guru

    2010-06-15

    The titled complex, obtained by co-crystallization (EtOH/25 degrees C), is apparently the only known complex of the free bases. Its crystal structure, as determined by X-ray diffraction at both 90 K and 313 K, showed that one A-T pair involves a Hoogsteen interaction, and the other a Watson-Crick interaction but only with respect to the adenine unit. The absence of a clear-cut Watson-Crick base pair raises intriguing questions about the basis of the DNA double helix. Copyright 2010 Elsevier Ltd. All rights reserved.

  12. Non-Watson-Crick basepairing and hydration in RNA motifs: molecular dynamics of 5S rRNA loop E

    Czech Academy of Sciences Publication Activity Database

    Réblová, K.; Špačková, Naďa; Štefl, R.; Csaszar, K.; Koča, J.; Leontis, N. B.; Šponer, Jiří

    2003-01-01

    Roč. 84, č. 6 (2003), s. 3564-3582 ISSN 0006-3495 R&D Projects: GA MŠk LN00A016 Grant - others:National Institutes of Health(US) 2R15 GM55898; National Science Foundation(US) CHE-9732563 Institutional research plan: CEZ:AV0Z5004920 Keywords : non-Watson-Crick base pairs * ribosomal RNA * Loop E Subject RIV: BO - Biophysics Impact factor: 4.463, year: 2003

  13. DNA polymerase catalysis in the absence of Watson-Crick hydrogen bonds

    Science.gov (United States)

    Potapova, Olga; Chan, Chikio; DeLucia, Angela M.; Helquist, Sandra A.; Kool, Eric T.; Grindley, Nigel D. F.; Joyce, Catherine M.

    2008-01-01

    We report the first pre-steady-state kinetic studies of DNA replication in the absence of hydrogen bonds. We have used nonpolar nucleotide analogues that mimic the shape of a Watson-Crick base pair in order to investigate the kinetic consequences of a lack of hydrogen bonds in the polymerase reaction catalyzed by the Klenow fragment of DNA Polymerase I from Escherichia coli. With a thymine isostere lacking hydrogen bonding ability in the nascent pair, the efficiency (kpol/Kd) of the polymerase reaction is decreased by 30-fold, affecting ground state (Kd) and transition state (kpol) approximately equally. When both thymine and adenine analogues in the nascent pair lack hydrogen bonding ability, the efficiency of the polymerase reaction is decreased by about 1000-fold, with most the decrease attributable to the transition state. Reactions using nonpolar analogues at the primer terminal base pair demonstrated the requirement for a hydrogen bond between the polymerase and the minor groove of the primer-terminal base. The R668A mutation of Klenow fragment abolished this requirement, identifying R668 as the probable hydrogen bond donor. Detailed examination of the kinetic data suggested that Klenow fragment has an extremely low tolerance of even minor deviations of the analogue base pairs from ideal Watson-Crick geometry. Consistent with this idea, some analogue pairings were better tolerated by Klenow fragment mutants having more spacious active sites. By contrast, the Y-family polymerase Dbh was much less sensitive to changes in base pair dimensions, and more dependent on hydrogen bonding between base-paired partners. PMID:16411765

  14. [Analysis of Conformational Features of Watson-Crick Duplex Fragments by Molecular Mechanics and Quantum Mechanics Methods].

    Science.gov (United States)

    Poltev, V I; Anisimov, V M; Sanchez, C; Deriabina, A; Gonzalez, E; Garcia, D; Rivas, F; Polteva, N A

    2016-01-01

    limits typical for the corresponding family. We observe that popular functionals in density functional theory calculations lead to the overestimated distances between base pairs, while MP2 computations and the newer complex functionals produce the structures that have too close atom-atom contacts. A detailed study of some complementary desoxydinucleoside monophosphate complexes with Na-ions highlights the existence of several energy minima corresponding to BI-conformations, in other words, the complexity of the relief pattern of the potential energy surface of complementary desoxydinucleoside monophosphate complexes. This accounts for variability of conformational parameters of duplex fragments with the same base sequence. Popular molecular mechanics force fields AMBER and CHARMM reproduce most of the conformational characteristics of desoxydinucleoside monophosphates and their complementary complexes with Na-ions but fail to reproduce some details of the dependence of the Watson-Crick duplex conformation on the nucleotide sequence.

  15. Theoretical Study of the Hoogsteen–Watson-Crick Junctions in DNA

    OpenAIRE

    Cubero, Elena; Luque, F. Javier; Orozco, Modesto

    2005-01-01

    A series of d (AT)n oligonucleotides containing mixtures of normal B-type Watson-Crick and antiparallel Hoogsteen helices have been studied using molecular dynamics simulation techniques to analyze the structural and thermodynamic impact of the junction between Watson-Crick and antiparallel Hoogsteen structures. Analysis of molecular dynamics simulations strongly suggests that for all oligonucleotides studied the antiparallel Hoogsteen appears as a reasonable conformation, only slightly less ...

  16. Spatial, Hysteretic, and Adaptive Host-Guest Chemistry in a Metal-Organic Framework with Open Watson-Crick Sites.

    Science.gov (United States)

    Cai, Hong; Li, Mian; Lin, Xiao-Rong; Chen, Wei; Chen, Guang-Hui; Huang, Xiao-Chun; Li, Dan

    2015-09-01

    Biological and artificial molecules and assemblies capable of supramolecular recognition, especially those with nucleobase pairing, usually rely on autonomous or collective binding to function. Advanced site-specific recognition takes advantage of cooperative spatial effects, as in local folding in protein-DNA binding. Herein, we report a new nucleobase-tagged metal-organic framework (MOF), namely ZnBTCA (BTC=benzene-1,3,5-tricarboxyl, A=adenine), in which the exposed Watson-Crick faces of adenine residues are immobilized periodically on the interior crystalline surface. Systematic control experiments demonstrated the cooperation of the open Watson-Crick sites and spatial effects within the nanopores, and thermodynamic and kinetic studies revealed a hysteretic host-guest interaction attributed to mild chemisorption. We further exploited this behavior for adenine-thymine binding within the constrained pores, and a globally adaptive response of the MOF host was observed. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  17. Theoretical study of the Hoogsteen-Watson-Crick junctions in DNA.

    Science.gov (United States)

    Cubero, Elena; Luque, F Javier; Orozco, Modesto

    2006-02-01

    A series of d (AT)(n) oligonucleotides containing mixtures of normal B-type Watson-Crick and antiparallel Hoogsteen helices have been studied using molecular dynamics simulation techniques to analyze the structural and thermodynamic impact of the junction between Watson-Crick and antiparallel Hoogsteen structures. Analysis of molecular dynamics simulations strongly suggests that for all oligonucleotides studied the antiparallel Hoogsteen appears as a reasonable conformation, only slightly less stable than the canonical B-type Watson-Crick one. The junctions between the Watson-Crick and Hoogsteen structures introduces a priori a sharp discontinuity in the helix, because the properties of each type of conformation are very well preserved in the corresponding fragments. However, and quite counterintuitively, junctions do not largely distort the duplex in structural, dynamics or energetic terms. Our results strongly support the possibility that small fragments of antiparallel Hoogsteen duplex might be embedded into large fragments of B-type Watson-Crick helices, making possible protein-DNA interactions that are specific of the antiparallel Hoogsteen conformation.

  18. Theoretical Study of the Hoogsteen–Watson-Crick Junctions in DNA

    Science.gov (United States)

    Cubero, Elena; Luque, F. Javier; Orozco, Modesto

    2006-01-01

    A series of d (AT)n oligonucleotides containing mixtures of normal B-type Watson-Crick and antiparallel Hoogsteen helices have been studied using molecular dynamics simulation techniques to analyze the structural and thermodynamic impact of the junction between Watson-Crick and antiparallel Hoogsteen structures. Analysis of molecular dynamics simulations strongly suggests that for all oligonucleotides studied the antiparallel Hoogsteen appears as a reasonable conformation, only slightly less stable than the canonical B-type Watson-Crick one. The junctions between the Watson-Crick and Hoogsteen structures introduces a priori a sharp discontinuity in the helix, because the properties of each type of conformation are very well preserved in the corresponding fragments. However, and quite counterintuitively, junctions do not largely distort the duplex in structural, dynamics or energetic terms. Our results strongly support the possibility that small fragments of antiparallel Hoogsteen duplex might be embedded into large fragments of B-type Watson-Crick helices, making possible protein-DNA interactions that are specific of the antiparallel Hoogsteen conformation. PMID:16287814

  19. An unusual mode of DNA duplex association: Watson-Crick interaction of all-purine deoxyribonucleic acids.

    Science.gov (United States)

    Battersby, Thomas R; Albalos, Maria; Friesenhahn, Michel J

    2007-05-01

    Nucleic acid duplexes associating through purine-purine base pairing have been constructed and characterized in a remarkable demonstration of nucleic acids with mixed sequence and a natural backbone in an alternative duplex structure. The antiparallel deoxyribose all-purine duplexes associate specifically through Watson-Crick pairing, violating the nucleobase size-complementarity pairing convention found in Nature. Sequence-specific recognition displayed by these structures makes the duplexes suitable, in principle, for information storage and replication fundamental to molecular evolution in all living organisms. All-purine duplexes can be formed through association of purines found in natural ribonucleosides. Key to the formation of these duplexes is the N(3)-H tautomer of isoguanine, preferred in the duplex, but not in aqueous solution. The duplexes have relevance to evolution of the modern genetic code and can be used for molecular recognition of natural nucleic acids.

  20. Effect of electronic coupling of Watson-Crick hopping in DNA poly(dA)-poly(dT)

    Science.gov (United States)

    Risqi, A. M.; Yudiarsah, E.

    2017-07-01

    Charge transport properties of poly(dA)-poly(dT) DNA has been studied by using thigh binding Hamiltonian approach. Molecule DNA that we use consist of 32 base pair of adenine (A) and thymine (T) and backbone is consist of phosphate and sugar. The molecule DNA is contacted electrode at both ends. Charge transport in molecule DNA depend on the environment, we studied the effect of electronic coupling of Watson-Crick hopping in poly(dA)-poly(dT) DNA to transmission probability and characteristic I-V. The electronic coupling constant influence charge transport between adenine-thymine base pairs at the same site. Transmission probability is studied by using transfer matrix and scattering matrix method, and the result of transmission probability is used to calculate the characteristic I-V by using formula Landauer Buttiker. The result shows that when the electronic coupling increase then transmission probability and characteristic I-V increase slightly.

  1. How many tautomerization pathways connect Watson-Crick-like G*·T DNA base mispair and wobble mismatches?

    Science.gov (United States)

    Brovarets', Ol'ha O; Hovorun, Dmytro M

    2015-01-01

    In this study, we have theoretically demonstrated the intrinsic ability of the wobble G·T(w)/G*·T*(w)/G·T(w1)/G·T(w2) and Watson-Crick-like G*·T(WC) DNA base mispairs to interconvert into each other via the DPT tautomerization. We have established that among all these transitions, only one single G·T(w) ↔ G*·T(WC) pathway is eligible from a biological perspective. It involves short-lived intermediate - the G·T*(WC) base mispair - and is governed by the planar, highly stable, and zwitterionic [Formula: see text] transition state stabilized by the participation of the unique pattern of the five intermolecular O6(+)H⋯O4(-), O6(+)H⋯N3(-), N1(+)H⋯N3(-), N1(+)H⋯O2(-), and N2(+)H⋯O2(-) H-bonds. This non-dissociative G·T(w) ↔ G*·T(WC) tautomerization occurs without opening of the pair: Bases within mispair remain connected by 14 different patterns of the specific intermolecular interactions that successively change each other along the IRC. Novel kinetically controlled mechanism of the thermodynamically non-equilibrium spontaneous point GT/TG incorporation errors has been suggested. The mutagenic effect of the analogues of the nucleotide bases, in particular 5-bromouracil, can be attributed to the decreasing of the barrier of the acquisition by the wobble pair containing these compounds of the enzymatically competent Watson-Crick's geometry via the intrapair mutagenic tautomerization directly in the essentially hydrophobic recognition pocket of the replication DNA-polymerase machinery. Proposed approaches are able to explain experimental data, namely growth of the rate of the spontaneous point incorporation errors during DNA biosynthesis with increasing temperature.

  2. Visualizing Transient Watson-Crick Like Mispairs in DNA and RNA Duplexes

    Science.gov (United States)

    Kimsey, Isaac J.; Petzold, Katja; Sathyamoorthy, Bharathwaj; Stein, Zachary W.; Al-Hashimi, Hashim M.

    2015-01-01

    Rare tautomeric and anionic nucleobases are believed to play fundamental biological roles but their prevalence and functional importance has remained elusive because they exist transiently, in low-abundance, and involve subtle movements of protons that are difficult to visualize. Using NMR relaxation dispersion, we show that wobble dG•dT and rG•rU mispairs in DNA and RNA duplexes exist in dynamic equilibrium with short-lived, low-populated Watson-Crick like mispairs that are stabilized by rare enolic or anionic bases. These mispairs can evade Watson-Crick fidelity checkpoints and form with probabilities (10−3-10−5) that strongly imply a universal role in replication and translation errors. Our results indicate that rare tautomeric and anionic bases are widespread in nucleic acids, expanding their structural and functional complexity beyond that attainable with canonical bases. PMID:25762137

  3. Visualizing transient Watson-Crick-like mispairs in DNA and RNA duplexes.

    Science.gov (United States)

    Kimsey, Isaac J; Petzold, Katja; Sathyamoorthy, Bharathwaj; Stein, Zachary W; Al-Hashimi, Hashim M

    2015-03-19

    Rare tautomeric and anionic nucleobases are believed to have fundamental biological roles, but their prevalence and functional importance has remained elusive because they exist transiently, in low abundance, and involve subtle movements of protons that are difficult to visualize. Using NMR relaxation dispersion, we show here that wobble dG•dT and rG•rU mispairs in DNA and RNA duplexes exist in dynamic equilibrium with short-lived, low-populated Watson-Crick-like mispairs that are stabilized by rare enolic or anionic bases. These mispairs can evade Watson-Crick fidelity checkpoints and form with probabilities (10(-3) to 10(-5)) that strongly imply a universal role in replication and translation errors. Our results indicate that rare tautomeric and anionic bases are widespread in nucleic acids, expanding their structural and functional complexity beyond that attainable with canonical bases.

  4. Estimation of strength in different extra Watson-Crick hydrogen bonds in DNA double helices through quantum chemical studies.

    Science.gov (United States)

    Bandyopadhyay, D; Bhattacharyya, D

    2006-10-15

    It was shown earlier, from database analysis, model building studies, and molecular dynamics simulations that formation of cross-strand bifurcated or Extra Watson-Crick hydrogen (EWC) bonds between successive base pairs may lead to extra rigidity to DNA double helices of certain sequences. The strengths of these hydrogen bonds are debatable, however, as they do not have standard linear geometry criterion. We have therefore carried out detailed ab initio quantum chemical studies using RHF/6-31G(2d,2p) and B3LYP/6-31G(2p,2d) basis sets to determine strengths of several bent hydrogen bonds with different donor and acceptors. Interaction energy calculations, corrected for the basis set superposition errors, suggest that N-H...O type bent EWC hydrogen bonds are possible along same strands or across the strands between successive base pairs, leading to significant stability (ca. 4-9 kcal/mol). The N-H...N and C-H...O type interactions, however, are not so stabilizing. Hence, consideration of EWC N-H...O H-bonds can lead to a better understanding of DNA sequence directed structural features. Copyright (c) 2006 Wiley Periodicals, Inc.

  5. Nanoswitches based on DNA base pairs: why adenine-thymine is less suitable than guanine-cytosine

    NARCIS (Netherlands)

    Fonseca Guerra, C.; van der Wijst, T.; Bickelhaupt, F.M.

    2006-01-01

    Substituted Watson-Crick guanine-cytosine (GC) base pairs were recently shown to yield robust three-state nanoswitches. Here, we address the question: Can such supramolecular switches also be based on Watson-Crick adenine-thymine (AT) base pairs? We have theoretically analyzed AT pairs in which

  6. Non-Watson-Crick structures in oligodeoxynucleotides: Self-association of d(TpCpGpA) stabilized at acidic pH

    International Nuclear Information System (INIS)

    Topping, R.J.; Stone, M.P.; Brush, C.K.; Harris, T.M.

    1988-01-01

    The 1 H NMR spectrum of the tetradeoxynucleotide d(TpCpGpA) was examined as a function of temperature, pH, and concentration. At pH 7 and above the solution conformation for this oligodeoxynucleotide appears to be a mixture of random coil and Watson-Crick duplex. At 25 degree C, a pH titration of d(TpCpGaA) shown that distinct conformational changes occur as the pH is lowered below 7.0. These conformational changes are reversible upon readjusting the pH to neutrality, indicating the presence of a pH-dependent set of conformational equilibria. At 25 degree C, the various conformational state in the mixture are in rapid exchange on the NMR time scale. Examination of the titration curve shown the presence of distinct conformational states at pH greater than 7, and between pH 4 and pH 5. When the pH titration is repeated at 5 degree C, the conformational equilibria are in slow exchange on the NMR time scale; distinct signals from each conformational state are observable. The stable conformational state present between pH 4 and pH 5 represents an ordered conformation of d(TpCpGpA) which dissociates to a less ordered structure upon raising the temperature. The ordered conformation differs from the Watson-Crick helix, as is shown from nuclear Overhauser enhancement experiments, as well as chemical shift data. These results indicate that their ordered conformation is similar to the conformation of d(TpCpGpA) observed between pH 4 and pH 5. In the present case it is likely that stabilization of an ordered duplex conformation for d(TpCpGpA) is achieved by protonation of cytosine. A possible model which could explain the data involves formation of Hoogsteen C + :G base pairs

  7. Probing the Watson-Crick, wobble, and sugar-edge hydrogen bond sites of uracil and thymine.

    Science.gov (United States)

    Müller, Andreas; Frey, Jann A; Leutwyler, Samuel

    2005-06-16

    The nucleobases uracil (U) and thymine (T) offer three hydrogen-bonding sites for double H-bond formation via neighboring N-H and C=O groups, giving rise to the Watson-Crick, wobble and sugar-edge hydrogen bond isomers. We probe the hydrogen bond properties of all three sites by forming hydrogen bonded dimers of U, 1-methyluracil (1MU), 3-methyluracil (3MU), and T with 2-pyridone (2PY). The mass- and isomer-specific S1 origins exhibit large spectral blue shifts relative to the 2PY monomer. Ab initio CIS calculations of the spectral shifts of the different hydrogen-bonded dimers show a linear correlation with experiment. This correlation allows us to identify the R2PI spectra of the weakly populated Watson-Crick and wobble isomers of both 2PY.U and 2PY.T. (3) PW91 density functional calculation of the ground-state binding and dissociation energies De and D0 are in agreement with the assignment of the dominant hydrogen bond isomers of 2PY.U, 2PY.3MU and 2PY.T as the sugar-edge form. For 2PY.U, 2PY.T and 2PY.1MU the measured wobble:Watson-Crick:sugar-edge isomer ratios are in good agreement with the calculated ratios, based on the ab initio dissociation energies and gas-phase statistical mechanics. The Watson-Crick and wobble isomers are thereby determined to be several kcal/mol less strongly bound than the sugar-edge isomers. The 36 observed intermolecular frequencies of the nine different H-bonded isomers give detailed insight into the intermolecular force field.

  8. Human DNA primase uses Watson-Crick hydrogen bonds to distinguish between correct and incorrect nucleoside triphosphates.

    Science.gov (United States)

    Moore, Chad L; Zivkovic, Aleksandra; Engels, Joachim W; Kuchta, Robert D

    2004-09-28

    Human DNA primase synthesizes short RNA primers that DNA polymerase alpha further elongates. Primase readily misincorporates the natural NTPs and will generate a wide variety of mismatches. In contrast, primase exhibited a remarkable resistance to polymerizing NTPs containing unnatural bases. This included bases whose shape was almost identical to the natural bases (4-aminobenzimidazole and 4,6-difluorobenzimidazole), bases shaped very differently than a natural base [e.g., 5- and 6-(trifluoromethyl)benzimidazole], bases much more hydrophobic than a natural base [e.g., 4- and 7-(trifluoromethyl)benzimidazole], bases of similar hydrophobicity as a natural base but with the Watson-Crick hydrogen-bonding groups in unusual positions (7-beta-D-guanine), and bases capable of forming only one Watson-Crick hydrogen bond with the template base (purine and 4-aminobenzimidazole). Primase only polymerized NTP analogues containing bases capable of forming hydrogen bonds between the equivalent of both N-1 and the exocyclic group at C-6 of a purine NTP (2-fluoroadenine, 2-chloroadenine, 3-deazaadenine, and hypoxanthine) and N-3 and the exocyclic group at C-4 of a pyrimidine. These data indicate that human primase requires the formation of Watson-Crick hydrogen bonds in order to polymerize a NTP, a situation very different than what is observed with some DNA polymerases. The implications of these results with respect to current theories of how polymerases discriminate between right and wrong (d)NTPs are discussed.

  9. Highly Accurate Classification of Watson-Crick Basepairs on Termini of Single DNA Molecules

    Science.gov (United States)

    Winters-Hilt, Stephen; Vercoutere, Wenonah; DeGuzman, Veronica S.; Deamer, David; Akeson, Mark; Haussler, David

    2003-01-01

    We introduce a computational method for classification of individual DNA molecules measured by an α-hemolysin channel detector. We show classification with better than 99% accuracy for DNA hairpin molecules that differ only in their terminal Watson-Crick basepairs. Signal classification was done in silico to establish performance metrics (i.e., where train and test data were of known type, via single-species data files). It was then performed in solution to assay real mixtures of DNA hairpins. Hidden Markov Models (HMMs) were used with Expectation/Maximization for denoising and for associating a feature vector with the ionic current blockade of the DNA molecule. Support Vector Machines (SVMs) were used as discriminators, and were the focus of off-line training. A multiclass SVM architecture was designed to place less discriminatory load on weaker discriminators, and novel SVM kernels were used to boost discrimination strength. The tuning on HMMs and SVMs enabled biophysical analysis of the captured molecule states and state transitions; structure revealed in the biophysical analysis was used for better feature selection. PMID:12547778

  10. Insights into Watson-Crick/Hoogsteen breathing dynamics and damage repair from the solution structure and dynamic ensemble of DNA duplexes containing m1A.

    Science.gov (United States)

    Sathyamoorthy, Bharathwaj; Shi, Honglue; Zhou, Huiqing; Xue, Yi; Rangadurai, Atul; Merriman, Dawn K; Al-Hashimi, Hashim M

    2017-05-19

    In the canonical DNA double helix, Watson-Crick (WC) base pairs (bps) exist in dynamic equilibrium with sparsely populated (∼0.02-0.4%) and short-lived (lifetimes ∼0.2-2.5 ms) Hoogsteen (HG) bps. To gain insights into transient HG bps, we used solution-state nuclear magnetic resonance spectroscopy, including measurements of residual dipolar couplings and molecular dynamics simulations, to examine how a single HG bp trapped using the N1-methylated adenine (m1A) lesion affects the structural and dynamic properties of two duplexes. The solution structure and dynamic ensembles of the duplexes reveals that in both cases, m1A forms a m1A•T HG bp, which is accompanied by local and global structural and dynamic perturbations in the double helix. These include a bias toward the BI backbone conformation; sugar repuckering, major-groove directed kinking (∼9°); and local melting of neighboring WC bps. These results provide atomic insights into WC/HG breathing dynamics in unmodified DNA duplexes as well as identify structural and dynamic signatures that could play roles in m1A recognition and repair. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  11. Wobble↔Watson-Crick tautomeric transitions in the homo-purine DNA mismatches: a key to the intimate mechanisms of the spontaneous transversions.

    Science.gov (United States)

    Brovarets', Ol'ha O; Hovorun, Dmytro M

    2015-01-01

    The intrinsic capability of the homo-purine DNA base mispairs to perform wobble↔Watson-Crick/Topal-Fresco tautomeric transitions via the sequential intrapair double proton transfer was discovered for the first time using QM (MP2/DFT) and QTAIM methodologies that are crucial for understanding the microstructural mechanisms of the spontaneous transversions.

  12. Molecular dynamics analysis of stabilities of the telomeric Watson-Crick duplex and the associated i-motif as a function of pH and temperature.

    Science.gov (United States)

    Panczyk, Tomasz; Wolski, Pawel

    2018-06-01

    This work deals with a molecular dynamics analysis of the protonated and deprotonated states of the natural sequence d[(CCCTAA) 3 CCCT] of the telomeric DNA forming the intercalated i-motif or paired with the sequence d[(CCCTAA) 3 CCCT] and forming the Watson-Crick (WC) duplex. By utilizing the amber force field for nucleic acids we built the i-motif and the WC duplex either with native cytosines or using their protonated forms. We studied, by applying molecular dynamics simulations, the role of hydrogen bonds between cytosines or in cytosine-guanine pairs in the stabilization of both structures in the physiological fluid. We found that hydrogen bonds exist in the case of protonated i-motif and in the standard form of the WC duplex. They, however, vanish in the case of the deprotonated i-motif and protonated form of the WC duplex. By determining potentials of mean force in the enforced unwrapping of these structures we found that the protonated i-motif is thermodynamically the most stable. Its deprotonation leads to spontaneous and observed directly in the unbiased calculations unfolding of the i-motif to the hairpin structure at normal temperature. The WC duplex is stable in its standard form and its slight destabilization is observed at the acidic pH. However, the protonated WC duplex unwraps very slowly at 310 K and its decomposition was not observed in the unbiased calculations. At higher temperatures (ca. 400 K or more) the WC duplex unwraps spontaneously. Copyright © 2018. Published by Elsevier B.V.

  13. DNA with Parallel Strand Orientation: A Nanometer Distance Study with Spin Labels in the Watson-Crick and the Reverse Watson-Crick Double Helix.

    Science.gov (United States)

    Wunnicke, Dorith; Ding, Ping; Yang, Haozhe; Seela, Frank; Steinhoff, Heinz-Jürgen

    2015-10-29

    Parallel-stranded (ps) DNA characterized by its sugar-phosphate backbones pointing in the same direction represents an alternative pairing system to antiparallel-stranded (aps) DNA with the potential to inhibit transcription and translation. 25-mer oligonucleotides were selected containing only dA·dT base pairs to compare spin-labeled nucleobase distances over a range of 10 or 15 base pairs in ps DNA with those in aps DNA. By means of the copper(I)-catalyzed Huisgen-Meldal-Sharpless alkyne-azide cycloaddition, the spin label 4-azido-2,2,6,6-tetramethylpiperidine-1-oxyl was clicked to 7-ethynyl-7-deaza-2'-deoxyadenosine or 5-ethynyl-2'-deoxyuridine to yield 25-mer oligonucleotides incorporating two spin labels. The interspin distances between spin labeled residues were determined by pulse EPR spectroscopy. The results reveal that in ps DNA these distances are between 5 and 10% longer than in aps DNA when the labeled DNA segment is located near the center of the double helix. The interspin distance in ps DNA becomes shorter compared with aps DNA when one of the spin labels occupies a position near the end of the double helix.

  14. Single-stranded γPNAs for in vivo site-specific genome editing via Watson-Crick recognition.

    Science.gov (United States)

    Bahal, Raman; Quijano, Elias; McNeer, Nicole A; Liu, Yanfeng; Bhunia, Dinesh C; Lopez-Giraldez, Francesco; Fields, Rachel J; Saltzman, William M; Ly, Danith H; Glazer, Peter M

    2014-01-01

    Triplex-forming peptide nucleic acids (PNAs) facilitate gene editing by stimulating recombination of donor DNAs within genomic DNA via site-specific formation of altered helical structures that further stimulate DNA repair. However, PNAs designed for triplex formation are sequence restricted to homopurine sites. Herein we describe a novel strategy where next generation single-stranded gamma PNAs (γPNAs) containing miniPEG substitutions at the gamma position can target genomic DNA in mouse bone marrow at mixed-sequence sites to induce targeted gene editing. In addition to enhanced binding, γPNAs confer increased solubility and improved formulation into poly(lactic-co-glycolic acid) (PLGA) nanoparticles for efficient intracellular delivery. Single-stranded γPNAs induce targeted gene editing at frequencies of 0.8% in mouse bone marrow cells treated ex vivo and 0.1% in vivo via IV injection, without detectable toxicity. These results suggest that γPNAs may provide a new tool for induced gene editing based on Watson-Crick recognition without sequence restriction.

  15. The nature of the transition mismatches with Watson-Crick architecture: the G*·T or G·T* DNA base mispair or both? A QM/QTAIM perspective for the biological problem.

    Science.gov (United States)

    Brovarets', Ol'ha O; Hovorun, Dmytro M

    2015-01-01

    This study provides the first accurate investigation of the tautomerization of the biologically important guanine*·thymine (G*·T) DNA base mispair with Watson-Crick geometry, involving the enol mutagenic tautomer of the G and the keto tautomer of the T, into the G·T* mispair (∆G = .99 kcal mol(-1), population = 15.8% obtained at the MP2 level of quantum-mechanical theory in the continuum with ε = 4), formed by the keto tautomer of the G and the enol mutagenic tautomer of the T base, using DFT and MP2 methods in vacuum and in the weakly polar medium (ε = 4), characteristic for the hydrophobic interfaces of specific protein-nucleic acid interactions. We were first able to show that the G*·T↔G·T* tautomerization occurs through the asynchronous concerted double proton transfer along two antiparallel O6H···O4 and N1···HN3 H-bonds and is assisted by the third N2H···O2 H-bond, that exists along the entire reaction pathway. The obtained results indicate that the G·T* base mispair is stable from the thermodynamic point of view complex, while it is dynamically unstable structure in vacuum and dynamically stable structure in the continuum with ε = 4 with lifetime of 6.4·10(-12) s, that, on the one side, makes it possible to develop all six low-frequency intermolecular vibrations, but, on the other side, it is by three orders less than the time (several ns) required for the replication machinery to forcibly dissociate a base pair into the monomers during DNA replication. One of the more significant findings to emerge from this study is that the short-lived G·T* base mispair, which electronic interaction energy between the bases (-23.76 kcal mol(-1)) exceeds the analogical value for the G·C Watson-Crick nucleobase pair (-20.38 kcal mol(-1)), "escapes from the hands" of the DNA replication machinery by fast transforming into the G*·T mismatch playing an indirect role of its supplier during the DNA replication. So

  16. Watson-Crick hydrogen bonds : Nature and role in DNA replication

    NARCIS (Netherlands)

    Guerra, Célia Fonseca; Bickelhaupt, F. Matthias

    2006-01-01

    The hydrogen bonds in DNA Watson–Crick base pairs have long been considered predominantly electrostatic phenomena. In this chapter, we show with state-of-the-art calculations that this is not true and that electrostatic interactions and covalent contributions in these hydrogen bonds are in fact of

  17. Widespread Transient Hoogsteen Base-Pairs in Canonical Duplex DNA with Variable Energetics

    Science.gov (United States)

    Alvey, Heidi S.; Gottardo, Federico L.; Nikolova, Evgenia N.; Al-Hashimi, Hashim M.

    2015-01-01

    Hoogsteen base-pairing involves a 180 degree rotation of the purine base relative to Watson-Crick base-pairing within DNA duplexes, creating alternative DNA conformations that can play roles in recognition, damage induction, and replication. Here, using Nuclear Magnetic Resonance R1ρ relaxation dispersion, we show that transient Hoogsteen base-pairs occur across more diverse sequence and positional contexts than previously anticipated. We observe sequence-specific variations in Hoogsteen base-pair energetic stabilities that are comparable to variations in Watson-Crick base-pair stability, with Hoogsteen base-pairs being more abundant for energetically less favorable Watson-Crick base-pairs. Our results suggest that the variations in Hoogsteen stabilities and rates of formation are dominated by variations in Watson-Crick base pair stability, suggesting a late transition state for the Watson-Crick to Hoogsteen conformational switch. The occurrence of sequence and position-dependent Hoogsteen base-pairs provide a new potential mechanism for achieving sequence-dependent DNA transactions. PMID:25185517

  18. Tautomeric transition between wobble A·C DNA base mispair and Watson-Crick-like A·C* mismatch: microstructural mechanism and biological significance.

    Science.gov (United States)

    Brovarets', Ol'ha O; Hovorun, Dmytro M

    2015-06-21

    Here, we use MP2/DFT quantum-chemical methods combined with Quantum Theory of Atoms in Molecules to study the tautomeric transition between wobble A·C(w) mismatch and Watson-Crick-like A·C*(WC) base mispair, proceeding non-dissociatively via sequential proton transfer between bases through the planar, highly stable and zwitterionic TS(A∙C-)(A∙C(W)A∙C&(WC)) transition state joined by the participation of (A)N6(+)H∙∙∙N4(-)(C), (A)N1(+)H∙∙∙N4(-)(C) and (A)C2(+)H∙∙∙N3(-)(C) H-bonds. Notably, the A·C(w) ↔ A·C*(WC) tautomerization reaction is accompanied by 10 unique patterns of the specific intermolecular interactions that consistently replace each other. Our data suggest that biologically significant A·C(w) → A·C*(WC) tautomerization is a kinetically controlled pathway for formation of the enzymatically competent Watson-Crick-like A·C*(WC) DNA base mispair in the essentially hydrophobic recognition pocket of the high-fidelity DNA-polymerase, responsible for the occurrence of spontaneous point AC/CA incorporation errors during DNA biosynthesis.

  19. Structure of 2,4-Diaminopyrimidine - Theobromine Alternate Base Pairs

    Science.gov (United States)

    Gengeliczki, Zsolt; Callahan, Michael P.; Kabelac, Martin; Rijs, Anouk M.; deVries, Mattanjah S.

    2011-01-01

    We report the structure of clusters of 2,4-diaminopyrimidine with 3,7-dimethylxanthine (theobromine) in the gas phase determined by IR-UV double resonance spectroscopy in both the near-IR and mid-IR regions in combination with ab initio computations. These clusters represent potential alternate nucleobase pairs, geometrically equivalent to guanine-cytosine. We have found the four lowest energy structures, which include the Watson-Crick base pairing motif. This Watson-Crick structure has not been observed by resonant two-photon ionization (R2PI) in the gas phase for the canonical DNA base pairs.

  20. Design of two and three input molecular logic gates using non-Watson-Crick base pairing-based molecular beacons.

    Science.gov (United States)

    Lin, Jia-Hui; Tseng, Wei-Lung

    2014-03-21

    This study presents a single, resettable, and sensitive molecular beacon (MB) used to operate molecular-scale logic gates. The MB consists of a random DNA sequence, a fluorophore at the 5'-end, and a quencher at the 3'-end. The presence of Hg(2+), Ag(+), and coralyne promoted the formation of stable T-Hg(2+)-T, C-Ag(+)-C, and A2-coralyne-A2 coordination in the MB probe, respectively, thereby driving its conformational change. The metal ion or small molecule-mediated coordination of mismatched DNA brought the fluorophore and the quencher into close proximity, resulting in collisional quenching of fluorescence between the two organic dyes. Because thiol can bind Hg(2+) and remove it from the T-Hg(2+)-T-based MB, adding thiol to a solution of the T-Hg(2+)-T-based MB allowed the fluorophore and the quencher to be widely separated. A similar phenomenon was observed when replacing Hg(2+) with Ag(+). Because Ag(+) strongly binds to iodide, cyanide, and cysteine, they were capable of removing Ag(+) from the C-Ag(+)-C-based MB, restoring the fluorescence of the MB. Moreover, the fluorescence of the A2-coralyne-A2-based MB could be switched on by adding polyadenosine. Using these analytes as inputs and the MB as a signal transducer, we successfully developed a series of two-input, three-input, and set-reset logic gates at the molecular level.

  1. Physico-chemical profiles of the wobble ↔ Watson-Crick G*·2AP(w) ↔ G·2AP(WC) and A·2AP(w) ↔ A*·2AP(WC) tautomerisations: a QM/QTAIM comprehensive survey.

    Science.gov (United States)

    Brovarets', Ol'ha O; Voiteshenko, Ivan S; Hovorun, Dmytro M

    2017-12-20

    This study is intended to clarify in detail the tautomeric transformations of the wobble (w) G*·2AP(w) and A·2AP(w) nucleobase mispairs involving 2-aminopurine (2AP) into the Watson-Crick (WC) G·2AP(WC) and A*·2AP(WC) base mispairs (asterisks denote mutagenic tautomers of the DNA bases), respectively, by quantum-mechanical methods and Bader's Quantum Theory of Atoms in Molecules. Our previously reported methodology has been used, which allows the evolution of the physico-chemical parameters to be tracked along the entire internal reaction coordinate (IRC), not exclusively in the stationary states of these reactions. These biologically important G*·2AP(w) ↔ G·2AP(WC) and A·2AP(w) ↔ A*·2AP(WC) w ↔ WC tautomerisations, which are involved in mutagenic tautomerically-conformational pathways, determine the origin of the transitions and transversions induced by 2AP. In addition, it is established that they proceed through planar, highly stable, zwitterionic transition states and they exhibit similar physico-chemical profiles and stages of sequential intrapair proton transfer, followed by spatial rearrangement of the nucleobases relative to each other within the base pairs. These w ↔ WC tautomerisations occur non-dissociatively and are accompanied by a significant alteration in geometry (from wobble to Watson-Crick and vice versa) and redistribution of the specific intermolecular interactions, which can be divided into 10 patterns including AHB H-bonds and loosened A-H-B covalent bridges along the IRC of tautomerisation. Based on the redistribution of the geometrical and electron-topological parameters of the intrapair hydrogen bonds, exactly 9 key points have been allocated to characterize the evolution of these reactions.

  2. Hydrogen Bonding in DNA Base Pairs: Reconciliation of Theory and Experiment

    NARCIS (Netherlands)

    Fonseca Guerra, C.; Bickelhaupt, F.M.; Snijders, J.G.; Baerends, E.J.

    2000-01-01

    Up till now, there has been a significant disagreement between theory and experiment regarding hydrogen bond lengths in Watson - Crick base pairs. To investigate the possible sources of this discrepancy, we have studied numerous model systems for adenine - thymine (AT) and guanine - cytosine (GC)

  3. [The Watson-Crick model of the DNA doublehelix. The history of the discovery and the role of the protein paradigm].

    Science.gov (United States)

    Hagemann, Rudolf

    2007-01-01

    At the beginning, the two fundamental papers by Watson and Crick published in 1953 are presented. Subsequently, the main phases of protein and nucleic acids research, starting in the middle of the 19th century, are shortly reviewed. It is outlined, how the 'protein-paradigm' was gradually developed and ultimately became widely accepted. It is then described how Caspersson in 1936 newly raised the question what the chemical nature of genes was: proteins or nucleic acids ? In the main part of this report six lines of research are reviewed, the results of which led to the demise of the 'protein paradigm', the creation of the Watson-Crick model of the DNA and the elaboration of the mechanism of DNA replication: (a) mutation experiments with UV and determination of the UV action spectrum, (b) determination of the chemical identity of the transforming agent in bacteria, (c) detailed chemical analysis of the DNA of different organisms, (d) molecular investigation of the infection of bacteria by bacteriophages, (e) X-ray analysis of DNA fibers, (f) model building and theoretical treatment of all data obtained. In this article, the factors promoting and inhibiting scientific progress in this field are described (and, above all, the relations between scientists with fixated concepts). The results from these lines of research led to the recognition of the decisive role of nucleic acids as the carriers of genetic information and, in this way, formally established the 'nucleic acid paradigm'. Finally the question is discussed why Watson and Crick found the right solution for the DNA structure (and not one of their competitors).

  4. The Importance of Short- and Long-Range Exchange on Various Excited State Properties of DNA Monomers, Stacked Complexes, and Watson-Crick Pairs.

    Science.gov (United States)

    Raeber, Alexandra E; Wong, Bryan M

    2015-05-12

    We present a detailed analysis of several time-dependent DFT (TD-DFT) methods, including conventional hybrid functionals and two types of nonempirically tuned range-separated functionals, for predicting a diverse set of electronic excitations in DNA nucleobase monomers and dimers. This large and extensive set of excitations comprises a total of 50 different transitions (for each tested DFT functional) that includes several n → π and π → π* valence excitations, long-range charge-transfer excitations, and extended Rydberg transitions (complete with benchmark calculations from high-level EOM-CCSD(T) methods). The presence of localized valence excitations as well as extreme long-range charge-transfer excitations in these systems poses a serious challenge for TD-DFT methods that allows us to assess the importance of both short- and long-range exchange contributions for simultaneously predicting all of these various transitions. In particular, we find that functionals that do not have both short- and full long-range exchange components are unable to predict the different types of nucleobase excitations with the same accuracy. Most importantly, the current study highlights the importance of both short-range exchange and a nonempirically tuned contribution of long-range exchange for accurately predicting the diverse excitations in these challenging nucleobase systems.

  5. The physicochemical essence of the purine·pyrimidine transition mismatches with Watson-Crick geometry in DNA: A·C* versa A*·C. A QM and QTAIM atomistic understanding.

    Science.gov (United States)

    Brovarets', Ol'ha O; Hovorun, Dmytro M

    2015-01-01

    It was established for the first time by DFT and MP2 quantum-mechanical (QM) methods either in vacuum, so in the continuum with a low dielectric constant (ε = 4), typical for hydrophobic interfaces of specific protein-nucleic acid interactions, that the repertoire for the tautomerisation of the biologically important adenine · cytosine* (A · C*) mismatched DNA base pair, formed by the amino tautomer of the A and the imino mutagenic tautomer of the C, into the A*·C base mispair (∆G = 2.72 kcal mol(-1) obtained at the MP2 level of QM theory in the continuum with ε = 4), formed by the imino mutagenic tautomer of the A and the amino tautomer of the C, proceeds via the asynchronous concerted double proton transfer along two antiparallel H-bonds through the transition state (TSA · C* ↔ A* · C). The limiting stage of the A · C* → A* · C tautomerisation is the final proton transfer along the intermolecular N6H · · · N4 H-bond. It was found that the A · C*/A* · C DNA base mispairs with Watson-Crick geometry are associated by the N6H · · · N4/N4H · · · N6, N3H · · · N1/N1H · · · N3 and C2H · · · O2 H-bonds, respectively, while the TSA · C*↔ A* · C is joined by the N6-H-N4 covalent bridge and the N1H · · · N3 and C2H · · · O2 H-bonds. It was revealed that the A · C* ↔ A* · C tautomerisation is assisted by the true C2H · · · O2 H-bond, that in contrast to the two others conventional H-bonds exists along the entire intrinsic reaction coordinate (IRC) range herewith becoming stronger at the transition from vacuum to the continuum with ε = 4. To better understand the behavior of the intermolecular H-bonds and base mispairs along the IRC of the A · C* ↔ A* · C tautomerisation, the profiles of their electron-topological, energetical, geometrical, polar and charge characteristics are reported in this study. It was established based on the profiles of the H-bond energies that all three H-bonds are cooperative, mutually

  6. How does the long G·G* Watson-Crick DNA base mispair comprising keto and enol tautomers of the guanine tautomerise? The results of a QM/QTAIM investigation.

    Science.gov (United States)

    Brovarets', Ol'ha O; Hovorun, Dmytro M

    2014-08-14

    The double proton transfer (DPT) in the long G·G* Watson-Crick base mispair (|C6N1(G*)N1C6(G)| = 36.4°; C1 symmetry), involving keto and enol tautomers of the guanine (G) nucleobase, along two intermolecular neighboring O6H···O6 (8.39) and N1···HN1 (6.14 kcal mol(-1)) H-bonds that were established to be slightly anti-cooperative, leads to its transformation into the G*·G base mispair through a single transition state (|C6N1N1C6| = 37.1°; C1), namely to the interconversion into itself. It was shown that the G·G* ↔ G*·G tautomerisation via the DPT is assisted by the third specific contact, that sequentially switches along the intrinsic reaction coordinate (IRC) in an original way: (G)N2H···N2(G*) H-bond (-25.13 to -10.37) → N2···N2 van der Waals contact (-10.37 to -9.23) → (G)N2···HN2(G*) H-bond (-9.23 to 0.79) → (G*)N2···HN2(G) H-bond (0.79 to 7.35 Bohr). The DPT tautomerisation was found to proceed through the asynchronous concerted mechanism by employing the QM/QTAIM approach and the methodology of the scans of the geometric, electron-topological, energetic, polar and NBO properties along the IRC. Nine key points, that can be considered as part of the tautomerisation repertoire, have been established and analyzed in detail. Furthermore, it was shown that the G·G* or G*·G base mispair is a thermodynamically and dynamically stable structure with a lifetime of 8.22 × 10(-10) s and all 6 low-frequency intermolecular vibrations are able to develop during this time span. Lastly, our results highlight the importance of the G·G* ↔ G*·G DPT tautomerisation, which can have implications for biological and chemical sensing applications.

  7. Alternative Watson-Crick Synthetic Genetic Systems.

    Science.gov (United States)

    Benner, Steven A; Karalkar, Nilesh B; Hoshika, Shuichi; Laos, Roberto; Shaw, Ryan W; Matsuura, Mariko; Fajardo, Diego; Moussatche, Patricia

    2016-11-01

    In its "grand challenge" format in chemistry, "synthesis" as an activity sets out a goal that is substantially beyond current theoretical and technological capabilities. In pursuit of this goal, scientists are forced across uncharted territory, where they must answer unscripted questions and solve unscripted problems, creating new theories and new technologies in ways that would not be created by hypothesis-directed research. Thus, synthesis drives discovery and paradigm changes in ways that analysis cannot. Described here are the products that have arisen so far through the pursuit of one grand challenge in synthetic biology: Recreate the genetics, catalysis, evolution, and adaptation that we value in life, but using genetic and catalytic biopolymers different from those that have been delivered to us by natural history on Earth. The outcomes in technology include new diagnostic tools that have helped personalize the care of hundreds of thousands of patients worldwide. In science, the effort has generated a fundamentally different view of DNA, RNA, and how they work. Copyright © 2016 Cold Spring Harbor Laboratory Press; all rights reserved.

  8. A quantum theoretical study of reactions of methyldiazonium ion with DNA base pairs

    International Nuclear Information System (INIS)

    Shukla, P.K.; Ganapathy, Vinay; Mishra, P.C.

    2011-01-01

    Graphical abstract: Reactions of methyldiazonium ion at the different sites of the DNA bases in the Watson-Crick GC and AT base pairs were investigated employing density functional and second order Moller-Plesset (MP2) perturbation theories. Display Omitted Highlights: → Methylation of the DNA bases is important as it can cause mutation and cancer. → Methylation reactions of the GC and AT base pairs with CH 3 N 2 + were not studied earlier theoretically. → Experimental observations have been explained using theoretical methods. - Abstract: Methylation of the DNA bases in the Watson-Crick GC and AT base pairs by the methyldiazonium ion was investigated employing density functional and second order Moller-Plesset (MP2) perturbation theories. Methylation at the N3, N7 and O6 sites of guanine, N1, N3 and N7 sites of adenine, O2 and N3 sites of cytosine and the O2 and O4 sites of thymine were considered. The computed reactivities for methylation follow the order N7(guanine) > N3(adenine) > O6(guanine) which is in agreement with experiment. The base pairing in DNA is found to play a significant role with regard to reactivities of the different sites.

  9. Classification of pseudo pairs between nucleotide bases and amino acids by analysis of nucleotide-protein complexes.

    Science.gov (United States)

    Kondo, Jiro; Westhof, Eric

    2011-10-01

    Nucleotide bases are recognized by amino acid residues in a variety of DNA/RNA binding and nucleotide binding proteins. In this study, a total of 446 crystal structures of nucleotide-protein complexes are analyzed manually and pseudo pairs together with single and bifurcated hydrogen bonds observed between bases and amino acids are classified and annotated. Only 5 of the 20 usual amino acid residues, Asn, Gln, Asp, Glu and Arg, are able to orient in a coplanar fashion in order to form pseudo pairs with nucleotide bases through two hydrogen bonds. The peptide backbone can also form pseudo pairs with nucleotide bases and presents a strong bias for binding to the adenine base. The Watson-Crick side of the nucleotide bases is the major interaction edge participating in such pseudo pairs. Pseudo pairs between the Watson-Crick edge of guanine and Asp are frequently observed. The Hoogsteen edge of the purine bases is a good discriminatory element in recognition of nucleotide bases by protein side chains through the pseudo pairing: the Hoogsteen edge of adenine is recognized by various amino acids while the Hoogsteen edge of guanine is only recognized by Arg. The sugar edge is rarely recognized by either the side-chain or peptide backbone of amino acid residues.

  10. Solid state radiation chemistry of co-crystallized DNA base pairs studied with EPR and ENDOR

    International Nuclear Information System (INIS)

    Nelson, W.H.; Nimmala, S.; Hole, E.O.; Sagstuen, E.; Close, D.M.

    1995-01-01

    For a number of years, the authors' group has focused on identification of radicals formed from x-irradiation of DNA components by application of EPR and ENDOR spectroscopic techniques to samples in the form of single crystals. With single crystals as samples, it is possible to use the detailed packing and structural information available from x-ray or neutron diffraction reports. This report summarizes results from two crystal systems in which DNA bases are paired by hydrogen bonding. Extensive results are available from one of these, 1-methyl-thymine:9-methyladenine (MTMA), in which the base pairing is the Hoogsteen configuration. Although this configuration is different from that found by Watson-Crick in DNA, nonetheless the hydrogen bond between T(O4) and A(NH 2 ) is present. Although MTMA crystals have been studied previously, the objective was to apply the high-resolution technique of ENDOR to crystals irradiated and studied at temperatures of 10 K or lower in the effort to obtain direct evidence for specific proton transfers. The second system, from which the results are only preliminary, is 9-ethylguanine:1-methyl-5-fluorocytosine (GFC) in which the G:C bases pair is in the Watson Crick configuration. Both crystal systems are anhydrous, so the results include no possible effects from water interactions

  11. Imidazopyridine/Pyrrole and hydroxybenzimidazole/pyrrole pairs for DNA minor groove recognition.

    Science.gov (United States)

    Renneberg, Dorte; Dervan, Peter B

    2003-05-14

    The DNA binding properties of fused heterocycles imidazo[4,5-b]pyridine (Ip) and hydroxybenzimidazole (Hz) paired with pyrrole (Py) in eight-ring hairpin polyamides are reported. The recognition profile of Ip/Py and Hz/Py pairs were compared to the five-membered ring pairs Im/Py and Hp/Py on a DNA restriction fragment at four 6-base pair recognition sites which vary at a single position 5'-TGTNTA-3', where N = G, C, T, A. The Ip/Py pair distinguishes G.C from C.G, T.A, and A.T, and the Hz/Py pair distinguishes T.A from A.T, G.C, and C.G, affording a new set of heterocycle pairs to target the four Watson-Crick base pairs in the minor groove of DNA.

  12. Electrostatics Explains the Position-Dependent Effect of G⋅U Wobble Base Pairs on the Affinity of RNA Kissing Complexes.

    Science.gov (United States)

    Abi-Ghanem, Josephine; Rabin, Clémence; Porrini, Massimiliano; Dausse, Eric; Toulmé, Jean-Jacques; Gabelica, Valérie

    2017-10-06

    In the RNA realm, non-Watson-Crick base pairs are abundant and can affect both the RNA 3D structure and its function. Here, we investigated the formation of RNA kissing complexes in which the loop-loop interaction is modulated by non-Watson-Crick pairs. Mass spectrometry, surface plasmon resonance, and UV-melting experiments show that the G⋅U wobble base pair favors kissing complex formation only when placed at specific positions. We tried to rationalize this effect by molecular modeling, including molecular mechanics Poisson-Boltzmann surface area (MMPBSA) thermodynamics calculations and PBSA calculations of the electrostatic potential surfaces. Modeling reveals that the G⋅U stabilization is due to a specific electrostatic environment defined by the base pairs of the entire loop-loop region. The loop is not symmetric, and therefore the identity and position of each base pair matters. Predicting and visualizing the electrostatic environment created by a given sequence can help to design specific kissing complexes with high affinity, for potential therapeutic, nanotechnology or analytical applications. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  13. Roles of the active site residues and metal cofactors in noncanonical base-pairing during catalysis by human DNA polymerase iota.

    Science.gov (United States)

    Makarova, Alena V; Ignatov, Artem; Miropolskaya, Nataliya; Kulbachinskiy, Andrey

    2014-10-01

    Human DNA polymerase iota (Pol ι) is a Y-family polymerase that can bypass various DNA lesions but possesses very low fidelity of DNA synthesis in vitro. Structural analysis of Pol ι revealed a narrow active site that promotes noncanonical base-pairing during catalysis. To better understand the structure-function relationships in the active site of Pol ι we investigated substitutions of individual amino acid residues in its fingers domain that contact either the templating or the incoming nucleotide. Two of the substitutions, Y39A and Q59A, significantly decreased the catalytic activity but improved the fidelity of Pol ι. Surprisingly, in the presence of Mn(2+) ions, the wild-type and mutant Pol ι variants efficiently incorporated nucleotides opposite template purines containing modifications that disrupted either Hoogsteen or Watson-Crick base-pairing, suggesting that Pol ι may use various types of interactions during nucleotide addition. In contrast, in Mg(2+) reactions, wild-type Pol ι was dependent on Hoogsteen base-pairing, the Y39A mutant was essentially inactive, and the Q59A mutant promoted Watson-Crick interactions with template purines. The results suggest that Pol ι utilizes distinct mechanisms of nucleotide incorporation depending on the metal cofactor and reveal important roles of specific residues from the fingers domain in base-pairing and catalysis. Copyright © 2014 Elsevier B.V. All rights reserved.

  14. Energetics and dynamics of the non-natural fluorescent 4AP:DAP base pair

    KAUST Repository

    Chawla, Mohit

    2018-01-02

    The fluorescent non-natural 4-aminophthalimide (4AP) base, when paired to the complementary 2,4-diaminopyrimidine (DAP) nucleobase, is accommodated in a B-DNA duplex being efficiently recognized and incorporated by DNA polymerases. To complement the experimental studies and rationalize the impact of the above non-natural bases on the structure, stability and dynamics of nucleic acid structures, we performed quantum mechanics (QM) calculations along with classical molecular dynamics (MD) simulations. QM calculations were initially focused on the geometry and energetics of the 4AP:DAP non-natural pair and of H-bonded base pairs between 4AP and all the natural bases in their classical Watson-Crick geometries. The QM calculations indicate that the 4AP:DAP pair, despite the fact that it can form 3 H-bonds in a classic Watson-Crick geometry, has a stability comparable to the A:T pair. Then, we extended the study to reverse Watson-Crick geometries, characteristic of parallel strands. MD simulations were carried out on two 13-mer DNA duplexes, featuring a central 4AP:DAP or A:T pair, respectively. No major structural deformation of the duplex was observed during the MD simulation. Snapshots from the MD simulations were subjected to QM calculations to investigate the 4AP:DAP interaction energy when embedded into a duplex structure, and to investigate the impact of the two non-natural bases on the stacking interactions with adjacent bases in the DNA duplex. We found a slight increase in stacking interactions involving the 4AP:DAP pair, counterbalanced by a moderate decrease in H-bonding interactions of the 4AP:DAP and of the adjacent base pairs in the duplex. The results of our study are in agreement with experimental data and complement them by providing an insight into which factors contribute positively and which factors contribute negatively to the structural compatibility of the fluorescent 4AP:DAP pair with a B-DNA structure.

  15. Hydrogen bond disruption in DNA base pairs from (14)C transmutation.

    Science.gov (United States)

    Sassi, Michel; Carter, Damien J; Uberuaga, Blas P; Stanek, Christopher R; Mancera, Ricardo L; Marks, Nigel A

    2014-09-04

    Recent ab initio molecular dynamics simulations have shown that radioactive carbon does not normally fragment DNA bases when it decays. Motivated by this finding, density functional theory and Bader analysis have been used to quantify the effect of C → N transmutation on hydrogen bonding in DNA base pairs. We find that (14)C decay has the potential to significantly alter hydrogen bonds in a variety of ways including direct proton shuttling (thymine and cytosine), thermally activated proton shuttling (guanine), and hydrogen bond breaking (cytosine). Transmutation substantially modifies both the absolute and relative strengths of the hydrogen bonding pattern, and in two instances (adenine and cytosine), the density at the critical point indicates development of mild covalent character. Since hydrogen bonding is an important component of Watson-Crick pairing, these (14)C-induced modifications, while infrequent, may trigger errors in DNA transcription and replication.

  16. Ultrafast deactivation processes in the 2-aminopyridine dimer and the adenine-thymine base pair: Similarities and differences

    International Nuclear Information System (INIS)

    Ai Yuejie; Zhang Feng; Cui Ganglong; Fang Weihai; Luo Yi

    2010-01-01

    2-aminopyridine dimer has frequently been used as a model system for studying photochemistry of DNA base pairs. We examine here the relevance of 2-aminopyridine dimer for a Watson-Crick adenine-thymine base pair by studying UV-light induced photodynamics along two main hydrogen bridges after the excitation to the localized 1 ππ* excited-state. The respective two-dimensional potential-energy surfaces have been determined by time-dependent density functional theory with Coulomb-attenuated hybrid exchange-correlation functional (CAM-B3LYP). Different mechanistic aspects of the deactivation pathway have been analyzed and compared in detail for both systems, while the related reaction rates have also be obtained from Monte Carlo kinetic simulations. The limitations of the 2-aminopyridine dimer as a model system for the adenine-thymine base pair are discussed.

  17. Portrait of a discovery. Watson, Crick, and the double helix.

    Science.gov (United States)

    de Chadarevian, Soraya

    2003-03-01

    This essay examines an iconic image of twentieth-century science: Antony Barrington Brown's photograph of James Watson, Francis Crick, and the double-helical model of DNA. The detailed reconstruction of the production, reception, and uses of the photograph reveals the central role of the image in making the discovery it portrays. Taken in May 1953, two full months after the scientists built the model, to accompany a report on the structure in Time magazine, the photograph (like the report) was never published. It came into circulation only fifteen years later, as an illustration in Watson's best-selling book The Double Helix. While the image served as a historical document and advertisement for the book, only the book provided the description that made the image as well as the people and the model it represented famous. The history of the image provides insights into the retrospective construction of the discovery, which has since been celebrated as the origin of a new science of life.

  18. The synthesis of nucleoside bases with 14 C

    International Nuclear Information System (INIS)

    Matloubi, H.; Mehrdad, M.

    1997-01-01

    Labelled organic compounds have been widely and diligently applied to research problems in life science and chemistry. In many laboratories they have lost their novelty and have been become conventional research tools since long time ago. these applications frequently require organic compounds substituted (or labelled) with isotopes, but the isotopes are (with certain exception) extracted in first place in simple inorganic forms. The conversion of these simple form into the more or less complex labelled compounds called for by research workers has become in effect a new branch of practical organic chemistry. The preparation of labelled compounds, carbon-14 is probably more extensively and variously used than any other isotope. It emits only beta-particles. In this project, two kinds of nucleoside bases under the name uracil-2- 14 C and thymine (methyl- 14 C) were prepared.(author). 14 refs., 3 figs., 2 tabs

  19. Interactions between Al₁₂X (X = Al, C, N and P) nanoparticles and DNA nucleobases/base pairs: implications for nanotoxicity.

    Science.gov (United States)

    Jin, Peng; Chen, Yongsheng; Zhang, Shengbai B; Chen, Zhongfang

    2012-02-01

    The interactions between neutral Al(12)X(I ( h )) (X = Al, C, N and P) nanoparticles and DNA nucleobases, namely adenine (A), thymine (T), guanine (G) and cytosine (C), as well as the Watson-Crick base pairs (BPs) AT and GC, were investigated by means of density functional theory computations. The Al(12)X clusters can tightly bind to DNA bases and BPs to form stable complexes with negative binding Gibbs free energies at room temperature, and considerable charge transfers occur between the bases/BPs and the Al(12)X clusters. These strong interactions, which are also expected for larger Al nanoparticles, may have potentially adverse impacts on the structure and stability of DNA and thus cause its dysfunction.

  20. AT Base Pair Anions vs. (9-methyl-A)(1-methyl-T) Base Pair Anions

    International Nuclear Information System (INIS)

    Radisic, Dunja; Bowen, Kit H.; Dabkowska, Iwona; Storoniak, Piotr; Rak, Janusz; Gutowski, Maciej S.

    2005-01-01

    The anionic base pairs of adenine and thymine, (AT)-, and 9-methyladenine and 1-methylthymine, (MAMT)-, have been investigated both theoretically and experimentally in a complementary, synergistic study. Calculations on (AT)- found that it had undergone a barrier-free proton transfer (BFPT) similar to that seen in other dimer anion systems and that its structural configuration that was neither Watson-Crick (WC) nor Hoogsteen (HS). The vertical detachment energy (VDE) of (AT)- was determined by anion photoelectron spectroscopy and found to be in agreement with the VDE value predicted by theory for the BFPT mechanism. An AT pair in DNA is structurally immobilized into the WC configuration, in part, by being bonded to the sugars of the double helix. This circumstance was mimicked by methylating the sites on both A and T where these sugars would have been tied, viz., 9-methyladenine and 1-methylthymine. Calculations found no BFPT in (MAMT)- and a resulting (MAMT)- configuration that wa s either HS or WC, with the configurations differing in stability by ca. 2 kcal/mol. The photoelectron spectrum of (MAMT)- occurred at a completely different electron binding energy than had (AT)-. Moreover, the VDE value of (MAMT)- was in agreement with that predicted by theory. The configuration of (MAMT)- and its lack of electron-induced proton transfer are inter-related. While there may be other pathways for electron-induced damage, BFPT in the WC/HS configurations of (AT)- is not feasible

  1. AT base pair anions versus (9-methyl-A)(1-methyl-T) base pair anions.

    Science.gov (United States)

    Radisic, Dunja; Bowen, Kit H; Dabkowska, Iwona; Storoniak, Piotr; Rak, Janusz; Gutowski, Maciej

    2005-05-04

    The anionic base pairs of adenine and thymine, (AT)(-), and 9-methyladenine and 1-methylthymine, (MAMT)(-), have been investigated both theoretically and experimentally in a complementary, synergistic study. Calculations on (AT)(-) found that it had undergone a barrier-free proton transfer (BFPT) similar to that seen in other dimer anion systems and that its structural configuration was neither Watson-Crick (WC) nor Hoogsteen (HS). The vertical detachment energy (VDE) of (AT)(-) was determined by anion photoelectron spectroscopy and found to be in agreement with the VDE value predicted by theory for the BFPT mechanism. An AT pair in DNA is structurally immobilized into the WC configuration, in part, by being bonded to the sugars of the double helix. This circumstance was mimicked by methylating the sites on both A and T where these sugars would have been tied, viz., 9-methyladenine and 1-methylthymine. Calculations found no BFPT in (MAMT)(-) and a resulting (MAMT)(-) configuration that was either HS or WC, with the configurations differing in stability by ca. 2 kcal/mol. The photoelectron spectrum of (MAMT)(-) occurred at a completely different electron binding energy than had (AT)(-). Moreover, the VDE value of (MAMT)(-) was in agreement with that predicted by theory. The configuration of (MAMT)(-) and its lack of electron-induced proton transfer are inter-related. While there may be other pathways for electron-induced DNA alterations, BFPT in the WC/HS configurations of (AT)(-) is not feasible.

  2. Unstable Hoogsteen base pairs adjacent to echinomycin binding sites within a DNA duplex

    International Nuclear Information System (INIS)

    Gilbert, D.E.; van der Marel, G.A.; van Boom, J.H.; Feigon, J.

    1989-01-01

    The bisintercalation complex present between the DNA octamer [d(ACGTACGT)] 2 and the cyclic octadepsipeptide antibiotic echinomycin has been studied by one- and two-dimensional proton NMR, and the results obtained have been compared with the crystal structures of related DNA-echinomycin complexes. Two echinomycins are found to bind cooperatively to each DNA duplex at the CpG steps, with the two quinoxaline rings of each echinomycin bisintercalating between the C·G and A·T base pairs. At low temperatures, the A·T base pairs on either side of the intercalation site adopt the Hoogsteen conformation, as observed in the crystal structures. However, as the temperature is raised, the Hoogsteen base pairs in the interior of the duplex are destabilized and are observed to be exchanging between the Hoogsteen base pair and either an open or a Watson-Crick base-paired state. The terminal A·T base pairs, which are not as constrained by the helix as the internal base pairs, remain stably Hoogsteen base-paired up to at least 45 degree C. The implications of these results for the biological role of Hoogsteen base pairs in echinomycin-DNA complexes in vivo are discussed

  3. Hoogsteen base pairs proximal and distal to echinomycin binding sites on DNA

    International Nuclear Information System (INIS)

    Mendel, D.; Dervan, P.B.

    1987-01-01

    Forms of the DNA double helix containing non-Watson-Crick base-pairing have been discovered recently based on x-ray diffraction analysis of quionoxaline antibiotic-oligonucleotide complexes. In an effort to find evidence for Hoogsteen base-pairing at quinoxaline-binding sites in solution, chemical footprinting (differential cleavage reactivity) of echinomycin bound to DNA restriction fragments was examined. The authors report that purines (A>G) in the first and/or fourth base-pair positions of occupied echinomycin-binding sites are hyperreactive to diethyl pyrocarbonate. The correspondence of the solid-state data and the sites of diethyl pyrocarbonate hyperreactivity suggests that diethyl pyrocarbonate may be a sensitive reagent for the detection of Hoogsteen base-pairing in solution. Moreover, a 12-base-pair segment of alternating A-T DNA, which is 6 base pairs away from the nearest strong echinomycin-binding site, is also hyperreactive to diethyl pyrocarbonate in the presence of echinomycin. This hyperreactive segment may be an altered form of right-handed DNA that is entirely Hoogsteen base-paired

  4. Base-pairing preferences, physicochemical properties and mutational behaviour of the DNA lesion 8-nitroguanine.

    Science.gov (United States)

    Bhamra, Inder; Compagnone-Post, Patricia; O'Neil, Ian A; Iwanejko, Lesley A; Bates, Andrew D; Cosstick, Richard

    2012-11-01

    8-Nitro-2'-deoxyguanosine (8-nitrodG) is a relatively unstable, mutagenic lesion of DNA that is increasingly believed to be associated with tissue inflammation. Due to the lability of the glycosidic bond, 8-nitrodG cannot be incorporated into oligodeoxynucleotides (ODNs) by chemical DNA synthesis and thus very little is known about its physicochemical properties and base-pairing preferences. Here we describe the synthesis of 8-nitro-2'-O-methylguanosine, a ribonucleoside analogue of this lesion, which is sufficiently stable to be incorporated into ODNs. Physicochemical studies demonstrated that 8-nitro-2'-O-methylguanosine adopts a syn conformation about the glycosidic bond; thermal melting studies and molecular modelling suggest a relatively stable syn-8-nitroG·anti-G base pair. Interestingly, when this lesion analogue was placed in a primer-template system, extension of the primer by either avian myeloblastosis virus reverse transcriptase (AMV-RT) or human DNA polymerase β (pol β), was significantly impaired, but where incorporation opposite 8-nitroguanine did occur, pol β showed a 2:1 preference to insert dA over dC, while AMV-RT incorporated predominantly dC. The fact that no 8-nitroG·G base pairing is seen in the primer extension products suggests that the polymerases may discriminate against this pairing system on the basis of its poor geometric match to a Watson-Crick pair.

  5. Surprising conformers of the biologically important A·T DNA base pairs: QM/QTAIM proofs

    Science.gov (United States)

    Brovarets', Ol'ha O.; Tsiupa, Kostiantyn S.; Hovorun, Dmytro M.

    2018-02-01

    For the first time novel high-energy conformers – A·T(wWC) (5.36), A·T(wrWC) (5.97), A·T(wH) (5.78) and A·T(wrH) (ΔG=5.82 kcal•mol-1) were revealed for each of the four biologically important A·T(WC) DNA base pairsWatson-Crick A·T(WC), reverse Watson-Crick A·T(rWC), Hoogsteen A·T(H) and reverse Hoogsteen A·T(rH) at the MP2/aug-cc-pVDZ//B3LYP/6-311++G(d,p) level of quantum-mechanical theory in the continuum with ɛ=4 under normal conditions. Each of these conformers possesses substantially non-planar wobble (w) structure and is stabilized by the participation of the two anti-parallel N6H/N6H'…O4/O2 and N3H…N6 H-bonds, involving the pyramidalized amino group of the A DNA base as an acceptor and a donor of the H-bonding. The transition states – TSA·T(WC)↔A·T(wWC), TSA·T(rWC)↔A·T(wrWC), TSA·T(H)↔A·T(wH) and TSA·T(rH)↔A·T(wrH), controlling the dipole-active transformations of the conformers from the main plane-symmetric state into the high-energy, significantly non-planar state and vice versa, were localized. They also possess wobble structures similarly to the high-energy conformers and are stabilized by the participation of the N6H/N6H'…O4/O2 and N3H…N6 H-bonds. Discovered conformers of the A·T DNA base pairs are dynamically stable short-lived structures (lifetime τ = (1.4-3.9) ps). Their possible biological significance and future perspectives have been briefly discussed.

  6. Surprising Conformers of the Biologically Important A·T DNA Base Pairs: QM/QTAIM Proofs

    Directory of Open Access Journals (Sweden)

    Ol'ha O. Brovarets'

    2018-02-01

    Full Text Available For the first time novel high-energy conformers–A·T(wWC (5.36, A·T(wrWC (5.97, A·T(wH (5.78, and A·T(wrH (ΔG = 5.82 kcal·mol−1 (See Graphical Abstract were revealed for each of the four biologically important A·T DNA base pairsWatson-Crick A·T(WC, reverse Watson-Crick A·T(rWC, Hoogsteen A·T(H and reverse Hoogsteen A·T(rH at the MP2/aug-cc-pVDZ//B3LYP/6-311++G(d,p level of quantum-mechanical theory in the continuum with ε = 4 under normal conditions. Each of these conformers possesses substantially non-planar wobble (w structure and is stabilized by the participation of the two anti-parallel N6H/N6H′…O4/O2 and N3H…N6 H-bonds, involving the pyramidalized amino group of the A DNA base as an acceptor and a donor of the H-bonding. The transition states – TSA·T(WC↔A·T(wWC, TSA·T(rWC↔A·T(wrWC, TSA·T(H↔A·T(wH, and TSA·T(rH↔A·T(wrH, controlling the dipole-active transformations of the conformers from the main plane-symmetric state into the high-energy, significantly non-planar state and vice versa, were localized. They also possess wobble structures similarly to the high-energy conformers and are stabilized by the participation of the N6H/N6H′…O4/O2 and N3H…N6 H-bonds. Discovered conformers of the A·T DNA base pairs are dynamically stable short-lived structures [lifetime τ = (1.4–3.9 ps]. Their possible biological significance and future perspectives have been briefly discussed.

  7. O6-ethylguanine carcinogenic lesions in DNA: An NMR study of O6etG·C pairing in dodecanucleotide duplexes

    International Nuclear Information System (INIS)

    Kalnik, M.W.; Li, B.F.L.; Swann, P.F.; Patel, D.J.

    1989-01-01

    The pairing of O 6 etG with C located four base pairs in from either end of the self-complementary d(C1-G2-C3-O 6 etG4-A5-G6-C7-T8-C9-G10-C11-G12) duplex (designated O 6 etG·C 12-mer) has been investigated from an analysis of proton and phosphorus two-dimensional NMR experiments. The structural consequences of increasing the alkyl group size were elucidated from a comparative study of the pairing of O 6 meG4 with C9 in a related sequence (designated O 6 meG·C 12-mer). The NMR parameters for both O 6 alkG-containing dodecanucleotides are also compared with those of the control sequence containing G4·C9 base pairs (designated G·C 12-mer). The NOE cross-peaks detected in the two-dimensional NOESY spectra of the O 6 alkG·C 12-mer duplexes in H 2 O solution establish that the O 6 etG4/O 6 meG4 and C9 bases at the lesion site stack into the helix between the flanking C3·G10 and A5·T8 Watson-Crick base pairs. The observed NOEs between the amino protons of C9 and the CH 3 protons of O 6 alkG4 establish a syn orientation of the O 6 -alkyl group with respect to the N 1 of alkylated guanine. A wobble alignment of the O 6 alkG4·C9 base pair stabilized by two hydrogen bonds, one between the amino group of C9 and N 1 of O 6 alkG and the other between the amino group of O 6 alkG and N 3 of C9, is tentatively proposed on the basis of the NOEs between the amino protons of C9 at the lesion site and the imino protons of flanking Watson-Crick base pairs

  8. Dual door entry to exciplex emission in a chimeric DNA duplex containing non-nucleoside-nucleoside pair.

    Science.gov (United States)

    Bag, Subhendu Sekhar; Talukdar, Sangita; Kundu, Rajen; Saito, Isao; Jana, Subhashis

    2014-01-25

    Dual door entry to exciplex formation was established in a chimeric DNA duplex wherein a fluorescent non-nucleosidic base surrogate () is paired against a fluorescent nucleosidic base surrogate (). Packing of the nucleobases via intercalative stacking interactions led to an exciplex emission either via FRET from the donor or direct excitation of the FRET acceptor .

  9. Deuterium isotope effects and fractionation factors of hydrogen-bonded A:T base pairs of DNA

    International Nuclear Information System (INIS)

    Vakonakis, Ioannis; Salazar, Miguel; Kang, Mijeong; Dunbar, Kim R.; Li Wang, Andy C.

    2003-01-01

    Deuterium isotope effects and fractionation factors of N1...H3-N3 hydrogen bonded Watson-Crick A:T base pairs of two DNA dodecamers are presented here. Specifically, two-bond deuterium isotope effects on the chemical shifts of 13 C2 and 13 C4, 2 Δ 13 C2 and 2 Δ 13 C4, and equilibrium deuterium/protium fractionation factors of H3, Φ, were measured and seen to correlate with the chemical shift of the corresponding imino proton, δ H3 . Downfield-shifted imino protons associated with larger values of 2 Δ 13 C2 and 2 Δ 13 C4 and smaller Φ values, which together suggested that the effective H3-N3 vibrational potentials were more anharmonic in the stronger hydrogen bonds of these DNA molecules. We anticipate that 2 Δ 13 C2, 2 Δ 13 C4 and Φ values can be useful gauges of hydrogen bond strength of A:T base pairs

  10. Interaction of the Adenine-Thymine Watson-Crick and Adenine-Adenine Reverse-Hoogsteen DNA Base Pairs with Hydrated Group IIa (Mg .sup.2+./sup., Ca .sup.2+./sup., Sr .sup.2+./sup., Ba .sup.2+./sup.) and IIb (Zn .sup.2+./sup., Cd .sup.2+./sup., Hg .sup.2+./sup.) Metal Cations: Absence of the Base Pair Stabilization by Metal-Induced Polarization Effects

    Czech Academy of Sciences Publication Activity Database

    Šponer, Jiří; Sabat, M.; Burda, J. V.; Leszczynski, J.; Hobza, Pavel

    1999-01-01

    Roč. 103, č. 13 (1999), s. 2528-2534 ISSN 1089-5647 R&D Projects: GA ČR GA203/97/0029 Grant - others:NSF(US) EHR108767; NIH(US) GM08047 Subject RIV: BO - Biophysics Impact factor: 3.265, year: 1999

  11. Moving beyond Watson-Crick models of coarse grained DNA dynamics.

    Science.gov (United States)

    Linak, Margaret C; Tourdot, Richard; Dorfman, Kevin D

    2011-11-28

    DNA produces a wide range of structures in addition to the canonical B-form of double-stranded DNA. Some of these structures are stabilized by Hoogsteen bonds. We developed an experimentally parameterized, coarse-grained model that incorporates such bonds. The model reproduces many of the microscopic features of double-stranded DNA and captures the experimental melting curves for a number of short DNA hairpins, even when the open state forms complicated secondary structures. We demonstrate the utility of the model by simulating the folding of a thrombin aptamer, which contains G-quartets, and strand invasion during triplex formation. Our results highlight the importance of including Hoogsteen bonding in coarse-grained models of DNA.

  12. Nucleic acid nanomaterials: Silver-wired DNA

    Science.gov (United States)

    Auffinger, Pascal; Ennifar, Eric

    2017-10-01

    DNA double helical structures are supramolecular assemblies that are typically held together by classical Watson-Crick pairing. Now, nucleotide chelation of silver ions supports an extended silver-DNA hybrid duplex featuring an uninterrupted silver array.

  13. Glutamate Receptor Aptamers and ALS

    Science.gov (United States)

    2009-01-01

    considered difficult because such a process uses the one-to-one correspondence of Watson - Crick pairing. In contrast, the transfer of function is...same nucleotides in M1 exhibited no NMIA reactivity. In general, non-reactive nucleotides were thought to be Watson - Crick based- paired. A number of...about 14 rounds of selections, the SELEX was terminated. The DNA pool from the 11th, 12th and 14th rounds were cloned and sequenced. Consensus

  14. Effect of the sulphur atom on geometry and spectra of the biomolecule 2-thiouracil and in the WC base pair 2-thiouridine-adenosine. Influence of water in the first hydration shell.

    Science.gov (United States)

    Alcolea Palafox, M; Rastogi, V K; Singh, S P

    2018-04-01

    The effect of the sulphur atom on 2-thiouracil (2TU) and 2-thiouridine molecules, as compared with uracil and uridine molecules, respectively, was carried out in several environments. The predicted IR spectrum of 2TU in the isolated state was compared with that obtained for uracil molecule and with those reported experimentally in matrix isolation. Its crystal unit cell in the solid state was simulated through a tetramer form using DFT methods for the first time. The calculated Raman spectrum was compared to the experimental ones in the solid state. A linear scaling procedure was used for this task. The first hydration shell was simulated by explicit number of water molecules surrounding 2TU up to 30 and was compared with that obtained in uracil molecule. Water molecules 'distributed' around 2TU was preferred over that 'clustering', because it can better reproduce the hydration and their effects on different parameters of the molecular structure of 2TU and uracil. The total atomic charges and several calculated thermodynamic parameters were discussed. The effect of the sulphur atom on the Watson-Crick (WC) and reverse WC base pair uridine-adenosine was estimated, and the CP corrected interaction energies were calculated. 2-thiouridine has a weaker WC pair than that with uridine, although its slight higher dipole moment (μ) facilitates the interaction with the water molecules. Several helical parameters were determined.

  15. Studies of Single Biomolecules, DNA Conformational Dynamics, and Protein Binding

    Science.gov (United States)

    2008-07-11

    Nucleotide Base pairs Hydrogen bonds FIG. 1: Ladder structure of DNA showing the Watson - Crick bonding of the bases A, T, G, and C which are suspended by a...protected against unwanted action of chemicals and proteins. The three-dimensional structure of DNA is the famed Watson - Crick double-helix, the equilibrium...quantitative analysis [88]. [1] A. Kornberg and T. A. Baker, DNA Replication (W. H. Freeman, New York, 1992). [2] J. D. Watson and F. H. C. Crick

  16. Toll-Like Receptor-9-Mediated Invasion in Breast Cancer

    Science.gov (United States)

    2011-07-01

    AMBER starting from the in-vacuum minimized Watson - Crick based paired 9-mer hairpin structures. These models were then used with NMR derived distance...the cell. The oligonucleotides studied adopt many different secondary structures such as Watson - Crick duplex, hairpin, quadruplex, and single...deoxyoligonucleotide. Although the mechanism(s) for this induction is unknown, our studies reveal key insights into the structural and sequence requirements for DNA

  17. Orbital interactions and charge redistribution in weak hydrogen bonds: The Watson-Crick AT mimic adenine-2,4-difluorotoluene

    NARCIS (Netherlands)

    Fonseca Guerra, C.; Bickelhaupt, F.M.

    2003-01-01

    An overview is given of results that reestablish hydrogen bonding as an essential factor in DNA replication involving natural bases as well as less polar mimics and they also confirm the importance of steric factors, in line with Kool's experimental work. In addition they show that knowledge of the

  18. DNA before Watson & Crick-The Pioneering Studies of J. M. Gulland and D. O. Jordan at Nottingham

    Science.gov (United States)

    Booth, Harold; Hey, Michael J.

    1996-10-01

    A description placed in a historical context, of the physico-chemical investigations of DNA carried out in the period 1940-1950 by a group at University College, Nottingham led by J.M.Gulland and D.O.Jordan. The isolation of a pure sample of DNA from calf thymus was followed by its analysis by potentiometric titrations and by measurements at variable pH of viscosity and streaming birefringence. Unlike the phosphoric acid groups, the primary amino and enolic hydroxyl groups could only be titrated after prior treatment with strong acid or strong base. The conclusion of Gulland and Jordan, that extremes of pH caused liberation of amino and enolic hydoxyl groups by disruption of hydrogen bonds between neighbouring polynucleotide chains, proved to be of considerable importance. The article includes life histories of Gulland and Jordan, and reference to Linus Pauling's remarkable foresight during his Sir Jesse Boot Foundation Lecture delivered at Nottingham in 1948.

  19. Noncanonical structures and their thermodynamics of DNA and RNA under molecular crowding: beyond the Watson-Crick double helix.

    Science.gov (United States)

    Sugimoto, Naoki

    2014-01-01

    How does molecular crowding affect the stability of nucleic acid structures inside cells? Water is the major solvent component in living cells, and the properties of water in the highly crowded media inside cells differ from that in buffered solution. As it is difficult to measure the thermodynamic behavior of nucleic acids in cells directly and quantitatively, we recently developed a cell-mimicking system using cosolutes as crowding reagents. The influences of molecular crowding on the structures and thermodynamics of various nucleic acid sequences have been reported. In this chapter, we discuss how the structures and thermodynamic properties of nucleic acids differ under various conditions such as highly crowded environments, compartment environments, and in the presence of ionic liquids, and the major determinants of the crowding effects on nucleic acids are discussed. The effects of molecular crowding on the activities of ribozymes and riboswitches on noncanonical structures of DNA- and RNA-like quadruplexes that play important roles in transcription and translation are also described. © 2014 Elsevier Inc. All rights reserved.

  20. Requirement for a conserved, tertiary interaction in the core of 23S ribosomal RNA

    DEFF Research Database (Denmark)

    Aagaard, C; Douthwaite, S

    1994-01-01

    RNA. Every substitution that disrupts the potential for Watson-Crick base pairing between these positions reduces or abolishes the participation of 23S rRNA in protein synthesis. All mutant 23S rRNAs are assembled into 50S subunits, but the mutant subunits are less able to stably interact with 30S subunits...... is nonfunctional. In contrast to the considerable effect the mutations have on function, they impart only slight structural changes on the naked rRNA, and these are limited to the immediate vicinity of the mutations. The data show that positions 1262 and 2017 pair in a Watson-Crick manner, but the data also...

  1. Theoretical Characterization of Sulfur-to-Selenium Substitution in an Emissive RNA Alphabet: Impact on H-bonding Potential and Photophysical Properties

    KAUST Repository

    Chawla, Mohit; Poater, Albert; Besalu-Sala, Pau; Kalra, Kanav; Oliva, Romina; Cavallo, Luigi

    2018-01-01

    of the classical Watson-Crick base pairs, thus potentially mimicking the natural bases in a RNA duplex in terms of H-bonding. In contrast, our calculations indicate that H-bonded base pairs involving the Hoogsteen edge of purines are destabilized as compared

  2. Interaction of Cu+ with cytosine and formation of i-motif-like C-M+-C complexes: alkali versus coinage metals

    NARCIS (Netherlands)

    Gao, J.; Berden, G.; Rodgers, M.T.; Oomens, J.

    2016-01-01

    The Watson-Crick structure of DNA is among the most well-known molecular structures of our time. However, alternative base-pairing motifs are also known to occur, often depending on base sequence, pH, or the presence of cations. Pairing of cytosine (C) bases induced by the sharing of a single proton

  3. B-DNA model systems in non-terran bio-solvents : Implications for structure, stability and replication

    NARCIS (Netherlands)

    Hamlin, Trevor A.; Poater, Jordi; Fonseca Guerra, Célia; Bickelhaupt, F. Matthias

    2017-01-01

    We have computationally analyzed a comprehensive series of Watson-Crick and mismatched B-DNA base pairs, in the gas phase and in several solvents, including toluene, chloroform, ammonia, methanol and water, using dispersion-corrected density functional theory and implicit solvation. Our analyses

  4. Substituent Effects on Hydrogen Bonds in DNA : A Kohn-Sham DFT Approach

    NARCIS (Netherlands)

    Guerra, Célia Fonseca; Bickelhaupt, F. Matthias

    2006-01-01

    In this Chapter, we discuss how the hydrogen bonds in Watson-Crick base pairs can be tuned both structurally and in terms of bond strength by exposing the DNA bases to different kinds of substitutions: (1) substitution in the X-H Y hydrogen bonding moiety, (2) remote substitution, i.e., introducing

  5. Unusual hydrogen bonding patterns in AF [aminofluorene] and AAF [acetylaminofluorene] modified DNA

    International Nuclear Information System (INIS)

    Broyde, S.; Hingerty, B.E.; Shapiro, R.; Norman, D.; Oak Ridge National Lab., TN; New York Univ., NY; Columbia Univ., New York, NY

    1989-01-01

    New structures are presented for AF and AAF modified DNAs that place the carcinogen in the minor groove of a B-DNA helix. These structures employ non-Watson-Crick base pairing schemes with syn guanine at the modification site. 32 refs., 9 figs

  6. Condensing the information in DNA with double-headed nucleotides

    DEFF Research Database (Denmark)

    Hornum, Mick; Sharma, Pawan K; Reslow-Jacobsen, Charlotte

    2017-01-01

    A normal duplex holds as many Watson-Crick base pairs as the number of nucleotides in its constituent strands. Here we establish that single nucleotides can be designed to functionally imitate dinucleotides without compromising binding affinity. This effectively allows sequence information...

  7. LNA-antisense rivals siRNA for gene silencing

    DEFF Research Database (Denmark)

    Jepsen, Jan Stenvang; Wengel, Jesper; Stenvang, Jan

    2004-01-01

    Locked nucleic acid (LNA) is a class of nucleic acid analogs possessing unprecedented binding affinity toward complementary DNA and RNA while obeying the Watson-Crick base-pairing rules. For efficient gene silencing in vitro and in vivo, fully modified or chimeric LNA oligonucleotides have been a...

  8. NMR structural studies of the ionizing radiation adduct 7-hydro-8-oxodeoxyguanosine (8-oxo-7H-dG) opposite deoxyadenosine in a DNA duplex. 8-oxo-7H-dG(syn)·dA(anti) alignment at lesion site

    International Nuclear Information System (INIS)

    Kouchakdjian, M.; Patel, D.J.; Bodepudi, V.; Shibutani, S.; Eisenberg, M.; Johnson, F.; Grollman, A.P.

    1991-01-01

    Proton NMR studies are reported on the complementary d(C1-C2-A3-C4-T5-A6-oxo-G7-T8-C9-A10-C11-C12)·d(G13-G14-T15-G16-A17-A18-T19-A20-G21-T22-G23-G24) dodecanucleotide duplex (designated 8-oxo-7H-dG·dA 12-mer), which contains a centrally located 7-hydro-8-oxodeoxyguanosine (8-oxo-7H-dG) residue, a group commonly found in DNA that has been exposed to ionizing radiation or oxidizing free radicals. From the NMR spectra it can be deduced that this moiety exists as two tautomers, or gives rise to two DNA conformations, that are in equilibrium and that exchange slowly. The present study focuses on the major component of the equilibrium that originates in the 6,8-dioxo tautomer of 8-oxo-7H-dG. The authors have assigned the exchangeable NH1, NH7, and NH 2 -2 base protons located on the Watson-Crick and Hoogsteen edges of 8-oxo-7H-dG7 in the 8-oxo-7H-dG·dA 12-mer duplex, using an analysis of one- and two-dimensional nuclear Overhauser enhancement (NOE) data in H 2 O solution. They were able to detect a set of intra- and interstrand NOEs between protons (exchangeable and nonexchangeable) on adjacent residues in the d(A6-oxo-G7-T8)·d(A17-A18-T19) trinucleotide segment centered about the lesion site that establishes stacking of the oxo-dG7(syn)·dA(anti) pair between stable Watson-Crick dA6·dT19 and dT8·A17 base pairs with minimal perturbation of the helix. The structural studies demonstrate that 8-oxo-7H-dG(syn)·dA(anti) forms a stable pair in the interior of the helix, providing a basis for the observed incorporation of dA opposite 8-oxo-7H-dG when readthrough occurs past this oxidized nucleoside base

  9. Structure and Dynamics of RNA Repeat Expansions That Cause Huntington's Disease and Myotonic Dystrophy Type 1.

    Science.gov (United States)

    Chen, Jonathan L; VanEtten, Damian M; Fountain, Matthew A; Yildirim, Ilyas; Disney, Matthew D

    2017-07-11

    RNA repeat expansions cause a host of incurable, genetically defined diseases. The most common class of RNA repeats consists of trinucleotide repeats. These long, repeating transcripts fold into hairpins containing 1 × 1 internal loops that can mediate disease via a variety of mechanism(s) in which RNA is the central player. Two of these disorders are Huntington's disease and myotonic dystrophy type 1, which are caused by r(CAG) and r(CUG) repeats, respectively. We report the structures of two RNA constructs containing three copies of a r(CAG) [r(3×CAG)] or r(CUG) [r(3×CUG)] motif that were modeled with nuclear magnetic resonance spectroscopy and simulated annealing with restrained molecular dynamics. The 1 × 1 internal loops of r(3×CAG) are stabilized by one-hydrogen bond (cis Watson-Crick/Watson-Crick) AA pairs, while those of r(3×CUG) prefer one- or two-hydrogen bond (cis Watson-Crick/Watson-Crick) UU pairs. Assigned chemical shifts for the residues depended on the identity of neighbors or next nearest neighbors. Additional insights into the dynamics of these RNA constructs were gained by molecular dynamics simulations and a discrete path sampling method. Results indicate that the global structures of the RNA are A-form and that the loop regions are dynamic. The results will be useful for understanding the dynamic trajectory of these RNA repeats but also may aid in the development of therapeutics.

  10. Anti-parallel triplexes

    DEFF Research Database (Denmark)

    Kosbar, Tamer R.; Sofan, Mamdouh A.; Waly, Mohamed A.

    2015-01-01

    about 6.1 °C when the TFO strand was modified with Z and the Watson-Crick strand with adenine-LNA (AL). The molecular modeling results showed that, in case of nucleobases Y and Z a hydrogen bond (1.69 and 1.72 Å, respectively) was formed between the protonated 3-aminopropyn-1-yl chain and one...... of the phosphate groups in Watson-Crick strand. Also, it was shown that the nucleobase Y made a good stacking and binding with the other nucleobases in the TFO and Watson-Crick duplex, respectively. In contrast, the nucleobase Z with LNA moiety was forced to twist out of plane of Watson-Crick base pair which......The phosphoramidites of DNA monomers of 7-(3-aminopropyn-1-yl)-8-aza-7-deazaadenine (Y) and 7-(3-aminopropyn-1-yl)-8-aza-7-deazaadenine LNA (Z) are synthesized, and the thermal stability at pH 7.2 and 8.2 of anti-parallel triplexes modified with these two monomers is determined. When, the anti...

  11. Orbital interactions and charge redistribution in weak hydrogen bonds: Watson-Crick GC mimic involving C-H proton donor and F proton acceptor groups

    NARCIS (Netherlands)

    Fonseca Guerra, C.; Baerends, E.J.; Bickelhaupt, F.M.

    2006-01-01

    The discovery by Kool and coworkers that 2,4-difluorotoluene (F) mimics thymine (T) in DNA replication has led to controversy regarding the question of whether this mimic has the capability of forming hydrogen bonds with adenine (A). Recently, we have provided evidence for an important role of both

  12. Targeting MicroRNAs with Small Molecules a Novel Approach to Treating Breast Cancer

    Science.gov (United States)

    2011-10-01

    or deoxyribozyme, is a catalytic DNA that site-specifically cleaves the target RNA Watson – Crick base pairing to a complementary target sequence...RNA A-helix fold among the selected pre- miRNA targets. Furthermore, 3D characteristics including Watson - Crick base pairs and wobble base pairs...phosphorothioate backbone in addition to 2′-O-methoxyethyl AMOs are ASOs against miRNAs and therefore produce ASO–miRNA duplexes through Watson – Crick binding

  13. Insights into the Structures of DNA Damaged by Hydroxyl Radical: Crystal Structures of DNA Duplexes Containing 5-Formyluracil

    Directory of Open Access Journals (Sweden)

    Masaru Tsunoda

    2010-01-01

    Full Text Available Hydroxyl radicals are potent mutagens that attack DNA to form various base and ribose derivatives. One of the major damaged thymine derivatives is 5-formyluracil (fU, which induces pyrimidine transition during replication. In order to establish the structural basis for such mutagenesis, the crystal structures of two kinds of DNA d(CGCGRATfUCGCG with R = A/G have been determined by X-ray crystallography. The fU residues form a Watson-Crick-type pair with A and two types of pairs (wobble and reversed wobble with G, the latter being a new type of base pair between ionized thymine base and guanine base. In silico structural modeling suggests that the DNA polymerase can accept the reversed wobble pair with G, as well as the Watson-Crick pair with A.

  14. Hydrogen bond indices and tertiary structure of yeast tRNA sup(Phe)

    International Nuclear Information System (INIS)

    Giambiagi, M.S. de; Giambiagi, M.; Esquivel, D.M.S.

    1982-01-01

    The rigidity and stability of the tertiary structure of yeast tRNA sup(Phe) is related to a bond index employed in an IEHT calculation. The index permits a quantitative estimate of the electronic cloud along the hydrogen bond, having thus an appealing physical meaning. The results indicate that Hoogsteen-type bonds have, as expected, greater electronic population than Watson-Crick type ones. Other non-Watson-Crick pairings, the wobble pair and G 15 -C 48 , exhibit high values of the index for the NH...O bond. In the triples, the electronic density of the hydrogen bridges does not weaken, comparing it with the one of the pairs involved. Contour density maps are shown and dipolar moments of pairs and triples are qualitatively discussed. (Author) [pt

  15. Targeting Micrornas With Small Molecules: A Novel Approach to Treating Breast Cancer

    Science.gov (United States)

    2010-10-01

    DNAzyme, or deoxyribozyme, is a catalytic DNA that site-specifically cleaves the target RNA Watson – Crick base pairing to a complementary target...conserved antiparallel RNA A-helix fold among the selected pre- miRNA targets (Fig. 1a). Furthermore, 3D characteristics including Watson - Crick base pairs... Watson – Crick binding, leading to RNAse-H- mediated cleavage of the mRNA of the target gene. The ASOs also inhibit transcription, splicing, and

  16. Engineering Improvements in a Bacterial Therapeutic Delivery System for Breast Cancer

    Science.gov (United States)

    2010-09-01

    combining the number of Watson - Crick base pairs (+1) with mismatches (-1). Hairpin secondary structures were screened by using the probe sequence to...Annual Report 5 Aim 2. Task 1. To identify DNA sequences that act as promoters in tumors but not in normal tissue (year 1). This step of the...promoters using Nimblegen arrays. Plasmid DNA was extracted from the original promoter library (Library-0), from a sub-library of clones activated in

  17. Massively Parallel Nanostructure Assembly Strategies for Sensing and Information Technology. Phase 2

    Science.gov (United States)

    2013-05-25

    Mirkin In order to remove the nanoparticle thin-film superlattices from the saline environment necessary to preserve Watson - Crick base-pairing and...polypyrroles and motor proteins. Functionalizing carbon nanotube bridged wires with biological receptors allowed fabrication of biosensors that could detect DNA ...the application of electrical stimuli. From an assembly perspective, we report on two major advances: (1) the utilization of DNA -mediated assembly to

  18. Modeling Thermal Inactivation of Bacillus Spores

    Science.gov (United States)

    2009-03-01

    information is preserved and replicated by the Watson - Crick base pairing in which 4-3 complementary bases recognize each other. One incorrect amino acid can...hydrolysis reactions to take place with the spore’s DNA and other proteins. These chemical reactions degrade the DNA and proteins to such an extent that the... DNA cannot be repaired or replicated, thus causing spore death. We further assert that damage to a spore is based on a certain initial DNA information

  19. Interaction entre la proteine ribosomique L20 et l'ARN 23S : sondage direct par piege optique

    OpenAIRE

    Mangeol , Pierre

    2009-01-01

    This thesis is focused on force measurements applied to single RNA alone or associated with a protein. One of the biggest challenges arising when studying RNA comes from its structure, essentially because the interactions taking place are not reduced to the Watson-Crick base pairs and tertiary interactions are frequent. Force measurements give complementary information compared to classical bulk measurements, because they enable to probe directly the complex interactions in RNA and give an ac...

  20. Mahonian pairs

    OpenAIRE

    Sagan, Bruce E.; Savage, Carla D.

    2012-01-01

    We introduce the notion of a Mahonian pair. Consider the set, P^*, of all words having the positive integers as alphabet. Given finite subsets S,T of P^*, we say that (S,T) is a Mahonian pair if the distribution of the major index, maj, over S is the same as the distribution of the inversion number, inv, over T. So the well-known fact that maj and inv are equidistributed over the symmetric group, S_n, can be expressed by saying that (S_n,S_n) is a Mahonian pair. We investigate various Mahonia...

  1. Predicting and Modeling RNA Architecture

    Science.gov (United States)

    Westhof, Eric; Masquida, Benoît; Jossinet, Fabrice

    2011-01-01

    SUMMARY A general approach for modeling the architecture of large and structured RNA molecules is described. The method exploits the modularity and the hierarchical folding of RNA architecture that is viewed as the assembly of preformed double-stranded helices defined by Watson-Crick base pairs and RNA modules maintained by non-Watson-Crick base pairs. Despite the extensive molecular neutrality observed in RNA structures, specificity in RNA folding is achieved through global constraints like lengths of helices, coaxiality of helical stacks, and structures adopted at the junctions of helices. The Assemble integrated suite of computer tools allows for sequence and structure analysis as well as interactive modeling by homology or ab initio assembly with possibilities for fitting within electronic density maps. The local key role of non-Watson-Crick pairs guides RNA architecture formation and offers metrics for assessing the accuracy of three-dimensional models in a more useful way than usual root mean square deviation (RMSD) values. PMID:20504963

  2. Synthesis and Structural Characterization of 2'-Fluoro-α-L-RNA-Modified Oligonucleotides

    DEFF Research Database (Denmark)

    Bundgaard Jensen, Troels; Pasternak, Anna; Stahl Madsen, Andreas

    2011-01-01

    with the smallest destabilization towards RNA. Thermodynamic data show that the duplex formation with 2'-fluoro-α-L-RNA nucleotides is enthalpically disfavored but entropically favored. 2'-Fluoro-α-L-RNA nucleotides exhibit very good base pairing specificity following Watson-Crick rules. The 2'-fluoro......-α-L-RNA monomer was designed as a monocyclic mimic of the bicyclic α-L-LNA, and molecular modeling showed that this indeed is the case as the 2'-fluoro monomer adopts a C3'-endo/C2'-exo sugar pucker. Molecular modeling of modified duplexes show that the 2'-fluoro-α-L-RNA nucleotides partake in Watson-Crick base......We describe the synthesis and binding properties of oligonucleotides that contain one or more 2'-fluoro-α-L-RNA thymine monomer(s). Incorporation of 2'-fluoro-α-L-RNA thymine into oligodeoxynucleotides decreased thermal binding stability slightly upon hybridization with complementary DNA and RNA...

  3. Thermal stability of G-rich anti-parallel DNA triplexes upon insertion of LNA and α-l-LNA

    DEFF Research Database (Denmark)

    Kosbar, Tamer R.; Sofan, Mamdouh A.; Abou-Zeid, Laila

    2015-01-01

    G-rich anti-parallel DNA triplexes were modified with LNA or α-l-LNA in their Watson-Crick and TFO strands. The triplexes were formed by targeting a pyrimidine strand to a putative hairpin formed by Hoogsteen base pairing in order to use the UV melting method to evaluate the stability...... of the triplexes. Their thermal stability was reduced when the TFO strand was modified with LNA or α-l-LNA. The same trend was observed when the TFO strand and the purine Watson-Crick strand both were modified with LNA. When all triad components were modified with α-l-LNA and LNA in the middle of the triplex...

  4. Structure of the DNA duplex d(ATTAAT2 with Hoogsteen hydrogen bonds.

    Directory of Open Access Journals (Sweden)

    Francisco J Acosta-Reyes

    Full Text Available The traditional Watson-Crick base pairs in DNA may occasionally adopt a Hoogsteen conformation, with a different organization of hydrogen bonds. Previous crystal structures have shown that the Hoogsteen conformation is favored in alternating AT sequences of DNA. Here we present new data for a different sequence, d(ATTAAT2, which is also found in the Hoogsteen conformation. Thus we demonstrate that other all-AT sequences of DNA with a different sequence may be found in the Hoogsteen conformation. We conclude that any all-AT sequence might acquire this conformation under appropriate conditions. We also compare the detailed features of DNA in either the Hoogsteen or Watson-Crick conformations.

  5. The conformation of 23S rRNA nucleotide A2058 determines its recognition by the ErmE methyltransferase

    DEFF Research Database (Denmark)

    Vester, B; Hansen, L H; Douthwaite, S

    1995-01-01

    the effects of mutations around position A2058 on methylation. Mutagenizing A2058 (to G or U) completely abolishes methylation of 23S rRNA by ErmE. No methylation occurred at other sites in the rRNA, demonstrating the fidelity of ErmE for A2058. Breaking the neighboring G2057-C2611 Watson-Crick base pair...... by introducing either an A2057 or a U2611 mutation, greatly reduces the rate of methylation at A2058. Methylation remains impaired after these mutations have been combined to create a new A2057-U2611 Watson-Crick base interaction. The conformation of this region in 23S rRNA was probed with chemical reagents...

  6. Impact of Heterogeneity and Lattice Bond Strength on DNA Triangle Crystal Growth.

    Science.gov (United States)

    Stahl, Evi; Praetorius, Florian; de Oliveira Mann, Carina C; Hopfner, Karl-Peter; Dietz, Hendrik

    2016-09-07

    One key goal of DNA nanotechnology is the bottom-up construction of macroscopic crystalline materials. Beyond applications in fields such as photonics or plasmonics, DNA-based crystal matrices could possibly facilitate the diffraction-based structural analysis of guest molecules. Seeman and co-workers reported in 2009 the first designed crystal matrices based on a 38 kDa DNA triangle that was composed of seven chains. The crystal lattice was stabilized, unprecedentedly, by Watson-Crick base pairing. However, 3D crystallization of larger designed DNA objects that include more chains such as DNA origami remains an unsolved problem. Larger objects would offer more degrees of freedom and design options with respect to tailoring lattice geometry and for positioning other objects within a crystal lattice. The greater rigidity of multilayer DNA origami could also positively influence the diffractive properties of crystals composed of such particles. Here, we rationally explore the role of heterogeneity and Watson-Crick interaction strengths in crystal growth using 40 variants of the original DNA triangle as model multichain objects. Crystal growth of the triangle was remarkably robust despite massive chemical, geometrical, and thermodynamical sample heterogeneity that we introduced, but the crystal growth sensitively depended on the sequences of base pairs next to the Watson-Crick sticky ends of the triangle. Our results point to weak lattice interactions and high concentrations as decisive factors for achieving productive crystallization, while sample heterogeneity and impurities played a minor role.

  7. Is the DPT tautomerization of the long A·G Watson-Crick DNA base mispair a source of the adenine and guanine mutagenic tautomers? A QM and QTAIM response to the biologically important question.

    Science.gov (United States)

    Brovarets', Ol'ha O; Zhurakivsky, Roman O; Hovorun, Dmytro M

    2014-03-05

    Herein, we first address the question posed in the title by establishing the tautomerization trajectory via the double proton transfer of the adenine·guanine (A·G) DNA base mispair formed by the canonical tautomers of the A and G bases into the A*·G* DNA base mispair, involving mutagenic tautomers, with the use of the quantum-mechanical calculations and quantum theory of atoms in molecules (QTAIM). It was detected that the A·G ↔ A*·G* tautomerization proceeds through the asynchronous concerted mechanism. It was revealed that the A·G base mispair is stabilized by the N6H···O6 (5.68) and N1H···N1 (6.51) hydrogen bonds (H-bonds) and the N2H···HC2 dihydrogen bond (DH-bond) (0.68 kcal·mol(-1) ), whereas the A*·G* base mispair-by the O6H···N6 (10.88), N1H···N1 (7.01) and C2H···N2 H-bonds (0.42 kcal·mol(-1) ). The N2H···HC2 DH-bond smoothly and without bifurcation transforms into the C2H···N2 H-bond at the IRC = -10.07 Bohr in the course of the A·G ↔ A*·G* tautomerization. Using the sweeps of the energies of the intermolecular H-bonds, it was observed that the N6H···O6 H-bond is anticooperative to the two others-N1H···N1 and N2H···HC2 in the A·G base mispair, while the latters are significantly cooperative, mutually strengthening each other. In opposite, all three O6H···N6, N1H···N1, and C2H···N2 H-bonds are cooperative in the A*·G* base mispair. All in all, we established the dynamical instability of the А*·G* base mispair with a short lifetime (4.83·10(-14) s), enabling it not to be deemed feasible source of the A* and G* mutagenic tautomers of the DNA bases. The small lifetime of the А*·G* base mispair is predetermined by the negative value of the Gibbs free energy for the A*·G* → A·G transition. Moreover, all of the six low-frequency intermolecular vibrations cannot develop during this lifetime that additionally confirms the aforementioned results. Thus, the A*·G* base mispair cannot be considered as a source of the mutagenic tautomers of the DNA bases, as the A·G base mispair dissociates during DNA replication exceptionally into the A and G monomers in the canonical tautomeric form. Copyright © 2013 Wiley Periodicals, Inc.

  8. Detection of mutations in genes by specific LNA primers

    DEFF Research Database (Denmark)

    2001-01-01

    acid (LNA). LNA oligomers obey the Watson-Crick base-pairing rules and form duplexes that are significantly more stable than similar duplexes formed by DNA. The "allele-specific" LNA-containing oligonucleotides wherein the LNA nucleotide(s) are found at the 3' position can be extended by means......The present invention relates to a method of detecting variant nucleic acid whose nucleotide sequence differs from one another at a single (or more) position(s). The method uses a set of chimeric oligonucleotides containing DNA monomers and monomers of a novel class of DNA analogues, locked nucleic...

  9. Selective DNA-Mediated Assembly of Gold Nanoparticles on Electroded Substrates

    Science.gov (United States)

    2008-06-01

    might use the Watson - Crick base-pairing of DNA as a means for ultrahigh-precision engineering is well- known.5,6 The idea is to use the highly specific...Selective DNA -Mediated Assembly of Gold Nanoparticles on Electroded Substrates K. E. Sapsford,†,‡,∇ D. Park,§ E. R. Goldman,‡ E. E. Foos,| S. A...electrodes via DNA hybridization. Protocols are demonstrated for maximizing selectivity and coverage using 15mers as the active binding agents. Detailed

  10. Assembling RNA Nanoparticles.

    Science.gov (United States)

    Xiao, Shou-Jun

    2017-01-01

    RNA nanoparticles are designed and self-assembled according to noncanonical interactions of naturally conserved RNA motifs and/or canonical Watson-Crick base-pairing interactions, which have potential applications in gene therapy and nanomedicine. These artificially engineered nanoparticles are mainly synthesized from in vitro transcribed RNAs, purified by denaturing and native polyacrylamide gel electrophoresis (PAGE), and characterized with native PAGE, AFM, and TEM technologies. The protocols of in vitro transcription, denaturing and native PAGE, and RNA nanoparticle self-assembly are described in detail.

  11. G-Quadruplexes in DNA Replication: A Problem or a Necessity?

    Science.gov (United States)

    Valton, Anne-Laure; Prioleau, Marie-Noëlle

    2016-11-01

    DNA replication is a highly regulated process that ensures the correct duplication of the genome at each cell cycle. A precise cell type-specific temporal program controls the duplication of complex vertebrate genomes in an orderly manner. This program is based on the regulation of both replication origin firing and replication fork progression. G-quadruplexes (G4s), DNA secondary structures displaying noncanonical Watson-Crick base pairing, have recently emerged as key controllers of genome duplication. Here we discuss the various means by which G4s affect this fundamental cellular process. Copyright © 2016 Elsevier Ltd. All rights reserved.

  12. Biologically important conformational features of DNA as interpreted by quantum mechanics and molecular mechanics computations of its simple fragments.

    Science.gov (United States)

    Poltev, V; Anisimov, V M; Dominguez, V; Gonzalez, E; Deriabina, A; Garcia, D; Rivas, F; Polteva, N A

    2018-02-01

    Deciphering the mechanism of functioning of DNA as the carrier of genetic information requires identifying inherent factors determining its structure and function. Following this path, our previous DFT studies attributed the origin of unique conformational characteristics of right-handed Watson-Crick duplexes (WCDs) to the conformational profile of deoxydinucleoside monophosphates (dDMPs) serving as the minimal repeating units of DNA strand. According to those findings, the directionality of the sugar-phosphate chain and the characteristic ranges of dihedral angles of energy minima combined with the geometric differences between purines and pyrimidines determine the dependence on base sequence of the three-dimensional (3D) structure of WCDs. This work extends our computational study to complementary deoxydinucleotide-monophosphates (cdDMPs) of non-standard conformation, including those of Z-family, Hoogsteen duplexes, parallel-stranded structures, and duplexes with mispaired bases. For most of these systems, except Z-conformation, computations closely reproduce experimental data within the tolerance of characteristic limits of dihedral parameters for each conformation family. Computation of cdDMPs with Z-conformation reveals that their experimental structures do not correspond to the internal energy minimum. This finding establishes the leading role of external factors in formation of the Z-conformation. Energy minima of cdDMPs of non-Watson-Crick duplexes demonstrate different sequence-dependence features than those known for WCDs. The obtained results provide evidence that the biologically important regularities of 3D structure distinguish WCDs from duplexes having non-Watson-Crick nucleotide pairing.

  13. Pairing correlations in nuclei

    International Nuclear Information System (INIS)

    Baba, C.V.K.

    1988-01-01

    There are many similarities between the properties of nucleons in nuclei and electrons in metals. In addition to the properties explainable in terms of independent particle motion, there are many important co-operative effects suggesting correlated motion. Pairing correlation which leads to superconductivity in metals and several important properties in nuclei , is an exmple of such correlations. An attempt has been made to review the effects of pairing correlations in nuclei. Recent indications of reduction in pairing correlations at high angular momenta is discussed. A comparision between pairing correlations in the cases of nuclei and electrons in metals is attempted. (author). 20 refs., 10 figs

  14. Secure pairing with biometrics

    NARCIS (Netherlands)

    Buhan, I.R.; Boom, B.J.; Doumen, J.M.; Hartel, Pieter H.; Veldhuis, Raymond N.J.

    Secure pairing enables two devices that share no prior context with each other to agree upon a security association, which they can use to protect their subsequent communication. Secure pairing offers guarantees of the association partner identity and it should be resistant to eavesdropping and to a

  15. Affine pairings on ARM

    NARCIS (Netherlands)

    Acar, T.; Lauter, K.; Naehrig, M.; Shumow, D.

    2011-01-01

    Pairings on elliptic curves are being used in an increasing number of cryptographic applications on many different devices and platforms, but few performance numbers for cryptographic pairings have been reported on embedded and mobile devices. In this paper we give performance numbers for affine and

  16. Solutions of nuclear pairing

    International Nuclear Information System (INIS)

    Balantekin, A. B.; Pehlivan, Y.

    2007-01-01

    We give the exact solution of orbit dependent nuclear pairing problem between two nondegenerate energy levels using the Bethe ansatz technique. Our solution reduces to previously solved cases in the appropriate limits including Richardson's treatment of reduced pairing in terms of rational Gaudin algebra operators

  17. Pair correlations in nuclei

    International Nuclear Information System (INIS)

    Shimizu, Yoshifumi

    2009-01-01

    Except for the closed shell nuclei, almost all nuclei are in the superconducting state at their ground states. This well-known pair correlation in nuclei causes various interesting phenomena. It is especially to be noted that the pair correlation becomes weak in the excited states of nuclei with high angular momentum, which leads to the pair phase transition to the normal state in the high spin limit. On the other hand, the pair correlation becomes stronger in the nuclei with lower nucleon density than in those with normal density. In the region of neutron halo or skin state of unstable nuclei, this phenomenon is expected to be further enhanced to be observed compared to the ground state of stable nuclei. An overview of those interesting aspects caused via the pair correlation is presented here in the sections titled 'pair correlations in ground states', pair correlations in high spin states' and 'pair correlations in unstable nuclei' focusing on the high spin state. (S. Funahashi)

  18. Cooper Pairs in Insulators?

    International Nuclear Information System (INIS)

    Valles, James

    2008-01-01

    Nearly 50 years elapsed between the discovery of superconductivity and the emergence of the microscopic theory describing this zero resistance state. The explanation required a novel phase of matter in which conduction electrons joined in weakly bound pairs and condensed with other pairs into a single quantum state. Surprisingly, this Cooper pair formation has also been invoked to account for recently uncovered high-resistance or insulating phases of matter. To address this possibility, we have used nanotechnology to create an insulating system that we can probe directly for Cooper pairs. I will present the evidence that Cooper pairs exist and dominate the electrical transport in these insulators and I will discuss how these findings provide new insight into superconductor to insulator quantum phase transitions.

  19. Au pair trajectories

    DEFF Research Database (Denmark)

    Dalgas, Karina Märcher

    2015-01-01

    pair-sending families in the Philippines, this dissertation examines the long-term trajectories of these young Filipinas. It shows how the au pairs’ local and transnational family relations develop over time and greatly influence their life trajectories. A focal point of the study is how au pairs...... that Filipina au pairs see their stay abroad as an avenue of personal development and social recognition, I examine how the au pairs re-position themselves within their families at home through migration, and how they navigate between the often conflicting expectations of participation in the sociality......Since 2000, thousands of young Filipino migrants have come to Denmark as au pairs. Officially, they are there to “broaden their cultural horizons” by living temporarily with a Danish host family, but they also conduct domestic labor in exchange for food and money, which allows them to send...

  20. Mesoscopic pairing without superconductivity

    Science.gov (United States)

    Hofmann, Johannes

    2017-12-01

    We discuss pairing signatures in mesoscopic nanowires with a variable attractive pairing interaction. Depending on the wire length, density, and interaction strength, these systems realize a simultaneous bulk-to-mesoscopic and BCS-BEC crossover, which we describe in terms of the parity parameter that quantifies the odd-even energy difference and generalizes the bulk Cooper pair binding energy to mesoscopic systems. We show that the parity parameter can be extracted from recent measurements of conductance oscillations in SrTiO3 nanowires by Cheng et al. [Nature (London) 521, 196 (2015), 10.1038/nature14398], where it marks the critical magnetic field that separates pair and single-particle currents. Our results place the experiment in the fluctuation-dominated mesoscopic regime on the BCS side of the crossover.

  1. Investigations into nuclear pairing

    International Nuclear Information System (INIS)

    Clark, R.M.

    2006-01-01

    This paper is divided in two main sections focusing on different aspects of collective nuclear behavior. In the first section, solutions are considered for the collective pairing Hamiltonian. In particular, an approximate solution at the critical point of the pairing transition from harmonic vibration (normal nuclear behavior) to deformed rotation (superconducting behavior) in gauge space is found by analytic solution of the Hamiltonian. The eigenvalues are expressed in terms of the zeros of Bessel functions of integer order. The results are compared to the pairing bands based on the Pb isotopes. The second section focuses on the experimental search for the Giant Pairing Vibration (GPV) in nuclei. After briefly describing the origin of the GPV, and the reasons that the state has remained unidentified, a novel idea for populating this state is presented. A recent experiment has been performed using the LIBERACE+STARS detector system at the 88-Inch Cyclotron of LBNL to test the idea. (Author)

  2. Stereospecificity of oligonucleotide interactions revisited: no evidence for heterochiral hybridization and ribozyme/DNAzyme activity.

    Directory of Open Access Journals (Sweden)

    Kai Hoehlig

    Full Text Available A major challenge for the application of RNA- or DNA-oligonucleotides in biotechnology and molecular medicine is their susceptibility to abundant nucleases. One intriguing possibility to tackle this problem is the use of mirror-image (l-oligonucleotides. For aptamers, this concept has successfully been applied to even develop therapeutic agents, so-called Spiegelmers. However, for technologies depending on RNA/RNA or RNA/DNA hybridization, like antisense or RNA interference, it has not been possible to use mirror-image oligonucleotides because Watson-Crick base pairing of complementary strands is (thought to be stereospecific. Many scientists consider this a general principle if not a dogma. A recent publication proposing heterochiral Watson-Crick base pairing and sequence-specific hydrolysis of natural RNA by mirror-image ribozymes or DNAzymes (and vice versa prompted us to systematically revisit the stereospecificity of oligonucleotides hybridization and catalytic activity. Using hyperchromicity measurements we demonstrate that hybridization only occurs among homochiral anti-parallel complementary oligonucleotide strands. As expected, achiral PNA hybridizes to RNA and DNA irrespective of their chirality. In functional assays we could not confirm an alleged heterochiral hydrolytic activity of ribozymes or DNAzymes. Our results confirm a strict stereospecificity of oligonucleotide hybridization and clearly argue against the possibility to use mirror-image oligonucleotides for gene silencing or antisense applications.

  3. Noncanonical self-assembly of multifunctional DNA nanoflowers for biomedical applications.

    Science.gov (United States)

    Zhu, Guizhi; Hu, Rong; Zhao, Zilong; Chen, Zhuo; Zhang, Xiaobing; Tan, Weihong

    2013-11-06

    DNA nanotechnology has been extensively explored to assemble various functional nanostructures for versatile applications. Mediated by Watson-Crick base-pairing, these DNA nanostructures have been conventionally assembled through hybridization of many short DNA building blocks. Here we report the noncanonical self-assembly of multifunctional DNA nanostructures, termed as nanoflowers (NFs), and the versatile biomedical applications. These NFs were assembled from long DNA building blocks generated via rolling circle replication (RCR) of a designer template. NF assembly was driven by liquid crystallization and dense packaging of building blocks, without relying on Watson-Crick base-pairing between DNA strands, thereby avoiding the otherwise conventional complicated DNA sequence design. NF sizes were readily tunable in a wide range, by simply adjusting such parameters as assembly time and template sequences. NFs were exceptionally resistant to nuclease degradation, denaturation, or dissociation at extremely low concentration, presumably resulting from the dense DNA packaging in NFs. The exceptional biostability is critical for biomedical applications. By rational design, NFs can be readily incorporated with myriad functional moieties. All these properties make NFs promising for versatile applications. As a proof-of-principle demonstration, in this study, NFs were integrated with aptamers, bioimaging agents, and drug loading sites, and the resultant multifunctional NFs were demonstrated for selective cancer cell recognition, bioimaging, and targeted anticancer drug delivery.

  4. [Paired kidneys in transplant].

    Science.gov (United States)

    Regueiro López, Juan C; Leva Vallejo, Manuel; Prieto Castro, Rafael; Anglada Curado, Francisco; Vela Jiménez, Francisco; Ruiz García, Jesús

    2009-02-01

    Many factors affect the graft and patient survival on the renal transplant outcome. These factors depend so much of the recipient and donor. We accomplished a study trying to circumvent factors that depend on the donor. We checked the paired kidneys originating of a same donor cadaver. We examined the risk factors in the evolution and follow-up in 278 couples of kidney transplant. We describe their differences, significance, the graft and patient survival, their functionality in 3 and 5 years and the risk factors implicated in their function. We study immunogenic and no immunogenic variables, trying to explain the inferior results in the grafts that are established secondly. We regroup the paired kidneys in those that they did not show paired initial function within the same couple. The results yield a discreet deterioration in the graft and patient survival for second group establish, superior creatinina concentration, without obtaining statistical significance. The Cox regression study establishes the early rejection (inferior to three months) and DR incompatibility values like risk factors. This model of paired kidneys would be able to get close to best-suited form for risk factors analysis in kidney transplant from cadaver donors, if more patients examine themselves in the same way. The paired kidneys originating from the same donor do not show the same function in spite of sharing the same conditions of the donor and perioperative management.

  5. Junctionless Cooper pair transistor

    Energy Technology Data Exchange (ETDEWEB)

    Arutyunov, K. Yu., E-mail: konstantin.yu.arutyunov@jyu.fi [National Research University Higher School of Economics , Moscow Institute of Electronics and Mathematics, 101000 Moscow (Russian Federation); P.L. Kapitza Institute for Physical Problems RAS , Moscow 119334 (Russian Federation); Lehtinen, J.S. [VTT Technical Research Centre of Finland Ltd., Centre for Metrology MIKES, P.O. Box 1000, FI-02044 VTT (Finland)

    2017-02-15

    Highlights: • Junctionless Cooper pair box. • Quantum phase slips. • Coulomb blockade and gate modulation of the Coulomb gap. - Abstract: Quantum phase slip (QPS) is the topological singularity of the complex order parameter of a quasi-one-dimensional superconductor: momentary zeroing of the modulus and simultaneous 'slip' of the phase by ±2π. The QPS event(s) are the dynamic equivalent of tunneling through a conventional Josephson junction containing static in space and time weak link(s). Here we demonstrate the operation of a superconducting single electron transistor (Cooper pair transistor) without any tunnel junctions. Instead a pair of thin superconducting titanium wires in QPS regime was used. The current–voltage characteristics demonstrate the clear Coulomb blockade with magnitude of the Coulomb gap modulated by the gate potential. The Coulomb blockade disappears above the critical temperature, and at low temperatures can be suppressed by strong magnetic field.

  6. High-resolution NMR studies of chimeric DNA-RNA-DNA duplexes, heteronomous base pairing, and continuous base stacking at junctions

    International Nuclear Information System (INIS)

    Chou, Shanho; Flynn, P.; Wang, A.; Reid, B.

    1991-01-01

    Two symmetrical DNA-RNA-DNA duplex chimeras, d(CGCG)r(AAUU)d(CGCG) (designated rAAUU) and d(CGCG)r(UAUA)d(CGCG) (designated rUAUA), and a nonsymmetrical chimeric duplex, d(CGTT)r(AUAA)d(TGCG)/d(CGCA)r(UUAU)d(AACG) (designated rAUAA), as well as their pure DNA analogues, containing dU instead of T, have been synthesized by solid-phase phosphoramidite methods and studied by high-resolution NMR techniques. The 1D imino proton NOE spectra of these d-r-d chimeras indicate normal Watson-Crick hydrogen bonding and base stacking at the junction region. Preliminary qualitative NOESY, COSY, and chemical shift data suggest that the internal RNA segment contains C3'-endo (A-type) sugar conformations except for the first RNA residues (position 5 and 17) following the 3' end of the DNA block, which, unlike the other six ribonucleotides, exhibit detectable H1'-H2' J coupling. The nucleosides of the two flanking DNA segments appear to adopt a fairly normal C2'-endo B-DNA conformation except at the junction with the RNA blocks (residues 4 and 16), where the last DNA residue appears to adopt an intermediate sugar conformation. The data indicate that A-type and B-type conformations can coexist in a single short continuous nucleic acid duplex, but these results differ somewhat from previous theoretical model studies

  7. Frustrated Lewis Pairs

    Indian Academy of Sciences (India)

    Home; Journals; Resonance – Journal of Science Education; Volume 19; Issue 11. Frustrated Lewis Pairs : Enabling via inability. Sanjoy Mukherjee ... Author Affiliations. Sanjoy Mukherjee Pakkirisamy Thilagar1. Department of Inorgainic and Physical Chemistry Indian Institute of Science Bangalore 560 012, India.

  8. Paired fuzzy sets

    DEFF Research Database (Denmark)

    Rodríguez, J. Tinguaro; Franco de los Ríos, Camilo; Gómez, Daniel

    2015-01-01

    In this paper we want to stress the relevance of paired fuzzy sets, as already proposed in previous works of the authors, as a family of fuzzy sets that offers a unifying view for different models based upon the opposition of two fuzzy sets, simply allowing the existence of different types...

  9. Affine pairings on ARM

    NARCIS (Netherlands)

    Acar, T.; Lauter, K.; Naehrig, M.; Shumow, D.; Abdalla, M.; Lange, T.

    2013-01-01

    We report on relative performance numbers for affine and projective pairings on a dual-core Cortex A9 ARM processor. Using a fast inversion in the base field and doing inversion in extension fields by using the norm map to reduce to inversions in smaller fields, we find a very low ratio of

  10. Excited cooper pairs

    Energy Technology Data Exchange (ETDEWEB)

    Lopez-Arrietea, M. G.; Solis, M. A.; De Llano, M. [Universidad Nacional Autonoma de Mexico, Mexico, D.F (Mexico)

    2001-02-01

    Excited cooper pairs formed in a many-fermion system are those with nonzero total center-of mass momentum (CMM). They are normally neglected in the standard Bardeen-Cooper-Schrieffer (BCS) theory of superconductivity for being too few compared with zero CMM pairs. However, a Bose-Einstein condensation picture requires both zero and nonzero CMM pairs. Assuming a BCS model interaction between fermions we determine the populations for all CMM values of Cooper pairs by actually calculating the number of nonzero-CMM pairs relative to that of zero-CMM ones in both 2D and 3D. Although this ratio decreases rapidly with CMM, the number of Cooper pairs for any specific CMM less than the maximum (or breakup of the pair) momentum turns out to be typically larger than about 95% of those with zero-CMM at zero temperature T. Even at T {approx}100 K this fraction en 2D is still as large as about 70% for typical quasi-2D cuprate superconductor parameters. [Spanish] Los pares de cooper excitados formados en un sistema de muchos electrones, son aquellos con momentos de centro de masa (CMM) diferente de cero. Normalmente estos no son tomados en cuenta en la teoria estandar de la superconductividad de Bardeen-Cooper-Schrieffer (BCS) al suponer que su numero es muy pequeno comparados con los pares de centro de masa igual a cero. Sin embargo, un esquema de condensacion Bose-Einstein requiere de ambos pares, con CMM cero y diferente de cero. Asumiendo una interaccion modelo BCS entre los fermiones, determinamos la poblacion de pares cooper con cada uno de todos los posibles valores del CMM calculando el numero de pares con momentos de centro de masa diferente de cero relativo a los pares de CMM igual a cero, en 2D y 3D. Aunque esta razon decrece rapidamente con el CMM, el numero de pares de cooper para cualquier CMM especifico menor que el momento maximo (o rompimiento de par) es tipicamente mas grande que el 95% de aquellos con CMM cero. Aun a T {approx}100 K esta fraccion en 2D es

  11. Multi-pair states in electron–positron pair creation

    Energy Technology Data Exchange (ETDEWEB)

    Wöllert, Anton, E-mail: woellert@mpi-hd.mpg.de; Bauke, Heiko, E-mail: heiko.bauke@mpi-hd.mpg.de; Keitel, Christoph H.

    2016-09-10

    Ultra strong electromagnetic fields can lead to spontaneous creation of single or multiple electron–positron pairs. A quantum field theoretical treatment of the pair creation process combined with numerical methods provides a description of the fermionic quantum field state, from which all observables of the multiple electron–positron pairs can be inferred. This allows to study the complex multi-particle dynamics of electron–positron pair creation in-depth, including multi-pair statistics as well as momentum distributions and spin. To illustrate the potential benefit of this approach, it is applied to the intermediate regime of pair creation between nonperturbative Schwinger pair creation and perturbative multiphoton pair creation where the creation of multi-pair states becomes nonnegligible but cascades do not yet set in. Furthermore, it is demonstrated how spin and helicity of the created electrons and positrons are affected by the polarization of the counterpropagating laser fields, which induce the creation of electron–positron pairs.

  12. Multi-pair states in electron–positron pair creation

    International Nuclear Information System (INIS)

    Wöllert, Anton; Bauke, Heiko; Keitel, Christoph H.

    2016-01-01

    Ultra strong electromagnetic fields can lead to spontaneous creation of single or multiple electron–positron pairs. A quantum field theoretical treatment of the pair creation process combined with numerical methods provides a description of the fermionic quantum field state, from which all observables of the multiple electron–positron pairs can be inferred. This allows to study the complex multi-particle dynamics of electron–positron pair creation in-depth, including multi-pair statistics as well as momentum distributions and spin. To illustrate the potential benefit of this approach, it is applied to the intermediate regime of pair creation between nonperturbative Schwinger pair creation and perturbative multiphoton pair creation where the creation of multi-pair states becomes nonnegligible but cascades do not yet set in. Furthermore, it is demonstrated how spin and helicity of the created electrons and positrons are affected by the polarization of the counterpropagating laser fields, which induce the creation of electron–positron pairs.

  13. Design of Tail-Clamp Peptide Nucleic Acid Tethered with Azobenzene Linker for Sequence-Specific Detection of Homopurine DNA

    Directory of Open Access Journals (Sweden)

    Shinjiro Sawada

    2017-10-01

    Full Text Available DNA carries genetic information in its sequence of bases. Synthetic oligonucleotides that can sequence-specifically recognize a target gene sequence are a useful tool for regulating gene expression or detecting target genes. Among the many synthetic oligonucleotides, tail-clamp peptide nucleic acid (TC-PNA offers advantages since it has two homopyrimidine PNA strands connected via a flexible ethylene glycol-type linker that can recognize complementary homopurine sequences via Watson-Crick and Hoogsteen base pairings and form thermally-stable PNA/PNA/DNA triplex structures. Here, we synthesized a series of TC-PNAs that can possess different lengths of azobenzene-containing linkers and studied their binding behaviours to homopurine single-stranded DNA. Introduction of azobenzene at the N-terminus amine of PNA increased the thermal stability of PNA-DNA duplexes. Further extension of the homopyrimidine PNA strand at the N-terminus of PNA-AZO further increased the binding stability of the PNA/DNA/PNA triplex to the target homopurine sequence; however, it induced TC-PNA/DNA/TC-PNA complex formation. Among these TC-PNAs, 9W5H-C4-AZO consisting of nine Watson-Crick bases and five Hoogsteen bases tethered with a beta-alanine conjugated azobenzene linker gave a stable 1:1 TC-PNA/ssDNA complex and exhibited good mismatch recognition. Our design for TC-PNA-AZO can be utilized for detecting homopurine sequences in various genes.

  14. Electron attachment to the guanine-cytosine nucleic acid base pair and the effects of monohydration and proton transfer.

    Science.gov (United States)

    Gupta, Ashutosh; Jaeger, Heather M; Compaan, Katherine R; Schaefer, Henry F

    2012-05-17

    The guanine-cytosine (GC) radical anion and its interaction with a single water molecule is studied using ab initio and density functional methods. Z-averaged second-order perturbation theory (ZAPT2) was applied to GC radical anion for the first time. Predicted spin densities show that the radical character is localized on cytosine. The Watson-Crick monohydrated GC anion is compared to neutral GC·H2O, as well as to the proton-transferred analogue on the basis of structural and energetic properties. In all three systems, local minima are identified that correspond to water positioned in the major and minor grooves of macromolecular DNA. On the anionic surface, two novel structures have water positioned above or below the GC plane. On the neutral and anionic surfaces, the global minimum can be described as water interacting with the minor groove. These structures are predicted to have hydration energies of 9.7 and 11.8 kcal mol(-1), respectively. Upon interbase proton-transfer (PT), the anionic global minimum has water positioned in the major groove, and the hydration energy increases to 13.4 kcal mol(-1). PT GC·H2O(•-) has distonic character; the radical character resides on cytosine, while the negative charge is localized on guanine. The effects of proton transfer are further investigated through the computed adiabatic electron affinities (AEA) of GC and monohydrated GC, and the vertical detachment energies (VDE) of the corresponding anions. Monohydration increases the AEAs and VDEs by only 0.1 eV, while proton-transfer increases the VDEs substantially (0.8 eV). The molecular charge distribution of monohydrated guanine-cytosine radical anion depends heavily on interbase proton transfer.

  15. Coulomb pair-creation

    International Nuclear Information System (INIS)

    Hrasko, P.; Foeldy, L.; Toth, A.

    1986-07-01

    Electron-positron pair production in strong Coulomb fields is outlined. It is shown that the singular behaviour of the adiabatic basis can be removed if solutions of the time dependent external field Dirac equation are used as a basis to expand the fermion field operator. This latter 'asymptotic basis' makes it possible to introduce Feynman-propagator. Applying the reduction technique, the computation of all of the basic quantities can be reduced to the solution of an integral equation. The positron spectrum for separable potential model with Lorentzian time dependence and for potential jump is analyzed in the pole approximation. (author)

  16. Pairing correlations around scission

    International Nuclear Information System (INIS)

    Krappe, H.J.; Fadeev, S.

    2001-01-01

    To describe pairing correlations in a fissioning system one commonly projects the BCS wave function separately onto good particle numbers in each fragment in the exit channel, but only onto the total number of particles in the parent system. We propose to interpolate between these limiting situations by the generator-coordinate method with the particle-number difference between the nascent fragments as the generator coordinate. Model calculations are presented for the Hill-Wheeler-box potential with a δ-function diaphragm to mimic scission

  17. Au pairs on Facebook

    DEFF Research Database (Denmark)

    Dalgas, Karina Märcher

    2016-01-01

    Ethnographers are increasingly making use of Facebook to acquire access and general acquaintance with their field of study. However, little has been written on how Facebook is used methodologically in research that does not have social media sites as the main focus of interest. This article argues...... the au pairs resist and embrace such dominant representations, and on how such representations are ascribed different meanings in the transnational social fields of which the migrant are a part. The article is based on ethnographic fieldwork conducted between 2010 and 2014 in Denmark, the Philippines...

  18. Analysis of stacking overlap in nucleic acid structures: algorithm and application.

    Science.gov (United States)

    Pingali, Pavan Kumar; Halder, Sukanya; Mukherjee, Debasish; Basu, Sankar; Banerjee, Rahul; Choudhury, Devapriya; Bhattacharyya, Dhananjay

    2014-08-01

    RNA contains different secondary structural motifs like pseudo-helices, hairpin loops, internal loops, etc. in addition to anti-parallel double helices and random coils. The secondary structures are mainly stabilized by base-pairing and stacking interactions between the planar aromatic bases. The hydrogen bonding strength and geometries of base pairs are characterized by six intra-base pair parameters. Similarly, stacking can be represented by six local doublet parameters. These dinucleotide step parameters can describe the quality of stacking between Watson-Crick base pairs very effectively. However, it is quite difficult to understand the stacking pattern for dinucleotides consisting of non canonical base pairs from these parameters. Stacking interaction is a manifestation of the interaction between two aromatic bases or base pairs and thus can be estimated best by the overlap area between the planar aromatic moieties. We have calculated base pair overlap between two consecutive base pairs as the buried van der Waals surface between them. In general, overlap values show normal distribution for the Watson-Crick base pairs in most double helices within a range from 45 to 50 Å(2) irrespective of base sequence. The dinucleotide steps with non-canonical base pairs also are seen to have high overlap value, although their twist and few other parameters are rather unusual. We have analyzed hairpin loops of different length, bulges within double helical structures and pseudo-continuous helices using our algorithm. The overlap area analyses indicate good stacking between few looped out bases especially in GNRA tetraloop, which was difficult to quantitatively characterise from analysis of the base pair or dinucleotide step parameters. This parameter is also seen to be capable to distinguish pseudo-continuous helices from kinked helix junctions.

  19. Assessing Intimacy: The Pair Inventory.

    Science.gov (United States)

    Schaefer, Mark T.; Olson, David H.

    1981-01-01

    Personal Assessment of Intimacy in Relationships (PAIR) provides systematic information in five types of intimacy: emotional, social, sexual, intellectual and recreational. PAIR can be used with couples in marital therapy and enrichment groups. (Author)

  20. QSO Pairs across Active Galaxies

    Indian Academy of Sciences (India)

    2016-01-27

    Jan 27, 2016 ... Several QSO pairs have been reported and their redshifts determined, where the two objects in each pair are located across an active galaxy. The usually accepted explanation of such occurrences is that the pair is ejected from the parent galaxy. Currently interpreted redshifted spectra for both the QSOs ...

  1. Pairing in hadron structure

    International Nuclear Information System (INIS)

    Chela-Flores, J.

    1981-08-01

    A many-body approach to hadron structure is presented, in which we consider two parton species: spin-0 (b-partons), and spin-1/2 (f-partons). We extend a boson and a fermion pairing scheme for the b-, and f-partons respectively, into a Yang-Mills gauge theory. The main feature of this theory is that the gauge field is not identified with the usual gluon field variable in QCD. We study the confinement problem of the hadron constituents, and obtain, for low temperatures, partons that are confined by energy gaps. As the critical temperatures for the corresponding phase transitions are approached, the energy gap gradually disappears, and confinement is lost. The theory goes beyond the non-relativistic harmonic oscillator quark model, in the sense of giving physical reasons why a non-relativistic approximation is adequate in describing the internal dynamics of hadron structure. (author)

  2. Use of Nucleic Acid Analogs for the Study of Nucleic Acid Interactions

    Directory of Open Access Journals (Sweden)

    Shu-ichi Nakano

    2011-01-01

    Full Text Available Unnatural nucleosides have been explored to expand the properties and the applications of oligonucleotides. This paper briefly summarizes nucleic acid analogs in which the base is modified or replaced by an unnatural stacking group for the study of nucleic acid interactions. We also describe the nucleoside analogs of a base pair-mimic structure that we have examined. Although the base pair-mimic nucleosides possess a simplified stacking moiety of a phenyl or naphthyl group, they can be used as a structural analog of Watson-Crick base pairs. Remarkably, they can adopt two different conformations responding to their interaction energies, and one of them is the stacking conformation of the nonpolar aromatic group causing the site-selective flipping of the opposite base in a DNA double helix. The base pair-mimic nucleosides can be used to study the mechanism responsible for the base stacking and the flipping of bases out of a nucleic acid duplex.

  3. Paired Hall states

    International Nuclear Information System (INIS)

    Greiter, M.

    1992-01-01

    This dissertation contains a collection of individual articles on various topics. Their significance in the corresponding field as well as connections between them are emphasized in a general and comprehensive introduction. In the first article, the author explores the consequences for macroscopic effective Lagrangians of assuming that the momentum density is proportional to the flow of conserved current. The universal corrections obtained for the macroscopic Lagrangian of a superconductor describe the London Hall effect, and provide a fully consistent derivation of it. In the second article, a heuristic principle is proposed for quantized Hall states: the existence and incompressibility of fractionally quantized Hall states is explained by an argument based on an adiabatic localization of magnetic flux, the process of trading uniform flux for an equal amount of fictitious flux attached to the particles. This principle is exactly implemented in the third article. For a certain class of model Hamiltonians, the author obtains Laughlin's Jastrow type wave functions explicitly from a filled Landau level, by smooth extrapolation in quantum statistics. The generalization of this analysis to the torus geometry shows that theorems restricting the possibilities of quantum statistics on closed surfaces are circumvented in the presence of a magnetic field. In the last article, the existence is proposed of a novel incompressible quantum liquid, a paired Hall state, at a half filled Landau level. This state arises adiabatically from free fermions in zero magnetic field, and reduces to a state previously proposed by Halperin in the limit of tightly bound pairs. It supports unusual excitations, including neutral fermions and charge e/4 anyons with statistical parameter θ = π/8

  4. Multi-pair states in electron–positron pair creation

    Directory of Open Access Journals (Sweden)

    Anton Wöllert

    2016-09-01

    Full Text Available Ultra strong electromagnetic fields can lead to spontaneous creation of single or multiple electron–positron pairs. A quantum field theoretical treatment of the pair creation process combined with numerical methods provides a description of the fermionic quantum field state, from which all observables of the multiple electron–positron pairs can be inferred. This allows to study the complex multi-particle dynamics of electron–positron pair creation in-depth, including multi-pair statistics as well as momentum distributions and spin. To illustrate the potential benefit of this approach, it is applied to the intermediate regime of pair creation between nonperturbative Schwinger pair creation and perturbative multiphoton pair creation where the creation of multi-pair states becomes nonnegligible but cascades do not yet set in. Furthermore, it is demonstrated how spin and helicity of the created electrons and positrons are affected by the polarization of the counterpropagating laser fields, which induce the creation of electron–positron pairs.

  5. Pair potentials in liquid metals

    International Nuclear Information System (INIS)

    Faber, T.E.

    1980-01-01

    The argument which justifies the use of a pair potential to describe the structure-dependent term in the energy of liquid metals is briefly reviewed. Because there is an additional term in the energy which depends upon volume rather than structure, and because the pair potential itself is volume-dependent, the relationship between pair potential and observable properties such as pressure, bulk modulus and pair distribution function is more complicated for liquid metals than it is for molecular liquids. Perhaps for this reason, the agreement between pair potentials inferred from observable properties and pair potentials calculated by means of pseudo-potential theory is still far from complete. The pair potential concept is applicable only to simple liquid metals, in which the electron-ion interaction is weak. No attempt is made to discuss liquid transition and rare-earth metals, which are not simple in this sense. (author)

  6. Experimental many-pairs nonlocality

    Science.gov (United States)

    Poh, Hou Shun; Cerè, Alessandro; Bancal, Jean-Daniel; Cai, Yu; Sangouard, Nicolas; Scarani, Valerio; Kurtsiefer, Christian

    2017-08-01

    Collective measurements on large quantum systems together with a majority voting strategy can lead to a violation of the Clauser-Horne-Shimony-Holt Bell inequality. In the presence of many entangled pairs, this violation decreases quickly with the number of pairs and vanishes for some critical pair number that is a function of the noise present in the system. Here we show that a different binning strategy can lead to a more substantial Bell violation when the noise is sufficiently small. Given the relation between the critical pair number and the source noise, we then present an experiment where the critical pair number is used to quantify the quality of a high visibility photon pair source. Our results demonstrate nonlocal correlations using collective measurements operating on clusters of more than 40 photon pairs.

  7. A device that operates within a self-assembled 3D DNA crystal

    Science.gov (United States)

    Hao, Yudong; Kristiansen, Martin; Sha, Ruojie; Birktoft, Jens J.; Hernandez, Carina; Mao, Chengde; Seeman, Nadrian C.

    2017-08-01

    Structural DNA nanotechnology finds applications in numerous areas, but the construction of objects, 2D and 3D crystalline lattices and devices is prominent among them. Each of these components has been developed individually, and most of them have been combined in pairs. However, to date there are no reports of independent devices contained within 3D crystals. Here we report a three-state 3D device whereby we change the colour of the crystals by diffusing strands that contain dyes in or out of the crystals through the mother-liquor component of the system. Each colouring strand is designed to pair with an extended triangle strand by Watson-Crick base pairing. The arm that contains the dyes is quite flexible, but it is possible to establish the presence of the duplex proximal to the triangle by X-ray crystallography. We modelled the transition between the red and blue states through a simple kinetic model.

  8. Kramers Pairs in configuration interaction

    DEFF Research Database (Denmark)

    Avery, John Scales; Avery, James Emil

    2003-01-01

    The theory of symmetry-preserving Kramers pair creation operators is reviewed and formulas for applying these operators to configuration interaction calculations are derived. A new and more general type of symmetry-preserving pair creation operator is proposed and shown to commute with the total ...

  9. Property (RD) for Hecke Pairs

    International Nuclear Information System (INIS)

    Shirbisheh, Vahid

    2012-01-01

    As the first step towards developing noncommutative geometry over Hecke C ∗ -algebras, we study property (RD) (Rapid Decay) for Hecke pairs. When the subgroup H in a Hecke pair (G, H) is finite, we show that the Hecke pair (G, H) has (RD) if and only if G has (RD). This provides us with a family of examples of Hecke pairs with property (RD). We also adapt Paul Jolissant’s works in Jolissaint (J K-Theory 2:723–735, 1989; Trans Amer Math Soc 317(1):167–196, 1990) to the setting of Hecke C ∗ -algebras and show that when a Hecke pair (G, H) has property (RD), the algebra of rapidly decreasing functions on the set of double cosets is closed under holomorphic functional calculus of the associated (reduced) Hecke C ∗ -algebra. Hence they have the same K 0 -groups.

  10. Instability of vortex pair leapfrogging

    DEFF Research Database (Denmark)

    Tophøj, Laust; Aref, Hassan

    2013-01-01

    Leapfrogging is a periodic solution of the four-vortex problem with two positive and two negative point vortices all of the same absolute circulation arranged as co-axial vortex pairs. The set of co-axial motions can be parameterized by the ratio 0 vortex pair sizes at the time when one...... pair passes through the other. Leapfrogging occurs for α > σ2, where is the silver ratio. The motion is known in full analytical detail since the 1877 thesis of Gröbli and a well known 1894 paper by Love. Acheson ["Instability of vortex leapfrogging," Eur. J. Phys.21, 269-273 (2000...... pairs fly off to infinity, and a "walkabout" mode, where the vortices depart from leapfrogging but still remain within a finite distance of one another. We show numerically that this transition is more gradual, a result that we relate to earlier investigations of chaotic scattering of vortex pairs [L...

  11. Theoretical Characterization of Sulfur-to-Selenium Substitution in an Emissive RNA Alphabet: Impact on H-bonding Potential and Photophysical Properties

    KAUST Repository

    Chawla, Mohit

    2018-02-23

    We employ density functional theory (DFT) and time-dependent DFT (TDDFT) calculations to investigate the structural, energetic and optical properties of a new computationally designed RNA alphabet, where the nucleobases,tsA, tsG, tsC, and tsU (ts-bases), have been derived by replacing sulfur with selenium in the previously reported tz-bases, based on the isothiazolo[4.3-d]pyrimidine heterocycle core. We find out that the modeled non-natural bases have minimal impact on the geometry and energetics of the classical Watson-Crick base pairs, thus potentially mimicking the natural bases in a RNA duplex in terms of H-bonding. In contrast, our calculations indicate that H-bonded base pairs involving the Hoogsteen edge of purines are destabilized as compared to their natural counterparts. We also focus on the photophysical properties of the non-natural bases and correlate their absorption/emission peaks to the strong impact of the modification on the energy of the lowest unoccupied molecular orbital. It is indeed stabilized by roughly 1.1-1.6 eV as compared to the natural analogues, resulting in a reduction of the gap between the highest occupied and the lowest unoccupied molecular orbital from 5.3-5.5 eV in the natural bases to 3.9-4.2 eV in the modified ones, with a consequent bathochromic shift in the absorption and emission spectra. Overall, our analysis clearly indicates that the newly modelled ts-bases are expected to exhibit better fluorescent properties as compared to the previously reported tz-bases, while retaining similar H-bonding properties. In addition, we show that a new RNA alphabet based on size-extended benzo-homologated ts-bases can also form stable Watson-Crick base pairs with the natural complementary nucleobases.

  12. 1H-1H correlations across N-H···N hydrogen bonds in nucleic acids

    International Nuclear Information System (INIS)

    Majumdar, Ananya; Gosser, Yuying; Patel, Dinshaw J.

    2001-01-01

    In 2H J NN -COSY experiments, which correlate protons with donor/acceptor nitrogens across N d ···HN a bonds, the receptor nitrogen needs to be assigned in order to unambiguously identify the hydrogen bond. For many situations this is a non-trivial task which is further complicated by poor dispersion of (N a ,N d ) resonances. To address these problems, we present pulse sequences to obtain direct, internucleotide correlations between protons in uniformly 13 C/ 15 N labeled nucleic acids containing N d ···HN a hydrogen bonds. Specifically, the pulse sequence H2(N1N3)H3 correlates H2(A,ω 1 ):H3(U,ω 2 ) protons across Watson-Crick A-U and mismatched G·A base pairs, the sequences H5(N3N1)H1/H6(N3N1)H1 correlate H5(C,ω 1 )/H6(C,ω 1 ):H1(G,ω 2 ) protons across Watson-Crick G-C base pairs, and the H 2 (N2N7)H8 sequence correlates NH 2 (G,A,C;ω 1 ):H8(G,A;ω 2 ) protons across G·G, A·A, sheared G·A and other mismatch pairs. These 1 H- 1 H connectivities circumvent the need for independent assignment of the donor/acceptor nitrogen and related degeneracy issues associated with poorly dispersed nitrogen resonances. The methodology is demonstrated on uniformly 13 C/ 15 N labeled samples of (a) an RNA regulatory element involving the HIV-1 TAR RNA fragment, (b) a multi-stranded DNA architecture involving a G·(C-A) triad-containing G-quadruplex and (c) a peptide-RNA complex involving an evolved peptide bound to the HIV-1 Rev response element (RRE) RNA fragment

  13. Pairing induced superconductivity in holography

    Science.gov (United States)

    Bagrov, Andrey; Meszena, Balazs; Schalm, Koenraad

    2014-09-01

    We study pairing induced superconductivity in large N strongly coupled systems at finite density using holography. In the weakly coupled dual gravitational theory the mechanism is conventional BCS theory. An IR hard wall cut-off is included to ensure that we can controllably address the dynamics of a single confined Fermi surface. We address in detail the interplay between the scalar order parameter field and fermion pairing. Adding an explicitly dynamical scalar operator with the same quantum numbers as the fermion-pair, the theory experiences a BCS/BEC crossover controlled by the relative scaling dimensions. We find the novel result that this BCS/BEC crossover exposes resonances in the canonical expectation value of the scalar operator. This occurs not only when the scaling dimension is degenerate with the Cooper pair, but also with that of higher derivative paired operators. We speculate that a proper definition of the order parameter which takes mixing with these operators into account stays finite nevertheless.

  14. Assembly and structural analysis of a covalently closed nano-scale DNA cage

    DEFF Research Database (Denmark)

    Andersen, Félicie Faucon; Knudsen, Bjarne; Oliveira, Cristiano Luis Pinto De

    2008-01-01

    for investigations of DNA-interacting enzymes. More recently, strategies for synthesis of more complex two-dimensional (2D) and 3D DNA structures have emerged. However, the building of such structures is still in progress and more experiences from different research groups and different fields of expertise...... be described as a nano-scale DNA cage, Hence, in theory it could hold proteins or other bio-molecules to enable their investigation in certain harmful environments or even allow their organization into higher order structures...... The inherent properties of DNA as a stable polymer with unique affinity for partner molecules determined by the specific Watson-Crick base pairing makes it an ideal component in self-assembling structures. This has been exploited for decades in the design of a variety of artificial substrates...

  15. Comparative melting and healing of B-DNA and Z-DNA by an infrared laser pulse

    Energy Technology Data Exchange (ETDEWEB)

    Man, Viet Hoang; Pan, Feng; Sagui, Celeste, E-mail: sagui@ncsu.edu; Roland, Christopher, E-mail: cmroland@ncsu.edu [Department of Physics, North Carolina State University, Raleigh, North Carolina 27695-8202 (United States)

    2016-04-14

    We explore the use of a fast laser melting simulation approach combined with atomistic molecular dynamics simulations in order to determine the melting and healing responses of B-DNA and Z-DNA dodecamers with the same d(5′-CGCGCGCGCGCG-3′){sub 2} sequence. The frequency of the laser pulse is specifically tuned to disrupt Watson-Crick hydrogen bonds, thus inducing melting of the DNA duplexes. Subsequently, the structures relax and partially refold, depending on the field strength. In addition to the inherent interest of the nonequilibrium melting process, we propose that fast melting by an infrared laser pulse could be used as a technique for a fast comparison of relative stabilities of same-sequence oligonucleotides with different secondary structures with full atomistic detail of the structures and solvent. This could be particularly useful for nonstandard secondary structures involving non-canonical base pairs, mismatches, etc.

  16. 1H and 31P resonance assignments and secondary structure of hairpin conformer of IA mismatched oligonucleotide d-GGTACIAGTACC

    International Nuclear Information System (INIS)

    Chary, K.V.R.; Rastogi, V.K.; Govil, Girjesh

    1994-01-01

    Almost complete 1 H and 31 P resonance assignments of two coexisting conformers, duplex and an hairpin, of d-GGTACIAGTACC at 1.25mM concentration and 305 K have been achieved. The results demonstrate that the hairpin conformer has a structure with two purines I6 and A7 forming a two-base loop on a B-DNA stem. Stacking is continued on the 5'-side of the loop, with the I6 stacked upon C5. The base A7, on the 3'-side of the loop stacks partially with I6. The glycosidic angle for G8 is in the anti domain and it maintains normal Watson-Crick base-pairing with the opposite C5. (author). 28 refs., 7 figs., 2 tabs

  17. Ab initio study of the excited-state coupled electron-proton-transfer process in the 2-aminopyridine dimer

    International Nuclear Information System (INIS)

    Sobolewski, Andrzej L.; Domcke, Wolfgang

    2003-01-01

    The low-lying 1 ππ* excited states of the 2-aminopyridine dimer have been investigated with multi-reference ab initio methods (CASSCF and MRMP2). The 2-aminopyridine dimer can be considered as a mimetic model of Watson-Crick DNA base pairs. The reaction path and the energy profile for single proton transfer in the lowest 1 ππ* inter-monomer charge-transfer state have been obtained. A weakly avoided crossing of the 1 ππ* surface with the electronic ground-state surface has been found near the single-proton-transfer minimum of the 1 ππ* surface. From the splitting of the adiabatic surfaces at the avoided crossing, an internal-conversion lifetime of the excited state of <100 ps has been estimated. The potential relevance of these results for the rationalization of radiation-induced mutations and the photostability of the genetic code is briefly discussed

  18. Comparative melting and healing of B-DNA and Z-DNA by an infrared laser pulse

    International Nuclear Information System (INIS)

    Man, Viet Hoang; Pan, Feng; Sagui, Celeste; Roland, Christopher

    2016-01-01

    We explore the use of a fast laser melting simulation approach combined with atomistic molecular dynamics simulations in order to determine the melting and healing responses of B-DNA and Z-DNA dodecamers with the same d(5′-CGCGCGCGCGCG-3′) 2 sequence. The frequency of the laser pulse is specifically tuned to disrupt Watson-Crick hydrogen bonds, thus inducing melting of the DNA duplexes. Subsequently, the structures relax and partially refold, depending on the field strength. In addition to the inherent interest of the nonequilibrium melting process, we propose that fast melting by an infrared laser pulse could be used as a technique for a fast comparison of relative stabilities of same-sequence oligonucleotides with different secondary structures with full atomistic detail of the structures and solvent. This could be particularly useful for nonstandard secondary structures involving non-canonical base pairs, mismatches, etc.

  19. Hybridization Properties of RNA Containing 8-Methoxyguanosine and 8-Benzyloxyguanosine.

    Directory of Open Access Journals (Sweden)

    Daniel Sylwester Baranowski

    Full Text Available Modified nucleobase analogues can serve as powerful tools for changing physicochemical and biological properties of DNA or RNA. Guanosine derivatives containing bulky substituents at 8 position are known to adopt syn conformation of N-glycoside bond. On the contrary, in RNA the anti conformation is predominant in Watson-Crick base pairing. In this paper two 8-substituted guanosine derivatives, 8-methoxyguanosine and 8-benzyloxyguanosine, were synthesized and incorporated into oligoribonucleotides to investigate their influence on the thermodynamic stability of RNA duplexes. The methoxy and benzyloxy substituents are electron-donating groups, decreasing the rate of depurination in the monomers, as confirmed by N-glycoside bond stability assessments. Thermodynamic stability studies indicated that substitution of guanosine by 8-methoxy- or 8-benzyloxyguanosine significantly decreased the thermodynamic stability of RNA duplexes. Moreover, the presence of 8-substituted guanosine derivatives decreased mismatch discrimination. Circular dichroism spectra of modified RNA duplexes exhibited patterns typical for A-RNA geometry.

  20. Energy loss function for biological material: poly(CSP)

    International Nuclear Information System (INIS)

    Fung, A.Y.C.; Zaider, M.

    1994-01-01

    In this paper calculated cross sections are presented for the interaction of electrons with poly(CSP), a single-stranded chain that contains one cytosine sugar phosphate unit in the elementary cell. To model a single strand of helical DNA (e.g. the base stacking), the Watson-Crick model for the geometry of poly(CSP) has been used. The use, for computational simplicity, of a single, rather than a double stranded polynucleotide may be justified on the basis of previous calculations indicating that -to a good approximation - the electronic structure (other than excitation states) of complementary base pairs may be described as a superposition of the corresponding structures of the individual components. (Author)

  1. Synthesis and AFM visualization of DNA nanostructures

    International Nuclear Information System (INIS)

    Mizuno, Rika; Haruta, Hirotaka; Morii, Takashi; Okada, Takao; Asakawa, Takeshi; Hayashi, Kenshi

    2004-01-01

    We propose a novel bottom-up approach for the fabrication of various desired nanostructures, based on self-assembly of oligonucleotides governed by Watson-Crick base pairing. Using this approach, we designed Y-shaped, closed Y-shaped, H-shaped, and hexagonal structures with oligonucleotides. These structures were autonomously fabricated simply by mixing equimolar solutions of oligonucleotides and performing hybridization. After synthesis of the nanostructures, we confirmed their validity by agarose gel electrophoresis and atomic force microscope (AFM) visualization. We detected bands of the desired molecular sizes in the gel electrophoresis and observed the desired structures by AFM analysis. We concluded that the synthesized structures were consistent with our intended design and that AFM visualization is a very useful tool for the observation of nanostructures

  2. Emergent Computation Emphasizing Bioinformatics

    CERN Document Server

    Simon, Matthew

    2005-01-01

    Emergent Computation is concerned with recent applications of Mathematical Linguistics or Automata Theory. This subject has a primary focus upon "Bioinformatics" (the Genome and arising interest in the Proteome), but the closing chapter also examines applications in Biology, Medicine, Anthropology, etc. The book is composed of an organized examination of DNA, RNA, and the assembly of amino acids into proteins. Rather than examine these areas from a purely mathematical viewpoint (that excludes much of the biochemical reality), the author uses scientific papers written mostly by biochemists based upon their laboratory observations. Thus while DNA may exist in its double stranded form, triple stranded forms are not excluded. Similarly, while bases exist in Watson-Crick complements, mismatched bases and abasic pairs are not excluded, nor are Hoogsteen bonds. Just as there are four bases naturally found in DNA, the existence of additional bases is not ignored, nor amino acids in addition to the usual complement of...

  3. Aqua[bis(pyrimidin-2-yl-kappa N)amine](carbonato-kappa 2O,O')copper(II) dihydrate.

    Science.gov (United States)

    van Albada, Gerard A; Mutikainen, Ilpo; Turpeinen, Urho; Reedijk, Jan

    2002-03-01

    The title mononuclear complex, [Cu(CO(3))(C(8)H(7)N(5))(H(2)O)] x 2H(2)O, was obtained by fixation of CO(2) by a mixture of copper(II) tetrafluoroborate and the ligand bis(pyrimidin-2-yl)amine in ethanol/water. The Cu(II) ion of the complex has a distorted square-pyramidal environment, with a basal plane formed by two N atoms of the ligand and two chelating O atoms of the carbonate group, while the apical position is occupied by the O atom of the coordinating water molecule. In the solid state, hydrogen-bonding interactions are dominant, the most unusual being the Watson-Crick-type coplanar ligand pairing through two N--H...N bonds. Lattice water molecules also participate in hydrogen bonding.

  4. Development of mercury (II) ion biosensors based on mercury-specific oligonucleotide probes.

    Science.gov (United States)

    Li, Lanying; Wen, Yanli; Xu, Li; Xu, Qin; Song, Shiping; Zuo, Xiaolei; Yan, Juan; Zhang, Weijia; Liu, Gang

    2016-01-15

    Mercury (II) ion (Hg(2+)) contamination can be accumulated along the food chain and cause serious threat to the public health. Plenty of research effort thus has been devoted to the development of fast, sensitive and selective biosensors for monitoring Hg(2+). Thymine was demonstrated to specifically combine with Hg(2+) and form a thymine-Hg(2+)-thymine (T-Hg(2+)-T) structure, with binding constant even higher than T-A Watson-Crick pair in DNA duplex. Recently, various novel Hg(2+) biosensors have been developed based on T-rich Mercury-Specific Oligonucleotide (MSO) probes, and exhibited advanced selectivity and excellent sensitivity for Hg(2+) detection. In this review, we explained recent development of MSO-based Hg(2+) biosensors mainly in 3 groups: fluorescent biosensors, colorimetric biosensors and electrochemical biosensors. Copyright © 2015 Elsevier B.V. All rights reserved.

  5. DNA nanotechnology from the test tube to the cell.

    Science.gov (United States)

    Chen, Yuan-Jyue; Groves, Benjamin; Muscat, Richard A; Seelig, Georg

    2015-09-01

    The programmability of Watson-Crick base pairing, combined with a decrease in the cost of synthesis, has made DNA a widely used material for the assembly of molecular structures and dynamic molecular devices. Working in cell-free settings, researchers in DNA nanotechnology have been able to scale up system complexity and quantitatively characterize reaction mechanisms to an extent that is infeasible for engineered gene circuits or other cell-based technologies. However, the most intriguing applications of DNA nanotechnology - applications that best take advantage of the small size, biocompatibility and programmability of DNA-based systems - lie at the interface with biology. Here, we review recent progress in the transition of DNA nanotechnology from the test tube to the cell. We highlight key successes in the development of DNA-based imaging probes, prototypes of smart therapeutics and drug delivery systems, and explore the future challenges and opportunities for cellular DNA nanotechnology.

  6. Detection of DNA damage based on metal-mediated molecular beacon and DNA strands displacement reaction

    Science.gov (United States)

    Xiong, Yanxiang; Wei, Min; Wei, Wei; Yin, Lihong; Pu, Yuepu; Liu, Songqin

    2014-01-01

    DNA hairpin structure probes are usually designed by forming intra-molecular duplex based on Watson-Crick hydrogen bonds. In this paper, a molecular beacon based on silver ions-mediated cytosine-Ag+-cytosine base pairs was used to detect DNA. The inherent characteristic of the metal ligation facilitated the design of functional probe and the adjustment of its binding strength compared to traditional DNA hairpin structure probes, which make it be used to detect DNA in a simple, rapid and easy way with the help of DNA strands displacement reaction. The method was sensitive and also possesses the good specificity to differentiate the single base mismatched DNA from the complementary DNA. It was also successfully applied to study the damage effect of classic genotoxicity chemicals such as styrene oxide and sodium arsenite on DNA, which was significant in food science, environmental science and pharmaceutical science.

  7. How stable are the mutagenic tautomers of DNA bases?

    Directory of Open Access Journals (Sweden)

    Brovarets’ O. O.

    2010-02-01

    Full Text Available Aim. To determine the lifetime of the mutagenic tautomers of DNA base pairs through the investigation of the physicochemical mechanisms of their intramolecular proton transfer. Methods. Non-empirical quantum chemistry, the analysis of the electron density by means of Bader’s atom in molecules (AIM theory and physicochemical kinetics were used. Results. Physicochemical character of the transition state of the intramolecular tautomerisation of DNA bases was investigated, the lifetime of mutagenic tautomers was calculated. Conclusions. The lifetime of the DNA bases mutagenic tautomers by 3–10 orders exceeds typical time of DNA replication in the cell (~103 s. This fact confirms that the postulate, on which the Watson-Crick tautomeric hypothesis of spontaneous transitions grounds, is adequate. The absence of intramolecular H-bonds in the canonical and mutagenic tautomeric forms determine their high stability

  8. Structural DNA Nanotechnology: Artificial Nanostructures for Biomedical Research.

    Science.gov (United States)

    Ke, Yonggang; Castro, Carlos; Choi, Jong Hyun

    2018-04-04

    Structural DNA nanotechnology utilizes synthetic or biologic DNA as designer molecules for the self-assembly of artificial nanostructures. The field is founded upon the specific interactions between DNA molecules, known as Watson-Crick base pairing. After decades of active pursuit, DNA has demonstrated unprecedented versatility in constructing artificial nanostructures with significant complexity and programmability. The nanostructures could be either static, with well-controlled physicochemical properties, or dynamic, with the ability to reconfigure upon external stimuli. Researchers have devoted considerable effort to exploring the usability of DNA nanostructures in biomedical research. We review the basic design methods for fabricating both static and dynamic DNA nanostructures, along with their biomedical applications in fields such as biosensing, bioimaging, and drug delivery. Expected final online publication date for the Annual Review of Biomedical Engineering Volume 20 is June 4, 2018. Please see http://www.annualreviews.org/page/journal/pubdates for revised estimates.

  9. DNA nanotechnology from the test tube to the cell

    Science.gov (United States)

    Chen, Yuan-Jyue; Groves, Benjamin; Muscat, Richard A.; Seelig, Georg

    2015-09-01

    The programmability of Watson-Crick base pairing, combined with a decrease in the cost of synthesis, has made DNA a widely used material for the assembly of molecular structures and dynamic molecular devices. Working in cell-free settings, researchers in DNA nanotechnology have been able to scale up system complexity and quantitatively characterize reaction mechanisms to an extent that is infeasible for engineered gene circuits or other cell-based technologies. However, the most intriguing applications of DNA nanotechnology -- applications that best take advantage of the small size, biocompatibility and programmability of DNA-based systems -- lie at the interface with biology. Here, we review recent progress in the transition of DNA nanotechnology from the test tube to the cell. We highlight key successes in the development of DNA-based imaging probes, prototypes of smart therapeutics and drug delivery systems, and explore the future challenges and opportunities for cellular DNA nanotechnology.

  10. A survey of advancements in nucleic acid-based logic gates and computing for applications in biotechnology and biomedicine.

    Science.gov (United States)

    Wu, Cuichen; Wan, Shuo; Hou, Weijia; Zhang, Liqin; Xu, Jiehua; Cui, Cheng; Wang, Yanyue; Hu, Jun; Tan, Weihong

    2015-03-04

    Nucleic acid-based logic devices were first introduced in 1994. Since then, science has seen the emergence of new logic systems for mimicking mathematical functions, diagnosing disease and even imitating biological systems. The unique features of nucleic acids, such as facile and high-throughput synthesis, Watson-Crick complementary base pairing, and predictable structures, together with the aid of programming design, have led to the widespread applications of nucleic acids (NA) for logic gate and computing in biotechnology and biomedicine. In this feature article, the development of in vitro NA logic systems will be discussed, as well as the expansion of such systems using various input molecules for potential cellular, or even in vivo, applications.

  11. Nuclear scissors mode with pairing

    International Nuclear Information System (INIS)

    Balbutsev, E. B.; Malov, L. A.; Schuck, P.; Urban, M.; Vinas, X.

    2008-01-01

    The coupled dynamics of the scissors mode and the isovector giant quadrupole resonance are studied using a generalized Wigner function moments method, taking into account pair correlations. Equations of motion for angular momentum, quadrupole moment, and other relevant collective variables are derived on the basis of the time-dependent Hartree-Fock-Bogolyubov equations. Analytical expressions for energy centroids and transition probabilities are found for the harmonic-oscillator model with the quadrupole-quadrupole residual interaction and monopole pairing force. Deformation dependences of energies and B(M1) values are correctly reproduced. The inclusion of pair correlations leads to a drastic improvement in the description of qualitative and quantitative characteristics of the scissors mode.

  12. Pairing mechanism in oxide superconductors

    International Nuclear Information System (INIS)

    Hirsch, J.E.

    1988-01-01

    A useful way to learn about the pairing mechanism that is responsible for high T c superconductivity is to study properties of model Hamiltonians on small systems. The goal is to find the simplest model that can describe the essential physics of high T c superconductivity. The authors have used Monte Carlo simulation and exact diagonalization techniques to study properties of systems of up to 64 sites. Their results show that spin fluctuations and other spin related mechanisms induced by a Hubbard on-site repulsion U are not likely to give rise to pairing, neither in one nor in multiple band models. In contrast, charge fluctuations in a model with both strong U and V (repulsion between Cu and O) are shown to give rise to pairing and it is suggested that this model provides a plausible mechanism for high T c superconductivity

  13. QCD pairing in primordial nuggets

    Science.gov (United States)

    Lugones, G.; Horvath, J. E.

    2003-08-01

    We analyze the problem of boiling and surface evaporation of quark nuggets in the cosmological quark-hadron transition. Recently, it has been shown that QCD pairing modifies the stability properties of strange quark matter. More specifically, strange quark matter in a color-flavor locked state was found to be absolutely stable for a much wider range of the parameters than ordinary unpaired strange quark matter (G. Lugones and J. E. Horvath, Phys. Rev. D, 66, 074017 (2002)). Assuming that primordial quark nuggets are actually formed we analyze the consequences of pairing on the rates of boiling and surface evaporation in order to determine whether they could have survived.

  14. Exclusive electroproduction of pion pairs

    International Nuclear Information System (INIS)

    Warkentin, N.; Schaefer, A.; Diehl, M.; Ivanov, D. Yu.

    2007-01-01

    We investigate electroproduction of pion pairs on the nucleon in the framework of QCD factorization for hard exclusive processes. We extend previous analyses by taking the hard-scattering coefficients at next-to-leading order in α s . The dynamics of the produced pion pair is described by two-pion distribution amplitudes, for which we perform a detailed theoretical and phenomenological analysis. In particular, we obtain constraints on these quantities by comparing our results with measurements of angular observables that are sensitive to the interference between two-pion production in the isoscalar and isovector channels. (orig.)

  15. Instantons in lepton pair production

    International Nuclear Information System (INIS)

    Brandenburg, A.; Ringwald, A.; Utermann, A.

    2006-05-01

    We consider QCD instanton-induced contributions to lepton pair production in hadron-hadron collisions. We relate these contributions to those known from deep inelastic scattering and demonstrate that they can be calculated reliably for sufficiently large momentum transfer. We observe that the instanton contribution to the angular distribution of the lepton pairs at finite momentum transfer strongly violates the Lam-Tung relation - a relation between coefficient functions of the angular distribution which is valid within the framework of ordinary perturbation theory. The drastic violation of this relation, as seen in experimental data, might be related to such instanton-induced effects. (Orig.)

  16. Synthesis and binding properties of new selective ligands for the nucleobase opposite the AP site.

    Science.gov (United States)

    Abe, Yukiko; Nakagawa, Osamu; Yamaguchi, Rie; Sasaki, Shigeki

    2012-06-01

    DNA is continuously damaged by endogenous and exogenous factors such as oxidative stress or DNA alkylating agents. These damaged nucleobases are removed by DNA N-glycosylase and form apurinic/apyrimidinic sites (AP sites) as intermediates in the base excision repair (BER) pathway. AP sites are also representative DNA damages formed by spontaneous hydrolysis. The AP sites block DNA polymerase and a mismatch nucleobase is inserted opposite the AP sites by polymerization to cause acute toxicities and mutations. Thus, AP site specific compounds have attracted much attention for therapeutic and diagnostic purposes. In this study, we have developed nucleobase-polyamine conjugates as the AP site binding ligand by expecting that the nucleobase part would play a role in the specific recognition of the nucleobase opposite the AP site by the Watson-Crick base pair formation and that the polyamine part should contribute to the access of the ligand to the AP site by a non-specific interaction to the DNA phosphate backbone. The nucleobase conjugated with 3,3'-diaminodipropylamine (A-ligand, G-ligand, C-ligand, T-ligand and U-ligand) showed a specific stabilization of the duplex containing the AP site depending on the complementary combination with the nucleobase opposite the AP site; that is A-ligand to T, G-ligand to C, C-ligand to G, T- and U-ligand to A. The thermodynamic binding parameters clearly indicated that the specific stabilization is due to specific binding of the ligands to the complementary AP site. These results have suggested that the complementary base pairs of the Watson-Crick type are formed at the AP site. Copyright © 2012 Elsevier Ltd. All rights reserved.

  17. Guanidinium Pairing Facilitates Membrane Translocation

    Czech Academy of Sciences Publication Activity Database

    Allolio, Christoph; Baxová, Katarína; Vazdar, M.; Jungwirth, Pavel

    2016-01-01

    Roč. 120, č. 1 (2016), s. 143-153 ISSN 1520-6106 R&D Projects: GA ČR GA13-06181S Institutional support: RVO:61388963 Keywords : ab initio molecular dynamics * guanidinium * like charge pairing * membrane Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 3.177, year: 2016

  18. Pairing Linguistic and Music Intelligences

    Science.gov (United States)

    DiEdwardo, MaryAnn Pasda

    2005-01-01

    This article describes how music in the language classroom setting can be a catalyst for developing reading, writing, and understanding skills. Studies suggest that pairing music and linguistic intelligences in the college classroom improves students' grades and abilities to compose theses statements for research papers in courses that emphasize…

  19. Conjugal Pairing in Escherichia Coli

    Indian Academy of Sciences (India)

    Home; Journals; Resonance – Journal of Science Education; Volume 13; Issue 8. Conjugal Pairing in Escherichia Coli. Joshua Lederberg. Classics Volume 13 Issue 8 August 2008 pp 793-794. Fulltext. Click here to view fulltext PDF. Permanent link: https://www.ias.ac.in/article/fulltext/reso/013/08/0793-0794 ...

  20. Rank error-correcting pairs

    DEFF Research Database (Denmark)

    Martinez Peñas, Umberto; Pellikaan, Ruud

    2017-01-01

    Error-correcting pairs were introduced as a general method of decoding linear codes with respect to the Hamming metric using coordinatewise products of vectors, and are used for many well-known families of codes. In this paper, we define new types of vector products, extending the coordinatewise ...

  1. 'Leonard pairs' in classical mechanics

    International Nuclear Information System (INIS)

    Zhedanov, Alexei; Korovnichenko, Alyona

    2002-01-01

    Leonard pairs (LP) are matrices with the property of mutual tri-diagonality. We introduce and study a classical analogue of LP. We show that corresponding classical 'Leonard' dynamical variables satisfy non-linear relations of the AW-type with respect to Poisson brackets. (author)

  2. Pair plasma relaxation time scales.

    Science.gov (United States)

    Aksenov, A G; Ruffini, R; Vereshchagin, G V

    2010-04-01

    By numerically solving the relativistic Boltzmann equations, we compute the time scale for relaxation to thermal equilibrium for an optically thick electron-positron plasma with baryon loading. We focus on the time scales of electromagnetic interactions. The collisional integrals are obtained directly from the corresponding QED matrix elements. Thermalization time scales are computed for a wide range of values of both the total-energy density (over 10 orders of magnitude) and of the baryonic loading parameter (over 6 orders of magnitude). This also allows us to study such interesting limiting cases as the almost purely electron-positron plasma or electron-proton plasma as well as intermediate cases. These results appear to be important both for laboratory experiments aimed at generating optically thick pair plasmas as well as for astrophysical models in which electron-positron pair plasmas play a relevant role.

  3. Statistical deprojection of galaxy pairs

    Science.gov (United States)

    Nottale, Laurent; Chamaraux, Pierre

    2018-06-01

    Aims: The purpose of the present paper is to provide methods of statistical analysis of the physical properties of galaxy pairs. We perform this study to apply it later to catalogs of isolated pairs of galaxies, especially two new catalogs we recently constructed that contain ≈1000 and ≈13 000 pairs, respectively. We are particularly interested by the dynamics of those pairs, including the determination of their masses. Methods: We could not compute the dynamical parameters directly since the necessary data are incomplete. Indeed, we only have at our disposal one component of the intervelocity between the members, namely along the line of sight, and two components of their interdistance, i.e., the projection on the sky-plane. Moreover, we know only one point of each galaxy orbit. Hence we need statistical methods to find the probability distribution of 3D interdistances and 3D intervelocities from their projections; we designed those methods under the term deprojection. Results: We proceed in two steps to determine and use the deprojection methods. First we derive the probability distributions expected for the various relevant projected quantities, namely intervelocity vz, interdistance rp, their ratio, and the product rp v_z^2, which is involved in mass determination. In a second step, we propose various methods of deprojection of those parameters based on the previous analysis. We start from a histogram of the projected data and we apply inversion formulae to obtain the deprojected distributions; lastly, we test the methods by numerical simulations, which also allow us to determine the uncertainties involved.

  4. Thermodynamic basis for engineering high-affinity, high-specificity binding-induced DNA clamp nanoswitches.

    Science.gov (United States)

    Idili, Andrea; Plaxco, Kevin W; Vallée-Bélisle, Alexis; Ricci, Francesco

    2013-12-23

    Naturally occurring chemoreceptors almost invariably employ structure-switching mechanisms, an observation that has inspired the use of biomolecular switches in a wide range of artificial technologies in the areas of diagnostics, imaging, and synthetic biology. In one mechanism for generating such behavior, clamp-based switching, binding occurs via the clamplike embrace of two recognition elements onto a single target molecule. In addition to coupling recognition with a large conformational change, this mechanism offers a second advantage: it improves both affinity and specificity simultaneously. To explore the physics of such switches we have dissected here the thermodynamics of a clamp-switch that recognizes a target DNA sequence through both Watson-Crick base pairing and triplex-forming Hoogsteen interactions. When compared to the equivalent linear DNA probe (which relies solely on Watson-Crick interactions), the extra Hoogsteen interactions in the DNA clamp-switch increase the probe's affinity for its target by ∼0.29 ± 0.02 kcal/mol/base. The Hoogsteen interactions of the clamp-switch likewise provide an additional specificity check that increases the discrimination efficiency toward a single-base mismatch by 1.2 ± 0.2 kcal/mol. This, in turn, leads to a 10-fold improvement in the width of the "specificity window" of this probe relative to that of the equivalent linear probe. Given these attributes, clamp-switches should be of utility not only for sensing applications but also, in the specific field of DNA nanotechnology, for applications calling for a better control over the building of nanostructures and nanomachines.

  5. Fidelity Mechanisms of DNA Polymerase Alpha

    Science.gov (United States)

    2008-07-23

    between right and wrong dNTPs. With purine dNTPs, the enzyme uses a combination of positive and negative selectivity. The Watson - Crick hydrogen...dNTP as a dCTP analogue despite the lack of a Watson - Crick hydrogen bond. We specifically examined the role of O2 of a pyrimidine by synthesizing 4...cases the compounds could form 2 Watson - Crick hydrogen bonds. The lack of polymerization resulted from very weak binding of the dNTPs to pol α

  6. The 5S rRNA loop E: chemical probing and phylogenetic data versus crystal structure.

    Science.gov (United States)

    Leontis, N B; Westhof, E

    1998-09-01

    A significant fraction of the bases in a folded, structured RNA molecule participate in noncanonical base pairing interactions, often in the context of internal loops or multi-helix junction loops. The appearance of each new high-resolution RNA structure provides welcome data to guide efforts to understand and predict RNA 3D structure, especially when the RNA in question is a functionally conserved molecule. The recent publication of the crystal structure of the "Loop E" region of bacterial 5S ribosomal RNA is such an event [Correll CC, Freeborn B, Moore PB, Steitz TA, 1997, Cell 91:705-712]. In addition to providing more examples of already established noncanonical base pairs, such as purine-purine sheared pairings, trans-Hoogsteen UA, and GU wobble pairs, the structure provides the first high-resolution views of two new purine-purine pairings and a new GU pairing. The goal of the present analysis is to expand the capabilities of both chemical probing and phylogenetic analysis to predict with greater accuracy the structures of RNA molecules. First, in light of existing chemical probing data, we investigate what lessons could be learned regarding the interpretation of this widely used method of RNA structure probing. Then we analyze the 3D structure with reference to molecular phylogeny data (assuming conservation of function) to discover what alternative base pairings are geometrically compatible with the structure. The comparisons between previous modeling efforts and crystal structures show that the intricate involvements of ions and water molecules in the maintenance of non-Watson-Crick pairs render the process of correctly identifying the interacting sites in such pairs treacherous, except in cases of trans-Hoogsteen A/U or sheared A/G pairs for the adenine N1 site. The phylogenetic analysis identifies A/A, A/C, A/U and C/A, C/C, and C/U pairings isosteric with sheared A/G, as well as A/A and A/C pairings isosteric with both G/U and G/G bifurcated pairings

  7. Charge Aspects of Composite Pair Superconductivity

    Science.gov (United States)

    Flint, Rebecca

    2014-03-01

    Conventional Cooper pairs form from well-defined electronic quasiparticles, making the internal structure of the pair irrelevant. However, in the 115 family of superconductors, the heavy electrons are forming as they pair and the internal pair structure becomes as important as the pairing mechanism. Conventional spin fluctuation mediated pairing cannot capture the direct transition from incoherent local moments to heavy fermion superconductivity, but the formation of composite pairs favored by the two channel Kondo effect can. These composite pairs are local d-wave pairs formed by two conduction electrons in orthogonal Kondo channels screening the same local moment. Composite pairing shares the same symmetries as magnetically mediated pairing, however, only composite pairing necessarily involves a redistribution of charge within the unit cell originating from the internal pair structure, both as a monopole (valence change) and a quadrupole effect. This redistribution will onset sharply at the superconducting transition temperature. A smoking gun test for composite pairing is therefore a sharp signature at Tc - for example, a cusp in the Mossbauer isomer shift in NpPd5Al2 or in the NQR shift in (Ce,Pu)CoIn5.

  8. Kinetic equations with pairing correlations

    International Nuclear Information System (INIS)

    Fauser, R.

    1995-12-01

    The Gorkov equations are derived for a general non-equilibrium system. The Gorkov factorization is generalized by the cumulant expansion of the 2-particle correlation and by a generalized Wick theorem in the case of a perturbation expansion. A stationary solution for the Green functions in the Schwinger-Keldysh formalism is presented taking into account pairing correlations. Especially the effects of collisional broadening on the spectral functions and Green functions is discussed. Kinetic equations are derived in the quasi-particle approximation and in the case of particles with width. Explicit expressions for the self-energies are given. (orig.)

  9. Endocrine factors of pair bonding.

    Science.gov (United States)

    Stárka, L

    2007-01-01

    Throughout literature--fiction and poetry, fine arts and music--falling in love and enjoying romantic love plays a central role. While several psychosocial conceptions of pair attachment consider the participation of hormones, human endocrinology has dealt with this theme only marginally. According to some authors in addictology, falling in love shows some signs of hormonal response to stressors with changes in dopamine and serotonin signalling and neurotrophin (transforming growth factor b) concentration. Endorphins, oxytocin and vasopressin may play a role during the later phases of love. However, proof of hormonal events associated with love in humans has, until recently, been lacking.

  10. Pairs of dual periodic frames

    DEFF Research Database (Denmark)

    Christensen, Ole; Goh, Say Song

    2012-01-01

    The time–frequency analysis of a signal is often performed via a series expansion arising from well-localized building blocks. Typically, the building blocks are based on frames having either Gabor or wavelet structure. In order to calculate the coefficients in the series expansion, a dual frame...... is needed. The purpose of the present paper is to provide constructions of dual pairs of frames in the setting of the Hilbert space of periodic functions L2(0,2π). The frames constructed are given explicitly as trigonometric polynomials, which allows for an efficient calculation of the coefficients...

  11. Filipino au pairs on the move

    DEFF Research Database (Denmark)

    Dalgas, Karina Märcher

    2016-01-01

    Most Filipina au pairs in Denmark send remittances back home, and for many, au pairing forms part of longer-term migration trajectories. This article explores how Filipina au pairs try to carve out a future for themselves abroad. It shows that they navigate within tight webs of financial interdep......Most Filipina au pairs in Denmark send remittances back home, and for many, au pairing forms part of longer-term migration trajectories. This article explores how Filipina au pairs try to carve out a future for themselves abroad. It shows that they navigate within tight webs of financial...

  12. Ion pairing in ionic liquids

    International Nuclear Information System (INIS)

    Kirchner, Barbara; Malberg, Friedrich; Firaha, Dzmitry S; Hollóczki, Oldamur

    2015-01-01

    In the present article we briefly review the extensive discussion in literature about the presence or absence of ion pair-like aggregates in ionic liquids. While some experimental studies point towards the presence of neutral subunits in ionic liquids, many other experiments cannot confirm or even contradict their existence. Ion pairs can be detected directly in the gas phase, but no direct method is available to observe such association behavior in the liquid, and the corresponding indirect experimental proofs are based on such assumptions as unity charges at the ions. However, we have shown by calculating ionic liquid clusters of different sizes that assuming unity charges for ILs is erroneous, because a substantial charge transfer is taking place between the ionic liquid ions that reduce their total charge. Considering these effects might establish a bridge between the contradicting experimental results on this matter. Beside these results, according to molecular dynamics simulations the lifetimes of ion–ion contacts and their joint motions are far too short to verify the existence of neutral units in these materials. (topical review)

  13. Some advances in pairing theory

    International Nuclear Information System (INIS)

    Rowe, D.J.

    2001-01-01

    Two advances are reviewed in the application of pairing-force theory in the nuclear shell model. The first exploits a discovery that a wide range of two-nucleon interactions conserve seniority as a good quantum number. As a consequence, the eigenstates of a Hamiltonian with such an interaction belong to irreducible representations of a compact unitary-symplectic group. This makes it possible to extend the simply-solvable models with J=0 pairing forces to a much richer set of models and still obtain states uniquely classified by their seniority and angular momentum quantum numbers. Moreover, many of the low-lying energy levels of such models can be obtained algebraically; in technical terms, the models are in some cases completely solvable and in other cases partially solvable by algebraic methods. The second advance exploits the discovery that, in a coherent state representation, states of good nucleon number can be projected analytically from BCS vacuum and excited quasiparticle states. This makes it possible to perform calculations in a number-projected BCS basis without losing much of the advantage of working of the quasiparticle scheme. (Author)

  14. PandA : pairings and arithmetic

    NARCIS (Netherlands)

    Chuengsatiansup, C.; Naehrig, M.; Ribarski, P.; Schwabe, P.; Cao, Z.; Zhang, F.

    2014-01-01

    This paper introduces PandA, a software framework for Pairings and Arithmetic. It is designed to bring together advances in the efficient computation of cryptographic pairings and the development and implementation of pairing-based protocols. The intention behind the PandA framework is to give

  15. Dynamical pairing correlations in rotating nuclei

    International Nuclear Information System (INIS)

    Szymanski, Z.

    1985-01-01

    When the atomic nucleus rotates fast enough the static pair correlations may be destroyed. In this situation the pair-vibrations become an important manifestation of the short-range attractive pairing force. The influence of this effect on nuclear properties at high spin is discussed. (orig.)

  16. Pair shell model description of collective motions

    International Nuclear Information System (INIS)

    Chen Hsitseng; Feng Dahsuan

    1996-01-01

    The shell model in the pair basis has been reviewed with a case study of four particles in a spherical single-j shell. By analyzing the wave functions according to their pair components, the novel concept of the optimum pairs was developed which led to the proposal of a generalized pair mean-field method to solve the many-body problem. The salient feature of the method is its ability to handle within the framework of the spherical shell model a rotational system where the usual strong configuration mixing complexity is so simplified that it is now possible to obtain analytically the band head energies and the moments of inertia. We have also examined the effects of pair truncation on rotation and found the slow convergence of adding higher spin pairs. Finally, we found that when the SDI and Q .Q interactions are of equal strengths, the optimum pair approximation is still valid. (orig.)

  17. Solar Drift-Pair Bursts

    Science.gov (United States)

    Stanislavsky, A.; Volvach, Ya.; Konovalenko, A.; Koval, A.

    2017-08-01

    In this paper a new sight on the study of solar bursts historically called drift pairs (DPs) is presented. Having a simple morphology on dynamic spectra of radio records (two short components separated in time, and often they are very similar) and discovered at the dawn of radio astronomy, their features remain unexplained totally up to now. Generally, the DPs are observed during the solar storms of type III bursts, but not every storm of type III bursts is linked with DPs. Detected by ground-based instruments at decameter and meter wavelengths, the DP bursts are limited in frequency bandwidth. They can drift from high frequencies to low ones and vice versa. Their frequency drift rate may be both lower and higher than typical rates of type III bursts at the same frequency range. The development of low-frequency radio telescopes and data processing provide additional possibilities in the research. In this context the fresh analysis of DPs, made from recent observations in the summer campaign of 2015, are just considered. Their study was implemented by updated tools of the UTR-2 radio telescope at 9-33 MHz. During 10-12 July of 2015, DPs forming the longest patterns on dynamic spectra are about 7% of the total number of recorded DPs. Their marvelous resemblance in frequency drift rates with the solar S-bursts is discussed.

  18. Production of magnetic monopole pairs

    International Nuclear Information System (INIS)

    Maher, R.L.

    1980-01-01

    Using a covariant photon propagator (developed by W.B. Campbell) to represent a photon exchange between a magnetic monopole and an electric charge, the first order production amplitudes in a Feynman-Dyson perturbation expansion and the resulting differential cross-sections are calculated for monopole pair creation from: (i) electron positron annihilation, (ii) photon scattering in the presence of a nucleus, and (iii) electron scattering in the presence of a nucleus. This theory does not specify the spin character of magnetic monopoles, so all processes are calculated twice: for spin zero monopoles and for spin one-half monopoles. In the first and last processes the differential cross-sections have sufficiently different dependences on the production angles (associated with the monopoles momenta), so that near threshold experiments could distinguish between whether monopoles are either spin one-half or spin zero entities. For the t'Hooft monopole mass estimate (5-8 x 10 3 GeV) very high energy particle and photon beam sources would be required to achieve threshold for these production processes

  19. Report on Pairing-based Cryptography.

    Science.gov (United States)

    Moody, Dustin; Peralta, Rene; Perlner, Ray; Regenscheid, Andrew; Roginsky, Allen; Chen, Lily

    2015-01-01

    This report summarizes study results on pairing-based cryptography. The main purpose of the study is to form NIST's position on standardizing and recommending pairing-based cryptography schemes currently published in research literature and standardized in other standard bodies. The report reviews the mathematical background of pairings. This includes topics such as pairing-friendly elliptic curves and how to compute various pairings. It includes a brief introduction to existing identity-based encryption (IBE) schemes and other cryptographic schemes using pairing technology. The report provides a complete study of the current status of standard activities on pairing-based cryptographic schemes. It explores different application scenarios for pairing-based cryptography schemes. As an important aspect of adopting pairing-based schemes, the report also considers the challenges inherent in validation testing of cryptographic algorithms and modules. Based on the study, the report suggests an approach for including pairing-based cryptography schemes in the NIST cryptographic toolkit. The report also outlines several questions that will require further study if this approach is followed.

  20. An Entropic Approach for Pair Trading

    Directory of Open Access Journals (Sweden)

    Daisuke Yoshikawa

    2017-06-01

    Full Text Available In this paper, we derive the optimal boundary for pair trading. This boundary defines the points of entry into or exit from the market for a given stock pair. However, if the assumed model contains uncertainty, the resulting boundary could result in large losses. To avoid this, we develop a more robust strategy by accounting for the model uncertainty. To incorporate the model uncertainty, we use the relative entropy as a penalty function in the expected profit from pair trading.

  1. Magnetized pair Bose gas: relativistic superconductor

    International Nuclear Information System (INIS)

    Daicic, J.; Frankel, N.E.; Kowalenko, V.

    1993-01-01

    The magnetized Bose gas at temperatures above pair threshold is investigated. New magnetization laws are obtained for a wide range of field strengths, and the gas is shown to exhibit the Meissner effect. Some related results for the Fermi gas, a relativistic paramagnet, are also discussed. It is concluded that the pair gases, through the interplay between pair creation, temperature, field strength, statistics and/in the case of fermions/spin, have remarkable magnetic properties. 14 refs

  2. Variational study of the pair hopping model

    International Nuclear Information System (INIS)

    Fazekas, P.

    1990-01-01

    We study the ground state of a Hamiltonian introduced by Kolb and Penson for modelling situations in which small electron pairs are formed. The Hamiltonian consists of a tight binding band term, and a term describing the nearest neighbour hopping of electron pairs. We give a Gutzwiller-type variational treatment, first with a single-parameter Ansatz treated in the single site Gutzwiller approximation, and then with more complicated trial wave functions, and an improved Gutzwiller approximation. The calculation yields a transition from a partially paired normal state, in which the spin susceptibility has a diminished value, into a fully paired state. (author). 16 refs, 2 figs

  3. Dual origin of pairing in nuclei

    Energy Technology Data Exchange (ETDEWEB)

    Idini, A. [University of Jyvaskyla, Department of Physics (Finland); Potel, G. [Michigan State University, National Superconducting Cyclotron Laboratory (United States); Barranco, F. [Escuela Superior de Ingenieros, Universidad de Sevilla, Departamento de Fìsica Aplicada III (Spain); Vigezzi, E., E-mail: enrico.vigezzi@mi.infn.it [INFN Sezione di Milano (Italy); Broglia, R. A. [Università di Milano, Dipartimento di Fisica (Italy)

    2016-11-15

    The pairing correlations of the nucleus {sup 120}Sn are calculated by solving the Nambu–Gor’kov equations, including medium polarization effects resulting from the interweaving of quasiparticles, spin and density vibrations, taking into account, within the framework of nuclear field theory (NFT), processes leading to self-energy and vertex corrections and to the induced pairing interaction. From these results one can not only demonstrate the inevitability of the dual origin of pairing in nuclei, but also extract information which can be used at profit to quantitatively disentangle the contributions to the pairing gap Δ arising from the bare and from the induced pairing interaction. The first is the strong {sup 1}S{sub 0} short-range NN potential resulting from meson exchange between nucleons moving in time reversal states within an energy range of hundreds of MeV from the Fermi energy. The second results from the exchange of vibrational modes between nucleons moving within few MeV from the Fermi energy. Short- (v{sub p}{sup bare}) and long-range (v{sub p}{sup ind}) pairing interactions contribute essentially equally to nuclear Cooper pair stability. That is to the breaking of gauge invariance in open-shell superfluid nuclei and thus to the order parameter, namely to the ground state expectation value of the pair creation operator. In other words, to the emergent property of generalized rigidity in gauge space, and associated rotational bands and Cooper pair tunneling between members of these bands.

  4. Pair production in small angle Bhabha scattering

    International Nuclear Information System (INIS)

    Arbuzov, A.B.; Kuraev, Eh.A.; Merenkov, N.P.; Trentadue, L.

    1995-01-01

    The radiative corrections due to a pair production in the small angle high energy e + e - Bhabha scattering are considered. The corrections due to the production of virtual pairs as well as real soft and hard ones are calculated analytically. The collinear and semi-collinear kinematical regions of the hard pair production are taken into account. The results in the leading and next-to-leading logarithmic approximations provide the accuracy of Ο (0.1%). The results of numerical calculations show that the effects of pairs production are to be taken into account in the precise luminosity determination at LEP. 9 refs., 3 figs., 2 tabs

  5. Heteroditopic receptors for ion-pair recognition.

    Science.gov (United States)

    McConnell, Anna J; Beer, Paul D

    2012-05-21

    Ion-pair recognition is a new field of research emerging from cation and anion coordination chemistry. Specific types of heteroditopic receptor designs for ion pairs and the complexity of ion-pair binding are discussed to illustrate key concepts such as cooperativity. The importance of this area of research is reflected by the wide variety of potential applications of ion-pair receptors, including applications as membrane transport and salt solubilization agents and sensors. Copyright © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  6. Dual origin of pairing in nuclei

    Science.gov (United States)

    Idini, A.; Potel, G.; Barranco, F.; Vigezzi, E.; Broglia, R. A.

    2016-11-01

    The pairing correlations of the nucleus 120Sn are calculated by solving the Nambu-Gor'kov equations, including medium polarization effects resulting from the interweaving of quasiparticles, spin and density vibrations, taking into account, within the framework of nuclear field theory (NFT), processes leading to self-energy and vertex corrections and to the induced pairing interaction. From these results one can not only demonstrate the inevitability of the dual origin of pairing in nuclei, but also extract information which can be used at profit to quantitatively disentangle the contributions to the pairing gap Δ arising from the bare and from the induced pairing interaction. The first is the strong 1 S 0 short-range NN potential resulting from meson exchange between nucleons moving in time reversal states within an energy range of hundreds of MeV from the Fermi energy. The second results from the exchange of vibrational modes between nucleons moving within few MeV from the Fermi energy. Short- ( v p bare) and long-range ( v p ind) pairing interactions contribute essentially equally to nuclear Cooper pair stability. That is to the breaking of gauge invariance in open-shell superfluid nuclei and thus to the order parameter, namely to the ground state expectation value of the pair creation operator. In other words, to the emergent property of generalized rigidity in gauge space, and associated rotational bands and Cooper pair tunneling between members of these bands.

  7. Finding Maximal Pairs with Bounded Gap

    DEFF Research Database (Denmark)

    Brodal, Gerth Stølting; Lyngsø, Rune B.; Pedersen, Christian N. S.

    1999-01-01

    . In this paper we present methods for finding all maximal pairs under various constraints on the gap. In a string of length n we can find all maximal pairs with gap in an upper and lower bounded interval in time O(n log n+z) where z is the number of reported pairs. If the upper bound is removed the time reduces...... to O(n+z). Since a tandem repeat is a pair where the gap is zero, our methods can be seen as a generalization of finding tandem repeats. The running time of our methods equals the running time of well known methods for finding tandem repeats....

  8. Superimposed Code Theorectic Analysis of DNA Codes and DNA Computing

    Science.gov (United States)

    2010-03-01

    that the hybridization that occurs between a DNA strand and its Watson - Crick complement can be used to perform mathematical computation. This research...ssDNA single stranded DNA WC Watson – Crick A Adenine C Cytosine G Guanine T Thymine ... Watson - Crick (WC) duplex, e.g., TCGCA TCGCA . Note that non-WC duplexes can form and such a formation is called a cross-hybridization. Cross

  9. Pair plasma in pulsar magnetospheres

    International Nuclear Information System (INIS)

    Asseo, Estelle

    2003-01-01

    The main features of radiation received from pulsars imply that they are neutron stars which contain an extremely intense magnetic field and emit coherently in the radio domain. Most recent studies attribute the origin of the coherence to plasma instabilities arising in pulsar magnetospheres; they mainly concern the linear, or the nonlinear, character of the involved unstable waves. We briefly introduce radio pulsars and specify physical conditions in pulsar emission regions: geometrical properties, magnetic field, pair creation processes and repartition of relativistic charged particles. We point to the main ingredients of the linear theory, extensively explored since the 1970s: (i) a dispersion relation specific to the pulsar case; (ii) the characteristics of the waves able to propagate in relativistic pulsar plasmas; (iii) the different ways in which a two-humped distribution of particles may arise in a pulsar magnetosphere and favour the development of a two-stream instability. We sum up recent improvements of the linear theory: (i) the determination of a 'coupling function' responsible for high values of the wave field components and electromagnetic energy available; (ii) the obtention of new dispersion relations for actually anisotropic pulsar plasmas with relativistic motions and temperatures; (iii) the interaction between a plasma and a beam, both with relativistic motions and temperatures; (iv) the interpretation of observed 'coral' and 'conal' features, associated with the presence of boundaries and curved magnetic field lines in the emission region; (v) the detailed topology of the magnetic field in the different parts of the emission region and its relation to models recently proposed to interpret drifting subpulses observed from PSR 0943+10, showing 20 sub-beams of emission. We relate the nonlinear evolution of the two-stream instability and development of strong turbulence in relativistic pulsar plasmas to the emergence of relativistic solitons, able

  10. Stereo Pair: Wellington, New Zealand

    Science.gov (United States)

    2000-01-01

    Wellington, the capital city of New Zealand, is located on the shores of Port Nicholson, a natural harbor at the south end of North Island. The city was founded in 1840 by British emigrants and now has a regional population of more than 400,000 residents. As seen here, the natural terrain imposes strong control over the urban growth pattern (urban features generally appear gray or white in this view). Rugged hills generally rising to 300 meters (1,000 feet) help protect the city and harbor from strong winter windsNew Zealand is seismically active and faults are readily seen in the topography. The Wellington Fault forms the straight northwestern (left) shoreline of the harbor. Toward the southwest (down) the fault crosses through the city, then forms linear canyons in the hills before continuing offshore at the bottom. Toward the northeast (upper right) the fault forms the sharp mountain front along the northern edge of the heavily populated Hutt Valley.This stereoscopic image pair was generated using topographic data from the Shuttle Radar Topography Mission, combined with an enhanced true color Landsat7 satellite image. The topography data are used to create two differing perspectives of a single image, one perspective for each eye. In doing so, each point in the image is shifted slightly, depending on its elevation. When stereoscopically merged, the result is a vertically exaggerated view of the Earth's surface in its full three dimensions.Landsat satellites have provided visible light and infrared images of the Earth continuously since 1972. SRTM topographic data match the 30 meter (99 foot) spatial resolution of most Landsat images and will provide a valuable complement for studying the historic and growing Landsat data archive. The Landsat 7 Thematic Mapper image used here was provided to the SRTM project by the United States Geological Survey, Earth Resources Observation Systems (EROS) data Center, Sioux Falls, South Dakota.Elevation data used in this image

  11. SRTM Stereo Pair: Fiji Islands

    Science.gov (United States)

    2000-01-01

    image pair and viewing them with a stereoscope. When stereoscopically merged, the result is a vertically exaggerated view of the Earth's surface in its full three dimensions.This image was acquired by SRTM aboard the Space Shuttle Endeavour, launched on February 11, 2000. SRTM used the same radar instrument that comprised the Spaceborne Imaging Radar-C/X-Band Synthetic Aperture Radar (SIR-C/X-SAR) that flew twice on the Space Shuttle Endeavour in 1994. SRTM was designed to collect three-dimensional measurements of the Earth's surface. To collect the 3-D data, engineers added a 60-meter-long (about 200 feet) mast, installed additional C-band and X-band antennas, and improved tracking and navigation devices. The mission is a cooperative project between the National Aeronautics and Space Administration (NASA), the National Imagery and Mapping Agency (NIMA) of the U.S. Department of Defense (DoD), and the German and Italian space agencies. It is managed by NASA's Jet Propulsion Laboratory, Pasadena, CA, for NASA's Earth Science Enterprise, Washington, DC.Size: 192 km (119 miles) x 142 km (88 miles) Location: 17.8 deg. South lat., 178.0 deg. East lon. Orientation: North at top Date Acquired: February 19, 2000 Image: NASA/JPL/NIMA

  12. Hole pairing induced by antiferromagnetic spin fluctuations

    International Nuclear Information System (INIS)

    Su, Z.B.; Yu Lu; Dong, J.M.; Tosatti, E.

    1987-08-01

    The effective interaction induced by antiferromagnetic spin fluctuations is considered in the random phase approximation in the context of the recently discovered high T c oxide superconductors. This effective attraction favours a triplet pairing of holes. The implications of such pairing mechanism are discussed in connection with the current experimental observations. (author). 30 refs, 2 figs

  13. Exploring Pair Programming Benefits for MIS Majors

    Science.gov (United States)

    Dongo, Tendai; Reed, April H.; O'Hara, Margaret

    2016-01-01

    Pair programming is a collaborative programming practice that places participants in dyads, working in tandem at one computer to complete programming assignments. Pair programming studies with Computer Science (CS) and Software Engineering (SE) majors have identified benefits such as technical productivity, program/design quality, academic…

  14. Exclusive production of W pairs in CMS

    CERN Document Server

    INSPIRE-00002838

    2014-01-01

    We report the results on the search for exclusive production of $W$ pairs in the LHC with data collected by the Compact Muon Solenoid detector in proton-proton collisions at $\\sqrt{s}$~=~7~TeV. The analysis comprises the two-photon production of a $W$ pairs, ${pp\\to p\\,W^{+}W^{-}\\,p\\to p\\,\

  15. Exclusive production of $W$ pairs in CMS

    OpenAIRE

    Da Silveira, Gustavo Gil; CMS

    2014-01-01

    We report the results on the search for exclusive production of $W$ pairs in the LHC with data collected by the Compact Muon Solenoid detector in proton-proton collisions at $\\sqrt{s}$~=~7~TeV. The analysis comprises the two-photon production of a $W$ pairs, ${pp\\to p\\,W^{+}W^{-}\\,p\\to p\\,\

  16. Becoming independent through au pair migration

    DEFF Research Database (Denmark)

    Dalgas, Karina Märcher

    2015-01-01

    . This article argues that, despite this critique, au pairing does play an important formative role for young Filipinas because it opens up for experiences abroad that enable them to be recognised as independent adults in Philippine society. Rather than autonomy, however, au pairs define their independence...

  17. Drift wave in pair-ion plasma

    Indian Academy of Sciences (India)

    ion plasma are discussed. It is shown that the temperature and/or mass difference of both species could produce drift wave in a pair-ion plasma. The results are discussed in the context of the fullerene pair-ion plasma experiment.

  18. A New Secure Pairing Protocol using Biometrics

    NARCIS (Netherlands)

    Buhan, I.R.

    2008-01-01

    Secure Pairing enables two devices, which share no prior context with each other, to agree upon a security association that they can use to protect their subsequent communication. Secure pairing offers guarantees of the association partner identity and it should be resistant to eavesdropping or to a

  19. Pair creation at large inherent angles

    International Nuclear Information System (INIS)

    Chen, P.; Tauchi, T.; Schroeder, D.V.

    1992-01-01

    In the next-generation linear colliders, the low-energy e + e - pairs created during the collision of high-energy e + e - beams would cause potential deleterious background problems to the detectors. At low collider energies, the pairs are made essentially by the incoherent process, where the pair is created by the interaction of beamstrahlung photons on the individual particles in the oncoming beam. This problem was first identified by Zolotarev, et al. At energies where the beamstrahlung parameter Υ lies approximately in the range 0.6 approx-lt Υ approx-lt 100, pair creation from the beamstrahlung photons is dominated by a coherent process, first noted by Chen. The seriousness of this pair creation problem lies in the transverse momenta that the pair particles carry when leaving the interaction point (IP) with large angles. Since the central issue is the transverse momentum for particles with large angles, the authors notice that there is another source for it. Namely, when the pair particles are created at low energies, the intrinsic angles of these pairs when produced may already be large. In this paper they reinvestigate the problem, following essentially the same equivalent photon approach, but with changes in specific details including the virtual photon spectrum. In addition, various assumptions are made more explicit. The formulas derived are then applied to the collider parameters designed by Palmer

  20. String pair production in non homogeneous backgrounds

    Energy Technology Data Exchange (ETDEWEB)

    Bolognesi, S. [Department of Physics “E. Fermi” University of Pisa, and INFN - Sezione di Pisa,Largo Pontecorvo, 3, Ed. C, 56127 Pisa (Italy); Rabinovici, E. [Racah Institute of Physics, The Hebrew University of Jerusalem,91904 Jerusalem (Israel); Tallarita, G. [Departamento de Ciencias, Facultad de Artes Liberales,Universidad Adolfo Ibáñez, Santiago 7941169 (Chile)

    2016-04-28

    We consider string pair production in non homogeneous electric backgrounds. We study several particular configurations which can be addressed with the Euclidean world-sheet instanton technique, the analogue of the world-line instanton for particles. In the first case the string is suspended between two D-branes in flat space-time, in the second case the string lives in AdS and terminates on one D-brane (this realizes the holographic Schwinger effect). In some regions of parameter space the result is well approximated by the known analytical formulas, either the particle pair production in non-homogeneous background or the string pair production in homogeneous background. In other cases we see effects which are intrinsically stringy and related to the non-homogeneity of the background. The pair production is enhanced already for particles in time dependent electric field backgrounds. The string nature enhances this even further. For spacial varying electrical background fields the string pair production is less suppressed than the rate of particle pair production. We discuss in some detail how the critical field is affected by the non-homogeneity, for both time and space dependent electric field backgrouds. We also comment on what could be an interesting new prediction for the small field limit. The third case we consider is pair production in holographic confining backgrounds with homogeneous and non-homogeneous fields.

  1. Thermodynamics of pairing phase transition in nuclei

    International Nuclear Information System (INIS)

    Karim, Afaque; Ahmad, Shakeb

    2014-01-01

    The pairing gaps, pairing energy, heat capacity and entropy are calculated within BCS (Bardeen- Cooper-Schrieffer) based quasi particle approach, including thermal fluctuations on pairing field within pairing model for all nuclei (light, medium, heavy and super heavy nuclei). Quasi particles approach in BCS theory was introduced and reformulated to study various properties. For thermodynamic behavior of nuclei at finite temperatures, the anomalous averages of creation and annihilation operators are introduced. It is solved self consistently at finite temperatures to obtain BCS Hamiltonian. After doing unitary transformation, we obtained the Hamiltonian in the diagonal form. Thus, one gets temperature dependence gap parameter and pairing energy for nuclei. Moreover, the energy at finite temperatures is the sum of the condensation energy and the thermal energy of fermionic quasi particles. With the help of BCS Hamiltonian, specific heat, entropy and free energy are calculated for different nuclei. In this paper the gap parameter occupation number and pairing energy as a function of temperature which is important for all the light, medium, heavy and super heavy nuclei is calculated. Moreover, the various thermo dynamical quantities like specific heat, entropy and free energy is also obtained for different nuclei. Thus, the thermodynamics of pairing phase transition in nuclei is studied

  2. Exploring Pair Programming Benefits for MIS Majors

    Directory of Open Access Journals (Sweden)

    April H. Reed

    2016-12-01

    Full Text Available Pair programming is a collaborative programming practice that places participants in dyads, working in tandem at one computer to complete programming assignments. Pair programming studies with Computer Science (CS and Software Engineering (SE majors have identified benefits such as technical productivity, program/design quality, academic performance, and increased satisfaction for their participants. In this paper, pair programming is studied with Management Information Systems (MIS majors, who (unlike CS and SE majors taking several programming courses typically take only one programming course and often struggle to develop advanced programming skills within that single course. The researchers conducted two pair programming experiments in an introductory software development course for MIS majors over three semesters to determine if pair programming could enhance learning for MIS students. The program results, researchers’ direct observations, and participants’ responses to a survey questionnaire were analyzed after each experiment. The results indicate that pair programming appears to be beneficial to MIS students’ technical productivity and program design quality, specifically the ability to create programs using high-level concepts. Additionally, results confirmed increased student satisfaction and reduced frustration, as the pairs worked collaboratively to produce a program while actively communicating and enjoying the process.

  3. Effect of pairing on nuclear dynamics

    International Nuclear Information System (INIS)

    Scamps, Guillaume

    2014-01-01

    Pairing correlations is an essential component for the description of the atomic nuclei. The effects of pairing on static property of nuclei are now well known. In this thesis, the effect of pairing on nuclear dynamics is investigated. Theories that includes pairing are benchmarked in a model case. The TDHF+BCS theory turns out to be a good compromise between the physics taken into account and the numerical cost. This TDHF+BCS theory was retained for realistic calculations. Nevertheless, the application of pairing in the BCS approximation may induce new problems due to (1) the particle number symmetry breaking, (2) the non-conservation of the continuity equation. These difficulties are analysed in detail and solutions are proposed. In this thesis, a 3 dimensional TDHF+BCS code is developed to simulate the nuclear dynamic. Applications to giant resonances show that pairing modify only the low lying peaks. The high lying collective components are only affected by the initial conditions. An exhaustive study of the giant quadrupole resonances with the TDHF+BCS theory is performed on more than 700 spherical or deformed nuclei. Is is shown that the TDHF+BCS theory reproduces well the collective energy of the resonance. After validation on the small amplitude limit problem, the approach was applied to study nucleon transfer in heavy ion reactions. A new method to extract transfer probabilities is introduced. It is demonstrated that pairing significantly increases the two-nucleon transfer probability. (author) [fr

  4. String pair production in non homogeneous backgrounds

    International Nuclear Information System (INIS)

    Bolognesi, S.; Rabinovici, E.; Tallarita, G.

    2016-01-01

    We consider string pair production in non homogeneous electric backgrounds. We study several particular configurations which can be addressed with the Euclidean world-sheet instanton technique, the analogue of the world-line instanton for particles. In the first case the string is suspended between two D-branes in flat space-time, in the second case the string lives in AdS and terminates on one D-brane (this realizes the holographic Schwinger effect). In some regions of parameter space the result is well approximated by the known analytical formulas, either the particle pair production in non-homogeneous background or the string pair production in homogeneous background. In other cases we see effects which are intrinsically stringy and related to the non-homogeneity of the background. The pair production is enhanced already for particles in time dependent electric field backgrounds. The string nature enhances this even further. For spacial varying electrical background fields the string pair production is less suppressed than the rate of particle pair production. We discuss in some detail how the critical field is affected by the non-homogeneity, for both time and space dependent electric field backgrouds. We also comment on what could be an interesting new prediction for the small field limit. The third case we consider is pair production in holographic confining backgrounds with homogeneous and non-homogeneous fields.

  5. Nonrandom network connectivity comes in pairs

    Directory of Open Access Journals (Sweden)

    Felix Z. Hoffmann

    2017-02-01

    Full Text Available Overrepresentation of bidirectional connections in local cortical networks has been repeatedly reported and is a focus of the ongoing discussion of nonrandom connectivity. Here we show in a brief mathematical analysis that in a network in which connection probabilities are symmetric in pairs, Pij = Pji, the occurrences of bidirectional connections and nonrandom structures are inherently linked; an overabundance of reciprocally connected pairs emerges necessarily when some pairs of neurons are more likely to be connected than others. Our numerical results imply that such overrepresentation can also be sustained when connection probabilities are only approximately symmetric.

  6. Soliton pair creation at finite temperatures

    International Nuclear Information System (INIS)

    Grigoriev, D.Yu.; Rubakov, V.A.

    1988-01-01

    Creation of soliton-antisoliton pairs at finite temperature is considered within a (1+1)-dimensional model of a real scalar field. It is argued that at certain temperatures, the soliton pair creation in quantum theory can be investigated by studying classical field evolution in real time. The classical field equations are solved numerically, and the pair creation rate and average number of solitons are evaluated. No peculiar suppression of the rate is observed. Some results on the sphaleron transitions in (1+1)-dimensional abelian Higgs model are also presented. (orig.)

  7. Pairing fluctuations in trapped Fermi gases

    International Nuclear Information System (INIS)

    Viverit, Luciano; Bruun, Georg M.; Minguzzi, Anna; Fazio, Rosario

    2004-01-01

    We examine the contribution of pairing fluctuations to the superfluid order parameter for harmonically trapped atomic Fermi gases in the BCS regime. In the limit of small systems we consider, both analytically and numerically, their space and temperature dependence. We predict a parity effect, i.e., that pairing fluctuations show a maximum or a minimum at the center of the trap, depending on the value of the last occupied shell being even or odd. We propose to detect pairing fluctuations by measuring the density-density correlation function after a ballistic expansion of the gas

  8. AudioPairBank: Towards A Large-Scale Tag-Pair-Based Audio Content Analysis

    OpenAIRE

    Sager, Sebastian; Elizalde, Benjamin; Borth, Damian; Schulze, Christian; Raj, Bhiksha; Lane, Ian

    2016-01-01

    Recently, sound recognition has been used to identify sounds, such as car and river. However, sounds have nuances that may be better described by adjective-noun pairs such as slow car, and verb-noun pairs such as flying insects, which are under explored. Therefore, in this work we investigate the relation between audio content and both adjective-noun pairs and verb-noun pairs. Due to the lack of datasets with these kinds of annotations, we collected and processed the AudioPairBank corpus cons...

  9. English for au pairs the au pair's guide to learning English

    CERN Document Server

    Curtis, Lucy

    2014-01-01

    English for Au Pairs has interlinked stories about a group of au pairs new to England. Marta, an 18-year-old from Poland arrives in the UK to work as an au pair. Throughout her year-long stay she has many different experiences - some bad, some good - but with the support of her host family she finds new friends and improves her English. English for Au Pairs offers insight into the joys and difficulties of being an au pair while at the same time reinforcing English language learning through grammar explanations and exercises.

  10. Effects of disorder on the electron pairing

    International Nuclear Information System (INIS)

    Oviedo-Roa, R.; Wang, C.; Navarro, O.

    1996-01-01

    The electron pairing in randomly disordered lattices is studied by using an attractive Hubbard model, and by mapping the many-body problem onto a tight-binding one in a higher dimensional space, where a diagonal disorder is considered within the coherent-potential approximation. The results show an enhancement of the pair-binding energy as the self-energy difference increases in a binary alloy A x B 1-x . This fact suggests that the pairing process is highly sensitive to the one-particle localization condition. A ground-state phase diagram for on-site interaction disorder shows regions where pairing is avoided for ordered diatomic systems but not for disordered case

  11. Pairing properties of realistic effective interactions

    Directory of Open Access Journals (Sweden)

    Gargano A.

    2016-01-01

    Full Text Available We investigate the pairing properties of an effective shell-model interaction defined within a model space outside 132Sn and derived by means of perturbation theory from the CD-Bonn free nucleon-nucleon potential. It turns out that the neutron pairing component of the effective interaction is significantly weaker than the proton one, which accounts for the large pairing gap difference observed in the two-valence identical particle nuclei 134Sn and 134Te. The role of the contribution arising from one particle-one hole excitations in determining the pairing force is discussed and its microscopic structure is also analyzed in terms of the multipole decomposition.

  12. Statistical mechanics of magnetized pair Fermi gas

    International Nuclear Information System (INIS)

    Daicic, J.; Frankel, N.E.; Kowalenko, V.

    1993-01-01

    Following previous work on the magnetized pair Bose gas this contribution presents the statistical mechanics of the charged relativistic Fermi gas with pair creation in d spatial dimensions. Initially, the gas in no external fields is studied. As a result, expansions for the various thermodynamic functions are obtained in both the μ/m→0 (neutrino) limit, and about the point μ/m =1, where μ is the chemical potential. The thermodynamics of a gas of quantum-number conserving massless fermions is also discussed. Then a complete study of the pair Fermi gas in a homogeneous magnetic field, is presented investigating the behavior of the magnetization over a wide range of field strengths. The inclusion of pairs leads to new results for the net magnetization due to the paramagnetic moment of the spins and the diamagnetic Landau orbits. 20 refs

  13. Degenerated differential pair with controllable transconductance

    NARCIS (Netherlands)

    Mensink, Clemens; Mensink, Clemens H.J.; Nauta, Bram

    1998-01-01

    A differential pair with input transistors and provided with a variable degeneration resistor. The degeneration resistor comprises a series arrangement of two branches of coupled resistors which are shunted in mutually corresponding points by respective control transistors whose gates are

  14. Projected entangled pair states: status and prospects

    Energy Technology Data Exchange (ETDEWEB)

    Verstraete, Frank [Universitaet Wien (Austria)

    2008-07-01

    We report on the progress made to extend the density matrix renormalization group to higher dimensions, discuss the underlying theory of projected entangled pair states (PEPS) and illustrate its potential on the hand of a few examples.

  15. Isovectorial pairing in solvable and algebraic models

    International Nuclear Information System (INIS)

    Lerma, Sergio; Vargas, Carlos E; Hirsch, Jorge G

    2011-01-01

    Schematic interactions are useful to gain some insight in the behavior of very complicated systems such as the atomic nuclei. Prototypical examples are, in this context, the pairing interaction and the quadrupole interaction of the Elliot model. In this contribution the interplay between isovectorial pairing, spin-orbit, and quadrupole terms in a harmonic oscillator shell (the so-called pairing-plus-quadrupole model) is studied by algebraic methods. The ability of this model to provide a realistic description of N = Z even-even nuclei in the fp-shell is illustrated with 44 Ti. Our calculations which derive from schematic and simple terms confirm earlier conclusions obtained by using realistic interactions: the SU(3) symmetry of the quadrupole term is broken mainly by the spin-orbit term, but the energies depends strongly on pairing.

  16. Three mirror pairs of fermion families

    International Nuclear Information System (INIS)

    Montvay, I.

    1988-01-01

    A simple model with three mirror pairs of fermion families is considered which allows for a substantial mixing between the mirror fermion partners without conflicting with known phenomenology. (orig.)

  17. QCD angular correlations for muon pair production

    International Nuclear Information System (INIS)

    Kajantie, K.; Raitio, R.; Lindfors, J.

    1978-01-01

    Angular distributions of muons are discussed in the framework of a QCD treatment of muon pair production in hadron-hadron collisions. The predicted angular effects are independent of the infrared behavior of QCD. Measuring them will permit one to determine whether the origin of the large transverse momentum of the pair is in the quark transverse momenta or in a constituent-constituent subprocess. (author)

  18. Pairing interaction method in crystal field theory

    International Nuclear Information System (INIS)

    Dushin, R.B.

    1989-01-01

    Expressions, permitting to describe matrix elements of secular equation for metal-ligand pairs via parameters of the method of pairing interactions, genealogical coefficients and Clebsch-Gordan coefficients, are given. The expressions are applicable to any level or term of f n and d n configurations matrix elements for the terms of the maximum multiplicity of f n and d n configurations and also for the main levels of f n configurations are tabulated

  19. Influence of quadrupole pairing on backbending

    International Nuclear Information System (INIS)

    Faessler, A.; Wakai, M.

    1978-01-01

    The backbending phenomenon is attributed to the Coriolis antipairing and the rotational alignment effects. We can consider both effects simultaneously by applying the cranked Hartree-Fock-Bogoliubov theory to the description of the rotational motion of nuclei. In usual treatments of the backbending, however, only the monopole pairing force is considered and pairing forces of other types are neglected. This may be the main reason for starting of the backbending at too small total angular momentum in theoretical results. (orig.) [de

  20. Transverse Momentum Distributions for Heavy Quark Pairs

    OpenAIRE

    Berger, Edmond L.; Meng, Ruibin

    1993-01-01

    We study the transverse momentum distribution for a $pair$ of heavy quarks produced in hadron-hadron interactions. Predictions for the large transverse momentum region are based on exact order $\\alpha_s^3$ QCD perturbation theory. For the small transverse momentum region, we use techniques for all orders resummation of leading logarithmic contributions associated with initial state soft gluon radiation. The combination provides the transverse momentum distribution of heavy quark pairs for all...

  1. Seniority zero pair coupled cluster doubles theory

    International Nuclear Information System (INIS)

    Stein, Tamar; Henderson, Thomas M.; Scuseria, Gustavo E.

    2014-01-01

    Coupled cluster theory with single and double excitations accurately describes weak electron correlation but is known to fail in cases of strong static correlation. Fascinatingly, however, pair coupled cluster doubles (p-CCD), a simplified version of the theory limited to pair excitations that preserve the seniority of the reference determinant (i.e., the number of unpaired electrons), has mean field computational cost and is an excellent approximation to the full configuration interaction (FCI) of the paired space provided that the orbital basis defining the pairing scheme is adequately optimized. In previous work, we have shown that optimization of the pairing scheme in the seniority zero FCI leads to a very accurate description of static correlation. The same conclusion extends to p-CCD if the orbitals are optimized to make the p-CCD energy stationary. We here demonstrate these results with numerous examples. We also explore the contributions of different seniority sectors to the coupled cluster doubles (CCD) correlation energy using different orbital bases. We consider both Hartree-Fock and Brueckner orbitals, and the role of orbital localization. We show how one can pair the orbitals so that the role of the Brueckner orbitals at the CCD level is retained at the p-CCD level. Moreover, we explore ways of extending CCD to accurately describe strongly correlated systems

  2. Base pair probability estimates improve the prediction accuracy of RNA non-canonical base pairs.

    Directory of Open Access Journals (Sweden)

    Michael F Sloma

    2017-11-01

    Full Text Available Prediction of RNA tertiary structure from sequence is an important problem, but generating accurate structure models for even short sequences remains difficult. Predictions of RNA tertiary structure tend to be least accurate in loop regions, where non-canonical pairs are important for determining the details of structure. Non-canonical pairs can be predicted using a knowledge-based model of structure that scores nucleotide cyclic motifs, or NCMs. In this work, a partition function algorithm is introduced that allows the estimation of base pairing probabilities for both canonical and non-canonical interactions. Pairs that are predicted to be probable are more likely to be found in the true structure than pairs of lower probability. Pair probability estimates can be further improved by predicting the structure conserved across multiple homologous sequences using the TurboFold algorithm. These pairing probabilities, used in concert with prior knowledge of the canonical secondary structure, allow accurate inference of non-canonical pairs, an important step towards accurate prediction of the full tertiary structure. Software to predict non-canonical base pairs and pairing probabilities is now provided as part of the RNAstructure software package.

  3. Base pair probability estimates improve the prediction accuracy of RNA non-canonical base pairs.

    Science.gov (United States)

    Sloma, Michael F; Mathews, David H

    2017-11-01

    Prediction of RNA tertiary structure from sequence is an important problem, but generating accurate structure models for even short sequences remains difficult. Predictions of RNA tertiary structure tend to be least accurate in loop regions, where non-canonical pairs are important for determining the details of structure. Non-canonical pairs can be predicted using a knowledge-based model of structure that scores nucleotide cyclic motifs, or NCMs. In this work, a partition function algorithm is introduced that allows the estimation of base pairing probabilities for both canonical and non-canonical interactions. Pairs that are predicted to be probable are more likely to be found in the true structure than pairs of lower probability. Pair probability estimates can be further improved by predicting the structure conserved across multiple homologous sequences using the TurboFold algorithm. These pairing probabilities, used in concert with prior knowledge of the canonical secondary structure, allow accurate inference of non-canonical pairs, an important step towards accurate prediction of the full tertiary structure. Software to predict non-canonical base pairs and pairing probabilities is now provided as part of the RNAstructure software package.

  4. Generalized pairing strategies-a bridge from pairing strategies to colorings

    Directory of Open Access Journals (Sweden)

    Győrffy Lajos

    2016-12-01

    Full Text Available In this paper we define a bridge between pairings and colorings of the hypergraphs by introducing a generalization of pairs called t-cakes for t ∈ ℕ, t ≥ 2. For t = 2 the 2-cakes are the same as the well-known pairs of system of distinct representatives, that can be turned to pairing strategies in Maker-Breaker hypergraph games, see Hales and Jewett [12]. The two-colorings are the other extremity of t-cakes, in which the whole ground set of the hypergraph is one big cake that we divide into two parts (color classes. Starting from the pairings (2-cake placement and two-colorings we define the generalized t-cake placements where we pair p elements by q elements (p, q ∈ ℕ, 1 ≤ p, q < t, p + q = t.

  5. Radical-pair based avian magnetoreception

    Science.gov (United States)

    Procopio, Maria; Ritz, Thorsten

    2014-03-01

    Behavioural experiments suggest that migratory birds possess a magnetic compass sensor able to detect the direction of the geomagnetic. One hypothesis for the basis of this remarkable sensory ability is that the coherent quantum spin dynamics of photoinduced radical pair reactions transduces directional magnetic information from the geomagnetic field into changes of reaction yields, possibly involving the photoreceptor cryptochrome in the birds retina. The suggested radical-pair based avian magnetoreception has attracted attention in the field of quantum biology as an example of a biological sensor which might exploit quantum coherences for its biological function. Investigations on such a spin-based sensor have focussed on uncovering the design features for the design of a biomimetic magnetic field sensor. We study the effects of slow fluctuations in the nuclear spin environment on the directional signal. We quantitatively evaluate the robustness of signals under fluctuations on a timescale longer than the lifetime of a radical pair, utilizing two models of radical pairs. Our results suggest design principles for building a radical-pair based compass sensor that is both robust and highly directional sensitive.

  6. Isominkowskian theory of Cooper Pairs in superconductors

    International Nuclear Information System (INIS)

    Animalu, A.O.E.

    1993-01-01

    Via the use of Santilli's isominkowskian space, the author presents a relativistic extension of the author's recent treatment of the Cooper Pair in superconductivity based on the Lie-isotopic lifting of quantum mechanics known as Hadronic Mechanics. The isominkowskian treatment reduces the solution of the eiganvalue problem for the quasiparticle energy spectrum to a geometric problem of specifying the metric of the isominkowskian space inside the pair in various models of ordinary high T c superconductors. The use of an intriguing realization of the metric due to Dirac reduces the dimensionality of the interior space to two yielding a spin mutation from 1/2 to zero inside a Cooper pair in two-band BCS and Hubbard models. 12 refs

  7. On pair-absorption in intrinsic vapours

    International Nuclear Information System (INIS)

    Hotop, R.; Niemax, K.; Schlueter, D.

    1982-01-01

    The bound-state pair-absorption bands Cs(6 2 S 1 sub(/) 2 ) + Cs(6 2 S 1 sub(/) 2 ) + hν → Cs(5 2 D 5 sub(/) 2 sub(,) 3 sub(/) 2 ) + Cs(6 2 P 1 sub(/) 2 ) and the K-K continuum-state pair-absorptions in the wavelength region 2.350 <= lambda <= 2.850 Angstroem have been investigated experimentally. In the case of the bound-state pair-absorption bands a theoretical approach for the absorption cross section at the band centre is given which is in good agreement with the experimental observation. Differences between our and the theoretical formulas given by the Stanford group are discussed. (orig.)

  8. Pair production by a deep potential well

    International Nuclear Information System (INIS)

    Nikishov, A.I.

    1987-01-01

    Solutions are obtained for the Dirac and Klein-Gordon equations with a one-dimensional symmetric potential well, having a flat bottom and arbitrary depth, width and field strengths at the walls. Quasi-stationary solutions describing a pair production by the well and the inverse process are obtained. It is shown that if the pair production probability is small, it is expressed in terms of the pair production probability on one wall and the particle oscillation frequency in the well. If the well has a supercritical depth, the lower continuum contains positron resonance scattering states at energies close to the real part of the quasi-stationary level energy (Zeldovich's effect). The qualitative dependence of the positron penetration coefficient through the wall on its energy and the well depth is an evidence that the solution of the so called one-particle Dirac equation describes in fact a many-particle system with a charge of 0 or 1

  9. The inverse problem for Schwinger pair production

    Directory of Open Access Journals (Sweden)

    F. Hebenstreit

    2016-02-01

    Full Text Available The production of electron–positron pairs in time-dependent electric fields (Schwinger mechanism depends non-linearly on the applied field profile. Accordingly, the resulting momentum spectrum is extremely sensitive to small variations of the field parameters. Owing to this non-linear dependence it is so far unpredictable how to choose a field configuration such that a predetermined momentum distribution is generated. We show that quantum kinetic theory along with optimal control theory can be used to approximately solve this inverse problem for Schwinger pair production. We exemplify this by studying the superposition of a small number of harmonic components resulting in predetermined signatures in the asymptotic momentum spectrum. In the long run, our results could facilitate the observation of this yet unobserved pair production mechanism in quantum electrodynamics by providing suggestions for tailored field configurations.

  10. Hadronic production of massive lepton pairs

    International Nuclear Information System (INIS)

    Berger, E.L.

    1982-12-01

    A review is presented of recent experimental and theoretical progress in studies of the production of massive lepton pairs in hadronic collisions. I begin with the classical Drell-Yan annihilation model and its predictions. Subsequently, I discuss deviations from scaling, the status of the proofs of factorization in the parton model, higher-order terms in the perturbative QCD expansion, the discrepancy between measured and predicted yields (K factor), high-twist terms, soft gluon effects, transverse-momentum distributions, implications for weak vector boson (W +- and Z 0 ) yields and production properties, nuclear A dependence effects, correlations of the lepton pair with hadrons in the final state, and angular distributions in the lepton-pair rest frame

  11. Charged topological black hole pair creation

    International Nuclear Information System (INIS)

    Mann, R.B.

    1998-01-01

    I examine the pair creation of black holes in space-times with a cosmological constant of either sign. I consider cosmological C-metrics and show that the conical singularities in this metric vanish only for three distinct classes of black hole metric, two of which have compact event horizons on each spatial slice. One class is a generalization of the Reissner-Nordstroem (anti-)de Sitter black holes in which the event horizons are the direct product of a null line with a 2-surface with topology of genus g. The other class consists of neutral black holes whose event horizons are the direct product of a null conoid with a circle. In the presence of a domain wall, black hole pairs of all possible types will be pair created for a wide range of mass and charge, including even negative mass black holes. I determine the relevant instantons and Euclidean actions for each case. (orig.)

  12. Theory of antiferromagnetic pairing in cuprate superconductors

    International Nuclear Information System (INIS)

    Plakida, N.M.

    2006-01-01

    A review of the antiferromagnetic exchange and spin-fluctuation pairing theory in the cuprate superconductors is given. We briefly discuss a phenomenological approach and a theory in the limit of weak Coulomb correlations. A microscopic theory in the strong correlation limit is presented in more detail. In particular, results of our recently developed theory for the effective p-d Hubbard model and the reduced t-J model are given. We have proved that retardation effects for the antiferromagnetic exchange interaction are unimportant that results in pairing of all charge carriers in the conduction band and high Tc proportional to the Fermi energy. The spin-fluctuation interaction caused by kinematic interaction gives an additional contribution to the d-wave pairing. Dependence of Tc on the hole concentration and the lattice constant (or pressure) and an oxygen isotope shift are discussed

  13. Holographic EPR pairs, wormholes and radiation

    Science.gov (United States)

    Chernicoff, Mariano; Güijosa, Alberto; Pedraza, Juan F.

    2013-10-01

    As evidence for the ER = EPR conjecture, it has recently been observed that the string that is holographically dual to an entangled quark-antiquark pair separating with (asymptotically) uniform acceleration has a wormhole on its worldsheet. We point out that a two-sided horizon and a wormhole actually appear for much more generic quark-antiquark trajectories, which is consistent with the fact that the members of an EPR pair need not be permanently out of causal contact. The feature that determines whether the causal structure of the string worldsheet is trivial or not turns out to be the emission of gluonic radiation by the dual quark and antiquark. In the strongly-coupled gauge theory, it is only when radiation is emitted that one obtains an unambiguous separation of the pair into entangled subsystems, and this is what is reflected on the gravity side by the existence of the worldsheet horizon.

  14. Drell-Yan lepton pair photoproduction

    International Nuclear Information System (INIS)

    Badalyan, R.G.; Grabskij, V.O.; Matinyan, S.G.

    1989-01-01

    The study of photon structure functions by spectra of massive lepton pairs (M l + l - ≥ 2 GeV) in photon fragmentation region in γp-interactions at high energies is suggested. In calculations of Drell-Yan lepton pair inclusive spectra in γp-interactions for photon structure functions there are used results obtained within QCD, data on γγ-interactions in e + e - → e + e - X on colliders as well as results from the analysis of vector meson non-diffractive photoproduction at high energies. It is shown that there exists a sufficienly wide kinematic region over variables X l + l - and M l + l - , wherein photon structure functions can be studied by spectra of Grell-Yan lepton pairs in the processes of their photoproduction. 31 refs.; 6 figs.; 1 tab

  15. Lax pairs: a novel type of separability

    International Nuclear Information System (INIS)

    Fokas, A S

    2009-01-01

    An attempt is made to place into historical context the fundamental concept of Lax pairs. For economy of presentation, emphasis is placed on the effectiveness of Lax pairs for the analysis of integrable nonlinear evolution PDEs. It is argued that Lax pairs provide a deeper type of separability than the classical separation of variables. Indeed, it is shown that: (a) the solution of the Cauchy problem of evolution equations is based on the derivation of a nonlinear Fourier transform pair, and this is achieved by employing the spectral analysis of one of the two eigenvalue equations forming a Lax pair; thus, although this methodology still follows the reverent philosophy of the classical separation of variables and transform methods, it can be applied to a class of nonlinear PDEs. (b) The solution of initial-boundary-value problems of evolution equations is based on the simultaneous spectral analysis of both equations forming a Lax pair and hence, in a sense, it employs the synthesis instead of the separation of variables; this methodology does not have a direct classical analogue, however, it can be considered as the nonlinearization of a method which combines Green's function classical integral representations with an analogue of the method of images, but which are now formulated in the spectral (Fourier) instead of the physical space. In addition to presenting a general methodology for analysing initial- and initial-boundary-value problems for nonlinear integrable evolution equations in one and two spatial variables, recent progress is reviewed for the derivation and the solution of integrable nonlinear evolution PDEs formulated in higher than two spatial dimensions. (topical review)

  16. Top quark pair production in ATLAS

    CERN Document Server

    Moreno Llacer, M; The ATLAS collaboration

    2010-01-01

    Top-quark pairs are expected to be produced at the LHC, even at the lower beam energy and luminosity in the first years of running. Establishing the top-pair signal and measuring the production cross-section are important benchmarks for ATLAS, and will help understand the detector performance for events with high-pT leptons, high jet multiplicity, missing transverse energy. The prospects for early top physics measurements will be shown, with a particular emphasis on the progress achieved with data so far.

  17. Mass resolution for lepton pairs at Isabelle

    International Nuclear Information System (INIS)

    Baltay, C.; Paige, F.E.

    1978-01-01

    Experiments measuring e + e - and μ + μ-pairs will be the principal way of searching at ISABELLE for the Z 0 and for vector mesons made from new heavy quark-antiquark (Q anti Q ) pairs. Although the best possible mass resolution is clearly of benefit in such experiments, excessive resolution would lead to an unnecessarily large detector. It is believed that a mass resolution of a few percent is appropriate in searching both for the Z 0 and for new Q anti Q states. However, there are some interesting experiments which would require much better mass resolution, of order 1/4% FWHM. 9 references

  18. Ponderomotive effects in multiphoton pair production

    Science.gov (United States)

    Kohlfürst, Christian; Alkofer, Reinhard

    2018-02-01

    The Dirac-Heisenberg-Wigner formalism is employed to investigate electron-positron pair production in cylindrically symmetric but otherwise spatially inhomogeneous, oscillating electric fields. The oscillation frequencies are hereby tuned to obtain multiphoton pair production in the nonperturbative threshold regime. An effective mass, as well as a trajectory-based semiclassical analysis, is introduced in order to interpret the numerical results for the distribution functions as well as for the particle yields and spectra. The results, including the asymptotic particle spectra, display clear signatures of ponderomotive forces.

  19. Holographic EPR Pairs, Wormholes and Radiation

    OpenAIRE

    Chernicoff, Mariano; Güijosa, Alberto; Pedraza, Juan F.

    2013-01-01

    As evidence for the ER=EPR conjecture, it has recently been observed that the string that is holographically dual to an entangled quark-antiquark pair separating with (asymptotically) uniform acceleration has a wormhole on its worldsheet. We point out that a two-sided horizon and a wormhole actually appear for much more generic quark-antiquark trajectories, which is consistent with the fact that the members of an EPR pair need not be permanently out of causal contact. The feature that determi...

  20. Gluino-pair production at the Tevatron

    International Nuclear Information System (INIS)

    Beenakker, W.; Spira, M.; Zerwas, P.M.

    1995-05-01

    The next-to-leading order QCD corrections to the production of gluino pairs at the Tevatron are presented in this paper. Similar to the production of squark-antisquark pairs, the dependence of the cross section on the renormalization/factorization scale is reduced considerably by including the higher-order corrections. The cross section increases with respect to the lowest-order calculation which, in previous experimental analyses, had been evaluated at the scale of the invariant energy of the partonic subprocesses. (orig.)

  1. Facial expressions and pair bonds in hylobatids.

    Science.gov (United States)

    Florkiewicz, Brittany; Skollar, Gabriella; Reichard, Ulrich H

    2018-06-06

    Facial expressions are an important component of primate communication that functions to transmit social information and modulate intentions and motivations. Chimpanzees and macaques, for example, produce a variety of facial expressions when communicating with conspecifics. Hylobatids also produce various facial expressions; however, the origin and function of these facial expressions are still largely unclear. It has been suggested that larger facial expression repertoires may have evolved in the context of social complexity, but this link has yet to be tested at a broader empirical basis. The social complexity hypothesis offers a possible explanation for the evolution of complex communicative signals such as facial expressions, because as the complexity of an individual's social environment increases so does the need for communicative signals. We used an intraspecies, pair-focused study design to test the link between facial expressions and sociality within hylobatids, specifically the strength of pair-bonds. The current study compared 206 hr of video and 103 hr of focal animal data for ten hylobatid pairs from three genera (Nomascus, Hoolock, and Hylobates) living at the Gibbon Conservation Center. Using video footage, we explored 5,969 facial expressions along three dimensions: repertoire use, repertoire breadth, and facial expression synchrony [FES]. We then used focal animal data to compare dimensions of facial expressiveness to pair bond strength and behavioral synchrony. Hylobatids in our study overlapped in only half of their facial expressions (50%) with the only other detailed, quantitative study of hylobatid facial expressions, while 27 facial expressions were uniquely observed in our study animals. Taken together, hylobatids have a large facial expression repertoire of at least 80 unique facial expressions. Contrary to our prediction, facial repertoire composition was not significantly correlated with pair bond strength, rates of territorial synchrony

  2. Effect of proton transfer on the electronic coupling in DNA

    International Nuclear Information System (INIS)

    Rak, Janusz; Makowska, Joanna; Voityuk, Alexander A.

    2006-01-01

    The effects of single and double proton transfer within Watson-Crick base pairs on donor-acceptor electronic couplings, V da , in DNA are studied on the bases of quantum chemical calculations. Four dimers [AT,AT], [GC,GC], [GC,AT] and [GC,TA)] are considered. Three techniques - the generalized Mulliken-Hush scheme, the fragment charge method and the diabatic states method - are employed to estimate V da for hole transfer between base pairs. We show that both single- and double proton transfer (PT) reactions may substantially affect the electronic coupling in DNA. The electronic coupling in [AT,AT] is predicted to be most sensitive to PT. Single PT within the first base pair in the dimer leads to increase in the hole transfer efficiency by a factor of 4, while proton transfer within the second pair should substantially, by 2.7 times, decrease the rate of charge transfer. Thus, directional asymmetry of the PT effects on the electronic coupling is predicted. The changes in the V da matrix elements correlate with the topological properties of orbitals of donor and acceptor and can be qualitatively rationalized in terms of resonance structures of donor and acceptor. Atomic pair contributions to the V da matrix elements are also analyzed

  3. Control of box C/D snoRNP assembly by N6-methylation of adenine.

    Science.gov (United States)

    Huang, Lin; Ashraf, Saira; Wang, Jia; Lilley, David Mj

    2017-09-01

    N 6 -methyladenine is the most widespread mRNA modification. A subset of human box C/D snoRNA species have target GAC sequences that lead to formation of N 6 -methyladenine at a key trans Hoogsteen-sugar A·G base pair, of which half are methylated in vivo The GAC target is conserved only in those that are methylated. Methylation prevents binding of the 15.5-kDa protein and the induced folding of the RNA Thus, the assembly of the box C/D snoRNP could in principle be regulated by RNA methylation at its critical first stage. Crystallography reveals that N 6 -methylation of adenine prevents the formation of trans Hoogsteen-sugar A·G base pairs, explaining why the box C/D RNA cannot adopt its kinked conformation. More generally, our data indicate that sheared A·G base pairs (but not Watson-Crick base pairs) are more susceptible to disruption by N 6 mA methylation and are therefore possible regulatory sites. The human signal recognition particle RNA and many related Alu retrotransposon RNA species are also methylated at N6 of an adenine that forms a sheared base pair with guanine and mediates a key tertiary interaction. © 2017 The Authors. Published under the terms of the CC BY 4.0 license.

  4. Dislocation processes in quasicrystals-Kink-pair formation control or jog-pair formation control

    International Nuclear Information System (INIS)

    Takeuchi, Shin

    2005-01-01

    A computer simulation of dislocation in a model quasiperiodic lattice indicates that the dislocation feels a large Peierls potential when oriented in particular directions. For a dislocation with a high Peierls potential, the glide velocity and the climb velocity of the dislocation can be described almost in parallel in terms of the kink-pair formation followed by kink motion and the jog-pair formation followed by jog motion, respectively. The activation enthalpy of the kink-pair formation is the sum of the kink-pair formation enthalpy and the atomic jump activation enthalpy, while the activation enthalpy of the jog-pair formation involves the jog-pair enthalpy and the self-diffusion enthalpy. Since the kink-pair energy can be considerably larger than the jog-pair energy, the climb velocity can be faster than the glide velocity, so that the plastic deformation of quasicrystals can be brought not by dislocation glide but by dislocation climb at high temperatures

  5. Pair- ${v}$ -SVR: A Novel and Efficient Pairing nu-Support Vector Regression Algorithm.

    Science.gov (United States)

    Hao, Pei-Yi

    This paper proposes a novel and efficient pairing nu-support vector regression (pair--SVR) algorithm that combines successfully the superior advantages of twin support vector regression (TSVR) and classical -SVR algorithms. In spirit of TSVR, the proposed pair--SVR solves two quadratic programming problems (QPPs) of smaller size rather than a single larger QPP, and thus has faster learning speed than classical -SVR. The significant advantage of our pair--SVR over TSVR is the improvement in the prediction speed and generalization ability by introducing the concepts of the insensitive zone and the regularization term that embodies the essence of statistical learning theory. Moreover, pair--SVR has additional advantage of using parameter for controlling the bounds on fractions of SVs and errors. Furthermore, the upper bound and lower bound functions of the regression model estimated by pair--SVR capture well the characteristics of data distributions, thus facilitating automatic estimation of the conditional mean and predictive variance simultaneously. This may be useful in many cases, especially when the noise is heteroscedastic and depends strongly on the input values. The experimental results validate the superiority of our pair--SVR in both training/prediction speed and generalization ability.This paper proposes a novel and efficient pairing nu-support vector regression (pair--SVR) algorithm that combines successfully the superior advantages of twin support vector regression (TSVR) and classical -SVR algorithms. In spirit of TSVR, the proposed pair--SVR solves two quadratic programming problems (QPPs) of smaller size rather than a single larger QPP, and thus has faster learning speed than classical -SVR. The significant advantage of our pair--SVR over TSVR is the improvement in the prediction speed and generalization ability by introducing the concepts of the insensitive zone and the regularization term that embodies the essence of statistical learning theory

  6. Collective neutrino-pair emission due to Cooper pairing of protons in superconducting neutron stars

    International Nuclear Information System (INIS)

    Leinson, L.B.

    2001-01-01

    The neutrino emission due to formation and breaking of Cooper pairs of protons in superconducting cores of neutron stars is considered with taking into account the electromagnetic coupling of protons to ambient electrons. It is shown that collective response of electrons to the proton quantum transition contributes coherently to the complete interaction with a neutrino field and enhances the neutrino-pair production. Our calculation shows that the contribution of the vector weak current to the ννbar emissivity of protons is much larger than that calculated by different authors without taking into account the plasma effects. Partial contribution of the pairing protons to the total neutrino radiation from the neutron star core is very sensitive to the critical temperatures for the proton and neutron pairing. We show domains of these parameters where the neutrino radiation, caused by a singlet-state pairing of protons is dominating

  7. Intermittent pair-housing, pair relationship qualities, and HPA activity in adult female rhesus macaques.

    Science.gov (United States)

    Hannibal, Darcy L; Cassidy, Lauren C; Vandeleest, Jessica; Semple, Stuart; Barnard, Allison; Chun, Katie; Winkler, Sasha; McCowan, Brenda

    2018-05-02

    Laboratory rhesus macaques are often housed in pairs and may be temporarily or permanently separated for research, health, or management reasons. While both long-term social separations and introductions can stimulate a stress response that impacts inflammation and immune function, the effects of short-term overnight separations and whether qualities of the pair relationship mediate these effects are unknown. In this study, we investigated the effects of overnight separations on the urinary cortisol concentration of 20 differentially paired adult female rhesus macaques (Macaca mulatta) at the California National Primate Research Center. These females were initially kept in either continuous (no overnight separation) or intermittent (with overnight separation) pair-housing and then switched to the alternate pair-housing condition part way through the study. Each study subject was observed for 5 weeks, during which we collected measures of affiliative, aggressive, anxious, abnormal, and activity-state behaviors in both pair-housing conditions. Additionally, up to three urine samples were collected from each subject per week and assayed for urinary free cortisol and creatinine. Lastly, the behavioral observer scored each pair on four relationship quality attributes ("Anxious," "Tense," "Well-meshed," and "Friendly") using a seven-point scale. Data were analyzed using a generalized linear model with gamma distribution and an information theoretic approach to determine the best model set. An interaction between the intermittent pairing condition and tense pair adjective rating was in the top three models of the best model set. Dominance and rates of affiliation were also important for explaining urinary cortisol variation. Our results suggest that to prevent significant changes in HPA-axis activation in rhesus macaque females, which could have unintended effects on research outcomes, pairs with "Tense" relationships and overnight separations preventing tactile contact

  8. Pair Negotiation When Developing English Speaking Tasks

    Science.gov (United States)

    Bohórquez Suárez, Ingrid Liliana; Gómez Sará, Mary Mily; Medina Mosquera, Sindy Lorena

    2011-01-01

    This study analyzes what characterizes the negotiations of seventh graders at a public school in Bogotá when working in pairs to develop speaking tasks in EFL classes. The inquiry is a descriptive case study that follows the qualitative paradigm. As a result of analyzing the data, we obtained four consecutive steps that characterize students'…

  9. Drift wave in pair-ion plasma

    Indian Academy of Sciences (India)

    of charged particles in electromagnetic fields. The linear and nonlinear collective modes in electron-positron plasma have been investigated theoretically [3–6]. Recently, Oohara and Hatakeyama [7] have developed a novel method for generating a pair plasma con- sisting of only negative and positive ions with equal mass ...

  10. Klein tunneling phenomenon with pair creation process

    Science.gov (United States)

    Wu, G. Z.; Zhou, C. T.; Fu, L. B.

    2018-01-01

    In this paper, we study the Klein tunneling phenomenon with electron-positron pair creation process. Pairs can be created from the vacuum by a supercritical single-well potential (for electrons). In the time region, the time-dependent growth pattern of the created pairs can be characterized by four distinct regimes which can be considered as four different statuses of the single well. We find that if positrons penetrate the single well by Klein tunneling in different statuses, the total number of the tunneling positrons will be different. If Klein tunneling begins at the initial stage of the first status i.e. when the sing well is empty, the tunneling process and the total number of tunneling positrons are similar to the traditional Klein tunneling case without considering the pair creation process. As the tunneling begins later, the total tunneling positron number increases. The number will finally settle to an asymptotic value when the tunneling begins later than the settling-down time t s of the single well which has been defined in this paper.

  11. Effective pair potentials for spherical nanoparticles

    International Nuclear Information System (INIS)

    Van Zon, Ramses

    2009-01-01

    An effective description for rigid spherical nanoparticles in a fluid of point particles is presented. The points inside the nanoparticles and the point particles are assumed to interact via spherically symmetric additive pair potentials, while the distribution of points inside the nanoparticles is taken to be spherically symmetric and smooth. The resulting effective pair interactions between a nanoparticle and a point particle, as well as between two nanoparticles, are then given by spherically symmetric potentials. If overlap between particles is allowed, as can occur for some forms of the pair potentials, the effective potential generally has non-analytic points. It is shown that for each effective potential the expressions for different overlapping cases can be written in terms of one analytic auxiliary potential. Even when only non-overlapping situations are possible, the auxiliary potentials facilitate the formulation of the effective potentials. Effective potentials for hollow nanoparticles (appropriate e.g. for buckyballs) are also considered and shown to be related to those for solid nanoparticles. For hollow nanoparticles overlap is more physical, since this covers the case of a smaller particle embedded in a larger, hollow nanoparticle. Finally, explicit expressions are given for the effective potentials derived from basic pair potentials of power law and exponential form, as well as from the commonly used London–van der Waals, Morse, Buckingham, and Lennard-Jones potentials. The applicability of the latter is demonstrated by comparison with an atomic description of nanoparticles with an internal face centered cubic structure

  12. Odd-frequency pairing in superconducting heterostructures

    Energy Technology Data Exchange (ETDEWEB)

    Golubov, A A [Faculty of Science and Technology and MESA Institute for Nanotechnology, University of Twente, 7500 AE Enschede (Netherlands); Tanaka, Y [Department of Applied Physics, Nagoya University, Nagoya, 464-8603 (Japan); Asano, Y [Department of Applied Physics, Hokkaido University, Sapporo 060-8628 (Japan); Tanuma, Y [Institute of Physics, Kanagawa University, 3-7-1, Rokkakubashi, Kanagawa-ku, Yokohama 221-8686 (Japan)], E-mail: a.golubov@utwente.nl

    2009-04-22

    We review the theory of odd-frequency pairing in superconducting heterostructures, where an odd-frequency pairing component is induced near interfaces. A general description of the superconducting proximity effect in a normal metal or a ferromagnet attached to an unconventional superconductor (S) is given within quasiclassical kinetic theory for various types of symmetry state in S. Various possible symmetry classes in a superconductor are considered which are consistent with the Pauli principle: even-frequency spin-singlet even-parity (ESE) state, even-frequency spin-triplet odd-parity (ETO) state, odd-frequency spin-triplet even-parity (OTE) state and odd-frequency spin-singlet odd-parity (OSO) state. As an example, we consider a junction between a diffusive normal metal (DN) and a p-wave superconductor (even-frequency spin-triplet odd-parity symmetry), where the pairing amplitude in DN belongs to an odd-frequency spin-triplet even-parity symmetry class. We also discuss the manifestation of odd-frequency pairing in conventional superconductor/normal (S/N) proximity systems and its relation to the classical McMillan-Rowell oscillations.

  13. Impact of Paired Tutoring and Mentoring.

    Science.gov (United States)

    Bruce, Jennifer E.; Trammell, Jack

    2003-01-01

    Discusses a study that examines the effects of paired tutoring and mentoring on academic achievement of college freshmen in a probationary program. Results show that students with mentoring and tutoring services by the same person show greater academic gains as measured by compliance and academic achievement than do those students who were…

  14. Pair breaking and charge relaxation in superconductors

    International Nuclear Information System (INIS)

    Nielson, J.B.; Pethick, C.J.; Rammer, J.; Smith, H.

    1982-01-01

    We present a general formalism based on the quasiclassical Green's function for calculating charge imbalance in nonequilibrium superconductors. Our discussion is sufficiently general that it applies at arbitrary temperatures, and under conditions when the width of quasiparticle states are appreciable due to pair breaking processes, and when strong coupling effects are significant. As a first application we demonstrate in detail how in the limit of smallpair breaking and for a weak coupling superconductor the collision term in the formalism reduces to the one in the quasiparticle Boltzmann equation. We next treat the case of charge imbalance generated by tunnel injection, with pair breaking by phonons and magnetic impurities. Over the range of temperatures investigated exerimentally to date, the calculated charge imbalance is rather close to that evaluated using the Boltzmann equation, even if pair braeking is so strong as almost to destroy superconductivity. Finally we consider charge imbalance generated by the combined influence of a supercurrent and a temperature gradient. We give calculations for a dirty superconductor with scattering by phonons as the pair breaking mechanism, and the results give a reasonable account of the experimental data of Clarke, Fjordboge, and Lindelof. We carry out calculations for the case of impurity scattering along which are valid not only in the clean and dirty limits, but also for intermediate situations. These enable us to see how the large contribution to the charge imbalance found for energies close to the gap edge in the clean case is reduced with increasing impurity scattering

  15. Pseudopotential transformation of correlated-pair equations

    International Nuclear Information System (INIS)

    Szasz, L.; Brown, L.

    1975-01-01

    A pseudopotential transformation for correlated-pair equations is derived that yields solutions that are pseudowavefunctions, i.e., they do not have to be orthogonal to the core functions. The approximate solutions for the transformation will be much simpler to compute, but they do not involve a loss of accuracy

  16. Predictive labeling with dependency pairs using SAT

    NARCIS (Netherlands)

    Koprowski, A.; Middeldorp, A.; Pfenning, F.

    2007-01-01

    This paper combines predictive labeling with dependency pairs and reports on its implementation. Our starting point is the method of proving termination of rewrite systems using semantic labeling with infinite models in combination with lexicographic path orders. We replace semantic labeling with

  17. Multipole pair vibrations in superfluid 3He

    International Nuclear Information System (INIS)

    Baldo, M.; Giansiracusa, G.; Lombardo, U.; Pucci, R.; Petronio, G.

    1978-01-01

    Starting from a path integral formation of the 3 He superfluidity, the authors study the pair vibrations around the BCS solution. For both the BW and ABM states get a set of possible excitations. In particular it is shown that a new type of excitation is present for pure 1 = 2 spin singlet vibration. (Auth.)

  18. Pion-pair production by two photons

    International Nuclear Information System (INIS)

    Terazawa, Hidezumi.

    1994-07-01

    The cross section for pion-pair production by two photons is calculated approximately by using the low energy theorem previously derived from partially-conserved-axial-vector-current hypothesis and current algebra, and found to agree very well with the experimental data recently obtained by the Mark II, TPC/Two-Gamma and CLEO Collaborations. (author)

  19. Computing Hypercrossed Complex Pairings in Digital Images

    Directory of Open Access Journals (Sweden)

    Simge Öztunç

    2013-01-01

    Full Text Available We consider an additive group structure in digital images and introduce the commutator in digital images. Then we calculate the hypercrossed complex pairings which generates a normal subgroup in dimension 2 and in dimension 3 by using 8-adjacency and 26-adjacency.

  20. Phenomena, dynamics and instabilities of vortex pairs

    International Nuclear Information System (INIS)

    Williamson, C H K; Asselin, D J; Leweke, T; Harris, D M

    2014-01-01

    Our motivation for studying the dynamics of vortex pairs stems initially from an interest in the trailing wake vortices from aircraft and the dynamics of longitudinal vortices close to a vehicle surface. However, our motivation also comes from the fact that vortex–vortex interactions and vortex–wall interactions are fundamental to many turbulent flows. The intent of the paper is to present an overview of some of our recent work concerning the formation and structure of counter-rotating vortex pairs. We are interested in the long-wave and short-wave three-dimensional instabilities that evolve for an isolated vortex pair, but also we would like to know how vortex pairs interact with a wall, including both two-dimensional interactions, and also the influence of the surface on the three-dimensional instabilities. The emphasis of this presentation is on physical mechanisms by which vortices interact with each other and with surfaces, principally from an experimental approach, but also coupled with analytical studies. (paper)

  1. A Novel Approach for Collaborative Pair Programming

    Science.gov (United States)

    Goel, Sanjay; Kathuria, Vanshi

    2010-01-01

    The majority of an engineer's time in the software industry is spent working with other programmers. Agile methods of software development like eXtreme Programming strongly rely upon practices like daily meetings and pair programming. Hence, the need to learn the skill of working collaboratively is of primary importance for software developers.…

  2. Pair production of intermediate vector bosons

    International Nuclear Information System (INIS)

    Mikaelian, K.O.

    1979-01-01

    The production of intermediate vector boson pairs W + W - , Z 0 Z 0 , W +- Z 0 and W +- γ in pp and p anti p collisions is discussed. The motivation is to detect the self-interactions among the four intermediate vector bosons

  3. Pairing the Adult Learner and Boutique Wineries

    Science.gov (United States)

    Holyoke, Laura; Heath-Simpson, Delta

    2013-01-01

    This study explored connections between adult learners and their experiences in the context of small boutique wineries operating in the start-up phase of the organizational life cycle. The research objective was to gain insight regarding the pairing of adult learners with the entering of a specialty industry. Fourteen individuals from four…

  4. Plasma analog of particle-pair production

    International Nuclear Information System (INIS)

    Tsidulko, Yu.A.; Berk, H.L.

    1996-09-01

    It is shown that the plasma axial shear flow instability satisfies the Klein-Gordon equation. The plasma instability is then shown to be analogous to spontaneous particle-pair production when a potential energy is present that is greater than twice the particle rest mass energy. Stability criteria can be inferred based on field theoretical conservation laws

  5. Frustrated Lewis pairs: Design and reactivity

    Indian Academy of Sciences (India)

    for FLP systems and their unique reactivity are discussed here. Keywords. Lewis .... we will concentrate on the design principles of such. FLPs and the ... Designs of frustrated Lewis pairs ..... 64 and neutral titanium (III) complex [Cp2TiOC6.

  6. Environmentally benign working pairs for adsorption refrigeration

    International Nuclear Information System (INIS)

    Cui Qun; Tao Gang; Chen Haijun; Guo Xinyue; Yao Huqing

    2005-01-01

    This paper begins from adsorption working pairs: water and ethanol were selected as refrigerants; 13x molecular sieve, silica gel, activated carbon, adsorbent NA and NB, proposed by authors, were selected as adsorbents, and the performance of adsorption working pairs in adsorption refrigeration cycle was studied. The adsorption isotherms of adsorbents (NA and NB) were obtained by high-vacuum gravimetric method. Desorption properties of adsorbents were analyzed and compared by thermal analysis method. The performance of adsorption refrigeration was studied on simulation device of adsorption refrigeration cycle. After presentation of adsorption isotherms, the thermodynamic performance for their use in adsorption refrigeration system was calculated. The results show: (1) the maximum adsorption capacity of water on adsorbent NA reaches 0.7 kg/kg, and the maximum adsorption capacity of ethanol on adsorbent NB is 0.68 kg/kg, which is three times that of ethanol on activated carbon, (2) the refrigeration capacity of NA-water working pair is 922 kJ/kg, the refrigeration capacity of NB-ethanol is 2.4 times that of activated carbon-methanol, (3) as environmental friendly and no public hazard adsorption working pair, NA-H 2 O and NB-ethanol can substitute activated carbon-methanol in adsorption refrigeration system using low-grade heat source

  7. Fermion pair physics at LEP2

    International Nuclear Information System (INIS)

    Georgios, Anagnostou

    2004-01-01

    Combined measurements of the 4 LEP collaborations for the fermion pair processes e + e - →f anti f are presented. The results show no significant deviations when compared with the Standard Model predictions and are used to set limits on contact interactions, Z' gauge bosons and low scale gravity models with large extra dimensions. (orig.)

  8. Frustrated Lewis pairs-assisted tritium labeling

    Czech Academy of Sciences Publication Activity Database

    Marek, Aleš; Široká, Sabina; Elbert, Tomáš

    2016-01-01

    Roč. 14, č. 5 (2016), s. 219 ISSN 2336-7202. [Sjezd českých a slovenských chemických společností /68./. 04.09.2016-07.09.2016, Praha] Institutional support: RVO:61388963 Keywords : frustrated Lewis pairs * one-pot synthesis * tritium -labeling Subject RIV: CC - Organic Chemistry

  9. Angular assymetries in a shielded pair line

    International Nuclear Information System (INIS)

    Fanchiotti, H.; Garcia Canal, C.A.; Vucetich, H.

    1979-01-01

    The capacitance matrix and surface charge density distribution of an unbalanced pair line with both longitudinal and balanced excitations is presented. In particular the case in which the axes of the inner wires are not restricted to lie on a line through the axis of the shield is discussed

  10. Binaries and triples among asteroid pairs

    Science.gov (United States)

    Pravec, Petr; Scheirich, Peter; Kušnirák, Peter; Hornoch, Kamil; Galád, Adrián

    2015-08-01

    Despite major achievements obtained during the past two decades, our knowledge of the population and properties of small binary and multiple asteroid systems is still far from advanced. There is a numerous indirect evidence for that most small asteroid systems were formed by rotational fission of cohesionless parent asteroids that were spun up to the critical frequency presumably by YORP, but details of the process are lacking. Furthermore, as we proceed with observations of more and more binary and paired asteroids, we reveal new facts that substantially refine and sometimes change our understanding of the asteroid systems. One significant new finding we have recently obtained is that primaries of many asteroid pairs are actually binary or triple systems. The first such case found is (3749) Balam (Vokrouhlický, ApJL 706, L37, 2009). We have found 9 more binary systems among asteroid pairs within our ongoing NEOSource photometric project since October 2012. They are (6369) 1983 UC, (8306) Shoko, (9783) Tensho-kan, (10123) Fideoja, (21436) Chaoyichi, (43008) 1999 UD31, (44620) 1999 RS43, (46829) 1998 OS14 and (80218) 1999 VO123. We will review their characteristics. These paired binaries as we call them are mostly similar to binaries in the general ("background") population (of unpaired asteroids), but there are a few trends. The paired binaries tend to have larger secondaries with D_2/D_1 = 0.3 to 0.5 and they also tend to be wider systems with 8 of the 10 having orbital periods between 30 and 81 hours, than average among binaries in the general population. There may be also a larger fraction of triples; (3749) Balam is a confirmed triple, having a larger close and a smaller distant satellite, and (8306) Shoko and (10123) Fideoja are suspect triples as they show additional rotational lightcurve components with periods of 61 and 38.8 h that differ from the orbital period of 36.2 and 56.5 h, respectively. The unbound secondaries tend to be of the same size or

  11. Database proton NMR chemical shifts for RNA signal assignment and validation

    Energy Technology Data Exchange (ETDEWEB)

    Barton, Shawn; Heng Xiao [University of Maryland, Baltimore County, Howard Hughes Medical Institute (United States); Johnson, Bruce A., E-mail: bruce@onemoonscientific.com [University of Maryland, Baltimore County, Department of Chemistry and Biochemistry (United States); Summers, Michael F., E-mail: summers@hhmi.umbc.edu [University of Maryland, Baltimore County, Howard Hughes Medical Institute (United States)

    2013-01-15

    The Biological Magnetic Resonance Data Bank contains NMR chemical shift depositions for 132 RNAs and RNA-containing complexes. We have analyzed the {sup 1}H NMR chemical shifts reported for non-exchangeable protons of residues that reside within A-form helical regions of these RNAs. The analysis focused on the central base pair within a stretch of three adjacent base pairs (BP triplets), and included both Watson-Crick (WC; G:C, A:U) and G:U wobble pairs. Chemical shift values were included for all 4{sup 3} possible WC-BP triplets, as well as 137 additional triplets that contain one or more G:U wobbles. Sequence-dependent chemical shift correlations were identified, including correlations involving terminating base pairs within the triplets and canonical and non-canonical structures adjacent to the BP triplets (i.e. bulges, loops, WC and non-WC BPs), despite the fact that the NMR data were obtained under different conditions of pH, buffer, ionic strength, and temperature. A computer program (RNAShifts) was developed that enables convenient comparison of RNA {sup 1}H NMR assignments with database predictions, which should facilitate future signal assignment/validation efforts and enable rapid identification of non-canonical RNA structures and RNA-ligand/protein interaction sites.

  12. Schwinger pair creation of Kaluza-Klein particles: Pair creation without tunneling

    International Nuclear Information System (INIS)

    Friedmann, Tamar; Verlinde, Herman

    2005-01-01

    We study Schwinger pair creation of charged Kaluza-Klein (KK) particles from a static KK electric field. We find that the gravitational backreaction of the electric field on the geometry--which is incorporated via the electric KK-Melvin solution--prevents the electrostatic potential from overcoming the rest mass of the KK particles, thus impeding the tunneling mechanism which is often thought of as responsible for the pair creation. However, we find that pair creation still occurs with a finite rate formally similar to the classic Schwinger result, but via an apparently different mechanism, involving a combination of the Unruh effect and vacuum polarization due to the E-field

  13. Neutron pair and proton pair transfer reactions between identical cores in the sulfur region

    International Nuclear Information System (INIS)

    Mermaz, M.C.

    1995-12-01

    Optical model and exact finite range distorted-wave Born approximation analyses were performed on neutron pair exchange between identical cores for 32 S and 34 S nuclei and on proton pair exchange between identical cores for 30 Si and 32 S. The extracted spectroscopic factors were compared with theoretical ones deduced from Hartree-Fock calculations on these pair of nuclei. The enhancement of the experimental cross sections with respect to the theoretical ones strongly suggests evidence for a nuclear Josephson effect. (author). 15 refs., 5 figs., 3 tabs

  14. Model for pairing phase transition in atomic nuclei

    International Nuclear Information System (INIS)

    Schiller, A.; Guttormsen, M.; Hjorth-Jensen, M.; Rekstad, J.; Siem, S.

    2002-01-01

    A model is developed which allows the investigation and classification of the pairing phase transition in atomic nuclei. The regions of the parameter space are discussed for which a pairing phase transition can be observed. The model parameters include number of particles, attenuation of pairing correlations with increasing seniority, single-particle level spacing, and pairing gap parameter

  15. Paired peer learning through engineering education outreach

    Science.gov (United States)

    Fogg-Rogers, Laura; Lewis, Fay; Edmonds, Juliet

    2017-01-01

    Undergraduate education incorporating active learning and vicarious experience through education outreach presents a critical opportunity to influence future engineering teaching and practice capabilities. Engineering education outreach activities have been shown to have multiple benefits; increasing interest and engagement with science and engineering for school children, providing teachers with expert contributions to engineering subject knowledge, and developing professional generic skills for engineers such as communication and teamwork. This pilot intervention paired 10 pre-service teachers and 11 student engineers to enact engineering outreach in primary schools, reaching 269 children. A longitudinal mixed methods design was employed to measure change in attitudes and Education Outreach Self-Efficacy in student engineers; alongside attitudes, Teaching Engineering Self-Efficacy and Engineering Subject Knowledge Confidence in pre-service teachers. Highly significant improvements were noted in the pre-service teachers' confidence and self-efficacy, while both the teachers and engineers qualitatively described benefits arising from the paired peer mentor model.

  16. Top quark pair production beyond NNLO

    Energy Technology Data Exchange (ETDEWEB)

    Muselli, Claudio [TIF Lab, Dipartimento di Fisica, Università di Milano, and INFN - Sezione di Milano,Via Celoria 16, I-20133 Milano (Italy); Bonvini, Marco [Rudolf Peierls Centre for Theoretical Physics, University of Oxford,1 Keble Road, OX1 3NP, Oxford (United Kingdom); Forte, Stefano [TIF Lab, Dipartimento di Fisica, Università di Milano, and INFN - Sezione di Milano,Via Celoria 16, I-20133 Milano (Italy); Marzani, Simone [Center for Theoretical Physics, Massachusetts Institute of Technology,77 Massachusetts Avenue, Cambridge, MA 02139 (United States); Ridolfi, Giovanni [Dipartimento di Fisica, Università di Genova and INFN - Sezione di Genova,Via Dodecaneso 33, I-16146 Genova (Italy)

    2015-08-17

    We construct an approximate expression for the total cross section for the production of a heavy quark-antiquark pair in hadronic collisions at next-to-next-to-next-to-leading order (N{sup 3}LO) in α{sub s}. We use a technique which exploits the analyticity of the Mellin space cross section, and the information on its singularity structure coming from large N (soft gluon, Sudakov) and small N (high energy, BFKL) all order resummations, previously introduced and used in the case of Higgs production. We validate our method by comparing to available exact results up to NNLO. We find that N{sup 3}LO corrections increase the predicted top pair cross section at the LHC by about 4% over the NNLO.

  17. Top quark pair production beyond NNLO

    International Nuclear Information System (INIS)

    Muselli, Claudio; Bonvini, Marco; Forte, Stefano; Marzani, Simone; Ridolfi, Giovanni

    2015-01-01

    We construct an approximate expression for the total cross section for the production of a heavy quark-antiquark pair in hadronic collisions at next-to-next-to-next-to-leading order (N 3 LO) in α s . We use a technique which exploits the analyticity of the Mellin space cross section, and the information on its singularity structure coming from large N (soft gluon, Sudakov) and small N (high energy, BFKL) all order resummations, previously introduced and used in the case of Higgs production. We validate our method by comparing to available exact results up to NNLO. We find that N 3 LO corrections increase the predicted top pair cross section at the LHC by about 4% over the NNLO.

  18. Photoproduction of Drell-Yan lepton pairs

    International Nuclear Information System (INIS)

    Jones, L.M.; Sullivan, J.D.; Willen, D.E.; Wyld, H.W.

    1979-01-01

    We investigate the Drell-Yan reaction γp → (μ + μ - ) X with an eye to experimental determination of the photon structure functions. Contributions to the process from both the nonhadronic anomaly and the vector-dominance piece are estimated: we find that the cross section from the anomaly dominates the vector-dominance contribution at large Q 2 . The background from Bethe-Heitler pairs is also calculated; it is somewhat suppressed by going to y=0, and further suppressed relative to the Drell-Yan contribution for fixed Q 2 by looking at high center-of-mass energies and at small Q/sub perpendicular/ for the pair. Overall we find that the absolute Drell-Yan cross sections in the regions of interest are very small; experimental study of the process will be difficult

  19. A search for resonant Z pair production

    Energy Technology Data Exchange (ETDEWEB)

    Boveia, Antonio [Univ. of California, Santa Barbara, CA (United States)

    2008-12-01

    I describe a search for anomalous production of Z pairs through a new massive resonance X in 2.5-2.9 fb-1 of p$\\bar{p}$ collisions at √s = 1.96 TeV using the CDFII Detector at the Fermilab Tevatron. I reconstruct Z pairs through their decays to electrons, muons, and quarks. To achieve perhaps the most efficient lepton reconstruction ever used at CDF, I apply a thorough understanding of the detector and new reconstruction software heavily revised for this purpose. In particular, I have designed and employ new general-purpose algorithms for tracking at large η in order to increase muon acceptance. Upon analyzing the unblinded signal samples, I observe no X → ZZ candidates and set upper limits on the production cross section using a Kaluza-Klein graviton-like acceptance.

  20. Magnetically-enhanced open string pair production

    Science.gov (United States)

    Lu, J. X.

    2017-12-01

    We consider the stringy interaction between two parallel stacks of D3 branes placed at a separation. Each stack of D3 branes in a similar fashion carry an electric flux and a magnetic flux with the two sharing no common field strength index. The interaction amplitude has an imaginary part, giving rise to the Schwinger-like pair production of open strings. We find a significantly enhanced rate of this production when the two electric fluxes are almost identical and the brane separation is on the order of string scale. This enhancement will be largest if the two magnetic fluxes are opposite in direction. This novel enhancement results from the interplay of the non-perturbative Schwinger-type pair production due to the electric flux and the stringy tachyon due to the magnetic flux, and may have realistic physical applications.

  1. Radiation- and pair-loaded shocks

    Science.gov (United States)

    Lyutikov, Maxim

    2018-06-01

    We consider the structure of mildly relativistic shocks in dense media, taking into account the radiation and pair loading, and diffusive radiation energy transfer within the flow. For increasing shock velocity (increasing post-shock temperature), the first important effect is the efficient energy redistribution by radiation within the shock that leads to the appearance of an isothermal jump, whereby the flow reaches the final state through a discontinuous isothermal transition. The isothermal jump, on scales much smaller than the photon diffusion length, consists of a weak shock and a quick relaxation to the isothermal conditions. Highly radiation-dominated shocks do not form isothermal jump. Pair production can mildly increase the overall shock compression ratio to ≈10 (4 for matter-dominated shocks and 7 of the radiation-dominated shocks).

  2. Dynamics and Instabilities of Vortex Pairs

    Science.gov (United States)

    Leweke, Thomas; Le Dizès, Stéphane; Williamson, Charles H. K.

    2016-01-01

    This article reviews the characteristics and behavior of counter-rotating and corotating vortex pairs, which are seemingly simple flow configurations yet immensely rich in phenomena. Since the reviews in this journal by Widnall (1975) and Spalart (1998) , who studied the fundamental structure and dynamics of vortices and airplane trailing vortices, respectively, there have been many analytical, computational, and experimental studies of vortex pair flows. We discuss two-dimensional dynamics, including the merging of same-sign vortices and the interaction with the mutually induced strain, as well as three-dimensional displacement and core instabilities resulting from this interaction. Flows subject to combined instabilities are also considered, in particular the impingement of opposite-sign vortices on a ground plane. We emphasize the physical mechanisms responsible for the flow phenomena and clearly present the key results that are useful to the reader for predicting the dynamics and instabilities of parallel vortices.

  3. Space-Efficient Re-Pair Compression

    DEFF Research Database (Denmark)

    Bille, Philip; Gørtz, Inge Li; Prezza, Nicola

    2017-01-01

    Re-Pair [5] is an effective grammar-based compression scheme achieving strong compression rates in practice. Let n, σ, and d be the text length, alphabet size, and dictionary size of the final grammar, respectively. In their original paper, the authors show how to compute the Re-Pair grammar...... in expected linear time and 5n + 4σ2 + 4d + √n words of working space on top of the text. In this work, we propose two algorithms improving on the space of their original solution. Our model assumes a memory word of [log2 n] bits and a re-writable input text composed by n such words. Our first algorithm runs...

  4. Glass scintillator pair for compensation neutron logging

    International Nuclear Information System (INIS)

    Ji Changsong; Li Xuezhi; Yiu Guangduo

    1985-01-01

    Glass scintillator pair types ST 1604 and ST 1605 for compensation of neutron logging is developed. The neutron sensitive material used is multistick lithium glass scintillators 3 and 4 mm in diameter respectively. Thermoneutron detection efficiencies are 50-60% and 100% respectively. The detection efficiency for 60 Co γ ray is lower than 0.3%. The type ST 1604 and ST 1605 may also be used as high sensitive neutron detectors in an intensive γ ray field

  5. On $ \\phi $ -amicable pairs (with appendix)

    NARCIS (Netherlands)

    G.L. Cohen; H.J.J. te Riele (Herman)

    1995-01-01

    textabstractLet $\\phi(n)$ denote Euler's totient function, i.e., the number of positive integers~$pairs of positive integers $(a_0,a_1)$ with $a_0\\le a_1$ such that $\\phi(a_0)=\\phi(a_1)=(a_0+a_1)/k$ for some integer $k\\ge1$. We call these numbers $\\phi$--{\\it

  6. Signature scheme based on bilinear pairs

    Science.gov (United States)

    Tong, Rui Y.; Geng, Yong J.

    2013-03-01

    An identity-based signature scheme is proposed by using bilinear pairs technology. The scheme uses user's identity information as public key such as email address, IP address, telephone number so that it erases the cost of forming and managing public key infrastructure and avoids the problem of user private generating center generating forgery signature by using CL-PKC framework to generate user's private key.

  7. Hadronic production of lepton pairs (experimental)

    International Nuclear Information System (INIS)

    Boucrot, J.

    1980-12-01

    Hadonic production of lepton pairs has become a good testground of Q.C.D. The large effects predicted in cross sections and in Psub(T) distributions are seen and may be one of the good indirect proofs of the existence of gluons. Detailed experimental results are available, and clearly it is necessary that higher order Q.C.D. corrections should be estimated

  8. W+- pairs and neutral currents at ISABELLE

    International Nuclear Information System (INIS)

    Mikaelian, K.O.

    1975-01-01

    A report is presented on two different types of processes which may form part of the weak interactions program. The first is the production of pairs of charged weak bosons in the process pp → W + W - X; the second involves searching for neutral current effects in the rate for ordinary lepton production, without measuring any charge asymmetry or helicities using the reaction pp → l + l - X

  9. Narrowband polarization entangled telecom photon pair source

    OpenAIRE

    Kaiser , Florian; Issautier , Amandine; Alibart , Olivier; Martin , Anthony; Tanzilli , Sébastien

    2011-01-01

    Contributed Talk; International audience; During the last decade, quantum entanglement has paved the way out to of the lab modern applications such as quantum computation and communication. Today, small scale quantum networks exist already, but they are limited to a few 100 km distance, due to intrinsic fiber transmission losses and non perfect detectors. These networks are typically established using photon pair sources based on spontaneous parametric down conversion (SPDC). Widely used enta...

  10. Determination of the pairing-strength constants in the isovector plus isoscalar pairing case

    Science.gov (United States)

    Mokhtari, D.; Fellah, M.; Allal, N. H.

    2016-05-01

    A method for the determination of the pairing-strength constants, in the neutron-proton (n-p) isovector plus isoscalar pairing case, is proposed in the framework of the BCS theory. It is based on the fitting of these constants to reproduce the experimentally known pairing gap parameters as well as the root-mean-squared (r.m.s) charge radii values. The method is applied to some proton-rich even-even nuclei. The single-particle energies used are those of a deformed Woods-Saxon mean field. It is shown that the obtained value of the ratio GnpT=0/G npT=1 is of the same order as the ones, arbitrary chosen, of some previous works. The effect of the inclusion of the isoscalar n-p pairing in the r.m.s matter radii is then numerically studied for the same nuclei.

  11. Neutrino signal from pair-instability supernovae

    Science.gov (United States)

    Wright, Warren P.; Gilmer, Matthew S.; Fröhlich, Carla; Kneller, James P.

    2017-11-01

    A very massive star with a carbon-oxygen core in the range of 64M ⊙Earth from two, one-dimensional pair-instability supernova simulations which bracket the mass range of stars which explode by this mechanism taking into account the full time and energy dependence of the neutrino emission and the flavor evolution through the outer layers of the star. We calculate the neutrino signals in five different detectors chosen to represent present or near future designs. We find the more massive progenitors explode as pair-instability supernova which can easily be detected in multiple different neutrino detectors at the "standard" supernova distance of 10 kpc producing several events in DUNE, JUNO, and Super-Kamiokande, while the lightest progenitors produce only a handful of events (if any) in the same detectors. The proposed Hyper-Kamiokande detector would detect neutrinos from a large pair-instability supernova as far as ˜50 kpc allowing it to reach the Megallanic Clouds and the several very high mass stars known to exist there.

  12. Exclusive production of W pairs in CMS

    Directory of Open Access Journals (Sweden)

    Silveira Da

    2014-04-01

    Full Text Available We report the results on the search for exclusive production of W pairs in the LHC with data collected by the Compact Muon Solenoid detector in proton-proton collisions at √s = 7 TeV. The analysis comprises the two-photon production of a W pairs, pp → pW+ W− p → p νe± νµ∓ p. Two events are observed in data for pT(ℓ > 4 GeV, |η(ℓ| 20 GeV, in agreement with the standard model prediction of 2.2 ± 0.4 signal events with 0.84 ± 0.15 background events. Moreover, a study of the tail of the lepton pair transverse momentum distribution is performed to search for an evidence of anomalous quartic gauge couplings in the γγ → W+ W− vertex. As no events are observed in data, it results in a model-independent upper limits for the anomalous W quartic gauge couplings aW0,C/Λ2, which are of the order of 10−4.

  13. Galactic Pairs in the Early Universe

    Science.gov (United States)

    Kohler, Susanna

    2018-02-01

    In the spirit of Valentines Day, today well be exploring apparent pairs of galaxies in the distant, early universe. How can we tell whether these duos are actually paired galaxies, as opposed to disguised singles?Real Pair, or Trick of the Light?In the schematic timeline of the universe, the epoch of reionization is when the first galaxies and quasars began to form and evolve. [NASA]The statistics of merging galaxies throughout the universe reveal not only direct information about how galaxies interact, but also cosmological information about the structure of the universe. While weve observed many merging galaxy pairs at low redshift, however, its much more challenging to identify these duos in the early universe.A merging pair of galaxies at high redshift appears to us as a pair of unresolved blobs that lie close to each other in the sky. But spotting such a set of objects doesnt necessarily mean were looking at a merger! There are three possible scenarios to explain an observed apparent duo:Its a pair of galaxies in a stage of merger.Its a projection coincidence; the two galaxies arent truly near each other.Its a single galaxy being gravitationally lensed by a foreground object. This strong lensing produces the appearance of multiple galaxies.Hubble photometry of one of the three galaxy groups identified at z 8, with the galaxies in the image labeled with their corresponding approximate photometric redshifts. [Adapted from Chaikin et al. 2018]Hunting for Distant DuosIn a recent study led by Evgenii Chaikin (Peter the Great St. Petersburg Polytechnic University, Russia), a team of scientists has explored the Hubble Ultra Deep Field in search ofhigh-redshift galaxies merging during the epoch of reionization, when the first galaxies formed and evolved.Using an approach called the dropout technique, which leverages the visibility of the galaxies in different wavelength filters, Chaikin and collaborators obtain approximate redshifts for an initial sample of 7

  14. Pair formation by a deep potential well

    International Nuclear Information System (INIS)

    Nikishov, A.I.

    1987-01-01

    We obtain solutions of the Dirac and Klein-Gordon equations for a symmetric one-dimensional potential well with a flat bottom, and arbitrary depth, width, and field strength at the walls. Quasistationary solutions are found describing pair creation by the well, and the inverse process. It is shown that when the probability of pair creation by the well is small, it can be expressed in terms of the probability of pair creation at one of the walls and the oscillation frequency of the particle in the well. Among the states of the lower continuum, there are positron resonance scattering states for supercritical well depths. The energies of these states are close to the real part of the quasistationary energy level (the Zel'dovich effect). The qualitative dependence of the transmission coefficient of the positron through the well on its energy and the well width supports the idea that the solution of the so-called one-particle Dirac equation describes a many-particle system with charge 0 or 1

  15. Pair creation by dynamic field configurations

    International Nuclear Information System (INIS)

    Aoyama, H.

    1982-01-01

    This thesis deals with the dynamics of the classical configuration of a quantum field unstable due to pair creation. The effective action method is developed first to treat such problems for a simple two-field model. Physical quantities such as pair creation probabilities are related to a complex function called the effective configuration, which is defined to minimize the effective action. Unitarity of the S-matrix is verified at the lowest order of the weak-field approximation. At the same order, the real valued vacuum expectation value of the quantum field, named the real configuration, is constructed in terms of the effective configuration. An integro-differential equation for the real configuration is given and is used to show that the real configuration is causal, while the effective configuration is not. Two practical applications of the effective action method are discussed. The first deals with pair creation in an anisotropic universe, and the real geometry is given in terms of the effective geometry in the samll anisotropy limit. The second deals with expanding vacuum bubbles. Corresponding to three possible situations, three kinds of field equations of each of the effective configuration and the real configuration are obtained. The behavior of the bubble is also studied by a semi-classical method, and one of the three situations is suggested to be plausible

  16. Quantitative evaluation of pairs and RS steganalysis

    Science.gov (United States)

    Ker, Andrew D.

    2004-06-01

    We give initial results from a new project which performs statistically accurate evaluation of the reliability of image steganalysis algorithms. The focus here is on the Pairs and RS methods, for detection of simple LSB steganography in grayscale bitmaps, due to Fridrich et al. Using libraries totalling around 30,000 images we have measured the performance of these methods and suggest changes which lead to significant improvements. Particular results from the project presented here include notes on the distribution of the RS statistic, the relative merits of different "masks" used in the RS algorithm, the effect on reliability when previously compressed cover images are used, and the effect of repeating steganalysis on the transposed image. We also discuss improvements to the Pairs algorithm, restricting it to spatially close pairs of pixels, which leads to a substantial performance improvement, even to the extent of surpassing the RS statistic which was previously thought superior for grayscale images. We also describe some of the questions for a general methodology of evaluation of steganalysis, and potential pitfalls caused by the differences between uncompressed, compressed, and resampled cover images.

  17. Pair-correlations in swimmer suspensions

    Science.gov (United States)

    Nambiar, Sankalp; Subramanian, Ganesh

    2017-11-01

    Suspensions of rear-actuated swimming microorganisms, such as E.coli, exhibit several interesting phenomena including spontaneous pattern formation above a critical concentration, novel rheological properties, shear-induced concentration banding etc. Explanations based on mean-field theory are only qualitative, since interactions between swimmers are important for typical experimental concentrations. We analytically characterize the hydrodynamic pair-interactions in a quiescent suspension of slender straight swimmers. The pair-correlation, calculated at leading order by integrating the swimmer velocity disturbances along straight trajectories, decays as 1/r2 for r >> L (L being the swimmer size). This allows us to characterize both polar and nematic correlations in an interacting swimmer suspension. In the absence of correlations, the velocity covariance asymptotes from a constant for r > L, the latter being characteristic of a suspension of non-interacting point force-dipoles. On including correlations, the slow decay of the pair-orientation correlation leads to an additional contribution to the velocity covariance that diverges logarithmically with system size.

  18. Estimating Eulerian spectra from pairs of drifters

    Science.gov (United States)

    LaCasce, Joe

    2017-04-01

    GPS-tracked surface drifters offer the possibility of sampling energetic variations at the ocean surface on scales of only 10s of meters, much less than that resolved by satellite. Here we investigate whether velocity differences between pairs of drifters can be used to estimate kinetic energy spectra. Theoretical relations between the spectrum and the second-order longitudinal structure function for 2D non-divergent flow are derived. The structure function is a natural statistic for particle pairs and is easily calculated. However it integrates contributions across wavenumber, and this tends to obscure the spectral dependencies when turbulent inertial ranges are of finite extent. Nevertheless, the transform from spectrum to structure function is robust, as illustrated with Eulerian data collected from aircraft. The inverse transform, from structure function to spectrum, is much less robust, yielding poor results in particular at large wavenumbers. This occurs because the transform involves a filter function which magnifies contributions from large pair separations, which tend to be noisy. Fitting the structure function to a polynomial improves the spectral estimate, but not sufficiently to distinguish correct inertial range dependencies. Thus with Lagrangian data, it is appears preferable to focus on structure functions, despite their shortcomings.

  19. Magnetic Pair Creation Transparency in Pulsars

    Science.gov (United States)

    Story, Sarah; Baring, M. G.

    2013-04-01

    The Fermi gamma-ray pulsar database now exceeds 115 sources and has defined an important part of Fermi's science legacy, providing rich information for the interpretation of young energetic pulsars and old millisecond pulsars. Among the well established population characteristics is the common occurrence of exponential turnovers in the 1-10 GeV range. These turnovers are too gradual to arise from magnetic pair creation in the strong magnetic fields of pulsar inner magnetospheres, so their energy can be used to provide lower bounds to the typical altitude of GeV band emission. We explore such constraints due to single-photon pair creation transparency below the turnover energy. We adopt a semi-analytic approach, spanning both domains when general relativistic influences are important and locales where flat spacetime photon propagation is modified by rotational aberration effects. Our work clearly demonstrates that including near-threshold physics in the pair creation rate is essential to deriving accurate attenuation lengths. The altitude bounds, typically in the range of 2-6 neutron star radii, provide key information on the emission altitude in radio quiet pulsars that do not possess double-peaked pulse profiles. For the Crab pulsar, which emits pulsed radiation up to energies of 120 GeV, we obtain a lower bound of around 15 neutron star radii to its emission altitude.

  20. Paired and interacting galaxies: Conference summary

    International Nuclear Information System (INIS)

    Norman, C.A.

    1990-01-01

    The author gives a summary of the conference proceedings. The conference began with the presentation of the basic data sets on pairs, groups, and interacting galaxies with the latter being further discussed with respect to both global properties and properties of the galactic nuclei. Then followed the theory, modelling and interpretation using analytic techniques, simulations and general modelling for spirals and ellipticals, starbursts and active galactic nuclei. Before the conference the author wrote down the three questions concerning pairs, groups and interacting galaxies that he hoped would be answered at the meeting: (1) How do they form, including the role of initial conditions, the importance of subclustering, the evolution of groups to compact groups, and the fate of compact groups; (2) How do they evolve, including issues such as relevant timescales, the role of halos and the problem of overmerging, the triggering and enhancement of star formation and activity in the galactic nuclei, and the relative importance of dwarf versus giant encounters; and (3) Are they important, including the frequency of pairs and interactions, whether merging and interactions are very important aspects of the life of a normal galaxy at formation, during its evolution, in forming bars, shells, rings, bulges, etc., and in the formation and evolution of active galaxies? Where possible he focuses on these three central issues in the summary

  1. Orthogonal expansions related to compact Gelfand pairs

    DEFF Research Database (Denmark)

    Berg, Christian; Peron, Ana P.; Porcu, Emilio

    2017-01-01

    . The functions of this class are the functions having a uniformly convergent expansion ∑ϕεZB(ϕ)(u)ϕ(x) for xεG,uεL, where the sum is over the space Z of positive definite spherical functions ϕ:G→C for the Gelfand pair, and (B(ϕ))ϕεZ is a family of continuous positive definite functions on L such that ∑ϕε......For a locally compact group G, let P(G) denote the set of continuous positive definite functions f:G→C. Given a compact Gelfand pair (G,K) and a locally compact group L, we characterize the class PK#(G,L) of functions fεP(G×L) which are bi-invariant in the G-variable with respect to K......(d)) and (U(q),U(q-1)) as well as for the product of these Gelfand pairs.The result generalizes recent theorems of Berg-Porcu (2016) and Guella-Menegatto (2016)....

  2. Strong pairing approximation in comparison with the exact solutions to the pairing Hamiltonian

    Directory of Open Access Journals (Sweden)

    Lunyov A.V.

    2016-01-01

    Full Text Available Results of the Strong Pairing Approximation (SPA as a method with the exact particle number conservation are compared with those of the quasiparticle method (QM. It is shown that SPA comes to the same equations as QM for the gap parameter, chemical potential and one- and two-quasiparticle states. Calculations are performed for 14864Gd84 as an example, and compared with the exact solutions to the pairing Hamiltonian.

  3. Detecting nonlocal Cooper pair entanglement by optical Bell inequality violation

    OpenAIRE

    Nigg, Simon E.; Tiwari, Rakesh P.; Walter, Stefan; Schmidt, Thomas L.

    2014-01-01

    Based on the Bardeen Cooper Schrieffer (BCS) theory of superconductivity, the coherent splitting of Cooper pairs from a superconductor to two spatially separated quantum dots has been predicted to generate nonlocal pairs of entangled electrons. In order to test this hypothesis, we propose a scheme to transfer the spin state of a split Cooper pair onto the polarization state of a pair of optical photons. We show that the produced photon pairs can be used to violate a Bell inequality, unambiguo...

  4. The paired-domination and the upper paired-domination numbers of graphs

    Directory of Open Access Journals (Sweden)

    Włodzimierz Ulatowski

    2015-01-01

    Full Text Available In this paper we continue the study of paired-domination in graphs. A paired-dominating set, abbreviated PDS, of a graph \\(G\\ with no isolated vertex is a dominating set of vertices whose induced subgraph has a perfect matching. The paired-domination number of \\(G\\, denoted by \\(\\gamma_{p}(G\\, is the minimum cardinality of a PDS of \\(G\\. The upper paired-domination number of \\(G\\, denoted by \\(\\Gamma_{p}(G\\, is the maximum cardinality of a minimal PDS of \\(G\\. Let \\(G\\ be a connected graph of order \\(n\\geq 3\\. Haynes and Slater in [Paired-domination in graphs, Networks 32 (1998, 199-206], showed that \\(\\gamma_{p}(G\\leq n-1\\ and they determine the extremal graphs \\(G\\ achieving this bound. In this paper we obtain analogous results for \\(\\Gamma_{p}(G\\. Dorbec, Henning and McCoy in [Upper total domination versus upper paired-domination, Questiones Mathematicae 30 (2007, 1-12] determine \\(\\Gamma_{p}(P_n\\, instead in this paper we determine \\(\\Gamma_{p}(C_n\\. Moreover, we describe some families of graphs \\(G\\ for which the equality \\(\\gamma_{p}(G=\\Gamma_{p}(G\\ holds.

  5. Monovalent cation induced structural transitions in telomeric DNAs: G-DNA folding intermediates

    International Nuclear Information System (INIS)

    Hardin, C.C.; Watson, T.; Henderson, E.; Prosser, J.K.

    1991-01-01

    Telomeric DNA consists of G- and C-rich strands that are always polarized such that the G-rich strand extends past the 3' end of the duplex to form a 12-16-base overhang. These overhanging strands can self-associate in vitro to form intramolecular structures that have several unusual physical properties and at least one common feature, the presence of non-Watson-Crick G·G base pairs. The term G-DNA was coined for this class of structures. On the basis of gel electrophoresis, imino proton NMR, and circular dichroism (CD) results, the authors find that changing the counterions from sodium to potassium specifically induces conformational transitions in the G-rich telomeric DNA from Tetrahymena, d(T 2 G 4 ) 4 (TET4), which results in a change from the intramolecular species to an apparent multistranded structure, accompanied by an increase in the melting temperature of the base pairs of >25 degree, as monitored by loss of the imino proton NMR signals. They infer that the multistranded structure is a quadruplex. The results indicate that specific differences in ionic interactions can result in a switch in telomeric DNAs between intramolecular hairpin-like or quadruplex-containing species and intermolecular quadruplex structures, all of which involve G·G base pairing interaction. They propose a model in which duplex or hairpin forms of G-DNA are folding intermediates in the formation of either 1-, 2-, or 4-stranded quadruplex structures

  6. Mechanism of error-free DNA synthesis across N1-methyl-deoxyadenosine by human DNA polymerase-ι

    Energy Technology Data Exchange (ETDEWEB)

    Jain, Rinku; Choudhury, Jayati Roy; Buku, Angeliki; Johnson, Robert E.; Prakash, Louise; Prakash, Satya; Aggarwal, Aneel K.

    2017-03-08

    N1-methyl-deoxyadenosine (1-MeA) is formed by methylation of deoxyadenosine at the N1 atom. 1-MeA presents a block to replicative DNA polymerases due to its inability to participate in Watson-Crick (W-C) base pairing. Here we determine how human DNA polymerase-ι (Polι) promotes error-free replication across 1-MeA. Steady state kinetic analyses indicate that Polι is ~100 fold more efficient in incorporating the correct nucleotide T versus the incorrect nucleotide C opposite 1-MeA. To understand the basis of this selectivity, we determined ternary structures of Polι bound to template 1-MeA and incoming dTTP or dCTP. In both structures, template 1-MeA rotates to the syn conformation but pairs differently with dTTP versus dCTP. Thus, whereas dTTP partakes in stable Hoogsteen base pairing with 1-MeA, dCTP fails to gain a “foothold” and is largely disordered. Together, our kinetic and structural studies show how Polι maintains discrimination between correct and incorrect incoming nucleotide opposite 1-MeA in preserving genome integrity.

  7. Prediction of the secondary structure of the mitochondrial tRNASer (UCN) of Lutzomyia hartmanni (Diptera: Psychodidae)

    International Nuclear Information System (INIS)

    Perez Doria, Alveiro; Bejarano, Eduar E

    2011-01-01

    Lutzomyia (Helcocyrtomyia) hartmanni is a sand fly that has been implicated in the transmission of Leishmania (Viannia) colombiensis, an etiologic agent of cutaneous Leishmaniasis in Colombia. The objective of this work was to explore the potential usefulness of the mitochondrial serine transfer RNA (UCN) (tRNASer) in the taxonomic determination of L. hartmanni. Mitochondrial DNA was extracted, amplified and sequenced from entomological material collected in Envigado, Antioquia, Colombia. The tRNASer gene length was 68 nucleotide pairs, with an average adenine-thymine content of 80.9%. The studied tRNASer differs from other sand fly tRNASer known to date, on the basis of its primary and secondary structure. The observed number of intrachain base pairing was 7 in the acceptor arm, 3 in the dihydrouridine (DHU) arm, 5 in the anticodon arm, and 5 in the ribothymidine-pseudouridine-cytosine (TC) arm. The size of the DHU, anticodon, variable and TC loops was estimated to be 5, 7, 4, and 8 nucleotides, respectively. The notorious absence of non-Watson-Crick base pairs in the four arms of the tRNASer distinguishes that of L. hartmanni from others Lutzomyia spp.

  8. Top quark pair production at the LHC

    Energy Technology Data Exchange (ETDEWEB)

    Baernreuther, Peter

    2012-06-28

    One of the most interesting and manifold processes in the Standard Model of elementary particle physics is the top quark pair production. It enabled the discovery of the top quark at the Tevatron in 1995 and the determination of many of its properties. By means of a precise measurement and calculation of the cross section of top quark pair production it is possible to extract the top quark mass. Improvements in the gluon parton distribution functions (important for the Higgs boson production) or improvements in the prediction of the Higgs mass are also closely linked with the top quark pair production. Furthermore, the production process plays an important role in the discovery of new physics. On the one hand the top quark pair decays form the largest part of the background in many BSM models, on the other hand BSM physics can be detected directly in the decay process by investigating the charge symmetry or the invariant mass spectrum. At the LHC it will be possible for the first time to produce a large amount of top quarks; thereby the statistical errors of the observables will be strongly reduced. The enormous increase in the production rate has two reasons. On the one hand, the acceleration energy of the LHC (14 TeV and 7 TeV) is significantly greater than that of the Tevatron (1.96 Tev). This leads to an increase of the cross section by a factor of 100 ({proportional_to}7.3 pb at the Tevatron to {proportional_to}800 pb at 14 TeV LHC). On the other hand, the luminosity of the LHC outperforms the Tevatron by a factor of 10-100. The reduced experimental errors for the observables demand an improvement of the theoretical error. The experimental accuracy of the LHC and the great relevance of the process led to an intensive activity of different research groups in order to improve the calculation of the cross section of top quark pair production. This work presents for the first time a complete numerical result for the full NNLO correction for the top quark pair

  9. Top quark pair production at the LHC

    International Nuclear Information System (INIS)

    Baernreuther, Peter

    2012-01-01

    One of the most interesting and manifold processes in the Standard Model of elementary particle physics is the top quark pair production. It enabled the discovery of the top quark at the Tevatron in 1995 and the determination of many of its properties. By means of a precise measurement and calculation of the cross section of top quark pair production it is possible to extract the top quark mass. Improvements in the gluon parton distribution functions (important for the Higgs boson production) or improvements in the prediction of the Higgs mass are also closely linked with the top quark pair production. Furthermore, the production process plays an important role in the discovery of new physics. On the one hand the top quark pair decays form the largest part of the background in many BSM models, on the other hand BSM physics can be detected directly in the decay process by investigating the charge symmetry or the invariant mass spectrum. At the LHC it will be possible for the first time to produce a large amount of top quarks; thereby the statistical errors of the observables will be strongly reduced. The enormous increase in the production rate has two reasons. On the one hand, the acceleration energy of the LHC (14 TeV and 7 TeV) is significantly greater than that of the Tevatron (1.96 Tev). This leads to an increase of the cross section by a factor of 100 (∝7.3 pb at the Tevatron to ∝800 pb at 14 TeV LHC). On the other hand, the luminosity of the LHC outperforms the Tevatron by a factor of 10-100. The reduced experimental errors for the observables demand an improvement of the theoretical error. The experimental accuracy of the LHC and the great relevance of the process led to an intensive activity of different research groups in order to improve the calculation of the cross section of top quark pair production. This work presents for the first time a complete numerical result for the full NNLO correction for the top quark pair production in quark anti

  10. Older Galaxy Pair Has Surprisingly Youthful Glow

    Science.gov (United States)

    2007-01-01

    [figure removed for brevity, see original site] Poster Version A pair of interacting galaxies might be experiencing the galactic equivalent of a mid-life crisis. For some reason, the pair, called Arp 82, didn't make their stars early on as is typical of most galaxies. Instead, they got a second wind later in life -- about 2 billion years ago -- and started pumping out waves of new stars as if they were young again. Arp 82 is an interacting pair of galaxies with a strong bridge and a long tail. NGC 2535 is the big galaxy and NGC 2536 is its smaller companion. The disk of the main galaxy looks like an eye, with a bright 'pupil' in the center and oval-shaped 'eyelids.' Dramatic 'beads on a string' features are visible as chains of evenly spaced star-formation complexes along the eyelids. These are presumably the result of large-scale gaseous shocks from a grazing encounter. The colors of this galaxy indicate that the observed stars are young to intermediate in age, around 2 million to 2 billion years old, much less than the age of the universe (13.7 billion years). The puzzle is: why didn't Arp 82 form many stars earlier, like most galaxies of that mass range? Scientifically, it is an oddball and provides a relatively nearby lab for studying the age of intermediate-mass galaxies. This picture is a composite captured by Spitzer's infrared array camera with light at wavelength 8 microns shown in red, NASA's Galaxy Evolution Explorer combined 1530 and 2310 Angstroms shown in blue, and the Southeastern Association for Research in Astronomy Observatory light at 6940 Angstroms shown in green.

  11. Augmenting Think-Pair-Share with Simulations

    Science.gov (United States)

    Lee, Kevin M.; Siedell, C. M.; Prather, E. E.; CATS

    2009-01-01

    Computer simulations are valuable tools for the teaching and learning of introductory astronomy. They enable students to link together small pieces of information into mental models of complex physical systems that are far beyond their everyday experience. They can also be used to authentically test a student's conceptual understanding of a physical system by asking the student to make predictions regarding its behavior. Students receive formative feedback by testing their predictions in simulations. Think-Pair-Share - the posing of conceptual questions to students and having them vote on the answer before and after discussion with their peers - can benefit considerably from the incorporation of simulations. Simulations can be used for delivering content that precedes Think-Pair-Share, as the prompt the questions is based upon, or as a feedback tool to illustrate the answer to a question. These techniques are utilized in ClassAction - a collection of materials designed to enhance the metacognitive skills of Astro 101 students by promoting interactive engagement and providing rapid feedback. The main focus is dynamic conceptual questions largely based upon graphics that can be projected in the classroom. Many questions are available in a Flash computer database and instructors have the capability to recast these questions into alternate permutations based on their own preferences and student responses. Outlines, graphics, and simulations are included which instructors can use to provide feedback. This poster provides examples of simulation usage in Think-Pair-Share related to sky motions, lunar phases, and stellar properties. A multi-institutional classroom validation study of ClassAction is currently underway as a Collaboration of Astronomy Teaching Scholars (CATS) research project. All materials are publicly available at http://astro.unl.edu. We would like to thank the NSF for funding under Grant Nos. 0404988 and 0715517, a CCLI Phase III Grant for the

  12. Paired structures and bipolar knowledge representation

    DEFF Research Database (Denmark)

    Montero, Javier; Bustince, Humberto; Franco, Camilo

    In this strictly positional paper we propose a general approach to bipolar knowledge representation, where the meaning of concepts can be modelled by examining their decomposition into opposite and neutral categories. In particular, it is the semantic relationship between the opposite categories...... and at the same time the type of neutrality rising in between opposites. Based on this first level of bipolar knowledge representation, paired structures in fact offer the means to characterize a specific bipolar valuation scale depending on the meaning of the concept that has to be verified. In this sense...

  13. Z Boson Pair-Production at LEP

    CERN Document Server

    Achard, P; Aguilar-Benítez, M; Alcaraz, J; Alemanni, G; Allaby, James V; Aloisio, A; Alviggi, M G; Anderhub, H; Andreev, V P; Anselmo, F; Arefev, A; Azemoon, T; Aziz, T; Bagnaia, P; Bajo, A; Baksay, G; Baksay, L; Baldew, S V; Banerjee, S; Banerjee, Sw; Barczyk, A; Barillère, R; Bartalini, P; Basile, M; Batalova, N; Battiston, R; Bay, A; Becattini, F; Becker, U; Behner, F; Bellucci, L; Berbeco, R; Berdugo, J; Berges, P; Bertucci, B; Betev, B L; Biasini, M; Biglietti, M; Biland, A; Blaising, J J; Blyth, S C; Bobbink, Gerjan J; Böhm, A; Boldizsar, L; Borgia, B; Bottai, S; Bourilkov, D; Bourquin, Maurice; Braccini, S; Branson, J G; Brochu, F; Burger, J D; Burger, W J; Cai, X D; Capell, M; Cara Romeo, G; Carlino, G; Cartacci, A M; Casaus, J; Cavallari, F; Cavallo, N; Cecchi, C; Cerrada, M; Chamizo-Llatas, M; Chang, Y H; Chemarin, M; Chen, A; Chen, G; Chen, G M; Chen, H F; Chen, H S; Chiefari, G; Cifarelli, Luisa; Cindolo, F; Clare, I; Clare, R; Coignet, G; Colino, N; Costantini, S; de la Cruz, B; Cucciarelli, S; van Dalen, J A; De Asmundis, R; Déglon, P L; Debreczeni, J; Degré, A; Dehmelt, K; Deiters, K; Della Volpe, D; Delmeire, E; Denes, P; De Notaristefani, F; De Salvo, A; Diemoz, M; Dierckxsens, M; Dionisi, C; Dittmar, M; Doria, A; Dova, M T; Duchesneau, D; Duda, M; Echenard, B; Eline, A; El-Hage, A; El-Mamouni, H; Engler, A; Eppling, F J; Extermann, P; Falagán, M A; Falciano, S; Favara, A; Fay, J; Fedin, O; Felcini, M; Ferguson, T; Fesefeldt, H S; Fiandrini, E; Field, J H; Filthaut, Frank; Fisher, P H; Fisher, W; Fisk, I; Forconi, G; Freudenreich, Klaus; Furetta, C; Galaktionov, Yu; Ganguli, S N; García-Abia, P; Gataullin, M; Gentile, S; Giagu, S; Gong, Z F; Grenier, G; Grimm, O; Grünewald, M W; Guida, M; van Gulik, R; Gupta, V K; Gurtu, A; Gutay, L J; Haas, D; Hatzifotiadou, D; Hebbeker, T; Hervé, A; Hirschfelder, J; Hofer, H; Hohlmann, M; Holzner, G; Hou, S R; Hu, Y; Jin, B N; Jones, L W; de Jong, P; Josa-Mutuberria, I; Käfer, D; Kaur, M; Kienzle-Focacci, M N; Kim, J K; Kirkby, Jasper; Kittel, E W; Klimentov, A; König, A C; Kopal, M; Koutsenko, V F; Kräber, M H; Krämer, R W; Krüger, A; Kunin, A; Ladrón de Guevara, P; Laktineh, I; Landi, G; Lebeau, M; Lebedev, A; Lebrun, P; Lecomte, P; Lecoq, P; Le Coultre, P; Le Goff, J M; Leiste, R; Levtchenko, M; Levchenko, P M; Li, C; Likhoded, S; Lin, C H; Lin, W T; Linde, Frank L; Lista, L; Liu, Z A; Lohmann, W; Longo, E; Lü, Y S; Luci, C; Luminari, L; Lustermann, W; Ma Wen Gan; Malgeri, L; Malinin, A; Maña, C; Mans, J; Martin, J P; Marzano, F; Mazumdar, K; McNeil, R R; Mele, S; Merola, L; Meschini, M; Metzger, W J; Mihul, A; Milcent, H; Mirabelli, G; Mnich, J; Mohanty, G B; Muanza, G S; Muijs, A J M; Musicar, B; Musy, M; Nagy, S; Natale, S; Napolitano, M; Nessi-Tedaldi, F; Newman, H; Nisati, A; Novák, T; Nowak, H; Ofierzynski, R A; Organtini, G; Pal, I; Palomares, C; Paolucci, P; Paramatti, R; Passaleva, G; Patricelli, S; Paul, T; Pauluzzi, M; Paus, C; Pauss, Felicitas; Pedace, M; Pensotti, S; Perret-Gallix, D; Petersen, B; Piccolo, D; Pierella, F; Pioppi, M; Piroué, P A; Pistolesi, E; Plyaskin, V; Pohl, M; Pozhidaev, V; Pothier, J; Prokofev, D; Prokofiev, D O; Quartieri, J; Rahal-Callot, G; Rahaman, M A; Raics, P; Raja, N; Ramelli, R; Rancoita, P G; Ranieri, R; Raspereza, A V; Razis, P A; Ren, D; Rescigno, M; Reucroft, S; Riemann, S; Riles, K; Roe, B P; Romero, L; Rosca, A; Rosier-Lees, S; Roth, S; Rosenbleck, C; Roux, B; Rubio, J A; Ruggiero, G; Rykaczewski, H; Sakharov, A; Saremi, S; Sarkar, S; Salicio, J; Sánchez, E; Schäfer, C; Shchegelskii, V; Schopper, Herwig Franz; Schotanus, D J; Sciacca, C; Servoli, L; Shevchenko, S; Shivarov, N; Shoutko, V; Shumilov, E; Shvorob, A V; Son, D; Souga, C; Spillantini, P; Steuer, M; Stickland, D P; Stoyanov, B; Strässner, A; Sudhakar, K; Sultanov, G G; Sun, L Z; Sushkov, S; Suter, H; Swain, J D; Szillási, Z; Tang, X W; Tarjan, P; Tauscher, Ludwig; Taylor, L; Tellili, B; Teyssier, D; Timmermans, C; Ting, Samuel C C; Ting, S M; Tonwar, S C; Tóth, J; Tully, C; Tung, K L; Ulbricht, J; Valente, E; Van de Walle, R T; Vásquez, R; Veszpremi, V; Vesztergombi, G; Vetlitskii, I; Vicinanza, D; Viertel, Gert M; Villa, S; Vivargent, M; Vlachos, S; Vodopyanov, I; Vogel, H; Vogt, H; Vorobev, I; Vorobyov, A A; Wadhwa, M; Wang, Q; Wang, X L; Wang, Z M; Weber, M; Wienemann, P; Wilkens, H; Wynhoff, S; Xia, L; Xu, Z Z; Yamamoto, J; Yang, B Z; Yang, C G; Yang, H J; Yang, M; Yeh, S C; Zalite, A; Zalite, Yu; Zhang, Z P; Zhao, J; Zhu, G Y; Zhu, R Y; Zhuang, H L; Zichichi, A; Zimmermann, B; Zöller, M

    2003-01-01

    Events stemming from the pair-production of Z bosons in e^+e^- collisions are studied using 217.4 pb^-1 of data collected with the L3 detector at centre-of-mass energies from 200 GeV up to 209 GeV. The special case of events with b quarks is also investigated. Combining these events with those collected at lower centre-of-mass energies, the Standard Model predictions for the production mechanism are verified. In addition, limits are set on anomalous couplings of neutral gauge bosons and on effects of extra space dimensions.

  14. Pair Negotiation When Developing English Speaking Tasks

    Directory of Open Access Journals (Sweden)

    Ingrid Liliana Bohórquez Suárez

    2011-12-01

    Full Text Available This study analyzes what characterizes the negotiations of seventh graders at a public school in Bogotá when working in pairs to develop speaking tasks in EFL classes. The inquiry is a descriptive case study that follows the qualitative paradigm. As a result of analyzing the data, we obtained four consecutive steps that characterize students’ negotiations: Establishing a connection with a partner to work with, proposing practical alternatives, refusing mates’ propositions, and making practical decisions. Moreover, we found that the constant performance of the process of negotiation provokes students to construct a sociolinguistic identity that allows agreements to emerge.

  15. Production of supersymmetric pairs at antipp colliders

    International Nuclear Information System (INIS)

    Peschanski, R.

    1985-02-01

    Production and decay rates of squarks and gluinos at antipp colliders are shown to depend not only on the mass scale but on the ratio of squark to gluino mass. In the degenerate case which is shown to be natural in a large class of broken Supergravity models with minimal field content the predicted cross-sections are enhanced by a sizeable factor. This gives an improved bound on the squark mass (70 GeV) from the analysis of Cern monojets and indications for the search of squark decay modes of supersymmetric pairs at antipp colliders in the near future

  16. Pairing correlations in a fissioning potential well

    International Nuclear Information System (INIS)

    Krappe, H.J.; Fadeev, S.

    1999-01-01

    To describe pairing correlations in a fissioning system one commonly projects the BCS wave function separately onto good particle numbers in each fragment in the exit channel, but only onto the total number of particles in the parent system. We propose to interpolate between these limiting situations by the generator-coordinate method with the particle-number difference between the nascent fragments as the generator coordinate. Model calculations are presented for the Hill-Wheeler box potential with a δ-function diaphragm to mimic scission

  17. Hadroproduction of massive lepton pairs and QCD

    International Nuclear Information System (INIS)

    Berger, E.L.

    1979-04-01

    A survey is presented of some current issues of interest in attempts to describe the production of massive lepton pairs in hadronic collisions at high energies. I concentrate on the interpretation of data in terms of the parton model and on predictions derived from quantum-chromodynamics (QCD), their reliability and their confrontation with experiment. Among topics treated are the connection with deep-inelastic lepton scattering, universality of structure functions, and the behavior of cross-sections as a function of transverse momentum

  18. Dimer pair correlations on the brick lattice

    International Nuclear Information System (INIS)

    Yokoi, C.S.O.; Nagle, J.F.; Sulinas, S.R.

    1986-01-01

    Using exact methods, pair-correlation functions are studied in the dimer model defined on a brick lattice. At long distances these functions exhibit strongly anisotropic algebraic decay and, near criticality, the length scales diverge differently in the two principal directions. The critical exponents are v /sub x/ =1/2 and v /sub y/ =1. These results are in agreement with deductions drawn from recent exact finite-size scaling calculations. We also interpret our results in the light of domain wall theories of commensurate-incommensurate transitions, and in particular we study the relation of the present model to the discrete version of the Pokrovsky-Talapov model introduced by Villain

  19. Detecting nonlocal Cooper pair entanglement by optical Bell inequality violation

    Energy Technology Data Exchange (ETDEWEB)

    Nigg, Simon E.; Tiwari, Rakesh P.; Walter, Stefan; Schmidt, Thomas L. [Department of Physics, University of Basel, Klingelbergstrasse 82, 4056 Basel (Switzerland)

    2015-07-01

    Based on the Bardeen Cooper Schrieffer (BCS) theory of superconductivity, the coherent splitting of Cooper pairs from a superconductor to two spatially separated quantum dots has been predicted to generate nonlocal pairs of entangled electrons. In order to test this hypothesis, we propose a scheme to transfer the spin state of a split Cooper pair onto the polarization state of a pair of optical photons. We show that the produced photon pairs can be used to violate a Bell inequality, unambiguously demonstrating the entanglement of the split Cooper pairs.

  20. Detecting nonlocal Cooper pair entanglement by optical Bell inequality violation

    Science.gov (United States)

    Nigg, Simon E.; Tiwari, Rakesh P.; Walter, Stefan; Schmidt, Thomas L.

    2015-03-01

    Based on the Bardeen-Cooper-Schrieffer theory of superconductivity, the coherent splitting of Cooper pairs from a superconductor to two spatially separated quantum dots has been predicted to generate nonlocal pairs of entangled electrons. In order to test this hypothesis, we propose a scheme to transfer the spin state of a split Cooper pair onto the polarization state of a pair of optical photons. We show that the photon pairs produced can be used to violate a Bell inequality, unambiguously demonstrating the entanglement of the split Cooper pairs.

  1. Frequent Pairs in Data Streams: Exploiting Parallelism and Skew

    DEFF Research Database (Denmark)

    Campagna, Andrea; Kutzkow, Konstantin; Pagh, Rasmus

    2011-01-01

    We introduce the Pair Streaming Engine (PairSE) that detects frequent pairs in a data stream of transactions. Our algorithm finds the most frequent pairs with high probability, and gives tight bounds on their frequency. It is particularly space efficient for skewed distribution of pair supports...... items mining in data streams. We show how to efficiently scale these approaches to handle large transactions. We report experimental results showcasing precision and recall of our method. In particular, we find that often our method achieves excellent precision, returning identical upper and lower...... bounds on the supports of the most frequent pairs....

  2. Pair Production Constraints on Superluminal Neutrinos Revisited

    International Nuclear Information System (INIS)

    Brodsky, Stanley

    2012-01-01

    We revisit the pair creation constraint on superluminal neutrinos considered by Cohen and Glashow in order to clarify which types of superluminal models are constrained. We show that a model in which the superluminal neutrino is effectively light-like can evade the Cohen-Glashow constraint. In summary, any model for which the CG pair production process operates is excluded because such timelike neutrinos would not be detected by OPERA or other experiments. However, a superluminal neutrino which is effectively lightlike with fixed p 2 can evade the Cohen-Glashow constraint because of energy-momentum conservation. The coincidence involved in explaining the SN1987A constraint certainly makes such a picture improbable - but it is still intrinsically possible. The lightlike model is appealing in that it does not violate Lorentz symmetry in particle interactions, although one would expect Hughes-Drever tests to turn up a violation eventually. Other evasions of the CG constraints are also possible; perhaps, e.g., the neutrino takes a 'short cut' through extra dimensions or suffers anomalous acceleration in matter. Irrespective of the OPERA result, Lorentz-violating interactions remain possible, and ongoing experimental investigation of such possibilities should continue.

  3. Using Dictionary Pair Learning for Seizure Detection.

    Science.gov (United States)

    Ma, Xin; Yu, Nana; Zhou, Weidong

    2018-02-13

    Automatic seizure detection is extremely important in the monitoring and diagnosis of epilepsy. The paper presents a novel method based on dictionary pair learning (DPL) for seizure detection in the long-term intracranial electroencephalogram (EEG) recordings. First, for the EEG data, wavelet filtering and differential filtering are applied, and the kernel function is performed to make the signal linearly separable. In DPL, the synthesis dictionary and analysis dictionary are learned jointly from original training samples with alternating minimization method, and sparse coefficients are obtained by using of linear projection instead of costly [Formula: see text]-norm or [Formula: see text]-norm optimization. At last, the reconstructed residuals associated with seizure and nonseizure sub-dictionary pairs are calculated as the decision values, and the postprocessing is performed for improving the recognition rate and reducing the false detection rate of the system. A total of 530[Formula: see text]h from 20 patients with 81 seizures were used to evaluate the system. Our proposed method has achieved an average segment-based sensitivity of 93.39%, specificity of 98.51%, and event-based sensitivity of 96.36% with false detection rate of 0.236/h.

  4. Generalized quantum interference of correlated photon pairs

    Science.gov (United States)

    Kim, Heonoh; Lee, Sang Min; Moon, Han Seb

    2015-01-01

    Superposition and indistinguishablility between probability amplitudes have played an essential role in observing quantum interference effects of correlated photons. The Hong-Ou-Mandel interference and interferences of the path-entangled photon number state are of special interest in the field of quantum information technologies. However, a fully generalized two-photon quantum interferometric scheme accounting for the Hong-Ou-Mandel scheme and path-entangled photon number states has not yet been proposed. Here we report the experimental demonstrations of the generalized two-photon interferometry with both the interferometric properties of the Hong-Ou-Mandel effect and the fully unfolded version of the path-entangled photon number state using photon-pair sources, which are independently generated by spontaneous parametric down-conversion. Our experimental scheme explains two-photon interference fringes revealing single- and two-photon coherence properties in a single interferometer setup. Using the proposed interferometric measurement, it is possible to directly estimate the joint spectral intensity of a photon pair source. PMID:25951143

  5. Odd-frequency pairing in superconducting heterostructures .

    Science.gov (United States)

    Golubov, A. A.; Tanaka, Y.; Yokoyama, T.; Asano, Y.

    2007-03-01

    We present a general theory of the proximity effect in junctions between unconventional superconductors and diffusive normal metals (DN) or ferromagnets (DF). We consider all possible symmetry classes in a superconductor allowed by the Pauli principle: even-frequency spin-singlet even-parity state, even-frequency spin-triplet odd-parity state, odd-frequency spin-triplet even-parity state and odd-frequency spin-singlet odd-parity state. For each of the above states, symmetry and spectral properties of the induced pair amplitude in the DN (DF) are determined. The cases of junctions with spin-singlet s- and d-wave superconductors and spin-triplet p-wave superconductors are adressed in detail. We discuss the interplay between the proximity effect and midgap Andreev bound states arising at interfaces in unconventional (d- or p-wave) junctions. The most striking property is the odd-frequency symmetry of the pairing amplitude induced in DN (DF) in contacts with p-wave superconductors. This leads to zero-energy singularity in the density of states and to anomalous screening of an external magnetic field. Peculiarities of Josephson effect in d- or p-wave junctions are discussed. Experiments are suggested to detect an order parameter symmetry using heterostructures with unconventional superconductors.

  6. The leptoquark hunter's guide: pair production

    Science.gov (United States)

    Diaz, Bastian; Schmaltz, Martin; Zhong, Yi-Ming

    2017-10-01

    Leptoquarks occur in many new physics scenarios and could be the next big discovery at the LHC. The purpose of this paper is to point out that a model-independent search strategy covering all possible leptoquarks is possible and has not yet been fully exploited. To be systematic we organize the possible leptoquark final states according to a leptoquark matrix with entries corresponding to nine experimentally distinguishable leptoquark decays: any of {light-jet, b-jet, top} with any of {neutrino, e/ μ, τ}. The 9 possibilities can be explored in a largely model-independent fashion with pair-production of leptoquarks at the LHC. We review the status of experimental searches for the 9 components of the leptoquark matrix, pointing out which 3 have not been adequately covered. We plead that experimenters publish bounds on leptoquark cross sections as functions of mass for as wide a range of leptoquark masses as possible. Such bounds are essential for reliable recasts to general leptoquark models. To demonstrate the utility of the leptoquark matrix approach we collect and summarize searches with the same final states as leptoquark pair production and use them to derive bounds on a complete set of Minimal Leptoquark models which span all possible flavor and gauge representations for scalar and vector leptoquarks.

  7. Cooperative interactions between paired domain and homeodomain.

    Science.gov (United States)

    Jun, S; Desplan, C

    1996-09-01

    The Pax proteins are a family of transcriptional regulators involved in many developmental processes in all higher eukaryotes. They are characterized by the presence of a paired domain (PD), a bipartite DNA binding domain composed of two helix-turn-helix (HTH) motifs,the PAI and RED domains. The PD is also often associated with a homeodomain (HD) which is itself able to form homo- and hetero-dimers on DNA. Many of these proteins therefore contain three HTH motifs each able to recognize DNA. However, all PDs recognize highly related DNA sequences, and most HDs also recognize almost identical sites. We show here that different Pax proteins use multiple combinations of their HTHs to recognize several types of target sites. For instance, the Drosophila Paired protein can bind, in vitro, exclusively through its PAI domain, or through a dimer of its HD, or through cooperative interaction between PAI domain and HD. However, prd function in vivo requires the synergistic action of both the PAI domain and the HD. Pax proteins with only a PD appear to require both PAI and RED domains, while a Pax-6 isoform and a new Pax protein, Lune, may rely on the RED domain and HD. We propose a model by which Pax proteins recognize different target genes in vivo through various combinations of their DNA binding domains, thus expanding their recognition repertoire.

  8. Optimisation of a quantum pair space thruster

    Directory of Open Access Journals (Sweden)

    Valeriu DRAGAN

    2012-06-01

    Full Text Available The paper addresses the problem of propulsion for long term space missions. Traditionally a space propulsion unit has a propellant mass which is ejected trough a nozzle to generate thrust; this is also the case with inert gases energized by an on-board power unit. Unconventional methods for propulsion include high energy LASERs that rely on the momentum of photons to generate thrust. Anti-matter has also been proposed for energy storage. Although the momentum of ejected gas is significantly higher, the LASER propulsion offers the perspective of unlimited operational time – provided there is a power source. The paper will propose the use of the quantum pair formation for generating a working mass, this is different than conventional anti-matter thrusters since the material particles generated are used as propellant not as energy storage.Two methods will be compared: LASER and positron-electron, quantum pair formation. The latter will be shown to offer better momentum above certain energy levels.For the demonstrations an analytical solution is obtained and provided in the form of various coefficients. The implications are, for now, theoretical however the practicality of an optimized thruster using such particles is not to be neglected for long term space missions.

  9. Understanding Fomalhaut as a Cooper pair

    Science.gov (United States)

    Feng, F.; Jones, H. R. A.

    2018-03-01

    Fomalhaut is a nearby stellar system and has been found to be a triple based on astrometric observations. With new radial velocity and astrometric data, we study the association between Fomalhaut A, B, and C in a Bayesian framework, finding that the system is gravitationally bound or at least associated. Based on simulations of the system, we find that Fomalhaut C can be easily destabilized through combined perturbations from the Galactic tide and stellar encounters. Considering that observing the disruption of a triple is probably rare in the solar neighbourhood, we conclude that Fomalhaut C is a so-called `gravitational pair' of Fomalhaut A and B. Like the Cooper pair mechanism in superconductors, this phenomenon only appears once the orbital energy of a component becomes comparable with the energy fluctuations caused by the environment. Based on our simulations, we find (1) an upper limit of 8 km s-1 velocity difference is appropriate when selecting binary candidates, and (2) an empirical formula for the escape radius, which is more appropriate than tidal radius when measuring the stability of wide binaries.

  10. Leptoquark pair production in hadronic interactions

    International Nuclear Information System (INIS)

    Bluemlein, J.; Boos, E.; Moskovskij Gosudarstvennyj Univ., Moscow; Kryukov, A.; Moskovskij Gosudarstvennyj Univ., Moscow

    1996-10-01

    The scalar and vector leptoquark pair production cross sections in hadronic collisions are calculated. In a model independent analysis we consider the most general C and P conserving couplings of gluons to both scalar and vector leptoquarks described by an effective low-energy Lagangian which obeys SU(3) c invariance. Analytrical expressions are derived for the differential and integral scattering cross sections including the case of anomalous vector leptoquark couplings, κ G and λ G , to the gluon field. Numerical predictions are given for the kinematic range of the TEVATRON and LHC. The pair production cross sections are also calculated for the resolved photon contributions to ep → e anti ΦΦX at HERA and LEP x LHC, and for the process γγ → Φ anti ΦX at possible future e + e - linear colliders and γγ colliders. Estimates of the search potential for scalar and vector leptoquarks at present and future high energy colliders are given. (orig.)

  11. Synergy between pair coupled cluster doubles and pair density functional theory

    Energy Technology Data Exchange (ETDEWEB)

    Garza, Alejandro J.; Bulik, Ireneusz W. [Department of Chemistry, Rice University, Houston, Texas 77251-1892 (United States); Henderson, Thomas M. [Department of Chemistry and Department of Physics and Astronomy, Rice University, Houston, Texas 77251-1892 (United States); Scuseria, Gustavo E. [Department of Chemistry and Department of Physics and Astronomy, Rice University, Houston, Texas 77251-1892 (United States); Chemistry Department, Faculty of Science, King Abdulaziz University, Jeddah 21589 (Saudi Arabia)

    2015-01-28

    Pair coupled cluster doubles (pCCD) has been recently studied as a method capable of accounting for static correlation with low polynomial cost. We present three combinations of pCCD with Kohn–Sham functionals of the density and on-top pair density (the probability of finding two electrons on top of each other) to add dynamic correlation to pCCD without double counting. With a negligible increase in computational cost, these pCCD+DFT blends greatly improve upon pCCD in the description of typical problems where static and dynamic correlations are both important. We argue that—as a black-box method with low scaling, size-extensivity, size-consistency, and a simple quasidiagonal two-particle density matrix—pCCD is an excellent match for pair density functionals in this type of fusion of multireference wavefunctions with DFT.

  12. Treatment of pairing correlations based on the equations of motion for zero-coupled pair operators

    International Nuclear Information System (INIS)

    Andreozzi, F.; Covello, A.; Gargano, A.; Ye, L.J.; Porrino, A.

    1985-01-01

    The pairing problem is treated by means of the equations of motion for zero-coupled pair operators. Exact equations for the seniority-v states of N particles are derived. These equations can be solved by a step-by-step procedure which consists of progressively adding pairs of particles to a core. The theory can be applied at several levels of approximation depending on the number of core states which are taken into account. Some numerical applications to the treatment of v = 0, v = 1, and v = 2 states in the Ni isotopes are performed. The accuracy of various approximations is tested by comparison with exact results. For the seniority-one and seniority-two problems it turns out that the results obtained from the first-order theory are very accurate, while those of higher order calculations are practically exact. Concerning the seniority-zero problem, a fifth-order calculation reproduces quite well the three lowest states

  13. Quantifying inbreeding avoidance through extra-pair reproduction.

    Science.gov (United States)

    Reid, Jane M; Arcese, Peter; Keller, Lukas F; Germain, Ryan R; Duthie, A Bradley; Losdat, Sylvain; Wolak, Matthew E; Nietlisbach, Pirmin

    2015-01-01

    Extra-pair reproduction is widely hypothesized to allow females to avoid inbreeding with related socially paired males. Consequently, numerous field studies have tested the key predictions that extra-pair offspring are less inbred than females' alternative within-pair offspring, and that the probability of extra-pair reproduction increases with a female's relatedness to her socially paired male. However, such studies rarely measure inbreeding or relatedness sufficiently precisely to detect subtle effects, or consider biases stemming from failure to observe inbred offspring that die during early development. Analyses of multigenerational song sparrow (Melospiza melodia) pedigree data showed that most females had opportunity to increase or decrease the coefficient of inbreeding of their offspring through extra-pair reproduction with neighboring males. In practice, observed extra-pair offspring had lower inbreeding coefficients than females' within-pair offspring on average, while the probability of extra-pair reproduction increased substantially with the coefficient of kinship between a female and her socially paired male. However, simulations showed that such effects could simply reflect bias stemming from inbreeding depression in early offspring survival. The null hypothesis that extra-pair reproduction is random with respect to kinship therefore cannot be definitively rejected in song sparrows, and existing general evidence that females avoid inbreeding through extra-pair reproduction requires reevaluation given such biases. © 2014 The Author(s). Evolution © 2014 The Society for the Study of Evolution.

  14. Enhanced stability of bound pairs at nonzero lattice momenta

    International Nuclear Information System (INIS)

    Kornilovitch, Pavel

    2004-01-01

    A two-body problem on the square lattice is analyzed. The interaction potential consists of strong on-site repulsion and nearest-neighbor attraction. The exact pairing conditions are derived for s-, p-, and d-symmetric bound states. The pairing conditions are strong functions of the total pair momentum K. It is found that the stability of pairs increases with K. At weak attraction, the pairs do not form at the Γ point but stabilize at lattice momenta close to the Brillouin zone boundary. The phase boundaries in the momentum space, which separate stable and unstable pairs, are calculated. It is found that the pairs are formed easier along the (π,0) direction than along the (π,π) direction. This might lead to the appearance of 'hot pairing spots' on the K x and K y axes

  15. Pair formation models for sexually transmitted infections : A primer

    NARCIS (Netherlands)

    Kretzschmar, MEE; Heijne, Janneke C M

    For modelling sexually transmitted infections, duration of partnerships can strongly influence the transmission dynamics of the infection. If partnerships are monogamous, pairs of susceptible individuals are protected from becoming infected, while pairs of infected individuals delay onward

  16. Theoretical analysis of noncanonical base pairing interactions in ...

    Indian Academy of Sciences (India)

    PRAKASH KUMAR

    Noncanonical base pairs in RNA have strong structural and functional implications but are currently not considered ..... Full optimizations of the systems were also carried out using ... of the individual bases in the base pair through the equation.

  17. Quasi spin pairing and the structure of the Lipkin model

    International Nuclear Information System (INIS)

    Cambiaggio, M.C.; Plastino, A.

    1978-01-01

    By introducing the concepts of quasi-spin pairing and quasi-spin seniority, the Lipkin model is extended to a variable number of particles. The properties of quasi-spin pairing are seen to be quite similar to those of ordinary pairing. The quasi-spin seniority allows one to obtain a simple classification of excited multiplets. A 'pairing plus monopole' model is studied in connection with the Hartree-Fock theory. (orig.) [de

  18. Extensions of Bessel sequences to dual pairs of frames

    DEFF Research Database (Denmark)

    Christensen, Ole; Kim, Hong Oh; Kim, Rae Young

    2013-01-01

    Tight frames in Hilbert spaces have been studied intensively for the past years. In this paper we demonstrate that it often is an advantage to use pairs of dual frames rather than tight frames. We show that in any separable Hilbert space, any pairs of Bessel sequences can be extended to a pair of...... be extended to a pair of dual frames. © 2012 Elsevier Inc. All rights reserved....

  19. Force induced DNA melting

    International Nuclear Information System (INIS)

    Santosh, Mogurampelly; Maiti, Prabal K

    2009-01-01

    When pulled along the axis, double-strand DNA undergoes a large conformational change and elongates by roughly twice its initial contour length at a pulling force of about 70 pN. The transition to this highly overstretched form of DNA is very cooperative. Applying a force perpendicular to the DNA axis (unzipping), double-strand DNA can also be separated into two single-stranded DNA, this being a fundamental process in DNA replication. We study the DNA overstretching and unzipping transition using fully atomistic molecular dynamics (MD) simulations and argue that the conformational changes of double-strand DNA associated with either of the above mentioned processes can be viewed as force induced DNA melting. As the force at one end of the DNA is increased the DNA starts melting abruptly/smoothly above a critical force depending on the pulling direction. The critical force f m , at which DNA melts completely decreases as the temperature of the system is increased. The melting force in the case of unzipping is smaller compared to the melting force when the DNA is pulled along the helical axis. In the case of melting through unzipping, the double-strand separation has jumps which correspond to the different energy minima arising due to sequence of different base pairs. The fraction of Watson-Crick base pair hydrogen bond breaking as a function of force does not show smooth and continuous behavior and consists of plateaus followed by sharp jumps.

  20. Intramolecular tautomerisation and the conformational variability of some classical mutagens – cytosine derivatives: quantum chemical study

    Directory of Open Access Journals (Sweden)

    Hovorun D. M.

    2011-04-01

    Full Text Available Aim. To determine the lifetime of the mutagenic cytosine derivatives through the investigation of the physicochemical mechanisms of their intramolecular proton transfer. Methods. Non-empirical quantum chemistry, the analysis of the electron density by means of Bader’s atoms in molecules (AIM theory and physicochemical kinetics were used. Results. It is shown that the modification of all investigated compounds, except DCyt, prevents their pairing in both mutagenic and canonical tautomeric forms with a base which is an interacting partner. This effect can inhibit their mutagenic potential. It is also established that Watson-Crick tautomeric hypothesis can be formally expanded for the investigated molecules so far as a lifetime of the mutagenic tautomers much more exceeds characteristic time for the incorporation of one nucleotides pair by DNA biosynthesis machinery. It seems that just within the frame of this hypothesis it will be possible to give an adequate explanation of the mechanisms of mutagenic action of N4-aminocytosine, N4-methoxycytosine, N4-hydroxycytosine and N4dehydrocytosine, which have much more energy advantageous imino form in comparison with amino form. Conclusions. For the first time the comprehensive conformational analysis of a number of classical mutagens, namely cytosine derivatives, has been performed using the methods of non-empirical quantum chemistry at the MP2/6-311++G (2df,pd//B3LYP/6-311++G(d,p level of theory

  1. Computational and Empirical Trans-hydrogen Bond Deuterium Isotope Shifts Suggest that N1-N3 A:U Hydrogen Bonds of RNA are Shorter than those of A:T Hydrogen Bonds of DNA

    International Nuclear Information System (INIS)

    Kim, Yong-Ick; Manalo, Marlon N.; Perez, Lisa M.; LiWang, Andy

    2006-01-01

    Density functional theory calculations of isolated Watson-Crick A:U and A:T base pairs predict that adenine 13 C2 trans-hydrogen bond deuterium isotope shifts due to isotopic substitution at the pyrimidine H3, 2h Δ 13 C2, are sensitive to the hydrogen-bond distance between the N1 of adenine and the N3 of uracil or thymine, which supports the notion that 2h Δ 13 C2 is sensitive to hydrogen-bond strength. Calculated 2h Δ 13 C2 values at a given N1-N3 distance are the same for isolated A:U and A:T base pairs. Replacing uridine residues in RNA with 5-methyl uridine and substituting deoxythymidines in DNA with deoxyuridines do not statistically shift empirical 2h Δ 13 C2 values. Thus, we show experimentally and computationally that the C7 methyl group of thymine has no measurable affect on 2h Δ 13 C2 values. Furthermore, 2h Δ 13 C2 values of modified and unmodified RNA are more negative than those of modified and unmodified DNA, which supports our hypothesis that RNA hydrogen bonds are stronger than those of DNA. It is also shown here that 2h Δ 13 C2 is context dependent and that this dependence is similar for RNA and DNA

  2. Structural and energetic characterization of the emissive RNA alphabet based on the isothiazolo[4,3-d]pyrimidine heterocycle core

    KAUST Repository

    Chawla, Mohit; Poater, Albert; Oliva, Romina; Cavallo, Luigi

    2016-01-01

    We present theoretical characterization of fluorescent non-natural nucleobases, tzA, tzG, tzC, and tzU, derived from the isothiazolo[4,3-d]pyrimidine heterocycle. Consistent with the experimental evidence, our calculations show that the non-natural bases have minimal impact on the geometry and stability of the classical Watson-Crick base pairs, allowing them to accurately mimic natural bases in a RNA duplex, in terms of H-bonding. In contrast, our calculations indicate that H-bonded base pairs involving the Hoogsteen edge are destabilized relative to their natural counterparts. Analysis of the photophysical properties of the non-natural bases allowed us to correlate their absorption/emission peaks to the strong impact of the modification on the energy of the lowest unoccupied molecular orbital, LUMO, which is stabilized by roughly 1.0-1.2 eV relative to the natural analogues, while the highest occupied molecular orbital, HOMO, is not substantially affected. As a result, the HOMO-LUMO gap is reduced from 5.3-5.5 eV in the natural bases to 4.0-4.4 eV in the modified ones, with a consequent bathochromic shift in the absorption and emission spectra. © 2016 the Owner Societies.

  3. Structure and conformational dynamics of the domain 5 RNA hairpin of a bacterial group II intron revealed by solution nuclear magnetic resonance and molecular dynamics simulations.

    Science.gov (United States)

    Pechlaner, Maria; Sigel, Roland K O; van Gunsteren, Wilfred F; Dolenc, Jožica

    2013-10-08

    Nuclear magnetic resonance (NMR) nuclear Overhauser enhancement (NOE) data obtained for a 35-nucleotide RNA segment of a bacterial group II intron indicate a helical hairpin structure in which three parts, a terminal pentaloop, a bulge, and a G-A mismatch, display no Watson-Crick base pairing. The 668 NOE upper distance bounds for atom pairs are insufficient to uniquely determine the conformation of these segments. Therefore, molecular dynamics simulations including time-averaged distance restraints have been used to obtain a conformational ensemble compatible with the observed NMR data. The ensemble shows alternating hydrogen bonding patterns for the mentioned segments. In particular, in the pentaloop and in the bulge, the hydrogen bonding networks correspond to distinct conformational clusters that could not be captured by using conventional single-structure refinement techniques. This implies that, to obtain a realistic picture of the conformational ensemble of such flexible biomolecules, it is necessary to properly account for the conformational variability in the structure refinement of RNA fragments.

  4. Guanine is indispensable for immunoglobulin switch region RNA-DNA hybrid formation

    International Nuclear Information System (INIS)

    Mizuta, Ryushin; Mizuta, Midori; Kitamura, Daisuke

    2005-01-01

    It is suggested that the formation of the switch (S) region RNA-DNA hybrid and the subsequent generation of higher-order chromatin structures including R-loop initiate a class switch recombination of the immunoglobulin gene. The primary factor of this recombination is the S-region derived noncoding RNA. However, the biochemical character of this guanine-rich (G-rich) transcript is poorly understood. The present study was performed to analyze the structure of this G-rich RNA using atomic force microscope (AFM). The in vitro transcribed S-region RNA was spread on a mica plate, air-dried and observed by non-contact mode AFM in air. The G-rich transcripts tend to aggregate on the template DNA and to generate a higher-order RNA-DNA complex. However, the transcripts that incorporated guanine analogues as substitutes for guanine neither aggregated nor generated higher-order structures. Incorporation of guanine analogues in transcribes RNA partially disrupts hydrogen bonds related to guanine, such as Watson-Crick GC-base pair and Hoogsteen bond GG-base pair. Thus, aggregation of S-region RNA and generation of the higher-order RNA-DNA complex are attributed to hydrogen bonds of guanine. (author)

  5. Sensitivity of hydrogen bonds of DNA and RNA to hydration, as gauged by 1JNH measurements in ethanol-water mixtures

    International Nuclear Information System (INIS)

    Manalo, Marlon N.; Kong Xiangming; LiWang, Andy

    2007-01-01

    Hydrogen-bond lengths of nucleic acids are (1) longer in DNA than in RNA, and (2) sequence dependent. The physicochemical basis for these variations in hydrogen-bond lengths is unknown, however. Here, the notion that hydration plays a significant role in nucleic acid hydrogen-bond lengths is tested. Watson-Crick N1...N3 hydrogen-bond lengths of several DNA and RNA duplexes are gauged using imino 1 J NH measurements, and ethanol is used as a cosolvent to lower water activity. We find that 1 J NH values of DNA and RNA become less negative with added ethanol, which suggests that mild dehydration reduces hydrogen-bond lengths even as the overall thermal stabilities of these duplexes decrease. The 1 J NH of DNA are increased in 8 mol% ethanol to those of RNA in water, which suggests that the greater hydration of DNA plays a significant role in its longer hydrogen bonds. The data also suggest that ethanol-induced dehydration is greater for the more hydrated G:C base pairs and thereby results in greater hydrogen-bond shortening than for the less hydrated A:T/U base pairs of DNA and RNA

  6. Viroids: from genotype to phenotype just relying on RNA sequence and structural motifs

    Directory of Open Access Journals (Sweden)

    Ricardo eFlores

    2012-06-01

    Full Text Available As a consequence of two unique physical properties, small size and circularity, viroid RNAs do not code for proteins and thus depend on RNA sequence/structural motifs for interacting with host proteins that mediate their invasion, replication, spread, and circumvention of defensive barriers. Viroid genomes fold up on themselves adopting collapsed secondary structures wherein stretches of nucleotides stabilized by Watson-Crick pairs are flanked by apparently unstructured loops. However, compelling data show that they are instead stabilized by alternative non-canonical pairs and that specific loops in the rod-like secondary structure, characteristic of Potato spindle tuber viroid and most other members of the family Pospiviroidae, are critical for replication and systemic trafficking. In contrast, rather than folding into a rod-like secondary structure, most members of the family Avsunvioidae adopt multibranched conformations occasionally stabilized by kissing loop interactions critical for viroid viability in vivo. Besides these most stable secondary structures, viroid RNAs alternatively adopt during replication transient metastable conformations containing elements of local higher-order structure, prominent among which are the hammerhead ribozymes catalyzing a key replicative step in the family Avsunvioidae, and certain conserved hairpins that also mediate replication steps in the family Pospiviroidae. Therefore, different RNA structures ⎯either global or local ⎯ determine different functions, thus highlighting the need for in-depth structural studies on viroid RNAs.

  7. From structure prediction to genomic screens for novel non-coding RNAs.

    Science.gov (United States)

    Gorodkin, Jan; Hofacker, Ivo L

    2011-08-01

    Non-coding RNAs (ncRNAs) are receiving more and more attention not only as an abundant class of genes, but also as regulatory structural elements (some located in mRNAs). A key feature of RNA function is its structure. Computational methods were developed early for folding and prediction of RNA structure with the aim of assisting in functional analysis. With the discovery of more and more ncRNAs, it has become clear that a large fraction of these are highly structured. Interestingly, a large part of the structure is comprised of regular Watson-Crick and GU wobble base pairs. This and the increased amount of available genomes have made it possible to employ structure-based methods for genomic screens. The field has moved from folding prediction of single sequences to computational screens for ncRNAs in genomic sequence using the RNA structure as the main characteristic feature. Whereas early methods focused on energy-directed folding of single sequences, comparative analysis based on structure preserving changes of base pairs has been efficient in improving accuracy, and today this constitutes a key component in genomic screens. Here, we cover the basic principles of RNA folding and touch upon some of the concepts in current methods that have been applied in genomic screens for de novo RNA structures in searches for novel ncRNA genes and regulatory RNA structure on mRNAs. We discuss the strengths and weaknesses of the different strategies and how they can complement each other.

  8. Structural and energetic characterization of the emissive RNA alphabet based on the isothiazolo[4,3-d]pyrimidine heterocycle core

    KAUST Repository

    Chawla, Mohit

    2016-06-01

    We present theoretical characterization of fluorescent non-natural nucleobases, tzA, tzG, tzC, and tzU, derived from the isothiazolo[4,3-d]pyrimidine heterocycle. Consistent with the experimental evidence, our calculations show that the non-natural bases have minimal impact on the geometry and stability of the classical Watson-Crick base pairs, allowing them to accurately mimic natural bases in a RNA duplex, in terms of H-bonding. In contrast, our calculations indicate that H-bonded base pairs involving the Hoogsteen edge are destabilized relative to their natural counterparts. Analysis of the photophysical properties of the non-natural bases allowed us to correlate their absorption/emission peaks to the strong impact of the modification on the energy of the lowest unoccupied molecular orbital, LUMO, which is stabilized by roughly 1.0-1.2 eV relative to the natural analogues, while the highest occupied molecular orbital, HOMO, is not substantially affected. As a result, the HOMO-LUMO gap is reduced from 5.3-5.5 eV in the natural bases to 4.0-4.4 eV in the modified ones, with a consequent bathochromic shift in the absorption and emission spectra. © 2016 the Owner Societies.

  9. DNA rendering of polyhedral meshes at the nanoscale

    Science.gov (United States)

    Benson, Erik; Mohammed, Abdulmelik; Gardell, Johan; Masich, Sergej; Czeizler, Eugen; Orponen, Pekka; Högberg, Björn

    2015-07-01

    It was suggested more than thirty years ago that Watson-Crick base pairing might be used for the rational design of nanometre-scale structures from nucleic acids. Since then, and especially since the introduction of the origami technique, DNA nanotechnology has enabled increasingly more complex structures. But although general approaches for creating DNA origami polygonal meshes and design software are available, there are still important constraints arising from DNA geometry and sense/antisense pairing, necessitating some manual adjustment during the design process. Here we present a general method of folding arbitrary polygonal digital meshes in DNA that readily produces structures that would be very difficult to realize using previous approaches. The design process is highly automated, using a routeing algorithm based on graph theory and a relaxation simulation that traces scaffold strands through the target structures. Moreover, unlike conventional origami designs built from close-packed helices, our structures have a more open conformation with one helix per edge and are therefore stable under the ionic conditions usually used in biological assays.

  10. Multispectroscopic and Theoretical Exploration of the Comparative Binding Aspects of Bioflavonoid Fisetin with Triple- and Double-Helical Forms of RNA.

    Science.gov (United States)

    Bhuiya, Sutanwi; Haque, Lucy; Goswami, Rapti; Das, Suman

    2017-12-14

    The interactions of RNA triplex (U.A*U) and duplex (A.U) with naturally occurring flavonoid fisetin (FTN) have been examined at pH 7.0 using various spectroscopic, viscometric, and theoretical studies. Experimental observations showed that the ligand binds with both double- and triple-helical forms of RNA, although the binding affinity is greater for the triplex structure (5.94 × 10 6 M -1 ) compared to that for the duplex counterpart (1.0 × 10 5 M -1 ). Thermal melting experiments revealed that the Hoogsteen base-paired third strand of triplex was stabilized to a greater extent (∼14 °C) compared with the Watson-Crick base-paired second strand (∼4 °C) in the presence of FTN. From fluorimetric study, we observed that U.A*U and A.U primarily bind to the photoproduced tautomer of FTN in the excited state. Steady-state and time-resolved anisotropy measurements illustrate considerable modulations of the spectroscopic properties of the tautomeric FTN within the RNA environment. Viscometric, fluorescence quenching, and thermal melting studies all together support the mode of binding to be intercalation. Theoretical study explains the experimental absorption and emission (dual fluorescence) behavior of FTN along with the excited-state intramolecular proton transfer process.

  11. Supra-molecular hydrogen-bonding patterns in the N(9)-H protonated and N(7)-H tautomeric form of an N(6) -benzoyl-adenine salt: N (6)-benzoyl-adeninium nitrate.

    Science.gov (United States)

    Karthikeyan, Ammasai; Jeeva Jasmine, Nithianantham; Thomas Muthiah, Packianathan; Perdih, Franc

    2016-02-01

    In the title molecular salt, C12H10N5O(+)·NO3 (-), the adenine unit has an N (9)-protonated N(7)-H tautomeric form with non-protonated N(1) and N(3) atoms. The dihedral angle between the adenine ring system and the phenyl ring is 51.10 (10)°. The typical intra-molecular N(7)-H⋯O hydrogen bond with an S(7) graph-set motif is also present. The benzoyl-adeninium cations also form base pairs through N-H⋯O and C-H⋯N hydrogen bonds involving the Watson-Crick face of the adenine ring and the C and O atoms of the benzoyl ring of an adjacent cation, forming a supra-molecular ribbon with R 2 (2)(9) rings. Benzoyl-adeninum cations are also bridged by one of the oxygen atoms of the nitrate anion, which acts as a double acceptor, forming a pair of N-H⋯O hydrogen bonds to generate a second ribbon motif. These ribbons together with π-π stacking inter-actions between the phenyl ring and the five- and six-membered adenine rings of adjacent mol-ecules generate a three-dimensional supra-molecular architecture.

  12. Hydration sites of unpaired RNA bases: a statistical analysis of the PDB structures

    Directory of Open Access Journals (Sweden)

    Carugo Oliviero

    2011-10-01

    Full Text Available Abstract Background Hydration is crucial for RNA structure and function. X-ray crystallography is the most commonly used method to determine RNA structures and hydration and, therefore, statistical surveys are based on crystallographic results, the number of which is quickly increasing. Results A statistical analysis of the water molecule distribution in high-resolution X-ray structures of unpaired RNA nucleotides showed that: different bases have the same penchant to be surrounded by water molecules; clusters of water molecules indicate possible hydration sites, which, in some cases, match those of the major and minor grooves of RNA and DNA double helices; complex hydrogen bond networks characterize the solvation of the nucleotides, resulting in a significant rigidity of the base and its surrounding water molecules. Interestingly, the hydration sites around unpaired RNA bases do not match, in general, the positions that are occupied by the second nucleotide when the base-pair is formed. Conclusions The hydration sites around unpaired RNA bases were found. They do not replicate the atom positions of complementary bases in the Watson-Crick pairs.

  13. G-quadruplexes Significantly Stimulate Pif1 Helicase-catalyzed Duplex DNA Unwinding*

    Science.gov (United States)

    Duan, Xiao-Lei; Liu, Na-Nv; Yang, Yan-Tao; Li, Hai-Hong; Li, Ming; Dou, Shuo-Xing; Xi, Xu-Guang

    2015-01-01

    The evolutionarily conserved G-quadruplexes (G4s) are faithfully inherited and serve a variety of cellular functions such as telomere maintenance, gene regulation, DNA replication initiation, and epigenetic regulation. Different from the Watson-Crick base-pairing found in duplex DNA, G4s are formed via Hoogsteen base pairing and are very stable and compact DNA structures. Failure of untangling them in the cell impedes DNA-based transactions and leads to genome instability. Cells have evolved highly specific helicases to resolve G4 structures. We used a recombinant nuclear form of Saccharomyces cerevisiae Pif1 to characterize Pif1-mediated DNA unwinding with a substrate mimicking an ongoing lagging strand synthesis stalled by G4s, which resembles a replication origin and a G4-structured flap in Okazaki fragment maturation. We find that the presence of G4 may greatly stimulate the Pif1 helicase to unwind duplex DNA. Further studies reveal that this stimulation results from G4-enhanced Pif1 dimerization, which is required for duplex DNA unwinding. This finding provides new insights into the properties and functions of G4s. We discuss the observed activation phenomenon in relation to the possible regulatory role of G4s in the rapid rescue of the stalled lagging strand synthesis by helping the replicator recognize and activate the replication origin as well as by quickly removing the G4-structured flap during Okazaki fragment maturation. PMID:25627683

  14. Interaction of Cu(+) with cytosine and formation of i-motif-like C-M(+)-C complexes: alkali versus coinage metals.

    Science.gov (United States)

    Gao, Juehan; Berden, Giel; Rodgers, M T; Oomens, Jos

    2016-03-14

    The Watson-Crick structure of DNA is among the most well-known molecular structures of our time. However, alternative base-pairing motifs are also known to occur, often depending on base sequence, pH, or the presence of cations. Pairing of cytosine (C) bases induced by the sharing of a single proton (C-H(+)-C) may give rise to the so-called i-motif, which occurs primarily in expanded trinucleotide repeats and the telomeric region of DNA, particularly at low pH. At physiological pH, silver cations were recently found to stabilize C dimers in a C-Ag(+)-C structure analogous to the hemiprotonated C-dimer. Here we use infrared ion spectroscopy in combination with density functional theory calculations at the B3LYP/6-311G+(2df,2p) level to show that copper in the 1+ oxidation state induces an analogous formation of C-Cu(+)-C structures. In contrast to protons and these transition metal ions, alkali metal ions induce a different dimer structure, where each ligand coordinates the alkali metal ion in a bidentate fashion in which the N3 and O2 atoms of both cytosine ligands coordinate to the metal ion, sacrificing hydrogen-bonding interactions between the ligands for improved chelation of the metal cation.

  15. Pair production by a superhard photon in a crystal

    International Nuclear Information System (INIS)

    Kalashnikov, N.P.; Kovalev, G.V.; Strikhanov, M.N.

    1980-01-01

    Electron-positron pair production by a hard photon moving almost parallelly to the crystallographic axis or monocrystal plane is considered. Calculation is conducted of the production differential by the energies of pair components and total cross section of pair production in the case when primary photon moved at a small angle THETA 0 m 2 /U [ru

  16. Evolution of closely linked gene pairs in vertebrate genomes

    NARCIS (Netherlands)

    Franck, E.; Hulsen, T.; Huynen, M.A.; Jong, de W.W.; Lunsen, N.H.; Madsen, O.

    2008-01-01

    The orientation of closely linked genes in mammalian genomes is not random: there are more head-to-head (h2h) gene pairs than expected. To understand the origin of this enrichment in h2h gene pairs, we have analyzed the phylogenetic distribution of gene pairs separated by less than 600 bp of

  17. (RN) pair production by photons in a hot Maxwellian plasma

    International Nuclear Information System (INIS)

    Haug, E.

    2004-01-01

    The production of electron-positron pairs by photons in the Coulomb Field of electrons and positrons (triplet production) in hot thermal plasmas is investigated. The pair production rate for this process is calculated as a function of the photon energy and compared with the rate of photon-nucleus pair production for semi-relativistic and relativistic plasma temperatures. (author)

  18. A Golub-Kahan-type reduction method for matrix pairs

    NARCIS (Netherlands)

    Hochstenbach, M.E.; Reichel, L.; Yu, X.

    2015-01-01

    We describe a novel method for reducing a pair of large matrices {A;B} to a pair of small matrices {H;K}. The method is an extension of Golub-Kahan bidiagonalization to matrix pairs, and simplifies to the latter method when B is the identity matrix. Applications to Tikhonov regularization of large

  19. A Golub-Kahan-type reduction method for matrix pairs

    NARCIS (Netherlands)

    Hochstenbach, M.E.; Reichel, L.; Yu, X.

    2015-01-01

    We describe a novel method for reducing a pair of large matrices {A,B} to a pair of small matrices {H,K}. The method is an extension of Golub–Kahan bidiagonalization to matrix pairs, and simplifies to the latter method when B is the identity matrix. Applications to Tikhonov regularization of large

  20. On extensions of wavelet systems to dual pairs of frames

    DEFF Research Database (Denmark)

    Christensen, Ole; Kim, Hong Oh; Kim, Rae Young

    2015-01-01

    It is an open problem whether any pair of Bessel sequences with wavelet structure can be extended to a pair of dual frames by adding a pair of singly generated wavelet systems. We consider the particular case where the given wavelet systems are generated by the multiscale setup with trigonometric...

  1. QSO Pairs across Active Galaxies: Evidence of Blueshifts? D. Basu

    Indian Academy of Sciences (India)

    2006-12-04

    Dec 4, 2006 ... Abstract. Several QSO pairs have been reported and their redshifts determined, where the two objects in each pair are located across an active galaxy. The usually accepted explanation of such occurrences is that the pair is ejected from the parent galaxy. Currently interpreted redshifted spec- tra for both ...

  2. Sharp corners as sources of spiral pairs

    International Nuclear Information System (INIS)

    Biton, Y.; Rabinovitch, A.; Braunstein, D.; Friedman, M.; Aviram, I.

    2010-01-01

    It is demonstrated that using the FitzHugh-Nagumo model, stimulation of excitable media inside a region possessing sharp corners, can lead to the appearance of sources of spiral-pairs of sustained activity. The two conditions for such source creation are: The corners should be less than 120 deg. and the range of stimulating amplitudes should be small, occurring just above the threshold value and decreasing with the corner angle. The basic mechanisms driving the phenomenon are discussed. These include: A. If the corner angle is below 120 deg., the wave generated inside cannot emerge at the corner tip, resulting in the creation of two free edges which start spiraling towards each other. B. Spiraling must be strong enough; otherwise annihilation of the rotating arms would occur too soon to create a viable source. C. The intricacies of the different radii involved are elucidated. Possible applications in heart stimulation and in chemical reactions are considered.

  3. Neutron area monitor with TLD pairs

    International Nuclear Information System (INIS)

    Guzman G, K. A.; Borja H, C. G.; Valero L, C.; Hernandez D, V. M.; Vega C, H. R.

    2011-11-01

    The response of a passive neutron area monitor with pairs of thermoluminescent dosimeters has been calculated using the Monte Carlo code MCNP5. The response was calculated for one TLD 600 located at the center of a polyethylene cylinder, as moderator. When neutrons collide with the moderator lose their energy reaching the TLD with thermal energies where the ambient dose equivalent is calculated. The response was calculated for 47 monoenergetic neutron sources ranging from 1E(-9) to 20 MeV. Response was calculated using two irradiation geometries, one with an upper source and another with a lateral source. For both irradiation schemes the response was calculated with the TLDs in two positions, one parallel to the source and another perpendicular to the source. The advantage of this passive neutron monitor area is that can be used in locations with intense, pulsed and mixed radiation fields. (Author)

  4. Radiative corrections for the leptonic pair production

    Energy Technology Data Exchange (ETDEWEB)

    Elend, H H

    1971-01-01

    The one-photon bremsstrahlung correction for symmetrical lepton pair production is newly calculated. For this, from all the Feynman diagrams, the subset is picked out for this process which essentially contributes to the symmetrical case. The matrix element square value for the chosen sub-set is expressed by the Bethe-Heitler matrix element square value provided with certain kinematic factors (Huld relationship), where a) a development after the energy of the Bremsquantum, assumed to be small, is carried out and the series is cut off after the second term beyond the infrared section, b) a high-energy approximation is made. Furthermore, c) the structure of the target nucleus and of the recoil transfered to it is neglected, d) the integration on the phase space of the bremsquantitum is carried out with a peaking approximation. All these approximations are individually discussed, and the validity limits which they set for the bremsstrahlung in the result are accurately given.

  5. One Monopole-Antimonopole Pair Solutions

    International Nuclear Information System (INIS)

    Teh, Rosy; Wong, K.-M.

    2009-01-01

    We present new classical generalized one monopole-antimonopole pair solutions of the SU(2) Yang-Mills-Higgs theory with the Higgs field in the adjoint representation. We show that in general the one monopole-antimonopole solution need not be solved by imposing mθ-winding number to be integer greater than one. We also show that this solution can be solved when m = 1 by transforming the large distance asymptotic solutions to general solutions that depend on a parameter p. Secondly we show that these large distance asymptotic solutions can be further generalized to the Jacobi elliptic functions. We focus our numerical calculation on the Jacobi elliptic functions solution when the nφ-winding number is one and show that this generalized Jacobi elliptic 1-MAP solution possesses lower energy. All these solutions are numerical finite energy non-BPS solutions of the Yang-Mills-Higgs field theory.

  6. An advanced KB mirror pair for microfocusing

    CERN Document Server

    Ferme, J J

    2001-01-01

    A new range of micro-focusing mirrors based on KB pairs has been developed by SESO for Beamline Nanospectroscopy at the Elettra Storage Ring in Trieste, Italy. Both the focusing and the aspheric shape are adjustable with stepper motors. The goal of the beamline is to have a high photon density spot with a variable size in the experimental chamber over the whole soft X-ray range. The estimated dimension of the final spot should be smaller than 4 mu m sup 2 FWHM, with a photon density of the order of 10 sup 1 sup 3 photons/s mu m sup 2; this may be achieved only by accepting an angular divergence on these mirrors of between 5 and 10 mrad. This condition can be fulfilled only with elliptical (or plane elliptical) mirrors with very limited residual slope errors (below 1 mu rad RMS) that are able to correct even small focal distance errors.

  7. Na Cl ion pair association in water-DMSO mixtures: Effect of ion pair ...

    Indian Academy of Sciences (India)

    The 12-6-1 potential model predicts running coordination numbers closest to experimental data. Keywords. ... value of interaction energy minimum between the Na. + and Cl. − ..... ion pair mostly remains as a CIP, a fair amount of SAIP is also ...

  8. Asteroid clusters similar to asteroid pairs

    Science.gov (United States)

    Pravec, P.; Fatka, P.; Vokrouhlický, D.; Scheeres, D. J.; Kušnirák, P.; Hornoch, K.; Galád, A.; Vraštil, J.; Pray, D. P.; Krugly, Yu. N.; Gaftonyuk, N. M.; Inasaridze, R. Ya.; Ayvazian, V. R.; Kvaratskhelia, O. I.; Zhuzhunadze, V. T.; Husárik, M.; Cooney, W. R.; Gross, J.; Terrell, D.; Világi, J.; Kornoš, L.; Gajdoš, Š.; Burkhonov, O.; Ehgamberdiev, Sh. A.; Donchev, Z.; Borisov, G.; Bonev, T.; Rumyantsev, V. V.; Molotov, I. E.

    2018-04-01

    We studied the membership, size ratio and rotational properties of 13 asteroid clusters consisting of between 3 and 19 known members that are on similar heliocentric orbits. By backward integrations of their orbits, we confirmed their cluster membership and estimated times elapsed since separation of the secondaries (the smaller cluster members) from the primary (i.e., cluster age) that are between 105 and a few 106 years. We ran photometric observations for all the cluster primaries and a sample of secondaries and we derived their accurate absolute magnitudes and rotation periods. We found that 11 of the 13 clusters follow the same trend of primary rotation period vs mass ratio as asteroid pairs that was revealed by Pravec et al. (2010). We generalized the model of the post-fission system for asteroid pairs by Pravec et al. (2010) to a system of N components formed by rotational fission and we found excellent agreement between the data for the 11 asteroid clusters and the prediction from the theory of their formation by rotational fission. The two exceptions are the high-mass ratio (q > 0.7) clusters of (18777) Hobson and (22280) Mandragora for which a different formation mechanism is needed. Two candidate mechanisms for formation of more than one secondary by rotational fission were published: the secondary fission process proposed by Jacobson and Scheeres (2011) and a cratering collision event onto a nearly critically rotating primary proposed by Vokrouhlický et al. (2017). It will have to be revealed from future studies which of the clusters were formed by one or the other process. To that point, we found certain further interesting properties and features of the asteroid clusters that place constraints on the theories of their formation, among them the most intriguing being the possibility of a cascade disruption for some of the clusters.

  9. PAIR'14 / PAIR'15 STUDENT CONFERENCES ON PLANNING IN ARTIFICIAL INTELLIGENCE AND ROBOTICS

    Directory of Open Access Journals (Sweden)

    Editorial Foreword

    2015-12-01

    Full Text Available Dear Readerthe original idea of the student conference on “Planning in Artificial Intelligence and Robotics” (PAIR is to join young researchers from particular laboratories in Czech Republic, where planning problems are investigated from artificial intelligence (AI or robotics points of view. The first year of PAIR has been organized at the Dept. of Computer Science, Faculty Electrical Engineering, Czech Technical University in 2014.At PAIR 2014, laboratories from Prague and Brno were presented. In particular, students and researchers from Charles University, Czech Technical University in Prague, Brno University of Technology, and Central European Institute of Technology participated at the event. Beside an introduction of the particular research groups and their topics, students presented contributions on their current research results. Ten papers were presented on topics ranging from domain–independent planning, trajectory planning to applications for unmanned aerial and legged robots. This first event provides us an initial experience with the community of young researchers in Czech Republic that are working planning in robotic or AI. Based on the success of PAIR 2014, we decided to continue with our effort to establish a suitable fora for students that are geographically very close, but usually do not meet, because of participation on different Robotics and AI events.The second student conference on Planning in Artificial Intelligence and Robotics (PAIR 2015 successfully continues the tradition of the first year of the conference organized in Prague. This year, the conference was collocated with 10th anniversary of RoboTour contest in Písek. This format enable us to extend the impact of the PAIR conference and improve the visibility of the growing student community. The conference reached a good amount of interesting papers focused on image processing for mobile robots, swarm control, driving simulation, robot control, or domain

  10. A natively paired antibody library yields drug leads with higher sensitivity and specificity than a randomly paired antibody library.

    Science.gov (United States)

    Adler, Adam S; Bedinger, Daniel; Adams, Matthew S; Asensio, Michael A; Edgar, Robert C; Leong, Renee; Leong, Jackson; Mizrahi, Rena A; Spindler, Matthew J; Bandi, Srinivasa Rao; Huang, Haichun; Tawde, Pallavi; Brams, Peter; Johnson, David S

    2018-04-01

    Deep sequencing and single-chain variable fragment (scFv) yeast display methods are becoming more popular for discovery of therapeutic antibody candidates in mouse B cell repertoires. In this study, we compare a deep sequencing and scFv display method that retains native heavy and light chain pairing with a related method that randomly pairs heavy and light chain. We performed the studies in a humanized mouse, using interleukin 21 receptor (IL-21R) as a test immunogen. We identified 44 high-affinity binder scFv with the native pairing method and 100 high-affinity binder scFv with the random pairing method. 30% of the natively paired scFv binders were also discovered with the randomly paired method, and 13% of the randomly paired binders were also discovered with the natively paired method. Additionally, 33% of the scFv binders discovered only in the randomly paired library were initially present in the natively paired pre-sort library. Thus, a significant proportion of "randomly paired" scFv were actually natively paired. We synthesized and produced 46 of the candidates as full-length antibodies and subjected them to a panel of binding assays to characterize their therapeutic potential. 87% of the antibodies were verified as binding IL-21R by at least one assay. We found that antibodies with native light chains were more likely to bind IL-21R than antibodies with non-native light chains, suggesting a higher false positive rate for antibodies from the randomly paired library. Additionally, the randomly paired method failed to identify nearly half of the true natively paired binders, suggesting a higher false negative rate. We conclude that natively paired libraries have critical advantages in sensitivity and specificity for antibody discovery programs.

  11. Demographic mechanisms of inbreeding adjustment through extra-pair reproduction.

    Science.gov (United States)

    Reid, Jane M; Duthie, A Bradley; Wolak, Matthew E; Arcese, Peter

    2015-07-01

    One hypothesis explaining extra-pair reproduction is that socially monogamous females mate with extra-pair males to adjust the coefficient of inbreeding (f) of extra-pair offspring (EPO) relative to that of within-pair offspring (WPO) they would produce with their socially paired male. Such adjustment of offspring f requires non-random extra-pair reproduction with respect to relatedness, which is in turn often assumed to require some mechanism of explicit pre-copulatory or post-copulatory kin discrimination. We propose three demographic processes that could potentially cause mean f to differ between individual females' EPO and WPO given random extra-pair reproduction with available males without necessarily requiring explicit kin discrimination. Specifically, such a difference could arise if social pairings formed non-randomly with respect to relatedness or persisted non-randomly with respect to relatedness, or if the distribution of relatedness between females and their sets of potential mates changed during the period through which social pairings persisted. We used comprehensive pedigree and pairing data from free-living song sparrows (Melospiza melodia) to quantify these three processes and hence investigate how individual females could adjust mean offspring f through instantaneously random extra-pair reproduction. Female song sparrows tended to form social pairings with unrelated or distantly related males slightly less frequently than expected given random pairing within the defined set of available males. Furthermore, social pairings between more closely related mates tended to be more likely to persist across years than social pairings between less closely related mates. However, these effects were small and the mean relatedness between females and their sets of potential extra-pair males did not change substantially across the years through which social pairings persisted. Our framework and analyses illustrate how demographic and social structuring within

  12. Isolated galaxies, pairs, and groups of galaxies

    International Nuclear Information System (INIS)

    Kuneva, I.; Kalinkov, M.

    1990-01-01

    The authors searched for isolated galaxies, pairs and groups of galaxies in the CfA survey (Huchra et al. 1983). It was assumed that the distances to galaxies are given by R = V/H sub o, where H sub o = 100 km s(exp -1) Mpc(exp -1) and R greater than 6 Mpc. The searching procedure is close to those, applied to find superclusters of galaxies (Kalinkov and Kuneva 1985, 1986). A sphere with fixed radius r (asterisk) is described around each galaxy. The mean spatial density in the sphere is m. Let G 1 be any galaxy and G 2 be its nearest neighbor at a distance R 2 . If R sub 2 exceeds the 95 percent quintile in the distribution of the distances of the second neighbors, then G 1 is an isolated galaxy. Let the midpoint of G 1 and G 2 be O 2 and r 2 =R 2 2. For the volume V 2 , defined with the radius r 2 , the density D 2 less than k mu, the galaxy G 2 is a single one and the procedure for searching for pairs and groups, beginning with this object is over and we have to pass to another object. Here the authors present the groups - isolated and nonisolated - with n greater than 3, found in the CfA survey in the Northern galactic hemisphere. The parameters used are k = 10 and r (asterisk) = 5 Mpc. Table 1 contains: (1) the group number, (2) the galaxy, nearest to the multiplet center, (3) multiplicity n, (4) the brightest galaxy if it is not listed in (2); (5) and (6) are R.A. and Dec. (1950), (7) - mean distance D in Mpc. Further there are the mean density rho (8) of the multiplet (galaxies Mpc (exp -3)), (9) the density rho (asterisk) for r (asterisk) = 5 Mpc and (10) the density rho sub g for the group with its nearest neighbor. The parenthesized digits for densities in the last three columns are powers of ten

  13. Investigation of tau pair production at PETRA

    International Nuclear Information System (INIS)

    Kuester, H.

    1983-11-01

    The reaction e + e - -> tau + tau - has been measured at center of mass energies around 34 GeV. The selection is sensitive to 93% of the tau pair decays, thus making possible a high identification efficiency of proportional 70% over a large solid angle. The total cross section has been measured to Rsub(tau) = sigmasub(tautau)/sigmasub(point) = .94 +- .06(stat.) +- .06(syst.). In the differential cross section a charge asymmetry of Asub(tau) = (-(9.0 +- 6.6)% was observed, corresponding to a tau axial vector coupling to the weak neutral current of asub(tau) = -.94 +- 0.69. Moreover, final states from the decays tau -> πν, tau -> eνν, and tau -> μνν have been isolated and branching ratios into these channels have been determined. From the inclusive momentum spectra of the observed decay products (including the channel tau -> rhoν) the forward backward asymmetry of tau polarization has been determined to Asub(p,tau) = -(1 +- 22)% which corresponds to vsub(tau) = -.1 +- 2.9. Tests on factorization are discussed. (orig.) [de

  14. Perpendicular relativistic shocks in magnetized pair plasma

    Science.gov (United States)

    Plotnikov, Illya; Grassi, Anna; Grech, Mickael

    2018-04-01

    Perpendicular relativistic (γ0 = 10) shocks in magnetized pair plasmas are investigated using two dimensional Particle-in-Cell simulations. A systematic survey, from unmagnetized to strongly magnetized shocks, is presented accurately capturing the transition from Weibel-mediated to magnetic-reflection-shaped shocks. This transition is found to occur for upstream flow magnetizations 10-3 10-2, it leaves place to a purely electromagnetic precursor following from the strong emission of electromagnetic waves at the shock front. Particle acceleration is found to be efficient in weakly magnetized perpendicular shocks in agreement with previous works, and is fully suppressed for σ > 10-2. Diffusive Shock Acceleration is observed only in weakly magnetized shocks, while a dominant contribution of Shock Drift Acceleration is evidenced at intermediate magnetizations. The spatial diffusion coefficients are extracted from the simulations allowing for a deeper insight into the self-consistent particle kinematics and scale with the square of the particle energy in weakly magnetized shocks. These results have implications for particle acceleration in the internal shocks of AGN jets and in the termination shocks of Pulsar Wind Nebulae.

  15. Development of pair distribution function analysis

    International Nuclear Information System (INIS)

    Vondreele, R.; Billinge, S.; Kwei, G.; Lawson, A.

    1996-01-01

    This is the final report of a 3-year LDRD project at LANL. It has become more and more evident that structural coherence in the CuO 2 planes of high-T c superconducting materials over some intermediate length scale (nm range) is important to superconductivity. In recent years, the pair distribution function (PDF) analysis of powder diffraction data has been developed for extracting structural information on these length scales. This project sought to expand and develop this technique, use it to analyze neutron powder diffraction data, and apply it to problems. In particular, interest is in the area of high-T c superconductors, although we planned to extend the study to the closely related perovskite ferroelectric materials andother materials where the local structure affects the properties where detailed knowledge of the local and intermediate range structure is important. In addition, we planned to carry out single crystal experiments to look for diffuse scattering. This information augments the information from the PDF

  16. Efficient Implementation of the Pairing on Mobilephones Using BREW

    Science.gov (United States)

    Yoshitomi, Motoi; Takagi, Tsuyoshi; Kiyomoto, Shinsaku; Tanaka, Toshiaki

    Pairing based cryptosystems can accomplish novel security applications such as ID-based cryptosystems, which have not been constructed efficiently without the pairing. The processing speed of the pairing based cryptosystems is relatively slow compared with the other conventional public key cryptosystems. However, several efficient algorithms for computing the pairing have been proposed, namely Duursma-Lee algorithm and its variant ηT pairing. In this paper, we present an efficient implementation of the pairing over some mobilephones. Moreover, we compare the processing speed of the pairing with that of the other standard public key cryptosystems, i. e. RSA cryptosystem and elliptic curve cryptosystem. Indeed the processing speed of our implementation in ARM9 processors on BREW achieves under 100 milliseconds using the supersingular curve over F397. In addition, the pairing is more efficient than the other public key cryptosystems, and the pairing can be achieved enough also on BREW mobilephones. It has become efficient enough to implement security applications, such as short signature, ID-based cryptosystems or broadcast encryption, using the pairing on BREW mobilephones.

  17. Observing Pair-Work Task in an English Speaking Class

    Directory of Open Access Journals (Sweden)

    Diana Achmad

    2014-01-01

    Full Text Available This paper reports on students’ pair-work interactions to develop their speaking skills in an ELT classroom which consisted of international learners. A number of 16 learners of intermediate proficiency with IELTS score band 5.5 were observed. The teacher had paired those he considered among them to be the more competent ones (hereafter, stronger with the less competent ones (hereafter, weaker; therefore, eight pairs were observed during the lesson. The task given to the students was to express ‘Agree and Disagree’ in the context of giving opinions related to social life. Based on the observations, the task was successfully implemented by six pairs; thus, the two others faced some problems. From the first pair, it was seen that the stronger student had intimated the weaker one into speaking during the task. The other pair, who was both of the same native, did not converse in English as expected and mostly used their native language to speak with one another presumably due to respect from the stronger student towards the weaker one. In situations like this, when pair-work becomes unproductive, rotating pairs is recommended to strengthen information sharing and assigning roles to avoid a student from taking over the activity from his or her pair. In conclusion, pairing international learners with mixed speaking proficiency by teachers must be conducted as effectively as possible by initially identifying their ability and learning culture to profoundly expand the students’ language resources.

  18. Topological Nodal Cooper Pairing in Doped Weyl Metals

    Science.gov (United States)

    Li, Yi; Haldane, F. D. M.

    2018-02-01

    We generalize the concept of Berry connection of the single-electron band structure to that of a two-particle Cooper pairing state between two Fermi surfaces with opposite Chern numbers. Because of underlying Fermi surface topology, the pairing Berry phase acquires nontrivial monopole structure. Consequently, pairing gap functions have topologically protected nodal structure as vortices in the momentum space with the total vorticity solely determined by the pair monopole charge qp. The nodes of gap function behave as the Weyl-Majorana points of the Bogoliubov-de Gennes pairing Hamiltonian. Their relation with the connection patterns of the surface modes from the Weyl band structure and the Majorana surface modes inside the pairing gap is also discussed. Under the approximation of spherical Fermi surfaces, the pairing symmetry are represented by monopole harmonic functions. The lowest possible pairing channel carries angular momentum number j =|qp|, and the corresponding gap functions are holomorphic or antiholomorphic functions on Fermi surfaces. After projected on the Fermi surfaces with nontrivial topology, all the partial-wave channels of pairing interactions acquire the monopole charge qp independent of concrete pairing mechanism.

  19. Pulsar Pair Cascades in Magnetic Fields with Offset Polar Caps

    Science.gov (United States)

    Harding, Alice K.; Muslimov, Alex G.

    2012-01-01

    Neutron star magnetic fields may have polar caps (PC) that are offset from the dipole axis, through field-line sweepback near the light cylinder or non-symmetric currents within the star. The effects of such offsets on electron-positron pair cascades are investigated, using simple models of dipole magnetic fields with small distortions that shift the PCs by different amounts or directions. Using a Monte Carlo pair cascade simulation, we explore the changes in the pair spectrum, multiplicity and energy flux across the PC, as well as the trends in pair flux and pair energy flux with spin-down luminosity, L(sub sd). We also give an estimate of the distribution of heating flux from returning positrons on the PC for different offsets. We find that even modest offsets can produce significant increases in pair multiplicity, especially for pulsars that are near or beyond the pair death lines for centered PCs, primarily because of higher accelerating fields. Pair spectra cover several decades in energy, with the spectral range of millisecond pulsars (MSPs) two orders of magnitude higher than for normal pulsars, and PC offsets allow significant extension of all spectra to lower pair energies. We find that the total PC pair luminosity L(sub pair) is proportional to L(sub sd), with L(sub pair) approximates 10(exp -3) L(sub sd) for normal pulsars and L(sub pair) approximates 10(exp -2) L(sub sd) for MSPs. Remarkably, the total PC heating luminosity for even large offsets increases by less than a factor of two, even though the PC area increases by much larger factors, because most of the heating occurs near the magnetic axis.

  20. PLANNING IN ARTIFICIAL INTELLIGENCE AND ROBOTICS (PAIR

    Directory of Open Access Journals (Sweden)

    Editorial, Foreword

    2016-11-01

    Full Text Available September 18th, 2016Deggendorf, Germanyhttp://robotics.fel.cvut.cz/pair16/Organized by: Artificial Intelligence Center Department of Computer Science Faculty of Electrical Engineering Czech Technical University in PragueTechnicka 2, Prague 6, 166 27, Czech RepublicGuest editors:Jan Faigl (Artificial Intelligence Center, Department of Computer Science, Faculty of Electrical Engineering, Czech Technical University in PragueJiří Vokřínek (Artificial Intelligence Center, Department of Computer Science, Faculty of Electrical Engineering, Czech Technical University in PragueScientific comittee:D. Belter (Poznań University of Technology, PolandW. Dorner (Technische Hochschule Deggendorf, GermanyJ. Faigl (Czech Technical University in PragueT. Krajník (University of Lincoln, United KingdomA. Komenda (Czech Technical University in PragueG. Kupris (Technische Hochschule Deggendorf, GermanyM. Rollo (Czech Technical University in PragueM. Saska (Czech Technical University in PragueJ. Vokřínek (Czech Technical University in PragueV. Vonásek (Czech Technical University in PragueK. Walas (Poznań University of Technology, Poland Foreword:The third year of the student conference on “Planning in Artificial Intelligence and Robotics” (PAIR continues in joining young researchers and students interested in robotics and artificial intelligence. In 2016, we follow the schema of the last year as a joint event with the RoboTour competition in Deggendorf, Germany. Thanks to the great collaboration with Gerald Kupris and Wolfgang Donner from Technische Hochschule Deggendorf and support from Czech Technical University under project No. SVK 26/16/F3 and Bayerisches Staatsministerium der Finanzen, für Landesentwicklung und Heimat, we have been able to provide accommodations and travel support to participants and an invited speaker. Fourteen papers have accepted and listed in the conference program. The papers have been authored by students from Central Europe

  1. Hidden Pair of Supermassive Black Holes

    Science.gov (United States)

    Kohler, Susanna

    2015-08-01

    Could a pair of supermassive black holes (SMBHs) be lurking at the center of the galaxy Mrk 231? A recent study finds that this may be the case and the unique spectrum of this galaxy could be the key to discovering more hidden binary SMBH systems.Where Are the Binary Supermassive Black Holes?Its believed that most, if not all, galaxies have an SMBH at their centers. As two galaxies merge, the two SMBHs should evolve into a closely-bound binary system before they eventually merge. Given the abundance of galaxy mergers, we would expect to see the kinematic and visual signatures of these binary SMBHs among observed active galactic nuclei yet such evidence for sub-parsec binary SMBH systems remains scarce and ambiguous. This has led researchers to wonder: is there another way that we might detect these elusive systems?A collaboration led by Chang-Shuo Yan (National Astronomical Observatories, Chinese Academy of Sciences) thinks that there is. The group suggests that these systems might have distinct signatures in their optical-to-UV spectra, and they identify a system that might be just such a candidate: Mrk 231.A Binary CandidateProposed model of Mrk 231. Two supermassive black holes, each with their own mini-disk, orbit each other in the center of a circumbinary disk. The secondary black hole has cleared gap in the circumbinary disk as a result of its orbit around the primary black hole. [Yan et al. 2015]Mrk 231 is a galaxy with a disturbed morphology and tidal tails strong clues that it might be in the final stages of a galactic merger. In addition to these signs, Mrk 231 also has an unusual spectrum for a quasar: its continuum emission displays an unexpected drop in the near-UV band.Yan and her collaborators propose that the odd behavior of Mrk 231s spectrum can be explained if the center of the galaxy houses a pair of SMBHs each with its own mini accretion disk surrounded by a circumbinary accretion disk. As the secondary SMBH orbits the primary SMBH (with a

  2. Stereo Pair, Salt Lake City, Utah

    Science.gov (United States)

    2002-01-01

    The 2002 Winter Olympics are hosted by Salt Lake City at several venues within the city, in nearby cities, and within the adjacent Wasatch Mountains. This image pair provides a stereoscopic map view of north central Utah that includes all of these Olympic sites. In the south, next to Utah Lake, Provo hosts the ice hockey competition. In the north, northeast of the Great Salt Lake, Ogden hosts curling and the nearby Snowbasin ski area hosts the downhill events. In between, southeast of the Great Salt Lake, Salt Lake City hosts the Olympic Village and the various skating events. Further east, across the Wasatch Mountains, the Park City ski resort hosts the bobsled, ski jumping, and snowboarding events. The Winter Olympics are always hosted in mountainous terrain. This view shows the dramatic landscape that makes the Salt Lake City region a world-class center for winter sports.This stereoscopic image was generated by draping a Landsat satellite image over a Shuttle Radar Topography Mission digital elevation model. Two differing perspectives were then calculated, one for each eye. They can be seen in 3-D by viewing the left image with the right eye and the right image with the left eye (cross-eyed viewing or by downloading and printing the image pair and viewing them with a stereoscope. When stereoscopically merged, the result is a vertically exaggerated view of Earth's surface in its full three dimensions.Landsat has been providing visible and infrared views of the Earth since 1972. SRTM elevation data matches the 30-meter (98-foot) resolution of most Landsat images and will substantially help in analyzing the large and growing Landsat image archive, managed by the U.S. Geological Survey (USGS).Elevation data used in this image was acquired by the Shuttle Radar Topography Mission (SRTM) aboard the Space Shuttle Endeavour, launched on Feb. 11, 2000. SRTM used the same radar instrument that comprised the Spaceborne Imaging Radar-C/X-Band Synthetic Aperture Radar (SIR

  3. Electron Microscopic Visualization of Protein Assemblies on Flattened DNA Origami.

    Science.gov (United States)

    Mallik, Leena; Dhakal, Soma; Nichols, Joseph; Mahoney, Jacob; Dosey, Anne M; Jiang, Shuoxing; Sunahara, Roger K; Skiniotis, Georgios; Walter, Nils G

    2015-07-28

    DNA provides an ideal substrate for the engineering of versatile nanostructures due to its reliable Watson-Crick base pairing and well-characterized conformation. One of the most promising applications of DNA nanostructures arises from the site-directed spatial arrangement with nanometer precision of guest components such as proteins, metal nanoparticles, and small molecules. Two-dimensional DNA origami architectures, in particular, offer a simple design, high yield of assembly, and large surface area for use as a nanoplatform. However, such single-layer DNA origami were recently found to be structurally polymorphous due to their high flexibility, leading to the development of conformationally restrained multilayered origami that lack some of the advantages of the single-layer designs. Here we monitored single-layer DNA origami by transmission electron microscopy (EM) and discovered that their conformational heterogeneity is dramatically reduced in the presence of a low concentration of dimethyl sulfoxide, allowing for an efficient flattening onto the carbon support of an EM grid. We further demonstrated that streptavidin and a biotinylated target protein (cocaine esterase, CocE) can be captured at predesignated sites on these flattened origami while maintaining their functional integrity. Our demonstration that protein assemblies can be constructed with high spatial precision (within ∼2 nm of their predicted position on the platforms) by using strategically flattened single-layer origami paves the way for exploiting well-defined guest molecule assemblies for biochemistry and nanotechnology applications.

  4. Replicative DNA polymerase mutations in cancer.

    Science.gov (United States)

    Heitzer, Ellen; Tomlinson, Ian

    2014-02-01

    Three DNA polymerases - Pol α, Pol δ and Pol ɛ - are essential for DNA replication. After initiation of DNA synthesis by Pol α, Pol δ or Pol ɛ take over on the lagging and leading strand respectively. Pol δ and Pol ɛ perform the bulk of replication with very high fidelity, which is ensured by Watson-Crick base pairing and 3'exonuclease (proofreading) activity. Yeast models have shown that mutations in the exonuclease domain of Pol δ and Pol ɛ homologues can cause a mutator phenotype. Recently, we identified germline exonuclease domain mutations (EDMs) in human POLD1 and POLE that predispose to 'polymerase proofreading associated polyposis' (PPAP), a disease characterised by multiple colorectal adenomas and carcinoma, with high penetrance and dominant inheritance. Moreover, somatic EDMs in POLE have also been found in sporadic colorectal and endometrial cancers. Tumors with EDMs are microsatellite stable and show an 'ultramutator' phenotype, with a dramatic increase in base substitutions. Copyright © 2014 The Authors. Published by Elsevier Ltd.. All rights reserved.

  5. Germline and somatic polymerase ε and δ mutations define a new class of hypermutated colorectal and endometrial cancers.

    Science.gov (United States)

    Briggs, Sarah; Tomlinson, Ian

    2013-06-01

    Polymerases ε and δ are the main enzymes that replicate eukaryotic DNA. Accurate replication occurs through Watson-Crick base pairing and also through the action of the polymerases' exonuclease (proofreading) domains. We have recently shown that germline exonuclease domain mutations (EDMs) of POLE and POLD1 confer a high risk of multiple colorectal adenomas and carcinoma (CRC). POLD1 mutations also predispose to endometrial cancer (EC). These mutations are associated with high penetrance and dominant inheritance, although the phenotype can be variable. We have named the condition polymerase proofreading-associated polyposis (PPAP). Somatic POLE EDMs have also been found in sporadic CRCs and ECs, although very few somatic POLD1 EDMs have been detected. Both the germline and the somatic DNA polymerase EDMs cause an 'ultramutated', apparently microsatellite-stable, type of cancer, sometimes leading to over a million base substitutions per tumour. Here, we present the evidence for POLE and POLD1 as important contributors to the pathogenesis of CRC and EC, and highlight some of the key questions in this emerging field. Copyright © 2013 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd.

  6. Hydrogen-Bonding Capability of a Templating Difluorotoluene Nucleotide Residue in an RB69 DNA Polymerase Ternary Complex

    Energy Technology Data Exchange (ETDEWEB)

    Xia, Shuangluo; Konigsberg, William H.; Wang, Jimin (Yale)

    2011-08-29

    Results obtained using 2,4-difluorotoluene nucleobase (dF) as a nonpolar thymine isostere by Kool and colleagues challenged the Watson-Crick dogma that hydrogen bonds between complementary bases are an absolute requirement for accurate DNA replication. Here, we report crystal structure of an RB69 DNA polymerase L561A/S565G/Y567A triple mutant ternary complex with a templating dF opposite dTTP at 1.8 {angstrom}-resolution. In this structure, direct hydrogen bonds were observed between: (i) dF and the incoming dTTP, (ii) dF and residue G568 of the polymerase, and (iii) dF and ordered water molecules surrounding the nascent base pair. Therefore, this structure provides evidence that a templating dF can form novel hydrogen bonds with the incoming dTTP and with the enzyme that differ from those formed with a templating dT.

  7. Theoretical studies on the electronic and optoelectronic properties of [A.2AP(w)/A*.2AP(WC)/C.2AP(w)/C*.2AP(WC)/C.A(w)/C*.A(WC)]-Au8 mismatch nucleobase complexes

    Science.gov (United States)

    Srivastava, Ruby

    2018-01-01

    The electronic and optoelectronic properties of [A.2AP(w)/A*.2AP(WC)/C.2AP(w)/C*.2AP(WC)/C.A(w)/ C*.A(WC)]-Au8 metal-mismatch nucleobase complexes are investigated by means of density functional theory and time-dependent methods. We selected these mispairs as 2-aminopurine (2AP) produces incorporation errors when binding with cytosine (C) into the wobble (w) C.2AP(w) mispair, and is tautomerised into Watson-Crick (WC)-like base mispair C*.2AP(WC) and less effectively produces A.2AP(w)/A*.2AP(WC) mispairs. The vertical ionisation potential, vertical electron affinity, hardness and electrophilicity index of these complexes have also been discussed. The modifications of energy levels and charge density distributions of the frontier orbitals are also analysed. The absorption spectra of these complexes lie in the visible region, which suggests their application in fluorescent-bio imaging. The mechanism of cooperativity effect is studied by molecular orbital potential (MEP), atoms-in-molecules (AIM) and natural bond orbital analyses. Most metalated pairs have smaller HOMO-LUMO band gaps than the isolated mismatch nucleobases which suggest interesting consequences for electron transfer through DNA duplexes.

  8. Structure of human DNA polymerase iota and the mechanism of DNA synthesis.

    Science.gov (United States)

    Makarova, A V; Kulbachinskiy, A V

    2012-06-01

    Cellular DNA polymerases belong to several families and carry out different functions. Highly accurate replicative DNA polymerases play the major role in cell genome replication. A number of new specialized DNA polymerases were discovered at the turn of XX-XXI centuries and have been intensively studied during the last decade. Due to the special structure of the active site, these enzymes efficiently perform synthesis on damaged DNA but are characterized by low fidelity. Human DNA polymerase iota (Pol ι) belongs to the Y-family of specialized DNA polymerases and is one of the most error-prone enzymes involved in DNA synthesis. In contrast to other DNA polymerases, Pol ι is able to use noncanonical Hoogsteen interactions for nucleotide base pairing. This allows it to incorporate nucleotides opposite various lesions in the DNA template that impair Watson-Crick interactions. Based on the data of X-ray structural analysis of Pol ι in complexes with various DNA templates and dNTP substrates, we consider the structural peculiarities of the Pol ι active site and discuss possible mechanisms that ensure the unique behavior of the enzyme on damaged and undamaged DNA.

  9. Triple-helix molecular switch-based aptasensors and DNA sensors.

    Science.gov (United States)

    Bagheri, Elnaz; Abnous, Khalil; Alibolandi, Mona; Ramezani, Mohammad; Taghdisi, Seyed Mohammad

    2018-07-15

    Utilization of traditional analytical techniques is limited because they are generally time-consuming and require high consumption of reagents, complicated sample preparation and expensive equipment. Therefore, it is of great interest to achieve sensitive, rapid and simple detection methods. It is believed that nucleic acids assays, especially aptamers, are very important in modern life sciences for target detection and biological analysis. Aptamers and DNA-based sensors have been widely used for the design of various sensors owing to their unique features. In recent years, triple-helix molecular switch (THMS)-based aptasensors and DNA sensors have been broadly utilized for the detection and analysis of different targets. The THMS relies on the formation of DNA triplex via Watson-Crick and Hoogsteen base pairings under optimal conditions. This review focuses on recent progresses in the development and applications of electrochemical, colorimetric, fluorescence and SERS aptasensors and DNA sensors, which are based on THMS. Also, the advantages and drawbacks of these methods are discussed. Copyright © 2018 Elsevier B.V. All rights reserved.

  10. Label-Free Potentiometry for Detecting DNA Hybridization Using Peptide Nucleic Acid and DNA Probes

    Directory of Open Access Journals (Sweden)

    Yuji Miyahara

    2013-02-01

    Full Text Available Peptide nucleic acid (PNA has outstanding affinity over DNA for complementary nucleic acid sequences by forming a PNA-DNA heterodimer upon hybridization via Watson-Crick base-pairing. To verify whether PNA probes on an electrode surface enhance sensitivity for potentiometric DNA detection or not, we conducted a comparative study on the hybridization of PNA and DNA probes on the surface of a 10-channel gold electrodes microarray. Changes in the charge density as a result of hybridization at the solution/electrode interface on the self-assembled monolayer (SAM-formed microelectrodes were directly transformed into potentiometric signals using a high input impedance electrometer. The charge readout allows label-free, reagent-less, and multi-parallel detection of target oligonucleotides without any optical assistance. The differences in the probe lengths between 15- to 22-mer dramatically influenced on the sensitivity of the PNA and DNA sensors. Molecular type of the capturing probe did not affect the degree of potential shift. Theoretical model for charged rod-like duplex using the Gouy-Chapman equation indicates the dominant effect of electrostatic attractive forces between anionic DNA and underlying electrode at the electrolyte/electrode interface in the potentiometry.

  11. Base Sequence Context Effects on Nucleotide Excision Repair

    Directory of Open Access Journals (Sweden)

    Yuqin Cai

    2010-01-01

    Full Text Available Nucleotide excision repair (NER plays a critical role in maintaining the integrity of the genome when damaged by bulky DNA lesions, since inefficient repair can cause mutations and human diseases notably cancer. The structural properties of DNA lesions that determine their relative susceptibilities to NER are therefore of great interest. As a model system, we have investigated the major mutagenic lesion derived from the environmental carcinogen benzo[a]pyrene (B[a]P, 10S (+-trans-anti-B[a]P-2-dG in six different sequence contexts that differ in how the lesion is positioned in relation to nearby guanine amino groups. We have obtained molecular structural data by NMR and MD simulations, bending properties from gel electrophoresis studies, and NER data obtained from human HeLa cell extracts for our six investigated sequence contexts. This model system suggests that disturbed Watson-Crick base pairing is a better recognition signal than a flexible bend, and that these can act in concert to provide an enhanced signal. Steric hinderance between the minor groove-aligned lesion and nearby guanine amino groups determines the exact nature of the disturbances. Both nearest neighbor and more distant neighbor sequence contexts have an impact. Regardless of the exact distortions, we hypothesize that they provide a local thermodynamic destabilization signal for repair.

  12. Sequence- and structure-dependent DNA base dynamics: Synthesis, structure, and dynamics of site and sequence specifically spin-labeled DNA

    International Nuclear Information System (INIS)

    Spaltenstein, A.; Robinson, B.H.; Hopkins, P.B.

    1989-01-01

    A nitroxide spin-labeled analogue of thymidine (1a), in which the methyl group is replaced by an acetylene-tethered nitroxide, was evaluated as a probe for structural and dynamics studies of sequence specifically spin-labeled DNA. Residue 1a was incorporated into synthetic deoxyoligonucleotides by using automated phosphite triester methods. 1 H NMR, CD, and thermal denaturation studies indicate that 1a (T) does not significantly alter the structure of 5'-d(CGCGAATT*CGCG) from that of the native dodecamer. EPR studies on monomer, single-stranded, and duplexed DNA show that 1a readily distinguishes environments of different rigidity. Comparison of the general line-shape features of the observed EPR spectra of several small duplexes (12-mer, 24-mer) with simulated EPR spectra assuming isotropic motion suggests that probe 1a monitors global tumbling of small duplexes. Increasing the length of the DNA oligomers results in significant deviation from isotropic motion, with line-shape features similar to those of calculated spectra of objects with isotropic rotational correlation times of 20-100 ns. EPR spectra of a spin-labeled GT mismatch and a T bulge in long DNAs are distinct from those of spin-labeled Watson-Crick paired DNAs, further demonstrating the value of EPR as a tool in the evaluation of local dynamic and structural features in macromolecules

  13. Toward transferable interatomic van der Waals interactions without electrons: The role of multipole electrostatics and many-body dispersion

    International Nuclear Information System (INIS)

    Bereau, Tristan; Lilienfeld, O. Anatole von

    2014-01-01

    We estimate polarizabilities of atoms in molecules without electron density, using a Voronoi tesselation approach instead of conventional density partitioning schemes. The resulting atomic dispersion coefficients are calculated, as well as many-body dispersion effects on intermolecular potential energies. We also estimate contributions from multipole electrostatics and compare them to dispersion. We assess the performance of the resulting intermolecular interaction model from dispersion and electrostatics for more than 1300 neutral and charged, small organic molecular dimers. Applications to water clusters, the benzene crystal, the anti-cancer drug ellipticine—intercalated between two Watson-Crick DNA base pairs, as well as six macro-molecular host-guest complexes highlight the potential of this method and help to identify points of future improvement. The mean absolute error made by the combination of static electrostatics with many-body dispersion reduces at larger distances, while it plateaus for two-body dispersion, in conflict with the common assumption that the simple 1/R 6 correction will yield proper dissociative tails. Overall, the method achieves an accuracy well within conventional molecular force fields while exhibiting a simple parametrization protocol

  14. A model capturing novel strand symmetries in bacterial DNA

    International Nuclear Information System (INIS)

    Sobottka, Marcelo; Hart, Andrew G.

    2011-01-01

    Highlights: → We propose a simple stochastic model to construct primitive DNA sequences. → The model provide an explanation for Chargaff's second parity rule in primitive DNA sequences. → The model is also used to predict a novel type of strand symmetry in primitive DNA sequences. → We extend the results for bacterial DNA sequences and compare distributional properties intrinsic to the model to statistical estimates from 1049 bacterial genomes. → We find out statistical evidences that the novel type of strand symmetry holds for bacterial DNA sequences. -- Abstract: Chargaff's second parity rule for short oligonucleotides states that the frequency of any short nucleotide sequence on a strand is approximately equal to the frequency of its reverse complement on the same strand. Recent studies have shown that, with the exception of organellar DNA, this parity rule generally holds for double-stranded DNA genomes and fails to hold for single-stranded genomes. While Chargaff's first parity rule is fully explained by the Watson-Crick pairing in the DNA double helix, a definitive explanation for the second parity rule has not yet been determined. In this work, we propose a model based on a hidden Markov process for approximating the distributional structure of primitive DNA sequences. Then, we use the model to provide another possible theoretical explanation for Chargaff's second parity rule, and to predict novel distributional aspects of bacterial DNA sequences.

  15. The sequence d(CGGCGGCCGC) self-assembles into a two dimensional rhombic DNA lattice

    International Nuclear Information System (INIS)

    Venkadesh, S.; Mandal, P.K.; Gautham, N.

    2011-01-01

    Highlights: → This is the first crystal structure of a four-way junction with sticky ends. → Four junction structures bind to each other and form a rhombic cavity. → Each rhombus binds to others to form 'infinite' 2D tiles. → This is an example of bottom-up fabrication of a DNA nano-lattice. -- Abstract: We report here the crystal structure of the partially self-complementary decameric sequence d(CGGCGGCCGC), which self assembles to form a four-way junction with sticky ends. Each junction binds to four others through Watson-Crick base pairing at the sticky ends to form a rhombic structure. The rhombuses bind to each other and form two dimensional tiles. The tiles stack to form the crystal. The crystal diffracted in the space group P1 to a resolution of 2.5 A. The junction has the anti-parallel stacked-X conformation like other junction structures, though the formation of the rhombic net noticeably alters the details of the junction geometry.

  16. Enzymatic primer-extension with glycerol-nucleoside triphosphates on DNA templates.

    Directory of Open Access Journals (Sweden)

    Jesse J Chen

    Full Text Available BACKGROUND: Glycerol nucleic acid (GNA has an acyclic phosphoglycerol backbone repeat-unit, but forms stable duplexes based on Watson-Crick base-pairing. Because of its structural simplicity, GNA is of particular interest with respect to the possibility of evolving functional polymers by in vitro selection. Template-dependent GNA synthesis is essential to any GNA-based selection system. PRINCIPAL FINDINGS: In this study, we investigated the ability of various DNA polymerases to use glycerol-nucleoside triphosphates (gNTPs as substrates for GNA synthesis on DNA templates. Therminator DNA polymerase catalyzes quantitative primer-extension by the incorporation of two glyceronucleotides, with much less efficient extension up to five glyceronucleotides. Steady-state kinetic experiments suggested that GNA synthesis by Therminator was affected by both decreased catalytic rates and weakened substrate binding, especially for pyrimidines. In an attempt to improve pyrimidine incorporation by providing additional stacking interactions, we synthesized two new gNTP analogs with 5-propynyl substituted pyrimidine nucleobases. This led to more efficient incorporation of gC, but not gT. CONCLUSIONS: We suggest that directed evolution of Therminator might lead to mutants with improved substrate binding and catalytic efficiency.

  17. Structural mechanisms of human RecQ helicases WRN and BLM

    Directory of Open Access Journals (Sweden)

    Ken eKitano

    2014-10-01

    Full Text Available The RecQ family DNA helicases WRN (Werner syndrome protein and BLM (Bloom syndrome protein play a key role in protecting the genome against deleterious changes. In humans, mutations in these proteins lead to rare genetic diseases associated with cancer predisposition and accelerated aging. WRN and BLM are distinguished from other helicases by possessing signature tandem domains toward the C terminus, referred to as the RecQ C-terminal (RQC and helicase-and-ribonuclease D-C-terminal (HRDC domains. Although the precise function of the HRDC domain remains unclear, the previous crystal structure of a WRN RQC-DNA complex visualized a central role for the RQC domain in recognizing, binding and unwinding DNA at branch points. In particular, a prominent hairpin structure (the β-wing within the RQC winged-helix motif acts as a scalpel to induce the unpairing of a Watson-Crick base pair at the DNA duplex terminus. A similar RQC-DNA interaction was also observed in the recent crystal structure of a BLM-DNA complex. I review the latest structures of WRN and BLM, and then provide a docking simulation of BLM with a Holliday junction. The model offers an explanation for the efficient branch migration activity of the RecQ family toward recombination and repair intermediates.

  18. Quadruplexes in 'Dicty': crystal structure of a four-quartet G-quadruplex formed by G-rich motif found in the Dictyostelium discoideum genome.

    Science.gov (United States)

    Guédin, Aurore; Lin, Linda Yingqi; Armane, Samir; Lacroix, Laurent; Mergny, Jean-Louis; Thore, Stéphane; Yatsunyk, Liliya A

    2018-06-01

    Guanine-rich DNA has the potential to fold into non-canonical G-quadruplex (G4) structures. Analysis of the genome of the social amoeba Dictyostelium discoideum indicates a low number of sequences with G4-forming potential (249-1055). Therefore, D. discoideum is a perfect model organism to investigate the relationship between the presence of G4s and their biological functions. As a first step in this investigation, we crystallized the dGGGGGAGGGGTACAGGGGTACAGGGG sequence from the putative promoter region of two divergent genes in D. discoideum. According to the crystal structure, this sequence folds into a four-quartet intramolecular antiparallel G4 with two lateral and one diagonal loops. The G-quadruplex core is further stabilized by a G-C Watson-Crick base pair and a A-T-A triad and displays high thermal stability (Tm > 90°C at 100 mM KCl). Biophysical characterization of the native sequence and loop mutants suggests that the DNA adopts the same structure in solution and in crystalline form, and that loop interactions are important for the G4 stability but not for its folding. Four-tetrad G4 structures are sparse. Thus, our work advances understanding of the structural diversity of G-quadruplexes and yields coordinates for in silico drug screening programs and G4 predictive tools.

  19. Modulation of lipoprotein metabolism by antisense technology: preclinical drug discovery methodology.

    Science.gov (United States)

    Crooke, Rosanne M; Graham, Mark J

    2013-01-01

    Antisense oligonucleotides (ASOs) are a new class of specific therapeutic agents that alter the intermediary metabolism of mRNA, resulting in the suppression of disease-associated gene products. ASOs exert their pharmacological effects after hybridizing, via Watson-Crick base pairing, to a specific target RNA. If appropriately designed, this event results in the recruitment of RNase H, the degradation of targeted mRNA or pre-mRNA, and subsequent inhibition of the synthesis of a specific protein. A key advantage of the technology is the ability to selectively inhibit targets that cannot be modulated by traditional therapeutics such as structural proteins, transcription factors, and, of topical interest, lipoproteins. In this chapter, we will first provide an overview of antisense technology, then more specifically describe the status of lipoprotein-related genes that have been studied using the antisense platform, and finally, outline the general methodology required to design and evaluate the in vitro and in vivo efficacy of those drugs.

  20. Label-Free Potentiometry for Detecting DNA Hybridization Using Peptide Nucleic Acid and DNA Probes

    Science.gov (United States)

    Goda, Tatsuro; Singi, Ankit Balram; Maeda, Yasuhiro; Matsumoto, Akira; Torimura, Masaki; Aoki, Hiroshi; Miyahara, Yuji

    2013-01-01

    Peptide nucleic acid (PNA) has outstanding affinity over DNA for complementary nucleic acid sequences by forming a PNA-DNA heterodimer upon hybridization via Watson-Crick base-pairing. To verify whether PNA probes on an electrode surface enhance sensitivity for potentiometric DNA detection or not, we conducted a comparative study on the hybridization of PNA and DNA probes on the surface of a 10-channel gold electrodes microarray. Changes in the charge density as a result of hybridization at the solution/electrode interface on the self-assembled monolayer (SAM)-formed microelectrodes were directly transformed into potentiometric signals using a high input impedance electrometer. The charge readout allows label-free, reagent-less, and multi-parallel detection of target oligonucleotides without any optical assistance. The differences in the probe lengths between 15- to 22-mer dramatically influenced on the sensitivity of the PNA and DNA sensors. Molecular type of the capturing probe did not affect the degree of potential shift. Theoretical model for charged rod-like duplex using the Gouy-Chapman equation indicates the dominant effect of electrostatic attractive forces between anionic DNA and underlying electrode at the electrolyte/electrode interface in the potentiometry. PMID:23435052