WorldWideScience

Sample records for watson told mccubbrey

  1. Distributional Watson transforms

    NARCIS (Netherlands)

    Dijksma, A.; Snoo, H.S.V. de

    1974-01-01

    For all Watson transforms W in L2(R+) a triple of Hilbert space LG ⊂ L2(R+) ⊂ L'G is constructed such that W may be extended to L'G. These results allow the construction of a triple L ⊂ L2(R+) ⊂ L', where L is a Gelfand-Fréchet space. This leads to a theory of distributional Watson transforms.

  2. A Challenge to Watson

    Science.gov (United States)

    Detterman, Douglas K.

    2011-01-01

    Watson's Jeopardy victory raises the question of the similarity of artificial intelligence and human intelligence. Those of us who study human intelligence issue a challenge to the artificial intelligence community. We will construct a unique battery of tests for any computer that would provide an actual IQ score for the computer. This is the same…

  3. Data Discovery with IBM Watson

    Science.gov (United States)

    Fessler, J.

    2016-12-01

    BM Watson is a cognitive computing system that uses machine learning, statistical analysis, and natural language processing to find and understand the clues in questions posed to it. Watson was made famous when it bested two champions on TV's Jeopardy! show. Since then, Watson has evolved into a platform of cognitive services that can be trained on very granular fields up study. Watson is being used to support a number of subject domains, such as cancer research, public safety, engineering, and the intelligence community. IBM will be providing a presentation and demonstration on the Watson technology and will discuss its capabilities including Natural Language Processing, text analytics and enterprise search, as well as cognitive computing with deep Q&A. The team will also be giving examples of how IBM Watson technology is being used to support real-world problems across a number of public sector agencies

  4. The circumstances of the missing biographer or why Watson didn't narrate these four Sherlock Holmes stories.

    Science.gov (United States)

    Caplan, R M

    1982-06-01

    The author provides arguments to explain why four of Arthur Conan Doyle's sixty stories about Sherlock Holmes were not narrated by Dr. Watson. The arguments relate to logical demands of the plot in the cases of the two stories told by an unidentified narrator. The two told by Holmes seem to demand Watson's absence because the final elucidation requires skill in cutaneous diagnosis; the presence of a medical man would have, or should have, relieved the dramatic tension of the mystery too soon. The Sherlock Holmes stories can provide delightful diversion as well as serve constantly to enhance our appreciation for highly alert and careful physical examination.

  5. Making IBM's Computer, Watson, Human

    Science.gov (United States)

    Rachlin, Howard

    2012-01-01

    This essay uses the recent victory of an IBM computer (Watson) in the TV game, "Jeopardy," to speculate on the abilities Watson would need, in addition to those it has, to be human. The essay's basic premise is that to be human is to behave as humans behave and to function in society as humans function. Alternatives to this premise are considered…

  6. Weighted Watson-Crick automata

    Energy Technology Data Exchange (ETDEWEB)

    Tamrin, Mohd Izzuddin Mohd [Department of Information System, Kulliyyah of Information and Communication Technology, International Islamic University Malaysia, 50728 Gombak, Selangor (Malaysia); Turaev, Sherzod; Sembok, Tengku Mohd Tengku [Department of Computer Science, Kulliyyah of Information and Communication Technology, International Islamic University Malaysia, 50728 Gombak, Selangor (Malaysia)

    2014-07-10

    There are tremendous works in biotechnology especially in area of DNA molecules. The computer society is attempting to develop smaller computing devices through computational models which are based on the operations performed on the DNA molecules. A Watson-Crick automaton, a theoretical model for DNA based computation, has two reading heads, and works on double-stranded sequences of the input related by a complementarity relation similar with the Watson-Crick complementarity of DNA nucleotides. Over the time, several variants of Watson-Crick automata have been introduced and investigated. However, they cannot be used as suitable DNA based computational models for molecular stochastic processes and fuzzy processes that are related to important practical problems such as molecular parsing, gene disease detection, and food authentication. In this paper we define new variants of Watson-Crick automata, called weighted Watson-Crick automata, developing theoretical models for molecular stochastic and fuzzy processes. We define weighted Watson-Crick automata adapting weight restriction mechanisms associated with formal grammars and automata. We also study the generative capacities of weighted Watson-Crick automata, including probabilistic and fuzzy variants. We show that weighted variants of Watson-Crick automata increase their generative power.

  7. Weighted Watson-Crick automata

    International Nuclear Information System (INIS)

    Tamrin, Mohd Izzuddin Mohd; Turaev, Sherzod; Sembok, Tengku Mohd Tengku

    2014-01-01

    There are tremendous works in biotechnology especially in area of DNA molecules. The computer society is attempting to develop smaller computing devices through computational models which are based on the operations performed on the DNA molecules. A Watson-Crick automaton, a theoretical model for DNA based computation, has two reading heads, and works on double-stranded sequences of the input related by a complementarity relation similar with the Watson-Crick complementarity of DNA nucleotides. Over the time, several variants of Watson-Crick automata have been introduced and investigated. However, they cannot be used as suitable DNA based computational models for molecular stochastic processes and fuzzy processes that are related to important practical problems such as molecular parsing, gene disease detection, and food authentication. In this paper we define new variants of Watson-Crick automata, called weighted Watson-Crick automata, developing theoretical models for molecular stochastic and fuzzy processes. We define weighted Watson-Crick automata adapting weight restriction mechanisms associated with formal grammars and automata. We also study the generative capacities of weighted Watson-Crick automata, including probabilistic and fuzzy variants. We show that weighted variants of Watson-Crick automata increase their generative power

  8. Closure properties of Watson-Crick grammars

    Science.gov (United States)

    Zulkufli, Nurul Liyana binti Mohamad; Turaev, Sherzod; Tamrin, Mohd Izzuddin Mohd; Azeddine, Messikh

    2015-12-01

    In this paper, we define Watson-Crick context-free grammars, as an extension of Watson-Crick regular grammars and Watson-Crick linear grammars with context-free grammar rules. We show the relation of Watson-Crick (regular and linear) grammars to the sticker systems, and study some of the important closure properties of the Watson-Crick grammars. We establish that the Watson-Crick regular grammars are closed under almost all of the main closure operations, while the differences between other Watson-Crick grammars with their corresponding Chomsky grammars depend on the computational power of the Watson-Crick grammars which still need to be studied.

  9. Interview with Mark Watson

    Directory of Open Access Journals (Sweden)

    Katy Shaw

    2016-04-01

    Full Text Available Mark Watson is a British comedian and novelist. His five novels to date – 'Bullet Points' (2004, 'A Light-Hearted Look At Murder' (2007, 'Eleven' (2010, 'The Knot' (2012 and 'Hotel Alpha' (2014 – explore human relationships and communities in contemporary society. His latest novel Hotel Alpha tells the story of an extraordinary hotel in London and two mysterious disappearances that raise questions no one seems willing to answer. External to the novel, readers can also discover more about the hotel and its inhabitants in one hundred extra stories that expand the world of the novel and can be found at http://www.hotelalphastories.com. In conversation here with Dr Katy Shaw, Mark offers some reflections on his writing process, the field of contemporary literature, and the vitality of the novel form in the twenty-first century.

  10. de Jean Watson

    Directory of Open Access Journals (Sweden)

    Thaís Schossler

    2008-01-01

    Full Text Available Este estudio tuvo como objetivo conocer la percepción del cuidador domiciliario del anciano acerca del cuidado de sí mismo, teniendo como base teórica a Jean Watson en su Teoría del Cuidado Humano. La investigación se caracterizó por un abordaje cualitativo, de tipo exploratorio-descriptivo, el cual fue desarrollado en la Unidad de la Vila Floresta con nueve cuidadores domiciliarios de ancianos, integrantes del Programa de Atención a Domicilio. La recolección de informaciones se realizó en el período de agosto a octubre de 2006, por medio de una entrevista parcialmente estructurada. Se utilizó el análisis de contenido de Bardin y emergieron las categorías: compartir el cuidado al anciano - una posibilidad para cuidar de sí mismo; descansar, pasear, dormir, uno no tiene más ese derecho; presencia de la familia: una necesidad sentida por el cuidador domiciliar; (desequilibrio del cuerpo físico y mental, una resultante percibida en el (descuidado de sí mismo. Se concluye que el cuidador domiciliario es el principal responsable por el cuidado del anciano y que el cuidado de sí mismo se hace presente en su realidad.

  11. Test Review: Watson, G., & Glaser, E. M. (2010), "Watson-Glaser™ II Critical Thinking Appraisal." Washington State University, Pullman, USA

    Science.gov (United States)

    Sternod, Latisha; French, Brian

    2016-01-01

    The Watson-Glaser™ II Critical Thinking Appraisal (Watson-Glaser II; Watson & Glaser, 2010) is a revised version of the "Watson-Glaser Critical Thinking Appraisal®" (Watson & Glaser, 1994). The Watson-Glaser II introduces a simplified model of critical thinking, consisting of three subdimensions: recognize assumptions, evaluate…

  12. A conversation with Geoff Watson

    OpenAIRE

    Beran, R. J.; Fisher, N. I.

    1998-01-01

    Geoffrey Stuart Watson, Professor Emeritus at Princeton University, celebrated his 75th birthday on December 3, 1996. A native Australian, his early education included Bendigo High School and Scotch College in Melbourne. After graduating with a B.A. (Hons.) from Melbourne University in December 1942, he spent the next few years, during and after World War II, doing research and teaching on applied mathematical topics. His wandering as a scholar began in 1947, when he became ...

  13. Ed Watson - 1940-2006

    CERN Multimedia

    2006-01-01

    Ed Watson passed away suddenly on 1 August in Geneva, he was 66. He leaves his wife and two children. Ed Watson arrived at CERN in March 1973 to work on digital electronics and CAMAC systems under Bob Dobinson, after many years at Rolls Royce in Scotland. He joined the European Muon Collaboration in 1976, where he played a major role in the design, deployment and running of its data acquisition system (DAQ) with David Botterill, Bob Dobinson, and Vicky White. The CAMAC-ROMULUS system was by far the largest and most advanced of its time, and it became a defining standard for DAQ systems for years to come. Ed was deeply involved in the detailed planning of the control rooms and the experiment cabling, as well as sharing the responsibility for the CAMAC readout system. He had a real talent for trouble shooting and played a vital part in supporting the experiment throughout its lifetime. He offered great moral support to the younger members of the collaboration and helped them a great deal with their work. The...

  14. Multi-head Watson-Crick automata

    OpenAIRE

    Chatterjee, Kingshuk; Ray, Kumar Sankar

    2015-01-01

    Inspired by multi-head finite automata and Watson-Crick automata in this paper, we introduce new structure namely multi-head Watson-Crick automata where we replace the single tape of multi-head finite automaton by a DNA double strand. The content of the second tape is determined using a complementarity relation similar to Watson-Crick complementarity relation. We establish the superiority of our model over multi-head finite automata and also show that both the deterministic and non-determinis...

  15. Sommerfeld-Watson transformation for nuclear fission

    International Nuclear Information System (INIS)

    Alexandru, G.

    1978-01-01

    It is proved that the fission matrix element can be written like a Sommerfeld-Watson relation. This leads to a dispersion relation for the fission process in which the substraction term is uniquely determined. (author)

  16. A chat with James Watson

    CERN Multimedia

    2011-01-01

    On 6 September, Nobel laureate James Watson paid a visit to CERN. In this interview, he shares his views with CERN's Paola Catapano.      var flash_video_player=get_video_player_path(); insert_player_for_external('Video/Public/Movies/2011/CERN-MOVIE-2011-144/CERN-MOVIE-2011-144-0753-kbps-640x360-25-fps-audio-64-kbps-44-kHz-stereo', 'mms://mediastream.cern.ch/MediaArchive/Video/Public/Movies/2011/CERN-MOVIE-2011-144/CERN-MOVIE-2011-144-0480-kbps-512x288-25-fps-audio-128-kbps-48-kHz-stereo.wmv', 'false', 480, 360, 'https://mediastream.cern.ch/MediaArchive/Video/Public/Movies/2011/CERN-MOVIE-2011-144/CERN-MOVIE-2011-144-posterframe-640x360-at-10-percent.jpg', '1384418', true, 'Video/Public/Movies/2011/CERN-MOVIE-2011-144/CERN-MOVIE-2011-144-0600-kbps-maxH-360-25-fps-audio-128-kbps-48-kHz-stereo.mp4');

  17. Ed Watson 1940-2006

    CERN Multimedia

    2006-01-01

    Ed Watson arrived at CERN in March 1973 to work on digital electronics and CAMAC systems under Bob Dobinson, after many years at Rolls Royce in Scotland. He joined the European Muon Collaboration in 1976, where he played a major role in the design, deployment and running of its data acquisition system (DAQ) with David Botterill, Bob Dobinson, and Vicky White. The CAMAC-ROMULUS system was by far the largest and most advanced of its time, and it became a defining standard for DAQ systems for years to come. Ed was deeply involved in the detailed planning of the control rooms and the experiment cabling, as well as sharing the responsibility for the CAMAC readout system. He had a real talent for trouble shooting and played a vital part in supporting the experiment throughout its lifetime. He offered great moral support to the younger members of the collaboration and helped them a great deal with their work. The EMC had a wonderful social life to which Ed was a major contributor - who can forget its barbecues?  In...

  18. 78 FR 43198 - Watson Cogeneration Company; Notice of Filing

    Science.gov (United States)

    2013-07-19

    ... DEPARTMENT OF ENERGY Federal Energy Regulatory Commission [Docket No. TX13-1-000] Watson... Commission's (Commission) Regulations, 18 CFR 36.1, Watson Cogeneration Company filed an application... physical interconnection to the Watson facility; (2) direct SCE and California Independent System Operator...

  19. Oncologists partner with Watson on genomics.

    Science.gov (United States)

    2015-08-01

    A new collaboration between IBM Watson Health and more than a dozen cancer centers uses the power of cognitive computing to dramatically reduce the time it takes to analyze data from patients' DNA and identify targeted treatment options. ©2015 American Association for Cancer Research.

  20. Did John B. Watson Really "Found" Behaviorism?

    Science.gov (United States)

    Malone, John C

    2014-05-01

    Developments culminating in the nineteenth century, along with the predictable collapse of introspective psychology, meant that the rise of behavioral psychology was inevitable. In 1913, John B. Watson was an established scientist with impeccable credentials who acted as a strong and combative promoter of a natural science approach to psychology when just such an advocate was needed. He never claimed to have founded "behavior psychology" and, despite the acclaim and criticism attending his portrayal as the original behaviorist, he was more an exemplar of a movement than a founder. Many influential writers had already characterized psychology, including so-called mental activity, as behavior, offered many applications, and rejected metaphysical dualism. Among others, William Carpenter, Alexander Bain, and (early) Sigmund Freud held views compatible with twentieth-century behaviorism. Thus, though Watson was the first to argue specifically for psychology as a natural science, behaviorism in both theory and practice had clear roots long before 1913. If behaviorism really needs a "founder," Edward Thorndike might seem more deserving, because of his great influence and promotion of an objective psychology, but he was not a true behaviorist for several important reasons. Watson deserves the fame he has received, since he first made a strong case for a natural science (behaviorist) approach and, importantly, he made people pay attention to it.

  1. MEASURE FOR MEASURE: A THRICE TOLD TALE

    Directory of Open Access Journals (Sweden)

    HALIMAH MOHAMED ALI

    2009-01-01

    Full Text Available This paper argues that Measure for Measure is a difficult play to perform because it has problematic themes, especially the theme of sexuality, that clash with the way of life and thinking of contemporary society. As such, any director who chooses to stage it must consider these difficulties and how to present them in a natural manner without making the audience feel that the whole production is contrived. The directors of the two major productions discussed in this paper tried their best to present a Measure for Measure that would be acceptable to the modern society. It is evident that there are many interpretations of the Duke and Isabella's characters and also of Isabella's reaction to the Duke's proposal at the end of the play. It can be concluded that no interpretation is wrong because each actor or director brings with him his own reading of the play, and every reading has been influenced by other performances and textual criticisms. Since Measure for Measure is a thematically rich play, it should not be confined to a single interpretation. The different performances of Measure for Measure have proven that theatre is experimental as well as ageless. Because it is a brilliant play with a myriad of interpretations, Measure for Measure will not cease to be a favourite for directors in times to come. It is not wrong to predict that fans of Shakespeare in general and of Measure for Measure in particular can look forward to many more productions.For experienced Shakespeare observers all performances are thrice-told tales. The perceiving eye absorbs the performance even as the mind's eye attends to the text. Both are augmented by the inner ear buzzing with those other voices, both critical and dramatic, carried by the observer into the theatre.(Crowl, Samuel 1992: 3

  2. Training IBM Watson using Automatically Generated Question-Answer Pairs

    OpenAIRE

    Lee, Jangho; Kim, Gyuwan; Yoo, Jaeyoon; Jung, Changwoo; Kim, Minseok; Yoon, Sungroh

    2016-01-01

    IBM Watson is a cognitive computing system capable of question answering in natural languages. It is believed that IBM Watson can understand large corpora and answer relevant questions more effectively than any other question-answering system currently available. To unleash the full power of Watson, however, we need to train its instance with a large number of well-prepared question-answer pairs. Obviously, manually generating such pairs in a large quantity is prohibitively time consuming and...

  3. Graham Watson: Eesti vajab enam riigi sekkumist majandusse

    Index Scriptorium Estoniae

    Watson, Graham

    2009-01-01

    18. aprillil pidasid keskerakondlased Tallinnas Euroopa Parlamendi valimiste konverentsi. Euroopa Parlamendi demokraatide ja liberaalide fraktsiooni juht Graham Watson saatis Keskerakonnale videotervituse

  4. CERN told to start technical thinking for next collider

    CERN Multimedia

    1998-01-01

    CERN has been told to begin technical design work for the successor to the LHC. A report commissioned last year, suggests that future design work should focus on developping cost-effective high-field magnets (1 page).

  5. Uporaba orodja poslovne inteligence IBM Watson za predvidevanje prodaje

    OpenAIRE

    Stojić, Igor

    2016-01-01

    Diplomska naloga obravnava uporabo orodja IBM Watson in njegovo poslovno vrednost, ki jo ima v okviru oblikovanja napovedi prihodnje prodaje produktov. V teoretičnem delu podrobneje opredeljuje napovedovanje in smoter le-tega. V okviru empiričnega dela pa je bila izvedena primerjava uporabe ERP sistemov SAP in IBM Watson, pri čemer je bil dosledno prikazan postopek oblikovanja napovedi, tako s SAP kot tudi z IBM Watson, s slednjim pa tudi identificiran parameter, ki vpliva na prodajo nekateri...

  6. What I Wish My Professors Had Told Me

    Science.gov (United States)

    Collins, Jennifer

    2016-01-01

    What do you wish your undergraduate professors told you before you ever set foot in a classroom? Jennifer Collins, one such professor who prepares pre-service teachers, has a list of six "truths" she shares with her students. In this article, Collins outlines those pieces of advice, which include understanding your larger purpose,…

  7. The multiple personalities of Watson and Crick strands.

    Science.gov (United States)

    Cartwright, Reed A; Graur, Dan

    2011-02-08

    In genetics it is customary to refer to double-stranded DNA as containing a "Watson strand" and a "Crick strand." However, there seems to be no consensus in the literature on the exact meaning of these two terms, and the many usages contradict one another as well as the original definition. Here, we review the history of the terminology and suggest retaining a single sense that is currently the most useful and consistent. The Saccharomyces Genome Database defines the Watson strand as the strand which has its 5'-end at the short-arm telomere and the Crick strand as its complement. The Watson strand is always used as the reference strand in their database. Using this as the basis of our standard, we recommend that Watson and Crick strand terminology only be used in the context of genomics. When possible, the centromere or other genomic feature should be used as a reference point, dividing the chromosome into two arms of unequal lengths. Under our proposal, the Watson strand is standardized as the strand whose 5'-end is on the short arm of the chromosome, and the Crick strand as the one whose 5'-end is on the long arm. Furthermore, the Watson strand should be retained as the reference (plus) strand in a genomic database. This usage not only makes the determination of Watson and Crick unambiguous, but also allows unambiguous selection of reference stands for genomics. This article was reviewed by John M. Logsdon, Igor B. Rogozin (nominated by Andrey Rzhetsky), and William Martin.

  8. The multiple personalities of Watson and Crick strands

    Directory of Open Access Journals (Sweden)

    Graur Dan

    2011-02-01

    Full Text Available Abstract Background In genetics it is customary to refer to double-stranded DNA as containing a "Watson strand" and a "Crick strand." However, there seems to be no consensus in the literature on the exact meaning of these two terms, and the many usages contradict one another as well as the original definition. Here, we review the history of the terminology and suggest retaining a single sense that is currently the most useful and consistent. Proposal The Saccharomyces Genome Database defines the Watson strand as the strand which has its 5'-end at the short-arm telomere and the Crick strand as its complement. The Watson strand is always used as the reference strand in their database. Using this as the basis of our standard, we recommend that Watson and Crick strand terminology only be used in the context of genomics. When possible, the centromere or other genomic feature should be used as a reference point, dividing the chromosome into two arms of unequal lengths. Under our proposal, the Watson strand is standardized as the strand whose 5'-end is on the short arm of the chromosome, and the Crick strand as the one whose 5'-end is on the long arm. Furthermore, the Watson strand should be retained as the reference (plus strand in a genomic database. This usage not only makes the determination of Watson and Crick unambiguous, but also allows unambiguous selection of reference stands for genomics. Reviewers This article was reviewed by John M. Logsdon, Igor B. Rogozin (nominated by Andrey Rzhetsky, and William Martin.

  9. Replication infidelity via a mismatch with Watson-Crick geometry.

    Science.gov (United States)

    Bebenek, Katarzyna; Pedersen, Lars C; Kunkel, Thomas A

    2011-02-01

    In describing the DNA double helix, Watson and Crick suggested that "spontaneous mutation may be due to a base occasionally occurring in one of its less likely tautomeric forms." Indeed, among many mispairing possibilities, either tautomerization or ionization of bases might allow a DNA polymerase to insert a mismatch with correct Watson-Crick geometry. However, despite substantial progress in understanding the structural basis of error prevention during polymerization, no DNA polymerase has yet been shown to form a natural base-base mismatch with Watson-Crick-like geometry. Here we provide such evidence, in the form of a crystal structure of a human DNA polymerase λ variant poised to misinsert dGTP opposite a template T. All atoms needed for catalysis are present at the active site and in positions that overlay with those for a correct base pair. The mismatch has Watson-Crick geometry consistent with a tautomeric or ionized base pair, with the pH dependence of misinsertion consistent with the latter. The results support the original idea that a base substitution can originate from a mismatch having Watson-Crick geometry, and they suggest a common catalytic mechanism for inserting a correct and an incorrect nucleotide. A second structure indicates that after misinsertion, the now primer-terminal G • T mismatch is also poised for catalysis but in the wobble conformation seen in other studies, indicating the dynamic nature of the pathway required to create a mismatch in fully duplex DNA.

  10. 78 FR 64016 - Importer of Controlled Substances; Notice of Registration; Watson Pharma, Inc.

    Science.gov (United States)

    2013-10-25

    ... Registration; Watson Pharma, Inc. By Notice dated May 24, 2013, and published in the Federal Register on June 4, 2013, 78 FR 33440, Watson Pharma, Inc., 2455 Wardlow Road, Corona, California 92880-2882, made... in 21 U.S.C. 823(a) and 952(a) and determined that the registration of Watson Pharma, Inc., to import...

  11. 78 FR 17231 - Importer of Controlled Substances, Notice of Registration, Watson Pharma, Inc.

    Science.gov (United States)

    2013-03-20

    ... Registration, Watson Pharma, Inc. By Notice dated November 5, 2012, and published in the Federal Register on November 13, 2012, 77 FR 67675, Watson Pharma, Inc., 2455 Wardlow Road, Corona, California 92880-2882, made.... 823(a) and Sec. 952(a) and determined that the registration of Watson Pharma, Inc., to import the...

  12. [From humanism to nihilism: dialectics on Jean Watson's caring theory].

    Science.gov (United States)

    Krol, Pawel J; Lavoie, Mireille

    2015-09-01

    nursing today is heir to values that have developed over many years. In addition to the values of human care, present-day nursing embraces values that shape our modern world. This dialectical study first traces the evolution of a number of the traditional values associated with human care that nursing has retained. It goes on to show how some of the values of human care have been cast aside in favour of modern--neoliberal, technocratic and bureaucratic--values which have in turn given rise to disturbing problems of instrumentalization. Watson's theory of caring proposes two ways to remedy such instrumentalization: espousing a transcendental, metaphysical mode of thought and adopting an altruistic humanism. However, many critics have questioned the theoretical consistency and very legitimacy of the theory as a means of dealing with instrumentalization. this study analyses Watson's proposals, using a Nietzschean dialectic approach to test them and to suggest possible solutions. Significant problems in terms of both consistency and relevance are brought to light, tending to refute Watson's notions. the study findings suggest that the application of Watson's theory may paradoxically perpetuate dualism and nihilism and, rather than curb their invasive impact, lead inevitably to a conversion to instrumental values. it's suggested an alternative, ethics-of-life approach based on the synthesis of our dialectics that would foster a return to, and respect for, humanity's essential nature.

  13. Jokulhlaups and sediment transport in Watson River, Kangerlussuaq, West Greenland

    DEFF Research Database (Denmark)

    Mikkelsen, A. B.; Hasholt, Bent; Knudsen, N. T.

    2013-01-01

    For 3 years, during a 4-year observation period (2007-2010), jokulhlaups were observed from a lake at the northern margin of Russells Gletscher. At a gauging station located on a bedrock sill near the outlet of Watson River into Sdr Stromfjord, discharge and sediment transport was monitored during...

  14. Watson-Crick hydrogen bonding of unlocked nucleic acids

    DEFF Research Database (Denmark)

    Langkjær, Niels; Wengel, Jesper; Pasternak, Anna

    2015-01-01

    We herein describe the synthesis of two new unlocked nucleic acid building blocks containing hypoxanthine and 2,6-diaminopurine as nucleobase moieties and their incorporation into oligonucleotides. The modified oligonucleotides were used to examine the thermodynamic properties of UNA against unmo...... unmodified oligonucleotides and the resulting thermodynamic data support that the hydrogen bonding face of UNA is Watson-Crick like....

  15. Relativistic generalisation of the Kroll-Watson formula

    International Nuclear Information System (INIS)

    Kaminski, J.Z.

    1985-01-01

    The relativistic analogue of the space-translation method is derived. Using this method the generalisation of the Kroll-Watson formula [1973, Phys. Rev. A. 8 804] is obtained for the scattering of an arbitrary charged particle (e.g. mesons, hyperons, quarks, etc). The separation of the background and resonant parts of the scattering amplitude is predicted. (author)

  16. Little Albert's alleged neurological impairment: Watson, Rayner, and historical revision.

    Science.gov (United States)

    Digdon, Nancy; Powell, Russell A; Harris, Ben

    2014-11-01

    In 2012, Fridlund, Beck, Goldie, and Irons (2012) announced that "Little Albert"-the infant that Watson and Rayner used in their 1920 study of conditioned fear (Watson & Rayner, 1920)-was not the healthy child the researchers described him to be, but was neurologically impaired almost from birth. Fridlund et al. also alleged that Watson had committed serious ethical breaches in regard to this research. Our article reexamines the evidentiary bases for these claims and arrives at an alternative interpretation of Albert as a normal infant. In order to set the stage for our interpretation, we first briefly describe the historical context for the Albert study, as well as how the study has been construed and revised since 1920. We then discuss the evidentiary issues in some detail, focusing on Fridlund et al.'s analysis of the film footage of Albert, and on the context within which Watson and Rayner conducted their study. In closing, we return to historical matters to speculate about why historiographical disputes matter and what the story of neurologically impaired Albert might be telling us about the discipline of psychology today.

  17. Chuck Watson's ``differential psychoacoustics:'' Individual differences in auditory abilities

    Science.gov (United States)

    Kidd, Gary R.

    2004-05-01

    Chuck Watson was among the first in the psychoacoustic community to seriously address the topic of individual differences. At a time when there was little concern with variation among ``normal listeners'' in psychoacoustic research, Watson began a research program to document the range of human auditory abilities. The primary goals were to determine the number of distinct abilities, to specify the nature of each ability, and to document the distribution of these abilities in the general population. Thanks to Watson's talent for organizing and directing large-scale projects and his workmanlike approach to science, a large and valuable body of data on human individual differences has been collected. The research program began about 20 years ago with the study of basic auditory abilities, and it has expanded to include other modalities and cognitive/intellectual abilities in adults and children. A somewhat biased view of the importance of this work will be presented by one of Watson's many colleagues in this endeavor. The talk will provide an overview of this ongoing research program as well as a brief review of some related research by other investigators. New findings from recent extensions of this work will also be discussed.

  18. Elementary? Question Answering, IBM's Watson, and the Jeopardy ...

    Indian Academy of Sciences (India)

    IAS Admin

    One of the most readable accounts of early AI systems, including. NLP systems, may be .... tions of these questions to annotations of information segments in ..... Watson as a decision-aide rather than as a decision-maker will be a safe step ...

  19. How a low-fidelity DNA polymerase chooses non-Watson-Crick from Watson-Crick incorporation.

    Science.gov (United States)

    Wu, Wen-Jin; Su, Mei-I; Wu, Jian-Li; Kumar, Sandeep; Lim, Liang-Hin; Wang, Chun-Wei Eric; Nelissen, Frank H T; Chen, Ming-Chuan Chad; Doreleijers, Jurgen F; Wijmenga, Sybren S; Tsai, Ming-Daw

    2014-04-02

    A dogma for DNA polymerase catalysis is that the enzyme binds DNA first, followed by MgdNTP. This mechanism contributes to the selection of correct dNTP by Watson-Crick base pairing, but it cannot explain how low-fidelity DNA polymerases overcome Watson-Crick base pairing to catalyze non-Watson-Crick dNTP incorporation. DNA polymerase X from the deadly African swine fever virus (Pol X) is a half-sized repair polymerase that catalyzes efficient dG:dGTP incorporation in addition to correct repair. Here we report the use of solution structures of Pol X in the free, binary (Pol X:MgdGTP), and ternary (Pol X:DNA:MgdGTP with dG:dGTP non-Watson-Crick pairing) forms, along with functional analyses, to show that Pol X uses multiple unprecedented strategies to achieve the mutagenic dG:dGTP incorporation. Unlike high fidelity polymerases, Pol X can prebind purine MgdNTP tightly and undergo a specific conformational change in the absence of DNA. The prebound MgdGTP assumes an unusual syn conformation stabilized by partial ring stacking with His115. Upon binding of a gapped DNA, also with a unique mechanism involving primarily helix αE, the prebound syn-dGTP forms a Hoogsteen base pair with the template anti-dG. Interestingly, while Pol X prebinds MgdCTP weakly, the correct dG:dCTP ternary complex is readily formed in the presence of DNA. H115A mutation disrupted MgdGTP binding and dG:dGTP ternary complex formation but not dG:dCTP ternary complex formation. The results demonstrate the first solution structural view of DNA polymerase catalysis, a unique DNA binding mode, and a novel mechanism for non-Watson-Crick incorporation by a low-fidelity DNA polymerase.

  20. Some Econometric Results for the Blanchard-Watson Bubble Model

    DEFF Research Database (Denmark)

    Johansen, Soren; Lange, Theis

    The purpose of the present paper is to analyse a simple bubble model suggested by Blanchard and Watson. The model is defined by y(t) =s(t)¿y(t-1)+e(t), t=1,…,n, where s(t) is an i.i.d. binary variable with p=P(s(t)=1), independent of e(t) i.i.d. with mean zero and finite variance. We take ¿>1 so...

  1. Watson, Skinner y Algunas Disputas dentro del Conductismo

    Directory of Open Access Journals (Sweden)

    RICARDO PELLÓN SUÁREZ DE PUGA

    2013-01-01

    Full Text Available Con motivo del primer centenario de la publicación del manifiesto conductista, se revisa brevemente la concepción de Watson (1913 sobre el aprendizaje y la conducta, y se extiende dicho análisis al conductismo de B. F. Skinner y a las disputas entre enfoques molares y moleculares en el análisis de la conducta.

  2. How the challenge of explaining learning influenced the origins and development of John B. Watson's behaviorism.

    Science.gov (United States)

    Rilling, M

    2000-01-01

    Before he invented behaviorism, John B. Watson considered learning one of the most important topics in psychology. Watson conducted excellent empirical research on animal learning. He developed behaviorism in part to promote research and elevate the status of learning in psychology. Watson was much less successful in the adequacy and originality of the mechanisms he proposed to explain learning. By assimilating the method of classical conditioning and adopting Pavlov's theory of stimulus substitution, Watson linked behaviorism with a new method that could compete with both Titchener's method of introspection and Freud's methods of psychoanalysis. Watson's interest in explaining psychopathology led to the discovery of conditioned emotional responses and a behavioristic explanation for the learning of phobic behavior. Watson established learning as a central topic for basic research and application in American psychology.

  3. Watson: A new link in the IIE iron chain

    Science.gov (United States)

    Olsen, Edward; Davis, Andrew; Clarke, Roy S., Jr.; Schultz, Ludolf; Weber, Hartwig W.; Clayton, Robert; Mayeda, Toshiko; Jarosewich, Eugene; Sylvester, Paul; Grossman, Lawrence

    1994-01-01

    Watson, which was found in 1972 in South Australia, contains the largest single silicate rock mass seen in any known iron meteorite. A comprehensive study has been completed on this unusual meteorite: petrography, metallography, analyses of the silicate inclusion (whole rock chemical analysis, INAA, RNAA, noble gases, and oxygen isotope analysis) and mineral compositions (by electron microprobe and ion microprobe). The whole rock has a composition of an H-chondrite minus the normal H-group metal and troilite content. The oxygen isotope composition is that of the silicates in the IIE iron meteorites and lies along an oxygen isotope fractionation line with the H-group chondrites. Trace elements in the metal confirm Watson is a new IIE iron. Whole rock Watson silicate shows an enrichment in K and P (each approximately 2X H-chondrites). The silicate inclusion has a highly equilibrated igneous (peridotite-like) texture with olivine largely poikilitic within low-Ca pyroxene: olivine (Fa20), opx (Fs17Wo3), capx (Fs9Wo14)(with very fine exsolution lamellae), antiperthite feldspar (An1-3Or5) with less than 1 micron exsolution lamellae (An1-3Or greater than 40), shocked feldspar with altered stoichiometry, minor whitlockite (also a poorly characterized interstitial phosphate-rich phase) and chromite, and only traces of metal and troilite. The individual silicate minerals have normal chondritic REE patterns, but whitlockite has a remarkable REE pattern. It is very enriched in light REE (La is 720X C1, and Lu is 90X C1, as opposed to usual chonditic values of approximately 300X and 100-150X, respectively) with a negative Eu anomaly. The enrichment of whole rock K is expressed both in an unusually high mean modal Or content of the feldspar, Or13, and in the presence of antiperthite.

  4. IBM Watson Analytics: Automating Visualization, Descriptive, and Predictive Statistics.

    Science.gov (United States)

    Hoyt, Robert Eugene; Snider, Dallas; Thompson, Carla; Mantravadi, Sarita

    2016-10-11

    We live in an era of explosive data generation that will continue to grow and involve all industries. One of the results of this explosion is the need for newer and more efficient data analytics procedures. Traditionally, data analytics required a substantial background in statistics and computer science. In 2015, International Business Machines Corporation (IBM) released the IBM Watson Analytics (IBMWA) software that delivered advanced statistical procedures based on the Statistical Package for the Social Sciences (SPSS). The latest entry of Watson Analytics into the field of analytical software products provides users with enhanced functions that are not available in many existing programs. For example, Watson Analytics automatically analyzes datasets, examines data quality, and determines the optimal statistical approach. Users can request exploratory, predictive, and visual analytics. Using natural language processing (NLP), users are able to submit additional questions for analyses in a quick response format. This analytical package is available free to academic institutions (faculty and students) that plan to use the tools for noncommercial purposes. To report the features of IBMWA and discuss how this software subjectively and objectively compares to other data mining programs. The salient features of the IBMWA program were examined and compared with other common analytical platforms, using validated health datasets. Using a validated dataset, IBMWA delivered similar predictions compared with several commercial and open source data mining software applications. The visual analytics generated by IBMWA were similar to results from programs such as Microsoft Excel and Tableau Software. In addition, assistance with data preprocessing and data exploration was an inherent component of the IBMWA application. Sensitivity and specificity were not included in the IBMWA predictive analytics results, nor were odds ratios, confidence intervals, or a confusion matrix

  5. Building Watson: An Overview of the DeepQA Project

    OpenAIRE

    Ferrucci, David; Brown, Eric; Chu-Carroll, Jennifer; Fan, James; Gondek, David; Kalyanpur, Aditya A.; Lally, Adam; Murdock, J. William; Nyberg, Eric; Prager, John; Schlaefer, Nico; Welty, Chris

    2010-01-01

    IBM Research undertook a challenge to build a computer system that could compete at the human champion level in real time on the American TV Quiz show, Jeopardy! The extent of the challenge includes fielding a real-time automatic contestant on the show, not merely a laboratory exercise. The Jeopardy! Challenge helped us address requirements that led to the design of the DeepQA architecture and the implementation of Watson. After 3 years of intense research and development by a core team of ab...

  6. Impact parameter representation from the Watson-Sommerfeld transform

    International Nuclear Information System (INIS)

    Islam, M.M.

    1976-01-01

    Using the Watson-Sommerfeld transform the elastic scattering amplitude of two spinless particles is shown to have an exact and unique impact parameter, or Fourier-Bessel (FB) representation. The representation is valid for all physical energies and scattering angles. Wallace's recent work is found to be an asymptotic expansion of the FB amplitude obtained from the partial-wave expansion. The way singularities of the partial-wave amplitude in the l-plane enter in the FB amplitude is also explicitly shown. (Auth.)

  7. "Elementary, my dear Watson". Per una falsa citazione

    Directory of Open Access Journals (Sweden)

    Irene Minella

    2014-12-01

    Full Text Available Nowhere, among Sir Arthur Conan Doyle's pages concerning one of the most celebrated characters of British literature, Sherlock Holmes, is to be found the interjection: "Elementary, my dear Watson!". Exploring the creation of the London investigator as well as Holmes' first appearance in theatre, cinema and literature, this essay will help to understand why he is still so popular and why the 'non-quotation' keeps haunting the collective imagination. Despite its philological inaccuracy, the interjection has become so famous that it has been used even outside its original context.

  8. Portrait of a discovery. Watson, Crick, and the double helix.

    Science.gov (United States)

    de Chadarevian, Soraya

    2003-03-01

    This essay examines an iconic image of twentieth-century science: Antony Barrington Brown's photograph of James Watson, Francis Crick, and the double-helical model of DNA. The detailed reconstruction of the production, reception, and uses of the photograph reveals the central role of the image in making the discovery it portrays. Taken in May 1953, two full months after the scientists built the model, to accompany a report on the structure in Time magazine, the photograph (like the report) was never published. It came into circulation only fifteen years later, as an illustration in Watson's best-selling book The Double Helix. While the image served as a historical document and advertisement for the book, only the book provided the description that made the image as well as the people and the model it represented famous. The history of the image provides insights into the retrospective construction of the discovery, which has since been celebrated as the origin of a new science of life.

  9. [Under what conditions does G.C Watson-Crick DNA base pair acquire all four configurations characteristic for A.T Watson-Crick DNA base pair?].

    Science.gov (United States)

    Brovarets', O O

    2013-01-01

    At the MP2/6-311++G(2df,pd)//B3LYP/6-311++G(d,p) level of theory it was established for the first time, that the Löwdin's G*.C* DNA base pair formed by the mutagenic tautomers can acquire, as the A-T Watson-Crick DNA base pair, four biologically important configurations, namely: Watson-Crick, reverse Watson-Crick, Hoogsteen and reverse Hoogsteen. This fact demonstrates rather unexpected role of the tautomerisation of the one of the Watson-Crick DNA base pairs, in particular, via double proton transfer: exactly the G.C-->G*.C* tautomerisation allows to overcome steric hindrances for the implementation of the above mentioned configurations. Geometric, electron-topological and energetic properties of the H-bonds that stabilise the studied pairs, as well as the energetic characteristics of the latters are presented.

  10. 77 FR 67675 - Importer of Controlled Substances; Notice of Application; Watson Pharma, Inc.

    Science.gov (United States)

    2012-11-13

    ... DEPARTMENT OF JUSTICE Drug Enforcement Administration Importer of Controlled Substances; Notice of Application; Watson Pharma, Inc. Pursuant to Title 21 Code of Federal Regulations 1301.34(a), this is notice that on August 28, 2012, Watson Pharma, Inc., 2455 Wardlow Road, Corona, California 92880-2882, made...

  11. 78 FR 33440 - Importer of Controlled Substances, Notice of Application; Watson Pharma, Inc.

    Science.gov (United States)

    2013-06-04

    ... DEPARTMENT OF JUSTICE Drug Enforcement Administration Importer of Controlled Substances, Notice of Application; Watson Pharma, Inc. Pursuant to Title 21 Code of Federal Regulations 1301.34 (a), this is notice that on May 3, 2013, Watson Pharma, Inc., 2455 Wardlow Road, Corona, California 92880-2882, made...

  12. On the scaling limits of Galton Watson processes in varying environment

    NARCIS (Netherlands)

    Bansaye, V.; Simatos, F.

    2011-01-01

    Renormalized sequences of Galton Watson processes converge to Continuous State Branching Processes (CSBP), characterized by a L\\'evy triplet of two numbers and a measure. This paper investigates the case of Galton Watson processes in varying environment and provides an explicit sufficient condition

  13. John B. Watson's Alleged Sex Research: An Appraisal of the Evidence

    Science.gov (United States)

    Benjamin, Ludy T. Jr.; Whitaker, Jodi L.; Ramsey, Russell M.; Zeve, Daniel R.

    2007-01-01

    In 1974, a story was published about clandestine research done by John B. Watson that was judged to be so reprehensible that it was offered as the real reason he was fired from his faculty position at Johns Hopkins University in 1920, at perhaps the peak of his academic career. Watson's dismissal from Johns Hopkins may have been the most important…

  14. From theory to practice: caring science according to Watson and Brewer.

    Science.gov (United States)

    Clarke, Pamela N; Watson, Jean; Brewer, Barbara B

    2009-10-01

    Caring science is presented by Jean Watson and Barbara Brewer through an interview and dialogue format. Jean Watson presents caring science and its philosophy and evolution and the impact of her model on nursing and other disciplines. Barbara Brewer addresses the implementation of the model in a Magnet hospital setting and describes how her leadership facilitated implementation.

  15. Predicting the Mechanism and Kinetics of the Watson-Crick to Hoogsteen Base Pairing Transition

    NARCIS (Netherlands)

    Vreede, J.; Bolhuis, P.G.; Swenson, D.W.H.

    2016-01-01

    DNA duplexes predominantly contain Watson-Crick (WC) base pairs. Yet, a non-negligible number of base pairs converts to the Hoogsteen (HG) hydrogen bonding pattern, involving a 180° rotation of the purine base relative to Watson-Crick. These WC to HG conversions alter the conformation of DNA, and

  16. [Are schizophrenic patients being told their diagnosis today in France?

    Science.gov (United States)

    Villani, M; Kovess-Masféty, V

    2017-04-01

    The progressive shifts in the legal and social contexts, along with major changes in information seeking habits with the development of the Internet, have placed patients' information at the core of medical practice. This has to be applied to the psychiatric fields as well, and to questions about how schizophrenic patients are being told their diagnosis nowadays in France. This paper is a national and international literature review about schizophrenia diagnosis disclosure practices, from 1972 to 2014, using French and English languages and various psychology and medical databases. The used key words were "diagnosis", "disclosure", "communication", "breaking bad news", "information", "schizophrenia" and "psychosis". Proportions of diagnosis announcement: our results show that the proportion of psychiatrists delivering schizophrenia diagnosis to their patients varies between countries. Although we must acknowledge that the questionnaires and samples are diverse, we have found that psychiatrists are in general less prone to deliver diagnosis information in France (from 13,5% to 39% given the studies), Germany (28%), Italy (30%), and Japan (30%), than in Anglo-Saxon countries. Thus, 70% of the psychiatrists in North America and 56% in Australia claim that they disclose their diagnosis to schizophrenic patients. In the United-Kingdom, a study targeting psychotic patients themselves has shown that 47% of them had been told their diagnosis by their doctor. Even in the countries where the proportion of diagnosis disclosure is the highest, there remains a substantial difference with other mental illnesses such as affective or anxiety disorders, which are almost always labeled as such in the information communicated to the patient (90% in North America). Diagnostic information about schizophrenia continues therefore to appear problematic for health professionals, which can seem a paradox given the recent social and legal evolutions, the therapeutic progress, the proved

  17. Watson will see you now: a supercomputer to help clinicians make informed treatment decisions.

    Science.gov (United States)

    Doyle-Lindrud, Susan

    2015-02-01

    IBM has collaborated with several cancer care providers to develop and train the IBM supercomputer Watson to help clinicians make informed treatment decisions. When a patient is seen in clinic, the oncologist can input all of the clinical information into the computer system. Watson will then review all of the data and recommend treatment options based on the latest evidence and guidelines. Once the oncologist makes the treatment decision, this information can be sent directly to the insurance company for approval. Watson has the ability to standardize care and accelerate the approval process, a benefit to the healthcare provider and the patient.

  18. Annual Quality Assurance Conference Files by Nicola Watson and Rui Li

    Science.gov (United States)

    26th Annual Quality Assurance Conference. Abstract: An Innovative Water Management Device for Online and Canister-based Thermal Desorption of Trace-level VVOCs in High Humidity Ambient Air by Nicola Watson and Rui Li

  19. Non-Watson Crick base pairs might stabilize RNA structural motifs in ...

    Indian Academy of Sciences (India)

    Watson Crick base pairs, internal loops and pseudoknots have been the highlighting feature of recent structural determination of RNAs. The recent crystal structure of group-I introns has demonstrated that these might constitute RNA structural ...

  20. The Game is aFoot, Watson: DeepQA systems and the future of HCI

    OpenAIRE

    Keates, Simeon; Varker, Philip

    2012-01-01

    In February 2011, the IBM Watson DeepQA (deep question and answer) system took part in a special challenge, pitting its question and answer capability against former Jeopardy!TM grand champions in a televised match. Watson emerged victorious from the challenge, demonstrating that current question answering technology has advanced to the point where it can arguably be more dependable than human experts. This new system represents a significant breakthrough in humanity’s decades-long endeavour ...

  1. Watson's theorem and resonant pion photoproduction amplitude in the delta channel

    International Nuclear Information System (INIS)

    Wittman, R.; Davidson, R.; Mukhopadhyay, N.C.

    1984-01-01

    The CGLN and BL theories of the pion photoproduction on nucleons, used in nuclear calculations, are examined regarding their predictions of the resonant M 1 + and E 1 + multipoles. The nonunitary BL approach violates Watson's theorem, and predicts these multipoles porly. In the static limit, the CGLN multipoles satisfy Watson's theorem and are in fine agreement with data. The unitarized BL multipoles agree with those from the Olsson theory and data. (orig.)

  2. A comparative study of the second-order Born and Faddeev-Watson approximations: Pt. 3

    International Nuclear Information System (INIS)

    Roberts, M.J.

    1988-01-01

    Singularities which arise in the second-order Born and Faddeev-Watson approximations for ionisation processes are examined. A regularisation procedure for the latter is suggested. Comparison with He(e,2e)He + experimental data in symmetric coplanar energy-sharing kinematics shows that the second-order Faddeev-Watson approximation is inferior to the second Born results of Byron et al. (1985. J. Phys. B: At. Mol. Phys. 18, 3203). (author)

  3. Theoretical Study of the Hoogsteen–Watson-Crick Junctions in DNA

    OpenAIRE

    Cubero, Elena; Luque, F. Javier; Orozco, Modesto

    2005-01-01

    A series of d (AT)n oligonucleotides containing mixtures of normal B-type Watson-Crick and antiparallel Hoogsteen helices have been studied using molecular dynamics simulation techniques to analyze the structural and thermodynamic impact of the junction between Watson-Crick and antiparallel Hoogsteen structures. Analysis of molecular dynamics simulations strongly suggests that for all oligonucleotides studied the antiparallel Hoogsteen appears as a reasonable conformation, only slightly less ...

  4. Watson's behaviorism: a comparison of the two editions (1925 and 1930).

    Science.gov (United States)

    Carpintero, Helio

    2004-05-01

    J.B. Watson's Behaviorism, a complete presentation of the mature psychological points of view of its author, had 2 editions, in 1925 and 1930, which presented significant differences in their texts. Although Watson maximized such variations, to the point of considering the 2nd edition as nearly a brand-new book, both suppressions and additions reveal his feelings when presenting his ideas to a general audience. Such variations are here presented through an in-depth analysis.

  5. The case of the missing fingerprints or Dr Watson's cosmology

    International Nuclear Information System (INIS)

    Longair, M.S.

    1987-01-01

    The cosmological problem has four main areas of uncertainty -the origin of isotropy of the universe, the origin of the fluctuations from which galaxies form, the explanation of why we live in a matter universe rather than one composed of equal amounts of matter and antimatter and why the Universe seems to be within a factor of 10 of the critical, flat universe. These cannot be explained satisfactorily within the Hot Big Bang theory after a millisecond or so. The solutions are presumed, therefore, to lie in the very early universe when it was less than about a millisecond old. The clues which lead to this conclusion are set out in terms of a detective story with Sherlock Holmes explaining the facts about the universe to Dr Watson. Holmes first explains the size of the universe in terms of distances and sizes of stars, galaxies and galaxy clusters. Evidence from pictures of the universe at different temperatures, (X-ray pictures, gamma-ray pictures, far infra-red pictures and pictures at radio and millimetre wavelengths) is presented. Holmes then starts to build up a realistic model of the universe using two of the facts collected (the isotropy of the universe and the expansion of the universe), one assumption (the cosmological principle) and one theory of gravity (General Relativity). However the universe which emerges does not solve the four problems mentioned. Quasars, which provide information (illustrated) from earlier epochs of the universe may, therefore, help to solve the problems. (U.K.)

  6. Robonaut 2 and Watson: Cognitive Dexterity for Future Exploration

    Science.gov (United States)

    Badger, Julia M.; Strawser, Philip; Farrell, Logan; Goza, S. Michael; Claunch, Charles A.; Chancey, Raphael; Potapinski, Russell

    2018-01-01

    Future exploration missions will dictate a level of autonomy never before experienced in human spaceflight. Mission plans involving the uncrewed phases of complex human spacecraft in deep space will require a coordinated autonomous capability to be able to maintain the spacecraft when ground control is not available. One promising direction involves embedding intelligence into the system design both through the employment of state-of-the-art system engineering principles as well as through the creation of a cognitive network between a smart spacecraft or habitat and embodiments of cognitive agents. The work described here details efforts to integrate IBM's Watson and other cognitive computing services into NASA Johnson Space Center (JSC)'s Robonaut 2 (R2) anthropomorphic robot. This paper also discusses future directions this work will take. A cognitive spacecraft management system that is able to seamlessly collect data from subsystems, determine corrective actions, and provide commands to enable those actions is the end goal. These commands could be to embedded spacecraft systems or to a set of robotic assets that are tied into the cognitive system. An exciting collaboration with Woodside provides a promising Earth-bound testing analog, as controlling and maintaining not normally manned off-shore platforms have similar constraints to the space missions described.

  7. The Towers Watson Approach to Improving Corporate Wellness.

    Science.gov (United States)

    Wootton, Adam

    2012-06-01

    Encouraging employees to take care of their health is in the interests of everyone. Employees benefit from being healthier and happier, employers benefit from having an engaged workforce, lower absenteeism, and lower medical costs, and society as a whole benefits from using less medical resources. Employers have been trying to push healthy messages to employees for a long time and have had some good success. For example, an increased emphasis on the dangers of tobacco use in employer and government communications has helped bring about a significant decrease in smoking. However, overall population health in key risk areas (such as obesity and diabetes) continues to decline. These areas are where employers can really make a difference in health outcomes-and effective communications are critical to success. Towers Watson helps many companies educate employees about health and wellness and encourage more effective use of healthcare. The challenge is to find new and engaging ways to deliver this information so that employees take notice-and take action. After all, the amount of material employees receive on a daily basis from marketers, employers, and each other across the wide range of available media makes it extremely difficult to be heard. This is where gaming comes in-and why we think it's the tool to be incorporating into communication and engagement plans.

  8. A comment on Watson, Deary, and Austin and Watson, Roberts, Gow, and Deary : How to investigate whether personality items form a hierarchical scale?

    NARCIS (Netherlands)

    Meijer, Rob R.

    I comment on two recent papers by Watson et al. (2007, 2008) who investigated whether personality items form a hierarchical scale. I discuss that the methods they used are inappropriate and discuss alternative methods presented in the literature. (C) 2009 Elsevier Ltd All rights reserved..

  9. Theoretical study of the Hoogsteen-Watson-Crick junctions in DNA.

    Science.gov (United States)

    Cubero, Elena; Luque, F Javier; Orozco, Modesto

    2006-02-01

    A series of d (AT)(n) oligonucleotides containing mixtures of normal B-type Watson-Crick and antiparallel Hoogsteen helices have been studied using molecular dynamics simulation techniques to analyze the structural and thermodynamic impact of the junction between Watson-Crick and antiparallel Hoogsteen structures. Analysis of molecular dynamics simulations strongly suggests that for all oligonucleotides studied the antiparallel Hoogsteen appears as a reasonable conformation, only slightly less stable than the canonical B-type Watson-Crick one. The junctions between the Watson-Crick and Hoogsteen structures introduces a priori a sharp discontinuity in the helix, because the properties of each type of conformation are very well preserved in the corresponding fragments. However, and quite counterintuitively, junctions do not largely distort the duplex in structural, dynamics or energetic terms. Our results strongly support the possibility that small fragments of antiparallel Hoogsteen duplex might be embedded into large fragments of B-type Watson-Crick helices, making possible protein-DNA interactions that are specific of the antiparallel Hoogsteen conformation.

  10. Theoretical Study of the Hoogsteen–Watson-Crick Junctions in DNA

    Science.gov (United States)

    Cubero, Elena; Luque, F. Javier; Orozco, Modesto

    2006-01-01

    A series of d (AT)n oligonucleotides containing mixtures of normal B-type Watson-Crick and antiparallel Hoogsteen helices have been studied using molecular dynamics simulation techniques to analyze the structural and thermodynamic impact of the junction between Watson-Crick and antiparallel Hoogsteen structures. Analysis of molecular dynamics simulations strongly suggests that for all oligonucleotides studied the antiparallel Hoogsteen appears as a reasonable conformation, only slightly less stable than the canonical B-type Watson-Crick one. The junctions between the Watson-Crick and Hoogsteen structures introduces a priori a sharp discontinuity in the helix, because the properties of each type of conformation are very well preserved in the corresponding fragments. However, and quite counterintuitively, junctions do not largely distort the duplex in structural, dynamics or energetic terms. Our results strongly support the possibility that small fragments of antiparallel Hoogsteen duplex might be embedded into large fragments of B-type Watson-Crick helices, making possible protein-DNA interactions that are specific of the antiparallel Hoogsteen conformation. PMID:16287814

  11. IBM Watson: How Cognitive Computing Can Be Applied to Big Data Challenges in Life Sciences Research.

    Science.gov (United States)

    Chen, Ying; Elenee Argentinis, J D; Weber, Griff

    2016-04-01

    Life sciences researchers are under pressure to innovate faster than ever. Big data offer the promise of unlocking novel insights and accelerating breakthroughs. Ironically, although more data are available than ever, only a fraction is being integrated, understood, and analyzed. The challenge lies in harnessing volumes of data, integrating the data from hundreds of sources, and understanding their various formats. New technologies such as cognitive computing offer promise for addressing this challenge because cognitive solutions are specifically designed to integrate and analyze big datasets. Cognitive solutions can understand different types of data such as lab values in a structured database or the text of a scientific publication. Cognitive solutions are trained to understand technical, industry-specific content and use advanced reasoning, predictive modeling, and machine learning techniques to advance research faster. Watson, a cognitive computing technology, has been configured to support life sciences research. This version of Watson includes medical literature, patents, genomics, and chemical and pharmacological data that researchers would typically use in their work. Watson has also been developed with specific comprehension of scientific terminology so it can make novel connections in millions of pages of text. Watson has been applied to a few pilot studies in the areas of drug target identification and drug repurposing. The pilot results suggest that Watson can accelerate identification of novel drug candidates and novel drug targets by harnessing the potential of big data. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

  12. J. B. Watson y la Publicidad, los Inicios de la Psicología del Consumidor

    Directory of Open Access Journals (Sweden)

    FELIPE PARRADO CORREDOR

    2013-01-01

    Full Text Available La investigación del comportamiento de las personas frente a los productos y servicios se remonta a los inicios del siglo XX y J. B. Watson es uno de sus principales precursores. Watson ofreció un curso de psicología aplicada titulado Psicología de la Publicidad, introdujo en varias empresas las técnicas experimentales para el mercadeo de sus productos y, tras su retiro de la vida académica, se vinculó a la agencia de publicidad Walter Thompson, donde desarrolló campañas masivas con los mismos principios de las reacciones emocionales condicionadas. En este ensayo se expone la importancia del trabajo de Watson en la psicología de la publicidad, como precursor de los desarrollos científicos de la psicología del consumidor.

  13. A history of the term radical behaviorism: From Watson to Skinner

    Science.gov (United States)

    Schneider, Susan M.; Morris, Edward K.

    1987-01-01

    This paper describes the origins and evolution of the term radical behaviorism. John B. Watson's coining of behaviorism in 1913 is presented first, followed by a discussion of the uses of “radical” within psychology during these early years. When the term radical behaviorism first emerged in the early 1920s, its referent was Watson's behaviorism, most specifically his stance on consciousness. In the 1930s, B. F. Skinner described his own position with the term radical behaviorism in an unpublished manuscript, and then in 1945 first referred in print to his views as such. Today, radical behaviorism is generally applied to Skinner's views alone. The paper concludes with a brief discussion of a similarity in Watson's and Skinner's positions on consciousness, which seems a possible historical and philosophical connection between their respective radical behaviorisms. PMID:22477958

  14. Fit for Practice: Analysis and Evaluation of Watson's Theory of Human Caring.

    Science.gov (United States)

    Pajnkihar, Majda; McKenna, Hugh P; Štiglic, Gregor; Vrbnjak, Dominika

    2017-07-01

    The aim of the authors of this paper is to analyze Watson's theory of human caring for its usefulness and worth in education, practice, and research. The reason for undertaking this analysis is to evaluate if Watson's theory would be useful for nursing in those countries where such theories were not an established part of the nursing curriculum. Furthermore, in some European countries, their political past or cultural influences led to an unquestioned adoption of the biomedical model. As their political culture changes, many social structures have had to be revisited, and for nursing, this has meant the introduction of theoretical reasoning, teaching, and practice.

  15. Conformational analysis of a covalently cross-linked Watson-Crick base pair model.

    Science.gov (United States)

    Jensen, Erik A; Allen, Benjamin D; Kishi, Yoshito; O'Leary, Daniel J

    2008-11-15

    Low-temperature NMR experiments and molecular modeling have been used to characterize the conformational behavior of a covalently cross-linked DNA base pair model. The data suggest that Watson-Crick or reverse Watson-Crick hydrogen bonding geometries have similar energies and can interconvert at low temperatures. This low-temperature process involves rotation about the crosslink CH(2)C(5') (psi) carbon-carbon bond, which is energetically preferred over the alternate CH(2)N(3) (phi) carbon-nitrogen bond rotation.

  16. Conformational Analysis of a Covalently Cross-Linked Watson-Crick Base Pair Model

    OpenAIRE

    Jensen, Erik A.; Allen, Benjamin D.; Kishi, Yoshito; O'Leary, Daniel J.

    2008-01-01

    Low temperature NMR experiments and molecular modeling have been used to characterize the conformational behavior of a covalently cross-linked DNA base pair model. The data suggest that Watson-Crick or reverse Watson-Crick hydrogen bonding geometries have similar energies and can interconvert at low temperatures. This low-temperature process involves rotation about the crosslink CH2–C(5′) (ψ) carbon-carbon bond, which is energetically preferred over the alternate CH2–N(3) (ϕ) carbon-nitrogen ...

  17. J. B. Watson y la Publicidad, los Inicios de la Psicología del Consumidor

    Directory of Open Access Journals (Sweden)

    FELIPE PARRADO CORREDOR

    2013-12-01

    Full Text Available Research regarding the behavior of individuals with respect to products and services dates back to the beginning of the 20th century, and J. B. Watson is one of its main precursors. Watson taught an applied psychology course called Psychology of Advertising, introduced many companies to experimental techniques for the marketing of their products, and, after retiring from academic life, joined the Walter Thompson advertising agency, where he developed massive campaigns using the principles of conditioned emotional responses. The article highlights the importance of Watson’s work in the psychology of advertising, as a forerunner of the scientific developments of consumer psychology.

  18. Correlations of noninvasive BOLD and TOLD MRI with pO2 and relevance to tumor radiation response.

    Science.gov (United States)

    Hallac, Rami R; Zhou, Heling; Pidikiti, Rajesh; Song, Kwang; Stojadinovic, Strahinja; Zhao, Dawen; Solberg, Timothy; Peschke, Peter; Mason, Ralph P

    2014-05-01

    To examine the potential use of blood oxygenation level dependent (BOLD) and tissue oxygenation level dependent (TOLD) contrast MRI to assess tumor oxygenation and predict radiation response. BOLD and TOLD MRI were performed on Dunning R3327-AT1 rat prostate tumors during hyperoxic gas breathing challenge at 4.7 T. Animals were divided into two groups. In Group 1 (n = 9), subsequent (19) F MRI based on spin lattice relaxation of hexafluorobenzene reporter molecule provided quantitative oximetry for comparison. For Group 2 rats (n = 13) growth delay following a single dose of 30 Gy was compared with preirradiation BOLD and TOLD assessments. Oxygen (100%O2 ) and carbogen (95%O2 /5%CO2 ) challenge elicited similar BOLD, TOLD and pO2 responses. Strong correlations were observed between BOLD or R2* response and quantitative (19) F pO2 measurements. TOLD response showed a general trend with weaker correlation. Irradiation caused a significant tumor growth delay and tumors with larger changes in TOLD and R1 values upon oxygen breathing exhibited significantly increased tumor growth delay. These results provide further insight into the relationships between oxygen sensitive (BOLD/TOLD) MRI and tumor pO2 . Moreover, a larger increase in R1 response to hyperoxic gas challenge coincided with greater tumor growth delay following irradiation. Copyright © 2013 Wiley Periodicals, Inc.

  19. The Watson-Glaser Critical Thinking Appraisal and the Performance of Business Management Students.

    Science.gov (United States)

    Hicks, R. E.; Southey, G. N.

    1990-01-01

    The 80-item Watson-Glaser Critical Thinking Appraisal-Form A was administered to 415 business management students in Australia as a step toward adapting the test for Australian use. The results correspond reasonably closely to the U.S. data. Analysis of group results and item statistics provided information about necessary modifications. (SLD)

  20. Laser-assisted collisions: The Kroll-Watson formula and bremsstrahlung theory

    International Nuclear Information System (INIS)

    Geltman, S.

    1996-01-01

    Recent measurements on CO 2 -laser-assisted electron-atom collisions have shown large inconsistencies with the Kroll-Watson formula for small-angle scattering. We have carried out a detailed study to compare the predictions of Kroll-Watson theory (for both single and multimode fields) with those of conventional perturbation theory for stimulated free-free transitions. It is found that for E 0 /2ω 2 <1, where perturbation theory is valid, there are large differences with the Kroll-Watson theory. Comparisons of experimental variations with respect to scattering angle and electron energy show much better agreement with perturbation theory than with Kroll-Watson theory. A study of the angular variations in perturbation theory shows that use of the open-quote open-quote outgoing close-quote close-quote wave final state gives much better agreement with experiment than does the open-quote open-quote ingoing close-quote close-quote wave final state, which is different from the choice made in early bremsstrahlung theory. copyright 1996 The American Physical Society

  1. On the extension of the Fermi-Watson Theorem to high energy diffraction

    International Nuclear Information System (INIS)

    Malecki, A.; Istituto Nazionale di Fisica Nucleare, Frascati

    1995-12-01

    The Fermi-Watson theorem, established for low energy reactions and then applied to high energy collision, is revisited. Its use for the processes of inelastic diffraction is discussed. The theorem turns out to be valid in the case inclusive cross-section of diffractive transition

  2. AVE bond index in the H-bond of the Watson-Crick pairs

    International Nuclear Information System (INIS)

    Giambiagi, M.; Giambiagi, M.S. de; Barroso Filho, W.

    1981-01-01

    The normal Watson-Crick base pairs are treated as super-molecules. The properties of the electronic distribution along the N-H...Y bonds are studied in an all-valence-electrons calculation, through a bond index formula devised for non-orthogonal basis. Eletronic density diagrams of the adenine-uracil base pair are analysed. (Auhor) [pt

  3. Watson-Crick base pairs with thiocarbonyl groups: How sulfur changes the hydrogen bonds in DNA

    NARCIS (Netherlands)

    Fonseca Guerra, C.; Baerends, E.J.; Bickelhaupt, F.M.

    2008-01-01

    We have theoretically analyzed mimics of Watson-Crick AT and GC base pairs in which N-H•••O hydrogen bonds are replaced by N-H•••S, using the generalized gradient approximation (GGA) of density functional theory at BP86/TZ2P level. The general effect of the above substitutions is an elongation and a

  4. Substituent effif ects on hydrogen bonding in Watson-Crick base pairs. A theoretical study

    NARCIS (Netherlands)

    Fonseca Guerra, C.; van der Wijst, T.; Bickelhaupt, F.M.

    2005-01-01

    We have theoretically analyzed Watson-Crick AT and GC base pairs in which purine C8 and/or pyrimidine C6 positions carry a substituent X = H, F, Cl or Br, using the generalized gradient approximation (GGA) of density functional theory at BP86/TZ2P. The purpose is to study the effects on structure

  5. Finding Little Albert: A Journey to John B. Watson's Infant Laboratory

    Science.gov (United States)

    Beck, Hall P.; Levinson, Sharman; Irons, Gary

    2009-01-01

    In 1920, John Watson and Rosalie Rayner claimed to have conditioned a baby boy, Albert, to fear a laboratory rat. In subsequent tests, they reported that the child's fear generalized to other furry objects. After the last testing session, Albert disappeared, creating one of the greatest mysteries in the history of psychology. This article…

  6. Hazardous Waste Cleanup: IBM Corporation-TJ Watson Research Center in Yorktown Heights, New York

    Science.gov (United States)

    IBM Corporation -TJ Watson Research Center is located in southern Yorktown near the boundary separating the Town of Yorktown from the Town of New Castle. The site occupies an area of approximately 217 acres and adjoins land uses are predominantly residenti

  7. A comparative study of the second-order Born and Faddeev-Watson approximations for electron-atom collisions

    International Nuclear Information System (INIS)

    Fargher, H.E.; Roberts, M.J.

    1983-01-01

    Simplified versions of the second-order Born and Faddeev-Watson approximations are applied to the excitation of the n=2 levels of atomic hydrogen by the impact of 54.4 eV electrons. The theories are compared with the measurements of differential cross sections and angular correlation parameters. The results indicate that the Born approximation is better at low angles of scattering but that the Faddeev-Watson approximation is better at high angles. The importance of the phases of the two-body T matrices in the Faddeev-Watson approximation is illustrated. (author)

  8. O pensamento em Watson: rompendo com o legado metafísico e buscando uma referência materializante

    Directory of Open Access Journals (Sweden)

    Cláudio Ivan de Oliveira

    Full Text Available O trabalho de Watson sobre o pensamento foi tratado inadequadamente por muitos intérpretes, gerando uma lacuna na interpretação histórica visto que Watson exerceu ampla influência sobre a Psicologia. Nosso objetivo é sanar parte deste problema esclarecendo as principais posições de Watson sobre pensamento. Nossa hipótese é que a teoria watsoniana sobre o pensamento como hábito é uma forma de referencialização materializante influenciada pela desmetafisicização do pensamento Ocidental proveniente do Iluminismo. Admitimos que a teoria de Watson reproduziu premissas do erro de categoria cartesiano. Assumimos também que a prioritária associação entre pensamento e linguagem watsoniana denuncia influências indiretas da tradição filosófica grega clássica.

  9. Meltwater chemistry and solute export from a Greenland ice sheet catchment, Watson River, West Greenland

    DEFF Research Database (Denmark)

    Yde, Jacob C.; Knudsen, N. Tvis; Hasholt, Bent

    2014-01-01

    –2010 for the Watson River sector of the GrIS that drains into the fjord Kangerlussuaq. The hydrochemistry is dominated by Ca2+ and HCO3− with a relatively high molar K+/Na+ ratio of 0.6 ± 0.1, typical for meltwaters draining a gneissic lithology. Low molar Ca2+/Na+ and Mg2+/Na+ ratios indicate that weathering....... However, when normalized by discharge the denudation rates are comparable to other Arctic sites. When extrapolating the results from the Watson River catchment to the entire Greenland for 2007–2010, the solute export from Greenland meltwater varied between 7.1 × 106 and 7.8 × 106 tons, whilst the major...

  10. Watson-Crick base pairing controls excited-state decay in natural DNA.

    Science.gov (United States)

    Bucher, Dominik B; Schlueter, Alexander; Carell, Thomas; Zinth, Wolfgang

    2014-10-13

    Excited-state dynamics are essential to understanding the formation of DNA lesions induced by UV light. By using femtosecond IR spectroscopy, it was possible to determine the lifetimes of the excited states of all four bases in the double-stranded environment of natural DNA. After UV excitation of the DNA duplex, we detected a concerted decay of base pairs connected by Watson-Crick hydrogen bonds. A comparison of single- and double-stranded DNA showed that the reactive charge-transfer states formed in the single strands are suppressed by base pairing in the duplex. The strong influence of the Watson-Crick hydrogen bonds indicates that proton transfer opens an efficient decay path in the duplex that prohibits the formation or reduces the lifetime of reactive charge-transfer states. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  11. Visualizing Transient Watson-Crick Like Mispairs in DNA and RNA Duplexes

    Science.gov (United States)

    Kimsey, Isaac J.; Petzold, Katja; Sathyamoorthy, Bharathwaj; Stein, Zachary W.; Al-Hashimi, Hashim M.

    2015-01-01

    Rare tautomeric and anionic nucleobases are believed to play fundamental biological roles but their prevalence and functional importance has remained elusive because they exist transiently, in low-abundance, and involve subtle movements of protons that are difficult to visualize. Using NMR relaxation dispersion, we show that wobble dG•dT and rG•rU mispairs in DNA and RNA duplexes exist in dynamic equilibrium with short-lived, low-populated Watson-Crick like mispairs that are stabilized by rare enolic or anionic bases. These mispairs can evade Watson-Crick fidelity checkpoints and form with probabilities (10−3-10−5) that strongly imply a universal role in replication and translation errors. Our results indicate that rare tautomeric and anionic bases are widespread in nucleic acids, expanding their structural and functional complexity beyond that attainable with canonical bases. PMID:25762137

  12. Visualizing transient Watson-Crick-like mispairs in DNA and RNA duplexes.

    Science.gov (United States)

    Kimsey, Isaac J; Petzold, Katja; Sathyamoorthy, Bharathwaj; Stein, Zachary W; Al-Hashimi, Hashim M

    2015-03-19

    Rare tautomeric and anionic nucleobases are believed to have fundamental biological roles, but their prevalence and functional importance has remained elusive because they exist transiently, in low abundance, and involve subtle movements of protons that are difficult to visualize. Using NMR relaxation dispersion, we show here that wobble dG•dT and rG•rU mispairs in DNA and RNA duplexes exist in dynamic equilibrium with short-lived, low-populated Watson-Crick-like mispairs that are stabilized by rare enolic or anionic bases. These mispairs can evade Watson-Crick fidelity checkpoints and form with probabilities (10(-3) to 10(-5)) that strongly imply a universal role in replication and translation errors. Our results indicate that rare tautomeric and anionic bases are widespread in nucleic acids, expanding their structural and functional complexity beyond that attainable with canonical bases.

  13. Complexes of DNA bases and Watson-Crick base pairs with small neutral gold clusters.

    Science.gov (United States)

    Kryachko, E S; Remacle, F

    2005-12-08

    The nature of the DNA-gold interaction determines and differentiates the affinity of the nucleobases (adenine, thymine, guanine, and cytosine) to gold. Our preliminary computational study [Kryachko, E. S.; Remacle, F. Nano Lett. 2005, 5, 735] demonstrates that two major bonding factors govern this interaction: the anchoring, either of the Au-N or Au-O type, and the nonconventional N-H...Au hydrogen bonding. In this paper, we offer insight into the nature of nucleobase-gold interactions and provide a detailed characterization of their different facets, i.e., geometrical, energetic, and spectroscopic aspects; the gold cluster size and gold coordination effects; proton affinity; and deprotonation energy. We then investigate how the Watson-Crick DNA pairing patterns are modulated by the nucleobase-gold interaction. We do so in terms of the proton affinities and deprotonation energies of those proton acceptors and proton donors which are involved in the interbase hydrogen bondings. A variety of properties of the most stable Watson-Crick [A x T]-Au3 and [G x C]-Au3 hybridized complexes are described and compared with the isolated Watson-Crick A x T and G x C ones. It is shown that enlarging the gold cluster size to Au6 results in a rather short gold-gold bond in the Watson-Crick interbase region of the [G x C]-Au6 complex that bridges the G x C pair and thus leads to a significant strengthening of G x C pairing.

  14. Comparable stability of Hoogsteen and Watson-Crick base pairs in ionic liquid choline dihydrogen phosphate.

    Science.gov (United States)

    Tateishi-Karimata, Hisae; Nakano, Miki; Sugimoto, Naoki

    2014-01-08

    The instability of Hoogsteen base pairs relative to Watson-Crick base pairs has limited biological applications of triplex-forming oligonucleotides. Hydrated ionic liquids (ILs) provide favourable environments for a wide range of chemical reactions and are known to impact the stabilities of Watson-Crick base pairs. We found that DNA triplex formation was significantly stabilized in hydrated choline dihydrogen phosphate as compared with an aqueous buffer at neutral pH. Interestingly, the stability of Hoogsteen base pairs was found to be comparable with that of Watson-Crick base pairs in the hydrated IL. Molecular dynamics simulations of a DNA triplex in the presence of choline ions revealed that the DNA triplex was stabilized because of the binding of choline ion around the third strand in the grooves. Our finding will facilitate the development of new DNA materials. Our data also indicate that triplex formation may be stabilized inside cells where choline ions and their derivatives are abundant in vivo.

  15. When a clear strong voice was needed: A retrospective review of Watson's (1924/1930) behaviorism.

    Science.gov (United States)

    Malone, John C; García-Penagos, Andrés

    2014-07-25

    Despite the attention given John B. Watson during the century since he introduced behaviorism, there remain questions about what he really contributed. He is still appropriately criticized for his arrogant self-promotion and especially for his perceived emphasis on a simple S-R reflexology. However, we argue that the former was necessary at the time and that criticism of Watson on the second count only diverts attention from the genuine contributions that he did make. In support of these contentions we examine several aspects of his contributions that warrant clarification, namely, his promotion of applied comparative psychology, his views on the nature of mind, his originality, criticism from and respect afforded by contemporaries, his relation to recent interest in "the embodiment of mind," his treatment of thinking, and his appreciation of Freud's work. We organize our discussion around specific chapters of the two editions of Behaviorism, but in support of our arguments we include publications of Watson that are less well known. Those works develop some important points that are only briefly treated in both editions of Behaviorism. © Society for the Experimental Analysis of Behavior.

  16. WATSON: Detecting organic material in subsurface ice using deep-UV fluorescence and Raman spectroscopy

    Science.gov (United States)

    Eshelman, E.; Wanger, G.; Manatt, K.; Malaska, M.; Willis, M.; Abbey, W.; Doloboff, I.; Beegle, L. W.; DeFlores, L. P.; Priscu, J. C.; Lane, A. L.; Carrier, B. L.; Mellerowicz, B.; Kim, D.; Paulsen, G.; Zacny, K.; Bhartia, R.

    2017-12-01

    Future astrobiological missions to Europa and other ocean worlds may benefit from next-generation instrumentation capable of in situ organic and life detection in subsurface ice environments. WATSON (Wireline Analysis Tool for in Situ Observation of Northern ice sheets) is an instrument under development at NASA's Jet Propulsion Laboratory. WATSON contains high-TRL instrumentation developed for SHERLOC, the Mars 2020 deep-UV fluorescence and Raman spectrometer, including a 248.6 nm NeCu hollow cathode laser as an excitation source. In WATSON, these technologies provide spectroscopic capabilities highly sensitive to many organic compounds, including microbes, in an instrument package approximately 1.2 m long with a 101.6 mm diameter, designed to accommodate a 108 mm ice borehole. Interrogation into the ice wall with a laser allows for a non-destructive in situ measurement that preserves the spatial distribution of material within the ice. We report on a successful deployment of WATSON to Kangerlussuaq, Greenland, where the instrument was lowered to a 4.5 m depth in a hand-cored hole on the Kangerlussuaq sector of the Greenland ice sheet. Motorized stages within the instrument were used to raster a laser across cm-scale regions of the interior surface of the borehole, obtaining fluorescence spectral maps with a 200 µm spatial resolution and a spectral range from 265 nm to 440 nm. This region includes the UV emission bands of many aromatic compounds and microbes, and includes the water and ice Raman O-H stretching modes. We additionally report on experiments designed to inform an early-2018 deployment to Kangerlussuaq where WATSON will be incorporated into a Honeybee Robotics planetary deep drill, with a goal of drilling to a depth of 100 m and investigating the distribution of organic material within the ice sheet. These experiments include laboratory calibrations to determine the sensitivity to organic compounds embedded in ice at various depths, as well as

  17. The scientists A history of science told through the lives of its greatest inventors

    CERN Document Server

    Gribbin, John

    2004-01-01

    By focusing on the scientists themselves, Gribbin has written an anecdotal narrative enlivened with stories of personal drama, success and failure. A bestselling science writer with an international reputation, Gribbin is among the few authors who could even attempt a work of this magnitude. Praised as “a sequence of witty, information-packed tales” and “a terrifi c read” by The Times upon its recent British publication, The Scientists breathes new life into such venerable icons as Galileo, Isaac Newton, Albert Einstein and Linus Pauling, as well as lesser lights whose stories have been undeservedly neglected. Filled with pioneers, visionaries, eccentrics and madmen, this is the history of science as it has never been told before.

  18. Flouting maxim by sherlock holmes and dr. Watson in tv series Of sherlock season

    Directory of Open Access Journals (Sweden)

    Lina Affifatusholihah

    2017-04-01

    In running daily activities, people will always meet and interact with other people, and language is a medium that is used by humans to interact with each other. In a conversation or discussion, everyone should pay attention to the four maxims in order that there are no errors in communication. However, it is not uncommon that the four rules above are breached by the speakers. This is called non-observance of the maxims, and one of a non-observance of the maxims that often occurs in is flouting maxim. The aims of this paper are to describe types of maxims that are flouted by Sherlock Holmes and dr. Watson as well as to describe how the maxims are flouted in Sherlock TV series season 1. This research used qualitative descriptive method. The researcher classifies the utterances to know what kind of maxim which are flouted, categorizes those into the category based on the Grice’s theory of Cooperative Principle, namely: maxim of quantity, quality, relation and manner. The research procedure begin by searching the script in the internet, matching the utterances in the script and in film and sorting the utterances between Sherlock Holmes and dr. Watson as well observing every word or sentence which are flouted by the main characters. The findings find that all kinds of maxims are flouted by Sherlock and dr. Watson. The result of analysis shows that the maxim flouted when the speakers say something irrelevant; something roguishness or lied to hide the truth in the form of rhetorical question; the information becomes more or too informative than what is required; and something obscurity of expression, ambiguity, or unnecessary prolixity.

  19. Fanconi anaemia and the repair of Watson and Crick DNA crosslinks.

    Science.gov (United States)

    Kottemann, Molly C; Smogorzewska, Agata

    2013-01-17

    The function of Fanconi anaemia proteins is to maintain genomic stability. Their main role is in the repair of DNA interstrand crosslinks, which, by covalently binding the Watson and the Crick strands of DNA, impede replication and transcription. Inappropriate repair of interstrand crosslinks causes genomic instability, leading to cancer; conversely, the toxicity of crosslinking agents makes them a powerful chemotherapeutic. Fanconi anaemia proteins can promote stem-cell function, prevent tumorigenesis, stabilize replication forks and inhibit inaccurate repair. Recent advances have identified endogenous aldehydes as possible culprits of DNA damage that may induce the phenotypes seen in patients with Fanconi anaemia.

  20. Enol tautomers of Watson-Crick base pair models are metastable because of nuclear quantum effects.

    Science.gov (United States)

    Pérez, Alejandro; Tuckerman, Mark E; Hjalmarson, Harold P; von Lilienfeld, O Anatole

    2010-08-25

    Intermolecular enol tautomers of Watson-Crick base pairs could emerge spontaneously via interbase double proton transfer. It has been hypothesized that their formation could be facilitated by thermal fluctuations and proton tunneling, and possibly be relevant to DNA damage. Theoretical and computational studies, assuming classical nuclei, have confirmed the dynamic stability of these rare tautomers. However, by accounting for nuclear quantum effects explicitly through Car-Parrinello path integral molecular dynamics calculations, we find the tautomeric enol form to be dynamically metastable, with lifetimes too insignificant to be implicated in DNA damage.

  1. Teoria do cuidado transpessoal de jean watson no cuidado domiciliar de enfermagem a crianca: uma reflexao

    Directory of Open Access Journals (Sweden)

    Ingrid Meireles Gomes

    2013-09-01

    Full Text Available Trata-se de um ensaio reflexivo sobre o potencial de utilização da Teoria do Cuidado Transpessoal de Jean Watson, na realização do cuidado domiciliar de enfermagem direcionado à criança, desenvolvido à luz dos 10 elementos do Processo Clinical Caritas. Este referencial teórico permite desenvolver a transpessoalidade no cuidado domiciliar da criança, momento em que o enfermeiro precisa desenvolver autoconhecimento, ter suporte teórico-filosófico e valer-se deste conhecimento, a fim de ultrapassar o paradigma da objetividade e do biologicismo.

  2. Richard Watson.

    Science.gov (United States)

    Wright, Ian; Bevin, William

    2017-11-25

    An inspirational equine veterinary surgeon with a keen interest in racing, to whom horses were a way of life. He took much pride in the success of his homebred racehorses. British Veterinary Association.

  3. Destination memory in schizophrenia: "Did I told Elvis Presley about the thief?"

    Science.gov (United States)

    El Haj, Mohamad; Altman, Rosalie; Bortolon, Catherine; Capdevielle, Delphine; Raffard, Stéphane

    2017-02-01

    Destination memory refers to the ability to remember to whom a piece of information was previously transmitted. Our paper assessed this ability in schizophrenia. Twenty-five patients with schizophrenia and 25 control participants told proverbs (e.g., "send a thief to catch a thief") to pictures of celebrities (e.g., Elvis Presley). Afterward, participants had to indicate to which celebrity they had previously said the proverbs. Participants also completed a binding task in which they were required to associate letters with their corresponding context (i.e., location). Analysis revealed worse destination memory and binding in patients with schizophrenia than in controls. In both populations, destination memory was significantly correlated with performances on the binding task. Our findings suggest difficulty in the ability to attribute information to its appropriate destination in schizophrenia. This difficulty may be related to compromise in binding separate cues together to form a coherent representation of an event in memory. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  4. James Watson's most inconvenient truth: race realism and the moralistic fallacy.

    Science.gov (United States)

    Rushton, J Philippe; Jensen, Arthur R

    2008-11-01

    Recent editorials in this journal have defended the right of eminent biologist James Watson to raise the unpopular hypothesis that people of sub-Saharan African descent score lower, on average, than people of European or East Asian descent on tests of general intelligence. As those editorials imply, the scientific evidence is substantial in showing a genetic contribution to these differences. The unjustified ill treatment meted out to Watson therefore requires setting the record straight about the current state of the evidence on intelligence, race, and genetics. In this paper, we summarize our own previous reviews based on 10 categories of evidence: The worldwide distribution of test scores; the g factor of mental ability; heritability differences; brain size differences; trans-racial adoption studies; racial admixture studies; regression-to-the-mean effects; related life-history traits; human origins research; and the poverty of predictions from culture-only explanations. The preponderance of evidence demonstrates that in intelligence, brain size, and other life-history variables, East Asians average a higher IQ and larger brain than Europeans who average a higher IQ and larger brain than Africans. Further, these group differences are 50-80% heritable. These are facts, not opinions and science must be governed by data. There is no place for the "moralistic fallacy" that reality must conform to our social, political, or ethical desires.

  5. The McLean-Watson line strength formula and its implementation

    International Nuclear Information System (INIS)

    Hey, J D

    2009-01-01

    We consider the application of the line strength formula recently derived by Watson (2006 J. Phys. B: At. Mol. Opt. Phys. 39 L291) to transitions between states of high principal quantum number in hydrogenic atoms and ions (Rydberg-Rydberg transitions). Apparent difficulties in the implementation of this formula are overcome by the use of recurrence relations derived by the ladder operator technique of Infeld and Hull (1951 Rev. Mod. Phys. 23 21), and set out in an earlier paper by the present author (2006 J. Phys. B: At. Mol. Opt. Phys. 39 2641). The use of the McLean-Watson formula for such cases is illustrated by the determination of the radiative lifetimes for levels with n ∼ 1000 and comparison of present results with approximate formulae. Interest in this work on the radial matrix elements for large n and n' is related both to measurements of radio recombination lines from tenuous space plasmas, e.g. Stepkin et al (2007 Mon. Not. R. Astron. Soc. 374 852) and to the calculation of Stark broadening for such spectra, e.g. Gigosos et al (2007 Astron. Astrophys. 466 1189), Stambulchik et al (2007 Phys. Rev. E 75 016401) and Stambulchik and Maron (2008 J. Phys. B: At. Mol. Opt. Phys. 41 095703). In addition, we discuss the question of inaccuracy caused by the omission of fine structure in such calculations, and the numerical stability of the recurrence relations used to implement the line strength formulae.

  6. Assistência em Enfermagem e Jean Watson: Uma reflexão sobre a empatia

    Directory of Open Access Journals (Sweden)

    Roberta Maria Savieto

    2016-03-01

    Full Text Available Resumo Objetivo: Relacionar a empatia com a Teoria do Cuidado Humano, de Jean Watson, no contexto atual da Enfermagem. Métodos: Trata-se de um ensaio teórico-reflexivo que propõe uma discussão acerca da empatia e sua relação com a Teoria do Cuidado Humano, de Jean Watson, na prática contemporânea da Enfermagem. Resultado: É apresentado o processo Clinical Caritas e cada elemento de cuidado que o compõe visando propor e discutir as conexões com a empatia na assistência em Enfermagem. Torna-se imperioso aliar aspectos técnicos e humanísticos na oferta do cuidado de Enfermagem, além de resgatar a valorização da abordagem da empatia na formação de profissionais da saúde, bem como na continuidade dos estudos após a graduação. Conclusão: Entende-se que essa reflexão pode contribuir para a reorganização de ideias e conceitos sobre aprimoramentos essenciais que se mostram necessários à prática atual da Enfermagem, além de reforçar seu crescimento enquanto ciência.

  7. El relato de la experiencia depresiva: Aplicando los factores cuidativos de Jean Watson The expression of the depressive experience: the application of Jean Watson caring factors

    Directory of Open Access Journals (Sweden)

    Carme Ferré-Grau

    2008-03-01

    Full Text Available La elevada frecuencia de personas con trastornos depresivos en todos los niveles de atención y la complejidad de los cuidados, conlleva la necesidad, para la enfermera, de desarrollar nuevas habilidades y competencias en el abordaje integral de los pacientes y su familia. Para la comprensión de una persona con depresión es útil una mirada etnográfica que nos permita conocer la expresión subjetiva de la vivencia de la enfermedad. Un marco adecuado de referencia para ayudar en el cuidado de estos procesos es la teoría de Jean Watson sobre la Filosofía y Ciencia de los Cuidados Humanos, que a través de sus diez factores cuidativos enmarca el rol de la enfermera en "cómo tener cuidado de...". Este artículo trata de analizar, a través de los factores cuidativos de Watson, las vivencias subjetivas relacionadas con la transformación del cuerpo y la mente de las personas con depresión: el sufrimiento y el dolor, la autoimagen y el reconocimiento, la falta de energía, la pérdida de la esperanza. Se concluye que no es posible controlar el cuerpo sin controlar la mente y para ello nos puede ayudar el análisis subjetivo de la experiencia y la aplicación de los factores cuidativos.The high frequency of people with depressive disorders in Primary Health Care as well as in Hospital and the complexity of care, carry for nurses the need to develop new skills and competences to deal with complete care of patiens and families. To understand a person suffering depressive disorders may be useful an ethnographic look that let us know the subjective expression of the experience of being ill. An appropriate framework to help care is Jean Watson’s Philosophy and Science of Human Caring, trough 10 caring factors that frame the nursing role "to take care of…". This paper tries to analyze the subjective experience related to body and mind changes: suffering and pain, self-image and acceptance, lack of energy, loss of hope… in patients with

  8. Charge transport properties of DNA aperiodic molecule: The role of interbase hopping in Watson-Crick base pair

    Science.gov (United States)

    Sinurat, E. N.; Yudiarsah, E.

    2017-07-01

    The charge transport properties of DNA aperiodic molecule has been studied by considering various interbase hopping parameter on Watson-Crick base pair. 32 base pairs long double-stranded DNA aperiodic model with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. Transfer matrix method has been used to calculate transmission probabilities, for determining I-V characteristic using Landauer Büttiker formula. DNA molecule is modeled using tight binding hamiltonian combined with the theory of Slater-Koster. The result show, the increment of Watson-Crick hopping value leads to the transmission probabilities and current of DNA aperiodic molecule increases.

  9. The extension of a DNA double helix by an additional Watson-Crick base pair on the same backbone

    DEFF Research Database (Denmark)

    Kumar, P.; Sharma, P. K.; Madsen, Charlotte S.

    2013-01-01

    Additional base pair: The DNA duplex can be extended with an additional Watson-Crick base pair on the same backbone by the use of double-headed nucleotides. These also work as compressed dinucleotides and form two base pairs with cognate nucleobases on the opposite strand.......Additional base pair: The DNA duplex can be extended with an additional Watson-Crick base pair on the same backbone by the use of double-headed nucleotides. These also work as compressed dinucleotides and form two base pairs with cognate nucleobases on the opposite strand....

  10. Formation of base triplets by non-Watson-Crick bonds mediates homologous recognition in RecA recombination filaments.

    OpenAIRE

    Rao, B J; Radding, C M

    1994-01-01

    Whereas complementary strands of DNA recognize one another by forming Watson-Crick base pairs, the way in which RecA protein enables a single strand to recognize homology in duplex DNA has remained unknown. Recent experiments, however, have shown that a single plus strand in the RecA filament can recognize an identical plus strand via bonds that, by definition, are non-Watson-Crick. In experiments reported here, base substitutions had the same qualitative and quantitative effects on the pairi...

  11. The Thurgood Marshall School of Law Empirical Findings: A Report of the Watson-Glaser for the 2009-2010 Test Takers

    Science.gov (United States)

    Kadhi, T.; Palasota, A.; Holley, D.; Rudley, D.

    2010-01-01

    The following report gives the statistical findings of the 2009-2010 Watson-Glaser test. Data is pre-existing and was given to the Evaluator by email from the Director, Center for Legal Pedagogy. Statistical analyses were run using SPSS 17 to address the following questions: 1. What are the statistical descriptors of the Watson-Glaser results of…

  12. The form of electron-atom excitation amplitudes at high momentum transfers in the Faddeev-Watson approximation

    International Nuclear Information System (INIS)

    Catalan, G.; Roberts, M.J.

    1979-01-01

    A form of the off-shell Coulomb T matrix, which has a well defined on-shell limit, is used in the Faddeev-Watson multiple-scattering expansion for a direct three-body collision process. Using the excitation of atomic hydrogen by electron impact as an example, approximations to the second-order terms, which are valid for high momentum transfers of the incident electron, are derived. It is shown how the resulting asymptotic behaviour of the second-order Faddeev-Watson approximation is related to the high momentum transfer limit of the second Born approximation. The results are generalised to the excitation of more complex atoms. The asymptotic forms of the Faddeev-Watson and Born approximations are compared with other theories and with measurements of differential cross sections and angular correlation parameters for the excitation of H(2p) and He(2 1 P). The results indicate that the Faddeev-Watson approximation converges more rapidly at high momentum transfers than does the Born approximation. (author)

  13. Thermodynamic stability of Hoogsteen and Watson-Crick base pairs in the presence of histone H3-mimicking peptide.

    Science.gov (United States)

    Pramanik, Smritimoy; Nakamura, Kaori; Usui, Kenji; Nakano, Shu-ichi; Saxena, Sarika; Matsui, Jun; Miyoshi, Daisuke; Sugimoto, Naoki

    2011-03-14

    We found that Hoogsteen base pairs were stabilized by molecular crowding and a histone H3-mimicking peptide, which was not observed for Watson-Crick base pairs. Our findings demonstrate that the type of DNA base pair is critical for the interaction between DNA and histones.

  14. The extension of a DNA double helix by an additional Watson-Crick base pair on the same backbone.

    Science.gov (United States)

    Kumar, Pawan; Sharma, Pawan K; Madsen, Charlotte S; Petersen, Michael; Nielsen, Poul

    2013-06-17

    Additional base pair: The DNA duplex can be extended with an additional Watson-Crick base pair on the same backbone by the use of double-headed nucleotides. These also work as compressed dinucleotides and form two base pairs with cognate nucleobases on the opposite strand. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  15. Crick's gossip test and Watson's boredom principle: A pseudo-mathematical analysis of effort in scientific research.

    Science.gov (United States)

    Charlton, Bruce G

    2008-01-01

    Crick and Watson gave complementary advice to the aspiring scientist based on the insight that to do your best work you need to make your greatest possible effort. Crick made the positive suggestion to work on the subject which most deeply interests you, the thing about which you spontaneously gossip - Crick termed this 'the gossip test'. Watson made the negative suggestion of avoiding topics and activities that bore you - which I have termed 'the boredom principle'. This is good advice because science is tough and the easy things have already been done. Solving the harder problems that remain requires a lot of effort. But in modern biomedical science individual effort does not necessarily correlate with career success as measured by salary, status, job security, etc. This is because Crick and Watson are talking about revolutionary science - using Thomas Kuhn's distinction between paradigm-shifting 'revolutionary' science and incremental 'normal' science. There are two main problems with pursuing a career in revolutionary science. The first is that revolutionary science is intrinsically riskier than normal science, the second that even revolutionary success in a scientific backwater may be less career-enhancing than mundane work in a trendy field. So, if you pick your scientific problem using the gossip test and the boredom principle, you might also be committing career suicide. This may explain why so few people follow Crick and Watson's advice. The best hope for future biomedical science is that it will evolve towards a greater convergence between individual effort and career success.

  16. Photoinduced electron transfer in a Watson-Crick base-paired, 2-aminopurine:uracil-C60 hydrogen bonding conjugate.

    Science.gov (United States)

    D'Souza, Francis; Gadde, Suresh; Islam, D-M Shafiqul; Pang, Siew-Cheng; Schumacher, Amy Lea; Zandler, Melvin E; Horie, Rumiko; Araki, Yasuyaki; Ito, Osamu

    2007-02-07

    A fluorescent reporter molecule, 2-aminopurine was self-assembled via Watson-Crick base-pairing to a uracil appended fullerene to form a donor-acceptor conjugate; efficient photoinduced charge separation was confirmed by time-resolved emission and transient absorption spectral studies.

  17. Watson-Crick Base Pair Radical Cation as a Model for Oxidative Damage in DNA.

    Science.gov (United States)

    Feketeová, Linda; Chan, Bun; Khairallah, George N; Steinmetz, Vincent; Maitre, Philippe; Radom, Leo; O'Hair, Richard A J

    2017-07-06

    The deleterious cellular effects of ionizing radiation are well-known, but the mechanisms causing DNA damage are poorly understood. The accepted molecular events involve initial oxidation and deprotonation at guanine sites, triggering hydrogen atom abstraction reactions from the sugar moieties, causing DNA strand breaks. Probing the chemistry of the initially formed radical cation has been challenging. Here, we generate, spectroscopically characterize, and examine the reactivity of the Watson-Crick nucleobase pair radical cation in the gas phase. We observe rich chemistry, including proton transfer between the bases and propagation of the radical site in deoxyguanosine from the base to the sugar, thus rupturing the sugar. This first example of a gas-phase model system providing molecular-level details on the chemistry of an ionized DNA base pair paves the way toward a more complete understanding of molecular processes induced by radiation. It also highlights the role of radical propagation in chemistry, biology, and nanotechnology.

  18. Energy Landscape and Pathways for Transitions between Watson-Crick and Hoogsteen Base Pairing in DNA.

    Science.gov (United States)

    Chakraborty, Debayan; Wales, David J

    2018-01-04

    The recent discovery that Hoogsteen (HG) base pairs are widespread in DNA across diverse sequences and positional contexts could have important implications for understanding DNA replication and DNA-protein recognition. While evidence is emerging that the Hoogsteen conformation could be a thermodynamically accessible conformation of the DNA duplex and provide a means to expand its functionality, relatively little is known about the molecular mechanism underlying the Watson-Crick (WC) to HG transition. In this Perspective, we describe pathways and kinetics for this transition at an atomic level of detail, using the energy landscape perspective. We show that competition between the duplex conformations results in a double funnel landscape, which explains some recent experimental observations. The interconversion pathways feature a number of intermediates, with a variable number of WC and HG base pairs. The relatively slow kinetics, with possible deviations from two-state behavior, suggest that this conformational switch is likely to be a challenging target for both simulation and experiment.

  19. Capturing student mathematical engagement through differently enacted classroom practices: applying a modification of Watson's analytical tool

    Science.gov (United States)

    Patahuddin, Sitti Maesuri; Puteri, Indira; Lowrie, Tom; Logan, Tracy; Rika, Baiq

    2018-04-01

    This study examined student mathematical engagement through the intended and enacted lessons taught by two teachers in two different middle schools in Indonesia. The intended lesson was developed using the ELPSA learning design to promote mathematical engagement. Based on the premise that students will react to the mathematical tasks in the forms of words and actions, the analysis focused on identifying the types of mathematical engagement promoted through the intended lesson and performed by students during the lesson. Using modified Watson's analytical tool (2007), students' engagement was captured from what the participants' did or said mathematically. We found that teachers' enacted practices had an influence on student mathematical engagement. The teacher who demonstrated content in explicit ways tended to limit the richness of the engagement; whereas the teacher who presented activities in an open-ended manner fostered engagement.

  20. LEOPARD syndrome is not linked to the Marfan syndrome and the Watson syndrome loci

    Energy Technology Data Exchange (ETDEWEB)

    Rass-Rothchild, A.: Abeliovitch, D.; Kornstein, A. [Tel Aviv Univ. (Israel)]|[Hebrew Univ., Jerusalem (Israel)

    1994-09-01

    The acronym LEOPARD stands for a syndromic association of Lentigines, Eletrocardiographic changes, Ocular hypertelorism, Pulmonic stenosis, Abnormal genitalia, Retardation of growth and sensorineural Deafness. Inheritance is autosomal dominant with high penetrance and variable expressivity. In 1990 Torok et al. reported on the association of LEOPARD and Marfan syndrome. In addition a clinical similarity (cardiac and cutaneous involvement) exists with the Watson syndrome (neurofibromatosis and pulmonic stenosis) which is linked to the marker D17S33 on chromosome 17. We studied possible linkage of LEOPARD syndrome to the Marfan syndrome locus on chromosome 15 (D15S1, MF13, and (TAAAA)n repeats) and to the NF-1 locus on chromosome 17 in a family with 9 cases of LEOPARD syndrome. Close linkage between LEOPARD syndrome and both the Marfan locus on chromosome 15 and the NF-1 locus on chromosome 17 was excluded (lod score <-2.0 through {theta} = 0.1).

  1. End of the Line? Paul Watson and the Future of the Sea Shepherd Conservation Society

    Directory of Open Access Journals (Sweden)

    Gerry Joseph Nagtzaam

    2014-03-01

    Full Text Available This paper critically examines the Sea Shepherd Conservation Society (‘SSCS’ and the legal challenges they are currently facing to continue its self-appointed role to protect oceanic life through direct action.  In Part One, the article examines the history of this radical environmental group and; the role performed by its charismatic leader Paul Watson; it’s organisational structure and its strategies and tactics; its governing philosophy and its attitudes to violence.  Part Two provides a history of the various direct actions carried out by the group; it further examines the organisation’s ongoing confrontations with the Japanese whaling fleet; documents the current legal travails the group and its leader are experiencing; and lastly asks what impact these issues will have on the group’s viability as a direct action group going forward.

  2. DNA polymerase catalysis in the absence of Watson-Crick hydrogen bonds

    Science.gov (United States)

    Potapova, Olga; Chan, Chikio; DeLucia, Angela M.; Helquist, Sandra A.; Kool, Eric T.; Grindley, Nigel D. F.; Joyce, Catherine M.

    2008-01-01

    We report the first pre-steady-state kinetic studies of DNA replication in the absence of hydrogen bonds. We have used nonpolar nucleotide analogues that mimic the shape of a Watson-Crick base pair in order to investigate the kinetic consequences of a lack of hydrogen bonds in the polymerase reaction catalyzed by the Klenow fragment of DNA Polymerase I from Escherichia coli. With a thymine isostere lacking hydrogen bonding ability in the nascent pair, the efficiency (kpol/Kd) of the polymerase reaction is decreased by 30-fold, affecting ground state (Kd) and transition state (kpol) approximately equally. When both thymine and adenine analogues in the nascent pair lack hydrogen bonding ability, the efficiency of the polymerase reaction is decreased by about 1000-fold, with most the decrease attributable to the transition state. Reactions using nonpolar analogues at the primer terminal base pair demonstrated the requirement for a hydrogen bond between the polymerase and the minor groove of the primer-terminal base. The R668A mutation of Klenow fragment abolished this requirement, identifying R668 as the probable hydrogen bond donor. Detailed examination of the kinetic data suggested that Klenow fragment has an extremely low tolerance of even minor deviations of the analogue base pairs from ideal Watson-Crick geometry. Consistent with this idea, some analogue pairings were better tolerated by Klenow fragment mutants having more spacious active sites. By contrast, the Y-family polymerase Dbh was much less sensitive to changes in base pair dimensions, and more dependent on hydrogen bonding between base-paired partners. PMID:16411765

  3. First a hero of science and now a martyr to science: the James Watson Affair - political correctness crushes free scientific communication.

    Science.gov (United States)

    Charlton, Bruce G

    2008-01-01

    In 2007 James D. Watson, perhaps the most famous living scientist, was forced to retire from his position and retreat from public life in the face of international mass media condemnation following remarks concerning genetically-caused racial differences in intelligence. Watson was punished for stating forthright views on topics that elite opinion has determined should be discussed only with elaborate caution, frequent disclaimers, and solemn deference to the currently-prevailing pieties. James Watson has always struck many people as brash; however this blunt, truth-telling quality was intrinsic to his role in one of the greatest scientific discoveries. Much more importantly than 'good manners', Watson has consistently exemplified the cardinal scientific virtue: he speaks what he understands to be the truth without regard for the opinion of others. The most chilling aspect of the Watson Affair was the way in which so many influential members of the scientific research community joined the media condemnation directed against Watson. Perhaps the most egregious betrayal of science was an article by editorialists of the premier UK scientific journal Nature. Instead of defending the freedom of discourse in pursuit of scientific truth, Nature instead blamed Watson for being 'crass' and lacking 'sensitivity' in discussing human genetic differences. But if asked to choose between the 'sensitive' editors of Nature or the 'crass' genius of James D. Watson, all serious scientists must take the side of Watson. Because when a premier researcher such as Watson is hounded from office by a vicious, arbitrary and untruthful mob; all lesser scientists are made vulnerable to analogous treatment at the whim of the media. A zealous and coercive brand of 'political correctness' is now making the biological truth of human genetic differences intolerably difficult to discover and discuss in US and UK. This needs to change. My hope is that truth will prevail over political correctness and

  4. Mispairs with Watson-Crick base-pair geometry observed in ternary complexes of an RB69 DNA polymerase variant.

    Science.gov (United States)

    Xia, Shuangluo; Konigsberg, William H

    2014-04-01

    Recent structures of DNA polymerase complexes with dGMPCPP/dT and dCTP/dA mispairs at the insertion site have shown that they adopt Watson-Crick geometry in the presence of Mn(2+) indicating that the tautomeric or ionization state of the base has changed. To see whether the tautomeric or ionization state of base-pair could be affected by its microenvironment, we determined 10 structures of an RB69 DNA polymerase quadruple mutant with dG/dT or dT/dG mispairs at position n-1 to n-5 of the Primer/Template duplex. Different shapes of the mispairs, including Watson-Crick geometry, have been observed, strongly suggesting that the local environment of base-pairs plays an important role in their tautomeric or ionization states. © 2014 The Protein Society.

  5. Hydration of Watson-Crick base pairs and dehydration of Hoogsteen base pairs inducing structural polymorphism under molecular crowding conditions.

    Science.gov (United States)

    Miyoshi, Daisuke; Nakamura, Kaori; Tateishi-Karimata, Hisae; Ohmichi, Tatsuo; Sugimoto, Naoki

    2009-03-18

    It has been revealed recently that molecular crowding, which is one of the largest differences between in vivo and in vitro conditions, is a critical factor determining the structure, stability, and function of nucleic acids. However, the effects of molecular crowding on Watson-Crick and Hoogsteen base pairs remain unclear. In order to investigate directly and quantitatively the molecular crowding effects on base pair types in nucleic acids, we designed intramolecular parallel- and antiparallel-stranded DNA duplexes consisting of Hoogsteen and Watson-Crick base pairs, respectively, as well as an intramolecular parallel-stranded triplex containing both types of base pairs. Thermodynamic analyses demonstrated that the values of free energy change at 25 degrees C for Hoogsteen base-pair formations decreased from +1.45 +/- 0.15 to +1.09 +/- 0.13 kcal mol(-1), and from -1.89 +/- 0.13 to -2.71 +/- 0.11 kcal mol(-1) in the intramolecular duplex and triplex, respectively, when the concentration of PEG 200 (polyethylene glycol with average molecular weight 200) increased from 0 to 20 wt %. However, corresponding values for Watson-Crick formation in the duplex and triplex increased from -10.2 +/- 0.2 to -8.7 +/- 0.1 kcal mol(-1), and from -10.8 +/- 0.2 to -9.2 +/- 0.2 kcal mol(-1), respectively. Furthermore, it was revealed that the opposing effects of molecular crowding on the Hoogsteen and Watson-Crick base pairs were due to different behaviors of water molecules binding to the DNA strands.

  6. Case study: IBM Watson Analytics cloud platform as Analytics-as-a-Service system for heart failure early detection

    OpenAIRE

    Guidi, Gabriele; Miniati, Roberto; Mazzola, Matteo; Iadanza, Ernesto

    2016-01-01

    In the recent years the progress in technology and the increasing availability of fast connections have produced a migration of functionalities in Information Technologies services, from static servers to distributed technologies. This article describes the main tools available on the market to perform Analytics as a Service (AaaS) using a cloud platform. It is also described a use case of IBM Watson Analytics, a cloud system for data analytics, applied to the following research scope: detect...

  7. Non-Watson-Crick basepairing and hydration in RNA motifs: molecular dynamics of 5S rRNA loop E

    Czech Academy of Sciences Publication Activity Database

    Réblová, K.; Špačková, Naďa; Štefl, R.; Csaszar, K.; Koča, J.; Leontis, N. B.; Šponer, Jiří

    2003-01-01

    Roč. 84, č. 6 (2003), s. 3564-3582 ISSN 0006-3495 R&D Projects: GA MŠk LN00A016 Grant - others:National Institutes of Health(US) 2R15 GM55898; National Science Foundation(US) CHE-9732563 Institutional research plan: CEZ:AV0Z5004920 Keywords : non-Watson-Crick base pairs * ribosomal RNA * Loop E Subject RIV: BO - Biophysics Impact factor: 4.463, year: 2003

  8. Probing the Watson-Crick, wobble, and sugar-edge hydrogen bond sites of uracil and thymine.

    Science.gov (United States)

    Müller, Andreas; Frey, Jann A; Leutwyler, Samuel

    2005-06-16

    The nucleobases uracil (U) and thymine (T) offer three hydrogen-bonding sites for double H-bond formation via neighboring N-H and C=O groups, giving rise to the Watson-Crick, wobble and sugar-edge hydrogen bond isomers. We probe the hydrogen bond properties of all three sites by forming hydrogen bonded dimers of U, 1-methyluracil (1MU), 3-methyluracil (3MU), and T with 2-pyridone (2PY). The mass- and isomer-specific S1 origins exhibit large spectral blue shifts relative to the 2PY monomer. Ab initio CIS calculations of the spectral shifts of the different hydrogen-bonded dimers show a linear correlation with experiment. This correlation allows us to identify the R2PI spectra of the weakly populated Watson-Crick and wobble isomers of both 2PY.U and 2PY.T. (3) PW91 density functional calculation of the ground-state binding and dissociation energies De and D0 are in agreement with the assignment of the dominant hydrogen bond isomers of 2PY.U, 2PY.3MU and 2PY.T as the sugar-edge form. For 2PY.U, 2PY.T and 2PY.1MU the measured wobble:Watson-Crick:sugar-edge isomer ratios are in good agreement with the calculated ratios, based on the ab initio dissociation energies and gas-phase statistical mechanics. The Watson-Crick and wobble isomers are thereby determined to be several kcal/mol less strongly bound than the sugar-edge isomers. The 36 observed intermolecular frequencies of the nine different H-bonded isomers give detailed insight into the intermolecular force field.

  9. Human DNA primase uses Watson-Crick hydrogen bonds to distinguish between correct and incorrect nucleoside triphosphates.

    Science.gov (United States)

    Moore, Chad L; Zivkovic, Aleksandra; Engels, Joachim W; Kuchta, Robert D

    2004-09-28

    Human DNA primase synthesizes short RNA primers that DNA polymerase alpha further elongates. Primase readily misincorporates the natural NTPs and will generate a wide variety of mismatches. In contrast, primase exhibited a remarkable resistance to polymerizing NTPs containing unnatural bases. This included bases whose shape was almost identical to the natural bases (4-aminobenzimidazole and 4,6-difluorobenzimidazole), bases shaped very differently than a natural base [e.g., 5- and 6-(trifluoromethyl)benzimidazole], bases much more hydrophobic than a natural base [e.g., 4- and 7-(trifluoromethyl)benzimidazole], bases of similar hydrophobicity as a natural base but with the Watson-Crick hydrogen-bonding groups in unusual positions (7-beta-D-guanine), and bases capable of forming only one Watson-Crick hydrogen bond with the template base (purine and 4-aminobenzimidazole). Primase only polymerized NTP analogues containing bases capable of forming hydrogen bonds between the equivalent of both N-1 and the exocyclic group at C-6 of a purine NTP (2-fluoroadenine, 2-chloroadenine, 3-deazaadenine, and hypoxanthine) and N-3 and the exocyclic group at C-4 of a pyrimidine. These data indicate that human primase requires the formation of Watson-Crick hydrogen bonds in order to polymerize a NTP, a situation very different than what is observed with some DNA polymerases. The implications of these results with respect to current theories of how polymerases discriminate between right and wrong (d)NTPs are discussed.

  10. Ultraviolet Absorption Induces Hydrogen-Atom Transfer in G⋅C Watson-Crick DNA Base Pairs in Solution.

    Science.gov (United States)

    Röttger, Katharina; Marroux, Hugo J B; Grubb, Michael P; Coulter, Philip M; Böhnke, Hendrik; Henderson, Alexander S; Galan, M Carmen; Temps, Friedrich; Orr-Ewing, Andrew J; Roberts, Gareth M

    2015-12-01

    Ultrafast deactivation pathways bestow photostability on nucleobases and hence preserve the structural integrity of DNA following absorption of ultraviolet (UV) radiation. One controversial recovery mechanism proposed to account for this photostability involves electron-driven proton transfer (EDPT) in Watson-Crick base pairs. The first direct observation is reported of the EDPT process after UV excitation of individual guanine-cytosine (G⋅C) Watson-Crick base pairs by ultrafast time-resolved UV/visible and mid-infrared spectroscopy. The formation of an intermediate biradical species (G[-H]⋅C[+H]) with a lifetime of 2.9 ps was tracked. The majority of these biradicals return to the original G⋅C Watson-Crick pairs, but up to 10% of the initially excited molecules instead form a stable photoproduct G*⋅C* that has undergone double hydrogen-atom transfer. The observation of these sequential EDPT mechanisms across intermolecular hydrogen bonds confirms an important and long debated pathway for the deactivation of photoexcited base pairs, with possible implications for the UV photochemistry of DNA. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  11. The Effect of Nonzero Autocorrelation Coefficients on the Distributions of Durbin-Watson Test Estimator: Three Autoregressive Models

    Directory of Open Access Journals (Sweden)

    Mei-Yu LEE

    2014-11-01

    Full Text Available This paper investigates the effect of the nonzero autocorrelation coefficients on the sampling distributions of the Durbin-Watson test estimator in three time-series models that have different variance-covariance matrix assumption, separately. We show that the expected values and variances of the Durbin-Watson test estimator are slightly different, but the skewed and kurtosis coefficients are considerably different among three models. The shapes of four coefficients are similar between the Durbin-Watson model and our benchmark model, but are not the same with the autoregressive model cut by one-lagged period. Second, the large sample case shows that the three models have the same expected values, however, the autoregressive model cut by one-lagged period explores different shapes of variance, skewed and kurtosis coefficients from the other two models. This implies that the large samples lead to the same expected values, 2(1 – ρ0, whatever the variance-covariance matrix of the errors is assumed. Finally, comparing with the two sample cases, the shape of each coefficient is almost the same, moreover, the autocorrelation coefficients are negatively related with expected values, are inverted-U related with variances, are cubic related with skewed coefficients, and are U related with kurtosis coefficients.

  12. Benchmark studies on the building blocks of DNA. 3. Watson-Crick and stacked base pairs.

    Science.gov (United States)

    Szalay, Péter G; Watson, Thomas; Perera, Ajith; Lotrich, Victor; Bartlett, Rodney J

    2013-04-18

    Excited states of stacked adenine-thymine and guanine-cytosine pairs as well as the Watson-Crick pair of guanine-thymine have been investigated using the equation of motion coupled-cluster (EOM-CC) method with single and double as well as approximate triple excitations. Transitions have been assigned, and the form of the excitations has been analyzed. The majority of the excitations could be classified as localized on the nucleobases, but for all three studied systems, charge-transfer (CT) transitions could also be identified. The main aim of this study was to compare the performance of lower-level methods (ADC(2) and TDDFT) to the high-level EOM-CC ones. It was shown that both ADC(2) and TDDFT with long-range correction have nonsystematic error in excitation energies, causing alternation of the energetic ordering of the excitations. Considering the high costs of the EOM-CC calculations, there is a need for reliable new approximate methods.

  13. Determining the Walker exponent and developing a modified Smith-Watson-Topper parameter model

    Energy Technology Data Exchange (ETDEWEB)

    Lv, Zhiqiang; Huang, Hong Zhong; Wang, Hai Kun; Gao, Huiying; Zuo, Fang Jun [University of Electronic Science and Technology of China, Chengdu (China)

    2016-03-15

    Mean stress effects significantly influence the fatigue life of components. In general, tensile mean stresses are known to reduce the fatigue life of components, whereas compressive mean stresses are known to increase it. To date, various methods that account for mean stress effects have been studied. In this research, considering the high accuracy of mean stress correction and the difficulty in obtaining the material parameter of the Walker method, a practical method is proposed to describe the material parameter of this method. The test data of various materials are then used to verify the proposed practical method. Furthermore, by applying the Walker material parameter and the Smith-Watson-Topper (SWT) parameter, a modified strain-life model is developed to consider sensitivity to mean stress of materials. In addition, three sets of experimental fatigue data from super alloy GH4133, aluminum alloy 7075-T651, and carbon steel are used to estimate the accuracy of the proposed model. A comparison is also made between the SWT parameter method and the proposed strainlife model. The proposed strain-life model provides more accurate life prediction results than the SWT parameter method.

  14. Detection of protonated non-Watson-Crick base pairs using electrospray ionization mass spectrometry.

    Science.gov (United States)

    Ishida, Riyoko; Iwahashi, Hideo

    2018-03-01

    Many studies have shown that protonated nucleic acid base pairs are involved in a wide variety of nucleic acid structures. However, little information is available on relative stability of hemiprotonated self- and non-self-dimers at monomer level. We used electrospray ionization mass spectrometry (ESI-MS) to evaluate the relative stability under various concentrations of hydrogen ion. These enable conjecture of the formation of protonated non-Watson-Crick base pairs based on DNA and RNA base sequence. In the present study, we observed that ESI-MS peaks corresponded to respective self-dimers for all examined nucleosides except for adenosine. Peak heights depended on the concentration of hydrogen ion. The ESI-MS peak heights of the hemiprotonated cytidine dimers and the hemiprotonated thymidine dimer sharply increased with increased concentration of hydrogen ion, suggesting direct participation of hydrogen ion in dimer formations. In ESI-MS measurements of the solutions containing adenosine, cytidine, thymidine and guanosine, we observed protonated cytidine-guanosine dimer (CH+-G) and protonated cytidine-thymidine dimer (CH+-T) in addition to hemiprotonated cytidine-cytidine dimer (CH+-C) with following relative peak height, (CH+-C) > (CH+-G) ≈ (CH+-T) > (CH+-A). Additionally, in the ESI-MS measurements of solutions containing adenosine, thymidine and guanosine, we observed a considerable amount of protonated adenosine-guanosine (AH+-G) and protonated adenosine-thymidine (AH+-T).

  15. Proton tunneling in the A∙T Watson-Crick DNA base pair: myth or reality?

    Science.gov (United States)

    Brovarets', Ol'ha O; Hovorun, Dmytro M

    2015-01-01

    The results and conclusions reached by Godbeer et al. in their recent work, that proton tunneling in the A∙T(WC) Watson-Crick (WC) DNA base pair occurs according to the Löwdin's (L) model, but with a small (~10(-9)) probability were critically analyzed. Here, it was shown that this finding overestimates the possibility of the proton tunneling at the A∙T(WC)↔A*∙T*(L) tautomerization, because this process cannot be implemented as a chemical reaction. Furthermore, it was outlined those biologically important nucleobase mispairs (A∙A*↔A*∙A, G∙G*↔G*∙G, T∙T*↔T*∙T, C∙C*↔C*∙C, H∙H*↔H*∙H (H - hypoxanthine)) - the players in the field of the spontaneous point mutagenesis - where the tunneling of protons is expected and for which the application of the model proposed by Godbeer et al. can be productive.

  16. Long-Range Vibrational Dynamics Are Directed by Watson-Crick Base Pairing in Duplex DNA.

    Science.gov (United States)

    Hithell, Gordon; Shaw, Daniel J; Donaldson, Paul M; Greetham, Gregory M; Towrie, Michael; Burley, Glenn A; Parker, Anthony W; Hunt, Neil T

    2016-05-05

    Ultrafast two-dimensional infrared (2D-IR) spectroscopy of a 15-mer A-T DNA duplex in solution has revealed structure-dependent vibrational coupling and energy transfer processes linking bases with the sugar-phosphate backbone. Duplex melting induces significant changes in the positions of off-diagonal peaks linking carbonyl and ring-stretching vibrational modes of the adenine and thymine bases with vibrations of the phosphate group and phosphodiester linkage. These indicate that Watson-Crick hydrogen bonding and helix formation lead to a unique vibrational coupling arrangement of base vibrational modes with those of the phosphate unit. On the basis of observations from time-resolved 2D-IR data, we conclude that rapid energy transfer processes occur between base and backbone, mediated by additional modes located on the deoxyribose moiety within the same nucleotide. These relaxation dynamics are insensitive to duplex melting, showing that efficient intramolecular energy relaxation to the solvent via the phosphate groups is the key to excess energy dissipation in both single- and double-stranded DNA.

  17. Highly Accurate Classification of Watson-Crick Basepairs on Termini of Single DNA Molecules

    Science.gov (United States)

    Winters-Hilt, Stephen; Vercoutere, Wenonah; DeGuzman, Veronica S.; Deamer, David; Akeson, Mark; Haussler, David

    2003-01-01

    We introduce a computational method for classification of individual DNA molecules measured by an α-hemolysin channel detector. We show classification with better than 99% accuracy for DNA hairpin molecules that differ only in their terminal Watson-Crick basepairs. Signal classification was done in silico to establish performance metrics (i.e., where train and test data were of known type, via single-species data files). It was then performed in solution to assay real mixtures of DNA hairpins. Hidden Markov Models (HMMs) were used with Expectation/Maximization for denoising and for associating a feature vector with the ionic current blockade of the DNA molecule. Support Vector Machines (SVMs) were used as discriminators, and were the focus of off-line training. A multiclass SVM architecture was designed to place less discriminatory load on weaker discriminators, and novel SVM kernels were used to boost discrimination strength. The tuning on HMMs and SVMs enabled biophysical analysis of the captured molecule states and state transitions; structure revealed in the biophysical analysis was used for better feature selection. PMID:12547778

  18. Case of the missing fingerprints or Dr. Watson's cosmology

    Energy Technology Data Exchange (ETDEWEB)

    Longair, M.S.

    1987-01-01

    The cosmological problem has four main areas of uncertainty -the origin of isotropy of the universe, the origin of the fluctuations from which galaxies form, the explanation of why we live in a matter universe rather than one composed of equal amounts of matter and antimatter and why the Universe seems to be within a factor of 10 of the critical, flat universe. These cannot be explained satisfactorily within the Hot Big Bang theory after a millisecond or so. The solutions are presumed, therefore, to lie in the very early universe when it was less than about a millisecond old. The clues which lead to this conclusion are set out in terms of a detective story with Sherlock Holmes explaining the facts about the universe to Dr Watson. Holmes first explains the size of the universe in terms of distances and sizes of stars, galaxies and galaxy clusters. Evidence from pictures of the universe at different temperatures, (X-ray pictures, gamma-ray pictures, far infra-red pictures and pictures at radio and millimetre wavelengths) is presented. Holmes then starts to build up a realistic model of the universe using two of the facts collected (the isotropy of the universe and the expansion of the universe), one assumption (the cosmological principle) and one theory of gravity (General Relativity). However the universe which emerges does not solve the four problems mentioned. Quasars, which provide information (illustrated) from earlier epochs of the universe may, therefore, help to solve the problems. (U.K.).

  19. Application of the Faddeev-Watson expansion to thermal collisions of Rydberg atoms with neutral particles

    International Nuclear Information System (INIS)

    de Prunele, E.

    1983-01-01

    The Faddeev-Watson expansion (FWE) for the T operator is applied to the study of thermal collisions between Rydberg atom and neutral atom. These collisions are considered as a three-body problem (the perturber, the Rydberg electron, and its parent core) and it is assumed, as already done in most theoretical works dealing with Rydberg-atom--atom collisions, that the core-perturber interaction can be neglected. Then the evaluation of the FWE first- and second-order terms is made tractable by using an appropriate separable potential for the Rydberg-electron--perturber interaction. The evaluation of the second-order term allows us to estimate the importance of taking into account explicitly the Rydberg-electron--core interaction in the expression of the (three-body) T operator for the thermal collisions considered. Detailed calculations for the process Rb(n, l = 0)+He →Rb(n',l')+He are presented and discussed. The FWE second-order term has been evaluated for the first time by taking the (two-body) t operator associated with the Rydberg atom (valence electron plus parent core) as the Coulomb potential. The contribution of the FWE second-order term to the scattering amplitude decreases as n increases and is found especially significant when both the momentum transfers involved in the collision are large and the values of l and l' are small

  20. Applications of the Galton-Watson process to human DNA evolution and demography

    CERN Document Server

    Neves, A G M

    2005-01-01

    We show that the problem of existence of a mitochondrial Eve can be understood as an application of the Galton--Watson process and presents interesting analogies with critical phenomena in Statistical Mechanics. In the approximation of small survival probability, and assuming limited progeny, we are able to find for a genealogic tree the maximum and minimum survival probabilities over all probability distributions for the number of children per woman constrained to a given mean. As a consequence, we can relate existence of a mitochondrial Eve to quantitative demographic data of early mankind. In particular, we show that a mitochondrial Eve may exist even in an exponentially growing population, provided that the mean number of children per woman $\\overline N$ is constrained to a small range depending on the probability $p$ that a child is a female. Assuming that the value $p \\approx 0.488$ valid nowadays has remained fixed for thousands of generations, the range where a mitochondrial Eve occurs with sizeable p...

  1. Stability of non-Watson-Crick G-A/A-G base pair in synthetic DNA and RNA oligonucleotides.

    Science.gov (United States)

    Ito, Yuko; Sone, Yumiko; Mizutani, Takaharu

    2004-03-01

    A non-Watson-Crick G-A/A-G base pair is found in SECIS (selenocysteine-insertion sequence) element in the 3'-untranslated region of Se-protein mRNAs and in the functional site of the hammerhead ribozyme. We studied the stability of G-A/A-G base pair (bold) in 17mer GT(U)GACGGAAACCGGAAC synthetic DNA and RNA oligonucleotides by thermal melting experiments and gel electrophoresis. The measured Tm value of DNA oligonucleotide having G-A/A-G pair showed an intermediate value (58 degrees C) between that of Watson-Crick G-C/C-G base pair (75 degrees C) and that of G-G/A-A of non-base-pair (40 degrees C). Similar thermal melting patterns were obtained with RNA oligonucleotides. This result indicates that the secondary structure of oligonucleotide having G-A/A-G base pair is looser than that of the G-C type Watson-Crick base pair. In the comparison between RNA and DNA having G-A/A-G base pair, the Tm value of the RNA oligonucleotide was 11 degrees C lower than that of DNA, indicating that DNA has a more rigid structure than RNA. The stained pattern of oligonucleotide on polyacrylamide gel clarified that the mobility of the DNA oligonucleotide G-A/A-G base pair changed according to the urea concentration from the rigid state (near the mobility of G-C/C-G oligonucleotide) in the absence of urea to the random state (near the mobility of G-G/A-A oligonucleotide) in 7 M urea. However, the RNA oligonucleotide with G-A/A-G pair moved at an intermediate mobility between that of oligonucleotide with G-C/C-G and of the oligonucleotide with G-G/A-A, and the mobility pattern did not depend on urea concentration. Thus, DNA and RNA oligonucleotides with the G-A/A-G base pair showed a pattern indicating an intermediate structure between the rigid Watson-Crick base pair and the random structure of non-base pair. RNA with G-A/A-G base pair has the intermediate structure not influenced by urea concentration. Finally, this study indicated that the intermediate rigidity imparted by Non-Watson

  2. DNA base dimers are stabilized by hydrogen-bonding interactions including non-Watson-Crick pairing near graphite surfaces.

    Science.gov (United States)

    Shankar, Akshaya; Jagota, Anand; Mittal, Jeetain

    2012-10-11

    Single- and double-stranded DNA are increasingly being paired with surfaces and nanoparticles for numerous applications, such as sensing, imaging, and drug delivery. Unlike the majority of DNA structures in bulk that are stabilized by canonical Watson-Crick pairing between Ade-Thy and Gua-Cyt, those adsorbed on surfaces are often stabilized by noncanonical base pairing, quartet formation, and base-surface stacking. Not much is known about these kinds of interactions. To build an understanding of the role of non-Watson-Crick pairing on DNA behavior near surfaces, one requires basic information on DNA base pair stacking and hydrogen-bonding interactions. All-atom molecular simulations of DNA bases in two cases--in bulk water and strongly adsorbed on a graphite surface--are conducted to study the relative strengths of stacking and hydrogen bond interactions for each of the 10 possible combinations of base pairs. The key information obtained from these simulations is the free energy as a function of distance between two bases in a pair. We find that stacking interactions exert the dominant influence on the stability of DNA base pairs in bulk water as expected. The strength of stability for these stacking interactions is found to decrease in the order Gua-Gua > Ade-Gua > Ade-Ade > Gua-Thy > Gua-Cyt > Ade-Thy > Ade-Cyt > Thy-Thy > Cyt-Thy > Cyt-Cyt. On the other hand, mutual interactions of surface-adsorbed base pairs are stabilized mostly by hydrogen-bonding interactions in the order Gua-Cyt > Ade-Gua > Ade-Thy > Ade-Ade > Cyt-Thy > Gua-Gua > Cyt-Cyt > Ade-Cyt > Thy-Thy > Gua-Thy. Interestingly, several non-Watson-Crick base pairings, which are commonly ignored, have similar stabilization free energies due to interbase hydrogen bonding as Watson-Crick pairs. This clearly highlights the importance of non-Watson-Crick base pairing in the development of secondary structures of oligonucleotides near surfaces.

  3. [Analysis of Conformational Features of Watson-Crick Duplex Fragments by Molecular Mechanics and Quantum Mechanics Methods].

    Science.gov (United States)

    Poltev, V I; Anisimov, V M; Sanchez, C; Deriabina, A; Gonzalez, E; Garcia, D; Rivas, F; Polteva, N A

    2016-01-01

    It is generally accepted that the important characteristic features of the Watson-Crick duplex originate from the molecular structure of its subunits. However, it still remains to elucidate what properties of each subunit are responsible for the significant characteristic features of the DNA structure. The computations of desoxydinucleoside monophosphates complexes with Na-ions using density functional theory revealed a pivotal role of DNA conformational properties of single-chain minimal fragments in the development of unique features of the Watson-Crick duplex. We found that directionality of the sugar-phosphate backbone and the preferable ranges of its torsion angles, combined with the difference between purines and pyrimidines. in ring bases, define the dependence of three-dimensional structure of the Watson-Crick duplex on nucleotide base sequence. In this work, we extended these density functional theory computations to the minimal' fragments of DNA duplex, complementary desoxydinucleoside monophosphates complexes with Na-ions. Using several computational methods and various functionals, we performed a search for energy minima of BI-conformation for complementary desoxydinucleoside monophosphates complexes with different nucleoside sequences. Two sequences are optimized using ab initio method at the MP2/6-31++G** level of theory. The analysis of torsion angles, sugar ring puckering and mutual base positions of optimized structures demonstrates that the conformational characteristic features of complementary desoxydinucleoside monophosphates complexes with Na-ions remain within BI ranges and become closer to the corresponding characteristic features of the Watson-Crick duplex crystals. Qualitatively, the main characteristic features of each studied complementary desoxydinucleoside monophosphates complex remain invariant when different computational methods are used, although the quantitative values of some conformational parameters could vary lying within the

  4. Kinetics and Thermodynamics of Watson-Crick Base Pairing Driven DNA Origami Dimerization.

    Science.gov (United States)

    Zenk, John; Tuntivate, Chanon; Schulman, Rebecca

    2016-03-16

    We investigate the kinetics and thermodynamics of DNA origami dimerization using flat rectangle origami components and different architectures of Watson-Crick complementary single-stranded DNA ("sticky end") linking strategies. We systematically vary the number of linkers, the length of the sticky ends on the linker, and linker architecture and measure the corresponding yields as well as forward and reverse reaction rate constants through fluorescence quenching assays. Yields were further verified using atomic force microscopy. We calculate values of H° and ΔS° for various interface designs and find nonlinear van't Hoff behavior, best described by two linear equations, suggesting distinct regimes of dimerization between those with and those without well-formed interfaces. We find that self-assembly reactions can be tuned by manipulating the interface architecture without suffering a loss in yield, even when yield is high, ∼75-80%. We show that the second-order forward reaction rate constant (k(on)) depends on both linker architecture and number of linkers used, with typical values on the order of 10(5)-10(6) (M·s)(-1), values that are similar to those of bimolecular association of small, complementary DNA strands. The k(on) values are generally non-Arrhenius, tending to increase with decreasing temperature. Finally, we use kinetic and thermodynamic information about the optimal linking architecture to extend the system to an infinite, two-component repeating lattice system and show that we can form micron-sized lattices, with well-formed structures up to 8 μm(2).

  5. Leucaena lanceolata S. Watson ssp. lanceolata, ESPECIE FORESTAL CON POTENCIAL PARA SER INTRODUCIDA EN SISTEMAS SILVOPASTORILES

    Directory of Open Access Journals (Sweden)

    María L. Román-Miranda

    2013-01-01

    Full Text Available La utilización de especies forestales en los sistemas de producción agropecuaria contribuye a reducir la presión en los bosques naturales y se pueden incorporar en áreas no arboladas. El objetivo de este estudio fue evaluar la calidad nutritiva, germinación, desarrollo de plántula en vivero y diversidad de usos de Leucaena lanceolata S. Watson ssp. lanceolata. El material comestible y las semillas se colectaron en Tomatlán, Jalisco. Se realizaron análisis bromatológicos, pruebas de escarificación y evaluación de plántula en vivero sobre tres suelos con diferente pH. El experimento se analizó en un diseño completamente al azar con comparación de medias de Tukey (P ≤ 0.05. Además, se hicieron entrevistas a productores, una revisión bibliográfica y consulta de ejemplares en los herbarios para conocer los usos locales y potenciales de la especie. Los resultados indican alto contenido de materia seca (97.40 % y proteína cruda (29.05 %, mayor germinación en los tratamientos térmicos, mejor desarrollo de la plántula en el suelo ligeramente ácido (6.57 y la diversidad de usos incluye leña, forraje y madera, entre otros. Por el alto valor nutritivo y diversidad de usos en el medio rural, L. lanceolata representa una opción viable para utilizarse en sistemas silvopastoriles del trópico seco.

  6. Performance characterization of Watson Ahumada motion detector using random dot rotary motion stimuli.

    Directory of Open Access Journals (Sweden)

    Siddharth Jain

    Full Text Available The performance of Watson & Ahumada's model of human visual motion sensing is compared against human psychophysical performance. The stimulus consists of random dots undergoing rotary motion, displayed in a circular annulus. The model matches psychophysical observer performance with respect to most parameters. It is able to replicate some key psychophysical findings such as invariance of observer performance to dot density in the display, and decrease of observer performance with frame duration of the display.Associated with the concept of rotary motion is the notion of a center about which rotation occurs. One might think that for accurate estimation of rotary motion in the display, this center must be accurately known. A simple vector analysis reveals that this need not be the case. Numerical simulations confirm this result, and may explain the position invariance of MST(d cells. Position invariance is the experimental finding that rotary motion sensitive cells are insensitive to where in their receptive field rotation occurs.When all the dots in the display are randomly drawn from a uniform distribution, illusory rotary motion is perceived. This case was investigated by Rose & Blake previously, who termed the illusory rotary motion the omega effect. Two important experimental findings are reported concerning this effect. First, although the display of random dots evokes perception of rotary motion, the direction of motion perceived does not depend on what dot pattern is shown. Second, the time interval between spontaneous flips in perceived direction is lognormally distributed (mode approximately 2 s. These findings suggest the omega effect fits in the category of a typical bistable illusion, and therefore the processes that give rise to this illusion may be the same processes that underlie much of other bistable phenomenon.

  7. Volume Estimates in Chronic Hemodialysis Patients by the Watson Equation and Bioimpedance Spectroscopy and the Impact on the Kt/Vurea calculation.

    Science.gov (United States)

    Noori, Nazanin; Wald, Ron; Sharma Parpia, Arti; Goldstein, Marc B

    2018-01-01

    Accurate assessment of total body water (TBW) is essential for the evaluation of dialysis adequacy (Kt/V urea ). The Watson formula, which is recommended for the calculation of TBW, was derived in healthy volunteers thereby leading to potentially inaccurate TBW estimates in maintenance hemodialysis recipients. Bioimpedance spectroscopy (BIS) may be a robust alternative for the measurement of TBW in hemodialysis recipients. The primary objective of this study was to evaluate the accuracy of Watson formula-derived TBW estimates as compared with TBW measured with BIS. Second, we aimed to identify the anthropometric characteristics that are most likely to generate inaccuracy when using the Watson formula to calculate TBW. Finally, we derived novel anthropometric equations for the more accurate estimation of TBW. This was a cross-sectional study of prevalent in-center HD patients at St Michael's Hospital. One hundred eighty-four hemodialysis patients (109 men and 75 women) were evaluated in this study. Anthropometric measurements including weight, height, waist circumference, midarm circumference, and 4-site skinfold (biceps, triceps, subscapular, and suprailiac) thickness were measured; fat mass was measured using the formula by Durnin and Womersley. We measured TBW by BIS using the Body Composition Monitor (Fresenius Medical Care, Bad Homburg, Germany). We used the Bland-Altman method to calculate the difference between the TBW derived from the Watson method and the BIS. To derive new equations for TBW estimation, Pearson's correlation coefficients between BIS-TBW (the reference test) and other variables were examined. We used the least squares regression analysis to develop parsimonious equations to predict TBW. TBW values based on the Watson method had a high correlation with BIS-TBW (correlation coefficients = 0.87 and P Watson formula overestimated TBW by 5.1 (4.5-5.8) liters and 3.8 (3.0-4.5) liters, in men and women, respectively. Higher fat mass and waist

  8. Does the Watson-Jones or Modified Smith-Petersen Approach Provide Superior Exposure for Femoral Neck Fracture Fixation?

    Science.gov (United States)

    Lichstein, Paul M; Kleimeyer, John P; Githens, Michael; Vorhies, John S; Gardner, Michael J; Bellino, Michael; Bishop, Julius

    2018-04-24

    A well-reduced femoral neck fracture is more likely to heal than a poorly reduced one, and increasing the quality of the surgical exposure makes it easier to achieve anatomic fracture reduction. Two open approaches are in common use for femoral neck fractures, the modified Smith-Petersen and Watson-Jones; however, to our knowledge, the quality of exposure of the femoral neck exposure provided by each approach has not been investigated. (1) What is the respective area of exposed femoral neck afforded by the Watson-Jones and modified Smith-Petersen approaches? (2) Is there a difference in the ability to visualize and/or palpate important anatomic landmarks provided by the Watson-Jones and modified Smith-Petersen approaches? Ten fresh-frozen human pelvi underwent both modified Smith-Petersen (utilizing the caudal extent of the standard Smith-Petersen interval distal to the anterosuperior iliac spine and parallel to the palpable interval between the tensor fascia lata and the sartorius) and Watson-Jones approaches. Dissections were performed by three fellowship-trained orthopaedic traumatologists with extensive experience in both approaches. Exposure (in cm) was quantified with calibrated digital photographs and specialized software. Modified Smith-Petersen approaches were analyzed before and after rectus femoris tenotomy. The ability to visualize and palpate seven clinically relevant anatomic structures (the labrum, femoral head, subcapital femoral neck, basicervical femoral neck, greater trochanter, lesser trochanter, and medial femoral neck) was also recorded. The quantified area of the exposed proximal femur was utilized to compare which approach afforded the largest field of view of the femoral neck and articular surface for assessment of femoral neck fracture and associated femoral head injury. The ability to visualize and palpate surrounding structures was assessed so that we could better understand which approach afforded the ability to assess structures that

  9. William Watson Cheyne (1852-1932): a life in medicine and his innovative surgical treatment of congenital hydrocephalus.

    Science.gov (United States)

    Watson, Caroline C; Griessenauer, Christoph J; Loukas, Marios; Blount, Jeffrey P; Tubbs, R Shane

    2013-11-01

    William Watson Cheyne lived and trained during a period of great advances in medical knowledge and surgical techniques. Despite his various contributions to the fields of bacteriology and surgery, little is known about his career or his life apart from his affiliations with Joseph Lister. This article aims to identify Cheyne as a pioneer in the treatment of congenital hydrocephalus and sheds light on the man who existed in Lister's shadow for most of his life. Cheyne's technique for surgical intervention of hydrocephalus was a great turning point and contributes to the current treatment strategy utilized today for hydrocephalus.

  10. Dissociation of single-strand DNA: single-walled carbon nanotube hybrids by Watson-Crick base-pairing.

    Science.gov (United States)

    Jung, Seungwon; Cha, Misun; Park, Jiyong; Jeong, Namjo; Kim, Gunn; Park, Changwon; Ihm, Jisoon; Lee, Junghoon

    2010-08-18

    It has been known that single-strand DNA wraps around a single-walled carbon nanotube (SWNT) by pi-stacking. In this paper it is demonstrated that such DNA is dissociated from the SWNT by Watson-Crick base-pairing with a complementary sequence. Measurement of field effect transistor characteristics indicates a shift of the electrical properties as a result of this "unwrapping" event. We further confirm the suggested process through Raman spectroscopy and gel electrophoresis. Experimental results are verified in view of atomistic mechanisms with molecular dynamics simulations and binding energy analyses.

  11. Metal-mediated DNA base pairing: alternatives to hydrogen-bonded Watson-Crick base pairs.

    Science.gov (United States)

    Takezawa, Yusuke; Shionoya, Mitsuhiko

    2012-12-18

    With its capacity to store and transfer the genetic information within a sequence of monomers, DNA forms its central role in chemical evolution through replication and amplification. This elegant behavior is largely based on highly specific molecular recognition between nucleobases through the specific hydrogen bonds in the Watson-Crick base pairing system. While the native base pairs have been amazingly sophisticated through the long history of evolution, synthetic chemists have devoted considerable efforts to create alternative base pairing systems in recent decades. Most of these new systems were designed based on the shape complementarity of the pairs or the rearrangement of hydrogen-bonding patterns. We wondered whether metal coordination could serve as an alternative driving force for DNA base pairing and why hydrogen bonding was selected on Earth in the course of molecular evolution. Therefore, we envisioned an alternative design strategy: we replaced hydrogen bonding with another important scheme in biological systems, metal-coordination bonding. In this Account, we provide an overview of the chemistry of metal-mediated base pairing including basic concepts, molecular design, characteristic structures and properties, and possible applications of DNA-based molecular systems. We describe several examples of artificial metal-mediated base pairs, such as Cu(2+)-mediated hydroxypyridone base pair, H-Cu(2+)-H (where H denotes a hydroxypyridone-bearing nucleoside), developed by us and other researchers. To design the metallo-base pairs we carefully chose appropriate combinations of ligand-bearing nucleosides and metal ions. As expected from their stronger bonding through metal coordination, DNA duplexes possessing metallo-base pairs exhibited higher thermal stability than natural hydrogen-bonded DNAs. Furthermore, we could also use metal-mediated base pairs to construct or induce other high-order structures. These features could lead to metal-responsive functional

  12. Direct NMR Evidence that Transient Tautomeric and Anionic States in dG·dT Form Watson-Crick-like Base Pairs.

    Science.gov (United States)

    Szymanski, Eric S; Kimsey, Isaac J; Al-Hashimi, Hashim M

    2017-03-29

    The replicative and translational machinery utilizes the unique geometry of canonical G·C and A·T/U Watson-Crick base pairs to discriminate against DNA and RNA mismatches in order to ensure high fidelity replication, transcription, and translation. There is growing evidence that spontaneous errors occur when mismatches adopt a Watson-Crick-like geometry through tautomerization and/or ionization of the bases. Studies employing NMR relaxation dispersion recently showed that wobble dG·dT and rG·rU mismatches in DNA and RNA duplexes transiently form tautomeric and anionic species with probabilities (≈0.01-0.40%) that are in concordance with replicative and translational errors. Although computational studies indicate that these exceptionally short-lived and low-abundance species form Watson-Crick-like base pairs, their conformation could not be directly deduced from the experimental data, and alternative pairing geometries could not be ruled out. Here, we report direct NMR evidence that the transient tautomeric and anionic species form hydrogen-bonded Watson-Crick-like base pairs. A guanine-to-inosine substitution, which selectively knocks out a Watson-Crick-type (G)N2H 2 ···O2(T) hydrogen bond, significantly destabilized the transient tautomeric and anionic species, as assessed by lack of any detectable chemical exchange by imino nitrogen rotating frame spin relaxation (R 1ρ ) experiments. An 15 N R 1ρ NMR experiment targeting the amino nitrogen of guanine (dG-N2) provides direct evidence for Watson-Crick (G)N2H 2 ···O2(T) hydrogen bonding in the transient tautomeric state. The strategy presented in this work can be generally applied to examine hydrogen-bonding patterns in nucleic acid transient states including in other tautomeric and anionic species that are postulated to play roles in replication and translational errors.

  13. Quasi-four-particle first-order Faddeev-Watson-Lovelace terms in proton-helium scattering

    Science.gov (United States)

    Safarzade, Zohre; Akbarabadi, Farideh Shojaei; Fathi, Reza; Brunger, Michael J.; Bolorizadeh, Mohammad A.

    2017-06-01

    The Faddeev-Watson-Lovelace equations, which are typically used for solving three-particle scattering problems, are based on the assumption of target having one active electron while the other electrons remain passive during the collision process. So, in the case of protons scattering from helium or helium-like targets, in which there are two bound-state electrons, the passive electron has a static role in the collision channel to be studied. In this work, we intend to assign a dynamic role to all the target electrons, as they are physically active in the collision. By including an active role for the second electron in proton-helium-like collisions, a new form of the Faddeev-Watson-Lovelace integral equations is needed, in which there is no disconnected kernel. We consider the operators and the wave functions associated with the electrons to obey the Pauli exclusion principle, as the electrons are indistinguishable. In addition, a quasi-three-particle collision is assumed in the initial channel, where the electronic cloud is represented as a single identity in the collision.

  14. RNAHelix: computational modeling of nucleic acid structures with Watson-Crick and non-canonical base pairs.

    Science.gov (United States)

    Bhattacharyya, Dhananjay; Halder, Sukanya; Basu, Sankar; Mukherjee, Debasish; Kumar, Prasun; Bansal, Manju

    2017-02-01

    Comprehensive analyses of structural features of non-canonical base pairs within a nucleic acid double helix are limited by the availability of a small number of three dimensional structures. Therefore, a procedure for model building of double helices containing any given nucleotide sequence and base pairing information, either canonical or non-canonical, is seriously needed. Here we describe a program RNAHelix, which is an updated version of our widely used software, NUCGEN. The program can regenerate duplexes using the dinucleotide step and base pair orientation parameters for a given double helical DNA or RNA sequence with defined Watson-Crick or non-Watson-Crick base pairs. The original structure and the corresponding regenerated structure of double helices were found to be very close, as indicated by the small RMSD values between positions of the corresponding atoms. Structures of several usual and unusual double helices have been regenerated and compared with their original structures in terms of base pair RMSD, torsion angles and electrostatic potentials and very high agreements have been noted. RNAHelix can also be used to generate a structure with a sequence completely different from an experimentally determined one or to introduce single to multiple mutation, but with the same set of parameters and hence can also be an important tool in homology modeling and study of mutation induced structural changes.

  15. Spatial, Hysteretic, and Adaptive Host-Guest Chemistry in a Metal-Organic Framework with Open Watson-Crick Sites.

    Science.gov (United States)

    Cai, Hong; Li, Mian; Lin, Xiao-Rong; Chen, Wei; Chen, Guang-Hui; Huang, Xiao-Chun; Li, Dan

    2015-09-01

    Biological and artificial molecules and assemblies capable of supramolecular recognition, especially those with nucleobase pairing, usually rely on autonomous or collective binding to function. Advanced site-specific recognition takes advantage of cooperative spatial effects, as in local folding in protein-DNA binding. Herein, we report a new nucleobase-tagged metal-organic framework (MOF), namely ZnBTCA (BTC=benzene-1,3,5-tricarboxyl, A=adenine), in which the exposed Watson-Crick faces of adenine residues are immobilized periodically on the interior crystalline surface. Systematic control experiments demonstrated the cooperation of the open Watson-Crick sites and spatial effects within the nanopores, and thermodynamic and kinetic studies revealed a hysteretic host-guest interaction attributed to mild chemisorption. We further exploited this behavior for adenine-thymine binding within the constrained pores, and a globally adaptive response of the MOF host was observed. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  16. Crystal structure of an intermolecular 2:1 complex between adenine and thymine. Evidence for both Hoogsteen and 'quasi-Watson-Crick' interactions.

    Science.gov (United States)

    Chandrasekhar, Sosale; Naik, Tangali R Ravikumar; Nayak, Susanta K; Row, Tayur N Guru

    2010-06-15

    The titled complex, obtained by co-crystallization (EtOH/25 degrees C), is apparently the only known complex of the free bases. Its crystal structure, as determined by X-ray diffraction at both 90 K and 313 K, showed that one A-T pair involves a Hoogsteen interaction, and the other a Watson-Crick interaction but only with respect to the adenine unit. The absence of a clear-cut Watson-Crick base pair raises intriguing questions about the basis of the DNA double helix. Copyright 2010 Elsevier Ltd. All rights reserved.

  17. The Vision of "Industrie 4.0" in the Making-a Case of Future Told, Tamed, and Traded.

    Science.gov (United States)

    Pfeiffer, Sabine

    2017-01-01

    Since industrial trade fair Hannover Messe 2011, the term "Industrie 4.0" has ignited a vision of a new Industrial Revolution and has been inspiring a lively, ongoing debate among the German public about the future of work, and hence society, ever since. The discourse around this vision of the future eventually spread to other countries, with public awareness reaching a temporary peak in 2016 when the World Economic Forum's meeting in Davos was held with the motto "Mastering the Fourth Industrial Revolution." How is it possible for a vision originally established by three German engineers to unfold and bear fruit at a global level in such a short period of time? This article begins with a summary of the key ideas that are discussed under the label Industrie 4.0. The main purpose, based on an in-depth discourse analysis, is to debunk the myth about the origin of this powerful vision and to trace the narrative back to the global economic crisis in 2009 and thus to the real actors, central discourse patterns, and hidden intentions of this vision of a new Industrial Revolution. In conclusion, the discourse analysis reveals that this is not a case of visioneering but one of a future told, tamed, and traded.

  18. [History lived, history told: Psychiatrists' perspectives on the development of the department of Psychiatry of the University of Montreal].

    Science.gov (United States)

    Younsi, Ouanessa

    2015-01-01

    We have interviewed psychiatrists from different generations at the Département de psychiatrie de l'Université de Montréal to discern the history lived and told by those who have made (and still make) the history of the Department. The goal of this approach was to grasp the past in order to enlighten the future of the Département de psychiatrie de l'Université de Montréal. Thirteen psychiatrists of the department have been interviewed about their perspective on the history of the Département de psychiatrie de l'Université de Montréal. Interviews have identified an issue in the communication of history among the Department. Indeed, most of the younger psychiatrists were not aware of some of the main events and figures which were part of the development of the Department. The older psychiatrists mention Dr Camille Laurin as an important figure of the Department's early stages. Psychotherapy, education and clinical practice appear as key aspects of the Department's history. Many aspects of the Department's history appear unknown to the younger psychiatrists. A course on History of Psychiatry, including the Department's history, would be a great addition to the psychiatry residency program.

  19. Sources of solutes to the proglacial Watson River (Akuliarusiarsuup Kuua) near Kangerlussuaq, West Greenland

    Science.gov (United States)

    Deuerling, K. M.; Martin, J. B.; Martin, E. E.; Scribner, C. A.

    2013-12-01

    Chemical weathering of silicate rocks in glacial forelands is a potential sink for atmospheric CO2 and therefore may impact long-term climate variability. Physical weathering in glacial environments enhances the rate of chemical weathering, particularly through subglacial production of rock flour with a high surface area to volume ratio. This reactive material is transported to and chemically weathered within the proglacial system, increasing concentrations of solutes as water flows downstream. Water from proglacial rivers may also acquire solutes and draw down atmospheric CO2 through reactions driven by hyporheic zone (HZ) exchange in the broad, braided reaches of the river channel. However, few studies have addressed this process and none to date have directly examined porewater contributions. We address these questions in the Watson River/Akuliarusiarsuup Kuua (WR), which flows approximately 40 km from its headwaters, through the town of Kangerlussuaq, and into Søndre Strømfjord. We have collected river water samples five times from six sites over the 2012 and 2013 summer melt seasons and three transects of PW from sand flats located along the river. Specific conductivity (SpC), pH, and dissolved ion concentrations increase downstream, consistent with ongoing chemical weathering reactions along the flow path. Relative abundances of Na+, K+, and SiO2 increase downstream relative to Ca2+ and Mg2+ concentrations. These signals indicate preferential dissolution of biotite and/or alkali feldspar. Additionally, 206Pb/204Pb ratios become more nonradiogenic downstream, lending further evidence to dissolution of readily weathered minerals. Over the course of the melt season, SpC, pH, and dissolved ion concentrations decrease, consistent with the increase in discharge due to supraglacial melting. The greatest downstream SpC increase (~2x) occurs where the river exits largely bedrock channeled flow and enters the braided portion at the Sandflugtdalen. In general, PW

  20. Automatic Determination of the Need for Intravenous Contrast in Musculoskeletal MRI Examinations Using IBM Watson's Natural Language Processing Algorithm.

    Science.gov (United States)

    Trivedi, Hari; Mesterhazy, Joseph; Laguna, Benjamin; Vu, Thienkhai; Sohn, Jae Ho

    2018-04-01

    Magnetic resonance imaging (MRI) protocoling can be time- and resource-intensive, and protocols can often be suboptimal dependent upon the expertise or preferences of the protocoling radiologist. Providing a best-practice recommendation for an MRI protocol has the potential to improve efficiency and decrease the likelihood of a suboptimal or erroneous study. The goal of this study was to develop and validate a machine learning-based natural language classifier that can automatically assign the use of intravenous contrast for musculoskeletal MRI protocols based upon the free-text clinical indication of the study, thereby improving efficiency of the protocoling radiologist and potentially decreasing errors. We utilized a deep learning-based natural language classification system from IBM Watson, a question-answering supercomputer that gained fame after challenging the best human players on Jeopardy! in 2011. We compared this solution to a series of traditional machine learning-based natural language processing techniques that utilize a term-document frequency matrix. Each classifier was trained with 1240 MRI protocols plus their respective clinical indications and validated with a test set of 280. Ground truth of contrast assignment was obtained from the clinical record. For evaluation of inter-reader agreement, a blinded second reader radiologist analyzed all cases and determined contrast assignment based on only the free-text clinical indication. In the test set, Watson demonstrated overall accuracy of 83.2% when compared to the original protocol. This was similar to the overall accuracy of 80.2% achieved by an ensemble of eight traditional machine learning algorithms based on a term-document matrix. When compared to the second reader's contrast assignment, Watson achieved 88.6% agreement. When evaluating only the subset of cases where the original protocol and second reader were concordant (n = 251), agreement climbed further to 90.0%. The classifier was

  1. Assessing the Watson-Barker Listening Test (WBLT)-Form C in Measuring Listening Comprehension of Post-Secondary Hispanic-American Students

    Science.gov (United States)

    Worthington, Debra L.; Keaton, Shaughan; Cook, John; Fitch-Hauser, Margaret; Powers, William G.

    2014-01-01

    The Watson-Barker Listening Test (WBLT) is one of the most popular measures of listening comprehension. However, participants in studies utilizing this scale have been almost exclusively Anglo-American. At the same time, previous research questions the psychometric properties of the test. This study addressed both of these issues by testing the…

  2. Immersion in the Field: The Elementary Block Network in the Watson College of Education at the University of North Carolina Wilmington

    Science.gov (United States)

    Roseboro, Donyell; Lewis, Somer; Buchanan, Lisa; Higgins, Heidi; Schlichting, Katie; Brinkley, Brian

    2014-01-01

    In 1989, the Watson College of Education at the University of North Carolina Wilmington started the Model Clinical Teaching Project and the Consortium for the Advancement of Public Education's School Reform Initiative (CAPE). Since that time, the partnership system has grown to include 146 schools across twelve traditional school districts and…

  3. Wobble↔Watson-Crick tautomeric transitions in the homo-purine DNA mismatches: a key to the intimate mechanisms of the spontaneous transversions.

    Science.gov (United States)

    Brovarets', Ol'ha O; Hovorun, Dmytro M

    2015-01-01

    The intrinsic capability of the homo-purine DNA base mispairs to perform wobble↔Watson-Crick/Topal-Fresco tautomeric transitions via the sequential intrapair double proton transfer was discovered for the first time using QM (MP2/DFT) and QTAIM methodologies that are crucial for understanding the microstructural mechanisms of the spontaneous transversions.

  4. Principles of RNA base pairing: Structures and energies of cis and trans-Watson-Crick/Sugar Edge base pairs revealed by quantum chemical calculations

    Czech Academy of Sciences Publication Activity Database

    Šponer, Judit E.; Leszczynski, J.; Šponer, Jiří

    2005-01-01

    Roč. 22, č. 6 (2005), s. 826 ISSN 0739-1102. [Albany 2005. Conversation /14./. 14.06.2005-18.06.2005, Albany] Institutional research plan: CEZ:AV0Z50040507 Keywords : RNA base pairing * DNA * Watson-Crick/Sugar Edge Subject RIV: BO - Biophysics

  5. Various extraction methods influence the adhesive properties of DDGS .... pennycress (Thlaspi arvense L.) and lesquerella (Lesquerella fendleri A. Gary (S. Watson) in the fabrication of lignocellulosic composites

    Science.gov (United States)

    Lignocellulosic composite (LC) panels were fabricated using an adhesive matrix prepared from three different agricultural by-products: dried distillers grains with solubles (DDGS), pennycress (Thlaspi arvense L.) press cake (PPC) or lesquerella (Lesquerella fendleri A. Gary (S. Watson) press cake (L...

  6. Silver(I)-Mediated Base Pairs in DNA Sequences Containing 7-Deazaguanine/Cytosine: towards DNA with Entirely Metallated Watson-Crick Base Pairs.

    Science.gov (United States)

    Méndez-Arriaga, José M; Maldonado, Carmen R; Dobado, José A; Galindo, Miguel A

    2018-03-26

    DNA sequences comprising noncanonical 7-deazaguanine ( 7C G) and canonical cytosine (C) are capable of forming Watson-Crick base pairs via hydrogen bonds as well as silver(I)-mediated base pairs by coordination to central silver(I) ions. Duplexes I and II containing 7C G and C have been synthesized and characterized. The incorporation of silver(I) ions into these duplexes has been studied by means of temperature-dependent UV spectroscopy, circular dichroism, and DFT calculations. The results suggest the formation of DNA molecules comprising contiguous metallated 7C G-Ag I -C Watson-Crick base pairs that preserve the original B-type conformation. Furthermore, additional studies performed on duplex III indicated that, in the presence of Ag I ions, 7C G-C and 7C A-T Watson-Crick base pairs ( 7C A, 7-deazadenine; T, thymine) can be converted to metallated 7C G-Ag I -C and 7C A-Ag I -T base pairs inside the same DNA molecule whilst maintaining its initial double helix conformation. These findings are very important for the development of customized silver-DNA nanostructures based on a Watson-Crick complementarity pattern. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  7. Effect of electronic coupling of Watson-Crick hopping in DNA poly(dA)-poly(dT)

    Science.gov (United States)

    Risqi, A. M.; Yudiarsah, E.

    2017-07-01

    Charge transport properties of poly(dA)-poly(dT) DNA has been studied by using thigh binding Hamiltonian approach. Molecule DNA that we use consist of 32 base pair of adenine (A) and thymine (T) and backbone is consist of phosphate and sugar. The molecule DNA is contacted electrode at both ends. Charge transport in molecule DNA depend on the environment, we studied the effect of electronic coupling of Watson-Crick hopping in poly(dA)-poly(dT) DNA to transmission probability and characteristic I-V. The electronic coupling constant influence charge transport between adenine-thymine base pairs at the same site. Transmission probability is studied by using transfer matrix and scattering matrix method, and the result of transmission probability is used to calculate the characteristic I-V by using formula Landauer Buttiker. The result shows that when the electronic coupling increase then transmission probability and characteristic I-V increase slightly.

  8. An unusual mode of DNA duplex association: Watson-Crick interaction of all-purine deoxyribonucleic acids.

    Science.gov (United States)

    Battersby, Thomas R; Albalos, Maria; Friesenhahn, Michel J

    2007-05-01

    Nucleic acid duplexes associating through purine-purine base pairing have been constructed and characterized in a remarkable demonstration of nucleic acids with mixed sequence and a natural backbone in an alternative duplex structure. The antiparallel deoxyribose all-purine duplexes associate specifically through Watson-Crick pairing, violating the nucleobase size-complementarity pairing convention found in Nature. Sequence-specific recognition displayed by these structures makes the duplexes suitable, in principle, for information storage and replication fundamental to molecular evolution in all living organisms. All-purine duplexes can be formed through association of purines found in natural ribonucleosides. Key to the formation of these duplexes is the N(3)-H tautomer of isoguanine, preferred in the duplex, but not in aqueous solution. The duplexes have relevance to evolution of the modern genetic code and can be used for molecular recognition of natural nucleic acids.

  9. Fingerprints of Both Watson-Crick and Hoogsteen Isomers of the Isolated (Cytosine-Guanine)H+ Pair.

    Science.gov (United States)

    Cruz-Ortiz, Andrés F; Rossa, Maximiliano; Berthias, Francis; Berdakin, Matías; Maitre, Philippe; Pino, Gustavo A

    2017-11-16

     Gas phase protonated guanine-cytosine (CGH + ) pair was generated using an electrospray ionization source from solutions at two different pH (5.8 and 3.2). Consistent evidence from MS/MS fragmentation patterns and differential ion mobility spectra (DIMS) point toward the presence of two isomers of the CGH + pair, whose relative populations depend strongly on the pH of the solution. Gas phase infrared multiphoton dissociation (IRMPD) spectroscopy in the 900-1900 cm -1 spectral range further confirms that the Watson-Crick isomer is preferentially produced (91%) at pH = 5.8, while the Hoogsteen isomer predominates (66%) at pH = 3.2). These fingerprint signatures are expected to be useful for the development of new analytical methodologies and to trigger isomer selective photochemical studies of protonated DNA base pairs.

  10. Case Study: IBM Watson Analytics Cloud Platform as Analytics-as-a-Service System for Heart Failure Early Detection

    Directory of Open Access Journals (Sweden)

    Gabriele Guidi

    2016-07-01

    Full Text Available In the recent years the progress in technology and the increasing availability of fast connections have produced a migration of functionalities in Information Technologies services, from static servers to distributed technologies. This article describes the main tools available on the market to perform Analytics as a Service (AaaS using a cloud platform. It is also described a use case of IBM Watson Analytics, a cloud system for data analytics, applied to the following research scope: detecting the presence or absence of Heart Failure disease using nothing more than the electrocardiographic signal, in particular through the analysis of Heart Rate Variability. The obtained results are comparable with those coming from the literature, in terms of accuracy and predictive power. Advantages and drawbacks of cloud versus static approaches are discussed in the last sections.

  11. Critique of the Watson-Glaser Critical Thinking Appraisal Test: The More You Know, the Lower Your Score

    Directory of Open Access Journals (Sweden)

    Kevin Possin

    2014-12-01

    Full Text Available The Watson-Glaser Critical Thinking Appraisal Test is one of the oldest, most frequently used, multiple-choice critical-thinking tests on the market in business, government, and legal settings for purposes of hiring and promotion. I demonstrate, however, that the test has serious construct-validity issues, stemming primarily from its ambiguous, unclear, misleading, and sometimes mysterious instructions, which have remained unaltered for decades. Erroneously scored items further diminish the test’s validity. As a result, having enhanced knowledge of formal and informal logic could well result in test subjects receiving lower scores on the test. That’s not how things should work for a CT assessment test.

  12. Structural variability and the nature of intermolecular interactions in Watson-Crick B-DNA base pairs.

    Science.gov (United States)

    Czyznikowska, Z; Góra, R W; Zaleśny, R; Lipkowski, P; Jarzembska, K N; Dominiak, P M; Leszczynski, J

    2010-07-29

    A set of nearly 100 crystallographic structures was analyzed using ab initio methods in order to verify the effect of the conformational variability of Watson-Crick guanine-cytosine and adenine-thymine base pairs on the intermolecular interaction energy and its components. Furthermore, for the representative structures, a potential energy scan of the structural parameters describing mutual orientation of the base pairs was carried out. The results were obtained using the hybrid variational-perturbational interaction energy decomposition scheme. The electron correlation effects were estimated by means of the second-order Møller-Plesset perturbation theory and coupled clusters with singles and doubles method adopting AUG-cc-pVDZ basis set. Moreover, the characteristics of hydrogen bonds in complexes, mimicking those appearing in B-DNA, were evaluated using topological analysis of the electron density. Although the first-order electrostatic energy is usually the largest stabilizing component, it is canceled out by the associated exchange repulsion in majority of the studied crystallographic structures. Therefore, the analyzed complexes of the nucleic acid bases appeared to be stabilized mainly by the delocalization component of the intermolecular interaction energy which, in terms of symmetry adapted perturbation theory, encompasses the second- and higher-order induction and exchange-induction terms. Furthermore, it was found that the dispersion contribution, albeit much smaller in terms of magnitude, is also a vital stabilizing factor. It was also revealed that the intermolecular interaction energy and its components are strongly influenced by four (out of six) structural parameters describing mutual orientation of bases in Watson-Crick pairs, namely shear, stagger, stretch, and opening. Finally, as a part of a model study, much of the effort was devoted to an extensive testing of the UBDB databank. It was shown that the databank quite successfully reproduces the

  13. How many tautomerization pathways connect Watson-Crick-like G*·T DNA base mispair and wobble mismatches?

    Science.gov (United States)

    Brovarets', Ol'ha O; Hovorun, Dmytro M

    2015-01-01

    In this study, we have theoretically demonstrated the intrinsic ability of the wobble G·T(w)/G*·T*(w)/G·T(w1)/G·T(w2) and Watson-Crick-like G*·T(WC) DNA base mispairs to interconvert into each other via the DPT tautomerization. We have established that among all these transitions, only one single G·T(w) ↔ G*·T(WC) pathway is eligible from a biological perspective. It involves short-lived intermediate - the G·T*(WC) base mispair - and is governed by the planar, highly stable, and zwitterionic [Formula: see text] transition state stabilized by the participation of the unique pattern of the five intermolecular O6(+)H⋯O4(-), O6(+)H⋯N3(-), N1(+)H⋯N3(-), N1(+)H⋯O2(-), and N2(+)H⋯O2(-) H-bonds. This non-dissociative G·T(w) ↔ G*·T(WC) tautomerization occurs without opening of the pair: Bases within mispair remain connected by 14 different patterns of the specific intermolecular interactions that successively change each other along the IRC. Novel kinetically controlled mechanism of the thermodynamically non-equilibrium spontaneous point GT/TG incorporation errors has been suggested. The mutagenic effect of the analogues of the nucleotide bases, in particular 5-bromouracil, can be attributed to the decreasing of the barrier of the acquisition by the wobble pair containing these compounds of the enzymatically competent Watson-Crick's geometry via the intrapair mutagenic tautomerization directly in the essentially hydrophobic recognition pocket of the replication DNA-polymerase machinery. Proposed approaches are able to explain experimental data, namely growth of the rate of the spontaneous point incorporation errors during DNA biosynthesis with increasing temperature.

  14. Artificial intelligence in neurodegenerative disease research: use of IBM Watson to identify additional RNA-binding proteins altered in amyotrophic lateral sclerosis.

    Science.gov (United States)

    Bakkar, Nadine; Kovalik, Tina; Lorenzini, Ileana; Spangler, Scott; Lacoste, Alix; Sponaugle, Kyle; Ferrante, Philip; Argentinis, Elenee; Sattler, Rita; Bowser, Robert

    2018-02-01

    Amyotrophic lateral sclerosis (ALS) is a devastating neurodegenerative disease with no effective treatments. Numerous RNA-binding proteins (RBPs) have been shown to be altered in ALS, with mutations in 11 RBPs causing familial forms of the disease, and 6 more RBPs showing abnormal expression/distribution in ALS albeit without any known mutations. RBP dysregulation is widely accepted as a contributing factor in ALS pathobiology. There are at least 1542 RBPs in the human genome; therefore, other unidentified RBPs may also be linked to the pathogenesis of ALS. We used IBM Watson ® to sieve through all RBPs in the genome and identify new RBPs linked to ALS (ALS-RBPs). IBM Watson extracted features from published literature to create semantic similarities and identify new connections between entities of interest. IBM Watson analyzed all published abstracts of previously known ALS-RBPs, and applied that text-based knowledge to all RBPs in the genome, ranking them by semantic similarity to the known set. We then validated the Watson top-ten-ranked RBPs at the protein and RNA levels in tissues from ALS and non-neurological disease controls, as well as in patient-derived induced pluripotent stem cells. 5 RBPs previously unlinked to ALS, hnRNPU, Syncrip, RBMS3, Caprin-1 and NUPL2, showed significant alterations in ALS compared to controls. Overall, we successfully used IBM Watson to help identify additional RBPs altered in ALS, highlighting the use of artificial intelligence tools to accelerate scientific discovery in ALS and possibly other complex neurological disorders.

  15. Effect of Watson-Crick and Hoogsteen base pairing on the conformational stability of C8-phenoxyl-2'-deoxyguanosine adducts.

    Science.gov (United States)

    Millen, Andrea L; Churchill, Cassandra D M; Manderville, Richard A; Wetmore, Stacey D

    2010-10-14

    Bulky DNA addition products (adducts) formed through attack at the C8 site of guanine can adopt the syn orientation about the glycosidic bond due to changes in conformational stability or hydrogen-bonding preferences directly arising from the bulky group. Indeed, the bulky substituent may improve the stability of (non-native) Hoogsteen pairs. Therefore, such adducts often result in mutations upon DNA replication. This work examines the hydrogen-bonded pairs between the Watson-Crick and Hoogsteen faces of the ortho or para C8-phenoxyl-2'-deoxyguanosine adduct and each natural (undamaged) nucleobase with the goal to clarify the conformational preference of this type of damage, as well as provide insight into the likelihood of subsequent mutation events. B3LYP/6-311+G(2df,p)//B3LYP/6-31G(d) hydrogen-bond strengths were determined using both nucleobase and nucleoside models for adduct pairs, as well as the corresponding complexes involving natural 2'-deoxyguanosine. In addition to the magnitude of the binding strengths, the R(C1'···C1') distances and ∠(N9C1'C1') angles, as well as the degree of propeller-twist and buckle distortions, were carefully compared to the values observed in natural DNA strands. Due to structural changes in the adduct monomer upon inclusion of the sugar moiety, the monomer deformation energy significantly affects the relative hydrogen-bond strengths calculated with the nucleobase and nucleoside models. Therefore, we recommend the use of at least a nucleoside model to accurately evaluate hydrogen-bond strengths of base pairs involving flexible, bulky nucleobase adducts. Our results also emphasize the importance of considering both the magnitude of the hydrogen-bond strength and the structure of the base pair when predicting the preferential binding patterns of nucleobases. Using our best models, we conclude that the Watson-Crick face of the ortho phenoxyl adduct forms significantly more stable complexes than the Hoogsteen face, which

  16. UK Institute of Physics (IOP) President Sir Gareth Roberts (right) at CERN on 9 July with (right to left) IOP council vice-president and distinguished physicist Peter Kalmus, CERN engineer Tim Watson and IOP director of science Peter Cooper

    CERN Multimedia

    Patrice Loiez

    1999-01-01

    UK Institute of Physics (IOP) President Sir Gareth Roberts (right) at CERN on 9 July with (right to left) IOP council vice-president and distinguished physicist Peter Kalmus, CERN engineer Tim Watson and IOP director of science Peter Cooper

  17. Mass of 17O from Penning-trap mass spectrometry and molecular spectroscopy: A precision test of the Dunham-Watson model in carbon monoxide

    International Nuclear Information System (INIS)

    Mount, Brianna J.; Redshaw, Matthew; Myers, Edmund G.; Mueller, Holger S. P.

    2010-01-01

    By fitting the Dunham-Watson model to extensive rotational and vibrational spectroscopic data of isotopic variants of CO, and by using existing precise masses of 13 C, 16 O, and 18 O from Penning-trap mass spectrometry, we determine the atomic mass of 17 O to be M[ 17 O]=16.999 131 644(30) u, where the uncertainty is purely statistical. Using Penning-trap mass spectrometry, we have also directly determined the atomic mass of 17 O with the more precise result M[ 17 O]=16.999 131 756 6(9) u. The Dunham-Watson model applied to the molecular spectroscopic data hence predicts the mass of 17 O to better than 1 part in 10 8 .

  18. Accommodation of an N-(deoxyguanosin-8-yl)-2-acetylaminofluorene adduct in the active site of human DNA polymerase iota: Hoogsteen or Watson-Crick base pairing?

    Science.gov (United States)

    Donny-Clark, Kerry; Shapiro, Robert; Broyde, Suse

    2009-01-13

    Bypass across DNA lesions by specialized polymerases is essential for maintenance of genomic stability. Human DNA polymerase iota (poliota) is a bypass polymerase of the Y family. Crystal structures of poliota suggest that Hoogsteen base pairing is employed to bypass minor groove DNA lesions, placing them on the spacious major groove side of the enzyme. Primer extension studies have shown that poliota is also capable of error-free nucleotide incorporation opposite the bulky major groove adduct N-(deoxyguanosin-8-yl)-2-acetylaminofluorene (dG-AAF). We present molecular dynamics simulations and free energy calculations suggesting that Watson-Crick base pairing could be employed in poliota for bypass of dG-AAF. In poliota with Hoogsteen-paired dG-AAF the bulky AAF moiety would reside on the cramped minor groove side of the template. The Hoogsteen-capable conformation distorts the active site, disrupting interactions necessary for error-free incorporation of dC opposite the lesion. Watson-Crick pairing places the AAF rings on the spacious major groove side, similar to the position of minor groove adducts observed with Hoogsteen pairing. Watson-Crick-paired structures show a well-ordered active site, with a near reaction-ready ternary complex. Thus our results suggest that poliota would utilize the same spacious region for lesion bypass of both major and minor groove adducts. Therefore, purine adducts with bulk on the minor groove side would use Hoogsteen pairing, while adducts with the bulky lesion on the major groove side would utilize Watson-Crick base pairing as indicated by our MD simulations for dG-AAF. This suggests the possibility of an expanded role for poliota in lesion bypass.

  19. The influence of anharmonic and solvent effects on the theoretical vibrational spectra of the guanine-cytosine base pairs in Watson-Crick and Hoogsteen configurations.

    Science.gov (United States)

    Bende, Attila; Muntean, Cristina M

    2014-03-01

    The theoretical IR and Raman spectra of the guanine-cytosine DNA base pairs in Watson-Crick and Hoogsteen configurations were computed using DFT method with M06-2X meta-hybrid GGA exchange-correlation functional, including the anharmonic corrections and solvent effects. The results for harmonic frequencies and their anharmonic corrections were compared with our previously calculated values obtained with the B3PW91 hybrid GGA functional. Significant differences were obtained for the anharmonic corrections calculated with the two different DFT functionals, especially for the stretching modes, while the corresponding harmonic frequencies did not differ considerable. For the Hoogtseen case the H⁺ vibration between the G-C base pair can be characterized as an asymmetric Duffing oscillator and therefore unrealistic anharmonic corrections for normal modes where this proton vibration is involved have been obtained. The spectral modification due to the anharmonic corrections, solvent effects and the influence of sugar-phosphate group for the Watson-Crick and Hoogsteen base pair configurations, respectively, were also discussed. For the Watson-Crick case also the influence of the stacking interaction on the theoretical IR and Raman spectra was analyzed. Including the anharmonic correction in our normal mode analysis is essential if one wants to obtain correct assignments of the theoretical frequency values as compared with the experimental spectra.

  20. Silver (I) as DNA glue: Ag+-mediated guanine pairing revealed by removing Watson-Crick constraints

    Science.gov (United States)

    Swasey, Steven M.; Leal, Leonardo Espinosa; Lopez-Acevedo, Olga; Pavlovich, James; Gwinn, Elisabeth G.

    2015-01-01

    Metal ion interactions with DNA have far-reaching implications in biochemistry and DNA nanotechnology. Ag+ is uniquely interesting because it binds exclusively to the bases rather than the backbone of DNA, without the toxicity of Hg2+. In contrast to prior studies of Ag+ incorporation into double-stranded DNA, we remove the constraints of Watson-Crick pairing by focusing on homo-base DNA oligomers of the canonical bases. High resolution electro-spray ionization mass spectrometry reveals an unanticipated Ag+-mediated pairing of guanine homo-base strands, with higher stability than canonical guanine-cytosine pairing. By exploring unrestricted binding geometries, quantum chemical calculations find that Ag+ bridges between non-canonical sites on guanine bases. Circular dichroism spectroscopy shows that the Ag+-mediated structuring of guanine homobase strands persists to at least 90 °C under conditions for which canonical guanine-cytosine duplexes melt below 20 °C. These findings are promising for DNA nanotechnology and metal-ion based biomedical science. PMID:25973536

  1. Silver (I) as DNA glue: Ag(+)-mediated guanine pairing revealed by removing Watson-Crick constraints.

    Science.gov (United States)

    Swasey, Steven M; Leal, Leonardo Espinosa; Lopez-Acevedo, Olga; Pavlovich, James; Gwinn, Elisabeth G

    2015-05-14

    Metal ion interactions with DNA have far-reaching implications in biochemistry and DNA nanotechnology. Ag(+) is uniquely interesting because it binds exclusively to the bases rather than the backbone of DNA, without the toxicity of Hg(2+). In contrast to prior studies of Ag(+) incorporation into double-stranded DNA, we remove the constraints of Watson-Crick pairing by focusing on homo-base DNA oligomers of the canonical bases. High resolution electro-spray ionization mass spectrometry reveals an unanticipated Ag(+)-mediated pairing of guanine homo-base strands, with higher stability than canonical guanine-cytosine pairing. By exploring unrestricted binding geometries, quantum chemical calculations find that Ag(+) bridges between non-canonical sites on guanine bases. Circular dichroism spectroscopy shows that the Ag(+)-mediated structuring of guanine homobase strands persists to at least 90 °C under conditions for which canonical guanine-cytosine duplexes melt below 20 °C. These findings are promising for DNA nanotechnology and metal-ion based biomedical science.

  2. Light-emitting self-assembled peptide nucleic acids exhibit both stacking interactions and Watson-Crick base pairing.

    Science.gov (United States)

    Berger, Or; Adler-Abramovich, Lihi; Levy-Sakin, Michal; Grunwald, Assaf; Liebes-Peer, Yael; Bachar, Mor; Buzhansky, Ludmila; Mossou, Estelle; Forsyth, V Trevor; Schwartz, Tal; Ebenstein, Yuval; Frolow, Felix; Shimon, Linda J W; Patolsky, Fernando; Gazit, Ehud

    2015-04-01

    The two main branches of bionanotechnology involve the self-assembly of either peptides or DNA. Peptide scaffolds offer chemical versatility, architectural flexibility and structural complexity, but they lack the precise base pairing and molecular recognition available with nucleic acid assemblies. Here, inspired by the ability of aromatic dipeptides to form ordered nanostructures with unique physical properties, we explore the assembly of peptide nucleic acids (PNAs), which are short DNA mimics that have an amide backbone. All 16 combinations of the very short di-PNA building blocks were synthesized and assayed for their ability to self-associate. Only three guanine-containing di-PNAs-CG, GC and GG-could form ordered assemblies, as observed by electron microscopy, and these di-PNAs efficiently assembled into discrete architectures within a few minutes. The X-ray crystal structure of the GC di-PNA showed the occurrence of both stacking interactions and Watson-Crick base pairing. The assemblies were also found to exhibit optical properties including voltage-dependent electroluminescence and wide-range excitation-dependent fluorescence in the visible region.

  3. Free energy landscape and transition pathways from Watson-Crick to Hoogsteen base pairing in free duplex DNA.

    Science.gov (United States)

    Yang, Changwon; Kim, Eunae; Pak, Youngshang

    2015-09-18

    Houghton (HG) base pairing plays a central role in the DNA binding of proteins and small ligands. Probing detailed transition mechanism from Watson-Crick (WC) to HG base pair (bp) formation in duplex DNAs is of fundamental importance in terms of revealing intrinsic functions of double helical DNAs beyond their sequence determined functions. We investigated a free energy landscape of a free B-DNA with an adenosine-thymine (A-T) rich sequence to probe its conformational transition pathways from WC to HG base pairing. The free energy landscape was computed with a state-of-art two-dimensional umbrella molecular dynamics simulation at the all-atom level. The present simulation showed that in an isolated duplex DNA, the spontaneous transition from WC to HG bp takes place via multiple pathways. Notably, base flipping into the major and minor grooves was found to play an important role in forming these multiple transition pathways. This finding suggests that naked B-DNA under normal conditions has an inherent ability to form HG bps via spontaneous base opening events. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  4. [Quantum-chemical investigation of tautomerization ways of Watson-Crick DNA base pair guanine-cytosine].

    Science.gov (United States)

    Brovarets', O O; Hovorun, D M

    2010-01-01

    A novel physico-chemical mechanism of the Watson-Crick DNA base pair Gua.Cyt tautomerization Gua.Cyt*Gua.CytGua*.Cyt (mutagenic tautomers of bases are marked by asterisks) have been revealed and realized in a pathway of single proton transfer through two mutual isoenergetic transition states with Gibbs free energy of activation 30.4 and 30.6 kcal/mol and they are ion pairs stabilized by three (N2H...N3, N1H...N4- and O6+H...N4-) and five (N2H...O2, N1H...O2, N1H...N3, O6+H...N4- and 06+H...N4-) H-bonds accordingly. Stable base pairs Gua-Cyt* and Gua*.Cyt which dissociate comparably easy into monomers have acceptable relative Gibbs energies--12.9 and 14.3 kcal/mol--for the explanation of the nature of the spontaneous transitions of DNA replication. Results are obtained at the MP2/6-311++G(2df,pd)//B3LYP/6-31 1++G(d,p) level of theory in vacuum approach.

  5. Estimation of strength in different extra Watson-Crick hydrogen bonds in DNA double helices through quantum chemical studies.

    Science.gov (United States)

    Bandyopadhyay, D; Bhattacharyya, D

    2006-10-15

    It was shown earlier, from database analysis, model building studies, and molecular dynamics simulations that formation of cross-strand bifurcated or Extra Watson-Crick hydrogen (EWC) bonds between successive base pairs may lead to extra rigidity to DNA double helices of certain sequences. The strengths of these hydrogen bonds are debatable, however, as they do not have standard linear geometry criterion. We have therefore carried out detailed ab initio quantum chemical studies using RHF/6-31G(2d,2p) and B3LYP/6-31G(2p,2d) basis sets to determine strengths of several bent hydrogen bonds with different donor and acceptors. Interaction energy calculations, corrected for the basis set superposition errors, suggest that N-H...O type bent EWC hydrogen bonds are possible along same strands or across the strands between successive base pairs, leading to significant stability (ca. 4-9 kcal/mol). The N-H...N and C-H...O type interactions, however, are not so stabilizing. Hence, consideration of EWC N-H...O H-bonds can lead to a better understanding of DNA sequence directed structural features. Copyright (c) 2006 Wiley Periodicals, Inc.

  6. Single-stranded γPNAs for in vivo site-specific genome editing via Watson-Crick recognition.

    Science.gov (United States)

    Bahal, Raman; Quijano, Elias; McNeer, Nicole A; Liu, Yanfeng; Bhunia, Dinesh C; Lopez-Giraldez, Francesco; Fields, Rachel J; Saltzman, William M; Ly, Danith H; Glazer, Peter M

    2014-01-01

    Triplex-forming peptide nucleic acids (PNAs) facilitate gene editing by stimulating recombination of donor DNAs within genomic DNA via site-specific formation of altered helical structures that further stimulate DNA repair. However, PNAs designed for triplex formation are sequence restricted to homopurine sites. Herein we describe a novel strategy where next generation single-stranded gamma PNAs (γPNAs) containing miniPEG substitutions at the gamma position can target genomic DNA in mouse bone marrow at mixed-sequence sites to induce targeted gene editing. In addition to enhanced binding, γPNAs confer increased solubility and improved formulation into poly(lactic-co-glycolic acid) (PLGA) nanoparticles for efficient intracellular delivery. Single-stranded γPNAs induce targeted gene editing at frequencies of 0.8% in mouse bone marrow cells treated ex vivo and 0.1% in vivo via IV injection, without detectable toxicity. These results suggest that γPNAs may provide a new tool for induced gene editing based on Watson-Crick recognition without sequence restriction.

  7. Higher order structural effects stabilizing the reverse watson-crick guanine-cytosine base pair in functional RNAs

    KAUST Repository

    Chawla, Mohit

    2013-10-10

    The G:C reverse Watson-Crick (W:W trans) base pair, also known as Levitt base pair in the context of tRNAs, is a structurally and functionally important base pair that contributes to tertiary interactions joining distant domains in functional RNA molecules and also participates in metabolite binding in riboswitches. We previously indicated that the isolated G:C W:W trans base pair is a rather unstable geometry, and that dicationic metal binding to the Guanine base or posttranscriptional modification of the Guanine can increase its stability. Herein, we extend our survey and report on other H-bonding interactions that can increase the stability of this base pair. To this aim, we performed a bioinformatics search of the PDB to locate all the occurencies of G:C trans base pairs. Interestingly, 66% of the G:C trans base pairs in the PDB are engaged in additional H-bonding interactions with other bases, the RNA backbone or structured water molecules. High level quantum mechanical calculations on a data set of representative crystal structures were performed to shed light on the structural stability and energetics of the various crystallographic motifs. This analysis was extended to the binding of the preQ1 metabolite to a preQ1-II riboswitch. 2013 The Author(s).

  8. Watson-Crick Base Pairing, Electronic and Photophysical Properties of Triazole Modified Adenine Analogues: A Computational Study

    KAUST Repository

    Das, Shubhajit

    2015-09-17

    We employ first-principles Density Functional Theory (DFT) and time-dependent DFT (TDDFT) to elucidate structural, electronic and optical properties of a few recently reported triazole adenine nucleobase analogues. The results are compared against the findings obtained for both natural adenine nucleobase and available experimental data. The optical absorption of these adenine analogues are calculated both in gas-phase and in solvent (methanol) using Polarized Continuum Model (PCM). We find that all the analogues show a red-shifted absorption profile as compared to adenine. Our simulated emission spectra in solvent compare fairly well with experimentally observed results. We investigate base paring ability of these adenine analogues with thymine. The calculations on the intrinsic stability of these base pairs ascertain that all the adenine analogues form the hydrogen bonded Watson-Crick base pair with similar H-bonding energy as obtained for natural adenine-thymine base pair. In our study, we provide a microscopic origin of the low-energy absorption and emission peaks, observed experimentally.

  9. Silver (I) as DNA glue: Ag+-mediated guanine pairing revealed by removing Watson-Crick constraints

    Science.gov (United States)

    Swasey, Steven M.; Leal, Leonardo Espinosa; Lopez-Acevedo, Olga; Pavlovich, James; Gwinn, Elisabeth G.

    2015-05-01

    Metal ion interactions with DNA have far-reaching implications in biochemistry and DNA nanotechnology. Ag+ is uniquely interesting because it binds exclusively to the bases rather than the backbone of DNA, without the toxicity of Hg2+. In contrast to prior studies of Ag+ incorporation into double-stranded DNA, we remove the constraints of Watson-Crick pairing by focusing on homo-base DNA oligomers of the canonical bases. High resolution electro-spray ionization mass spectrometry reveals an unanticipated Ag+-mediated pairing of guanine homo-base strands, with higher stability than canonical guanine-cytosine pairing. By exploring unrestricted binding geometries, quantum chemical calculations find that Ag+ bridges between non-canonical sites on guanine bases. Circular dichroism spectroscopy shows that the Ag+-mediated structuring of guanine homobase strands persists to at least 90 °C under conditions for which canonical guanine-cytosine duplexes melt below 20 °C. These findings are promising for DNA nanotechnology and metal-ion based biomedical science.

  10. Watson-Crick Base Pairing, Electronic and Photophysical Properties of Triazole Modified Adenine Analogues: A Computational Study

    KAUST Repository

    Das, Shubhajit; Samanta, Pralok Kumar; Pati, Swapan

    2015-01-01

    We employ first-principles Density Functional Theory (DFT) and time-dependent DFT (TDDFT) to elucidate structural, electronic and optical properties of a few recently reported triazole adenine nucleobase analogues. The results are compared against the findings obtained for both natural adenine nucleobase and available experimental data. The optical absorption of these adenine analogues are calculated both in gas-phase and in solvent (methanol) using Polarized Continuum Model (PCM). We find that all the analogues show a red-shifted absorption profile as compared to adenine. Our simulated emission spectra in solvent compare fairly well with experimentally observed results. We investigate base paring ability of these adenine analogues with thymine. The calculations on the intrinsic stability of these base pairs ascertain that all the adenine analogues form the hydrogen bonded Watson-Crick base pair with similar H-bonding energy as obtained for natural adenine-thymine base pair. In our study, we provide a microscopic origin of the low-energy absorption and emission peaks, observed experimentally.

  11. Determination of redox potentials for the Watson-Crick base pairs, DNA nucleosides, and relevant nucleoside analogues.

    Science.gov (United States)

    Crespo-Hernandez, Carlos E; Close, David M; Gorb, Leonid; Leszczynski, Jerzy

    2007-05-17

    Redox potentials for the DNA nucleobases and nucleosides, various relevant nucleoside analogues, Watson-Crick base pairs, and seven organic dyes are presented based on DFT/B3LYP/6-31++G(d,p) and B3YLP/6-311+G(2df,p)//B3LYP/6-31+G* levels of calculations. The values are determined from an experimentally calibrated set of equations that correlate the vertical ionization (electron affinity) energy of 20 organic molecules with their experimental reversible oxidation (reduction) potential. Our results are in good agreement with those estimated experimentally for the DNA nucleosides in acetonitrile solutions (Seidel et al. J. Phys. Chem. 1996, 100, 5541). We have found that nucleosides with anti conformation exhibit lower oxidation potentials than the corresponding syn conformers. The lowering in the oxidation potential is due to the formation of an intramolecular hydrogen bonding interaction between the 5'-OH group of the sugar and the N3 of the purine bases or C2=O of the pyrimidine bases in the syn conformation. Pairing of adenine or guanine with its complementary pyrimidine base decreases its oxidation potential by 0.15 or 0.28 V, respectively. The calculated energy difference between the oxidation potential for the G.C base pair and that of the guanine base is in good agreement with the experimental value estimated recently (0.34 V: Caruso, T.; et al. J. Am. Chem. Soc. 2005, 127, 15040). The complete and consistent set of reversible redox values determined in this work for the DNA constituents is expected to be of considerable value to those studying charge and electronic energy transfer in DNA.

  12. 8 May 2014 - W. Watson-Wright, Assistant Director General and Executive Secretary UNESCO Intergovernmental Oceanographic Commission Assistant Director-General for the Natural Sciences Sector ad interim visiting the CMS cavern with CMS Collaboration Deputy Spkokesperson K. Borras. Adviser to the Director-General, in charge of Relations with International Organisations M. Bona present throughout.

    CERN Multimedia

    Brice, Maximilien

    2014-01-01

    Ms Wendy Watson-Wright Assistant Director General and Executive Secretary UNESCO Intergovernmental Oceanographic Commission Assistant Director-General for the Natural Sciences Sector ad interim UNESCO

  13. EVALUATIVE LANGUAGE IN SPOKEN AND SIGNED STORIES TOLD BY A DEAF CHILD WITH A COCHLEAR IMPLANT: WORDS, SIGNS OR PARALINGUISTIC EXPRESSIONS?

    Directory of Open Access Journals (Sweden)

    Ritva Takkinen

    2011-01-01

    Full Text Available In this paper the use and quality of the evaluative language produced by a bilingual child in a story-telling situation is analysed. The subject, an 11-year-old Finnish boy, Jimmy, is bilingual in Finnish sign language (FinSL and spoken Finnish.He was born deaf but got a cochlear implant at the age of five.The data consist of a spoken and a signed version of “The Frog Story”. The analysis shows that evaluative devices and expressions differ in the spoken and signed stories told by the child. In his Finnish story he uses mostly lexical devices – comments on a character and the character’s actions as well as quoted speech occasionally combined with prosodic features. In his FinSL story he uses both lexical and paralinguistic devices in a balanced way.

  14. [The Watson-Crick model of the DNA doublehelix. The history of the discovery and the role of the protein paradigm].

    Science.gov (United States)

    Hagemann, Rudolf

    2007-01-01

    At the beginning, the two fundamental papers by Watson and Crick published in 1953 are presented. Subsequently, the main phases of protein and nucleic acids research, starting in the middle of the 19th century, are shortly reviewed. It is outlined, how the 'protein-paradigm' was gradually developed and ultimately became widely accepted. It is then described how Caspersson in 1936 newly raised the question what the chemical nature of genes was: proteins or nucleic acids ? In the main part of this report six lines of research are reviewed, the results of which led to the demise of the 'protein paradigm', the creation of the Watson-Crick model of the DNA and the elaboration of the mechanism of DNA replication: (a) mutation experiments with UV and determination of the UV action spectrum, (b) determination of the chemical identity of the transforming agent in bacteria, (c) detailed chemical analysis of the DNA of different organisms, (d) molecular investigation of the infection of bacteria by bacteriophages, (e) X-ray analysis of DNA fibers, (f) model building and theoretical treatment of all data obtained. In this article, the factors promoting and inhibiting scientific progress in this field are described (and, above all, the relations between scientists with fixated concepts). The results from these lines of research led to the recognition of the decisive role of nucleic acids as the carriers of genetic information and, in this way, formally established the 'nucleic acid paradigm'. Finally the question is discussed why Watson and Crick found the right solution for the DNA structure (and not one of their competitors).

  15. Tautomeric transition between wobble A·C DNA base mispair and Watson-Crick-like A·C* mismatch: microstructural mechanism and biological significance.

    Science.gov (United States)

    Brovarets', Ol'ha O; Hovorun, Dmytro M

    2015-06-21

    Here, we use MP2/DFT quantum-chemical methods combined with Quantum Theory of Atoms in Molecules to study the tautomeric transition between wobble A·C(w) mismatch and Watson-Crick-like A·C*(WC) base mispair, proceeding non-dissociatively via sequential proton transfer between bases through the planar, highly stable and zwitterionic TS(A∙C-)(A∙C(W)A∙C&(WC)) transition state joined by the participation of (A)N6(+)H∙∙∙N4(-)(C), (A)N1(+)H∙∙∙N4(-)(C) and (A)C2(+)H∙∙∙N3(-)(C) H-bonds. Notably, the A·C(w) ↔ A·C*(WC) tautomerization reaction is accompanied by 10 unique patterns of the specific intermolecular interactions that consistently replace each other. Our data suggest that biologically significant A·C(w) → A·C*(WC) tautomerization is a kinetically controlled pathway for formation of the enzymatically competent Watson-Crick-like A·C*(WC) DNA base mispair in the essentially hydrophobic recognition pocket of the high-fidelity DNA-polymerase, responsible for the occurrence of spontaneous point AC/CA incorporation errors during DNA biosynthesis.

  16. ANALISIS KESALAHAN SISWA KELAS X MIA 3 SMA NEGERI 1 TANJUNGPINANG TAHUN PELAJARAN 2015/2016 DALAM MENYELESAIKAN PERMASALAHAN PELUANG DENGAN MENGGUNAKAN KATEGORI KESALAHAN WATSON

    Directory of Open Access Journals (Sweden)

    Susilawati Susilawati

    2016-06-01

    Full Text Available Studi ini bertujuan untuk menganalisa dan mengklasifikasi kesalahan siswa dalam menyelesaikan permasalahan peluang. Subjek studi ini adalah 38 siswa dari kelas X MIA 3 di SMA Negeri 1 Tanjungpinang. Instrumen yang digunakan adalah tes tertulis yang memuat 5 butir soal uraian yang disusun dan divalidasi bersama oleh peneliti dan guru matematika kelas X MIA 3. Kesalahan yang dianalisis dikategorikan dengan menggunakan kategori kesalahan Watson diantaranya data tidak tepat (inappropriate data/id, prosedur tidak tepat (inappropriate procedure/ip, data hilang (ommited data/od, kesimpulan hilang (ommited conclusion/oc, konflik level respon (response level conflict/rlc, manipulasi tidak langsung (undirected manipulation/um, masalah hierarki keterampilan (skills hierarchy problem/shp, dan jenis kesalahan lain dalam kategori terakhir. Hasil analisis kesalahan menunjukkan persentase data tidak tepat sebesar 14,43 %, prosedur tidak tepat sebesar 12,08 %, data hilang sebesar 19,13%, kesimpulan hilang sebesar 21,14%, konflik level respon sebesar 1,34 %, manipulasi tidak langsung sebesar 12,75 %, serta persentase masalah hirarki keterampilan sebesar 19,13 %. Kata Kunci: Peluang, Kesalahan Siswa, Kategori Kesalahan Menurut Watson DOI: http://dx.doi.org/10.22342/jpm.10.2.3630.39-52

  17. Effects of Nursing Care Based on Watson's Theory of Human Caring on Anxiety, Distress, And Coping, When Infertility Treatment Fails: A Randomized Controlled Trial.

    Science.gov (United States)

    Durgun Ozan, Yeter; Okumuş, Hülya

    2017-06-01

    Introduction: The failure of infertility treatment leads to individual, familial, and social problems. The objective of this study was to evaluate the effectiveness of the nursing care program based on Watson's "Theory of Human Caring" on anxiety and distress caused by coping when the treatment fails. Methods: This study randomized controlled trial study was conducted from April to November 2012, with 86 Turkish women with infertility (intervention group: 45, control group: 41). Follow-up of 32 infertile women, who failed infertility treatment from intervention group, and 35 infertile women, who failed infertility treatment from control group, continued for another four weeks. Data were collected through Spiel Berger's State/Trait Anxiety Inventory, Distress Scale, and Ways of Coping Questionnaire. The analyses of data were conducted using SPSS ver 13. Results: The intervention and control groups significantly differed in terms of anxiety, distress, and coping levels. The intervention group's mean anxiety score decreased by thirteen points and distress by fourteen points (in a positive direction). The intervention group's mean positive coping style score increased. Whereas a negative increase was observed in the control group's values depending on the failure of the treatment. Conclusion: Watson's theory of human caring is recommended as a guide to nursing patients with infertility treatment to decrease levels of anxiety and distress, and to increase the positive coping style among infertile women.

  18. On the calculation of line strengths, oscillator strengths and lifetimes for very large principal quantum numbers in hydrogenic atoms and ions by the McLean–Watson formula

    International Nuclear Information System (INIS)

    Hey, J D

    2014-01-01

    As a sequel to an earlier study (Hey 2009 J. Phys. B: At. Mol. Opt. Phys. 42 125701), we consider further the application of the line strength formula derived by Watson (2006 J. Phys. B: At. Mol. Opt. Phys. 39 L291) to transitions arising from states of very high principal quantum number in hydrogenic atoms and ions (Rydberg–Rydberg transitions, n > 1000). It is shown how apparent difficulties associated with the use of recurrence relations, derived (Hey 2006 J. Phys. B: At. Mol. Opt. Phys. 39 2641) by the ladder operator technique of Infeld and Hull (1951 Rev. Mod. Phys. 23 21), may be eliminated by a very simple numerical device, whereby this method may readily be applied up to n ≈ 10 000. Beyond this range, programming of the method may entail greater care and complexity. The use of the numerically efficient McLean–Watson formula for such cases is again illustrated by the determination of radiative lifetimes and comparison of present results with those from an asymptotic formula. The question of the influence on the results of the omission or inclusion of fine structure is considered by comparison with calculations based on the standard Condon–Shortley line strength formula. Interest in this work on the radial matrix elements for large n and n′ is related to measurements of radio recombination lines from tenuous space plasmas, e.g. Stepkin et al (2007 Mon. Not. R. Astron. Soc. 374 852), Bell et al (2011 Astrophys. Space Sci. 333 377), to the calculation of electron impact broadening parameters for such spectra (Watson 2006 J. Phys. B: At. Mol. Opt. Phys. 39 1889) and comparison with other theoretical methods (Peach 2014 Adv. Space Res. in press), to the modelling of physical processes in H II regions (Roshi et al 2012 Astrophys. J. 749 49), and the evaluation bound–bound transitions from states of high n during primordial cosmological recombination (Grin and Hirata 2010 Phys. Rev. D 81 083005, Ali-Haïmoud and Hirata 2010 Phys. Rev. D 82 063521

  19. Aplicação da Teoria do Cuidado Transpessoal de Jean Watson: uma década de produção brasileira Aplicación de la Teoría del Cuidado Transpersonal de Jean Watson: una década de producción brasileña Jean Watson's Theory of Human Caring: a decade of Brazilian publications

    Directory of Open Access Journals (Sweden)

    Luciane Favero

    2009-01-01

    Full Text Available Esta revisão sistemática objetivou descrever e analisar a aplicação da Teoria do Cuidado Transpessoal de Jean Watson nas pesquisas divulgadas em publicações de Enfermagem brasileiras dos últimos dez anos. O levantamento bibliográfico abrangeu 34 produções científicas selecionadas nas bases de dados eletrônicas MEDLINE (MEDLARS [Medical Literature Analysis and Retrieval System] On-line, LILACS (Literatura Latino Americana e do Caribe em Ciências da Saúde, BDENF (Base de dados de Enfermagem e SciELO (Scientific Electronic Library On-line, que após aplicação dos critérios de inclusão estabelecidos, compuseram a amostra do estudo. Os resultados apontaram que a Região Sul concentra 61,8% das produções referidas ao tema de estudo, que ela pode ser aplicada nos níveis de atenção primária, secundária e terciária e que 64,7% das produções utilizam os fatores de cuidado propostos por Jean Watson em 1979. Emerge a necessidade de aprimoramento das pesquisas acerca da transformação ocorrida na Teoria do Cuidado Transpessoal, com abordagem do Processo Clinical Caritas, porém como são escassos os estudos referentes a esta temática, dificultam sua utilização prática.Esta revisión sistemática tuvo como objetivo describir y analizar la aplicación de la Teoría del Cuidado Transpersonal de Jean Watson en las investigaciones divulgadas en publicaciones de Enfermería brasileñas de los últimos diez años. El levantamiento bibliográfico abarcó 34 producciones seleccionadas en las bases de datos electrónicas MEDLINE (MEDLARS [Medical Literature Analysis and Retrieval System] On-line, LILACS (Literatura Latinoamericana y del Caribe en Ciencias de la Salud, BDENF (Base de datos de Enfermería y SciELO (Scientific Electronic Library On-line, que después de la aplicación de los criterios de inclusión establecidos, compusieron la muestra del estudio. Los resultados señalaron que la región Sur concentra el 61,8% de las

  20. Can tautomerization of the A·T Watson-Crick base pair via double proton transfer provoke point mutations during DNA replication? A comprehensive QM and QTAIM analysis.

    Science.gov (United States)

    Brovarets, Ol'ha O; Hovorun, Dmytro M

    2014-01-01

    Trying to answer the question posed in the title, we have carried out a detailed theoretical investigation of the biologically important mechanism of the tautomerization of the A·T Watson-Crick DNA base pair, information that is hard to establish experimentally. By combining theoretical investigations at the MP2 and density functional theory levels of QM theory with quantum theory of atoms in molecules analysis, the tautomerization of the A·T Watson-Crick base pair by the double proton transfer (DPT) was comprehensively studied in vacuo and in the continuum with a low dielectric constant (ϵ = 4) corresponding to a hydrophobic interfaces of protein-nucleic acid interactions. Based on the sweeps of the electron-topological, geometric, and energetic parameters, which describe the course of the tautomerization along its intrinsic reaction coordinate (IRC), it was proved that the A·T → A(∗)·T(∗) tautomerization through the DPT is a concerted (i.e. the pathway without an intermediate) and asynchronous (i.e. protons move with a time gap) process. The limiting stage of this phenomenon is the final PT along the N6H⋯O4 hydrogen bond (H-bond). The continuum with ϵ = 4 does not affect qualitatively the course of the tautomerization reaction: similar to that observed in vacuo, it proceeds via a concerted asynchronous process with the same structure of the transition state (TS). For the first time, the nine key points along the IRC of the A·T base pair tautomerization, which could be considered as electron-topological "fingerprints" of a concerted asynchronous process of the tautomerization via the DPT, have been identified and fully characterized. These nine key points have been used to define the reactant, TS, and product regions of the DPT in the A·T base pair. Considering the energy dependence of each of the three H-bonds, which stabilize the Watson-Crick and Löwdin's base pairs, along the IRC of the tautomerization, it was found that all these H

  1. Determination of h2JNN and h1JHN coupling constants across Watson-Crick base pairs in the Antennapedia homeodomain-DNA complex using TROSY

    International Nuclear Information System (INIS)

    Pervushin, Konstantin; Fernandez, Cesar; Riek, Roland; Ono, Akira; Kainosho, Masatsune; Wuethrich, Kurt

    2000-01-01

    This paper describes NMR measurements of 15 N- 15 N and 1 H- 15 N scalar couplings across hydrogen bonds in Watson-Crick base pairs, h2 J NN and h1 J HN , in a 17 kDa Antennapedia homeodomain-DNA complex. A new NMR experiment is introduced which relies on zero-quantum coherence-based transverse relaxation-optimized spectroscopy (ZQ-TROSY) and enables measurements of h1 J HN couplings in larger molecules. The h2 J NN and h1 J HN couplings open a new avenue for comparative studies of DNA duplexes and other forms of nucleic acids free in solution and in complexes with proteins, drugs or possibly other classes of compounds

  2. Can an Excess Electron Localise on a Purine Moiety in the Adenine-thymine Watson-Crick Base Pair? A Computational Study

    International Nuclear Information System (INIS)

    Mazurkiewicz, Kamil; Haranczyk, Maciej; Gutowski, Maciej S.; Rak, Janusz

    2007-01-01

    The electron affinity and the propensity to electron-induced proton transfer (PT) of hydrogen-bonded complexes between the Watson-Crick adenine-thymine pair (AT) and simple organic acid (HX), attached to adenine in the Hoogsteen-type configuration, were studied at the B3LYP/6-31+G** level. Although the carboxyl group is deprotonated at physiological pH, its neutral form, COOH, resembles the peptide bond or the amide fragment in the side chain of asparagine (Asn) or glutamine (Gln). Thus, these complexes mimic the interaction between the DNA environment (e.g., proteins) and nucleobase pairs incorporated in the biopolymer. Electron attachment is thermodynamically feasible and adiabatic electron affinities range from 0.41 to 1.28 eV, while the vertical detachment energies of the resulting anions span the range of 0.39-2.88 eV. Low-energy activation barriers separate the anionic minima: aHX(AT) from the more stable single-PT anionic geometry, aHX(AT)-SPT, and aHX(AT)-SPT from the double-PT anionic geometry, aHX(AT)-DPT. Interaction between the adenine of the Watson-Crick AT base pair with an acidic proton donor probably counterbalances the larger EA of isolated thymine, as SOMO is almost evenly delocalized over both types of nucleic bases in the aHX(AT) anions. Moreover, as a result of PT the excess electron localizes entirely on adenine. Thus, in DNA interacting with its physiological environment, damage induced by low-energy electrons could begin, contrary to the current view, with the formation of purine anions, which are not formed in isolated DNA because of the greater stability of anionic pyrimidines.

  3. Non-Watson-Crick structures in oligodeoxynucleotides: Self-association of d(TpCpGpA) stabilized at acidic pH

    International Nuclear Information System (INIS)

    Topping, R.J.; Stone, M.P.; Brush, C.K.; Harris, T.M.

    1988-01-01

    The 1 H NMR spectrum of the tetradeoxynucleotide d(TpCpGpA) was examined as a function of temperature, pH, and concentration. At pH 7 and above the solution conformation for this oligodeoxynucleotide appears to be a mixture of random coil and Watson-Crick duplex. At 25 degree C, a pH titration of d(TpCpGaA) shown that distinct conformational changes occur as the pH is lowered below 7.0. These conformational changes are reversible upon readjusting the pH to neutrality, indicating the presence of a pH-dependent set of conformational equilibria. At 25 degree C, the various conformational state in the mixture are in rapid exchange on the NMR time scale. Examination of the titration curve shown the presence of distinct conformational states at pH greater than 7, and between pH 4 and pH 5. When the pH titration is repeated at 5 degree C, the conformational equilibria are in slow exchange on the NMR time scale; distinct signals from each conformational state are observable. The stable conformational state present between pH 4 and pH 5 represents an ordered conformation of d(TpCpGpA) which dissociates to a less ordered structure upon raising the temperature. The ordered conformation differs from the Watson-Crick helix, as is shown from nuclear Overhauser enhancement experiments, as well as chemical shift data. These results indicate that their ordered conformation is similar to the conformation of d(TpCpGpA) observed between pH 4 and pH 5. In the present case it is likely that stabilization of an ordered duplex conformation for d(TpCpGpA) is achieved by protonation of cytosine. A possible model which could explain the data involves formation of Hoogsteen C + :G base pairs

  4. Informed consent and placebo effects: a content analysis of information leaflets to identify what clinical trial participants are told about placebos.

    Directory of Open Access Journals (Sweden)

    Felicity L Bishop

    Full Text Available Placebo groups are used in randomised clinical trials (RCTs to control for placebo effects, which can be large. Participants in trials can misunderstand written information particularly regarding technical aspects of trial design such as randomisation; the adequacy of written information about placebos has not been explored. We aimed to identify what participants in major RCTs in the UK are told about placebos and their effects.We conducted a content analysis of 45 Participant Information Leaflets (PILs using quantitative and qualitative methodologies. PILs were obtained from trials on a major registry of current UK clinical trials (the UKCRN database. Eligible leaflets were received from 44 non-commercial trials but only 1 commercial trial. The main limitation is the low response rate (13.5%, but characteristics of included trials were broadly representative of all non-commercial trials on the database. 84% of PILs were for trials with 50:50 randomisation ratios yet in almost every comparison the target treatments were prioritized over the placebos. Placebos were referred to significantly less frequently than target treatments (7 vs. 27 mentions, p<001 and were significantly less likely than target treatments to be described as triggering either beneficial effects (1 vs. 45, p<001 or adverse effects (4 vs. 39, p<001. 8 PILs (18% explicitly stated that the placebo treatment was either undesirable or ineffective.PILs from recent high quality clinical trials emphasise the benefits and adverse effects of the target treatment, while largely ignoring the possible effects of the placebo. Thus they provide incomplete and at times inaccurate information about placebos. Trial participants should be more fully informed about the health changes that they might experience from a placebo. To do otherwise jeopardises informed consent and is inconsistent with not only the science of placebos but also the fundamental rationale underpinning placebo controlled

  5. Accommodation of an N-(deoxyguanosin-8-yl)-2-acetylaminofluorene adduct in the active site of human DNA polymerase ι: Hoogsteen or Watson-Crick base pairing?†

    Science.gov (United States)

    Donny-Clark, Kerry; Shapiro, Robert; Broyde, Suse

    2009-01-01

    Bypass across DNA lesions by specialized polymerases is essential for maintenance of genomic stability. Human DNA polymerase ι (polι) is a bypass polymerase of the Y family. Crystal structures of polι suggest that Hoogsteen base pairing is employed to bypass minor groove DNA lesions, placing them on the spacious major groove side of the enzyme. Primer extension studies have shown that polι is also capable of error-free nucleotide incorporation opposite the bulky major groove adduct N-(deoxyguanosin-8-yl)-2-acetyl-aminofluorene (dG-AAF). We present molecular dynamics simulations and free energy calculations suggesting that Watson-Crick base pairing could be employed in polι for bypass of dG-AAF. In polι with Hoogsteen paired dG-AAF the bulky AAF moiety would reside on the cramped minor groove side of the template. The Hoogsteen-capable conformation distorts the active site, disrupting interactions necessary for error-free incorporation of dC opposite the lesion. Watson-Crick pairing places the AAF rings on the spacious major groove side, similar to the position of minor groove adducts observed with Hoogsteen pairing. Watson-Crick paired structures show a well-ordered active site, with a near reaction-ready ternary complex. Thus our results suggest that polι would utilize the same spacious region for lesion bypass of both major and minor groove adducts. Therefore, purine adducts with bulk on the minor groove side would use Hoogsteen pairing, while adducts with the bulky lesion on the major groove side would utilize Watson-Crick base pairing as indicated by our MD simulations for dG-AAF. This suggests the possibility of an expanded role for polι in lesion bypass. PMID:19072536

  6. Comparación entre bioimpedancia espectroscópica y fórmula de Watson para medición de volumen corporal en pacientes en diálisis peritoneal

    Directory of Open Access Journals (Sweden)

    Gonzalo Martínez Fernández

    2016-01-01

    Conclusiones: Existen diferencias en el V de los pacientes de una unidad de DP según sea calculado por fórmula de Watson o por BIS. La presencia de hipertensión, diabetes, hipoalbuminemia, obesidad, malnutrición, inflamación, E/I ratio ≥1 y la ausencia de diuresis residual se asocia con la aparición de estas diferencias.

  7. DFT investigation of the vibrational properties of GC Watson-Crick and Hoogsteen base pairs in the presence of Mg²⁺, Ca²⁺, and Cu²⁺ ions.

    Science.gov (United States)

    Morari, Cristian; Muntean, Cristina M; Tripon, Carmen; Buimaga-Iarinca, Luiza; Calborean, Adrian

    2014-04-01

    The binding effects of Mg²⁺, Ca²⁺, and Cu²⁺ ions on the vibrational properties of guanine-cytosine base pairs have been performed using density functional theory investigations. Both Watson-Crick and Hoogsteen configurations of the base pairs were investigated. In Watson-Crick configuration, the metal was coordinated at N7 atom of guanine, while in the case of Hoogsteen configuration, the coordination is at N3 atom of guanine. We have pointed out the geometric properties of the metal-GC base pairs structure, as well as the vibrational bands that can be used to detect the presence of metallic ions in the Watson-Crick and Hoogsteen GC structures. For the geometric models used by us, the vibrational amplitudes of metallic atoms were stronger for wavenumbers lower than 500 cm⁻¹. This suggests that in the experimental studies on DNA the presence of the three metallic atoms (Mg, Ca, and Cu) can be explicitly detected at low frequencies.

  8. Presenting a new kinetic model for methanol to light olefins reactions over a hierarchical SAPO-34 catalyst using the Langmuir-Hinshelwood-Hougen-Watson mechanism

    Science.gov (United States)

    Javad Azarhoosh, Mohammad; Halladj, Rouein; Askari, Sima

    2017-10-01

    In this study, a new kinetic model for methanol to light olefins (MTO) reactions over a hierarchical SAPO-34 catalyst using the Langmuir-Hinshelwood-Hougen-Watson (LHHW) mechanism was presented and the kinetic parameters was obtained using a genetic algorithm (GA) and genetic programming (GP). Several kinetic models for the MTO reactions have been presented. However, due to the complexity of the reactions, most reactions are considered lumped and elementary, which cannot be deemed a completely accurate kinetic model of the process. Therefore, in this study, the LHHW mechanism is presented as kinetic models of MTO reactions. Because of the non-linearity of the kinetic models and existence of many local optimal points, evolutionary algorithms (GA and GP) are used in this study to estimate the kinetic parameters in the rate equations. Via the simultaneous connection of the code related to modelling the reactor and the GA and GP codes in the MATLAB R2013a software, optimization of the kinetic models parameters was performed such that the least difference between the results from the kinetic models and experiential results was obtained and the best kinetic parameters of MTO process reactions were achieved. A comparison of the results from the model with experiential results showed that the present model possesses good accuracy.

  9. Complexes of DNA bases and Watson-Crick base pairs interaction with neutral silver Agn (n = 8, 10, 12) clusters: a DFT and TDDFT study.

    Science.gov (United States)

    Srivastava, Ruby

    2018-03-01

    We study the binding of the neutral Ag n (n = 8, 10, 12) to the DNA base-adenine (A), guanine (G) and Watson-Crick -adenine-thymine, guanine-cytosine pairs. Geometries of complexes were optimized at the DFT level using the hybrid B3LYP functional. LANL2DZ effective core potential was used for silver and 6-31 + G ** was used for all other atoms. NBO charges were analyzed using the Natural population analysis. The absorption properties of Ag n -A,G/WC complexes were also studied using time-dependent density functional theory. The absorption spectra for these complexes show wavelength in the visible region. It was revealed that silver clusters interact more strongly with WC pairs than with isolated DNA complexes. Furthermore, it was found that the electronic charge transferred from silver to isolated DNA clusters are less than the electronic charge transferred from silver to the Ag n -WC complexes. The vertical ionization potential, vertical electron affinity, hardness, and electrophilicity index of Ag n -DNA/WC complexes have also been discussed.

  10. High-Resolution Crystal Structure of a Silver(I)-RNA Hybrid Duplex Containing Watson-Crick-like C-Silver(I)-C Metallo-Base Pairs.

    Science.gov (United States)

    Kondo, Jiro; Tada, Yoshinari; Dairaku, Takenori; Saneyoshi, Hisao; Okamoto, Itaru; Tanaka, Yoshiyuki; Ono, Akira

    2015-11-02

    Metallo-base pairs have been extensively studied for applications in nucleic acid-based nanodevices and genetic code expansion. Metallo-base pairs composed of natural nucleobases are attractive because nanodevices containing natural metallo-base pairs can be easily prepared from commercially available sources. Previously, we have reported a crystal structure of a DNA duplex containing T-Hg(II)-T base pairs. Herein, we have determined a high-resolution crystal structure of the second natural metallo-base pair between pyrimidine bases C-Ag(I)-C formed in an RNA duplex. One Ag(I) occupies the center between two cytosines and forms a C-Ag(I)-C base pair through N3-Ag(I)-N3 linear coordination. The C-Ag(I)-C base pair formation does not disturb the standard A-form conformation of RNA. Since the C-Ag(I)-C base pair is structurally similar to the canonical Watson-Crick base pairs, it can be a useful building block for structure-based design and fabrication of nucleic acid-based nanodevices. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  11. Insights into Watson-Crick/Hoogsteen breathing dynamics and damage repair from the solution structure and dynamic ensemble of DNA duplexes containing m1A.

    Science.gov (United States)

    Sathyamoorthy, Bharathwaj; Shi, Honglue; Zhou, Huiqing; Xue, Yi; Rangadurai, Atul; Merriman, Dawn K; Al-Hashimi, Hashim M

    2017-05-19

    In the canonical DNA double helix, Watson-Crick (WC) base pairs (bps) exist in dynamic equilibrium with sparsely populated (∼0.02-0.4%) and short-lived (lifetimes ∼0.2-2.5 ms) Hoogsteen (HG) bps. To gain insights into transient HG bps, we used solution-state nuclear magnetic resonance spectroscopy, including measurements of residual dipolar couplings and molecular dynamics simulations, to examine how a single HG bp trapped using the N1-methylated adenine (m1A) lesion affects the structural and dynamic properties of two duplexes. The solution structure and dynamic ensembles of the duplexes reveals that in both cases, m1A forms a m1A•T HG bp, which is accompanied by local and global structural and dynamic perturbations in the double helix. These include a bias toward the BI backbone conformation; sugar repuckering, major-groove directed kinking (∼9°); and local melting of neighboring WC bps. These results provide atomic insights into WC/HG breathing dynamics in unmodified DNA duplexes as well as identify structural and dynamic signatures that could play roles in m1A recognition and repair. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  12. 2-Methoxypyridine as a Thymidine Mimic in Watson-Crick Base Pairs of DNA and PNA: Synthesis, Thermal Stability, and NMR Structural Studies.

    Science.gov (United States)

    Novosjolova, Irina; Kennedy, Scott D; Rozners, Eriks

    2017-11-02

    The development of nucleic acid base-pair analogues that use new modes of molecular recognition is important both for fundamental research and practical applications. The goal of this study was to evaluate 2-methoxypyridine as a cationic thymidine mimic in the A-T base pair. The hypothesis was that including protonation in the Watson-Crick base pairing scheme would enhance the thermal stability of the DNA double helix without compromising the sequence selectivity. DNA and peptide nucleic acid (PNA) sequences containing the new 2-methoxypyridine nucleobase (P) were synthesized and studied by using UV thermal melting and NMR spectroscopy. Introduction of P nucleobase caused a loss of thermal stability of ≈10 °C in DNA-DNA duplexes and ≈20 °C in PNA-DNA duplexes over a range of mildly acidic to neutral pH. Despite the decrease in thermal stability, the NMR structural studies showed that P-A formed the expected protonated base pair at pH 4.3. Our study demonstrates the feasibility of cationic unnatural base pairs; however, future optimization of such analogues will be required. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  13. Highly Stable Double-Stranded DNA Containing Sequential Silver(I)-Mediated 7-Deazaadenine/Thymine Watson-Crick Base Pairs.

    Science.gov (United States)

    Santamaría-Díaz, Noelia; Méndez-Arriaga, José M; Salas, Juan M; Galindo, Miguel A

    2016-05-17

    The oligonucleotide d(TX)9 , which consists of an octadecamer sequence with alternating non-canonical 7-deazaadenine (X) and canonical thymine (T) as the nucleobases, was synthesized and shown to hybridize into double-stranded DNA through the formation of hydrogen-bonded Watson-Crick base pairs. dsDNA with metal-mediated base pairs was then obtained by selectively replacing W-C hydrogen bonds by coordination bonds to central silver(I) ions. The oligonucleotide I adopts a duplex structure in the absence of Ag(+) ions, and its stability is significantly enhanced in the presence of Ag(+) ions while its double-helix structure is retained. Temperature-dependent UV spectroscopy, circular dichroism spectroscopy, and ESI mass spectrometry were used to confirm the selective formation of the silver(I)-mediated base pairs. This strategy could become useful for preparing stable metallo-DNA-based nanostructures. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  14. Evidence for Watson-Crick and not Hoogsteen or wobble base pairing in the selection of nucleotides for insertion opposite pyrimidines and a thymine dimer by yeast DNA pol eta.

    Science.gov (United States)

    Hwang, Hanshin; Taylor, John-Stephen

    2005-03-29

    We have recently reported that pyrene nucleotide is preferentially inserted opposite an abasic site, the 3'-T of a thymine dimer, and most undamaged bases by yeast DNA polymerase eta (pol eta). Because pyrene is a nonpolar molecule with no H-bonding ability, the unusually high efficiencies of dPMP insertion are ascribed to its superior base stacking ability, and underscore the importance of base stacking in the selection of nucleotides by pol eta. To investigate the role of H-bonding and base pair geometry in the selection of nucleotides by pol eta, we determined the insertion efficiencies of the base-modified nucleotides 2,6-diaminopurine, 2-aminopurine, 6-chloropurine, and inosine which would make a different number of H-bonds with the template base depending on base pair geometry. Watson-Crick base pairing appears to play an important role in the selection of nucleotide analogues for insertion opposite C and T as evidenced by the decrease in the relative insertion efficiencies with a decrease in the number of Watson-Crick H-bonds and an increase in the number of donor-donor and acceptor-acceptor interactions. The selectivity of nucleotide insertion is greater opposite the 5'-T than the 3'-T of the thymine dimer, in accord with previous work suggesting that the 5'-T is held more rigidly than the 3'-T. Furthermore, insertion of A opposite both Ts of the dimer appears to be mediated by Watson-Crick base pairing and not by Hoogsteen base pairing based on the almost identical insertion efficiencies of A and 7-deaza-A, the latter of which lacks H-bonding capability at N7. The relative efficiencies for insertion of nucleotides that can form Watson-Crick base pairs parallel those for the Klenow fragment, whereas the Klenow fragment more strongly discriminates against mismatches, in accord with its greater shape selectivity. These results underscore the importance of H-bonding and Watson-Crick base pair geometry in the selection of nucleotides by both pol eta and the

  15. The first example of a Hoogsteen base-paired DNA duplex in dynamic equilibrium with a Watson-Crick base-paired duplex--a structural (NMR), kinetic and thermodynamic study.

    Science.gov (United States)

    Isaksson, J; Zamaratski, E; Maltseva, T V; Agback, P; Kumar, A; Chattopadhyaya, J

    2001-06-01

    A single-point substitution of the O4' oxygen by a CH2 group at the sugar residue of A6 (i.e. 2'-deoxyaristeromycin moiety) in a self-complementary DNA duplex, 5'-d(C1G2C3G4A5A6T7T8C9G10C11G12)2(-3), has been shown to steer the fully Watson-Crick basepaired DNA duplex (1A), akin to the native counterpart, to a doubly A6:T7 Hoogsteen basepaired (1B) B-type DNA duplex, resulting in a dynamic equilibrium of (1A)(1B): Keq = k1/k(-1) = 0.56+/-0.08. The dynamic conversion of the fully Watson-Crick basepaired (1A) to the partly Hoogsteen basepaired (1B) structure is marginally kinetically and thermodynamically disfavoured [k1 (298K) = 3.9 0.8 sec(-1); deltaHdegrees++ = 164+/-14 kJ/mol; -TdeltaS degrees++ (298K) = -92 kJ/mol giving a deltaG degrees++ 298 of 72 kJ/mol. Ea (k1) = 167 14 kJ/mol] compared to the reverse conversion of the Hoogsteen (1B) to the Watson-Crick (1A) structure [k-1 (298K) = 7.0 0.6 sec-1, deltaH degrees++ = 153 13 kJ/mol; -TdeltaSdegrees++ (298K) = -82 kJ/mol giving a deltaGdegrees++(298) of 71 kJ/mol. Ea (k-1) = 155 13 kJ/mol]. Acomparison of deltaGdegrees++(298) of the forward (k1) and backward (k-1) conversions, (1A)(1B), shows that there is ca 1 kJ/mol preference for the Watson-Crick (1A) over the double Hoogsteen basepaired (1B) DNA duplex, thus giving an equilibrium ratio of almost 2:1 in favour of the fully Watson-Crick basepaired duplex. The chemical environments of the two interconverting DNA duplexes are very different as evident from their widely separated sets of chemical shifts connected by temperature-dependent exchange peaks in the NOESY and ROESY spectra. The fully Watson-Crick basepaired structure (1A) is based on a total of 127 intra, 97 inter and 17 cross-strand distance constraints per strand, whereas the double A6:T7 Hoogsteen basepaired (1B) structure is based on 114 intra, 92 inter and 15 cross-strand distance constraints, giving an average of 22 and 20 NOE distance constraints per residue and strand, respectively. In addition

  16. How Healthcare Can Refocus on Its Super-Customers (Patients, n =1) and Customers (Doctors and Nurses) by Leveraging Lessons from Amazon, Uber, and Watson.

    Science.gov (United States)

    Kolker, Evelyne; Özdemir, Vural; Kolker, Eugene

    2016-06-01

    Healthcare is transforming with data-intensive omics technologies and Big Data. The "revolution" has already happened in technology, but the bottlenecks have shifted to the social domain: Who can be empowered by Big Data? Who are the users and customers? In this review and innovation field analysis, we introduce the idea of a "super-customer" versus "customer" and relate both to 21st century healthcare. A "super-customer" in healthcare is the patient, sample size of n = 1, while "customers" are the providers of healthcare (e.g., doctors and nurses). The super-customers have been patients, enabled by unprecedented social practices, such as the ability to track one's physical activities, personal genomics, patient advocacy for greater autonomy, and self-governance, to name but a few. In contrast, the originally intended customers-providers, doctors, and nurses-have relatively lagged behind. With patients as super-customers, there are valuable lessons to be learned from industry examples, such as Amazon and Uber. To offer superior quality service, healthcare organizations have to refocus on the needs, pains, and aspirations of their super-customers by enabling the customers. We propose a strategic solution to this end: the PPT-DAM (People-Process-Technology empowered by Data, Analytics, and Metrics) approach. When applied together with the classic Experiment-Execute-Evaluate iterative methodology, we suggest PPT-DAM is an extremely powerful approach to deliver quality health services to super-customers and customers. As an example, we describe the PPT-DAM implementation by the Benchmarking Improvement Program at the Seattle Children's Hospital. Finally, we forecast that cognitive systems in general and IBM Watson in particular, if properly implemented, can bring transformative and sustainable capabilities in healthcare far beyond the current ones.

  17. Molecular dynamics analysis of stabilities of the telomeric Watson-Crick duplex and the associated i-motif as a function of pH and temperature.

    Science.gov (United States)

    Panczyk, Tomasz; Wolski, Pawel

    2018-06-01

    This work deals with a molecular dynamics analysis of the protonated and deprotonated states of the natural sequence d[(CCCTAA) 3 CCCT] of the telomeric DNA forming the intercalated i-motif or paired with the sequence d[(CCCTAA) 3 CCCT] and forming the Watson-Crick (WC) duplex. By utilizing the amber force field for nucleic acids we built the i-motif and the WC duplex either with native cytosines or using their protonated forms. We studied, by applying molecular dynamics simulations, the role of hydrogen bonds between cytosines or in cytosine-guanine pairs in the stabilization of both structures in the physiological fluid. We found that hydrogen bonds exist in the case of protonated i-motif and in the standard form of the WC duplex. They, however, vanish in the case of the deprotonated i-motif and protonated form of the WC duplex. By determining potentials of mean force in the enforced unwrapping of these structures we found that the protonated i-motif is thermodynamically the most stable. Its deprotonation leads to spontaneous and observed directly in the unbiased calculations unfolding of the i-motif to the hairpin structure at normal temperature. The WC duplex is stable in its standard form and its slight destabilization is observed at the acidic pH. However, the protonated WC duplex unwraps very slowly at 310 K and its decomposition was not observed in the unbiased calculations. At higher temperatures (ca. 400 K or more) the WC duplex unwraps spontaneously. Copyright © 2018. Published by Elsevier B.V.

  18. The influence of N-7 guanine modifications on the strength of Watson-Crick base pairing and guanine N-1 acidity: Comparison of gas-phase and condensed-phase trends

    Czech Academy of Sciences Publication Activity Database

    Burda, J. V.; Šponer, Jiří; Hrabáková, J.; Zeizinger, M.; Leszczynski, J.

    2003-01-01

    Roč. 107, č. 22 (2003), s. 5349-5356 ISSN 1520-6106 R&D Projects: GA MŠk ME 517; GA MŠk LN00A016 Grant - others:Wellcome Trust(GB) GR067507MF; ONR(US) N00034-03-1-0116; National Science Foundation(US) CREST 9805465 Institutional research plan: CEZ:AV0Z5004920 Keywords : Watson-Crick base pairing * guanines * gas-phase and condensed-phase trends Subject RIV: BO - Biophysics Impact factor: 3.679, year: 2003

  19. Overlapping Residual Herbicides for Control of Photosystem (PS) II- and 4-Hydroxyphenylpyruvate Dioxygenase (HPPD)-Inhibitor-Resistant Palmer amaranth (Amaranthus palmeri S. Watson) in Glyphosate-Resistant Maize

    Science.gov (United States)

    Chahal, Parminder S.; Ganie, Zahoor A.; Jhala, Amit J.

    2018-01-01

    A Palmer amaranth (Amaranthus palmeri S. Watson) biotype has evolved resistance to photosystem (PS) II- (atrazine) and 4-hydroxyphenylpyruvate dioxygenase (HPPD)-inhibiting herbicides (mesotrione, tembotrione, and topramezone) in maize seed production field in Nebraska, USA. The objectives of this study were to determine the effect of soil residual pre-emergence (PRE) herbicides followed by (fb) tank-mixture of residual and foliar active post-emergence (POST) herbicides on PS-II- and HPPD-inhibitor-resistant Palmer amaranth control, maize yield, and net economic returns. Field experiments were conducted in a grower's field infested with PS II- and HPPD-inhibitor-resistant Palmer amaranth near Shickley in Fillmore County, Nebraska, USA in 2015 and 2016. The contrast analysis suggested that saflufenacil plus dimethenamid-P or pyroxasulfone plus saflufenacil applied PRE provided 80–82% Palmer amaranth control compared to 65 and 39% control with saflufenacil and pyroxasulfone applied alone at 3 weeks after PRE (WAPRE), respectively. Among the PRE fb POST herbicide programs, 95–98% Palmer amaranth control was achieved with pyroxasulfone plus safluefenacil, or saflufenacil plus dimethenamid-P applied PRE, fb glyphosate plus topramezone plus dimethenamid-P plus atrazine, glyphosate plus diflufenzopyr plus dicamba plus pyroxasulfone, glyphosate plus diflufenzopyr plus pendimethalin, or glyphosate plus diflufenzopyr plus dicamba plus atrazine applied POST at 3 weeks after POST (WAPOST) through maize harvest. Based on contrast analysis, PRE fb POST programs provided 77–83% Palmer amaranth control at 3 WAPOST through maize harvest compared to 12–15% control with PRE-only and 66–84% control with POST-only programs. Similarly, PRE fb POST programs provided 99% biomass reduction at 6 WAPOST compared to PRE-only (28%) and POST-only (87%) programs. PRE fb POST programs provided higher maize yield (13,617 kg ha−1) and net return (US $1,724 ha−1) compared to the PRE

  20. Observation of H-bond mediated 3hJH2H3coupling constants across Watson-Crick AU base pairs in RNA

    International Nuclear Information System (INIS)

    Luy, Burkhard; Richter, Uwe; DeJong, Eric S.; Sorensen, Ole W.; Marino, John P.

    2002-01-01

    3h J H2H3 trans-hydrogen bond scalar coupling constants have been observed for the first time in Watson-Crick AU base pairs in uniformly 15 N-labeled RNA oligonucleotides using a new 2h J NN -HNN-E. COSY experiment. The experiment utilizes adenosine H2 (AH2) for original polarization and detection, while employing 2h J NN couplings for coherence transfer across the hydrogen bonds (H-bonds). The H3 protons of uracil bases are unperturbed throughout the experiment so that these protons appear as passive spins in E. COSY patterns. 3h J H2H3 coupling constants can therefore be accurately measured in the acquisition dimension from the displacement of the E. COSY multiplet components, which are separated by the relatively large 1 J H3N3 coupling constants in the indirect dimension of the two-dimensional experiment. The 3h J H2H3 scalar coupling constants determined for AU base pairs in the two RNA hairpins examined here have been found to be positive and range in magnitude up to 1.8 Hz. Using a molecular fragment representation of an AU base pair, density functional theory/finite field perturbation theory (DFT/FPT) methods have been applied to attempt to predict the relative contributions of H-bond length and angular geometry to the magnitude of 3h J H2H3 coupling constants. Although the DFT/FPT calculations did not reproduce the full range of magnitude observed experimentally for the 3h J H2H3 coupling constants, the calculations do predict the correct sign and general trends in variation in size of these coupling constants. The calculations suggest that the magnitude of the coupling constants depends largely on H-bond length, but can also vary with differences in base pair geometry. The dependency of the 3h J H2H3 coupling constant on H-bond strength and geometry makes it a new probe for defining base pairs in NMR studies of nucleic acids

  1. Differential stabilities and sequence-dependent base pair opening dynamics of Watson-Crick base pairs with 5-hydroxymethylcytosine, 5-formylcytosine, or 5-carboxylcytosine.

    Science.gov (United States)

    Szulik, Marta W; Pallan, Pradeep S; Nocek, Boguslaw; Voehler, Markus; Banerjee, Surajit; Brooks, Sonja; Joachimiak, Andrzej; Egli, Martin; Eichman, Brandt F; Stone, Michael P

    2015-02-10

    5-Hydroxymethylcytosine (5hmC), 5-formylcytosine (5fC), and 5-carboxylcytosine (5caC) form during active demethylation of 5-methylcytosine (5mC) and are implicated in epigenetic regulation of the genome. They are differentially processed by thymine DNA glycosylase (TDG), an enzyme involved in active demethylation of 5mC. Three modified Dickerson-Drew dodecamer (DDD) sequences, amenable to crystallographic and spectroscopic analyses and containing the 5'-CG-3' sequence associated with genomic cytosine methylation, containing 5hmC, 5fC, or 5caC placed site-specifically into the 5'-T(8)X(9)G(10)-3' sequence of the DDD, were compared. The presence of 5caC at the X(9) base increased the stability of the DDD, whereas 5hmC or 5fC did not. Both 5hmC and 5fC increased imino proton exchange rates and calculated rate constants for base pair opening at the neighboring base pair A(5):T(8), whereas 5caC did not. At the oxidized base pair G(4):X(9), 5fC exhibited an increase in the imino proton exchange rate and the calculated kop. In all cases, minimal effects to imino proton exchange rates occurred at the neighboring base pair C(3):G(10). No evidence was observed for imino tautomerization, accompanied by wobble base pairing, for 5hmC, 5fC, or 5caC when positioned at base pair G(4):X(9); each favored Watson-Crick base pairing. However, both 5fC and 5caC exhibited intranucleobase hydrogen bonding between their formyl or carboxyl oxygens, respectively, and the adjacent cytosine N(4) exocyclic amines. The lesion-specific differences observed in the DDD may be implicated in recognition of 5hmC, 5fC, or 5caC in DNA by TDG. However, they do not correlate with differential excision of 5hmC, 5fC, or 5caC by TDG, which may be mediated by differences in transition states of the enzyme-bound complexes.

  2. Effect of Temperature and Drought Stress on Germination of Slender Amaranth (Amaranthus viridis L. and Prostrate Pigweed (Amaranthus blitoides S. Watson Seeds

    Directory of Open Access Journals (Sweden)

    Marjan Diayanat

    2018-02-01

    Full Text Available Introduction: Slender amaranth (Amaranthus viridis L. and prostrate pigweed (Amaranthus blitoides S. Watson are two common weeds in vegetables and summer crop fields of Iran. The two Amaranthus species have all the attributes required by ecologically successful annual weeds: rapid growth, early reproduction and continuous seed production. Knowledge of the germination requirements of these weeds will helps determine the proper conditions for germination and emergence and allow better management of them. Water and temperature are determining factors for seed germination of weed. Both factors can, separately or jointly, affect the germination percentage and germination rate. Water stress is one of the main constraints on plant growth and the most common environmental stresses around the world. Water stress affects the different aspects of plant growth and causes reduction and delay in seed germination. Seed germination of all plant species requires a minimum of water to be absorbed and swelled and that is why osmotic potential should not be less than a certain amount. Materials and Methods: Seeds were harvested from vegetable fields of Karaj. For breaking dormancy, seeds were treated with concentrated sulfuric acid for two minutes. Two experiments were conducted at Islamic Azad University, Science and Research Branch, Ecology lab, in 2016. First experiment was based on completely randomized design with 4 replications .The seeds were treated with different temperatures (5, 10, 15, 20, 25, 30, 35, 40 and 45oC. Germination percentage and germination rate were measured and seed were considered to have germinated with the emergence of the radical. Intersected lines model is used to determine the cardinal temperature. Second experiment was conducted to determine the effects of simulated dry conditions (use PEG and temperature on seed germination of slender amaranth and prostrate pigweed. Exposure to polyethylene glycol (PEG-6000 solutions has been

  3. pH-Modulated Watson-Crick duplex-quadruplex equilibria of guanine-rich and cytosine-rich DNA sequences 140 base pairs upstream of the c-kit transcription initiation site.

    Science.gov (United States)

    Bucek, Pavel; Jaumot, Joaquim; Aviñó, Anna; Eritja, Ramon; Gargallo, Raimundo

    2009-11-23

    Guanine-rich regions of DNA are sequences capable of forming G-quadruplex structures. The formation of a G-quadruplex structure in a region 140 base pairs (bp) upstream of the c-kit transcription initiation site was recently proposed (Fernando et al., Biochemistry, 2006, 45, 7854). In the present study, the acid-base equilibria and the thermally induced unfolding of the structures formed by a guanine-rich region and by its complementary cytosine-rich strand in c-kit were studied by means of circular dichroism and molecular absorption spectroscopies. In addition, competition between the Watson-Crick duplex and the isolated structures was studied as a function of pH value and temperature. Multivariate data analysis methods based on both hard and soft modeling were used to allow accurate quantification of the various acid-base species present in the mixtures. Results showed that the G-quadruplex and i-motif coexist with the Watson-Crick duplex over the pH range from 3.0 to 6.5, approximately, under the experimental conditions tested in this study. At pH 7.0, the duplex is practically the only species present.

  4. Pyrrolo-dC Metal-Mediated Base Pairs in the Reverse Watson-Crick Double Helix: Enhanced Stability of Parallel DNA and Impact of 6-Pyridinyl Residues on Fluorescence and Silver-Ion Binding.

    Science.gov (United States)

    Yang, Haozhe; Mei, Hui; Seela, Frank

    2015-07-06

    Reverse Watson-Crick DNA with parallel-strand orientation (ps DNA) has been constructed. Pyrrolo-dC (PyrdC) nucleosides with phenyl and pyridinyl residues linked to the 6 position of the pyrrolo[2,3-d]pyrimidine base have been incorporated in 12- and 25-mer oligonucleotide duplexes and utilized as silver-ion binding sites. Thermal-stability studies on the parallel DNA strands demonstrated extremely strong silver-ion binding and strongly enhanced duplex stability. Stoichiometric UV and fluorescence titration experiments verified that a single (2py) PyrdC-(2py) PyrdC pair captures two silver ions in ps DNA. A structure for the PyrdC silver-ion base pair that aligns 7-deazapurine bases head-to-tail instead of head-to-head, as suggested for canonical DNA, is proposed. The silver DNA double helix represents the first example of a ps DNA structure built up of bidentate and tridentate reverse Watson-Crick base pairs stabilized by a dinuclear silver-mediated PyrdC pair. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  5. FT-IR and FT-Raman spectra of 5-chlorocytosine: Solid state simulation and tautomerism. Effect of the chlorine substitution in the Watson-Crick base pair 5-chlorodeoxycytidine-deoxyguanosine

    Science.gov (United States)

    Alcolea Palafox, M.; Rastogi, V. K.; Singh, S. P.

    2018-01-01

    The laser Raman and IR spectra of 5-chlorocytosine have been recorded and accurately assigned in the solid state using Density functional calculations (DFT) together with the linear scaling equation procedure (LSE) and the solid state simulation of the crystal unit cell through a tetramer form. These results remarkably improve those reported previously by other authors. Several new scaling equations were proposed to be used in related molecules. The six main tautomers of the biomolecule 5-chlorocytosine were determined and optimized at the MP2 and CCSD levels, using different basis sets. The relative stabilities were compared with those obtained in cytosine and their 5-halo derivatives. Several relationships between energies, geometric parameters and NBO atomic charges were established. The effect of the chlorine substitution in the fifth position was evaluated through the stability of the Watson-Crick (WC) base pair of 5-chlorodeoxycytidine with deoxyguanosine, and through their vibrational spectra.

  6. Ancient loons stories Pingree told me

    CERN Document Server

    Davis, Philip J

    2016-01-01

    The book is a collection of short stories, small anecdotes in the life of some historical characters. More concretely, it focuses on the oddities and singularities of some well-known historical figures, not only in science, but also in arts, politics and social sciences. … the book shows the fascination for ancient history, the treasures hidden in original sources and the importance of exploring unusual connections.-Javier Martinez, The European Mathematical Society, January 2013… a rambling, illuminating and thoroughly enjoyable bio/autobiographical and historical sketch, setting Pingree's immense erudition in its professional and intellectual context. Besides a string of amusing and intriguing anecdotes plentifully sprinkled with photos and sketches, this small volume supplies a valuable reminder of how complex, surprising and just plain strange the history of the exact sciences can be.-Kim Plofker, MAA Reviews, October 2012.

  7. Lies your science columnist told you

    CERN Multimedia

    Cole, K C

    2000-01-01

    Discovering the Higgs boson is often quoted as the way to discover the origin of mass. This article explains that the Higgs is actually responsible for the 'rest mass' of fundamental particles but the general concept of mass is still poorly understood (2 pages).

  8. 'As I told Henning the other day'

    DEFF Research Database (Denmark)

    Andersen, Nina Møller

    2008-01-01

    En analyse af sætningen 'Som jeg også sagde til Henning forleden dag' ud fra henholdsvis en klassisk argumentationsanalytisk synsvinkel, en sproghandlingsanalytisk synsvinkel og en dialogisk sysnvinkel (BAchtin)......En analyse af sætningen 'Som jeg også sagde til Henning forleden dag' ud fra henholdsvis en klassisk argumentationsanalytisk synsvinkel, en sproghandlingsanalytisk synsvinkel og en dialogisk sysnvinkel (BAchtin)...

  9. Who Told you that you were Analogue?

    OpenAIRE

    Brown, A

    2017-01-01

    Before breakfast, my social media newsfeed drew my attention to two features on the wet collodion process: one article about lumen prints; two articles about World Cyanotype Day; and a video about Daguerrotypes. Somewhere, an algorithm is channelling digital representations of early photographic techniques towards me. \\ud Welcome to the future.

  10. NMR solution structure of an N2-guanine DNA adduct derived from the potent tumorigen dibenzo[a,l]pyrene: Intercalation from the minor groove with ruptured Watson-Crick base pairing

    Science.gov (United States)

    Tang, Yijin; Liu, Zhi; Ding, Shuang; Lin, Chin H.; Cai, Yuqin; Rodriguez, Fabian A.; Sayer, Jane M.; Jerina, Donald M.; Amin, Shantu; Broyde, Suse; Geacintov, Nicholas E.

    2012-01-01

    The most potent tumorigen identified among the polycyclic aromatic hydrocarbons (PAH) is the non-planar fjord region dibenzo[a,l]pyrene (DB[a,l]P). It is metabolically activated in vivo through the widely-studied diol epoxide (DE) pathway to form covalent adducts with DNA bases, predominantly guanine and adenine. The (+)-11S,12R,13R,14S DE enantiomer forms adducts via its C14-position with the exocyclic amino group of guanine. Here, we present the first NMR solution structure of a DB[a,l]P-derived adduct, the 14R (+)-trans-anti-DB[a,l]P–N2-dG (DB[a,l]P-dG) lesion in double-stranded DNA. In contrast to the stereochemically identical benzo[a]pyrene-derived N2-dG adduct (B[a]P-dG) in which the B[a]P rings reside in the B-DNA minor groove on the 3’-side of the modifed deoxyguanosine, in the DB[a,l]P-derived adduct the DB[a,l]P rings intercalate into the duplex on the 3’-side of the modified base from the sterically crowded minor groove. Watson-Crick base pairing of the modified guanine with the partner cytosine is broken, but these bases retain some stacking with the bulky DB[a,l]P ring system. This new theme in PAH DE - DNA adduct conformation differs from: (1) the classical intercalation motif where Watson-Crick base-pairing is intact at the lesion site, and (2) the base-displaced intercalation motif in which the damaged base and its partner are extruded from the helix . The structural considerations that lead to the intercalated conformation of the DB[a,l]P-dG lesion in contrast to the minor groove alignment of the B[a]P-dG adduct, and the implications of the DB[a,l]P-dG conformational motif for the recognition of such DNA lesions by the human nucleotide excision repair apparatus, are discussed. PMID:23121427

  11. The nature of the transition mismatches with Watson-Crick architecture: the G*·T or G·T* DNA base mispair or both? A QM/QTAIM perspective for the biological problem.

    Science.gov (United States)

    Brovarets', Ol'ha O; Hovorun, Dmytro M

    2015-01-01

    This study provides the first accurate investigation of the tautomerization of the biologically important guanine*·thymine (G*·T) DNA base mispair with Watson-Crick geometry, involving the enol mutagenic tautomer of the G and the keto tautomer of the T, into the G·T* mispair (∆G = .99 kcal mol(-1), population = 15.8% obtained at the MP2 level of quantum-mechanical theory in the continuum with ε = 4), formed by the keto tautomer of the G and the enol mutagenic tautomer of the T base, using DFT and MP2 methods in vacuum and in the weakly polar medium (ε = 4), characteristic for the hydrophobic interfaces of specific protein-nucleic acid interactions. We were first able to show that the G*·T↔G·T* tautomerization occurs through the asynchronous concerted double proton transfer along two antiparallel O6H···O4 and N1···HN3 H-bonds and is assisted by the third N2H···O2 H-bond, that exists along the entire reaction pathway. The obtained results indicate that the G·T* base mispair is stable from the thermodynamic point of view complex, while it is dynamically unstable structure in vacuum and dynamically stable structure in the continuum with ε = 4 with lifetime of 6.4·10(-12) s, that, on the one side, makes it possible to develop all six low-frequency intermolecular vibrations, but, on the other side, it is by three orders less than the time (several ns) required for the replication machinery to forcibly dissociate a base pair into the monomers during DNA replication. One of the more significant findings to emerge from this study is that the short-lived G·T* base mispair, which electronic interaction energy between the bases (-23.76 kcal mol(-1)) exceeds the analogical value for the G·C Watson-Crick nucleobase pair (-20.38 kcal mol(-1)), "escapes from the hands" of the DNA replication machinery by fast transforming into the G*·T mismatch playing an indirect role of its supplier during the DNA replication. So

  12. Intramolecular CH···O hydrogen bonds in the AI and BI DNA-like conformers of canonical nucleosides and their Watson-Crick pairs. Quantum chemical and AIM analysis.

    Science.gov (United States)

    Yurenko, Yevgen P; Zhurakivsky, Roman O; Samijlenko, Svitlana P; Hovorun, Dmytro M

    2011-08-01

    The aim of this work is to cast some light on the H-bonds in double-stranded DNA in its AI and BI forms. For this purpose, we have performed the MP2 and DFT quantum chemical calculations of the canonical nucleoside conformers, relative to the AI and BI DNA forms, and their Watson-Crick pairs, which were regarded as the simplest models of the double-stranded DNA. Based on the atoms-in-molecules analysis (AIM), five types of the CH···O hydrogen bonds, involving bases and sugar, were detected numerically from 1 to 3 per a conformer: C2'H···O5', C1'H···O2, C6H···O5', C8H···O5', and C6H···O4'. The energy values of H-bonds occupy the range of 2.3-5.6 kcal/mol, surely exceeding the kT value (0.62 kcal/mol). The nucleoside CH···O hydrogen bonds appeared to "survive" turns of bases against the sugar, sometimes in rather large ranges of the angle values, pertinent to certain conformations, which points out to the source of the DNA lability, necessary for the conformational adaptation in processes of its functioning. The calculation of the interactions in the dA·T nucleoside pair gives evidence, that additionally to the N6H···O4 and N1···N3H canonical H-bonds, between the bases adenine and thymine the third one (C2H···O2) is formed, which, though being rather weak (about 1 kcal/mol), satisfies the AIM criteria of H-bonding and may be classified as a true H-bond. The total energy of all the CH···O nontraditional intramolecular H-bonds in DNA nucleoside pairs appeared to be commensurable with the energy of H-bonds between the bases in Watson-Crick pairs, which implies their possible important role in the DNA shaping.

  13. Nuclear magnetic resonance solution structure of an N(2)-guanine DNA adduct derived from the potent tumorigen dibenzo[a,l]pyrene: intercalation from the minor groove with ruptured Watson-Crick base pairing.

    Science.gov (United States)

    Tang, Yijin; Liu, Zhi; Ding, Shuang; Lin, Chin H; Cai, Yuqin; Rodriguez, Fabian A; Sayer, Jane M; Jerina, Donald M; Amin, Shantu; Broyde, Suse; Geacintov, Nicholas E

    2012-12-04

    The most potent tumorigen identified among the polycyclic aromatic hydrocarbons (PAH) is the nonplanar fjord region dibenzo[a,l]pyrene (DB[a,l]P). It is metabolically activated in vivo through the widely studied diol epoxide (DE) pathway to form covalent adducts with DNA bases, predominantly guanine and adenine. The (+)-11S,12R,13R,14S DE enantiomer forms adducts via its C14 position with the exocyclic amino group of guanine. Here, we present the first nuclear magnetic resonance solution structure of a DB[a,l]P-derived adduct, the 14R-(+)-trans-anti-DB[a,l]P-N(2)-dG (DB[a,l]P-dG) lesion in double-stranded DNA. In contrast to the stereochemically identical benzo[a]pyrene-derived N(2)-dG adduct (B[a]P-dG) in which the B[a]P rings reside in the B-DNA minor groove on the 3'-side of the modifed deoxyguanosine, in the DB[a,l]P-derived adduct the DB[a,l]P rings intercalate into the duplex on the 3'-side of the modified base from the sterically crowded minor groove. Watson-Crick base pairing of the modified guanine with the partner cytosine is broken, but these bases retain some stacking with the bulky DB[a,l]P ring system. This new theme in PAH DE-DNA adduct conformation differs from (1) the classical intercalation motif in which Watson-Crick base pairing is intact at the lesion site and (2) the base-displaced intercalation motif in which the damaged base and its partner are extruded from the helix. The structural considerations that lead to the intercalated conformation of the DB[a,l]P-dG lesion in contrast to the minor groove alignment of the B[a]P-dG adduct, and the implications of the DB[a,l]P-dG conformational motif for the recognition of such DNA lesions by the human nucleotide excision repair apparatus, are discussed.

  14. VALOR NUTRICIO Y CONTENIDO DE SAPONINAS EN GERMINADOS DE HUAUZONTLE (Chenopodium nuttalliae Saff., CALABACITA (Cucurbita pepo L., CANOLA (Brassica napus L. Y AMARANTO (Amaranthus leucocarpus S. Watson syn. hypochondriacus L.

    Directory of Open Access Journals (Sweden)

    M. R. Barrón-Yánez

    2009-01-01

    (Brassica napus L. y amaranto (Amaranthus leucocarpus S. Watson syn. hypochondriacus L.. Se realizó un análisis proximal y la cuantificación de saponinas en semillas y germinados de las cuatro especies. El contenido de proteína fue más alto en los germinados de canola que en las semillas, pero en huauzontle, calabacita y amaranto no varió. El contenido de lípidos en las semillas de canola, huauzontle y amaranto disminuyó en sus germinados, pero se incrementó en calabacita. El contenido de saponinas en los germinados fue de 2,873.23 en huauzontle, 155.40 en calabacita, 429.81 en canola, y 491.45 mg 100·g-1 de peso seco en amaranto. El contenido de saponinas en semillas fue de 5280.57, 0.00, 35.77 y 42.84 mg 100·g-1 en peso seco, respectivamente. Los niveles del contenido de saponinas en semillas y germinados para las cuatro especies estudiadas no representan toxicidad para humanos. El valor nutricio fue mejor en el germinado de canola que en el de huauzontle, calabaza y amaranto. El sabor de los germinados de huauzontle y amaranto fue mejor que en los de canola y calabacita.

  15. How Mg2+ ion and water network affect the stability and structure of non-Watson-Crick base pairs in E. coli loop E of 5S rRNA: a molecular dynamics and reference interaction site model (RISM) study.

    Science.gov (United States)

    Shanker, Sudhanshu; Bandyopadhyay, Pradipta

    2017-08-01

    The non-Watson-Crick (non-WC) base pairs of Escherichia coli loop E of 5S rRNA are stabilized by Mg 2+ ions through water-mediated interaction. It is important to know the synergic role of Mg 2+ and the water network surrounding Mg 2+ in stabilizing the non-WC base pairs of RNA. For this purpose, free energy change of the system is calculated using molecular dynamics (MD) simulation as Mg 2+ is pulled from RNA, which causes disturbance of the water network. It was found that Mg 2+ remains hexahydrated unless it is close to or far from RNA. In the pentahydrated form, Mg 2+ interacts directly with RNA. Water network has been identified by two complimentary methods; MD followed by a density-based clustering algorithm and three-dimensional-reference interaction site model. These two methods gave similar results. Identification of water network around Mg 2+ and non-WC base pairs gives a clue to the strong effect of water network on the stability of this RNA. Based on sequence analysis of all Eubacteria 5s rRNA, we propose that hexahydrated Mg 2+ is an integral part of this RNA and geometry of base pairs surrounding it adjust to accommodate the [Formula: see text]. Overall the findings from this work can help in understanding the basis of the complex structure and stability of RNA with non-WC base pairs.

  16. Various Extraction Methods Influence the Adhesive Properties of Dried Distiller’s Grains and Solubles, and Press Cakes of Pennycress (Thlaspi arvense L. and Lesquerella [Lesquerella fendleri (A. Gary S. Watson], in the Fabrication of Lignocellulosic Composites

    Directory of Open Access Journals (Sweden)

    Brent Tisserat

    2018-04-01

    Full Text Available Lignocellulosic composite (LC panels were fabricated using an adhesive matrix prepared from three different agricultural by-products: dried distillers grains with solubles (DDGS, pennycress (Thlaspi arvense L. press cake (PPC, or lesquerella [Lesquerella fendleri (A. Gary S. Watson] press cake (LPC reinforced with Paulownia elongata L. wood (PW particles. The goal in this study was to assess the mechanical properties of composites utilizing these low-cost matrix materials, which were subjected to various oil extraction methods. Three types of oil extraction methods were utilized: ethanol, supercritical CO2, and hexane, in order to generate matrix materials. These matrix materials were mixed with equal proportions of PW and hot pressed to generate panels. Overall, hexane extraction was the best method to enhance the mechanical properties of the matrices used to fabricate lignocellulosic composites. LPC’s produced a matrix that gave the resulting composite superior flexural properties compared to composites generated from DDGS and PPC matrices. The mechanical properties of composites generated from soy products (soybean meal flour or soy protein isolate were similar to those derived from DDGS, PPC, or LPC. The dimensional stability properties of LCs were improved when the hexane extraction method was employed, unlike with the other extraction methods that were used to generate matrices.

  17. Why the tautomerization of the G·C Watson-Crick base pair via the DPT does not cause point mutations during DNA replication? QM and QTAIM comprehensive analysis.

    Science.gov (United States)

    Brovarets', Ol'ha O; Hovorun, Dmytro M

    2014-01-01

    The ground-state tautomerization of the G·C Watson-Crick base pair by the double proton transfer (DPT) was comprehensively studied in vacuo and in the continuum with a low dielectric constant (ϵ = 4), corresponding to a hydrophobic interface of protein-nucleic acid interactions, using DFT and MP2 levels of quantum-mechanical (QM) theory and quantum theory "Atoms in molecules" (QTAIM). Based on the sweeps of the electron-topological, geometric, polar, and energetic parameters, which describe the course of the G·C ↔ G*·C* tautomerization (mutagenic tautomers of the G and C bases are marked with an asterisk) through the DPT along the intrinsic reaction coordinate (IRC), it was proved that it is, strictly speaking, a concerted asynchronous process both at the DFT and MP2 levels of theory, in which protons move with a small time gap in vacuum, while this time delay noticeably increases in the continuum with ϵ = 4. It was demonstrated using the conductor-like polarizable continuum model (CPCM) that the continuum with ϵ = 4 does not qualitatively affect the course of the tautomerization reaction. The DPT in the G·C Watson-Crick base pair occurs without any intermediates both in vacuum and in the continuum with ϵ = 4 at the DFT/MP2 levels of theory. The nine key points along the IRC of the G·C base pair tautomerization, which could be considered as electron-topological "fingerprints" of a concerted asynchronous process of the tautomerization via the DPT, have been identified and fully characterized. These key points have been used to define the reactant, transition state, and product regions of the DPT reaction in the G·C base pair. Analysis of the energetic characteristics of the H-bonds allows us to arrive at a definite conclusion that the middle N1H⋯N3/N3H⋯N1 and the lower N2H⋯O2/N2H⋯O2 parallel H-bonds in the G·C/G*·C* base pairs, respectively, are anticooperative, that is, the strengthening of the middle H-bond is accompanied

  18. How does the long G·G* Watson-Crick DNA base mispair comprising keto and enol tautomers of the guanine tautomerise? The results of a QM/QTAIM investigation.

    Science.gov (United States)

    Brovarets', Ol'ha O; Hovorun, Dmytro M

    2014-08-14

    The double proton transfer (DPT) in the long G·G* Watson-Crick base mispair (|C6N1(G*)N1C6(G)| = 36.4°; C1 symmetry), involving keto and enol tautomers of the guanine (G) nucleobase, along two intermolecular neighboring O6H···O6 (8.39) and N1···HN1 (6.14 kcal mol(-1)) H-bonds that were established to be slightly anti-cooperative, leads to its transformation into the G*·G base mispair through a single transition state (|C6N1N1C6| = 37.1°; C1), namely to the interconversion into itself. It was shown that the G·G* ↔ G*·G tautomerisation via the DPT is assisted by the third specific contact, that sequentially switches along the intrinsic reaction coordinate (IRC) in an original way: (G)N2H···N2(G*) H-bond (-25.13 to -10.37) → N2···N2 van der Waals contact (-10.37 to -9.23) → (G)N2···HN2(G*) H-bond (-9.23 to 0.79) → (G*)N2···HN2(G) H-bond (0.79 to 7.35 Bohr). The DPT tautomerisation was found to proceed through the asynchronous concerted mechanism by employing the QM/QTAIM approach and the methodology of the scans of the geometric, electron-topological, energetic, polar and NBO properties along the IRC. Nine key points, that can be considered as part of the tautomerisation repertoire, have been established and analyzed in detail. Furthermore, it was shown that the G·G* or G*·G base mispair is a thermodynamically and dynamically stable structure with a lifetime of 8.22 × 10(-10) s and all 6 low-frequency intermolecular vibrations are able to develop during this time span. Lastly, our results highlight the importance of the G·G* ↔ G*·G DPT tautomerisation, which can have implications for biological and chemical sensing applications.

  19. "Doktor Watson minu õuel!" / Allar Viivik

    Index Scriptorium Estoniae

    Viivik, Allar

    2002-01-01

    Äsjalahkunud näitlejat Vitali Solominit (1941-2002) meenutab Juuliku villa elanik Leo Orav. Siin filmis režissöör Igor Maslennikov paar episoodi "Baskerville'de koerast" vene Sherlock Holmes'i seriaalist. Vitali Solomin mängis doktor Watsonit. Ka teistest selle seriaali võttepaikadest Eestis

  20. Alternative Watson-Crick Synthetic Genetic Systems.

    Science.gov (United States)

    Benner, Steven A; Karalkar, Nilesh B; Hoshika, Shuichi; Laos, Roberto; Shaw, Ryan W; Matsuura, Mariko; Fajardo, Diego; Moussatche, Patricia

    2016-11-01

    In its "grand challenge" format in chemistry, "synthesis" as an activity sets out a goal that is substantially beyond current theoretical and technological capabilities. In pursuit of this goal, scientists are forced across uncharted territory, where they must answer unscripted questions and solve unscripted problems, creating new theories and new technologies in ways that would not be created by hypothesis-directed research. Thus, synthesis drives discovery and paradigm changes in ways that analysis cannot. Described here are the products that have arisen so far through the pursuit of one grand challenge in synthetic biology: Recreate the genetics, catalysis, evolution, and adaptation that we value in life, but using genetic and catalytic biopolymers different from those that have been delivered to us by natural history on Earth. The outcomes in technology include new diagnostic tools that have helped personalize the care of hundreds of thousands of patients worldwide. In science, the effort has generated a fundamentally different view of DNA, RNA, and how they work. Copyright © 2016 Cold Spring Harbor Laboratory Press; all rights reserved.

  1. NMR studies of echinomycin bisintercalation complexes with d(A1-C2-G3-T4) and d(T1-C2-G3-A4) duplexes in aqueous solution: sequence-dependent formation of Hoogsteen A1 x T4 and Watson-Crick T1 x A4 base pairs flanking the bisintercalation site

    International Nuclear Information System (INIS)

    Gao, X.; Patel, D.J.

    1988-01-01

    The authors report on two-dimensional proton NMR studies of echinomycin complexes with the self-complementary d(A1-C2-G3-Tr) and d(T1-C2-G3-A4) duplexes in aqueous solution. The exchangeable and nonexchangeable antibiotic and nucleic acid protons in the 1 echinomycin per tetranucleotide duplex complexes have been assigned from analyses of scalar coupling and distance connectivities in two-dimensional data sets records in H 2 O and D 2 O solution. An analysis of the intermolecular NOE patterns for both complexes combined with large upfield imino proton and large downfield phosphorus complexation chemical shift changes demonstrates that the two quinoxaline chromophores of echinomycin bisintercalate into the minor groove surrounding the dC-dG step of each tetranucleotide duplex. Further, the quinoxaline rings selectively stack between A1 and C2 bases in the d(ACGT) complex and between T1 and C2 bases in the d(TCGA) complex. The intermolecular NOE patterns and the base and sugar proton chemical shifts for residues C2 and G3 are virtually identical for the d(ACGT) and d(TCGA) complexes. A large set of intermolecular contacts established from nuclear Overhauser effects (NOEs) between antibiotic and nucleic acid protons in the echinomycin-tetranucleotide complexes in solution are consistent with corresponding contacts reported for echinomycin-oligonucleotide complexes in the crystalline state. The authors demonstrate that the G x G base pairs adopt Watson-Crick pairing in both d(ACGT) and d(TCGA) complexes in solution. By contrast, the A1 x T4 base pairs adopt Hoogsteen pairing for the echinomycin-d(A1-C2-G3-Tr) complex while the T1 x A4 base pairs adopt Watson-Crick pairing for the echinomycin-d(T1-C2-G3-A4) complex in aqueous solution. These results emphasize the role of sequence in discriminating between Watson-Crick and Hoogsteen pairs at base pairs flanking the echinomycin bisintercalation site in solution

  2. Physico-chemical profiles of the wobble ↔ Watson-Crick G*·2AP(w) ↔ G·2AP(WC) and A·2AP(w) ↔ A*·2AP(WC) tautomerisations: a QM/QTAIM comprehensive survey.

    Science.gov (United States)

    Brovarets', Ol'ha O; Voiteshenko, Ivan S; Hovorun, Dmytro M

    2017-12-20

    This study is intended to clarify in detail the tautomeric transformations of the wobble (w) G*·2AP(w) and A·2AP(w) nucleobase mispairs involving 2-aminopurine (2AP) into the Watson-Crick (WC) G·2AP(WC) and A*·2AP(WC) base mispairs (asterisks denote mutagenic tautomers of the DNA bases), respectively, by quantum-mechanical methods and Bader's Quantum Theory of Atoms in Molecules. Our previously reported methodology has been used, which allows the evolution of the physico-chemical parameters to be tracked along the entire internal reaction coordinate (IRC), not exclusively in the stationary states of these reactions. These biologically important G*·2AP(w) ↔ G·2AP(WC) and A·2AP(w) ↔ A*·2AP(WC) w ↔ WC tautomerisations, which are involved in mutagenic tautomerically-conformational pathways, determine the origin of the transitions and transversions induced by 2AP. In addition, it is established that they proceed through planar, highly stable, zwitterionic transition states and they exhibit similar physico-chemical profiles and stages of sequential intrapair proton transfer, followed by spatial rearrangement of the nucleobases relative to each other within the base pairs. These w ↔ WC tautomerisations occur non-dissociatively and are accompanied by a significant alteration in geometry (from wobble to Watson-Crick and vice versa) and redistribution of the specific intermolecular interactions, which can be divided into 10 patterns including AHB H-bonds and loosened A-H-B covalent bridges along the IRC of tautomerisation. Based on the redistribution of the geometrical and electron-topological parameters of the intrapair hydrogen bonds, exactly 9 key points have been allocated to characterize the evolution of these reactions.

  3. The physicochemical essence of the purine·pyrimidine transition mismatches with Watson-Crick geometry in DNA: A·C* versa A*·C. A QM and QTAIM atomistic understanding.

    Science.gov (United States)

    Brovarets', Ol'ha O; Hovorun, Dmytro M

    2015-01-01

    It was established for the first time by DFT and MP2 quantum-mechanical (QM) methods either in vacuum, so in the continuum with a low dielectric constant (ε = 4), typical for hydrophobic interfaces of specific protein-nucleic acid interactions, that the repertoire for the tautomerisation of the biologically important adenine · cytosine* (A · C*) mismatched DNA base pair, formed by the amino tautomer of the A and the imino mutagenic tautomer of the C, into the A*·C base mispair (∆G = 2.72 kcal mol(-1) obtained at the MP2 level of QM theory in the continuum with ε = 4), formed by the imino mutagenic tautomer of the A and the amino tautomer of the C, proceeds via the asynchronous concerted double proton transfer along two antiparallel H-bonds through the transition state (TSA · C* ↔ A* · C). The limiting stage of the A · C* → A* · C tautomerisation is the final proton transfer along the intermolecular N6H · · · N4 H-bond. It was found that the A · C*/A* · C DNA base mispairs with Watson-Crick geometry are associated by the N6H · · · N4/N4H · · · N6, N3H · · · N1/N1H · · · N3 and C2H · · · O2 H-bonds, respectively, while the TSA · C*↔ A* · C is joined by the N6-H-N4 covalent bridge and the N1H · · · N3 and C2H · · · O2 H-bonds. It was revealed that the A · C* ↔ A* · C tautomerisation is assisted by the true C2H · · · O2 H-bond, that in contrast to the two others conventional H-bonds exists along the entire intrinsic reaction coordinate (IRC) range herewith becoming stronger at the transition from vacuum to the continuum with ε = 4. To better understand the behavior of the intermolecular H-bonds and base mispairs along the IRC of the A · C* ↔ A* · C tautomerisation, the profiles of their electron-topological, energetical, geometrical, polar and charge characteristics are reported in this study. It was established based on the profiles of the H-bond energies that all three H-bonds are cooperative, mutually

  4. A Boyer-Moore (or Watson-Watson) type algorithm for regular tree pattern matching

    NARCIS (Netherlands)

    Watson, B.W.; Aarts, E.H.L.; Eikelder, ten H.M.M.; Hemerik, C.; Rem, M.

    1995-01-01

    In this chapter, I outline a new algorithm for regular tree pattern matching. The existence of this algorithm was first mentioned in the statements accompanying my dissertation, [2]. In order to avoid repeating the material in my dissertation, it is assumed that the reader is familiar with Chapters

  5. Work Transitions as Told: A Narrative Approach to Biographical Learning

    Science.gov (United States)

    Hallqvist, Anders; Hyden, Lars-Christer

    2013-01-01

    In this article, we introduce a narrative approach to biographical learning; that is, an approach that considers autobiographical storytelling as a practice through which claims about life history are performed and negotiated. Using insights from narrative theory, we highlight evaluations in those narratives and suggest their crucial role in…

  6. [The history of the psychiatry not told by Foucault].

    Science.gov (United States)

    Freitas, Fernando Ferreira Pinto de

    2004-01-01

    The article proposes a revision of the approach to madness and the birth of the psychiatric institution taken by Foucault in History of Madness. The hypothesis is that the origins of modern Psychiatry revolutionize the approach to madness by proposing it is possible to dialogue with the insane, because the madman is not someone who has lost his reason . It is hoped that this critique of Foucault's book will be a contribution to the process of psychiatric reform currently underway in Brazil.

  7. Believing What You're Told: Politeness and Scalar Inferences

    Directory of Open Access Journals (Sweden)

    Diana Mazzarella

    2018-06-01

    Full Text Available The experimental pragmatics literature has extensively investigated the ways in which distinct contextual factors affect the computation of scalar inferences, whose most studied example is the one that allows “Some X-ed” to mean Not all X-ed. Recent studies from Bonnefon et al. (2009, 2011 investigate the effect of politeness on the interpretation of scalar utterances. They argue that when the scalar utterance is face-threatening (“Some people hated your speech” (i the scalar inference is less likely to be derived, and (ii the semantic interpretation of “some” (at least some is arrived at slowly and effortfully. This paper re-evaluates the role of politeness in the computation of scalar inferences by drawing on the distinction between “comprehension” and “epistemic assessment” of communicated information. In two experiments, we test the hypothesis that, in these face-threatening contexts, scalar inferences are largely derived but are less likely to be accepted as true. In line with our predictions, we find that slowdowns in the face-threatening condition are attributable to longer reaction times at the (latter epistemic assessment stage, but not at the comprehension stage.

  8. We Are Told That Marihuana Is Harmless, Except...

    Science.gov (United States)

    Camp, William L.

    1973-01-01

    Examination of the medical research literature reveals specifics on marihuana use concerning excessive damage to individuals who may have certain physical or psychological inabilities to handle this substance, who may use it in doses that are more than minimal, or who may use it over extended periods of time. (Author)

  9. What your mother never told you about ... physics teaching

    Science.gov (United States)

    Roudebush, Deborah

    2010-03-01

    When I entered high school teaching after working in industry for several years, I was sure I knew exactly what to do. I was convinced that I would be the sage on the stage and would wow the students with my clear explanations, amazing problem-solving techniques, and perfect lab instructions. I was convinced that the students would soak up the wisdom and insight that I was offering and that, if the students just followed my directions exactly, they would be able to solve new and exciting problems. Instead, I found that the students became amazingly adept at applied mathematics and understood few of the underlying physics concepts. In fact, some of my star students who headed off to become physics majors were unprepared for the thought required and changed majors within two years.

  10. THE STORY OF SUPERNOVA “REFSDAL” TOLD BY MUSE

    Energy Technology Data Exchange (ETDEWEB)

    Grillo, C. [Dark Cosmology Centre, Niels Bohr Institute, University of Copenhagen, Juliane Maries Vej 30, DK-2100 Copenhagen (Denmark); Karman, W.; Caputi, K. I. [Kapteyn Astronomical Institute, University of Groningen, Postbus 800, 9700 AV Groningen (Netherlands); Suyu, S. H. [Institute of Astronomy and Astrophysics, Academia Sinica, P.O. Box 23-141, Taipei 10617, Taiwan (China); Rosati, P.; Caminha, G. B. [Dipartimento di Fisica e Scienze della Terra, Università degli Studi di Ferrara, Via Saragat 1, I-44122 Ferrara (Italy); Balestra, I. [University Observatory Munich, Scheinerstrasse 1, D-81679 Munich (Germany); Mercurio, A. [INAF—Osservatorio Astronomico di Capodimonte, Via Moiariello 16, I-80131 Napoli (Italy); Lombardi, M. [Dipartimento di Fisica, Università degli Studi di Milano, via Celoria 16, I-20133 Milano (Italy); Treu, T. [Department of Physics and Astronomy, University of California, Los Angeles, CA 90095 (United States); Rodney, S. A. [Department of Physics and Astronomy, University of South Carolina, 712 Main St., Columbia, SC 29208 (United States); Gavazzi, R. [Institut d’Astrophysique de Paris, UMR7095 CNRS-Universitè Pierre et Marie Curie, 98bis bd Arago, F-75014 Paris (France); Halkola, A., E-mail: grillo@dark-cosmology.dk

    2016-05-10

    We present Multi Unit Spectroscopic Explorer (MUSE) observations in the core of the Hubble Frontier Fields (HFF) galaxy cluster MACS J1149.5+2223, where the first magnified and spatially resolved multiple images of supernova (SN) “Refsdal” at redshift 1.489 were detected. Thanks to a Director's Discretionary Time program with the Very Large Telescope and the extraordinary efficiency of MUSE, we measure 117 secure redshifts with just 4.8 hr of total integration time on a single 1 arcmin{sup 2} target pointing. We spectroscopically confirm 68 galaxy cluster members, with redshift values ranging from 0.5272 to 0.5660, and 18 multiple images belonging to seven background, lensed sources distributed in redshifts between 1.240 and 3.703. Starting from the combination of our catalog with those obtained from extensive spectroscopic and photometric campaigns using the Hubble Space Telescope ( HST ), we select a sample of 300 (164 spectroscopic and 136 photometric) cluster members, within approximately 500 kpc from the brightest cluster galaxy, and a set of 88 reliable multiple images associated with 10 different background source galaxies and 18 distinct knots in the spiral galaxy hosting SN “Refsdal.” We exploit this valuable information to build six detailed strong-lensing models, the best of which reproduces the observed positions of the multiple images with an rms offset of only 0.″26. We use these models to quantify the statistical and systematic errors on the predicted values of magnification and time delay of the next emerging image of SN “Refsdal.” We find that its peak luminosity should occur between 2016 March and June and should be approximately 20% fainter than the dimmest (S4) of the previously detected images but above the detection limit of the planned HST /WFC3 follow-up. We present our two-dimensional reconstruction of the cluster mass density distribution and of the SN “Refsdal” host galaxy surface brightness distribution. We outline the road map toward even better strong-lensing models with a synergetic MUSE and HST effort.

  11. The Story of Supernova “Refsdal” Told by Muse

    NARCIS (Netherlands)

    Grillo, C.; Karman, W.; Suyu, S. H.; Rosati, P.; Balestra, I.; Mercurio, A.; Lombardi, M.; Treu, T.; Caminha, G. B.; Halkola, A.; Rodney, S. A.; Gavazzi, R.; Caputi, K. I.

    2016-01-01

    We present Multi Unit Spectroscopic Explorer (MUSE) observations in the core of the Hubble Frontier Fields (HFF) galaxy cluster MACS J1149.5+2223, where the first magnified and spatially resolved multiple images of supernova (SN) "Refsdal" at redshift 1.489 were detected. Thanks to a Director's

  12. THE STORY OF SUPERNOVA “REFSDAL” TOLD BY MUSE

    International Nuclear Information System (INIS)

    Grillo, C.; Karman, W.; Caputi, K. I.; Suyu, S. H.; Rosati, P.; Caminha, G. B.; Balestra, I.; Mercurio, A.; Lombardi, M.; Treu, T.; Rodney, S. A.; Gavazzi, R.; Halkola, A.

    2016-01-01

    We present Multi Unit Spectroscopic Explorer (MUSE) observations in the core of the Hubble Frontier Fields (HFF) galaxy cluster MACS J1149.5+2223, where the first magnified and spatially resolved multiple images of supernova (SN) “Refsdal” at redshift 1.489 were detected. Thanks to a Director's Discretionary Time program with the Very Large Telescope and the extraordinary efficiency of MUSE, we measure 117 secure redshifts with just 4.8 hr of total integration time on a single 1 arcmin 2 target pointing. We spectroscopically confirm 68 galaxy cluster members, with redshift values ranging from 0.5272 to 0.5660, and 18 multiple images belonging to seven background, lensed sources distributed in redshifts between 1.240 and 3.703. Starting from the combination of our catalog with those obtained from extensive spectroscopic and photometric campaigns using the Hubble Space Telescope ( HST ), we select a sample of 300 (164 spectroscopic and 136 photometric) cluster members, within approximately 500 kpc from the brightest cluster galaxy, and a set of 88 reliable multiple images associated with 10 different background source galaxies and 18 distinct knots in the spiral galaxy hosting SN “Refsdal.” We exploit this valuable information to build six detailed strong-lensing models, the best of which reproduces the observed positions of the multiple images with an rms offset of only 0.″26. We use these models to quantify the statistical and systematic errors on the predicted values of magnification and time delay of the next emerging image of SN “Refsdal.” We find that its peak luminosity should occur between 2016 March and June and should be approximately 20% fainter than the dimmest (S4) of the previously detected images but above the detection limit of the planned HST /WFC3 follow-up. We present our two-dimensional reconstruction of the cluster mass density distribution and of the SN “Refsdal” host galaxy surface brightness distribution. We outline the road map toward even better strong-lensing models with a synergetic MUSE and HST effort.

  13. DOE Told to Make Its Science More Visible

    CERN Multimedia

    Malakoff, David

    2003-01-01

    A review panel says the Department of Energy needs to improve higher-level management of its 3.3 billions of $ science programm and do a better job of promoting its scientific efforts to stand any chance of gaining more resources (½ page)

  14. Pharmacogenetics and the print media: what is the public told?

    Science.gov (United States)

    Almomani, Basima; Hawwa, Ahmed F; Goodfellow, Nicola A; Millership, Jeffrey S; McElnay, James C

    2015-05-09

    Pharmacogenetics is a rapidly growing field that aims to identify the genes that influence drug response. This science can be used as a powerful tool to tailor drug treatment to the genetic makeup of individuals. The present study explores the coverage of the topic of pharmacogenetics and its potential benefit in personalised medicine by the UK newsprint media. The LexisNexis database was used to identify and retrieve full text articles from the 10 highest circulation national daily newspapers and their Sunday equivalents in the UK. Content analysis of newspaper articles which referenced pharmacogenetic testing was carried out. A second researcher coded a random sample (21%) of newspaper articles to establish the inter-rater reliability of coding. Of the 256 articles captured by the search terms, 96 articles (with pharmacogenetics as a major component) met the study inclusion criteria. The majority of articles over-stated the benefits of pharmacogenetic testing while paying less attention to the associated risks. Overall beneficial effects were mentioned 5.3 times more frequently than risks (p pharmacogenetically based personalised medicine was discussed were cancer, cardiovascular disease and CNS diseases. Only 13% of newspaper articles that cited a specific scientific study mentioned this link in the article. There was a positive correlation between the size of the article and both the number of benefits and risks stated (P < 0.01). More comprehensive coverage of the area of personalised medicine within the print media is needed to inform public debate on the inclusion of pharmacogentic testing in routine practice.

  15. The changing ecology of Narragansett Bay as told by habitat

    Science.gov (United States)

    Narragansett Bay has changed in many ways over millennia due to natural and human forces, and the rate of this change increased greatly after European colonization. We evaluated distributions of three stressors and four habitats in eight subdivisions of the Bay for aspects of ec...

  16. Durbin-Watson statistic for the least trimmed squares

    Czech Academy of Sciences Publication Activity Database

    Víšek, Jan Ámos

    2001-01-01

    Roč. 8, č. 14 (2001), s. 1-40 ISSN 1212-074X Grant - others:GA UK(CZ) 255/2000/A EK/FSV Institutional research plan: CEZ:AV0Z1075907 Keywords : diagnostics * robustness * regression Subject RIV: BB - Applied Statistics, Operational Research

  17. Garri Potter povzroslel! / Daniel Radcliffe, Emma Watson ; interv. Stass Tõrkin

    Index Scriptorium Estoniae

    Radcliffe, Daniel, 1989-

    2005-01-01

    Peaosatäitja järjekorras neljandas Potteri ekraniseeringus "Harry Potter ja tulepeeker" endast, oma tegelaskuju arengust. Samas ka lühiintervjuu näitlejanna Emma Watsoniga. Režissöör Mike Newell : Suurbritannia-USA 2005

  18. Kate Watson on Reynold Humphries’ Hollywood’s Blacklists

    Directory of Open Access Journals (Sweden)

    2008-12-01

    Full Text Available Reynold Humphries. Hollywood’s Blacklists: A Political and Cultural History. Edinburgh: Edinburgh University Press, 2008. Reynold Humphries’ Hollywood’s Blacklists provides a comprehensive examination of the historical and political ramifications of the blacklisting process and of Communism in the motion picture industry. His section on ‘The Background’ initially sets up just this, making the debate and dispute accessible even to those not au fait with such knowledge. This section is informat...

  19. "Elementar, Meu Caro Watson": Jô Soares Reinvents the Classics

    Science.gov (United States)

    Martin, Sarah

    2016-01-01

    Detective fiction--with its roots primarily in Europe and the United States--was slow to catch on in Brazil, where national authors did not attempt more than small forays into the genre for most of the twentieth century. This was due in large part to the particularities of Brazilian society, in which law enforcement agencies, rife with corruption,…

  20. Discourses of Indiscipline: An Informal Hobbesian Riposte to Cate Watson

    Science.gov (United States)

    McManus, Michael

    2006-01-01

    Classroom battles are real and not a metaphor. Warfare is a historical and present fact of human life. Life really is a battle and conflict inevitable; injuries to the psyche are just as real as those to the body. Schools cannot step outside society. It is not Foucault but Thomas Hobbes who offers the most perceptive insight into human behaviour…

  1. What Would It Be Like to Be IBM's Computer, Watson?

    Science.gov (United States)

    Schlinger, Henry D., Jr.

    2012-01-01

    Rachlin (2012) makes two general assertions: (a) "To be human is to behave as humans behave, and to function in society as humans function," and (b) "essential human attributes such as consciousness, the ability to love, to feel pain, to sense, to perceive, and to imagine may all be possessed by a computer'. Although Rachlin's article is an…

  2. Watson, Skinner y Algunas Disputas dentro del Conductismo

    Directory of Open Access Journals (Sweden)

    RICARDO PELLÓN SUÁREZ DE PUGA

    2013-12-01

    Full Text Available In the context of the first centennial of the publication of the behaviorist manifesto, this article conducts a brief review of Watson’s (1913 conception of learning and behavior, and extends that analysis to B. F. Skinner’s behaviorism and to the debates among molar and molecular approaches to behavior analysis.

  3. Watson, skinner y algunas disputas dentro del conductismo

    OpenAIRE

    Pellón Suárez de Puga, Ricardo

    2013-01-01

    In the context of the first centennial of the publication of the behaviorist manifesto, this article conducts a brief review of Watson’s (1913) conception of learning and behavior, and extends that analysis to B. F. Skinner’s behaviorism and to the debates among molar and molecular approaches to behavior analysis.

  4. Agentes virtuales con capacidades cognitivas utilizando IBM Watson

    OpenAIRE

    Carrillo Calderón, Manuel Esteban

    2017-01-01

    Resumen (castellano) En la actualidad, los avances en la tecnología informática y la creciente globalización por medio de Internet y las redes sociales han obligado a que los comercios tradicionales luchen por digitalizarse, a la par que los comercios online traten de ser cada vez más personales y cercanos a los clientes. En esto consiste el comercio electrónico conversacional, una evolución del ecosistema del comercio electrónico. Hoy en día, los chats automáticos con mensajes estándar...

  5. Концепция когнитивно-вычислительных технологий в бизнесе на примере системы IBM Watson

    OpenAIRE

    Мазуров Никита Юрьевич; Струков Иван Александрович; Лебедева Марина Юрьевна

    2016-01-01

    в данной статье рассматривается роль концепции когнитивно-вычислительных технологий в бизнесе на примере системы IBM Watson. Авторы отмечают, что сфера когнитивных технологий крайне перспективна.

  6. A double copy for N=2 supergravity: a linearised tale told on-shell

    International Nuclear Information System (INIS)

    Cardoso, G.L.; Nagy, S.; Nampuri, S.

    2016-01-01

    We construct the on-shell double copy dictionary for linearised four-dimensional N=2 supergravity coupled to one vector multiplet with a quadratic prepotential. We apply this dictionary to the weak-field approximation of dyonic BPS black holes in this theory.

  7. Trust and doubt: An examination of children's decision to believe what they are told about food.

    Science.gov (United States)

    Nguyen, Simone P; Gordon, Cameron L; Chevalier, Tess; Girgis, Helana

    2016-04-01

    The domain of food is one that is highly relevant and vital to the everyday lives of children. However, children's reasoning about this domain is poorly understood within the field of developmental psychology. Because children's learning about food, including its evaluative components (e.g., health, taste) is so heavily dependent on information conveyed by other people, a major developmental challenge that children face is determining who to distrust regarding food. In three studies, this investigation examined how 3- and 4-year-olds and adults (N=312) use different cues to determine when to ignore informant information (i.e., distrust what an informant tells them by choosing an alternative) in food- and non-food-specific scenarios. The results of Study 1 indicated that by age 4 years, children are less trusting of inaccurate sources of information compared with sources that have not demonstrated previous inaccuracy. Study 2 revealed that these results are applicable across the domain of objects. The results of Study 3 indicated that by age 4, children trust benevolent sources more often than malevolent ones. Thus, when reasoning about the evaluative components of food, by age 4, children appraise other people's untrustworthiness by paying attention to their inaccuracy and malevolence. Copyright © 2015 Elsevier Inc. All rights reserved.

  8. What students told us about their experiences and expectations of print and e-books

    Directory of Open Access Journals (Sweden)

    Lorraine Estelle

    2016-03-01

    Full Text Available For the last 13 years at least, many of us have participated in the debate about the development of e-books to support education. Librarians, publishers and intermediaries all have a view about the format and the business models to support it and, of course, studies and surveys of students have informed that debate. However, it is not often that information professionals have the opportunity to sit down with a group of students, listen to their perspective and ask them questions. The UKSG One-Day Conference held in London in November 2015 offered such an opportunity with a panel session of students chaired by Jeremy Upton, Director of Library & University Collections at the University of Edinburgh. The debate uncovered the continued role of print alongside emerging e-book models.  The students shared with us their frustrations in accessing the books they need, the financial challenges they face in terms of purchasing books and their expectations about library provision of books. This article is a summary for those readers who were unable to attend the session to hear for themselves the frank and eye-opening views from the student panel. As one member of the audience put it, the students provided us with gold dust.  The students who so generously gave us their time were Tess McGovern, student of English literature and Cameron Myers, a law student, from King’s College London; Saleh Ahmed and Thomas Ash, who are postgraduates in library studies from City University London; and Lucy Hensher, a geography student and Lenart Celar, a psychology student, from the University of Sussex.

  9. Comet Dust: The Story of Planet Formation as Told by the Tiniest of Particles

    Science.gov (United States)

    Wooden, D. H.

    2005-01-01

    Our planetary system formed out of a gas-rich disk-shaped nebula with the early Sun at its center. Many small icy bodies were consumed by the formation of the giant planets. However, many km-size icy bodies were tossed out of the giant-planet region to the cold, distant reaches of our solar system. Comets remained in their places of cold storage until perturbed into orbits that carry them into the inner solar system where they pass relatively close to the Sun. Comets are warmed by the Sun and shed material from their outer layers. The ices and gases shed by comets reveal simple and complex organic molecules were present at the time and in the region of the formation of the giant planets. Where the Earth was forming was too hot and had too intense sunlight for many of these ices and molecules to survive. The dust shed by comets tells us that some stardust survived unaltered but much of the dust was heated and crystallized before becoming part of the comet. Therefore, comet dust grains tell of large radial migrations from the cold outer reaches near Neptune into the hot regions near the forming Sun, and then back out to the cold regions where icy comets were accreting and forming. On 2005 July 4, the NASA Deep Impact Mission hit a comet and ejected primitive materials fiom its interior. These materials were not released into the comet s coma during normal activity. Despite the many passages of this comet close to the Sun, these primitive volatile gases and dust grains survived in its interior. Comet dust grains show that cold and hot materials were mixed into the same tiny particle very early in the formation of the solar system, and these aggregate dust grains never saw high temperatures again. The survival of primitive materials in comet nuclei suggests comets could have delivered organic molecules and primitive dust grains to early Earth.

  10. "For Your Own Good". Biopolitics told by J.G. Ballard (Italian original version

    Directory of Open Access Journals (Sweden)

    Pierangelo Di Vittorio

    2006-03-01

    Full Text Available “In a totally sane society, madness is the only freedom”, writes J.G. Ballard in his novel Running Wild. This is a dark and at first sight enigmatic statement, but it could be interpreted as a stunning synthesis of the relationship between health policies and the practices of freedom in modern history. A game that is not yet over and the results of which must therefore still be deciphered. What do we do when faced with policies that act only for our good, which preserve life, improve the conditions of health and safety? And besides, what does it mean if these policies are seen as a threat and our freedom seeks refuge in madness as the last stronghold of resistance? These are the questions Ballard asks in his story.

  11. The place of emotion in stories told by children: an exploratory study.

    Science.gov (United States)

    Allen, N B; Bradley, B S

    1993-09-01

    This study explored the relationship between developmental changes in children's understanding of emotions and their use of affective content (Wilkinson, Barnsley, Hanna, & Swan, 1980) and affective structure (Brewer & Lichtenstein, 1982) in the production of stories. We hypothesized that children with an advanced understanding of emotions would make more use of both affective content and affective structure. This relationship was found only for affective content, which was more advanced in girls than boys. Affective structure did not relate to affective understanding or sex but, rather, to verbal intelligence. The implications of these results for the part played by psychological processes in children's story telling are discussed.

  12. [Who told you to grow old and live on the streets?].

    Science.gov (United States)

    Brêtas, Ana Cristina Passarella; Marcolan, João Fernando; Rosa, Anderson da Silva; Fernandes, Flávia Saraiva Leão; Raizer, Milena Veiga

    2010-06-01

    This qualitative case study is part of another study: Aging, health and work. The objective of this excerpt was to identify the meaning of aging on the streets for the elderly living on the street. The subjects' statements were analyzed under the light of the following themes: history of aging and history of life on the streets. It was understood that the streets are usually a hostile environment for the elderly. It does not guarantee the basic life conditions, affecting the mental health of people who are forced to live on the streets, particularly the elderly. The street does not offer any way out and, together with to the life conditions of the elderly living on the streets leads to the gradual loss of self-esteem, significantly affecting self-care. In addition to these issues, we found that compromised functional capacity puts the life/survival of the elderly living on the streets at risk.

  13. Climate network analysis of regional precipitation extremes: The true story told by event synchronization

    Science.gov (United States)

    Odenweller, Adrian; Donner, Reik V.

    2017-04-01

    Over the last decade, complex network methods have been frequently used for characterizing spatio-temporal patterns of climate variability from a complex systems perspective, yielding new insights into time-dependent teleconnectivity patterns and couplings between different components of the Earth climate. Among the foremost results reported, network analyses of the synchronicity of extreme events as captured by the so-called event synchronization have been proposed to be powerful tools for disentangling the spatio-temporal organization of particularly extreme rainfall events and anticipating the timing of monsoon onsets or extreme floodings. Rooted in the analysis of spike train synchrony analysis in the neurosciences, event synchronization has the great advantage of automatically classifying pairs of events arising at two distinct spatial locations as temporally close (and, thus, possibly statistically - or even dynamically - interrelated) or not without the necessity of selecting an additional parameter in terms of a maximally tolerable delay between these events. This consideration is conceptually justified in case of the original application to spike trains in electroencephalogram (EEG) recordings, where the inter-spike intervals show relatively narrow distributions at high temporal sampling rates. However, in case of climate studies, precipitation extremes defined by daily precipitation sums exceeding a certain empirical percentile of their local distribution exhibit a distinctively different type of distribution of waiting times between subsequent events. This raises conceptual concerns if event synchronization is still appropriate for detecting interlinkages between spatially distributed precipitation extremes. In order to study this problem in more detail, we employ event synchronization together with an alternative similarity measure for event sequences, event coincidence rates, which requires a manual setting of the tolerable maximum delay between two events to be considered potentially related. Both measures are then used to generate climate networks from parts of the satellite-based TRMM precipitation data set at daily resolution covering the Indian and East Asian monsoon domains, respectively, thereby reanalysing previously published results. The obtained spatial patterns of degree densities and local clustering coefficients exhibit marked differences between both similarity measures. Specifically, we demonstrate that there exists a strong relationship between the fraction of extremes occurring at subsequent days and the degree density in the event synchronization based networks, suggesting that the spatial patterns obtained using this approach are strongly affected by the presence of serial dependencies between events. Given that a manual selection of the maximally tolerable delay between two events can be guided by a priori climatological knowledge and even used for systematic testing of different hypotheses on climatic processes underlying the emergence of spatio-temporal patterns of extreme precipitation, our results provide evidence that event coincidence rates are a more appropriate statistical characteristic for similarity assessment and network construction for climate extremes, while results based on event synchronization need to be interpreted with great caution.

  14. Schooling and Globalization: What Do We Tell Our Kids & Clients? What Are We Being Told?

    Science.gov (United States)

    Grant, Carl A.; Grant, Alicia

    2007-01-01

    With the effects of globalization everywhere, what should we say to our children and grandchildren about globalization and education? What are the print media--the books and magazines--telling us about globalization and education? This article examines what a person may take from the print media to talk with their children about effects of…

  15. What researchers told us about their experiences and expectations of scholarly communications ecosystems

    Directory of Open Access Journals (Sweden)

    Lorraine Estelle

    2017-03-01

    Full Text Available Publishers, vendors and librarians often discuss the needs of the researcher. However, it is not often that information professionals have the opportunity to sit down with a group of researchers, listen to their perspective and ask them questions. The UKSG One-Day Conference held in London in November 2016 offered such an opportunity with a panel session of researchers chaired by Charlie Rapple of Kudos. The researchers shared with us their frustrations about scholarly communications ecosystems and their ideas for improvements. A major source of frustration is the need for academics to publish, and publish well, to keep their jobs and progress. In doing so, they face what seem to be often insurmountable obstacles that they feel powerless to address or change. Themes of the session were the lack of incentives to peer review and join editorial boards, the role of social networking sites, open access and collaboration with libraries. The researchers who so generously gave us their time are Professor Andy Miah (University of Salford, Dr Mícheál Ó Fathartaigh (Dublin Business School and Dr Sabina Michnowicz (Hazard Centre, University College London.

  16. The Story Behind the Story: Meanings of Having One's Story Told by the American News Media

    National Research Council Canada - National Science Library

    Morris, Anne

    1999-01-01

    ... the experience of those involved. The meanings exemplars attribute to these experiences may suggest useful guidelines for journalists and journalism educators, public relations and public affairs professionals, and others...

  17. Rituals to free the spirit – or what the cremation pyre told

    DEFF Research Database (Denmark)

    Nielsen, Karen Høilund

    2009-01-01

    Sammenligning og diskussion af begravelsesriterne på gravpladsen Lindholm Høje (400-800 e.kr.) og skriftlige overleveringer om brandbegravelser og ledsagende ritualer, herunder hos Ibn Fadlan og i Beowulf-kvadet....

  18. Everything that you have ever been told about assessment center ratings is confounded.

    Science.gov (United States)

    Jackson, Duncan J R; Michaelides, George; Dewberry, Chris; Kim, Young-Jae

    2016-07-01

    Despite a substantial research literature on the influence of dimensions and exercises in assessment centers (ACs), the relative impact of these 2 sources of variance continues to raise uncertainties because of confounding. With confounded effects, it is not possible to establish the degree to which any 1 effect, including those related to exercises and dimensions, influences AC ratings. In the current study (N = 698) we used Bayesian generalizability theory to unconfound all of the possible effects contributing to variance in AC ratings. Our results show that ≤1.11% of the variance in AC ratings was directly attributable to behavioral dimensions, suggesting that dimension-related effects have no practical impact on the reliability of ACs. Even when taking aggregation level into consideration, effects related to general performance and exercises accounted for almost all of the reliable variance in AC ratings. The implications of these findings for recent dimension- and exercise-based perspectives on ACs are discussed. (PsycINFO Database Record (c) 2016 APA, all rights reserved).

  19. A double copy for N=2 supergravity: a linearised tale told on-shell

    Energy Technology Data Exchange (ETDEWEB)

    Cardoso, G.L.; Nagy, S.; Nampuri, S. [Center for Mathematical Analysis, Geometry and Dynamical Systems, Department of Mathematics, Instituto Superior Técnico, Universidade de Lisboa, Av. Rovisco Pais, 1049-001 Lisboa (Portugal)

    2016-10-24

    We construct the on-shell double copy dictionary for linearised four-dimensional N=2 supergravity coupled to one vector multiplet with a quadratic prepotential. We apply this dictionary to the weak-field approximation of dyonic BPS black holes in this theory.

  20. "Many Secrets Are Told around Horses": An Ethnographic Study of Equine-Assisted Psychotherapy

    Science.gov (United States)

    Van Tiem, Jennifer

    2014-01-01

    This dissertation presents an ethnography of equine-assisted psychotherapy (EAP) based on nine months of fieldwork at "Equine Healers," a non-profit organization in central Colorado that specialized in various therapeutic modalities associated with EAP. In bridging scholarly work around animals, a literature suffused with the notion of…

  1. The Story Not Told: Sex and Marriage in Pardo Bazan's "Los cirineos" and "La argolla"

    Science.gov (United States)

    Willem, Linda M.

    2012-01-01

    This article examines how narrative strategies of indirection employed in "Los cirineos" and "La argolla" engage the reader's ethical participation in examining and questioning societal norms concerning sex and marriage. In "Los cirineos," the opposition between the moral and the immoral is broken down by the presence of what Shlomith Rimmon Kenan…

  2. Changes in Central Walker Lane Strain Accommodation near Bridgeport, California; as told by the Stanislaus Group

    Science.gov (United States)

    Carlson, C. W.; Pluhar, C. J.; Glen, J. M.; Farner, M. J.

    2012-12-01

    Accommodating ~20-25% of the dextral-motion between the Pacific and North American plates the Walker Lane is represented as an elongate, NW oriented, region of active tectonics positioned between the northwesterly-translating Sierra Nevada microplate and the east-west extension of the Basin and Range. This region of transtension is being variably accommodated on regional-scale systems of predominantly strike-slip faulting. At the western edge of the central Walker Lane (ca. 38°-39°N latitude) is a region of crustal-scale blocks bounded by wedge-shaped depositional-basins and normal-fault systems, here defined as the west-central Walker Lane (WCWL). Devoid of obvious strike-slip faulting, the presence of tectonic-block vertical-axis rotations in the WCWL represents unrecognized components of dextral-shearing and/or changes of strain-accommodation over time. We use paleomagnetic reference directions for Eureka Valley Tuff (EVT) members of the late Miocene Stanislaus Group as spatial and temporal markers for documentation of tectonic-block vertical-axis rotations near Bridgeport, CA. Study-site rotations revealed discrete rotational domains of mean vertical-axis rotation ranging from ~10°-30° with heterogeneous regional distribution. Additionally, the highest measured magnitudes of vertical-axis rotation (~50°-60° CW) define a 'Region of High Strain' that includes the wedge-shaped Bridgeport Valley (Basin). This study revealed previously-unrecognized tectonic rotation of reference direction sites from prior studies for two (By-Day and Upper) of the three members of the EVT, resulting in under-estimates of regional strain accommodation by these studies. Mean remanent directions and virtual geomagnetic poles utilized in our study yielded a recalculated reference direction for the By-Day member of: Dec.=353.2°; Inc.= 43.7°; α95=10.1, in agreement with new measurements in the stable Sierra Nevada. This recalculated direction confirmed the presence of previously unrecognized reference site rotations, and provided an additional reference direction for determining vertical-axis rotation magnitudes. We present a kinematic model based on mean rotation magnitudes of ~30° CW for the Sweetwater Mountains and Bodie Hills that accounts for rotational-strain accommodation of dextral shear in the WCWL since the late Miocene. This model considers rotational magnitudes, paleostrain indicators, edge-effects, and strain-accommodating structures of rotating crustal blocks to represent changes in regional strain accommodation over time. The results and models presented here elucidate the complicated and evolving nature of the WCWL, and further understanding of variations in strain accommodation for the Walker Lane.

  3. I was told it restarts your brain: knowledge, power, and women's experiences of ECT.

    Science.gov (United States)

    Ejaredar, Maede; Hagen, Brad

    2014-02-01

    A discrepancy exists between clinician-led studies of people's experience of electroconvulsive therapy (ECT) and consumer-led studies, with the former typically being much more positive about the efficacy and side effects of ECT compared with the latter. Qualitative in-depth explorations of people's experiences of ECT are relatively rare, particularly those looking specifically at women's experience of ECT. The aim of this qualitative study was to explore women's experiences of ECT, particularly their experience of knowledge and power related to ECT. Qualitative analysis of the interviews with nine women resulted in four main themes emerging from the interviews with the women: (i) "he really didn't say much," (ii) "I'm going to be very upset with you," (iii) "I was just desperate," and (iv) "it was like we were cattle." Overall, participants found their experiences with ECT to be quite negative, and characterized by a lack of knowledge during the procedure, and a lack of power throughout the entire process.

  4. Knowledge of Love: Narratives of Romance Told by 12-Year-Old Children

    Science.gov (United States)

    Haldar, Marit

    2013-01-01

    This article reports research on young people's conceptualisations of love and romance through a gender perspective. The data are stories written by 12-year-old girls and boys in Norway who were asked to fantasise about their future love life. Their narratives are explored through discourse analysis and semiotics and analysed within a sociological…

  5. Trematodes of fishes of the Indo-west Pacific: told and untold richness.

    Science.gov (United States)

    Cribb, Thomas H; Bray, Rodney A; Diaz, Pablo E; Huston, Daniel C; Kudlai, Olena; Martin, Storm B; Yong, Russell Q-Y; Cutmore, Scott C

    2016-03-01

    The Indo-west Pacific is a marine bioregion stretching from the east coast of Africa to Hawaii, French Polynesia and Easter Island. An assessment of the literature from the region found reports of 2,582 trematode species infecting 1,485 fish species. Reports are concentrated in larger fishes, undoubtedly reflecting the tendency for larger hosts to be infected by more species of parasites as well as a collecting bias. Many hundreds of fish species, including many from families known to be rich in trematodes, have yet to be reported as hosts. Despite some areas (the Great Barrier Reef, Hawaii and the waters off China, India and Japan) receiving sustained attention, none can be considered to be comprehensively known. Several regions, most importantly in East Africa, French Polynesia and the Coral Triangle, are especially poorly known. The fauna of the Indo-west Pacific has been reported so unevenly that we consider it impossible to predict the true trematode richness for the region. We conclude that the greatest gap in our understanding is of the geographical distribution of species in the Indo-west Pacific. This is highlighted by the fact that 87% of trematodes in the region have been reported no more than five times. The reliable recognition of species is a major problem in this field; molecular approaches offer prospects for resolution of species identification but have been little adopted to date.

  6. You told me, Right? - Free and Informed Consent in European Patent Law

    DEFF Research Database (Denmark)

    Schovsbo, Jens Hemmingsen; Hellstadius, Åsa

    2017-01-01

    rules should be understood in the light of the development in health law and fundamental rights law where FIC has long been a central concept which is e.g. recognized in the EU’s Charter on Fundamental Rights. Against that basis, we suggest that patent law and patent practices have so far not fully......-compliance would amount to not only a violation of legal rules but also amount to a serious violation of principles of ordre public or morality in line with current patent law standards....

  7. Stories We've Told: 50 Years of CRLA Archives and Histories

    Science.gov (United States)

    O'Donnell Lussier, Kristie; Harper Shetron, Tamara

    2018-01-01

    The purpose of this historical overview of the College Reading and Learning Association (CRLA) is to examine the CRLA archives to determine phases in the organization's narrative development, to uncover trends, and to ascertain overarching principles in the dialog between the written record and living memory. The two-phase research study began…

  8. The universe in zero words the story of mathematics as told through equations

    CERN Document Server

    Mackenzie, Dana

    2012-01-01

    Most popular books about science, and even about mathematics, tiptoe around equations as if they were something to be hidden from the reader's tender eyes. Dana Mackenzie starts from the opposite premise: He celebrates equations. No history of art would be complete without pictures. Why, then, should a history of mathematics--the universal language of science--keep the masterpieces of the subject hidden behind a veil? The Universe in Zero Words tells the history of twenty-four great and beautiful equations that have shaped mathematics, science, and society--from the elementary

  9. Awakening: The Lived Experience of Creativity as Told by Eight Young Creators

    Science.gov (United States)

    Champa, Martha Marie

    2016-01-01

    Creativity is an aspect of the human condition that eludes a common definition, description, and experience. When trying to make sense of creativity, some describe creative behavior while others describe creative products. There are those who are curious about the process of creativity and others who want to understand what inspires that process.…

  10. Trematodes of fishes of the Indo-west Pacific: told and untold richness

    Czech Academy of Sciences Publication Activity Database

    Cribb, T.H.; Bray, R. A.; Diaz, P.E.; Huston, D.C.; Kudlai, Olena; Martin, S.B.; Yong, R.Q.-Y.; Cutmore, S.C.

    2016-01-01

    Roč. 93, č. 3 (2016), s. 237-247 ISSN 0165-5752 Institutional support: RVO:60077344 Keywords : Great Barrier reef * French Polynesia * Cardicola forsteri Subject RIV: EH - Ecology, Behaviour Impact factor: 1.181, year: 2016

  11. What have positron emission tomography and 'Zippy' told us about the neuropharmacology of drug addiction?

    Science.gov (United States)

    Cumming, Paul; Caprioli, Daniele; Dalley, Jeffrey W

    2011-08-01

    Translational molecular imaging with positron emission tomography (PET) and allied technologies offer unrivalled applications in the discovery of biomarkers and aetiological mechanisms relevant to human disease. Foremost among clinical PET findings during the past two decades of addiction research is the seminal discovery of reduced dopamine D(2/3) receptor expression in the striatum of drug addicts, which could indicate a predisposing factor and/or compensatory reaction to the chronic abuse of stimulant drugs. In parallel, recent years have witnessed significant improvements in the performance of small animal tomographs (microPET) and a refinement of animal models of addiction based on clinically relevant diagnostic criteria. This review surveys the utility of PET in the elucidation of neuropharmacological mechanisms underlying drug addiction. It considers the consequences of chronic drug exposure on regional brain metabolism and neurotransmitter function and identifies those areas where further research is needed, especially concerning the implementation of PET tracers targeting neurotransmitter systems other than dopamine, which increasingly have been implicated in the pathophysiology of drug addiction. In addition, this review considers the causal effects of behavioural traits such as impulsivity and novelty/sensation-seeking on the emergence of compulsive drug-taking. Previous research indicates that spontaneously high-impulsive rats--as exemplified by 'Zippy'--are pre-disposed to escalate intravenous cocaine self-administration, and subsequently to develop compulsive drug taking tendencies that endure despite concurrent adverse consequences of such behaviour, just as in human addiction. The discovery using microPET of pre-existing differences in dopamine D(2/3) receptor expression in the striatum of high-impulsive rats suggests a neural endophenotype that may likewise pre-dispose to stimulant addiction in humans. © 2011 The Authors. British Journal of Pharmacology © 2011 The British Pharmacological Society.

  12. CETIH: Historia contada a tres voces/CETIH: A Story Told by Three People

    Directory of Open Access Journals (Sweden)

    Laura Camacho

    2011-12-01

    Full Text Available Una vez más la Revista de Ingeniería se propone recordar un hito para la ingeniería colombiana que se gestó en la Universidad de los Andes. Pero, esta vez, la historia será contada a tres voces: Carlos Angulo Galvis, Fabio Castrellón y Juan Saldarriaga. Tres nombres que determinaron el origen, transformación y desaparición del Centro de Estudios Técnicos e Investigaciones Hidráulicas, más conocido como CETIH; siglas que aún hacen eco en la memoria de algunos de nuestros lectores.

  13. "Forget to whom you have told this proverb": directed forgetting of destination memory in Alzheimer's disease.

    Science.gov (United States)

    El Haj, Mohamad; Gandolphe, Marie-Charlotte; Allain, Philippe; Fasotti, Luciano; Antoine, Pascal

    2015-01-01

    Destination memory is the ability to remember the receiver of transmitted information. By means of a destination memory directed forgetting task, we investigated whether participants with Alzheimer's Disease (AD) were able to suppress irrelevant information in destination memory. Twenty-six AD participants and 30 healthy elderly subjects were asked to tell 10 different proverbs to 10 different celebrities (List 1). Afterwards, half of the participants were instructed to forget the destinations (i.e., the celebrities) whereas the other half were asked to keep them in mind. After telling 10 other proverbs to 10 other celebrities (List 2), participants were asked to read numbers aloud. Subsequently, all the participants were asked to remember the destinations of List 1 and List 2, regardless of the forget or remember instructions. The results show similar destination memory in AD participants who were asked to forget the destinations of List 1 and those who were asked to retain them. These findings are attributed to inhibitory deficits, by which AD participants have difficulties to suppress irrelevant information in destination memory.

  14. "Forget to whom you have told this proverb'': Directed forgetting of destination memory in Alzheimer's disease

    NARCIS (Netherlands)

    El Haj, M.; Gandolphe, M.C.; Allain, P.; Fasotti, L.; Antoine, P.

    2015-01-01

    Destination memory is the ability to remember the receiver of transmitted information. By means of a destination memory directed forgetting task, we investigated whether participants with Alzheimer's Disease (AD) were able to suppress irrelevant information in destination memory. Twenty-six AD

  15. TOLD LIKE IT IS! AN EVALUATION OF AN INTEGRATED ORAL DEVELOPMENT PILOT PROJECT

    Directory of Open Access Journals (Sweden)

    David Barr

    2005-09-01

    Full Text Available Much established pedagogical and CALL (computer-assisted language learning research advocates an integrated constructivist approach to the use of technology in language learning. This paper reports on a pilot project delivered to first year undergraduate French students. The project aim was to deliver a blend of collaborative and individual learning through a combination of CALL programs and online activities alongside traditional face-to-face conversation classes. Using quantitative analysis of a pre- and posttest and a variety of questionnaires, this project assessed student progress in developing oral skills across two groups, one (the treatment group using technology and the other (the comparison group being a traditional conversation class. Each group covered the same content and underwent the same assessment procedures. In addition, through qualitative analysis measures, the project evaluated the role played by additional variables in the learning process, as well as student and staff reactions to the two approaches. The study concludes by showing that while progress was made by both groups, the progress made by those not using technology was significantly greater than that made by students using technology over a short-term study. It also highlights the need for developing pedagogy to ensure that CALL-based teaching goes beyond rehearsal activity to achieve message-orientated communication.

  16. Side by Side: What a Comparative Usability Study Told Us about a Web Site Redesign

    Science.gov (United States)

    Dougan, Kirstin; Fulton, Camilla

    2009-01-01

    Library Web sites must compete against easy-to-use sites, such as Google Scholar, Google Books, and Wikipedia, for students' time and attention. Library Web sites must therefore be designed with aesthetics and user perceptions at the forefront. The Music and Performing Arts Library at Urbana-Champaign's Web site was overcrowded and in much need of…

  17. Nonlinear stories told by cups and saucers : Smart replic as with response 3D audio

    NARCIS (Netherlands)

    De Reus, L.; Verlinden, J.C.; Roozenburg, M.

    2013-01-01

    In museum exhibitions historical objects are usually shown by visual display, in a showcase with extra textual information added to it. Museum visitors can never touch the objects, let alone use them. As a result, visitors ‘scan’ the displayed objects from a distance, something that needs

  18. Selling America: How Post-Recession Ads Told Americans the Story of Themselves

    Directory of Open Access Journals (Sweden)

    Adriana Mariella

    2017-09-01

    Full Text Available This work argues that after the recession in 2007, a kaleidoscope of similar themes about industrial Americana and the beauty of work came to dominate representations of “Americanness” in advertising and pop culture. Brands like Levi’s, Walmart, and Chrysler depended on the careful overlaying of collective imagination with existent myths about work, class, and grit, to create a distinct picture of America’s industrial past and establish themselves as part of its heritage. In doing so, they helped populate American culture with a hegemonic sense of national identity. They depicted an America built from greasy hands on Rust Belt factory floors, “summed up” (as Jameson or Barthes might put it in whiskey, grit, and the frontier, in skyscrapers and pick up trucks. In turn, this reconstructed past helped inform an understanding of what made America, America and the things that would keep it that way: labor, hard work, “making.” In a post-industrial economy where widespread anxiety about industrial decline helped wage a Presidential campaign on promises to restore America to its former industrial glory, the stakes for remembering our past in this way are particularly high. To better understand how our past came to be remembered in this way, I look to modern culture’s blurred lines between entertainment and advertising, memory and fact, identity and myth, a phenomenon that has allowed advertising to disguise itself as historical fact and embed itself in collective memory. In capitalizing (quite literally on anxieties of the modern moment to appeal to traditional American notions, it is able to reinforce and re-invent them in the process.

  19. DNA with Parallel Strand Orientation: A Nanometer Distance Study with Spin Labels in the Watson-Crick and the Reverse Watson-Crick Double Helix.

    Science.gov (United States)

    Wunnicke, Dorith; Ding, Ping; Yang, Haozhe; Seela, Frank; Steinhoff, Heinz-Jürgen

    2015-10-29

    Parallel-stranded (ps) DNA characterized by its sugar-phosphate backbones pointing in the same direction represents an alternative pairing system to antiparallel-stranded (aps) DNA with the potential to inhibit transcription and translation. 25-mer oligonucleotides were selected containing only dA·dT base pairs to compare spin-labeled nucleobase distances over a range of 10 or 15 base pairs in ps DNA with those in aps DNA. By means of the copper(I)-catalyzed Huisgen-Meldal-Sharpless alkyne-azide cycloaddition, the spin label 4-azido-2,2,6,6-tetramethylpiperidine-1-oxyl was clicked to 7-ethynyl-7-deaza-2'-deoxyadenosine or 5-ethynyl-2'-deoxyuridine to yield 25-mer oligonucleotides incorporating two spin labels. The interspin distances between spin labeled residues were determined by pulse EPR spectroscopy. The results reveal that in ps DNA these distances are between 5 and 10% longer than in aps DNA when the labeled DNA segment is located near the center of the double helix. The interspin distance in ps DNA becomes shorter compared with aps DNA when one of the spin labels occupies a position near the end of the double helix.

  20. Computer‐Assisted Library Instruction and Face‐to‐Face Library Instruction Prove Equally Effective for Teaching Basic Library Skills in Academic Libraries. A review of: Zhang, Li, Watson, Erin M. and Banfield, Laura. ʺThe Efficacy of Computer‐Assisted Instruction Versus Face‐to‐Face Instruction in Academic Libraries: A Systematic Review.ʺ The Journal of Academic Librarianship 33.4 (July 2007: 478‐484.

    Directory of Open Access Journals (Sweden)

    Stephanie Walker

    2008-03-01

    , and case studies, with a sample size greater than one and with pre‐ and post‐test measurements;study participants had to be academic library patrons; the study needed to compare CAI and face‐to‐face instruction; and both the students’ information skills and reactions to the instruction had to be measured. This left 40 unique studies, which were then retrieved in full text. Next, studies were selected to meet the inclusion criteria further using the QUOROM format, a reporting structure used for improving the quality of reports of meta‐analyses of randomised trials (Moher et al 1896‐1900. Evaluation of methodological quality was then done using a dual method: authors Watson and Zhang assessed the studies independently, each using the “Checklist for Study Quality” developed by Downs and Black (Downs and Black 377‐384, adapted slightly to remove non‐relevant questions. After analysis, when additional information was needed, original study authors werecontacted. Finally, ten studies were included in the analysis.The instruction sessions covered many topics, such as catalog use, reading citations, awareness of library services and collections, basic searching of bibliographic databases, and more. But all could qualify as basic, rather than advanced, library instruction. All studies did pre‐ and posttests of students’ skills – some immediatelyafter instruction, and others with a time lapse of up to six weeks. Most authors created their own tests, though one adapted an existing scale. Individual performance improvement was not studied in many cases due to privacy concerns.Main Results ‐ Nine of the ten studies found CAI and face‐to‐face instruction equally effective; the tenth study found face to‐face instruction more effective. The students’ reaction to instruction methods varied – some students felt more satisfied with face‐to‐face instruction and felt that they learned better, while other studies found that students receiving CAI

  1. Anger and Approach: Reply to Watson (2009) and to Tomarken and Zald (2009)

    Science.gov (United States)

    Carver, Charles S.; Harmon-Jones, Eddie

    2009-01-01

    C. S. Carver and E. Harmon-Jones reviewed evidence consistent with the idea that anger arises from a behavioral approach system. Commentary on that article by A. J. Tomarken and D. H. Zald raised questions about the many elements involved in acts of approach and limitations on what information can be provided by electroencephalograms. Commentary…

  2. Determining Baseline Emissions at Mississippi Power Company's Watson Electric Generating Station

    Science.gov (United States)

    This document may be of assistance in applying the New Source Review (NSR) air permitting regulations including the Prevention of Significant Deterioration (PSD) requirements. This document is part of the NSR Policy and Guidance Database. Some documents in the database are a scanned or retyped version of a paper photocopy of the original. Although we have taken considerable effort to quality assure the documents, some may contain typographical errors. Contact the office that issued the document if you need a copy of the original.

  3. Finding Superman & Global Competitiveness: A Conversation with Arthur Levine & Watson Scott Swail. Policy Perspectives

    Science.gov (United States)

    Levine, Arthur; Swail, Watson Scott

    2014-01-01

    On March 21 2013, the "Educational Policy Institute" held the first day of the EPI Forum on Education & the Economy in Orlando, Florida. The Forum was designed to discuss critical issues related to the nexus of education and the workforce. This document presents the transcribed session that featured two of the authors of the Teachers…

  4. KlenTaq polymerase replicates unnatural base pairs by inducing a Watson-Crick geometry.

    Science.gov (United States)

    Betz, Karin; Malyshev, Denis A; Lavergne, Thomas; Welte, Wolfram; Diederichs, Kay; Dwyer, Tammy J; Ordoukhanian, Phillip; Romesberg, Floyd E; Marx, Andreas

    2012-07-01

    Many candidate unnatural DNA base pairs have been developed, but some of the best-replicated pairs adopt intercalated structures in free DNA that are difficult to reconcile with known mechanisms of polymerase recognition. Here we present crystal structures of KlenTaq DNA polymerase at different stages of replication for one such pair, dNaM-d5SICS, and show that efficient replication results from the polymerase itself, inducing the required natural-like structure.

  5. Watson-Crick hydrogen bonds : Nature and role in DNA replication

    NARCIS (Netherlands)

    Guerra, Célia Fonseca; Bickelhaupt, F. Matthias

    2006-01-01

    The hydrogen bonds in DNA Watson–Crick base pairs have long been considered predominantly electrostatic phenomena. In this chapter, we show with state-of-the-art calculations that this is not true and that electrostatic interactions and covalent contributions in these hydrogen bonds are in fact of

  6. Moving beyond Watson-Crick models of coarse grained DNA dynamics.

    Science.gov (United States)

    Linak, Margaret C; Tourdot, Richard; Dorfman, Kevin D

    2011-11-28

    DNA produces a wide range of structures in addition to the canonical B-form of double-stranded DNA. Some of these structures are stabilized by Hoogsteen bonds. We developed an experimentally parameterized, coarse-grained model that incorporates such bonds. The model reproduces many of the microscopic features of double-stranded DNA and captures the experimental melting curves for a number of short DNA hairpins, even when the open state forms complicated secondary structures. We demonstrate the utility of the model by simulating the folding of a thrombin aptamer, which contains G-quartets, and strand invasion during triplex formation. Our results highlight the importance of including Hoogsteen bonding in coarse-grained models of DNA.

  7. Tunnel conductance of Watson-Crick nucleoside-base pairs from telegraph noise

    International Nuclear Information System (INIS)

    Chang Shuai; He Jin; Lin Lisha; Zhang Peiming; Liang Feng; Huang Shuo; Lindsay, Stuart; Young, Michael

    2009-01-01

    The use of tunneling signals to sequence DNA is presently hampered by the small tunnel conductance of a junction spanning an entire DNA molecule. The design of a readout system that uses a shorter tunneling path requires knowledge of the absolute conductance across base pairs. We have exploited the stochastic switching of hydrogen-bonded DNA base-nucleoside pairs trapped in a tunnel junction to determine the conductance of individual molecular pairs. This conductance is found to be sensitive to the geometry of the junction, but a subset of the data appears to come from unstrained molecular pairs. The conductances determined from these pairs are within a factor of two of the predictions of density functional calculations. The experimental data reproduces the counterintuitive theoretical prediction that guanine-deoxycytidine pairs (3 H-bonds) have a smaller conductance than adenine-thymine pairs (2 H-bonds). A bimodal distribution of switching lifetimes shows that both H-bonds and molecule-metal contacts break.

  8. Solvent effects on hydrogen bonds in Watson-Crick, mismatched, and modified DNA base pairs

    NARCIS (Netherlands)

    Poater, Jordi; Swart, Marcel; Guerra, Celia Fonseca; Bickelhaupt, F. Matthias

    2012-01-01

    We have theoretically analyzed a complete series of Watson–Crick and mismatched DNA base pairs, both in gas phase and in solution. Solvation causes a weakening and lengthening of the hydrogen bonds between the DNA bases because of the stabilization of the lone pairs involved in these bonds. We have

  9. A rule of seven in Watson-Crick base-pairing of mismatched sequences.

    Science.gov (United States)

    Cisse, Ibrahim I; Kim, Hajin; Ha, Taekjip

    2012-05-13

    Sequence recognition through base-pairing is essential for DNA repair and gene regulation, but the basic rules governing this process remain elusive. In particular, the kinetics of annealing between two imperfectly matched strands is not well characterized, despite its potential importance in nucleic acid-based biotechnologies and gene silencing. Here we use single-molecule fluorescence to visualize the multiple annealing and melting reactions of two untethered strands inside a porous vesicle, allowing us to precisely quantify the annealing and melting rates. The data as a function of mismatch position suggest that seven contiguous base pairs are needed for rapid annealing of DNA and RNA. This phenomenological rule of seven may underlie the requirement for seven nucleotides of complementarity to seed gene silencing by small noncoding RNA and may help guide performance improvement in DNA- and RNA-based bio- and nanotechnologies, in which off-target effects can be detrimental.

  10. Molecular moment similarity between several nucleoside analogs of thymidine and thymidine. sil@watson.ibm.com.

    Science.gov (United States)

    Silverman, B D; Pitman, M C; Platt, D E

    1999-06-01

    Molecular moment descriptors of the shape and charge distributions of twenty five nucleoside structures have been examined. The structures include thymidine as well as the difluorotoluene nucleoside analog which has been found to pair efficiently with adenine by polymerase catalysis. The remaining twenty three structures have been chosen to be as structurally similar to thymidine and to the difluorotoluene nucleoside analog as possible. The moment descriptors which include a description of the relationship of molecular charge to shape show the difluorotoluene nucleoside to be one of the most proximate molecules to thymidine in the space of the molecular moments. The calculations, therefore, suggest that polymerase specificity might be not only a consequence of molecular steric features alone but also of the molecular electrostatic environment and its registration with molecular shape.

  11. E.L.C. Watson se pionierstog deur Suid-Afrika (1912) | van der ...

    African Journals Online (AJOL)

    In the light of the Victorian era with all its restrictions, this new freedom of movement was very alluring. The motorcycle evolved out of the bicycle. Following the first Isle of Man TT (Tourist Trophy) in 1907, there was no stopping the popularity of the motorcycle. This influence was felt even in South Africa. It was in this zeitgeist ...

  12. [Sherlock Holmes, Watson and cocaine. A literary contribution to the history of drug addiction].

    Science.gov (United States)

    Fouassier, E

    1994-01-01

    From 1887 to 1927, Conan Doyle devoted fifty-six short stories and four novels to the extraordinary investigations of Sherlock Holmes. Special passages from these works, gathered here in the form of long extracts, evoke the passion of the celebrated detective for cocaine and constitute rather generally an original sort of evidence on the emergence of drug addicts in Europe at the end of the 19th century.

  13. The development of a spiritual wellness framework for the work context / Francois Gerald Watson

    OpenAIRE

    Watson, Francois Gerald

    2007-01-01

    Today's organisations are faced with changes such as increased competition and technological changes, not to mention the impact of globalisation on South African organisations. In a sense, the 21" century brought forth a more positive outlook and is described by some as the century of fortegenic living and wellness. Organisations today are searching for programmes that support strengths and wellness, as opposed to the historic employee assistance programmes. Spiritual wellness ...

  14. VizieR Online Data Catalog: AAVSO International Variable Star Index VSX (Watson+, 2006-2014)

    Science.gov (United States)

    Watson, C.; Henden, A. A.; Price, A.

    2018-05-01

    This file contains Galactic stars known or suspected to be variable. It lists all stars that have an entry in the AAVSO International Variable Star Index (VSX; http://www.aavso.org/vsx). The database consisted initially of the General Catalogue of Variable Stars (GCVS) and the New Catalogue of Suspected Variables (NSV) and was then supplemented with a large number of variable star catalogues, as well as individual variable star discoveries or variables found in the literature. Effort has also been invested to update the entries with the latest information regarding position, type and period and to remove duplicates. The VSX database is being continually updated and maintained. For historical reasons some objects outside of the Galaxy have been included. (3 data files).

  15. The practice of nurses caring for families of pediatric inpatients in light of Jean Watson

    Directory of Open Access Journals (Sweden)

    Maiara Rodrigues dos Santos

    2014-08-01

    Full Text Available Objective To know the facilities and the difficulties of nurses in caring practice of hospitalized children’s families in the light of Jean Watson’s Theory of Human Caring. Method It was used the descriptive qualitative approach. The data collection was conducted in three stages: presentation of theoretical content; engagement with families in the light of Watson’s theory; and semi-structured interview with 12 pediatric nurses. The interviews were analysed using inductive thematic analysis, being possible to form three themes: Recognizing a framework for care; Considering the institutional context; and Challenges in family’s relationship. Results The theory favored reflections about self, about the institutions and about nurses’ relationship with the family of the child, normalized by a consciousness toward caring attitudes. Conclusion In this process, it is imperative that nurses recognize the philosophical-theoretical foundations of care to attend the child’s family in hospital.

  16. "Nobody Told Me It Was Rape": A Parent's Guide for Talking with Teenagers about Acquaintance Rape and Sexual Exploitation.

    Science.gov (United States)

    Adams, Caren; Fay, Jennifer

    This book was written to help parents talk to their adolescent children about acquaintance rape and sexual exploitation. It may also be useful to family life educators presenting units on rape and sexual exploitation. Acquaintance rape and sexual exploitation are explained in the first section. The second section discusses talking with teenagers…

  17. What have positron emission tomography and ‘Zippy’ told us about the neuropharmacology of drug addiction?

    Science.gov (United States)

    Cumming, Paul; Caprioli, Daniele; Dalley, Jeffrey W

    2011-01-01

    Translational molecular imaging with positron emission tomography (PET) and allied technologies offer unrivalled applications in the discovery of biomarkers and aetiological mechanisms relevant to human disease. Foremost among clinical PET findings during the past two decades of addiction research is the seminal discovery of reduced dopamine D2/3 receptor expression in the striatum of drug addicts, which could indicate a predisposing factor and/or compensatory reaction to the chronic abuse of stimulant drugs. In parallel, recent years have witnessed significant improvements in the performance of small animal tomographs (microPET) and a refinement of animal models of addiction based on clinically relevant diagnostic criteria. This review surveys the utility of PET in the elucidation of neuropharmacological mechanisms underlying drug addiction. It considers the consequences of chronic drug exposure on regional brain metabolism and neurotransmitter function and identifies those areas where further research is needed, especially concerning the implementation of PET tracers targeting neurotransmitter systems other than dopamine, which increasingly have been implicated in the pathophysiology of drug addiction. In addition, this review considers the causal effects of behavioural traits such as impulsivity and novelty/sensation-seeking on the emergence of compulsive drug-taking. Previous research indicates that spontaneously high-impulsive rats – as exemplified by ‘Zippy’– are pre-disposed to escalate intravenous cocaine self-administration, and subsequently to develop compulsive drug taking tendencies that endure despite concurrent adverse consequences of such behaviour, just as in human addiction. The discovery using microPET of pre-existing differences in dopamine D2/3 receptor expression in the striatum of high-impulsive rats suggests a neural endophenotype that may likewise pre-dispose to stimulant addiction in humans. LINKED ARTICLES This article is part of a themed section on Imaging. To view the other articles in this section visit http://dx.doi.org/10.1111/bph.2011.163.issue-8BJP has previously published an Imaging in Pharmacology themed section, edited by A Davenport and C Daly. To view this section visit http://dx.doi.org/10.1111/bph.2010.159.issue-4 PMID:20846139

  18. Salient beliefs about eating and buying dark green vegetables as told by Mid-western African–American women☆

    Science.gov (United States)

    Sheats, Jylana L.; Middlestadt, Susan E.

    2013-01-01

    Vegetables in the dark green group are the most nutritious, yet intake is low. Studies suggest that an increase in fruit and vegetables may improve diet-related health outcomes of African Americans. The aim of this exploratory study was to use the Reasoned Action Approach (RAA) to qualitatively assess salient, top-of-the-mind, beliefs (consequences, circumstances and referents) about eating and buying more dark green leafy vegetables each week over the next 3 months. Adult (n = 30), Midwestern African–American women, who buy and prepare food for their household participated in a face-to-face salient belief elicitation. A content analysis of verbatim text and a descriptive analysis were conducted. Findings suggest that the RAA can be used to identify salient consequences, circumstances and referents about eating and buying more dark green leafy vegetables. The use of the RAA allowed for the extraction of specific beliefs that may aid in the development of nutrition education programs that consider the varying priorities, motivators and barriers that subgroups within the population have in regard to buying and consuming dark green leafy vegetables. PMID:23415980

  19. Statutory information for the children born of oocyte donation in the UK: what will they be told in 2008?

    Science.gov (United States)

    Abdalla, H; Shenfield, F; Latarche, E

    1998-04-01

    In the UK, non-identifying information on the donor is recorded by statute in assisted reproduction with gamete donation. This may be made available eventually to the resulting children. Prospective parents are counselled about openness, and often wish to know what may be available if the child has access to this information. We analysed forms from the Human Fertilisation and Embryology Authority completed by all donors at the Lister in-vitro fertilization unit. We found that 94% of oocyte donors did not respond to the last question asking for a brief description of themselves, leaving only profession and interests as information to be given in the future. There was a significant difference between the known and anonymous responders. This has important implications for the future parents who want to tell their child of his/her origins.

  20. A Story told through Plena: Claiming Identity and Cultural Autonomy in the Street Festivals of San Juan, Puerto Rico.

    Directory of Open Access Journals (Sweden)

    Paulina Guerrero

    2013-05-01

    Full Text Available Las Fiestas de la Calle de San Sebastián is a four day-long festival in San Juan, Puerto Rico. While the festival comprises music and dance that is a combination of various Caribbean and Latin American aesthetics, there is a small group of local musicians who insist on staying away from the larger throngs to specifically play a Puerto Rican music medium known as plena. By defining a distinct physical space that is separate from the rest of the festival, but also a part of the festival, they sing throughout the night speaking to contemporary issues of American imperialism, class warfare, and corrupt politicians. During the festival the complex power dynamics of Puerto Rico as a United States territory, lacking both independence as a sovereign nation and the same rights as a state, are manifested in festival performance. This performance tries to negotiate how the island remains autonomous while being attached to a more powerful mainland economy.

  1. What are older Latinos told about physical activity and cognition? A content analysis of a top-circulating magazine.

    Science.gov (United States)

    Rose, India D; Friedman, Daniela B; Marquez, David X; Fernandez, Karen

    2013-10-01

    Physical activity (PA) may reduce risk of developing Alzheimer's disease (AD). The objectives of this study were to: (a) Compare the content of English and Spanish PA-focused articles in American Association of Retired Persons (AARP) magazines; and (b) Determine whether these articles discuss PA as a potential correlate of AD. AARP (English) and AARP Segunda Juventud (Spanish) magazines were assessed for PA coverage from 2009 to 2010. Articles were analyzed using nonparametric tests. A total of 63 articles discussed PA (48 English; 15 Spanish). In AARP English, 70.8% of articles discussed formal exercise, while 53.3% of Spanish articles discussed formal exercise. Only three English articles mentioned that PA has the potential to reduce risk of AD. No Spanish articles mentioned this association. Spanish content did not adequately present cognitive health information. Culturally appropriate media coverage is needed to inform diverse populations about cognitive health and risks of AD.

  2. "I Was Told That My First Duty Was to Forget Physiology, Which Had No Relation to Medicine"

    Science.gov (United States)

    Walsh, Kieran

    2016-01-01

    There has been much recent commentary on integration in health care professional education. This commentary is of importance to physiology education as integration often touches on integration between preclinical and clinical sciences. There are different forms of integration, from horizontal to vertical to spiral, and different theories underpin…

  3. Lo que no te contaron de las fracturas de fémur. [What nobody told you about femur fractures.

    Directory of Open Access Journals (Sweden)

    Guillermo Alejandro Ricciardi

    2016-05-01

    Full Text Available Este trabajo relaciona  la bibliografía con la experiencia de nuestros cirujanos  para afrontar  dificultades con un  instrumental defectuoso en el tratamiento de fracturas de fémur con osteosíntesis endomedulares y estimar la existencia de un canal de reclamo. Objetivos 1.Enumerar inconvenientes técnicos presentados en cirugías de fémur. 3. Comparar  diferentes centros y problemas afrontados. 4. Estimar canales de reclamo. Material y Métodos 1: Estudio retrospectivo observacional descriptivo sobre las historias clínicas y archivo radiológico de nuestra institución. 2: Encuesta on-line enviada a traumatólogos generales. 3: Consulta con ANMAT, IRAM, Ministerio de Salud de la ciudad y la Nación. Resultados: 1. 31 pacientes con fracturas de fémur tratados con osteosíntesis endomedulares entre enero de 2008 a agosto de 2013. Se documentaron 19 casos de fallas o defectos del instrumental de colocación en 15 pacientes. Los problemas más frecuentes fueron las guías y las mechas. 3. 270 respuestas. 19 provincias nacionales. Respuestas de Colombia, Ecuador, Italia, Australia y Bolivia. Se obtuvieron 180 respuestas de centros privados y 90 de centros públicos. 4. 4 vías de reclamo: ANMAT bajo el programa de Tecnovigilancia, IRAM por el incumplimiento de las Normas ISO 9001, Ministerio de Salud por incumplimiento de la resolución 255 y por incumplimiento de la Ley Básica de Salud 153 Art. 12 (ítem k y l y AAOT, en la subcomisión de Implantes. Conclusión Queda explicita la diferencia entre hospitales públicos y centros privados donde en estos últimos las estadísticas fueron favorables. El medio laboral solo definió prevalencia de inconvenientes técnicos pero los tipos de inconvenientes fueron los mismos. Existen formas y recursos para denunciar y enfrentar esta problemática.

  4. My mother told me: the roles of maternal messages, body image, and disordered eating in maladaptive exercise.

    Science.gov (United States)

    Lease, Haidee J; Doley, Joanna R; Bond, Malcolm J

    2016-09-01

    The current study examined the relevance of familial environment (negative maternal messages) to the phenomenon of maladaptive (obligatory) exercise, defined as exercise fixation. Weight/shape concerns and exercise frequency were examined as potential mediators, evaluated both with and without eating disorder symptoms as a covariate. Self-report data comprising sociodemographic details and measures of parental weight messages, body image, obligatory exercise, and disordered eating symptoms were completed by 298 young female attendees of health and fitness centres. The frequency of negative maternal messages demonstrated significant associations with all of weight/shape concerns, exercise frequency, exercise fixation, and eating disorder symptoms. In the initial model, partial mediation of maternal messages to exercise fixation was evident as negative maternal messages continued to have a direct effect on exercise fixation. In the second model, with the inclusion of eating disorder symptoms as a covariate, this direct effect was maintained while mediation was no longer evident. The data provide further support for the association between disordered eating symptoms and maladaptive exercise, as defined by exercise fixation. Nevertheless, the importance of negative maternal messages as a key environmental enabler of exercise fixation has been demonstrated, even after the effects of weight/shape concerns and exercise frequency were accounted for. Clinically, addressing weight-related talk in the family home may reduce the incidence of problematic cognitions and behaviours associated with both maladaptive exercise and disordered eating symptoms.

  5. 'I told her this is your life': relationship dynamics, partner support and adherence to antiretroviral therapy among South African couples.

    Science.gov (United States)

    Conroy, Amy; Leddy, Anna; Johnson, Mallory; Ngubane, Thulani; van Rooyen, Heidi; Darbes, Lynae

    2017-11-01

    Despite the important role of social relationships for health and wellbeing, little is known about how primary partners affect adherence to HIV care and treatment. We qualitatively explored how relationship dynamics and partner support influence adherence among couples from KwaZulu-Natal, South Africa. Twenty-four heterosexual couples with at least one HIV-positive partner completed semi-structured interviews on topics including relationship dynamics (intimacy or emotional closeness, communication, violence), experiences with HIV care and treatment and HIV-related social support. The majority of couples were seroconcordant HIV-positive (92%) and both on antiretroviral therapy (ART) (63%). Participants described how primary partners both interfered with and supported adherence. Negative forms of influence included relationship conflict, which resulted in forgetfulness to take pills, and men's attempt to control use of ART. However, participants were more likely to highlight positive forms of influence on adherence, which included social support (instrumental, informational and emotional), intimacy and commitment. The findings also suggest a reciprocal relationship between ART and relationships such that couple ART use may enhance relationship quality. Primary partners are important pillars of support for ART adherence, especially in contexts of high unemployment and poverty. Future interventions that encourage and leverage these supportive relationships could improve ART adherence among heterosexual couples in similar settings.

  6. 'The full has never been told': building a theory of sexual health for heterosexual Black men of Caribbean descent.

    Science.gov (United States)

    Crowell, Candice N; Delgado-Romero, Edward A; Mosley, Della V; Huynh, Sophia

    2016-08-01

    Research on Black sexual health often fails to represent the heterogeneity of Black ethnic groups. For people of Caribbean descent in the USA, ethnicity is a salient cultural factor that influences definitions and experiences of sexual health. Most research on people of Caribbean descent focuses on the relatively high rate of STIs, but sexual health is defined more broadly than STI prevalence. Psychological and emotional indicators and the voice of participants are important to consider when exploring the sexual health of a minority culture. The purpose of this study was to qualitatively explore how heterosexual Black men of Caribbean descent define and understand sexual health for themselves. Eleven men who self-identified as Black, Caribbean and heterosexual participated in three focus groups and were asked to define sexual health, critique behaviours expertly identified as healthy and address what encourages and discourages sexual health in their lives. Findings point to six dimensions of sexual health for heterosexual Black men of Caribbean descent. These include: heterosexually privileged, protective, contextual, interpersonal, cultural and pleasurable dimensions. There were some notable departures from current expert definitions of sexual health. Recommendations for further theory development are provided.

  7. Take-or-pay contract robustness: A three step story told by the Brazil-Bolivia gas case?

    International Nuclear Information System (INIS)

    Glachant, Jean-Michel; Hallack, Michelle

    2009-01-01

    Neo-institutional economics (NEI) has long shown that take-or-pay (ToP) long-term contracts provide a robust framework for safeguarding the interests of both upstream and downstream parties in the gas industry. The case of gas trade between Brazil and Bolivia presents an opportunity to re-examine empirically and to review the robust nature of the ToP framework over time. This case reveals that the positions of the contractors actually change giving rise to a veritable lifecycle of the contractual arrangement. Such a contract can be seen to span three successive phases. The first phase of the contract cycle begins when it is signed; allowing the investments to begin. The second phase starts when investments have been completed and the actual trade in gas begins. The third phase of the contract cycle comes when the increasing flow of gas comes close to saturating capacity and the volume levels for downstream market volume have been reached. These three contract phases are thus distinguished by how robust the alignment of the parties' interests is. The added value of the paper is then both empirical and analytical: the case study provides a brand new lifecycle analysis of the performance of ToP long-term contracting into an NEI framework

  8. A Phenomenological Investigation of Student Achievement: Perceptions of Academic Success as Told by Single African American and Hispanic Mothers

    Science.gov (United States)

    Stewart, Shawn M.

    2010-01-01

    A number of factors seem to contribute to low student achievement in the organization of education. Some of these factors exist prior to children reaching school age. It seems as though a vast quantity of minority students struggle academically. Research supports the belief that socioeconomic status, ethnicity, and single-parent families have an…

  9. The urban violence against children and adolescents in Belo Horizonte: a story told through the maxillofacial traumas

    OpenAIRE

    Silva, Carlos José de Paula; Ferreira, Efigênia Ferreira e; Paula, Liliam Pacheco Pinto de; Naves, Marcelo Drummond; Vargas, Andreia Maria Duarte; Zarzar, Patricia Maria Pereira Araujo

    2011-01-01

    Os traumas maxilofaciais decorrentes da violência contra crianças e adolescentes impactam suas vidas, física e psiquicamente, pelas deformidades que podem provocar e pela exposição da lesão na face das vítimas. O objetivo deste trabalho é identificar a prevalência dos traumas maxilofaciais em crianças e adolescentes decorrentes da violência urbana em Belo Horizonte- Brasil. O estudo foi conduzido no Hospital Municipal Odilon Behrens, único hospital municipal de referência nesse tipo de atendi...

  10. "A welfare recipient may be drinking, but as long as he does as told - he may drink himself to death"

    DEFF Research Database (Denmark)

    Hansen, Maja Bæksgaard; Kloster, Stine; Danquah, Ida Høgstedt

    2015-01-01

    BACKGROUND: This paper is embedded in a randomised controlled trial (Alcohol and Employment) that investigated whether welfare-to-work schemes combined with alcohol treatment were more effective than welfare-to-work schemes alone for helping unemployed welfare recipients with alcohol problems get...... back to employment and reduce their alcohol problems. The implementation of Alcohol and Employment turned out to be challenging, and fewer welfare recipients than expected were enrolled. The aim of this paper was to identify and investigate obstacles to the implementation of Alcohol and Employment. Our...... through observations and focus group interviews with job consultants. Data were analysed thematically and thoroughly discussed among members of the project team; emerging themes were then grouped and read again repeatedly until the themes were consistent. RESULTS: Three themes emerged as the main factors...

  11. Held Hostage by Our Students, as Told by One of the Hostages: In Memory of Mr. Jack Ellison

    Science.gov (United States)

    Cottle, Thomas J.

    2010-01-01

    The philosopher Emmanuel Levinas suggested that the most ethical act possible is the discovery that one has assumed responsibility for the other. In fact it is the other that makes possible the genuine exploration of the self, an act dominating the adolescent era of development. Although rarely appearing in educational literature, Levinas has…

  12. (Un)Told Stories of Post-War Prostitution: Challenging Hegemonic Narratives on Human Trafficking and Peacekeeping in Kosovo

    NARCIS (Netherlands)

    de Wildt, R.

    2018-01-01

    Sex industries worldwide tend to flourish during United Nations (UN) peacekeeping missions. The hegemonic discourse claims that women engaged in prostitution in the context of peacekeeping missions are singular victims of trafficking who meet the demand of peacekeepers. The suggestion that UN

  13. Can All Doctors Be Like This? Seven Stories of Communication Transformation Told by Physicians Rated Highest by Patients.

    Science.gov (United States)

    Janisse, Tom; Tallman, Karen

    2017-01-01

    The top predictors of patient satisfaction with clinical visits are the quality of the physician-patient relationship and the communications contributing to their relationship. How do physicians improve their communication, and what effect does it have on them? This article presents the verbatim stories of seven high-performing physicians describing their transformative change in the areas of communication, connection, and well-being. Data for this study are based on interviews from a previous study in which a 6-question set was posed, in semistructured 60-minute interviews, to 77 of the highest-performing Permanente Medical Group physicians in 4 Regions on the "Art of Medicine" patient survey. Transformation stories emerged spontaneously during the interviews, and so it was an incidental finding when some physicians identified that they were not always high performing in their communication with patients. Seven different modes of transformation in communication were described by these physicians: a listening tool, an awareness course, finding new meaning in clinical practice, a technologic tool, a sudden insight, a mentor observation, and a physician-as-patient experience. These stories illustrate how communication skills can be learned through various activities and experiences that transform physicians into those who are highly successful communicators. All modes result in a change of state-a new way of seeing, of being-and are not just a new tool or a new practice, but a change in state of mind. This state resulted in a marked change of behavior, and a substantial improvement of communication and relationship.

  14. Context Specificity of Stress-activated Mitogen-activated Protein (MAP) Kinase Signaling: The Story as Told by Caenorhabditis elegans*

    Science.gov (United States)

    Andrusiak, Matthew G.; Jin, Yishi

    2016-01-01

    Stress-associated p38 and JNK mitogen-activated protein (MAP) kinase signaling cascades trigger specific cellular responses and are involved in multiple disease states. At the root of MAP kinase signaling complexity is the differential use of common components on a context-specific basis. The roundworm Caenorhabditis elegans was developed as a system to study genes required for development and nervous system function. The powerful genetics of C. elegans in combination with molecular and cellular dissections has led to a greater understanding of how p38 and JNK signaling affects many biological processes under normal and stress conditions. This review focuses on the studies revealing context specificity of different stress-activated MAPK components in C. elegans. PMID:26907690

  15. Context Specificity of Stress-activated Mitogen-activated Protein (MAP) Kinase Signaling: The Story as Told by Caenorhabditis elegans.

    Science.gov (United States)

    Andrusiak, Matthew G; Jin, Yishi

    2016-04-08

    Stress-associated p38 and JNK mitogen-activated protein (MAP) kinase signaling cascades trigger specific cellular responses and are involved in multiple disease states. At the root of MAP kinase signaling complexity is the differential use of common components on a context-specific basis. The roundwormCaenorhabditis eleganswas developed as a system to study genes required for development and nervous system function. The powerful genetics ofC. elegansin combination with molecular and cellular dissections has led to a greater understanding of how p38 and JNK signaling affects many biological processes under normal and stress conditions. This review focuses on the studies revealing context specificity of different stress-activated MAPK components inC. elegans. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  16. Things I Wish They Had Told Me: Advice From a Newly Tenured Faculty Member From a Small, Liberal Arts College

    Science.gov (United States)

    Sheldon, Peter

    2002-04-01

    I followed a relatively unique path to tenure. I knew I wanted to teach at a small, liberal arts college, so I chose to “post-doc” as a visiting faculty member instead of doing research. I continued to do research as I taught, but teaching was the main focus. I feel that the path that I followed, the opportunities for research and having found tremendously effective mentors in my three years as a visiting faculty member put me in the perfect position to find the job I wanted. I am now in the fourth year of my first tenure-track job, and find myself with tenure. Randolph-Macon Woman’s College is a nationally ranked liberal arts college in central VA with 720 students. The Department of Physics and Astronomy offers both a BA and a BS in physics, and in struggling to stay alive with only two faculty members, I have actually managed to keep going with a few research and grant opportunities. I hope that my experiences will strike a chord with some of the audience, and my experiences can help others to decide what is and what is not important to them in the finding and holding of a faculty job. Other topics that could be covered include juggling responsibilities, seeking grants, dealing with colleagues, interacting with students, and learning to teach.

  17. How Do I Begin to Tell a Story That Has Not Been Told? Anarchism, Autoethnography, and the Middle Ground

    Science.gov (United States)

    DeLeon, Abraham P.

    2010-01-01

    As a testament to the growing literature on autoethnography and my own connections to systemic and direct racism, this article is a therapeutic way to explore my past through the ancient way of telling, testifying, and developing knowledge through narrative inquiry. Testimony opens new ways of looking at the world by participating in a subversive…

  18. What Are Women Told When Requesting Family Planning Services at Clinics Associated with Catholic Hospitals? A Mystery Caller Study.

    Science.gov (United States)

    Guiahi, Maryam; Teal, Stephanie B; Swartz, Maryke; Huynh, Sandy; Schiller, Georgia; Sheeder, Jeanelle

    2017-12-01

    Catholic Church directives restrict family planning service provision at Catholic health care institutions. It is unclear whether obstetrics and gynecology clinics that are owned by or have business affiliations with Catholic hospitals offer family planning appointments. Mystery callers phoned 144 clinics nationwide that were found on Catholic hospital websites between December 2014 and February 2016, and requested appointments for birth control generally, copper IUD services specifically, tubal ligation and abortion. Chi-square and Fisher's exact tests assessed potential correlates of appointment availability, and multivariable logistic regressions were computed if bivariate testing suggested multiple correlates. Although 95% of clinics would schedule birth control appointments, smaller proportions would schedule appointments for copper IUDs (68%) or tubal ligation (58%); only 2% would schedule an abortion. Smaller proportions of Catholic-owned than of Catholic-affiliated clinics would schedule appointments for birth control (84% vs. 100%), copper IUDs (4% vs. 97%) and tubal ligation (29% vs. 72%); for birth control and copper IUD services, no other clinic characteristics were related to appointment availability. Multivariable analysis confirmed that tubal ligation appointments were less likely to be offered at Catholic-owned than at Catholic-affiliated clinics (odds ratio. 0.1); location and association with one of the top 10 Catholic health care systems also were significant. Adherence to church directives is inconsistent at Catholic-associated clinics. Women visiting such clinics who want highly effective methods may need to rely on less effective methods or delay method uptake while seeking services elsewhere. Copyright © 2017 by the Guttmacher Institute.

  19. “Forget to Whom You Have Told This Proverb”: Directed Forgetting of Destination Memory in Alzheimer's Disease

    Science.gov (United States)

    El Haj, Mohamad; Gandolphe, Marie-Charlotte; Allain, Philippe; Fasotti, Luciano; Antoine, Pascal

    2015-01-01

    Destination memory is the ability to remember the receiver of transmitted information. By means of a destination memory directed forgetting task, we investigated whether participants with Alzheimer's Disease (AD) were able to suppress irrelevant information in destination memory. Twenty-six AD participants and 30 healthy elderly subjects were asked to tell 10 different proverbs to 10 different celebrities (List 1). Afterwards, half of the participants were instructed to forget the destinations (i.e., the celebrities) whereas the other half were asked to keep them in mind. After telling 10 other proverbs to 10 other celebrities (List 2), participants were asked to read numbers aloud. Subsequently, all the participants were asked to remember the destinations of List 1 and List 2, regardless of the forget or remember instructions. The results show similar destination memory in AD participants who were asked to forget the destinations of List 1 and those who were asked to retain them. These findings are attributed to inhibitory deficits, by which AD participants have difficulties to suppress irrelevant information in destination memory. PMID:25918456

  20. "They Told Me to Take Him Somewhere Else": Caregivers' Experiences Seeking Emergency Dental Care for Their Children.

    Science.gov (United States)

    Meyer, Beau D; Lee, Jessica Y; Lampiris, Lewis N; Mihas, Paul; Vossers, Sarah; Divaris, Kimon

    2017-05-15

    The purpose of this mixed-methods study was to examine pediatric emergency dental trends in two safety net clinics and care-seeking experiences of young children's caregivers. Administrative data were used to describe and compare emergency first visits of children ages zero to six years in a community-based (CC) and a University-based (UC) safety net clinic from 2010 to 2014. In-person interviews were conducted with 11 caregivers of children ages zero to six presenting for nontrauma-related emergency visits at the UC from January to August 2016. Interviews were transcribed verbatim, coded, and analyzed inductively using Atlas. ti.7.5.9. The UC experienced significantly more emergency first visits (33 percent) than the CC (five percent, P<0.001), and the majority of these UC visits were referrals. Caregivers were dissatisfied with the experienced barriers of access to care and lack of child-centeredness, specifically the referral out of the dental home for emergency dental care. A considerable proportion of children's first visits at dental safety net clinics was emergency related. Children's caregivers voiced issues related to access to care and lack of child-centered care. Discordance was apparent between how professional organizations define the dental home and how caregivers experience it in the context of emergency care.

  1. (Mis)understanding Science: The Problem with Scientific Breakthroughs.

    Science.gov (United States)

    Evans, James P

    2016-09-01

    On Saturday morning, February 28, 1953, the mystery of heredity appeared secure. Humans hadn't the faintest idea of how genetic information was transmitted-how the uncanny resemblance between mother and daughter, grandfather and grandson was conveyed across generations. Yet, by that Saturday afternoon, two individuals, James Watson and Francis Crick, had glimpsed the solution to these mysteries. The story of Watson and Crick's great triumph has been told and retold and has rightly entered the pantheon of scientific legend. But Watson and Crick's breakthrough was just that: a rupture and dramatic discontinuity in human knowledge that solved a deep mystery, the likes of which occurs, perhaps, a couple of times each century. And that's the problem. The story is just so good and so irresistible that it has misled generations of scientists about what to expect regarding a life in science. And more damaging, the resulting breakthrough mentality misleads the public, the media, and society's decision-makers about how science really works, all to the detriment of scientific progress and our society's well-being. © 2016 The Hastings Center.

  2. Capturing Student Mathematical Engagement through Differently Enacted Classroom Practices: Applying a Modification of Watson's Analytical Tool

    Science.gov (United States)

    Patahuddin, Sitti Maesuri; Puteri, Indira; Lowrie, Tom; Logan, Tracy; Rika, Baiq

    2018-01-01

    This study examined student mathematical engagement through the intended and enacted lessons taught by two teachers in two different middle schools in Indonesia. The intended lesson was developed using the ELPSA learning design to promote mathematical engagement. Based on the premise that students will react to the mathematical tasks in the forms…

  3. Orbital interactions and charge redistribution in weak hydrogen bonds: The Watson-Crick AT mimic adenine-2,4-difluorotoluene

    NARCIS (Netherlands)

    Fonseca Guerra, C.; Bickelhaupt, F.M.

    2003-01-01

    An overview is given of results that reestablish hydrogen bonding as an essential factor in DNA replication involving natural bases as well as less polar mimics and they also confirm the importance of steric factors, in line with Kool's experimental work. In addition they show that knowledge of the

  4. Design of two and three input molecular logic gates using non-Watson-Crick base pairing-based molecular beacons.

    Science.gov (United States)

    Lin, Jia-Hui; Tseng, Wei-Lung

    2014-03-21

    This study presents a single, resettable, and sensitive molecular beacon (MB) used to operate molecular-scale logic gates. The MB consists of a random DNA sequence, a fluorophore at the 5'-end, and a quencher at the 3'-end. The presence of Hg(2+), Ag(+), and coralyne promoted the formation of stable T-Hg(2+)-T, C-Ag(+)-C, and A2-coralyne-A2 coordination in the MB probe, respectively, thereby driving its conformational change. The metal ion or small molecule-mediated coordination of mismatched DNA brought the fluorophore and the quencher into close proximity, resulting in collisional quenching of fluorescence between the two organic dyes. Because thiol can bind Hg(2+) and remove it from the T-Hg(2+)-T-based MB, adding thiol to a solution of the T-Hg(2+)-T-based MB allowed the fluorophore and the quencher to be widely separated. A similar phenomenon was observed when replacing Hg(2+) with Ag(+). Because Ag(+) strongly binds to iodide, cyanide, and cysteine, they were capable of removing Ag(+) from the C-Ag(+)-C-based MB, restoring the fluorescence of the MB. Moreover, the fluorescence of the A2-coralyne-A2-based MB could be switched on by adding polyadenosine. Using these analytes as inputs and the MB as a signal transducer, we successfully developed a series of two-input, three-input, and set-reset logic gates at the molecular level.

  5. Crystal structure of metallo DNA duplex containing consecutive Watson-Crick-like T-Hg(II)-T base pairs.

    Science.gov (United States)

    Kondo, Jiro; Yamada, Tom; Hirose, Chika; Okamoto, Itaru; Tanaka, Yoshiyuki; Ono, Akira

    2014-02-24

    The metallo DNA duplex containing mercury-mediated T-T base pairs is an attractive biomacromolecular nanomaterial which can be applied to nanodevices such as ion sensors. Reported herein is the first crystal structure of a B-form DNA duplex containing two consecutive T-Hg(II)-T base pairs. The Hg(II) ion occupies the center between two T residues. The N3-Hg(II) bond distance is 2.0 Å. The relatively short Hg(II)-Hg(II) distance (3.3 Å) observed in consecutive T-Hg(II)-T base pairs suggests that the metallophilic attraction could exist between them and may stabilize the B-form double helix. To support this, the DNA duplex is largely distorted and adopts an unusual nonhelical conformation in the absence of Hg(II). The structure of the metallo DNA duplex itself and the Hg(II)-induced structural switching from the nonhelical form to the B-form provide the basis for structure-based design of metal-conjugated nucleic acid nanomaterials. Copyright © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  6. Higher order structural effects stabilizing the reverse watson-crick guanine-cytosine base pair in functional RNAs

    KAUST Repository

    Chawla, Mohit; Abdel-Azeim, Safwat; Oliva, Romina; Cavallo, Luigi

    2013-01-01

    of the Guanine can increase its stability. Herein, we extend our survey and report on other H-bonding interactions that can increase the stability of this base pair. To this aim, we performed a bioinformatics search of the PDB to locate all the occurencies of G

  7. DNA before Watson & Crick-The Pioneering Studies of J. M. Gulland and D. O. Jordan at Nottingham

    Science.gov (United States)

    Booth, Harold; Hey, Michael J.

    1996-10-01

    A description placed in a historical context, of the physico-chemical investigations of DNA carried out in the period 1940-1950 by a group at University College, Nottingham led by J.M.Gulland and D.O.Jordan. The isolation of a pure sample of DNA from calf thymus was followed by its analysis by potentiometric titrations and by measurements at variable pH of viscosity and streaming birefringence. Unlike the phosphoric acid groups, the primary amino and enolic hydroxyl groups could only be titrated after prior treatment with strong acid or strong base. The conclusion of Gulland and Jordan, that extremes of pH caused liberation of amino and enolic hydoxyl groups by disruption of hydrogen bonds between neighbouring polynucleotide chains, proved to be of considerable importance. The article includes life histories of Gulland and Jordan, and reference to Linus Pauling's remarkable foresight during his Sir Jesse Boot Foundation Lecture delivered at Nottingham in 1948.

  8. Effective Lagrangians, Watson's theorem and the E2/M1 mixing ratio in the excitation of the Delta resonance

    International Nuclear Information System (INIS)

    Davidson, R.M.

    1992-01-01

    The author investigates theoretical uncertainties and model dependence in the extraction of the nucleon-delta(1232) electromagnetic transition amplitudes from the multipole data base. The starting point is an effective Lagrangian incorporating chiral symmetry, which includes at the tree level the pseudovector Born terms, leading t-channel vector meson exchanges, and s and u channel delta exchanges. The nucleon-delta magnetic dipole (M1) and electric quadrupole (E2) transition amplitudes are expressed in terms of two independent gauge couplings at the γNΔ vertex. After unitarizing the tree level amplitude, the gauge couplings are fitted to various multipole data sets, thus determining E2 and M1. Although there is much sensitivity to the method used to unitarize the amplitude, the author extracts the E2/M1 ratio to be negative, with a magnitude around 1.5%. 11 refs., 3 figs

  9. Elizabeth Shove, Mika Pantzar, Matt Watson, The Dynamics of Social Practice. Everyday Life and how it Changes

    OpenAIRE

    Ortar, Nathalie

    2012-01-01

    The dynamics of social practice s’inscrit dans une filiation qui marque depuis quelques années le paysage de la recherche de la sociologie de la consommation et de l’énergie. Son ambition est à la hauteur de l’importance prise par ces travaux puisque les auteurs souhaitent faire une différence grâce à la théorisation sociale pour influer sur les politiques publiques. L’ouvrage se veut également une critique de la théorie des choix rationnels et s’applique à démontrer pourquoi cette théorie es...

  10. 77 FR 64515 - Watson Pharmaceuticals, Inc., Actavis Inc., Actavis Pharma Holding 4 ehf., and Actavis S.a.r.l...

    Science.gov (United States)

    2012-10-22

    ... resulting from Parkinson's disease. Novartis markets branded Exelon in the United States. Currently, there... Pharma Holding 4 ehf., and Actavis S.a.r.l.; Analysis of Agreement Containing Consent Orders To Aid... agreement in this matter settles alleged violations of federal law prohibiting unfair or deceptive acts or...

  11. Noncanonical structures and their thermodynamics of DNA and RNA under molecular crowding: beyond the Watson-Crick double helix.

    Science.gov (United States)

    Sugimoto, Naoki

    2014-01-01

    How does molecular crowding affect the stability of nucleic acid structures inside cells? Water is the major solvent component in living cells, and the properties of water in the highly crowded media inside cells differ from that in buffered solution. As it is difficult to measure the thermodynamic behavior of nucleic acids in cells directly and quantitatively, we recently developed a cell-mimicking system using cosolutes as crowding reagents. The influences of molecular crowding on the structures and thermodynamics of various nucleic acid sequences have been reported. In this chapter, we discuss how the structures and thermodynamic properties of nucleic acids differ under various conditions such as highly crowded environments, compartment environments, and in the presence of ionic liquids, and the major determinants of the crowding effects on nucleic acids are discussed. The effects of molecular crowding on the activities of ribozymes and riboswitches on noncanonical structures of DNA- and RNA-like quadruplexes that play important roles in transcription and translation are also described. © 2014 Elsevier Inc. All rights reserved.

  12. See I told you I was taking it! - attitudes of adolescents with asthma towards a device monitoring their inhaler use: Implications for future design

    OpenAIRE

    Howard, Sam; Lang, Alexandra. R.; Sharples, Sarah; Shaw, Dominick E.

    2016-01-01

    Adherence to treatment in asthma is often poor, particularly in adolescents and children where the condition is most prevalent. Electronic monitoring devices have shown potential for improving inhaler use, yet little research has considered the attitudes of patients towards these devices. We gave seven adolescents with asthma an electronic monitoring device to use for one month and collected their views on important issues including monitoring and data sharing. Our results showed that partici...

  13. PIDs for digital content: Are they used as they should be? The example of DOI and ORCID, told from a research library perspective

    Science.gov (United States)

    Kraft, Angelina; Dreyer, Britta; Löwe, Peter

    2017-04-01

    For finding, linking and citing research content, persistent digital identifiers are the key, as a persistent identifier is a long-lasting reference to a resource. But are PIDs really used as they should be? With respect to the obstacles of the PID systems, we face a diverse landscape of stakeholders, legacy systems, competing interests and often incomprehensible messaging filled with technical jargon around PIDs. Insufficient metadata quality is another major challenge for these systems. While the principal task for service providers lies in collaborating to provide a shared and easy to use PID infrastructure, it is the key responsibility for data centers to provide rich metadata and structured access to research content. Especially metadata and structured access are imperative for the most basic services such as search, citation tracking and reuse. And of course all needs to be human- and machine interoperable, as we want our machines to be able to interpret PIDs depended on a specific use case. Since 2004, the German National Library of Science and Technology (TIB) has been providing DOI services to data centers in Germany. Recent developments make clear that requirements for PIDs have changed. Science has developed a need for PIDs at multiple content levels: In addition to DOIs for journal articles and research data, PIDs for people, physical objects, collections, software, funders, organizations, expeditions, resources, instruments and even for data management plans are required to enable different platforms to exchange information consistently and unambiguously. In this work we want to emphasize on the distinct increases of total DOI registrations for research data and other research output such as images, videos or software in Germany within the past decade and how research institutes and universities differ in their DOI registration workflows. We present use cases which illustrate the deployment of DOIs e.g. for dynamic data, and demonstrate the need of rich metadata for a successful performance of user services. Along with a broader acceptance of DOIs for research content beyond articles, institutes are faced with the challenge of providing appropriate recognition to their researchers for their published work. To promote this, the ORCID Germany Consortium was launched in October 2016. The consortium, administrated by TIB, is an essential building block of the ORCID DE project with the goal to facilitate the distribution of researcher IDs in Germany. An ORCID (Open Researcher and Contributor ID) provides scientists with an unambiguous identifier, enabling them to distinguish themselves from others, while at the same time simplifying the management of their research activity records (e.g. publications of papers, dissertation, research data, software, and attended conferences). ORCID Germany Consortium member institutions are able to link their academic records to the ORCID identifiers of their researchers and benefit from up-to-date and complete publication lists. DOIs and ORCIDs, if used correctly, are both machine-interoperable PIDs which not only make research more accessible, but also increase the visibility of all outputs of research, the researcher and the affiliated institution.

  14. “I would rather be told than not know” - A qualitative study exploring parental views on identifying the future risk of childhood overweight and obesity during infancy

    Directory of Open Access Journals (Sweden)

    Faye Bentley

    2017-08-01

    Full Text Available Abstract Background Risk assessment tools provide an opportunity to prevent childhood overweight and obesity through early identification and intervention to influence infant feeding practices. Engaging parents of infants is paramount for success however; the literature suggests there is uncertainty surrounding the use of such tools with concerns about stigmatisation, labelling and expressions of parental guilt. This study explores parents’ views on identifying future risk of childhood overweight and obesity during infancy and communicating risk to parents. Methods Semi-structured qualitative interviews were conducted with 23 parents and inductive, interpretive and thematic analysis performed. Results Three main themes emerged from the data: 1 Identification of infant overweight and obesity risk. Parents were hesitant about health professionals identifying infant overweight as believed they would recognise this for themselves, in addition parents feared judgement from health professionals. Identification of future obesity risk during infancy was viewed positively however the use of a non-judgemental communication style was viewed as imperative. 2 Consequences of infant overweight. Parents expressed immediate anxieties about the impact of excess weight on infant ability to start walking. Parents were aware of the progressive nature of childhood obesity however, did not view overweight as a significant problem until the infant could walk as viewed this as a point when any excess weight would be lost due to increased energy expenditure. 3 Parental attributions of causality, responsibility, and control. Parents articulated a high level of personal responsibility for preventing and controlling overweight during infancy, which translated into self-blame. Parents attributed infant overweight to overfeeding however articulated a reluctance to modify infant feeding practices prior to weaning. Conclusion This is the first study to explore the use of obesity risk tools in clinical practice, the findings suggest that identification, and communication of future overweight and obesity risk is acceptable to parents of infants. Despite this positive response, findings suggest that parents’ acceptance to identification of risk and implementation of behaviour change is time specific. The apparent level of parental responsibility, fear of judgement and self-blame also highlights the importance of health professionals approach to personalised risk communication so feelings of self-blame are negated and stigmatisation avoided.

  15. Gadè deceptions and lies told by the ill: The Caribbean sociocultural construction of truth in patient-healer encounters.

    Science.gov (United States)

    Massé, Raymond

    2002-08-01

    A constructivist approach in medical anthropology suggests that the boundary between lies and truth in sickness narratives is thin. Based on fieldwork in the French (Martinique) and English (Saint-Lucia) Carribbean with gadé and quimboiseurs (local folk healers), this paper addresses the gap between naïve romanticism and radical cynicism in the anthropological analysis of patient-healer encounters. Is the sick person lying when she accuses evil spirits for her behaviour or sickness? Is the quimboiseur who is building a meaningful explanation or diagnosis simply a liar taking advantage of his client's credulity? The challenge for anthropology is not to determine whether or not a person is lying when attributing their ill fortune to witchcraft. Instead, in this paper, the author approaches lying as a language-game played by both patients and folk healers. Concepts of lying as games, tactical lies, pragmatic creativity, and constructive lies are introduced here as a perspective for a reconsideration of lying as a pertinent research object.

  16. “What was done there is not to be told!” Plans for improvement and designs for ruin in Austen’s Sotherton Court

    Directory of Open Access Journals (Sweden)

    Roberta Grandi

    2012-07-01

    Full Text Available L’articolo prende in considerazione il romanzo Mansfield Park di Jane Austen, concentrandosi in particolare sulle descrizioni e sugli eventi legati a Sotherton Court, l’abitazione di Mr. Rushworth. Il romanzo dedica grande attenzione ai progetti di rinnovamento del parco di Sotherton, offrendo interessanti osservazioni riguardo alla moda per l’architettura dei giardini e alle differenti attitudini dei personaggi coinvolti. L’articolo si apre con una introduzione generale sulla situazione dell’architettura paesaggistica nell’epoca di Jane Austen e si dedica, poi, ad approfondire l’analisi degli elementi descritti nel romanzo. La seconda parte dell’articolo si sviluppa a partire dalla considerazione del parco come locus amoenus, il giardino di piacere, per poi studiare la visita a Sotherton Court come narrata nei capitoli 9 e 10 del primo volume. L’episodio mette in scenai personaggi principali mentre, protetti dall’intimità della “wilderness” e dell’“ha-ha”, si lasciano andare a comportamenti impropri. L’analisi mostra come questo episodio costituisca una prefigurazione metaforica dello sviluppo futuro della trama e come esso fornisca, allo stesso tempo, un giudizio morale sul comportamento dei personaggi.

  17. "Nobody Told Me They Didn't Speak English!": Teacher Language Views and Student Linguistic Repertoires in Hutterite Colony Schools in Canada

    Science.gov (United States)

    Sterzuk, Andrea; Nelson, Cynthia A.

    2016-01-01

    This article presents a qualitative study of five monolingual teachers' understandings of the linguistic repertoires of their multilingual students. These teachers deliver the Saskatchewan provincial curricula in English to Hutterite colony students who are users of three languages: (a) spoken Hutterisch as a home and community language, (b)…

  18. "We Were Told We're Not Teachers... It Gets Difficult to Draw the Line": Negotiating Roles in Peer-Assisted Study Sessions (PASS)

    Science.gov (United States)

    Brown, Kim; Nairn, Karen; van der Meer, Jacques; Scott, Carole

    2014-01-01

    Peer learning models in pre-service teacher education are in the early stages of implementation. In this article, we evaluated a pilot Peer-Assisted Study Sessions (PASS) program that supplemented a course for pre-service teachers at one New Zealand university. PASS participants discussed experiences of the program, revealing tensions between what…

  19. "I am, I am nothing, I am a story ever told": Performing personas - erotic expression in audiovisual performances Ney Matogrosso the authorization context of a dictatorship

    Directory of Open Access Journals (Sweden)

    Robson Pereira da Silva

    2016-01-01

    Full Text Available There is, in this article, the research into the performing transgressions of Ney Matogrosso in the context of the Brazilian dictatorship civil military. Thus, we understand the marginal personas (types / archetypes displayed procedurally in performative procedures artist Ney Matogrosso (phonogram, cover, brochure, spectacles, meaning his work over the years 1970 and 1980. The artist, in his works, reverses the concepts governed by affluent culture, this practice, consisting of audiovisual materials, widespread in the cultural industry, which ensures historically the performer of the production of the materiality of Music Popular Brazilian (MPB - recording performance. This study highlights the historicity of aesthetic subversion in Ney Matogrosso, as a front political attitude to the producer authoritarian regime prohibitions the erotic potential.

  20. "My mother told me that I should not": a qualitative study exploring the restrictions placed on adolescent girls living with HIV in Zambia.

    Science.gov (United States)

    Mackworth-Young, Constance Rs; Bond, Virginia; Wringe, Alison; Konayuma, Katongo; Clay, Sue; Chiiya, Chipo; Chonta, Mutale; Sievwright, Kirsty; Stangl, Anne L

    2017-12-01

    Adolescent girls in sub-Saharan Africa are disproportionately affected by HIV due to a range of social and structural factors. As they transition to adulthood, they are recipients of increasing blame for HIV infection and 'improper' sex, as well as increasing scrutiny, restrictions and surveillance. This study used a qualitative and participatory approach to explore the messaging and restrictions imposed on adolescent girls living with HIV in Zambia. Thirty-four in-depth interviews and four participatory workshops were carried out with 24 adolescent girls aged 15 to 19 years old living with HIV in Lusaka, Zambia. Key themes explored included experiences living with HIV, finding out about HIV status, disclosure, experiences with antiretroviral treatment, and support needs. Data were organized, coded and analysed using a grounded theory approach to thematic analysis. This analysis uses data on participants' experiences of living with HIV and their interactions with their parents, guardians and healthcare providers. Family and healthcare providers, partly in a quest to protect both the health of adolescent girls living with HIV and also to protect them from blaming discourse, imposed restrictions on their behaviour around three main topics: don't disclose your HIV status, don't have sex, and don't miss your medicines. These restrictions were often delivered using tactics of fear, and usually disconnected from other options. Participants responded to these messages in several ways, including internalizing the messages, changing their behaviour either to comply with or resist the restrictions, by remaining silent and anxious when restrictions were broken, and developing concerns around their own health and sexual and reproductive aspirations. Participants also sometimes experiencing stigma when restrictions could not be maintained. Restrictive messages were delivered to adolescent girls living with HIV through the broader social discourses of stigma, religion, and global and local narratives about HIV. Programmes aiming to support adolescent girls living with HIV need to work together with parents and healthcare providers to reflect on the impact of sanctioning messages, and to encourage more enabling and empowering messaging for adolescent girls living with HIV. © 2017 Zambart. Journal of the International AIDS Society published by John Wiley & sons Ltd on behalf of the International AIDS Society.

  1. "If You Had Told Me before That These Students Were Russians, I Would Not Have Believed It": An International Project about the (New) "Cold War"

    Science.gov (United States)

    Wansink, Bjorn; Zuiker, Itzél; Wubbels, Theo; Kamman, Maurits; Akkerman, Sanne

    2017-01-01

    Bjorn Wansink and his co-authors have aligned their teaching of a recent and controversial historical issue--the Cold War--in the light of a contemporary incident. This article demonstrates a means of ensuring that students understand that different cultures' views of their shared past are nuanced, rather than monolithic--a different concept in…

  2. Histórias de perdas fetais contadas por mulheres: estudo de análise qualitativa Histories of fetal losses told by women: research qualitative study

    Directory of Open Access Journals (Sweden)

    Alba Lúcia Dias dos Santos

    2004-04-01

    Full Text Available OBJETIVO: (Reconhecer o significado da perda fetal para mulheres que vivenciaram a experiência, a partir da compreensão do processo de gravidez, com base em seus relatos. MÉTODOS: Pesquisa de análise qualitativa com base nas histórias de sete mulheres que vivenciaram a experiência de perda fetal, no município de Arujá, SP, no período de julho de 1998 a junho de 1999. As mulheres foram identificadas a partir de atestados de óbito de nascidos mortos no período de estudo, obtidos no Cartório de Registro Civil de Arujá. Como procedimentos metodológicos, foram utilizadas a técnica de história oral para a coleta de dados e a técnica de análise de conteúdo do material coletado. As entrevistas realizadas foram gravadas e transcritas integralmente, e posteriormente recortadas para análise. RESULTADOS: Os achados foram analisados, contemplando dois momentos: o contexto circunstancial da gravidez e o impacto após a perda, adotando-se categorias temáticas específicas. A primeira parte aborda a percepção da gravidez, a notícia da vinda do bebê, os problemas de saúde até a perda e o atendimento do serviço de saúde. O significado da perda do bebê para as mulheres desse estudo foi evidenciado por três eixos centrais: perda de parte dela, fatalidade atribuída ao divino e mudanças de atitude perante a vida. A rede social de apoio a essas mulheres foi constituída sobre dois pilares: a família e a igreja, sendo praticamente inexistente o apoio de serviços de saúde. Ao final, todas elas expressaram a vontade de viver, a necessidade de trabalhar, de estudar e, até mesmo, de ter nova gravidez. CONCLUSÕES: Faz-se necessária uma mudança de paradigma nessa missão de atender pessoas; é preciso humanizar o atendimento nos serviços de saúde. Ficou muito evidente a necessidade do acompanhamento de usuárias de serviços de saúde que tiveram uma perda fetal, por uma equipe multiprofissional. Foi evidenciada, também, a importância de uma rede de apoio para mulheres que vivenciam esse problema.OBJECTIVE: To recognize the significance of fetal loss for women who have experienced it, starting from an understanding of the pregnancy process, based on their reports. METHODS: This was a qualitative analysis study based on the histories of seven women who experienced fetal loss in the town of Arujá, State of São Paulo, between July 1998 and June 1999. The women were identified from the death certificates of stillborn infants born within the study period, which were obtained from the Civil Registry Office of Arujá. The methodological procedures involved the utilization of the techniques of oral history-taking to gather data and content analysis to evaluate the material collected. The interviews were recorded, fully transcribed and subsequently prepared for analysis. RESULTS: The findings were analyzed as two points: the circumstantial context of the pregnancy and the impact after the loss, with the adoption of specific thematic categories. The first of these encompassed the woman's perception of the pregnancy, her awareness of the coming of the new baby, health problems up to the time of the loss, and the health service attendance. The significance of the loss for the women in this study was made evident along three central lines: the loss of a part of herself, attribution of the fatality to divine intervention and changes in attitude towards life. The social support network for these women was built on two pillars: family and church. Support from the health services was practically nonexistent. Finally, they all expressed their will to live and the need to work, study and even have another pregnancy. CONCLUSIONS: There needs to be a change in general concepts in the mission to attend to such women. The attendance provided by the healthcare services needs to be humanized. The need for multiprofessional follow-up of healthcare service users who suffered fetal loss was very evident. The importance of a support network for women who have gone through this problem was also shown.

  3. “And they told two friends…and so on”: RJ Reynolds’ viral marketing of Eclipse and its potential to mislead the public

    Science.gov (United States)

    Anderson, S J; Ling, P M

    2010-01-01

    Objective To explore viral marketing strategies for Eclipse cigarettes used by the RJ Reynolds Company (Winston-Salem, North Carolina, USA). Methods Analysis of previously secret tobacco industry documents and multimedia materials. Results The failure of RJ Reynolds’ (RJR) 1988 “smokeless” cigarette, Premier, was in part due to widespread bad word of mouth about the product’s flavour, quality and difficulty of use. In 1994 RJR introduced an updated version of Premier, the ostensibly “reduced risk” Eclipse cigarette. RJR developed viral marketing channels to promote Eclipse using (1) exploratory interviews to motivate consumers to spread the word about Eclipse prior to market release, (2) promotional videos featuring positive feedback from test group participants to portray majority consensus among triers, (3) “Tupperware”-like parties for Eclipse where participants received samples to pass around in their social circles and (4) the Eclipse website’s bulletin board as a forum for potential users to discuss the brand in their own words. These strategies targeted the brand’s likeliest adopters, recruited informal and credible representatives of the product unaffiliated with RJR, and controlled the information spread about the product. Conclusions Viral marketing techniques may be particularly useful to promote new tobacco products such as Eclipse that have limited appeal and need a highly motivated audience of early adopters and acceptors. Such techniques help evade the mass rejection that could follow mass promotion, circumvent marketing restrictions, and allow tobacco companies to benefit from health claims made by consumers. Cigarette manufacturers must be held accountable for perceived health benefits encouraged by all promotional activities including viral marketing. PMID:18332064

  4. "I would rather be told than not know" - A qualitative study exploring parental views on identifying the future risk of childhood overweight and obesity during infancy.

    Science.gov (United States)

    Bentley, Faye; Swift, Judy Anne; Cook, Rachel; Redsell, Sarah A

    2017-08-29

    Risk assessment tools provide an opportunity to prevent childhood overweight and obesity through early identification and intervention to influence infant feeding practices. Engaging parents of infants is paramount for success however; the literature suggests there is uncertainty surrounding the use of such tools with concerns about stigmatisation, labelling and expressions of parental guilt. This study explores parents' views on identifying future risk of childhood overweight and obesity during infancy and communicating risk to parents. Semi-structured qualitative interviews were conducted with 23 parents and inductive, interpretive and thematic analysis performed. Three main themes emerged from the data: 1) Identification of infant overweight and obesity risk. Parents were hesitant about health professionals identifying infant overweight as believed they would recognise this for themselves, in addition parents feared judgement from health professionals. Identification of future obesity risk during infancy was viewed positively however the use of a non-judgemental communication style was viewed as imperative. 2) Consequences of infant overweight. Parents expressed immediate anxieties about the impact of excess weight on infant ability to start walking. Parents were aware of the progressive nature of childhood obesity however, did not view overweight as a significant problem until the infant could walk as viewed this as a point when any excess weight would be lost due to increased energy expenditure. 3) Parental attributions of causality, responsibility, and control. Parents articulated a high level of personal responsibility for preventing and controlling overweight during infancy, which translated into self-blame. Parents attributed infant overweight to overfeeding however articulated a reluctance to modify infant feeding practices prior to weaning. This is the first study to explore the use of obesity risk tools in clinical practice, the findings suggest that identification, and communication of future overweight and obesity risk is acceptable to parents of infants. Despite this positive response, findings suggest that parents' acceptance to identification of risk and implementation of behaviour change is time specific. The apparent level of parental responsibility, fear of judgement and self-blame also highlights the importance of health professionals approach to personalised risk communication so feelings of self-blame are negated and stigmatisation avoided.

  5. What’s Easier: Doing What You Want, or Being Told What to Do? Cued versus Voluntary Language and Task Switching

    Science.gov (United States)

    Gollan, Tamar H.; Kleinman, Daniel; Wierenga, Christina E.

    2014-01-01

    The current study contrasted cued versus voluntary switching to investigate switching efficiency and possible sharing of control mechanisms across linguistic and non-linguistic domains. Bilinguals switched between naming pictures in Spanish versus English or between reading numbers aloud versus adding their digits, either without or with repetition of stimuli, and with fewer requirements as to when and how much they had to switch relative to previous instantiations of voluntary switching. Without repetition (Experiment 1), voluntary responses were faster than cued responses on both stay and switch trials (especially in the non-linguistic switching task), whereas in previous studies the voluntary advantage was restricted to switch-cost reduction. Similarly, when targets were presented repeatedly (Experiment 2), voluntary responses were faster overall for both linguistic and non-linguistic switching, though here the advantage tended to be larger on switch trials. Experiment 3 confirmed the overall voluntary speed advantage for the read-add task in monolinguals, and revealed a reduction in switch costs only for a different non-linguistic task (size-parity judgments). These results reveal greater overall advantages for voluntary over cued switching than previously reported, but also that the precise manifestation of the voluntary advantage can vary with different tasks. In the linguistic domain, lexical inaccessibility introduces some unique control mechanisms, and repetition may magnify cross-domain overlap in control mechanisms. Finally, under some limited conditions, cost-free switches were found in both linguistic and non-linguistic domains; however, suspension of top-down control may be restricted to language or highly automatic tasks. PMID:25313951

  6. "If We Only Told Our Story Better...": Re-Envisioning State-University Relations through the Lens of Public Engagement. WISCAPE Viewpoints

    Science.gov (United States)

    Weerts, David J.

    2011-01-01

    A prevailing notion among higher education leaders is that public relations and marketing efforts must be intensified to boost legislative support for colleges and universities. However, this view fails to consider whether the academy might increase its standing among legislators and the general public by becoming more productively engaged in…

  7. Building and Modification of the Continental Lithosphere: the History of the Contiguous U.S. as told by MLDs and LABs

    Science.gov (United States)

    Hopper, E.; Fischer, K. M.

    2016-12-01

    The lithosphere preserves a record of past and present tectonic processes in its internal structures and its boundary with the underlying asthenosphere. We use common conversion point stacked Sp converted waves recorded by EarthScope's Transportable Array, as well as other available permanent and temporary broadband stations, to image such structures in the lithospheric mantle of the contiguous U.S. In the tectonically youngest western U.S., a shallow, sharp velocity gradient at the base of the lithosphere suggests a boundary defined by ponded melt. The lithosphere thickens with age of volcanism, implying the lithosphere is a melt-mitigated, conductively cooling thermal boundary layer. Beneath older, colder lithosphere where melt fractions are likely much lower, the velocity gradient at the base of such a layer should be a more diffuse, primarily thermal boundary. This is consistent with observations in the eastern U.S. where the lithosphere-asthenosphere boundary (LAB) is locally sharp and shallower only in areas of inferred enhanced upwelling - such as ancient hot spot tracks and areas of inferred delamination. In the cratonic interior, the LAB is even more gradual in depth, and is transparent to Sp waves with dominant periods of 10 s. Although seismic imaging only provides a snapshot of the lithosphere as it is today, preserved internal structures extend the utility of this imaging back into deep geological time. Ancient accretion within the cratonic lithospheric mantle is preserved as dipping structures associated with relict subducted slabs from Paleoproterozoic continental accretion, suggesting that lateral accretion was integral to the cratonic mantle root formation process. Metasomatism, melt migration and ponding below a carbonated peridotite solidus explain a sub-horizontal mid-lithospheric discontinuity (MLD) commonly observed at 70-100 km depth. This type of MLD is strongest in Mesoproterozoic and older lithosphere, suggesting that it formed more vigorously in the deep past, that a billion years or more are required to build up an observable volatile-rich layer, or that strong, ancient lithosphere is required to support an inherently weak, volatilized layer.

  8. "And they told two friends...and so on": RJ Reynolds' viral marketing of Eclipse and its potential to mislead the public.

    Science.gov (United States)

    Anderson, S J; Ling, P M

    2008-08-01

    To explore viral marketing strategies for Eclipse cigarettes used by the RJ Reynolds Company (Winston-Salem, North Carolina, USA). Analysis of previously secret tobacco industry documents and multimedia materials. The failure of RJ Reynolds' (RJR) 1988 "smokeless" cigarette, Premier, was in part due to widespread bad word of mouth about the product's flavour, quality and difficulty of use. In 1994 RJR introduced an updated version of Premier, the ostensibly "reduced risk" Eclipse cigarette. RJR developed viral marketing channels to promote Eclipse using (1) exploratory interviews to motivate consumers to spread the word about Eclipse prior to market release, (2) promotional videos featuring positive feedback from test group participants to portray majority consensus among triers, (3) "Tupperware"-like parties for Eclipse where participants received samples to pass around in their social circles and (4) the Eclipse website's bulletin board as a forum for potential users to discuss the brand in their own words. These strategies targeted the brand's likeliest adopters, recruited informal and credible representatives of the product unaffiliated with RJR, and controlled the information spread about the product. Viral marketing techniques may be particularly useful to promote new tobacco products such as Eclipse that have limited appeal and need a highly motivated audience of early adopters and acceptors. Such techniques help evade the mass rejection that could follow mass promotion, circumvent marketing restrictions, and allow tobacco companies to benefit from health claims made by consumers. Cigarette manufacturers must be held accountable for perceived health benefits encouraged by all promotional activities including viral marketing.

  9. The Romance of Lady Isabel Burton : the story of her life / told in part by herself and in part by W.H. Wilkins

    Trove (Australia)

    Burton, Isabel, Lady, 1831-1896

    2004-01-01

    ... and ribbons The blaze of lights the odour of flowers the perfumes the diamonds and the magnificent dresses of the cream of the British aristocracy smote upon my senses all was new to me and all was sweet ...

  10. Fly with Me: How Stanley Park High School Developed an Alternative Vision and Practice, as Told through the Narrative of Four Teachers

    Science.gov (United States)

    Davies, Mike

    2018-01-01

    This article introduces texts by practitioners at Stanley Park High School, links these to articles about the school in the previous issue of "FORUM," and endorses the continuing commitment at Stanley Park to encouraging a thriving learning culture.

  11. “I told her this is your life”: Relationship Dynamics, Partner Support, and Adherence to Antiretroviral Therapy among South African Couples

    OpenAIRE

    Conroy, Amy; Leddy, Anna; Johnson, Mallory; Ngubane, Thulani; van Rooyen, Heidi; Darbes, Lynae

    2017-01-01

    Despite the important role of social relationships on health and well-being, little is known about how primary partners affect adherence to HIV care and treatment. We qualitatively explored how relationship dynamics and partner support influence adherence among couples from KwaZulu-Natal, South Africa. Twenty-four heterosexual couples with at least one HIV-positive partner completed semi-structured interviews on topics including relationship dynamics (intimacy or emotional closeness, communic...

  12. Doing the right thing without being told: joint effects of initiative climate and general self-efficacy on employee proactive customer service performance.

    Science.gov (United States)

    Raub, Steffen; Liao, Hui

    2012-05-01

    We developed and tested a cross-level model of the antecedents and outcomes of proactive customer service performance. Results from a field study of 900 frontline service employees and their supervisors in 74 establishments of a multinational hotel chain located in Europe, the Middle East, Africa, and Asia demonstrated measurement equivalence and suggested that, after controlling for service climate, initiative climate at the establishment level and general self-efficacy at the individual level predicted employee proactive customer service performance and interacted in a synergistic way. Results also showed that at the establishment level, controlling for service climate and collective general service performance, initiative climate was positively and indirectly associated with customer service satisfaction through the mediation of aggregated proactive customer service performance. We discuss important theoretical and practical implications of these findings. (PsycINFO Database Record (c) 2012 APA, all rights reserved).

  13. "But I wasn't told to": lack of education and workplace policy as barriers in the provision of family planning information.

    Science.gov (United States)

    Bell, Melissa M

    2015-01-01

    Access to family planning has been identified as critical to public health. Improving the linkage between medical and social services could result in improved access to care for those most at risk of unintended pregnancy. This study used a survey based on Alfred Bandura's social cognitive theory (1986) to increase the understanding of the barriers social workers confront in the provision of family planning information to clients. Although moral disagreement with family planning presented a barrier for some, workplace policy, participation in family planning trainings, and working in an urban setting were of greater value in understanding barriers.

  14. A little bird told me : Twitter may be growing at 700 per cent a week, but is it a valuable tool for the patch, or a distraction?

    Energy Technology Data Exchange (ETDEWEB)

    Stastny, P

    2009-10-15

    The social networking tool Twitter may soon be adopted by petroleum industry workers as a means of ensuring increased communications. Comprised of social networks, link sharing, and live searching, the tool can be used to conduct subject searchers as well as to link to quarterly reports and press releases. Twitter is also being used to manage crisis communications as well as to monitor activities on the Internet. Twitter may also provide a means for oil and gas operators to follow influential industry bloggers as well as to develop effective communications strategies. It was concluded that Twitter may offer an opportunity for companies to participate in non-traditional communications approaches such as online forums, and other media-sharing tools. 1 fig.

  15. Jim. L'historie de Jim Caron jeune homme racontee par lui-meme (Jim. The Story of Jim Caron as a Young Man Told by Himself).

    Science.gov (United States)

    Oliver, Julien

    This illustrated account of an interview with Jim Caron, a 101 year-old Franco-American resident of New Hampshire, is intended for use in a bilingual education setting. The narrative is divided into ten chapters and is written in the style of the spoken French dialect of Quebec and New England. In addition to details on the long life of Jim it…

  16. « This, I told myself, was really Africa ».Des territoires et des femmes. Récits féminins de voyage en Afrique Australe à la fin du XIXe siècle “This, I told myself, was really Africa”. Of Territories and Women.Women’s Travel Narratives in Late 19th Century Southern Africa

    Directory of Open Access Journals (Sweden)

    Ludmila Ommundsen

    2007-01-01

    Full Text Available In Victorian Britain, travel writing was informed by an unprecedented colonial expansion — in particular, the “scramble for Africa”— and the rise of the women’s movement in the late 19th century. Fuelled by the notions of motherhood and domesticity that characterized late imperial society, the presence of women in colonies served the purpose of domesticating the South. Yet, as geographical conquest merges with sexual conquest, the narratives of some female travellers in Southern Africa unveil unexpected territories that manifest specific territorialities. Although conjuring up feminist utopias, weren’t these female writers trying to construct a conspicuous literary ghetto?

  17. On the Pragmatic Functions of English Rhetoric in Public Speech: A Case Study of Emma Watson's "HeForShe"

    Science.gov (United States)

    Yuan, Bin

    2018-01-01

    The current research is mainly conducted to explore the pragmatic functions of English rhetoric in public speech. To do this, methods of close reading and case studies are adopted. The research first reveals that the boom of public speech programs helps reexamine the art of utterance, during the delivery of which English rhetoric plays an…

  18. 1,8-Naphthyridine-2,7-diamine: a potential universal reader of Watson-Crick base pairs for DNA sequencing by electron tunneling.

    Science.gov (United States)

    Liang, Feng; Lindsay, Stuart; Zhang, Peiming

    2012-11-21

    With the aid of Density Functional Theory (DFT), we designed 1,8-naphthyridine-2,7-diamine as a recognition molecule to read DNA base pairs for genomic sequencing by electron tunneling. NMR studies show that it can form stable triplets with both A : T and G : C base pairs through hydrogen bonding. Our results suggest that the naphthyridine molecule should be able to function as a universal base pair reader in a tunneling gap, generating distinguishable signatures under electrical bias for each of DNA base pairs.

  19. Orbital interactions and charge redistribution in weak hydrogen bonds: Watson-Crick GC mimic involving C-H proton donor and F proton acceptor groups

    NARCIS (Netherlands)

    Fonseca Guerra, C.; Baerends, E.J.; Bickelhaupt, F.M.

    2006-01-01

    The discovery by Kool and coworkers that 2,4-difluorotoluene (F) mimics thymine (T) in DNA replication has led to controversy regarding the question of whether this mimic has the capability of forming hydrogen bonds with adenine (A). Recently, we have provided evidence for an important role of both

  20. Solvent effect on the intermolecular proton transfer of the Watson and Crick guanine-cytosine and adenine-thymine base pairs: a polarizable continuum model study.

    Science.gov (United States)

    Romero, Eduardo E; Hernandez, Florencio E

    2018-01-03

    Herein we present our results on the study of the double proton transfer (DPT) mechanism in the adenine-thymine (AT) and guanine-cytosine (GC) base pairs, both in gas phase and in solution. The latter was modeled using the polarizable continuum method (PCM) in different solvents. According to our DFT calculations, the DPT may occur for both complexes in a stepwise mechanism in condensate phase. In gas phase only the GC base pair exhibits a concerted DPT mechanism. Using the Wigner's tunneling corrections to the transition state theory we demonstrate that such corrections are important for the prediction of the rate constants of both systems in gas and in condensate phase. We also show that (i) as the polarity of the medium decreases the equilibrium constant of the DPT reaction increases in both complexes, and (ii) that the equilibrium constant in the GC complex is four orders of magnitude larger than in AT. This observation suggests that the spontaneous mutations in DNA base pairs are more probable in GC than in AT.

  1. The Importance of Short- and Long-Range Exchange on Various Excited State Properties of DNA Monomers, Stacked Complexes, and Watson-Crick Pairs.

    Science.gov (United States)

    Raeber, Alexandra E; Wong, Bryan M

    2015-05-12

    We present a detailed analysis of several time-dependent DFT (TD-DFT) methods, including conventional hybrid functionals and two types of nonempirically tuned range-separated functionals, for predicting a diverse set of electronic excitations in DNA nucleobase monomers and dimers. This large and extensive set of excitations comprises a total of 50 different transitions (for each tested DFT functional) that includes several n → π and π → π* valence excitations, long-range charge-transfer excitations, and extended Rydberg transitions (complete with benchmark calculations from high-level EOM-CCSD(T) methods). The presence of localized valence excitations as well as extreme long-range charge-transfer excitations in these systems poses a serious challenge for TD-DFT methods that allows us to assess the importance of both short- and long-range exchange contributions for simultaneously predicting all of these various transitions. In particular, we find that functionals that do not have both short- and full long-range exchange components are unable to predict the different types of nucleobase excitations with the same accuracy. Most importantly, the current study highlights the importance of both short-range exchange and a nonempirically tuned contribution of long-range exchange for accurately predicting the diverse excitations in these challenging nucleobase systems.

  2. Recognition by nonaromatic and stereochemical subunit-containing polyamides of the four Watson-Crick base pairs in the DNA minor groove.

    Science.gov (United States)

    Zhang, Hong-Fei; Wu, Yan-Ling; Jiang, Shi-Kun; Wang, Pu; Sugiyama, Hiroshi; Chen, Xing-Lai; Zhang, Wen; Ji, Yan-Juan; Guo, Chuan-Xin

    2012-06-18

    In order to develop an optimal subunit as a T-recognition element in hairpin polyamides, 15 novel chirality-modified polyamides containing (R)-α,β-diaminopropionic acid ((R) β α-NH 2), (S)-α,β-diaminopropionic acid ((S) β α-NH 2), (1R,3S)-3-aminocyclopentanecarboxylic acid ((RS) Cp), (1S,3R)-3-amino-cyclopentanecarboxylic acid ((RS) Cp), (1R,3R)-3-aminocyclopentanecarboxylic acid ((RR) Cp) and (1S,3S)-3-amino-cyclopentanecarboxylic acid ((SS) Cp) residues were synthesized. Their binding characteristics to DNA sequences 5'-TGCNCAT-3'/3'-ACGN'GTA-5' (N⋅N'=A⋅T, T⋅A, G⋅C and C⋅G) were systemically studied by surface plasmon resonance (SPR) and molecular simulation (MSim) techniques. SPR showed that polyamide 4, AcIm-(S) β α-NH 2-ImPy-γ-ImPy-β-Py-βDp (β/(S) β α-NH 2 pair), bound to a DNA sequence containing a core binding site of 5'-TGCACAT-3' with a dissociation equilibrium constant (K(D) ) of 4.5×10(-8)  m. This was a tenfold improvement in specificity over 5'-TGCTCAT-3' (K(D) =4.5×10(-7)  M). MSim studies supported the SPR results. More importantly, for the first time, we found that chiral 3-aminocyclopentanecarboxylic acids in polyamides can be employed as base readers with only a small decrease in binding affinity to DNA. In particular, SPR showed that polyamide 9 ((RR) Cp/β pair) had a 15-fold binding preference for 5'-TGCTCAT-3' over 5'-TGCACAT-3'. A large difference in standard free energy change for A⋅T over T⋅A was determined (ΔΔG(o) =5.9 kJ mol(-1) ), as was a twofold decrease in interaction energy by MSim. Moreover, a 1:1 stoichiometry (9 to 5'-TGCTCAT-3'/3'-ACGAGTA-5') was shown by MSim to be optimal for the chiral five-membered cycle to fit the minor groove. Collectively, the study suggests that the (S)-α-amino-β-aminopropionic acid and (1R,3R)-3-aminocyclopentanecarboxylic acid can serve as a T-recognition element, and the stereochemistry and the nature of these subunits significantly influence binding properties in these recognition events. Subunit (1R,3R)-3-aminocyclopentanecarboxylic acid broadens our scope to design novel polyamides. Copyright © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  3. Manipulative interplay of two adozelesin molecules with d(ATTAAT)₂achieving ligand-stacked Watson-Crick and Hoogsteen base-paired duplex adducts.

    Science.gov (United States)

    Hopton, Suzanne R; Thompson, Andrew S

    2011-05-17

    Previous structural studies of the cyclopropapyrroloindole (CPI) antitumor antibiotics have shown that these ligands bind covalently edge-on into the minor groove of double-stranded DNA. Reversible covalent modification of the DNA via N3 of adenine occurs in a sequence-specific fashion. Early nuclear magnetic resonance and molecular modeling studies with both mono- and bis-alkylating ligands indicated that the ligands fit tightly within the minor groove, causing little distortion of the helix. In this study, we propose a new binding model for several of the CPI-based analogues, in which the aromatic secondary rings form π-stacked complexes within the minor groove. One of the adducts, formed with adozelesin and the d(ATTAAT)(2) sequence, also demonstrates the ability of these ligands to manipulate the DNA of the binding site, resulting in a Hoogsteen base-paired adduct. Although this type of base pairing has been previously observed with the bisfunctional CPI analogue bizelesin, this is the first time that such an observation has been made with a monoalkylating nondimeric analogue. Together, these results provide a new model for the design of CPI-based antitumor antibiotics, which also has a significant bearing on other structurally related and structurally unrelated minor groove-binding ligands. They indicate the dynamic nature of ligand-DNA interactions, demonstrating both DNA conformational flexibility and the ability of two DNA-bound ligands to interact to form stable covalent modified complexes.

  4. Validación de dos escalas utilizadas en la medición del cuidado humano transpersonal basadas en la Teoría de Jean Watson

    Directory of Open Access Journals (Sweden)

    Margarita del Carmen Poblete-Troncoso

    2012-01-01

    Full Text Available Objetivo: validar Caring Efficacy Scale y Nyberg's Caring Assessment, elementos basados en la Teoría Transpersonal del Cuidado Humano que se fundamenta en los aspectos humanos y éticos del cuidado. Método: los instrumentos fueron validados en una muestra de 360 enfermeras chilenas. Los coeficientes de alfa de Cronbach fueron de 0,76 para Caring Efficacy Scale, y de 0,82 para el Nyberg's Caring Assessment. En cuanto a la validez de constructo ambos instrumentos se correlacionan positiva y significativamente. Resultados: se pondera divergencia como estrategia de esta validez en ambos instrumentos y se utiliza una subescala que evalúa la falta de empatía con el sufrimiento del otro. Conclusión: la validación de estas escalas es un aporte al cuidado humano transpersonal, para conocer el significado que las enfermeras le otorgan, y cuán eficaces se sienten, así cómo remediar aspectos deficitarios en la enseñanza y práctica del cuidado.

  5. Texture and diet related behavior: a focus on satiation and satiety. Handbook of Behavior, Food and Nutrition, Part 2 Preedy VR, Watson RR, Martin CR 133-142

    NARCIS (Netherlands)

    Stafleu, A.; Zijlstra, N.; Hogenkamp, P.; Mars, M.

    2011-01-01

    In view of the increasing numbers in overweight and obesity, insight in food intake regulation is necessary. Food intake is regulated by sensory, cognitive, post-ingestive, and post-absorptive processes. Food properties, such as energy density, macronutrient composition, volume, and form, influence

  6. History of my Father Mogorotoɨ ‘Blue Macaw’: Words of the Ritual of the Fruits, which Come to Us as Food in Abundance, as Told by the Okaina Ethnic Group

    Directory of Open Access Journals (Sweden)

    Anastasia Candre

    2011-01-01

    Full Text Available Bilingual Witoto-Spanish text about the origin and stages of the yuakɨ ritual dance (ritual of the fruits, which is celebrated by the Witoto and other neighboring groups of the Caqueta-Putumayo interriverine region in the Colombo-Peruvian Amazon. This text was written by an indigenous woman in the buue dialect of the Witoto language from the memories of the speeches of her father in the “yard of tobacco and coca” when she was a child.

  7. TALES TOLD TO NIGHT: FUNCTION OF THE SURREAL IN FANTASTIC NARRATIVES GECEYE SÖYLENEN MASALLAR: FANTASTİK ANLATILARDA GERÇEKÜSTÜNÜN İŞLEVİ

    Directory of Open Access Journals (Sweden)

    Ebru Burcu YILMAZ

    2011-09-01

    Full Text Available The art, which has the power of to transform real by esthetizing, opens a door to metaphoric and fantastic different worlds in literary texts. In a fabulous world, man who is met in an extraordinary adventure is tested by supernatural powers in a fantastic world which is nested by real and magical things. In the object of to reach spiritual integrity, this adventure is presented in an explicit world of the symbolic language to clarify the spiritual structure and images in both literary and holy texts. In this work we try to interpret functionality of the surreal in narratives with samples. Gerçeği estetize ederek farklı görünümler içinde dönüştürme gücüne sahip olan sanat, edebî metinlerde de okuyucuya, mecaz ve fantastikle farklı âlemlerin kapılarını açar. Masalsı bir dünyada, alışılmışın dışında bir serüvenle karşımıza çıkan insan, gerçekle büyülü olanın iç içe geçtiği fantastik bir dünyada doğaüstü güçlerin sınamasından geçer. Ruhsal bütünlüğe ulaşma yolunda gerçekleştirilen bu maceranın gerek edebî gerekse kutsal metinlerdeki görüntüleri, ruhsal yapıyı aydınlatmak için simge dilinin kapalı anlam dünyasıyla birlikte sunulur. Bu çalışmada, gerçeküstünün, fantastik anlatılardaki işlevi örneklerden hareketle yorumlanmaya çalışılacaktır.

  8. Quem mandou ficar velho e morar na rua? ¿Quien te dijo que envejecieras y te fueras a vivir a la calle? Who told you to grow old and live on the streets?

    Directory of Open Access Journals (Sweden)

    Ana Cristina Passarella Brêtas

    2010-06-01

    Full Text Available Esta pesquisa é um estudo de caso qualitativo, e integra o estudo Envelhecimento, saúde e trabalho. Esse recorte teve por objetivo conhecer o significado do envelhecimento na rua para um idoso em situação de rua. A narrativa foi trabalhada à luz dos eixos temáticos: história do envelhecimento e história de vida na rua. Depreendemos que a rua quase sempre é um ambiente hostil para o idoso. Não garante condições básicas de vida, interferindo na saúde mental das pessoas que nela são obrigadas a viver, particularmente o idoso. A rua, por não mostrar possibilidades de saída, aliada às condições de vida do idoso em situação de rua leva a um processo gradual da perda da autoestima, interferindo sobremaneira no autocuidado. Acrescido a essas questões, constatamos que o comprometimento da capacidade funcional coloca em risco a sobre/vida do idoso em situação de rua.Esta investigación es un estudio de caso cualitativo; integra el estudio Envejecimiento, salud y trabajo. El presente recorte tuvo por objetivo conocer el significado del envejecimiento en la calle para un anciano en situación de carencia de hogar. La narrativa fue trabajada a la luz de los ejes temáticos: historia del envejecimiento e historia de la vida en la calle. Se infiere que la calle es, casi siempre, un ambiente hostil para el anciano. No garantiza condiciones básicas de vida, perjudicando la salud mental de las personas que son obligadas a vivir en tales condiciones, en particular el anciano. La calle, por no mostrar posibilidades de salida, sumando a esto las condiciones de vida del anciano en situación de calle, induce a un proceso gradual de pérdida de la autoestima, que interfiere radicalmente en el autocuidado. Incrementando dichas cuestiones, se constató que el compromiso de la capacidad funcional coloca al anciano en situación de calle en riesgo de supervivencia.This qualitative case study is part of another study: Aging, health and work. The objective of this excerpt was to identify the meaning of aging on the streets for the elderly living on the street. The subjects' statements were analyzed under the light of the following themes: history of aging and history of life on the streets. It was understood that the streets are usually a hostile environment for the elderly. It does not guarantee the basic life conditions, affecting the mental health of people who are forced to live on the streets, particularly the elderly. The street does not offer any way out and, together with to the life conditions of the elderly living on the streets leads to the gradual loss of self-esteem, significantly affecting self-care. In addition to these issues, we found that compromised functional capacity puts the life/survival of the elderly living on the streets at risk.

  9. MUJERES Y DOCENCIA. UNA MIRADA DESDE LA HISTORIA DE VIDA CONTADA POR SUS PROTAGONISTAS I WOMEN AND TEACHING. A LOOK FROM THE LIFE STORY AS TOLD BY ITS PROTAGONISTS

    Directory of Open Access Journals (Sweden)

    CARMEN BARRETO ALCOBA

    2018-05-01

    Full Text Available Teaching, as a profession, has been constituted into a space that has been filled by feminine presence. However, it is common to hear people talking about teachers with a masculine undertone, often neglecting the situation explained above. A question that guides this research is related to finding logical and valid explanations to how women incorporated into the labor of teaching. To explain how, from domestic duties, women transcend the private space and progressively start overtaking the public spaces. Even more importantly, they go on conquering these spaces to the point of generating national state concerns, not only to attend the education of all citizens, but also to promote legislations to attend problematic particular to women. In the lives of adolescent women teachers, a great part of the untold history of our society and country could be summoned. Thus, this investigation which is still undergoing, aims to rescue, collect and publish the stories of women teachers from Sucre state, Venezuela. In this sense, a qualitative paradigm has been selected for this study. The hermeneutics relative to life stories is helpful as a vehicle to obtain the required information. The interviewed women teachers constitute the evidence of the approaches that direct this research, since their pedagogical and life practice act as an important reference to understand the vital elements that typify the education in Sucre during the last years

  10. Every Story Tells a Story That Has Already Been Told: Intertextuality and Intermediality in Philip Pullman’s Spring-Heeled Jack and in Kevin Brooks’ iBoy

    Directory of Open Access Journals (Sweden)

    Michael C. Prusse

    2014-05-01

    Full Text Available Training English teachers involves acquainting them with suitable texts for their future classrooms. Ideally such texts touch upon matters that children and young adults respond to and such literature also offers learning opportunities both for the pre-service teachers and their students. It can be argued that such learning opportunities can be found when analysing superheroes, when considering the impact of the new media on young people or when focusing on the blending of different genres and texts. The two novels selected for this purpose are Philip Pullman’s Spring-Heeled Jack (1989 and Kevin Brooks’ iBoy (2010. The former is a hybrid of a traditional and a graphic novel and resorts to intertextual allusions, for instance by means of quotes at the beginning of each chapter. The latter text also resorts to quotations – but from different sources, namely almost exclusively from the worldwide web. While iBoy may at first sight look rather conventional as a novel, it nevertheless reveals its provenance from the digital age in the numbering of the chapters in the binary system. Young readers (and their teachers may thus discover the pleasures of literary reading when following Pullman’s superhero (taken from a Victorian penny-dreadful across London. Brooks’ hybrid protagonist, by contrast, a first-person narrator, allows readers to gain insights into the problematic side of his role and his powers. Ultimately these rather conventional novels succeed in capturing their readers’ attention and somewhat contradict critics who predict the arrival of a more hypertextual approach to reading because of the impact of the new media.

  11. Coercion to Compliance, Or How Great Expectations in Washington Are Actually Realized at the Local Level, This Being the Saga of School Desegregation in the South as Told by Two Sympathetic Observers--Lessons on Getting Things Done.

    Science.gov (United States)

    Rodgers, Harrell R., Jr.; Bullock, Charles S., III

    This volume is a study of individual behavior manifested in the desegregation process of 31 Georgia school districts from 1965 to 1974. Major objectives of the study are to glean insight into the variables that determine whether school officials involved would comply with the law and to assess the impact of Federal desegregation guidelines. The…

  12. "They told me all mothers have worries", stillborn mother's experiences of having a 'gut instinct' that something is wrong in pregnancy: Findings from an international case-control study.

    Science.gov (United States)

    Warland, Jane; Heazell, Alexander E P; Stacey, Tomasina; Coomarasamy, Christin; Budd, Jayne; Mitchell, Edwin A; O'Brien, Louise M

    2018-07-01

    To describe and explore 'gut instinct' that something was wrong in women who identified that they experienced gut instinct during pregnancy. A case-control study utilising an international web-based questionnaire. Stillborn cases (n = 146) and liveborn controls (n = 234) answered the gut instinct question within 30 days of the pregnancy ending. Of those, 84 cases and 27 controls also provided qualitative comment data. Descriptive statistics were used for the question, with a fixed option and summative content analysis was used to analyse the comment data. In all, 110 (75%) of the stillborn cases answered "yes" to the gut instinct question vs only 28 (12%) of the controls who had a livebirth meaning the risk of stillbirth was 22.5 fold higher in those who experience "gut instinct" than in those who do not experience this feeling. Four themes were identified from the comment data namely: When the gut instinct occurred; How the gut instinct made the woman feel; Dreams and other related phenomena; Reassured by someone or something. Women who had a stillborn baby reported a "gut instinct" that something was wrong more frequently than mothers of a live born baby. Our findings may be influenced by recall negativity bias, and a prospective study is needed to confirm or refute our findings. The possibility that "maternal intuition" exists during pregnancy and responds to changes in fetal or placental health merits further exploration. Maternity care providers should be alert to the woman when she expresses intuitive feelings, as well as asking her to report her concerns and act appropriately to assess and manage fetal wellbeing. Copyright © 2018 The Authors. Published by Elsevier Ltd.. All rights reserved.

  13. Vivendo com o diabetes: a experiência contada pela criança Viviendo con la diabetes: la experiencia relatada por niños Living with diabetes: the experience as it is told by children

    Directory of Open Access Journals (Sweden)

    Patrícia Luciana Moreira

    2006-02-01

    Full Text Available O diabetes mellitus como uma doença crônica exige adaptação nos âmbitos psicológico, social e físico. Este estudo tem por objetivo compreender a experiência da criança na vivência com a doença. Os referenciais teórico e metodológico utilizados foram o Interacionismo Simbólico e a Teoria Fundamentada nos Dados, respectivamente. Entrevistou-se 12 crianças na faixa etária entre 7 e 14 anos. Um total de 7 temas foram identificados nos dados coletados, sendo eles: "Vivendo algo inesperado", "Enfrentando uma dura realidade", "Tendo medo do que está acontecendo", "Vivendo sob controle", "Tentando adaptar-se à nova realidade", "Amadurecendo com a convivência", "Olhando para a doença de um jeito diferente". A vivência com o diabetes é algo que a criança enfrenta a cada dia, desde o momento do diagnóstico, tendo limitações na dieta, a inserção da insulinoterapia, a mudança no estilo de vida, fatos esses que desencadeiam sentimentos que oscilam entre medo, insegurança, revolta, aceitação e adaptação.La diabetes mellitus es una enfermedad crónica que exige adaptación en los ámbitos psicológico, social y físico. El presente trabajo tuvo como objetivo comprender la experiencia del niño viviendo con la enfermedad. Los referenciales teórico y metodológico utilizados fueron el Interaccionismo Simbólico y la Teoría Fundamentada en los Datos, respectivamente. Entrevistamos niños con las edades de 7 hasta 14 años. Un total de 7 temas fueron identificados en los datos recopilados, siendo ellos: "Viviendo algo inesperado", "Enfrentando una dura realidad", "Sintiendo miedo sobre lo que está pasando", "Viviendo bajo control", "Intentando adaptarse a la nueva realidad", "Madurando con la convivencia", "Mirando la enfermedad de una manera diferente". La vivencia con la diabetes es algo que el niño enfrenta cada día, desde el momento del diagnóstico, teniendo limitaciones en la dieta, la inserción de la insulinoterapia, el cambio en el estilo de vida, hechos esos que desencadenan sentimientos que oscilan entre miedo, inseguridad, indignación y adaptación.Diabetes mellitus is a chronic disease that demands adaptation in the psychological, social and physical sphere. This study aimed to understand the experiences of children with the disease. Symbolic Interactionism and Grounded Theory were used as a theoretical and methodological reference framework, respectively. We interviewed children in the age group between 7 and 14 years old. A total of 7 topics were identified in the collected data, which were: "Experiencing something unexpected", "Facing a harsh reality", "Being afraid of what is happening", "Living under control", "Trying to adapt to a new reality", "Maturing with this close relationship" and "Seeing this disease from a different angle". Living with diabetes is something these children are confronted with daily from the very moment it is diagnosed, having to live with a restricted diet, insulin therapy and life style changes, facts that bring about feelings that range from fear to insecurity, to revolt, to acceptance and adaptation.

  14. "And I Have Been Told That There Is Nothing Fun about Having Sex While You Are Still in High School": Dominant Discourses on Women's Sexual Practices and Desires in Life Orientation Programmes at School

    Science.gov (United States)

    Shefer, Tamara; Ngabaza, Sisa

    2015-01-01

    Young women's sexuality is a contested terrain in multiple ways in contemporary South Africa. A growing body of work in the context of HIV and gender-based violence illustrates how young women find it challenging to negotiate safe and equitable sexual relationships with men, and are often the victims of coercive sex, unwanted early pregnancies and…

  15. "The guys told us crying that they saw how they were killing her and they could not do anything": Psychosocial explorations of migrant journeys to the U.S.

    Directory of Open Access Journals (Sweden)

    Jana Sládková

    2014-03-01

    Full Text Available In this article I examine undocumented migrant experiences on their journeys to the U.S. Tens of thousands of Honduran migrants leave their homes in hopes to provide better for their families from afar. In in-depth interviews, 21 migrants from Honduras share the events they endure as they cross Guatemala, Mexico and the borders that divide them. I conducted narrative analyses and specifically used the analytical tools of high points and poises to locate the most salient experiences the migrants narrated as well as identifying particular selves the migrants were presenting. The high points centered around the crossings of the Mexico-U.S. border, encounters with gangs and the police in Mexico, and travels on top of freight trains. Most of these events were highly charged with potential short and long-term effects on the migrants' health. In trying to make sense of their experiences, migrants presented themselves as heroes helping others, victims of the migration systems, good parents, or unaffected bystanders. This research provides insight into the rarely explored psychosocial aspects of undocumented migration, illuminates how Honduran migrants who attempt this journey make sense of their experiences, and proposes interventions to mitigate the potentially tragic consequences of this migration.

  16. “The guys told us crying that they saw how they were killing her and they could not do anything”: Psychosocial explorations of migrant journeys to the U.S.+

    OpenAIRE

    Sládková, Jana

    2014-01-01

    In this article I examine undocumented migrant experiences on their journeys to the U.S. Tens of thousands of Honduran migrants leave their homes in hopes to provide better for their families from afar. In in-depth interviews, 21 migrants from Honduras share the events they endure as they cross Guatemala, Mexico and the borders that divide them. I conducted narrative analyses and specifically used the analytical tools of high points and poises to locate the most salient experiences the migran...

  17. "A welfare recipient may be drinking, but as long as he does as told--he may drink himself to death": a qualitative analysis of project implementation barriers among Danish job consultants.

    Science.gov (United States)

    Hansen, Maja Bæksgaard; Kloster, Stine; Danquah, Ida Høgstedt; Nielsen, Anette Søgaard; Becker, Ulrik; Tjørnhøj-Thomsen, Tine; Tolstrup, Janne Schurmann

    2015-03-18

    This paper is embedded in a randomised controlled trial (Alcohol and Employment) that investigated whether welfare-to-work schemes combined with alcohol treatment were more effective than welfare-to-work schemes alone for helping unemployed welfare recipients with alcohol problems get back to employment and reduce their alcohol problems. The implementation of Alcohol and Employment turned out to be challenging, and fewer welfare recipients than expected were enrolled. The aim of this paper was to identify and investigate obstacles to the implementation of Alcohol and Employment. Our main objective was to study the job consultants' role in the implementation process as they were key personnel in conducting the trial. The process evaluation was conducted in four Danish municipalities in 2011-2012. Data for identifying factors important for the implementation were collected through observations and focus group interviews with job consultants. Data were analysed thematically and thoroughly discussed among members of the project team; emerging themes were then grouped and read again repeatedly until the themes were consistent. Three themes emerged as the main factors influencing the degree of implementation of Alcohol and Employment: (1) The job consultants' personal attitudes toward alcohol were an important factor. The job consultants generally did not consider a high alcohol intake to be an impediment to employment, or they thought that alcohol problems were only symptoms of more profound problems. (2) The job consultants' perception of their own roles and responsibilities in relation to the welfare recipients was a barrier: they felt that addressing alcohol problems and at the same time sustaining trust with the welfare recipient was difficult. Also, they did not consider alcohol problems to be their responsibility. (3) Shortage of time and resources among the job consultants was determined to be an influential factor. We identified important factors at the individual level among the job consultants who threatened the implementation of Alcohol and Employment. Future studies in similar settings can take advantage of these findings when preparing interventions that are implemented by job consultants or similar professionals. ClinicalTrials.gov ID: NCT01416103.

  18. Conversational sensemaking

    Science.gov (United States)

    Preece, Alun; Webberley, Will; Braines, Dave

    2015-05-01

    Recent advances in natural language question-answering systems and context-aware mobile apps create opportunities for improved sensemaking in a tactical setting. Users equipped with mobile devices act as both sensors (able to acquire information) and effectors (able to act in situ), operating alone or in collectives. The currently- dominant technical approaches follow either a pull model (e.g. Apple's Siri or IBM's Watson which respond to users' natural language queries) or a push model (e.g. Google's Now which sends notifications to a user based on their context). There is growing recognition that users need more flexible styles of conversational interaction, where they are able to freely ask or tell, be asked or told, seek explanations and clarifications. Ideally such conversations should involve a mix of human and machine agents, able to collaborate in collective sensemaking activities with as few barriers as possible. Desirable capabilities include adding new knowledge, collaboratively building models, invoking specific services, and drawing inferences. As a step towards this goal, we collect evidence from a number of recent pilot studies including natural experiments (e.g. situation awareness in the context of organised protests) and synthetic experiments (e.g. human and machine agents collaborating in information seeking and spot reporting). We identify some principles and areas of future research for "conversational sensemaking".

  19. Comment on "Relating side chain organization of PNIPAm with its conformation in aqueous methanol" by D. Mukherji, M. Wagner, M. D. Watson, S. Winzen, T. E. de Oliveira, C. M. Marques and K. Kremer, Soft Matter, 2016, 12, 7995.

    Science.gov (United States)

    Pica, Andrea; Graziano, Giuseppe

    2017-11-01

    In a recent article, Kremer and co-workers have combined NMR measurements and very long, all-atom MD simulations to strengthen their original claim that PNIPAM cononsolvency in water-methanol solutions is driven by the ability of MeOH molecules to bridge different monomers far away along the polymeric chain. In this comment, the results presented by Kremer and co-workers are reviewed, analyzed, and questioned regarding their ability to provide support to the bridging mechanism. Here, some pieces of evidence are provided to show that: (1) the solvent-excluded volume effect plays always a fundamental role in polymer collapse; (2) PNIPAM cononsolvency is caused by the geometric-energetic frustration experienced by the polymer when it can interact with both water and methanol molecules at the same time.

  20. L'évolution des valeurs de soin humain : une analyse dialectique de la proposition d'humanisation de Watson à la lumière d'une perspective nietzschéenne

    OpenAIRE

    Krol, Pawel

    2014-01-01

    La pratique du soin infirmier d’aujourd’hui hérite d’une longue et complexe évolution de valeurs. Outre les valeurs traditionnellement humaines de soigner, la pratique infirmière d’aujourd’hui intègre aussi des valeurs qui façonnent notre monde moderne. Ainsi, nous retraçons d’abord l’évolution de quelques-unes des valeurs traditionnelles rattachées au soin humain conservées dans les pratiques infirmières. Puis, nous montrons que certaines valeurs traditionnelles de soin humain sont progressi...

  1. Is the DPT tautomerization of the long A·G Watson-Crick DNA base mispair a source of the adenine and guanine mutagenic tautomers? A QM and QTAIM response to the biologically important question.

    Science.gov (United States)

    Brovarets', Ol'ha O; Zhurakivsky, Roman O; Hovorun, Dmytro M

    2014-03-05

    Herein, we first address the question posed in the title by establishing the tautomerization trajectory via the double proton transfer of the adenine·guanine (A·G) DNA base mispair formed by the canonical tautomers of the A and G bases into the A*·G* DNA base mispair, involving mutagenic tautomers, with the use of the quantum-mechanical calculations and quantum theory of atoms in molecules (QTAIM). It was detected that the A·G ↔ A*·G* tautomerization proceeds through the asynchronous concerted mechanism. It was revealed that the A·G base mispair is stabilized by the N6H···O6 (5.68) and N1H···N1 (6.51) hydrogen bonds (H-bonds) and the N2H···HC2 dihydrogen bond (DH-bond) (0.68 kcal·mol(-1) ), whereas the A*·G* base mispair-by the O6H···N6 (10.88), N1H···N1 (7.01) and C2H···N2 H-bonds (0.42 kcal·mol(-1) ). The N2H···HC2 DH-bond smoothly and without bifurcation transforms into the C2H···N2 H-bond at the IRC = -10.07 Bohr in the course of the A·G ↔ A*·G* tautomerization. Using the sweeps of the energies of the intermolecular H-bonds, it was observed that the N6H···O6 H-bond is anticooperative to the two others-N1H···N1 and N2H···HC2 in the A·G base mispair, while the latters are significantly cooperative, mutually strengthening each other. In opposite, all three O6H···N6, N1H···N1, and C2H···N2 H-bonds are cooperative in the A*·G* base mispair. All in all, we established the dynamical instability of the А*·G* base mispair with a short lifetime (4.83·10(-14) s), enabling it not to be deemed feasible source of the A* and G* mutagenic tautomers of the DNA bases. The small lifetime of the А*·G* base mispair is predetermined by the negative value of the Gibbs free energy for the A*·G* → A·G transition. Moreover, all of the six low-frequency intermolecular vibrations cannot develop during this lifetime that additionally confirms the aforementioned results. Thus, the A*·G* base mispair cannot be considered as a source of the mutagenic tautomers of the DNA bases, as the A·G base mispair dissociates during DNA replication exceptionally into the A and G monomers in the canonical tautomeric form. Copyright © 2013 Wiley Periodicals, Inc.

  2. An in situ study of growth of Lemongrass Cymbopogon flexuosus (Nees ex Steud.) W. Watson on varying concentration of Chromium (Cr+6) on soil and its bioaccumulation: Perspectives on phytoremediation potential and phytostabilisation of chromium toxicity.

    Science.gov (United States)

    Patra, Deepak Kumar; Pradhan, Chinmay; Patra, Hemanta Kumar

    2018-02-01

    Chromium (Cr) contamination in soil is a growing concern in sustainable agricultural production and food safety. Remediation of Cr from contaminated soils is a challenging task which may not only help in sustaining agriculture but also in minimizing adverse environmental impacts. Pot culture experiments were performed with the application of varied concentration of Cr +6 to assess the Chromium accumulation potential of Lemongrass and to study the impact of toxic concentration of Cr +6 on morphological, physiological and biochemical parameters of the plant. The results showed an increasing accumulation trend of Chromium with increasing Chromium concentrations in both root and shoot of 60 days old Lemongrass plants, while the protein and chlorophyll contents decreased. Similarly, accumulation of Cr increased the levels of proline and antioxidant enzymes indicating the enhanced damage control activity. The potentiality of the plant with the capacity to accumulate and stabilize Cr compound in Cr contaminated soil by phytoremediation process has been explored in the present investigation. Copyright © 2017 Elsevier Ltd. All rights reserved.

  3. Algumas considerações sobre o fazer científico realizadas a partir da análise dos modelos de ciência propostos por Taylor, Wundt e Watson

    Directory of Open Access Journals (Sweden)

    Bruno Alvarenga Ribeiro

    Full Text Available A história das ciências como um todo, incluindo a história das ciências humanas e, particularmente, a história da Psicologia, nos presenteia com exemplos de como às vezes o fazer científico é restringido aos lugares comuns da metodologia. Dessa forma, o objetivo deste artigo é refletir sobre a crença de que a ciência é o próprio método que ela utiliza, demonstrando que metodologias particulares decorrem da adoção de determinados pressupostos filosóficos também particulares, que podem levar o fazer científico a algumas incorreções, nem sempre refutáveis por questões de lógica.

  4. On Fair Lotteries

    OpenAIRE

    STONE, PETER

    2008-01-01

    PUBLISHED When James Watson and Francis Crick submitted to Nature their groundbreaking paper relating DNA structure to protein synthesis, they faced a choice. In what order were their names to be listed? Would it be ?Watson and Crick,? or ?Crick and Watson?? They resolved the matter by tossing a coin (Crick, 1988, p. 66)

  5. Sleeping under the stars

    Science.gov (United States)

    Zirkel, Jack

    Sherlock Holmes and Dr. Watson went on a camping trip. As they lay down for the night, Holmes said, “Watson, look up at the sky and tell me what you see.”Watson:“! see millions and millions of stars.”

  6. MRI of the Chest

    Medline Plus

    Full Text Available ... eating and drinking before your exam vary between facilities. Unless you are told otherwise, take your regular ... with the specific exam and with the imaging facility. Unless you are told otherwise, you may follow ...

  7. Magnetic Resonance Imaging (MRI) -- Head

    Medline Plus

    Full Text Available ... eating and drinking before your exam vary between facilities. Unless you are told otherwise, take your regular ... with the specific exam and with the imaging facility. Unless you are told otherwise, you may follow ...

  8. A violência urbana contra crianças e adolescentes em Belo Horizonte: uma história contada através dos traumas maxilofaciais The urban violence against children and adolescents in Belo Horizonte: a story told through the maxillofacial traumas

    Directory of Open Access Journals (Sweden)

    Carlos José de Paula Silva

    2011-01-01

    Full Text Available Os traumas maxilofaciais decorrentes da violência contra crianças e adolescentes impactam suas vidas, física e psiquicamente, pelas deformidades que podem provocar e pela exposição da lesão na face das vítimas. O objetivo deste trabalho é identificar a prevalência dos traumas maxilofaciais em crianças e adolescentes decorrentes da violência urbana em Belo Horizonte- Brasil. O estudo foi conduzido no Hospital Municipal Odilon Behrens, único hospital municipal de referência nesse tipo de atendimento em Belo Horizonte. Coletaram-se os registros de vítimas atendidas de janeiro a dezembro de 2007. O principal evento de violência sofrido entre crianças e adolescentes foi agressão física, 44,2% e 64,7%, respectivamente. Entre as crianças, o tipo de trauma mais comum foi o trauma dentoalveolar (53,8%, e entre os adolescentes, trauma de tecidos moles (47,5%. O maior número de ocorrências se deu no período noturno: crianças (84,6% e adolescentes (74,8%. O gênero mais vitimado foi o masculino, crianças (63,5% e adolescentes (68,3%. Estratégias apropriadas para identificação do evento de violência e do agressor são necessários para que melhor sejam planejados mecanismos de proteção da criança e do adolescente, uma vez que a violência sofrida por crianças e adolescentes no Brasil, considerando a complexidade dessa fase da vida, assume um quadro sombrio, desconstruindo o desenvolvimento, a sociabilidade e comprometendo a visão das vítimas sobre si mesmas e sobre o mundo que as cercam.The maxillofacial traumas resulting from violence against children and adolescents have physical and psychical impact on their lives, because of the deformities and the injuries on their faces. This study aims to identify the prevalence of maxillofacial traumas in children and adolescents caused by urban violence in Belo Horizonte, Brazil. The study was conducted at Hospital Municipal Odilon Behrens, the primary reference hospital in this type of care in Belo Horizonte. We collected records of victims attended between January and December 2007. Among children and adolescents, the most recurring violence event was physical aggression, 44,2% and 64.7% respectively. Among children, the most common type was the dental-alveolar trauma (53.8%, while among adolescents, soft tissues trauma (47.5%. The highest number of occurrences was at night, for both children (84.6% and adolescents (74.8%. The most victimized gender was masculine, children (63.5%, and adolescents (68.3%. Appropriate strategies to indentify violent events, as well as the aggressor himself, are necessary for planning better protection mechanisms for children and adolescents, since the violence suffered by this group in Brazil, considering the complexity of this stage of life, takes a gloomy picture, deconstructing their development, sociability, and undermining the victims' perspective about themselves and the world around them.

  9. Studies of Single Biomolecules, DNA Conformational Dynamics, and Protein Binding

    Science.gov (United States)

    2008-07-11

    Nucleotide Base pairs Hydrogen bonds FIG. 1: Ladder structure of DNA showing the Watson - Crick bonding of the bases A, T, G, and C which are suspended by a...protected against unwanted action of chemicals and proteins. The three-dimensional structure of DNA is the famed Watson - Crick double-helix, the equilibrium...quantitative analysis [88]. [1] A. Kornberg and T. A. Baker, DNA Replication (W. H. Freeman, New York, 1992). [2] J. D. Watson and F. H. C. Crick

  10. Targeting Micrornas With Small Molecules: A Novel Approach to Treating Breast Cancer

    Science.gov (United States)

    2010-10-01

    DNAzyme, or deoxyribozyme, is a catalytic DNA that site-specifically cleaves the target RNA Watson – Crick base pairing to a complementary target...conserved antiparallel RNA A-helix fold among the selected pre- miRNA targets (Fig. 1a). Furthermore, 3D characteristics including Watson - Crick base pairs... Watson – Crick binding, leading to RNAse-H- mediated cleavage of the mRNA of the target gene. The ASOs also inhibit transcription, splicing, and

  11. Targeting MicroRNAs with Small Molecules a Novel Approach to Treating Breast Cancer

    Science.gov (United States)

    2011-10-01

    or deoxyribozyme, is a catalytic DNA that site-specifically cleaves the target RNA Watson – Crick base pairing to a complementary target sequence...RNA A-helix fold among the selected pre- miRNA targets. Furthermore, 3D characteristics including Watson - Crick base pairs and wobble base pairs...phosphorothioate backbone in addition to 2′-O-methoxyethyl AMOs are ASOs against miRNAs and therefore produce ASO–miRNA duplexes through Watson – Crick binding

  12. Superimposed Code Theorectic Analysis of DNA Codes and DNA Computing

    Science.gov (United States)

    2010-03-01

    that the hybridization that occurs between a DNA strand and its Watson - Crick complement can be used to perform mathematical computation. This research...ssDNA single stranded DNA WC Watson – Crick A Adenine C Cytosine G Guanine T Thymine ... Watson - Crick (WC) duplex, e.g., TCGCA TCGCA . Note that non-WC duplexes can form and such a formation is called a cross-hybridization. Cross

  13. Scientific and Technological Achievements, 1946-2011, of the AFRL Electromagnetics Technology Division (AFRL/RYH) and Its Progenitors

    Science.gov (United States)

    2012-07-01

    like saying Cambridge University, not Watson and Crick , deciphered the double helix structure of DNA . Consequently, I have endeavored to attribute...were reflected off the ionosphere to the earth’s surface, then back to the ionosphere, and so on. During the late 1940s the Army Air Forces’ Watson ...NM, Proving Grounds (The Army Signal Corps transferred Watson Laboratories to the Army Air Forces in 1945). A critical observation that enabled OTH

  14. Investigation of Nanophase Materials for Thermoelectric Applications

    National Research Council Canada - National Science Library

    Stokes, Kevin

    2004-01-01

    .... Watson Research Center. Our major accomplishments include the chemical synthesis of nanoparticles, nanorods and nanowires of lead chalcogenide, bismuth calcogenide and bismuth antimony materials...

  15. A report on the occurrence of Thraustochytrid species in Indian waters

    Digital Repository Service at National Institute of Oceanography (India)

    Raghukumar, S.; Raghukumar, C.

    Raghukumar Labyrinthuloidus minuta (Watson and Raper) Perkins, L. yorkensis, Perkins, Thraustochytrium aggregatum Ulken, T. motivum Goldstein, T. multirudimentale, Goldstein, T. striatum, Schneider, Schizochytrium mangrovei, Raghukumar and Ulkenia visurgensis...

  16. A Multi-center, Double-blind, Randomized Study, Comparing Clindamycin Phosphate Vaginal Cream 2% (Watson Laboratories, Inc.) to Clindesse® (Ther-Rx™, Clindamyin Phosphate Vaginal Cream 2%) and Both Active Treatments to a Placebo Control in the Treatment of Bacterial Vaginosis in Non-pregnant Women

    Science.gov (United States)

    2015-03-18

    BACTERIAL VAGINOSIS; Signs and Symptoms to be Evaluated and Recorded Include:; Vaginal Discharge: Color, Odor, and Consistency;; Vulvovaginal Itching and Irritation (Subjective): Absent, Mild, Moderate, or Severe; Vulvovaginal Inflammation (Objective): Absent, Mild, Moderate, or Severe.

  17. Distinguished Lectureship Award on the Applications of Physics: Illuminating My Career - From Flash Gordon to Laser Surgery

    Science.gov (United States)

    Wynne, James

    2015-03-01

    As a child, I was fascinated by television programs about Flash Gordon. His partner in conquering the universe was Dr. Alexis Zarkov, a physicist, who had invented, among other things, a death ray gun. My personal ``death ray'' was a magnifying glass, focusing sunlight on unsuspecting insects, like crawling ants. I also practiced sneaking up on resting, flying, stinging insects and burning their wings before they could take off and attack me. So I understood something about the power of sunlight. In my senior year of high school, I had a fabulous physics teacher, Lewis E. Love, and I knew after one week that I wanted to be a physicist, not a medical doctor, which is the career my parents wanted me to pursue. It turns out that the first laser functioned on May 16, 1960, just one month before I graduated from high school, and it was inevitable that I would pursue a career working with lasers. My first job as a physicist, during the summer of 1963, was working with lasers at TRG, Inc. a small company whose guru was Gordon Gould, now recognized as the inventor of the laser. After three summers at TRG, I spent three years working on nonlinear optics for my PhD thesis, under the guidance of Prof. Nicolaas Bloembergen, who later won the Nobel Prize in Physics for codifying nonlinear optics. Following completion of my PhD research in 1969, I joined IBM Research, where I have worked ever since. Upon joining the Quantum Electronics group in the Physical Sciences Dept. of the T.J. Watson Research Center, my management told me to ``do something great'' with lasers. After working on atomic spectroscopy with dye lasers through the 1970s, I had the inspiration to acquire an excimer laser for the Laser Physics and Chemistry group. Using this laser, my colleagues and I discovered excimer laser surgery, capable of removing human and animal tissue with great precision, while leaving the underlying and adjacent tissue free of collateral damage. This discovery laid the foundation for

  18. Analyzing the Teaching of Advanced Mathematics Courses via the Enacted Example Space

    Science.gov (United States)

    Fukawa-Connelly, Timothy Patrick; Newton, Charlene

    2014-01-01

    Examples are believed to be very important in developing conceptual understanding of mathematical ideas, useful both in mathematics research and instruction (Bills & Watson in "Educational Studies in Mathematics" 69:77-79, 2008; Mason & Watson, 2008; Bills & Tall, 1998; Tall & Vinner, 1981). In this study, we draw on the…

  19. Genetics by the Numbers

    Science.gov (United States)

    ... t understand how. All that changed when James Watson and Francis Crick showed that DNA is shaped like a spiral staircase that can ... split, copied and passed on to future generations. Watson and Crick received a Nobel Prize in 1962 for ... National DNA Day This Inside Life Science article also appears ...

  20. Nanoswitches based on DNA base pairs: why adenine-thymine is less suitable than guanine-cytosine

    NARCIS (Netherlands)

    Fonseca Guerra, C.; van der Wijst, T.; Bickelhaupt, F.M.

    2006-01-01

    Substituted Watson-Crick guanine-cytosine (GC) base pairs were recently shown to yield robust three-state nanoswitches. Here, we address the question: Can such supramolecular switches also be based on Watson-Crick adenine-thymine (AT) base pairs? We have theoretically analyzed AT pairs in which

  1. Does Size Matter?

    Science.gov (United States)

    Watson, David

    2014-01-01

    In this article, David Watson debates the pros and cons of leadership skills in both a small and large university. Watson relates his own experiences regarding the changing atmosphere of leadership. He states that his experiences have caused him to reflect on what is genuinely generic about individual capacities for institutional leadership: that…

  2. Bringing Precision Medicine to Community Oncologists.

    Science.gov (United States)

    2017-01-01

    Quest Diagnostics has teamed up with Memorial Sloan Kettering Cancer Center and IBM Watson Health to offer IBM Watson Genomics to its network of community cancer centers and hospitals. This new service aims to advance precision medicine by combining genomic tumor sequencing with the power of cognitive computing. ©2017 American Association for Cancer Research.

  3. Music Technology and Musical Creativity: Making Connections

    Science.gov (United States)

    Thompson, Douglas Earl

    2012-01-01

    This article is a preview of Scott Watson's new book, "Using Technology to Unlock Musical Creativity" (Oxford University Press, 2011). The book's main contents are summarized and one of the volume's 29 lessons is provided to assist readers in evaluating the book for their use. Particular attention is given to Watson's success in making the…

  4. the use of research in protected area management in Madagascar

    African Journals Online (AJOL)

    they are also expected to contribute to social objectives (Watson et al. 2014). ...... . Chapman, J. M., Algera ... Fuller, R. A., Lee, J. R. and Watson, J. E. M. 2014. Achieving open ... Kremen, C., Cameron, A., Moilanen, A., Phillips, S. J., Thomas, C. D., et al. 2008. Aligning ...

  5. Contemporary Danish book art

    DEFF Research Database (Denmark)

    Larsen, Poul Steen

    the Metropolitan Museum of Art, Thomas J. Watson Library, Helge Ernst, illustrator, Poul Kristensen, printer, Ole Olsen, bookbinder, exhibition catalog......the Metropolitan Museum of Art, Thomas J. Watson Library, Helge Ernst, illustrator, Poul Kristensen, printer, Ole Olsen, bookbinder, exhibition catalog...

  6. A Systems Thinking Framework for Assessing and Addressing Malaria Locally: An Alternative to the Globalization of Anti-Malaria Policies

    Science.gov (United States)

    Willis, Derek W.

    2010-01-01

    This dissertation analyzes a decision system that was used in the early 1900s in the Federated Malay States (FMS) by Malcolm Watson in order to make anti-malaria program recommendations to decision makers in a wide range of ecological settings. Watson's recommendations to decision makers throughout the FMS led to a dramatic suppression of malaria…

  7. Educational Technologists: Leading Change for a New Paradigm of Education

    Science.gov (United States)

    Aslan, Sinem; Reigeluth, Charles M.

    2013-01-01

    The transition from the industrial age to the information age has happened and is still happening in our society (Duffy, 2009). However, our current educational systems still operate based on the needs of the industrial-age society (Watson, Watson, & Reigeluth, n.d), making them among the least impacted organizations (Reigeluth & Joseph,…

  8. 75 FR 54296 - Information Collection; Trends in Use and Users in the Boundary Waters Canoe Area Wilderness, MN

    Science.gov (United States)

    2010-09-07

    ... notice should be addressed to Alan E. Watson, Aldo Leopold Wilderness Research Institute, USDA Forest... submitted by e-mail to: [email protected] . The public may inspect comments received at the Aldo Leopold... to the building. FOR FURTHER INFORMATION CONTACT: Alan E. Watson, Aldo Leopold Wilderness Research...

  9. 78 FR 6805 - Information Collection: Arctic National Wildlife Refuge Recreation Visitor Study-2013

    Science.gov (United States)

    2013-01-31

    .... ADDRESSES: Comments concerning this notice should be addressed to Alan E. Watson, Aldo Leopold Wilderness... . The public may inspect comments received at the Aldo Leopold Wilderness Research Institute, USDA... FURTHER INFORMATION CONTACT: Alan E. Watson, Aldo Leopold Wilderness Research Institute, (406) 542-4197...

  10. Behaviorism

    Science.gov (United States)

    Moore, J.

    2011-01-01

    Early forms of psychology assumed that mental life was the appropriate subject matter for psychology, and introspection was an appropriate method to engage that subject matter. In 1913, John B. Watson proposed an alternative: classical S-R behaviorism. According to Watson, behavior was a subject matter in its own right, to be studied by the…

  11. What are we being told about how to teach games? A three-dimensional analysis of comparative research into different instructional studies in Physical Education and School Sports. (¿Qué sabemos acerca de la enseñanza de los juegos deportivos? Un análisis tridimensional de la investigación comparativa de diferentes estudios de enseñanza en Educación Física Escolar.

    Directory of Open Access Journals (Sweden)

    Alfonso Valero Valenzuela

    2010-01-01

    Full Text Available AbstractDetermining what pedagogical approach could be most effective in delivering the desired learning outcomes in teaching games has been one of the more relevant concerns for physical education teachers, coaches and researches in the last few decades. Nevertheless, until recently, the research carried out in this field has been little profuse, has met with several difficulties and has been made from different perspectives, which has complicated its analysis altogether. The present study follows three main objectives: a to analyse the nature of the interventions used in the comparative investigation directed to teaching sports, b to determine the effects of the levels of treatment and, c to outline some didactic consequences. Twenty comparative studies were selected for a systematic review. With regards to the instructional approaches the teaching of games three lines of analysis were contemplated: 1 Studies that compare interventions using the part- vs. whole-task teaching methods. 2 Studies that compare the teaching via direct vs. indirect instruction. 3 Studies that compare skills-based approach with alternative approaches, especially the direct instruction model versus the TGfU model. Based on the three paradigms, it was shown that the whole-task teaching method generates both greater satisfaction and security for children in their own performance. Indirect instructional techniques have a positive influence at an affective and social level, as well as on their decision making. The alternative approaches to the skills-based approach examined show that a greater degree of understanding of game play and more affective, and enjoyable behavior was obtained through tactics-based approach. The three-dimensional review reported in this paper could be used as complementary research to aid in future longitudinal studies such as the investigation that look at the integration of diverse instructional studies.ResumenDeterminar qué aproximación pedagógica puede ser más eficaz para conseguir los resultados de aprendizaje deseados en la enseñanza de los juegos deportivos ha sido una de las preocupaciones más relevantes de profesores de educación física, entrenadores e investigadores en las últimas décadas. Sin embargo, hasta hace poco la investigación realizada en este campo ha sido poco profusa, ha contado con varias dificultades y ha sido abordada desde diferentes perspectivas, lo que ha dificultado su análisis en conjunto. El presente estudio pretende conseguir tres objetivos: a analizar la naturaleza de las intervenciones empleadas en la investigación comparativa dirigida a la enseñanza deportiva, b determinar los efectos de cada uno de los niveles de tratamiento y, c extraer posibles implicaciones didácticas. Se realizó una revisión sistemática de los 20 estudios comparativos seleccionados. Se contemplaron tres líneas de análisis de la enseñanza de juegos deportivos: 1 Estudios que comparan los métodos analíticos versus métodos globales. 2 Estudios que comparan la enseñanza mediante instrucción directa versus búsqueda (indirecta, y 3 Estudios que comparan modelos tradicionales con modelos alternativos, en especial, el modelo técnico versus el modelo comprensivo (TGfU. Basándonos en los tres paradigmas señalados, se encontró que el método de enseñanza global genera mayor satisfacción y seguridad para los niños en su propio rendimiento. Las técnicas de enseñanza indirectas tienen una influencia positiva a nivel afectivo y social, así como en su toma de decisión. La aproximación alternativa a la enseñanza técnica mostró que se obtenía un mayor grado de comprensión del juego y un comportamiento más afectivo y mayor diversión mediante la aproximación basada en la táctica. Creemos que la revisión tridimensional divulgada en este artículo podría utilizarse como investigación complementaria para ayudar en estudios longitudinales futuros, por ejemplo, en la investigación que analiza la integración de diversos enfoques de enseñanza.

  12. Belief about nicotine Modulates subjective craving and insula activity in Deprived smokers

    DEFF Research Database (Denmark)

    Gu, X. S.; Lohrenz, Terry; Salas, Ramiro

    2016-01-01

    Little is known about the specific neural mechanisms through which cognitive factors influence craving and associated brain responses, despite the initial success of cognitive therapies in treating drug addiction. In this study, we investigated how cognitive factors such as beliefs influence...... subjective craving and neural activities in nicotine-addicted individuals using model-based functional magnetic resonance imaging (fMRI) and neuropharmacology. Deprived smokers (N = 24) participated in a two-by-two balanced placebo design, which crossed beliefs about nicotine (told "nicotine" vs. told "no......, smokers demonstrated significantly reduced craving after smoking when told "nicotine in cigarette" but showed no change in craving when told "no nicotine." Second, neural activity in the insular cortex related to craving was only significant when smokers were told "nicotine" but not when told "no nicotine...

  13. Persuasive Communication and Feedback of Attitude Change

    OpenAIRE

    Yamaura, Kazuho; Kurokawa, Masaru; Suzuki, Kouhei

    1996-01-01

    This study examined how subjects who were persuaded to change their attitudes, actually changed their attitude after being told the degree of their changed attitudes. At first, 133 college students (Men : 27,Women : 106) were recorded for their initial attitudes (first session). After one week, the subjects were told opposite persuasion messages against their initial attitudes and their attitudes were measured again (second session). After another two weeks, the subjects were told how much th...

  14. Approaches to the classification of brands of professional football clubs in the system of sportive marketing

    OpenAIRE

    Romat, E.; Ostroverh, S.

    2014-01-01

    This article was told about methods of classification of professional football clubs in the system of sportive marketing in the total commercial conditions of the most popular kind sport, football. Also was told about importance of brand in the professional football club as an active method of increasing trade value multi-functional enterprise in the sport area, which works on business model. The criterions where proposed and also was told about essence of the classification, which is used to...

  15. Comparison of approximate methods for multiple scattering in high-energy collisions. II

    International Nuclear Information System (INIS)

    Nolan, A.M.; Tobocman, W.; Werby, M.F.

    1976-01-01

    The scattering in one dimension of a particle by a target of N like particles in a bound state has been studied. The exact result for the transmission probability has been compared with the predictions of the Glauber theory, the Watson optical potential model, and the adiabatic (or fixed scatterer) approximation. The approximate methods optical potential model is second best. The Watson method is found to work better when the kinematics suggested by Foldy and Walecka are used rather than that suggested by Watson, that is to say, when the two-body of the nucleon-nucleon reduced mass

  16. Fidelity Mechanisms of DNA Polymerase Alpha

    Science.gov (United States)

    2008-07-23

    between right and wrong dNTPs. With purine dNTPs, the enzyme uses a combination of positive and negative selectivity. The Watson - Crick hydrogen...dNTP as a dCTP analogue despite the lack of a Watson - Crick hydrogen bond. We specifically examined the role of O2 of a pyrimidine by synthesizing 4...cases the compounds could form 2 Watson - Crick hydrogen bonds. The lack of polymerization resulted from very weak binding of the dNTPs to pol α

  17. Defense.gov Special Report: Fort Hood Shooting

    Science.gov (United States)

    identify possible insider threats, Army Secretary John M. McHugh told lawmakers. Story Obama: Soldiers ," Army Secretary John M. McHugh told lawmakers. Story President Praises Swift Response to Fort Hood Remarks on Fort Hood Shooting at White House McHugh, Odierno Address Fort Hood Shooting Before Congress

  18. Storytelling as Action: Constructing Masculinities in a School Context.

    Science.gov (United States)

    Moita-Lopes, Luiz Paulo

    2003-01-01

    Examines how masculinities were constructed in a Brazilian mother tongue fifth grade classroom, highlighting stories students told one another in this context. An ethnographic approach allowed naturally occurring stories to be audiotaped. Stories told in schools helped construct hegemonic masculinity by drawing on coherent systems available in…

  19. The emperor's clothes in high resolution: an experimental study of the framing effect and the diffusion of HDTV

    NARCIS (Netherlands)

    Joor, Dirkjan; Beekhuizen, Wilco; van de Wijngaert, Lidwien; Baaren, Eva

    2009-01-01

    In this article, an experiment was conducted to measure the effect of framing a high definition television (HDTV) clip. One group of participants was told they were watching a brand new HDTV clip, while the other group was told they were watching a digital DVD clip. Both groups were in fact watching

  20. Listening and Learning from Rangatahi Maori: The Voices of Maori Youth

    Science.gov (United States)

    Berryman, Mere; Eley, Elizabeth; Copeland, David

    2017-01-01

    This paper presents three stories-over-time of the secondary schooling experiences of New Zealand's rangatahi Maori--or Maori youth. The stories span fifteen years of New Zealand schooling and are told from three perspectives: the experiences of the students as told in their own words; the voices of youth within the prevailing political contexts…

  1. WhatsApp, Doc?

    Science.gov (United States)

    Bal, Abhijit M

    2017-01-01

    Confidentiality underpins the trust between doctors and patients. As far back as the 2nd century BC, the great Indian physician, Charak, had stated: "Nothing that happens in the house of the sick man must be told outside, nor must the patient's condition be told to anyone who might do harm by that knowledge to the patient or to another".

  2. Rabbi: exploring the inner world through stories

    Energy Technology Data Exchange (ETDEWEB)

    Umaschi, M. [MIT Media Lab., Cambridge, MA (United States)

    1996-12-31

    In the oral tradition, stories were told by the elder sages in order to give indirect advice. Today most stories are told in order to entertain. While some research on storytelling systems has focused on drama/theater metaphors and adventure/mystery simulation games, my research emphasizes the counseling and self-awareness possibilities of storytelling.

  3. Fulltext PDF

    Indian Academy of Sciences (India)

    A characteristic common to most good scientists is an openness of mind; a wannabe scientist is told and advised to cultivate these attributes. I tried aninformal experiment; I told some scientists that here were facts whose authenticity is in question. First, that a certain coffee is made from beans passed through the digestive.

  4. To tell or not to tell the diagnosis of schizophrenia.

    OpenAIRE

    Donnelly, P

    1989-01-01

    Some patients with schizophrenia are not told their diagnosis. The moral, clinical and practical issues involved in telling or not telling the patient are discussed. In some cases a relative is told the diagnosis but not the patient. The implications for the family and clinical outcome are outlined. A case history illustrating some of these issues is presented.

  5. Interaction of the Adenine-Thymine Watson-Crick and Adenine-Adenine Reverse-Hoogsteen DNA Base Pairs with Hydrated Group IIa (Mg .sup.2+./sup., Ca .sup.2+./sup., Sr .sup.2+./sup., Ba .sup.2+./sup.) and IIb (Zn .sup.2+./sup., Cd .sup.2+./sup., Hg .sup.2+./sup.) Metal Cations: Absence of the Base Pair Stabilization by Metal-Induced Polarization Effects

    Czech Academy of Sciences Publication Activity Database

    Šponer, Jiří; Sabat, M.; Burda, J. V.; Leszczynski, J.; Hobza, Pavel

    1999-01-01

    Roč. 103, č. 13 (1999), s. 2528-2534 ISSN 1089-5647 R&D Projects: GA ČR GA203/97/0029 Grant - others:NSF(US) EHR108767; NIH(US) GM08047 Subject RIV: BO - Biophysics Impact factor: 3.265, year: 1999

  6. Genetics Home Reference: hereditary paraganglioma-pheochromocytoma

    Science.gov (United States)

    ... 295(6):628. Citation on PubMed Selak MA, Armour SM, MacKenzie ED, Boulahbel H, Watson DG, Mansfield ... qualified healthcare professional . About Selection Criteria for Links Data Files & API Site Map Subscribe Customer Support USA. ...

  7. Journal of Humanities - Vol 13, No 1 (1999)

    African Journals Online (AJOL)

    From cultural aesthetic to performance technique: Continuities and contrasts in improvisational milieux of Vimbuza and Jazz* · EMAIL FREE FULL TEXT EMAIL FREE FULL TEXT · DOWNLOAD FULL TEXT DOWNLOAD FULL TEXT. Watson Msosa, 47-58 ...

  8. Nucleic acid nanomaterials: Silver-wired DNA

    Science.gov (United States)

    Auffinger, Pascal; Ennifar, Eric

    2017-10-01

    DNA double helical structures are supramolecular assemblies that are typically held together by classical Watson-Crick pairing. Now, nucleotide chelation of silver ions supports an extended silver-DNA hybrid duplex featuring an uninterrupted silver array.

  9. Uus raamatusari õpetajatele / Inga Kukk

    Index Scriptorium Estoniae

    Kukk, Inga

    2003-01-01

    Haridus- ja teadusministeerium hakkas välja andma tänapäeva pedagoogika raamatusarja "XXI sajandi kool". Ilmumas on esimene raamat: George Watson. Koolikäitumise käsiraamat. Kommenteerivad Jaan Kõrgesaar, Krista Sillar

  10. The role of the yeast as probiotic in the protection against liver fibrosis

    African Journals Online (AJOL)

    khairy

    treatment groups have been fed by yeast from the first 35 to 60 days, respectively. The results show ... medicinal and pharmaceutical applications (Kumura et al., 2004 ..... sclerosis and rheumatoid arthritis (Nicklin et al., 1994;. Watson and ...

  11. RESEARCH REPORTS

    African Journals Online (AJOL)

    This study is concerned with the productivity of nurses working within the. Primary ..... rience more work-related stress and report this as overall poor health, than ... performance, and reduces the possibility of staff loss through burnout (Watson,.

  12. Effects of National Fadama III Programme on the Scope and Scale of ...

    African Journals Online (AJOL)

    User

    Agriculture is the backbone of Nigeria's economy, despite being a leading producer of oil in the ... financing for the diverse livelihood activities which the beneficiaries themselves ..... McIntyre B. D., Herren H. R., Wakhungu J., Watson R. T.),.

  13. Commentary on Malone: Who Founded Behaviorism?

    Science.gov (United States)

    Reese, Hayne W

    2015-05-01

    Malone (The Behavior Analyst, 37, 1-12 2014) argued that the emergence of behaviorism was inevitable with or without Watson's participation, mainly because protobehavioral ideas and dissatisfaction with classical structuralism were already widespread. However, the first premise is questionable because many of the ideas Malone cited were consistent with structuralism rather than behaviorism, and even if both premises were true they would not make the emergence of behaviorism-or anything else-inevitable. Historical evidence for inevitability is always retrospective and therefore always allows the logical fallacy of "after this, therefore because of this." In the relevant real world Watson existed, he was a psychologist, he was the first to publish an article that described a "behaviorism," and he promoted his behaviorism in later works. Stories about what would have happened without Watson's participation are therefore counterfactual and this lack of historicity makes the stories fictional rather than scientific. In the real world, Watson founded behaviorism.

  14. Human genes and genomes: science, health, society

    National Research Council Canada - National Science Library

    Rosenberg, Leon E; Rosenberg, Diane Drobnis

    2012-01-01

    "In the nearly 60 years since Watson and Crick proposed the double helical structure of DNA, the molecule of heredity, waves of discoveries have made genetics the most thrilling field in the sciences...

  15. 76 FR 7625 - Qualification of Drivers; Exemption Applications; Diabetes Mellitus

    Science.gov (United States)

    2011-02-10

    ... exempts, Thomas H. Adams, Jr., Charlie A. Barner, Charles G. Beasley, Philp M. Carr, Timothy D. Cochran..., Darwin D. Roberts, Robert A. Roskamp, David N. Studebaker, Danny J. Watson, Robert L. Wenzel, David A...

  16. 75 FR 9478 - Qualification of Drivers; Exemption Applications; Vision

    Science.gov (United States)

    2010-03-02

    ... and devices showing standard red, green, and amber (49 CFR 391.41(b)(10)). FMCSA recognizes that some..., Donald D. Overton, Willie L. Parks, Derrick A. Robinson, Clarence Robinshaw, Jr., Norman J. Watson and...

  17. Mahlburg's Work on Crank Functions

    Indian Academy of Sciences (India)

    IAS Admin

    640–651, 2006. [8]. G N Watson, Ramanujan's Vermutung uber zerfallungsanzahlen, J. Reine Angew Math., Vol.179, pp.97–128, 1938. [9]. J Lehner, Ramanujan identities involving the partition function for the moduli 11α, Amer. J. Math.

  18. Spectral density regression for bivariate extremes

    KAUST Repository

    Castro Camilo, Daniela; de Carvalho, Miguel

    2016-01-01

    can be seen as an extension of the Nadaraya–Watson estimator where the usual scalar responses are replaced by mean constrained densities on the unit interval. Numerical experiments with the methods illustrate their resilience in a variety of contexts

  19. Zeeman and orbital limiting magnetic fields in cuprates: The ...

    Indian Academy of Sciences (India)

    1IBM T. J. Watson Research Center, Yorktown Heights, New York 10598, ... In cuprates, in a view where pairing correlations set in at the pseudogap ... the field Hc2 bounding the superconducting response and the pseudogap closing field.

  20. trawl bycatch in the fishing grounds of Bus

    African Journals Online (AJOL)

    ajl yemi

    2011-11-30

    . Biol. 86: 1455-1462. Watson RA, Dredge MLC, Mayer DG (1990). Spatial and seasonal variation in demersal trawl fauna associated with a prawn fishery on the CentralGreat Barrier Reef, Australia. Aust. J. Mar. Freshw. Res.

  1. The Chemical Adventures of Sherlock Holmes: The Blackwater Escape.

    Science.gov (United States)

    Waddell, Thomas G.; Rybolt, Thomas R.

    2003-01-01

    Presents a mystery based on the well-known characters, Sherlock Holmes and Dr. Watson. Emphasizes qualitative inorganic analysis, laboratory observations, and oxidation-reduction processes. (Author/YDS)

  2. Teatripeegel : Milliseid elamusi on hooaeg pakkunud Mihkel Mutile / Mihkel Mutt

    Index Scriptorium Estoniae

    Mutt, Mihkel, 1953-

    1998-01-01

    Arthur Conan Doyle'i "Sherlock Holmes ja doktor Watson", lav. Ago-Endrik Kerge ja Bertold Brechti "Kolmekrossiooper", lav. Adolf Shapiro Tallinna Linnateatris. Humanitaarinstituudi teatrifakulteedi õpilaste esituses Jean Anouilh' "Antigone", lav. Lembit Peterson

  3. A preliminary geochemical study of zircons and monazites from ...

    Indian Academy of Sciences (India)

    R. Narasimhan (Krishtel eMaging) 1461 1996 Oct 15 13:05:22

    equation of Watson and Harrison (1983) predicts that zircon with Zr-contents ... tion equation of Montel (1993) predicts that the .... and geochemistry of the basalts of Gujarat state (western ... solution kinetics: implications for the thorium and light.

  4. R2 Cognitive Computing

    Data.gov (United States)

    National Aeronautics and Space Administration — Robonaut 2, a crew assistant robotic prototype, will be integrated with IBM’s Watson. R2 will embody the artificial intelligence to enable new levels of robotic...

  5. The Egg with Two Yellows

    Indian Academy of Sciences (India)

    Srimath

    James Watson, Seymour Benzer's work and his place in the .... A graduate student, Ronald J Konopka from. Dayton, joined him, hoping .... genetics of Thomas Hunt Morgan and his student Alfred ... the findings of Franz Boas, Frank A Brown Jr,.

  6. Use of the FAO AquaCrop model in developing sowing guidelines ...

    African Journals Online (AJOL)

    2014-03-03

    Mar 3, 2014 ... Thomas (1961) with indication of the meteorological stations (stars) used ...... FYLSTRA D, LASDON L, WATSON J and WARREN A (1998) Design ... JONES CA, KINIRY JR and DYKE PT (1987) CERES-Maize: A Simu-.

  7. Ainooson et al., Afr J Tradit Complement Altern Med. (2012) 9(1):8 ...

    African Journals Online (AJOL)

    AJTCAM

    Ainooson et al., Afr J Tradit Complement Altern Med. (2012) ..... The authors are grateful for the technical assistance offered by Messrs Thomas Ansah, Gordon Darku and George Ofei of ... Miller, J. R. (2003). ... R. Watson and V. R. Preedy.

  8. Plant gene technology: social considerations

    African Journals Online (AJOL)

    Administrator

    The genetic modification of plants by gene technology is of immense potential benefits, but there may be possible risks. ... As a new endeavour, however, people have a mixed ... reality by gene biotechnology (Watson, 1997). Industrial ...

  9. Coal fire mapping of East Basuria Colliery, Jharia coalfield using ...

    Indian Academy of Sciences (India)

    detect coal fire regions based on surface tem- perature ..... and non-coal fire regions have been delineated well in the ..... System Development Notes; Paterson Grant and Watson .... Schloemer S 2006 Innovative technologies for exploration,.

  10. Behaviorism and Neuroscience.

    Science.gov (United States)

    Thompson, Richard F.

    1994-01-01

    The influence of behaviorism's methods and theories on theory and research in the neurosciences is examined, partly in light of John B. Watson's 1913 essay. An attempt is made to reconcile classical behaviorism and modern cognitive psychology and neuroscience. (SLD)

  11. 76 FR 59141 - Determination That LOXITANE (Loxapine Succinate) Capsules and Three Other Drug Products Were Not...

    Science.gov (United States)

    2011-09-23

    ... Applicant NDA 017525 LOXITANE (loxapine Watson Laboratories succinate) Inc., 417 Wakara Capsules, Way, Suite.../milliliter. NDA 020828 FORTOVASE Hoffmann La Roche (saquinavir) Inc., 340 Kingsland Capsule, 200 mg. St...

  12. Publications | Page 272 | IDRC - International Development ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Fighting the violet vampire. In the fields of sub-Saharan Africa, Alan Watson and McGill University's Weed Research Group are battling devastating parasites — naturally. Something big was happening in these agricultural fields of.

  13. Fulltext PDF

    Indian Academy of Sciences (India)

    Unknown

    and Watson clearly showed how, in fact, a gene could work. ... fifties Crick suggested that RNA acts as an adaptor that enables amino acids to associate ... tions, segmentation and complementation in development and origin of life on earth.

  14. The discovery of the structure of DNA

    Science.gov (United States)

    Squires, G. L.

    2003-04-01

    On 25 April 1953, Nature published a letter by Francis Crick and James Watson, at the Cavendish Laboratory, Cambridge, proposing a structure for DNA. This letter marked the beginning of a revolution in biology. Besides Crick and Watson, two other scientists, Rosalind Franklin and Maurice Wilkins, played key roles in the discovery. After sketching the early careers of the four scientists, the present article gives an account of the physics and chemistry involved in the discovery, and the events leading up to it.

  15. Improving the Army’s Next Effort in Technology Forecasting

    Science.gov (United States)

    2010-09-01

    DC: Center for Technology and National Security Policy, National Defense University, August 2005). 6 James D. Watson and Francis Crick , “A...occurred within the life sciences disciplines. Most notably this occurred early on in 1953 via the discovery of DNA’s double helix structure by Watson and... Crick .6 A confluence of organic chemistry, physics, genomics, and information technology further provided the ability to amplify and replicate the

  16. Toll-Like Receptor-9-Mediated Invasion in Breast Cancer

    Science.gov (United States)

    2011-07-01

    AMBER starting from the in-vacuum minimized Watson - Crick based paired 9-mer hairpin structures. These models were then used with NMR derived distance...the cell. The oligonucleotides studied adopt many different secondary structures such as Watson - Crick duplex, hairpin, quadruplex, and single...deoxyoligonucleotide. Although the mechanism(s) for this induction is unknown, our studies reveal key insights into the structural and sequence requirements for DNA

  17. Nonequilibrium Phase Transitions Associated with DNA Replication

    Science.gov (United States)

    2011-02-11

    polymerases) catalyzing the growth of a DNA primer strand (the nascent chain of nucleotides complementary to the template strand) based on the Watson ...the fraction (error rate) of monomers for which y, where y is the correct Watson - Crick complementary base of , can be obtained by ¼ X...Nonequilibrium Phase Transitions Associated with DNA Replication Hyung-June Woo* and Anders Wallqvist Biotechnology High Performance Computing

  18. Glutamate Receptor Aptamers and ALS

    Science.gov (United States)

    2009-01-01

    considered difficult because such a process uses the one-to-one correspondence of Watson - Crick pairing. In contrast, the transfer of function is...same nucleotides in M1 exhibited no NMIA reactivity. In general, non-reactive nucleotides were thought to be Watson - Crick based- paired. A number of...about 14 rounds of selections, the SELEX was terminated. The DNA pool from the 11th, 12th and 14th rounds were cloned and sequenced. Consensus

  19. Automated Information Enrichment for a Better Search

    OpenAIRE

    José Luis Preza

    2016-01-01

    The process of adding the Metadata when uploading a digital object onto a repository is usually manual. This means that the user has to have already at hand the keywords and all the other information about the asset. This paper addresses the possibility of enriching the “manual metadata” by generating automated metadata using the cognitive services provided by technologies like IBM Watson platform. The cognitive computing services offered by IBM Watson automatically generate Semantic Data (in...

  20. Healthcare Information Technology (HIT) in an Anti-Access (A2) and Area Denial (AD) Environment

    Science.gov (United States)

    2014-03-01

    point for multiple sites to connect to each other so radiologists can read diagnostic images by managing firewall connections. The idea of multiple...learn from them.41 Although IBM’s Watson isn’t living up to the hype just yet, the artificial intelligent ( AI ) computer system is a precursor for a...on the ground can control a UAV with two passengers in it; one technician and one AI healthcare machine (Medical IBM Watson). Once the UAV lands

  1. Visual marking and change blindness : moving occluders and transient masks neutralize shape changes to ignored objects

    OpenAIRE

    Watson, Derrick G.; Kunar, Melina A.

    2010-01-01

    Visual search efficiency improves by presenting (previewing) one set of distractors before the target and remaining distractor items (D. G. Watson & G. W. Humphreys, 1997). Previous work has shown that this preview benefit is abolished if the old items change their shape when the new items are added (e.g., D. G. Watson & G. W. Humphreys, 2002). Here we present 5 experiments that examined whether such object changes are still effective in recapturing attention if the changes occur while the pr...

  2. OSA Proceedings on Ultrafast Electronics and Optoelectronics Held in San Francisco, California on January 25 -27, 1993. Volume 14,

    Science.gov (United States)

    1993-01-27

    Fetterman , University of California, Los Angeles M. Fischetti, IBM T. J. Watson Research Center D. Grischkowski, IBM T. J. Watson Research Center E. P. Ippen...Spectroscopy System ............................. 112 Jeffrey S. Bostak, Daniel W. Van Der Weide, Ikuro Aoki, Bertram A. Aul" and David M. Bloom Sub-Picosecond...Martin, F. K. Oshita, and H. R. Fetterman ix On-Wafer Optoelectronic Techniques for Millimeter-Wave Generation, Control, and Circuit Characterization

  3. Egyptian mothers’ preferences regarding how physicians break bad news about their child’s disability: A structured verbal questionnaire

    Directory of Open Access Journals (Sweden)

    Abdelmoktader Ahmed

    2012-07-01

    Full Text Available Abstract Background Breaking bad news to mothers whose children has disability is an important role of physicians. There has been considerable speculation about the inevitability of parental dissatisfaction with how they are informed of their child’s disability. Egyptian mothers’ preferences for how to be told the bad news about their child’s disability has not been investigated adequately. The objective of this study was to elicit Egyptian mothers’ preferences for how to be told the bad news about their child’s disability. Methods Mothers of 100 infants recently diagnosed with Down syndrome were interviewed regarding their preferences for how to be told bad news. Mothers were recruited through outpatient clinics of the Pediatric Genetics Department at Fayoum University Hospital (located 90 km southwest of Cairo, Egypt from January to June 2011. Results and discussion Questionnaire analyses revealed nine themes of parental preferences for how to be told information difficult to hear. Mothers affirmed previously reported recommendations for conveying bad medical news to parents, including being told early, being told of others with a similar condition, and being informed of the prognosis. Conclusions Mothers affirmed communication themes previously discussed in the literature, such as being told early, and being informed of the prognosis. Although more research is needed in this important area, we hope that our findings will stimulate future search and help health care providers in different societies establish guidelines for effectively communicating bad news.

  4. 45 King: A Story of the Southern Home

    OpenAIRE

    Deluca, Paul Matthew Webb

    2014-01-01

    The house at 45 King St. in Charleston, South Carolina is more than a home. It is a story of the home. A story told through history, through a vision exhibited in architectural drawings, and through the social heritage closest to my heart. 45 King is a story for the South; the story of its grandeur, its climate, its natural beauty, its hospitality, its comfort, and its veils. It is a story that was told yesterday and one that is still told today. Like an oral history, the telling of it may...

  5. A Storytelling Approach: Insights from the Shambaa.

    Science.gov (United States)

    Lamanna, Camillo

    2018-03-19

    Narrative medicine explores the stories that patients tell; this paper, conversely, looks at some of the stories that patients are told. The paper starts by examining the 'story' told by the Shambaa people of Tanzania to explain the bubonic plague and contrasts this with the stories told by Ghanaian communities to explain lymphatic filariasis. By harnessing insights from memory studies, these stories' memorability is claimed to be due to their use mnemonic devices woven into stories. The paper suggests that stories can be unpatronising, informative, and appropriate vehicles for communicating medical information to all age groups across all cultures.

  6. How Einstein Discovered the Special Theory of Relativity -R-ES ...

    Indian Academy of Sciences (India)

    The international physics community had set aside the year 2005 as the ... and Cosmology Research. Centre ... Einstein told Bernard Cohen that he thought that the ... search journal was available. A book by ..... creative ability. In spite of his ...

  7. MRI of the Chest

    Medline Plus

    Full Text Available ... told otherwise, take your regular medications as usual. Leave jewelry at home and wear loose, comfortable clothing. ... contrast material except when absolutely necessary for medical treatment. See the MRI Safety page for more information ...

  8. Magnetic Resonance Imaging (MRI) -- Head

    Medline Plus

    Full Text Available ... told otherwise, take your regular medications as usual. Leave jewelry at home and wear loose, comfortable clothing. ... contrast material except when absolutely necessary for medical treatment. See the MRI Safety page for more information ...

  9. Magnetic Resonance Imaging (MRI) -- Head

    Medline Plus

    Full Text Available ... told otherwise, take your regular medications as usual. Leave jewelry at home and wear loose, comfortable clothing. ... contrast material except when absolutely necessary for medical treatment. See ... work pens, pocket knives and eyeglasses body piercings ...

  10. MRI of the Chest

    Medline Plus

    Full Text Available ... told otherwise, take your regular medications as usual. Leave jewelry at home and wear loose, comfortable clothing. ... contrast material except when absolutely necessary for medical treatment. See the MRI ... pocket knives and eyeglasses body piercings ...

  11. Parkinson disease - discharge

    Science.gov (United States)

    Your doctor has told you that you have Parkinson disease . This disease affects the brain and leads ... have you take different medicines to treat your Parkinson disease and many of the problems that may ...

  12. THE UNTOLD STORY OF A LEGEND IN THE DEVELOPMENT OF ...

    African Journals Online (AJOL)

    PHILIP AYODELE

    The history of contemporary ceramics in Nigeria cannot be told without .... legends and illustrated these on his works thus preserving these as subject of ... he exhibited at Madrid, Spain in 1979; Stuttgart, Germany in 1980; Berlin, Germany.

  13. Fulltext PDF

    Indian Academy of Sciences (India)

    Shailesh Shirali's 'Classroom' and 'Think-it-over' contributions recall some ... be successful, it is not enough to be Hungarian, you must also ... He would ask people their age and on being told, would immediately tell them how many seconds.

  14. Nuclear Radiation and the Thyroid

    Science.gov (United States)

    ... told to evacuate? Nuclear releases are unpredictable and traffic jams are likely to delay speedy evacuation. People ... patient information section on the American Thyroid Association ® website at www.thyroid.org .

  15. Tennis elbow surgery - discharge

    Science.gov (United States)

    ... epicondylitis surgery - discharge; Lateral tendinosis surgery - discharge; Lateral tennis elbow surgery - discharge ... long as you are told. This helps ensure tennis elbow will not return. You may be prescribed a ...

  16. 76 FR 4940 - Algirdas J. Krisciunas, M.D.; Revocation of Registration

    Science.gov (United States)

    2011-01-27

    ... deaths in Broward County, ``they have * * * extra workers inspecting, they got a lot of money from the... just $250 at a couple of places. Id. Registrant told Rix that a new law passed in February would...

  17. National Cyber Expert Addresses ELP Class

    OpenAIRE

    Center for Homeland Defense and Security

    2012-01-01

    Center for Homeland Defense and Security, PRESS RELEASES Governments, businesses and educational institutions should be making cybersecurity a top priority, a leading expert told a class of the Center for Homeland Defense and Security’s Executive Leaders Program. Brian...

  18. Voice and silence in an autoethnography about chronic illness

    African Journals Online (AJOL)

    Kate H

    a lecture by Lori Hartwell, a transplant recipient from America. When she told us of her .... surprises of Photovoice and film in a study of chronic illness. International ... Considering the violence of voicelessness: Censorship and self- censorship ...

  19. Magnetic Resonance Imaging

    Science.gov (United States)

    ... Permanent cosmetics or tattoos Dentures/teeth with magnetic keepers Other implants that involve magnets Medication patch (i. ... or longer. You’ll be told ahead of time just how long your scan is expected to ...

  20. Returning from the War Zone: A Guide for Military Personnel

    Science.gov (United States)

    ... tent and all of a sudden felt a knife near his side and someone told him to ... problems, such as impatience or impulsiveness ■ ■ Trouble concentrating, making decisions, or thinking logically ■ ■ Trouble remembering things, amnesia ■ ■ ...