WorldWideScience

Sample records for watson-crick base pairs

  1. Non-Watson Crick base pairs might stabilize RNA structural motifs in ...

    Indian Academy of Sciences (India)

    Watson Crick base pairs, internal loops and pseudoknots have been the highlighting feature of recent structural determination of RNAs. The recent crystal structure of group-I introns has demonstrated that these might constitute RNA structural ...

  2. Non-Watson Crick base pairs might stabilize RNA structural motifs in ...

    Indian Academy of Sciences (India)

    Unknown

    [Chandrasekhar K and Malathi R 2003 Non-Watson Crick base pairs might stabilize RNA structural motifs in ribozymes – A comparative study of group-I intron structures; ... recognition sites for proteins, metal ions and small mole- cules (Jeffrey et al 1999; ..... From the sequence analysis (table 1, figure 1) we find an extreme ...

  3. Substituent effif ects on hydrogen bonding in Watson-Crick base pairs. A theoretical study

    NARCIS (Netherlands)

    Fonseca Guerra, C.; van der Wijst, T.; Bickelhaupt, F.M.

    2005-01-01

    We have theoretically analyzed Watson-Crick AT and GC base pairs in which purine C8 and/or pyrimidine C6 positions carry a substituent X = H, F, Cl or Br, using the generalized gradient approximation (GGA) of density functional theory at BP86/TZ2P. The purpose is to study the effects on structure

  4. Strong enhancement of vibrational relaxation by Watson-Crick base pairing.

    Science.gov (United States)

    Woutersen, Sander; Cristalli, Gloria

    2004-09-15

    We have studied the ultrafast dynamics of NH-stretch vibrational excitations in Watson-Crick base pairs consisting of adenine and uracil derivatives. To estimate the influence of the A:U hydrogen bonding on the vibrational dynamics, we have also studied the uracil derivative in monomeric form. The vibrational relaxation of the NH-stretching mode is found to occur much faster in the Watson-Crick base pair than in monomeric uracil. From the delay dependence of the transient vibrational spectra, it can be concluded that both in base-paired and monomeric uracil, the energy relaxation takes place in two steps, the first step being a rapid transfer of energy from the NH-stretching mode to an accepting mode, the second step the relaxation of this accepting mode. The transient spectra show evidence that in the base pair the hydrogen bond between the nucleobases acts as the accepting mode, and that the hydrogen bonding between the bases is responsible for the extremely fast vibrational relaxation in this system.

  5. The extension of a DNA double helix by an additional Watson-Crick base pair on the same backbone

    DEFF Research Database (Denmark)

    Kumar, P.; Sharma, P. K.; Madsen, Charlotte S.

    2013-01-01

    Additional base pair: The DNA duplex can be extended with an additional Watson-Crick base pair on the same backbone by the use of double-headed nucleotides. These also work as compressed dinucleotides and form two base pairs with cognate nucleobases on the opposite strand.......Additional base pair: The DNA duplex can be extended with an additional Watson-Crick base pair on the same backbone by the use of double-headed nucleotides. These also work as compressed dinucleotides and form two base pairs with cognate nucleobases on the opposite strand....

  6. Charge transport properties of DNA aperiodic molecule: The role of interbase hopping in Watson-Crick base pair

    Science.gov (United States)

    Sinurat, E. N.; Yudiarsah, E.

    2017-07-01

    The charge transport properties of DNA aperiodic molecule has been studied by considering various interbase hopping parameter on Watson-Crick base pair. 32 base pairs long double-stranded DNA aperiodic model with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. Transfer matrix method has been used to calculate transmission probabilities, for determining I-V characteristic using Landauer Büttiker formula. DNA molecule is modeled using tight binding hamiltonian combined with the theory of Slater-Koster. The result show, the increment of Watson-Crick hopping value leads to the transmission probabilities and current of DNA aperiodic molecule increases.

  7. Photoinduced electron transfer in a Watson-Crick base-paired, 2-aminopurine:uracil-C60 hydrogen bonding conjugate.

    Science.gov (United States)

    D'Souza, Francis; Gadde, Suresh; Islam, D-M Shafiqul; Pang, Siew-Cheng; Schumacher, Amy Lea; Zandler, Melvin E; Horie, Rumiko; Araki, Yasuyaki; Ito, Osamu

    2007-02-07

    A fluorescent reporter molecule, 2-aminopurine was self-assembled via Watson-Crick base-pairing to a uracil appended fullerene to form a donor-acceptor conjugate; efficient photoinduced charge separation was confirmed by time-resolved emission and transient absorption spectral studies.

  8. Higher order structural effects stabilizing the reverse watson-crick guanine-cytosine base pair in functional RNAs

    KAUST Repository

    Chawla, Mohit

    2013-10-10

    The G:C reverse Watson-Crick (W:W trans) base pair, also known as Levitt base pair in the context of tRNAs, is a structurally and functionally important base pair that contributes to tertiary interactions joining distant domains in functional RNA molecules and also participates in metabolite binding in riboswitches. We previously indicated that the isolated G:C W:W trans base pair is a rather unstable geometry, and that dicationic metal binding to the Guanine base or posttranscriptional modification of the Guanine can increase its stability. Herein, we extend our survey and report on other H-bonding interactions that can increase the stability of this base pair. To this aim, we performed a bioinformatics search of the PDB to locate all the occurencies of G:C trans base pairs. Interestingly, 66% of the G:C trans base pairs in the PDB are engaged in additional H-bonding interactions with other bases, the RNA backbone or structured water molecules. High level quantum mechanical calculations on a data set of representative crystal structures were performed to shed light on the structural stability and energetics of the various crystallographic motifs. This analysis was extended to the binding of the preQ1 metabolite to a preQ1-II riboswitch. 2013 The Author(s).

  9. Watson-Crick Base Pairing, Electronic and Photophysical Properties of Triazole Modified Adenine Analogues: A Computational Study

    KAUST Repository

    Das, Shubhajit

    2015-09-17

    We employ first-principles Density Functional Theory (DFT) and time-dependent DFT (TDDFT) to elucidate structural, electronic and optical properties of a few recently reported triazole adenine nucleobase analogues. The results are compared against the findings obtained for both natural adenine nucleobase and available experimental data. The optical absorption of these adenine analogues are calculated both in gas-phase and in solvent (methanol) using Polarized Continuum Model (PCM). We find that all the analogues show a red-shifted absorption profile as compared to adenine. Our simulated emission spectra in solvent compare fairly well with experimentally observed results. We investigate base paring ability of these adenine analogues with thymine. The calculations on the intrinsic stability of these base pairs ascertain that all the adenine analogues form the hydrogen bonded Watson-Crick base pair with similar H-bonding energy as obtained for natural adenine-thymine base pair. In our study, we provide a microscopic origin of the low-energy absorption and emission peaks, observed experimentally.

  10. Evidence for Watson-Crick and not Hoogsteen or wobble base pairing in the selection of nucleotides for insertion opposite pyrimidines and a thymine dimer by yeast DNA pol eta.

    Science.gov (United States)

    Hwang, Hanshin; Taylor, John-Stephen

    2005-03-29

    We have recently reported that pyrene nucleotide is preferentially inserted opposite an abasic site, the 3'-T of a thymine dimer, and most undamaged bases by yeast DNA polymerase eta (pol eta). Because pyrene is a nonpolar molecule with no H-bonding ability, the unusually high efficiencies of dPMP insertion are ascribed to its superior base stacking ability, and underscore the importance of base stacking in the selection of nucleotides by pol eta. To investigate the role of H-bonding and base pair geometry in the selection of nucleotides by pol eta, we determined the insertion efficiencies of the base-modified nucleotides 2,6-diaminopurine, 2-aminopurine, 6-chloropurine, and inosine which would make a different number of H-bonds with the template base depending on base pair geometry. Watson-Crick base pairing appears to play an important role in the selection of nucleotide analogues for insertion opposite C and T as evidenced by the decrease in the relative insertion efficiencies with a decrease in the number of Watson-Crick H-bonds and an increase in the number of donor-donor and acceptor-acceptor interactions. The selectivity of nucleotide insertion is greater opposite the 5'-T than the 3'-T of the thymine dimer, in accord with previous work suggesting that the 5'-T is held more rigidly than the 3'-T. Furthermore, insertion of A opposite both Ts of the dimer appears to be mediated by Watson-Crick base pairing and not by Hoogsteen base pairing based on the almost identical insertion efficiencies of A and 7-deaza-A, the latter of which lacks H-bonding capability at N7. The relative efficiencies for insertion of nucleotides that can form Watson-Crick base pairs parallel those for the Klenow fragment, whereas the Klenow fragment more strongly discriminates against mismatches, in accord with its greater shape selectivity. These results underscore the importance of H-bonding and Watson-Crick base pair geometry in the selection of nucleotides by both pol eta and the

  11. Pyrrolo-dC Metal-Mediated Base Pairs in the Reverse Watson-Crick Double Helix: Enhanced Stability of Parallel DNA and Impact of 6-Pyridinyl Residues on Fluorescence and Silver-Ion Binding.

    Science.gov (United States)

    Yang, Haozhe; Mei, Hui; Seela, Frank

    2015-07-06

    Reverse Watson-Crick DNA with parallel-strand orientation (ps DNA) has been constructed. Pyrrolo-dC (PyrdC) nucleosides with phenyl and pyridinyl residues linked to the 6 position of the pyrrolo[2,3-d]pyrimidine base have been incorporated in 12- and 25-mer oligonucleotide duplexes and utilized as silver-ion binding sites. Thermal-stability studies on the parallel DNA strands demonstrated extremely strong silver-ion binding and strongly enhanced duplex stability. Stoichiometric UV and fluorescence titration experiments verified that a single (2py) PyrdC-(2py) PyrdC pair captures two silver ions in ps DNA. A structure for the PyrdC silver-ion base pair that aligns 7-deazapurine bases head-to-tail instead of head-to-head, as suggested for canonical DNA, is proposed. The silver DNA double helix represents the first example of a ps DNA structure built up of bidentate and tridentate reverse Watson-Crick base pairs stabilized by a dinuclear silver-mediated PyrdC pair. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  12. FT-IR and FT-Raman spectra of 5-chlorocytosine: Solid state simulation and tautomerism. Effect of the chlorine substitution in the Watson-Crick base pair 5-chlorodeoxycytidine-deoxyguanosine

    Science.gov (United States)

    Alcolea Palafox, M.; Rastogi, V. K.; Singh, S. P.

    2018-01-01

    The laser Raman and IR spectra of 5-chlorocytosine have been recorded and accurately assigned in the solid state using Density functional calculations (DFT) together with the linear scaling equation procedure (LSE) and the solid state simulation of the crystal unit cell through a tetramer form. These results remarkably improve those reported previously by other authors. Several new scaling equations were proposed to be used in related molecules. The six main tautomers of the biomolecule 5-chlorocytosine were determined and optimized at the MP2 and CCSD levels, using different basis sets. The relative stabilities were compared with those obtained in cytosine and their 5-halo derivatives. Several relationships between energies, geometric parameters and NBO atomic charges were established. The effect of the chlorine substitution in the fifth position was evaluated through the stability of the Watson-Crick (WC) base pair of 5-chlorodeoxycytidine with deoxyguanosine, and through their vibrational spectra.

  13. How Mg(2+) ion and water network affect the stability and structure of non-Watson-Crick base pairs in E. coli loop E of 5S rRNA: a molecular dynamics and reference interaction site model (RISM) study.

    Science.gov (United States)

    Shanker, Sudhanshu; Bandyopadhyay, Pradipta

    2017-08-01

    The non-Watson-Crick (non-WC) base pairs of Escherichia coli loop E of 5S rRNA are stabilized by Mg(2+) ions through water-mediated interaction. It is important to know the synergic role of Mg(2+) and the water network surrounding Mg(2+) in stabilizing the non-WC base pairs of RNA. For this purpose, free energy change of the system is calculated using molecular dynamics (MD) simulation as Mg(2+) is pulled from RNA, which causes disturbance of the water network. It was found that Mg(2+) remains hexahydrated unless it is close to or far from RNA. In the pentahydrated form, Mg(2+) interacts directly with RNA. Water network has been identified by two complimentary methods; MD followed by a density-based clustering algorithm and three-dimensional-reference interaction site model. These two methods gave similar results. Identification of water network around Mg(2+) and non-WC base pairs gives a clue to the strong effect of water network on the stability of this RNA. Based on sequence analysis of all Eubacteria 5s rRNA, we propose that hexahydrated Mg(2+) is an integral part of this RNA and geometry of base pairs surrounding it adjust to accommodate the [Formula: see text]. Overall the findings from this work can help in understanding the basis of the complex structure and stability of RNA with non-WC base pairs.

  14. Molecular structure of deoxycytidyl-3'-methylphosphonate (RP) 5'-deoxyguanidine, d[Cp(CH3)G]. A neutral dinucleotide with Watson-Crick base pairing and a right handed helical twist.

    Science.gov (United States)

    Han, F; Watt, W; Duchamp, D J; Callahan, L; Kézdy, F J; Agarwal, K

    1990-01-01

    The crystal structure of d[Cp(CH3)G] has been determined as part of a project to study the mechanism of the B----Z transition in DNA. The asymmetric unit contains two dinucleotides and the equivalent of 7.5 water molecules, partially disordered over 12 definable positions. The two symmetry-independent dinucleotides form a duplex with Watson-Crick base-pairing and a right-handed helical sense. Comparison with previously determined structures of the B and A conformation showed that this duplex is closer to B than to A but significantly different from B. It corresponds to a stretched out helix with a 4 A rise per base pair and a helical twist of 32 degrees. This structure may serve as a model for the bending of DNA in certain situations. The configuration at the methyl phosphonate is RP, and a mechanism, based on this assignment, is presented for the B----Z transition in DNA. PMID:2339061

  15. Weighted Watson-Crick automata

    Energy Technology Data Exchange (ETDEWEB)

    Tamrin, Mohd Izzuddin Mohd [Department of Information System, Kulliyyah of Information and Communication Technology, International Islamic University Malaysia, 50728 Gombak, Selangor (Malaysia); Turaev, Sherzod; Sembok, Tengku Mohd Tengku [Department of Computer Science, Kulliyyah of Information and Communication Technology, International Islamic University Malaysia, 50728 Gombak, Selangor (Malaysia)

    2014-07-10

    There are tremendous works in biotechnology especially in area of DNA molecules. The computer society is attempting to develop smaller computing devices through computational models which are based on the operations performed on the DNA molecules. A Watson-Crick automaton, a theoretical model for DNA based computation, has two reading heads, and works on double-stranded sequences of the input related by a complementarity relation similar with the Watson-Crick complementarity of DNA nucleotides. Over the time, several variants of Watson-Crick automata have been introduced and investigated. However, they cannot be used as suitable DNA based computational models for molecular stochastic processes and fuzzy processes that are related to important practical problems such as molecular parsing, gene disease detection, and food authentication. In this paper we define new variants of Watson-Crick automata, called weighted Watson-Crick automata, developing theoretical models for molecular stochastic and fuzzy processes. We define weighted Watson-Crick automata adapting weight restriction mechanisms associated with formal grammars and automata. We also study the generative capacities of weighted Watson-Crick automata, including probabilistic and fuzzy variants. We show that weighted variants of Watson-Crick automata increase their generative power.

  16. Closure properties of Watson-Crick grammars

    Science.gov (United States)

    Zulkufli, Nurul Liyana binti Mohamad; Turaev, Sherzod; Tamrin, Mohd Izzuddin Mohd; Azeddine, Messikh

    2015-12-01

    In this paper, we define Watson-Crick context-free grammars, as an extension of Watson-Crick regular grammars and Watson-Crick linear grammars with context-free grammar rules. We show the relation of Watson-Crick (regular and linear) grammars to the sticker systems, and study some of the important closure properties of the Watson-Crick grammars. We establish that the Watson-Crick regular grammars are closed under almost all of the main closure operations, while the differences between other Watson-Crick grammars with their corresponding Chomsky grammars depend on the computational power of the Watson-Crick grammars which still need to be studied.

  17. Intramolecular CH···O hydrogen bonds in the AI and BI DNA-like conformers of canonical nucleosides and their Watson-Crick pairs. Quantum chemical and AIM analysis.

    Science.gov (United States)

    Yurenko, Yevgen P; Zhurakivsky, Roman O; Samijlenko, Svitlana P; Hovorun, Dmytro M

    2011-08-01

    The aim of this work is to cast some light on the H-bonds in double-stranded DNA in its AI and BI forms. For this purpose, we have performed the MP2 and DFT quantum chemical calculations of the canonical nucleoside conformers, relative to the AI and BI DNA forms, and their Watson-Crick pairs, which were regarded as the simplest models of the double-stranded DNA. Based on the atoms-in-molecules analysis (AIM), five types of the CH···O hydrogen bonds, involving bases and sugar, were detected numerically from 1 to 3 per a conformer: C2'H···O5', C1'H···O2, C6H···O5', C8H···O5', and C6H···O4'. The energy values of H-bonds occupy the range of 2.3-5.6 kcal/mol, surely exceeding the kT value (0.62 kcal/mol). The nucleoside CH···O hydrogen bonds appeared to "survive" turns of bases against the sugar, sometimes in rather large ranges of the angle values, pertinent to certain conformations, which points out to the source of the DNA lability, necessary for the conformational adaptation in processes of its functioning. The calculation of the interactions in the dA·T nucleoside pair gives evidence, that additionally to the N6H···O4 and N1···N3H canonical H-bonds, between the bases adenine and thymine the third one (C2H···O2) is formed, which, though being rather weak (about 1 kcal/mol), satisfies the AIM criteria of H-bonding and may be classified as a true H-bond. The total energy of all the CH···O nontraditional intramolecular H-bonds in DNA nucleoside pairs appeared to be commensurable with the energy of H-bonds between the bases in Watson-Crick pairs, which implies their possible important role in the DNA shaping.

  18. The nature of the transition mismatches with Watson-Crick architecture: the G*·T or G·T* DNA base mispair or both? A QM/QTAIM perspective for the biological problem.

    Science.gov (United States)

    Brovarets', Ol'ha O; Hovorun, Dmytro M

    2015-01-01

    This study provides the first accurate investigation of the tautomerization of the biologically important guanine*·thymine (G*·T) DNA base mispair with Watson-Crick geometry, involving the enol mutagenic tautomer of the G and the keto tautomer of the T, into the G·T* mispair (∆G = .99 kcal mol(-1), population = 15.8% obtained at the MP2 level of quantum-mechanical theory in the continuum with ε = 4), formed by the keto tautomer of the G and the enol mutagenic tautomer of the T base, using DFT and MP2 methods in vacuum and in the weakly polar medium (ε = 4), characteristic for the hydrophobic interfaces of specific protein-nucleic acid interactions. We were first able to show that the G*·T↔G·T* tautomerization occurs through the asynchronous concerted double proton transfer along two antiparallel O6H···O4 and N1···HN3 H-bonds and is assisted by the third N2H···O2 H-bond, that exists along the entire reaction pathway. The obtained results indicate that the G·T* base mispair is stable from the thermodynamic point of view complex, while it is dynamically unstable structure in vacuum and dynamically stable structure in the continuum with ε = 4 with lifetime of 6.4·10(-12) s, that, on the one side, makes it possible to develop all six low-frequency intermolecular vibrations, but, on the other side, it is by three orders less than the time (several ns) required for the replication machinery to forcibly dissociate a base pair into the monomers during DNA replication. One of the more significant findings to emerge from this study is that the short-lived G·T* base mispair, which electronic interaction energy between the bases (-23.76 kcal mol(-1)) exceeds the analogical value for the G·C Watson-Crick nucleobase pair (-20.38 kcal mol(-1)), "escapes from the hands" of the DNA replication machinery by fast transforming into the G*·T mismatch playing an indirect role of its supplier during the DNA replication. So

  19. Morpholino oligonucleotides do not participate perfectly in standard Watson-Crick complexes with RNA.

    Science.gov (United States)

    Xiao, Gaoping; Wesolowski, Donna; Izadjoo, Mina; Altman, Sidney

    2010-11-01

    RNase P from E. coli will cleave a RNA at a site designated in a complex with an external guide sequence (EGS). The location of the site is determined by the Watson-Crick complementary sequence that can be formed between the RNA and the EGS. Morpholino oligonucleotides (PMOs) that have the same base sequences as any particular EGS will not direct cleavage by RNase P of the target RNA at the expected site in three mRNAs. Instead, cleavage occurs at a secondary site that does not correspond exactly to the expected Watson-Crick sequence in the PMO. This cleavage in the mRNA for a drug resistance gene, CAT mRNA, is at least second order in the concentration of the PMOs, but the mechanism is not understood yet and might be more complicated than a simple second-order reaction. EGSs and PMOs inhibit the reactions of each other effectively in a competitive fashion. A basic peptide attached to the PMO (PPMO) is more effective because of its binding properties to the mRNA as a substrate. However, a PMO is just as efficient as a PPMO on a mRNA that is mutated so that the canonical W-C site has been altered. The altered mRNA is not recognizable by effective extensive W-C pairing to an EGS or PMO. The complex of a PMO on a mutated mRNA as a substrate shows that the dimensions of the modified oligonucleotide cannot be the same as a naked piece of single-stranded RNA.

  20. Watson-Crick hydrogen bonding of unlocked nucleic acids

    DEFF Research Database (Denmark)

    Langkjær, Niels; Wengel, Jesper; Pasternak, Anna

    2015-01-01

    We herein describe the synthesis of two new unlocked nucleic acid building blocks containing hypoxanthine and 2,6-diaminopurine as nucleobase moieties and their incorporation into oligonucleotides. The modified oligonucleotides were used to examine the thermodynamic properties of UNA against unmo...... unmodified oligonucleotides and the resulting thermodynamic data support that the hydrogen bonding face of UNA is Watson-Crick like....

  1. Watson-Crick hydrogen bonding of unlocked nucleic acids.

    Science.gov (United States)

    Langkjær, Niels; Wengel, Jesper; Pasternak, Anna

    2015-11-15

    We herein describe the synthesis of two new unlocked nucleic acid building blocks containing hypoxanthine and 2,6-diaminopurine as nucleobase moieties and their incorporation into oligonucleotides. The modified oligonucleotides were used to examine the thermodynamic properties of UNA against unmodified oligonucleotides and the resulting thermodynamic data support that the hydrogen bonding face of UNA is Watson-Crick like. Copyright © 2015 Elsevier Ltd. All rights reserved.

  2. Structure of 2,4-Diaminopyrimidine - Theobromine Alternate Base Pairs

    Science.gov (United States)

    Gengeliczki, Zsolt; Callahan, Michael P.; Kabelac, Martin; Rijs, Anouk M.; deVries, Mattanjah S.

    2011-01-01

    We report the structure of clusters of 2,4-diaminopyrimidine with 3,7-dimethylxanthine (theobromine) in the gas phase determined by IR-UV double resonance spectroscopy in both the near-IR and mid-IR regions in combination with ab initio computations. These clusters represent potential alternate nucleobase pairs, geometrically equivalent to guanine-cytosine. We have found the four lowest energy structures, which include the Watson-Crick base pairing motif. This Watson-Crick structure has not been observed by resonant two-photon ionization (R2PI) in the gas phase for the canonical DNA base pairs.

  3. Robust silver-mediated imidazolo-dC base pairs in metal DNA: dinuclear silver bridges with exceptional stability in double helices with parallel and antiparallel strand orientation.

    Science.gov (United States)

    Jana, Sunit Kumar; Guo, Xiurong; Mei, Hui; Seela, Frank

    2015-12-18

    A new unprecedented metal-mediated base pair was designed that stabilizes reverse Watson-Crick DNA (parallel strand orientation, ps) as well as canonical Watson-Crick DNA (antiparallel strand orientation, aps). This base pair contains two imidazolo-dC units decorated with furan residues. Tm measurements and spectroscopic studies reveal that each silver-mediated furano-imidazolo-dC forms exceptionally stable duplexes with ps and aps chain orientation. This stability increase by a silver-mediated base pair is the highest reported so far for ps and aps DNA helices.

  4. Theoretical Study of the Hoogsteen–Watson-Crick Junctions in DNA

    Science.gov (United States)

    Cubero, Elena; Luque, F. Javier; Orozco, Modesto

    2006-01-01

    A series of d (AT)n oligonucleotides containing mixtures of normal B-type Watson-Crick and antiparallel Hoogsteen helices have been studied using molecular dynamics simulation techniques to analyze the structural and thermodynamic impact of the junction between Watson-Crick and antiparallel Hoogsteen structures. Analysis of molecular dynamics simulations strongly suggests that for all oligonucleotides studied the antiparallel Hoogsteen appears as a reasonable conformation, only slightly less stable than the canonical B-type Watson-Crick one. The junctions between the Watson-Crick and Hoogsteen structures introduces a priori a sharp discontinuity in the helix, because the properties of each type of conformation are very well preserved in the corresponding fragments. However, and quite counterintuitively, junctions do not largely distort the duplex in structural, dynamics or energetic terms. Our results strongly support the possibility that small fragments of antiparallel Hoogsteen duplex might be embedded into large fragments of B-type Watson-Crick helices, making possible protein-DNA interactions that are specific of the antiparallel Hoogsteen conformation. PMID:16287814

  5. Spatial, Hysteretic, and Adaptive Host-Guest Chemistry in a Metal-Organic Framework with Open Watson-Crick Sites.

    Science.gov (United States)

    Cai, Hong; Li, Mian; Lin, Xiao-Rong; Chen, Wei; Chen, Guang-Hui; Huang, Xiao-Chun; Li, Dan

    2015-09-01

    Biological and artificial molecules and assemblies capable of supramolecular recognition, especially those with nucleobase pairing, usually rely on autonomous or collective binding to function. Advanced site-specific recognition takes advantage of cooperative spatial effects, as in local folding in protein-DNA binding. Herein, we report a new nucleobase-tagged metal-organic framework (MOF), namely ZnBTCA (BTC=benzene-1,3,5-tricarboxyl, A=adenine), in which the exposed Watson-Crick faces of adenine residues are immobilized periodically on the interior crystalline surface. Systematic control experiments demonstrated the cooperation of the open Watson-Crick sites and spatial effects within the nanopores, and thermodynamic and kinetic studies revealed a hysteretic host-guest interaction attributed to mild chemisorption. We further exploited this behavior for adenine-thymine binding within the constrained pores, and a globally adaptive response of the MOF host was observed. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  6. Is the DPT tautomerization of the long A·G Watson-Crick DNA base mispair a source of the adenine and guanine mutagenic tautomers? A QM and QTAIM response to the biologically important question.

    Science.gov (United States)

    Brovarets', Ol'ha O; Zhurakivsky, Roman O; Hovorun, Dmytro M

    2014-03-05

    Herein, we first address the question posed in the title by establishing the tautomerization trajectory via the double proton transfer of the adenine·guanine (A·G) DNA base mispair formed by the canonical tautomers of the A and G bases into the A*·G* DNA base mispair, involving mutagenic tautomers, with the use of the quantum-mechanical calculations and quantum theory of atoms in molecules (QTAIM). It was detected that the A·G ↔ A*·G* tautomerization proceeds through the asynchronous concerted mechanism. It was revealed that the A·G base mispair is stabilized by the N6H···O6 (5.68) and N1H···N1 (6.51) hydrogen bonds (H-bonds) and the N2H···HC2 dihydrogen bond (DH-bond) (0.68 kcal·mol(-1) ), whereas the A*·G* base mispair-by the O6H···N6 (10.88), N1H···N1 (7.01) and C2H···N2 H-bonds (0.42 kcal·mol(-1) ). The N2H···HC2 DH-bond smoothly and without bifurcation transforms into the C2H···N2 H-bond at the IRC = -10.07 Bohr in the course of the A·G ↔ A*·G* tautomerization. Using the sweeps of the energies of the intermolecular H-bonds, it was observed that the N6H···O6 H-bond is anticooperative to the two others-N1H···N1 and N2H···HC2 in the A·G base mispair, while the latters are significantly cooperative, mutually strengthening each other. In opposite, all three O6H···N6, N1H···N1, and C2H···N2 H-bonds are cooperative in the A*·G* base mispair. All in all, we established the dynamical instability of the А*·G* base mispair with a short lifetime (4.83·10(-14) s), enabling it not to be deemed feasible source of the A* and G* mutagenic tautomers of the DNA bases. The small lifetime of the А*·G* base mispair is predetermined by the negative value of the Gibbs free energy for the A*·G* → A·G transition. Moreover, all of the six low-frequency intermolecular vibrations cannot develop during this lifetime that additionally confirms the aforementioned results. Thus, the A*·G* base mispair cannot be

  7. Non-Watson-Crick RNA synthesis suited to origin functions.

    Science.gov (United States)

    Puthenvedu, Deepa; Majerfeld, Irene; Yarus, Michael

    2018-01-01

    A templated RNA synthesis is characterized in which G5'pp5'G accelerates synthesis of A5'pp5'A from pA and chemically activated ImpA precursors. Similar acceleration is not observable in the presence of UppU, CppC, AppG, AppA, or pG alone. Thus, it seems likely that AppA is templated by GppG via a form or forms of G:A base-pairing. AppA also appears, more slowly, via a previously known untemplated second-order chemical route. Such AppA synthesis requires only ordinary near-neutral solutions containing monovalent and divalent salts, and rates are only slightly sensitive to variation in pH. Templated synthesis rates are first order in pA, ImpA, and template GppG; thus third order overall. Therefore, this reaction resembles cross-templating of AppA on poly(U), but is notably slower and less sensitive to temperature. Viewing AppA as a coenzyme analog, GppG templating provides a simpler molecular route, termed para-templating, to encoded chemical functions. Para-templating can also arise from a single, localized nucleobase geosynthetic event which yields purines. It requires only a single backbone-forming chemistry. Thus it may have appeared earlier and served as evolutionary precursor for more complex forms of encoded genetic expression. © 2018 Puthenvedu et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

  8. BPS: a database of RNA base-pair structures.

    Science.gov (United States)

    Xin, Yurong; Olson, Wilma K

    2009-01-01

    The BPS (http://bps.rutgers.edu) is a database of RNA base-pair structures, higher-order base interactions and isosteric pairs (base pairs with similar shape). The main functions of the BPS are to find and annotate the structural and chemical features of the Watson-Crick and non-Watson-Crick (noncanonical) base pairs in high-resolution RNA structures, and to provide a user-friendly interface to browse and search for the base pairs. The current database contains 91,265 bp and 3386 higher-order base interactions from 426 RNA crystal structures and 61,819 bp that fall into one of 17 different isosteric classes. The base-pair data can be accessed by searches of base-pair patterns, structure identifiers (IDs) and structural types. The BPS also includes an Atlas with representative images of the various base pairs, higher-order base interactions and isosteric pairs and links to statistical information about these groups of structures.

  9. ISFOLD: structure prediction of base pairs in non-helical RNA motifs from isostericity signatures in their sequence alignments.

    Science.gov (United States)

    Mokdad, Ali; Frankel, Alan D

    2008-04-01

    The existence and identity of non-Watson-Crick base pairs (bps) within RNA bulges, internal loops, and hairpin loops cannot reliably be predicted by existing algorithms. We have developed the Isfold (Isosteric Folding) program as a tool to examine patterns of nucleotide substitutions from sequence alignments or mutation experiments and identify plausible bp interactions. We infer these interactions based on the observation that each non-Watson-Crick bp has a signature pattern of isosteric substitutions where mutations can be made that preserve the 3D structure. Isfold produces a dynamic representation of predicted bps within defined motifs in order of their probabilities. The software was developed under Windows XP, and is capable of running on PC and MAC with Matlab 7.1 (SP3) or higher. A PC stand-alone version that does not require Matlab also is available. This software and a user manual are freely available at www.ucsf.edu/frankel/isfold.

  10. N-H Stretching Excitations in Adenosine-Thymidine Base Pairs in Solution: Base Pair Geometries, Infrared Line Shapes and Ultrafast Vibrational Dynamics

    Science.gov (United States)

    Greve, Christian; Preketes, Nicholas K.; Fidder, Henk; Costard, Rene; Koeppe, Benjamin; Heisler, Ismael A.; Mukamel, Shaul; Temps, Friedrich; Nibbering, Erik T. J.; Elsaesser, Thomas

    2013-01-01

    We explore the N-H stretching vibrations of adenosine-thymidine base pairs in chloroform solution with linear and nonlinear infrared spectroscopy. Based on estimates from NMR measurements and ab initio calculations, we conclude that adenosine and thymidine form hydrogen bonded base pairs in Watson-Crick, reverse Watson-Crick, Hoogsteen and reverse Hoogsteen configurations with similar probability. Steady-state concentration- and temperature dependent linear FT-IR studies, including H/D exchange experiments, reveal that these hydrogen-bonded base pairs have complex N-H/N-D stretching spectra with a multitude of spectral components. Nonlinear 2D-IR spectroscopic results, together with IR-pump-IR-probe measurements, as also corroborated by ab initio calculations, reveal that the number of N-H stretching transitions is larger than the total number of N-H stretching modes. This is explained by couplings to other modes, such as an underdamped low-frequency hydrogen-bond mode, and a Fermi resonance with NH2 bending overtone levels of the adenosine amino-group. Our results demonstrate that modeling based on local N-H stretching vibrations only is not sufficient and call for further refinement of the description of the N-H stretching manifolds of nucleic acid base pairs of adenosine and thymidine, incorporating a multitude of couplings with fingerprint and low-frequency modes. PMID:23234439

  11. Classification of pseudo pairs between nucleotide bases and amino acids by analysis of nucleotide-protein complexes.

    Science.gov (United States)

    Kondo, Jiro; Westhof, Eric

    2011-10-01

    Nucleotide bases are recognized by amino acid residues in a variety of DNA/RNA binding and nucleotide binding proteins. In this study, a total of 446 crystal structures of nucleotide-protein complexes are analyzed manually and pseudo pairs together with single and bifurcated hydrogen bonds observed between bases and amino acids are classified and annotated. Only 5 of the 20 usual amino acid residues, Asn, Gln, Asp, Glu and Arg, are able to orient in a coplanar fashion in order to form pseudo pairs with nucleotide bases through two hydrogen bonds. The peptide backbone can also form pseudo pairs with nucleotide bases and presents a strong bias for binding to the adenine base. The Watson-Crick side of the nucleotide bases is the major interaction edge participating in such pseudo pairs. Pseudo pairs between the Watson-Crick edge of guanine and Asp are frequently observed. The Hoogsteen edge of the purine bases is a good discriminatory element in recognition of nucleotide bases by protein side chains through the pseudo pairing: the Hoogsteen edge of adenine is recognized by various amino acids while the Hoogsteen edge of guanine is only recognized by Arg. The sugar edge is rarely recognized by either the side-chain or peptide backbone of amino acid residues.

  12. Aviram-Ratner rectifying mechanism for DNA base-pair sequencing through graphene nanogaps

    Science.gov (United States)

    Agapito, Luis A.; Gayles, Jacob; Wolowiec, Christian; Kioussis, Nicholas

    2012-04-01

    We demonstrate that biological molecules such as Watson-Crick DNA base pairs can behave as biological Aviram-Ratner electrical rectifiers because of the spatial separation and weak hydrogen bonding between the nucleobases. We have performed a parallel computational implementation of the ab initio non-equilibrium Green’s function (NEGF) theory to determine the electrical response of graphene—base-pair—graphene junctions. The results show an asymmetric (rectifying) current-voltage response for the cytosine-guanine base pair adsorbed on a graphene nanogap. In sharp contrast we find a symmetric response for the thymine-adenine case. We propose applying the asymmetry of the current-voltage response as a sensing criterion to the technological challenge of rapid DNA sequencing via graphene nanogaps.

  13. Ultrafast deactivation processes in the 2-aminopyridine dimer and the adenine-thymine base pair: Similarities and differences

    Science.gov (United States)

    Ai, Yue-Jie; Zhang, Feng; Cui, Gang-Long; Luo, Yi; Fang, Wei-Hai

    2010-08-01

    2-aminopyridine dimer has frequently been used as a model system for studying photochemistry of DNA base pairs. We examine here the relevance of 2-aminopyridine dimer for a Watson-Crick adenine-thymine base pair by studying UV-light induced photodynamics along two main hydrogen bridges after the excitation to the localized π1π∗ excited-state. The respective two-dimensional potential-energy surfaces have been determined by time-dependent density functional theory with Coulomb-attenuated hybrid exchange-correlation functional (CAM-B3LYP). Different mechanistic aspects of the deactivation pathway have been analyzed and compared in detail for both systems, while the related reaction rates have also be obtained from Monte Carlo kinetic simulations. The limitations of the 2-aminopyridine dimer as a model system for the adenine-thymine base pair are discussed.

  14. Development of a Vivid FRET System Based on a Highly Emissive dG-dC Analogue Pair.

    Science.gov (United States)

    Han, Ji Hoon; Yamamoto, Seigi; Park, Soyoung; Sugiyama, Hiroshi

    2017-06-01

    A new type of Förster Resonance Energy Transfer (FRET) system using highly emissive isomorphic nucleobase analogues is reported. The FRET pair consists of 2-aminothieno[3,4-d]pyrimidine G-mimic deoxyribonucleoside ((th) dG) as an energy donor and 1,3-diaza-2-oxophenothiazine (tC) as an energy acceptor. The distance and orientation between donor and acceptor was controlled by systematic incorporation of (th) dG and tC into DNA sequences to investigate the FRET efficiencies. This is the first Watson-Crick base-pairable FRET pair to produce vivid colors. In addition, this nucleic acid-based FRET pair was used to monitor DNA conformation and achieved visualization of the B-Z transition. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  15. AT Base Pair Anions vs. (9-methyl-A)(1-methyl-T) Base Pair Anions

    Energy Technology Data Exchange (ETDEWEB)

    Radisic, Dunja; Bowen, Kit H.; Dabkowska, Iwona; Storoniak, Piotr; Rak, Janusz; Gutowski, Maciej S.

    2005-05-04

    The anionic base pairs of adenine and thymine, (AT)-, and 9-methyladenine and 1-methylthymine, (MAMT)-, have been investigated both theoretically and experimentally in a complementary, synergistic study. Calculations on (AT)- found that it had undergone a barrier-free proton transfer (BFPT) similar to that seen in other dimer anion systems and that its structural configuration that was neither Watson-Crick (WC) nor Hoogsteen (HS). The vertical detachment energy (VDE) of (AT)- was determined by anion photoelectron spectroscopy and found to be in agreement with the VDE value predicted by theory for the BFPT mechanism. An AT pair in DNA is structurally immobilized into the WC configuration, in part, by being bonded to the sugars of the double helix. This circumstance was mimicked by methylating the sites on both A and T where these sugars would have been tied, viz., 9-methyladenine and 1-methylthymine. Calculations found no BFPT in (MAMT)- and a resulting (MAMT)- configuration that wa s either HS or WC, with the configurations differing in stability by ca. 2 kcal/mol. The photoelectron spectrum of (MAMT)- occurred at a completely different electron binding energy than had (AT)-. Moreover, the VDE value of (MAMT)- was in agreement with that predicted by theory. The configuration of (MAMT)- and its lack of electron-induced proton transfer are inter-related. While there may be other pathways for electron-induced damage, BFPT in the WC/HS configurations of (AT)- is not feasible.

  16. A Novel Form of RNA Double Helix Based on G·U and C·A+ Wobble Base Pairing.

    Science.gov (United States)

    Garg, Ankur; Heinemann, Udo

    2017-11-09

    Wobble base pairs are critical in various physiological functions and have been linked to local structural perturbations in double helical structures of nucleic acids. We report a 1.38-Å resolution crystal structure of an antiparallel octadecamer RNA double helix in overall A conformation, which includes a unique, central stretch of six consecutive wobble base pairs (W helix) with two G·U and four rare C·A+ wobble pairs. Four adenines within the W helix are N1-protonated and wobble-base-paired with the opposing cytosine through two regular hydrogen bonds. Combined with the two G·U pairs, the C·A+ base pairs facilitate formation of a half turn of W-helical RNA flanked by six regular Watson-Crick base pairs in standard A conformation on either side. RNA melting experiments monitored by differential scanning calorimetry, UV and circular dichroism spectroscopy demonstrate that the RNA octadecamer undergoes a pH-induced structural transition which is consistent with the presence of a duplex with C·A+ base pairs at acidic pH. Our crystal structure provides a first glimpse of an RNA double helix based entirely on wobble base pairs with possible applications in RNA or DNA nanotechnology and pH biosensors. Published by Cold Spring Harbor Laboratory Press for the RNA Society.

  17. The structure of metallo-DNA with consecutive thymine-HgII-thymine base pairs explains positive entropy for the metallo base pair formation.

    Science.gov (United States)

    Yamaguchi, Hiroshi; Sebera, Jakub; Kondo, Jiro; Oda, Shuji; Komuro, Tomoyuki; Kawamura, Takuya; Dairaku, Takenori; Kondo, Yoshinori; Okamoto, Itaru; Ono, Akira; Burda, Jaroslav V; Kojima, Chojiro; Sychrovský, Vladimír; Tanaka, Yoshiyuki

    2014-04-01

    We have determined the three-dimensional (3D) structure of DNA duplex that includes tandem Hg(II)-mediated T-T base pairs (thymine-Hg(II)-thymine, T-Hg(II)-T) with NMR spectroscopy in solution. This is the first 3D structure of metallo-DNA (covalently metallated DNA) composed exclusively of 'NATURAL' bases. The T-Hg(II)-T base pairs whose chemical structure was determined with the (15)N NMR spectroscopy were well accommodated in a B-form double helix, mimicking normal Watson-Crick base pairs. The Hg atoms aligned along DNA helical axis were shielded from the bulk water. The complete dehydration of Hg atoms inside DNA explained the positive reaction entropy (ΔS) for the T-Hg(II)-T base pair formation. The positive ΔS value arises owing to the Hg(II) dehydration, which was approved with the 3D structure. The 3D structure explained extraordinary affinity of thymine towards Hg(II) and revealed arrangement of T-Hg(II)-T base pairs in metallo-DNA.

  18. Probing the nature of hydrogen bonds in DNA base pairs.

    Science.gov (United States)

    Mo, Yirong

    2006-07-01

    Energy decomposition analyses based on the block-localized wave-function (BLW-ED) method are conducted to explore the nature of the hydrogen bonds in DNA base pairs in terms of deformation, Heitler-London, polarization, electron-transfer and dispersion-energy terms, where the Heitler-London energy term is composed of electrostatic and Pauli-exchange interactions. A modest electron-transfer effect is found in the Watson-Crick adenine-thymine (AT), guanine-cytosine (GC) and Hoogsteen adenine-thymine (H-AT) pairs, confirming the weak covalence in the hydrogen bonds. The electrostatic attraction and polarization effects account for most of the binding energies, particularly in the GC pair. Both theoretical and experimental data show that the GC pair has a binding energy (-25.4 kcal mol(-1) at the MP2/6-31G** level) twice that of the AT (-12.4 kcal mol(-1)) and H-AT (-12.8 kcal mol(-1)) pairs, compared with three conventional N-H...O(N) hydrogen bonds in the GC pair and two in the AT or H-AT pair. Although the remarkably strong binding between the guanine and cytosine bases benefits from the opposite orientations of the dipole moments in these two bases assisted by the pi-electron delocalization from the amine groups to the carbonyl groups, model calculations demonstrate that pi-resonance has very limited influence on the covalence of the hydrogen bonds. Thus, the often adopted terminology "resonance-assisted hydrogen bonding (RHAB)" may be replaced with "resonance-assisted binding" which highlights the electrostatic rather than electron-transfer nature of the enhanced stabilization, as hydrogen bonds are usually regarded as weak covalent bonds.

  19. New insights into Hoogsteen base pairs in DNA duplexes from a structure-based survey.

    Science.gov (United States)

    Zhou, Huiqing; Hintze, Bradley J; Kimsey, Isaac J; Sathyamoorthy, Bharathwaj; Yang, Shan; Richardson, Jane S; Al-Hashimi, Hashim M

    2015-04-20

    Hoogsteen (HG) base pairs (bps) provide an alternative pairing geometry to Watson-Crick (WC) bps and can play unique functional roles in duplex DNA. Here, we use structural features unique to HG bps (syn purine base, HG hydrogen bonds and constricted C1'-C1' distance across the bp) to search for HG bps in X-ray structures of DNA duplexes in the Protein Data Bank. The survey identifies 106 A•T and 34 G•C HG bps in DNA duplexes, many of which are undocumented in the literature. It also uncovers HG-like bps with syn purines lacking HG hydrogen bonds or constricted C1'-C1' distances that are analogous to conformations that have been proposed to populate the WC-to-HG transition pathway. The survey reveals HG preferences similar to those observed for transient HG bps in solution by nuclear magnetic resonance, including stronger preferences for A•T versus G•C bps, TA versus GG steps, and also suggests enrichment at terminal ends with a preference for 5'-purine. HG bps induce small local perturbations in neighboring bps and, surprisingly, a small but significant degree of DNA bending (∼14°) directed toward the major groove. The survey provides insights into the preferences and structural consequences of HG bps in duplex DNA. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  20. Relative stability of AT and GC pairs in parallel DNA duplex formed by a natural sequence.

    Science.gov (United States)

    Borisova, O F; Shchyolkina, A K; Chernov, B K; Tchurikov, N A

    1993-05-17

    The low-cooperative melting of parallel DNA formed by a natural 40 bp long sequence from Drosophila: 5'-d(TGATTGATCGATTGTTTGCATGCACACGTTTTTGTGAGCG)-3' 5'-d(ACTAACTAGCTAACAAACGTACGTGTGCAAAAACACTCGC)-3' that possesses a normal nucleotide content was studied by using the special method of measuring the fluorescence of its complex with acriflavine as well as by conventional thermal denaturation. Acriflavine allows discrimination of the melting of AT and GC pairs because its fluorescence is quenched by neighbouring G bases. We have observed that about 40% of AT pairs melt at 14 degrees C while the remainder melt at 42 degrees C. The GC pairs remain stable up to approximately 40 degrees C and melt at 54 degrees C. The higher stability of GC pairs suggests the formation of cis Watson-Crick pairs in parallel DNA.

  1. Investigation of Nascent Base Pair and Polymerase Behavior in the Presence of Mismatches in DNA Polymerase I Using Molecular Dynamics.

    Science.gov (United States)

    Yeager, Andrew; Humphries, Kathryn; Farmer, Ellen; Cline, Gene; Miller, Bill R

    2018-02-26

    Optimizing DNA polymerases for a broad range of tasks requires an understanding of the factors influencing polymerase fidelity, but many details of polymerase behavior remain unknown, especially in the presence of mismatched nascent base pairs. Using molecular dynamics, the large fragment of Bacillus stearothermophilus DNA polymerase I is simulated in the presence of all 16 possible standard nucleoside triphosphate-template (dNTP-dN) pairs, including four Watson-Crick pairs and 12 mismatches. The precatalytic steps of nucleotide addition from nucleotide insertion to immediately preceding catalysis are explored using three starting structures representing different stages of nucleotide addition. From these simulations, interactions between dNTPs and the DNA-protein complex formed by the polymerase are elucidated. Patterns of large-scale conformational shifts, classification of nucleotide pairs based on composition, and investigation of the roles of residues interacting with dNTPs are completed on 50+ μs of simulation. The role of molecular dynamics in studies of polymerase behavior is discussed.

  2. Glyoxals as in vivo RNA structural probes of guanine base-pairing.

    Science.gov (United States)

    Mitchell, David; Ritchey, Laura E; Park, Hongmarn; Babitzke, Paul; Assmann, Sarah M; Bevilacqua, Philip C

    2018-01-01

    Elucidation of the folded structures that RNA forms in vivo is vital to understanding its functions. Chemical reagents that modify the Watson-Crick (WC) face of unprotected nucleobases are particularly useful in structure elucidation. Dimethyl sulfate penetrates cell membranes and informs on RNA base-pairing and secondary structure but only modifies the WC face of adenines and cytosines. We present glyoxal, methylglyoxal, and phenylglyoxal as potent in vivo reagents that target the WC face of guanines as well as cytosines and adenines. Tests on rice (Oryza sativa) 5.8S rRNA in vitro read out by reverse transcription and gel electrophoresis demonstrate specific modification of almost all guanines in a time- and pH-dependent manner. Subsequent in vivo tests on rice, a eukaryote, and Bacillus subtilis and Escherichia coli, Gram-positive and Gram-negative bacteria, respectively, showed that all three reagents enter living cells without prior membrane permeabilization or pH adjustment of the surrounding media and specifically modify solvent-exposed guanine, cytosine, and adenine residues. © 2018 Mitchell et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

  3. The effect of intermolecular interactions on the electric dipole polarizabilities of nucleic acid base complexes

    Science.gov (United States)

    Czyżnikowska, Żaneta; Góra, Robert W.; Zaleśny, Robert; Bartkowiak, Wojciech; Baranowska-Łączkowska, Angelika; Leszczynski, Jerzy

    2013-01-01

    In this Letter, we report on the interaction-induced electric dipole polarizabilities of 70 Watson-Crick B-DNA pairs (27 adenine-thymine and 43 guanine-cytosine complexes) and 38 structures of cytosine dimer in stacked alignment. In the case of hydrogen-bonded Watson-Crick base pairs the electrostatic as well as the induction and exchange-induction interactions, increase the average polarizability of the studied complexes, whereas the exchange-repulsion effects have the opposite effect and consistently diminish this property. On the other hand, in the case of the studied cytosine dimers in stacked alignment the dominant electrostatic contribution has generally much larger magnitude and the opposite sign, resulting in a significant reduction of the average polarizability of these complexes. As a part of this model study, we also assess the performance of recently developed LPol-ds reduced-size polarized basis set. Although being much smaller than the aug-cc-pVTZ set, the LPol-ds performs equally well as far as the excess polarizabilities of the studied hydrogen-bonded complexes are concerned.

  4. Base-pairing versatility determines wobble sites in tRNA anticodons of vertebrate mitogenomes.

    Directory of Open Access Journals (Sweden)

    Miguel M Fonseca

    Full Text Available BACKGROUND: Vertebrate mitochondrial genomes typically have one transfer RNA (tRNA for each synonymous codon family. This limited anticodon repertoire implies that each tRNA anticodon needs to wobble (establish a non-Watson-Crick base pairing between two nucleotides in RNA molecules to recognize one or more synonymous codons. Different hypotheses have been proposed to explain the factors that determine the nucleotide composition of wobble sites in vertebrate mitochondrial tRNA anticodons. Until now, the two major postulates--the "codon-anticodon adaptation hypothesis" and the "wobble versatility hypothesis"--have not been formally tested in vertebrate mitochondria because both make the same predictions regarding the composition of anticodon wobble sites. The same is true for the more recent "wobble cost hypothesis". PRINCIPAL FINDINGS: In this study we have analyzed the occurrence of synonymous codons and tRNA anticodon wobble sites in 1553 complete vertebrate mitochondrial genomes, focusing on three fish species with mtDNA codon usage bias reversal (L-strand is GT-rich. These mitogenomes constitute an excellent opportunity to study the evolution of the wobble nucleotide composition of tRNA anticodons because due to the reversal the predictions for the anticodon wobble sites differ between the existing hypotheses. We observed that none of the wobble sites of tRNA anticodons in these unusual mitochondrial genomes coevolved to match the new overall codon usage bias, suggesting that nucleotides at the wobble sites of tRNA anticodons in vertebrate mitochondrial genomes are determined by wobble versatility. CONCLUSIONS/SIGNIFICANCE: Our results suggest that, at wobble sites of tRNA anticodons in vertebrate mitogenomes, selection favors the most versatile nucleotide in terms of wobble base-pairing stability and that wobble site composition is not influenced by codon usage. These results are in agreement with the "wobble versatility hypothesis".

  5. How stable are the mutagenic tautomers of DNA bases?

    Directory of Open Access Journals (Sweden)

    Brovarets’ O. O.

    2010-02-01

    Full Text Available Aim. To determine the lifetime of the mutagenic tautomers of DNA base pairs through the investigation of the physicochemical mechanisms of their intramolecular proton transfer. Methods. Non-empirical quantum chemistry, the analysis of the electron density by means of Bader’s atom in molecules (AIM theory and physicochemical kinetics were used. Results. Physicochemical character of the transition state of the intramolecular tautomerisation of DNA bases was investigated, the lifetime of mutagenic tautomers was calculated. Conclusions. The lifetime of the DNA bases mutagenic tautomers by 3–10 orders exceeds typical time of DNA replication in the cell (~103 s. This fact confirms that the postulate, on which the Watson-Crick tautomeric hypothesis of spontaneous transitions grounds, is adequate. The absence of intramolecular H-bonds in the canonical and mutagenic tautomeric forms determine their high stability

  6. Development of mercury (II) ion biosensors based on mercury-specific oligonucleotide probes.

    Science.gov (United States)

    Li, Lanying; Wen, Yanli; Xu, Li; Xu, Qin; Song, Shiping; Zuo, Xiaolei; Yan, Juan; Zhang, Weijia; Liu, Gang

    2016-01-15

    Mercury (II) ion (Hg(2+)) contamination can be accumulated along the food chain and cause serious threat to the public health. Plenty of research effort thus has been devoted to the development of fast, sensitive and selective biosensors for monitoring Hg(2+). Thymine was demonstrated to specifically combine with Hg(2+) and form a thymine-Hg(2+)-thymine (T-Hg(2+)-T) structure, with binding constant even higher than T-A Watson-Crick pair in DNA duplex. Recently, various novel Hg(2+) biosensors have been developed based on T-rich Mercury-Specific Oligonucleotide (MSO) probes, and exhibited advanced selectivity and excellent sensitivity for Hg(2+) detection. In this review, we explained recent development of MSO-based Hg(2+) biosensors mainly in 3 groups: fluorescent biosensors, colorimetric biosensors and electrochemical biosensors. Copyright © 2015 Elsevier B.V. All rights reserved.

  7. A Survey of Advancements in Nucleic Acid-based Logic Gates and Computing for Applications in Biotechnology and biomedicine

    Science.gov (United States)

    Wu, Cuichen; Wan, Shuo; Hou, Weijia; Zhang, Liqin; Xu, Jiehua; Cui, Cheng; Wang, Yanyue; Hu, Jun

    2015-01-01

    Nucleic acid-based logic devices were first introduced in 1994. Since then, science has seen the emergence of new logic systems for mimicking mathematical functions, diagnosing disease and even imitating biological systems. The unique features of nucleic acids, such as facile and high-throughput synthesis, Watson-Crick complementary base pairing, and predictable structures, together with the aid of programming design, have led to the widespread applications of nucleic acids (NA) for logic gating and computing in biotechnology and biomedicine. In this feature article, the development of in vitro NA logic systems will be discussed, as well as the expansion of such systems using various input molecules for potential cellular, or even in vivo, applications. PMID:25597946

  8. Theoretical investigation of hydrogen atom transfer in the cytosine-guanine base pair and its coupling with electronic rearrangement. Concerted vs stepwise mechanism.

    Science.gov (United States)

    Villani, Giovanni

    2010-07-29

    The transformation of the DNA base pairs from the Watson-Crick (WC) structures to its tautomers having imino-enol form can be achieved via two types of hydrogen atom transfer processes: (i) concerted, and/or (ii) stepwise (step by step). Here, we have studied and compared these two mechanisms in the cytosine-guanine (C-G) system. In the first mechanism there is the concerted movement of two hydrogen atoms along two of the three H-bridges that bond the bases, one from the cytosine to guanine and the other in the opposite direction. This movement must be coupled to an electronic reorganization, with some bond orders that pass from single to double and vice versa, in order to preserve the neutrality of these new structures. In the stepwise mechanism the movement of the hydrogen atoms and the electronic reorganization are not concerted, and it implicates the movement of a hydrogen atom at a time with the identification of two or more steps in this reaction. There are two possible neutral imino-enol structures in the C-G system, and both have been considered here. The principal result from this paper is that a different behavior is observed if the hydrogen transfer begins with a H of the guanine or of the cytosine and that a concerted (synchronic in the N-N and asynchronic in the N-O) double-hydrogen transfer can be activated only when the first H atom to move is that of the guanine, in particular. This is different from the A-T system(1) studied previously where the movement in a N-N bridge produces a zwitterionic structure and that in the N-O the concerted double-hydrogen transfer. In both cases a general conclusion can be given: the concerted double-hydrogen process begins with a hydrogen atom of a purinic base.

  9. Consecutive non-natural PZ nucleobase pairs in DNA impact helical structure as seen in 50 μs molecular dynamics simulations.

    Science.gov (United States)

    Molt, Robert W; Georgiadis, Millie M; Richards, Nigel G J

    2017-04-20

    Little is known about the influence of multiple consecutive 'non-standard' ( , 6-amino-5-nitro-2(1H)-pyridone, and , 2-amino-imidazo[1,2-a]-1,3,5-triazin-4(8H)-one) nucleobase pairs on the structural parameters of duplex DNA. nucleobase pairs follow standard rules for Watson-Crick base pairing but have rearranged hydrogen bonding donor and acceptor groups. Using the X-ray crystal structure as a starting point, we have modeled the motions of a DNA duplex built from a self-complementary oligonucleotide (5΄-CTTATPPPZZZATAAG-3΄) in water over a period of 50 μs and calculated DNA local parameters, step parameters, helix parameters, and major/minor groove widths to examine how the presence of multiple, consecutive nucleobase pairs might impact helical structure. In these simulations, the -containing DNA duplex exhibits a significantly wider major groove and greater average values of stagger, slide, rise, twist and h-rise than observed for a 'control' oligonucleotide in which nucleobase pairs are replaced by . The molecular origins of these structural changes are likely associated with at least two differences between and . First, the electrostatic properties of differ from in terms of density distribution and dipole moment. Second, differences are seen in the base stacking of pairs in dinucleotide steps, arising from energetically favorable stacking of the nitro group in with π-electrons of the adjacent base.

  10. Base-Pairing Energies of Proton-Bound Dimers and Proton Affinities of 1-Methyl-5-Halocytosines: Implications for the Effects of Halogenation on the Stability of the DNA i-Motif

    Science.gov (United States)

    Yang, Bo; Wu, R. R.; Rodgers, M. T.

    2015-09-01

    (CCG)n•(CGG)n trinucleotide repeats have been found to be associated with fragile X syndrome, the most widespread inherited cause of mental retardation in humans. The (CCG)n•(CGG)n repeats adopt i-motif conformations that are preferentially stabilized by base-pairing interactions of noncanonical proton-bound dimers of cytosine (C+•C). Halogenated cytosine residues are one form of DNA damage that may be important in altering the structure and stability of DNA or DNA-protein interactions and, hence, regulate gene expression. Previously, we investigated the effects of 5-halogenation and 1-methylation of cytosine on the base-pairing energies (BPEs) using threshold collision-induced dissociation (TCID) techniques. In the present study, we extend our work to include proton-bound homo- and heterodimers of cytosine, 1-methyl-5-fluorocytosine, and 1-methyl-5-bromocytosine. All modifications examined here are found to produce a decrease in the BPEs. However, the BPEs of all of the proton-bound dimers examined significantly exceed those of Watson-Crick G•C, neutral C•C base pairs, and various methylated variants such that DNA i-motif conformations should still be preserved in the presence of these modifications. The proton affinities (PAs) of the halogenated cytosines are also obtained from the experimental data by competitive analysis of the primary dissociation pathways that occur in parallel for the proton-bound heterodimers. 5-Halogenation leads to a decrease in the N3 PA of cytosine, whereas 1-methylation leads to an increase in the N3 PA. Thus, the 1-methyl-5-halocytosines exhibit PAs that are intermediate.

  11. Base-Pairing Energies of Proton-Bound Dimers and Proton Affinities of 1-Methyl-5-Halocytosines: Implications for the Effects of Halogenation on the Stability of the DNA i-Motif.

    Science.gov (United States)

    Yang, Bo; Wu, R R; Rodgers, M T

    2015-09-01

    (CCG)(n)•(CGG)(n) trinucleotide repeats have been found to be associated with fragile X syndrome, the most widespread inherited cause of mental retardation in humans. The (CCG)(n)•(CGG)(n) repeats adopt i-motif conformations that are preferentially stabilized by base-pairing interactions of noncanonical proton-bound dimers of cytosine (C(+)•C). Halogenated cytosine residues are one form of DNA damage that may be important in altering the structure and stability of DNA or DNA-protein interactions and, hence, regulate gene expression. Previously, we investigated the effects of 5-halogenation and 1-methylation of cytosine on the base-pairing energies (BPEs) using threshold collision-induced dissociation (TCID) techniques. In the present study, we extend our work to include proton-bound homo- and heterodimers of cytosine, 1-methyl-5-fluorocytosine, and 1-methyl-5-bromocytosine. All modifications examined here are found to produce a decrease in the BPEs. However, the BPEs of all of the proton-bound dimers examined significantly exceed those of Watson-Crick G•C, neutral C•C base pairs, and various methylated variants such that DNA i-motif conformations should still be preserved in the presence of these modifications. The proton affinities (PAs) of the halogenated cytosines are also obtained from the experimental data by competitive analysis of the primary dissociation pathways that occur in parallel for the proton-bound heterodimers. 5-Halogenation leads to a decrease in the N3 PA of cytosine, whereas 1-methylation leads to an increase in the N3 PA. Thus, the 1-methyl-5-halocytosines exhibit PAs that are intermediate.

  12. Portrait of a discovery. Watson, Crick, and the double helix.

    Science.gov (United States)

    de Chadarevian, Soraya

    2003-03-01

    This essay examines an iconic image of twentieth-century science: Antony Barrington Brown's photograph of James Watson, Francis Crick, and the double-helical model of DNA. The detailed reconstruction of the production, reception, and uses of the photograph reveals the central role of the image in making the discovery it portrays. Taken in May 1953, two full months after the scientists built the model, to accompany a report on the structure in Time magazine, the photograph (like the report) was never published. It came into circulation only fifteen years later, as an illustration in Watson's best-selling book The Double Helix. While the image served as a historical document and advertisement for the book, only the book provided the description that made the image as well as the people and the model it represented famous. The history of the image provides insights into the retrospective construction of the discovery, which has since been celebrated as the origin of a new science of life.

  13. Hydration sites of unpaired RNA bases: a statistical analysis of the PDB structures

    Directory of Open Access Journals (Sweden)

    Carugo Oliviero

    2011-10-01

    Full Text Available Abstract Background Hydration is crucial for RNA structure and function. X-ray crystallography is the most commonly used method to determine RNA structures and hydration and, therefore, statistical surveys are based on crystallographic results, the number of which is quickly increasing. Results A statistical analysis of the water molecule distribution in high-resolution X-ray structures of unpaired RNA nucleotides showed that: different bases have the same penchant to be surrounded by water molecules; clusters of water molecules indicate possible hydration sites, which, in some cases, match those of the major and minor grooves of RNA and DNA double helices; complex hydrogen bond networks characterize the solvation of the nucleotides, resulting in a significant rigidity of the base and its surrounding water molecules. Interestingly, the hydration sites around unpaired RNA bases do not match, in general, the positions that are occupied by the second nucleotide when the base-pair is formed. Conclusions The hydration sites around unpaired RNA bases were found. They do not replicate the atom positions of complementary bases in the Watson-Crick pairs.

  14. Structural and energetic characterization of the emissive RNA alphabet based on the isothiazolo[4,3-d]pyrimidine heterocycle core

    KAUST Repository

    Chawla, Mohit

    2016-06-01

    We present theoretical characterization of fluorescent non-natural nucleobases, tzA, tzG, tzC, and tzU, derived from the isothiazolo[4,3-d]pyrimidine heterocycle. Consistent with the experimental evidence, our calculations show that the non-natural bases have minimal impact on the geometry and stability of the classical Watson-Crick base pairs, allowing them to accurately mimic natural bases in a RNA duplex, in terms of H-bonding. In contrast, our calculations indicate that H-bonded base pairs involving the Hoogsteen edge are destabilized relative to their natural counterparts. Analysis of the photophysical properties of the non-natural bases allowed us to correlate their absorption/emission peaks to the strong impact of the modification on the energy of the lowest unoccupied molecular orbital, LUMO, which is stabilized by roughly 1.0-1.2 eV relative to the natural analogues, while the highest occupied molecular orbital, HOMO, is not substantially affected. As a result, the HOMO-LUMO gap is reduced from 5.3-5.5 eV in the natural bases to 4.0-4.4 eV in the modified ones, with a consequent bathochromic shift in the absorption and emission spectra. © 2016 the Owner Societies.

  15. DNA adduct bypass polymerization by Sulfolobus solfataricus DNA polymerase Dpo4: analysis and crystal structures of multiple base pair substitution and frameshift products with the adduct 1,N2-ethenoguanine.

    Science.gov (United States)

    Zang, Hong; Goodenough, Angela K; Choi, Jeong-Yun; Irimia, Adriana; Loukachevitch, Lioudmila V; Kozekov, Ivan D; Angel, Karen C; Rizzo, Carmelo J; Egli, Martin; Guengerich, F Peter

    2005-08-19

    1,N(2)-Etheno(epsilon)guanine is a mutagenic DNA lesion derived from lipid oxidation products and also from some chemical carcinogens. Gel electrophoretic analysis of the products of primer extension by Sulfolobus solfataricus P2 DNA polymerase IV (Dpo4) indicated preferential incorporation of A opposite 3'-(1,N(2)-epsilon-G)TACT-5', among the four dNTPs tested individually. With the template 3'-(1,N(2)-epsilon-G)CACT-5', both G and A were incorporated. When primer extension was done in the presence of a mixture of all four dNTPs, high pressure liquid chromatography-mass spectrometry analysis of the products indicated that (opposite 3'-(1,N(2)-epsilon-G)CACT-5') the major product was 5'-GTGA-3' and the minor product was 5'-AGTGA-3'. With the template 3'-(1,N(2)-epsilon-G)TACT-5', the following four products were identified by high pressure liquid chromatography-mass spectrometry: 5'-AATGA-3', 5'-ATTGA-3', 5'-ATGA-3', and 5'-TGA-3'. An x-ray crystal structure of Dpo4 was solved (2.1 A) with a primer-template and A placed in the primer to be opposite the 1,N(2)-epsilon-G in the template 3'-(1,N(2)-epsilon-G)TACT 5'. The added A in the primer was paired across the template T with classic Watson-Crick geometry. Similar structures were observed in a ternary Dpo4-DNA-dATP complex and a ternary Dpo4-DNA-ddATP complex, with d(d)ATP opposite the template T. A similar structure was observed with a ddGTP adjacent to the primer and opposite the C next to 1,N(2)-epsilon-G in 3'-(1,N(2)-epsilon-G)CACT-5'. We concluded that Dpo4 uses several mechanisms, including A incorporation opposite 1,N(2)-epsilon-G and also a variation of dNTP-stabilized misalignment, to generate both base pair and frameshift mutations.

  16. Base Sequence Context Effects on Nucleotide Excision Repair

    Science.gov (United States)

    Cai, Yuqin; Patel, Dinshaw J.; Broyde, Suse; Geacintov, Nicholas E.

    2010-01-01

    Nucleotide excision repair (NER) plays a critical role in maintaining the integrity of the genome when damaged by bulky DNA lesions, since inefficient repair can cause mutations and human diseases notably cancer. The structural properties of DNA lesions that determine their relative susceptibilities to NER are therefore of great interest. As a model system, we have investigated the major mutagenic lesion derived from the environmental carcinogen benzo[a]pyrene (B[a]P), 10S (+)-trans-anti-B[a]P-N2-dG in six different sequence contexts that differ in how the lesion is positioned in relation to nearby guanine amino groups. We have obtained molecular structural data by NMR and MD simulations, bending properties from gel electrophoresis studies, and NER data obtained from human HeLa cell extracts for our six investigated sequence contexts. This model system suggests that disturbed Watson-Crick base pairing is a better recognition signal than a flexible bend, and that these can act in concert to provide an enhanced signal. Steric hinderance between the minor groove-aligned lesion and nearby guanine amino groups determines the exact nature of the disturbances. Both nearest neighbor and more distant neighbor sequence contexts have an impact. Regardless of the exact distortions, we hypothesize that they provide a local thermodynamic destabilization signal for repair. PMID:20871811

  17. Full design automation of multi-state RNA devices to program gene expression using energy-based optimization.

    Directory of Open Access Journals (Sweden)

    Guillermo Rodrigo

    Full Text Available Small RNAs (sRNAs can operate as regulatory agents to control protein expression by interaction with the 5' untranslated region of the mRNA. We have developed a physicochemical framework, relying on base pair interaction energies, to design multi-state sRNA devices by solving an optimization problem with an objective function accounting for the stability of the transition and final intermolecular states. Contrary to the analysis of the reaction kinetics of an ensemble of sRNAs, we solve the inverse problem of finding sequences satisfying targeted reactions. We show here that our objective function correlates well with measured riboregulatory activity of a set of mutants. This has enabled the application of the methodology for an extended design of RNA devices with specified behavior, assuming different molecular interaction models based on Watson-Crick interaction. We designed several YES, NOT, AND, and OR logic gates, including the design of combinatorial riboregulators. In sum, our de novo approach provides a new paradigm in synthetic biology to design molecular interaction mechanisms facilitating future high-throughput functional sRNA design.

  18. Label-free DNA biosensor based on a peptide nucleic acid-functionalized microstructured optical fiber-Bragg grating

    Science.gov (United States)

    Candiani, Alessandro; Bertucci, Alessandro; Giannetti, Sara; Konstantaki, Maria; Manicardi, Alex; Pissadakis, Stavros; Cucinotta, Annamaria; Corradini, Roberto; Selleri, Stefano

    2013-05-01

    We describe a novel sensing approach based on a functionalized microstructured optical fiber-Bragg grating for specific DNA target sequences detection. The inner surface of a microstructured fiber, where a Bragg grating was previously inscribed, has been functionalized by covalent linking of a peptide nucleic acid probe targeting a DNA sequence bearing a single point mutation implicated in cystic fibrosis (CF) disease. A solution of an oligonucleotide (ON) corresponding to a tract of the CF gene containing the mutated DNA has been infiltrated inside the fiber capillaries and allowed to hybridize to the fiber surface according to the Watson-Crick pairing. In order to achieve signal amplification, ON-functionalized gold nanoparticles were then infiltrated and used in a sandwich-like assay. Experimental measurements show a clear shift of the reflected high order mode of a Bragg grating for a 100 nM DNA solution, and fluorescence measurements have confirmed the successful hybridization. Several experiments have been carried out on the same fiber using the identical concentration, showing the same modulation trend, suggesting the possibility of the reuse of the sensor. Measurements have also been made using a 100 nM mismatched DNA solution, containing a single nucleotide mutation and corresponding to the wild-type gene, and the results demonstrate the high selectivity of the sensor.

  19. The m6A methylation perturbs the Hoogsteen pairing-guided incorporation of an oxidized nucleotide.

    Science.gov (United States)

    Wang, Shaoru; Song, Yanyan; Wang, Yafen; Li, Xin; Fu, Boshi; Liu, Yinong; Wang, Jiaqi; Wei, Lai; Tian, Tian; Zhou, Xiang

    2017-09-01

    Natural nucleic acid bases can form Watson-Crick (WC) or Hoogsteen (HG) base pairs. Importantly, 8-oxo-2'-deoxyguanosine (8-oxo-dG) in DNA or 8-oxo-dG 5'-triphosphate (8-oxo-dGTP) favors a syn conformation because of the steric repulsion between O8 and O4' of the deoxyribose ring. 8-oxo-dGTP can be incorporated into DNA opposite the templating adenine (A) using HG pairing as the dominant mechanism. Both RNA and DNA can be methylated at the N6 position of A to form N6-methyladenine (m6A). It has been found that certain viral infections may trigger an increase in the production of both 8-oxo-dGTP and m6A. The current study aims to systematically explore the effects of m6A methylation on HG base pairs and the consequent nucleotide incorporation. Our thermodynamic melting study shows that the m6A·8-oxo-dG is significantly less stable than the A·8-oxo-dG base pair in the paired region of a DNA duplex. Moreover, we have used pre-steady-state kinetics to examine the incorporation of 8-oxo-dGTP opposite m6A relative to A by a variety of reverse transcriptase (RT) enzymes and DNA polymerase (DNA pol) enzymes such as the human immunodeficiency virus type 1 (HIV-1) RT and human DNA pol β. The results demonstrate that all of these enzymes incorporate 8-oxo-dGTP less efficiently opposite m6A relative to A. Considering the steric bulk of the purine-purine pair between 8-oxo-dG and A, m6A methylation may affect the HG pairing to a great extent. Hence, it will be unfavorable to incorporate 8-oxo-dGTP into the growing strand opposite m6A. Moreover, the impeded incorporation of 8-oxo-dGTP opposite m6A has been extended to determine m6A at pre-defined positions in human rRNA. Our study may provide new insights into the roles of m6A in reducing the mutagenic potential of cellular 8-oxo-dGTP.

  20. The significant role of the intermolecular CH⋯O/N hydrogen bonds in governing the biologically important pairs of the DNA and RNA modified bases: a comprehensive theoretical investigation.

    Science.gov (United States)

    Brovarets', Ol'ha O; Yurenko, Yevgen P; Hovorun, Dmytro M

    2015-01-01

    contribution of the CH⋯O and CH⋯N H-bonds into the base pairs stability varies from 3.0/4.2 to 35.1/31.2% and from 3.0/4.3 to 44.4/46.5% at the DFT/MP2 levels of theory, accordingly. Energy decomposition analysis performed for all base pairs involving canonical and modified nucleobases defines the electrostatic attraction and Pauli repulsion as dominant stabilizing forces in all complexes. This observation was additionally confirmed by the results of the QTAIM delocalization indexes analysis. The studies reported here advance our understanding of the biological role of the weak CH⋯O/N H-bonds, that dictates the requirements for the structural and dynamical similarity of the canonical and mismatched pairs with Watson-Crick (WC) geometry, which facilitates their enzymatic incorporation into the DNA double helix during DNA replication. Thus, these H-bonds in the base pairs with WC geometry may be also considered as "the last drop" at the transmission of the electronic signal that launches the chemical incorporation of the incoming nucleoside triphosphate into DNA.

  1. Substituent effects on hydrogen bonds in DNA : A kohn-sham DFT approach

    NARCIS (Netherlands)

    Guerra, Célia Fonseca; Bickelhaupt, F. Matthias

    2006-01-01

    In this Chapter, we discuss how the hydrogen bonds in Watson-Crick base pairs can be tuned both structurally and in terms of bond strength by exposing the DNA bases to different kinds of substitutions: (1) substitution in the X-H Y hydrogen bonding moiety, (2) remote substitution, i.e., introducing

  2. Condensing the information in DNA with double-headed nucleotides

    DEFF Research Database (Denmark)

    Hornum, Mick; Sharma, Pawan K; Reslow-Jacobsen, Charlotte

    2017-01-01

    A normal duplex holds as many Watson-Crick base pairs as the number of nucleotides in its constituent strands. Here we establish that single nucleotides can be designed to functionally imitate dinucleotides without compromising binding affinity. This effectively allows sequence information...

  3. The donor substrate site within the peptidyl transferase loop of 23 S rRNA and its putative interactions with the CCA-end of N-blocked aminoacyl-tRNA(Phe)

    DEFF Research Database (Denmark)

    Porse, B T; Thi-Ngoc, H P; Garrett, R A

    1996-01-01

    was employed to test for Watson-Crick base-pairing interactions between the -CCA end of the P-site bound tRNA(Phe) and this region of the peptidyl-transferase loop. Single nucleotide substitutions were introduced into the -CCA end of tRNA(Phe) and the ability of the 3'-terminal pentanucleotide fragments to act...

  4. Sequence-dependent structural changes in a self-assembling DNA oligonucleotide.

    Science.gov (United States)

    Saoji, Maithili; Paukstelis, Paul J

    2015-12-01

    DNA has proved to be a remarkable molecule for the construction of sophisticated two-dimensional and three-dimensional architectures because of its programmability and structural predictability provided by complementary Watson-Crick base pairing. DNA oligonucleotides can, however, exhibit a great deal of local structural diversity. DNA conformation is strongly linked to both environmental conditions and the nucleobase identities inherent in the oligonucleotide sequence, but the exact relationship between sequence and local structure is not completely understood. This study examines how a single-nucleotide addition to a class of self-assembling DNA 13-mers leads to a significantly different overall structure under identical crystallization conditions. The DNA 13-mers self-assemble in the presence of Mg(2+) through a combination of Watson-Crick and noncanonical base-pairing interactions. The crystal structures described here show that all of the predicted Watson-Crick base pairs are present, with the major difference being a significant rearrangement of noncanonical base pairs. This includes the formation of a sheared A-G base pair, a junction of strands formed from base-triple interactions, and tertiary interactions that generate structural features similar to tandem sheared G-A base pairs. The adoption of this alternate noncanonical structure is dependent in part on the sequence in the Watson-Crick duplex region. These results provide important new insights into the sequence-structure relationship of short DNA oligonucleotides and demonstrate a unique interplay between Watson-Crick and noncanonical base pairs that is responsible for crystallization fate.

  5. Polarizable model potential function for nucleic acid bases.

    Science.gov (United States)

    Nakagawa, Setsuko

    2007-07-15

    A polarizable model potential (PMP) function for adenine (A), cytosine (C), guanine (G), thymine (T), and uracil (U) is developed on the basis of ab initio molecular orbital calculations at the MP2/6-31+G* level. The PMP function consists of Coulomb, van der Waals, and polarization terms. The permanent atomic charges of the Coulomb term are determined by using electrostatic potential (ESP) optimization. The multicenter polarizabilities of the polarization term are determined by using polarized one-electron potential (POP) optimization in which the electron density changes induced by a test charge are target. Isotropic and anisotropic polarizabilities are adopted as the multicenter polarizabilities. In the PMP calculations using the optimized parameters, the interaction energies of Watson-Crick type A-T and C-G base pairs were -15.6 and -29.4 kcal/mol, respectively. The interaction energy of Hoogsteen type A-T base pair was -17.8 kcal/mol. These results reproduce well the quantum chemistry calculations at the MP2/6-311++G(3df,2pd) level within the differences of 0.6 kcal/mol. The stacking energies of A-T and C-G were -9.7 and -10.9 kcal/mol. These reproduce well the calculation results at the MP2/6-311++G (2d,2p) level within the differences of 1.3 kcal/mol. The potential energy surfaces of the system in which a sodium ion or a chloride ion is adjacent to the nucleic acid base are calculated. The interaction energies of the PMP function reproduced well the calculation results at the MP2/6-31+G* or MP2/6-311++G(2d,2p) level. The reason why the PMP function reproduces well the high-level quantum mechanical interaction energies is addressed from the viewpoint of each energy terms. Copyright (c) 2007 Wiley Periodicals, Inc.

  6. Developing nucleic acid-based electrical detection systems.

    Science.gov (United States)

    Gabig-Ciminska, Magdalena

    2006-03-02

    Development of nucleic acid-based detection systems is the main focus of many research groups and high technology companies. The enormous work done in this field is particularly due to the broad versatility and variety of these sensing devices. From optical to electrical systems, from label-dependent to label-free approaches, from single to multi-analyte and array formats, this wide range of possibilities makes the research field very diversified and competitive. New challenges and requirements for an ideal detector suitable for nucleic acid analysis include high sensitivity and high specificity protocol that can be completed in a relatively short time offering at the same time low detection limit. Moreover, systems that can be miniaturized and automated present a significant advantage over conventional technology, especially if detection is needed in the field. Electrical system technology for nucleic acid-based detection is an enabling mode for making miniaturized to micro- and nanometer scale bio-monitoring devices via the fusion of modern micro- and nanofabrication technology and molecular biotechnology. The electrical biosensors that rely on the conversion of the Watson-Crick base-pair recognition event into a useful electrical signal are advancing rapidly, and recently are receiving much attention as a valuable tool for microbial pathogen detection. Pathogens may pose a serious threat to humans, animal and plants, thus their detection and analysis is a significant element of public health. Although different conventional methods for detection of pathogenic microorganisms and their toxins exist and are currently being applied, improvements of molecular-based detection methodologies have changed these traditional detection techniques and introduced a new era of rapid, miniaturized and automated electrical chip detection technologies into pathogen identification sector. In this review some developments and current directions in nucleic acid-based electrical

  7. Developing nucleic acid-based electrical detection systems

    Directory of Open Access Journals (Sweden)

    Gabig-Ciminska Magdalena

    2006-03-01

    Full Text Available Abstract Development of nucleic acid-based detection systems is the main focus of many research groups and high technology companies. The enormous work done in this field is particularly due to the broad versatility and variety of these sensing devices. From optical to electrical systems, from label-dependent to label-free approaches, from single to multi-analyte and array formats, this wide range of possibilities makes the research field very diversified and competitive. New challenges and requirements for an ideal detector suitable for nucleic acid analysis include high sensitivity and high specificity protocol that can be completed in a relatively short time offering at the same time low detection limit. Moreover, systems that can be miniaturized and automated present a significant advantage over conventional technology, especially if detection is needed in the field. Electrical system technology for nucleic acid-based detection is an enabling mode for making miniaturized to micro- and nanometer scale bio-monitoring devices via the fusion of modern micro- and nanofabrication technology and molecular biotechnology. The electrical biosensors that rely on the conversion of the Watson-Crick base-pair recognition event into a useful electrical signal are advancing rapidly, and recently are receiving much attention as a valuable tool for microbial pathogen detection. Pathogens may pose a serious threat to humans, animal and plants, thus their detection and analysis is a significant element of public health. Although different conventional methods for detection of pathogenic microorganisms and their toxins exist and are currently being applied, improvements of molecular-based detection methodologies have changed these traditional detection techniques and introduced a new era of rapid, miniaturized and automated electrical chip detection technologies into pathogen identification sector. In this review some developments and current directions in

  8. Developing nucleic acid-based electrical detection systems

    Science.gov (United States)

    Gabig-Ciminska, Magdalena

    2006-01-01

    Development of nucleic acid-based detection systems is the main focus of many research groups and high technology companies. The enormous work done in this field is particularly due to the broad versatility and variety of these sensing devices. From optical to electrical systems, from label-dependent to label-free approaches, from single to multi-analyte and array formats, this wide range of possibilities makes the research field very diversified and competitive. New challenges and requirements for an ideal detector suitable for nucleic acid analysis include high sensitivity and high specificity protocol that can be completed in a relatively short time offering at the same time low detection limit. Moreover, systems that can be miniaturized and automated present a significant advantage over conventional technology, especially if detection is needed in the field. Electrical system technology for nucleic acid-based detection is an enabling mode for making miniaturized to micro- and nanometer scale bio-monitoring devices via the fusion of modern micro- and nanofabrication technology and molecular biotechnology. The electrical biosensors that rely on the conversion of the Watson-Crick base-pair recognition event into a useful electrical signal are advancing rapidly, and recently are receiving much attention as a valuable tool for microbial pathogen detection. Pathogens may pose a serious threat to humans, animal and plants, thus their detection and analysis is a significant element of public health. Although different conventional methods for detection of pathogenic microorganisms and their toxins exist and are currently being applied, improvements of molecular-based detection methodologies have changed these traditional detection techniques and introduced a new era of rapid, miniaturized and automated electrical chip detection technologies into pathogen identification sector. In this review some developments and current directions in nucleic acid-based electrical

  9. Report on Pairing-based Cryptography.

    Science.gov (United States)

    Moody, Dustin; Peralta, Rene; Perlner, Ray; Regenscheid, Andrew; Roginsky, Allen; Chen, Lily

    2015-01-01

    This report summarizes study results on pairing-based cryptography. The main purpose of the study is to form NIST's position on standardizing and recommending pairing-based cryptography schemes currently published in research literature and standardized in other standard bodies. The report reviews the mathematical background of pairings. This includes topics such as pairing-friendly elliptic curves and how to compute various pairings. It includes a brief introduction to existing identity-based encryption (IBE) schemes and other cryptographic schemes using pairing technology. The report provides a complete study of the current status of standard activities on pairing-based cryptographic schemes. It explores different application scenarios for pairing-based cryptography schemes. As an important aspect of adopting pairing-based schemes, the report also considers the challenges inherent in validation testing of cryptographic algorithms and modules. Based on the study, the report suggests an approach for including pairing-based cryptography schemes in the NIST cryptographic toolkit. The report also outlines several questions that will require further study if this approach is followed.

  10. Base-displaced intercalation of the 2-amino-3-methylimidazo[4,5-f]quinolone N2-dG adduct in the NarI DNA recognition sequence.

    Science.gov (United States)

    Stavros, Kallie M; Hawkins, Edward K; Rizzo, Carmelo J; Stone, Michael P

    2014-03-01

    2-Amino-3-methylimidazo[4,5-f]quinolone (IQ), a heterocyclic amine found in cooked meats, undergoes bioactivation to a nitrenium ion, which alkylates guanines at both the C8-dG and N2-dG positions. The conformation of a site-specific N2-dG-IQ adduct in an oligodeoxynucleotide duplex containing the iterated CG repeat restriction site of the NarI endonuclease has been determined. The IQ moiety intercalates, with the IQ H4a and CH3 protons facing the minor groove, and the IQ H7a, H8a and H9a protons facing the major groove. The adducted dG maintains the anti-conformation about the glycosyl bond. The complementary dC is extruded into the major groove. The duplex maintains its thermal stability, which is attributed to stacking between the IQ moiety and the 5'- and 3'-neighboring base pairs. This conformation is compared to that of the C8-dG-IQ adduct in the same sequence, which also formed a 'base-displaced intercalated' conformation. However, the C8-dG-IQ adopted the syn conformation placing the Watson-Crick edge of the modified dG into the major groove. In addition, the C8-dG-IQ adduct was oriented with the IQ CH3 group and H4a and H5a facing the major groove. These differences may lead to differential processing during DNA repair and replication.

  11. Introducing a model of pairing based on base pair specific interactions between identical DNA sequences

    Science.gov (United States)

    (O’ Lee, Dominic J.

    2018-02-01

    At present, there have been suggested two types of physical mechanism that may facilitate preferential pairing between DNA molecules, with identical or similar base pair texts, without separation of base pairs. One mechanism solely relies on base pair specific patterns of helix distortion being the same on the two molecules, discussed extensively in the past. The other mechanism proposes that there are preferential interactions between base pairs of the same composition. We introduce a model, built on this second mechanism, where both thermal stretching and twisting fluctuations are included, as well as the base pair specific helix distortions. Firstly, we consider an approximation for weak pairing interactions, or short molecules. This yields a dependence of the energy on the square root of the molecular length, which could explain recent experimental data. However, analysis suggests that this approximation is no longer valid at large DNA lengths. In a second approximation, for long molecules, we define two adaptation lengths for twisting and stretching, over which the pairing interaction can limit the accumulation of helix disorder. When the pairing interaction is sufficiently strong, both adaptation lengths are finite; however, as we reduce pairing strength, the stretching adaptation length remains finite but the torsional one becomes infinite. This second state persists to arbitrarily weak values of the pairing strength; suggesting that, if the molecules are long enough, the pairing energy scales as length. To probe differences between the two pairing mechanisms, we also construct a model of similar form. However, now, pairing between identical sequences solely relies on the intrinsic helix distortion patterns. Between the two models, we see interesting qualitative differences. We discuss our findings, and suggest new work to distinguish between the two mechanisms.

  12. Distinct mechanisms of cis-syn thymine dimer bypass by Dpo4 and DNA polymerase eta.

    Science.gov (United States)

    Johnson, Robert E; Prakash, Louise; Prakash, Satya

    2005-08-30

    UV-light-induced cyclobutane pyrimidine dimers (CPDs) present a severe block to synthesis by replicative DNA polymerases (Pols), whereas Poleta promotes proficient and error-free replication through CPDs. Although the archael Dpo4, which, like Poleta, belongs to the Y family of DNA Pols, can also replicate through a CPD, it is much less efficient than Poleta. The x-ray crystal structure of Dpo4 complexed with either the 3'-thymine (T) or the 5' T of a cis-syn TT dimer has indicated that, whereas the 3' T of the dimer forms a Watson-Crick base pair with the incoming dideoxy ATP, the 5' T forms a Hoogsteen base pair with the dideoxy ATP in syn conformation. Based upon these observations, a similar mechanism involving Hoogsteen base pairing of the 5' T of the dimer with the incoming A has been proposed for Poleta. Here we examine the mechanisms of CPD bypass by Dpo4 and Poleta using nucleotide analogs that specifically disrupt the Hoogsteen or Watson-Crick base pairing. Our results show that both Dpo4 and Poleta incorporate dATP opposite the 5' T of the CPD via Watson-Crick base pairing and not by Hoogsteen base pairing. Furthermore, opposite the 3' T of the dimer, the two Pols differ strikingly in the mechanisms of dATP incorporation, with Dpo4 incorporating opposite an abasic-like intermediate and Poleta using the normal Watson-Crick base pairing. These observations have important implications for the mechanisms used for the inefficient vs. efficient bypass of CPDs by DNA Pols.

  13. DNA-Directed Base Pair Opening

    Directory of Open Access Journals (Sweden)

    Youri Timsit

    2012-10-01

    Full Text Available Strand separation is a fundamental molecular process essential for the reading of the genetic information during DNA replication, transcription and recombination. However, DNA melting in physiological conditions in which the double helix is expected to be stable represents a challenging problem. Current models propose that negative supercoiling destabilizes the double helix and promotes the spontaneous, sequence-dependent DNA melting. The present review examines an alternative view and reveals how DNA compaction may trigger the sequence dependent opening of the base pairs. This analysis shows that in DNA crystals, tight DNA-DNA interactions destabilize the double helices at various degrees, from the alteration of the base-stacking to the opening of the base-pairs. The electrostatic repulsion generated by the DNA close approach of the negatively charged sugar phosphate backbones may therefore provide a potential source of the energy required for DNA melting. These observations suggest a new molecular mechanism for the initial steps of strand separation in which the coupling of the DNA tertiary and secondary interactions both actively triggers the base pair opening and stabilizes the intermediate states during the melting pathway.

  14. Differential base stacking interactions induced by trimethylene interstrand DNA cross-links in the 5'-CpG-3' and 5'-GpC-3' sequence contexts.

    Science.gov (United States)

    Huang, Hai; Dooley, Patricia A; Harris, Constance M; Harris, Thomas M; Stone, Michael P

    2009-11-01

    Synthetically derived trimethylene interstrand DNA cross-links have been used as surrogates for the native cross-links that arise from the 1,N(2)-deoxyguanosine adducts derived from alpha,beta-unsaturated aldehydes. The native enal-mediated cross-linking occurs in the 5'-CpG-3' sequence context but not in the 5'-GpC-3' sequence context. The ability of the native enal-derived 1,N(2)-dG adducts to induce interstrand DNA cross-links in the 5'-CpG-3' sequence as opposed to the 5'-GpC-3' sequence is attributed to the destabilization of the DNA duplex in the latter sequence context. Here, we report higher accuracy solution structures of the synthetically derived trimethylene cross-links, which are refined from NMR data with the AMBER force field. When the synthetic trimethylene cross-links are placed into either the 5'-CpG-3' or the 5'-GpC-3' sequence contexts, the DNA duplex maintains B-DNA geometry with structural perturbations confined to the cross-linked base pairs. Watson-Crick hydrogen bonding is conserved throughout the duplexes. Although different from canonical B-DNA stacking, the cross-linked and the neighbor base pairs stack in the 5'-CpG-3' sequence. In contrast, the stacking at the cross-linked base pairs in the 5'-GpC-3' sequence is greatly perturbed. The pi-stacking interactions between the cross-linked and the neighbor base pairs are reduced. This is consistent with remarkable chemical shift perturbations of the C(5) H5 and H6 nucleobase protons that shifted downfield by 0.4-0.5 ppm. In contrast, these chemical shift perturbations in the 5'-CpG-3' sequence are not remarkable, consistent with the stacked structure. The differential stacking of the base pairs at the cross-linking region probably explains the difference in stabilities of the trimethylene cross-links in the 5'-CpG-3' and 5'-GpC-3' sequence contexts and might, in turn, account for the sequence selectivity of the interstrand cross-link formation induced by the native enal-derived 1,N(2)-d

  15. Interaction entre la proteine ribosomique L20 et l'ARN 23S : sondage direct par piege optique

    OpenAIRE

    Mangeol, Pierre

    2009-01-01

    This thesis is focused on force measurements applied to single RNA alone or associated with a protein. One of the biggest challenges arising when studying RNA comes from its structure, essentially because the interactions taking place are not reduced to the Watson-Crick base pairs and tertiary interactions are frequent. Force measurements give complementary information compared to classical bulk measurements, because they enable to probe directly the complex interactions in RNA and give an ac...

  16. LNA-antisense rivals siRNA for gene silencing

    DEFF Research Database (Denmark)

    Jepsen, Jan Stenvang; Wengel, Jesper; Stenvang, Jan

    2004-01-01

    Locked nucleic acid (LNA) is a class of nucleic acid analogs possessing unprecedented binding affinity toward complementary DNA and RNA while obeying the Watson-Crick base-pairing rules. For efficient gene silencing in vitro and in vivo, fully modified or chimeric LNA oligonucleotides have been a...... or phosphorothioate-DNA segment flanked by LNA gaps, rivals siRNA as the technology of choice for target validation and therapeutic applications....

  17. Crystal structure and mechanistic investigation of the twister ribozyme.

    Science.gov (United States)

    Liu, Yijin; Wilson, Timothy J; McPhee, Scott A; Lilley, David M J

    2014-09-01

    We present a crystal structure at 2.3-Å resolution of the recently described nucleolytic ribozyme twister. The RNA adopts a previously uncharacterized compact fold based on a double-pseudoknot structure, with the active site at its center. Eight highly conserved nucleobases stabilize the core of the ribozyme through the formation of one Watson-Crick and three noncanonical base pairs, and the highly conserved adenine 3' of the scissile phosphate is bound in the major groove of an adjacent pseudoknot. A strongly conserved guanine nucleobase directs its Watson-Crick edge toward the scissile phosphate in the crystal structure, and mechanistic evidence supports a role for this guanine as either a general base or acid in a concerted, general acid-base-catalyzed cleavage reaction.

  18. Predicting and Modeling RNA Architecture

    Science.gov (United States)

    Westhof, Eric; Masquida, Benoît; Jossinet, Fabrice

    2011-01-01

    SUMMARY A general approach for modeling the architecture of large and structured RNA molecules is described. The method exploits the modularity and the hierarchical folding of RNA architecture that is viewed as the assembly of preformed double-stranded helices defined by Watson-Crick base pairs and RNA modules maintained by non-Watson-Crick base pairs. Despite the extensive molecular neutrality observed in RNA structures, specificity in RNA folding is achieved through global constraints like lengths of helices, coaxiality of helical stacks, and structures adopted at the junctions of helices. The Assemble integrated suite of computer tools allows for sequence and structure analysis as well as interactive modeling by homology or ab initio assembly with possibilities for fitting within electronic density maps. The local key role of non-Watson-Crick pairs guides RNA architecture formation and offers metrics for assessing the accuracy of three-dimensional models in a more useful way than usual root mean square deviation (RMSD) values. PMID:20504963

  19. Structure of the DNA duplex d(ATTAAT2 with Hoogsteen hydrogen bonds.

    Directory of Open Access Journals (Sweden)

    Francisco J Acosta-Reyes

    Full Text Available The traditional Watson-Crick base pairs in DNA may occasionally adopt a Hoogsteen conformation, with a different organization of hydrogen bonds. Previous crystal structures have shown that the Hoogsteen conformation is favored in alternating AT sequences of DNA. Here we present new data for a different sequence, d(ATTAAT2, which is also found in the Hoogsteen conformation. Thus we demonstrate that other all-AT sequences of DNA with a different sequence may be found in the Hoogsteen conformation. We conclude that any all-AT sequence might acquire this conformation under appropriate conditions. We also compare the detailed features of DNA in either the Hoogsteen or Watson-Crick conformations.

  20. Amplification of Cooper pair splitting current in a graphene-based Cooper pair beam splitter geometry

    Science.gov (United States)

    Islam, SK Firoz; Saha, Arijit

    2017-09-01

    Motivated by the recent experiments [Scientific Reports 6, 23051 (2016), 10.1038/srep23051; Phys. Rev. Lett. 114, 096602 (2015), 10.1103/PhysRevLett.114.096602], we theoretically investigate Cooper pair splitting current in a graphene-based Cooper pair beam splitter geometry. By considering the graphene-based superconductor as an entangler device, instead of normal [two-dimensional (2D)] BCS superconductor, we show that the Cooper pair splitting current mediated by the crossed Andreev process is amplified compared to its normal superconductor counterpart. This amplification is attributed to the strong suppression of the local normal Andreev reflection process (arising from the Cooper pair splitting) from the graphene-based superconductor to lead via the same quantum dot, in comparison to the usual 2D superconductor. Due to the vanishing density of states at the Dirac point of undoped graphene, a doped graphene-based superconductor is considered here and it is observed that Cooper pair splitting current is very insensitive to the doping level in comparison to the usual 2D superconductor. The transport process of nonlocal spin-entangled electrons also depends on the type of pairing, i.e., whether the electron-hole pairing is onsite, intersublattice or the combination of both. The intersublattice pairing of graphene causes the maximum nonlocal Cooper pair splitting current, whereas the presence of both pairings reduces the Cooper pair splitting current.

  1. HuMiTar: A sequence-based method for prediction of human microRNA targets

    Directory of Open Access Journals (Sweden)

    Chen Ke

    2008-12-01

    Full Text Available Abstract Background MicroRNAs (miRs are small noncoding RNAs that bind to complementary/partially complementary sites in the 3' untranslated regions of target genes to regulate protein production of the target transcript and to induce mRNA degradation or mRNA cleavage. The ability to perform accurate, high-throughput identification of physiologically active miR targets would enable functional characterization of individual miRs. Current target prediction methods include traditional approaches that are based on specific base-pairing rules in the miR's seed region and implementation of cross-species conservation of the target site, and machine learning (ML methods that explore patterns that contrast true and false miR-mRNA duplexes. However, in the case of the traditional methods research shows that some seed region matches that are conserved are false positives and that some of the experimentally validated target sites are not conserved. Results We present HuMiTar, a computational method for identifying common targets of miRs, which is based on a scoring function that considers base-pairing for both seed and non-seed positions for human miR-mRNA duplexes. Our design shows that certain non-seed miR nucleotides, such as 14, 18, 13, 11, and 17, are characterized by a strong bias towards formation of Watson-Crick pairing. We contrasted HuMiTar with several representative competing methods on two sets of human miR targets and a set of ten glioblastoma oncogenes. Comparison with the two best performing traditional methods, PicTar and TargetScanS, and a representative ML method that considers the non-seed positions, NBmiRTar, shows that HuMiTar predictions include majority of the predictions of the other three methods. At the same time, the proposed method is also capable of finding more true positive targets as a trade-off for an increased number of predictions. Genome-wide predictions show that the proposed method is characterized by 1.99 signal

  2. NMR structural studies of a 15-mer DNA sequence from a ras protooncogene, modified at the first base of codon 61 with the carcinogen 4-aminobiphenyl.

    Science.gov (United States)

    Cho, B P; Beland, F A; Marques, M M

    1992-10-13

    Proton NMR studies were conducted on the complementary 15-mer duplex d(5'-TACTCTTCTTGACCT).(5'-AGGTCAAGAAGAGTA) (designated as unmodified 15-mer duplex) spanning a portion of the mouse c-Ha-ras protooncogene centered around codon 61. Identical studies were carried out on the same sequence, after specific modification with a reactive derivative of the carcinogen 4-aminobiphenyl (ABP), which resulted in incorporation of a single N-(deoxyguanosin-8-yl)-4-aminobiphenyl (dG-C8-ABP) adduct in the noncoding strand (designated as ABP-modified 15-mer duplex). The adduct was located at the position corresponding to the first base of codon 61. The NMR data for the unmodified 15-mer duplex were fully consistent with a standard right-handed B-type DNA duplex conformation, with the possible exception of the frayed terminal base pairs. The ABP-modified 15-mer duplex was found to adopt one major conformation, although at least one additional conformation could be detected especially near room temperature. The major form, which exhibited strikingly similar NOE patterns as to those of the parent oligomer, both in H2O and D2O spectra, assumed a standard Watson-Crick base pairing throughout the entire length of the duplex, including the modification site and its flanking base pairs. Although some local perturbation of the helix could be detected in the vicinity of the modified guanosine, the NOE distance constraints established that the helix was globally right-handed and that the glycosidic torsion angles had the normal anti orientation, both at the modified base and its partner cytidine. Furthermore, the absence of strong NOE interactions between protons in the ABP moiety, which was rapidly rotating, and the nucleic acid protons was consistent with positioning of the arylamine moiety in the major groove of a weakly distorted double-helical structure. Although insufficient data prevented a detailed characterization of the minor conformer(s), the observation of significant shieldings

  3. Structural insights into the translational infidelity mechanism

    Science.gov (United States)

    Rozov, Alexey; Demeshkina, Natalia; Westhof, Eric; Yusupov, Marat; Yusupova, Gulnara

    2015-06-01

    The decoding of mRNA on the ribosome is the least accurate process during genetic information transfer. Here we propose a unified decoding mechanism based on 11 high-resolution X-ray structures of the 70S ribosome that explains the occurrence of missense errors during translation. We determined ribosome structures in rare states where incorrect tRNAs were incorporated into the peptidyl-tRNA-binding site. These structures show that in the codon-anticodon duplex, a G.U mismatch adopts the Watson-Crick geometry, indicating a shift in the tautomeric equilibrium or ionization of the nucleobase. Additional structures with mismatches in the 70S decoding centre show that the binding of any tRNA induces identical rearrangements in the centre, which favours either isosteric or close to the Watson-Crick geometry codon-anticodon pairs. Overall, the results suggest that a mismatch escapes discrimination by preserving the shape of a Watson-Crick pair and indicate that geometric selection via tautomerism or ionization dominates the translational infidelity mechanism.

  4. An Insilico Design of Nanoclay Based Nanocomposites and Scaffolds in Bone Tissue Engineering

    Science.gov (United States)

    Sharma, Anurag

    scaffold. Overall, this study provides a leap into methodologies for in silico design of biomaterials for bone tissue engineering applications. Furthermore, as a part of this work, a molecular dynamics study of rice DNA in the presence of single walled carbon nanotube is carried out to understand the role played by molecular interactions in the conformation changes of rice DNA. The simulations results showed wrapping of DNA onto SWCNT, breaking and forming of hydrogen bonds due to unzipping of Watson-Crick (WC) nucleobase pairs and forming of new non-WC nucleobase pairs in DNA.

  5. An efficiently extended class of unnatural base pairs.

    Science.gov (United States)

    Leconte, Aaron M; Matsuda, Shigeo; Romesberg, Floyd E

    2006-05-31

    A third DNA base pair, which is synthesized efficiently and selectively, would have wide ranging applications from synthetic organisms to nucleic acids biotechnology. Hydrophobic unnatural nucleobases offer a promising route to such a pair, but are often limited by inefficient extension, defined as synthesis immediately following the unnatural pair. Here, we describe a simple screen which enables the characterization of large numbers of previously uncharacterized hetero base pairs. From this screen, we identified a class of unnatural base pairs which are extended more efficiently than any unnatural base pair reported to date. Screening, when complemented by further kinetic analysis, can improve the understanding of the determinants of efficient extension as well as identify viable hetero base pairs.

  6. Natural versus artificial creation of base pairs in DNA: origin of nucleobases from the perspectives of unnatural base pair studies.

    Science.gov (United States)

    Hirao, Ichiro; Kimoto, Michiko; Yamashige, Rie

    2012-12-18

    Since life began on Earth, the four types of bases (A, G, C, and T(U)) that form two sets of base pairs have remained unchanged as the components of nucleic acids that replicate and transfer genetic information. Throughout evolution, except for the U to T modification, the four base structures have not changed. This constancy within the genetic code raises the question of how these complicated nucleotides were generated from the molecules in a primordial soup on the early Earth. At some prebiotic stage, the complementarity of base pairs might have accelerated the generation and accumulation of nucleotides or oligonucleotides. We have no clues whether one pair of nucleobases initially appeared on the early Earth during this process or a set of two base pairs appeared simultaneously. Recently, researchers have developed new artificial pairs of nucleobases (unnatural base pairs) that function alongside the natural base pairs. Some unnatural base pairs in duplex DNA can be efficiently and faithfully amplified in a polymerase chain reaction (PCR) using thermostable DNA polymerases. The addition of unnatural base pair systems could expand the genetic alphabet of DNA, thus providing a new mechanism for the generation novel biopolymers by the site-specific incorporation of functional components into nucleic acids and proteins. Furthermore, the process of unnatural base pair development might provide clues to the origin of the natural base pairs in a primordial soup on the early Earth. In this Account, we describe the development of three representative types of unnatural base pairs that function as a third pair of nucleobases in PCR and reconsider the origin of the natural nucleic acids. As researchers developing unnatural base pairs, they use repeated "proof of concept" experiments. As researchers design new base pairs, they improve the structures that function in PCR and eliminate those that do not. We expect that this process is similar to the one functioning in the

  7. Array-Based Discovery of Aptamer Pairs

    Science.gov (United States)

    2014-12-11

    aptamer pairs that bind to human angiopoeitin-2 (Ang2), an important protein mediator of angiogenesis for colon , prostate and breast cancers.22,23 To...Sullenger, B. A. RNA 2009, 15, 2105−2111. (28) Zhou, G.; Huang, X.; Qu, Y. Biochem. Eng. J. 2010, 52, 117−122. (29) Drolet, D. W.; Moon -McDermott, L

  8. Substituent effects on the pairing and polymerase recognition of simple unnatural base pairs

    Science.gov (United States)

    Hwang, Gil Tae; Romesberg, Floyd E.

    2006-01-01

    As part of an effort to develop stable and replicable unnatural base pairs, we have evaluated a large number of unnatural nucleotides with predominantly hydrophobic nucleobases. Despite its limited aromatic surface area, a nucleobase analog scaffold that has emerged as being especially promising is the simple phenyl ring. Modifications of this scaffold with methyl and fluoro groups have been shown to impact base pair stability and polymerase recognition, suggesting that nucleobase shape, hydrophobicity and electrostatics are important. To further explore the impact of heteroatom substitution within this nucleobase scaffold, we report the synthesis, stability and polymerase recognition of nucleoside analogs bearing single bromo- or cyano-derivatized phenyl rings. Both modifications are found to generally stabilize base pair formation to a greater extent than methyl or fluoro substitution. Moreover, polymerase recognition of the unnatural base pairs is found to be very sensitive to both the position and nature of the heteroatom substituent. The results help identify the determinants of base pair stability and efficient replication and should contribute to the effort to develop stable and replicable unnatural base pairs. PMID:16617144

  9. Nucleic acid nanomaterials: Silver-wired DNA

    Science.gov (United States)

    Auffinger, Pascal; Ennifar, Eric

    2017-10-01

    DNA double helical structures are supramolecular assemblies that are typically held together by classical Watson-Crick pairing. Now, nucleotide chelation of silver ions supports an extended silver-DNA hybrid duplex featuring an uninterrupted silver array.

  10. Silver(I)-Mediated Hoogsteen-Type Base Pairs

    NARCIS (Netherlands)

    Megger, D.A.; Fonseca Guerra, C.; Bickelhaupt, F.M.; Müller, J.

    2011-01-01

    Metal-mediated Hoogsteen-type base pairs are useful for the construction of DNA duplexes containing contiguous stretches of metal ions along the helical axis. To fine-tune the stability of such base pairs and the selectivity toward different metal ions, the availability of a selection of artificial

  11. Base pairing in RNA structures: A computational analysis of ...

    Indian Academy of Sciences (India)

    The base pairing patterns in RNA structures are more versatile and completely different as compared to DNA. We present here results of ab-initio studies of structures and interaction energies of eight selected RNA base pairs reported in literature. Interaction energies, including BSSE correction, of hydrogen added crystal ...

  12. Noncanonical structures and their thermodynamics of DNA and RNA under molecular crowding: beyond the Watson-Crick double helix.

    Science.gov (United States)

    Sugimoto, Naoki

    2014-01-01

    How does molecular crowding affect the stability of nucleic acid structures inside cells? Water is the major solvent component in living cells, and the properties of water in the highly crowded media inside cells differ from that in buffered solution. As it is difficult to measure the thermodynamic behavior of nucleic acids in cells directly and quantitatively, we recently developed a cell-mimicking system using cosolutes as crowding reagents. The influences of molecular crowding on the structures and thermodynamics of various nucleic acid sequences have been reported. In this chapter, we discuss how the structures and thermodynamic properties of nucleic acids differ under various conditions such as highly crowded environments, compartment environments, and in the presence of ionic liquids, and the major determinants of the crowding effects on nucleic acids are discussed. The effects of molecular crowding on the activities of ribozymes and riboswitches on noncanonical structures of DNA- and RNA-like quadruplexes that play important roles in transcription and translation are also described. © 2014 Elsevier Inc. All rights reserved.

  13. Optimization of unnatural base pair packing for polymerase recognition.

    Science.gov (United States)

    Matsuda, Shigeo; Henry, Allison A; Romesberg, Floyd E

    2006-05-17

    As part of an effort to expand the genetic alphabet, we have been examining the ability of predominately hydrophobic nucleobase analogues to pair in duplex DNA and during polymerase-mediated replication. We previously reported the synthesis and thermal stability of unnatural base pairs formed between nucleotides bearing simple methyl-substituted phenyl ring nucleobase analogues. Several of these pairs are virtually as stable and selective as natural base pairs in the same sequence context. Here, we report the characterization of polymerase-mediated replication of the same unnatural base pairs. We find that every facet of replication, including correct and incorrect base pair synthesis, as well as continued primer extension beyond the unnatural base pair, is sensitive to the specific methyl substitution pattern of the nucleobase analogue. The results demonstrate that neither hydrogen bonding nor large aromatic surface area is required for polymerase recognition, and that interstrand interactions between small aromatic rings may be optimized for replication. Combined with our previous results, these studies suggest that appropriately derivatized phenyl nucleobase analogues represent a promising approach toward developing a third base pair and expanding the genetic alphabet.

  14. Major groove derivatization of an unnatural base pair.

    Science.gov (United States)

    Seo, Young Jun; Romesberg, Floyd E

    2009-09-21

    An unnatural base pair that is replicated and transcribed with good efficiency would lay the foundation for the long term goal of creating a semisynthetic organism, but also would have immediate in vitro applications, such as the enzymatic synthesis of site-specifically modified DNA and/or RNA. One of the most promising of the unnatural base pairs that we have identified is formed between d5SICS and dMMO2. The ortho substituents of these nucleotides are included to facilitate unnatural base pair extension, presumably by forming a hydrogen-bond with the polymerase, but the synthesis of the unnatural base pair still requires optimization. Recently, we have shown that meta and/or para substituents within the dMMO2 scaffold can facilitate unnatural base pair synthesis, although the mechanism remains unclear. To explore this issue, we synthesized and evaluated several dMMO2 derivatives with meta-chlorine, -bromine, -iodine, -methyl, or -propinyl substituents. Complete characterization of unnatural base pair and mispair synthesis and extension reveal that the modifications have large effects only on the efficiency of unnatural base pair synthesis and that the effects likely result from a combination of changes in steric interactions, polarity, and polarizability. The results also suggest that functionalized versions of the propinyl moiety of d5PrM should serve as suitable linkers to site-specifically incorporate other chemical functionalities into DNA. Similar modifications of d5SICS should allow labeling of DNA with two different functionalities, and the previously demonstrated efficient transcription of the unnatural base pair suggests that derivatives might similarly enable site-specific labeling of RNA.

  15. Kondo physics in double quantum dot based Cooper pair splitters

    Science.gov (United States)

    Wrześniewski, Kacper; Weymann, Ireneusz

    2017-11-01

    The Andreev transport properties of double quantum dot based Cooper pair splitters with one superconducting and two normal leads are studied theoretically in the Kondo regime. The influence of the superconducting pairing correlations on the local density of states, Andreev transmission coefficient, and Cooper pair splitting efficiency is thoroughly analyzed. It is shown that finite superconducting pairing potential quickly suppresses the SU(2 ) Kondo effect, which can however reemerge for relatively large values of coupling to superconductor. In the SU(4 ) Kondo regime, a crossover from the SU(4 ) to the SU(2 ) Kondo state is found as the coupling to superconductor is enhanced. The analysis is performed by means of the density-matrix numerical renormalization group method.

  16. Genetic alphabet expansion biotechnology by creating unnatural base pairs.

    Science.gov (United States)

    Lee, Kyung Hyun; Hamashima, Kiyofumi; Kimoto, Michiko; Hirao, Ichiro

    2017-10-16

    Recent studies have made it possible to expand the genetic alphabet of DNA, which is originally composed of the four-letter alphabet with A-T and G-C pairs, by introducing an unnatural base pair (UBP). Several types of UBPs function as a third base pair in replication, transcription, and/or translation. Through the UBP formation, new components with different physicochemical properties from those of the natural ones can be introduced into nucleic acids and proteins site-specifically, providing their increased functionalities. Here, we describe the genetic alphabet expansion technology by focusing on three types of UBPs, which were recently applied to the creations of DNA aptamers that bind to proteins and cells and semi-synthetic organisms containing DNAs with a six-letter alphabet. Copyright © 2017 Elsevier Ltd. All rights reserved.

  17. Positively charged base surrogate for highly stable "base pairing" through electrostatic and stacking interactions.

    Science.gov (United States)

    Kashida, Hiromu; Ito, Hidehiro; Fujii, Taiga; Hayashi, Takamitsu; Asanuma, Hiroyuki

    2009-07-29

    "Base pairs" of cationic dyes (p-methylstilbazole) were incorporated into oligodeoxyribonucleotides (ODNs). This "base pair" greatly stabilized the duplex through electrostatic and stacking interactions. The melting temperature of modified ODN was higher than those of neutral dyes and native base pairs. Further stabilization of the duplex was observed when the number of cationic dyes increased.

  18. Prediction of RNA base pairing probabilities on massively parallel computers.

    Science.gov (United States)

    Fekete, M; Hofacker, I L; Stadler, P F

    2000-01-01

    We present an implementation of McCaskill's algorithm for computing the base pair probabilities of an RNA molecule for massively parallel message passing architectures. The program can be used to routinely fold RNA sequences of more than 10,000 nucleotides. Applications to complete viral genomes are discussed.

  19. Waveguide-based OPO source of entangled photon pairs

    Energy Technology Data Exchange (ETDEWEB)

    Pomarico, Enrico; Sanguinetti, Bruno; Gisin, Nicolas; Thew, Robert; Zbinden, Hugo [Group of Applied Physics, University of Geneva, 1211 Geneva (Switzerland); Schreiber, Gerhard; Thomas, Abu; Sohler, Wolfgang [Angewandte Physik, University of Paderborn, 33095 Paderborn (Germany)], E-mail: enrico.pomarico@unige.ch

    2009-11-15

    In this paper, we present a compact source of narrow-band energy-time-entangled photon pairs in the telecom regime based on a Ti-indiffused periodically poled lithium niobate (PPLN) waveguide resonator, i.e. a waveguide with end-face dielectric multi-layer mirrors. This is a monolithic doubly resonant optical parametric oscillator (OPO) far below threshold, which generates photon pairs by spontaneous parametric down-conversion (SPDC) at around 1560 nm with a 117 MHz (0.91 pm)-bandwidth. A coherence time of 2.7 ns is estimated by a time correlation measurement and a high quality of the entangled states is confirmed by a Bell-type experiment. Since highly coherent energy-time-entangled photon pairs in the telecom regime are suitable for long distance transmission and manipulation, this source is well suited to the requirements of quantum communication.

  20. Studies on Nucleic Acids – Structure and Dynamics

    OpenAIRE

    Isaksson, Johan

    2005-01-01

    This thesis is based on six papers, Papers I-VI, focusing on the interplay between the stabilizing elements of nucleic acids self-assembly; hydrogen bonding, stacking and solvent effects. In Paper I we investigate how the substitution of the O4' for CH2 in the sugar moiety of adenosine (2'-deoxyaristeromycin) at the A6 position of the Dickerson-Drew dodecamer makes the two modified bases exist in a dynamic equilibrium between Hoogsteen and Watson-Crick base pairing in the NMR time scale. Pape...

  1. The effect of base pair mismatch on DNA strand displacement

    CERN Document Server

    Broadwater, Bo

    2016-01-01

    DNA strand displacement is a key reaction in DNA homologous recombination and DNA mismatch repair and is also heavily utilized in DNA-based computation and locomotion. Despite its ubiquity in science and engineering, sequence-dependent effects of displacement kinetics have not been extensively characterized. Here, we measured toehold-mediated strand displacement kinetics using single-molecule fluorescence in the presence of a single base pair mismatch. The apparent displacement rate varied significantly when the mismatch was introduced in the invading DNA strand. The rate generally decreased as the mismatch in the invader was encountered earlier in displacement. Our data indicate that a single base pair mismatch in the invader stalls branch migration, and displacement occurs via direct dissociation of the destabilized incumbent strand from the substrate strand. We combined both branch migration and direct dissociation into a model, which we term, the concurrent displacement model, and used the first passage t...

  2. G-Quadruplexes in DNA Replication: A Problem or a Necessity?

    Science.gov (United States)

    Valton, Anne-Laure; Prioleau, Marie-Noëlle

    2016-11-01

    DNA replication is a highly regulated process that ensures the correct duplication of the genome at each cell cycle. A precise cell type-specific temporal program controls the duplication of complex vertebrate genomes in an orderly manner. This program is based on the regulation of both replication origin firing and replication fork progression. G-quadruplexes (G4s), DNA secondary structures displaying noncanonical Watson-Crick base pairing, have recently emerged as key controllers of genome duplication. Here we discuss the various means by which G4s affect this fundamental cellular process. Copyright © 2016 Elsevier Ltd. All rights reserved.

  3. DFT study on metal-mediated uracil base pair complexes

    Directory of Open Access Journals (Sweden)

    Ayhan Üngördü

    2017-11-01

    Full Text Available The most stable of metal-mediated uracil base pair complexes were determined. Method was used density functional theory, B3LYP. The calculations of systems containing C, H, N, O were described by 6-311++G(d,p and cc-PVTZ basis sets and LANL2DZ and SDD basis sets was used for transition metals. Then Egap values of complexes were calculated and the electrical conductivity of the complexes for single nanowires was studied by band theory. Metal-mediated uracil base pair complexes which will be used as conductive wires in nanotechnology were predicted. In nanoworld, this study is expected to show a way for practical applications.

  4. Allometry of base pair specific-DNA contents in Tetrapoda.

    Science.gov (United States)

    Vinogradov, A E; Borkin, L J

    1993-01-01

    Cells of 82 species of Tetrapoda were stained with DNA base pair specific fluorochromes (Hoechst 33258 and olivomycin) and studied by means of flow cytometry. The genome size range was about 50-fold. The class Amphibia, which had the widest range of genome size variation (about 20-fold), exhibited linear allometry in their base pair specific DNA contents (bps-C-values), i.e., the more DNA they had, the lower the quotient of AT-pairs (C(AT) = 0.13 + 0.87 x C(GC), r = +0.998). Data for Mammalia, pooled with amphibians, fell on the same allometric line at the lower extreme end of genome size range, supporting the correlation. Reptilia-Aves (or Reptilia alone) pooled with Amphibia did not conform with this relationship. Reptilia-Aves form their own line (zone); pooled with Mammalia, this group showed no regularities in the relationship of their bps-DNA contents. Besides revealing the allometry of bps-C-values, these data indicate an integral genomic feature, localization within the same regression line, which Mammalia share with Amphibia but not with recent Reptilia (and Aves). These data also suggest that the relationship between DNA base frequencies and genome size is nonlinear (reciprocal); to obtain a linear relationship, the bps-C-values should be used. It is also concluded that caution is needed when DNA-content is measured for comparative purposes using a fluorescent dye which is known to be base-pair specific. DNA content values obtained with fluorochromes with different specificity may differ as much as by a factor of 1.8, the average discrepancy level is about 14%.

  5. Single base pair mutation analysis by PNA directed PCR clamping

    DEFF Research Database (Denmark)

    Ørum, H.; Nielsen, P.E.; Egholm, M.

    1993-01-01

    A novel method that allows direct analysis of single base mutation by the polymerase chain reaction (PCR) is described. The method utilizes the finding that PNAs (peptide nucleic acids) recognize and bind to their complementary nucleic acid sequences with higher thermal stability and specificity...... allows selective amplification/suppression of target sequences that differ by only one base pair. Finally we show that PNAs can be designed in such a way that blockage can be accomplished when the PNA target sequence is located between the PCR primers....

  6. Biologically important conformational features of DNA as interpreted by quantum mechanics and molecular mechanics computations of its simple fragments.

    Science.gov (United States)

    Poltev, V; Anisimov, V M; Dominguez, V; Gonzalez, E; Deriabina, A; Garcia, D; Rivas, F; Polteva, N A

    2018-02-01

    Deciphering the mechanism of functioning of DNA as the carrier of genetic information requires identifying inherent factors determining its structure and function. Following this path, our previous DFT studies attributed the origin of unique conformational characteristics of right-handed Watson-Crick duplexes (WCDs) to the conformational profile of deoxydinucleoside monophosphates (dDMPs) serving as the minimal repeating units of DNA strand. According to those findings, the directionality of the sugar-phosphate chain and the characteristic ranges of dihedral angles of energy minima combined with the geometric differences between purines and pyrimidines determine the dependence on base sequence of the three-dimensional (3D) structure of WCDs. This work extends our computational study to complementary deoxydinucleotide-monophosphates (cdDMPs) of non-standard conformation, including those of Z-family, Hoogsteen duplexes, parallel-stranded structures, and duplexes with mispaired bases. For most of these systems, except Z-conformation, computations closely reproduce experimental data within the tolerance of characteristic limits of dihedral parameters for each conformation family. Computation of cdDMPs with Z-conformation reveals that their experimental structures do not correspond to the internal energy minimum. This finding establishes the leading role of external factors in formation of the Z-conformation. Energy minima of cdDMPs of non-Watson-Crick duplexes demonstrate different sequence-dependence features than those known for WCDs. The obtained results provide evidence that the biologically important regularities of 3D structure distinguish WCDs from duplexes having non-Watson-Crick nucleotide pairing.

  7. Using Pair Programming to Teach CAD Based Engineering Graphics

    Science.gov (United States)

    Leland, Robert P.

    2010-01-01

    Pair programming was introduced into a course in engineering graphics that emphasizes solid modeling using SolidWorks. In pair programming, two students work at a single computer, and periodically trade off roles as driver (hands on the keyboard and mouse) and navigator (discuss strategy and design issues). Pair programming was used in a design…

  8. RNA enzymes with two small-molecule substrates.

    Science.gov (United States)

    Huang, F; Yang, Z; Yarus, M

    1998-11-01

    The 'RNA world' hypothesis posits ancient organisms employing versatile catalysis by RNAs. In particular, such a metabolism would have required RNA catalysts that join small molecules. Such anabolic reactions now occur very widely, for example in phospholipid, terpene, amino acid and nucleotide synthetic pathways in modern organisms. Present RNA systems, however, do not perform such reactions using substrates that do not base pair. Here we ask whether this lack is a methodological artifact due to the practice of selection-amplification, or a fundamental property of active sites reconstructed within RNA structures. Three rationally modified RNA enzymes, Iso6-G, Iso6-2G and Iso63G, catalyze the formation of (5'-->5') polyphosphate-linked oligonucleotides in trans. One of these, Iso6-G RNA, has a specific substrate site for a guanosine triphosphate, GTP, dGTP or ddGTP, and one nonspecific substrate site for a terminal-phosphate-containing small molecule. This ribozyme catalyzes multiple turnovers, proceeding at a constant rate. Guanosine specificity is probably not attributable to Watson-Crick base pairing. Ribozymes can readily bind multiple small-molecule substrates simultaneously and catalyze reactions that build up larger products, apparently independent of substrate-RNA Watson-Crick base pairing. RNA enzymes therefore parallel proteins, which often overcome the entropic difficulties of positioning multiple small substrates for catalysis of anabolic reactions. These results support the idea of a complex ancestral metabolism based on RNA catalysis.

  9. The loss of a hydrogen bond: Thermodynamic contributions of a non-standard nucleotide

    OpenAIRE

    Jolley, Elizabeth A.; Znosko, Brent M.

    2016-01-01

    Abstract Non-standard nucleotides are ubiquitous in RNA. Thermodynamic studies with RNA duplexes containing non-standard nucleotides, whether incorporated naturally or chemically, can provide insight into the stability of Watson?Crick pairs and the role of specific functional groups in stabilizing a Watson?Crick pair. For example, an A-U, inosine?U and pseudouridine?A pair each form two hydrogen bonds. However, an RNA duplex containing a central I?U pair or central ??A pair is 2.4 kcal/mol le...

  10. Unnatural base pair systems toward the expansion of the genetic alphabet in the central dogma

    Science.gov (United States)

    HIRAO, Ichiro; KIMOTO, Michiko

    2012-01-01

    Toward the expansion of the genetic alphabet of DNA, several artificial third base pairs (unnatural base pairs) have been created. Synthetic DNAs containing the unnatural base pairs can be amplified faithfully by PCR, along with the natural A–T and G–C pairs, and transcribed into RNA. The unnatural base pair systems now have high potential to open the door to next generation biotechnology. The creation of unnatural base pairs is a consequence of repeating “proof of concept” experiments. In the process, initially designed base pairs were modified to address their weak points. Some of them were artificially evolved to ones with higher efficiency and selectivity in polymerase reactions, while others were eliminated from the analysis. Here, we describe the process of unnatural base pair development, as well as the tests of their applications. PMID:22850726

  11. Learning preferences from paired opposite-based semantics

    DEFF Research Database (Denmark)

    Franco de los Ríos, Camilo; Rodríguez, J. Tinguaro; Montero, Javier

    2017-01-01

    on the character of opposition, the compound meaning of preference emerges from the fuzzy reinforcement of paired opposite concepts, searching for significant evidence for affirming dominance among the decision objects. Here we propose a general model for the paired decomposition of preference, examining its...... characteristic semantics under a binary and fuzzy logical frame, and identifying solutions with different values of significance for preference learning....

  12. Paired structures and other opposite-based models

    DEFF Research Database (Denmark)

    Rodríguez, J. Tinguaro; Franco, Camilo; Gómez, Daniel

    2015-01-01

    , that we will assume dependent on a specific negation, previously determined. In this way we can define a paired fuzzy set as a couple of opposite valuation fuzzy sets. Then we shall explore what kind of new valuation fuzzy sets can be generated from the semantic tension between those two poles, leading...... to a more complex valuation structure that still keeps the essence of being paired. In this way several neutral fuzzy sets can appear, in particular indeterminacy, ambivalence and conflict. Two consequences are then presented: on one hand, we will show how Atanassov´s Intuitionistic Fuzzy Sets can be viewed...... as a particular paired structure when the classical fuzzy negation is considered; on the other hand, the relationship of this model with bipolarity is reconsidered from our paired view....

  13. Sequence organization in African trypanosome minicircles is defined by 18 base pair inverted repeats.

    Science.gov (United States)

    Jasmer, D P; Stuart, K

    1986-03-01

    We have found that minicircles of African trypanosomes contain 18 base pair sequences that occur as 3 or 4 pairs of imperfect inverted repeats. The 18 base pair sequence is polar; one half is almost perfectly conserved, while the other half has a more variable sequence. The distribution of the 18 base pair sequences in minicircles defines two classes of sequences ('A' and 'B' segments) that have distinct characteristics. 'A' segments vary considerably in length and contain about 10% more G+C than 'B' segments which are all about 100 base pairs long. The 18 base pair sequences are absent from minicircles of other kinetoplastids. Thus, 'B' segments along with their terminal 18 base pair sequences superficially resemble insertion sequences. Minicircles of African trypanosomes therefore conserve their organization but have only limited nucleotide sequence homology.

  14. Trinucleotide's quadruplet symmetries and natural symmetry law of DNA creation ensuing Chargaff's second parity rule.

    Science.gov (United States)

    Rosandić, Marija; Vlahović, Ines; Glunčić, Matko; Paar, Vladimir

    2016-07-01

    For almost 50 years the conclusive explanation of Chargaff's second parity rule (CSPR), the equality of frequencies of nucleotides A=T and C=G or the equality of direct and reverse complement trinucleotides in the same DNA strand, has not been determined yet. Here, we relate CSPR to the interstrand mirror symmetry in 20 symbolic quadruplets of trinucleotides (direct, reverse complement, complement, and reverse) mapped to double-stranded genome. The symmetries of Q-box corresponding to quadruplets can be obtained as a consequence of Watson-Crick base pairing and CSPR together. Alternatively, assuming Natural symmetry law for DNA creation that each trinucleotide in one strand of DNA must simultaneously appear also in the opposite strand automatically leads to Q-box direct-reverse mirror symmetry which in conjunction with Watson-Crick base pairing generates CSPR. We demonstrate quadruplet's symmetries in chromosomes of wide range of organisms, from Escherichia coli to Neanderthal and human genomes, introducing novel quadruplet-frequency histograms and 3D-diagrams with combined interstrand frequencies. These "landscapes" are mutually similar in all mammals, including extinct Neanderthals, and somewhat different in most of older species. In human chromosomes 1-12, and X, Y the "landscapes" are almost identical and slightly different in the remaining smaller and telocentric chromosomes. Quadruplet frequencies could provide a new robust tool for characterization and classification of genomes and their evolutionary trajectories.

  15. Design of Tail-Clamp Peptide Nucleic Acid Tethered with Azobenzene Linker for Sequence-Specific Detection of Homopurine DNA

    Directory of Open Access Journals (Sweden)

    Shinjiro Sawada

    2017-10-01

    Full Text Available DNA carries genetic information in its sequence of bases. Synthetic oligonucleotides that can sequence-specifically recognize a target gene sequence are a useful tool for regulating gene expression or detecting target genes. Among the many synthetic oligonucleotides, tail-clamp peptide nucleic acid (TC-PNA offers advantages since it has two homopyrimidine PNA strands connected via a flexible ethylene glycol-type linker that can recognize complementary homopurine sequences via Watson-Crick and Hoogsteen base pairings and form thermally-stable PNA/PNA/DNA triplex structures. Here, we synthesized a series of TC-PNAs that can possess different lengths of azobenzene-containing linkers and studied their binding behaviours to homopurine single-stranded DNA. Introduction of azobenzene at the N-terminus amine of PNA increased the thermal stability of PNA-DNA duplexes. Further extension of the homopyrimidine PNA strand at the N-terminus of PNA-AZO further increased the binding stability of the PNA/DNA/PNA triplex to the target homopurine sequence; however, it induced TC-PNA/DNA/TC-PNA complex formation. Among these TC-PNAs, 9W5H-C4-AZO consisting of nine Watson-Crick bases and five Hoogsteen bases tethered with a beta-alanine conjugated azobenzene linker gave a stable 1:1 TC-PNA/ssDNA complex and exhibited good mismatch recognition. Our design for TC-PNA-AZO can be utilized for detecting homopurine sequences in various genes.

  16. Ferrocene-based Lewis acids and Lewis pairs: Synthesis and ...

    Indian Academy of Sciences (India)

    Optically active Lewis acids and Lewis pairs were synthesized and characterized by multinuclear NMR, UV/Vis spectroscopy and elemental analysis. Optical rotation measurements were carried out and the absolute configuration of the new chiral molecules confirmed by single crystal X-ray diffraction.

  17. Genomic analysis of plant chromosomes based on meiotic pairing

    Directory of Open Access Journals (Sweden)

    Lisete Chamma Davide

    2007-12-01

    Full Text Available This review presents the principles and applications of classical genomic analysis, with emphasis on plant breeding. The main mathematical models used to estimate the preferential chromosome pairing in diploid or polyploid, interspecific or intergenera hybrids are presented and discussed, with special reference to the applications and studies for the definition of genome relationships among species of the Poaceae family.

  18. Studies of base pair sequence effects on DNA solvation based on all ...

    Indian Academy of Sciences (India)

    Analysis of hydration density maps reveals that the flexibility of solute molecule has a significant effect on the nature of observed hydration. Energetic analysis of solute–solvent interactions based on proximity analysis of solvent reveals that the GC or CG base pairs interactmore strongly with watermolecules in the minor ...

  19. Raising the barrier for photoinduced DNA charge injection with a cyclohexyl artificial base pair.

    Science.gov (United States)

    Singh, Arunoday P N; Harris, Michelle A; Young, Ryan M; Miller, Stephen A; Wasielewski, Michael R; Lewis, Frederick D

    2015-01-01

    The effects of an artificial cyclohexyl base pair on the quantum yields of fluorescence and dynamics of charge separation and charge recombination have been investigated for several synthetic DNA hairpins. The hairpins possess stilbenedicarboxamide, perylenediimide, or naphthalenediimide linkers and base-paired stems. In the absence of the artificial base pair hole injection into both adenine and guanine purine bases is exergonic and irreversible, except in the case of stilbene with adenine for which it is slightly endergonic and reversible. Insertion of the artificial base pair renders hole injection endergonic or isoergonic except in the case of the powerful naphthalene acceptor for which it remains exergonic. Both hole injection and charge recombination are slower for the naphthalene acceptor in the presence of the artificial base pair than in its absence. The effect of an artificial base pair on charge separation and charge recombination in hairpins possessing stilbene and naphthalene acceptor linkers and a stilbenediether donor capping group has also been investigated. In the case of the stilbene acceptor-stilbene donor capped hairpins photoinduced charge separation across six base pairs is efficient in the absence of the artificial base pair but does not occur in its presence. In the case of the naphthalene acceptor-stilbene donor capped hairpins the artificial base pair slows but does not stop charge separation and charge recombination, leading to the formation of long-lived charge separated states.

  20. Crystal structure of a partly self-complementary peptide nucleic acid (PNA) oligomer showing a duplex-triplex network

    DEFF Research Database (Denmark)

    Petersson, Britt; Nielsen, Bettina Bryde; Rasmussen, Hanne

    2005-01-01

    of the decamer (G(4)A(5)T(6)C(7)). One right- and one left-handed Watson-Crick duplex are formed. The two PNA units C(9)T(10) change helical handedness, so that each PNA strand contains both a right- and a left-handed section. The changed handedness in C(9)T(10) allows formation of Hoogsteen hydrogen bonding...... Hoogsteen type. The structural diversity of this PNA demonstrates how the PNA backbone is able to adapt to structures governed by the stacking and hydrogen-bonding interactions between the nucleobases. The crystal structure further shows how PNA oligomers containing limited sequence complementarity may form......The X-ray structure of a partly self-complementary peptide nucleic acid (PNA) decamer (H-GTAGATCACT-l-Lys-NH(2)) to 2.60 A resolution is reported. The structure is mainly controlled by the canonical Watson-Crick base pairs formed by the self-complementary stretch of four bases in the middle...

  1. Developing Topological Insulator Fiber Based Photon Pairs Source for Ultrafast Optoelectronic Applications

    Science.gov (United States)

    2016-04-01

    DEVELOPING TOPOLOGICAL INSULATOR FIBER BASED PHOTON PAIRS SOURCE FOR ULTRAFAST OPTOELECTRONIC APPLICATIONS NORTHWESTERN UNIVERSITY...REPORT TYPE FINAL TECHNICAL REPORT 3. DATES COVERED (From - To) APRIL 2015 – DEC 2015 4. TITLE AND SUBTITLE DEVELOPING TOPOLOGICAL INSULATOR FIBER BASED...in developing a new source for the production of correlated/entangled photon pairs based on the unique nanolayer properties of topological insulator

  2. Prebiotic cytosine synthesis: a critical analysis and implications for the origin of life.

    Science.gov (United States)

    Shapiro, R

    1999-04-13

    A number of theories propose that RNA, or an RNA-like substance, played a role in the origin of life. Usually, such hypotheses presume that the Watson-Crick bases were readily available on prebiotic Earth, for spontaneous incorporation into a replicator. Cytosine, however, has not been reported in analyses of meteorites nor is it among the products of electric spark discharge experiments. The reported prebiotic syntheses of cytosine involve the reaction of cyanoacetylene (or its hydrolysis product, cyanoacetaldehyde), with cyanate, cyanogen, or urea. These substances undergo side reactions with common nucleophiles that appear to proceed more rapidly than cytosine formation. To favor cytosine formation, reactant concentrations are required that are implausible in a natural setting. Furthermore, cytosine is consumed by deamination (the half-life for deamination at 25 degrees C is approximately 340 yr) and other reactions. No reactions have been described thus far that would produce cytosine, even in a specialized local setting, at a rate sufficient to compensate for its decomposition. On the basis of this evidence, it appears quite unlikely that cytosine played a role in the origin of life. Theories that involve replicators that function without the Watson-Crick pairs, or no replicator at all, remain as viable alternatives.

  3. Thermal stability of G-rich anti-parallel DNA triplexes upon insertion of LNA and α-L-LNA.

    Science.gov (United States)

    Kosbar, Tamer R; Sofan, Mamdouh A; Abou-Zeid, Laila; Pedersen, Erik B

    2015-05-14

    G-rich anti-parallel DNA triplexes were modified with LNA or α-L-LNA in their Watson-Crick and TFO strands. The triplexes were formed by targeting a pyrimidine strand to a putative hairpin formed by Hoogsteen base pairing in order to use the UV melting method to evaluate the stability of the triplexes. Their thermal stability was reduced when the TFO strand was modified with LNA or α-L-LNA. The same trend was observed when the TFO strand and the purine Watson-Crick strand both were modified with LNA. When all triad components were modified with α-L-LNA and LNA in the middle of the triplex, the thermal melting was increased. When the pyrimidine sequence was modified with a single insertion of LNA or α-L-LNA the ΔTm increased. Moreover, increasing the number of α-L-LNA in the pyrimidine target sequence to six insertions, leads to a high increase in the thermal stability. The conformational S-type structure of α-L-LNA in anti-parallel triplexes is preferable for triplex stability.

  4. Thermal stability of G-rich anti-parallel DNA triplexes upon insertion of LNA and α-l-LNA

    DEFF Research Database (Denmark)

    Kosbar, Tamer R.; Sofan, Mamdouh A.; Abou-Zeid, Laila

    2015-01-01

    G-rich anti-parallel DNA triplexes were modified with LNA or α-l-LNA in their Watson-Crick and TFO strands. The triplexes were formed by targeting a pyrimidine strand to a putative hairpin formed by Hoogsteen base pairing in order to use the UV melting method to evaluate the stability...... of the triplexes. Their thermal stability was reduced when the TFO strand was modified with LNA or α-l-LNA. The same trend was observed when the TFO strand and the purine Watson-Crick strand both were modified with LNA. When all triad components were modified with α-l-LNA and LNA in the middle of the triplex......, the thermal melting was increased. When the pyrimidine sequence was modified with a single insertion of LNA or α-l-LNA the ΔTm increased. Moreover, increasing the number of α-l-LNA in the pyrimidine target sequence to six insertions, leads to a high increase in the thermal stability...

  5. Use of Nucleic Acid Analogs for the Study of Nucleic Acid Interactions

    Directory of Open Access Journals (Sweden)

    Shu-ichi Nakano

    2011-01-01

    Full Text Available Unnatural nucleosides have been explored to expand the properties and the applications of oligonucleotides. This paper briefly summarizes nucleic acid analogs in which the base is modified or replaced by an unnatural stacking group for the study of nucleic acid interactions. We also describe the nucleoside analogs of a base pair-mimic structure that we have examined. Although the base pair-mimic nucleosides possess a simplified stacking moiety of a phenyl or naphthyl group, they can be used as a structural analog of Watson-Crick base pairs. Remarkably, they can adopt two different conformations responding to their interaction energies, and one of them is the stacking conformation of the nonpolar aromatic group causing the site-selective flipping of the opposite base in a DNA double helix. The base pair-mimic nucleosides can be used to study the mechanism responsible for the base stacking and the flipping of bases out of a nucleic acid duplex.

  6. Paired fuzzy sets and other opposite-based models

    DEFF Research Database (Denmark)

    Montero, Javier; Gómez, Daniel; Tinguaro Rodríguez, J.

    2016-01-01

    In this paper we stress the relevance of those fuzzy models that impose a couple of simultaneous views in order to represent concepts. In particular, we point out that the basic model to start with should contain at least two somehow opposite valuations plus a number of neutral concepts...... that are generated from the semantic relationship between those two opposites. Such a basic model should be distinguished from some other similar approaches that can be found in the literature, and that may bring some difficulties in intuition, partially because of their denomination. The general term “paired fuzzy...

  7. Optimization of an unnatural base pair toward natural-like replication.

    Science.gov (United States)

    Seo, Young Jun; Hwang, Gil Tae; Ordoukhanian, Phillip; Romesberg, Floyd E

    2009-03-11

    Predominantly hydrophobic unnatural nucleotides that selectively pair within duplex DNA as well as during polymerase-mediated replication have recently received much attention as the cornerstone of efforts to expand the genetic alphabet. We recently reported the results of a screen and subsequent lead hit optimization that led to identification of the unnatural base pair formed between the nucleotides dMMO2 and d5SICS. This unnatural base pair is replicated by the Klenow fragment of Escherichia coli DNA polymerase I with better efficiency and fidelity than other candidates reported in the literature. However, its replication remains significantly less efficient than a natural base pair, and further optimization is necessary for its practical use. To better understand and optimize the slowest step of replication of the unnatural base pair, the insertion of dMMO2 opposite d5SICS, we synthesized two dMMO2 derivatives, d5FM and dNaM, which differ from the parent nucleobase in terms of shape, hydrophobicity, and polarizability. We find that both derivatives are inserted opposite d5SICS more efficiently than dMMO2 and that overall the corresponding unnatural base pairs are generally replicated with higher efficiency and fidelity than the pair between dMMO2 and d5SICS. In fact, in the case of the dNaM:d5SICS heteropair, the efficiency of each individual step of replication approaches that of a natural base pair, and the minimum overall fidelity ranges from 10(3) to 10(4). In addition, the data allow us to propose a generalized model of unnatural base pair replication, which should aid in further optimization of the unnatural base pair and possibly in the design of additional unnatural base pairs that are replicated with truly natural-like efficiency and fidelity.

  8. Lewis pair polymerization by classical and frustrated Lewis pairs: Acid, base and monomer scope and polymerization mechanism

    KAUST Repository

    Zhang, Yuetao

    2012-01-01

    Classical and frustrated Lewis pairs (LPs) of the strong Lewis acid (LA) Al(C 6F 5) 3 with several Lewis base (LB) classes have been found to exhibit exceptional activity in the Lewis pair polymerization (LPP) of conjugated polar alkenes such as methyl methacrylate (MMA) as well as renewable α-methylene-γ-butyrolactone (MBL) and γ-methyl- α-methylene-γ-butyrolactone (γ-MMBL), leading to high molecular weight polymers, often with narrow molecular weight distributions. This study has investigated a large number of LPs, consisting of 11 LAs as well as 10 achiral and 4 chiral LBs, for LPP of 12 monomers of several different types. Although some more common LAs can also be utilized for LPP, Al(C 6F 5) 3-based LPs are far more active and effective than other LA-based LPs. On the other hand, several classes of LBs, when paired with Al(C 6F 5) 3, can render highly active and effective LPP of MMA and γ-MMBL; such LBs include phosphines (e.g., P tBu 3), chiral chelating diphosphines, N-heterocyclic carbenes (NHCs), and phosphazene superbases (e.g., P 4- tBu). The P 4- tBu/Al(C 6F 5) 3 pair exhibits the highest activity of the LP series, with a remarkably high turn-over frequency of 9.6 × 10 4 h -1 (0.125 mol% catalyst, 100% MMA conversion in 30 s, M n = 2.12 × 10 5 g mol -1, PDI = 1.34). The polymers produced by LPs at RT are typically atactic (P γMMBL with ∼47% mr) or syndio-rich (PMMA with ∼70-75% rr), but highly syndiotactic PMMA with rr ∼91% can be produced by chiral or achiral LPs at -78 °C. Mechanistic studies have identified and structurally characterized zwitterionic phosphonium and imidazolium enolaluminates as the active species of the current LPP system, which are formed by the reaction of the monomer·Al(C 6F 5) 3 adduct with P tBu 3 and NHC bases, respectively. Kinetic studies have revealed that the MMA polymerization by the tBu 3P/ Al(C 6F 5) 3 pair is zero-order in monomer concentration after an initial induction period, and the polymerization

  9. The effects of unnatural base pairs and mispairs on DNA duplex stability and solvation.

    Science.gov (United States)

    Hwang, Gil Tae; Hari, Yoshiyuki; Romesberg, Floyd E

    2009-08-01

    In an effort to develop unnatural DNA base pairs we examined six pyridine-based nucleotides, d3MPy, d4MPy, d5MPy, d34DMPy, d35DMPy and d45DMPy. Each bears a pyridyl nucleobase scaffold but they are differentiated by methyl substitution, and were designed to vary both inter- and intra-strand packing within duplex DNA. The effects of the unnatural base pairs on duplex stability demonstrate that the pyridine scaffold may be optimized for stable and selective pairing, and identify one self pair, the pair formed between two d34DMPy nucleotides, which is virtually as stable as a dA:dT base pair in the same sequence context. In addition, we found that the incorporation of either the d34DMPy self pair or a single d34DMPy paired opposite a natural dA significantly increases oligonucleotide hybridization fidelity at other positions within the duplex. Hypersensitization of the duplex to mispairing appears to result from global and interdependent solvation effects mediated by the unnatural nucleotide(s) and the mispair. The results have important implications for our efforts to develop unnatural base pairs and suggest that the unnatural nucleotides might be developed as novel biotechnological tools, diagnostics, or therapeutics for applications where hybridization stringency is important.

  10. Development of artificial nucleic acid that recognizes a CG base pair in triplex DNA formation.

    Science.gov (United States)

    Hari, Yoshiyuki

    2013-01-01

    An oligonucleotide that can form a triplex with double-stranded DNA is called a triplex-forming oligonucleotide (TFO). TFOs have gained considerable attention because of their potential as gene targeting tools. However, triplex DNA formation involves inherent problems for practical use. The most important problem is that natural nucleotides in TFO do not have sufficient affinity and base pair-selectivity to pyrimidine-purine base pair, like a CG or TA base pair, within dsDNA. This suggests that dsDNA region including a CG or TA base pair cannot be targeted. Therefore, artificial nucleotides, especially with non-natural nucleobases, capable of direct recognition of a CG or TA base pair via hydrogen bond formation have been developed; however, nucleotides with better selectivity and stronger affinity are necessary for implementing this dsDNA-targeting technology using TFOs. Under such a background, we considered that facile and efficient synthesis of various nucleobase derivatives in TFOs would be useful for finding an ideal nucleobase for recognition of a CG or TA base pair because detailed and rational exploration of nucleobase structures is facilitated. Recently, to develop a nucleobase recognizing a CG base pair, we have used post-elongation modification, i.e., modification after oligonucleotide synthesis, for the facile synthesis of nucleobase derivatives. This review mainly summarizes our recent findings on the development of artificial nucleobases and nucleotides for recognition of a CG base pair in triplexes formed between dsDNA and TFOs.

  11. Structural landscape of base pairs containing post-transcriptional modifications in RNA.

    Science.gov (United States)

    Seelam, Preethi P; Sharma, Purshotam; Mitra, Abhijit

    2017-06-01

    Base pairs involving post-transcriptionally modified nucleobases are believed to play important roles in a wide variety of functional RNAs. Here we present our attempts toward understanding the structural and functional role of naturally occurring modified base pairs using a combination of X-ray crystal structure database analysis, sequence analysis, and advanced quantum chemical methods. Our bioinformatics analysis reveals that despite their presence in all major secondary structural elements, modified base pairs are most prevalent in tRNA crystal structures and most commonly involve guanine or uridine modifications. Further, analysis of tRNA sequences reveals additional examples of modified base pairs at structurally conserved tRNA regions and highlights the conservation patterns of these base pairs in three domains of life. Comparison of structures and binding energies of modified base pairs with their unmodified counterparts, using quantum chemical methods, allowed us to classify the base modifications in terms of the nature of their electronic structure effects on base-pairing. Analysis of specific structural contexts of modified base pairs in RNA crystal structures revealed several interesting scenarios, including those at the tRNA:rRNA interface, antibiotic-binding sites on the ribosome, and the three-way junctions within tRNA. These scenarios, when analyzed in the context of available experimental data, allowed us to correlate the occurrence and strength of modified base pairs with their specific functional roles. Overall, our study highlights the structural importance of modified base pairs in RNA and points toward the need for greater appreciation of the role of modified bases and their interactions, in the context of many biological processes involving RNA. © 2017 Seelam et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

  12. Discovery, characterization, and optimization of an unnatural base pair for expansion of the genetic alphabet.

    Science.gov (United States)

    Leconte, Aaron M; Hwang, Gil Tae; Matsuda, Shigeo; Capek, Petr; Hari, Yoshiyuki; Romesberg, Floyd E

    2008-02-20

    DNA is inherently limited by its four natural nucleotides. Efforts to expand the genetic alphabet, by addition of an unnatural base pair, promise to expand the biotechnological applications available for DNA as well as to be an essential first step toward expansion of the genetic code. We have conducted two independent screens of hydrophobic unnatural nucleotides to identify novel candidate base pairs that are well recognized by a natural DNA polymerase. From a pool of 3600 candidate base pairs, both screens identified the same base pair, dSICS:dMMO2, which we report here. Using a series of related analogues, we performed a detailed structure-activity relationship analysis, which allowed us to identify the essential functional groups on each nucleobase. From the results of these studies, we designed an optimized base pair, d5SICS:dMMO2, which is efficiently and selectively synthesized by Kf within the context of natural DNA.

  13. Pseudoknot in domain II of 23 S rRNA is essential for ribosome function

    DEFF Research Database (Denmark)

    Rosendahl, G; Hansen, L H; Douthwaite, S

    1995-01-01

    of these base-pairs is disrupted, and it is completely abolished upon disruption of both base-pairs. Each mutant 23 S rRNA is assembled into 50 S subunits, but the mutant subunits do not stably interact with 30 S to engage in protein synthesis. Enzymatic and chemical probing of ribosomal particles reveals...... and ribosomes, but is rendered unreactive when either the pseudoknot is broken or when the r-proteins are removed. The structure of the pseudoknot region is possibly influenced by interaction of an r-protein at or close to the pseudoknot. Re-establishing the pseudoknot Watson-Crick interactions with one...... "eukaryal" (1005G.1138C or 1006U.1137A) pair and one "bacterial" C.G pair largely restores the structure and function of the rRNA. Bacterial ribosomes containing both these eukaryal pairs also participate in protein synthesis, although at much reduced efficiency, and the structure of their pseudoknot region...

  14. Sequence dependency of canonical base pair opening in the DNA double helix.

    Science.gov (United States)

    Lindahl, Viveca; Villa, Alessandra; Hess, Berk

    2017-04-01

    The flipping-out of a DNA base from the double helical structure is a key step of many cellular processes, such as DNA replication, modification and repair. Base pair opening is the first step of base flipping and the exact mechanism is still not well understood. We investigate sequence effects on base pair opening using extensive classical molecular dynamics simulations targeting the opening of 11 different canonical base pairs in two DNA sequences. Two popular biomolecular force fields are applied. To enhance sampling and calculate free energies, we bias the simulation along a simple distance coordinate using a newly developed adaptive sampling algorithm. The simulation is guided back and forth along the coordinate, allowing for multiple opening pathways. We compare the calculated free energies with those from an NMR study and check assumptions of the model used for interpreting the NMR data. Our results further show that the neighboring sequence is an important factor for the opening free energy, but also indicates that other sequence effects may play a role. All base pairs are observed to have a propensity for opening toward the major groove. The preferred opening base is cytosine for GC base pairs, while for AT there is sequence dependent competition between the two bases. For AT opening, we identify two non-canonical base pair interactions contributing to a local minimum in the free energy profile. For both AT and CG we observe long-lived interactions with water and with sodium ions at specific sites on the open base pair.

  15. Roles of the amino group of purine bases in the thermodynamic stability of DNA base pairing.

    Science.gov (United States)

    Nakano, Shu-ichi; Sugimoto, Naoki

    2014-08-05

    The energetic aspects of hydrogen-bonded base-pair interactions are important for the design of functional nucleotide analogs and for practical applications of oligonucleotides. The present study investigated the contribution of the 2-amino group of DNA purine bases to the thermodynamic stability of oligonucleotide duplexes under different salt and solvent conditions, using 2'-deoxyriboinosine (I) and 2'-deoxyribo-2,6-diaminopurine (D) as non-canonical nucleotides. The stability of DNA duplexes was changed by substitution of a single base pair in the following order: G • C > D • T ≈ I • C > A • T > G • T > I • T. The apparent stabilization energy due to the presence of the 2-amino group of G and D varied depending on the salt concentration, and decreased in the water-ethanol mixed solvent. The effects of salt concentration on the thermodynamics of DNA duplexes were found to be partially sequence-dependent, and the 2-amino group of the purine bases might have an influence on the binding of ions to DNA through the formation of a stable base-paired structure. Our results also showed that physiological salt conditions were energetically favorable for complementary base recognition, and conversely, low salt concentration media and ethanol-containing solvents were effective for low stringency oligonucleotide hybridization, in the context of conditions employed in this study.

  16. Roles of the Amino Group of Purine Bases in the Thermodynamic Stability of DNA Base Pairing

    Directory of Open Access Journals (Sweden)

    Shu-ichi Nakano

    2014-08-01

    Full Text Available The energetic aspects of hydrogen-bonded base-pair interactions are important for the design of functional nucleotide analogs and for practical applications of oligonucleotides. The present study investigated the contribution of the 2-amino group of DNA purine bases to the thermodynamic stability of oligonucleotide duplexes under different salt and solvent conditions, using 2'-deoxyriboinosine (I and 2'-deoxyribo-2,6-diaminopurine (D as non-canonical nucleotides. The stability of DNA duplexes was changed by substitution of a single base pair in the following order: G•C > D•T ≈ I•C > A•T > G•T > I•T. The apparent stabilization energy due to the presence of the 2-amino group of G and D varied depending on the salt concentration, and decreased in the water-ethanol mixed solvent. The effects of salt concentration on the thermodynamics of DNA duplexes were found to be partially sequence-dependent, and the 2-amino group of the purine bases might have an influence on the binding of ions to DNA through the formation of a stable base-paired structure. Our results also showed that physiological salt conditions were energetically favorable for complementary base recognition, and conversely, low salt concentration media and ethanol-containing solvents were effective for low stringency oligonucleotide hybridization, in the context of conditions employed in this study.

  17. Efforts toward expansion of the genetic alphabet: structure and replication of unnatural base pairs.

    Science.gov (United States)

    Matsuda, Shigeo; Fillo, Jeremiah D; Henry, Allison A; Rai, Priyamrada; Wilkens, Steven J; Dwyer, Tammy J; Geierstanger, Bernhard H; Wemmer, David E; Schultz, Peter G; Spraggon, Glen; Romesberg, Floyd E

    2007-08-29

    Expansion of the genetic alphabet has been a long-time goal of chemical biology. A third DNA base pair that is stable and replicable would have a great number of practical applications and would also lay the foundation for a semisynthetic organism. We have reported that DNA base pairs formed between deoxyribonucleotides with large aromatic, predominantly hydrophobic nucleobase analogues, such as propynylisocarbostyril (dPICS), are stable and efficiently synthesized by DNA polymerases. However, once incorporated into the primer, these analogues inhibit continued primer elongation. More recently, we have found that DNA base pairs formed between nucleobase analogues that have minimal aromatic surface area in addition to little or no hydrogen-bonding potential, such as 3-fluorobenzene (d3FB), are synthesized and extended by DNA polymerases with greatly increased efficiency. Here we show that the rate of synthesis and extension of the self-pair formed between two d3FB analogues is sufficient for in vitro DNA replication. To better understand the origins of efficient replication, we examined the structure of DNA duplexes containing either the d3FB or dPICS self-pairs. We find that the large aromatic rings of dPICS pair in an intercalative manner within duplex DNA, while the d3FB nucleobases interact in an edge-on manner, much closer in structure to natural base pairs. We also synthesized duplexes containing the 5-methyl-substituted derivatives of d3FB (d5Me3FB) paired opposite d3FB or the unsubstituted analogue (dBEN). In all, the data suggest that the structure, electrostatics, and dynamics can all contribute to the extension of unnatural primer termini. The results also help explain the replication properties of many previously examined unnatural base pairs and should help design unnatural base pairs that are better replicated.

  18. Conformational specificity of non-canonical base pairs and higher order structures in nucleic acids: crystal structure database analysis

    Science.gov (United States)

    Mukherjee, Shayantani; Bansal, Manju; Bhattacharyya, Dhananjay

    2006-10-01

    Non-canonical base pairs contribute immensely to the structural and functional variability of RNA, which calls for a detailed characterization of their spatial conformation. Intra-base pair parameters, namely propeller, buckle, open-angle, stagger, shear and stretch describe structure of base pairs indicating planarity and proximity of association between the two bases. In order to study the conformational specificities of non-canonical base pairs occurring in RNA crystal structures, we have upgraded NUPARM software to calculate these intra-base pair parameters using a new base pairing edge specific axis system. Analysis of base pairs and base triples with the new edge specific axis system indicate the presence of specific structural signatures for different classes of non-canonical pairs and triples. Differentiating features could be identified for pairs in cis or trans orientation, as well as those involving sugar edges or C-H-mediated hydrogen bonds. It was seen that propeller for all types of base pairs in cis orientation are generally negative, while those for trans base pairs do not have any preference. Formation of a base triple is seen to reduce propeller of the associated base pair along with reduction of overall flexibility of the pairs. We noticed that base pairs involving sugar edge are generally more non-planar, with large propeller or buckle values, presumably to avoid steric clash between the bulky sugar moieties. These specific conformational signatures often provide an insight into their role in the structural and functional context of RNA.

  19. Reversibly locked thionucleobase pairs in DNA to study base flipping enzymes

    Directory of Open Access Journals (Sweden)

    Christine Beuck

    2014-10-01

    Full Text Available Covalently interstrand cross-linked DNA is an interesting tool to study DNA binding proteins that locally open up the DNA duplex by flipping single bases out of the DNA helix or melting whole stretches of base pairs to perform their function. The ideal DNA cross-link to study protein–DNA interactions should be specific and easy to synthesize, be stable during protein binding experiments, have a short covalent linker to avoid steric hindrance of protein binding, and should be available as a mimic for both A/T and G/C base pairs to cover all possible binding specificities. Several covalent interstrand cross-links have been described in the literature, but most of them fall short of at least one of the above criteria. We developed an efficient method to site-specifically and reversibly cross-link thionucleoside base pairs in synthetic duplex oligodeoxynucleotides by bisalkylation with 1,2-diiodoethane resulting in an ethylene-bridged base pair. Both linked A/T and G/C base pair analogs can conveniently be prepared which allows studying any base pair-opening enzyme regardless of its sequence specificity. The cross-link is stable in the absence of reducing agents but the linker can be quickly and tracelessly removed by the addition of thiol reagents like dithiothreitol. This property makes the cross-linking reaction fully reversible and allows for a switching of the linked base pair from locked to unlocked during biochemical experiments. Using the DNA methyltransferase from Thermus aquaticus (M.TaqI as example, we demonstrate that the presented cross-linked DNA with an ethylene-linked A/T base pair analog at the target position is a useful tool to determine the base-flipping equilibrium constant of a base-flipping enzyme which lies mostly on the extrahelical side for M.TaqI.

  20. Validation of a Crowdsourcing Methodology for Developing a Knowledge Base of Related Problem-Medication Pairs.

    Science.gov (United States)

    McCoy, A B; Wright, A; Krousel-Wood, M; Thomas, E J; McCoy, J A; Sittig, D F

    2015-01-01

    Clinical knowledge bases of problem-medication pairs are necessary for many informatics solutions that improve patient safety, such as clinical summarization. However, developing these knowledge bases can be challenging. We sought to validate a previously developed crowdsourcing approach for generating a knowledge base of problem-medication pairs in a large, non-university health care system with a widely used, commercially available electronic health record. We first retrieved medications and problems entered in the electronic health record by clinicians during routine care during a six month study period. Following the previously published approach, we calculated the link frequency and link ratio for each pair then identified a threshold cutoff for estimated problem-medication pair appropriateness through clinician review; problem-medication pairs meeting the threshold were included in the resulting knowledge base. We selected 50 medications and their gold standard indications to compare the resulting knowledge base to the pilot knowledge base developed previously and determine its recall and precision. The resulting knowledge base contained 26,912 pairs, had a recall of 62.3% and a precision of 87.5%, and outperformed the pilot knowledge base containing 11,167 pairs from the previous study, which had a recall of 46.9% and a precision of 83.3%. We validated the crowdsourcing approach for generating a knowledge base of problem-medication pairs in a large non-university health care system with a widely used, commercially available electronic health record, indicating that the approach may be generalizable across healthcare settings and clinical systems. Further research is necessary to better evaluate the knowledge, to compare crowdsourcing with other approaches, and to evaluate if incorporating the knowledge into electronic health records improves patient outcomes.

  1. Vinylimidazole-Based Asymmetric Ion Pair Comonomers: Synthesis, Polymerization Studies and Formation of Ionically Crosslinked PMMA

    NARCIS (Netherlands)

    Jana, S.; Vasantha, V.A.; Stubbs, L.P.; Parthiban, A.; Vancso, Gyula J.

    2013-01-01

    Vinylimidazole-based asymmetric ion pair comonomers (IPCs) which are free from nonpolymerizable counter ions have been synthesized, characterized and polymerized by free radical polymerization (FRP), atom transfer radical polymerization (ATRP), and reversible addition-fragmentation chain transfer

  2. Properties of 5- and/or 2-modified 2'-O-cyanoethyl uridine residue: 2'-O-cyanoethyl-5-propynyl-2-thiouridine as an efficient duplex stabilizing component.

    Science.gov (United States)

    Masaki, Yoshiaki; Miyasaka, Ryuta; Hirai, Kunihiro; Kanamori, Takashi; Tsunoda, Hirosuke; Ohkubo, Akihiro; Seio, Kohji; Sekine, Mitsuo

    2014-02-21

    We systematically synthesized eight types of 5- and/or 2-modified uridine derivatives and evaluated their effect on duplex stability. The incorporation of 2'-O-cyanoethyl-2-thio-5-propynyluridine (p(5)s(2)UOCE) into RNA was significantly effective for stabilization of RNA/RNA (+8.5 °C) and DNA/RNA (+10.4 °C) duplexes. These striking effects were maintained in oligonucleotides with different sequences or multiple incorporations. In addition, p(5)s(2)UOCE increased selectivity toward the correct AU Watson-Crick base pair over the most stable mismatched base pair in both RNA/RNA and DNA/RNA duplexes. Hence, p(5)s(2)UOCE could be useful for various applications of modified oligonucleotides that need high duplex stability and base pairing selectivity.

  3. A novel pseudo-complementary PNA G-C base pair

    DEFF Research Database (Denmark)

    Olsen, Anne G.; Dahl, Otto; Petersen, Asger Bjørn

    2011-01-01

    Pseudo-complementary oligonucleotide analogues and mimics provide novel opportunities for targeting duplex structures in RNA and DNA. Previously, a pseudo-complementary A-T base pair has been introduced. Towards sequence unrestricted targeting, a pseudo-complementary G-C base pair consisting...... of the unnatural nucleobases n6-methoxy-2,6-diaminopurine (previously described in a DNA context) and N4-benzoylcytosine is now presented for design of pseudo-complementary PNA oligomers (pcPNAs)....

  4. Base pair opening in a deoxynucleotide duplex containing a cis-syn thymine cyclobutane dimer lesion.

    Science.gov (United States)

    Wenke, Belinda B; Huiting, Leah N; Frankel, Elisa B; Lane, Benjamin F; Núñez, Megan E

    2013-12-23

    The cis-syn thymine cyclobutane dimer is a DNA photoproduct implicated in skin cancer. We compared the stability of individual base pairs in thymine dimer-containing duplexes to undamaged parent 10-mer duplexes. UV melting thermodynamic measurements, CD spectroscopy, and 2D NOESY NMR spectroscopy confirm that the thymine dimer lesion is locally and moderately destabilizing within an overall B-form duplex conformation. We measured the rates of exchange of individual imino protons by NMR using magnetization transfer from water and determined the equilibrium constant for the opening of each base pair K(op). In the normal duplex K(op) decreases from the frayed ends of the duplex toward the center, such that the central TA pair is the most stable with a K(op) of 8 × 10⁻⁷. In contrast, base pair opening at the 5'T of the thymine dimer is facile. The 5'T of the dimer has the largest equilibrium constant (K(op) = 3 × 10⁻⁴) in its duplex, considerably larger than even the frayed penultimate base pairs. Notably, base pairing by the 3'T of the dimer is much more stable than by the 5'T, indicating that the predominant opening mechanism for the thymine dimer lesion is not likely to be flipping out into solution as a single unit. The dimer asymmetrically affects the stability of the duplex in its vicinity, destabilizing base pairing on its 5' side more than on the 3' side. The striking differences in base pair opening between parent and dimer duplexes occur independently of the duplex-single strand melting transitions.

  5. Sequence dependency of canonical base pair opening in the DNA double helix

    Science.gov (United States)

    Villa, Alessandra

    2017-01-01

    The flipping-out of a DNA base from the double helical structure is a key step of many cellular processes, such as DNA replication, modification and repair. Base pair opening is the first step of base flipping and the exact mechanism is still not well understood. We investigate sequence effects on base pair opening using extensive classical molecular dynamics simulations targeting the opening of 11 different canonical base pairs in two DNA sequences. Two popular biomolecular force fields are applied. To enhance sampling and calculate free energies, we bias the simulation along a simple distance coordinate using a newly developed adaptive sampling algorithm. The simulation is guided back and forth along the coordinate, allowing for multiple opening pathways. We compare the calculated free energies with those from an NMR study and check assumptions of the model used for interpreting the NMR data. Our results further show that the neighboring sequence is an important factor for the opening free energy, but also indicates that other sequence effects may play a role. All base pairs are observed to have a propensity for opening toward the major groove. The preferred opening base is cytosine for GC base pairs, while for AT there is sequence dependent competition between the two bases. For AT opening, we identify two non-canonical base pair interactions contributing to a local minimum in the free energy profile. For both AT and CG we observe long-lived interactions with water and with sodium ions at specific sites on the open base pair. PMID:28369121

  6. Unveiled electric profiles within hydrogen bonds suggest DNA base pairs with similar bond strengths.

    Directory of Open Access Journals (Sweden)

    Y B Ruiz-Blanco

    Full Text Available Electrical forces are the background of all the interactions occurring in biochemical systems. From here and by using a combination of ab-initio and ad-hoc models, we introduce the first description of electric field profiles with intrabond resolution to support a characterization of single bond forces attending to its electrical origin. This fundamental issue has eluded a physical description so far. Our method is applied to describe hydrogen bonds (HB in DNA base pairs. Numerical results reveal that base pairs in DNA could be equivalent considering HB strength contributions, which challenges previous interpretations of thermodynamic properties of DNA based on the assumption that Adenine/Thymine pairs are weaker than Guanine/Cytosine pairs due to the sole difference in the number of HB. Thus, our methodology provides solid foundations to support the development of extended models intended to go deeper into the molecular mechanisms of DNA functioning.

  7. Fluorescent Protein Based FRET Pairs with Improved Dynamic Range for Fluorescence Lifetime Measurements

    Science.gov (United States)

    George Abraham, Bobin; Sarkisyan, Karen S.; Mishin, Alexander S.; Santala, Ville; Tkachenko, Nikolai V.; Karp, Matti

    2015-01-01

    Fluorescence Resonance Energy Transfer (FRET) using fluorescent protein variants is widely used to study biochemical processes in living cells. FRET detection by fluorescence lifetime measurements is the most direct and robust method to measure FRET. The traditional cyan-yellow fluorescent protein based FRET pairs are getting replaced by green-red fluorescent protein variants. The green-red pair enables excitation at a longer wavelength which reduces cellular autofluorescence and phototoxicity while monitoring FRET. Despite the advances in FRET based sensors, the low FRET efficiency and dynamic range still complicates their use in cell biology and high throughput screening. In this paper, we utilized the higher lifetime of NowGFP and screened red fluorescent protein variants to develop FRET pairs with high dynamic range and FRET efficiency. The FRET variations were analyzed by proteolytic activity and detected by steady-state and time-resolved measurements. Based on the results, NowGFP-tdTomato and NowGFP-mRuby2 have shown high potentials as FRET pairs with large fluorescence lifetime dynamic range. The in vitro measurements revealed that the NowGFP-tdTomato has the highest Förster radius for any fluorescent protein based FRET pairs yet used in biological studies. The developed FRET pairs will be useful for designing FRET based sensors and studies employing Fluorescence Lifetime Imaging Microscopy (FLIM). PMID:26237400

  8. Fluorescent Protein Based FRET Pairs with Improved Dynamic Range for Fluorescence Lifetime Measurements.

    Directory of Open Access Journals (Sweden)

    Bobin George Abraham

    Full Text Available Fluorescence Resonance Energy Transfer (FRET using fluorescent protein variants is widely used to study biochemical processes in living cells. FRET detection by fluorescence lifetime measurements is the most direct and robust method to measure FRET. The traditional cyan-yellow fluorescent protein based FRET pairs are getting replaced by green-red fluorescent protein variants. The green-red pair enables excitation at a longer wavelength which reduces cellular autofluorescence and phototoxicity while monitoring FRET. Despite the advances in FRET based sensors, the low FRET efficiency and dynamic range still complicates their use in cell biology and high throughput screening. In this paper, we utilized the higher lifetime of NowGFP and screened red fluorescent protein variants to develop FRET pairs with high dynamic range and FRET efficiency. The FRET variations were analyzed by proteolytic activity and detected by steady-state and time-resolved measurements. Based on the results, NowGFP-tdTomato and NowGFP-mRuby2 have shown high potentials as FRET pairs with large fluorescence lifetime dynamic range. The in vitro measurements revealed that the NowGFP-tdTomato has the highest Förster radius for any fluorescent protein based FRET pairs yet used in biological studies. The developed FRET pairs will be useful for designing FRET based sensors and studies employing Fluorescence Lifetime Imaging Microscopy (FLIM.

  9. Fluorescent Protein Based FRET Pairs with Improved Dynamic Range for Fluorescence Lifetime Measurements.

    Science.gov (United States)

    George Abraham, Bobin; Sarkisyan, Karen S; Mishin, Alexander S; Santala, Ville; Tkachenko, Nikolai V; Karp, Matti

    2015-01-01

    Fluorescence Resonance Energy Transfer (FRET) using fluorescent protein variants is widely used to study biochemical processes in living cells. FRET detection by fluorescence lifetime measurements is the most direct and robust method to measure FRET. The traditional cyan-yellow fluorescent protein based FRET pairs are getting replaced by green-red fluorescent protein variants. The green-red pair enables excitation at a longer wavelength which reduces cellular autofluorescence and phototoxicity while monitoring FRET. Despite the advances in FRET based sensors, the low FRET efficiency and dynamic range still complicates their use in cell biology and high throughput screening. In this paper, we utilized the higher lifetime of NowGFP and screened red fluorescent protein variants to develop FRET pairs with high dynamic range and FRET efficiency. The FRET variations were analyzed by proteolytic activity and detected by steady-state and time-resolved measurements. Based on the results, NowGFP-tdTomato and NowGFP-mRuby2 have shown high potentials as FRET pairs with large fluorescence lifetime dynamic range. The in vitro measurements revealed that the NowGFP-tdTomato has the highest Förster radius for any fluorescent protein based FRET pairs yet used in biological studies. The developed FRET pairs will be useful for designing FRET based sensors and studies employing Fluorescence Lifetime Imaging Microscopy (FLIM).

  10. Pairing susceptibility of iron-based superconductors within a two-layer Hubbard model

    Science.gov (United States)

    Wei, Dan; Wang, Jingyao; Wu, Yang; Liang, Ying; Ma, Tianxing

    2017-12-01

    By using the determinant quantum Monte Carlo method, we studied the dominant pairing susceptibility of iron-based superconductors within an extended Hubbard model, which describes the underlying electronic structure of both iron pnictides and iron chalcogenides. The extended Hubbard model is constructed by two iron layers, each of which forms two sublattices on a square structure. Although the coupling between the two layers has different effects on the behavior of pairings in iron pnictides and iron chalcogenides, our non-biased numerical simulations reveal that the pairing with Sxy symmetry dominates over the studied parameter for both materials.

  11. A device that operates within a self-assembled 3D DNA crystal

    Science.gov (United States)

    Hao, Yudong; Kristiansen, Martin; Sha, Ruojie; Birktoft, Jens J.; Hernandez, Carina; Mao, Chengde; Seeman, Nadrian C.

    2017-08-01

    Structural DNA nanotechnology finds applications in numerous areas, but the construction of objects, 2D and 3D crystalline lattices and devices is prominent among them. Each of these components has been developed individually, and most of them have been combined in pairs. However, to date there are no reports of independent devices contained within 3D crystals. Here we report a three-state 3D device whereby we change the colour of the crystals by diffusing strands that contain dyes in or out of the crystals through the mother-liquor component of the system. Each colouring strand is designed to pair with an extended triangle strand by Watson-Crick base pairing. The arm that contains the dyes is quite flexible, but it is possible to establish the presence of the duplex proximal to the triangle by X-ray crystallography. We modelled the transition between the red and blue states through a simple kinetic model.

  12. An atlas of RNA base pairs involving modified nucleobases with optimal geometries and accurate energies

    KAUST Repository

    Chawla, Mohit

    2015-06-27

    Posttranscriptional modifications greatly enhance the chemical information of RNA molecules, contributing to explain the diversity of their structures and functions. A significant fraction of RNA experimental structures available to date present modified nucleobases, with half of them being involved in H-bonding interactions with other bases, i.e. ‘modified base pairs’. Herein we present a systematic investigation of modified base pairs, in the context of experimental RNA structures. To this end, we first compiled an atlas of experimentally observed modified base pairs, for which we recorded occurrences and structural context. Then, for each base pair, we selected a representative for subsequent quantum mechanics calculations, to find out its optimal geometry and interaction energy. Our structural analyses show that most of the modified base pairs are non Watson–Crick like and are involved in RNA tertiary structure motifs. In addition, quantum mechanics calculations quantify and provide a rationale for the impact of the different modifications on the geometry and stability of the base pairs they participate in.

  13. Fluorescent Protein Based FRET Pairs with Improved Dynamic Range for Fluorescence Lifetime Measurements

    OpenAIRE

    Bobin George Abraham; Karen S Sarkisyan; Mishin, Alexander S.; Ville Santala; Tkachenko, Nikolai V.; Matti Karp

    2015-01-01

    Fluorescence Resonance Energy Transfer (FRET) using fluorescent protein variants is widely used to study biochemical processes in living cells. FRET detection by fluorescence lifetime measurements is the most direct and robust method to measure FRET. The traditional cyan-yellow fluorescent protein based FRET pairs are getting replaced by green-red fluorescent protein variants. The green-red pair enables excitation at a longer wavelength which reduces cellular autofluorescence and phototoxicit...

  14. Interrogation of Base Pairing of the Spiroiminodihydantoin Diastereomers Using the α-Hemolysin Latch.

    Science.gov (United States)

    Zeng, Tao; Fleming, Aaron M; Ding, Yun; White, Henry S; Burrows, Cynthia J

    2017-03-21

    Spiroiminodihydantoin (Sp) is a hyperoxidized form of guanine (G) resulting from oxidation by reactive oxygen species. The lesion is highly mutagenic, and the stereocenter renders the two isomers with distinct behaviors in chemical, spectroscopic, enzymatic, and computational studies. In this work, the α-hemolysin (αHL) latch sensing zone was employed to investigate the base pairing properties of the Sp diastereomers embedded in a double-stranded DNA. Duplexes containing (S)-Sp consistently gave deeper current blockage, and a baseline resolution of ∼0.8 pA was achieved between (S)-Sp:G and (R)-Sp:G base pairs. Ion fluxes were generally more hindered when Sp was placed opposite pyrimidines. Analysis of the current noise of blockade events further provided dynamics information about the Sp-containing base pairs. In general, base pairs comprised of (S)-Sp generated current fluctuations larger than those of their (R)-Sp counterparts, suggesting enhanced base pairing dynamics. The current noise was also substantially affected by the identity of the base opposite Sp, increasing in the following order: A < G < T < C. This report provides information about the dynamic structure of Sp in the DNA duplex and therefore has implications for the enzymatic repair of the Sp diastereomers.

  15. Solution structure, mechanism of replication, and optimization of an unnatural base pair.

    Science.gov (United States)

    Malyshev, Denis A; Pfaff, Danielle A; Ippoliti, Shannon I; Hwang, Gil Tae; Dwyer, Tammy J; Romesberg, Floyd E

    2010-11-08

    As part of an ongoing effort to expand the genetic alphabet for in vitro and eventual in vivo applications, we have synthesized a wide variety of predominantly hydrophobic unnatural base pairs and evaluated their replication in DNA. Collectively, the results have led us to propose that these base pairs, which lack stabilizing edge-on interactions, are replicated by means of a unique intercalative mechanism. Here, we report the synthesis and characterization of three novel derivatives of the nucleotide analogue dMMO2, which forms an unnatural base pair with the nucleotide analogue d5SICS. Replacing the para-methyl substituent of dMMO2 with an annulated furan ring (yielding dFMO) has a dramatically negative effect on replication, while replacing it with a methoxy (dDMO) or with a thiomethyl group (dTMO) improves replication in both steady-state assays and during PCR amplification. Thus, dTMO-d5SICS, and especially dDMO-d5SICS, represent significant progress toward the expansion of the genetic alphabet. To elucidate the structure-activity relationships governing unnatural base pair replication, we determined the solution structure of duplex DNA containing the parental dMMO2-d5SICS pair, and also used this structure to generate models of the derivative base pairs. The results strongly support the intercalative mechanism of replication, reveal a surprisingly high level of specificity that may be achieved by optimizing packing interactions, and should prove invaluable for the further optimization of the unnatural base pair.

  16. Power and sample size calculation for paired recurrent events data based on robust nonparametric tests.

    Science.gov (United States)

    Su, Pei-Fang; Chung, Chia-Hua; Wang, Yu-Wen; Chi, Yunchan; Chang, Ying-Ju

    2017-05-20

    The purpose of this paper is to develop a formula for calculating the required sample size for paired recurrent events data. The developed formula is based on robust non-parametric tests for comparing the marginal mean function of events between paired samples. This calculation can accommodate the associations among a sequence of paired recurrent event times with a specification of correlated gamma frailty variables for a proportional intensity model. We evaluate the performance of the proposed method with comprehensive simulations including the impacts of paired correlations, homogeneous or nonhomogeneous processes, marginal hazard rates, censoring rate, accrual and follow-up times, as well as the sensitivity analysis for the assumption of the frailty distribution. The use of the formula is also demonstrated using a premature infant study from the neonatal intensive care unit of a tertiary center in southern Taiwan. Copyright © 2017 John Wiley & Sons, Ltd. Copyright © 2017 John Wiley & Sons, Ltd.

  17. Influence of the absolute configuration of npe-caged cytosine on DNA single base pair stability.

    Science.gov (United States)

    Steinert, Hannah S; Schäfer, Florian; Jonker, Hendrik R A; Heckel, Alexander; Schwalbe, Harald

    2014-01-20

    Photolabile protecting groups are a versatile tool to trigger reactions by light irradiation. In this study, we have investigated the influence of the absolute configuration of the 1-(2-nitrophenyl)ethyl (NPE) cage group on a 15-base-pair duplex DNA. Using UV melting, we determined the global stability of the unmodified and the selectively (S)- and (R)-NPE-modified DNA sequences, respectively. We observe a differently destabilizing effect for the two NPE stereoisomers on the global stability. Analysis of the temperature dependence of imino proton exchange rates measured by NMR spectroscopy reveals that this effect can be attributed to decreased base pair stabilities of the caged and the 3'-neighbouring base pair, respectively. Furthermore, our NMR based structural models of the modified duplexes provide a structural basis for the distinct effect of the (S)- and the (R)-NPE group. Copyright © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  18. Triple Helix Formation in a Topologically Controlled DNA Nanosystem.

    Science.gov (United States)

    Yamagata, Yutaro; Emura, Tomoko; Hidaka, Kumi; Sugiyama, Hiroshi; Endo, Masayuki

    2016-04-11

    In the present study, we demonstrate single-molecule imaging of triple helix formation in DNA nanostructures. The binding of the single-molecule third strand to double-stranded DNA in a DNA origami frame was examined using two different types of triplet base pairs. The target DNA strand and the third strand were incorporated into the DNA frame, and the binding of the third strand was controlled by the formation of Watson-Crick base pairing. Triple helix formation was monitored by observing the structural changes in the incorporated DNA strands. It was also examined using a photocaged third strand wherein the binding of the third strand was directly observed using high-speed atomic force microscopy during photoirradiation. We found that the binding of the third strand could be controlled by regulating duplex formation and the uncaging of the photocaged strands in the designed nanospace. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  19. Theoretical Characterization of Sulfur-to-Selenium Substitution in an Emissive RNA Alphabet: Impact on H-bonding Potential and Photophysical Properties

    KAUST Repository

    Chawla, Mohit

    2018-02-23

    We employ density functional theory (DFT) and time-dependent DFT (TDDFT) calculations to investigate the structural, energetic and optical properties of a new computationally designed RNA alphabet, where the nucleobases,tsA, tsG, tsC, and tsU (ts-bases), have been derived by replacing sulfur with selenium in the previously reported tz-bases, based on the isothiazolo[4.3-d]pyrimidine heterocycle core. We find out that the modeled non-natural bases have minimal impact on the geometry and energetics of the classical Watson-Crick base pairs, thus potentially mimicking the natural bases in a RNA duplex in terms of H-bonding. In contrast, our calculations indicate that H-bonded base pairs involving the Hoogsteen edge of purines are destabilized as compared to their natural counterparts. We also focus on the photophysical properties of the non-natural bases and correlate their absorption/emission peaks to the strong impact of the modification on the energy of the lowest unoccupied molecular orbital. It is indeed stabilized by roughly 1.1-1.6 eV as compared to the natural analogues, resulting in a reduction of the gap between the highest occupied and the lowest unoccupied molecular orbital from 5.3-5.5 eV in the natural bases to 3.9-4.2 eV in the modified ones, with a consequent bathochromic shift in the absorption and emission spectra. Overall, our analysis clearly indicates that the newly modelled ts-bases are expected to exhibit better fluorescent properties as compared to the previously reported tz-bases, while retaining similar H-bonding properties. In addition, we show that a new RNA alphabet based on size-extended benzo-homologated ts-bases can also form stable Watson-Crick base pairs with the natural complementary nucleobases.

  20. Discrimination of Single Base Pair Differences Among Individual DNA Molecules Using a Nanopore

    Science.gov (United States)

    Vercoutere, Wenonah; DeGuzman, Veronica

    2003-01-01

    The protein toxin alpha-hemolysin form nanometer scale channels across lipid membranes. Our lab uses a single channel in an artificial lipid bilayer in a patch clamp device to capture and examine individual DNA molecules. This nanopore detector used with a support vector machine (SVM) can analyze DNA hairpin molecules on the millisecond time scale. We distinguish duplex stem length, base pair mismatches, loop length, and single base pair differences. The residual current fluxes also reveal structural molecular dynamics elements. DNA end-fraying (terminal base pair dissociation) can be observed as near full blockades, or spikes, in current. This technique can be used to investigate other biological processes dependent on DNA end-fraying, such as the processing of HIV DNA by HIV integrase.

  1. Direct identification of base-paired RNA nucleotides by correlated chemical probing.

    Science.gov (United States)

    Krokhotin, Andrey; Mustoe, Anthony M; Weeks, Kevin M; Dokholyan, Nikolay V

    2017-01-01

    Many RNA molecules fold into complex secondary and tertiary structures that play critical roles in biological function. Among the best-established methods for examining RNA structure are chemical probing experiments, which can report on local nucleotide structure in a concise and extensible manner. While probing data are highly useful for inferring overall RNA secondary structure, these data do not directly measure through-space base-pairing interactions. We recently introduced an approach for single-molecule correlated chemical probing with dimethyl sulfate (DMS) that measures RNA interaction groups by mutational profiling (RING-MaP). RING-MaP experiments reveal diverse through-space interactions corresponding to both secondary and tertiary structure. Here we develop a framework for using RING-MaP data to directly and robustly identify canonical base pairs in RNA. When applied to three representative RNAs, this framework identified 20%-50% of accepted base pairs with a RNA Society.

  2. Photoinduced excess electron injection into DNA duplexes containing mismatched base pairs.

    Science.gov (United States)

    Ito, Takeo; Kondo, Akiko; Hayashi, Aiko; Uchida, Tsukasa; Tanabe, Kazuhito; Nishimoto, Sei-ichi

    2008-01-01

    A series of DNA containing photoinduced electron donors and mismatched DNA base pairs have been prepared and applied for the chemical investigation of excess electron transfer (EET) in the duplex DNA. As the electron donors, phenothiazine (PTZ) with a flexible linker was tethered to the 5'-end or in the middle of the sequences, or diaminostilbene (DAS) was covalently linked to form a hairpin structure. The presence of mismatched base pair lowered EET efficiency in the DAS-capped DNA hairpins, on the other hand, efficient EET beyond the mismatch site was observed in the PTZ-conjugated DNA.

  3. Synthetic biology with artificially expanded genetic information systems. From personalized medicine to extraterrestrial life.

    Science.gov (United States)

    Benner, Steven A; Hutter, Daniel; Sismour, A Michael

    2003-01-01

    Over 15 years ago, the Benner group noticed that the DNA alphabet need not be limited to the four standard nucleotides known in natural DNA. Rather, twelve nucleobases forming six base pairs joined by mutually exclusive hydrogen bonding patterns are possible within the geometry of the Watson-Crick pair (Fig. 1). Synthesis and studies on these compounds have brought us to the threshold of a synthetic biology, an artificial chemical system that does basic processes needed for life (in particular, Darwinian evolution), but with unnatural chemical structures. At the same time, the artificial genetic information systems (AEGIS) that we have developed have been used in FDA-approved commercial tests for managing HIV and hepatitis C infections in individual patients, and in a tool that seeks the virus for severe acute respiratory syndrome (SARS). AEGIS also supports the next generation of robotic probes to search for genetic molecules on Mars, Europa, and elsewhere where NASA probes will travel.

  4. Structure and Dynamics of RNA Repeat Expansions That Cause Huntington's Disease and Myotonic Dystrophy Type 1.

    Science.gov (United States)

    Chen, Jonathan L; VanEtten, Damian M; Fountain, Matthew A; Yildirim, Ilyas; Disney, Matthew D

    2017-07-11

    RNA repeat expansions cause a host of incurable, genetically defined diseases. The most common class of RNA repeats consists of trinucleotide repeats. These long, repeating transcripts fold into hairpins containing 1 × 1 internal loops that can mediate disease via a variety of mechanism(s) in which RNA is the central player. Two of these disorders are Huntington's disease and myotonic dystrophy type 1, which are caused by r(CAG) and r(CUG) repeats, respectively. We report the structures of two RNA constructs containing three copies of a r(CAG) [r(3×CAG)] or r(CUG) [r(3×CUG)] motif that were modeled with nuclear magnetic resonance spectroscopy and simulated annealing with restrained molecular dynamics. The 1 × 1 internal loops of r(3×CAG) are stabilized by one-hydrogen bond (cis Watson-Crick/Watson-Crick) AA pairs, while those of r(3×CUG) prefer one- or two-hydrogen bond (cis Watson-Crick/Watson-Crick) UU pairs. Assigned chemical shifts for the residues depended on the identity of neighbors or next nearest neighbors. Additional insights into the dynamics of these RNA constructs were gained by molecular dynamics simulations and a discrete path sampling method. Results indicate that the global structures of the RNA are A-form and that the loop regions are dynamic. The results will be useful for understanding the dynamic trajectory of these RNA repeats but also may aid in the development of therapeutics.

  5. Emergent Computation Emphasizing Bioinformatics

    CERN Document Server

    Simon, Matthew

    2005-01-01

    Emergent Computation is concerned with recent applications of Mathematical Linguistics or Automata Theory. This subject has a primary focus upon "Bioinformatics" (the Genome and arising interest in the Proteome), but the closing chapter also examines applications in Biology, Medicine, Anthropology, etc. The book is composed of an organized examination of DNA, RNA, and the assembly of amino acids into proteins. Rather than examine these areas from a purely mathematical viewpoint (that excludes much of the biochemical reality), the author uses scientific papers written mostly by biochemists based upon their laboratory observations. Thus while DNA may exist in its double stranded form, triple stranded forms are not excluded. Similarly, while bases exist in Watson-Crick complements, mismatched bases and abasic pairs are not excluded, nor are Hoogsteen bonds. Just as there are four bases naturally found in DNA, the existence of additional bases is not ignored, nor amino acids in addition to the usual complement of...

  6. Sequence-specific base pair mimics are efficient topoisomerase IB inhibitors.

    Science.gov (United States)

    Vekhoff, Pierre; Duca, Maria; Guianvarc'h, Dominique; Benhida, Rachid; Arimondo, Paola B

    2012-01-10

    Topoisomerase IB controls DNA topology by cleaving DNA transiently. This property is used by inhibitors, such as camptothecin, that stabilize, by inhibiting the religation step, the cleavage complex, in which the enzyme is covalently attached to the 3'-phosphate of the cleaved DNA strand. These drugs are used in clinics as antitumor agents. Because three-dimensional structural studies have shown that camptothecin derivatives act as base pair mimics and intercalate between two base pairs in the ternary DNA-topoisomerase-inhibitor complex, we hypothesized that base pairs mimics could act like campthotecin and inhibit the religation reaction after the formation of the topoisomerase I-DNA cleavage complex. We show here that three base pair mimics, nucleobases analogues of the aminophenyl-thiazole family, once targeted specifically to a DNA sequence were potent topoisomerase IB inhibitors. The targeting was achieved through covalent linkage to a sequence-specific DNA ligand, a triplex-forming oligonucleotide, and was necessary to position and keep the nucleobase analogue in the cleavage complex. In the absence of triplex formation, only a weak binding to the DNA and topoisomerase I-mediated DNA cleavage was observed. The three compounds were equally active once conjugated, implying that the intercalation of the nucleobase upon triplex formation is the essential feature for the inhibition activity.

  7. Sequence-dependent base pair stepping dynamics in XPD helicase unwinding.

    Science.gov (United States)

    Qi, Zhi; Pugh, Robert A; Spies, Maria; Chemla, Yann R

    2013-05-28

    Helicases couple the chemical energy of ATP hydrolysis to directional translocation along nucleic acids and transient duplex separation. Understanding helicase mechanism requires that the basic physicochemical process of base pair separation be understood. This necessitates monitoring helicase activity directly, at high spatio-temporal resolution. Using optical tweezers with single base pair (bp) resolution, we analyzed DNA unwinding by XPD helicase, a Superfamily 2 (SF2) DNA helicase involved in DNA repair and transcription initiation. We show that monomeric XPD unwinds duplex DNA in 1-bp steps, yet exhibits frequent backsteps and undergoes conformational transitions manifested in 5-bp backward and forward steps. Quantifying the sequence dependence of XPD stepping dynamics with near base pair resolution, we provide the strongest and most direct evidence thus far that forward, single-base pair stepping of a helicase utilizes the spontaneous opening of the duplex. The proposed unwinding mechanism may be a universal feature of DNA helicases that move along DNA phosphodiester backbones. DOI:http://dx.doi.org/10.7554/eLife.00334.001.

  8. 6-Pyrazolylpurine as an Artificial Nucleobase for Metal-Mediated Base Pairing in DNA Duplexes.

    Science.gov (United States)

    Léon, J Christian; Sinha, Indranil; Müller, Jens

    2016-04-14

    The artificial nucleobase 6-pyrazol-1-yl-purine (6PP) has been investigated with respect to its usability in metal-mediated base pairing. As was shown by temperature-dependent UV spectroscopy, 6PP may form weakly stabilizing 6PP-Ag(I)-6PP homo base pairs. Interestingly, 6PP can be used to selectively recognize a complementary pyrimidine nucleobase. The addition of Ag(I) to a DNA duplex comprising a central 6PP:C mispair (C = cytosine) leads to a slight destabilization of the duplex. In contrast, a stabilizing 6PP-Ag(I)-T base pair is formed with a complementary thymine (T) residue. It is interesting to note that 6PP is capable of differentiating between the pyrimidine moieties despite the fact that it is not as sterically crowded as 6-(3,5-dimethylpyrazol-1-yl)purine, an artificial nucleobase that had previously been suggested for the recognition of nucleic acid sequences via the formation of a metal-mediated base pair. Hence, the additional methyl groups of 6-(3,5-dimethylpyrazol-1-yl)purine may not be required for the specific recognition of the complementary nucleobase.

  9. DNA nanotechnology from the test tube to the cell

    Science.gov (United States)

    Chen, Yuan-Jyue; Groves, Benjamin; Muscat, Richard A.; Seelig, Georg

    2015-09-01

    The programmability of Watson-Crick base pairing, combined with a decrease in the cost of synthesis, has made DNA a widely used material for the assembly of molecular structures and dynamic molecular devices. Working in cell-free settings, researchers in DNA nanotechnology have been able to scale up system complexity and quantitatively characterize reaction mechanisms to an extent that is infeasible for engineered gene circuits or other cell-based technologies. However, the most intriguing applications of DNA nanotechnology -- applications that best take advantage of the small size, biocompatibility and programmability of DNA-based systems -- lie at the interface with biology. Here, we review recent progress in the transition of DNA nanotechnology from the test tube to the cell. We highlight key successes in the development of DNA-based imaging probes, prototypes of smart therapeutics and drug delivery systems, and explore the future challenges and opportunities for cellular DNA nanotechnology.

  10. DNA nanotechnology from the test tube to the cell.

    Science.gov (United States)

    Chen, Yuan-Jyue; Groves, Benjamin; Muscat, Richard A; Seelig, Georg

    2015-09-01

    The programmability of Watson-Crick base pairing, combined with a decrease in the cost of synthesis, has made DNA a widely used material for the assembly of molecular structures and dynamic molecular devices. Working in cell-free settings, researchers in DNA nanotechnology have been able to scale up system complexity and quantitatively characterize reaction mechanisms to an extent that is infeasible for engineered gene circuits or other cell-based technologies. However, the most intriguing applications of DNA nanotechnology - applications that best take advantage of the small size, biocompatibility and programmability of DNA-based systems - lie at the interface with biology. Here, we review recent progress in the transition of DNA nanotechnology from the test tube to the cell. We highlight key successes in the development of DNA-based imaging probes, prototypes of smart therapeutics and drug delivery systems, and explore the future challenges and opportunities for cellular DNA nanotechnology.

  11. Spin wave mediated interaction as a mechanism of pairs formation in iron-based superconductors

    Science.gov (United States)

    Lima, Leonardo S.

    2018-03-01

    The spin wave mediated interaction between electrons has been proposed as mechanism to formation of electron pairs in iron-based superconductors. We employe the diagrammatic expansion to calculate the binding energy of electrons pairs mediated by spin wave. Therefore, we propose the coupling of electrons in high-temperature superconductors mediated by spin waves, since that is well known that this class of superconductors materials if relates with spin-1/2 two-dimensional antiferromagnets, where it is well known there be an interplay between antiferromagnetism 2D and high-temperature superconductivity.

  12. Tuning locality of pair coherence in graphene-based Andreev interferometers.

    Science.gov (United States)

    Kim, Minsoo; Jeong, Dongchan; Lee, Gil-Ho; Shin, Yun-Sok; Lee, Hyun-Woo; Lee, Hu-Jong

    2015-03-04

    We report on gate-tuned locality of superconductivity-induced phase-coherent magnetoconductance oscillations in a graphene-based Andreev interferometer, consisting of a T-shaped graphene bar in contact with a superconducting Al loop. The conductance oscillations arose from the flux change through the superconducting Al loop, with gate-dependent Fraunhofer-type modulation of the envelope. We confirm a transitional change in the character of the pair coherence, between local and nonlocal, in the same device as the effective length-to-width ratio of the device was modulated by tuning the pair-coherence length ξT in the graphene layer.

  13. RNA Base Pairing Determines the Conformations of RNA Inside Spherical Viruses

    Science.gov (United States)

    Erdemci-Tandogan, Gonca; Orland, Henri; Zandi, Roya

    2017-11-01

    Many simple RNA viruses enclose their genetic material by a protein shell called the capsid. While the capsid structures are well characterized for most viruses, the structure of RNA inside the shells and the factors contributing to it remain poorly understood. We study the impact of base pairing on the conformations of RNA and find that it undergoes a swollen coil to globule continuous transition as a function of the strength of the pairing interaction. We also observe a first order transition and kink profile as a function of RNA length. All these transitions could explain the different RNA profiles observed inside viral shells.

  14. Identity-based authenticated key exchange protocols from the Tate pairing

    Science.gov (United States)

    Shen, Jun; Jin, Hong; Yang, Zhiyong; Cui, Xiang

    2011-12-01

    Key agreement protocols are designed to establish a session keys between two or multiple entities oven an insecure network and the session key is used to assure confidentiality thought encryption. With the advantages of identity-based (ID-based) cryptography, there have been many ID-based key agreement protocols proposed. However, most of them are based on Weil pairing, which is more cost of computation compared with Tate paring. In this paper, we propose a newly ID-based key agreement protocol from the Tate pairing. Compared with previous protocols, the new protocol minimizes the cost of computation with no extra message exchange time. In addition, the proposed protocol provides known key security, no key control, no key-compromise impersonation and perfect forward secrecy.

  15. p-Stilbazole moieties as artificial base pairs for photo-cross-linking of DNA duplex.

    Science.gov (United States)

    Kashida, Hiromu; Doi, Tetsuya; Sakakibara, Takumi; Hayashi, Takamitsu; Asanuma, Hiroyuki

    2013-05-29

    In this study, we report a photo-cross-linking reaction between p-stilbazole moieties. p-Stilbazoles were introduced into base-paring positions of complementary DNA strands. The [2 + 2] photocycloaddition reaction occurred rapidly upon light irradiation at 340 nm. Consequently, duplex was cross-linked and highly stabilized after 3 min irradiation. The CD spectrum of the cross-linked duplex indicated that the B-form double-helical structure was not severely distorted. NMR analysis revealed only one conformation of the duplex prior to UV irradiation, whereas two diastereomers were detected after the photo-cross-linking reaction. Before UV irradiation, p-stilbazole can adopt two different stacking modes because of rotation around the single bond between the phenyl and vinyl groups; these conformations cannot be discriminated on the NMR time scale due to rapid interconversion. However, photo-cross-linking fixed the conformation and enabled discrimination both by NMR and HPLC. The artificial base pair of p-methylstilbazolium showed almost the same reactivity as p-stilbazole, indicating that positive charge does not affect the reactivity. When a natural nucleobase was present in the complementary strand opposite p-stilbazole, the duplex was significantly destabilized relative to the duplex with paired p-stilbazole moieties and no photoreaction occurred between p-stilbazole and the nucleobase. The p-stilbazole pair has potential as a "third base pair" for nanomaterials due to its high stability and superb orthogonality.

  16. Direct updating of an RNA base-pairing probability matrix with marginal probability constraints.

    Science.gov (United States)

    Hamada, Michiaki

    2012-12-01

    A base-pairing probability matrix (BPPM) stores the probabilities for every possible base pair in an RNA sequence and has been used in many algorithms in RNA informatics (e.g., RNA secondary structure prediction and motif search). In this study, we propose a novel algorithm to perform iterative updates of a given BPPM, satisfying marginal probability constraints that are (approximately) given by recently developed biochemical experiments, such as SHAPE, PAR, and FragSeq. The method is easily implemented and is applicable to common models for RNA secondary structures, such as energy-based or machine-learning-based models. In this article, we focus mainly on the details of the algorithms, although preliminary computational experiments will also be presented.

  17. Major groove substituents and polymerase recognition of a class of predominantly hydrophobic unnatural base pairs.

    Science.gov (United States)

    Lavergne, Thomas; Malyshev, Denis A; Romesberg, Floyd E

    2012-01-23

    Expansion of the genetic alphabet with an unnatural base pair is a long-standing goal of synthetic biology. We have developed a class of unnatural base pairs, formed between d5SICS and analogues of dMMO2 that are efficiently and selectively replicated by the Klenow fragment (Kf) DNA polymerase. In an effort to further characterize and optimize replication, we report the synthesis of five new dMMO2 analogues bearing different substituents designed to be oriented into the developing major groove and an analysis of their insertion opposite d5SICS by Kf and Thermus aquaticus DNA polymerase I (Taq). We also expand the analysis of the previously optimized pair, dNaM-d5SICS, to include replication by Taq. Finally, the efficiency and fidelity of PCR amplification of the base pairs by Taq or Deep Vent polymerases was examined. The resulting structure-activity relationship data suggest that the major determinants of efficient replication are the minimization of desolvation effects and the introduction of favorable hydrophobic packing, and that Taq is more sensitive than Kf to structural changes. In addition, we identify an analogue (dNMO1) that is a better partner for d5SICS than any of the previously identified dMMO2 analogues with the exception of dNaM. We also found that dNaM-d5SICS is replicated by both Kf and Taq with rates approaching those of a natural base pair. Copyright © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  18. Site-Specific Incorporation of Functional Components into RNA by an Unnatural Base Pair Transcription System

    Directory of Open Access Journals (Sweden)

    Rie Kawai

    2012-03-01

    Full Text Available Toward the expansion of the genetic alphabet, an unnatural base pair between 7-(2-thienylimidazo[4,5-b]pyridine (Ds and pyrrole-2-carbaldehyde (Pa functions as a third base pair in replication and transcription, and provides a useful tool for the site-specific, enzymatic incorporation of functional components into nucleic acids. We have synthesized several modified-Pa substrates, such as alkylamino-, biotin-, TAMRA-, FAM-, and digoxigenin-linked PaTPs, and examined their transcription by T7 RNA polymerase using Ds-containing DNA templates with various sequences. The Pa substrates modified with relatively small functional groups, such as alkylamino and biotin, were efficiently incorporated into RNA transcripts at the internal positions, except for those less than 10 bases from the 3′-terminus. We found that the efficient incorporation into a position close to the 3′-terminus of a transcript depended on the natural base contexts neighboring the unnatural base, and that pyrimidine-Ds-pyrimidine sequences in templates were generally favorable, relative to purine-Ds-purine sequences. The unnatural base pair transcription system provides a method for the site-specific functionalization of large RNA molecules.

  19. Mutated primer binding sites interacting with different tRNAs allow efficient murine leukemia virus replication

    DEFF Research Database (Denmark)

    Lund, Anders Henrik; Duch, M; Lovmand, J

    1993-01-01

    Two Akv murine leukemia virus-based retroviral vectors with primer binding sites matching tRNA(Gln-1) and tRNA(Lys-3) were constructed. The transduction efficiency of these mutated vectors was found to be comparable to that of a vector carrying the wild-type primer binding site matching t......RNA(Pro). Polymerase chain reaction amplification and sequence analysis of transduced proviruses confirmed the transfer of vectors with mutated primer binding sites and further showed that tRNA(Gln-2) may act efficiently in conjunction with the tRNA(Gln-1) primer binding site. We conclude that murine leukemia virus...... can replicate by using various tRNA molecules as primers and propose primer binding site-tRNA primer interactions to be of major importance for tRNA primer selection. However, efficient primer selection does not require perfect Watson-Crick base pairing at all 18 positions of the primer binding site....

  20. Designer nanoscale DNA assemblies programmed from the top down

    Science.gov (United States)

    Veneziano, Rémi; Ratanalert, Sakul; Zhang, Kaiming; Zhang, Fei; Yan, Hao; Chiu, Wah; Bathe, Mark

    2016-06-01

    Scaffolded DNA origami is a versatile means of synthesizing complex molecular architectures. However, the approach is limited by the need to forward-design specific Watson-Crick base pairing manually for any given target structure. Here, we report a general, top-down strategy to design nearly arbitrary DNA architectures autonomously based only on target shape. Objects are represented as closed surfaces rendered as polyhedral networks of parallel DNA duplexes, which enables complete DNA scaffold routing with a spanning tree algorithm. The asymmetric polymerase chain reaction is applied to produce stable, monodisperse assemblies with custom scaffold length and sequence that are verified structurally in three dimensions to be high fidelity by single-particle cryo-electron microscopy. Their long-term stability in serum and low-salt buffer confirms their utility for biological as well as nonbiological applications.

  1. Artificial DNA lattice fabrication by noncomplementarity and geometrical incompatibility.

    Science.gov (United States)

    Shin, Jihoon; Kim, Junghoon; Amin, Rashid; Kim, Seungjae; Kwon, Young Hun; Park, Sung Ha

    2011-06-28

    Fabrication of DNA nanostructures primarily follows two fundamental rules. First, DNA oligonucleotides mutually combine by Watson-Crick base-pairing rules between complementary base sequences. Second, the geometrical compatibility of the DNA oligonucleotide must match for lattices to form. Here we present a fabrication scheme of DNA nanostructures with noncomplementary and/or geometrically incompatible DNA oligonucleotides, which contradicts conventional DNA structure creation rules. Quantitative analyses of DNA lattice sizes were carried out to verify the unfavorable binding occurrences, which correspond to errors in algorithmic self-assembly. Further studies of these types of bindings may shed more light on the exact mechanisms at work in the self-assembly of DNA nanostructures.

  2. Structural DNA nanotechnology: state of the art and future perspective.

    Science.gov (United States)

    Zhang, Fei; Nangreave, Jeanette; Liu, Yan; Yan, Hao

    2014-08-13

    Over the past three decades DNA has emerged as an exceptional molecular building block for nanoconstruction due to its predictable conformation and programmable intra- and intermolecular Watson-Crick base-pairing interactions. A variety of convenient design rules and reliable assembly methods have been developed to engineer DNA nanostructures of increasing complexity. The ability to create designer DNA architectures with accurate spatial control has allowed researchers to explore novel applications in many directions, such as directed material assembly, structural biology, biocatalysis, DNA computing, nanorobotics, disease diagnosis, and drug delivery. This Perspective discusses the state of the art in the field of structural DNA nanotechnology and presents some of the challenges and opportunities that exist in DNA-based molecular design and programming.

  3. Faithful PCR Amplification of an Unnatural Base-Pair Analogue with Four Hydrogen Bonds.

    Science.gov (United States)

    Tarashima, Noriko; Komatsu, Yasuo; Furukawa, Kazuhiro; Minakawa, Noriaki

    2015-07-20

    In vitro replication of an unnatural imidazopyridopyridine:naphthyridine base pair, (i.e., ImN(N):NaO(O)), having four hydrogen bonds was investigated. Kinetic studies of single-nucleotide insertion revealed that ImN(N) and NaO(O) were recognized as complementary bases by an exonuclease-deficient Klenow fragment with higher specificity and efficiency than two previously described pairs (ImN(O):NaO(N) and ImO(N):NaN(O)) because of higher thermal and thermodynamic stabilities and the DAAD:ADDA (D=donor, A=acceptor) hydrogen-bonding pattern of the ImN(N):NaO(O) pair. Faithful polymerase chain reaction (PCR) amplification of a DNA fragment containing the ImN(N):NaO(O) pair was achieved by using DNA polymerases possessing 3'→5' exonuclease activity (≈99.5 % per doubling). © 2015 WILEY‐VCH Verlag GmbH & Co. KGaA, Weinheim.

  4. Nucleic Acid Base Analog FRET-Pair Facilitating Detailed Structural Measurements in Nucleic Acid Containing Systems

    DEFF Research Database (Denmark)

    Börjesson, Karl; Preus, Søren; El-Sagheer, Afaf

    2009-01-01

    toward detailed studies of the inherent dynamics of nucleic acid structures. Moreover, the placement of FRET-pair chromophores inside the base stack will be a great advantage in studies where other (biomacro)molecules interact with the nucleic acid. Lastly, our study gives possibly the first truly solid...... distances covering up to more than one turn of the DNA duplex. Importantly, we show that the rigid stacking of the two base analogs, and consequently excellent control of their exact positions and orientations, results in a high control of the orientation factor and hence very distinct FRET changes...... as the number of bases separating tCO and tC(nitro) is varied. A set of DNA strands containing the FRET-pair at wisely chosen locations will, thus, make it possible to accurately distinguish distance- from orientation-changes using FRET. In combination with the good nucleobase analog properties, this points...

  5. A High Visual Quality Embedding Method in Edges Based on Pixel Pair Difference

    Directory of Open Access Journals (Sweden)

    Yuan-bo MA

    2015-08-01

    Full Text Available In this paper, we proposed a new data hiding method based on diamond encoding (DE and pixel pair difference (PPD. DE proposes a pixel-wise algorithm which flexibly embeds different base digits to maximize payload and image visual quality. During DE embedding, digits embed in sequence without separately consider smooth areas and complex areas. We propose a method based on human visual system in that human eyes are more sensitive to the change of smooth areas where pixel pairs possess less difference. Embedding secret message in complex areas insignificantly affects visual quality of the image, correspondingly makes the stego image less detectable. The proposed method uses PPD to adaptively embed secret message in complex areas and thus improves DE performance. Experimental results illustrate that our algorithm has the same distortion with DE but provides a better visual quality of stego image.

  6. DNA Aptamer Generation by Genetic Alphabet Expansion SELEX (ExSELEX) Using an Unnatural Base Pair System.

    Science.gov (United States)

    Kimoto, Michiko; Matsunaga, Ken-ichiro; Hirao, Ichiro

    2016-01-01

    Genetic alphabet expansion of DNA using unnatural base pair systems is expected to provide a wide variety of novel tools and methods. Recent rapid progress in this area has enabled the creation of several types of unnatural base pairs that function as a third base pair in polymerase reactions. Presently, a major topic is whether the genetic alphabet expansion system actually increases nucleic acid functionalities. We recently applied our unnatural base pair system to in vitro selection (SELEX), using a DNA library containing four natural bases and an unnatural base, and succeeded in the generation of high-affinity DNA aptamers that specifically bind to target proteins. Only a few hydrophobic unnatural bases greatly augmented the affinity of the aptamers. Here, we describe a new approach (genetic alphabet Expansion SELEX, ExSELEX), using our hydrophobic unnatural base pair system for high affinity DNA aptamer generation.

  7. Mutagen-nucleic acid intercalative binding: structure of a 9-aminoacridine: 5-iodocytidylyl(3'-5')guanosine crystalline complex.

    Science.gov (United States)

    Sakore, T D; Jain, S C; Tsai, C C; Sobell, H M

    1977-01-01

    9-Aminoacridine forms a crystalline complex with the dinucleoside monophosphate, 5-iodocytidylyl(3'-5')guanosine. We have solved the three-dimensional structure of this complex by x-ray crystallography and have observed two distinct intercalative binding modes by this drug to miniature Watson-Crick double helical structures. The first of these involves a pseudosymmetric stacking interaction between 9-aminoacridine molecules and guanine-cytosine base-pairs. This configuration may be used by 9-aminoacridine when intercalating into DNA. The second configuration is an asymmetric interaction, largely governed by stacking forces between acridine and guanine rings. This type of association may play an important role in the mechanism of frameshift mutagenesis. PMID:264674

  8. Enzyme-free nucleic acid dynamical systems.

    Science.gov (United States)

    Srinivas, Niranjan; Parkin, James; Seelig, Georg; Winfree, Erik; Soloveichik, David

    2017-12-15

    Chemistries exhibiting complex dynamics-from inorganic oscillators to gene regulatory networks-have been long known but either cannot be reprogrammed at will or rely on the sophisticated enzyme chemistry underlying the central dogma. Can simpler molecular mechanisms, designed from scratch, exhibit the same range of behaviors? Abstract chemical reaction networks have been proposed as a programming language for complex dynamics, along with their systematic implementation using short synthetic DNA molecules. We developed this technology for dynamical systems by identifying critical design principles and codifying them into a compiler automating the design process. Using this approach, we built an oscillator containing only DNA components, establishing that Watson-Crick base-pairing interactions alone suffice for complex chemical dynamics and that autonomous molecular systems can be designed via molecular programming languages. Copyright © 2017 The Authors, some rights reserved; exclusive licensee American Association for the Advancement of Science. No claim to original U.S. Government Works.

  9. Mutagen-nucleic acid intercalative binding: structure of a 9-aminoacridine: 5-iodocytidylyl(3'-5')guanosine crystalline complex

    Energy Technology Data Exchange (ETDEWEB)

    Sakore, T.D.; Jain, S.C.; Tsai, C.C.; Sobell, H.M.

    1977-01-01

    9-Aminoacridine forms a crystalline complex with the dinucleoside monophosphate, 5-iodocytidylyl(3'-5')-guanosine. We have solved the three-dimensional structure of this complex by x-ray crystallography and have observed two distinct intercalative binding modes by this drug to miniature Watson-Crick double helical structures. The first of these involves a pseudosymmetric stacking interaction between 9-aminoacridine molecules and guanine-cytosine base-pairs. This configuration may be used by 9-aminoacridine when intercalating into DNA. The second configuration is an asymmetric interaction, largely governed by stacking forces between acridine and guanine rings. This type of association may play an important role in the mechanism of frameshift mutagenesis.

  10. Enhanced Stability of DNA Nanostructures by Incorporation of Unnatural Base Pairs.

    Science.gov (United States)

    Liu, Qing; Liu, Guocheng; Wang, Ting; Fu, Jing; Li, Rujiao; Song, Linlin; Wang, Zhen-Gang; Ding, Baoquan; Chen, Fei

    2017-11-03

    Self-assembled DNA nanostructures hold great promise in the fields of nanofabrication, biosensing and nanomedicine. However, the inherent low stability of the DNA double helices, formed by weak interactions, largely hinders the assembly and functions of DNA nanostructures. In this study, we redesigned and constructed a six-arm DNA junction by incorporation of the unnatural base pairs 5-Me-isoC/isoG and A/2-thioT into the double helices. They not only retained the structural integrity of the DNA nanostructure, but also showed enhanced thermal stability and resistance to T7 Exonuclease digestion. This research may expand the applications of DNA nanostructures in nanofabrication and biomedical fields, and furthermore, the genetic alphabet expansion with unnatural base pairs may enable us to construct more complicated and diversified self-assembled DNA nanostructures. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  11. Analysis of ultrafast relaxation in photoexcited DNA base pairs of adenine and thymine

    Science.gov (United States)

    Samoylova, E.; Schultz, T.; Hertel, I. V.; Radloff, W.

    2008-05-01

    The photoinduced dynamics in base pairs of adenine and thymine were analyzed by femtosecond pump-probe spectroscopy. On the short-time scale up to a few picoseconds, the characteristic time constants for the dimers are quite similar to the corresponding values of the monomers. This leads to the conclusion that ultrafast intramolecular relaxation proceeds via ππ ∗ and nπ ∗ states of one component within the dimer. On the long-time scale, we obtained a novel time constant of roughly 40 ps for the thymine dimer and the adenine-thymine base pair. This time constant was never observed in the monomers and is tentatively assigned to an intermolecular relaxation process, possibly via a hydrogen transfer state.

  12. Optimized distance-dependent atom-pair-based potential DOOP for protein structure prediction.

    Science.gov (United States)

    Chae, Myong-Ho; Krull, Florian; Knapp, Ernst-Walter

    2015-05-01

    The DOcking decoy-based Optimized Potential (DOOP) energy function for protein structure prediction is based on empirical distance-dependent atom-pair interactions. To optimize the atom-pair interactions, native protein structures are decomposed into polypeptide chain segments that correspond to structural motives involving complete secondary structure elements. They constitute near native ligand-receptor systems (or just pairs). Thus, a total of 8609 ligand-receptor systems were prepared from 954 selected proteins. For each of these hypothetical ligand-receptor systems, 1000 evenly sampled docking decoys with 0-10 Å interface root-mean-square-deviation (iRMSD) were generated with a method used before for protein-protein docking. A neural network-based optimization method was applied to derive the optimized energy parameters using these decoys so that the energy function mimics the funnel-like energy landscape for the interaction between these hypothetical ligand-receptor systems. Thus, our method hierarchically models the overall funnel-like energy landscape of native protein structures. The resulting energy function was tested on several commonly used decoy sets for native protein structure recognition and compared with other statistical potentials. In combination with a torsion potential term which describes the local conformational preference, the atom-pair-based potential outperforms other reported statistical energy functions in correct ranking of native protein structures for a variety of decoy sets. This is especially the case for the most challenging ROSETTA decoy set, although it does not take into account side chain orientation-dependence explicitly. The DOOP energy function for protein structure prediction, the underlying database of protein structures with hypothetical ligand-receptor systems and their decoys are freely available at http://agknapp.chemie.fu-berlin.de/doop/. © 2015 Wiley Periodicals, Inc.

  13. DNA electronic circular dichroism on the inter-base pair scale

    DEFF Research Database (Denmark)

    Di Meo, Florent; Nørby, Morten Steen; Rubio-Magnieto, Jenifer

    2015-01-01

    A successful elucidation of the near-ultraviolet electronic circular dichroism spectrum of a short double-stranded DNA is reported. Time-dependent density functional theory methods are shown to accurately predict spectra and assign bands on the microscopic base-pair scale, a finding that opens...... the field for using circular dichroism spectroscopy as a sensitive nanoscale probe of DNA to reveal its complex interactions with the environment. (Chemical Equation Presented)....

  14. Uncertain Risk Assessment of Knowledge Management: Based on Set Pair Analysis

    OpenAIRE

    Guibin Yang; Hongyu Gao

    2016-01-01

    Since the knowledge resource becomes an important part of enterprise resources, the knowledge management risks could significantly affect the enterprise operation efficiency. Controlling knowledge management risks is one of the enterprise management tasks; the managers and researchers focus on how to effectively evaluate the risks. This paper aims to solve this problem and puts forward an evaluation model of the uncertain risks of knowledge management. Based on set pair theory, a model is est...

  15. Does base-pairing strength play a role in microRNA repression?

    Science.gov (United States)

    Carmel, Ido; Shomron, Noam; Heifetz, Yael

    2012-11-01

    MicroRNAs (miRNAs) are short, single-stranded RNAs that silence gene expression by either degrading mRNA or repressing translation. Each miRNA regulates a specific set of mRNA "targets" by binding to complementary sequences in their 3' untranslated region. In this study, we examined the importance of the base-pairing strength of the miRNA-target duplex to repression. We hypothesized that if base-pairing strength affects the functionality of miRNA repression, organisms with higher body temperature or that live at higher temperatures will have miRNAs with higher G/C content so that the miRNA-target complex will remain stable. In the nine model organisms examined, we found a significant correlation between the average G/C content of miRNAs and physiological temperature, supporting our hypothesis. Next, for each organism examined, we compared the average G/C content of miRNAs that are conserved among distant organisms and that of miRNAs that are evolutionarily recent. We found that the average G/C content of ancient miRNAs is lower than recent miRNAs in homeotherms, whereas the trend was inversed in poikilotherms, suggesting that G/C content is associated with temperature, thus further supporting our hypothesis. In the organisms examined, the average G/C content of miRNA "seed" sequences was higher than that of mature miRNAs, which was higher than pre-miRNA loops, suggesting an association between the degree of functionality of the sequence and its average G/C content. Our analyses show a possible association between the base-pairing strength of miRNA-targets and the temperature of an organism, suggesting that base-pairing strength plays a role in repression by miRNAs.

  16. Iron-based superconductors: Current status of materials and pairing mechanism

    Energy Technology Data Exchange (ETDEWEB)

    Hosono, Hideo, E-mail: hosono@msl.titech.ac.jp [Materials and Structures Laboratory & Materials Research Center for Element Strategy, Tokyo Institute of Technology, 4259 Nagatsuta, Midori-ku, Yokohama 226-8503 (Japan); Kuroki, Kazuhiko [Department of Physics, Graduate School of Science, Osaka University, Toyonaka, Osaka 560-0043 (Japan)

    2015-07-15

    Highlight: • An up-to-date review by the discoverer and a theoretical pioneer of iron-based superconductor. - Abstract: Since the discovery of high T{sub c} iron-based superconductors in early 2008, more than 15,000 papers have been published as a result of intensive research. This paper describes the current status of iron-based superconductors (IBSC) covering most up-to-date research progress along with the some background research, focusing on materials (bulk and thin film) and pairing mechanism.

  17. A novel hazard assessment method for biomass gasification stations based on extended set pair analysis.

    Science.gov (United States)

    Yan, Fang; Xu, Kaili; Li, Deshun; Cui, Zhikai

    2017-01-01

    Biomass gasification stations are facing many hazard factors, therefore, it is necessary to make hazard assessment for them. In this study, a novel hazard assessment method called extended set pair analysis (ESPA) is proposed based on set pair analysis (SPA). However, the calculation of the connection degree (CD) requires the classification of hazard grades and their corresponding thresholds using SPA for the hazard assessment. In regard to the hazard assessment using ESPA, a novel calculation algorithm of the CD is worked out when hazard grades and their corresponding thresholds are unknown. Then the CD can be converted into Euclidean distance (ED) by a simple and concise calculation, and the hazard of each sample will be ranked based on the value of ED. In this paper, six biomass gasification stations are introduced to make hazard assessment using ESPA and general set pair analysis (GSPA), respectively. By the comparison of hazard assessment results obtained from ESPA and GSPA, the availability and validity of ESPA can be proved in the hazard assessment for biomass gasification stations. Meanwhile, the reasonability of ESPA is also justified by the sensitivity analysis of hazard assessment results obtained by ESPA and GSPA.

  18. Maximal frequent sequence based test suite reduction through DU-pairs

    Directory of Open Access Journals (Sweden)

    Narendra Kumar Rao Bangole

    2014-08-01

    Full Text Available The current paper illustrates the importance of clustering the frequent items of code coverage during test suite reduction. A modular Most maximal frequent sequence clustered algorithm has been used along with a Requirement residue based test case reduction process. DU-pairs form the basic code coverage requirement under consideration for test suite reduction. This algorithm farewell when compared with few other algorithms like Harrold Gupta and Soffa (HGS and Bi-Objective Greedy (BOG algorithms and Greedy algorithms in covering all the DU-Pairs. The coverage criteria achieved is 100% in many cases, except for few insufficient and incomplete test suites.DOI: http://dx.doi.org/10.15181/csat.v2i1.396

  19. Single-Molecule Force Spectroscopy of an Artificial DNA Duplex Comprising a Silver(I)-Mediated Base Pair.

    Science.gov (United States)

    Tan, Xinxin; Litau, Stefanie; Zhang, Xi; Müller, Jens

    2015-10-20

    Single-molecule force spectroscopy measurements of a DNA duplex comprising an artificial metal-mediated base pair are reported. The measurements reveal that DNA duplexes comprising one central imidazole:imidazole mispair rupture at lower forces than a related duplex with canonical base pairs only. In contrast, DNA duplexes with one central imidazole-Ag(+)-imidazole base pair (formed by the addition of Ag(+) to the aforementioned duplex with the mispair) rupture at higher forces. These measurements indicate for the first time that the increase in thermal stability of a nucleic acid duplex that is observed upon the formation of a metal-mediated base pair is accompanied by a concomitant mechanical stabilization. In fact, the mechanical stabilization even exceeds the thermal one. This result indicates that nucleic acids with metal-mediated base pairs should be ideal building blocks for rigid functionalized DNA nano-objects.

  20. Using gap symmetry and structure to reveal the pairing mechanism in Fe-based superconductors

    Science.gov (United States)

    Hirschfeld, Peter J.

    2016-01-01

    I review theoretical ideas and implications of experiments for the gap structure and symmetry of the Fe-based superconductors. Unlike any other class of unconventional superconductors, one has in these systems the possibility to tune the interactions by small changes in pressure, doping or disorder. Thus, measurements of order parameter evolution with these parameters should enable a deeper understanding of the underlying interactions. I briefly review the ;standard paradigm; for s-wave pairing in these systems, and then focus on developments in the past several years which have challenged this picture. I further discuss the reasons for the apparent close competition between pairing in s- and d-wave channels, particularly in those systems where one type of Fermi surface pocket - hole or electron - is missing. Observation of a transition between s- and d-wave symmetry, possibly via a time reversal symmetry breaking ;s + id; state, would provide an important confirmation of these ideas. Several proposals for detecting these novel phases are discussed, including the appearance of order parameter collective modes in Raman and optical conductivities. Transitions between two different types of s-wave states, involving various combinations of signs on Fermi surface pockets, can also proceed through a T-breaking ;s + is; state. I discuss recent work that suggests pairing may take place away from the Fermi level over a surprisingly large energy range, as well as the effect of glide plane symmetry of the Fe-based systems on the superconductivity, including various exotic, time and translational invariance breaking pair states that have been proposed. Finally, I address disorder issues, and the various ways systematic introduction of disorder can (and cannot) be used to extract information on gap symmetry and structure.

  1. Prediction of plant promoters based on hexamers and random triplet pair analysis

    Directory of Open Access Journals (Sweden)

    Noman Nasimul

    2011-06-01

    Full Text Available Abstract Background With an increasing number of plant genome sequences, it has become important to develop a robust computational method for detecting plant promoters. Although a wide variety of programs are currently available, prediction accuracy of these still requires further improvement. The limitations of these methods can be addressed by selecting appropriate features for distinguishing promoters and non-promoters. Methods In this study, we proposed two feature selection approaches based on hexamer sequences: the Frequency Distribution Analyzed Feature Selection Algorithm (FDAFSA and the Random Triplet Pair Feature Selecting Genetic Algorithm (RTPFSGA. In FDAFSA, adjacent triplet-pairs (hexamer sequences were selected based on the difference in the frequency of hexamers between promoters and non-promoters. In RTPFSGA, random triplet-pairs (RTPs were selected by exploiting a genetic algorithm that distinguishes frequencies of non-adjacent triplet pairs between promoters and non-promoters. Then, a support vector machine (SVM, a nonlinear machine-learning algorithm, was used to classify promoters and non-promoters by combining these two feature selection approaches. We referred to this novel algorithm as PromoBot. Results Promoter sequences were collected from the PlantProm database. Non-promoter sequences were collected from plant mRNA, rRNA, and tRNA of PlantGDB and plant miRNA of miRBase. Then, in order to validate the proposed algorithm, we applied a 5-fold cross validation test. Training data sets were used to select features based on FDAFSA and RTPFSGA, and these features were used to train the SVM. We achieved 89% sensitivity and 86% specificity. Conclusions We compared our PromoBot algorithm to five other algorithms. It was found that the sensitivity and specificity of PromoBot performed well (or even better with the algorithms tested. These results show that the two proposed feature selection methods based on hexamer frequencies

  2. TEM-based Pair Distribution Function study of interatomic distances in C-supported Pt

    Science.gov (United States)

    Tran, D. T.; Ozkaya, D.

    2017-09-01

    The interatomic distances have been characterised for a Pt on Carbon based fuel cell catalyst studied by analysing the atomic pair distribution functions (PDF) obtained from electron diffraction (ED) data taken in a transmission electron microscope (TEM). The experimental PDFs have been compared with atomistic models to examine C-C and Pt-Pt interatomic distances. Further, the models have been refined by reverse Monte-Carlo simulations (RMC) based on the experimental PDF, enabling the investigation of Pt-C interatomic distances. This has demonstrated the existence of an interatomic contact between the Pt and C.

  3. Acid-Base Pairs in Lewis Acidic Zeolites Promote Direct Aldol Reactions by Soft Enolization.

    Science.gov (United States)

    Lewis, Jennifer D; Van de Vyver, Stijn; Román-Leshkov, Yuriy

    2015-08-17

    Hf-, Sn-, and Zr-Beta zeolites catalyze the cross-aldol condensation of aromatic aldehydes with acetone under mild reaction conditions with near quantitative yields. NMR studies with isotopically labeled molecules confirm that acid-base pairs in the Si-O-M framework ensemble promote soft enolization through α-proton abstraction. The Lewis acidic zeolites maintain activity in the presence of water and, unlike traditional base catalysts, in acidic solutions. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  4. The analysis of photon pair source at telecom wavelength based on the BBO crystal (Conference Presentation)

    Science.gov (United States)

    Gajewski, Andrzej; Kolenderski, Piotr L.

    2016-10-01

    There are several problems that must be solved in order to increase the distance of quantum communication protocols based on photons as an information carriers. One of them is the dispersion, whose effects can be minimized by engineering spectral properties of transmitted photons. In particular, it is expected that positively correlated photon pairs can be very useful. We present the full characterization of a source of single photon pairs at a telecom wavelength based on type II spontaneous parametric down conversion (SPDC) process in a beta-barium borate (BBO) crystal. In the type II process, a pump photon, which is polarized extraordinarily, splits in a nonlinear medium into signal and idler photons, which are polarized perpendicularly to each other. In order for the process to be efficient a phase matching condition must be fulfilled. These conditions originate from momentum and energy conservation rules and put severe restrictions on source parameters. Seemingly, these conditions force the photon pair to be negatively correlated in their spectral domain. However, it is possible to achieve positive correlation for pulsed pumping. The experimentally available degrees of freedom of a source are the width of the pumping beam, the collected modes' widths, the length of the nonlinear crystal and the duration of the pumping pulse. In our numerical model we use the following figures of merit: the pair production rate, the efficiency of photon coupling into a single mode fiber, the spectral correlation of the coupled photon pair. The last one is defined as the Pearson correlation parameter for a joint spectral distribution. The aim here is to find the largest positive spectral correlation and the highest coupling efficiency. By resorting to the numerical model Ref. [1] we showed in Ref. [2], that by careful adjustment of the pump's and the collected modes' characteristics, one can optimize any of the source's parameters. Our numerical outcomes conform to the

  5. TABASCO: A single molecule, base-pair resolved gene expression simulator

    Directory of Open Access Journals (Sweden)

    Endy Drew

    2007-12-01

    Full Text Available Abstract Background Experimental studies of gene expression have identified some of the individual molecular components and elementary reactions that comprise and control cellular behavior. Given our current understanding of gene expression, and the goals of biotechnology research, both scientists and engineers would benefit from detailed simulators that can explicitly compute genome-wide expression levels as a function of individual molecular events, including the activities and interactions of molecules on DNA at single base pair resolution. However, for practical reasons including computational tractability, available simulators have not been able to represent genome-scale models of gene expression at this level of detail. Results Here we develop a simulator, TABASCO http://openwetware.org/wiki/TABASCO, which enables the precise representation of individual molecules and events in gene expression for genome-scale systems. We use a single molecule computational engine to track individual molecules interacting with and along nucleic acid polymers at single base resolution. Tabasco uses logical rules to automatically update and delimit the set of species and reactions that comprise a system during simulation, thereby avoiding the need for a priori specification of all possible combinations of molecules and reaction events. We confirm that single molecule, base-pair resolved simulation using TABASCO (Tabasco can accurately compute gene expression dynamics and, moving beyond previous simulators, provide for the direct representation of intermolecular events such as polymerase collisions and promoter occlusion. We demonstrate the computational capacity of Tabasco by simulating the entirety of gene expression during bacteriophage T7 infection; for reference, the 39,937 base pair T7 genome encodes 56 genes that are transcribed by two types of RNA polymerases active across 22 promoters. Conclusion Tabasco enables genome-scale simulation of

  6. Studies of base pair sequence effects on DNA solvation based on all-atom molecular dynamics simulations.

    Science.gov (United States)

    Dixit, Surjit B; Mezei, Mihaly; Beveridge, David L

    2012-07-01

    Detailed analyses of the sequence-dependent solvation and ion atmosphere of DNA are presented based on molecular dynamics (MD) simulations on all the 136 unique tetranucleotide steps obtained by the ABC consortium using the AMBER suite of programs. Significant sequence effects on solvation and ion localization were observed in these simulations. The results were compared to essentially all known experimental data on the subject. Proximity analysis was employed to highlight the sequence dependent differences in solvation and ion localization properties in the grooves of DNA. Comparison of the MD-calculated DNA structure with canonical A- and B-forms supports the idea that the G/C-rich sequences are closer to canonical A- than B-form structures, while the reverse is true for the poly A sequences, with the exception of the alternating ATAT sequence. Analysis of hydration density maps reveals that the flexibility of solute molecule has a significant effect on the nature of observed hydration. Energetic analysis of solute-solvent interactions based on proximity analysis of solvent reveals that the GC or CG base pairs interact more strongly with water molecules in the minor groove of DNA that the AT or TA base pairs, while the interactions of the AT or TA pairs in the major groove are stronger than those of the GC or CG pairs. Computation of solvent-accessible surface area of the nucleotide units in the simulated trajectories reveals that the similarity with results derived from analysis of a database of crystallographic structures is excellent. The MD trajectories tend to follow Manning's counterion condensation theory, presenting a region of condensed counterions within a radius of about 17 A from the DNA surface independent of sequence. The GC and CG pairs tend to associate with cations in the major groove of the DNA structure to a greater extent than the AT and TA pairs. Cation association is more frequent in the minor groove of AT than the GC pairs. In general, the

  7. Natural-like replication of an unnatural base pair for the expansion of the genetic alphabet and biotechnology applications.

    Science.gov (United States)

    Li, Lingjun; Degardin, Mélissa; Lavergne, Thomas; Malyshev, Denis A; Dhami, Kirandeep; Ordoukhanian, Phillip; Romesberg, Floyd E

    2014-01-22

    We synthesized a panel of unnatural base pairs whose pairing depends on hydrophobic and packing forces and identify dTPT3-dNaM, which is PCR amplified with a natural base pair-like efficiency and fidelity. In addition, the dTPT3 scaffold is uniquely tolerant of attaching a propargyl amine linker, resulting in the dTPT3(PA)-dNaM pair, which is amplified only slightly less well. The identification of dTPT3 represents significant progress toward developing an unnatural base pair for the in vivo expansion of an organism's genetic alphabet and for a variety of in vitro biotechnology applications where it is used to site-specifically label amplified DNA, and it also demonstrates for the first time that hydrophobic and packing forces are sufficient to mediate natural-like replication.

  8. Expanding the scope of replicable unnatural DNA: stepwise optimization of a predominantly hydrophobic base pair.

    Science.gov (United States)

    Lavergne, Thomas; Degardin, Mélissa; Malyshev, Denis A; Quach, Henry T; Dhami, Kirandeep; Ordoukhanian, Phillip; Romesberg, Floyd E

    2013-04-10

    As part of an ongoing effort to expand the genetic alphabet for in vitro and eventually in vivo applications, we have synthesized a wide variety of predominantly hydrophobic unnatural base pairs exemplified by d5SICS-dMMO2 and d5SICS-dNaM. When incorporated into DNA, the latter is replicated and transcribed with greater efficiency and fidelity than the former; however, previous optimization efforts identified the para and methoxy-distal meta positions of dMMO2 as particularly promising for further optimization. Here, we report the stepwise optimization of dMMO2 via the synthesis and evaluation of 18 novel para-derivatized analogs of dMMO2, followed by further derivatization and evaluation of the most promising analogs with meta substituents. Subject to size constraints, we find that para substituents can optimize replication via both steric and electronic effects and that meta methoxy groups are unfavorable, while fluoro substituents can be beneficial or deleterious depending on the para substituent. In addition, we find that improvements in the efficiency of unnatural triphosphate insertion translate most directly into higher fidelity replication. Importantly, we identify multiple, unique base pair derivatives that when incorporated into DNA are well replicated. The most promising, d5SICS-dFEMO, is replicated under some conditions with greater efficiency and fidelity than d5SICS-dNaM. These results clearly demonstrate the generality of hydrophobic forces for the control of base pairing within DNA, provide a wealth of new SAR data, and importantly identify multiple new candidates for eventual in vivo evaluation.

  9. The influence of 5-fluorouracil anticancer drug on the DNA base pairs; A quantum chemical study.

    Science.gov (United States)

    Nakhaei, Ebrahim; Nowroozi, Alireza; Ravari, Fateme

    2018-01-03

    In the present study, various hydrogen bonded complexes between 5-fluorouracil (FU) with AT and GC base pairs were studied. First, to determine the affinity of different sites of the parent structures (FU, AT, and GC) for the hydrogen bond formation, their molecular electrostatic potentials (MEP) are explored. The complexation energies and the strength of individual HBs of the plausible complexes were evaluated by energetic, geometric, spectroscopic, topologic and molecular orbital descriptors. Our results reveal that, the FU-GC complexes (34.76-44.42 kcal mol-1) are more stable than the FU-AT ones (21.00-30.35 kcal mol-1). Among the complexes, the FU3-AT1 and FU3-GC3 are the most stable structures in the both series, which can be related to the sites with the highest affinity. Second, a detail analysis of the hydrogen bond descriptors were performed to elucidate the effect of FU on the strength of HB interactions within the base pairs. Interestingly, due to the formation of various interactions between the active sites of basic molecules, the strength of HB within the base pairs in the most cases increase about +2.75 and +0.57 kcal mol-1 for the GC and AT nucleobases, respectively. Finally, several aromatic indices (HOMA, FLU, NICS (0) and NICS (1)) were applied to evaluate the significance of π-electron delocalization (π-ED) of 5/6 membered rings. These results clearly show that the π-ED of the benchmark systems increase with the formation or strengthening of the HB, which is in line with the resonance assisted hydrogen bond theory.

  10. DFT Description of Intermolecular Forces between 9-Aminoacridines and DNA Base Pairs

    Directory of Open Access Journals (Sweden)

    Sandra Cotes Oyaga

    2013-01-01

    Full Text Available The B3LYP method with 6-31G* basis set was used to predict the geometries of five 9-aminoacridines (9-AA 1(a–e, DNA base pairs, and respective complexes. Polarizabilities, charge distribution, frontier molecular orbital (FMO, and dipole moments were used to analyze the nature of interactions that allow reasonable drug diffusion levels. The results showed that charge delocalization, high polarizabilities, and high dipole moments play an important role in intermolecular interactions with DNA. The interactions of 9-AA 1(a–e with GC are the strongest. 9-AA 1(d displayed the strongest interaction and 9-AA 1(b the weakest.

  11. Superior coexistence: systematicALLY regulatING land subsidence BASED on set pair theory

    Science.gov (United States)

    Chen, Y.; Gong, S.-L.

    2015-11-01

    Anthropogenic land subsidence is an environmental side effect of exploring and using natural resources in the process of economic development. The key points of the system for controlling land subsidence include cooperation and superior coexistence while the economy develops, exploring and using natural resources, and geological environmental safety. Using the theory and method of set pair analysis (SPA), this article anatomises the factors, effects, and transformation of land subsidence. Based on the principle of superior coexistence, this paper promotes a technical approach to the system for controlling land subsidence, in order to improve the prevention and control of geological hazards.

  12. Superior coexistence: systematicALLY regulatING land subsidence BASED on set pair theory

    Directory of Open Access Journals (Sweden)

    Y. Chen

    2015-11-01

    Full Text Available Anthropogenic land subsidence is an environmental side effect of exploring and using natural resources in the process of economic development. The key points of the system for controlling land subsidence include cooperation and superior coexistence while the economy develops, exploring and using natural resources, and geological environmental safety. Using the theory and method of set pair analysis (SPA, this article anatomises the factors, effects, and transformation of land subsidence. Based on the principle of superior coexistence, this paper promotes a technical approach to the system for controlling land subsidence, in order to improve the prevention and control of geological hazards.

  13. Sequence-specific high mobility group box factors recognize 10-12-base pair minor groove motifs

    DEFF Research Database (Denmark)

    van Beest, M; Dooijes, D; van De Wetering, M

    2000-01-01

    , 12, and 10 base pairs, respectively. Footprinting with a deletion mutant of Ste11 reveals a novel interaction between the 3' base pairs of the extended DNA motif and amino acids C-terminal to the HMG domain. The sequence-specific interaction of Ste11 with these 3' base pairs contributes significantly......Sequence-specific high mobility group (HMG) box factors bind and bend DNA via interactions in the minor groove. Three-dimensional NMR analyses have provided the structural basis for this interaction. The cognate HMG domain DNA motif is generally believed to span 6-8 bases. However, alignment...... of promoter elements controlled by the yeast genes ste11 and Rox1 has indicated strict conservation of a larger DNA motif. By site selection, we identify a highly specific 12-base pair motif for Ste11, AGAACAAAGAAA. Similarly, we show that Tcf1, MatMc, and Sox4 bind unique, highly specific DNA motifs of 12...

  14. Minor groove hydrogen bonds and the replication of unnatural base pairs.

    Science.gov (United States)

    Matsuda, Shigeo; Leconte, Aaron M; Romesberg, Floyd E

    2007-05-02

    As part of an effort to expand the genetic alphabet, we examined the synthesis of DNA with six different unnatural nucleotides bearing methoxy-derivatized nucleobase analogues. Different nucleobase substitution patterns were used to systematically alter the nucleobase electronics, sterics, and hydrogen-bonding potential. We determined the ability of the Klenow fragment of E. coli DNA polymerase I to synthesize and extend the different unnatural base pairs and mispairs under steady-state conditions. Unlike other hydrogen-bond acceptors examined in the past, the methoxy groups do not facilitate mispairing, implying that they are not recognized by any of the hydrogen-bond donors of the natural nucleobases; however, they do facilitate replication. The more efficient replication results largely from an increase in the rate of extension of primers terminating at the unnatural base pair and, interestingly, requires that the methoxy group be at the ortho position where it is positioned in the developing minor groove and can form a functionally important hydrogen bond with the polymerase. Thus, ortho methoxy groups should be generally useful for the effort to expand the genetic alphabet.

  15. Eukaryotic TPP riboswitch regulation of alternative splicing involving long-distance base pairing.

    Science.gov (United States)

    Li, Sanshu; Breaker, Ronald R

    2013-03-01

    Thiamin pyrophosphate (TPP) riboswitches are found in organisms from all three domains of life. Examples in bacteria commonly repress gene expression by terminating transcription or by blocking ribosome binding, whereas most eukaryotic TPP riboswitches are predicted to regulate gene expression by modulating RNA splicing. Given the widespread distribution of eukaryotic TPP riboswitches and the diversity of their locations in precursor messenger RNAs (pre-mRNAs), we sought to examine the mechanism of alternative splicing regulation by a fungal TPP riboswitch from Neurospora crassa, which is mostly located in a large intron separating protein-coding exons. Our data reveal that this riboswitch uses a long-distance (∼530-nt separation) base-pairing interaction to regulate alternative splicing. Specifically, a portion of the TPP-binding aptamer can form a base-paired structure with a conserved sequence element (α) located near a 5' splice site, which greatly increases use of this 5' splice site and promotes gene expression. Comparative sequence analyses indicate that many fungal species carry a TPP riboswitch with similar intron architecture, and therefore the homologous genes in these fungi are likely to use the same mechanism. Our findings expand the scope of genetic control mechanisms relying on long-range RNA interactions to include riboswitches.

  16. Adaptation of the base-paired double-helix molecular architecture to extreme pressure

    Science.gov (United States)

    Girard, Eric; Prangé, Thierry; Dhaussy, Anne-Claire; Migianu-Griffoni, Evelyne; Lecouvey, Marc; Chervin, Jean-Claude; Mezouar, Mohamed; Kahn, Richard; Fourme, Roger

    2007-01-01

    The behaviour of the d(GGTATACC) oligonucleotide has been investigated by X-ray crystallography at 295 K in the range from ambient pressure to 2 GPa (∼20 000 atm). Four 3D-structures of the A-DNA form (at ambient pressure, 0.55, 1.09 and 1.39 GPa) were refined at 1.60 or 1.65 Å resolution. In addition to the diffraction pattern of the A-form, the broad meridional streaks previously explained by occluded B-DNA octamers within the channels of the crystalline A-form matrix were observed up to at least 2 GPa. This work highlights an important property of nucleic acids, their capability to withstand very high pressures, while keeping in such conditions a nearly invariant geometry of base pairs that store and carry genetic information. The double-helix base-paired architecture behaves as a molecular spring, which makes it especially adapted to very harsh conditions. These features may have contributed to the emergence of a RNA World at prebiotic stage. PMID:17617642

  17. A Bilinear Pairing-Based Dynamic Key Management and Authentication for Wireless Sensor Networks

    Directory of Open Access Journals (Sweden)

    Chin-Ling Chen

    2015-01-01

    Full Text Available In recent years, wireless sensor networks have been used in a variety of environments; a wireless network infrastructure, established to communicate and exchange information in a monitoring area, has also been applied in different environments. However, for sensitive applications, security is the paramount issue. In this paper, we propose using bilinear pairing to design dynamic key management and authentication scheme of the hierarchical sensor network. We use the dynamic key management and the pairing-based cryptography (PBC to establish the session key and the hash message authentication code (HMAC to support the mutual authentication between the sensors and the base station. In addition, we also embed the capability of the Global Positioning System (GPS to cluster nodes to find the best path of the sensor network. The proposed scheme can also provide the requisite security of the dynamic key management, mutual authentication, and session key protection. Our scheme can defend against impersonation attack, replay attack, wormhole attack, and message manipulation attack.

  18. Thermal transport in topological-insulator-based superconducting hybrid structures with mixed singlet and triplet pairing states

    Science.gov (United States)

    Li, Hai; Zhao, Yuan Yuan

    2017-11-01

    In the framework of the Bogoliubov–de Gennes equation, we investigate the thermal transport properties in topological-insulator-based superconducting hybrid structures with mixed spin-singlet and spin-triplet pairing states, and emphasize the different manifestations of the spin-singlet and spin-triplet pairing states in the thermal transport signatures. It is revealed that the temperature-dependent differential thermal conductance strongly depends on the components of the pairing state, and the negative differential thermal conductance only occurs in the spin-singlet pairing state dominated regime. It is also found that the thermal conductance is profoundly sensitive to the components of the pairing state. In the spin-singlet pairing state controlled regime, the thermal conductance obviously oscillates with the phase difference and junction length. With increasing the proportion of the spin-triplet pairing state, the oscillating characteristic of the thermal conductance fades out distinctly. These results suggest an alternative route for distinguishing the components of pairing states in topological-insulator-based superconducting hybrid structures.

  19. Classification of pseudo pairs between nucleotide bases and amino acids by analysis of nucleotide–protein complexes

    Science.gov (United States)

    Kondo, Jiro; Westhof, Eric

    2011-01-01

    Nucleotide bases are recognized by amino acid residues in a variety of DNA/RNA binding and nucleotide binding proteins. In this study, a total of 446 crystal structures of nucleotide–protein complexes are analyzed manually and pseudo pairs together with single and bifurcated hydrogen bonds observed between bases and amino acids are classified and annotated. Only 5 of the 20 usual amino acid residues, Asn, Gln, Asp, Glu and Arg, are able to orient in a coplanar fashion in order to form pseudo pairs with nucleotide bases through two hydrogen bonds. The peptide backbone can also form pseudo pairs with nucleotide bases and presents a strong bias for binding to the adenine base. The Watson–Crick side of the nucleotide bases is the major interaction edge participating in such pseudo pairs. Pseudo pairs between the Watson–Crick edge of guanine and Asp are frequently observed. The Hoogsteen edge of the purine bases is a good discriminatory element in recognition of nucleotide bases by protein side chains through the pseudo pairing: the Hoogsteen edge of adenine is recognized by various amino acids while the Hoogsteen edge of guanine is only recognized by Arg. The sugar edge is rarely recognized by either the side-chain or peptide backbone of amino acid residues. PMID:21737431

  20. Identification of DNA lesions using a third base pair for amplification and nanopore sequencing

    Science.gov (United States)

    Riedl, Jan; Ding, Yun; Fleming, Aaron M.; Burrows, Cynthia J.

    2015-01-01

    Damage to the genome is implicated in the progression of cancer and stress-induced diseases. DNA lesions exist in low levels, and cannot be amplified by standard PCR because they are frequently strong blocks to polymerases. Here, we describe a method for PCR amplification of lesion-containing DNA in which the site and identity could be marked, copied and sequenced. Critical for this method is installation of either the dNaM or d5SICS nucleotides at the lesion site after processing via the base excision repair process. These marker nucleotides constitute an unnatural base pair, allowing large quantities of marked DNA to be made by PCR amplification. Sanger sequencing confirms the potential for this method to locate lesions by marking, amplifying and sequencing a lesion in the KRAS gene. Detection using the α-hemolysin nanopore is also developed to analyse the markers in individual DNA strands with the potential to identify multiple lesions per strand. PMID:26542210

  1. GGIP: Structure and sequence-based GPCR-GPCR interaction pair predictor.

    Science.gov (United States)

    Nemoto, Wataru; Yamanishi, Yoshihiro; Limviphuvadh, Vachiranee; Saito, Akira; Toh, Hiroyuki

    2016-09-01

    G Protein-Coupled Receptors (GPCRs) are important pharmaceutical targets. More than 30% of currently marketed pharmaceutical medicines target GPCRs. Numerous studies have reported that GPCRs function not only as monomers but also as homo- or hetero-dimers or higher-order molecular complexes. Many GPCRs exert a wide variety of molecular functions by forming specific combinations of GPCR subtypes. In addition, some GPCRs are reportedly associated with diseases. GPCR oligomerization is now recognized as an important event in various biological phenomena, and many researchers are investigating this subject. We have developed a support vector machine (SVM)-based method to predict interacting pairs for GPCR oligomerization, by integrating the structure and sequence information of GPCRs. The performance of our method was evaluated by the Receiver Operating Characteristic (ROC) curve. The corresponding area under the curve was 0.938. As far as we know, this is the only prediction method for interacting pairs among GPCRs. Our method could accelerate the analyses of these interactions, and contribute to the elucidation of the global structures of the GPCR networks in membranes. Proteins 2016; 84:1224-1233. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

  2. Peptide tag/probe pairs based on the coordination chemistry for protein labeling.

    Science.gov (United States)

    Uchinomiya, Shohei; Ojida, Akio; Hamachi, Itaru

    2014-02-17

    Protein-labeling methods serve as essential tools for analyzing functions of proteins of interest under complicated biological conditions such as in live cells. These labeling methods are useful not only to fluorescently visualize proteins of interest in biological systems but also to conduct protein and cell analyses by harnessing the unique functions of molecular probes. Among the various labeling methods available, an appropriate binding pair consisting of a short peptide and a de novo designed small molecular probe has attracted attention because of its wide utility and versatility. Interestingly, most peptide tag/probe pairs exploit metal-ligand coordination interactions as the main binding force responsible for their association. Herein, we provide an overview of the recent progress of these coordination-chemistry-based protein-labeling methods and their applications for fluorescence imaging and functional analysis of cellular proteins, while highlighting our originally developed labeling methods. These successful examples clearly exemplify the utility and versatility of metal coordination chemistry in protein functional analysis.

  3. Radical-pair-based magnetoreception in birds: radio-frequency experiments and the role of cryptochrome.

    Science.gov (United States)

    Nießner, Christine; Winklhofer, Michael

    2017-07-01

    The radical-pair hypothesis of magnetoreception has gained a lot of momentum, since the flavoprotein cryptochrome was postulated as a structural candidate to host magnetically sensitive chemical reactions. Here, we first discuss behavioral tests using radio-frequency magnetic fields (0.1-10 MHz) to specifically disturb a radical-pair-based avian magnetic compass sense. While disorienting effects of broadband RF magnetic fields have been replicated independently in two competing labs, the effects of monochromatic RF magnetic fields administered at the electronic Larmor frequency (~1.3 MHz) are disparate. We give technical recommendations for future RF experiments. We then focus on two candidate magnetoreceptor proteins in birds, Cry1a and Cry1b, two splice variants of the same gene (Cry1). Immunohistochemical studies have identified Cry1a in the outer segments of the ultraviolet/violet-sensitive cone photoreceptors and Cry1b in the cytosol of retinal ganglion cells. The identification of the host neurons of these cryptochromes and their subcellular expression patterns presents an important advance, but much work lies ahead to gain some functional understanding. In particular, interaction partners of cryptochrome Cry1a and Cry1b remain to be identified. A candidate partner for Cry4 was previously suggested, but awaits independent replication.

  4. Quantum correlation of fiber-based telecom-band photon pairs through standard loss and random media.

    Science.gov (United States)

    Sua, Yong Meng; Malowicki, John; Lee, Kim Fook

    2014-08-15

    We study quantum correlation and interference of fiber-based telecom-band photon pairs with one photon of the pair experiencing multiple scattering in a random medium. We measure joint probability of two-photon detection for signal photon in a normal channel and idler photon in a channel, which is subjected to two independent conditions: standard loss (neutral density filter) and random media. We observe that both conditions degrade the correlation of signal and idler photons, and depolarization of the idler photon in random medium can enhance two-photon interference at certain relative polarization angles. Our theoretical calculation on two-photon polarization correlation and interference as a function of mean free path is in agreement with our experiment data. We conclude that quantum correlation of a polarization-entangled photon pair is better preserved than a polarization-correlated photon pair as one photon of the pair scatters through a random medium.

  5. Robust IR-based detection of stable and fractionally populated G-C(+) and A-T Hoogsteen base pairs in duplex DNA.

    Science.gov (United States)

    Stelling, Allison L; Xu, Yu; Zhou, Huiqing; Choi, Seung H; Clay, Mary C; Merriman, Dawn K; Al-Hashimi, Hashim M

    2017-06-01

    Noncanonical G-C(+) and A-T Hoogsteen base pairs can form in duplex DNA and play roles in recognition, damage repair, and replication. Identifying Hoogsteen base pairs in DNA duplexes remains challenging due to difficulties in resolving syn versus antipurine bases with X-ray crystallography; and size limitations and line broadening can make them difficult to characterize by NMR spectroscopy. Here, we show how infrared (IR) spectroscopy can identify G-C(+) and A-T Hoogsteen base pairs in duplex DNA across a range of different structural contexts. The utility of IR-based detection of Hoogsteen base pairs is demonstrated by characterizing the first example of adjacent A-T and G-C(+) Hoogsteen base pairs in a DNA duplex where severe broadening complicates detection with NMR. © 2017 Federation of European Biochemical Societies.

  6. Calculating Distortions of Short DNA Duplexes with Base Pairing Between an Oxidatively Damaged Guanine and a Guanine

    Directory of Open Access Journals (Sweden)

    Masayo Suzuki

    2014-07-01

    Full Text Available DNA is constantly being oxidized, and oxidized DNA is prone to mutation; moreover, guanine is highly sensitive to several oxidative stressors. Several oxidatively damaged forms of guanine—including 2,2,4-triamino-5(2H-oxazolone (Oz, iminoallantoin (Ia, and spiroiminodihydantoin (Sp—can be paired with guanine, and cause G:C-C:G transversions. Previous findings indicate that guanine is incorporated more efficiently opposite Oz than opposite Ia or Sp, and that these differences in efficiency cannot be explained by differences in the stabilities of G:Oz, G:Ia, and G:Sp base pairs calculated ab initio. Here, to explain previous experimental result, we used a 3-base-pair model DNA duplex to calculate the difference in the stability and the distortion of DNA containing a G:Oz, G:Ia, or G:Sp base pair. We found that the stability of the structure containing 5ꞌ and 3ꞌ base pairs adjacent to G:Oz was more stable than that containing the respective base pairs adjacent to G:Ia or G:Sp. Moreover, the distortion of the structure in the DNA model duplex that contained a G:Oz was smaller than that containing a G:Ia or G:Sp. Therefore, our discussion can explain the previous results involving translesion synthesis past an oxidatively damaged guanine.

  7. Deep RNA sequencing at single base-pair resolution reveals high complexity of the rice transcriptome

    DEFF Research Database (Denmark)

    Zhang, Guojie; Guo, Guangwu; Hu, Xueda

    2010-01-01

    Understanding the dynamics of eukaryotic transcriptome is essential for studying the complexity of transcriptional regulation and its impact on phenotype. However, comprehensive studies of transcriptomes at single base resolution are rare, even for modern organisms, and lacking for rice. Here, we...... present the first transcriptome atlas for eight organs of cultivated rice. Using high-throughput paired-end RNA-seq, we unambiguously detected transcripts expressing at an extremely low level, as well as a substantial number of novel transcripts, exons, and untranslated regions. An analysis of alternative...... splicing in the rice transcriptome revealed that alternative cis-splicing occurred in approximately 33% of all rice genes. This is far more than previously reported. In addition, we also identified 234 putative chimeric transcripts that seem to be produced by trans-splicing, indicating that transcript...

  8. Chemistry of stannylene-based Lewis pairs: dynamic tin coordination switching between donor and acceptor character.

    Science.gov (United States)

    Krebs, Kilian M; Freitag, Sarah; Schubert, Hartmut; Gerke, Birgit; Pöttgen, Rainer; Wesemann, Lars

    2015-03-16

    The coordination chemistry of cyclic stannylene-based intramolecular Lewis pairs is presented. The P→Sn adducts were treated with [Ni(COD)2] and [Pd(PCy3)2] (COD = 1,5-cyclooctadiene, PCy3 = tricyclohexylphosphine). In the isolated coordination compounds the stannylene moiety acts either as an acceptor or a donor ligand. Examples of a dynamic switch between these two coordination modes of the P-Sn ligand are illustrated and the structures in the solid state together with heteronuclear NMR spectroscopic findings are discussed. In the case of a Ni(0) complex, (119)Sn Mössbauer spectroscopy of the uncoordinated and coordinated phosphastannirane ligand is presented. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  9. A bilinear pairing based anonymous authentication scheme in wireless body area networks for mHealth.

    Science.gov (United States)

    Jiang, Qi; Lian, Xinxin; Yang, Chao; Ma, Jianfeng; Tian, Youliang; Yang, Yuanyuan

    2016-11-01

    Wireless body area networks (WBANs) have become one of the key components of mobile health (mHealth) which provides 24/7 health monitoring service and greatly improves the quality and efficiency of healthcare. However, users' concern about the security and privacy of their health information has become one of the major obstacles that impede the wide adoption of WBANs. Anonymous and unlinkable authentication is critical to protect the security and privacy of sensitive physiological information in transit from the client to the application provider. We first show that the anonymous authentication scheme of Wang and Zhang based on bilinear pairing is prone to client impersonation attack. Then, we propose an enhanced anonymous authentication scheme to remedy the flaw in Wang and Zhang's scheme. We give the security analysis to demonstrate that the enhanced scheme achieves the desired security features and withstands various known attacks.

  10. High-speed true random number generation based on paired memristors for security electronics

    Science.gov (United States)

    Zhang, Teng; Yin, Minghui; Xu, Changmin; Lu, Xiayan; Sun, Xinhao; Yang, Yuchao; Huang, Ru

    2017-11-01

    True random number generator (TRNG) is a critical component in hardware security that is increasingly important in the era of mobile computing and internet of things. Here we demonstrate a TRNG using intrinsic variation of memristors as a natural source of entropy that is otherwise undesirable in most applications. The random bits were produced by cyclically switching a pair of tantalum oxide based memristors and comparing their resistance values in the off state, taking advantage of the more pronounced resistance variation compared with that in the on state. Using an alternating read scheme in the designed TRNG circuit, the unbiasedness of the random numbers was significantly improved, and the bitstream passed standard randomness tests. The Pt/TaO x /Ta memristors fabricated in this work have fast programming/erasing speeds of ∼30 ns, suggesting a high random number throughput. The approach proposed here thus holds great promise for physically-implemented random number generation.

  11. Wavelet transform based on the optimal wavelet pairs for tunable diode laser absorption spectroscopy signal processing.

    Science.gov (United States)

    Li, Jingsong; Yu, Benli; Fischer, Horst

    2015-04-01

    This paper presents a novel methodology-based discrete wavelet transform (DWT) and the choice of the optimal wavelet pairs to adaptively process tunable diode laser absorption spectroscopy (TDLAS) spectra for quantitative analysis, such as molecular spectroscopy and trace gas detection. The proposed methodology aims to construct an optimal calibration model for a TDLAS spectrum, regardless of its background structural characteristics, thus facilitating the application of TDLAS as a powerful tool for analytical chemistry. The performance of the proposed method is verified using analysis of both synthetic and observed signals, characterized with different noise levels and baseline drift. In terms of fitting precision and signal-to-noise ratio, both have been improved significantly using the proposed method.

  12. Quantifying Magnetic Sensitivity of Radical Pair Based Compass by Quantum Fisher Information.

    Science.gov (United States)

    Guo, Li-Sha; Xu, Bao-Ming; Zou, Jian; Shao, Bin

    2017-07-19

    The radical pair (RP) based compass is considered as one of the principal models of avian magnetoreception. Different from the conventional approach where the sensitivity of RP based compass is described by the singlet yield, we introduce the quantum Fisher information (QFI), which represents the maximum information about the magnetic field's direction extracted from the RP state, to quantify the sensitivity of RP based compass. The consistency between our results and experimental observations suggests that the QFI may serve as a measure to describe the sensitivity of RP based compass. Besides, within the framework of quantum metrology, we give two specific possible measurement schemes and find that the conventional singlet yield is corresponding to the measurement of total angular momentum. Moreover, we show that the measurement of fluctuation of the total magnetic moment is much more accurate than the singlet yield measurement, and is close to the optimal measurement scheme. Finally, the effects of entanglement and decoherence are also discussed in the spirit of our approach.

  13. Observation of NanoDNA Liquid Crystal Phases from Four Base Pair Duplexes at Subambient Temperatures

    Science.gov (United States)

    Smith, Gregory; Fraccia, Tommaso; Bellini, Tommaso; Walba, David; Clark, Noel

    2014-03-01

    Based upon conventional Onsager model considerations, liquid crystal (LC) formation in DNA-water mixtures was originally thought to be impossible for DNA polymers of very short length (discovery of chiral nematic (N*), columnar CU and C2 LC phases in NanoDNA oligomers as short as 6 bases in length and have since described additional LC phases involving DNA with random sequences and various blunt or sticky-end duplex architecture, all in the regime of motif where hydrophobic forces or hydrogen bond mediated base-pairing enable unusually short polymers to stack into functionally longer units that permit them to exhibit LC phase behavior. We report now the existence of LC phases of ultra short duplexed NanoDNA, 4 bases in length, in blunt-end, sticky-end and random sequence configurations, all observed at temperatures of ~ 5 °C and not stable >13-15 °C. These oligomers demonstrate an unusual wealth of phase behavior, including the typical N*, CU and C2 phases as well as higher order dark and bright phases, including what we believe to be a Blue Phase. Grant support: NSF DMR 1207606 and NSF MRSEC DMR 0820579.

  14. miRNA-dis: microRNA precursor identification based on distance structure status pairs.

    Science.gov (United States)

    Liu, Bin; Fang, Longyun; Chen, Junjie; Liu, Fule; Wang, Xiaolong

    2015-04-01

    MicroRNA precursor identification is an important task in bioinformatics. Support Vector Machine (SVM) is one of the most effective machine learning methods used in this field. The performance of SVM-based methods depends on the vector representations of RNAs. However, the discriminative power of the existing feature vectors is limited, and many methods lack an interpretable model for analysis of characteristic sequence features. Prior studies have demonstrated that sequence or structure order effects were relevant for discrimination, but little work has explored how to use this kind of information for human pre-microRNA identification. In this study, in order to incorporate the structure-order information into the prediction, a method called "miRNA-dis" was proposed, in which the feature vector was constructed by the occurrence frequency of the "distance structure status pair" or just the "distance-pair". Rigorous cross-validations on a much larger and more stringent newly constructed benchmark dataset showed that the miRNA-dis outperformed some state-of-the-art predictors in this area. Remarkably, miRNA-dis trained with human data can correctly predict 87.02% of the 4022 pre-miRNAs from 11 different species ranging from animals, plants and viruses. miRNA-dis would be a useful high throughput tool for large-scale analysis of microRNA precursors. In addition, the learnt model can be easily analyzed in terms of discriminative features, and some interesting patterns were discovered, which could reflect the characteristics of microRNAs. A user-friendly web-server of miRNA-dis was constructed, which is freely accessible to the public at the web-site on http://bioinformatics.hitsz.edu.cn/miRNA-dis/.

  15. Prediction of contact residue pairs based on co-substitution between sites in protein structures.

    Directory of Open Access Journals (Sweden)

    Sanzo Miyazawa

    Full Text Available Residue-residue interactions that fold a protein into a unique three-dimensional structure and make it play a specific function impose structural and functional constraints in varying degrees on each residue site. Selective constraints on residue sites are recorded in amino acid orders in homologous sequences and also in the evolutionary trace of amino acid substitutions. A challenge is to extract direct dependences between residue sites by removing phylogenetic correlations and indirect dependences through other residues within a protein or even through other molecules. Rapid growth of protein families with unknown folds requires an accurate de novo prediction method for protein structure. Recent attempts of disentangling direct from indirect dependences of amino acid types between residue positions in multiple sequence alignments have revealed that inferred residue-residue proximities can be sufficient information to predict a protein fold without the use of known three-dimensional structures. Here, we propose an alternative method of inferring coevolving site pairs from concurrent and compensatory substitutions between sites in each branch of a phylogenetic tree. Substitution probability and physico-chemical changes (volume, charge, hydrogen-bonding capability, and others accompanied by substitutions at each site in each branch of a phylogenetic tree are estimated with the likelihood of each substitution, and their direct correlations between sites are used to detect concurrent and compensatory substitutions. In order to extract direct dependences between sites, partial correlation coefficients of the characteristic changes along branches between sites, in which linear multiple dependences on feature vectors at other sites are removed, are calculated and used to rank coevolving site pairs. Accuracy of contact prediction based on the present coevolution score is comparable to that achieved by a maximum entropy model of protein sequences for 15

  16. biobambam: tools for read pair collation based algorithms on BAM files

    Science.gov (United States)

    2014-01-01

    Background Sequence alignment data is often ordered by coordinate (id of the reference sequence plus position on the sequence where the fragment was mapped) when stored in BAM files, as this simplifies the extraction of variants between the mapped data and the reference or of variants within the mapped data. In this order paired reads are usually separated in the file, which complicates some other applications like duplicate marking or conversion to the FastQ format which require to access the full information of the pairs. Results In this paper we introduce biobambam, a set of tools based on the efficient collation of alignments in BAM files by read name. The employed collation algorithm avoids time and space consuming sorting of alignments by read name where this is possible without using more than a specified amount of main memory. Using this algorithm tasks like duplicate marking in BAM files and conversion of BAM files to the FastQ format can be performed very efficiently with limited resources. We also make the collation algorithm available in the form of an API for other projects. This API is part of the libmaus package. Conclusions In comparison with previous approaches to problems involving the collation of alignments by read name like the BAM to FastQ or duplication marking utilities our approach can often perform an equivalent task more efficiently in terms of the required main memory and run-time. Our BAM to FastQ conversion is faster than all widely known alternatives including Picard and bamUtil. Our duplicate marking is about as fast as the closest competitor bamUtil for small data sets and faster than all known alternatives on large and complex data sets.

  17. Novel H+-Ion Sensor Based on a Gated Lateral BJT Pair

    Science.gov (United States)

    Yuan, Heng; Zhang, Jixing; Cao, Chuangui; Zhang, Gangyuan; Zhang, Shaoda

    2015-01-01

    An H+-ion sensor based on a gated lateral bipolar junction transistor (BJT) pair that can operate without the classical reference electrode is proposed. The device is a special type of ion-sensitive field-effect transistor (ISFET). Classical ISFETs have the advantage of miniaturization, but  they are difficult to fabricate by a single fabrication process because of the bulky and brittle reference electrode materials. Moreover, the reference electrodes need to be separated from the sensor device in some cases. The proposed device is composed of two gated lateral BJT components, one of which had a silicide layer while the other was without the layer. The two components were operated under the metal-oxide semiconductor field-effect transistor (MOSFET)-BJT hybrid mode, which can be controlled by emitter voltage and base current. Buffer solutions with different pH values were used as the sensing targets to verify the characteristics of the proposed device. Owing to their different sensitivities, both components could simultaneously detect the H+-ion concentration and function as a reference to each other. Per the experimental results, the sensitivity of the proposed device was found to be approximately 0.175 μA/pH. This experiment demonstrates enormous potential to lower the cost of the ISFET-based sensor technology. PMID:26703625

  18. Novel H+-Ion Sensor Based on a Gated Lateral BJT Pair

    Directory of Open Access Journals (Sweden)

    Heng Yuan

    2015-12-01

    Full Text Available An H+-ion sensor based on a gated lateral bipolar junction transistor (BJT pair that can operate without the classical reference electrode is proposed. The device is a special type of ion-sensitive field-effect transistor (ISFET. Classical ISFETs have the advantage of miniaturization, but  they are difficult to fabricate by a single fabrication process because of the bulky and brittle reference electrode materials. Moreover, the reference electrodes need to be separated from the sensor device in some cases. The proposed device is composed of two gated lateral BJT components, one of which had a silicide layer while the other was without the layer. The two components were operated under the metal-oxide semiconductor field-effect transistor (MOSFET-BJT hybrid mode, which can be controlled by emitter voltage and base current. Buffer solutions with different pH values were used as the sensing targets to verify the characteristics of the proposed device. Owing to their different sensitivities, both components could simultaneously detect the H+-ion concentration and function as a reference to each other. Per the experimental results, the sensitivity of the proposed device was found to be approximately 0.175 μA/pH. This experiment demonstrates enormous potential to lower the cost of the ISFET-based sensor technology.

  19. Novel H⁺-Ion Sensor Based on a Gated Lateral BJT Pair.

    Science.gov (United States)

    Yuan, Heng; Zhang, Jixing; Cao, Chuangui; Zhang, Gangyuan; Zhang, Shaoda

    2015-12-23

    An H⁺-ion sensor based on a gated lateral bipolar junction transistor (BJT) pair that can operate without the classical reference electrode is proposed. The device is a special type of ion-sensitive field-effect transistor (ISFET). Classical ISFETs have the advantage of miniaturization, but  they are difficult to fabricate by a single fabrication process because of the bulky and brittle reference electrode materials. Moreover, the reference electrodes need to be separated from the sensor device in some cases. The proposed device is composed of two gated lateral BJT components, one of which had a silicide layer while the other was without the layer. The two components were operated under the metal-oxide semiconductor field-effect transistor (MOSFET)-BJT hybrid mode, which can be controlled by emitter voltage and base current. Buffer solutions with different pH values were used as the sensing targets to verify the characteristics of the proposed device. Owing to their different sensitivities, both components could simultaneously detect the H⁺-ion concentration and function as a reference to each other. Per the experimental results, the sensitivity of the proposed device was found to be approximately 0.175 μA/pH. This experiment demonstrates enormous potential to lower the cost of the ISFET-based sensor technology.

  20. A provably secure identity-based strong designated verifier proxy signature scheme from bilinear pairings

    Directory of Open Access Journals (Sweden)

    SK Hafizul Islam

    2014-01-01

    Full Text Available The proxy signature, a variant of the ordinary digital signature, has been an active research topic in recent years; it has many useful applications, including distributed systems and grid computing. Although many identity-based proxy signature schemes have been proposed in the literature, only a few proposals for identity-based strong designated verifier proxy signature (ID-SDVPS schemes are available. However, it has been found that most of the ID-SDVPS schemes that have been proposed to date are not efficient in terms of computation and security, and a computationally efficient and secured ID-SDVPS scheme using elliptic curve bilinear pairing has been proposed in this paper. The security of the scheme is mainly based on the hardness assumption of CDH and GBDH problems in the random oracle model, which is existentially unforgeable against different types of adversaries. Furthermore, the security of our scheme is simulated in the AVISPA (Automated Validation of Internet Security Protocols and Applications software, a widely used automated internet protocol validation tool, and the simulation results confirm strong security against both active and passive attacks. In addition, because of a high processing capability and supporting additional security features, the scheme is suitable for the environments in which less computational cost with strong security is required.

  1. Current Hormonal Contraceptive Use Predicts Female Extra-Pair and Dyadic Sexual Behavior: Evidence Based on Czech National Survey Data

    Directory of Open Access Journals (Sweden)

    Kateřina Klapilová

    2014-01-01

    Full Text Available Data from 1155 Czech women (493 using oral contraception, 662 non-users, obtained from the Czech National Survey of Sexual Behavior, were used to investigate evolutionary-based hypotheses concerning the predictive value of current oral contraceptive (OC use on extra-pair and dyadic (in-pair sexual behavior of coupled women. Specifically, the aim was to determine whether current OC use was associated with lower extra-pair and higher in-pair sexual interest and behavior, because OC use suppresses cyclical shifts in mating psychology that occur in normally cycling women. Zero-inflated Poisson (ZIP regression and negative binomial models were used to test associations between OC use and these sexual measures, controlling for other relevant predictors (e.g., age, parity, in-pair sexual satisfaction, relationship length. The overall incidence of having had an extra-pair partner or one-night stand in the previous year was not related to current OC use (the majority of the sample had not. However, among the women who had engaged in extra-pair sexual behavior, OC users had fewer one-night stands than non-users, and tended to have fewer partners, than non-users. OC users also had more frequent dyadic intercourse than non-users, potentially indicating higher commitment to their current relationship. These results suggest that suppression of fertility through OC use may alter important aspects of female sexual behavior, with potential implications for relationship functioning and stability.

  2. Current hormonal contraceptive use predicts female extra-pair and dyadic sexual behavior: evidence based on Czech National Survey data.

    Science.gov (United States)

    Klapilová, Kateřina; Cobey, Kelly D; Wells, Timothy; Roberts, S Craig; Weiss, Petr; Havlíček, Jan

    2014-01-10

    Data from 1155 Czech women (493 using oral contraception, 662 non-users), obtained from the Czech National Survey of Sexual Behavior, were used to investigate evolutionary-based hypotheses concerning the predictive value of current oral contraceptive (OC) use on extra-pair and dyadic (in-pair) sexual behavior of coupled women. Specifically, the aim was to determine whether current OC use was associated with lower extra-pair and higher in-pair sexual interest and behavior, because OC use suppresses cyclical shifts in mating psychology that occur in normally cycling women. Zero-inflated Poisson (ZIP) regression and negative binomial models were used to test associations between OC use and these sexual measures, controlling for other relevant predictors (e.g., age, parity, in-pair sexual satisfaction, relationship length). The overall incidence of having had an extra-pair partner or one-night stand in the previous year was not related to current OC use (the majority of the sample had not). However, among the women who had engaged in extra-pair sexual behavior, OC users had fewer one-night stands than non-users, and tended to have fewer partners, than non-users. OC users also had more frequent dyadic intercourse than non-users, potentially indicating higher commitment to their current relationship. These results suggest that suppression of fertility through OC use may alter important aspects of female sexual behavior, with potential implications for relationship functioning and stability.

  3. An entropy-based improved k-top scoring pairs (TSP) method for ...

    African Journals Online (AJOL)

    DR. NJ TONUKARI

    2012-06-05

    Jun 5, 2012 ... Engineering of the Ministry of Education, Changdhun 130012, People's Republic of China. 2Supercomputing Center ... disjoint top scoring pairs of genes as decision rules rather than only the highest pair and both ..... including C4.5 decision trees (DT), Naive Bayes (NB), k-nearest neighbor (k-NN), support ...

  4. Crystal structure of a 14 bp RNA duplex with non-symmetrical tandem GxU wobble base pairs.

    Science.gov (United States)

    Trikha, J; Filman, D J; Hogle, J M

    1999-01-01

    Adjacent GxU wobble base pairs are frequently found in rRNA. Atomic structures of small RNA motifs help to provide a better understanding of the effects of various tandem mismatches on duplex structure and stability, thereby providing better rules for RNA structure prediction and validation. The crystal structure of an RNA duplex containing the sequence r(GGUAUUGC-GGUACC)2 has been solved at 2.1 A resolution using experimental phases. Novel refinement strategies were needed for building the correct solvent model. At present, this is the only short RNA duplex structure containing 5'-U-U-3'/3'-G-G-5' non-symmetric tandem GxU wobble base pairs. In the 14mer duplex, the six central base pairs are all displaced away from the helix axis, yielding significant changes in local backbone conformation, helix parameters and charge distribution that may provide specific recognition sites for biologically relevant ligand binding. The greatest deviations from A-form helix occur where the guanine of a wobble base pair stacks over a purine from the opposite strand. In this vicinity, the intra-strand phosphate distances increase significantly, and the major groove width increases up to 3 A. Structural comparisons with other short duplexes containing symmetrical tandem GxU or GxT wobble base pairs show that nearest-neighbor sequence dependencies govern helical twist and the occurrence of cross-strand purine stacks. PMID:10076005

  5. A Novel Clustering Model Based on Set Pair Analysis for the Energy Consumption Forecast in China

    Directory of Open Access Journals (Sweden)

    Mingwu Wang

    2014-01-01

    Full Text Available The energy consumption forecast is important for the decision-making of national economic and energy policies. But it is a complex and uncertainty system problem affected by the outer environment and various uncertainty factors. Herein, a novel clustering model based on set pair analysis (SPA was introduced to analyze and predict energy consumption. The annual dynamic relative indicator (DRI of historical energy consumption was adopted to conduct a cluster analysis with Fisher’s optimal partition method. Combined with indicator weights, group centroids of DRIs for influence factors were transferred into aggregating connection numbers in order to interpret uncertainty by identity-discrepancy-contrary (IDC analysis. Moreover, a forecasting model based on similarity to group centroid was discussed to forecast energy consumption of a certain year on the basis of measured values of influence factors. Finally, a case study predicting China’s future energy consumption as well as comparison with the grey method was conducted to confirm the reliability and validity of the model. The results indicate that the method presented here is more feasible and easier to use and can interpret certainty and uncertainty of development speed of energy consumption and influence factors as a whole.

  6. Ion pair dissociation effects of aza-based anion receptors on lithium salts in polymer electrolytes

    Energy Technology Data Exchange (ETDEWEB)

    Yang, X.Q.; Lee, H.S.; Xiang, C.; McBreen, J. [Brookhaven National Lab., Upton, NY (United States); Choi, L.S. [Naval Research Lab., Washington, DC (United States); Okamoto, Y. [Polytechnic Univ., Brooklyn, NY (United States)

    1996-12-31

    The addition of aza-based anion receptors greatly increases the conductivity of polymer electrolytes based on LiCl and KI complexes with poly(ethylene oxide) (PEO). In some cases the conductivity increase is more than two orders of magnitude. Also the addition of the anion acceptors imparts a rubber like consistency to the normally stiff PEO salt films. Ion-ion, ion-polymer and anion-complex interactions were studied using Near Edge X-ray Absorption Fine Structure (NEXAFS) spectroscopy at the K and Cl K edges and at the I L{sub I} edge. The NEXAFS results show that Cl{sup {minus}} and I{sup {minus}} anions are complexed with the nitrogen groups of the anion receptors. The degree of complexation is related the chain length of the complexing agent and the number of R{double_bond}CF{sub 3}SO{sub 2} groups that are used to substitute for the amine hydrogen atoms in these aza-ether compounds. NEXAFS spectra at potassium K edge provide supplemental evidence for the ion pair dissociation effects of the anion receptors. The results show that dissociated K{sup +} cations are complexed with oxygen atoms of the PEO chains.

  7. Automatic detection of conserved base pairing patterns in RNA virus genomes.

    Science.gov (United States)

    Hofacker, I L; Stadler, P F

    1999-06-15

    Almost all RNA molecules--and consequently also almost all subsequences of a large RNA molecule-form secondary structures. The presence of secondary structure in itself therefore does not indicate any functional significance. In fact, we cannot expect a conserved secondary structure for all parts of a viral genome or a mRNA, even if there is a significant level of sequence conservation. We present a novel method for detecting conserved RNA secondary structures in a family of related RNA sequences. The method is based on combining the prediction of base pair probability matrices and comparative sequence analysis. It can be applied to small sets of long sequences and does not require a prior knowledge of conserved sequence or structure motifs. As such it can be used to scan large amounts of sequence data for regions that warrant further experimental investigation. Applications to complete genomic RNAs of some viruses show that in all cases the known secondary structure features are identified. In addition, we predict a substantial number of conserved structural elements which have not been described so far.

  8. Pairing symmetries of several iron-based superconductor families and some similarities with cuprates and heavy-fermions

    Directory of Open Access Journals (Sweden)

    Das Tanmoy

    2012-03-01

    Full Text Available We show that, by using the unit-cell transformation between 1 Fe per unit cell to 2 Fe per unit cell, one can qualitatively understand the pairing symmetry of several families of iron-based superconductors. In iron-pnictides and iron-chalcogenides, the nodeless s±-pairing and the resulting magnetic resonance mode transform nicely between the two unit cells, while retaining all physical properties unchanged. However, when the electron-pocket disappears from the Fermi surface with complete doping in KFe2As2, we find that the unit-cell invariant requirement prohibits the occurrence of s±-pairing symmetry (caused by inter-hole-pocket nesting. However, the intra-pocket nesting is compatible here, which leads to a nodal d-wave pairing. The corresponding Fermi surface topology and the pairing symmetry are similar to Ce-based heavy-fermion superconductors. Furthermore, when the Fermi surface hosts only electron-pockets in KyFe2-xSe2, the inter-electron-pocket nesting induces a nodeless and isotropic d-wave pairing. This situation is analogous to the electron-doped cuprates, where the strong antiferromagnetic order creates similar disconnected electron-pocket Fermi surface, and hence nodeless d-wave pairing appears. The unit-cell transformation in KyFe2-xSe2 exhibits that the d-wave pairing breaks the translational symmetry of the 2 Fe unit cell, and thus cannot be realized unless a vacancy ordering forms to compensate for it. These results are consistent with the coexistence picture of a competing order and nodeless d-wave superconductivity in both cuprates and KyFe1.6Se2.

  9. DNA base pair resolution measurements using resonance energy transfer efficiency in lanthanide doped nanoparticles.

    Directory of Open Access Journals (Sweden)

    Aleksandra Delplanque

    Full Text Available Lanthanide-doped nanoparticles are of considerable interest for biodetection and bioimaging techniques thanks to their unique chemical and optical properties. As a sensitive luminescence material, they can be used as (bio probes in Förster Resonance Energy Transfer (FRET where trivalent lanthanide ions (La3+ act as energy donors. In this paper we present an efficient method to transfer ultrasmall (ca. 8 nm NaYF4 nanoparticles dispersed in organic solvent to an aqueous solution via oxidation of the oleic acid ligand. Nanoparticles were then functionalized with single strand DNA oligomers (ssDNA by inducing covalent bonds between surface carboxylic groups and a 5' amine modified-ssDNA. Hybridization with the 5' fluorophore (Cy5 modified complementary ssDNA strand demonstrated the specificity of binding and allowed the fine control over the distance between Eu3+ ions doped nanoparticle and the fluorophore by varying the number of the dsDNA base pairs. First, our results confirmed nonradiative resonance energy transfer and demonstrate the dependence of its efficiency on the distance between the donor (Eu3+ and the acceptor (Cy5 with sensitivity at a nanometre scale.

  10. Genome Filtering Using Methylation- Sensitive Restriction Enzymes with Six Base Pair Recognition Sites

    Directory of Open Access Journals (Sweden)

    John P. Fellers

    2008-11-01

    Full Text Available The large fraction of repetitive DNA in many plant genomes has complicated all aspects of DNA sequencing and assembly, and thus techniques that enrich for genes and low-copy sequences have been employed to isolate gene space. Methyl-sensitive restriction enzymes, with six base pair recognition sites, were evaluated on genomic DNA of the bread wheat ‘Chinese Spring’ as a different approach to enrich for genes. I, I, I, and II were used to digest wheat genomic DNA and fragments ranging from 400 bp to 2.0 kb were cloned and unidirectionally sequenced. All four enzymes provided some level of enrichment for gene space; however, II and I reduced the number of clones with repeat elements to just 16.2 and 19.1%, respectively. II and I were also effective in enrichment in corn and tobacco. Corn libraries made with II and I had 58.7 and 71.2%, respectively, of the clones with significant expressed sequence tag (EST alignments, while tobacco libraries made with the same enzymes had 51.7 and 65.3%, respectively. With the development of ultra-throughput sequencing technologies, this technique provides an opportunity to rapidly and efficiently obtain sequencing from gene-rich regions.

  11. Self-Similarity Based Corresponding-Point Extraction from Weakly Textured Stereo Pairs

    Directory of Open Access Journals (Sweden)

    Min Mao

    2014-01-01

    Full Text Available For the areas of low textured in image pairs, there is nearly no point that can be detected by traditional methods. The information in these areas will not be extracted by classical interest-point detectors. In this paper, a novel weakly textured point detection method is presented. The points with weakly textured characteristic are detected by the symmetry concept. The proposed approach considers the gray variability of the weakly textured local regions. The detection mechanism can be separated into three steps: region-similarity computation, candidate point searching, and refinement of weakly textured point set. The mechanism of radius scale selection and texture strength conception are used in the second step and the third step, respectively. The matching algorithm based on sparse representation (SRM is used for matching the detected points in different images. The results obtained on image sets with different objects show high robustness of the method to background and intraclass variations as well as to different photometric and geometric transformations; the points detected by this method are also the complement of points detected by classical detectors from the literature. And we also verify the efficacy of SRM by comparing with classical algorithms under the occlusion and corruption situations for matching the weakly textured points. Experiments demonstrate the effectiveness of the proposed weakly textured point detection algorithm.

  12. Combining Accuracy and Efficiency: An Incremental Focal-Point Method Based on Pair Natural Orbitals.

    Science.gov (United States)

    Fiedler, Benjamin; Schmitz, Gunnar; Hättig, Christof; Friedrich, Joachim

    2017-12-12

    In this work, we present a new pair natural orbitals (PNO)-based incremental scheme to calculate CCSD(T) and CCSD(T0) reaction, interaction, and binding energies. We perform an extensive analysis, which shows small incremental errors similar to previous non-PNO calculations. Furthermore, slight PNO errors are obtained by using TPNO = TTNO with appropriate values of 10-7 to 10-8 for reactions and 10-8 for interaction or binding energies. The combination with the efficient MP2 focal-point approach yields chemical accuracy relative to the complete basis-set (CBS) limit. In this method, small basis sets (cc-pVDZ, def2-TZVP) for the CCSD(T) part are sufficient in case of reactions or interactions, while some larger ones (e.g., (aug)-cc-pVTZ) are necessary for molecular clusters. For these larger basis sets, we show the very high efficiency of our scheme. We obtain not only tremendous decreases of the wall times (i.e., factors >102) due to the parallelization of the increment calculations as well as of the total times due to the application of PNOs (i.e., compared to the normal incremental scheme) but also smaller total times with respect to the standard PNO method. That way, our new method features a perfect applicability by combining an excellent accuracy with a very high efficiency as well as the accessibility to larger systems due to the separation of the full computation into several small increments.

  13. Intercalation of a Zn(II) complex containing ciprofloxacin drug between DNA base pairs.

    Science.gov (United States)

    Shahabadi, Nahid; Asadian, Ali Ashraf; Mahdavi, Mryam

    2017-11-02

    In this study, an attempt has been made to study the interaction of a Zn(II) complex containing an antibiotic drug, ciprofloxacin, with calf thymus DNA using spectroscopic methods. It was found that Zn(II) complex could bind with DNA via intercalation mode as evidenced by: hyperchromism in UV-Vis spectrum; these spectral characteristics suggest that the Zn(II) complex interacts with DNA most likely through a mode that involves a stacking interaction between the aromatic chromophore and the base pairs of DNA. DNA binding constant (K b = 1.4 × 10 4 M -1 ) from spectrophotometric studies of the interaction of Zn(II) complex with DNA is comparable to those of some DNA intercalative polypyridyl Ru(II) complexes 1.0 -4.8 × 10 4 M -1 . CD study showed stabilization of the right-handed B form of DNA in the presence of Zn(II) complex as observed for the classical intercalator methylene blue. Thermodynamic parameters (ΔH DNA-MB, indicating that it binds to DNA in strong competition with MB for the intercalation.

  14. New imidazopyridopyrimidine:naphthyridine base-pairing motif, ImN(N):NaO(O), consisting of a DAAD:ADDA hydrogen bonding pattern, markedly stabilize DNA duplexes.

    Science.gov (United States)

    Kuramoto, Kazuyuki; Tarashima, Noriko; Hirama, Yasuyuki; Kikuchi, Yusaku; Minakawa, Noriaki; Matsuda, Akira

    2011-10-14

    The new imidazopyridopyrimidine:naphthyridine base-pairing motifs, ImO(O):NaN(N) and ImN(N):NaO(O), were designed. Among the base pairs examined, DNA duplexes containing ImN(N):NaO(O) pair(s) consisting of a DAAD:ADDA hydrogen bonding pattern (D = donor, A = acceptor) were markedly stabilized thermally and thermodynamically. This journal is © The Royal Society of Chemistry 2011

  15. Universal quantum gates for Single Cooper Pair Box based quantum computing

    Science.gov (United States)

    Echternach, P.; Williams, C. P.; Dultz, S. C.; Braunstein, S.; Dowling, J. P.

    2000-01-01

    We describe a method for achieving arbitrary 1-qubit gates and controlled-NOT gates within the context of the Single Cooper Pair Box (SCB) approach to quantum computing. Such gates are sufficient to support universal quantum computation.

  16. Neutron matter, neutron pairing, and neutron drops based on chiral effective field theory interactions

    Energy Technology Data Exchange (ETDEWEB)

    Krueger, Thomas

    2016-10-19

    calculate the pairing gaps in neutron matter and provide uncertainty estimates. The formation of heavy elements in the early universe proceeds through the rapid neutron-capture process. This process requires precise knowledge of the properties of very neutron-rich nuclei, which are unstable and at present not accessible in experiments. Thus, one can explore their properties only with theoretical calculations. Currently the only approach to the properties of all nuclei are energy-density functionals (EDFs). All EDFs used today are based on phenomenological models and fits to stable nuclei, which makes their predictive power for unknown (neutron-rich) nuclei unclear. Deriving an ab initio EDF directly from the nuclear forces is an important goal of nuclear theory. A promising approach is the optimised effective potential (OEP) method. We take a step into that direction and calculate neutron drops within the OEP formalism. In addition to the exact-exchange approximation we study for the first time the effect of second-order contributions and compare to quantum Monte Carlo and other results.

  17. Metal-semiconductor pair nanoparticles by a physical route based on bipolar mixing

    Science.gov (United States)

    Kala, Shubhra; Theissmann, Ralf; Rouenhoff, Marcel; Kruis, Frank Einar

    2016-03-01

    In this report a methodology is described and demonstrated for preparing Au-Ge pair nanoparticles with known compositions by extending and modifying the basic steps normally used to synthesize nanoparticles in carrier gas. For the formation of pair nanoparticles by bipolar mixing, two oppositely charged aerosols of nanoparticles having the desired size are produced with the help of two differential mobility analyzers. Then both are allowed to pass through a tube, which provides sufficient residence time to result in nanoparticle pair formation due to Brownian collisions influenced by Coulomb forces. The effect of residence time on the formation of nanoparticle pairs as well as the influence of diffusion and discharging is described. Subsequently, necessary modifications to the experimental setup are demonstrated systematically. The kinetics of nanoparticles pair formation in a carrier gas is also calculated and compared with measurements made with the help of an online aerosol size analysis technique. This synthesis of nanoparticle pairs can be seen as a possible route towards Janus-type nanoparticles.

  18. Estimation of the contribution of intrinsic currents to motoneuron firing based on paired motoneuron discharge records in the decerebrate cat.

    Science.gov (United States)

    Powers, Randall K; Nardelli, Paul; Cope, T C

    2008-07-01

    Motoneuron activation is strongly influenced by persistent inward currents (PICs) flowing through voltage-sensitive channels. PIC characteristics and their contribution to the control of motoneuron firing rate have been extensively described in reduced animal preparations, but their contribution to rate modulation in human motoneurons is controversial. It has recently been proposed that the analysis of discharge records of a simultaneously recorded pair of motor units can be used to make quantitative estimates of the PIC contribution, based on the assumption that the firing rate of an early recruited (reporter) unit can be used as a measure of the synaptic drive to a later recruited (test) unit. If the test unit's discharge is augmented by PICs, less synaptic drive will be required to sustain discharge than required to initially recruit it, and the difference in reporter unit discharge (Delta F) at test recruitment and de-recruitment is a measure of the size of the PIC contribution. We applied this analysis to discharge records of pairs of motoneurons in the decerebrate cat preparation, in which motoneuron PICs have been well-characterized and are known to be prominent. Mean Delta F values were positive in 58/63 pairs, and were significantly greater than zero in 40/63 pairs, as would be expected based on PIC characteristics recorded in this preparation. However, several lines of evidence suggest that the Delta F value obtained in a particular motoneuron pair may depend on a number of factors other than the PIC contribution to firing rate.

  19. Simulation-based investigation of the paired-gear method in cod-end selectivity studies

    DEFF Research Database (Denmark)

    Herrmann, Bent; Frandsen, Rikke; Holst, René

    2007-01-01

    -gear method is biased. We demonstrate that extreme parameter estimates as well as discrepancies between the paired-gear and covered cod-end experiments do not necessarily reflect physical or biological mechanisms. We believe that this phenomenon may help explain cases in the literature where the covered cod......In this paper, the paired-gear and covered cod-end methods for estimating the selectivity of trawl cod-ends are compared. A modified version of the cod-end selectivity simulator PRESEMO is used to simulate the data that would be collected from a paired-gear experiment where the test cod-end also...... had a small mesh cover. Thus, estimates of the selectivity parameters of the test cod-end can be made using both the paired-gear method and the covered cod-end method. These estimates are compared and, as it is assumed that the covered cod-end method is objective, we conclude that the paired...

  20. Comparison of Three Cre-LoxP Based Paired-End Library Construction Methods

    Energy Technology Data Exchange (ETDEWEB)

    Peng, Ze; Nath, Nandita; Tritt, Andrew; Liang, Shoudan; Han, James; Pennacchio, Len; Chen, Feng

    2013-03-26

    Paired-end library sequencing has been proven useful in scaffold construction during de novo whole genome shotgun assembly. The ability of generating mate pairs with > 8 Kb insert sizes is especially important for genomes containing long repeats. To make mate paired libraries for next generation sequencing, DNA fragments need to be circularized to bring the ends together. There are several methods that can be used for DNA circulation, namely ligation, hybridization and Cre-LoxP recombination. With higher circularization efficiency with large insert DNA fragments, Cre-LoxP recombination method generally has been used for constructing >8 kb insert size paired-end libraries. Second fragmentation step is also crucial for maintaining high library complexity and uniform genome coverage. Here we will describe the following three fragmentation methods: restriction enzyme digestion, random shearing and nick translation. We will present the comparison results for these three methods. Our data showed that all three methods are able to generate paired-end libraries with greater than 20 kb insert. Advantages and disadvantages of these three methods will be discussed as well.

  1. Mass renormalization and unconventional pairing in multi-band Fe-based superconductors- a phenomenological approach

    Energy Technology Data Exchange (ETDEWEB)

    Drechsler, S.L.; Efremov, D.; Grinenko, V. [IFW-Dresden (Germany); Johnston, S. [Inst. of Quantum Matter, University of British Coulumbia, Vancouver (Canada); Rosner, H. [MPI-cPfS, Dresden, (Germany); Kikoin, K. [Tel Aviv University (Israel)

    2015-07-01

    Combining DFT calculations of the density of states and plasma frequencies with experimental thermodynamic, optical, ARPES, and dHvA data taken from the literature, we estimate both the high-energy (Coulomb, Hund's rule coupling) and the low-energy (el-boson coupling) electronic mass renormalization [H(L)EMR] for typical Fe-pnictides with T{sub c}<40 K, focusing on (K,Rb,Cs)Fe{sub 2}As{sub 2}, (Ca,Na)122, (Ba,K)122, LiFeAs, and LaFeO{sub 1-x}F{sub x}As with and without As-vacancies. Using Eliashberg theory we show that these systems can NOT be described by a very strong el-boson coupling constant λ ≥ ∝ 2, being in conflict with the HEMR as seen by DMFT, ARPES and optics. Instead, an intermediate s{sub ±} coupling regime is realized, mainly based on interband spin fluctuations from one predominant pair of bands. For (Ca,Na)122, there is also a non-negligible intraband el-phonon/orbital fluctuation intraband contribution. The coexistence of magnetic As-vacancies and high-T{sub c}=28 K for LaFeO{sub 1-x}F{sub x}As{sub 1-δ} excludes an orbital fluctuation dominated s{sub ++} scenario at least for that system. In contrast, the line nodal BaFe{sub 2}(As,P){sub 2} near the quantum critical point is found as a superstrongly coupled system. The role of a pseudo-gap is briefly discussed for some of these systems.

  2. Identification of a two base pair deletion in five unrelated families with adrenoleukodystrophy: a possible hot spot for mutations

    NARCIS (Netherlands)

    Kemp, S.; Ligtenberg, M. J.; van Geel, B. M.; Barth, P. G.; Wolterman, R. A.; Schoute, F.; Sarde, C. O.; Mandel, J. L.; van Oost, B. A.; Bolhuis, P. A.

    1994-01-01

    The gene for X-linked adrenoleukodystrophy (ALD) was recently identified. Intragenic deletions of several kilobases were found in about 7% of patients. Point mutations, expected to be very heterogeneous, were identified so far in only two patients. We report the identification of a two base pair

  3. Geminal phosphorus/aluminum-based frustrated Lewis pairs: C-H versus C≡C activation and CO2 fixation

    NARCIS (Netherlands)

    Appelt, C.; Westenberg, H.; Bertini, F.; Ehlers, A.W.; Slootweg, J.C.; Lammertsma, K.; Uhl, W.

    2011-01-01

    Catch it! Geminal phosphorus/aluminum-based frustrated Lewis pairs (FLPs) are easily obtained by hydroalumination of alkynylphosphines. These FLPs can activate terminal acetylenes by two competitive pathways, which were analyzed by DFT calculations, and they can bind carbon dioxide reversibly.

  4. Transitions between Short-Term and Long-Term Memory in Learning Meaningful Unrelated Paired Associates Using Computer Based Drills.

    Science.gov (United States)

    Goldenberg, Tzvika Y.; Turnure, James E.

    1989-01-01

    Discussion of short-term and long-term memory in learning paired associates focuses on two microcomputer-based instructional design experiments with eleventh and twelfth graders that were modeled after traditional drill and practice routines. Research questions are presented, treatment conditions are explained, and additional research is…

  5. Construction of Pairing-Friendly Hyperelliptic Curves Based on the Closed Formulae of the Order of the Jacobian Group

    Science.gov (United States)

    Comuta, Aya; Kawazoe, Mitsuru; Takahashi, Tetsuya; Yoshizawa, Isamu

    An explicit construction of pairing-friendly hyperelliptic curves with ordinary Jacobians was firstly given by D. Freeman for the genus two case. In this paper, we give an explicit construction of pairing-friendly hyperelliptic curves of genus two and four with ordinary Jacobians based on the closed formulae for the order of the Jacobian of special hyperelliptic curves. For the case of genus two, we prove the closed formula for curves of type y2 = x5 + c. By using the formula, we develop an analogue of the Cocks-Pinch method for curves of type y2 = x5 + c. For the case of genus four, we also develop an analogue of the Cocks-Pinch method for curves of type y2 = x9 + cx. In particular, we construct the first examples of pairing-friendly hyperelliptic curves of genus four with ordinary Jacobians.

  6. Acceleration of Long-Range Photoinduced Electron Transfer through DNA by Hydroxyquinolines as Artificial Base Pairs.

    Science.gov (United States)

    Bätzner, Effi; Liang, Yu; Schweigert, Caroline; Unterreiner, Andreas-Neil; Wagenknecht, Hans-Achim

    2015-06-08

    The C-nucleoside based on the hydroxyquinoline ligand (Hq) is complementary to itself and forms stable Hq-Hq pairs in double-stranded DNA. These artificial Hq-Hq pairs may serve as artificial electron carriers for long-range photoinduced electron transfer in DNA, as elucidated by a combination of gel electrophoretic analysis of irradiated samples and time-resolved transient absorption spectroscopy. For this study, the Hq-Hq pair was combined with a DNA-based donor-acceptor system consisting of 6-N,N-dimethylaminopyrene conjugated to 2'-deoxyuridine as photoinducible electron donor, and methyl viologen attached to the 2'-position of uridine as electron acceptor. The Hq radical anion was identified in the time-resolved measurements and strand cleavage products support its role as an intermediate charge carrier. Hence, the Hq-Hq pair significantly enhances the electron hopping capability of DNA compared to natural DNA bases over long distances while keeping the self-assembly properties as the most attractive feature of DNA as a supramolecular architecture. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  7. Web Camera Based Eye Tracking to Assess Visual Memory on a Visual Paired Comparison Task

    Directory of Open Access Journals (Sweden)

    Nicholas T. Bott

    2017-06-01

    Full Text Available Background: Web cameras are increasingly part of the standard hardware of most smart devices. Eye movements can often provide a noninvasive “window on the brain,” and the recording of eye movements using web cameras is a burgeoning area of research.Objective: This study investigated a novel methodology for administering a visual paired comparison (VPC decisional task using a web camera.To further assess this method, we examined the correlation between a standard eye-tracking camera automated scoring procedure [obtaining images at 60 frames per second (FPS] and a manually scored procedure using a built-in laptop web camera (obtaining images at 3 FPS.Methods: This was an observational study of 54 clinically normal older adults.Subjects completed three in-clinic visits with simultaneous recording of eye movements on a VPC decision task by a standard eye tracker camera and a built-in laptop-based web camera. Inter-rater reliability was analyzed using Siegel and Castellan's kappa formula. Pearson correlations were used to investigate the correlation between VPC performance using a standard eye tracker camera and a built-in web camera.Results: Strong associations were observed on VPC mean novelty preference score between the 60 FPS eye tracker and 3 FPS built-in web camera at each of the three visits (r = 0.88–0.92. Inter-rater agreement of web camera scoring at each time point was high (κ = 0.81–0.88. There were strong relationships on VPC mean novelty preference score between 10, 5, and 3 FPS training sets (r = 0.88–0.94. Significantly fewer data quality issues were encountered using the built-in web camera.Conclusions: Human scoring of a VPC decisional task using a built-in laptop web camera correlated strongly with automated scoring of the same task using a standard high frame rate eye tracker camera.While this method is not suitable for eye tracking paradigms requiring the collection and analysis of fine-grained metrics, such as

  8. Investigations on therapeutic glucocerebrosidases through paired detection with fluorescent activity-based probes

    Science.gov (United States)

    Kallemeijn, Wouter W.; Scheij, Saskia; Hoogendoorn, Sascha; Witte, Martin D.; Herrera Moro Chao, Daniela; van Roomen, Cindy P. A. A.; Ottenhoff, Roelof; Overkleeft, Herman S.; Boot, Rolf G.; Aerts, Johannes M. F. G.

    2017-01-01

    Deficiency of glucocerebrosidase (GBA) causes Gaucher disease (GD). In the common non-neuronopathic GD type I variant, glucosylceramide accumulates primarily in the lysosomes of visceral macrophages. Supplementing storage cells with lacking enzyme is accomplished via chronic intravenous administration of recombinant GBA containing mannose-terminated N-linked glycans, mediating the selective uptake by macrophages expressing mannose-binding lectin(s). Two recombinant GBA preparations with distinct N-linked glycans are registered in Europe for treatment of type I GD: imiglucerase (Genzyme), contains predominantly Man(3) glycans, and velaglucerase (Shire PLC) Man(9) glycans. Activity-based probes (ABPs) enable fluorescent labeling of recombinant GBA preparations through their covalent attachment to the catalytic nucleophile E340 of GBA. We comparatively studied binding and uptake of ABP-labeled imiglucerase and velaglucerase in isolated dendritic cells, cultured human macrophages and living mice, through simultaneous detection of different GBAs by paired measurements. Uptake of ABP-labeled rGBAs by dendritic cells was comparable, as well as the bio-distribution following equimolar intravenous administration to mice. ABP-labeled rGBAs were recovered largely in liver, white-blood cells, bone marrow and spleen. Lungs, brain and skin, affected tissues in severe GD types II and III, were only poorly supplemented. Small, but significant differences were noted in binding and uptake of rGBAs in cultured human macrophages, in the absence and presence of mannan. Mannan-competed binding and uptake were largest for velaglucerase, when determined with single enzymes or as equimolar mixtures of both enzymes. Vice versa, imiglucerase showed more prominent binding and uptake not competed by mannan. Uptake of recombinant GBAs by cultured macrophages seems to involve multiple receptors, including several mannose-binding lectins. Differences among cells from different donors (n = 12

  9. Web Camera Based Eye Tracking to Assess Visual Memory on a Visual Paired Comparison Task.

    Science.gov (United States)

    Bott, Nicholas T; Lange, Alex; Rentz, Dorene; Buffalo, Elizabeth; Clopton, Paul; Zola, Stuart

    2017-01-01

    Background: Web cameras are increasingly part of the standard hardware of most smart devices. Eye movements can often provide a noninvasive "window on the brain," and the recording of eye movements using web cameras is a burgeoning area of research. Objective: This study investigated a novel methodology for administering a visual paired comparison (VPC) decisional task using a web camera.To further assess this method, we examined the correlation between a standard eye-tracking camera automated scoring procedure [obtaining images at 60 frames per second (FPS)] and a manually scored procedure using a built-in laptop web camera (obtaining images at 3 FPS). Methods: This was an observational study of 54 clinically normal older adults.Subjects completed three in-clinic visits with simultaneous recording of eye movements on a VPC decision task by a standard eye tracker camera and a built-in laptop-based web camera. Inter-rater reliability was analyzed using Siegel and Castellan's kappa formula. Pearson correlations were used to investigate the correlation between VPC performance using a standard eye tracker camera and a built-in web camera. Results: Strong associations were observed on VPC mean novelty preference score between the 60 FPS eye tracker and 3 FPS built-in web camera at each of the three visits (r = 0.88-0.92). Inter-rater agreement of web camera scoring at each time point was high (κ = 0.81-0.88). There were strong relationships on VPC mean novelty preference score between 10, 5, and 3 FPS training sets (r = 0.88-0.94). Significantly fewer data quality issues were encountered using the built-in web camera. Conclusions: Human scoring of a VPC decisional task using a built-in laptop web camera correlated strongly with automated scoring of the same task using a standard high frame rate eye tracker camera.While this method is not suitable for eye tracking paradigms requiring the collection and analysis of fine-grained metrics, such as fixation points, built

  10. Contact ion pair formation between hard acids and soft bases in aqueous solutions observed with 2DIR spectroscopy.

    Science.gov (United States)

    Sun, Zheng; Zhang, Wenkai; Ji, Minbiao; Hartsock, Robert; Gaffney, Kelly J

    2013-12-12

    The interaction of charged species in aqueous solution has important implications for chemical, biological, and environmental processes. We have used 2DIR spectroscopy to study the equilibrium dynamics of thiocyanate chemical exchange between free ion (NCS(-)) and contact ion pair configurations (MNCS(+)), where M(2+) = Mg(2+) or Ca(2+). Detailed studies of the influence of anion concentration and anion speciation show that the chemical exchange observed with the 2DIR measurements results from NCS(-) exchanging with other anion species in the first solvation shell surrounding Mg(2+) or Ca(2+). The presence of chemical exchange in the 2DIR spectra provides an indirect, but robust, determinant of contact ion pair formation. We observe preferential contact ion pair formation between soft Lewis base anions and hard Lewis acid cations. This observation cannot be easily reconciled with Pearson's acid-base concept or Collins' Law of Matching Water Affinities. The anions that form contact ion pairs also correspond to the ions with an affinity for water and protein surfaces, so similar physical and chemical properties may control these distinct phenomena.

  11. Eksperimentasi Model Pembelajaran Kooperatif Tipe Pairs Check (Pc), Think Pair Share (Tps), dan Problem Based Learning (Pbl) pada Materi Kubus dan Balok Ditinjau dari Gaya Belajar Siswa Kelas VIII SMP Negeri Se-kota Surakarta

    OpenAIRE

    Irawati, Suci; Budiyono, Budiyono; Slamet, Isnandar

    2015-01-01

    This study aimed at determining the effect of learning models on the learning achievement in Mathematics viewed from the students' Learning Style. The learning models compared were learning model Pairs Check (PC), Think Pair Share (TPS) and Problem Based Learning (PBL). This research was a quasi-experimental research with 3×3 factorial design. The population of research was all grade VIII students of Junior High School (SMP) in Surakarta. The samples were chosen by using stratified cluster ra...

  12. 4D Flexible Atom-Pairs: An efficient probabilistic conformational space comparison for ligand-based virtual screening

    Science.gov (United States)

    2011-01-01

    Background The performance of 3D-based virtual screening similarity functions is affected by the applied conformations of compounds. Therefore, the results of 3D approaches are often less robust than 2D approaches. The application of 3D methods on multiple conformer data sets normally reduces this weakness, but entails a significant computational overhead. Therefore, we developed a special conformational space encoding by means of Gaussian mixture models and a similarity function that operates on these models. The application of a model-based encoding allows an efficient comparison of the conformational space of compounds. Results Comparisons of our 4D flexible atom-pair approach with over 15 state-of-the-art 2D- and 3D-based virtual screening similarity functions on the 40 data sets of the Directory of Useful Decoys show a robust performance of our approach. Even 3D-based approaches that operate on multiple conformers yield inferior results. The 4D flexible atom-pair method achieves an averaged AUC value of 0.78 on the filtered Directory of Useful Decoys data sets. The best 2D- and 3D-based approaches of this study yield an AUC value of 0.74 and 0.72, respectively. As a result, the 4D flexible atom-pair approach achieves an average rank of 1.25 with respect to 15 other state-of-the-art similarity functions and four different evaluation metrics. Conclusions Our 4D method yields a robust performance on 40 pharmaceutically relevant targets. The conformational space encoding enables an efficient comparison of the conformational space. Therefore, the weakness of the 3D-based approaches on single conformations is circumvented. With over 100,000 similarity calculations on a single desktop CPU, the utilization of the 4D flexible atom-pair in real-world applications is feasible. PMID:21733172

  13. 4D Flexible Atom-Pairs: An efficient probabilistic conformational space comparison for ligand-based virtual screening

    Directory of Open Access Journals (Sweden)

    Jahn Andreas

    2011-07-01

    Full Text Available Abstract Background The performance of 3D-based virtual screening similarity functions is affected by the applied conformations of compounds. Therefore, the results of 3D approaches are often less robust than 2D approaches. The application of 3D methods on multiple conformer data sets normally reduces this weakness, but entails a significant computational overhead. Therefore, we developed a special conformational space encoding by means of Gaussian mixture models and a similarity function that operates on these models. The application of a model-based encoding allows an efficient comparison of the conformational space of compounds. Results Comparisons of our 4D flexible atom-pair approach with over 15 state-of-the-art 2D- and 3D-based virtual screening similarity functions on the 40 data sets of the Directory of Useful Decoys show a robust performance of our approach. Even 3D-based approaches that operate on multiple conformers yield inferior results. The 4D flexible atom-pair method achieves an averaged AUC value of 0.78 on the filtered Directory of Useful Decoys data sets. The best 2D- and 3D-based approaches of this study yield an AUC value of 0.74 and 0.72, respectively. As a result, the 4D flexible atom-pair approach achieves an average rank of 1.25 with respect to 15 other state-of-the-art similarity functions and four different evaluation metrics. Conclusions Our 4D method yields a robust performance on 40 pharmaceutically relevant targets. The conformational space encoding enables an efficient comparison of the conformational space. Therefore, the weakness of the 3D-based approaches on single conformations is circumvented. With over 100,000 similarity calculations on a single desktop CPU, the utilization of the 4D flexible atom-pair in real-world applications is feasible.

  14. A direct dynamics study of the deprotonated guanine·cytosine base pair: intra-base pair proton transfer, thermal dissociation vs. collision-induced dissociation, and comparison with experiment.

    Science.gov (United States)

    Liu, Jianbo

    2017-11-22

    Direct dynamics trajectories were calculated at the B3LYP/6-31G* level of theory to examine the intra-base pair proton transfer and dissociation of the deprotonated guanine (G)·cytosine (C) base pair under different excitation conditions, and to explore the origin of the nonstatistical product branching reported in a collision-induced dissociation (CID) experiment (Phys. Chem. Chem. Phys. 2016, 18, 32222). Trajectories for thermal excitation were initiated at two major conformers G·[C-H]- (hydrogen-bonded guanine and N1-deprotonated cytosine) and G·[C-H]-_PT (formed by proton transfer from the N1 of guanine to the N3 of deprotonated cytosine), and at their transition state (TS). Thermal excitation was realized by sampling molecular vibrational levels and TS's reaction coordinate energy with Boltzmann distributions at temperatures of 960 and 1330 K, which correspond to classical energies of 3.0 and 5.0 eV, respectively. Thermally excited trajectories undergo intra-base pair proton transfer extensively. The resulting conformation scrambling leads to nearly equal branching between the dissociation channels of [G-H]- + C and G + [C-H]-. Collisions of G·[C-H]- and G·[C-H]-_PT with Ar were each simulated at collision energies of 3.0 and 5.0 eV, respectively. The probability for intra-base pair proton transfer decreases substantially in collision trajectories. The CID product branching calculated on the basis of the population-weighted trajectory results of G·[C-H]- and G·[C-H]-_PT reveals a strong preference for [G-H]- + C, consistent with the experiment. Trajectory analysis corroborates that nonstatistical CID is attributed to inadequate conformation interconversion during collisional activation, and to the faster dissociation of the G·[C-H]-_PT conformer albeit G·[C-H]-_PT has nearly the same translational-to-vibrational energy transfer as G·[C-H]-.

  15. Structure and electronic properties of ion pairs accompanying cyclic morpholinium cation and alkylphosphite anion based ionic liquids

    Science.gov (United States)

    Verma, Prakash L.; Singh, Priti; Gejji, Shridhar P.

    2017-07-01

    Molecular insights for the formation of ion pairs accompanying the cyclic ammonium cation based room temperature ionic liquids (RTILs) composed of alkyl substituted N-methylmorpholinium (RMMor) and alkylphosphite [(Rsbnd O)2PHdbnd O] (Rdbnd ethyl, butyl, hexyl, octyl) anion have been derived from the M06-2x level of theory. Electronic structures, binding energies, and spectral characteristics of the ion pairs underlying these RTILs have been characterized. The ion pair formation is largely governed by Csbnd H⋯O and other intermolecular interactions. Calculated binding energies increase with the increasing alkyl chain on either cation or alkylphosphite anion. The cation-anion binding reveals signature in the frequency down-(red) shift of the characteristic anionic Pdbnd O stretching whereas the Psbnd H stretching exhibits a shift in the opposite direction in vibrational spectra which has further been rationalized through molecular electron density topography. Correlations of measured electrochemical stability with the separation of frontier orbital energies and binding energies in the ion pairs have further been established.

  16. A Subcarrier-Pair Based Resource Allocation Scheme Using Proportional Fairness for Cooperative OFDM-Based Cognitive Radio Networks

    Science.gov (United States)

    Ma, Yongtao; Zhou, Liuji; Liu, Kaihua

    2013-01-01

    The paper presents a joint subcarrier-pair based resource allocation algorithm in order to improve the efficiency and fairness of cooperative multiuser orthogonal frequency division multiplexing (MU-OFDM) cognitive radio (CR) systems. A communication model where one source node communicates with one destination node assisted by one half-duplex decode-and-forward (DF) relay is considered in the paper. An interference-limited environment is considered, with the constraint of transmitted sum-power over all channels and aggregate average interference towards multiple primary users (PUs). The proposed resource allocation algorithm is capable of maximizing both the system transmission efficiency and fairness among secondary users (SUs). Besides, the proposed algorithm can also keep the interference introduced to the PU bands below a threshold. A proportional fairness constraint is used to assure that each SU can achieve a required data rate, with quality of service guarantees. Moreover, we extend the analysis to the scenario where each cooperative SU has no channel state information (CSI) about non-adjacent links. We analyzed the throughput and fairness tradeoff in CR system. A detailed analysis of the performance of the proposed algorithm is presented with the simulation results. PMID:23939586

  17. A subcarrier-pair based resource allocation scheme using proportional fairness for cooperative OFDM-based cognitive radio networks.

    Science.gov (United States)

    Ma, Yongtao; Zhou, Liuji; Liu, Kaihua

    2013-08-09

    The paper presents a joint subcarrier-pair based resource allocation algorithm in order to improve the efficiency and fairness of cooperative multiuser orthogonal frequency division multiplexing (MU-OFDM) cognitive radio (CR) systems. A communication model where one source node communicates with one destination node assisted by one half-duplex decode-and-forward (DF) relay is considered in the paper. An interference-limited environment is considered, with the constraint of transmitted sum-power over all channels and aggregate average interference towards multiple primary users (PUs). The proposed resource allocation algorithm is capable of maximizing both the system transmission efficiency and fairness among secondary users (SUs). Besides, the proposed algorithm can also keep the interference introduced to the PU bands below a threshold. A proportional fairness constraint is used to assure that each SU can achieve a required data rate, with quality of service guarantees. Moreover, we extend the analysis to the scenario where each cooperative SU has no channel state information (CSI) about non-adjacent links. We analyzed the throughput and fairness tradeoff in CR system. A detailed analysis of the performance of the proposed algorithm is presented with the simulation results.

  18. Autonomous assembly of synthetic oligonucleotides built from an expanded DNA alphabet. Total synthesis of a gene encoding kanamycin resistance.

    Science.gov (United States)

    Merritt, Kristen K; Bradley, Kevin M; Hutter, Daniel; Matsuura, Mariko F; Rowold, Diane J; Benner, Steven A

    2014-01-01

    Many synthetic biologists seek to increase the degree of autonomy in the assembly of long DNA (L-DNA) constructs from short synthetic DNA fragments, which are today quite inexpensive because of automated solid-phase synthesis. However, the low information density of DNA built from just four nucleotide "letters", the presence of strong (G:C) and weak (A:T) nucleobase pairs, the non-canonical folded structures that compete with Watson-Crick pairing, and other features intrinsic to natural DNA, generally prevent the autonomous assembly of short single-stranded oligonucleotides greater than a dozen or so. We describe a new strategy to autonomously assemble L-DNA constructs from fragments of synthetic single-stranded DNA. This strategy uses an artificially expanded genetic information system (AEGIS) that adds nucleotides to the four (G, A, C, and T) found in standard DNA by shuffling hydrogen-bonding units on the nucleobases, all while retaining the overall Watson-Crick base-pairing geometry. The added information density allows larger numbers of synthetic fragments to self-assemble without off-target hybridization, hairpin formation, and non-canonical folding interactions. The AEGIS pairs are then converted into standard pairs to produce a fully natural L-DNA product. Here, we report the autonomous assembly of a gene encoding kanamycin resistance using this strategy. Synthetic fragments were built from a six-letter alphabet having two AEGIS components, 5-methyl-2'-deoxyisocytidine and 2'-deoxyisoguanosine (respectively S and B), at their overlapping ends. Gaps in the overlapped assembly were then filled in using DNA polymerases, and the nicks were sealed by ligase. The S:B pairs in the ligated construct were then converted to T:A pairs during PCR amplification. When cloned into a plasmid, the product was shown to make Escherichia coli resistant to kanamycin. A parallel study that attempted to assemble similarly sized genes with optimally designed standard nucleotides

  19. A polarization entangled photon-pair source based on a type-II PPLN waveguide emitting at a telecom wavelength

    Energy Technology Data Exchange (ETDEWEB)

    Martin, A; Issautier, A; Ostrowsky, D B; Alibart, O; Tanzilli, S [Laboratoire de Physique de la Matiere Condensee, CNRS UMR 6622, Universite de Nice-Sophia Antipolis, Parc Valrose, 06108 Nice Cedex 2 (France); Herrmann, H; Sohler, W, E-mail: sebastien.tanzilli@unice.f [Angewandte Physik, Universitat-GH-Paderborn, Postfach 1621, D-4790 Paderborn (Germany)

    2010-10-15

    We report the realization of a fiber-coupled polarization entangled photon-pair source at 1310 nm based on a birefringent titanium in-diffused waveguide integrated into periodically poled lithium niobate. By making use of a dedicated and high-performance setup, we characterized the quantum properties of the pairs by measuring two-photon interference in both Hong-Ou-Mandel and standard Bell inequality configurations. For the two sets of measurements we obtained interference net visibilities reaching nearly 100%, which represent important and competitive results compared to those for the similar waveguide-based configurations already reported. These results prove the relevance of our approach as an enabling technology for long-distance quantum communication.

  20. PPLN-based photon-pair source compatible with solid state quantum memories and telecom optical fibers

    Science.gov (United States)

    Latypov, I. Z.; Shkalikov, A. V.; Akat'ev, D. O.; Kalachev, A. A.

    2017-06-01

    We report on the realization of a tunable source of correlated photon pairs compatible with telecommunication networks and quantum memories involving dielectric crystals doped by Nd3+ ions. The source is based on spontaneous parametric down-conversion in a 25 mm periodically poled lithium niobate crystal pumped by 532 nm cw laser. Spectral and correlation characteristics of the corresponding heralded single-photon source compatible with quantum memories are presented.

  1. Sequence dependence of base-pair stacking in right-handed DNA in solution: proton nuclear Overhauser effect NMR measurements.

    Science.gov (United States)

    Patel, D J; Kozlowski, S A; Bhatt, R

    1983-07-01

    Single-crystal x-ray studies of d(C-G-C-G-A-A-T-T-C-G-C-G) exhibit base-pair propeller twisting [Dickerson, R. E. & Drew, H. R. (1981) J. Mol. Biol. 149, 761-786] that results in close contacts between adjacent purines in the minor groove in pyrimidine (3'-5')-purine steps and in the major groove in purine (3'-5')-pyrimidine steps [Calladine, C. R. (1982) J. Mol. Biol. 161, 343-362]. These observations require an approximately 3.4 A separation between the minor groove edges of adenosines on adjacent base pairs for the dA-dA step but predict a smaller separation for the dT-dA step and a larger separation for the dA-dT step in a D(A-T-T-A).d(T-A-A-T) fragment. We have confirmed these predictions from steady-state nuclear Overhauser effect measurements between assigned minor groove adenosine H-2 protons on adjacent base pairs in the proton NMR spectrum of the d(C1-G2-A3-T4-T5-A6-T6-A5-A4-T3-C2-G1) self-complementary dodecanucleotide duplex (henceforth called the Pribnow 12-mer) in solution. The measured cross-relaxation rates (product of steady-state nuclear Overhauser effect and selective spin- lattice relaxation rates) translate to interproton separations between adjacent adenosine H-2 protons of 4.22 A in the (dA3-dT4).(dA4-dT3) step, of 3.56 A in the (dT4-dT5).dA5-dA4) step, and of 3.17 A in the (dT5-dA6).(dT6-dA5) step for the Pribnow 12-mer duplex with an isotropic rotational correlation time of 9 ns at 5 degrees C. These proton NMR results show that the sequence-dependent base-pair stacking resulting from base-pair propeller twisting of defined handedness for right-handed DNA in the solid state is maintained in aqueous solution.

  2. Solar radiation concentrators paired with multijunction photoelectric converters in ground-based solar power plants (Part II)

    Science.gov (United States)

    Ionova, E. A.; Ulanov, M. V.; Davidyuk, N. Yu.; Sadchikov, N. A.

    2017-04-01

    The present work is devoted to determining the conditions of the joint operation of photoelectric converter-solar concentrator pairs, which are used in solar power plants with concentrators. Three-cascade photoconverters based on A3B5 materials with different distributions of solar radiation in spectral ranges are studied. Concentrators of solar radiation are designed as the Fresnel lenses with silicon-on-glass structure. Refractive lens profile fabricated on the basis of Wacker RT604 silicone rubber is characterized by significant changes in refractive index with temperature. The effect of geometric parameters of the Fresnel lenses and their operating temperature on characteristics of solar radiation concentration in specified spectral intervals have been examined. The parameters of concentrators being paired with a photoelectric converter, which may ensure the efficient functioning of the solar power plant, have been calculated.

  3. Efficient and sequence-independent replication of DNA containing a third base pair establishes a functional six-letter genetic alphabet.

    Science.gov (United States)

    Malyshev, Denis A; Dhami, Kirandeep; Quach, Henry T; Lavergne, Thomas; Ordoukhanian, Phillip; Torkamani, Ali; Romesberg, Floyd E

    2012-07-24

    The natural four-letter genetic alphabet, comprised of just two base pairs (dA-dT and dG-dC), is conserved throughout all life, and its expansion by the development of a third, unnatural base pair has emerged as a central goal of chemical and synthetic biology. We recently developed a class of candidate unnatural base pairs, exemplified by the pair formed between d5SICS and dNaM. Here, we examine the PCR amplification of DNA containing one or more d5SICS-dNaM pairs in a wide variety of sequence contexts. Under standard conditions, we show that this DNA may be amplified with high efficiency and greater than 99.9% fidelity. To more rigorously explore potential sequence effects, we used deep sequencing to characterize a library of templates containing the unnatural base pair as a function of amplification. We found that the unnatural base pair is efficiently replicated with high fidelity in virtually all sequence contexts. The results show that, for PCR and PCR-based applications, d5SICS-dNaM is functionally equivalent to a natural base pair, and when combined with dA-dT and dG-dC, it provides a fully functional six-letter genetic alphabet.

  4. Alpha–beta monitoring system based on pair of simultaneous Multi-Wire Proportional Counters

    Energy Technology Data Exchange (ETDEWEB)

    Wengrowicz, U.; Amidan, D. [Department of Nuclear Engineering, Ben Gurion University of the Negev, Beer-Sheva 84105 (Israel); NRC-Negev, P.O. Box 9001, Beer-Sheva 84190 (Israel); Orion, I. [Department of Nuclear Engineering, Ben Gurion University of the Negev, Beer-Sheva 84105 (Israel)

    2016-08-11

    A new approach for a simultaneous alpha–beta Multi-wire Proportional Counter (MWPC) is presented. The popular approach for alpha–beta monitoring systems consists of a large area MWPC using noble gas flow such as Argon Methane. This method of measurement is effective but requires large-scale and expensive maintenance due to the needs of gas flow control and periodic replacements. In this work, a pair of simultaneous MWPCs for alpha–beta measuring is presented. The developed detector consists of a sealed gas MWPC sensor for beta particles, behind a free air alpha sensor. This approach allows effective simultaneous detection and discrimination of both alpha and beta radiation without the maintenance cost noble gas flow required for unsealed detectors.

  5. Alpha-beta monitoring system based on pair of simultaneous Multi-Wire Proportional Counters

    Science.gov (United States)

    Wengrowicz, U.; Amidan, D.; Orion, I.

    2016-08-01

    A new approach for a simultaneous alpha-beta Multi-wire Proportional Counter (MWPC) is presented. The popular approach for alpha-beta monitoring systems consists of a large area MWPC using noble gas flow such as Argon Methane. This method of measurement is effective but requires large-scale and expensive maintenance due to the needs of gas flow control and periodic replacements. In this work, a pair of simultaneous MWPCs for alpha-beta measuring is presented. The developed detector consists of a sealed gas MWPC sensor for beta particles, behind a free air alpha sensor. This approach allows effective simultaneous detection and discrimination of both alpha and beta radiation without the maintenance cost noble gas flow required for unsealed detectors.

  6. Tunable midinfrared wavelength selective structures based on resonator with antisymmetric parallel graphene pair

    Science.gov (United States)

    Asgari, Somayyeh; Dolatabady, Alireza; Granpayeh, Nosrat

    2017-06-01

    A parallel graphene layer pair arranged in an antisymmetric configuration coupled through a cavity resonator is proposed and analyzed by the analytical method and the numerical finite-difference time-domain method. The structure operates as a bandpass filter in the midinfrared region. The feature, as the result of the wavelength selective property of the cavity resonator, can be tuned by varying the length of the resonator, the lateral coupling distance between the graphene layers, the dielectric refractive index of material inside the resonator, and, the most interesting, the chemical potential of the graphene layers. The proposed structure can be promoted to power splitters and refractive index sensors by proper designs. Various power division ratios can be realized by changing the relative positions and/or the chemical potentials of the output waveguides. The investigated components can be utilized in the design of midinfrared nanoscale photonic integrated circuits.

  7. Return and Risk of Pairs Trading Using a Simulation-Based Bayesian Procedure for Predicting Stable Ratios of Stock Prices

    Directory of Open Access Journals (Sweden)

    David Ardia

    2016-03-01

    Full Text Available We investigate the direct connection between the uncertainty related to estimated stable ratios of stock prices and risk and return of two pairs trading strategies: a conditional statistical arbitrage method and an implicit arbitrage one. A simulation-based Bayesian procedure is introduced for predicting stable stock price ratios, defined in a cointegration model. Using this class of models and the proposed inferential technique, we are able to connect estimation and model uncertainty with risk and return of stock trading. In terms of methodology, we show the effect that using an encompassing prior, which is shown to be equivalent to a Jeffreys’ prior, has under an orthogonal normalization for the selection of pairs of cointegrated stock prices and further, its effect for the estimation and prediction of the spread between cointegrated stock prices. We distinguish between models with a normal and Student t distribution since the latter typically provides a better description of daily changes of prices on financial markets. As an empirical application, stocks are used that are ingredients of the Dow Jones Composite Average index. The results show that normalization has little effect on the selection of pairs of cointegrated stocks on the basis of Bayes factors. However, the results stress the importance of the orthogonal normalization for the estimation and prediction of the spread—the deviation from the equilibrium relationship—which leads to better results in terms of profit per capital engagement and risk than using a standard linear normalization.

  8. DFT study on the attacking mechanisms of H and OH radicals to G-C and A-T base pairs in water

    Energy Technology Data Exchange (ETDEWEB)

    Okutsu, N.; Shimamura, K.; Shimizu, E.; Kurita, N., E-mail: kurita@cs.tut.ac.jp [Department of Computer Science and Engineering, Toyohashi University of Technology, Toyohashi, Aichi, 441-8580 (Japan); Shulga, S. [Institute for Food Biotechnology and Genomics, National Academy of Sciences of Ukraine, Kyiv (Ukraine); Danilov, V. I. [Institute of Molecular Biology and Genetics, National Academy of Sciences of Ukraine, Kyiv (Ukraine)

    2016-02-01

    To elucidate the effect of radicals on DNA base pairs, we investigated the attacking mechanism of OH and H radicals to the G-C and A-T base pairs, using the density functional theory (DFT) calculations in water approximated by the continuum solvation model. The DFT calculations revealed that the OH radical abstracts the hydrogen atom of a NH{sub 2} group of G or A base and induces a tautomeric reaction for an A-T base pair more significantly than for a G-C base pair. On the other hand, the H radical prefers to bind to the Cytosine NH{sub 2} group of G-C base pair and induce a tautomeric reaction from G-C to G*-C*, whose activation free energy is considerably small (−0.1 kcal/mol) in comparison with that (42.9 kcal/mol) for the reaction of an A-T base pair. Accordingly, our DFT calculations elucidated that OH and H radicals have a significant effect on A-T and G-C base pairs, respectively. This finding will be useful for predicting the effect of radiation on the genetic information recorded in the base sequences of DNA duplexes.

  9. INTERACTION OF IRON(II MIXED-LIGAND COMPLEXES WITH DNA: BASE-PAIR SPECIFICITY AND THERMAL DENATURATION STUDIES

    Directory of Open Access Journals (Sweden)

    Mudasir Mudasir

    2010-06-01

    Full Text Available A research about base-pair specificity of the DNA binding of [Fe(phen3]2+, [Fe(phen2(dip]2+ and [Fe(phen(dip2]2+ complexes and the effect of calf-thymus DNA (ct-DNA binding of these metal complexes on thermal denaturation of ct-DNA has been carried out. This research is intended to evaluate the preferential binding of the complexes to the sequence of DNA (A-T or G-C sequence and to investigate the binding strength and mode upon their interaction with DNA. Base-pair specificity of the DNA binding of the complexes was determined by comparing the equilibrium binding constant (Kb of each complex to polysynthetic DNA that contain only A-T or G-C sequence. The Kb value of the interaction was determined by spectrophotometric titration and thermal denaturation temperature (Tm was determined by monitoring the absorbance of the mixture solution of each complex and ct-DNA at λ =260 nm as temperature was elevated in the range of 25 - 100 oC. Results of the study show that in general all iron(II complexes studied exhibit a base-pair specificity in their DNA binding to prefer the relatively facile A-T sequence as compared to the G-C one. The thermal denaturation experiments have demonstrated that Fe(phen3]2+ and [Fe(phen2(dip]2+ interact weakly with double helical DNA via electrostatic interaction as indicated by insignificant changes in melting temperature, whereas [Fe(phen2(dip]2+  most probably binds to DNA in mixed modes of interaction, i.e.: intercalation and electrostatic interaction. This conclusion is based on the fact that the binding of [Fe(phen2(dip]2+ to ct-DNA moderately increase the Tm value of ct- DNA   Keywords: DNA Binding, mixed-ligand complexes

  10. Synthesis and degradation of nucleic acid components by formamide and iron sulfur minerals.

    Science.gov (United States)

    Saladino, Raffaele; Neri, Veronica; Crestini, Claudia; Costanzo, Giovanna; Graciotti, Michele; Di Mauro, Ernesto

    2008-11-19

    We describe the one-pot synthesis of a large panel of nucleic bases and related compounds from formamide in the presence of iron sulfur and iron-copper sulfur minerals as catalysts. The major products observed are purine, 1H-pyrimidinone, isocytosine, adenine, 2-aminopurine, carbodiimide, urea, and oxalic acid. Isocytosine and 2-aminopurine may recognize natural nucleobases by Watson-Crick and reverse Watson-Crick interactions, thus suggesting novel scenarios for the origin of primordial nucleic acids. Since the major problem in the origin of informational polymers is the instability of their precursors, we also investigate the effects of iron sulfur and iron-copper sulfur minerals on the stability of ribooligonucleotides in formamide and in water. All of the iron sulfur and iron-copper sulfur minerals stimulated degradation of RNA. The relevance of these findings with respect to the origin of informational polymers is discussed.

  11. Molecular mechanism of DNA recognition by the alpha subunit of the Oxytricha telomere binding protein.

    Science.gov (United States)

    Laporte, L; Benevides, J M; Thomas, G J

    1999-01-12

    Interactions between telomeric DNA and the alpha subunit of the heterodimeric telomere binding protein of Oxytricha nova have been probed by Raman spectroscopy, CD spectroscopy, and nondenaturing gel electrophoresis. Telomeric sequences investigated include the Oxytricha 3' overhang, d(T4G4)2, and the related sequence dT6(T4G4)2, which incorporates a 5'-thymidylate leader. Corresponding nontelomeric isomers, d(TG)8 and dT6(TG)8, have also been investigated. Both d(T4G4)2 and dT6(T4G4)2 form stable hairpins that contain Hoogsteen G.G base pairs [Laporte, L., and Thomas, G. J., Jr. (1998) J. Mol. Biol. 281, 261-270]. The alpha subunit binds specifically and stoichiometrically to the dT6(T4G4)2 hairpin and alters its secondary structure by inducing conformational changes in the 5'-thymidylate leader without extensive disruption of G.G base pairing. Conversely, binding of the alpha subunit to d(T4G4)2 eliminates G.G pairing and unfolds the hairpin. DNA unfolding is accompanied by conformational changes affecting both the backbone and dG residues, as evidenced by Raman and CD spectra. Interestingly, the alpha subunit also forms complexes with the nontelomeric isomers, d(TG)8 and dT6(TG)8, evidenced by altered electrophoretic mobility in nondenaturing gels; however, Raman and CD spectra of complexes of the alpha subunit with nontelomeric DNA suggest no significant changes in backbone or deoxynucleoside conformations. Similarly, the alpha subunit binds to but does not appreciably alter the secondary structure of duplex DNA. The present results show that while the alpha subunit has the capacity to bind to Watson-Crick and different non-Watson-Crick motifs, DNA refolding is specific to the Oxytricha telomeric hairpin and the retention of G.G pairing is specific to the telomeric sequence incorporating the 5' leading sequence. A model is proposed for alpha subunit binding to telomeric DNA, and the physiological role of the alpha subunit in telomere organization is discussed.

  12. Fast and automatic identification of particle tilt pairs based on Delaunay triangulation.

    Science.gov (United States)

    Vilas, J L; Navas, J; Gómez-Blanco, J; de la Rosa-Trevín, J M; Melero, R; Peschiera, I; Ferlenghi, I; Cuenca, J; Marabini, R; Carazo, J M; Vargas, J; Sorzano, C O S

    2016-12-01

    Random conical tilt (RCT) and orthogonal tilt reconstruction (OTR) are two remarkable methods for reconstructing the three-dimensional structure of macromolecules at low resolution. These techniques use two images at two different sample tilts. One of the most demanding steps in these methods at the image processing level is to identify corresponding particles on both micrographs, and manual or semiautomatic matching methods are usually used. Here we present an approach to solve this bottleneck with a fully automatic method for assigning particle tilt pairs. This new algorithm behaves correctly with a variety of samples, covering the range from small to large macromolecules and from sparse to densely populated fields of view. It is also more rapid than previous approaches. The roots of the method lie in a Delaunay triangulation of the set of independently picked coordinates on both the untilted and tilted micrographs. These triangulations are then used to search an affine transformation between the untilted and tilted triangles. The affine transformation that maximizes the number of correspondences between the two micrographs defines the coordinate matching. Copyright © 2016 Elsevier Inc. All rights reserved.

  13. Nuclear mass predictions based on Bayesian neural network approach with pairing and shell effects

    Science.gov (United States)

    Niu, Z. M.; Liang, H. Z.

    2018-03-01

    Bayesian neural network (BNN) approach is employed to improve the nuclear mass predictions of various models. It is found that the noise error in the likelihood function plays an important role in the predictive performance of the BNN approach. By including a distribution for the noise error, an appropriate value can be found automatically in the sampling process, which optimizes the nuclear mass predictions. Furthermore, two quantities related to nuclear pairing and shell effects are added to the input layer in addition to the proton and mass numbers. As a result, the theoretical accuracies are significantly improved not only for nuclear masses but also for single-nucleon separation energies. Due to the inclusion of the shell effect, in the unknown region, the BNN approach predicts a similar shell-correction structure to that in the known region, e.g., the predictions of underestimation of nuclear mass around the magic numbers in the relativistic mean-field model. This manifests that better predictive performance can be achieved if more physical features are included in the BNN approach.

  14. Meiotic cohesin-based chromosome structure is essential for homologous chromosome pairing in Schizosaccharomyces pombe.

    Science.gov (United States)

    Ding, Da-Qiao; Matsuda, Atsushi; Okamasa, Kasumi; Nagahama, Yuki; Haraguchi, Tokuko; Hiraoka, Yasushi

    2016-06-01

    Chromosome structure is dramatically altered upon entering meiosis to establish chromosomal architectures necessary for the successful progression of meiosis-specific events. An early meiotic event involves the replacement of the non-SMC mitotic cohesins with their meiotic equivalents in most part of the chromosome, forming an axis on meiotic chromosomes. We previously demonstrated that the meiotic cohesin complex is required for chromosome compaction during meiotic prophase in the fission yeast Schizosaccharomyces pombe. These studies revealed that chromosomes are elongated in the absence of the meiotic cohesin subunit Rec8 and shortened in the absence of the cohesin-associated protein Pds5. In this study, using super-resolution structured illumination microscopy, we found that Rec8 forms a linear axis on chromosomes, which is required for the organized axial structure of chromatin during meiotic prophase. In the absence of Pds5, the Rec8 axis is shortened whereas chromosomes are widened. In rec8 or pds5 mutants, the frequency of homologous chromosome pairing is reduced. Thus, Rec8 and Pds5 play an essential role in building a platform to support the chromosome architecture necessary for the spatial alignment of homologous chromosomes.

  15. pgRNAFinder: a web-based tool to design distance independent paired-gRNA.

    Science.gov (United States)

    Xiong, Yuanyan; Xie, Xiaowei; Wang, Yanzhi; Ma, Wenbing; Liang, Puping; Songyang, Zhou; Dai, Zhiming

    2017-11-15

    The CRISPR/Cas System has been shown to be an efficient and accurate genome-editing technique. There exist a number of tools to design the guide RNA sequences and predict potential off-target sites. However, most of the existing computational tools on gRNA design are restricted to small deletions. To address this issue, we present pgRNAFinder, with an easy-to-use web interface, which enables researchers to design single or distance-free paired-gRNA sequences. The web interface of pgRNAFinder contains both gRNA search and scoring system. After users input query sequences, it searches gRNA by 3' protospacer-adjacent motif (PAM), and possible off-targets, and scores the conservation of the deleted sequences rapidly. Filters can be applied to identify high-quality CRISPR sites. PgRNAFinder offers gRNA design functionality for 8 vertebrate genomes. Furthermore, to keep pgRNAFinder open, extensible to any organism, we provide the source package for local use. The pgRNAFinder is freely available at http://songyanglab.sysu.edu.cn/wangwebs/pgRNAFinder/, and the source code and user manual can be obtained from https://github.com/xiexiaowei/pgRNAFinder. songyang@bcm.edu or daizhim@mail.sysu.edu.cn. Supplementary data are available at Bioinformatics online.

  16. Stable source of high quality telecom-band polarization-entangled photon-pairs based on a single, pulse-pumped, short PPLN waveguide.

    Science.gov (United States)

    Lim, Han Chuen; Yoshizawa, Akio; Tsuchida, Hidemi; Kikuchi, Kazuro

    2008-08-18

    We demonstrate a stable source of high quality telecom-band polarization-entangled photon-pairs based on a single, pulse-pumped, short periodically-poled lithium niobate (PPLN) waveguide. Full quantum state tomographic measurement performed on the photon-pairs has revealed a very high state purity of 0.94, and an entanglement fidelity exceeding 0.96 at the low-rate-regime. At higher rates, entanglement quality degrades due to emission of multiple-pairs. Using a new model, we have confirmed that the observed degradation is largely due to double- and triple-pair emissions.

  17. Reversible phospholipid nanogels for deoxyribonucleic acid fragment size determinations up to 1500 base pairs and integrated sample stacking.

    Science.gov (United States)

    Durney, Brandon C; Bachert, Beth A; Sloane, Hillary S; Lukomski, Slawomir; Landers, James P; Holland, Lisa A

    2015-06-23

    Phospholipid additives are a cost-effective medium to separate deoxyribonucleic acid (DNA) fragments and possess a thermally-responsive viscosity. This provides a mechanism to easily create and replace a highly viscous nanogel in a narrow bore capillary with only a 10°C change in temperature. Preparations composed of dimyristoyl-sn-glycero-3-phosphocholine (DMPC) and 1,2-dihexanoyl-sn-glycero-3-phosphocholine (DHPC) self-assemble, forming structures such as nanodisks and wormlike micelles. Factors that influence the morphology of a particular DMPC-DHPC preparation include the concentration of lipid in solution, the temperature, and the ratio of DMPC and DHPC. It has previously been established that an aqueous solution containing 10% phospholipid with a ratio of [DMPC]/[DHPC]=2.5 separates DNA fragments with nearly single base resolution for DNA fragments up to 500 base pairs in length, but beyond this size the resolution decreases dramatically. A new DMPC-DHPC medium is developed to effectively separate and size DNA fragments up to 1500 base pairs by decreasing the total lipid concentration to 2.5%. A 2.5% phospholipid nanogel generates a resolution of 1% of the DNA fragment size up to 1500 base pairs. This increase in the upper size limit is accomplished using commercially available phospholipids at an even lower material cost than is achieved with the 10% preparation. The separation additive is used to evaluate size markers ranging between 200 and 1500 base pairs in order to distinguish invasive strains of Streptococcus pyogenes and Aspergillus species by harnessing differences in gene sequences of collagen-like proteins in these organisms. For the first time, a reversible stacking gel is integrated in a capillary sieving separation by utilizing the thermally-responsive viscosity of these self-assembled phospholipid preparations. A discontinuous matrix is created that is composed of a cartridge of highly viscous phospholipid assimilated into a separation matrix

  18. Synthesis and Structural Characterization of 2'-Fluoro-α-L-RNA-Modified Oligonucleotides

    DEFF Research Database (Denmark)

    Bundgaard Jensen, Troels; Pasternak, Anna; Stahl Madsen, Andreas

    2011-01-01

    -α-L-RNA monomer was designed as a monocyclic mimic of the bicyclic α-L-LNA, and molecular modeling showed that this indeed is the case as the 2'-fluoro monomer adopts a C3'-endo/C2'-exo sugar pucker. Molecular modeling of modified duplexes show that the 2'-fluoro-α-L-RNA nucleotides partake in Watson-Crick base...

  19. Optical fiber in-line Mach-Zehnder interferometer based on dual internal mirrors formed by a hollow sphere pair.

    Science.gov (United States)

    Hu, T Y; Wang, D N

    2013-08-15

    We demonstrate a fiber in-line Mach-Zehnder interferometer based on dual internal mirrors formed by a hollow sphere pair and fabricated by femtosecond laser micromachining together with the fusion splicing technique. The hollow sphere surface adjacent to the fiber core can reflect part of the incident light beam to the air-cladding interface, where the light beam is reflected again before returning to the fiber core by another hollow sphere surface and recombining with the light beam remaining in the fiber core. Such an interferometer is miniature and robust, and is sensitive to environmental variations and allows simultaneous surrounding refractive index, temperature, and curvature measurement.

  20. Thermally induced double proton transfer in GG and wobble GT base pairs: A possible origin of the mutagenic guanine

    Science.gov (United States)

    Padermshoke, Adchara; Katsumoto, Yukiteru; Masaki, Ryuta; Aida, Misako

    2008-05-01

    Double proton transfer (DPT) reactions in three guanine-guanine (GG) dimers, a guanine-thymine wobble (wGT) base pair, and a model compound 4(3H)-pyrimidinone (k-PP) dimer have been investigated using ab initio MO calculations and liquid-phase infrared (IR) spectroscopy. The calculations suggest that the DPT processes in these dimers are energetically accessible. Temperature-dependent IR measurements of the model compound reveal that slight thermal energy can induce the DPT reaction, and hence the enol tautomer can result. The present study demonstrates a potential pathway for the generation of the mutagenic amino-enol form of guanine.

  1. Optimization of the Municipal Waste Collection Route Based on the Method of the Minimum Pairing

    Directory of Open Access Journals (Sweden)

    Michal Petřík

    2016-01-01

    Full Text Available In the present article is shown the use of Maple program for processing of data describing the position of municipal waste sources and topology of collecting area. The data are further processed through the use of graph theory algorithms, which enable creation of collection round proposal. In this case study is described method of waste pick-up solution in a certain village of approx. 1,600 inhabitants and built-up area of approx. 30 hectares. Village has approx. 11.5 kilometers of ride able routes, with approx. 1 kilometer without waste source. The first part shows topology of the village in light of location of waste sources and capacity of the routes. In the second part are topological data converted into data that can be processed by use of the Graph Theory and the correspondent graph is shown. Optimizing collection route in a certain graph means to find the Euler circle. However, this circle can be constructed only on condition that all the vertices of the graph are of an even degree. Practically this means that is necessary to introduce auxiliary edges – paths that will be passed twice. These paths will connect vertices with odd values. The optimal solution then requires that the total length of the inserted edges was minimal possible, which corresponds to the minimum pairing method. As it is a problem of exponential complexity, it is necessary to make some simplifications. These simplifications are depicted graphically and the results are displayed in the conclusion. The resulting graph with embedded auxiliary edges can be used as a basic decision making material for creation of real collection round that respects local limitations such as one way streets or streets where is the waste collection is not possible from both sides at the same time.

  2. Accurate classification of brain gliomas by discriminate dictionary learning based on projective dictionary pair learning of proton magnetic resonance spectra.

    Science.gov (United States)

    Adebileje, Sikiru Afolabi; Ghasemi, Keyvan; Aiyelabegan, Hammed Tanimowo; Saligheh Rad, Hamidreza

    2017-04-01

    Proton magnetic resonance spectroscopy is a powerful noninvasive technique that complements the structural images of cMRI, which aids biomedical and clinical researches, by identifying and visualizing the compositions of various metabolites within the tissues of interest. However, accurate classification of proton magnetic resonance spectroscopy is still a challenging issue in clinics due to low signal-to-noise ratio, overlapping peaks of metabolites, and the presence of background macromolecules. This paper evaluates the performance of a discriminate dictionary learning classifiers based on projective dictionary pair learning method for brain gliomas proton magnetic resonance spectroscopy spectra classification task, and the result were compared with the sub-dictionary learning methods. The proton magnetic resonance spectroscopy data contain a total of 150 spectra (74 healthy, 23 grade II, 23 grade III, and 30 grade IV) from two databases. The datasets from both databases were first coupled together, followed by column normalization. The Kennard-Stone algorithm was used to split the datasets into its training and test sets. Performance comparison based on the overall accuracy, sensitivity, specificity, and precision was conducted. Based on the overall accuracy of our classification scheme, the dictionary pair learning method was found to outperform the sub-dictionary learning methods 97.78% compared with 68.89%, respectively. Copyright © 2016 John Wiley & Sons, Ltd. Copyright © 2016 John Wiley & Sons, Ltd.

  3. Milestones and Millennials: A Perfect Pairing-Competency-Based Medical Education and the Learning Preferences of Generation Y.

    Science.gov (United States)

    Desy, Janeve R; Reed, Darcy A; Wolanskyj, Alexandra P

    2017-02-01

    Millennials are quickly becoming the most prevalent generation of medical learners. These individuals have a unique outlook on education and have different preferences and expectations than their predecessors. As evidenced by its implementation by the Accreditation Council for Graduate Medical Education in the United States and the Royal College of Physicians and Surgeons in Canada, competency based medical education is rapidly gaining international acceptance. Characteristics of competency based medical education can be perfectly paired with Millennial educational needs in several dimensions including educational expectations, the educational process, attention to emotional quotient and professionalism, assessment, feedback, and intended outcomes. We propose that with its attention to transparency, personalized learning, and frequent formative assessment, competency based medical education is an ideal fit for the Millennial generation as it realigns education and assessment with the needs of these 21st century learners. Copyright © 2016 Mayo Foundation for Medical Education and Research. Published by Elsevier Inc. All rights reserved.

  4. Experimental demonstration of wavelength domain rogue-free ONU based on wavelength-pairing for TDM/WDM optical access networks.

    Science.gov (United States)

    Lee, Jie Hyun; Park, Heuk; Kang, Sae-Kyoung; Lee, Joon Ki; Chung, Hwan Seok

    2015-11-30

    In this study, we propose and experimentally demonstrate a wavelength domain rogue-free ONU based on wavelength-pairing of downstream and upstream signals for time/wavelength division-multiplexed optical access networks. The wavelength-pairing tunable filter is aligned to the upstream wavelength channel by aligning it to one of the downstream wavelength channels. Wavelength-pairing is implemented with a compact and cyclic Si-AWG integrated with a Ge-PD. The pairing filter covered four 100 GHz-spaced wavelength channels. The feasibility of the wavelength domain rogue-free operation is investigated by emulating malfunction of the misaligned laser. The wavelength-pairing tunable filter based on the Si-AWG blocks the upstream signal in the non-assigned wavelength channel before data collision with other ONUs.

  5. Structural characteristics of oligomeric DNA strands adsorbed onto single-walled carbon nanotubes.

    Science.gov (United States)

    Roxbury, Daniel; Jagota, Anand; Mittal, Jeetain

    2013-01-10

    The single-stranded DNA to single-walled carbon nanotube (SWCNT) hybrid continues to attract significant interest as an exemplary biological molecule-nanomaterial conjugate. In addition to their many biomedical uses, such as in vivo sensing and delivery of molecular cargo, DNA-SWCNT hybrids enable the sorting of SWCNTs according to their chirality. Current experimental methods have fallen short of identifying the actual structural ensemble of DNA adsorbed onto SWCNTs that enables and controls several of these phenomena. Molecular dynamics (MD) simulation has been a useful tool for studying the structure of these hybrid molecules. In recent studies, using replica exchange MD (REMD) simulation we have shown that novel secondary structures emerge and that these structures are DNA-sequence and SWCNT-type dependent. Here, we use REMD to investigate in detail the structural characteristics of two DNA-SWCNT recognition pairs: (TAT)(4)-(6,5)-SWCNT, i.e., DNA sequence TATTATTATTAT bound to the (6,5) chirality SWCNT, and (CCG)(2)CC-(8,7)-SWCNT as well as off-recognition pairs (TAT)(4)-(8,7)-SWCNT and (CCG)(2)CC-(6,5)-SWCNT. From a structural clustering analysis, dominant equilibrium structures are identified and show a right-handed self-stitched motif for (TAT)(4)-(6,5) in contrast to a left-handed β-barrel for (CCG)(2)CC-(8,7). Additionally, characteristics such as DNA end-to-end distance, solvent accessible SWCNT surface area, DNA hydrogen bonding between bases, and DNA dihedral distributions have been probed in detail as a function of the number of DNA strands adsorbed onto the nanotube. We find that the DNA structures adsorbed onto a nanotube are also stabilized by significant numbers of non-Watson-Crick hydrogen bonds (intrastrand and interstrand) in addition to π-π stacking between DNA bases and nanotube surface and Watson-Crick pairs. Finally, we provide a summary of DNA structures observed for various DNA-SWCNT hybrids as a preliminary set of motifs that may be

  6. Intermolecular Proton Transfer in Microhydrated Guanine-Cytosine Base Pairs: a New Mechanism for Spontaneous Mutation in DNA

    Science.gov (United States)

    Cerón-Carrasco, J. P.; Requena, A.; Zúñiga, J.; Michaux, C.; Perpête, E. A.; Jacquemin, D.

    2009-09-01

    Accurate calculations of the double proton transfer (DPT) in the adenine-thymine base pair (AT) were presented in a previous work [ J. Phys. Chem. A 2009, 113, 7892. ] where we demonstrated that the mechanism of the reaction in solution is strongly affected by surrounding water. Here we extend our methodology to the guanine-cytosine base pair (GC), for which it turns out that the proton transfer in the gas phase is a synchronous concerted mechanism. The O(G)-H-N(C) hydrogen bond strength emerges as the key parameter in this process, to the extent that complete transfer takes place by means of this hydrogen bond. Since the main effect of the molecular environment is precisely to weaken this bond, the direct proton transfer is not possible in solution, and thus the tautomeric equilibrium must be assisted by surrounding water molecules in an asynchronous concerted mechanism. This result demonstrates that water plays a crucial role in proton reactions. It does not act as a passive element but actually catalyzes the DPT.

  7. Computational DNA hole spectroscopy: A new tool to predict mutation hotspots, critical base pairs, and disease 'driver' mutations.

    Science.gov (United States)

    Villagrán, Martha Y Suárez; Miller, John H

    2015-08-27

    We report on a new technique, computational DNA hole spectroscopy, which creates spectra of electron hole probabilities vs. nucleotide position. A hole is a site of positive charge created when an electron is removed. Peaks in the hole spectrum depict sites where holes tend to localize and potentially trigger a base pair mismatch during replication. Our studies of mitochondrial DNA reveal a correlation between L-strand hole spectrum peaks and spikes in the human mutation spectrum. Importantly, we also find that hole peak positions that do not coincide with large variant frequencies often coincide with disease-implicated mutations and/or (for coding DNA) encoded conserved amino acids. This enables combining hole spectra with variant data to identify critical base pairs and potential disease 'driver' mutations. Such integration of DNA hole and variance spectra could ultimately prove invaluable for pinpointing critical regions of the vast non-protein-coding genome. An observed asymmetry in correlations, between the spectrum of human mtDNA variations and the L- and H-strand hole spectra, is attributed to asymmetric DNA replication processes that occur for the leading and lagging strands.

  8. Computational DNA hole spectroscopy: A new tool to predict mutation hotspots, critical base pairs, and disease ‘driver’ mutations

    Science.gov (United States)

    Suárez, Martha Y.; Villagrán; Miller, John H.

    2015-01-01

    We report on a new technique, computational DNA hole spectroscopy, which creates spectra of electron hole probabilities vs. nucleotide position. A hole is a site of positive charge created when an electron is removed. Peaks in the hole spectrum depict sites where holes tend to localize and potentially trigger a base pair mismatch during replication. Our studies of mitochondrial DNA reveal a correlation between L-strand hole spectrum peaks and spikes in the human mutation spectrum. Importantly, we also find that hole peak positions that do not coincide with large variant frequencies often coincide with disease-implicated mutations and/or (for coding DNA) encoded conserved amino acids. This enables combining hole spectra with variant data to identify critical base pairs and potential disease ‘driver’ mutations. Such integration of DNA hole and variance spectra could ultimately prove invaluable for pinpointing critical regions of the vast non-protein-coding genome. An observed asymmetry in correlations, between the spectrum of human mtDNA variations and the L- and H-strand hole spectra, is attributed to asymmetric DNA replication processes that occur for the leading and lagging strands. PMID:26310834

  9. High Fidelity, Efficiency and Functionalization of Ds-Px Unnatural Base Pairs in PCR Amplification for a Genetic Alphabet Expansion System.

    Science.gov (United States)

    Okamoto, Itaru; Miyatake, Yuya; Kimoto, Michiko; Hirao, Ichiro

    2016-11-18

    Genetic alphabet expansion of DNA using an artificial extra base pair (unnatural base pair) could augment nucleic acid and protein functionalities by increasing their components. We previously developed an unnatural base pair between 7-(2-thienyl)-imidazo[4,5-b]pyridine (Ds) and 2-nitro-4-propynylpyrrole (Px), which exhibits high fidelity as a third base pair in PCR amplification. Here, the fidelity and efficiency of Ds-Px pairing using modified Px bases with functional groups, such as diol, azide, ethynyl and biotin, were evaluated by an improved method with optimized PCR conditions. The results revealed that all of the base pairs between Ds and either one of the modified Px bases functioned with high amplification efficiency (0.76-0.81), high selectivity (≥99.96% per doubling), and less sequence dependency, in PCR using 3'-exonuclease-proficient Deep Vent DNA polymerase. We also demonstrated that the azide-Px in PCR-amplified DNA was efficiently modified with any functional groups by copper-free click reaction. This genetic alphabet expansion system could endow nucleic acids with a wide variety of increased functionalities by the site-specific incorporation of modified Px bases at desired positions in DNA.

  10. Chain propagation and termination mechanisms for polymerization of conjugated polar alkenes by [Al]-based frustrated Lewis pairs

    KAUST Repository

    He, Jianghua

    2014-11-25

    A combined experimental and theoretical study on mechanistic aspects of polymerization of conjugated polar alkenes by frustrated Lewis pairs (FLPs) based on N-heterocyclic carbene (NHC) and Al(C6F5)3 pairs is reported. This study consists of three key parts: structural characterization of active propagating intermediates, propagation kinetics, and chain-termination pathways. Zwitterionic intermediates that simulate the active propagating species in such polymerization have been generated or isolated from the FLP activation of monomers such as 2-vinylpyridine and 2-isopropenyl-2-oxazoline-one of which, IMes+-CH2C(Me)=(C3H2NO)Al(C6F5)3 - (2), has been structurally characterized. Kinetics performed on the polymerization of 2-vinylpyridine by ItBu/Al(C6F5)3 revealed that the polymerization follows a zero-order dependence on monomer concentration and a first-order dependence on initiator (ItBu) and activator [Al(C6F5)3] concentrations, indicating a bimolecular, activated monomer propagation mechanism. The Lewis pair polymerization of conjugate polar alkenes such as methacrylates is accompanied by competing chain-termination side reactions; between the two possible chain-termination pathways, the one that proceeds via intramolecular backbiting cyclization involving nucleophilic attack of the activated ester group of the growing polymer chain by the O-ester enolate active chain end to generate a six-membered lactone (δ-valerolactone)-terminated polymer chain is kinetically favored, but thermodynamically disfavored, over the pathway leading to the -ketoester-terminated chain, as revealed by computational studies.

  11. Effect of nucleobase sequence on the proton-transfer reaction and stability of the guanine-cytosine base pair radical anion.

    Science.gov (United States)

    Chen, Hsing-Yin; Yeh, Shu-Wen; Hsu, Sodio C N; Kao, Chai-Lin; Dong, Teng-Yuan

    2011-02-21

    The formation of base pair radical anions is closely related to many fascinating research fields in biology and chemistry such as radiation damage to DNA and electron transport in DNA. However, the relevant knowledge so far mainly comes from studies on isolated base pair radical anions, and their behavior in the DNA environment is less understood. In this study, we focus on how the nucleobase sequence affects the properties of the guanine-cytosine (GC) base pair radical anion. The energetic barrier and reaction energy for the proton transfer along the N(1)(G)-H···N(3)(C) hydrogen bond and the stability of GC˙(-) (i.e., electron affinity of GC) embedded in different sequences of base-pair trimer were evaluated using density functional theory. The computational results demonstrated that the presence of neighboring base pairs has an important influence on the behavior of GC˙(-) in the gas phase. The excess electron was found to be localized on the embedded GC and the charge leakage to neighboring base pairs was very minor in all of the investigated sequences. Accordingly, the sequence behavior of the proton-transfer reaction and the stability of GC˙(-) is chiefly governed by electrostatic interactions with adjacent base pairs. However, the effect of base stacking, due to its electrostatic nature, is severely screened upon hydration, and thus, the sequence dependence of the properties of GC˙(-) in aqueous environment becomes relatively weak and less than that observed in the gas phase. The effect of geometry relaxation associated with neighboring base pairs as well as the possibility of proton transfer along the N(2)(G)-H···O(2)(C) channel have also been investigated. The implications of the present findings to the electron transport and radiation damage of DNA are discussed.

  12. An entropy-based improved k-top scoring pairs (TSP) method for ...

    African Journals Online (AJOL)

    We compared Ik-TSP classifiers with 5 different machine learning methods and the k-TSP method based on 3 different feature selection methods on 9 binary class gene expression datasets and 10 multi-class gene expression datasets involving human cancers. Experimental results showed that the Ik-TSP method had ...

  13. Pairing based threshold cryptography improving on Libert-Quisquater and Baek-Zheng

    DEFF Research Database (Denmark)

    Desmedt, Yvo; Lange, Tanja

    2006-01-01

    In this paper we apply techniques from secret sharing and threshold decryption to show how to properly design an ID-based threshold system in which one assumes no trust in any party. In our scheme: We avoid that any single machine ever knew the master secret s of the trusted authority (TA). Inste...

  14. Synchronized Pair Configuration in Virtualization-Based Lab for Learning Computer Networks

    Science.gov (United States)

    Kongcharoen, Chaknarin; Hwang, Wu-Yuin; Ghinea, Gheorghita

    2017-01-01

    More studies are concentrating on using virtualization-based labs to facilitate computer or network learning concepts. Some benefits are lower hardware costs and greater flexibility in reconfiguring computer and network environments. However, few studies have investigated effective mechanisms for using virtualization fully for collaboration.…

  15. Biological phosphorylation of an Unnatural Base Pair (UBP using a Drosophila melanogaster deoxynucleoside kinase (DmdNK mutant.

    Directory of Open Access Journals (Sweden)

    Fei Chen

    Full Text Available One research goal for unnatural base pair (UBP is to replicate, transcribe and translate them in vivo. Accordingly, the corresponding unnatural nucleoside triphosphates must be available at sufficient concentrations within the cell. To achieve this goal, the unnatural nucleoside analogues must be phosphorylated to the corresponding nucleoside triphosphates by a cascade of three kinases. The first step is the monophosphorylation of unnatural deoxynucleoside catalyzed by deoxynucleoside kinases (dNK, which is generally considered the rate limiting step because of the high specificity of dNKs. Here, we applied a Drosophila melanogaster deoxyribonucleoside kinase (DmdNK to the phosphorylation of an UBP (a pyrimidine analogue (6-amino-5-nitro-3-(1'-b-d-2'-deoxyribofuranosyl-2(1H-pyridone, Z and its complementary purine analogue (2-amino-8-(1'-b-d-2'-deoxyribofuranosyl-imidazo[1,2-a]-1,3,5-triazin-4(8H-one, P. The results showed that DmdNK could efficiently phosphorylate only the dP nucleoside. To improve the catalytic efficiency, a DmdNK-Q81E mutant was created based on rational design and structural analyses. This mutant could efficiently phosphorylate both dZ and dP nucleoside. Structural modeling indicated that the increased efficiency of dZ phosphorylation by the DmdNK-Q81E mutant might be related to the three additional hydrogen bonds formed between E81 and the dZ base. Overall, this study provides a groundwork for the biological phosphorylation and synthesis of unnatural base pair in vivo.

  16. Topological classification of RNA structures.

    Science.gov (United States)

    Bon, Michael; Vernizzi, Graziano; Orland, Henri; Zee, A

    2008-06-13

    We present a novel topological classification of RNA secondary structures with pseudoknots. It is based on the topological genus of the circular diagram associated to the RNA base-pair structure. The genus is a positive integer number whose value quantifies the topological complexity of the folded RNA structure. In such a representation, planar diagrams correspond to pure RNA secondary structures and have zero genus, whereas non-planar diagrams correspond to pseudoknotted structures and have higher genus. The topological genus allows for the definition of topological folding motifs, similar in spirit to those introduced and commonly used in protein folding. We analyze real RNA structures from the databases Worldwide Protein Data Bank and Pseudobase and classify them according to their topological genus. For simplicity, we limit our analysis by considering only Watson-Crick complementary base pairs and G-U wobble base pairs. We compare the results of our statistical survey with existing theoretical and numerical models. We also discuss possible applications of this classification and show how it can be used for identifying new RNA structural motifs.

  17. Non-linguistic learning and aphasia: Evidence from a paired associate and feedback-based task

    Science.gov (United States)

    Vallila-Rohter, Sofia; Kiran, Swathi

    2013-01-01

    Though aphasia is primarily characterized by impairments in the comprehension and/or expression of language, research has shown that patients with aphasia also show deficits in cognitive-linguistic domains such as attention, executive function, concept knowledge and memory (Helm-Estabrooks, 2002 for review). Research in aphasia suggests that cognitive impairments can impact the online construction of language, new verbal learning, and transactional success (Freedman & Martin, 2001; Hula & McNeil, 2008; Ramsberger, 2005). In our research, we extend this hypothesis to suggest that general cognitive deficits influence progress with therapy. The aim of our study is to explore learning, a cognitive process that is integral to relearning language, yet underexplored in the field of aphasia rehabilitation. We examine non-linguistic category learning in patients with aphasia (n=19) and in healthy controls (n=12), comparing feedback and non-feedback based instruction. Participants complete two computer-based learning tasks that require them to categorize novel animals based on the percentage of features shared with one of two prototypes. As hypothesized, healthy controls showed successful category learning following both methods of instruction. In contrast, only 60% of our patient population demonstrated successful non-linguistic category learning. Patient performance was not predictable by standardized measures of cognitive ability. Results suggest that general learning is affected in aphasia and is a unique, important factor to consider in the field of aphasia rehabilitation. PMID:23127795

  18. Detection of Wuchereria bancrofti DNA in paired serum and urine samples using polymerase chain reaction-based systems.

    Science.gov (United States)

    Ximenes, Camila; Brandão, Eduardo; Oliveira, Paula; Rocha, Abraham; Rego, Tamisa; Medeiros, Rafael; Aguiar-Santos, Ana; Ferraz, João; Reis, Christian; Araujo, Paulo; Carvalho, Luiz; Melo, Fabio L

    2014-12-01

    The Global Program for the Elimination of Lymphatic Filariasis (GPELF) aims to eliminate this disease by the year 2020. However, the development of more specific and sensitive tests is important for the success of the GPELF. The present study aimed to standardise polymerase chain reaction (PCR)-based systems for the diagnosis of filariasis in serum and urine. Twenty paired biological urine and serum samples from individuals already known to be positive for Wuchereria bancrofti were collected during the day. Conventional PCR and semi-nested PCR assays were optimised. The detection limit of the technique for purified W. bancrofti DNA extracted from adult worms was 10 fg for the internal systems (WbF/Wb2) and 0.1 fg by using semi-nested PCR. The specificity of the primers was confirmed experimentally by amplification of 1 ng of purified genomic DNA from other species of parasites. Evaluation of the paired urine and serum samples by the semi-nested PCR technique indicated only two of the 20 tested individuals were positive, whereas the simple internal PCR system (WbF/Wb2), which has highly promising performance, revealed that all the patients were positive using both samples. This study successfully demonstrated the possibility of using the PCR technique on urine for the diagnosis of W. bancrofti infection.

  19. Detection of Wuchereria bancrofti DNA in paired serum and urine samples using polymerase chain reaction-based systems

    Directory of Open Access Journals (Sweden)

    Camila Ximenes

    2014-12-01

    Full Text Available The Global Program for the Elimination of Lymphatic Filariasis (GPELF aims to eliminate this disease by the year 2020. However, the development of more specific and sensitive tests is important for the success of the GPELF. The present study aimed to standardise polymerase chain reaction (PCR-based systems for the diagnosis of filariasis in serum and urine. Twenty paired biological urine and serum samples from individuals already known to be positive for Wuchereria bancrofti were collected during the day. Conventional PCR and semi-nested PCR assays were optimised. The detection limit of the technique for purified W. bancrofti DNA extracted from adult worms was 10 fg for the internal systems (WbF/Wb2 and 0.1 fg by using semi-nested PCR. The specificity of the primers was confirmed experimentally by amplification of 1 ng of purified genomic DNA from other species of parasites. Evaluation of the paired urine and serum samples by the semi-nested PCR technique indicated only two of the 20 tested individuals were positive, whereas the simple internal PCR system (WbF/Wb2, which has highly promising performance, revealed that all the patients were positive using both samples. This study successfully demonstrated the possibility of using the PCR technique on urine for the diagnosis of W. bancrofti infection.

  20. DEVELOPMENT OF A SECOND TYPE ELECTRODE BASED ON THE SILVER/SILVER IBUPROFENATE PAIR FOR IBUPROFEN QUANTIFICATION IN PHARMACEUTICAL SAMPLES

    Directory of Open Access Journals (Sweden)

    Selene I. Rivera-Hernández

    Full Text Available Ibuprofen is a widely used pharmaceutical because of its therapeutic properties; it is considered a safe medicament, thus it does not require medical prescription to be sold. However, in order to ensure consumer's health it is indispensable that the pharmaceutical industry relies on analytic methods for its quantification. Potentiometry has proven to be a successful technique using second type electrodes, which in agreement with Nernst's equation can detect anions activity. On consideration of this, this research work presents the development of a second type electrode based on the silver/silver ibuprofenate pair. This involved modifying a pure silver wire using a sodium ibuprofenate solution, to obtain the redox pair. The following analytic parameters were obtained with the aid of the modified electrode: a sensitivity of -0.049 V decade [ibuprofenate]-1, 8 µmol L-1 for the detection limit and a quantification limit of 1.2 µmol L-1. The repeatability value in terms of the relative standard deviation was 5.9%. After performing an interferences analysis using some ions and excipients, it was corroborated that there were none, thus allowing appropriate quantification on a real sample.

  1. Optimization of polymeric triiodide membrane electrode based on clozapine-triiodide ion-pair using experimental design.

    Science.gov (United States)

    Farhadi, Khalil; Bahram, Morteza; Shokatynia, Donya; Salehiyan, Floria

    2008-07-15

    Central composite design (CCD) and response surface methodology (RSM) were developed as experimental strategies for modeling and optimization of the influence of some variables on the performance of a new PVC membrane triiodide ion-selective electrode. This triiodide sensor is based on triiodide-clozapine ion-pair complexation. PVC, plasticizers, ion-pair amounts and pH were investigated as four variables to build a model to achieve the best Nernstian slope (59.9 mV) as response. The electrode is prepared by incorporating the ion-exchanger in PVC matrix plasticized with 2-nitrophenyl octal ether, which is directly coated on the surface of a graphite electrode. The influence of foreign ions on the electrode performance was also investigated. The optimized membranes demonstrate Nernstian response for triiodide ions over a wide linear range from 5.0 x 10(-6) to 1.0 x 10(-2)mol L(-1) with a limit of detection 2.0 x 10(-6) mol L(-1) at 25 degrees C. The electrodes could be used over a wide pH range 4-8, and have the advantages of easy to prepare, good selectivity and fast response time, long lifetime (over 3 months) and small interferences from hydrogen ion. The proposed electrode was successfully used as indicator electrode in potentiometric titration of triiodide ions and ascorbic acid.

  2. Multimerization of restriction fragments by magnesium-mediated stable base pairing between overhangs: a cause of electrophoretic mobility shift.

    Science.gov (United States)

    Tagashira, Hideki; Morita, Mitsunori; Ohyama, Takashi

    2002-10-08

    The electrophoretic mobility shift assay (EMSA) or simply the "gel shift assay" is one of the most sensitive methods for studying the ability of a protein to bind to DNA. EMSAs are also widely used to investigate protein- or sequence-dependent DNA bending. Here we report that electrophoresis using physiological concentrations of Mg(2+) can cause a mobility shift of restriction fragments in nondenaturing polyacrylamide gels as the overhangs form stable base pairs. This phenomenon was observed at even 37 degrees C. The retardation was, however, more pronounced at low temperatures, where a three-nucleotide overhang 5'-GAC also caused a mobility shift. The stability of the pairing was generally high when the overhangs of four nucleotides display high GC content, while the mobility shift caused by 5'-AATT was greater than those caused by 5'-GATC, 5'-TCGA, and 5'-CTAG. This observation should be taken into account to avoid misinterpretation of the data when the EMSA, especially the circular permutation gel mobility shift assay, is performed using a running buffer that contains Mg(2+) ions. The stable adhesion between short overhangs may present an important basis for genome stability and many genetic processes occurring in living cells.

  3. Demonstration of polarization sensitivity of emulsion-based pair conversion telescope for cosmic gamma-ray polarimetry

    Energy Technology Data Exchange (ETDEWEB)

    Ozaki, Keita, E-mail: ozaki@radix.h.kobe-u.ac.jp [Kobe University, 3-11, Tsurukabuto, Nada-ku, Kobe 657-8501 (Japan); Takahashi, Satoru, E-mail: satoru@radix.h.kobe-u.ac.jp [Nagoya University, Furo-cho, Chikusa-ku, Nagoya 464-8602 (Japan); Aoki, Shigeki; Kamada, Keiki; Kaneyama, Taichi; Nakagawa, Ryo; Rokujo, Hiroki [Kobe University, 3-11, Tsurukabuto, Nada-ku, Kobe 657-8501 (Japan)

    2016-10-11

    Linear polarization of high-energy gamma-rays (10MeV–100 GeV) can be detected by measuring the azimuthal angle of electron–positron pairs and observing the modulation of the azimuthal distribution. To demonstrate the gamma-ray polarization sensitivity of emulsion, we conducted a test using a polarized gamma-ray beam (0.8–2.4 GeV) at SPring-8/LEPS. Emulsion tracks were reconstructed using scanning data, and gamma-ray events were selected automatically. Using an optical microscope, out of the 2381 gamma-ray conversions that were observed, 1372 remained after event selection, on the azimuthal angle distribution of which we measured the modulation. From the distribution of the azimuthal angles of the selected events, a modulation factor of 0.21+0.11−0.09 was measured, from which the detection of a non-zero modulation was established with a significance of 3.06σ. This attractive polarimeter will be applied to the GRAINE project, a balloon-borne experiment that observes 10–100 GeV cosmic gamma-rays with an emulsion-based pair conversion telescope.

  4. Subtle Recognition of 14-Base Pair DNA Sequences via Threading Polyintercalation

    Science.gov (United States)

    2012-01-01

    Small molecules that bind DNA in a sequence-specific manner could act as antibiotic, antiviral, or anticancer agents because of their potential ability to manipulate gene expression. Our laboratory has developed threading polyintercalators based on 1,4,5,8-naphthalene diimide (NDI) units connected in a head-to-tail fashion by flexible peptide linkers. Previously, a threading tetraintercalator composed of alternating minor–major–minor groove-binding modules was shown to bind specifically to a 14 bp DNA sequence with a dissociation half-life of 16 days [Holman, G. G., et al. (2011) Nat. Chem. 3, 875–881]. Herein are described new NDI-based tetraintercalators with a different major groove-binding module and a reversed N to C directionality of one of the minor groove-binding modules. DNase I footprinting and kinetic analyses revealed that these new tetraintercalators are able to discriminate, by as much as 30-fold, 14 bp DNA binding sites that differ by 1 or 2 bp. Relative affinities were found to correlate strongly with dissociation rates, while overall C2 symmetry in the DNA-binding molecule appeared to contribute to enhanced association rates. PMID:22554127

  5. Nematic fluctuations, fermiology and the pairing potential in iron-based superconductors

    Energy Technology Data Exchange (ETDEWEB)

    Kretzschmar, Florian

    2015-08-18

    The thesis comprises a systematic study on the doping, temperature and momentum dependent electron dynamics in iron-based superconductors using inelastic light scattering. The observation of Bardasis-Schrieffer modes in the excitation spectrum of superconducting Ba{sub 0.6}K{sub 0.4}Fe{sub 2}As{sub 2} is reported and the energy and symmetry dependence of the modes are analyzed. The analysis yields the identification of a strong subdominant component of the interaction potential V(k,k{sup '}). Strong nematic fluctuations are investigated in Ba(Fe{sub 1-x}Co{sub x}){sub 2}As{sub 2}. The nature of the fluctuations and the origin of nematicity in Ba(Fe{sub 1-x}Co{sub x}){sub 2}As{sub 2} are identified.

  6. Cyanine-based probe\\tag-peptide pair fluorescence protein imaging and fluorescence protein imaging methods

    Science.gov (United States)

    Mayer-Cumblidge, M. Uljana; Cao, Haishi

    2013-01-15

    A molecular probe comprises two arsenic atoms and at least one cyanine based moiety. A method of producing a molecular probe includes providing a molecule having a first formula, treating the molecule with HgOAc, and subsequently transmetallizing with AsCl.sub.3. The As is liganded to ethanedithiol to produce a probe having a second formula. A method of labeling a peptide includes providing a peptide comprising a tag sequence and contacting the peptide with a biarsenical molecular probe. A complex is formed comprising the tag sequence and the molecular probe. A method of studying a peptide includes providing a mixture containing a peptide comprising a peptide tag sequence, adding a biarsenical probe to the mixture, and monitoring the fluorescence of the mixture.

  7. A Stereo Pair Based Method for Contactless Evaluation of the Human Breathing Pattern

    Directory of Open Access Journals (Sweden)

    V. S. Gnatiuk

    2015-01-01

    Full Text Available The development of contactless monitoring methods of human vital signs is an important goal for modern medicine. The particular relevance of this issue appears with the control of the patient at home on their own, for example, to estimate the parameters of breathing during sleep, quality assessment and identification of various kinds of sleep disorders, such as, for example, sleep apnea disorder (a condition, which is characterized by the cessation of pulmonary ventilation more than for 10 seconds and fall of blood oxygen saturation.In this article we have implemented and tested an algorithm for non-contact monitoring of breathing pattern by two entrenched webcams aimed at the person. The algorithm is based on using the methods of computer vision and processing of video sequences.Authors pay particular attention to disparity map construction approaches and improving the signal / noise ratio by a combination of known functions comparing the intensity of pixels: AD - a function of absolute differences, and Census function, comparing bit strings of investigated image regions.An important role in the noise minimization plays a simple, but effective assumption for aggregation, the gist of which is that pixels having similar intensity belong to the same structures in the image, and hence have a similar disparity. The variability of input parameters of the method and the ability to adjust the number of iterations provide accurate disparity maps for the input image of almost any quality (testing was conducted for webcams CBR CW 833M.The main result of this approach is the breathing profile based on the reconstructed depth maps, reflecting the respiration rate of the person under examination and presenting data on the amplitude variations of his chest.The main difference of the proposed method from other publications is a high accuracy and the breath profile calculation in real-time. It was achieved through OpenCL technology and parallel computations

  8. Stacked base-pair structures of adenine nucleosides stabilized by the formation of hydrogen-bonding network involving the two sugar groups

    Energy Technology Data Exchange (ETDEWEB)

    Asami, Hiroya [Graduate School of Bio- and Nanosystem Sciences, Yokohama City University, Yokohama 236-0027 (Japan); Yagi, Kiyoshi [Department of Chemistry, School of Chemical Sciences, University of Illinois at Urbana-Champaign, Urbana, IL 61801 (United States); Ohba, Masashi [Yokohama College of Pharmacy, Yokohama 245-0066 (Japan); Urashima, Shu-hei [Graduate School of Bio- and Nanosystem Sciences, Yokohama City University, Yokohama 236-0027 (Japan); Saigusa, Hiroyuki, E-mail: saigusa@yokohama-cu.ac.jp [Graduate School of Bio- and Nanosystem Sciences, Yokohama City University, Yokohama 236-0027 (Japan)

    2013-06-20

    Highlights: ► A combination of laser desorption and supersonic jet-cooling is used to produce base pairs of adenine nucleosides. ► Stacked base-pair structure of N6,N6-dimethyladnosine is identified by IR vibrational spectroscopy. ► Anharmonic vibrational calculation is employed to analyze the vibrational mode coupling in the stacked base pair. - Abstract: We have employed a laser desorption technique combined with supersonic-jet cooling for producing base pairs of adenine nucleosides, adenosine (Ado) and N6,N6-dimethyladenosine (DMAdo) under low-temperature conditions. The resulting base pairs are then ionized through resonant two-photon ionization (R2PI) and analyzed by time-of-flight mass spectrometry. It is found that dimers of these adenine nucleosides are stable, especially in the case of DMAdo, with respect to those of the corresponding bases, i.e., adenine and N6,N6-dimethyladenine. Structural analysis of the DMAdo dimer is performed based on the IR–UV double resonance measurements and theoretical calculations. The result demonstrates that the dimer possesses a stacked structure being stabilized by the formation of hydrogen-bonding network involving the two sugar groups. The occurrence of the frequency shift and broadening is explained satisfactorily based on the anharmonic coupling of the OH stretching modes with specific bending modes and low-frequency modes of base and sugar moieties.

  9. Stereo Vision-Based High Dynamic Range Imaging Using Differently-Exposed Image Pair.

    Science.gov (United States)

    Park, Won-Jae; Ji, Seo-Won; Kang, Seok-Jae; Jung, Seung-Won; Ko, Sung-Jea

    2017-06-22

    In this paper, a high dynamic range (HDR) imaging method based on the stereo vision system is presented. The proposed method uses differently exposed low dynamic range (LDR) images captured from a stereo camera. The stereo LDR images are first converted to initial stereo HDR images using the inverse camera response function estimated from the LDR images. However, due to the limited dynamic range of the stereo LDR camera, the radiance values in under/over-exposed regions of the initial main-view (MV) HDR image can be lost. To restore these radiance values, the proposed stereo matching and hole-filling algorithms are applied to the stereo HDR images. Specifically, the auxiliary-view (AV) HDR image is warped by using the estimated disparity between initial the stereo HDR images and then effective hole-filling is applied to the warped AV HDR image. To reconstruct the final MV HDR, the warped and hole-filled AV HDR image is fused with the initial MV HDR image using the weight map. The experimental results demonstrate objectively and subjectively that the proposed stereo HDR imaging method provides better performance compared to the conventional method.

  10. Stereo Vision-Based High Dynamic Range Imaging Using Differently-Exposed Image Pair

    Directory of Open Access Journals (Sweden)

    Won-Jae Park

    2017-06-01

    Full Text Available In this paper, a high dynamic range (HDR imaging method based on the stereo vision system is presented. The proposed method uses differently exposed low dynamic range (LDR images captured from a stereo camera. The stereo LDR images are first converted to initial stereo HDR images using the inverse camera response function estimated from the LDR images. However, due to the limited dynamic range of the stereo LDR camera, the radiance values in under/over-exposed regions of the initial main-view (MV HDR image can be lost. To restore these radiance values, the proposed stereo matching and hole-filling algorithms are applied to the stereo HDR images. Specifically, the auxiliary-view (AV HDR image is warped by using the estimated disparity between initial the stereo HDR images and then effective hole-filling is applied to the warped AV HDR image. To reconstruct the final MV HDR, the warped and hole-filled AV HDR image is fused with the initial MV HDR image using the weight map. The experimental results demonstrate objectively and subjectively that the proposed stereo HDR imaging method provides better performance compared to the conventional method.

  11. Relay Selection and Subcarrier-Pair Based Energy-Efficient Resource Allocation for Multirelay Cooperative OFDMA Networks

    Directory of Open Access Journals (Sweden)

    Wanming Hao

    2014-01-01

    Full Text Available Energy-efficient resource allocation is investigated for a relay-based multiuser cooperation orthogonal frequency division multiple access (OFDMA uplink system with amplify-and-forward (AF protocol for all relays. The objective is to maximize the total energy efficiency (EE of the uplink system with consideration of some practical limitations, such as the individual power constraint for the users and relays and the quality of service (QoS for every user. We formulate an energy-efficient resource allocation problem that seeks joint optimization of subcarrier pairing, relay selection, subcarrier assignment, and power allocation. Unlike previous optimization throughput models, we transform the considered EE problem in fractional form into an equivalent optimal problem in subtractive form, which is solved by using dual decomposition and subgradient methods. To reduce computation costs, we propose two low-complexity suboptimal schemes. Numerical studies are conducted to evaluate the EE of the proposed algorithms.

  12. Spliceosomal small nuclear RNAs of Tetrahymena thermophila and some possible snRNA-snRNA base-pairing interactions

    DEFF Research Database (Denmark)

    Orum, H; Nielsen, Henrik; Engberg, J

    1991-01-01

    organisms. Furthermore, secondary structures closely similar to phylogenetically proven models can be inferred from the T. thermophila data. Analysis of the snRNA sequences identifies three potential snRNA-snRNA base-pairing interactions, all of which are consistent with available phylogenetic data. Two......We have identified and characterized the full set of spliceosomal small nuclear RNAs (snRNAs; U1, U2, U4, U5 and U6) from the ciliated protozoan Tetrahymena thermophila. With the exception of U4 snRNA, the sizes of the T. thermophila snRNAs are closely similar to their metazoan homologues. The T....... thermophila snRNAs all have unique 5' ends, which start with an adenine residue. In contrast, with the exception of U6, their 3' ends show some size heterogeneity. The primary sequences of the T. thermophila snRNAs contain the sequence motifs shown, or proposed, to be of functional importance in other...

  13. Mechanism of error-free DNA synthesis across N1-methyl-deoxyadenosine by human DNA polymerase-ι

    Energy Technology Data Exchange (ETDEWEB)

    Jain, Rinku; Choudhury, Jayati Roy; Buku, Angeliki; Johnson, Robert E.; Prakash, Louise; Prakash, Satya; Aggarwal, Aneel K.

    2017-03-08

    N1-methyl-deoxyadenosine (1-MeA) is formed by methylation of deoxyadenosine at the N1 atom. 1-MeA presents a block to replicative DNA polymerases due to its inability to participate in Watson-Crick (W-C) base pairing. Here we determine how human DNA polymerase-ι (Polι) promotes error-free replication across 1-MeA. Steady state kinetic analyses indicate that Polι is ~100 fold more efficient in incorporating the correct nucleotide T versus the incorrect nucleotide C opposite 1-MeA. To understand the basis of this selectivity, we determined ternary structures of Polι bound to template 1-MeA and incoming dTTP or dCTP. In both structures, template 1-MeA rotates to the syn conformation but pairs differently with dTTP versus dCTP. Thus, whereas dTTP partakes in stable Hoogsteen base pairing with 1-MeA, dCTP fails to gain a “foothold” and is largely disordered. Together, our kinetic and structural studies show how Polι maintains discrimination between correct and incorrect incoming nucleotide opposite 1-MeA in preserving genome integrity.

  14. Thermodynamic, spectroscopic, and equilibrium binding studies of DNA sequence context effects in four 40 base pair deoxyoligonucleotides.

    Science.gov (United States)

    Vallone, P M; Benight, A S

    2000-07-04

    Effects of different end sequences on melting, circular dichroism spectra (CD), and enzyme binding properties were investigated for four 40 base pair, non-self-complementary duplex DNA oligomers. The center sequences of these oligoduplexes have either of two 22 base pair modules flanked on both sides by sequences differing in AT content. Temperature-induced melting transitions monitored by differential scanning calorimetry (DSC) and ultraviolet absorbance were measured for the six duplexes in buffered 115 mM Na(+) solutions. Values of the melting transition enthalpy, DeltaH(cal), and entropy, DeltaS(cal), were obtained directly from DSC experiments. Melting transition parameters, DeltaH(vH) and DeltaS(vH), were also estimated from a van't Hoff analysis of optical melting curves collected as a function of DNA concentration, assuming that the melting transition is two-state. Melting free energies (20 degrees C) evaluated from DSC melting experiments on the four duplex DNAs ranged from -52.2 to -77.5 kcal/mol. Free energies based on the van't Hoff analysis were -37.9 to -58.8 kcal/mol. Although the values are different, trends in the melting free energies of the four duplex DNAs as a function of sequence were identical in both DSC and optical analyses. Subject to several assumptions, values for the initiation free energy were estimated for each duplex, defined as DeltaG(int) = DeltaG(cal) - DeltaG(pred), where DeltaG(cal) is the experimental free energy at 20 degrees C determined from the experimentially measured values of the transition enthalpy, DeltaH(cal), and entropy, DeltaS(cal). The predicted free energy of the sequence, DeltaG(pred)(20 degrees C), is obtained using published nearest-neighbor sequence stability values. For three of the four duplexes, values of DeltaG(int) are essentially nil. In contrast, the duplex with 81.8% GC has a considerably higher estimate of DeltaG(int) = 7.1 kcal/mol. The CD spectra for the six duplexes collected over the wavelength

  15. Reporter molecules as probes of DNA conformation: structure of a crystalline complex containing 2-methyl-4-nitro-aniline ethylene dimethylammonium hydrobromide - 5-iodocytidylyl(3'-5')guanosine

    Energy Technology Data Exchange (ETDEWEB)

    Vyas, N.K.; Nyas, M.N.; Jain, S.C.; Sobell, H.M.

    1984-05-31

    2-Methyl-4-nitroaniline ethylene dimethylammonium hydrobromide forms a crystalline complex with the self-complementary dinucleoside monophosphate, 5-iodocytidylyl(3'-5')guanosine. The crystals are tetragonal, with a = b = 32.192 A and c = 23.964 A, space group P4/sub 3/2/sub 1/2. The structure has been solved to atomic resolution by Patterson and Fourier methods, and refined by full matrix least squares. 5-Iodocytidylyl(3'-5')guanosine molecules are held together in pairs through Watson-Crick base-pairing, forming an antiparallel duplex structure. Nitroaniline molecules stack above and below guanine-cytosine pairs in this duplex structure. In addition, a third nitroaniline molecule stacks on one of the other two nitroaniline molecules. The asymmetric unit contains two 5-iodocytidylyl(3'-5')guanosine molecules, three nitroaniline molecules, one bromide ion and thirty-one water molecules, at total of 160 atoms. Details of the structure are described. 15 references, 4 figures, 2 tables.

  16. Parallel-stranded DNA with mixed AT/GC composition: role of trans G.C base pairs in sequence dependent helical stability.

    Science.gov (United States)

    Shchyolkina, A K; Borisova, O F; Livshits, M A; Pozmogova, G E; Chernov, B K; Klement, R; Jovin, T M

    2000-08-22

    Parallel-stranded (ps) DNAs with mixed AT/GC content comprising G.C pairs in a varying sequence context have been investigated. Oligonucleotides were devised consisting of two 10-nt strands complementary either in a parallel or in an antiparallel orientation and joined via nonnucleotide linkers so as to form 10-bp ps or aps hairpins. A predominance of intramolecular hairpins over intermolecular duplexes was achieved by choice of experimental conditions and verified by fluorescence determinations yielding estimations of rotational relaxation times and fractional base pairing. A multistate mode of ps hairpin melting was revealed by temperature gradient gel electrophoresis (TGGE). The thermal stability of the ps hairpins with mixed AT/GC content depends strongly on the specific sequence in a manner peculiar to the ps double helix. The thermodynamic effects of incorporating trans G.C base pairs into an AT sequence are context-dependent: an isolated G. C base pair destabilizes the duplex whereas a block of > or =2 consecutive G.C base pairs exerts a stabilizing effect. A multistate heterogeneous zipper model for the thermal denaturation of the hairpins was derived and used in a global minimization procedure to compute the thermodynamic parameters of the ps hairpins from experimental melting data. In 0.1 M LiCl at 3 degrees C, the formation of a trans G.C pair in a GG/CC sequence context is approximately 3 kJ mol(-)(1) more favorable than the formation of a trans A.T pair in an AT/TA sequence context. However, GC/AT contacts contribute a substantial unfavorable free energy difference of approximately 2 kJ mol(-)(1). As a consequence, the base composition and fractional distribution of isolated and clustered G.C base pairs determine the overall stability of ps-DNA with mixed AT/GC sequences. Thus, the stability of ps-DNA comprising successive > or =2 G.C base pairs is greater than that of ps-DNA with an alternating AT sequence, whereas increasing the number of AT

  17. Distant neighbor base sequence context effects in human nucleotide excision repair of a benzo[a]pyrene-derived DNA lesion.

    Science.gov (United States)

    Cai, Yuqin; Kropachev, Konstantin; Xu, Rong; Tang, Yijin; Kolbanovskii, Marina; Kolbanovskii, Alexander; Amin, Shantu; Patel, Dinshaw J; Broyde, Suse; Geacintov, Nicholas E

    2010-06-11

    The effects of non-nearest base sequences, beyond the nucleotides flanking a DNA lesion on either side, on nucleotide excision repair (NER) in extracts from human cells were investigated. We constructed two duplexes containing the same minor groove-aligned 10S (+)-trans-anti-B[a]P-N(2)-dG (G*) DNA adduct, derived from the environmental carcinogen benzo[a]pyrene (B[a]P): 5'-C-C-A-T-C-G*-C-T-A-C-C-3' (CG*C-I), and 5'-C-A-C3-A4-C5-G*-C-A-C-A-C-3' (CG*C-II). We used polyacrylamide gel electrophoresis to compare the extent of DNA bending, and molecular dynamics simulations to analyze the structural characteristics of these two DNA duplexes. The NER efficiencies are 1.6(+/-0.2)-fold greater in the case of the CG*C-II than the CG*C-I sequence context in 135-mer duplexes. Gel electrophoresis and self-ligation circularization experiments revealed that the CG*C-II duplex is more bent than the CG*C-I duplex, while molecular dynamics simulations showed that the unique -C3-A4-C5- segment in the CG*C-II duplex plays a key role. The presence of a minor groove-positioned guanine amino group, the Watson-Crick partner to C3, acts as a wedge; facilitated by a highly deformable local -C3-A4- base step, this amino group allows the B[a]P ring system to produce a more enlarged minor groove in CG*C-II than in CG*C-I, as well as a local untwisting and enlarged and flexible Roll only in the CG*C-II sequence. These structural properties fit well with our earlier findings that in the case of the family of minor groove 10S (+)-trans-anti-B[a]P-N(2)-dG lesions, flexible bends and enlarged minor groove widths constitute NER recognition signals, and extend our understanding of sequence context effects on NER to the neighbors that are distant to the lesion. Copyright 2010 Elsevier Ltd. All rights reserved.

  18. Recent advances in mechanism-based chemotherapy drug-siRNA pairs in co-delivery systems for cancer: A review.

    Science.gov (United States)

    Wang, Mingfang; Wang, Jinyu; Li, Bingcheng; Meng, Lingxin; Tian, Zhaoxing

    2017-09-01

    Co-delivery of chemotherapy drugs and siRNA for cancer therapy has achieved remarkable results according to synergistic/combined antitumor effects, and is recognized as a promising therapeutic modality. However, little attention has been paid to the extremely complex mechanisms of chemotherapy drug-siRNA pairs during co-delivery process. Proper selection of chemotherapy drug-siRNA pairs is beneficial for achieving desirable cancer therapeutic effects. Exploring the inherent principles during chemotherapy drug-siRNA pair selection for co-delivery would greatly enhanced therapeutic efficiency. To achieve ideal results, this article will systematically review current different mechanism-based chemotherapy drug-siRNA pairs for co-delivery in cancer treatment. Large-scale library screening of recent different chemotherapy drug-siRNA pairs for co-delivery would help to establish the chemotherapy drug-siRNA pair selection principle, which could pave the way for co-delivery of chemotherapy drugs and siRNA for cancer treatment in clinic. Following the inherent principle of chemotherapy drug-siRNA pair, more effective co-delivery vectors can be designed in the future. Copyright © 2017 Elsevier B.V. All rights reserved.

  19. Implications for Damage Recognition during Dpo4-Mediated Mutagenic Bypass of m1G and m3C Lesions

    Science.gov (United States)

    Rechkoblit, Olga; Delaney, James C.; Essigmann, John M.; Patel, Dinshaw J.

    2012-01-01

    DNA is susceptible to alkylation damage by a number of environmental agents that modify the Watson-Crick edge of the bases. Such lesions, if not repaired, may be bypassed by Y-family DNA polymerases. The bypass polymerase Dpo4 is strongly inhibited by 1-methylguanine (m1G) and 3-methylcytosine (m3C), with nucleotide incorporation opposite these lesions being predominantly mutagenic. Further, extension following insertion of both correct and incorrect bases, introduces additional base substitution and deletion errors. Crystal structures of the Dpo4 ternary extension complexes with correct and mismatched 3′-terminal primer bases opposite the lesions reveal that both m1G and m3C remain positioned within the DNA template/primer helix. However, both correct and incorrect pairing partners exhibit pronounced primer terminal nucleotide distortion, being primarily evicted from the DNA helix when opposite m1G or misaligned when pairing with m3C. Our studies provide insights into mechanisms related to hindered and mutagenic bypass of methylated lesions and models associated with damage recognition by repair demethylases. PMID:21645853

  20. Implications for Damage Recognition during Dpo4-Mediated Mutagenic Bypass of m1G and m3C Lesions

    Energy Technology Data Exchange (ETDEWEB)

    Rechkoblit, Olga; Delaney, James C.; Essigmann, John M.; Patel, Dinshaw J. (MIT); (MSKCC)

    2012-05-08

    DNA is susceptible to alkylation damage by a number of environmental agents that modify the Watson-Crick edge of the bases. Such lesions, if not repaired, may be bypassed by Y-family DNA polymerases. The bypass polymerase Dpo4 is strongly inhibited by 1-methylguanine (m1G) and 3-methylcytosine (m3C), with nucleotide incorporation opposite these lesions being predominantly mutagenic. Further, extension after insertion of both correct and incorrect bases, introduces additional base substitution and deletion errors. Crystal structures of the Dpo4 ternary extension complexes with correct and mismatched 3'-terminal primer bases opposite the lesions reveal that both m1G and m3C remain positioned within the DNA template/primer helix. However, both correct and incorrect pairing partners exhibit pronounced primer terminal nucleotide distortion, being primarily evicted from the DNA helix when opposite m1G or misaligned when pairing with m3C. Our studies provide insights into mechanisms related to hindered and mutagenic bypass of methylated lesions and models associated with damage recognition by repair demethylases.

  1. Preferential cis-syn thymine dimer bypass by DNA polymerase eta occurs with biased fidelity.

    Science.gov (United States)

    McCulloch, Scott D; Kokoska, Robert J; Masutani, Chikahide; Iwai, Shigenori; Hanaoka, Fumio; Kunkel, Thomas A

    2004-03-04

    Human DNA polymerase eta (Pol eta) modulates susceptibility to skin cancer by promoting DNA synthesis past sunlight-induced cyclobutane pyrimidine dimers that escape nucleotide excision repair (NER). Here we have determined the efficiency and fidelity of dimer bypass. We show that Pol eta copies thymine dimers and the flanking bases with higher processivity than it copies undamaged DNA, and then switches to less processive synthesis. This ability of Pol eta to sense the dimer location as synthesis proceeds may facilitate polymerase switching before and after lesion bypass. Pol eta bypasses a dimer with low fidelity and with higher error rates at the 3' thymine than at the 5' thymine. A similar bias is seen with Sulfolobus solfataricus DNA polymerase 4, which forms a Watson-Crick base pair at the 3' thymine of a dimer but a Hoogsteen base pair at the 5' thymine (ref. 3). Ultraviolet-induced mutagenesis is also higher at the 3' base of dipyrimidine sequences. Thus, in normal people and particularly in individuals with NER-defective xeroderma pigmentosum who accumulate dimers, errors made by Pol eta during dimer bypass could contribute to mutagenesis and skin cancer.

  2. Structural Insights into Conformation Differences between DNA/TNA and RNA/TNA Chimeric Duplexes.

    Science.gov (United States)

    Anosova, Irina; Kowal, Ewa A; Sisco, Nicholas J; Sau, Sujay; Liao, Jen-Yu; Bala, Saikat; Rozners, Eriks; Egli, Martin; Chaput, John C; Van Horn, Wade D

    2016-09-15

    Threose nucleic acid (TNA) is an artificial genetic polymer capable of heredity and evolution, and is studied in the context of RNA chemical etiology. It has a four-carbon threose backbone in place of the five-carbon ribose of natural nucleic acids, yet forms stable antiparallel complementary Watson-Crick homoduplexes and heteroduplexes with DNA and RNA. TNA base-pairs more favorably with RNA than with DNA but the reason is unknown. Here, we employed NMR, ITC, UV, and CD to probe the structural and dynamic properties of heteroduplexes of RNA/TNA and DNA/TNA. The results indicate that TNA templates the structure of heteroduplexes, thereby forcing an A-like helical geometry. NMR measurement of kinetic and thermodynamic parameters for individual base pair opening events reveal unexpected asymmetric "breathing" fluctuations of the DNA/TNA helix. The results suggest that DNA is unable to fully adapt to the conformational constraints of the rigid TNA backbone and that nucleic acid breathing dynamics are determined from both backbone and base contributions. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  3. Prevalence of syn nucleobases in the active sites of functional RNAs

    Science.gov (United States)

    Sokoloski, Joshua E.; Godfrey, Stephanie A.; Dombrowski, Sarah E.; Bevilacqua, Philip C.

    2011-01-01

    Biological RNAs, like their DNA counterparts, contain helical stretches, which have standard Watson-Crick base pairs in the anti conformation. Most functional RNAs also adopt geometries with far greater complexity such as bulges, loops, and multihelical junctions. Occasionally, nucleobases in these regions populate the syn conformation wherein the base resides close to or over the ribose sugar, which leads to a more compact state. The importance of the syn conformation to RNA function is largely unknown. In this study, we analyze 51 RNAs with tertiary structure, including aptamers, riboswitches, ribozymes, and ribosomal RNAs, for number, location, and properties of syn nucleobases. These RNAs represent the set of nonoverlapping, moderate- to high-resolution structures available at present. We find that syn nucleobases are much more common among purines than pyrimidines, and that they favor C2′-endo-like conformations especially among those nucleobases in the intermediate syn conformation. Strikingly, most syn nucleobases participate in tertiary stacking and base-pairing interactions: Inspection of RNA structures revealed that the majority of the syn nucleobases are in regions assigned to function, with many syn nucleobases interacting directly with a ligand or ribozyme active site. These observations suggest that judicious placement of conformationally restricted nucleotides biased into the syn conformation could enhance RNA folding and catalysis. Such changes could also be useful for locking RNAs into functionally competent folds for use in X-ray crystallography and NMR. PMID:21873463

  4. A process-based approach to characterizing the effect of acute alprazolam challenge on visual paired associate learning and memory in healthy older adults.

    Science.gov (United States)

    Pietrzak, Robert H; Scott, James Cobb; Harel, Brian T; Lim, Yen Ying; Snyder, Peter J; Maruff, Paul

    2012-11-01

    Alprazolam is a benzodiazepine that, when administered acutely, results in impairments in several aspects of cognition, including attention, learning, and memory. However, the profile (i.e., component processes) that underlie alprazolam-related decrements in visual paired associate learning has not been fully explored. In this double-blind, placebo-controlled, randomized cross-over study of healthy older adults, we used a novel, "process-based" computerized measure of visual paired associate learning to examine the effect of a single, acute 1-mg dose of alprazolam on component processes of visual paired associate learning and memory. Acute alprazolam challenge was associated with a large magnitude reduction in visual paired associate learning and memory performance (d = 1.05). Process-based analyses revealed significant increases in distractor, exploratory, between-search, and within-search error types. Analyses of percentages of each error type suggested that, relative to placebo, alprazolam challenge resulted in a decrease in the percentage of exploratory errors and an increase in the percentage of distractor errors, both of which reflect memory processes. Results of this study suggest that acute alprazolam challenge decreases visual paired associate learning and memory performance by reducing the strength of the association between pattern and location, which may reflect a general breakdown in memory consolidation, with less evidence of reductions in executive processes (e.g., working memory) that facilitate visual paired associate learning and memory. Copyright © 2012 John Wiley & Sons, Ltd.

  5. Exploring a DNA Sequence for the Three-Dimensional Structure Determination of a Silver(I)-Mediated C-C Base Pair in a DNA Duplex By (1)H NMR Spectroscopy.

    Science.gov (United States)

    Dairaku, Takenori; Furuita, Kyoko; Sato, Hajime; Kondo, Yoshinori; Kojima, Chojiro; Ono, Akira; Tanaka, Yoshiyuki

    2015-01-01

    Recently, we discovered novel silver(I)-mediated cytosine-cytosine base pair (C-Ag(I)-C) in DNA duplexes. To understand the properties of these base pairs, we searched for a DNA sequence that can be used in NMR structure determination. After extensive sequence optimizations, a non-symmetric 15-base-paired DNA duplex with a single C-Ag(I)-C base pair flanked by 14 A-T base pairs was selected. In spite of its challenging length for NMR measurements (30 independent residues) with small sequence variation, we could assign most non-exchangeable protons (254 out of 270) and imino protons for structure determination.

  6. Multispectroscopic and Theoretical Exploration of the Comparative Binding Aspects of Bioflavonoid Fisetin with Triple- and Double-Helical Forms of RNA.

    Science.gov (United States)

    Bhuiya, Sutanwi; Haque, Lucy; Goswami, Rapti; Das, Suman

    2017-12-14

    The interactions of RNA triplex (U.A*U) and duplex (A.U) with naturally occurring flavonoid fisetin (FTN) have been examined at pH 7.0 using various spectroscopic, viscometric, and theoretical studies. Experimental observations showed that the ligand binds with both double- and triple-helical forms of RNA, although the binding affinity is greater for the triplex structure (5.94 × 106 M-1) compared to that for the duplex counterpart (1.0 × 105 M-1). Thermal melting experiments revealed that the Hoogsteen base-paired third strand of triplex was stabilized to a greater extent (∼14 °C) compared with the Watson-Crick base-paired second strand (∼4 °C) in the presence of FTN. From fluorimetric study, we observed that U.A*U and A.U primarily bind to the photoproduced tautomer of FTN in the excited state. Steady-state and time-resolved anisotropy measurements illustrate considerable modulations of the spectroscopic properties of the tautomeric FTN within the RNA environment. Viscometric, fluorescence quenching, and thermal melting studies all together support the mode of binding to be intercalation. Theoretical study explains the experimental absorption and emission (dual fluorescence) behavior of FTN along with the excited-state intramolecular proton transfer process.

  7. Parallel-stranded DNA and RNA duplexes - structural features and potential applications.

    Science.gov (United States)

    Szabat, Marta; Kierzek, Ryszard

    2017-12-01

    Nowadays, decades after the discovery of the right-handed B form of DNA, it is well known that nucleic acids have great conformational flexibility, exhibiting a large degree of variation in their structure. In nature, DNA and RNA exist in an antiparallel orientation, stabilized by Watson-Crick base pairs. However, in some cases, nucleic acid fragments with specific nucleotide sequences can adopt a parallel orientation involving non-canonical base pairing. Interestingly, parallel-stranded duplexes have been found in specific chromosome regions. Furthermore, parallel oriented regions have also been found in bacterial (Escherichia coli, Listeria innocua) and insect genomes (Drosophila melanogaster). These unusual structures could have a remarkable evolutionary role, as well as significant impact on biological processes. For example, parallel stretches were shown to be involved in processing the 3' ends of mRNAs and in specific gene silencing. Moreover, certain types of parallel-stranded duplexes may be useful tools, with several practical applications. They can constitute excellent templates for the formation of other structures and for the development of antigene and antisense approaches. © 2017 Federation of European Biochemical Societies.

  8. Inverse folding of RNA pseudoknot structures.

    Science.gov (United States)

    Gao, James Zm; Li, Linda Ym; Reidys, Christian M

    2010-06-23

    RNA exhibits a variety of structural configurations. Here we consider a structure to be tantamount to the noncrossing Watson-Crick and G-U-base pairings (secondary structure) and additional cross-serial base pairs. These interactions are called pseudoknots and are observed across the whole spectrum of RNA functionalities. In the context of studying natural RNA structures, searching for new ribozymes and designing artificial RNA, it is of interest to find RNA sequences folding into a specific structure and to analyze their induced neutral networks. Since the established inverse folding algorithms, RNAinverse, RNA-SSD as well as INFO-RNA are limited to RNA secondary structures, we present in this paper the inverse folding algorithm Inv which can deal with 3-noncrossing, canonical pseudoknot structures. In this paper we present the inverse folding algorithm Inv. We give a detailed analysis of Inv, including pseudocodes. We show that Inv allows to design in particular 3-noncrossing nonplanar RNA pseudoknot 3-noncrossing RNA structures-a class which is difficult to construct via dynamic programming routines. Inv is freely available at http://www.combinatorics.cn/cbpc/inv.html. The algorithm Inv extends inverse folding capabilities to RNA pseudoknot structures. In comparison with RNAinverse it uses new ideas, for instance by considering sets of competing structures. As a result, Inv is not only able to find novel sequences even for RNA secondary structures, it does so in the context of competing structures that potentially exhibit cross-serial interactions.

  9. Investigation on the ion pair amphiphiles and their in vitro release of amantadine drug based on PLGA–PEG–PLGA gel

    Energy Technology Data Exchange (ETDEWEB)

    Yang, Xiaoxia, E-mail: yxx-678@163.com; Ji, Xiaoqing; Shi, Chunhuan; Liu, Jing [Shandong University, School of Pharmaceutical Science and Center for Pharmaceutical Research & Drug Delivery Systems (China); Wang, Haiyang [Institute of Materia Medica Shandong Academy of Medical Sciences, Shandong Taitian Newdrug Discovery Co.Ltd (China); Luan, Yuxia, E-mail: yuxialuan@sdu.edu.cn [Shandong University, School of Pharmaceutical Science and Center for Pharmaceutical Research & Drug Delivery Systems (China)

    2014-12-15

    The amantadine drug and oleic acid surfactant are used to form amantadine-based ion pair amphiphiles based on proton transfer reaction between the drug and the surfactant molecules. The ion pair amphiphiles are characterized by {sup 1}H-nuclear magnetic resonance, Fourier transform infrared spectroscopy, and X-ray diffraction. Self-assembly properties of amantadine-based ion pair amphiphiles are studied by surface tension determination, transmission electron microscopy, zeta potential, and dynamic light scattering. The aggregation behavior studies indicate that the as-prepared ion pair amphiphiles can self-assemble into vesicles with the size of 200–300 nm in aqueous solution. The drug release results show that the amantadine release rate could be well controlled by incorporating the amantadine-based ion pair vesicles in poly (lactic-co-glycolic acid)-poly (ethylene glycol)-poly (lactic-co-glycolic acid) (PLGA–PEG–PLGA) copolymer hydrogel. The drug release from the AT–OA vesicle-loaded PLGA–PEG–PLGA hydrogel is significantly inhibited in comparison with the AT-loaded PLGA–PEG–PLGA hydrogel. The present work thus demonstrates that the vesicle-loaded hydrogel is a good candidate for the drug delivery system with long-term controlled drug release behavior.

  10. Investigation on the ion pair amphiphiles and their in vitro release of amantadine drug based on PLGA-PEG-PLGA gel

    Science.gov (United States)

    Yang, Xiaoxia; Ji, Xiaoqing; Shi, Chunhuan; Liu, Jing; Wang, Haiyang; Luan, Yuxia

    2014-12-01

    The amantadine drug and oleic acid surfactant are used to form amantadine-based ion pair amphiphiles based on proton transfer reaction between the drug and the surfactant molecules. The ion pair amphiphiles are characterized by 1H-nuclear magnetic resonance, Fourier transform infrared spectroscopy, and X-ray diffraction. Self-assembly properties of amantadine-based ion pair amphiphiles are studied by surface tension determination, transmission electron microscopy, zeta potential, and dynamic light scattering. The aggregation behavior studies indicate that the as-prepared ion pair amphiphiles can self-assemble into vesicles with the size of 200-300 nm in aqueous solution. The drug release results show that the amantadine release rate could be well controlled by incorporating the amantadine-based ion pair vesicles in poly (lactic-co-glycolic acid)-poly (ethylene glycol)-poly (lactic-co-glycolic acid) (PLGA-PEG-PLGA) copolymer hydrogel. The drug release from the AT-OA vesicle-loaded PLGA-PEG-PLGA hydrogel is significantly inhibited in comparison with the AT-loaded PLGA-PEG-PLGA hydrogel. The present work thus demonstrates that the vesicle-loaded hydrogel is a good candidate for the drug delivery system with long-term controlled drug release behavior.

  11. Deciphering molecular mechanisms of arginine deiminase-based therapy - Comparative response analysis in paired human primary and recurrent glioblastomas.

    Science.gov (United States)

    Maletzki, Claudia; Rosche, Yvonne; Riess, Christin; Scholz, Aline; William, Doreen; Classen, Carl Friedrich; Kreikemeyer, Bernd; Linnebacher, Michael; Fiedler, Tomas

    2017-12-25

    Arginine auxotrophy constitutes the Achilles' heel for several tumors, among them glioblastoma multiforme (GBM). Hence, arginine-depleting enzymes such as arginine deiminase (ADI) from Streptococcus pyogenes are promising for treatment of primary and maybe even refractory GBM. Based on our previous study in which ADI-susceptibility was shown on a panel of patient-derived GBM cell lines, we here aimed at deciphering underlying molecular mechanisms of ADI-mediated growth inhibition. We found that ADI (35 mU/mL) initially induces a cellular stress-response that is characterized by upregulation of genes primarily belonging to the heat-shock protein family. In addition to autophagocytosis, we show for the first time that senescence constitutes another cellular response mechanism upon ADI-treatment and that this bacterial enzyme is able to act as radiosensitizer (¼ cases). Long-term treatment schedules revealed no resistance development, with treated cells showing morphological signs of cell stress. Next, several combination strategies were employed to optimize ADI-based treatment. Simultaneous and sequential S. pyogenes ADI-based combinations included substances acting at different molecular pathways (curcumin, resveratrol, quinacrine, and sorafenib, 2 × 72 h treatment). Adding drugs to GBM cell lines (n = 4, including a matched pair of primary and recurrent GBM in one case) accelerated and potentiated ADI-mediated cytotoxicity. Autophagy was identified as the main cause of tumor growth inhibition. Of note, residual cells again showed classical signs of senescence in most combinations. Our results suggest an alternative treatment regimen for this fatal cancer type which circumvents many of the traditional barriers. Using the metabolic defect in GBM thus warrants further (pre-) clinical evaluation. Copyright © 2017 Elsevier B.V. All rights reserved.

  12. 19-base pair deletion polymorphism of the dihydrofolate reductase (DHFR gene: maternal risk of Down syndrome and folate metabolism

    Directory of Open Access Journals (Sweden)

    Cristiani Cortez Mendes

    Full Text Available CONTEXT AND OBJECTIVE: Polymorphisms in genes involved in folate metabolism may modulate the maternal risk of Down syndrome (DS. This study evaluated the influence of a 19-base pair (bp deletion polymorphism in intron-1 of the dihydrofolate reductase (DHFR gene on the maternal risk of DS, and investigated the association between this polymorphism and variations in the concentrations of serum folate and plasma homocysteine (Hcy and plasma methylmalonic acid (MMA. DESIGN AND SETTING: Analytical cross-sectional study carried out at Faculdade de Medicina de São José do Rio Preto (Famerp. METHODS: 105 mothers of individuals with free trisomy of chromosome 21, and 184 control mothers were evaluated. Molecular analysis on the polymorphism was performed using the polymerase chain reaction (PCR through differences in the sizes of fragments. Folate was quantified by means of chemiluminescence, and Hcy and MMA by means of liquid chromatography and sequential mass spectrometry. RESULTS: There was no difference between the groups in relation to allele and genotype frequencies (P = 0.44; P = 0.69, respectively. The folate, Hcy and MMA concentrations did not differ significantly between the groups, in relation to genotypes (P > 0.05. CONCLUSIONS: The 19-bp deletion polymorphism of DHFR gene was not a maternal risk factor for DS and was not related to variations in the concentrations of serum folate and plasma Hcy and MMA in the study population.

  13. Deep RNA sequencing reveals the smallest known mitochondrial micro exon in animals: The placozoan cox1 single base pair exon.

    Science.gov (United States)

    Osigus, Hans-Jürgen; Eitel, Michael; Schierwater, Bernd

    2017-01-01

    The phylum Placozoa holds a key position for our understanding of the evolution of mitochondrial genomes in Metazoa. Placozoans possess large mitochondrial genomes which harbor several remarkable characteristics such as a fragmented cox1 gene and trans-splicing cox1 introns. A previous study also suggested the existence of cox1 mRNA editing in Trichoplax adhaerens, yet the only formally described species in the phylum Placozoa. We have analyzed RNA-seq data of the undescribed sister species, Placozoa sp. H2 ("Panama" clone), with special focus on the mitochondrial mRNA. While we did not find support for a previously postulated cox1 mRNA editing mechanism, we surprisingly found two independent transcripts representing intermediate cox1 mRNA splicing stages. Both transcripts consist of partial cox1 exon as well as overlapping intron fragments. The data suggest that the cox1 gene harbors a single base pair (cytosine) micro exon. Furthermore, conserved group I intron structures flank this unique micro exon also in other placozoans. We discuss the evolutionary origin of this micro exon in the context of a self-splicing intron gain in the cox1 gene of the last common ancestor of extant placozoans.

  14. High yield and ultrafast sources of electrically triggered entangled-photon pairs based on strain-tunable quantum dots.

    Science.gov (United States)

    Zhang, Jiaxiang; Wildmann, Johannes S; Ding, Fei; Trotta, Rinaldo; Huo, Yongheng; Zallo, Eugenio; Huber, Daniel; Rastelli, Armando; Schmidt, Oliver G

    2015-12-01

    Triggered sources of entangled photon pairs are key components in most quantum communication protocols. For practical quantum applications, electrical triggering would allow the realization of compact and deterministic sources of entangled photons. Entangled-light-emitting-diodes based on semiconductor quantum dots are among the most promising sources that can potentially address this task. However, entangled-light-emitting-diodes are plagued by a source of randomness, which results in a very low probability of finding quantum dots with sufficiently small fine structure splitting for entangled-photon generation (∼10(-2)). Here we introduce strain-tunable entangled-light-emitting-diodes that exploit piezoelectric-induced strains to tune quantum dots for entangled-photon generation. We demonstrate that up to 30% of the quantum dots in strain-tunable entangled-light-emitting-diodes emit polarization-entangled photons. An entanglement fidelity as high as 0.83 is achieved with fast temporal post selection. Driven at high speed, that is 400 MHz, strain-tunable entangled-light-emitting-diodes emerge as promising devices for high data-rate quantum applications.

  15. Whole genome sequencing reveals a 7 base-pair deletion in DMD exon 42 in a dog with muscular dystrophy.

    Science.gov (United States)

    Nghiem, Peter P; Bello, Luca; Balog-Alvarez, Cindy; López, Sara Mata; Bettis, Amanda; Barnett, Heather; Hernandez, Briana; Schatzberg, Scott J; Piercy, Richard J; Kornegay, Joe N

    2017-04-01

    Dystrophin is a key cytoskeletal protein coded by the Duchenne muscular dystrophy (DMD) gene located on the X-chromosome. Truncating mutations in the DMD gene cause loss of dystrophin and the classical DMD clinical syndrome. Spontaneous DMD gene mutations and associated phenotypes occur in several other species. The mdx mouse model and the golden retriever muscular dystrophy (GRMD) canine model have been used extensively to study DMD disease pathogenesis and show efficacy and side effects of putative treatments. Certain DMD gene mutations in high-risk, the so-called hot spot areas can be particularly helpful in modeling molecular therapies. Identification of specific mutations has been greatly enhanced by new genomic methods. Whole genome, next generation sequencing (WGS) has been recently used to define DMD patient mutations, but has not been used in dystrophic dogs. A dystrophin-deficient Cavalier King Charles Spaniel (CKCS) dog was evaluated at the functional, histopathological, biochemical, and molecular level. The affected dog's phenotype was compared to the previously reported canine dystrophinopathies. WGS was then used to detect a 7 base pair deletion in DMD exon 42 (c.6051-6057delTCTCAAT mRNA), predicting a frameshift in gene transcription and truncation of dystrophin protein translation. The deletion was confirmed with conventional PCR and Sanger sequencing. This mutation is in a secondary DMD gene hotspot area distinct from the one identified earlier at the 5' donor splice site of intron 50 in the CKCS breed.

  16. Evaluation of the comprehensive palatability of Japanese sake paired with dishes by multiple regression analysis based on subdomains.

    Science.gov (United States)

    Nakamura, Ryo; Nakano, Kumiko; Tamura, Hiroyasu; Mizunuma, Masaki; Fushiki, Tohru; Hirata, Dai

    2017-08-01

    Many factors contribute to palatability. In order to evaluate the palatability of Japanese alcohol sake paired with certain dishes by integrating multiple factors, here we applied an evaluation method previously reported for palatability of cheese by multiple regression analysis based on 3 subdomain factors (rewarding, cultural, and informational). We asked 94 Japanese participants/subjects to evaluate the palatability of sake (1st evaluation/E1 for the first cup, 2nd/E2 and 3rd/E3 for the palatability with aftertaste/afterglow of certain dishes) and to respond to a questionnaire related to 3 subdomains. In E1, 3 factors were extracted by a factor analysis, and the subsequent multiple regression analyses indicated that the palatability of sake was interpreted by mainly the rewarding. Further, the results of attribution-dissections in E1 indicated that 2 factors (rewarding and informational) contributed to the palatability. Finally, our results indicated that the palatability of sake was influenced by the dish eaten just before drinking.

  17. Base pairing interaction between 5'- and 3'-UTRs controls icaR mRNA translation in Staphylococcus aureus.

    Science.gov (United States)

    Ruiz de los Mozos, Igor; Vergara-Irigaray, Marta; Segura, Victor; Villanueva, Maite; Bitarte, Nerea; Saramago, Margarida; Domingues, Susana; Arraiano, Cecilia M; Fechter, Pierre; Romby, Pascale; Valle, Jaione; Solano, Cristina; Lasa, Iñigo; Toledo-Arana, Alejandro

    2013-01-01

    The presence of regulatory sequences in the 3' untranslated region (3'-UTR) of eukaryotic mRNAs controlling RNA stability and translation efficiency is widely recognized. In contrast, the relevance of 3'-UTRs in bacterial mRNA functionality has been disregarded. Here, we report evidences showing that around one-third of the mapped mRNAs of the major human pathogen Staphylococcus aureus carry 3'-UTRs longer than 100-nt and thus, potential regulatory functions. We selected the long 3'-UTR of icaR, which codes for the repressor of the main exopolysaccharidic compound of the S. aureus biofilm matrix, to evaluate the role that 3'-UTRs may play in controlling mRNA expression. We showed that base pairing between the 3'-UTR and the Shine-Dalgarno (SD) region of icaR mRNA interferes with the translation initiation complex and generates a double-stranded substrate for RNase III. Deletion or substitution of the motif (UCCCCUG) within icaR 3'-UTR was sufficient to abolish this interaction and resulted in the accumulation of IcaR repressor and inhibition of biofilm development. Our findings provide a singular example of a new potential post-transcriptional regulatory mechanism to modulate bacterial gene expression through the interaction of a 3'-UTR with the 5'-UTR of the same mRNA.

  18. Base pairing interaction between 5'- and 3'-UTRs controls icaR mRNA translation in Staphylococcus aureus.

    Directory of Open Access Journals (Sweden)

    Igor Ruiz de los Mozos

    Full Text Available The presence of regulatory sequences in the 3' untranslated region (3'-UTR of eukaryotic mRNAs controlling RNA stability and translation efficiency is widely recognized. In contrast, the relevance of 3'-UTRs in bacterial mRNA functionality has been disregarded. Here, we report evidences showing that around one-third of the mapped mRNAs of the major human pathogen Staphylococcus aureus carry 3'-UTRs longer than 100-nt and thus, potential regulatory functions. We selected the long 3'-UTR of icaR, which codes for the repressor of the main exopolysaccharidic compound of the S. aureus biofilm matrix, to evaluate the role that 3'-UTRs may play in controlling mRNA expression. We showed that base pairing between the 3'-UTR and the Shine-Dalgarno (SD region of icaR mRNA interferes with the translation initiation complex and generates a double-stranded substrate for RNase III. Deletion or substitution of the motif (UCCCCUG within icaR 3'-UTR was sufficient to abolish this interaction and resulted in the accumulation of IcaR repressor and inhibition of biofilm development. Our findings provide a singular example of a new potential post-transcriptional regulatory mechanism to modulate bacterial gene expression through the interaction of a 3'-UTR with the 5'-UTR of the same mRNA.

  19. A 30-base pair element is responsible for the myeloid-specific activity of the human neutrophil elastase promoter.

    Science.gov (United States)

    Srikanth, S; Rado, T A

    1994-12-23

    Human neutrophil elastase (HNE), a serine protease, is expressed only in the promyelocytic stages of granulocyte maturation. We examined several regions of the promoter for transcriptional activity and report that a 30-base pair (bp) element located between -76 and -106 in the 5'-flanking region of HNE is sufficient for myeloid-specific expression of HNE. Gel shift assays using nuclear extracts from myeloid and non-myeloid cells reveal several myeloid-specific complexes binding to the 30-bp element. Examination of DNA-protein interactions shows that at least two myeloid-specific proteins of 38 and 55 kDa bind to this element. DNase I protection analysis reveals two distinct footprints between -80 to -91 and -94 to -104 within this element. Transient expression studies using deletion constructs of the HNE 5'-flanking region show that the 30-bp element is active in myeloid cells K 562 and U 937 but not in HeLa cells. Internal deletion of this element results in a 60-85% loss of promoter activity in myeloid cells. Additional functional studies also show that a 19-bp region between -112 and -131 contributes to transcriptional activity of the elastase promoter as well.

  20. Paired fuzzy sets

    DEFF Research Database (Denmark)

    Rodríguez, J. Tinguaro; Franco de los Ríos, Camilo; Gómez, Daniel

    2015-01-01

    In this paper we want to stress the relevance of paired fuzzy sets, as already proposed in previous works of the authors, as a family of fuzzy sets that offers a unifying view for different models based upon the opposition of two fuzzy sets, simply allowing the existence of different types of neu...

  1. Structure and conformational dynamics of scaffolded DNA origami nanoparticles.

    Science.gov (United States)

    Pan, Keyao; Bricker, William P; Ratanalert, Sakul; Bathe, Mark

    2017-06-20

    Synthetic DNA is a highly programmable nanoscale material that can be designed to self-assemble into 3D structures that are fully determined by underlying Watson-Crick base pairing. The double crossover (DX) design motif has demonstrated versatility in synthesizing arbitrary DNA nanoparticles on the 5-100 nm scale for diverse applications in biotechnology. Prior computational investigations of these assemblies include all-atom and coarse-grained modeling, but modeling their conformational dynamics remains challenging due to their long relaxation times and associated computational cost. We apply all-atom molecular dynamics and coarse-grained finite element modeling to DX-based nanoparticles to elucidate their fine-scale and global conformational structure and dynamics. We use our coarse-grained model with a set of secondary structural motifs to predict the equilibrium solution structures of 45 DX-based DNA origami nanoparticles including a tetrahedron, octahedron, icosahedron, cuboctahedron and reinforced cube. Coarse-grained models are compared with 3D cryo-electron microscopy density maps for these five DNA nanoparticles and with all-atom molecular dynamics simulations for the tetrahedron and octahedron. Our results elucidate non-intuitive atomic-level structural details of DX-based DNA nanoparticles, and offer a general framework for efficient computational prediction of global and local structural and mechanical properties of DX-based assemblies that are inaccessible to all-atom based models alone. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  2. Pair-Bonded Humans Conform to Sexual Stereotypes in Web-Based Advertisements for Extra-Marital Partners

    OpenAIRE

    Trish C. Kelley; Hare, James F.

    2010-01-01

    Partners advertisements provide advertisers with access to a large pool of prospective mates, and have proven useful in documenting sex differences in human mating preferences. We coded data from an Internet site (AshleyMadison.com) catering to advertisers engaged in existing pair-bonded relationships. While we predicted that pair-bonding may liberate advertisers from conforming to sexual stereotypes of male promiscuity and female choosiness, our results are uniformly consistent with those st...

  3. ACL2 Meets the GPU: Formalizing a CUDA-based Parallelizable All-Pairs Shortest Path Algorithm in ACL2

    Directory of Open Access Journals (Sweden)

    David S. Hardin

    2013-04-01

    Full Text Available As Graphics Processing Units (GPUs have gained in capability and GPU development environments have matured, developers are increasingly turning to the GPU to off-load the main host CPU of numerically-intensive, parallelizable computations. Modern GPUs feature hundreds of cores, and offer programming niceties such as double-precision floating point, and even limited recursion. This shift from CPU to GPU, however, raises the question: how do we know that these new GPU-based algorithms are correct? In order to explore this new verification frontier, we formalized a parallelizable all-pairs shortest path (APSP algorithm for weighted graphs, originally coded in NVIDIA's CUDA language, in ACL2. The ACL2 specification is written using a single-threaded object (stobj and tail recursion, as the stobj/tail recursion combination yields the most straightforward translation from imperative programming languages, as well as efficient, scalable executable specifications within ACL2 itself. The ACL2 version of the APSP algorithm can process millions of vertices and edges with little to no garbage generation, and executes at one-sixth the speed of a host-based version of APSP coded in C – a very respectable result for a theorem prover. In addition to formalizing the APSP algorithm (which uses Dijkstra's shortest path algorithm at its core, we have also provided capability that the original APSP code lacked, namely shortest path recovery. Path recovery is accomplished using a secondary ACL2 stobj implementing a LIFO stack, which is proven correct. To conclude the experiment, we ported the ACL2 version of the APSP kernels back to C, resulting in a less than 5% slowdown, and also performed a partial back-port to CUDA, which, surprisingly, yielded a slight performance increase.

  4. In Silico Identification of RNA Modifications from High-Throughput Sequencing Data Using HAMR.

    Science.gov (United States)

    Kuksa, Pavel P; Leung, Yuk Yee; Vandivier, Lee E; Anderson, Zachary; Gregory, Brian D; Wang, Li-San

    2017-01-01

    RNA molecules are often altered post-transcriptionally by the covalent modification of their nucleotides. These modifications are known to modulate the structure, function, and activity of RNAs. When reverse transcribed into cDNA during RNA sequencing library preparation, atypical (modified) ribonucleotides that affect Watson-Crick base pairing will interfere with reverse transcriptase (RT), resulting in cDNA products with mis-incorporated bases or prematurely terminated RNA products. These interactions with RT can therefore be inferred from mismatch patterns in the sequencing reads, and are distinguishable from simple base-calling errors, single-nucleotide polymorphisms (SNPs), or RNA editing sites. Here, we describe a computational protocol for the in silico identification of modified ribonucleotides from RT-based RNA-seq read-out using the High-throughput Analysis of Modified Ribonucleotides (HAMR) software. HAMR can identify these modifications transcriptome-wide with single nucleotide resolution, and also differentiate between different types of modifications to predict modification identity. Researchers can use HAMR to identify and characterize RNA modifications using RNA-seq data from a variety of common RT-based sequencing protocols such as Poly(A), total RNA-seq, and small RNA-seq.

  5. An unprecedented nucleic acid capture mechanism for excision of DNA damage

    Energy Technology Data Exchange (ETDEWEB)

    Rubinson, Emily H.; Prakasha Gowda, A.S.; Spratt, Thomas E.; Gold, Barry; Eichmanbrand, Brandt F. (Pitt); (Vanderbilt); (Penn)

    2010-11-18

    DNA glycosylases that remove alkylated and deaminated purine nucleobases are essential DNA repair enzymes that protect the genome, and at the same time confound cancer alkylation therapy, by excising cytotoxic N3-methyladenine bases formed by DNA-targeting anticancer compounds. The basis for glycosylase specificity towards N3- and N7-alkylpurines is believed to result from intrinsic instability of the modified bases and not from direct enzyme functional group chemistry. Here we present crystal structures of the recently discovered Bacillus cereus AlkD glycosylase in complex with DNAs containing alkylated, mismatched and abasic nucleotides. Unlike other glycosylases, AlkD captures the extrahelical lesion in a solvent-exposed orientation, providing an illustration for how hydrolysis of N3- and N7-alkylated bases may be facilitated by increased lifetime out of the DNA helix. The structures and supporting biochemical analysis of base flipping and catalysis reveal how the HEAT repeats of AlkD distort the DNA backbone to detect non-Watson-Crick base pairs without duplex intercalation.

  6. Attenuation-based kV pair selection in dual source dual energy computed tomography angiography of the chest: impact on radiation dose and image quality

    Energy Technology Data Exchange (ETDEWEB)

    Renapurkar, Rahul D.; Azok, Joseph; Lempel, Jason; Karim, Wadih; Graham, Ruffin [Thoracic Imaging, L10, Imaging Institute, Cleveland Clinic, Cleveland, OH (United States); Primak, Andrew [Siemens Medical Solutions, Malvern, PA (United States); Tandon, Yasmeen [Case Western Reserve University-Metro Health Medical Center, Department of Radiology, Cleveland, OH (United States); Bullen, Jennifer [Quantitative Health Sciences, Cleveland Clinic, Cleveland, OH (United States); Dong, Frank [Section of Medical Physics, Cleveland Clinic, Cleveland, OH (United States)

    2017-08-15

    The purpose of this study was to evaluate the impact of attenuation-based kilovoltage (kV) pair selection in dual source dual energy (DSDE)-pulmonary embolism (PE) protocol examinations on radiation dose savings and image quality. A prospective study was carried out on 118 patients with suspected PE. In patients in whom attenuation-based kV pair selection selected the 80/140Sn kV pair, the pre-scan 100/140Sn CTDIvol (computed tomography dose index volume) values were compared with the pre-scan 80/140Sn CTDIvol values. Subjective and objective image quality parameters were assessed. Attenuation-based kV pair selection switched to the 80/140Sn kV pair (''switched'' cohort) in 63 out of 118 patients (53%). The mean 100/140Sn pre-scan CTDIvol was 8.8 mGy, while the mean 80/140Sn pre-scan CTDIvol was 7.5 mGy. The average estimated dose reduction for the ''switched'' cohort was 1.3 mGy (95% CI 1.2, 1.4; p < 0.001), representing a 15% reduction in dose. After adjusting for patient weight, mean attenuation was significantly higher in the ''switched'' vs. ''non-switched'' cohorts in all five pulmonary arteries and in all lobes on iodine maps. This study demonstrates that attenuation-based kV pair selection in DSDE examination is feasible and can offer radiation dose reduction without compromising image quality. (orig.)

  7. Thermodynamic Basis for the Emergence of Genomes during Prebiotic Evolution

    Science.gov (United States)

    Woo, Hyung-June; Vijaya Satya, Ravi; Reifman, Jaques

    2012-01-01

    The RNA world hypothesis views modern organisms as descendants of RNA molecules. The earliest RNA molecules must have been random sequences, from which the first genomes that coded for polymerase ribozymes emerged. The quasispecies theory by Eigen predicts the existence of an error threshold limiting genomic stability during such transitions, but does not address the spontaneity of changes. Following a recent theoretical approach, we applied the quasispecies theory combined with kinetic/thermodynamic descriptions of RNA replication to analyze the collective behavior of RNA replicators based on known experimental kinetics data. We find that, with increasing fidelity (relative rate of base-extension for Watson-Crick versus mismatched base pairs), replications without enzymes, with ribozymes, and with protein-based polymerases are above, near, and below a critical point, respectively. The prebiotic evolution therefore must have crossed this critical region. Over large regions of the phase diagram, fitness increases with increasing fidelity, biasing random drifts in sequence space toward ‘crystallization.’ This region encloses the experimental nonenzymatic fidelity value, favoring evolutions toward polymerase sequences with ever higher fidelity, despite error rates above the error catastrophe threshold. Our work shows that experimentally characterized kinetics and thermodynamics of RNA replication allow us to determine the physicochemical conditions required for the spontaneous crystallization of biological information. Our findings also suggest that among many potential oligomers capable of templated replication, RNAs may have evolved to form prebiotic genomes due to the value of their nonenzymatic fidelity. PMID:22693440

  8. Site-specific labeling of DNA and RNA using an efficiently replicated and transcribed class of unnatural base pairs.

    Science.gov (United States)

    Seo, Young Jun; Malyshev, Denis A; Lavergne, Thomas; Ordoukhanian, Phillip; Romesberg, Floyd E

    2011-12-14

    Site-specific labeling of enzymatically synthesized DNA or RNA has many potential uses in basic and applied research, ranging from facilitating biophysical studies to the in vitro evolution of functional nucleic acids and the construction of various nanomaterials and biosensors. As part of our efforts to expand the genetic alphabet, we have developed a class of unnatural base pairs, exemplified by d5SICS-dMMO2 and d5SICS-dNaM, which are efficiently replicated and transcribed, and which may be ideal for the site-specific labeling of DNA and RNA. Here, we report the synthesis and analysis of the ribo- and deoxyribo-variants, (d)5SICS and (d)MMO2, modified with free or protected propargylamine linkers that allow for the site-specific modification of DNA or RNA during or after enzymatic synthesis. We also synthesized and evaluated the α-phosphorothioate variant of d5SICSTP, which provides a route to backbone thiolation and an additional strategy for the postamplification site-specific labeling of DNA. The deoxynucleotides were characterized via steady-state kinetics and PCR, while the ribonucleosides were characterized by the transcription of both a short, model RNA as well as full length tRNA. The data reveal that while there are interesting nucleotide and polymerase-specific sensitivities to linker attachment, both (d)MMO2 and (d)5SICS may be used to produce DNA or RNA site-specifically modified with multiple, different functional groups with sufficient efficiency and fidelity for practical applications. © 2011 American Chemical Society

  9. Resistance of human cytomegalovirus to cyclopropavir maps to a base pair deletion in the open reading frame of UL97.

    Science.gov (United States)

    Gentry, Brian G; Vollmer, Laura E; Hall, Ellie D; Borysko, Katherine Z; Zemlicka, Jiri; Kamil, Jeremy P; Drach, John C

    2013-09-01

    Human cytomegalovirus (HCMV) is a widespread pathogen in the human population, affecting many immunologically immature and immunocompromised patients, and can result in severe complications, such as interstitial pneumonia and mental retardation. Current chemotherapies for the treatment of HCMV infections include ganciclovir (GCV), foscarnet, and cidofovir. However, the high incidences of adverse effects (neutropenia and nephrotoxicity) limit the use of these drugs. Cyclopropavir (CPV), a guanosine nucleoside analog, is 10-fold more active against HCMV than GCV (50% effective concentrations [EC50s] = 0.46 and 4.1 μM, respectively). We hypothesize that the mechanism of action of CPV is similar to that of GCV: phosphorylation to a monophosphate by viral pUL97 protein kinase with further phosphorylation to a triphosphate by endogenous kinases, resulting in inhibition of viral DNA synthesis. To test this hypothesis, we isolated a CPV-resistant virus, sequenced its genome, and discovered that bp 498 of UL97 was deleted. This mutation caused a frameshift in UL97 resulting in a truncated protein that lacks a kinase domain. To determine if this base pair deletion was responsible for drug resistance, the mutation was engineered into the wild-type viral genome, which was then exposed to increasing concentrations of CPV. The results demonstrate that the engineered virus was approximately 72-fold more resistant to CPV (EC50 = 25.8 ± 3.1 μM) than the wild-type virus (EC50 = 0.36 ± 0.11 μM). We conclude, therefore, that this mutation is sufficient for drug resistance and that pUL97 is involved in the mechanism of action of CPV.

  10. Lumping of degree-based mean-field and pair-approximation equations for multistate contact processes

    Science.gov (United States)

    Kyriakopoulos, Charalampos; Grossmann, Gerrit; Wolf, Verena; Bortolussi, Luca

    2018-01-01

    Contact processes form a large and highly interesting class of dynamic processes on networks, including epidemic and information-spreading networks. While devising stochastic models of such processes is relatively easy, analyzing them is very challenging from a computational point of view, particularly for large networks appearing in real applications. One strategy to reduce the complexity of their analysis is to rely on approximations, often in terms of a set of differential equations capturing the evolution of a random node, distinguishing nodes with different topological contexts (i.e., different degrees of different neighborhoods), such as degree-based mean-field (DBMF), approximate-master-equation (AME), or pair-approximation (PA) approaches. The number of differential equations so obtained is typically proportional to the maximum degree kmax of the network, which is much smaller than the size of the master equation of the underlying stochastic model, yet numerically solving these equations can still be problematic for large kmax. In this paper, we consider AME and PA, extended to cope with multiple local states, and we provide an aggregation procedure that clusters together nodes having similar degrees, treating those in the same cluster as indistinguishable, thus reducing the number of equations while preserving an accurate description of global observables of interest. We also provide an automatic way to build such equations and to identify a small number of degree clusters that give accurate results. The method is tested on several case studies, where it shows a high level of compression and a reduction of computational time of several orders of magnitude for large networks, with minimal loss in accuracy.

  11. Is the whole greater than the sum of its parts? De novo assembly strategies for bacterial genomes based on paired-end sequencing.

    Science.gov (United States)

    Chen, Ting-Wen; Gan, Ruei-Chi; Chang, Yi-Feng; Liao, Wei-Chao; Wu, Timothy H; Lee, Chi-Ching; Huang, Po-Jung; Lee, Cheng-Yang; Chen, Yi-Ywan M; Chiu, Cheng-Hsun; Tang, Petrus

    2015-08-28

    Whole genome sequence construction is becoming increasingly feasible because of advances in next generation sequencing (NGS), including increasing throughput and read length. By simply overlapping paired-end reads, we can obtain longer reads with higher accuracy, which can facilitate the assembly process. However, the influences of different library sizes and assembly methods on paired-end sequencing-based de novo assembly remain poorly understood. We used 250 bp Illumina Miseq paired-end reads of different library sizes generated from genomic DNA from Escherichia coli DH1 and Streptococcus parasanguinis FW213 to compare the assembly results of different library sizes and assembly approaches. Our data indicate that overlapping paired-end reads can increase read accuracy but sometimes cause insertion or deletions. Regarding genome assembly, merged reads only outcompete original paired-end reads when coverage depth is low, and larger libraries tend to yield better assembly results. These results imply that distance information is the most critical factor during assembly. Our results also indicate that when depth is sufficiently high, assembly from subsets can sometimes produce better results. In summary, this study provides systematic evaluations of de novo assembly from paired end sequencing data. Among the assembly strategies, we find that overlapping paired-end reads is not always beneficial for bacteria genome assembly and should be avoided or used with caution especially for genomes containing high fraction of repetitive sequences. Because increasing numbers of projects aim at bacteria genome sequencing, our study provides valuable suggestions for the field of genomic sequence construction.

  12. Evaluating a team-based approach to research capacity building using a matched-pairs study design.

    Science.gov (United States)

    Holden, Libby; Pager, Susan; Golenko, Xanthe; Ware, Robert S; Weare, Robyn

    2012-03-12

    There is a continuing need for research capacity building initiatives for primary health care professionals. Historically strategies have focused on interventions aimed at individuals but more recently theoretical frameworks have proposed team-based approaches. Few studies have evaluated these new approaches. This study aims to evaluate a team-based approach to research capacity building (RCB) in primary health using a validated quantitative measure of research capacity in individual, team and organisation domains. A non-randomised matched-pairs trial design was used to evaluate the impact of a multi-strategy research capacity building intervention. Four intervention teams recruited from one health service district were compared with four control teams from outside the district, matched on service role and approximate size. All were multi-disciplinary allied health teams with a primary health care role. Random-effects mixed models, adjusting for the potential clustering effect of teams, were used to determine the significance of changes in mean scores from pre- to post-intervention. Comparisons of intervention versus control groups were made for each of the three domains: individual, team and organisation. The Individual Domain measures the research skills of the individual, whereas Team and Organisation Domains measure the team/organisation's capacity to support and foster research, including research culture. In all three domains (individual, team and organisation) there were no occasions where improvements were significantly greater for the control group (comprising the four control teams, n = 32) compared to the intervention group (comprising the four intervention teams, n = 37) either in total domain score or domain item scores. However, the intervention group had a significantly greater improvement in adjusted scores for the Individual Domain total score and for six of the fifteen Individual Domain items, and to a lesser extent with Team and Organisation

  13. Polymerase recognition of 2-thio-iso-guanine·5-methyl-4-pyrimidinone (iGs·P)--A new DD/AA base pair.

    Science.gov (United States)

    Lee, Dong-Kye; Switzer, Christopher

    2016-02-15

    Polymerase specificity is reported for a previously unknown base pair with a non-standard DD/AA hydrogen bonding pattern: 2-thio-iso-guanine·5-methyl-4-pyrimidinone. Our findings suggest that atomic substitution may provide a solution for low fidelity previously associated with enzymatic copying of iso-guanine. Copyright © 2016 Elsevier Ltd. All rights reserved.

  14. Young Learners' Interactional Development in Task-Based Paired-Assessment in Their First and Foreign Languages: A Case of English Learners in China

    Science.gov (United States)

    Butler, Yuko Goto; Zeng, Wei

    2015-01-01

    In response to the growing interest in evaluating young learners' foreign language (FL) performance, this study aims to deepen our understanding of young learners' developmental differences in interaction during task-based paired-language assessments. To examine age effects separately from the effect of general language proficiency, we analysed…

  15. Design and synthesis of heterocyclic cations for specific DNA recognition: from AT-rich to mixed-base-pair DNA sequences.

    Science.gov (United States)

    Chai, Yun; Paul, Ananya; Rettig, Michael; Wilson, W David; Boykin, David W

    2014-02-07

    The compounds synthesized in this research were designed with the goal of establishing a new paradigm for mixed-base-pair DNA sequence-specific recognition. The design scheme starts with a cell-permeable heterocyclic cation that binds to AT base pair sites in the DNA minor groove. Modifications were introduced in the original compound to include an H-bond accepting group to specifically recognize the G-NH that projects into the minor groove. Therefore, a series of heterocyclic cations substituted with an azabenzimidazole ring has been designed and synthesized for mixed-base-pair DNA recognition. The most successful compound, 12a, had an azabenzimidazole to recognize G and additional modifications for general minor groove interactions. It binds to the DNA site -AAAGTTT- more strongly than the -AAATTT- site without GC and indicates the design success. Structural modifications of 12a generally weakened binding. The interactions of the new compound with a variety of DNA sequences with and without GC base pairs were evaluated by thermal melting analysis, circular dichroism, fluorescence emission spectroscopy, surface plasmon resonance, and molecular modeling.

  16. Pair-Bonded Humans Conform to Sexual Stereotypes in Web-Based Advertisements for Extra-Marital Partners

    Directory of Open Access Journals (Sweden)

    Trish C. Kelley

    2010-10-01

    Full Text Available Partners advertisements provide advertisers with access to a large pool of prospective mates, and have proven useful in documenting sex differences in human mating preferences. We coded data from an Internet site (AshleyMadison.com catering to advertisers engaged in existing pair-bonded relationships. While we predicted that pair-bonding may liberate advertisers from conforming to sexual stereotypes of male promiscuity and female choosiness, our results are uniformly consistent with those stereotypes. Our findings thus provide further evidence that human mating behavior is highly constrained by fundamental biological differences between males and females.

  17. Pair-bonded humans conform to sexual stereotypes in web-based advertisements for extra-marital partners.

    Science.gov (United States)

    Kelley, Trish C; Hare, James F

    2010-10-20

    Partners advertisements provide advertisers with access to a large pool of prospective mates, and have proven useful in documenting sex differences in human mating preferences. We coded data from an Internet site (AshleyMadison.com) catering to advertisers engaged in existing pair-bonded relationships. While we predicted that pair-bonding may liberate advertisers from conforming to sexual stereotypes of male promiscuity and female choosiness, our results are uniformly consistent with those stereotypes. Our findings thus provide further evidence that human mating behavior is highly constrained by fundamental biological differences between males and females.

  18. The Role of Repulsion in Colloidal Crystal Engineering with DNA

    Energy Technology Data Exchange (ETDEWEB)

    Seo, Soyoung E. [Department; Li, Tao [X-ray; Senesi, Andrew J. [X-ray; Mirkin, Chad A. [Department; Lee, Byeongdu [X-ray

    2017-11-07

    Hybridization interactions between DNA-functionalized nanoparticles (DNA-NPs) can be used to program the crystallization behavior of superlattices, yielding access to complex three-dimensional structures with more than 30 different lattice symmetries. The first superlattice structures using DNA-NPs as building blocks were identified almost two decades ago, yet the role of repulsive interactions in guiding structure formation is still largely unexplored. Here, a com-prehensive approach is taken to study the role of repulsion in the assembly behavior of DNA-NPs, enabling the calculation of interparticle interaction potentials based on experimental results. In this work, we used two different means to assemble DNA-NPs—Watson-Crick base pairing interactions and depletion interactions—and systematically varied the salt concen-tration to study the effective interactions in DNA-NP superlattices. A comparison between the two systems allows us to decouple the repulsive forces from the attractive hybridization interactions that are sensitive to the ionic environment. We find that the gap distance between adjacent DNA-NPs follows a simple power law dependence on solution ionic strength regardless of the type of attractive forces present. This result suggests that the observed trend is driven by repulsive inter-actions. To better understand such behavior, we propose a mean-field model that provides a mathematical description for the observed trend. This model shows that the trend is due to the variation in the effective cross-sectional diameter of DNA duplex and the thickness of DNA shell.

  19. 2012 IUPAP C10 Young Scientist Prize on the Structure and Dynamics of Condensed Matter Lecture: Spin Fluctuations and Pairing in Fe-based Superconductors

    Science.gov (United States)

    Christianson, A. D.

    2012-02-01

    The origin of superconductivity in the Fe-based superconductors, like that in other unconventional superconductors, remains shrouded in mystery. How the pairing bosons emerge either due to or in spite of the strong magnetic interactions found in the Fe-based superconductors is one of the most thoroughly investigated questions in the field. A prominent example of the interplay of superconductivity and magnetism is the dramatic shift of spectral weight from the low energy spin excitations to an energy which is related to the superconducting gap resulting in a peak in the spin excitation spectrum localized in both momentum and energy which occurs at the onset of superconductivity. The appearance of the new peak in the spin excitation spectrum below the superconducting transition temperature is referred to as s spin resonance and is most commonly interpreted as indicating a sign change of the superconducting order parameter on different portions of the Fermi surface and thus is consistent with an extended s-wave or s± pairing symmetry in many Fe-based superconductors. We will review the observations and implications of the spin resonance across the Fe-based superconductors. In particular we will examine the relationship between the resonance energy and the superconducting transition temperature as a function of chemical doping and pressure. While the spin resonance provides important information about pairing symmetry, there does not appear to be sufficient spectral to explain the pairing strength. Thus the remainder of the spin excitation spectrum must be examined to determine if spin fluctuations are ultimately responsible for pairing in the Fe-based materials. Consequently, we will discuss in detail the way in which the spin excitations evolve from the nonsuperconducting compounds to their superconducting relatives as a function of chemical doping.

  20. Systematic exploration of a class of hydrophobic unnatural base pairs yields multiple new candidates for the expansion of the genetic alphabet.

    Science.gov (United States)

    Dhami, Kirandeep; Malyshev, Denis A; Ordoukhanian, Phillip; Kubelka, Tomáš; Hocek, Michal; Romesberg, Floyd E

    2014-01-01

    We have developed a family of unnatural base pairs (UBPs), which rely on hydrophobic and packing interactions for pairing and which are well replicated and transcribed. While the pair formed between d5SICS and dNaM (d5SICS-dNaM) has received the most attention, and has been used to expand the genetic alphabet of a living organism, recent efforts have identified dTPT3-dNaM, which is replicated with even higher fidelity. These efforts also resulted in more UBPs than could be independently analyzed, and thus we now report a PCR-based screen to identify the most promising. While we found that dTPT3-dNaM is generally the most promising UBP, we identified several others that are replicated nearly as well and significantly better than d5SICS-dNaM, and are thus viable candidates for the expansion of the genetic alphabet of a living organism. Moreover, the results suggest that continued optimization should be possible, and that the putatively essential hydrogen-bond acceptor at the position ortho to the glycosidic linkage may not be required. These results clearly demonstrate the generality of hydrophobic forces for the control of base pairing within DNA, provide a wealth of new structure-activity relationship data and importantly identify multiple new candidates for in vivo evaluation and further optimization. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

  1. DNA recognition by the SwaI restriction endonuclease involves unusual distortion of an 8 base pair A:T-rich target.

    Science.gov (United States)

    Shen, Betty W; Heiter, Daniel F; Lunnen, Keith D; Wilson, Geoffrey G; Stoddard, Barry L

    2017-02-17

    R.SwaI, a Type IIP restriction endonuclease, recognizes a palindromic eight base pair (bp) symmetric sequence, 5΄-ATTTAAAT-3΄, and cleaves that target at its center to generate blunt-ended DNA fragments. Here, we report three crystal structures of SwaI: unbound enzyme, a DNA-bound complex with calcium ions; and a DNA-bound, fully cleaved complex with magnesium ions. We compare these structures to two structurally similar ‘PD-D/ExK’ restriction endonucleases (EcoRV and HincII) that also generate blunt-ended products, and to a structurally distinct enzyme (the HNH endonuclease PacI) that also recognizes an 8-bp target site consisting solely of A:T base pairs. Binding by SwaI induces an extreme bend in the target sequence accompanied by un-pairing and re-ordering of its central A:T base pairs. This result is reminiscent of a more dramatic target deformation previously described for PacI, implying that long A:T-rich target sites might display structural or dynamic behaviors that play a significant role in endonuclease recognition and cleavage.

  2. Cooper pairs in atomic nuclei

    Energy Technology Data Exchange (ETDEWEB)

    Pittel, S. [Bartol Research Institute and Department of Physics and Astronomy, University of Delaware, Newark, 19716 Delaware (United States); Dussel, G. G. [Departamento de Fisica J.J. Giambiagi, Universidad de Buenos Aires, 1428 Buenos Aires (Argentina); Dukelsky, J.; Sarriguren, P. [Instituto de Estructura de la Materia, CSIC, Serrano 123, 28006 Madrid (Spain)

    2008-12-15

    We describe recent efforts to study Cooper pairs in atomic nuclei. We consider a self-consistent Hartree Fock mean field for the even Sm isotopes and compare results based on three treatments of pairing correlations: a BCS treatment, a number-projected BCS treatment and an exact treatment using the Richardson Ansatz. Significant differences are seen in the pairing correlation energies. Furthermore, because it does not average over the properties of the fermion pairs, the Richardson solution permits a more meaningful definition of the Cooper wave function and of the fraction of pairs that are collective. Our results confirm that only a few pairs near the Fermi surface in realistic atomic nuclei are collective. (Author)

  3. DNA duplex-supported artificial esterase mimicking by cooperative grafting functional groups.

    Science.gov (United States)

    Xu, Liang; Ji, Chuanshi; Bai, Yu; He, Junlin; Liu, Keliang

    2013-05-10

    The molecular structures of enzyme mimics may be modified to optimize their catalytic properties. In this study, to generate artificial enzyme mimics, Watson-Crick base paired DNA duplexes were designed as scaffolds which were assembled by nucleotides modified with specific functional groups. This process allowed various functional groups to be precisely assembled at different sites on the duplexes. By using this strategy, the 5-[2-(1H-imidazolyl-4)-(E)-ethylene]-2'-deoxythymidine (1) analog with the 5-substituted imidazolyl group was incorporated into single strands of DNA. Upon DNA duplex formation, several combinations of the imidazolyl group were formed. Using p-nitrophenyl acetate as the substrate of the catalytic reaction, we evaluated the hydrolysis capabilities of the imidazolyl assemblies. The catalytic ability was closely related to the distribution of imidazolyl groups in the DNA duplex. The most effective catalytic center was that of the duplex O5-O6 construct with three imidazolyl groups. This construct displayed bell-shaped pH-dependent and Mg(2+)-independent kinetic curves, which are typical characteristics of imidazolyl-mediated catalytic reactions. Copyright © 2013 Elsevier Inc. All rights reserved.

  4. Label-free potentiometry for detecting DNA hybridization using peptide nucleic acid and DNA probes.

    Science.gov (United States)

    Goda, Tatsuro; Singi, Ankit Balram; Maeda, Yasuhiro; Matsumoto, Akira; Torimura, Masaki; Aoki, Hiroshi; Miyahara, Yuji

    2013-02-07

    Peptide nucleic acid (PNA) has outstanding affinity over DNA for complementary nucleic acid sequences by forming a PNA-DNA heterodimer upon hybridization via Watson-Crick base-pairing. To verify whether PNA probes on an electrode surface enhance sensitivity for potentiometric DNA detection or not, we conducted a comparative study on the hybridization of PNA and DNA probes on the surface of a 10-channel gold electrodes microarray. Changes in the charge density as a result of hybridization at the solution/electrode interface on the self-assembled monolayer (SAM)-formed microelectrodes were directly transformed into potentiometric signals using a high input impedance electrometer. The charge readout allows label-free, reagent-less, and multi-parallel detection of target oligonucleotides without any optical assistance. The differences in the probe lengths between 15- to 22-mer dramatically influenced on the sensitivity of the PNA and DNA sensors. Molecular type of the capturing probe did not affect the degree of potential shift. Theoretical model for charged rod-like duplex using the Gouy-Chapman equation indicates the dominant effect of electrostatic attractive forces between anionic DNA and underlying electrode at the electrolyte/electrode interface in the potentiometry.

  5. Toward transferable interatomic van der Waals interactions without electrons: The role of multipole electrostatics and many-body dispersion

    Energy Technology Data Exchange (ETDEWEB)

    Bereau, Tristan, E-mail: bereau@mpip-mainz.mpg.de [Max-Planck-Institut für Polymerforschung, Ackermannweg 10, 55128 Mainz, Germany and Department of Chemistry, University of Basel, 4056 Basel (Switzerland); Lilienfeld, O. Anatole von [Department of Chemistry, Institute of Physical Chemistry, University of Basel, 4056 Basel, Switzerland and Argonne Leadership Computing Facility, Argonne National Laboratory, Argonne, Illinois 60439 (United States)

    2014-07-21

    We estimate polarizabilities of atoms in molecules without electron density, using a Voronoi tesselation approach instead of conventional density partitioning schemes. The resulting atomic dispersion coefficients are calculated, as well as many-body dispersion effects on intermolecular potential energies. We also estimate contributions from multipole electrostatics and compare them to dispersion. We assess the performance of the resulting intermolecular interaction model from dispersion and electrostatics for more than 1300 neutral and charged, small organic molecular dimers. Applications to water clusters, the benzene crystal, the anti-cancer drug ellipticine—intercalated between two Watson-Crick DNA base pairs, as well as six macro-molecular host-guest complexes highlight the potential of this method and help to identify points of future improvement. The mean absolute error made by the combination of static electrostatics with many-body dispersion reduces at larger distances, while it plateaus for two-body dispersion, in conflict with the common assumption that the simple 1/R{sup 6} correction will yield proper dissociative tails. Overall, the method achieves an accuracy well within conventional molecular force fields while exhibiting a simple parametrization protocol.

  6. Structural mechanisms of human RecQ helicases WRN and BLM

    Directory of Open Access Journals (Sweden)

    Ken eKitano

    2014-10-01

    Full Text Available The RecQ family DNA helicases WRN (Werner syndrome protein and BLM (Bloom syndrome protein play a key role in protecting the genome against deleterious changes. In humans, mutations in these proteins lead to rare genetic diseases associated with cancer predisposition and accelerated aging. WRN and BLM are distinguished from other helicases by possessing signature tandem domains toward the C terminus, referred to as the RecQ C-terminal (RQC and helicase-and-ribonuclease D-C-terminal (HRDC domains. Although the precise function of the HRDC domain remains unclear, the previous crystal structure of a WRN RQC-DNA complex visualized a central role for the RQC domain in recognizing, binding and unwinding DNA at branch points. In particular, a prominent hairpin structure (the β-wing within the RQC winged-helix motif acts as a scalpel to induce the unpairing of a Watson-Crick base pair at the DNA duplex terminus. A similar RQC-DNA interaction was also observed in the recent crystal structure of a BLM-DNA complex. I review the latest structures of WRN and BLM, and then provide a docking simulation of BLM with a Holliday junction. The model offers an explanation for the efficient branch migration activity of the RecQ family toward recombination and repair intermediates.

  7. Mitochondrial tRNAAla C5601T mutation may modulate the clinical expression of tRNAMet A4435G mutation in a Han Chinese family with hypertension.

    Science.gov (United States)

    Zheng, Ping; Li, Shiliang; Liu, Chun; Zha, Zhengbiao; Wei, Xiang; Yuan, Yuan

    2017-12-06

    Mutations in mitochondrial DNA, especially in mitochondrial tRNA (mt-tRNA) genes, are the important causes for maternally inherited hypertension. In this study, we reported the clinical, genetic, and molecular characterization of a Han Chinese family with hypertension. Most strikingly, this family exhibited a high penetrance and expressivity of hypertension. Sequence analysis of the complete mt-tRNA genes showed the presence of tRNAMet A4435G and tRNAAla C5601T mutations. The A4435G had already been reported as a pathogenic mutation associated with hypertension; in addition, the C5601T mutation, which was located at the highly conserved nucleotide of T arm of tRNAAla, created a novel Watson-Crick base pairing and may result in failure of tRNA metabolism. Moreover, bioinformatics analysis indicated that the C5601T mutation altered the secondary structure of tRNAAla. Thus, the mitochondrial dysfunction, caused by the A4435G mutation, may be worsened by the C5601T mutation. Taken together, our data indicated that the co-occurrence of the A4435G and C5601T mutations may account for the high penetrance and expressivity of hypertension in this family. Therefore, our study provided novel insight into the pathophysiology of maternally inherited hypertension.

  8. The structure of SV40 large T hexameric helicase in complex with AT-rich origin DNA.

    Science.gov (United States)

    Gai, Dahai; Wang, Damian; Li, Shu-Xing; Chen, Xiaojiang S

    2016-12-06

    DNA replication is a fundamental biological process. The initial step in eukaryotic DNA replication is the assembly of the pre-initiation complex, including the formation of two head-to-head hexameric helicases around the replication origin. How these hexameric helicases interact with their origin dsDNA remains unknown. Here, we report the co-crystal structure of the SV40 Large-T Antigen (LT) hexameric helicase bound to its origin dsDNA. The structure shows that the six subunits form a near-planar ring that interacts with the origin, so that each subunit makes unique contacts with the DNA. The origin dsDNA inside the narrower AAA+ domain channel shows partial melting due to the compression of the two phosphate backbones, forcing Watson-Crick base-pairs within the duplex to flip outward. This structure provides the first snapshot of a hexameric helicase binding to origin dsDNA, and suggests a possible mechanism of origin melting by LT during SV40 replication in eukaryotic cells.

  9. Domain movements during CCA-addition: a new function for motif C in the catalytic core of the human tRNA nucleotidyltransferases.

    Science.gov (United States)

    Ernst, Felix G M; Rickert, Christian; Bluschke, Alexander; Betat, Heike; Steinhoff, Heinz-Jürgen; Mörl, Mario

    2015-01-01

    CCA-adding enzymes are highly specific RNA polymerases that synthesize and maintain the sequence CCA at the tRNA 3'-end. This nucleotide triplet is a prerequisite for tRNAs to be aminoacylated and to participate in protein biosynthesis. During CCA-addition, a set of highly conserved motifs in the catalytic core of these enzymes is responsible for accurate sequential nucleotide incorporation. In the nucleotide binding pocket, three amino acid residues form Watson-Crick-like base pairs to the incoming CTP and ATP. A reorientation of these templating amino acids switches the enzyme's specificity from CTP to ATP recognition. However, the mechanism underlying this essential structural rearrangement is not understood. Here, we show that motif C, whose actual function has not been identified yet, contributes to the switch in nucleotide specificity during polymerization. Biochemical characterization as well as EPR spectroscopy measurements of the human enzyme reveal that mutating the highly conserved amino acid position D139 in this motif interferes with AMP incorporation and affects interdomain movements in the enzyme. We propose a model of action, where motif C forms a flexible spring element modulating the relative orientation of the enzyme's head and body domains to accommodate the growing 3'-end of the tRNA. Furthermore, these conformational transitions initiate the rearranging of the templating amino acids to switch the specificity of the nucleotide binding pocket from CTP to ATP during CCA-synthesis.

  10. Role of human DNA polymerase κ in extension opposite from a cis-syn thymine dimer.

    Science.gov (United States)

    Vasquez-Del Carpio, Rodrigo; Silverstein, Timothy D; Lone, Samer; Johnson, Robert E; Prakash, Louise; Prakash, Satya; Aggarwal, Aneel K

    2011-04-29

    Exposure of DNA to UV radiation causes covalent linkages between adjacent pyrimidines. The most common lesion found in DNA from these UV-induced linkages is the cis-syn cyclobutane pyrimidine dimer. Human DNA polymerase κ (Polκ), a member of the Y-family of DNA polymerases, is unable to insert nucleotides opposite the 3'T of a cis-syn T-T dimer, but it can efficiently extend from a nucleotide inserted opposite the 3'T of the dimer by another DNA polymerase. We present here the structure of human Polκ in the act of inserting a nucleotide opposite the 5'T of the cis-syn T-T dimer. The structure reveals a constrained active-site cleft that is unable to accommodate the 3'T of a cis-syn T-T dimer but is remarkably well adapted to accommodate the 5'T via Watson-Crick base pairing, in accord with a proposed role for Polκ in the extension reaction opposite from cyclobutane pyrimidine dimers in vivo. Copyright © 2011 Elsevier Ltd. All rights reserved.

  11. Calculated distortions of duplex DNA by a cis, syn cyclobutane thymine dimer are unaffected by a 3' TpA step.

    Science.gov (United States)

    Cooney, M G; Miller, J H

    1997-01-01

    Molecular dynamics simulations were performed on the duplex DNA dodecamers d(CGCGAA TT CGCG): d(CGCGAATTCGCG) and d(GCACGAA TT AAG): d(CTTAATTCGTGC), where TT denotes a cis, syn cyclobutane thymine dimer. The constant temperature and pressure algorithm of the AMBER 4.1 molecular-modeling package was used with explicit water and counterions, periodic boundary conditions and electrostatic interactions evaluated by the particle-mesh Ewald method. Results were analyzed by the CURVES algorithm and its implementation in DIALS and WINDOWS. Calculated distortions of DNA structure by the thymine dimer were qualitatively and quantitatively similar for the two sequences. Despite the enhanced flexibility of the native TpA dinucleotide step, major deviations from the B-DNA values of helicoidal parameters were found only at the Ap and p dinucleotide steps in both sequences. Only the AT base pairs of the two sequences that contain the 5' thymine of the dimers exhibited weakened Watson-Crick hydrogen bonds and anomalous stretching. Hence, we conclude that the pattern of structural perturbations responsible for recognition of cis, syn thymine dimers by repair enzymes is not sensitive to their sequence context. PMID:9060440

  12. Role of Human DNA Polymerase kappa in Extension Opposite from a cis-syn Thymine Dimer

    Energy Technology Data Exchange (ETDEWEB)

    R Vasquez-Del Carpio; T Silverstein; S Lone; R Johnson; L Prakash; S Prakash; A Aggarwal

    2011-12-31

    Exposure of DNA to UV radiation causes covalent linkages between adjacent pyrimidines. The most common lesion found in DNA from these UV-induced linkages is the cis-syn cyclobutane pyrimidine dimer. Human DNA polymerase {Kappa} (Pol{Kappa}), a member of the Y-family of DNA polymerases, is unable to insert nucleotides opposite the 3'T of a cis-syn T-T dimer, but it can efficiently extend from a nucleotide inserted opposite the 3'T of the dimer by another DNA polymerase. We present here the structure of human Pol{Kappa} in the act of inserting a nucleotide opposite the 5'T of the cis-syn T-T dimer. The structure reveals a constrained active-site cleft that is unable to accommodate the 3'T of a cis-syn T-T dimer but is remarkably well adapted to accommodate the 5'T via Watson-Crick base pairing, in accord with a proposed role for Pol{Kappa} in the extension reaction opposite from cyclobutane pyrimidine dimers in vivo.

  13. Long Acting Ionically Paired Embonate Based Nanocrystals of Donepezil for the Treatment of Alzheimer's Disease: a Proof of Concept Study.

    Science.gov (United States)

    Mittapelly, Naresh; Thalla, Maharshi; Pandey, Gitu; Banala, Venkatesh Teja; Sharma, Shweta; Arya, Abhishek; Mishra, Sandeep; Mitra, Kalyan; Shukla, Shubha; Mishra, Prabhat Ranjan

    2017-11-01

    The aim of the present study was to prepare a patient friendly long acting donepezil (D) nanocrystals (NCs) formulation, with a high payload for i.m administration. As the native D hydrochloride salt has high aqueous solubility it is necessary to increase its hydrophobicity prior to the NCs formation. D was ionically paired with embonic acid (E) in aqueous media and was successfully characterized using techniques like DSC, PXRD, FT-IR, NMR etc. Later, we converted the bulk ion pair into NCs using high pressure homogenization technique to study further in-vitro and in-vivo. The bulk ion pair has a drug content of 66% w/w and an 11,000 reduced solubility in comparison to native D hydrochloride. Also, its crystalline nature was confirmed by DSC and PXRD. The possible interaction sites responsible for the ion pair formation were identified though NMR. The prepared NCs has mean particle size 677.5 ± 72.5 nm and PDI 0.152 ± 0.061. In-vitro release showed a slow dissolution of NCs. Further, excellent bio compatibility of NCs were demonstrated in 3T3 cells. Following i.m administration of single dose of NCs, the D plasma level was found to be detectable up to 18 days. In vivo pharmacodynamic studies revealed that the single dose NCs i.m injection improved spatial memory learning and retention in ICV STZ model. Our results suggest that the developed formulation has a potential to replace the current daily dosing regimen to a less frequent dosing schedule. Graphical Abstract Improved pharmacokinetic and pharmacodynamic profile after administration of single dose donpezil embonate nanocrystals in Rats.

  14. Paired associative stimulation of left and right human motor cortex shapes interhemispheric motor inhibition based on a Hebbian mechanism.

    Science.gov (United States)

    Rizzo, V; Siebner, H S; Morgante, F; Mastroeni, C; Girlanda, P; Quartarone, A

    2009-04-01

    This study was designed to examine whether corticocortical paired associative stimulation (cc-PAS) can modulate interhemispheric inhibition (IHI) in the human brain. Twelve healthy right-handed volunteers received 90 paired transcranial stimuli to the right and left primary motor hand area (M1(HAND)) at an interstimulus interval (ISI) of 8 ms. Left-to-right cc-PAS (first pulse given to left M1(HAND)) attenuated left-to-right IHI for one hour after cc-PAS. Left-to-right cc-PAS also increased corticospinal excitability in the conditioned right M1(HAND). These effects were not seen in an asymptomatic individual with callosal agenesis. Additional experiments showed no changes in left-to-right IHI or corticospinal excitability when left-to-right cc-PAS was given at an ISI of 1 ms or at multiple ISIs in random order. At the behavioral level, left-to-right cc-PAS speeded responses with the left but not right index finger during a simple reaction time task. Right-to-left cc-PAS (first pulse given to right M1(HAND)) reduced right-to-left IHI without increasing corticospinal excitability in left M1(HAND). These results provide a proof of principle that cc-PAS can induce associative plasticity in connections between the targeted cortical areas. The efficacy of cc-PAS to induce lasting changes in excitability depends on the exact timing of the stimulus pairs suggesting an underlying Hebbian mechanism.

  15. Predicting Bond Dissociation Energies of Transition-Metal Compounds by Multiconfiguration Pair-Density Functional Theory and Second-Order Perturbation Theory Based on Correlated Participating Orbitals and Separated Pairs.

    Science.gov (United States)

    Bao, Junwei Lucas; Odoh, Samuel O; Gagliardi, Laura; Truhlar, Donald G

    2017-02-14

    We study the performance of multiconfiguration pair-density functional theory (MC-PDFT) and multireference perturbation theory for the computation of the bond dissociation energies in 12 transition-metal-containing diatomic molecules and three small transition-metal-containing polyatomic molecules and in two transition-metal dimers. The first step is a multiconfiguration self-consistent-field calculation, for which two choices must be made: (i) the active space and (ii) its partition into subspaces, if the generalized active space formulation is used. In the present work, the active space is chosen systematically by using three correlated-participating-orbitals (CPO) schemes, and the partition is chosen by using the separated-pair (SP) approximation. Our calculations show that MC-PDFT generally has similar accuracy to CASPT2, and the active-space dependence of MC-PDFT is not very great for transition-metal-ligand bond dissociation energies. We also find that the SP approximation works very well, and in particular SP with the fully translated BLYP functional SP-ftBLYP is more accurate than CASPT2. SP greatly reduces the number of configuration state functions relative to CASSCF. For the cases of FeO and NiO with extended-CPO active space, for which complete active space calculations are unaffordable, SP calculations are not only affordable but also of satisfactory accuracy. All of the MC-PDFT results are significantly better than the corresponding results with broken-symmetry spin-unrestricted Kohn-Sham density functional theory. Finally we test a perturbation theory method based on the SP reference and find that it performs slightly worse than CASPT2 calculations, and for most cases of the nominal-CPO active space, the approximate SP perturbation theory calculations are less accurate than the much less expensive SP-PDFT calculations.

  16. Structural Insights into DNA Replication Without Hydrogen-Bonds

    Science.gov (United States)

    Betz, Karin; Malyshev, Denis A.; Lavergne, Thomas; Welte, Wolfram; Diederichs, Kay; Romesberg, Floyd E.; Marx, Andreas

    2014-01-01

    The genetic alphabet is comprised of two base pairs, and the development of a third, unnatural base pair would increase the genetic and chemical potential of DNA. d5SICS-dNaM is one of the most efficiently replicated unnatural base pairs identified to date, but its pairing is mediated by only hydrophobic and packing forces, and in free duplex DNA it forms a cross-strand intercalated structure that makes its efficient replication difficult to understand. Recent studies of the KlenTaq polymerase revealed that the insertion of d5SICSTP opposite dNaM proceeds via a mutually induced-fit mechanism, where the presence of the triphosphate induces the polymerase to form the catalytically competent closed structure, which in turn induces the pairing nucleotides of the developing unnatural base pair to adopt a planar Watson-Crick-like structure. To understand the remaining steps of replication, we now report the characterization of the pre-chemistry complexes corresponding to the insertion of dNaMTP opposite d5SICS, as well as multiple post-chemistry complexes in which the already formed unnatural base pair is positioned at the post-insertion site. Unlike with the insertion of d5SICSTP opposite dNaM, addition of dNaMTP does not fully induce the formation of the catalytically competent closed state. The data also reveal that once synthesized and translocated to the post-insertion position, the unnatural nucleobases again intercalate. Two modes of intercalation are observed, depending on the nature of the flanking nucleotides, and are each stabilized by different interactions with the polymerase, and each appear to reduce the affinity with which the next correct triphosphate binds. Thus, continued primer extension is limited by de-intercalation and rearrangements with the polymerase active site that are required to populate the catalytically active, triphosphate bound conformation. PMID:24283923

  17. A configuration space of homologous proteins conserving mutual information and allowing a phylogeny inference based on pair-wise Z-score probabilities

    Directory of Open Access Journals (Sweden)

    Maréchal Eric

    2005-03-01

    Full Text Available Abstract Background Popular methods to reconstruct molecular phylogenies are based on multiple sequence alignments, in which addition or removal of data may change the resulting tree topology. We have sought a representation of homologous proteins that would conserve the information of pair-wise sequence alignments, respect probabilistic properties of Z-scores (Monte Carlo methods applied to pair-wise comparisons and be the basis for a novel method of consistent and stable phylogenetic reconstruction. Results We have built up a spatial representation of protein sequences using concepts from particle physics (configuration space and respecting a frame of constraints deduced from pair-wise alignment score properties in information theory. The obtained configuration space of homologous proteins (CSHP allows the representation of real and shuffled sequences, and thereupon an expression of the TULIP theorem for Z-score probabilities. Based on the CSHP, we propose a phylogeny reconstruction using Z-scores. Deduced trees, called TULIP trees, are consistent with multiple-alignment based trees. Furthermore, the TULIP tree reconstruction method provides a solution for some previously reported incongruent results, such as the apicomplexan enolase phylogeny. Conclusion The CSHP is a unified model that conserves mutual information between proteins in the way physical models conserve energy. Applications include the reconstruction of evolutionary consistent and robust trees, the topology of which is based on a spatial representation that is not reordered after addition or removal of sequences. The CSHP and its assigned phylogenetic topology, provide a powerful and easily updated representation for massive pair-wise genome comparisons based on Z-score computations.

  18. Non covalent interactions in RNA and DNA base pairs: a quantum-mechanical study of the coupling between solvent and electronic density.

    Science.gov (United States)

    Lipparini, Filippo; Scalmani, Giovanni; Mennucci, Benedetta

    2009-12-28

    It is well-known that a solvent can modify the relative importance of the different constituents (electrostatic and dispersion) of non-covalent interactions, but much less is known about how these solvent-induced modifications specifically couple with the polarization of the electronic density and electronic correlation. Here we present a quantum mechanical analysis of the effects of the solvent on the non covalent interactions (both stacking and hydrogen bonding) in base pairs using a hierarchy of combinations between a MP2 correlated description for the base pairs and the polarizable continuum model (PCM) for the solvent. A comparison of the results obtained in these different combinations of increasing accuracy allows us to better analyze the important role played by the coupling between correlated electronic densities and solvent polarization in determining the relative importance of stacking and hydrogen bonding effects.

  19. Polymerase recognition and stability of fluoro-substituted pyridone nucleobase analogues.

    Science.gov (United States)

    Hwang, Gil Tae; Leconte, Aaron M; Romesberg, Floyd E

    2007-09-03

    Recently much effort has been focused on designing unnatural base pairs that are stable and replicated by DNA polymerases with high efficiency and fidelity. This work has helped to identify a variety of nucleobase properties that are capable of mediating the required interbase interactions in the absence of Watson-Crick hydrogen-bonding complementarity. These properties include shape complementarity, the presence of a suitably positioned hydrogen-bond donor in the developing minor groove, and fluorine substitution. In order to help characterize how each factor contributes to base pairing stability and replication, we synthesized and characterized three fluoro-substituted pyridone nucleoside analogues, 3 FP, 4 FP, and 5 FP. Generally, we found that the specific fluorine substitution pattern of the analogues had little impact on unnatural pair or mispair stability, with the exception of mispairs with dG, which were also the most stable. The mispair between dG and 3 FP was less stable than that with 4 FP or 5 FP, which likely resulted from specific interbase interactions. While fluorine substitution had little impact on the synthesis of the unnatural base pairs, it significantly enhanced mispairing with dG. Remarkably, the mispair between dG and 3 FP was the most efficiently synthesized, due to a favorable entropy of activation, which possibly resulted from the displacement of water molecules from dG in the phosphoryl transfer transition state. The more efficient synthesis of the 3 FP-dG mispair, despite its being the least stable of the three, suggests that the determinants of synthesis and stability are distinct. Finally, we found that fluorine substitution significantly increased the rate at which the pyridone-based unnatural base pairs were extended; this suggests that both minor groove hydrogen-bond acceptors and fluorine substituents could be used to simultaneously optimize unnatural base pairs.

  20. Design and Development of a Two-Color Emissive FRET Pair Based on a Photostable Fluorescent Deoxyuridine Donor Presenting a Mega-Stokes Shift.

    Science.gov (United States)

    Barthes, Nicolas P F; Gavvala, Krishna; Bonhomme, Dominique; Dabert-Gay, Anne Sophie; Debayle, Delphine; Mély, Yves; Michel, Benoît Y; Burger, Alain

    2016-11-18

    We report the synthesis and site-specific incorporation in oligodeoxynucleotides (ODNs) of an emissive deoxyuridine analog electronically conjugated on its C5-position with a 3-methoxychromone moiety acting as a fluorophore. When incorporated in ODNs, this fluorescent deoxyuridine analog exhibits remarkable photostability and good quantum yields. This deoxyuridine analog also displays a mega-Stokes shift, which allows for its use as an efficient donor for FRET-based studies when paired with the yellow emissive indocarbocyanine Cy3 acceptor.

  1. DNA Electronic Circular Dichroism on the Inter-Base Pair Scale: An Experimental-Theoretical Case Study of the AT Homo-Oligonucleotide.

    Science.gov (United States)

    Di Meo, Florent; Pedersen, Morten N; Rubio-Magnieto, Jenifer; Surin, Mathieu; Linares, Mathieu; Norman, Patrick

    2015-02-05

    A successful elucidation of the near-ultraviolet electronic circular dichroism spectrum of a short double-stranded DNA is reported. Time-dependent density functional theory methods are shown to accurately predict spectra and assign bands on the microscopic base-pair scale, a finding that opens the field for using circular dichroism spectroscopy as a sensitive nanoscale probe of DNA to reveal its complex interactions with the environment.

  2. Novel conformation of an RNA structural switch.

    Science.gov (United States)

    Kennedy, Scott D; Kierzek, Ryszard; Turner, Douglas H

    2012-11-20

    The RNA duplex, (5'GACGAGUGUCA)(2), has two conformations in equilibrium. The nuclear magnetic resonance solution structure reveals that the major conformation of the loop, 5'GAGU/3'UGAG, is novel and contains two unusual Watson-Crick/Hoogsteen GG pairs with G residues in the syn conformation, two A residues stacked on each other in the center of the helix with inverted sugars, and two bulged-out U residues. The structure provides a benchmark for testing approaches for predicting local RNA structure and a sequence that allows the design of a unique arrangement of functional groups and/or a conformational switch into nucleic acids.

  3. Visualization of drug-nucleic acid interactions at atomic resolution. II. Structure of an ethidium/dinucleoside monophosphate crystalline complex, ethidium:5-iodocytidylyl(3'5')guanosine

    Energy Technology Data Exchange (ETDEWEB)

    Jain, S.C.; Tsair, C.C.; Sobell, H.M.

    1977-01-01

    Ethidium forms a second crystalline complex with the dinucleoside monophosphate 5-iodocytidyl(3'-5')guanosine (iodoCpG). These crystals are monoclinic, P2/sub 1/, with a = 14.06 A, b = 32.34 A, c = 16.53 A, ..beta.. = 117.8/sup 0/. The structure has been solved to atomic resolution using rigid-body Patterson vector search and Fourier methods, and refined by full matrix least-squares to a residual of 0.16 on 3180 observed reflections. Both iodoCpG molecules are hydrogen-bonded together by guanine.cytosine Watson--Crick base-pairing. Adjacent base-pairs within this paired iodoCpG structure and between neighboring iodoCpG molecules in adjoining unit cells are separated by 6.7 A. Approximate 2-fold symmetry is used in the interaction; this reflects the pseudo-2-fold symmetry axis of the phenanthridinium ring system in ethidium coinciding with the approximate 2-fold axis relating base-paired iodoCpG molecules. The phenyl and ethyl groups of the intercalated ethidium molecule lie in the narrow groove of the miniature iodoCpG double-helix. The stacked ethidium, however, lies in the opposite direction, its phenyl and ethyl groups neighboring iodine atoms on cytosine residues. Base-pairs within the paired nucleotide units are related by a twist of about 8/sup 0/. The magnitude of this angular twist reflects conformational changes in the sugar--phosphate chains accompanying intercalation. These primarily reflect the differences in ribose sugar ring puckering that are observed (i.e., both iodocytidine residues have C3' endo sugar conformations, while both guanosine residues have C2' endo sugar conformations), and alterations in the glycosidic torsional angles that describe the base-sugar orientation.

  4. Stem-loop structures of the repetitive DNA sequences located at human centromeres

    Energy Technology Data Exchange (ETDEWEB)

    Gupta, G.; Garcia, A.E.; Ratliff, R.; Moyzis, R.K. [Los Alamos National Lab., NM (United States); Catasti, P.; Hong, Lin; Yau, P. [California Univ., Davis, CA (United States). Dept. of Biological Chemistry; Bradbury, E.M. [Los Alamos National Lab., NM (United States)]|[California Univ., Davis, CA (United States). Dept. of Biological Chemistry

    1993-09-01

    The presence of the highly conserved repetitive DNA sequences in the human centromeres argues for a special role of these sequences in their biological functions - most likely achieved by the formation of unusual structures. This prompted us to carry out quantitative one- and two-dimensional nuclear magnetic resonance (lD/2D NMR) spectroscopy to determine the structural properties of the human centromeric repeats, d(AATGG){sub n.d}(CCATT){sub n}. The studies on centromeric DNAs reveal that the complementary sequence, d(AATGG){sub n.d}(CCATT){sub n}, adopts the usual Watson-Crick B-DNA duplex and the pyrimidine-rich d(CCATT){sub n} strand is essentially a random coil. However, the purine-rich d(AATGG){sub n} strand is shown to adopt unusual stem-loop structures for repeat lengths, n=2,3,4, and 6. In addition to normal Watson-Crick A{center_dot}T pairs, the stem-loop structures are stabilized by mismatch A{center_dot}G and G{center_dot}G pairs in the stem and G-G-A stacking in the loop. Stem-loop structures of d(AATGG)n are independently verified by gel electrophoresis and nuclease digestion studies. Thermal melting studies show that the DNA repeats, d(AATGG){sub n}, are as stable as the corresponding Watson-Crick duplex d(AATGG){sub n.d}(CCATT){sub n}. Therefore, the sequence d(AATGG){sub n} can, indeed, nucleate a stem-loop structure at little free-energy cost and if, during mitosis, they are located on the chromosome surface they can provide specific recognition sites for kinetochore function.

  5. Crystal structures of a ddATP-, ddTTP-, ddCTP, and ddGTP- trapped ternary complex of Klentaq1: insights into nucleotide incorporation and selectivity.

    Science.gov (United States)

    Li, Y; Waksman, G

    2001-06-01

    The mechanism by which DNA polymerase I enzymes function has been the subject of extensive biochemical and structural studies. We previously determined the structure of a ternary complex of the large fragment of DNA polymerase I from Thermus aquaticus (Klentaq1) bound to a primer/template DNA and a dideoxycytidine 5'-triphosphate (ddCTP). In this report, we present the details of the 2.3-A resolution crystal structures of three additional ternary complexes of Klentaq1 bound to a primer/template DNA and a dideoxyguanosine 5'-triphosphate (ddGTP), a dideoxythymidine 5'-triphosphate (ddTTP), or a dideoxyadenosine 5'-triphosphate (ddATP). Comparison of the active site of the four ternary complexes reveals that the protein residues around the nascent base pair (that formed between the incoming dideoxynucleoside triphosphate [ddNTP] and the template base) form a snug binding pocket into which only a correct Watson-Crick base pair can fit. Except in the ternary complex bound to dideoxyguanosine 5'-triphosphate, there are no sequence specific contacts between the protein side chains and the nascent base pair, suggesting that steric constraints imposed by the protein onto the nascent base pair is the major contributor to nucleotide selectivity at the polymerase active site. The protein around the polymerase active site also shows plasticity, which may be responsible for the substrate diversity of the enzyme. Two conserved side chains, Q754 and R573, form hydrogen bonds with the N3 atom in the purine base and O2 atom in the pyrimidine base at the minor groove side of the base pair formed by the incorporated ddNMP and the corresponding template base in all the four ternary complexes. These hydrogen-bonding interactions may provide a means of detecting misincorporation at this position.

  6. A pair of novel Cd(II) enantiomers based on lactate derivatives: Synthesis, crystal structures and properties

    Energy Technology Data Exchange (ETDEWEB)

    Xu, Zhong-Xuan, E-mail: xuzhongxuan1974@163.com [Department of Chemistry, Zunyi Normal College, Zunyi, Guizhou 563002 (China); State Key Laboratory of Structural Chemistry, Fujian Institute of Research on the Structure of Matter, the Chinese Academy of Sciences, Fuzhou, Fujian 350002 (China); Ao, Ke-Hou [Department of Chemistry, Zunyi Normal College, Zunyi, Guizhou 563002 (China); Zhang, Jian [State Key Laboratory of Structural Chemistry, Fujian Institute of Research on the Structure of Matter, the Chinese Academy of Sciences, Fuzhou, Fujian 350002 (China)

    2016-09-15

    A pair of novel 3D homochiral metal−organic frameworks (HMOFs), namely [Cd{sub 2.5}((R)-CIA){sub 6}(1,4-DIB)(H{sub 2}O){sub 2}]·((CH{sub 3}){sub 2}NH{sub 2})·H{sub 2}O (1-D), [Cd{sub 2.5}((S)-CIA){sub 6}(1,4-DIB)(H{sub 2}O){sub 2}]·((CH{sub 3}){sub 2}NH{sub 2})·H{sub 2}O (1-L), have been synthesized using lactic acid derivative ligands ((R)-H{sub 3}CIA and (S)-H{sub 3}CIA) and 1,4-DIB. Crystallographic analyses indicate that the complexes 1-D and 1-L are packed by cage substructures. Some physical characteristics, such as solid-state circular dichroism (CD), thermal stabilities and photoluminescent properties are also investigated. Our results highlight the effective method to apply lactic acid derivative ligands to form interesting HMOFs. - Graphical abstract: Using lactic acid derivative ligands ((R)-H{sub 3}CIA and (S)-H{sub 3}CIA) and 1,4-DIB to assemble with Cd{sup 2+} ions, a pair of novel 3D homochiral metal-organic frameworks (HMOFs) with cage substructures have been synthesized. Display Omitted - Highlights: • Lactic acid derivative ligands • Cage substructure • Enantiomers.

  7. Dislocation network with pair-coupling structure in {111} γ/γ' interface of Ni-based single crystal superalloy.

    Science.gov (United States)

    Ru, Yi; Li, Shusuo; Zhou, Jian; Pei, Yanling; Wang, Hui; Gong, Shengkai; Xu, Huibin

    2016-08-11

    The γ/γ' interface dislocation network is reported to improve the high temperature creep resistance of single crystal superalloys and is usually found to deposit in {001} interface. In this work, a new type of dislocation network was found in {111} γ/γ' interface at a single crystal model superalloy crept at 1100 °C/100 MPa. The dislocations in the network are screw with Burgers vectors of 1/2 a and most interestingly, they exhibit a pair-coupling structure. Further investigation indicates that the formation of {111} interface dislocation network occurs when the γ' raft structure begins to degrade by the dislocations cutting into the rafted γ' through the interface. In this condition, the pair-coupling structure is established by the dislocations gliding in a single {111} plane of γ', in order to remove the anti-phase boundary in γ'; these dislocations also act as diffusion channels for dissolving of the γ' particle that is unstable under the interfacial stress from lattice misfit, which leads to the formation of {111}-type zigzag interface. The formation of this network arises as a consequence of more negative misfit, low-alloying γ' particle and proper test conditions of temperature and stress.

  8. New potentiometric electrode based on ion pair complex for determination of tropicamide in pure and pharmaceutical formulations

    Directory of Open Access Journals (Sweden)

    Mouhammed Khateeb

    2016-12-01

    Full Text Available Construction and general performance of a novel modified carbon paste electrode (MCPE for determination of tropicamide (TPC in pure form and pharmaceutical formulations have been examined. Tropicamide-tetraphenylborate (TPC–TPB ion pair has been prepa­red and used as electroactive material. The best MCPE electrode was composed of 7 % ion-pair, 46.5 % dioctylphthalat and 46.5 % graphite powder. The electrode shows stable potentiometric response for TPC in the concentration range 0.3–221.0 µM at 25 °C and pH range of 2.0–8.0. The electrode exhibits near Nernstian slope of 59.71±0.30 mV/decade and lower limit of detection of 0.09 µM with fast response time (less than 15 s. The selectivity of the electrode (TPC–TPB was investigated with respect to some organic and inorganic cations. The MCPE was designed to have better mechanical resistance. The proposed method was successfully applied for determination of TPC in eye drop formulation.

  9. rSNPBase 3.0: an updated database of SNP-related regulatory elements, element-gene pairs and SNP-based gene regulatory networks.

    Science.gov (United States)

    Guo, Liyuan; Wang, Jing

    2017-11-11

    Here, we present the updated rSNPBase 3.0 database (http://rsnp3.psych.ac.cn), which provides human SNP-related regulatory elements, element-gene pairs and SNP-based regulatory networks. This database is the updated version of the SNP regulatory annotation database rSNPBase and rVarBase. In comparison to the last two versions, there are both structural and data adjustments in rSNPBase 3.0: (i) The most significant new feature is the expansion of analysis scope from SNP-related regulatory elements to include regulatory element-target gene pairs (E-G pairs), therefore it can provide SNP-based gene regulatory networks. (ii) Web function was modified according to data content and a new network search module is provided in the rSNPBase 3.0 in addition to the previous regulatory SNP (rSNP) search module. The two search modules support data query for detailed information (related-elements, element-gene pairs, and other extended annotations) on specific SNPs and SNP-related graphic networks constructed by interacting transcription factors (TFs), miRNAs and genes. (3) The type of regulatory elements was modified and enriched. To our best knowledge, the updated rSNPBase 3.0 is the first data tool supports SNP functional analysis from a regulatory network prospective, it will provide both a comprehensive understanding and concrete guidance for SNP-related regulatory studies. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  10. Visualization of drug-nucleic acid interactions at atomic resolution. I. Structure of an ethidium/dinucleoside monophosphate crystalline complex, ethidium:5-iodouridylyl(3'5')adenosine

    Energy Technology Data Exchange (ETDEWEB)

    Tsai, C.C.; Jain, S.C.; Sobell, H.M.

    1977-01-01

    Ethidium forms a crystalline complex with the dinucleoside monophosphate 5-iodouridyly(3'-5')adenosine (iodoUpA). These crystals are monoclinic, space group C2, with unit cell dimensions, a = 28.45 A, b = 13.54 A, c = 34.13 A, ..beta.. = 98.6/sup 0/. The structure has been solved to atomic resolution by Patterson and Fourier methods, and refined by full matrix least-squares to a residual of 0.20 on 2017 observed reflections. The asymmetric unit contains two ethidium molecules, two iodoUpA molecules and 27 water molecules, a total of 155 atoms excluding hydrogens. The two iodoUpA molecules are held together by adenine.uracil Watson--Crick-type base-pairing. Adjacent base-pairs within this paired iodoUpA structure and between neighboring iodoUpA molecules in adjoining unit cells are separated by about 6.7 A; this separation results from intercalative binding by one ethidium molecule and stacking by the other ethidium molecule above and below the base-pairs. Non-crystallographic 2-fold symmetry is utilized in this model drug--nucleic acid interaction, the intercalated ethidium molecule being oriented such that its phenyl and ethyl groups lie in the narrow groove of the miniature nucleic acid double-helix. Base-pairs within the paired nucleotide units are related by a twist of 8/sup 0/. The magnitude of this angular twist is related to conformational changes in the sugar--phosphate chains that accompany drug intercalation. These changes partly reflect the differences in ribose sugar ring puckering that are observed. Additional small but systematic changes occur in torsional angles that involve the phosphodiester linkages and the C4'--C5' bond. Solution studies have indicated a marked sequence-specific binding preference in ethidium--dinucleotide interactions, and a probable structural explanation for this is provided by this study.

  11. Merging Problem-Based Learning with Simulation-Based Learning in the Medical Undergraduate Curriculum: The PAIRED Framework for Enhancing Lifelong Learning.

    Science.gov (United States)

    Koh, Jansen; Dubrowski, Adam

    2016-06-19

    Lifelong learning is an essential trait that is expected of every physician. The CanMeds 2005 Physician Competency Framework emphasizes lifelong learning as a key competency that physicians must achieve in becoming better physicians. However, many physicians are not competent at engaging in lifelong learning. The current medical education system is deficient in preparing medical students to develop and carry out their own lifelong learning curriculum upon graduation. Despite understanding how physicians learn at work, medical students are not trained to learn while working. Similarly, although barriers to lifelong learning are known, medical students are not adequately skilled in overcoming these barriers. Learning to learn is just as important, if not more, as acquiring the skills and knowledge required of a physician. The medical undergraduate curriculum lacks a specific learning strategy to prepare medical students in becoming an adept lifelong learner. In this article, we propose a learning strategy for lifelong learning at the undergraduate level. In developing this novel strategy, we paid particular attention to two parameters. First, this strategy should be grounded on literature describing a physician's lifelong learning process. Second, the framework for implementing this strategy must be based on existing undergraduate learning strategies to obviate the need for additional resources, learner burden, and faculty time. In this paper, we propose a Problem, Analysis, Independent Research Reporting, Experimentation Debriefing (PAIRED) framework that follows the learning process of a physician and serves to synergize the components of problem-based learning and simulation-based learning in specifically targeting the barriers to lifelong learning.

  12. Intra- and interspecific phylogenetic relationships among diploid Triticum-Aegilops species (Poaceae) based on base-pair substitutions, indels, and microsatellites in chloroplast noncoding sequences.

    Science.gov (United States)

    Yamane, Kyoko; Kawahara, Taihachi

    2005-11-01

    This study analyzes intra- and interspecific variation in chloroplast DNA (cpDNA) in diploid Triticum-Aegilops species. This analysis focused on DNA sequence variation in noncoding regions of cpDNA, which included base-pair substitutions, insertion/deletions (indels, 50 loci pooled), microsatellites (7 loci pooled), and inversions. Nine of 13 Triticum-Aegilops species were successfully identified and genotyped using these data. Sixty-two haplotypes were detected in 115 accessions of 13 diploid species. Because of the large number of characters examined, novel deep relationships within and among Triticum-Aegilops species could be identified and evaluated. Phylogenetic trees for the genus Triticum-Aegilops were constructed with Hordeum vulgare and Dasypyrum villosum as outgroups, and the results were compared to previous studies. These data support the following inferences: (1) Aegilops species should be included in Triticum; (2) groups D, T, M, N, U, and section Sitopsis (except Ae. speltoides) underwent speciation concurrently, but most diploid species evolved independently; (3) Ae. mutica does not occupy a basal position in Triticum-Aegilops; (4) Ae. speltoides is in a basal position and differs significantly from other Sitopsis species; (5) Ae. caudata is polyphyletic in all trees; (6) the genus Aegilops is paraphyletic with Secale.

  13. Proof of ion-pair structures in ammonium-based protic ionic liquids using combined NMR and DFT/PCM-based chemical shift calculations.

    Science.gov (United States)

    Lozynski, M; Pernak, J; Gdaniec, Z; Gorska, B; Béguin, F

    2017-09-20

    The self-assembly of triethylammonium bis(trifluoromethylsulfonyl)imide, i.e. [(C 2 H 5 ) 3 NH][TFSI], in chloroform and aqueous solutions has been investigated using 1 H NMR spectroscopy and computational (DFT/PCM prediction) methods. We have examined a number of ion pairs formed between the [(C 2 H 5 ) 3 NH] + cation with different conformations of alkyl substituents as well as various dispositions of the multi-site [TFSI] - anion. Based on the agreement between the calculated (DFT) and observed 1 H NMR chemical shifts, [(C 2 H 5 ) 3 NH][TFSI] in chloroform formed lipophilic complexes with effective N + -HN or N + -HO hydrogen bonding, whereas hydrophilic complexes with C α -HO and C α -HF hydrogen bonding are found in aqueous solutions. This study provides a new insight into the self-aggregation of ammonium PILs incorporating the widely used [TFSI] - anion and demonstrates the importance of solvent effects on chemical shifts. The simulations with explicit and implicit dielectric continuum solvents are found to be the most realistic method, yielding a representative ensemble of structures.

  14. Atomic-Level Organization of Vicinal Acid-Base Pairs through the Chemisorption of Aniline and Derivatives onto Mesoporous SBA15

    KAUST Repository

    Basset, Jean-Marie

    2016-06-09

    The design of novel heterogeneous catalysts with multiple adjacent functionalities is of high interest for heterogeneous catalysis. Herein, we report a method to obtain a majority bifunctional acid-base pairs on SBA15. Aniline reacts with SBA15 by opening siloxane bridges leading to N-phenylsilanamine-silanol pairs. In contrast with ammonia treated surfaces, the material is stable under air/moisture. Advanced solid state MAS NMR: 2D ¹H-¹H double-quantum, ¹H-¹³C HETCOR experiments and dynamic nuclear polarization enhanced ²⁹Si and ¹⁵N spectra demonstrate both the close proximity between the two moieties and the formation of a covalent Si-N surface bond and confirm the design of vicinal acid-base pairs. This approach was successfully applied to the design of a series of aniline derivatives bifunctional SBA15. A correlation of the substituents effects on the aromatic ring (Hammet parameters) on the kinetics of the model reaction of Knoevenagel is observed.

  15. Ross filter pairs for metal artefact reduction in x-ray tomography: a case study based on imaging and segmentation of metallic implants

    Science.gov (United States)

    Arhatari, Benedicta D.; Abbey, Brian

    2018-01-01

    Ross filter pairs have recently been demonstrated as a highly effective means of producing quasi-monoenergetic beams from polychromatic X-ray sources. They have found applications in both X-ray spectroscopy and for elemental separation in X-ray computed tomography (XCT). Here we explore whether they could be applied to the problem of metal artefact reduction (MAR) for applications in medical imaging. Metal artefacts are a common problem in X-ray imaging of metal implants embedded in bone and soft tissue. A number of data post-processing approaches to MAR have been proposed in the literature, however these can be time-consuming and sometimes have limited efficacy. Here we describe and demonstrate an alternative approach based on beam conditioning using Ross filter pairs. This approach obviates the need for any complex post-processing of the data and enables MAR and segmentation from the surrounding tissue by exploiting the absorption edge contrast of the implant.

  16. Pair-Wise, Deformable Mirror, Image Plane-Based Diversity Electric Field Estimation for High Contrast Coronagraphy

    Science.gov (United States)

    Give'on, Amir; Kern, Brian D.; Shaklan, Stuart

    2011-01-01

    In this paper we describe the complex electric field reconstruction from image plane intensity measurements for high contrast coronagraphic imaging. A deformable mirror (DM) surface is modied with pairs of complementary shapes to create diversity in the image plane of the science camera where the intensity of the light is measured. Along with the Electric Field Conjugation correction algorithm, this estimation method has been used in various high contrast imaging testbeds to achieve the best contrasts to date both in narrow and in broad band light. We present the basic methodology of estimation in easy to follow list of steps, present results from HCIT and raise several open quations we are confronted with using this method.

  17. Pressure-induced polyamorphism by quantitative structure factor and pair distribution function analysis in two Ce-based metallic glasses

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Linji; Sun, Fei; Hong, Xinguo; Wang, Junlong; Liu, Gang; Kong, Lingping; Yang, Hongwang; Liu, Xiuru; Zhao, Yong; Yang, Wenge

    2017-02-01

    We utilized the pair distribution function method to characterize the pressure-induced polyamorphic transition in Ce60Al20Cu20 and Ce55Al45 metallic glass at room temperature. Using synchrotron high-energy x-ray diffraction we collected scattering information from a large Q-space coverage, which in turn gave a high resolution g(r) that provided accurate local structure information. We observed a sudden change in compressibility and the nearest neighbor distance at 3.50–6.32 GPa for Ce60Al20Cu20 and 2.20–6.89 GPa for Ce55Al45. The origin of the volume collapse seemed to be pressure-induced qualitative changes in bond shortening that corresponded to different coordination spheres. The polyamorphic transitions in these two systems from low-density glass (LDG) to high-density glass (HDG) are associated with local atomic rearrangements.

  18. Architecture based on the integration of intermolecular G-quadruplex structure with sticky-end pairing and colorimetric detection of DNA hybridization.

    Science.gov (United States)

    Li, Hongbo; Wu, Zai-Sheng; Shen, Zhifa; Shen, Guoli; Yu, Ruqin

    2014-02-21

    An interesting discovery is reported in that G-rich hairpin-based recognition probes can self-assemble into a nano-architecture based on the integration of an intermolecular G-quadruplex structure with the sticky-end pairing effect in the presence of target DNAs. Moreover, GNPs modified with partly complementary DNAs can intensively aggregate by hybridization-based intercalation between intermolecular G-quadruplexes, indicating an inspiring assembly mechanism and a powerful colorimetric DNA detection. The proposed intermolecular G-quadruplex-integrated sticky-end pairing assembly (called GISA)-based colorimetric system allows a specific and quantitative assay of p53 DNA with a linear range of more than two orders of magnitude and a detection limit of 0.2 nM, suggesting a considerably improved analytical performance. And more to the point, the discrimination of single-base mismatched target DNAs can be easily conducted via visual observation. The successful development of the present colorimetric system, especially the GISA-based aggregation mechanism of GNPs is different from traditional approaches, and offers a critical insight into the dependence of the GNP aggregation on the structural properties of oligonucleotides, opening a good way to design colorimetric sensing probes and DNA nanostructure.

  19. Synthesis of 5-[3-(2-aminopyrimidin-4-yl)aminopropyn-1-yl]uracil derivative that recognizes Ade-Thy base pairs in double-stranded DNA.

    Science.gov (United States)

    Ito, Yu; Masaki, Yoshiaki; Kanamori, Takashi; Ohkubo, Akihiro; Seio, Kohji; Sekine, Mitsuo

    2016-01-01

    5-[3-(2-Aminopyrimidin-4-yl)aminopropyn-1-yl]uracil (Ura(Pyr)) was designed as a new nucleobase to recognize Ade-Thy base pair in double-stranded DNA. We successfully synthesized the dexoynucleoside phosphoramidite having Ura(Pyr) and incorporated it into triplex forming oligonucleotides (TFOs). Melting temperature analysis revealed that introduction of Ura(Pyr) into TFOs could effectively stabilize their triplex structures without loss of base recognition capabilities. Copyright © 2015 Elsevier Ltd. All rights reserved.

  20. Communication: An improved linear scaling perturbative triples correction for the domain based local pair-natural orbital based singles and doubles coupled cluster method [DLPNO-CCSD(T)].

    Science.gov (United States)

    Guo, Yang; Riplinger, Christoph; Becker, Ute; Liakos, Dimitrios G; Minenkov, Yury; Cavallo, Luigi; Neese, Frank

    2018-01-07

    In this communication, an improved perturbative triples correction (T) algorithm for domain based local pair-natural orbital singles and doubles coupled cluster (DLPNO-CCSD) theory is reported. In our previous implementation, the semi-canonical approximation was used and linear scaling was achieved for both the DLPNO-CCSD and (T) parts of the calculation. In this work, we refer to this previous method as DLPNO-CCSD(T0) to emphasize the semi-canonical approximation. It is well-established that the DLPNO-CCSD method can predict very accurate absolute and relative energies with respect to the parent canonical CCSD method. However, the (T0) approximation may introduce significant errors in absolute energies as the triples correction grows up in magnitude. In the majority of cases, the relative energies from (T0) are as accurate as the canonical (T) results of themselves. Unfortunately, in rare cases and in particular for small gap systems, the (T0) approximation breaks down and relative energies show large deviations from the parent canonical CCSD(T) results. To address this problem, an iterative (T) algorithm based on the previous DLPNO-CCSD(T0) algorithm has been implemented [abbreviated here as DLPNO-CCSD(T)]. Using triples natural orbitals to represent the virtual spaces for triples amplitudes, storage bottlenecks are avoided. Various carefully designed approximations ease the computational burden such that overall, the increase in the DLPNO-(T) calculation time over DLPNO-(T0) only amounts to a factor of about two (depending on the basis set). Benchmark calculations for the GMTKN30 database show that compared to DLPNO-CCSD(T0), the errors in absolute energies are greatly reduced and relative energies are moderately improved. The particularly problematic case of cumulene chains of increasing lengths is also successfully addressed by DLPNO-CCSD(T).

  1. Communication: An improved linear scaling perturbative triples correction for the domain based local pair-natural orbital based singles and doubles coupled cluster method [DLPNO-CCSD(T)

    KAUST Repository

    Guo, Yang

    2018-01-04

    In this communication, an improved perturbative triples correction (T) algorithm for domain based local pair-natural orbital singles and doubles coupled cluster (DLPNO-CCSD) theory is reported. In our previous implementation, the semi-canonical approximation was used and linear scaling was achieved for both the DLPNO-CCSD and (T) parts of the calculation. In this work, we refer to this previous method as DLPNO-CCSD(T0) to emphasize the semi-canonical approximation. It is well-established that the DLPNO-CCSD method can predict very accurate absolute and relative energies with respect to the parent canonical CCSD method. However, the (T0) approximation may introduce significant errors in absolute energies as the triples correction grows up in magnitude. In the majority of cases, the relative energies from (T0) are as accurate as the canonical (T) results of themselves. Unfortunately, in rare cases and in particular for small gap systems, the (T0) approximation breaks down and relative energies show large deviations from the parent canonical CCSD(T) results. To address this problem, an iterative (T) algorithm based on the previous DLPNO-CCSD(T0) algorithm has been implemented [abbreviated here as DLPNO-CCSD(T)]. Using triples natural orbitals to represent the virtual spaces for triples amplitudes, storage bottlenecks are avoided. Various carefully designed approximations ease the computational burden such that overall, the increase in the DLPNO-(T) calculation time over DLPNO-(T0) only amounts to a factor of about two (depending on the basis set). Benchmark calculations for the GMTKN30 database show that compared to DLPNO-CCSD(T0), the errors in absolute energies are greatly reduced and relative energies are moderately improved. The particularly problematic case of cumulene chains of increasing lengths is also successfully addressed by DLPNO-CCSD(T).

  2. Communication: An improved linear scaling perturbative triples correction for the domain based local pair-natural orbital based singles and doubles coupled cluster method [DLPNO-CCSD(T)

    Science.gov (United States)

    Guo, Yang; Riplinger, Christoph; Becker, Ute; Liakos, Dimitrios G.; Minenkov, Yury; Cavallo, Luigi; Neese, Frank

    2018-01-01

    In this communication, an improved perturbative triples correction (T) algorithm for domain based local pair-natural orbital singles and doubles coupled cluster (DLPNO-CCSD) theory is reported. In our previous implementation, the semi-canonical approximation was used and linear scaling was achieved for both the DLPNO-CCSD and (T) parts of the calculation. In this work, we refer to this previous method as DLPNO-CCSD(T0) to emphasize the semi-canonical approximation. It is well-established that the DLPNO-CCSD method can predict very accurate absolute and relative energies with respect to the parent canonical CCSD method. However, the (T0) approximation may introduce significant errors in absolute energies as the triples correction grows up in magnitude. In the majority of cases, the relative energies from (T0) are as accurate as the canonical (T) results of themselves. Unfortunately, in rare cases and in particular for small gap systems, the (T0) approximation breaks down and relative energies show large deviations from the parent canonical CCSD(T) results. To address this problem, an iterative (T) algorithm based on the previous DLPNO-CCSD(T0) algorithm has been implemented [abbreviated here as DLPNO-CCSD(T)]. Using triples natural orbitals to represent the virtual spaces for triples amplitudes, storage bottlenecks are avoided. Various carefully designed approximations ease the computational burden such that overall, the increase in the DLPNO-(T) calculation time over DLPNO-(T0) only amounts to a factor of about two (depending on the basis set). Benchmark calculations for the GMTKN30 database show that compared to DLPNO-CCSD(T0), the errors in absolute energies are greatly reduced and relative energies are moderately improved. The particularly problematic case of cumulene chains of increasing lengths is also successfully addressed by DLPNO-CCSD(T).

  3. S-1-Based versus capecitabine-based preoperative chemoradiotherapy in the treatment of locally advanced rectal cancer: a matched-pair analysis.

    Directory of Open Access Journals (Sweden)

    Meng Su

    Full Text Available OBJECTIVE: The aim of this paper was to compare the efficacy and safety of S-1-based and capecitabine-based preoperative chemoradiotherapy regimens in patients with locally advanced rectal cancer through a retrospective matched-pair analysis. MATERIALS AND METHODS: Between Jan 2010 and Mar 2014, 24 patients with locally advanced rectal cancer who received preoperative radiotherapy concurrently with S-1 were individually matched with 24 contemporary patients with locally advanced rectal cancer who received preoperative radiotherapy concurrently with capecitabine according to clinical stage (as determined by pelvic magnetic resonance imaging and computed tomography and age (within five years. All these patients performed mesorectal excision 4-8 weeks after the completion of chemoradiotherapy. RESULTS: The tumor volume reduction rates were 55.9±15.1% in the S-1 group and 53.8±16.0% in the capecitabine group (p = 0.619. The overall downstaging, including both T downstaging and N downstaging, occurred in 83.3% of the S-1 group and 70.8% of the capecitabine group (p = 0.508. The significant tumor regression, including regression grade I and II, occurred in 33.3% of S-1 patients and 25.0% of capecitabine patients (p = 0.754. In the two groups, Grade 4 adverse events were not observed and Grade 3 consisted of only two cases of diarrhea, and no patient suffered hematologic adverse event of Grade 2 or higher. However, the incidence of diarrhea (62.5% vs 33.3%, p = 0.014 and hand-foot syndrome (29.2% vs 0%, p = 0.016 were higher in capecitabine group. Other adverse events did not differ significantly between two groups. CONCLUSIONS: The two preoperative chemoradiotherapy regimens were effective and safe for patients of locally advanced rectal cancer, but regimen with S-1 exhibited a lower incidence of adverse events.

  4. Solvation of deoxynucleosides in aqueous mixtures of organic solvents probed through their intrinsic fluorescence: Implications for open base pair states in DNA

    Science.gov (United States)

    Ababneh, Anas Mohammad

    Because of the importance of solvation in the function of DNA, there is considerable interest in understanding the solvation network of its constituent components. This is of particular importance in connection with the closing of base pairs that have been disrupted as a result of structural fluctuations. Following the opening of a base pair, the open base is exposed to a heterogeneous environment which involves polar as well as nonpolar interactions. Toward the goal of understanding how the open bases interact with such a heterogeneous environment, we have studied the intrinsic fluorescence properties of the purine and pyrimidine nucleosides (dG, dA, dT, and dC) in organic solvents in the presence of small amounts of water. Exposure of the nucleoside to water was done by preparing solutions in three different ways: (i) "premixed" solution in which the nucleoside is dissolved in a water-organic solvent mixture, (ii) "carry its own water" solution in which the nucleoside is first dissolved in water and then diluted in the organic solvent, and (iii) "injected" solution in which water is added to a solution of the nucleoside in the organic solvent. The organic solvents used in the present study were: n-butanol, acetonitrile, methanol, n-propanol, isopropanol, and isobutanol. We find that for n-butanol and acetonitrile, which have a high degree of amphiphilicity and weak hydrogen bonding ability, respectively, the fluorescence spectral properties of the purines are found to depend on the sequence of the steps in which the aqueous mixture was formed. By contrast, no such dependence was observed in the other organic solvents. On the other hand, no such dependence was observed for the pyrimidines in any of the organic solvents used in the present study. These findings suggest that the final solvation network around the purines is dependent on the nature of the environment to which they were initially exposed. This would tend to present an impediment to the closing of

  5. Structural Insight into the Discrimination between 8-oxoguanine Glycosidic Conformers by DNA Repair Enzymes: A Molecular Dynamics Study of hOgg1 and FPG.

    Science.gov (United States)

    Sowlati-Hashjin, Shahin; Wetmore, Stacey D

    2018-01-10

    hOgg1 and FPG are the primary DNA repair enzymes responsible for removing the major guanine oxidative product (G), namely 7,8-dihydro-8-oxoguanine (OG), in humans and bacteria, respectively. While natural G adopts the anti conformation and forms a Watson-Crick pair with cytosine (C), OG can also adopt the syn conformation and form a Hoogsteen pair with adenine (A). hOgg1 removes OG paired with C, but is inactive toward the OG:A pair. In contrast, FPG removes OG from OG:C pairs, and also exhibits appreciable (although diminished) activity toward OG:A pairs. As a first step toward understanding this difference in activity, we have employed molecular dynamics simulations to examine how the anti and syn conformers of OG are accommodated in the hOgg1 and FPG active sites. When anti-OG is bound, hOgg1 active site residues are properly aligned to initiate catalytic base departure, while geometrical parameters required for the catalytic reaction are not conserved for syn-OG. On the other hand, the FPG catalytic residues are suitably aligned for both OG conformers, with anti-OG being more favorably bound. Thus, our data suggests that the differential ability of hOgg1 and FPG to accommodate the anti and syn-OG glycosidic conformations is an important factor that contributes to the relative experimental excision rates. Nevertheless, the positions of the nucleophiles with respect to the lesion in the active sites suggest that the reactant complex is poised to initiate catalysis through a similar mechanism for both repair enzymes, and supports a recently proposed mechanism in which sugar-ring opening precedes nucleoside deglycosylation.

  6. The cost of wobble translation in fungal mitochondrial genomes: integration of two traditional hypotheses

    Directory of Open Access Journals (Sweden)

    Xia Xuhua

    2008-07-01

    Full Text Available Abstract Background Fungal and animal mitochondrial genomes typically have one tRNA for each synonymous codon family. The codon-anticodon adaptation hypothesis predicts that the wobble nucleotide of a tRNA anticodon should evolve towards maximizing Watson-Crick base pairing with the most frequently used codon within each synonymous codon family, whereas the wobble versatility hypothesis argues that the nucleotide at the wobble site should be occupied by a nucleotide most versatile in wobble pairing, i.e., the tRNA wobble nucleotide should be G for NNY codon families, and U for NNR and NNN codon families (where Y stands for C or U, R for A or G and N for any nucleotide. Results We here integrate these two traditional hypotheses on tRNA anticodons into a unified model based on an analysis of the wobble costs associated with different wobble base pairs. This novel approach allows the relative cost of wobble pairing to be qualitatively evaluated. A comprehensive study of 36 fungal genomes suggests very different costs between two kinds of U:G wobble pairs, i.e., (1 between a G at the wobble site of a tRNA anticodon and a U at the third codon position (designated MU3:G and (2 between a U at the wobble site of a tRNA anticodon and a G at the third codon position (designated MG3:U. Conclusion In general, MU3:G is much smaller than MG3:U, suggesting no selection against U-ending codons in NNY codon families with a wobble G in the tRNA anticodon but strong selection against G-ending codons in NNR codon families with a wobble U at the tRNA anticodon. This finding resolves several puzzling observations in fungal genomics and corroborates previous studies showing that U3:G wobble is energetically more favorable than G3:U wobble.

  7. Evidence for habitat partitioning based on adaptation to environmental light in a pair of sympatric lizard species.

    Science.gov (United States)

    Leal, Manuel; Fleishman, Leo J

    2002-02-22

    Terrestrial habitats exhibit a variety of light environments. If species exhibit evolutionary adaptations of their visual system or signals to habitat light conditions, then these conditions can directly influence the structure of communities. We evaluated habitat light characteristics and visual-signal design in a pair of sympatric species of lizards: Anolis cooki and Anolis cristatellus. We found that each species occupies a distinct microhabitat with respect to light intensity and spectral quality. We measured the relative retinal spectral sensitivity and found significant differences between the species that correlate with differences in habitat spectral quality. We measured the spectral reflectance of the dewlaps (colourful throat fans used in communication), and found that the A. cooki dewlap reflects little ultraviolet (UV), while that of A. cristatellus reflects strongly in the UV. For both species downwelling light (irradiance) is rich in UV. However the background light (radiance) is rich in UV for A. cooki, but low in UV for A. cristatellus. Thus, the dewlap of each species creates a high contrast with the background in the UV. Our findings strongly suggest that these two species are partitioning their habitat through specializations of the visual system and signal design to microhabitat light conditions.

  8. Pms2 and uracil-DNA glycosylases act jointly in the mismatch repair pathway to generate Ig gene mutations at A-T base pairs.

    Science.gov (United States)

    Girelli Zubani, Giulia; Zivojnovic, Marija; De Smet, Annie; Albagli-Curiel, Olivier; Huetz, François; Weill, Jean-Claude; Reynaud, Claude-Agnès; Storck, Sébastien

    2017-04-03

    During somatic hypermutation (SHM) of immunoglobulin genes, uracils introduced by activation-induced cytidine deaminase are processed by uracil-DNA glycosylase (UNG) and mismatch repair (MMR) pathways to generate mutations at G-C and A-T base pairs, respectively. Paradoxically, the MMR-nicking complex Pms2/Mlh1 is apparently dispensable for A-T mutagenesis. Thus, how detection of U:G mismatches is translated into the single-strand nick required for error-prone synthesis is an open question. One model proposed that UNG could cooperate with MMR by excising a second uracil in the vicinity of the U:G mismatch, but it failed to explain the low impact of UNG inactivation on A-T mutagenesis. In this study, we show that uracils generated in the G1 phase in B cells can generate equal proportions of A-T and G-C mutations, which suggests that UNG and MMR can operate within the same time frame during SHM. Furthermore, we show that Ung-/-Pms2-/- mice display a 50% reduction in mutations at A-T base pairs and that most remaining mutations at A-T bases depend on two additional uracil glycosylases, thymine-DNA glycosylase and SMUG1. These results demonstrate that Pms2/Mlh1 and multiple uracil glycosylases act jointly, each one with a distinct strand bias, to enlarge the immunoglobulin gene mutation spectrum from G-C to A-T bases. © 2017 Girelli Zubani et al.

  9. THE EVALUATION OF POSSIBILITY OF NORMAL OPERATION OF CABLES BASED ON TWISTED PAIRS WITH PVC JACKET UNDER THE CONDITIONS OF HIGH HUMIDITY AND TEMPERATURE

    Directory of Open Access Journals (Sweden)

    G. V. Bezprozvannych

    2017-10-01

    Full Text Available Introduction. Development of cables for structured cabling systems based on twisted pairs for shipbuilding is carried out in two main directions: increasing the fire safety of cables and increasing the long-term permissible operating temperature by using new, more heat-resistant, electrical insulating materials. Purpose. Substantiation of the possibility of unshielded cables on the basis of unshielded twisted pairs with thermoplastic polyethylene insulation in PVC protective jacket in conditions of high humidity and high operating temperatures on the basis of the results of accelerated aging. Methodology. The cycle of aging under conditions of increased humidity is performed for 336 hours. Then the sample was under natural drying conditions for 1440 hours. Thermal aging in a thermostat at 90 °C was carried out in two stages: first – for 206 hours, the second – for 260 hours. In the initial state and after accelerated aging, measurements of the capacitance and tangent of the dielectric loss angle of all the insulating gaps at frequencies of 100 Hz, 1 and 10 kHz were performed. Results. According to the results of accelerated aging under conditions of high humidity and temperature, it is established that the design of an unshielded cable based on unshielded twisted pairs with thermoplastic polyethylene insulation in a protective coating based on PVC-plastic is resistant to external influencing factors. Practical value. The prolonged holding at temperature of 90 °C is equivalent to operation at temperature of 40 °C for 6.8 years. At higher operating temperatures, the lifetime of the cable is significantly reduced.

  10. Paired measurement of urinary creatinine in neonates based on a Jaffe and an enzymatic IDMS-traceable assay.

    Science.gov (United States)

    Allegaert, Karel; Vermeersch, Pieter; Smits, Anne; Mekahli, Djalila; Levtchenko, Elena; Pauwels, Steven

    2014-04-15

    Urinary creatinine can be quantified by Jaffe or enzymatic assays and is commonly used as denominator of urinary excretion of electrolytes or protein. Paired analysis in pediatric and adult samples documented inter-assay differences (up to 80%). We verified the interchangeability of two IDMS-traceable assays (Jaffe and enzymatic) for neonatal urine and report on neonatal urinary creatinine values using these IDMS-traceable methods. Creatinine was measured in 84 neonatal urine samples from 46 neonates by an IDMS traceable Jaffe and enzymatic assay (Roche Diagnostics, Cobas c702 module). Creatinine values, differences in urinary creatinine and clinical characteristics were described and covariates of between assay difference were explored (Wilcoxon, Bland-Altman, correlation, multiple regression). Median Jaffe and enzymatic urinary creatinine concentrations were 9.25 (range 3.7-42.2) and 9.15 (range 3.8-42.9) mg/dL respectively, resulting in a median difference of 0.08 (SD 0.6, range -2.4 to 0.96) mg/dL. In a multiple regression model, urinary enzymatic creatinine concentration (r = 0.45) and postnatal age (r = -0.59) remained independent variables of the difference between both assays (r2 adj = 0.45). The tested IDMS-traceable assays showed interchangeable in heterogeneous neonatal urine samples. Using these assays, neonatal urinary creatinine showed 5-20 fold lower values than those observed in children or adults with a significant negative correlation with postnatal age.

  11. Proton-transfer in hydrogenated guanine-cytosine trimer neutral species, cations, and anions embedded in B-form DNA.

    Science.gov (United States)

    Lin, Yuexia; Wang, Hongyan; Wu, Yingxi; Gao, Simin; Schaefer, Henry F

    2014-04-14

    The neutral DNA trimers with the hydrogen atom added to the C8 site of the middle guanine-cytosine (GC) base pair, the DNA trimers protonated at the N7 site of the middle GC base pair, and the anionic species resulting from hydride addition to the C6 site of the middle GC base pair are investigated using theoretical methods. The canonical Watson-Crick structures (WC), transition state structures (TS) and proton-transferred structures (PT) of each relevant system are optimized in the gas phase and in aqueous solution, in order to understand the processes of proton transfer. The proton transfer reactions of the DNA trimers are compared with the corresponding isolated hydrogenated GC base pairs to explore the influence of the surrounding molecules and the base sequence. The proton transfer reactions of the neutral species, cations, and anions are compared, aiming to clarify the effects of the system's total charge. The results reveal that the surrounding molecules decrease the reaction energies of proton-transfer in aqueous solution. The structures with the dATGCAT and dGCGCGC sequences facilitate proton H4a transfer, but hinder proton H1 transfer. The structures with the dCGGCCG and dTAGCTA sequences facilitate proton H1 transfer. The net charge on the system plays an important role in determining the single and double proton-transfer patterns. Anions are more likely to experience proton-transfer reactions than neutral species and cations, and all the proton-transfer reactions of the anions are exothermic.

  12. In Vivo Structure-Activity Relationships and Optimization of an Unnatural Base Pair for Replication in a Semi-Synthetic Organism.

    Science.gov (United States)

    Feldman, Aaron W; Romesberg, Floyd E

    2017-08-23

    In an effort to expand the genetic alphabet and create semi-synthetic organisms (SSOs) that store and retrieve increased information, we have developed the unnatural base pairs (UBPs) dNaM and d5SICS or dTPT3 (dNaM-d5SICS and dNaM-dTPT3). The UBPs form based on hydrophobic and packing forces, as opposed to complementary hydrogen bonding, and while they are both retained within the in vivo environment of an Escherichia coli SSO, their development was based on structure-activity relationship (SAR) data generated in vitro. To address the likely possibility of different requirements of the in vivo environment, we screened 135 candidate UBPs for optimal performance in the SSO. Interestingly, we find that in vivo SARs differ from those collected in vitro, and most importantly, we identify four UBPs whose retention in the DNA of the SSO is higher than that of dNaM-dTPT3, which was previously the most promising UBP identified. The identification of these four UBPs further demonstrates that when optimized, hydrophobic and packing forces may be used to replace the complementary hydrogen bonding used by natural pairs and represents a significant advance in our continuing efforts to develop SSOs that store and retrieve more information than natural organisms.

  13. Secondary structures of rRNAs from all three domains of life.

    Directory of Open Access Journals (Sweden)

    Anton S Petrov

    Full Text Available Accurate secondary structures are important for understanding ribosomes, which are extremely large and highly complex. Using 3D structures of ribosomes as input, we have revised and corrected traditional secondary (2° structures of rRNAs. We identify helices by specific geometric and molecular interaction criteria, not by co-variation. The structural approach allows us to incorporate non-canonical base pairs on parity with Watson-Crick base pairs. The resulting rRNA 2° structures are up-to-date and consistent with three-dimensional structures, and are information-rich. These 2° structures are relatively simple to understand and are amenable to reproduction and modification by end-users. The 2° structures made available here broadly sample the phylogenetic tree and are mapped with a variety of data related to molecular interactions and geometry, phylogeny and evolution. We have generated 2° structures for both large subunit (LSU 23S/28S and small subunit (SSU 16S/18S rRNAs of Escherichia coli, Thermus thermophilus, Haloarcula marismortui (LSU rRNA only, Saccharomyces cerevisiae, Drosophila melanogaster, and Homo sapiens. We provide high-resolution editable versions of the 2° structures in several file formats. For the SSU rRNA, the 2° structures use an intuitive representation of the central pseudoknot where base triples are presented as pairs of base pairs. Both LSU and SSU secondary maps are available (http://apollo.chemistry.gatech.edu/RibosomeGallery. Mapping of data onto 2° structures was performed on the RiboVision server (http://apollo.chemistry.gatech.edu/RiboVision.

  14. Ion pair-based liquid-phase microextraction combined with cuvetteless UV-vis micro-spectrophotometry as a miniaturized assay for monitoring ammonia in waters.

    Science.gov (United States)

    Senra-Ferreiro, Sonia; Pena-Pereira, Francisco; Costas-Mora, Isabel; Romero, Vanesa; Lavilla, Isela; Bendicho, Carlos

    2011-09-15

    A miniaturized method based on liquid-phase microextraction (LPME) in combination with microvolume UV-vis spectrophotometry for monitoring ammonia in waters is proposed. The methodology is based on the extraction of the ion pair formed between the blue indophenol obtained according to the Berthelot reaction and a quaternary ammonium salt into a microvolume of organic solvent. Experimental parameters affecting the LPME performance such as type and concentration of the quaternary ammonium ion salt required to form the ion pair, type and volume of extractant solvent, effect of disperser solvent, ionic strength and extraction time, were optimized. A detection limit of 5.0 μg L(-1) ammonia and an enrichment factor of 30 can be attained after a microextraction time of 4 min. The repeatability, expressed as relative standard deviation, was 7.6% (n=7). The proposed method can be successfully applied to the determination of trace amounts of ammonia in several environmental water samples. Copyright © 2011 Elsevier B.V. All rights reserved.

  15. A comparative research of different ensemble surrogate models based on set pair analysis for the DNAPL-contaminated aquifer remediation strategy optimization

    Science.gov (United States)

    Hou, Zeyu; Lu, Wenxi; Xue, Haibo; Lin, Jin

    2017-08-01

    Surrogate-based simulation-optimization technique is an effective approach for optimizing the surfactant enhanced aquifer remediation (SEAR) strategy for clearing DNAPLs. The performance of the surrogate model, which is used to replace the simulation model for the aim of reducing computation burden, is the key of corresponding researches. However, previous researches are generally based on a stand-alone surrogate model, and rarely make efforts to improve the approximation accuracy of the surrogate model to the simulation model sufficiently by combining various methods. In this regard, we present set pair analysis (SPA) as a new method to build ensemble surrogate (ES) model, and conducted a comparative research to select a better ES modeling pattern for the SEAR strategy optimization problems. Surrogate models were developed using radial basis function artificial neural network (RBFANN), support vector regression (SVR), and Kriging. One ES model is assembling RBFANN model, SVR model, and Kriging model using set pair weights according their performance, and the other is assembling several Kriging (the best surrogate modeling method of three) models built with different training sample datasets. Finally, an optimization model, in which the ES model was embedded, was established to obtain the optimal remediation strategy. The results showed the residuals of the outputs between the best ES model and simulation model for 100 testing samples were lower than 1.5%. Using an ES model instead of the simulation model was critical for considerably reducing the computation time of simulation-optimization process and maintaining high computation accuracy simultaneously.

  16. A single base pair in the right terminal domain of tomato planta macho viroid is a virulence determinant factor on tomato.

    Science.gov (United States)

    Li, Rugang; Padmanabhan, Chellappan; Ling, Kai-Shu

    2017-01-01

    Tomato planta macho viroid (TPMVd), including isolates previously designated as Mexican papita viroid (MPVd), causes serious disease on tomatoes in North America. Two predominant variants, sharing 93.8% sequence identity, incited distinct severe (MPVd-S) or mild (MPVd-M) symptoms on tomato. To identify virulence determinant factor, a series of chimeric infectious clones were generated using synthetic DNA approach to progressively replace each structural domain between the two variants. In bioassays on tomato 'Rutgers', three chimeras containing Terminal Left and Pathogenicity (MPVd-H1), Central (MPVd-H2), or Variable (MPVd-H3) of MPVd-S, incited mild to intermediate symptoms. However, a chimera containing Terminal Right (TR) of MPVd-S (MPVd-H4) incited severe symptoms. Only one base-pair mutation in the TR domain between MPVd-M (176U:A185) and MPVd-S (174G:C183) was identified. A reciprocal mutant (MPVd-H5) rendered the chimeric viroid mild on tomato. This single base-pair in the TR domain was determined as the virulence determinant factor for TPMVd. Published by Elsevier Inc.

  17. Analysis and Simulation of the Simplified Aircraft-Based Paired Approach Concept With the ALAS Alerting Algorithm in Conjunction With Echelon and Offset Strategies

    Science.gov (United States)

    Torres-Pomales, Wilfredo; Madden, Michael M.; Butler, Rickey W.; Perry, Raleigh B.

    2014-01-01

    This report presents analytical and simulation results of an investigation into proposed operational concepts for closely spaced parallel runways, including the Simplified Aircraft-based Paired Approach (SAPA) with alerting and an escape maneuver, MITRE?s echelon spacing and no escape maneuver, and a hybrid concept aimed at lowering the visibility minima. We found that the SAPA procedure can be used at 950 ft separations or higher with next-generation avionics and that 1150 ft separations or higher is feasible with current-rule compliant ADS-B OUT. An additional 50 ft reduction in runway separation for the SAPA procedure is possible if different glideslopes are used. For the echelon concept we determined that current generation aircraft cannot conduct paired approaches on parallel paths using echelon spacing on runways less than 1400 ft apart and next-generation aircraft will not be able to conduct paired approach on runways less than 1050 ft apart. The hybrid concept added alerting and an escape maneuver starting 1 NM from the threshold when flying the echelon concept. This combination was found to be effective, but the probability of a collision can be seriously impacted if the turn component of the escape maneuver has to be disengaged near the ground (e.g. 300 ft or below) due to airport buildings and surrounding terrain. We also found that stabilizing the approach path in the straight-in segment was only possible if the merge point was at least 1.5 to 2 NM from the threshold unless the total system error can be sufficiently constrained on the offset path and final turn.

  18. Rapid pair-wise synteny analysis of large bacterial genomes using web-based GeneOrder4.0

    OpenAIRE

    Mahadevan Padmanabhan; Seto Donald

    2010-01-01

    Abstract Background The growing whole genome sequence databases necessitate the development of user-friendly software tools to mine these data. Web-based tools are particularly useful to wet-bench biologists as they enable platform-independent analysis of sequence data, without having to perform complex programming tasks and software compiling. Findings GeneOrder4.0 is a web-based "on-the-fly" synteny and gene order analysis tool for comparative bacterial genomics (ca. 8 Mb). It enables the v...

  19. Imidazolo-dC metal-mediated base pairs: purine nucleosides capture two Ag(+) ions and form a duplex with the stability of a covalent DNA cross-link.

    Science.gov (United States)

    Mei, Hui; Ingale, Sachin A; Seela, Frank

    2014-12-01

    8-Phenylimidazolo-dC ((ph) ImidC, 2) forms metal-mediated DNA base pairs by entrapping two silver ions. To this end, the fluorescent "purine" 2'-deoxyribonucleoside 2 has been synthesised and converted into the phosphoramidite 6. Owing to the ease of nucleobase deprotonation, the new Ag(+) -mediated base pair containing a "purine" skeleton is much stronger than that derived from the pyrrolo- [3,4-d]pyrimidine system ((ph) PyrdC, 1). The silver-mediated (ph) ImidC-(ph) ImidC base pair fits well into the DNA double helix and has the stability of a covalent cross-link. The formation of such artificial metal base pairs might not be limited to DNA but may be applicable to other nucleic acids such as RNA, PNA and GNA as well as other biopolymers. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  20. Matched-pair classification

    Energy Technology Data Exchange (ETDEWEB)

    Theiler, James P [Los Alamos National Laboratory

    2009-01-01

    Following an analogous distinction in statistical hypothesis testing, we investigate variants of machine learning where the training set comes in matched pairs. We demonstrate that even conventional classifiers can exhibit improved performance when the input data has a matched-pair structure. Online algorithms, in particular, converge quicker when the data is presented in pairs. In some scenarios (such as the weak signal detection problem), matched pairs can be generated from independent samples, with the effect not only doubling the nominal size of the training set, but of providing the structure that leads to better learning. A family of 'dipole' algorithms is introduced that explicitly takes advantage of matched-pair structure in the input data and leads to further performance gains. Finally, we illustrate the application of matched-pair learning to chemical plume detection in hyperspectral imagery.

  1. Thioflavin T binds dimeric parallel-stranded GA-containing non-G-quadruplex DNAs: a general approach to lighting up double-stranded scaffolds.

    Science.gov (United States)

    Liu, Shuangna; Peng, Pai; Wang, Huihui; Shi, Lili; Li, Tao

    2017-12-01

    A molecular rotor thioflavin T (ThT) is usually used as a fluorescent ligand specific for G-quadruplexes. Here, we demonstrate that ThT can tightly bind non-G-quadruplex DNAs with several GA motifs and dimerize them in a parallel double-stranded mode, accompanied by over 100-fold enhancement in the fluorescence emission of ThT. The introduction of reverse Watson-Crick T-A base pairs into these dimeric parallel-stranded DNA systems remarkably favors the binding of ThT into the pocket between G•G and A•A base pairs, where ThT is encapsulated thereby restricting its two rotary aromatic rings in the excited state. A similar mechanism is also demonstrated in antiparallel DNA duplexes where several motifs of two consecutive G•G wobble base pairs are incorporated and serve as the active pockets for ThT binding. The insight into the interactions of ThT with non-G-quadruplex DNAs allows us to introduce a new concept for constructing DNA-based sensors and devices. As proof-of-concept experiments, we design a DNA triplex containing GA motifs in its Hoogsteen hydrogen-bonded two parallel strands as a pH-driven nanoswitch and two GA-containing parallel duplexes as novel metal sensing platforms where C-C and T-T mismatches are included. This work may find further applications in biological systems (e.g. disease gene detection) where parallel duplex or triplex stretches are involved. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  2. Single DNA denaturation and bubble dynamics

    DEFF Research Database (Denmark)

    Metzler, Ralf; Ambjörnsson, Tobias; Hanke, Andreas

    2009-01-01

    While the Watson-Crick double-strand is the thermodynamically stable state of DNA in a wide range of temperature and salt conditions, even at physiological conditions local denaturation bubbles may open up spontaneously due to thermal activation. By raising the ambient temperature, titration......, or by external forces in single molecule setups bubbles proliferate until full denaturation of the DNA occurs. Based on the Poland-Scheraga model we investigate both the equilibrium transition of DNA denaturation and the dynamics of the denaturation bubbles with respect to recent single DNA chain experiments...

  3. Functionalization of DNA nanostructures with proteins.

    Science.gov (United States)

    Saccà, Barbara; Niemeyer, Christof M

    2011-12-01

    Proteins possess intrinsic functionalities, which have been optimized in billions of years of natural evolution. The conjugation of proteins with artificial nucleic acids allows one to further functionalize proteins with a synthetically accessible, physicochemically robust tag, which is addressable in a highly specific manner by Watson-Crick hybridization. The resulting DNA-protein conjugates can be advantageously used in a variety of applications, ranging from biomedical diagnostics to DNA-based nanofabrication. This critical review provides an overview on chemical approaches to the synthesis of DNA-protein conjugates and their applications in biomolecular nanosciences (96 references).

  4. The effects of computer-based games and collaboration in large groups vs. collaboration in pairs or traditional methods

    OpenAIRE

    Martín San José, Juan Fernando; Juan Lizandra, María Carmen; Segui, Ignacio; García García, Inmaculada

    2015-01-01

    As new technologies have emerged in the last few years, the learning process has been changing. New and powerful e-learning systems are being developed and new teaching methods can be used in classrooms. In this paper, we present a computer-based game with an educational background that is played on a large-size tabletop display. The game can be used as reinforcement for educational content related to historical ages. The game uses natural interaction. A study to compare the tradi...

  5. Visualization of drug-nucleic acid interactions at atomic resolution. VII. Structure of an ethidium/dinucleoside monophosphate crystalline complex, ethidium: uridylyl(3'-5')adenosine

    Energy Technology Data Exchange (ETDEWEB)

    Jain, S.C.; Sobell, H.M.

    1984-01-01

    Ethidium forms a crystalline complex with the dinucleoside monophosphate, uridylyl (3'-5') adenosine (UpA). The complex crystallizes in the monoclinic space group P2/sub 1/ with unit cell dimensions, a = 13.704 A, b = 31.674 A, c = 15.131 A, ..beta.. = 113.8/sup 0/. This light atom structure has been solved to atomic resolution and refined by full matrix least squares to a residual of 0.12, using 3034 observed reflections. The asymmetric unit consists of two ethidium molecules, two UpA molecules and 19 solvent molecules, a total of 145 non-hydrogen atoms. The two UPa molecules are hydrogen-bonded together by Watson-Crick base pairing. Base-pairs in this duplex are separated by 6.7 A; this reflects intercalative binding by one of the ethidium molecules. The other ethidium molecule stacks on either side of the intercalated base-paired dinucleoside monophosphate, being related by a unit cell translation along the a axis. The conformation of the sugar-phosphate backbone accompanying intercalation has been accurately determined in this analysis, and contains the mixed sugar-puckering pattern: C3' endo (3'-5') C2' endo. This same structural feature has been observed in the ethidium-iodoUpA and ethidium-iodoCpG complexes, and exists in two additional structures containing ethidium-CpG. Taken together, these studies confirm the authors earlier sugar-puckering assignments and demonstrate that iodine covalently bound to the C5 position on uridine or cytosine does not alter the basic sugar-phosphate geometry or the mode of ethidium intercalation in these model studies. The authors have proposed this stereochemistry to explain the intercalation of ethidium into both DNA and into double-helical RNA. 15 references, 10 figures, 2 tables.

  6. Cyanine-based probe\\tag-peptide pair for fluorescence protein imaging and fluorescence protein imaging methods

    Science.gov (United States)

    Mayer-Cumblidge, M Uljana [Richland, WA; Cao, Haishi [Richland, WA

    2010-08-17

    A molecular probe comprises two arsenic atoms and at least one cyanine based moiety. A method of producing a molecular probe includes providing a molecule having a first formula, treating the molecule with HgOAc, and subsequently transmetallizing with AsCl.sub.3. The As is liganded to ethanedithiol to produce a probe having a second formula. A method of labeling a peptide includes providing a peptide comprising a tag sequence and contacting the peptide with a biarsenical molecular probe. A complex is formed comprising the tag sequence and the molecular probe. A method of studying a peptide includes providing a mixture containing a peptide comprising a peptide tag sequence, adding a biarsenical probe to the mixture, and monitoring the fluorescence of the mixture.

  7. [Polyelectrolyte invariance of the acid-base equilibrium in native DNA with varying GC-pair levels].

    Science.gov (United States)

    Slonitskiĭ, S V; Boĭkova, D V

    1994-01-01

    The influence of the ionic strength of solution on the protonation of the Micrococcus lysodeicticus DNA molecule was studied by means of circular dichroism, spectrophotometric and potentiometric titration in a wide range of the supporting electrolyte concentration ([NaCl] = 0.5-0.005 M). The concept of local pH determined in Poisson-Boltzman approximation by the electrostatic potential in the monohydrate layer of the macromolecule was used for the interpretation of the data obtained. A phase diagram was constructed in a plot of pHloc vs. log[Na+], which described the polymorphic transformations in the protonated DNA molecule. The comparison of the data obtained with those for the calf thymus DNA showed that the polyelectrolyte invariance of the acid-base equilibrium in natural DNAs is electrostatic in origin and does not depend on the GC content.

  8. Unique TTC repeat base pair loss mutation in cases of pure neural leprosy: A survival strategy of Mycobacterium leprae?

    Directory of Open Access Journals (Sweden)

    Abhishek De

    2015-01-01

    Full Text Available Background: Genomic reduction helps obligate intracellular microbes to survive difficult host niches. Adaptation of Mycobacterium leprae in cases of pure neural leprosy (PNL in the intracellular niche of peripheral nerves can be associated with some gene loss. Recently, a stable but variable number of tandem repefzats (TTC have been reported in strains of M. leprae. FolP and rpoB genes are the two common mutation sites which deal with the susceptibility of the bacteria to drugs. Aim: We attempted to find if genomic reduction of M. leprae in context of these TTC repeats or mutations in folP1 and rpoB can be the reason for the restriction of M. leprae in the nerves in PNL. Materials and Methods: DNA extracts taken from fine needle aspiration of affected nerves of 24 PNL cases were studied for tandem repeats with 21TTC primer in multiplex-PCR. Mutations were also studied by PCR Amplification of SRDR (Sulphone Resistance Determining Region of the folP1 and multiple primer PCR amplification refractory mutation system (MARS of the rpoB. Results: Of the 24 PNL, only 1 patient showed mutation in the rpoB gene and none in the folp1 gene. Studying the mutation in TTC region of the M. leprae gene we found that all the cases have a loss of a few bases in the sequence. Conclusion: We can conclude that there is consistent loss in the bases in the TTC region in all cases of pure neural Hansen and we postulate that it may be an adaptive response of the bacteria to survive host niche resulting in its restriction to peripheral nerves.

  9. Assignment of chromosomal locations for unassigned SNPs/scaffolds based on pair-wise linkage disequilibrium estimates

    Directory of Open Access Journals (Sweden)

    Nicholas Frank W

    2010-04-01

    Full Text Available Abstract Background Recent developments of high-density SNP chips across a number of species require accurate genetic maps. Despite rapid advances in genome sequence assembly and availability of a number of tools for creating genetic maps, the exact genome location for a number of SNPs from these SNP chips still remains unknown. We have developed a locus ordering procedure based on linkage disequilibrium (LODE which provides estimation of the chromosomal positions of unaligned SNPs and scaffolds. It also provides an alternative means for verification of genetic maps. We exemplified LODE in cattle. Results The utility of the LODE procedure was demonstrated using data from 1,943 bulls genotyped for 73,569 SNPs across three different SNP chips. First, the utility of the procedure was tested by analysing the masked positions of 1,500 randomly-chosen SNPs with known locations (50 from each chromosome, representing three classes of minor allele frequencies (MAF, namely >0.05, 0.01 Conclusion The LODE procedure described in this study is an efficient and accurate method for positioning SNPs (MAF>0.05, for validating and checking the quality of a genome assembly, and offers a means for positioning of unordered scaffolds containing SNPs. The LODE procedure will be helpful in refining genome sequence assemblies, especially those being created from next-generation sequencing where high-throughput SNP discovery and genotyping platforms are integrated components of genome analysis.

  10. Novel single base-pair deletion in exon 1 of XK gene leading to McLeod syndrome with chorea, muscle wasting, peripheral neuropathy, acanthocytosis and haemolysis.

    Science.gov (United States)

    Wiethoff, Sarah; Xiromerisiou, Georgia; Bettencourt, Conceição; Kioumi, Anna; Tsiptsios, Iakovos; Tychalas, Athanasios; Evaggelia, Markousi; George, Kaltsounis; Makris, Vasileios; Hardy, John; Houlden, Henry

    2014-04-15

    We present a 70-year-old male patient of Greek origin with choreatic movements of the tongue and face, lower limb muscle weakness, peripheral neuropathy, elevated creatinephosphokinase (CPK), acanthocytosis and haemolysis in the absence of Kell RBC antigens with an additional Factor IX-deficiency. Genetic testing for mutations in the three exons of the XK gene revealed a previously unreported hemizygous single base-pair frameshift deletion at exon 1 (c.229delC, p.Leu80fs). In conclusion, we hereby describe a rare phenotype of a patient with McLeod syndrome which was discovered coincidentally during routine blood group testing and consecutively genetically confirmed. Copyright © 2014 The Authors. Published by Elsevier B.V. All rights reserved.

  11. 5-Methylation of Cytosine in CG:CG Base-Pair Steps: A Physicochemical Mechanism for the Epigenetic Control of DNA Nanomechanics

    Science.gov (United States)

    Yusufaly, Tahir; Olson, Wilma; Li, Yun

    2014-03-01

    Van der Waals density functional theory is integrated with analysis of a non-redundant set of protein-DNA crystal structures from the Nucleic Acid Database to study the stacking energetics of CG:CG base-pair steps, specifically the role of cytosine 5-methylation. Principal component analysis of the steps reveals the dominant collective motions to correspond to a tensile ``opening'' mode and two shear ``sliding'' and ``tearing'' modes in the orthogonal plane. The stacking interactions of the methyl groups are observed to globally inhibit CG:CG step overtwisting while simultaneously softening the modes locally via potential energy modulations that create metastable states. The results have implications for the epigenetic control of DNA mechanics.

  12. MTRAP: Pairwise sequence alignment algorithm by a new measure based on transition probability between two consecutive pairs of residues

    Directory of Open Access Journals (Sweden)

    Ohya Masanori

    2010-05-01

    Full Text Available Abstract Background Sequence alignment is one of the most important techniques to analyze biological systems. It is also true that the alignment is not complete and we have to develop it to look for more accurate method. In particular, an alignment for homologous sequences with low sequence similarity is not in satisfactory level. Usual methods for aligning protein sequences in recent years use a measure empirically determined. As an example, a measure is usually defined by a combination of two quantities (1 and (2 below: (1 the sum of substitutions between two residue segments, (2 the sum of gap penalties in insertion/deletion region. Such a measure is determined on the assumption that there is no an intersite correlation on the sequences. In this paper, we improve the alignment by taking the correlation of consecutive residues. Results We introduced a new method of alignment, called MTRAP by introducing a metric defined on compound systems of two sequences. In the benchmark tests by PREFAB 4.0 and HOMSTRAD, our pairwise alignment method gives higher accuracy than other methods such as ClustalW2, TCoffee, MAFFT. Especially for the sequences with sequence identity less than 15%, our method improves the alignment accuracy significantly. Moreover, we also showed that our algorithm works well together with a consistency-based progressive multiple alignment by modifying the TCoffee to use our measure. Conclusions We indicated that our method leads to a significant increase in alignment accuracy compared with other methods. Our improvement is especially clear in low identity range of sequences. The source code is available at our web page, whose address is found in the section "Availability and requirements".

  13. A comparative research of different ensemble surrogate models based on set pair analysis for the DNAPL-contaminated aquifer remediation strategy optimization.

    Science.gov (United States)

    Hou, Zeyu; Lu, Wenxi; Xue, Haibo; Lin, Jin

    2017-08-01

    Surrogate-based simulation-optimization technique is an effective approach for optimizing the surfactant enhanced aquifer remediation (SEAR) strategy for clearing DNAPLs. The performance of the surrogate model, which is used to replace the simulation model for the aim of reducing computation burden, is the key of corresponding researches. However, previous researches are generally based on a stand-alone surrogate model, and rarely make efforts to improve the approximation accuracy of the surrogate model to the simulation model sufficiently by combining various methods. In this regard, we present set pair analysis (SPA) as a new method to build ensemble surrogate (ES) model, and conducted a comparative research to select a better ES modeling pattern for the SEAR strategy optimization problems. Surrogate models were developed using radial basis function artificial neural network (RBFANN), support vector regression (SVR), and Kriging. One ES model is assembling RBFANN model, SVR model, and Kriging model using set pair weights according their performance, and the other is assembling several Kriging (the best surrogate modeling method of three) models built with different training sample datasets. Finally, an optimization model, in which the ES model was embedded, was established to obtain the optimal remediation strategy. The results showed the residuals of the outputs between the best ES model and simulation model for 100 testing samples were lower than 1.5%. Using an ES model instead of the simulation model was critical for considerably reducing the computation time of simulation-optimization process and maintaining high computation accuracy simultaneously. Copyright © 2017 Elsevier B.V. All rights reserved.

  14. Twisting Motion Frequency Dependent I-V Characteristics of 102 Base Pairs Poly(dG)-Poly(dC) DNA Molecule

    Science.gov (United States)

    Yudiarsah, Efta

    2017-05-01

    The I-V characteristic of 102 base pair Poly(dG)-Poly(dC) DNA molecule have been calculated for several base pairs twisting motion frequencies. The calculation is carried out on doubled-stranded DNA model sandwiched in between two metallic electrodes. The effect is studied by taking into account twisting angle dependent on-site energy and hopping constant in the tight binding Hamiltonian of double-strand DNA model. We use semi-empirical Slater-Koster theory in the twisting angle dependent intra- and inter-strand hopping constant. We consider the temperature dependent sugar-phosphate backbone on-site energy by employing random energy disorder using uniform distribution function. The standard deviation of twisting angle is obtained by assuming that the average kinetic energy of twisting motions is proportional to system temperature. The transfer and scattering matrix methods are used simultaneously in calculating the transmission probability of charge on the molecule. We choose the contacts between molecule and both electrodes such that the main features of transport properties of the molecule do not change much by the presence of metallic electrodes. By assuming the voltage drops symmetrically at the contacts, Landauer-Buttiker Formalism is used in calculating the I-V characteristic of the molecule from transmission probability. The results show that the magnitude of current increases by twisting motion frequency increment. Larger current magnitude increment is observed at higher voltage. The influence of twisting motion frequency on the I-V characteristic is stronger at higher temperature, in the range of considered temperature.

  15. Organometallic frustrated Lewis pair chemistry.

    Science.gov (United States)

    Erker, Gerhard

    2011-08-07

    Frustrated Lewis pairs are playing an increasingly important role in organometallic chemistry. Examples are presented and discussed where organometallic systems themselves serve as the Lewis base or Lewis acid components in frustrated Lewis pair chemistry, mostly through their attached functional groups. Activation of dihydrogen takes place easily in many of these systems. This may lead to the generation of novel catalyst systems but also in many cases to the occurrence of specific reactions at the periphery of the organometallic frameworks. Increasingly, FLP reactions are used to carry out functional group conversions in organometallic systems under mild reaction conditions. The limits of typical FLP reactivity are explored with selected organometallic examples, a discussion that points toward new developments, such as the discovery of facile new 1,1-carboboration reactions. Learning more and more about the broad spectrum of frustrated Lewis pair chemistry helps us to find novel reactions and applications.

  16. A Novel 13 Base Pair Insertion in the Sonic Hedgehog ZRS Limb Enhancer (LMBR1) Causes Preaxial Polydactyly with Triphalangeal Thumb

    Science.gov (United States)

    Laurell, Tobias; VanderMeer, Julia E; Wenger, Aaron M.; Grigelioniene, Giedre; Nordenskjöld, Agneta; Arner, Marianne; Ekblom, Anna Gerber; Bejerano, Gill; Ahituv, Nadav; Nordgren, Ann

    2012-01-01

    Mutations in the Sonic Hedgehog limb enhancer, the zone of polarizing activity regulatory sequence (LMBR1, commonly called the ZRS), cause limb malformations. In humans, three classes of mutations have been proposed based on the limb phenotype; single base changes throughout the region cause preaxial polydactyly, single base changes at one specific site cause Werner mesomelic syndrome and large duplications cause polysyndactyly. This study presents a novel mutation– a small insertion. In a Swedish family with autosomal dominant preaxial polydactyly, we found a 13 base pair insertion within the ZRS, ZRS603ins13 (NG-009240.1:g.106934_106935ins13). Computational transcription factor binding site predictions suggest that this insertion creates new binding sites and a mouse enhancer assay shows that this insertion causes ectopic gene expression. This study is the first to discover a small insertion in an enhancer that causes a human limb malformation and suggests a potential mechanism that could explain the ectopic expression caused by this mutation. PMID:22495965

  17. A school-based rope skipping intervention for adolescents in Hong Kong: protocol of a matched-pair cluster randomized controlled trial.

    Science.gov (United States)

    Ha, Amy S; Lonsdale, Chris; Ng, Johan Y Y; Lubans, David R

    2014-05-30

    Schools present venues for physical activity promotion among youth, with physical education (PE) considered the primary vehicle responsible for increasing activity levels. Yet students are not very physically active during typical school PE classes. With the aim to engage Hong Kong students in more moderate-to-vigorous physical activity (MVPA) during PE, a fitness infusion intervention using rope skipping was designed, and its effectiveness will be examined. Rope skipping was chosen because a) it provides moderate-to-high intensity physical activity; b) is inexpensive; c) students find it enjoyable; and d) is feasible in typical environments in Hong Kong, where PE classes are large in size (up to 40 students) and space available for physical activity is usually limited. A matched-pair cluster randomized controlled trial was designed. Secondary school students from 24 classes (from 12 schools) will be recruited to participate in the trial. Students' baseline MVPA will be measured during school PE. Classes will be matched according to baseline variables and one class from each pair will be randomized into the experimental group. Teachers in the experimental group will be invited to attend a teacher workshop, and will insert a 15-minute rope skipping activity in four consecutive PE lessons. Motivational factors based on self-determination theory will also be measured as secondary outcomes. The effectiveness of the intervention will be evaluated by comparing changes in the proportion of lesson time spent in MVPA from baseline to follow-up across the experimental and control groups. Physical activity levels in PE are often very low and there is a need to identify feasible low-cost interventions that can be easily disseminated. If the results of the study suggest the intervention to be effective, it could be implemented to schools throughout Hong Kong and other cities where space is limited. ACTRN12613000968774. Registered on 30 August 2013.

  18. Treating sub-valence correlation effects in domain based pair natural orbital coupled cluster calculations: an out-of-the-box approach

    KAUST Repository

    Bistoni, Giovanni

    2017-06-12

    The validity of the main approximations used in canonical and domain based pair natural orbital coupled cluster methods (CCSD(T) and DLPNO-CCSD(T), respectively) in standard chemical applications is discussed. In particular, we investigate the dependence of the results on the number of electrons included in the correlation treatment in frozen-core (FC) calculations and on the main threshold governing the accuracy of DLPNO all-electron (AE) calculations. Initially, scalar relativistic orbital energies for the ground state of the atoms from Li to Rn in the periodic table are calculated. An energy criterion is applied for determining the orbitals that can be excluded from the correlation treatment in FC coupled cluster calculations without significant loss of accuracy. The heterolytic dissociation energy (HDE) of a series of metal compounds (LiF, NaF, AlF3, CaF2, CuF, GaF3, YF3, AgF, InF3, HfF4 and AuF) is calculated at the canonical CCSD(T) level, and the dependence of the results on the number of correlated electrons is investigated. Although for many of the studied reactions sub-valence correlation effects contribute significantly to the HDE, the use of an energy criterion permits a conservative definition of the size of the core, allowing FC calculations to be performed in a black-box fashion while retaining chemical accuracy. A comparison of the CCSD and the DLPNO-CCSD methods in describing the core-core, core-valence and valence-valence components of the correlation energy is given. It is found that more conservative thresholds must be used for electron pairs containing at least one core electron in order to achieve high accuracy in AE DLPNO-CCSD calculations relative to FC calculations. With the new settings, the DLPNO-CCSD method reproduces canonical CCSD results in both AE and FC calculations with the same accuracy.

  19. From structure prediction to genomic screens for novel non-coding RNAs.

    Directory of Open Access Journals (Sweden)

    Jan Gorodkin

    2011-08-01

    Full Text Available Non-coding RNAs (ncRNAs are receiving more and more attention not only as an abundant class of genes, but also as regulatory structural elements (some located in mRNAs. A key feature of RNA function is its structure. Computational methods were developed early for folding and prediction of RNA structure with the aim of assisting in functional analysis. With the discovery of more and more ncRNAs, it has become clear that a large fraction of these are highly structured. Interestingly, a large part of the structure is comprised of regular Watson-Crick and GU wobble base pairs. This and the increased amount of available genomes have made it possible to employ structure-based methods for genomic screens. The field has moved from folding prediction of single sequences to computational screens for ncRNAs in genomic sequence using the RNA structure as the main characteristic feature. Whereas early methods focused on energy-directed folding of single sequences, comparative analysis based on structure preserving changes of base pairs has been efficient in improving accuracy, and today this constitutes a key component in genomic screens. Here, we cover the basic principles of RNA folding and touch upon some of the concepts in current methods that have been applied in genomic screens for de novo RNA structures in searches for novel ncRNA genes and regulatory RNA structure on mRNAs. We discuss the strengths and weaknesses of the different strategies and how they can complement each other.

  20. Sequence dependent structure and thermodynamics of DNA oligonucleotides and polynucleotides: uv melting and NMR (nuclear magnetic resonance) studies

    Energy Technology Data Exchange (ETDEWEB)

    Aboul-ela, F.M.

    1987-12-01

    Thermodynamic parameters for double strand formation have been measured for the twenty-five DNA double helices made by mixing deoxyoligonucleotides of the sequence dCA/sub 3/XA/sub 3/G with the complement dCT/sub 3/YT/sub 3/G. Each of the bases A, C, G, T, and I (I = hypoxanthine) have been substituted at the positions labeled X and Y. The results are analyzed in terms of nearest neighbors. At higher temperatures the sequences containing a G)centerreverse arrowdot)C base pair become more stable than those containing only A)centerreverse arrowdot)T. All molecules containing mismatcher are destabilized with respect to those with only Watson-Crick pairing, but there is a wide range of destabilization. Large neighboring base effects upon stability were observed. For example, when (X, Y) = (I, A), the duplex is eightfold more stable than when (X, Y) = (A, I). Independent of sequence effects the order of stabilities is: I)centerreverse arrowdot)C )succ) I)centerreverse arrowdot) A)succ) I)centerreverse arrowdot)T approx. I)centerreverse arrowdot)G. All of these results are discussed within the context of models for sequence dependent DNA secondary structure, replication fidelity and mechanisms of mismatch repair, and implications for probe design. The duplex deoxyoligonucleotide d(GGATGGGAG))centerreverse arrowdot)d(CTCCCATCC) is a portion of the gene recognition sequence of the protein transcription factor IIIA. The crystal structure of this oligonucleotide was shown to be A-form The present study employs Nuclear Magnetic Resonance, optical, chemical and enzymatic techniques to investigate the solution structure of this DNA 9-mer. (157 refs., 19 figs., 10 tabs.

  1. Pairing in spherical nanograins

    Energy Technology Data Exchange (ETDEWEB)

    Kuzmenko, N.K., E-mail: kuzmenko@NK9433.spb.ed [V.G. Khlopin Radium Institute, 2-nd Murinsky avenue 28, 194021 St.-Petersburg (Russian Federation); Mikhajlov, V.M. [Institute of Physics, St.-Petersburg State University, Ul' yanovskaya 3, 198904 Petergof (Russian Federation)

    2010-02-01

    Conditions are ascertained when the pairing and other thermodynamic properties of spherical nanograins with numbers of delocalized electrons N<10{sup 5} can be investigated by using the Single Shell Model (SSM) that gives the eigenvalues of the pairing Hamiltonian for a solitary shell. In the frame of SSM the exact canonical and grand canonical descriptions are employed first to analyze the absence of the abrupt superconducting-normal phase transition in finite systems in which an increase of the pairing and BCS critical temperature can be observed and secondly to study such new phenomena as the temperature re-entrance of the pairing in postcritical magnetic fields and also low temperature oscillations of the magnetic susceptibility and electronic heat capacity in an increasing uniform magnetic field.

  2. A Thiazole Coumarin (TC) Turn-On Fluorescence Probe for AT-Base Pair Detection and Multipurpose Applications in Different Biological Systems

    Science.gov (United States)

    Narayanaswamy, Nagarjun; Kumar, Manoj; Das, Sadhan; Sharma, Rahul; Samanta, Pralok K.; Pati, Swapan K.; Dhar, Suman K.; Kundu, Tapas K.; Govindaraju, T.

    2014-09-01

    Sequence-specific recognition of DNA by small turn-on fluorescence probes is a promising tool for bioimaging, bioanalytical and biomedical applications. Here, the authors report a novel cell-permeable and red fluorescent hemicyanine-based thiazole coumarin (TC) probe for DNA recognition, nuclear staining and cell cycle analysis. TC exhibited strong fluorescence enhancement in the presence of DNA containing AT-base pairs, but did not fluoresce with GC sequences, single-stranded DNA, RNA and proteins. The fluorescence staining of HeLa S3 and HEK 293 cells by TC followed by DNase and RNase digestion studies depicted the selective staining of DNA in the nucleus over the cytoplasmic region. Fluorescence-activated cell sorting (FACS) analysis by flow cytometry demonstrated the potential application of TC in cell cycle analysis in HEK 293 cells. Metaphase chromosome and malaria parasite DNA imaging studies further confirmed the in vivo diagnostic and therapeutic applications of probe TC. Probe TC may find multiple applications in fluorescence spectroscopy, diagnostics, bioimaging and molecular and cell biology.

  3. Efficient visible and near-infrared photoluminescent attapulgite-based lanthanide one-dimensional nanomaterials assembled by ion-pairing interactions.

    Science.gov (United States)

    Xu, Jun; Zhang, Ye; Chen, Hao; Liu, Weisheng; Tang, Yu

    2014-06-07

    Attapulgite, a one-dimensional fibrillar nanomaterial present in nature, with its extreme stability, is a promising material to act as a new carrier of luminescent lanthanide complexes for further applications. Herein, a series of lanthanide complexes Na[Ln(TTA)4] have been attached to attapulgite (Atta) via ion-pairing interactions, generating the first example of attapulgite-based visible and near-infrared (NIR) luminescent lanthanide one-dimensional nanomaterials, where TTA is 2-thenoyltrifluoroacetonate and Ln is Eu, Sm, Nd, Er or Yb. The hybrid materials were characterized by CHN elemental analysis, inductively coupled plasma-atomic emission spectroscopy (ICP), powder X-ray diffraction (PXRD), thermogravimetry (TG), transmission electron microscopy (TEM), and UV-vis absorption spectra. In order to investigate the photophysical behaviours of these materials, the visible and NIR luminescent spectra and the energy transfer process have been systematically investigated. Moreover, efforts have been made to produce Eu- and Sm-based plastic attapulgite materials by utilizing poly(methyl methacrylate) (PMMA) matrices, and the dispersibility of the lanthanide-doped hybrids in PMMA provides them with a high mechanical strength. The lanthanide-doped attapulgite appears to be an interesting material for photophysical applications. The results of this work would have potential significance for the design and assembly of luminescent lanthanide materials for light-emitting diodes (LED), sunlight-conversion films, optical amplifiers, solar concentrators, and lasers.

  4. Hydrolysis of RNA/DNA hybrids containing nonpolar pyrimidine isosteres defines regions essential for HIV type 1 polypurine tract selection.

    Science.gov (United States)

    Rausch, Jason W; Qu, Jin; Yi-Brunozzi, Hye Young; Kool, Eric T; Le Grice, Stuart F J

    2003-09-30

    Both x-ray crystallography and chemical footprinting indicate that bases of the HIV type 1 (HIV-1) polypurine tract (PPT)-containing RNA/DNA hybrid deviate from standard Watson-Crick base pairing. However, the contribution of these structural anomalies to the accuracy of plus-strand primer selection by HIV-1 reverse transcriptase is not immediately clear. To address this issue, DNA templates harboring single and pairwise non-hydrogen-bonding isosteres of cytosine (2-fluoro-4-methylbenzene deoxyribonucleoside) and thymine (2,4-difluoro-5-methylbenzene deoxyribonucleoside) were synthesized and hybridized to PPT-containing RNA primers as a means of locally removing hydrogen bonding and destabilizing paired structure. Cleavage of these hybrids was examined with p66/p51 HIV-1 reverse transcriptase and a mutant carrying an alteration in the p66 RNase H primer shown to specifically impair PPT processing. Analog insertion within the PPT (rG):(dC) and central (rA):(dT) tracts repositioned the RNase H domain such that the RNA/DNA hybrid was cleaved 3-4 bp from the site of insertion, a distance corresponding closely to the spatial separation between the catalytic center and RNase H primer grip. However, PPT processing was significantly impaired when the junction between these tracts was substituted. Substitutions within the upstream (rA):(dT) tract, where maximum distortion had previously been observed, destroyed PPT processing. Collectively, our scanning mutagenesis approach implicates multiple regions of the PPT in the accuracy with which it is excised from (+) U3 RNA and DNA, and also provides evidence for close cooperation between the RNase H primer grip and catalytic center in achieving this cleavage.

  5. Determination of melamine in milk-based products and other food and beverage products by ion-pair liquid chromatography-tandem mass spectrometry

    Energy Technology Data Exchange (ETDEWEB)

    Ibanez, Maria; Sancho, Juan V. [Research Institute for Pesticides and Water, University Jaume I, E-12071, Castellon (Spain); Hernandez, Felix, E-mail: felix.hernandez@qfa.uji.es [Research Institute for Pesticides and Water, University Jaume I, E-12071, Castellon (Spain)

    2009-09-01

    This paper describes a fast method for the sensitive and selective determination of melamine in a wide range of food matrices, including several milk-based products. The method involves an extraction with aqueous 1% trichloroacetic acid before the injection of the 10-fold diluted extract into the liquid chromatography-electrospray tandem mass spectrometry (LC-ESI-MS/MS) system, using labelled melamine as the internal standard. As melamine is present in aqueous media in the cationic form, the chromatographic separation in reversed-phase LC requires the use of anionic ion-pair reagents, such as tridecafluoroheptanoic acid (THFA). This allows a satisfactory chromatographic retention and peak shape in all the types of food samples investigated. The method has been validated in six food matrices (biscuit, dry pasta and four milk-based products) by means of recovery experiments in samples spiked at 1 and 5 mg kg{sup -1}. Average recoveries (n = 5) ranged from 77% to 100%, with excellent precision (RSDs lower than 5%) and limits of detection between 0.01 and 0.1 mg kg{sup -1}. In addition, accuracy and robustness of the method was proven in different soya-based matrices by means of quality control (QC) sample analysis. QC recoveries, at 1 and 2.5 mg kg{sup -1}, were satisfactory, ranging from 79% to 110%. The method developed in this work has been applied to the determination of melamine in different types of food samples. All detections were confirmed by acquiring two MS/MS transitions (127 > 85 for quantification; 127 > 68 for confirmation) and comparing their ion intensity ratio with that of reference standards. Accuracy of the method was also assessed by applying it to a milk-based product and a baking mix material as part of an EU proficiency test, in which highly satisfactory results were obtained.

  6. Ordered pairing in liquid metallic hydrogen

    Science.gov (United States)

    Carlsson, A. E.; Ashcroft, N. W.

    1983-01-01

    We study two possible types of pairing involving the protons of a proposed low-temperature liquid phase metallic hydrogen. Electron-proton pairing, which can result in an insulating phase, is investigated by using an approximate solution of an Eliashberg-type equation for the anomalous self-energy. A very low estimate of the transition temperature is obtained by including proton correlations in the effective interaction. For proton-proton pairing, we derive a new proton pair potential based on the Abrikosov wave function. This potential includes the electron-proton interaction to all orders and has a much larger well depth than is obtained with linear screening methods. This suggests the possibility of either a superfluid paired phase analogous to that in He-3, or alternatively a phase with true molecular pairing.

  7. tRNASer (UCN MITOCONDRIAL DE Lutzomyia hartmanni PREDICCIÓN DE LA ESTRUCTURA SECUNDARIA DEL tRNASer (UCN MITOCONDRIAL DEL FLEBOTOMÍNEO Lutzomyia hartmanni (DIPTERA: PSYCHODIDAE Prediction of the Secondary Structure of the Mitochondrial tRNASer (UCN of Lutzomyia hartmanni (Diptera: Psychodidae

    Directory of Open Access Journals (Sweden)

    ALVEIRO PÉREZ-DORIA

    Full Text Available Lutzomyia (Helcocyrtomyia hartmanni es un flebotomíneo implicado en la transmisión de Leishmania (Viannia colombiensis, uno de los agentes etiológicos de leishmaniasis cutánea en Colombia. El objetivo de este trabajo fue explorar la utilidad potencial del RNA de transferencia mitocondrial para Serina (UCN (tRNASer, en la discriminación taxonómica de L. hartmanni. El DNA mitocondrial se extrajo, amplificó y secuenció a partir de material entomológico recolectado en Envigado, Antioquia, Colombia. El gen tRNASer de L. hartmanni mostró una longitud de 68 pares de bases, con un contenido AT del 80,9%. Éste se diferencia de los demás tRNASer de Lutzomyia conocidos a la fecha tanto por sustituciones en la secuencia primaria de nucleótidos como por los cambios que éstas generan en la estructura secundaria. El número de apareamientos intracatenarios fue siete en el brazo aceptor del aminoácido, tres en el brazo dihidrouridina (DHU, cinco en el brazo del anticodón y cinco en el brazo ribotimidina-pseudouridina-citosina (T C. El tamaño de las lupas DHU, anticodón, variable y T C correspondió a cinco, siete, cuatro y ocho nucleótidos, respectivamente. La ausencia notoria de pares de bases no-Watson-Crick en los cuatro brazos del tRNASer de L. hartmanni, la distingue de otras especies de Lutzomyia.Lutzomyia (Helcocyrtomyia hartmanni is a sand fly that has been implicated in the transmission of Leishmania (Viannia colombiensis, an etiologic agent of cutaneous leishmaniasis in Colombia. The objective of this work was to explore the potential usefulness of the mitochondrial serine transfer RNA (UCN (tRNASer in the taxonomic determination of L. hartmanni. Mitochondrial DNA was extracted, amplified and sequenced from entomological material collected in Envigado, Antioquia, Colombia. The tRNASer gene length was 68 nucleotide pairs, with an average adenine-thymine content of 80,9%. The studied tRNASer differs from other sand fly tRNASer known

  8. Space-Efficient Re-Pair Compression

    DEFF Research Database (Denmark)

    Bille, Philip; Gørtz, Inge Li; Prezza, Nicola

    2017-01-01

    Re-Pair [5] is an effective grammar-based compression scheme achieving strong compression rates in practice. Let n, σ, and d be the text length, alphabet size, and dictionary size of the final grammar, respectively. In their original paper, the authors show how to compute the Re-Pair grammar...

  9. DNA and Protein Requirements for Substrate Conformational Changes Necessary for Human Flap Endonuclease-1-catalyzed Reaction*

    Science.gov (United States)

    Algasaier, Sana I.; Exell, Jack C.; Bennet, Ian A.; Thompson, Mark J.; Gotham, Victoria J. B.; Shaw, Steven J.; Craggs, Timothy D.; Finger, L. David; Grasby, Jane A.

    2016-01-01

    Human flap endonuclease-1 (hFEN1) catalyzes the essential removal of single-stranded flaps arising at DNA junctions during replication and repair processes. hFEN1 biological function must be precisely controlled, and consequently, the protein relies on a combination of protein and substrate conformational changes as a prerequisite for reaction. These include substrate bending at the duplex-duplex junction and transfer of unpaired reacting duplex end into the active site. When present, 5′-flaps are thought to thread under the helical cap, limiting reaction to flaps with free 5′-termini in vivo. Here we monitored DNA bending by FRET and DNA unpairing using 2-aminopurine exciton pair CD to determine the DNA and protein requirements for these substrate conformational changes. Binding of DNA to hFEN1 in a bent conformation occurred independently of 5′-flap accommodation and did not require active site metal ions or the presence of conserved active site residues. More stringent requirements exist for transfer of the substrate to the active site. Placement of the scissile phosphate diester in the active site required the presence of divalent metal ions, a free 5′-flap (if present), a Watson-Crick base pair at the terminus of the reacting duplex, and the intact secondary structure of the enzyme helical cap. Optimal positioning of the scissile phosphate additionally required active site conserved residues Tyr40, Asp181, and Arg100 and a reacting duplex 5′-phosphate. These studies suggest a FEN1 reaction mechanism where junctions are bound and 5′-flaps are threaded (when present), and finally the substrate is transferred onto active site metals initiating cleavage. PMID:26884332

  10. Theoretical Probing of Weak Anion-Cation Interactions in Certain Pyridinium based Ionic Liquid Ion-Pairs and the Application of Molecular Electrostatic Potential in their Ionic Crystal Density Determination : A Comparative Study Using Density Functional Approach.

    Science.gov (United States)

    Joseph, Aswathy; Thomas, Vibin Ipe; Żyła, Gaweł; Alapat, Padmanabhan Sridharan; Mathew, Suresh

    2017-11-07

    A comprehensive study on the structure, nature of interaction and properties of six ionic pairs of 1-butylpyridinium and 1-butyl-4-methylpyridinium cations in combination with tetrafluoroborate (BF4-), chloride (Cl-) and bromide (Br-) anions have been carried out using Density Functional Theory (DFT). The anion-cation interaction energy (ΔEint), theoretical band gap, molecular orbital energy-order, DFT-based chemical activity descriptors: chemical potential (μ), chemical hardness (η) and electrophilicity index (ω) and distribution of density of states (DOS) of these ion-pairs were investigated. The ascendancy of -CH3 substituent at the 4th position of the 1-butylpyridinium cation ring on the values of ΔEint, theoretical band gap and chemical activity descriptors was evaluated. The ΔEint values were negative for all the six ion-pairs and were highest for Cl- containing ion-pairs. The theoretical band-gap value after -CH3 substitution increased from 3.78 to 3.96 eV (for Cl-) and from 2.74 to 2.88 eV (for Br-) and decreased from 4.9 to 4.89 eV (for BF4-). Ion-pairs of BF4- were more susceptible to charge transfer processes as inferred from their significantly high η values and comparatively small difference in ω value after -CH3 substitution. The change in η and μ values due to the -CH3 substituent is negligibly small in all cases except for the ion-pairs of Cl-. The entropy change (ΔS) was negative for all the ion-pairs. Critical point (CP) analysis were carried out to investigate the AIM topological parameters at the inter-ionic bond critical points (BCPs). The RDG isosurface analysis indicated that anion-cation interaction was dominated by strong Hcat….Xani and Ccat….Xani interactions in ion-pairs of Cl- and Br- whereas weak van der Waal's effect dominated in ion-pairs of BF4-. The molecular electrostatic potential (MESP) based parameter ΔΔVmin measuring the anion-cation interaction strength showed a good linear correlation with ΔEint for all 1

  11. Nucleic acid-functionalized transition metal nanosheets for biosensing applications.

    Science.gov (United States)

    Mo, Liuting; Li, Juan; Liu, Qiaoling; Qiu, Liping; Tan, Weihong

    2017-03-15

    In clinical diagnostics, as well as food and environmental safety practices, biosensors are powerful tools for monitoring biological or biochemical processes. Two-dimensional (2D) transition metal nanomaterials, including transition metal chalcogenides (TMCs) and transition metal oxides (TMOs), are receiving growing interest for their use in biosensing applications based on such unique properties as high surface area and fluorescence quenching abilities. Meanwhile, nucleic acid probes based on Watson-Crick base-pairing rules are also being widely applied in biosensing based on their excellent recognition capability. In particular, the emergence of functional nucleic acids in the 1980s, especially aptamers, has substantially extended the recognition capability of nucleic acids to various targets, ranging from small organic molecules and metal ions to proteins and cells. Based on π-π stacking interaction between transition metal nanosheets and nucleic acids, biosensing systems can be easily assembled. Therefore, the combination of 2D transition metal nanomaterials and nucleic acids brings intriguing opportunities in bioanalysis and biomedicine. In this review, we summarize recent advances of nucleic acid-functionalized transition metal nanosheets in biosensing applications. The structure and properties of 2D transition metal nanomaterials are first discussed, emphasizing the interaction between transition metal nanosheets and nucleic acids. Then, the applications of nucleic acid-functionalized transition metal nanosheet-based biosensors are discussed in the context of different signal transducing mechanisms, including optical and electrochemical approaches. Finally, we provide our perspectives on the current challenges and opportunities in this promising field. Copyright © 2016 Elsevier B.V. All rights reserved.

  12. Rapid genotyping assays for the 4-base pair deletion of canine MDR1/ABCB1 gene and low frequency of the mutant allele in Border Collie dogs.

    Science.gov (United States)

    Mizukami, Keijiro; Chang, Hye-Sook; Yabuki, Akira; Kawamichi, Takuji; Hossain, Mohammad A; Rahman, Mohammad M; Uddin, Mohammad M; Yamato, Osamu

    2012-01-01

    P-glycoprotein, encoded by the MDR1 or ABCB1 gene, is an integral component of the blood-brain barrier as an efflux pump for xenobiotics crucial in limiting drug uptake into the central nervous system. Dogs homozygous for a 4-base pair deletion of the canine MDR1 gene show altered expression or function of P-glycoprotein, resulting in neurotoxicosis after administration of the substrate drugs. In the present study, the usefulness of microchip electrophoresis for genotyping assays detecting this deletion mutation was evaluated. Mutagenically separated polymerase chain reaction (MS-PCR) and real-time PCR assays were newly developed and evaluated. Furthermore, a genotyping survey was carried out in a population of Border Collies dogs in Japan to determine the allele frequency in this breed. Microchip electrophoresis showed advantages in detection sensitivity and time saving over other modes of electrophoresis. The MS-PCR assay clearly discriminated all genotypes. Real-time PCR assay was most suitable for a large-scale survey due to its high throughput and rapidity. The genotyping survey demonstrated that the carrier and mutant allele frequencies were 0.49% and 0.25%, respectively, suggesting that the mutant allele frequency in Border Collies is markedly low compared to that in the susceptible dog breeds such as rough and smooth Collies.

  13. Alteration of intersubunit acid–base pair interactions at the quasi-threefold axis of symmetry of Cucumber mosaic virus disrupts aphid vector transmission

    Energy Technology Data Exchange (ETDEWEB)

    Bricault, Christine A. [Department of Plant Pathology and Plant-Microbe Biology, 334 Plant Science Building, Cornell University, Ithaca, NY 14850 (United States); Perry, Keith L., E-mail: KLP3@cornell.edu [Department of Plant Pathology and Plant-Microbe Biology, 334 Plant Science Building, Cornell University, Ithaca, NY 14850 (United States)

    2013-06-05

    In the atomic model of Cucumber mosaic virus (CMV), six amino acid residues form stabilizing salt bridges between subunits of the asymmetric unit at the quasi-threefold axis of symmetry. To evaluate the effects of these positions on virion stability and aphid vector transmissibility, six charged amino acid residues were individually mutated to alanine. All of the six engineered viruses were viable and exhibited near wild type levels of virion stability in the presence of urea. Aphid vector transmissibility was nearly or completely eliminated in the case of four of the mutants; two mutants demonstrated intermediate aphid transmissibility. For the majority of the engineered mutants, second-site mutations were observed following aphid transmission and/or mechanical passaging, and one restored transmission rates to that of the wild type. CMV capsids tolerate disruption of acid–base pairing interactions at the quasi-threefold axis of symmetry, but these interactions are essential for maintaining aphid vector transmissibility. - Highlights: ► Amino acids between structural subunits of Cucumber mosaic virus affect vector transmission. ► Mutant structural stability was retained, while aphid vector transmissibility was disrupted. ► Spontaneous, second-site mutations restored aphid vector transmissibility.

  14. Base Pairing Interaction between 5′- and 3′-UTRs Controls icaR mRNA Translation in Staphylococcus aureus

    Science.gov (United States)

    Ruiz de los Mozos, Igor; Vergara-Irigaray, Marta; Segura, Victor; Villanueva, Maite; Bitarte, Nerea; Saramago, Margarida; Domingues, Susana; Arraiano, Cecilia M.; Fechter, Pierre; Romby, Pascale; Valle, Jaione; Solano, Cristina; Lasa, Iñigo; Toledo-Arana, Alejandro

    2013-01-01

    The presence of regulatory sequences in the 3′ untranslated region (3′-UTR) of eukaryotic mRNAs controlling RNA stability and translation efficiency is widely recognized. In contrast, the relevance of 3′-UTRs in bacterial mRNA functionality has been disregarded. Here, we report evidences showing that around one-third of the mapped mRNAs of the major human pathogen Staphylococcus aureus carry 3′-UTRs longer than 100-nt and thus, potential regulatory functions. We selected the long 3′-UTR of icaR, which codes for the repressor of the main exopolysaccharidic compound of the S. aureus biofilm matrix, to evaluate the role that 3′-UTRs may play in controlling mRNA expression. We showed that base pairing between the 3′-UTR and the Shine-Dalgarno (SD) region of icaR mRNA interferes with the translation initiation complex and generates a double-stranded substrate for RNase III. Deletion or substitution of the motif (UCCCCUG) within icaR 3′-UTR was sufficient to abolish this interaction and resulted in the accumulation of IcaR repressor and inhibition of biofilm development. Our findings provide a singular example of a new potential post-transcriptional regulatory mechanism to modulate bacterial gene expression through the interaction of a 3′-UTR with the 5′-UTR of the same mRNA. PMID:24367275

  15. Optimization of ion-pair based hollow fiber liquid phase microextraction combined with HPLC-UV for the determination of methimazole in biological samples and animal feed.

    Science.gov (United States)

    Ebrahimzadeh, Homeira; Asgharinezhad, Ali Akbar; Adlnasab, Laleh; Shekari, Nafiseh

    2012-08-01

    Ion-pair based hollow fiber liquid phase microextraction (IP-HFLPME) coupled with high performance liquid chromatography-ultraviolet detection was applied for the preconcentration and determination of methimazole in biological samples and animal feed. Optimization of the conditions for the high extraction efficiency was studied simultaneously using the experimental design. For the first step, the Plackett-Burman design was applied to screen the significant factors on the extraction efficiency. Central composite design (CCD) was then used for the optimization of important factors and the response surface equations were obtained. The optimum experimental conditions were donor phase pH, 12.2; extraction temperature, 45°C; extraction time, 50 min; sodium perchlorate concentration, 1.5 M; cetyltrimethylammonium bromide concentration, 0.65 mM, and without salt addition in donor phase. The limit of detection and the dynamic linear range were in the range of 0.1-0.7 μg L(-1) and 0.5-1000 μg L(-1), respectively. Preconcentration factors were obtained in the range of 93-155 in different matrices. Finally, the performance of the proposed method was tested for the determination of trace amounts of methimazole in plasma, urine, bovine milk, and animal feed samples, and satisfactory results were obtained (RSDs < 7.1%). © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  16. Assessment of the Coordination Ability of Sustainable Social-Ecological Systems Development Based on a Set Pair Analysis: A Case Study in Yanchi County, China

    Directory of Open Access Journals (Sweden)

    Ya Wang

    2016-08-01

    Full Text Available Sandy desertification is one of the most severe ecological problems in the world. Essentially, it is land degradation caused by discordance in the Social-Ecological Systems (SES. The ability to coordinate SES is a principal characteristic of regional sustainable development and a key factor in desertification control. This paper directly and comprehensively evaluates the ability to coordinate SES in the desertification reversal process. Assessment indicators and standards for SES have been established using statistical data and materials from government agencies. We applied a coordinated development model based on Identical-Discrepancy-Contrary (IDC situational ranking of a Set Pair Analysis (SPA to analyze the change in Yanchi County’s coordination ability since it implemented the grazing prohibition policy. The results indicated that Yanchi County was basically in the secondary grade of the national sustainable development level, and the subsystems’ development trend was relatively stable. Coordinate ability increased from 0.686 in 2003 to 0.957 in 2014 and experienced “weak coordination to basic coordination to high coordination” development processes. We concluded that drought, the grazing prohibition dilemma and the ecological footprint were key factors impeding the coordination of SES development in this area. These findings should provide information about desertification control and ecological policy implementation to guarantee sustainable rehabilitation.

  17. Combinatorial DNA Damage Pairing Model Based on X-Ray-Induced Foci Predicts the Dose and LET Dependence of Cell Death in Human Breast Cells

    Energy Technology Data Exchange (ETDEWEB)

    Vadhavkar, Nikhil [Massachusetts Inst. of Technology (MIT), Cambridge, MA (United States); Pham, Christopher [University of Texas, Houston, TX (United States). MD Anderson Cancer Center; Georgescu, Walter [Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States). Life Sciences Div.; Deschamps, Thomas [Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States). Life Sciences Div.; Heuskin, Anne-Catherine [Univ. of Namur (Belgium). Namur Research inst. for Life Sciences (NARILIS), Research Center for the Physics of Matter and Radiation (PMR); Tang, Jonathan [Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States). Life Sciences Div.; Costes, Sylvain V. [Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States). Life Sciences Div.

    2014-09-01

    are based on experimental RIF and are three times larger than the hypothetical LEM voxel used to fit survival curves. Our model is therefore an alternative to previous approaches that provides a testable biological mechanism (i.e., RIF). In addition, we propose that DSB pairing will help develop more accurate alternatives to the linear cancer risk model (LNT) currently used for regulating exposure to very low levels of ionizing radiation.

  18. Junctionless Cooper pair transistor

    Energy Technology Data Exchange (ETDEWEB)

    Arutyunov, K. Yu., E-mail: konstantin.yu.arutyunov@jyu.fi [National Research University Higher School of Economics , Moscow Institute of Electronics and Mathematics, 101000 Moscow (Russian Federation); P.L. Kapitza Institute for Physical Problems RAS , Moscow 119334 (Russian Federation); Lehtinen, J.S. [VTT Technical Research Centre of Finland Ltd., Centre for Metrology MIKES, P.O. Box 1000, FI-02044 VTT (Finland)

    2017-02-15

    Highlights: • Junctionless Cooper pair box. • Quantum phase slips. • Coulomb blockade and gate modulation of the Coulomb gap. - Abstract: Quantum phase slip (QPS) is the topological singularity of the complex order parameter of a quasi-one-dimensional superconductor: momentary zeroing of the modulus and simultaneous 'slip' of the phase by ±2π. The QPS event(s) are the dynamic equivalent of tunneling through a conventional Josephson junction containing static in space and time weak link(s). Here we demonstrate the operation of a superconducting single electron transistor (Cooper pair transistor) without any tunnel junctions. Instead a pair of thin superconducting titanium wires in QPS regime was used. The current–voltage characteristics demonstrate the clear Coulomb blockade with magnitude of the Coulomb gap modulated by the gate potential. The Coulomb blockade disappears above the critical temperature, and at low temperatures can be suppressed by strong magnetic field.

  19. Pairing gaps in nucleonic superfluids

    Energy Technology Data Exchange (ETDEWEB)

    Chen, J.M.C. (McDonnell Center for the Space Sciences and Dept. of Physics, Washington Univ., St. Louis, MO (United States)); Clark, J.W. (McDonnell Center for the Space Sciences and Dept. of Physics, Washington Univ., St. Louis, MO (United States)); Dave, R.D. (McDonnell Center for the Space Sciences and Dept. of Physics, Washington Univ., St. Louis, MO (United States)); Khodel, V.V. (McDonnell Center for the Space Sciences and Dept. of Physics, Washington Univ., St. Louis, MO (United States))

    1993-04-05

    Singlet S-wave nucleonic superfluids are studied within a microscopic many-body theory that incorporates explicit spatial correlations due to strong short-range repulsive forces as well as the momentum-space pairing correlations of BCS theory. The theory is formulated within the method of correlated basis functions (CBF). Within this scheme, there results a nonlinear problem for the superfluid energy gap that is identical in form to the gap problem of conventional BCS theory. However, the input single-particle energies and pairing matrix elements are dressed by the short-range spatial correlations and accordingly incorporate an important class of medium corrections. The effective pairing force of the theory is finite even if the bare two-nucleon potential contains an infinitely hard core; both the pairing matrix elements and single-particle energies are to be constructed from normal-state CBF matrix elements and may be evaluated by cluster-expansion techniques. The theory is explicated and applied at a variational level that is equivalent to the leading order of a CBF superstate perturbation theory. New results are presented for the [sup 1]S[sub 0] pairing gap [Delta][sub kF] in pure neutron matter at densities relevant to the inner crust of a neutron star, based on a simplified version of the Reid soft-core interaction and spin-dependent spatial correlations optimized in the correlated normal state. Careful considering is given to the treatment of the gap equation at large intermediate-state momenta. The variational gap function evaluated at the Fermi surface, [Delta][sub F], is found to be larger than predicted in earlier work. Estimates of the suppression of the gap due to polarization processes (and other particle-particle and hole-irreducible medium effects of higher order within CBF superstate perturbation theory) yield values of [Delta][sub kF].

  20. Detecting nonlocal Cooper pair entanglement by optical Bell inequality violation

    OpenAIRE

    Nigg, Simon E.; Tiwari, Rakesh P.; Walter, Stefan; Schmidt, Thomas L.

    2014-01-01

    Based on the Bardeen Cooper Schrieffer (BCS) theory of superconductivity, the coherent splitting of Cooper pairs from a superconductor to two spatially separated quantum dots has been predicted to generate nonlocal pairs of entangled electrons. In order to test this hypothesis, we propose a scheme to transfer the spin state of a split Cooper pair onto the polarization state of a pair of optical photons. We show that the produced photon pairs can be used to violate a Bell inequality, unambiguo...

  1. Experimental dem Extraction from Aster Stereo Pairs and 3d Registration Based on Icesat Laser Altimetry Data in Upstream Area of Lambert Glacier, Antarctica

    Science.gov (United States)

    Hai, G.; Xie, H.; Chen, J.; Chen, L.; Li, R.; Tong, X.

    2017-09-01

    DEM Extraction from ASTER stereo pairs and three-dimensional registration by reference to ICESat laser altimetry data are carried out in upstream area of Lambert Glacier, East Antarctica. Since the study area is located in inland of East Antarctica where few textures exist, registration between DEM and ICESat data is performed. Firstly, the ASTER DEM generation is based on rational function model (RFM) and the procedure includes: a) rational polynomial coefficient (RPC) computation from ASTER metadata, b) L1A image product de-noise and destriping, c) local histogram equalization and matching, d) artificial collection of tie points and bundle adjustment, and e) coarse-to-fine hierarchical matching of five levels and grid matching. The matching results are filtered semi-automatically. Hereafter, DEM is interpolated using spline method with ground points converted from matching points. Secondly, the generated ASTER DEM is registered to ICESat data in three-dimensional space after Least-squares rigid transformation using singular value decomposition (SVD). The process is stated as: a) correspondence selection of terrain feature points from ICESat and DEM profiles, b) rigid transformation of generated ASTER DEM using selected feature correspondences based on least squares technique. The registration shows a good result that the elevation difference between DEM and ICESat data is low with a mean value less than 2 meters and the standard deviation around 7 meters. This DEM is generated and specially registered in Antarctic typical region without obvious ground rock control points and serves as true terrain input for further radar altimetry simulation.

  2. Au pair trajectories

    DEFF Research Database (Denmark)

    Dalgas, Karina Märcher

    2015-01-01

    Since 2000, thousands of young Filipino migrants have come to Denmark as au pairs. Officially, they are there to “broaden their cultural horizons” by living temporarily with a Danish host family, but they also conduct domestic labor in exchange for food and money, which allows them to send...

  3. Aspectual Pairing in Polish

    NARCIS (Netherlands)

    Młynarczyk, A.K.

    2004-01-01

    The received view on Slavic aspect is that it is intrinsically complex, and that there is little hope of discerning any substantial regularity. We argue that this view is mistaken. We argue that the vast majority of Polish verbs really do come in aspectual pairs and that far from being a mysterious

  4. Excited cooper pairs

    Energy Technology Data Exchange (ETDEWEB)

    Lopez-Arrietea, M. G.; Solis, M. A.; De Llano, M. [Universidad Nacional Autonoma de Mexico, Mexico, D.F (Mexico)

    2001-02-01

    Excited cooper pairs formed in a many-fermion system are those with nonzero total center-of mass momentum (CMM). They are normally neglected in the standard Bardeen-Cooper-Schrieffer (BCS) theory of superconductivity for being too few compared with zero CMM pairs. However, a Bose-Einstein condensation picture requires both zero and nonzero CMM pairs. Assuming a BCS model interaction between fermions we determine the populations for all CMM values of Cooper pairs by actually calculating the number of nonzero-CMM pairs relative to that of zero-CMM ones in both 2D and 3D. Although this ratio decreases rapidly with CMM, the number of Cooper pairs for any specific CMM less than the maximum (or breakup of the pair) momentum turns out to be typically larger than about 95% of those with zero-CMM at zero temperature T. Even at T {approx}100 K this fraction en 2D is still as large as about 70% for typical quasi-2D cuprate superconductor parameters. [Spanish] Los pares de cooper excitados formados en un sistema de muchos electrones, son aquellos con momentos de centro de masa (CMM) diferente de cero. Normalmente estos no son tomados en cuenta en la teoria estandar de la superconductividad de Bardeen-Cooper-Schrieffer (BCS) al suponer que su numero es muy pequeno comparados con los pares de centro de masa igual a cero. Sin embargo, un esquema de condensacion Bose-Einstein requiere de ambos pares, con CMM cero y diferente de cero. Asumiendo una interaccion modelo BCS entre los fermiones, determinamos la poblacion de pares cooper con cada uno de todos los posibles valores del CMM calculando el numero de pares con momentos de centro de masa diferente de cero relativo a los pares de CMM igual a cero, en 2D y 3D. Aunque esta razon decrece rapidamente con el CMM, el numero de pares de cooper para cualquier CMM especifico menor que el momento maximo (o rompimiento de par) es tipicamente mas grande que el 95% de aquellos con CMM cero. Aun a T {approx}100 K esta fraccion en 2D es

  5. Average glandular dose in paired digital mammography and digital breast tomosynthesis acquisitions in a population based screening program: effects of measuring breast density, air kerma and beam quality

    Science.gov (United States)

    Helge Østerås, Bjørn; Skaane, Per; Gullien, Randi; Catrine Trægde Martinsen, Anne

    2018-02-01

    The main purpose was to compare average glandular dose (AGD) for same-compression digital mammography (DM) and digital breast tomosynthesis (DBT) acquisitions in a population based screening program, with and without breast density stratification, as determined by automatically calculated breast density (Quantra™). Secondary, to compare AGD estimates based on measured breast density, air kerma and half value layer (HVL) to DICOM metadata based estimates. AGD was estimated for 3819 women participating in the screening trial. All received craniocaudal and mediolateral oblique views of each breasts with paired DM and DBT acquisitions. Exposure parameters were extracted from DICOM metadata. Air kerma and HVL were measured for all beam qualities used to acquire the mammograms. Volumetric breast density was estimated using Quantra™. AGD was estimated using the Dance model. AGD reported directly from the DICOM metadata was also assessed. Mean AGD was 1.74 and 2.10 mGy for DM and DBT, respectively. Mean DBT/DM AGD ratio was 1.24. For fatty breasts: mean AGD was 1.74 and 2.27 mGy for DM and DBT, respectively. For dense breasts: mean AGD was 1.73 and 1.79 mGy, for DM and DBT, respectively. For breasts of similar thickness, dense breasts had higher AGD for DM and similar AGD for DBT. The DBT/DM dose ratio was substantially lower for dense compared to fatty breasts (1.08 versus 1.33). The average c-factor was 1.16. Using previously published polynomials to estimate glandularity from thickness underestimated the c-factor by 5.9% on average. Mean AGD error between estimates based on measurements (air kerma and HVL) versus DICOM header data was 3.8%, but for one mammography unit as high as 7.9%. Mean error of using the AGD value reported in the DICOM header was 10.7 and 13.3%, respectively. Thus, measurement of breast density, radiation dose and beam quality can substantially affect AGD estimates.

  6. The stability of duplexes involving AT and/or G4EtC base pairs is not dependent on their AT/G4EtC ratio content. Implication for DNA sequencing by hybridization.

    Science.gov (United States)

    Nguyen, H K; Bonfils, E; Auffray, P; Costaglioli, P; Schmitt, P; Asseline, U; Durand, M; Maurizot, J C; Dupret, D; Thuong, N T

    1998-09-15

    Sequencing by the recently reported hybridization technique requires the formation of DNA duplexes with similar stabilities. In this paper we describe a new strategy to obtain DNA duplexes with a thermal stability independent of their AT/GC ratio content. Melting data were acquired on 35 natural and 27 modified duplexes of a given length and of varying base compositions. Duplexes built with AT and/or G4EtC base pairs exhibit a thermal stability restrained to a lower range of temperature than that of the corresponding natural compounds (16 instead of 51 degrees C). The 16 degrees C difference in thermal stability observed between the least stable and the most stable duplex built with AT and/or G4EtC base pairs is mainly due to the sequence effect and not to their AT/G4EtC ratio content. Thus N -4-ethyl-2'-deoxycytidine (d4EtC) hybridizes specifically with natural deoxyguanosine leading to a G4EtC base pair whose stability is very close to that of the natural AT base pair. Oligonucleotide probes involving d4EtC can be easily prepared by chemical synthesis with phosphoramidite chemistry. Modified DNA targets were successfully amplified by random priming or PCR techniques using d4EtCTP, dATP, dGTP and dTTP in the presence of DNA polymerase. This new system might be very useful for DNA sequencing by hybridization.

  7. Translation mechanisms involving long-distance base pairing interactions between the 5' and 3' non-translated regions and internal ribosomal entry are conserved for both genomic RNAs of Blackcurrant reversion nepovirus.

    Science.gov (United States)

    Karetnikov, Alexey; Lehto, Kirsi

    2008-02-20

    One of the mechanisms of functioning for viral cap-independent translational enhancers (CITEs), located in 3' non-translated regions (NTRs), is 3' NTR-5' leader long-distance base pairing. Previously, we have demonstrated that the RNA2 3' NTR of Blackcurrant reversion nepovirus (BRV) contains a CITE, which must base pair with the 5' NTR to facilitate translation. Here we compared translation strategies employed by BRV RNA1 and RNA2, by using mutagenesis of the BRV NTRs in firefly luciferase reporter mRNA, in plant protoplasts. Translation mechanisms, based on 3' CITEs, 5' NTR-3' NTR base pairing and poly(A) tail-stimulation, were found conserved between RNA1 and RNA2. The 40S ribosomal subunit entry at the RNA1 leader occurred, at least partly, via an internal ribosomal entry site (IRES). Two RNA1 leader segments complementary to plant 18S rRNA enhanced translation. A model for BRV RNAs translation, involving IRES-dependent 40S subunit recruitment and long-distance 5' NTR-3' NTR base pairing, is discussed.

  8. Origin, evolution, and mechanism of 5' tRNA editing in chytridiomycete fungi.

    Science.gov (United States)

    Laforest, Marie-Josée; Bullerwell, Charles E; Forget, Lise; Lang, B Franz

    2004-08-01

    5' tRNA editing has been demonstrated to occur in the mitochondria of the distantly related rhizopod amoeba Acanthamoeba castellanii and the chytridiomycete fungus Spizellomyces punctatus. In these organisms, canonical tRNA structures are restored by removing mismatched nucleotides at the first three 5' positions and replacing them with nucleotides capable of forming Watson-Crick base pairs with their 3' counterparts. This form of editing seems likely to occur in members of Amoebozoa other than A. castellanii, as well as in members of Heterolobosea. Evidence for 5' tRNA editing has not been found to date, however, in any other fungus including the deeply branching chytridiomycete Allomyces macrogynus. We predicted that a similar form of tRNA editing would occur in members of the chytridiomycete order Monoblepharidales based on the analysis of complete mitochondrial tRNA complements. This prediction was confirmed by analysis of tRNA sequences using a tRNA circularization/RT-PCR-based approach. The presence of partially and completely unedited tRNAs in members of the Monoblepharidales suggests the involvement of a 5'-to-3' exonuclease rather than an endonuclease in removing the three 5' nucleotides from a tRNA substrate. Surprisingly, analysis of the mtDNA of the chytridiomycete Rhizophydium brooksianum, which branches as a sister group to S. punctatus in molecular phylogenies, did not suggest the presence of editing. This prediction was also confirmed experimentally. The absence of tRNA editing in R. brooksianum raises the possibility that 5' tRNA editing may have evolved twice independently within Chytridiomycota, once in the lineage leading to S. punctatus and once in the lineage leading to the Monoblepharidales.

  9. Structures of hydrated Li+-thymine and Li+-uracil complexes by IRMPD spectroscopy in the N-H/O-H stretching region.

    Science.gov (United States)

    Gillis, Elizabeth A L; Rajabi, Khadijeh; Fridgen, Travis D

    2009-02-05

    The interaction of lithium ions with two pyrimidine nucleobases, thymine and uracil, as well as the solvation of various complexes by one and two water molecules, has been studied in the gas phase. IRMPD spectra are reported for each of B-Li(+)-(H(2)O)(n) (n = 1-2) and B(2)-Li-(H(2)O)(m) (m = 0-1) for B = thymine, uracil over the 2500-4000 cm(-1) region. Calculations were performed using the B3LYP density functional in conjunction with the 6-31+G(d,p) basis set to model the vibrational spectra as well as MP2/6-311++G(2d,p) theory to model the thermochemistry of potential structures. Experimental and theoretical results were used in combination to determine structures of each complex, which are reported here. The lithium cation in all complexes was found to bond to the O4 oxygen in both thymine and uracil, and the first two water molecules of solvation were found to bond to Li(+). The experimental spectra obtained for BLi(+)(H(2)O)(n) (n = 1-2) and B(2)Li(+) for thymine and uracil clearly resemble one another, suggesting similar structural features in terms of bonding between the base and Li(+), as well as for solvation. This was confirmed through theoretical work. The addition of water to the lithium ion-bound DNA base dimers has been shown to induce a significant change in structure of the dimer to a hydrogen-bonded system similar to base pairing in the Watson-Crick model of DNA.

  10. FRET Characterization of Complex Conformational Changes in a Large 16S Ribosomal RNA Fragment Site-Specifically Labeled Using Unnatural Base Pairs.

    Science.gov (United States)

    Lavergne, Thomas; Lamichhane, Rajan; Malyshev, Denis A; Li, Zhengtao; Li, Lingjun; Sperling, Edit; Williamson, James R; Millar, David P; Romesberg, Floyd E

    2016-05-20

    Ribosome assembly has been studied intensively using Förster resonance energy transfer (FRET) with fluorophore-labeled fragments of RNA produced by chemical synthesis. However, these studies are limited by the size of the accessible RNA fragments. We have developed a replicable unnatural base pair (UBP) formed between (d)5SICS and (d)MMO2 or (d)NaM, which efficiently directs the transcription of RNA containing unnatural nucleotides. We now report the synthesis and evaluation of several of the corresponding ribotriphosphates bearing linkers that enable the chemoselective attachment of different functionalities. We found that the RNA polymerase from T7 bacteriophage does not incorporate NaM derivatives but does efficiently incorporate 5SICS(CO), whose linker enables functional group conjugation via Click chemistry, and when combined with the previously identified MMO2(A), whose amine side chains permits conjugation via NHS coupling chemistry, enables site-specific double labeling of transcribed RNA. To study ribosome assembly, we transcribed RNA corresponding to a 243-nt fragment of the central domain of Thermus thermophilus 16S rRNA containing 5SICS(CO) and MMO2(A) at defined locations and then site-specifically attached the fluorophores Cy3 and Cy5. FRET was characterized using single-molecule total internal reflection fluorescence (smTIRF) microscopy in the presence of various combinations of added ribosomal proteins. We demonstrate that each of the fragment's two three-helix junctions exist in open and closed states, with the latter favored by sequential protein binding. These results elucidate early and previously uncharacterized folding events underlying ribosome assembly and demonstrate the applicability of UBPs for biochemical, structural, and functional studies of RNAs.

  11. Effects of a School-Based Social-Emotional and Character Development Program on Health Behaviors: A Matched-Pair, Cluster-Randomized Controlled Trial.

    Science.gov (United States)

    Bavarian, Niloofar; Lewis, Kendra M; Acock, Alan; DuBois, David L; Yan, Zi; Vuchinich, Samuel; Silverthorn, Naida; Day, Joseph; Flay, Brian R

    2016-02-01

    There is considerable research that suggests that school-based social-emotional programs can foster improved mental health and reduce problem behaviors for participating youth; in contrast, much less is known about the impact of these programs on physical health, even though some of these programs also include at least limited direct attention to promoting physical health behaviors. We examined the effects of one such program, Positive Action (PA), on physical health behaviors and body mass ind