WorldWideScience

Sample records for watson school engineering

  1. Data Discovery with IBM Watson

    Science.gov (United States)

    Fessler, J.

    2016-12-01

    BM Watson is a cognitive computing system that uses machine learning, statistical analysis, and natural language processing to find and understand the clues in questions posed to it. Watson was made famous when it bested two champions on TV's Jeopardy! show. Since then, Watson has evolved into a platform of cognitive services that can be trained on very granular fields up study. Watson is being used to support a number of subject domains, such as cancer research, public safety, engineering, and the intelligence community. IBM will be providing a presentation and demonstration on the Watson technology and will discuss its capabilities including Natural Language Processing, text analytics and enterprise search, as well as cognitive computing with deep Q&A. The team will also be giving examples of how IBM Watson technology is being used to support real-world problems across a number of public sector agencies

  2. UK Institute of Physics (IOP) President Sir Gareth Roberts (right) at CERN on 9 July with (right to left) IOP council vice-president and distinguished physicist Peter Kalmus, CERN engineer Tim Watson and IOP director of science Peter Cooper

    CERN Multimedia

    Patrice Loiez

    1999-01-01

    UK Institute of Physics (IOP) President Sir Gareth Roberts (right) at CERN on 9 July with (right to left) IOP council vice-president and distinguished physicist Peter Kalmus, CERN engineer Tim Watson and IOP director of science Peter Cooper

  3. A conversation with Geoff Watson

    OpenAIRE

    Beran, R. J.; Fisher, N. I.

    1998-01-01

    Geoffrey Stuart Watson, Professor Emeritus at Princeton University, celebrated his 75th birthday on December 3, 1996. A native Australian, his early education included Bendigo High School and Scotch College in Melbourne. After graduating with a B.A. (Hons.) from Melbourne University in December 1942, he spent the next few years, during and after World War II, doing research and teaching on applied mathematical topics. His wandering as a scholar began in 1947, when he became ...

  4. Civil Engineering in Primary Schools

    Science.gov (United States)

    Brown, Martin; Strong, Alan

    2010-01-01

    For many children of primary school age, an engineer is the man who comes to service the central heating system or who fixes the family car when it breaks down. Most have never met a "real" professional engineer, and have no idea of what is involved in the exciting world of engineering. Most assume that engineers are men. To try to…

  5. Distributional Watson transforms

    NARCIS (Netherlands)

    Dijksma, A.; Snoo, H.S.V. de

    1974-01-01

    For all Watson transforms W in L2(R+) a triple of Hilbert space LG ⊂ L2(R+) ⊂ L'G is constructed such that W may be extended to L'G. These results allow the construction of a triple L ⊂ L2(R+) ⊂ L', where L is a Gelfand-Fréchet space. This leads to a theory of distributional Watson transforms.

  6. The Thurgood Marshall School of Law Empirical Findings: A Report of the Watson-Glaser for the 2009-2010 Test Takers

    Science.gov (United States)

    Kadhi, T.; Palasota, A.; Holley, D.; Rudley, D.

    2010-01-01

    The following report gives the statistical findings of the 2009-2010 Watson-Glaser test. Data is pre-existing and was given to the Evaluator by email from the Director, Center for Legal Pedagogy. Statistical analyses were run using SPSS 17 to address the following questions: 1. What are the statistical descriptors of the Watson-Glaser results of…

  7. A Challenge to Watson

    Science.gov (United States)

    Detterman, Douglas K.

    2011-01-01

    Watson's Jeopardy victory raises the question of the similarity of artificial intelligence and human intelligence. Those of us who study human intelligence issue a challenge to the artificial intelligence community. We will construct a unique battery of tests for any computer that would provide an actual IQ score for the computer. This is the same…

  8. Making IBM's Computer, Watson, Human

    Science.gov (United States)

    Rachlin, Howard

    2012-01-01

    This essay uses the recent victory of an IBM computer (Watson) in the TV game, "Jeopardy," to speculate on the abilities Watson would need, in addition to those it has, to be human. The essay's basic premise is that to be human is to behave as humans behave and to function in society as humans function. Alternatives to this premise are considered…

  9. Weighted Watson-Crick automata

    Energy Technology Data Exchange (ETDEWEB)

    Tamrin, Mohd Izzuddin Mohd [Department of Information System, Kulliyyah of Information and Communication Technology, International Islamic University Malaysia, 50728 Gombak, Selangor (Malaysia); Turaev, Sherzod; Sembok, Tengku Mohd Tengku [Department of Computer Science, Kulliyyah of Information and Communication Technology, International Islamic University Malaysia, 50728 Gombak, Selangor (Malaysia)

    2014-07-10

    There are tremendous works in biotechnology especially in area of DNA molecules. The computer society is attempting to develop smaller computing devices through computational models which are based on the operations performed on the DNA molecules. A Watson-Crick automaton, a theoretical model for DNA based computation, has two reading heads, and works on double-stranded sequences of the input related by a complementarity relation similar with the Watson-Crick complementarity of DNA nucleotides. Over the time, several variants of Watson-Crick automata have been introduced and investigated. However, they cannot be used as suitable DNA based computational models for molecular stochastic processes and fuzzy processes that are related to important practical problems such as molecular parsing, gene disease detection, and food authentication. In this paper we define new variants of Watson-Crick automata, called weighted Watson-Crick automata, developing theoretical models for molecular stochastic and fuzzy processes. We define weighted Watson-Crick automata adapting weight restriction mechanisms associated with formal grammars and automata. We also study the generative capacities of weighted Watson-Crick automata, including probabilistic and fuzzy variants. We show that weighted variants of Watson-Crick automata increase their generative power.

  10. Weighted Watson-Crick automata

    International Nuclear Information System (INIS)

    Tamrin, Mohd Izzuddin Mohd; Turaev, Sherzod; Sembok, Tengku Mohd Tengku

    2014-01-01

    There are tremendous works in biotechnology especially in area of DNA molecules. The computer society is attempting to develop smaller computing devices through computational models which are based on the operations performed on the DNA molecules. A Watson-Crick automaton, a theoretical model for DNA based computation, has two reading heads, and works on double-stranded sequences of the input related by a complementarity relation similar with the Watson-Crick complementarity of DNA nucleotides. Over the time, several variants of Watson-Crick automata have been introduced and investigated. However, they cannot be used as suitable DNA based computational models for molecular stochastic processes and fuzzy processes that are related to important practical problems such as molecular parsing, gene disease detection, and food authentication. In this paper we define new variants of Watson-Crick automata, called weighted Watson-Crick automata, developing theoretical models for molecular stochastic and fuzzy processes. We define weighted Watson-Crick automata adapting weight restriction mechanisms associated with formal grammars and automata. We also study the generative capacities of weighted Watson-Crick automata, including probabilistic and fuzzy variants. We show that weighted variants of Watson-Crick automata increase their generative power

  11. Closure properties of Watson-Crick grammars

    Science.gov (United States)

    Zulkufli, Nurul Liyana binti Mohamad; Turaev, Sherzod; Tamrin, Mohd Izzuddin Mohd; Azeddine, Messikh

    2015-12-01

    In this paper, we define Watson-Crick context-free grammars, as an extension of Watson-Crick regular grammars and Watson-Crick linear grammars with context-free grammar rules. We show the relation of Watson-Crick (regular and linear) grammars to the sticker systems, and study some of the important closure properties of the Watson-Crick grammars. We establish that the Watson-Crick regular grammars are closed under almost all of the main closure operations, while the differences between other Watson-Crick grammars with their corresponding Chomsky grammars depend on the computational power of the Watson-Crick grammars which still need to be studied.

  12. The School Advanced Ventilation Engineering Software (SAVES)

    Science.gov (United States)

    The School Advanced Ventilation Engineering Software (SAVES) package is a tool to help school designers assess the potential financial payback and indoor humidity control benefits of Energy Recovery Ventilation (ERV) systems for school applications.

  13. Interview with Mark Watson

    Directory of Open Access Journals (Sweden)

    Katy Shaw

    2016-04-01

    Full Text Available Mark Watson is a British comedian and novelist. His five novels to date – 'Bullet Points' (2004, 'A Light-Hearted Look At Murder' (2007, 'Eleven' (2010, 'The Knot' (2012 and 'Hotel Alpha' (2014 – explore human relationships and communities in contemporary society. His latest novel Hotel Alpha tells the story of an extraordinary hotel in London and two mysterious disappearances that raise questions no one seems willing to answer. External to the novel, readers can also discover more about the hotel and its inhabitants in one hundred extra stories that expand the world of the novel and can be found at http://www.hotelalphastories.com. In conversation here with Dr Katy Shaw, Mark offers some reflections on his writing process, the field of contemporary literature, and the vitality of the novel form in the twenty-first century.

  14. High School Teachers' Conceptions of Engineers and Engineering

    Science.gov (United States)

    Hoh, Yin Kiong

    2012-01-01

    This paper describes a workshop activity the author has carried out with 80 high school science teachers to enable them to overcome their stereotypical perceptions of engineers and engineering. The activity introduced them to the biographies of prominent women in engineering, and raised their awareness of these female engineers' contributions to…

  15. de Jean Watson

    Directory of Open Access Journals (Sweden)

    Thaís Schossler

    2008-01-01

    Full Text Available Este estudio tuvo como objetivo conocer la percepción del cuidador domiciliario del anciano acerca del cuidado de sí mismo, teniendo como base teórica a Jean Watson en su Teoría del Cuidado Humano. La investigación se caracterizó por un abordaje cualitativo, de tipo exploratorio-descriptivo, el cual fue desarrollado en la Unidad de la Vila Floresta con nueve cuidadores domiciliarios de ancianos, integrantes del Programa de Atención a Domicilio. La recolección de informaciones se realizó en el período de agosto a octubre de 2006, por medio de una entrevista parcialmente estructurada. Se utilizó el análisis de contenido de Bardin y emergieron las categorías: compartir el cuidado al anciano - una posibilidad para cuidar de sí mismo; descansar, pasear, dormir, uno no tiene más ese derecho; presencia de la familia: una necesidad sentida por el cuidador domiciliar; (desequilibrio del cuerpo físico y mental, una resultante percibida en el (descuidado de sí mismo. Se concluye que el cuidador domiciliario es el principal responsable por el cuidado del anciano y que el cuidado de sí mismo se hace presente en su realidad.

  16. Transition from high schools to engineering education

    DEFF Research Database (Denmark)

    Kolmos, Anette; Holgaard, Jette Egelund; Clausen, Nicolaj Riise

    2017-01-01

    Pre-university engineering education has received increasing attention to attract more students to engineering and make them better prepared to enter engineering studies at university level. Denmark is one of the countries that offer established high school curriculum that makes engineering...... the core identity of the school. In a longitudinal research project, the cohort of all Danish engineering students who were enrolled in 2010 has been followed. This study takes a quantitative approach to highlight the differences in preparedness for engineering students who have a background...... themselves as being better prepared in relation to the conduct of experiments, engineering analysis and tolls, as well as in relation to process competences as design, problem solving and teamwork. The students from the profession-oriented high schools also find themselves better prepared in relation...

  17. Test Review: Watson, G., & Glaser, E. M. (2010), "Watson-Glaser™ II Critical Thinking Appraisal." Washington State University, Pullman, USA

    Science.gov (United States)

    Sternod, Latisha; French, Brian

    2016-01-01

    The Watson-Glaser™ II Critical Thinking Appraisal (Watson-Glaser II; Watson & Glaser, 2010) is a revised version of the "Watson-Glaser Critical Thinking Appraisal®" (Watson & Glaser, 1994). The Watson-Glaser II introduces a simplified model of critical thinking, consisting of three subdimensions: recognize assumptions, evaluate…

  18. Washington Schools Learn from Value Engineering.

    Science.gov (United States)

    Doleae, Michael L.; Childs, Harvey C.

    1983-01-01

    Results of two value engineering studies have shown that a review early in the design process can help save costs in school construction, maintenance, operation, and replacement. The value engineering concepts and technical manual are being presented throughout the state of Washington. (MLF)

  19. Ed Watson - 1940-2006

    CERN Multimedia

    2006-01-01

    Ed Watson passed away suddenly on 1 August in Geneva, he was 66. He leaves his wife and two children. Ed Watson arrived at CERN in March 1973 to work on digital electronics and CAMAC systems under Bob Dobinson, after many years at Rolls Royce in Scotland. He joined the European Muon Collaboration in 1976, where he played a major role in the design, deployment and running of its data acquisition system (DAQ) with David Botterill, Bob Dobinson, and Vicky White. The CAMAC-ROMULUS system was by far the largest and most advanced of its time, and it became a defining standard for DAQ systems for years to come. Ed was deeply involved in the detailed planning of the control rooms and the experiment cabling, as well as sharing the responsibility for the CAMAC readout system. He had a real talent for trouble shooting and played a vital part in supporting the experiment throughout its lifetime. He offered great moral support to the younger members of the collaboration and helped them a great deal with their work. The...

  20. Multi-head Watson-Crick automata

    OpenAIRE

    Chatterjee, Kingshuk; Ray, Kumar Sankar

    2015-01-01

    Inspired by multi-head finite automata and Watson-Crick automata in this paper, we introduce new structure namely multi-head Watson-Crick automata where we replace the single tape of multi-head finite automaton by a DNA double strand. The content of the second tape is determined using a complementarity relation similar to Watson-Crick complementarity relation. We establish the superiority of our model over multi-head finite automata and also show that both the deterministic and non-determinis...

  1. Sommerfeld-Watson transformation for nuclear fission

    International Nuclear Information System (INIS)

    Alexandru, G.

    1978-01-01

    It is proved that the fission matrix element can be written like a Sommerfeld-Watson relation. This leads to a dispersion relation for the fission process in which the substraction term is uniquely determined. (author)

  2. A chat with James Watson

    CERN Multimedia

    2011-01-01

    On 6 September, Nobel laureate James Watson paid a visit to CERN. In this interview, he shares his views with CERN's Paola Catapano.      var flash_video_player=get_video_player_path(); insert_player_for_external('Video/Public/Movies/2011/CERN-MOVIE-2011-144/CERN-MOVIE-2011-144-0753-kbps-640x360-25-fps-audio-64-kbps-44-kHz-stereo', 'mms://mediastream.cern.ch/MediaArchive/Video/Public/Movies/2011/CERN-MOVIE-2011-144/CERN-MOVIE-2011-144-0480-kbps-512x288-25-fps-audio-128-kbps-48-kHz-stereo.wmv', 'false', 480, 360, 'https://mediastream.cern.ch/MediaArchive/Video/Public/Movies/2011/CERN-MOVIE-2011-144/CERN-MOVIE-2011-144-posterframe-640x360-at-10-percent.jpg', '1384418', true, 'Video/Public/Movies/2011/CERN-MOVIE-2011-144/CERN-MOVIE-2011-144-0600-kbps-maxH-360-25-fps-audio-128-kbps-48-kHz-stereo.mp4');

  3. Ed Watson 1940-2006

    CERN Multimedia

    2006-01-01

    Ed Watson arrived at CERN in March 1973 to work on digital electronics and CAMAC systems under Bob Dobinson, after many years at Rolls Royce in Scotland. He joined the European Muon Collaboration in 1976, where he played a major role in the design, deployment and running of its data acquisition system (DAQ) with David Botterill, Bob Dobinson, and Vicky White. The CAMAC-ROMULUS system was by far the largest and most advanced of its time, and it became a defining standard for DAQ systems for years to come. Ed was deeply involved in the detailed planning of the control rooms and the experiment cabling, as well as sharing the responsibility for the CAMAC readout system. He had a real talent for trouble shooting and played a vital part in supporting the experiment throughout its lifetime. He offered great moral support to the younger members of the collaboration and helped them a great deal with their work. The EMC had a wonderful social life to which Ed was a major contributor - who can forget its barbecues?  In...

  4. Impact of an Engineering Case Study in a High School Pre-Engineering Course

    Science.gov (United States)

    Rutz, Eugene; Shafer, Michelle

    2011-01-01

    Students at an all-girls high school who were enrolled in an introduction to engineering course were presented an engineering case study to determine if the case study affected their attitudes toward engineering and their abilities to solve engineering problems. A case study on power plants was implemented during a unit on electrical engineering.…

  5. JAERI Nuclear Engineering School and technology transfer

    International Nuclear Information System (INIS)

    Nishimura, Kazuaki; Kawaguchi, Chiyoji

    1978-01-01

    A method is introduced to evaluate the degree of nuclear technology transfer; that is, the output powers of Japanese nuclear reactors constructed in these 20 years are chronologically plotted in a semi-log figure. All reactors plotted are classified into imported and domestic ones according to a value of domestication factor. A space between two historical trajectories of reactor construction may be interpreted as one of the measures indicating the degree of nuclear technology transfer. In connection with this method, historical change of educational and training courses in Nuclear Engineering School of Japan Atomic Energy Research Institute is reviewed in this report. (author)

  6. Examining Gender Inequality in a High School Engineering Course

    Science.gov (United States)

    Riegle-Crumb, Catherine; Moore, Chelsea

    2013-01-01

    This paper examines gender inequality within the context of an upper-level high school engineering course recently offered in Texas. Data was collected from six high schools that serve students from a variety of backgrounds. Among the almost two hundred students who enrolled in this challenge-based engineering course, females constituted a clear…

  7. Building a Framework for Engineering Design Experiences in High School

    Science.gov (United States)

    Denson, Cameron D.; Lammi, Matthew

    2014-01-01

    In this article, Denson and Lammi put forth a conceptual framework that will help promote the successful infusion of engineering design experiences into high school settings. When considering a conceptual framework of engineering design in high school settings, it is important to consider the complex issue at hand. For the purposes of this…

  8. 78 FR 43198 - Watson Cogeneration Company; Notice of Filing

    Science.gov (United States)

    2013-07-19

    ... DEPARTMENT OF ENERGY Federal Energy Regulatory Commission [Docket No. TX13-1-000] Watson... Commission's (Commission) Regulations, 18 CFR 36.1, Watson Cogeneration Company filed an application... physical interconnection to the Watson facility; (2) direct SCE and California Independent System Operator...

  9. Oncologists partner with Watson on genomics.

    Science.gov (United States)

    2015-08-01

    A new collaboration between IBM Watson Health and more than a dozen cancer centers uses the power of cognitive computing to dramatically reduce the time it takes to analyze data from patients' DNA and identify targeted treatment options. ©2015 American Association for Cancer Research.

  10. The School for Nuclear Engineering is 25 years old: Where teachers go to school

    International Nuclear Information System (INIS)

    Knapp, W.

    1986-01-01

    For a quarter of a century the School for Nuclear Engineering at the Karlsruhe Nuclear Research Centre has provided further education in all areas of nuclear engineering. The courses are attended by all kinds of people: school teachers, shift managers in nuclear power stations and engineers from the Third World, for example. (orig.) [de

  11. High School Student Modeling in the Engineering Design Process

    Science.gov (United States)

    Mentzer, Nathan; Huffman, Tanner; Thayer, Hilde

    2014-01-01

    A diverse group of 20 high school students from four states in the US were individually provided with an engineering design challenge. Students chosen were in capstone engineering courses and had taken multiple engineering courses. As students considered the problem and developed a solution, observational data were recorded and artifacts…

  12. Examining Gender Inequality In A High School Engineering Course.

    Science.gov (United States)

    Riegle-Crumb, Catherine; Moore, Chelsea

    2013-01-01

    This paper examines gender inequality within the context of an upper-level high school engineering course recently offered in Texas. Data was collected from six high schools that serve students from a variety of backgrounds. Among the almost two hundred students who enrolled in this challenge-based engineering course, females constituted a clear minority, comprising only a total of 14% of students. Quantitative analyses of surveys administered at the beginning of the school year (Fall 2011) revealed statistically significant gender gaps in personal attitudes towards engineering and perceptions of engineering climate. Specifically, we found that compared to males, females reported lower interest in and intrinsic value for engineering, and expressed less confidence in their engineering skills. Additionally, female students felt that the classroom was less inclusive and viewed engineering occupations as less progressive. Gender disparities on all of these measures did not significantly decrease by the end of the school year (Spring 2012). Findings suggest that efforts to increase the representation of women in the engineering pipeline via increasing exposure in secondary education must contend not only with obstacles to recruiting high school girls into engineering courses, but must also work to remedy gender differences in engineering attitudes within the classroom.

  13. Supervisor's experiments on radiation safety trainings in school of engineering

    International Nuclear Information System (INIS)

    Nomura, Kiyoshi

    2005-01-01

    Radiation safety training courses in School of Engineering, The University of Tokyo, were introduced. The number of radiation workers and the usage of radiation and radioisotopes have been surveyed for past 14 years. The number of radiation workers in School of Engineering has increased due to the treatment of X-ray analysis of materials, recently. It is important for workers to understand the present situation of School of Engineering before the treatment of radiation and radioisotopes. What the supervisor should tell to radiation workers were presented herewith. The basic questionnaires after the lecture are effective for radiation safety trainings. (author)

  14. Did John B. Watson Really "Found" Behaviorism?

    Science.gov (United States)

    Malone, John C

    2014-05-01

    Developments culminating in the nineteenth century, along with the predictable collapse of introspective psychology, meant that the rise of behavioral psychology was inevitable. In 1913, John B. Watson was an established scientist with impeccable credentials who acted as a strong and combative promoter of a natural science approach to psychology when just such an advocate was needed. He never claimed to have founded "behavior psychology" and, despite the acclaim and criticism attending his portrayal as the original behaviorist, he was more an exemplar of a movement than a founder. Many influential writers had already characterized psychology, including so-called mental activity, as behavior, offered many applications, and rejected metaphysical dualism. Among others, William Carpenter, Alexander Bain, and (early) Sigmund Freud held views compatible with twentieth-century behaviorism. Thus, though Watson was the first to argue specifically for psychology as a natural science, behaviorism in both theory and practice had clear roots long before 1913. If behaviorism really needs a "founder," Edward Thorndike might seem more deserving, because of his great influence and promotion of an objective psychology, but he was not a true behaviorist for several important reasons. Watson deserves the fame he has received, since he first made a strong case for a natural science (behaviorist) approach and, importantly, he made people pay attention to it.

  15. Re-Engineering Primary School Teachers for Sustainable ...

    African Journals Online (AJOL)

    engineer primary school teachers for sustainable development in Onitsha North Local Government Area. Three research questions and a hypothesis were formulated to guide the study. Descriptive survey research design was used. 300 primary ...

  16. A Multidisciplinary Engineering Summer School in an Industrial Setting

    DEFF Research Database (Denmark)

    Larsen, Peter Gorm; Fernandes, Joao M.; Habel, Jacek

    2009-01-01

    Most university-level engineering studies produce technically skilled engineers. However, typically students face several difficulties when working in multidisciplinary teams when they initiate their industrial careers. In a globalised world, it becomes increasingly important that engineers...... are capable of collaborating across disciplinary boundaries and exhibit soft competencies, like communication, interpersonal and social skills, time planning, creativity, initiative, and reflection. To prepare a group of engineering and industrial design students to acquire those capabilities......, an international summer school that combined industrial design with different kinds of engineering disciplines was organised on the site of Bang & Olufsen (B&O) in Denmark. This multidisciplinary engineering summer school was attended by students from six European university-level teaching institutions...

  17. Engineering Education in K-12 Schools

    Science.gov (United States)

    Spence, Anne

    2013-03-01

    Engineers rely on physicists as well as other scientists and mathematicians to explain the world in which we live. Engineers take this knowledge of the world and use it to create the world that never was. The teaching of physics and other sciences as well as mathematics is critical to maintaining our national workforce. Science and mathematics education are inherently different, however, from engineering education. Engineering educators seek to enable students to develop the habits of mind critical for innovation. Through understanding of the engineering design process and how it differs from the scientific method, students can apply problem and project based learning to solve the challenges facing society today. In this talk, I will discuss the elements critical to a solid K-12 engineering education that integrates science and mathematics to solve challenges throughout the world.

  18. Training IBM Watson using Automatically Generated Question-Answer Pairs

    OpenAIRE

    Lee, Jangho; Kim, Gyuwan; Yoo, Jaeyoon; Jung, Changwoo; Kim, Minseok; Yoon, Sungroh

    2016-01-01

    IBM Watson is a cognitive computing system capable of question answering in natural languages. It is believed that IBM Watson can understand large corpora and answer relevant questions more effectively than any other question-answering system currently available. To unleash the full power of Watson, however, we need to train its instance with a large number of well-prepared question-answer pairs. Obviously, manually generating such pairs in a large quantity is prohibitively time consuming and...

  19. Graham Watson: Eesti vajab enam riigi sekkumist majandusse

    Index Scriptorium Estoniae

    Watson, Graham

    2009-01-01

    18. aprillil pidasid keskerakondlased Tallinnas Euroopa Parlamendi valimiste konverentsi. Euroopa Parlamendi demokraatide ja liberaalide fraktsiooni juht Graham Watson saatis Keskerakonnale videotervituse

  20. Beyond Blackboards: Engaging Underserved Middle School Students in Engineering.

    Science.gov (United States)

    Blanchard, Sarah; Judy, Justina; Muller, Chandra; Crawford, Richard H; Petrosino, Anthony J; White, Christina K; Lin, Fu-An; Wood, Kristin L

    Beyond Blackboards is an inquiry-centered, after-school program designed to enhance middle school students' engagement with engineering through design-based experiences focused on the 21 st Century Engineering Challenges. Set within a predominantly low-income, majority-minority community, our study aims to investigate the impact of Beyond Blackboards on students' interest in and understanding of engineering, as well as their ability to align their educational and career plans. We compare participants' and nonparticipants' questionnaire responses before the implementation and at the end of the program's first academic year. Statistically significant findings indicate a school-wide increase in students' interest in engineering careers, supporting a shift in school culture. However, only program participants showed increased enjoyment of design-based strategies, understanding of what engineers do, and awareness of the steps for preparing for an engineering career. These quantitative findings are supported by qualitative evidence from participant focus groups highlighting the importance of mentors in shaping students' awareness of opportunities within engineering.

  1. Enhancement of Global Communication Skill at the School of Engineering

    Science.gov (United States)

    Morimura, Kumiko

    Globalization is one of the most important challenges for universities. Especially for the School of Engineering, it is crucial to foster researchers or engineers with broader perspective. International communication competency is essential for them in order to deal with other professionals from overseas. Center for Innovation in Engineering Education established in the School of Engineering at the University of Tokyo in 2005 started two programs for graduate and undergraduate students to enhance their international communication competency and to increase international competitiveness. ‘English for Scientists and Engineers A, B’ are for the graduate students to learn how to write papers in English and how to make good presentations. Special English Lessons are for the undergraduate students to have a chance to practice English conversation or prepare for TOEFL test. In this paper, the authors discuss the details of the programs, their purpose and the future tasks.

  2. Encouraging the Learning of Hydraulic Engineering Subjects in Agricultural Engineering Schools

    Science.gov (United States)

    Sinobas, Leonor Rodríguez; Sánchez Calvo, Raúl

    2014-01-01

    Several methodological approaches to improve the understanding and motivation of students in Hydraulic Engineering courses have been adopted in the Agricultural Engineering School at Technical University of Madrid. During three years student's progress and satisfaction have been assessed by continuous monitoring and the use of…

  3. Immersion in the Field: The Elementary Block Network in the Watson College of Education at the University of North Carolina Wilmington

    Science.gov (United States)

    Roseboro, Donyell; Lewis, Somer; Buchanan, Lisa; Higgins, Heidi; Schlichting, Katie; Brinkley, Brian

    2014-01-01

    In 1989, the Watson College of Education at the University of North Carolina Wilmington started the Model Clinical Teaching Project and the Consortium for the Advancement of Public Education's School Reform Initiative (CAPE). Since that time, the partnership system has grown to include 146 schools across twelve traditional school districts and…

  4. High School Student Information Access and Engineering Design Performance

    Science.gov (United States)

    Mentzer, Nathan

    2014-01-01

    Developing solutions to engineering design problems requires access to information. Research has shown that appropriately accessing and using information in the design process improves solution quality. This quasi-experimental study provides two groups of high school students with a design problem in a three hour design experience. One group has…

  5. Implementing Concepts of Pharmaceutical Engineering into High School Science Classrooms

    Science.gov (United States)

    Kimmel, Howard; Hirsch, Linda S.; Simon, Laurent; Burr-Alexander, Levelle; Dave, Rajesh

    2009-01-01

    The Research Experience for Teachers was designed to help high school science teachers develop skills and knowledge in research, science and engineering with a focus on the area of pharmaceutical particulate and composite systems. The experience included time for the development of instructional modules for classroom teaching. Results of the…

  6. Aspects of Mutual Engagement: School of Engineering and Industry Collaborations

    Science.gov (United States)

    Stroud, Dean; Hopkins, Andrew

    2016-01-01

    This paper is a case study of collaboration between a large steel company and a university's school of engineering. Our aim is to contribute to understandings of engagement between employers and higher education institutions and explore some of the complexities of such collaborations in their initiation and propagation. The analysis derives from…

  7. Future engineers: the intrinsic technology motivation of secondary school pupils

    Science.gov (United States)

    Jones, Lewis C. R.; McDermott, Hilary J.; Tyrer, John R.; Zanker, Nigel P.

    2018-07-01

    The supply of students motivated to study engineering in higher education is critical to the sector. Results are presented from the 'Mindsets STEM Enhancement Project'. Fifty-seven new resources packs, designed to improve STEM education in Design and Technology, were given to schools across London. A modified Intrinsic Motivation Inventory questionnaire measured pupils' (n = 458) motivation towards technology. The results show that although pupils have positive reactions to the technology content within Design and Technology lessons, the type of STEM resources and lessons created through the project had made no significant difference on pupils' interest/enjoyment towards technology. This suggests stand-alone resources do not improve pupil motivation. The impact of this work to engineering higher education is that the existing levels and the inability to improve pupil motivation in technology at school could be a factor affecting the pursuit of a technology or engineering related education or career.

  8. Uporaba orodja poslovne inteligence IBM Watson za predvidevanje prodaje

    OpenAIRE

    Stojić, Igor

    2016-01-01

    Diplomska naloga obravnava uporabo orodja IBM Watson in njegovo poslovno vrednost, ki jo ima v okviru oblikovanja napovedi prihodnje prodaje produktov. V teoretičnem delu podrobneje opredeljuje napovedovanje in smoter le-tega. V okviru empiričnega dela pa je bila izvedena primerjava uporabe ERP sistemov SAP in IBM Watson, pri čemer je bil dosledno prikazan postopek oblikovanja napovedi, tako s SAP kot tudi z IBM Watson, s slednjim pa tudi identificiran parameter, ki vpliva na prodajo nekateri...

  9. Engineering for All: A Middle School Program to Introduce Students to Engineering as a Potential Social Good

    Science.gov (United States)

    Hacker, Michael; Crismond, David; Hecht, Deborah; Lomask, Michal

    2017-01-01

    This article is the first of a two-part series about Engineering for All (EfA), a $1.7M National Science Foundation-funded project, which introduces middle school students to engineering, not only as a career path, but as an endeavor with potential for doing social good. Engineering for All opens students' eyes to the role engineers play in…

  10. Robonaut 2 and Watson: Cognitive Dexterity for Future Exploration

    Science.gov (United States)

    Badger, Julia M.; Strawser, Philip; Farrell, Logan; Goza, S. Michael; Claunch, Charles A.; Chancey, Raphael; Potapinski, Russell

    2018-01-01

    Future exploration missions will dictate a level of autonomy never before experienced in human spaceflight. Mission plans involving the uncrewed phases of complex human spacecraft in deep space will require a coordinated autonomous capability to be able to maintain the spacecraft when ground control is not available. One promising direction involves embedding intelligence into the system design both through the employment of state-of-the-art system engineering principles as well as through the creation of a cognitive network between a smart spacecraft or habitat and embodiments of cognitive agents. The work described here details efforts to integrate IBM's Watson and other cognitive computing services into NASA Johnson Space Center (JSC)'s Robonaut 2 (R2) anthropomorphic robot. This paper also discusses future directions this work will take. A cognitive spacecraft management system that is able to seamlessly collect data from subsystems, determine corrective actions, and provide commands to enable those actions is the end goal. These commands could be to embedded spacecraft systems or to a set of robotic assets that are tied into the cognitive system. An exciting collaboration with Woodside provides a promising Earth-bound testing analog, as controlling and maintaining not normally manned off-shore platforms have similar constraints to the space missions described.

  11. Educational experiments of radiochemistry in the nuclear engineering school

    International Nuclear Information System (INIS)

    Akatsu, Eiko

    1995-06-01

    Educational experiments of radiochemistry are described. They were an improvement of educational experiment of burn-up measurement as well as experiments on a solvent extraction, a cation exchange behavior of 60 Co, liquid scintillation spectrometry and half-life determination of 87 Rb, and determination of 137 Cs in sea water. Two or one of the experiments were ordinarily studied, depending the occasional situations, by the students of the general course or of the nuclear engineering course in the Nuclear Engineering School, Nuclear Education Center, JAERI from 1976 to 1994. (author)

  12. The Fu Foundation School of Engineering & Applied Science - Columbia

    Science.gov (United States)

    Engineering Mechanics Computer Science Earth and Environmental Engineering Electrical Engineering Industrial Engineering & Applied Science - Columbia University Admissions Undergraduates Graduates Distance Learning Physics and Applied Mathematics Biomedical Engineering Chemical Engineering Civil Engineering and

  13. Young Engineers and Sciences (YES) - Mentoring High School Students

    Science.gov (United States)

    Boice, Daniel C.; Asbell, E.; Reiff, P. H.

    2008-09-01

    Young Engineers and Scientists (YES) is a community partnership between Southwest Research Institute (SwRI), and local high schools in San Antonio, Texas (USA) during the past 16 years. The YES program provides talented high school juniors and seniors a bridge between classroom instruction and real world, research experiences in physical sciences (including space science) and engineering. YES consists of two parts: 1) an intensive three-week summer workshop held at SwRI where students experience the research environment first-hand; develop skills and acquire tools for solving scientific problems, attend mini-courses and seminars on electronics, computers and the Internet, careers, science ethics, and other topics; and select individual research projects to be completed during the academic year; and 2) a collegial mentorship where students complete individual research projects under the guidance of their mentors during the academic year and earn honors credit. At the end of the school year, students publicly present and display their work, acknowledging their accomplishments and spreading career awareness to other students and teachers. During these years, YES has developed a website for topics in space science from the perspective of high school students, including NASA's Magnetospheric Multiscale Mission (MMS) (http://yesserver.space.swri.edu). High school science teachers participate in the workshop and develop space-related lessons for classroom presentation in the academic year. Student evaluations indicate the effectiveness of YES on their academic preparation and choice of college majors. Over the past 16 years, all YES graduates have entered college, several have worked for SwRI, one business has started, and three scientific publications have resulted. Acknowledgements. We acknowledge funding and support from the NASA MMS Mission, Texas Space Grant Consortium, Northside Independent School District, SwRI, and several local charitable foundations.

  14. The multiple personalities of Watson and Crick strands.

    Science.gov (United States)

    Cartwright, Reed A; Graur, Dan

    2011-02-08

    In genetics it is customary to refer to double-stranded DNA as containing a "Watson strand" and a "Crick strand." However, there seems to be no consensus in the literature on the exact meaning of these two terms, and the many usages contradict one another as well as the original definition. Here, we review the history of the terminology and suggest retaining a single sense that is currently the most useful and consistent. The Saccharomyces Genome Database defines the Watson strand as the strand which has its 5'-end at the short-arm telomere and the Crick strand as its complement. The Watson strand is always used as the reference strand in their database. Using this as the basis of our standard, we recommend that Watson and Crick strand terminology only be used in the context of genomics. When possible, the centromere or other genomic feature should be used as a reference point, dividing the chromosome into two arms of unequal lengths. Under our proposal, the Watson strand is standardized as the strand whose 5'-end is on the short arm of the chromosome, and the Crick strand as the one whose 5'-end is on the long arm. Furthermore, the Watson strand should be retained as the reference (plus) strand in a genomic database. This usage not only makes the determination of Watson and Crick unambiguous, but also allows unambiguous selection of reference stands for genomics. This article was reviewed by John M. Logsdon, Igor B. Rogozin (nominated by Andrey Rzhetsky), and William Martin.

  15. The multiple personalities of Watson and Crick strands

    Directory of Open Access Journals (Sweden)

    Graur Dan

    2011-02-01

    Full Text Available Abstract Background In genetics it is customary to refer to double-stranded DNA as containing a "Watson strand" and a "Crick strand." However, there seems to be no consensus in the literature on the exact meaning of these two terms, and the many usages contradict one another as well as the original definition. Here, we review the history of the terminology and suggest retaining a single sense that is currently the most useful and consistent. Proposal The Saccharomyces Genome Database defines the Watson strand as the strand which has its 5'-end at the short-arm telomere and the Crick strand as its complement. The Watson strand is always used as the reference strand in their database. Using this as the basis of our standard, we recommend that Watson and Crick strand terminology only be used in the context of genomics. When possible, the centromere or other genomic feature should be used as a reference point, dividing the chromosome into two arms of unequal lengths. Under our proposal, the Watson strand is standardized as the strand whose 5'-end is on the short arm of the chromosome, and the Crick strand as the one whose 5'-end is on the long arm. Furthermore, the Watson strand should be retained as the reference (plus strand in a genomic database. This usage not only makes the determination of Watson and Crick unambiguous, but also allows unambiguous selection of reference stands for genomics. Reviewers This article was reviewed by John M. Logsdon, Igor B. Rogozin (nominated by Andrey Rzhetsky, and William Martin.

  16. Replication infidelity via a mismatch with Watson-Crick geometry.

    Science.gov (United States)

    Bebenek, Katarzyna; Pedersen, Lars C; Kunkel, Thomas A

    2011-02-01

    In describing the DNA double helix, Watson and Crick suggested that "spontaneous mutation may be due to a base occasionally occurring in one of its less likely tautomeric forms." Indeed, among many mispairing possibilities, either tautomerization or ionization of bases might allow a DNA polymerase to insert a mismatch with correct Watson-Crick geometry. However, despite substantial progress in understanding the structural basis of error prevention during polymerization, no DNA polymerase has yet been shown to form a natural base-base mismatch with Watson-Crick-like geometry. Here we provide such evidence, in the form of a crystal structure of a human DNA polymerase λ variant poised to misinsert dGTP opposite a template T. All atoms needed for catalysis are present at the active site and in positions that overlay with those for a correct base pair. The mismatch has Watson-Crick geometry consistent with a tautomeric or ionized base pair, with the pH dependence of misinsertion consistent with the latter. The results support the original idea that a base substitution can originate from a mismatch having Watson-Crick geometry, and they suggest a common catalytic mechanism for inserting a correct and an incorrect nucleotide. A second structure indicates that after misinsertion, the now primer-terminal G • T mismatch is also poised for catalysis but in the wobble conformation seen in other studies, indicating the dynamic nature of the pathway required to create a mismatch in fully duplex DNA.

  17. Encouraging the learning of hydraulic engineering subjects in agricultural engineering schools

    Science.gov (United States)

    Rodríguez Sinobas, Leonor; Sánchez Calvo, Raúl

    2014-09-01

    Several methodological approaches to improve the understanding and motivation of students in Hydraulic Engineering courses have been adopted in the Agricultural Engineering School at Technical University of Madrid. During three years student's progress and satisfaction have been assessed by continuous monitoring and the use of 'online' and web tools in two undergraduate courses. Results from their application to encourage learning and communication skills in Hydraulic Engineering subjects are analysed and compared to the initial situation. Student's academic performance has improved since their application, but surveys made among students showed that not all the methodological proposals were perceived as beneficial. Their participation in the 'online', classroom and reading activities was low although they were well assessed.

  18. Results of Summer Enrichment Program to Promote High School Students' Interest in Engineering

    Science.gov (United States)

    Hart, Brenda; McAnulty, Kate

    2014-01-01

    For more than thirty years, personnel from the University of Louisville J.B. Speed School of Engineering have presented a summer program targeting high school students historically underrepresented in engineering fields. INSPIRE provides these students with an introduction to careers in engineering and assists the students in planning their…

  19. First-Year Engineering Students' Portrayal of Engineering in a Proposed Museum Exhibit for Middle School Students

    Science.gov (United States)

    Mena, Irene B.; Diefes-Dux, Heidi A.

    2012-04-01

    Students' perceptions of engineering have been documented through studies involving interviews, surveys, and word associations that take a direct approach to asking students about various aspects of their understanding of engineering. Research on perceptions of engineering rarely focuses on how students would portray engineering to others. First-year engineering student teams proposed a museum exhibit, targeted to middle school students, to explore the question "What is engineering?" The proposals took the form of a poster. The overarching research question focuses on how these students would portray engineering to middle school students as seen through their museum exhibit proposals. A preliminary analysis was done on 357 posters to determine the overall engineering themes for the proposed museum exhibits. Forty of these posters were selected and, using open coding, more thoroughly analyzed to learn what artifacts/objects, concepts, and skills student teams associate with engineering. These posters were also analyzed to determine if there were any differences by gender composition of the student teams. Building, designing, and teamwork are skills the first-year engineering students link to engineering. Regarding artifacts, students mentioned those related to transportation and structures most often. All-male teams were more likely to focus on the idea of space and to mention teamwork and designing as engineering skills; equal-gender teams were more likely to focus on the multidisciplinary aspect of engineering. This analysis of student teams' proposals provides baseline data, positioning instructors to develop and assess instructional interventions that stretch students' self-exploration of engineering.

  20. Engineering education for youth: Diverse elementary school students' experiences with engineering design

    Science.gov (United States)

    Hegedus, Theresa

    Lingering concerns over the persistent achievement gap amidst the trend of an increasingly diverse society have been compounded by calls from the Oval Office, the National Science Board, and nationwide media to also address our current creativity crisis. Now, more than ever, we have a responsibility to produce a STEM-capable (science, technology, engineering, and mathematics) workforce to meet the demands of our rapidly changing local and global economic landscape. Barriers exist in our traditional educational system, which has historically limited underrepresented groups' affiliation and membership in the disciplines of science and engineering. The recent incorporation of engineering into the latest science education reform efforts presents an opportunity to expose students as early as elementary school to engineering practices and habits of mind, which have the potential to stimulate creative thinking skills through engineering design. This qualitative study was designed to examine the ways in which engineering education has the potential to promote creativity and academic competence in elementary science classrooms. As a part of my study, a diverse group of students from two fifth-grade classrooms took part in a 10-12 hour, engineering-based curriculum unit (Engineering is Elementary) during their regular science instructional time. Using a sociocultural lens, to include cultural production and identities in practice as part of my framework, I analyzed group and individual performances through classroom observations, student interviews, and teacher reflections to better understand the meaning students made of their experiences with engineering. Findings from the study included the ways in which creativity was culturally produced in the classroom to include: 1) idea generation; 2) design and innovation; 3) gumption/resourcefulness; and 4) social value. Opportunities for collaboration increased through each stage of the unit culminating with the design challenge

  1. An Engineering Research Program for High School Science Teachers: Year Two Changes and Results

    Science.gov (United States)

    DeJong, Brian P.; Yelamarthi, Kumar; Kaya, Tolga

    2016-01-01

    The research experiences for teachers program at Central Michigan University was initiated to team in-service and pre-service teachers with undergraduate engineering students and engineering faculty, in an engineering research setting. During the six-week program, teachers learn engineering concepts and develop high-school instructional material…

  2. Educational laboratory experiments on chemistry in a nuclear engineering school

    International Nuclear Information System (INIS)

    Akatsu, E.

    1982-01-01

    An educational laboratory experiment on radiochemistry was investigated by students in the general course of the Nuclear Engineering School of Japan Atomic Energy Research Institute. Most of them are not chemical engineers, but electrical and mechanical engineers. Therefore, the educational experiment was designed for them by introducing a ''word experiment'' in the initial stage and by reducing the chemical procedure as far as possible. It began with calculations on a simple solvent extraction process-the ''word experiment''--followed by the chemical separation of 144 Pr from 144 Ce with tri-n-butyl phosphate in a nitric acid system and then measurement of the radioactive decay and growth of the separated 144 Pr and 144 Ce, respectively. The chemical procedure was explained by the phenomenon but not by the mechanism of chelation. Most students thought the experiment was an exercise in solvent extraction or radiochemical separation rather than a radioactive equilibrium experiment. However, a pure chemist considered it as a sort of physical experiment, where the chemical procedure was used only for preparation of measuring samples. Another experiment, where 137 Cs was measured after isolation with ammonium phosphomolybdate, was also investigated. The experiment eliminated the need for students who were not chemists to know how to use radioactive tracers. These students appreciated the realization that they could understand the radioactivity in the environmental samples in a chemical frame of reference even though they were not chemists

  3. Accreditation of Spanish engineering programs, first experiences. The case of the Terrassa School of Engineering

    Directory of Open Access Journals (Sweden)

    Mª Dolores Álvarez

    2016-03-01

    Full Text Available The implementation of the European Space for Higher Education has entailed new requirements for Spanish Higher Education Programs. Regulations (RD 1393, 2007 stablish that university programs, in order to have official validity, must be submitted to an external evaluation process before their official implementation, denominated Validation, and to an ex-post process or Accreditation. Terrassa School of Engineering (EET was one of the first schools in Spain to adapt to the European Space for Higher Education, in the academic period 2009-10 and then, one of the first university institutions submitted to an accreditation process. In this communication, the important role of the Internal Quality Assurance System in the assessment of the school’s programs is exposed as well as the approach followed in the key steps of the process: Accreditation

  4. 78 FR 64016 - Importer of Controlled Substances; Notice of Registration; Watson Pharma, Inc.

    Science.gov (United States)

    2013-10-25

    ... Registration; Watson Pharma, Inc. By Notice dated May 24, 2013, and published in the Federal Register on June 4, 2013, 78 FR 33440, Watson Pharma, Inc., 2455 Wardlow Road, Corona, California 92880-2882, made... in 21 U.S.C. 823(a) and 952(a) and determined that the registration of Watson Pharma, Inc., to import...

  5. 78 FR 17231 - Importer of Controlled Substances, Notice of Registration, Watson Pharma, Inc.

    Science.gov (United States)

    2013-03-20

    ... Registration, Watson Pharma, Inc. By Notice dated November 5, 2012, and published in the Federal Register on November 13, 2012, 77 FR 67675, Watson Pharma, Inc., 2455 Wardlow Road, Corona, California 92880-2882, made.... 823(a) and Sec. 952(a) and determined that the registration of Watson Pharma, Inc., to import the...

  6. [From humanism to nihilism: dialectics on Jean Watson's caring theory].

    Science.gov (United States)

    Krol, Pawel J; Lavoie, Mireille

    2015-09-01

    nursing today is heir to values that have developed over many years. In addition to the values of human care, present-day nursing embraces values that shape our modern world. This dialectical study first traces the evolution of a number of the traditional values associated with human care that nursing has retained. It goes on to show how some of the values of human care have been cast aside in favour of modern--neoliberal, technocratic and bureaucratic--values which have in turn given rise to disturbing problems of instrumentalization. Watson's theory of caring proposes two ways to remedy such instrumentalization: espousing a transcendental, metaphysical mode of thought and adopting an altruistic humanism. However, many critics have questioned the theoretical consistency and very legitimacy of the theory as a means of dealing with instrumentalization. this study analyses Watson's proposals, using a Nietzschean dialectic approach to test them and to suggest possible solutions. Significant problems in terms of both consistency and relevance are brought to light, tending to refute Watson's notions. the study findings suggest that the application of Watson's theory may paradoxically perpetuate dualism and nihilism and, rather than curb their invasive impact, lead inevitably to a conversion to instrumental values. it's suggested an alternative, ethics-of-life approach based on the synthesis of our dialectics that would foster a return to, and respect for, humanity's essential nature.

  7. Jokulhlaups and sediment transport in Watson River, Kangerlussuaq, West Greenland

    DEFF Research Database (Denmark)

    Mikkelsen, A. B.; Hasholt, Bent; Knudsen, N. T.

    2013-01-01

    For 3 years, during a 4-year observation period (2007-2010), jokulhlaups were observed from a lake at the northern margin of Russells Gletscher. At a gauging station located on a bedrock sill near the outlet of Watson River into Sdr Stromfjord, discharge and sediment transport was monitored during...

  8. Watson-Crick hydrogen bonding of unlocked nucleic acids

    DEFF Research Database (Denmark)

    Langkjær, Niels; Wengel, Jesper; Pasternak, Anna

    2015-01-01

    We herein describe the synthesis of two new unlocked nucleic acid building blocks containing hypoxanthine and 2,6-diaminopurine as nucleobase moieties and their incorporation into oligonucleotides. The modified oligonucleotides were used to examine the thermodynamic properties of UNA against unmo...... unmodified oligonucleotides and the resulting thermodynamic data support that the hydrogen bonding face of UNA is Watson-Crick like....

  9. Relativistic generalisation of the Kroll-Watson formula

    International Nuclear Information System (INIS)

    Kaminski, J.Z.

    1985-01-01

    The relativistic analogue of the space-translation method is derived. Using this method the generalisation of the Kroll-Watson formula [1973, Phys. Rev. A. 8 804] is obtained for the scattering of an arbitrary charged particle (e.g. mesons, hyperons, quarks, etc). The separation of the background and resonant parts of the scattering amplitude is predicted. (author)

  10. Little Albert's alleged neurological impairment: Watson, Rayner, and historical revision.

    Science.gov (United States)

    Digdon, Nancy; Powell, Russell A; Harris, Ben

    2014-11-01

    In 2012, Fridlund, Beck, Goldie, and Irons (2012) announced that "Little Albert"-the infant that Watson and Rayner used in their 1920 study of conditioned fear (Watson & Rayner, 1920)-was not the healthy child the researchers described him to be, but was neurologically impaired almost from birth. Fridlund et al. also alleged that Watson had committed serious ethical breaches in regard to this research. Our article reexamines the evidentiary bases for these claims and arrives at an alternative interpretation of Albert as a normal infant. In order to set the stage for our interpretation, we first briefly describe the historical context for the Albert study, as well as how the study has been construed and revised since 1920. We then discuss the evidentiary issues in some detail, focusing on Fridlund et al.'s analysis of the film footage of Albert, and on the context within which Watson and Rayner conducted their study. In closing, we return to historical matters to speculate about why historiographical disputes matter and what the story of neurologically impaired Albert might be telling us about the discipline of psychology today.

  11. Chuck Watson's ``differential psychoacoustics:'' Individual differences in auditory abilities

    Science.gov (United States)

    Kidd, Gary R.

    2004-05-01

    Chuck Watson was among the first in the psychoacoustic community to seriously address the topic of individual differences. At a time when there was little concern with variation among ``normal listeners'' in psychoacoustic research, Watson began a research program to document the range of human auditory abilities. The primary goals were to determine the number of distinct abilities, to specify the nature of each ability, and to document the distribution of these abilities in the general population. Thanks to Watson's talent for organizing and directing large-scale projects and his workmanlike approach to science, a large and valuable body of data on human individual differences has been collected. The research program began about 20 years ago with the study of basic auditory abilities, and it has expanded to include other modalities and cognitive/intellectual abilities in adults and children. A somewhat biased view of the importance of this work will be presented by one of Watson's many colleagues in this endeavor. The talk will provide an overview of this ongoing research program as well as a brief review of some related research by other investigators. New findings from recent extensions of this work will also be discussed.

  12. Elementary? Question Answering, IBM's Watson, and the Jeopardy ...

    Indian Academy of Sciences (India)

    IAS Admin

    One of the most readable accounts of early AI systems, including. NLP systems, may be .... tions of these questions to annotations of information segments in ..... Watson as a decision-aide rather than as a decision-maker will be a safe step ...

  13. Chinese engineering students' cross-cultural adaptation in graduate school

    Science.gov (United States)

    Jiang, Xinquan

    This study explores cross-cultural adaptation experience of Chinese engineering students in the U.S. I interact with 10 Chinese doctoral students in engineering from a public research university through in-depth interviews to describe (1) their perceptions of and responses to key challenges they encountered in graduate school, (2) their perspectives on the challenges that stem from cross-cultural differences, and (3) their conceptualization of cross-cultural adaptation in the context of graduate school. My findings reveal that the major challenges participants encounter during graduate school are academic issues related to cultural differences and difficulties of crossing cultural boundaries and integrating into the university community. These challenges include finding motivation for doctoral study, becoming an independent learner, building a close relationship with faculty, interacting and forming relationships with American people, and gaining social recognition and support. The engineering students in this study believe they are less successful in their social integration than they are in accomplishing academic goals, mainly because of their preoccupation with academics, language barriers and cultural differences. The presence of a large Chinese student community on campus has provided a sense of community and social support for these students, but it also contributes to diminishing their willingness and opportunities to interact with people of different cultural backgrounds. Depending on their needs and purposes, they have different insights into the meaning of cross-cultural adaptation and therefore, and choose different paths to establish themselves in a new environment. Overall, they agree that cross-cultural adaptation involves a process of re-establishing themselves in new academic, social, and cultural communities, and adaptation is necessary for their personal and professional advancement in the U.S. They also acknowledge that encountering and adjusting

  14. First Year Experiences in School of Mechanical Engineering Kanazawa University

    Science.gov (United States)

    Kinari, Toshiyasu; Kanjin, Yuichi; Furuhata, Toru; Tada, Yukio

    This paper reports two lectures of the first year experience, ‧Lecture on Life in Campus and Society‧ and ‧Freshman Seminar‧ and discusses their effects. Both lectures have been given freshmen of the school of mechanical engineering, Kanazawa University in H20 spring term. The former lecture is aimed at freshmen to keep on a proper way in both social and college life. It consists of normal class and e-learning system lectures. E-learning system examination requires students to review the whole text book and that seems to have brought better results in the survey. The latter seminar is aimed at freshmen to get active and self-disciplined learning way through their investigation, discussion, presentation, writing work, and so on.

  15. Genetic Engineering: A Matter that Requires Further Refinement in Spanish Secondary School Textbooks

    Science.gov (United States)

    Martinez-Gracia, M. V.; Gil-Quylez, M. J.; Osada, J.

    2003-01-01

    Genetic engineering is now an integral part of many high school textbooks but little work has been done to assess whether it is being properly addressed. A checklist with 19 items was used to analyze how genetic engineering is presented in biology textbooks commonly used in Spanish high schools, including the content, its relationship with…

  16. Australian Enrolment Trends in Technology and Engineering: Putting the T and E Back into School STEM

    Science.gov (United States)

    Kennedy, JohnPaul; Quinn, Frances; Lyons, Terry

    2018-01-01

    There has been much political and educational focus on Science, Technology, Engineering and Mathematics (STEM) in Australian schools in recent years and while there has been significant research examining science and mathematics enrolments in senior high school, little is known about the corresponding trends in Technologies and engineering.…

  17. How a low-fidelity DNA polymerase chooses non-Watson-Crick from Watson-Crick incorporation.

    Science.gov (United States)

    Wu, Wen-Jin; Su, Mei-I; Wu, Jian-Li; Kumar, Sandeep; Lim, Liang-Hin; Wang, Chun-Wei Eric; Nelissen, Frank H T; Chen, Ming-Chuan Chad; Doreleijers, Jurgen F; Wijmenga, Sybren S; Tsai, Ming-Daw

    2014-04-02

    A dogma for DNA polymerase catalysis is that the enzyme binds DNA first, followed by MgdNTP. This mechanism contributes to the selection of correct dNTP by Watson-Crick base pairing, but it cannot explain how low-fidelity DNA polymerases overcome Watson-Crick base pairing to catalyze non-Watson-Crick dNTP incorporation. DNA polymerase X from the deadly African swine fever virus (Pol X) is a half-sized repair polymerase that catalyzes efficient dG:dGTP incorporation in addition to correct repair. Here we report the use of solution structures of Pol X in the free, binary (Pol X:MgdGTP), and ternary (Pol X:DNA:MgdGTP with dG:dGTP non-Watson-Crick pairing) forms, along with functional analyses, to show that Pol X uses multiple unprecedented strategies to achieve the mutagenic dG:dGTP incorporation. Unlike high fidelity polymerases, Pol X can prebind purine MgdNTP tightly and undergo a specific conformational change in the absence of DNA. The prebound MgdGTP assumes an unusual syn conformation stabilized by partial ring stacking with His115. Upon binding of a gapped DNA, also with a unique mechanism involving primarily helix αE, the prebound syn-dGTP forms a Hoogsteen base pair with the template anti-dG. Interestingly, while Pol X prebinds MgdCTP weakly, the correct dG:dCTP ternary complex is readily formed in the presence of DNA. H115A mutation disrupted MgdGTP binding and dG:dGTP ternary complex formation but not dG:dCTP ternary complex formation. The results demonstrate the first solution structural view of DNA polymerase catalysis, a unique DNA binding mode, and a novel mechanism for non-Watson-Crick incorporation by a low-fidelity DNA polymerase.

  18. Gender Differences in the Consistency of Middle School Students’ Interest in Engineering and Science Careers

    OpenAIRE

    Ing, Marsha; Aschbacher, Pamela R; Tsai, Sherry M

    2014-01-01

    This longitudinal study analyzes survey responses in seventh, eighth, and ninth grade from diverse public school students (n = 482) to explore gender differences in engineering and science career preferences. Females were far more likely to express interest in a science career (31%) than an engineering career (13%), while the reverse was true for males (58% in engineering, 39% in science). After controlling for student and school demographic characteristics, females were as consistent as male...

  19. A Project-Based Engineering and Leadership Workshop for High School Students

    Science.gov (United States)

    Ryder, Linda Sue; Pegg, Jerine; Wood, Nathan

    2012-01-01

    Summer outreach programs provide pre-college participants an introduction to college life and exposure to engineering in an effort to raise the level of interest and bring more students into engineering fields. The Junior Engineering, Mathematics, and Science (JEMS) program is a project-based summer workshop in which teams of high school students…

  20. Engaging High School and Engineering Students: A Multifaceted Outreach Program Based on a Mechatronics Platform

    Science.gov (United States)

    Habash, Riadh W. Y.; Suurtamm, Christine

    2010-01-01

    If we aim to enhance the interest of students in engineering and therefore produce the best engineers, it is essential to strengthen the pipeline to high school education. This paper discusses several outreach activities undertaken by the Faculty of Engineering and Faculty of Education, University of Ottawa (UO), Ottawa, ON, Canada, to help the…

  1. Some Econometric Results for the Blanchard-Watson Bubble Model

    DEFF Research Database (Denmark)

    Johansen, Soren; Lange, Theis

    The purpose of the present paper is to analyse a simple bubble model suggested by Blanchard and Watson. The model is defined by y(t) =s(t)¿y(t-1)+e(t), t=1,…,n, where s(t) is an i.i.d. binary variable with p=P(s(t)=1), independent of e(t) i.i.d. with mean zero and finite variance. We take ¿>1 so...

  2. Watson, Skinner y Algunas Disputas dentro del Conductismo

    Directory of Open Access Journals (Sweden)

    RICARDO PELLÓN SUÁREZ DE PUGA

    2013-01-01

    Full Text Available Con motivo del primer centenario de la publicación del manifiesto conductista, se revisa brevemente la concepción de Watson (1913 sobre el aprendizaje y la conducta, y se extiende dicho análisis al conductismo de B. F. Skinner y a las disputas entre enfoques molares y moleculares en el análisis de la conducta.

  3. Effects of Engineering Design-Based Science on Elementary School Science Students' Engineering Identity Development across Gender and Grade

    Science.gov (United States)

    Capobianco, Brenda M.; Yu, Ji H.; French, Brian F.

    2015-04-01

    The integration of engineering concepts and practices into elementary science education has become an emerging concern for science educators and practitioners, alike. Moreover, how children, specifically preadolescents (grades 1-5), engage in engineering design-based learning activities may help science educators and researchers learn more about children's earliest identification with engineering. The purpose of this study was to examine the extent to which engineering identity differed among preadolescents across gender and grade, when exposing students to engineering design-based science learning activities. Five hundred fifty preadolescent participants completed the Engineering Identity Development Scale (EIDS), a recently developed measure with validity evidence that characterizes children's conceptions of engineering and potential career aspirations. Data analyses of variance among four factors (i.e., gender, grade, and group) indicated that elementary school students who engaged in the engineering design-based science learning activities demonstrated greater improvements on the EIDS subscales compared to those in the comparison group. Specifically, students in the lower grade levels showed substantial increases, while students in the higher grade levels showed decreases. Girls, regardless of grade level and participation in the engineering learning activities, showed higher scores in the academic subscale compared to boys. These findings suggest that the integration of engineering practices in the science classroom as early as grade one shows potential in fostering and sustaining student interest, participation, and self-concept in engineering and science.

  4. Influence of Science, Technology, and Engineering Curriculum on Rural Midwestern High School Student Career Decisions

    Science.gov (United States)

    Killingsworth, John

    Low degree completion in technical and engineering degrees is a growing concern for policymakers and educators in the United States. This study was an examination of the behaviors of adolescents specific to career decisions related to technology and engineering. The central research question for this study was: do rural, Midwestern high school technical and engineering curricula serve to engage students sufficiently to encourage them to persist through high school while sustaining their interests in technology and engineering careers? Engaging students in technology and engineering fields is the challenge for educators throughout the country and the Midwest. Rural schools have the additional challenge of meeting those issues because of resource limitations. Students in three Midwestern schools were surveyed to determine the level of interest in technology and engineering. The generalized likelihood ratio test was used to overcome concerns for small sample sizes. Accounting for dependent variables, multiple independent variables are examined using descriptive statistics to determine which have greater influence on career decisions, specifically those related to technology and engineering. A typical science curriculum is defined for rural Midwestern high schools. This study concludes that such curriculum achieves the goal of maintaining or increasing student interest and engagement in STEM careers. Furthermore, those schools that incorporate contextual and experiential learning activities into the curriculum demonstrate increased results in influencing student career choices toward technology and engineering careers. Implications for parents, educators, and industry professionals are discussed.

  5. The Influence of Toy Design Activities on Middle School Students' Understanding of the Engineering Design Processes

    Science.gov (United States)

    Zhou, Ninger; Pereira, Nielsen L.; George, Tarun Thomas; Alperovich, Jeffrey; Booth, Joran; Chandrasegaran, Senthil; Tew, Jeffrey David; Kulkarni, Devadatta M.; Ramani, Karthik

    2017-10-01

    The societal demand for inspiring and engaging science, technology, engineering, and mathematics (STEM) students and preparing our workforce for the emerging creative economy has necessitated developing students' self-efficacy and understanding of engineering design processes from as early as elementary school levels. Hands-on engineering design activities have shown the potential to promote middle school students' self-efficacy and understanding of engineering design processes. However, traditional classrooms often lack hands-on engineering design experiences, leaving students unprepared to solve real-world design problems. In this study, we introduce the framework of a toy design workshop and investigate the influence of the workshop activities on students' understanding of and self-efficacy beliefs in engineering design. Using a mixed method approach, we conducted quantitative analyses to show changes in students' engineering design self-efficacy and qualitative analyses to identify students' understanding of the engineering design processes. Findings show that among the 24 participants, there is a significant increase in students' self-efficacy beliefs after attending the workshop. We also identified major themes such as design goals and prototyping in students' understanding of engineering design processes. This research provides insights into the key elements of middle school students' engineering design learning and the benefits of engaging middle school students in hands-on toy design workshops.

  6. Capturing student mathematical engagement through differently enacted classroom practices: applying a modification of Watson's analytical tool

    Science.gov (United States)

    Patahuddin, Sitti Maesuri; Puteri, Indira; Lowrie, Tom; Logan, Tracy; Rika, Baiq

    2018-04-01

    This study examined student mathematical engagement through the intended and enacted lessons taught by two teachers in two different middle schools in Indonesia. The intended lesson was developed using the ELPSA learning design to promote mathematical engagement. Based on the premise that students will react to the mathematical tasks in the forms of words and actions, the analysis focused on identifying the types of mathematical engagement promoted through the intended lesson and performed by students during the lesson. Using modified Watson's analytical tool (2007), students' engagement was captured from what the participants' did or said mathematically. We found that teachers' enacted practices had an influence on student mathematical engagement. The teacher who demonstrated content in explicit ways tended to limit the richness of the engagement; whereas the teacher who presented activities in an open-ended manner fostered engagement.

  7. How the challenge of explaining learning influenced the origins and development of John B. Watson's behaviorism.

    Science.gov (United States)

    Rilling, M

    2000-01-01

    Before he invented behaviorism, John B. Watson considered learning one of the most important topics in psychology. Watson conducted excellent empirical research on animal learning. He developed behaviorism in part to promote research and elevate the status of learning in psychology. Watson was much less successful in the adequacy and originality of the mechanisms he proposed to explain learning. By assimilating the method of classical conditioning and adopting Pavlov's theory of stimulus substitution, Watson linked behaviorism with a new method that could compete with both Titchener's method of introspection and Freud's methods of psychoanalysis. Watson's interest in explaining psychopathology led to the discovery of conditioned emotional responses and a behavioristic explanation for the learning of phobic behavior. Watson established learning as a central topic for basic research and application in American psychology.

  8. Recruiting Future Engineers Through Effective Guest Speaking In Elementary School Classrooms

    Energy Technology Data Exchange (ETDEWEB)

    Kevin Young

    2007-11-01

    In this paper, the author describes how engineers can increase the number of future engineers by volunteering as guest speakers in the elementary school classroom. The paper is divided into three main subjects. First, the importance of engineers speaking directly with young students is discussed. Next, several best practice techniques for speaking with young students are described. Finally, information on getting started as a guest speaker is presented, and a list of resources available to guest speakers is provided. The guest engineer speaking to an elementary school audience (ages 6-11) performs a critical role in encouraging young students to pursue a career in engineering. Often, he or she is the first engineer these students meet in person, providing a crucial first impression of the engineering career field and a positive visual image of what an engineer really looks like. A dynamic speaker presenting a well-delivered talk creates a lasting, positive impression on students, influencing their future decisions to pursue careers in engineering. By reaching these students early in life, the guest speaker will help dispel the many prevailing stereotypes about engineers which discourage so many students, especially young women, from considering this career. The guest speaker can ensure young students gain a positive first impression of engineers and the engineering career field by following some best practice techniques in preparing for and delivering their presentation. The author, an electrical engineer, developed these best practice techniques over the past 10 years while presenting over 350 talks on engineering subjects to elementary school students as a volunteer speaker with the U.S. Department of Energy, Idaho National Laboratory’s Speakers Bureau. Every engineer can make a meaningful contribution toward reversing the predicted shortfall of future engineers by volunteering to speak with young students at the elementary school level. Elementary school

  9. A Multidisciplinary Engineering Summer School in an Industrial Setting

    DEFF Research Database (Denmark)

    Larsen, Peter Gorm; Fernandes, Joao M.; Habel, Jacek

    2009-01-01

    are capable of collaborating across disciplinary boundaries and exhibit soft competencies, like communication, interpersonal and social skills, time planning, creativity, initiative, and reflection. To prepare a group of engineering and industrial design students to acquire those capabilities......Most university-level engineering studies produce technically skilled engineers. However, typically students face several difficulties when working in multidisciplinary teams when they initiate their industrial careers. In a globalised world, it becomes increasingly important that engineers...

  10. High School Engineering and Technology Education Integration through Design Challenges

    Science.gov (United States)

    Mentzer, Nathan

    2011-01-01

    This study contextualized the use of the engineering design process by providing descriptions of how each element in a design process was integrated in an eleventh grade industry and engineering systems course. The guiding research question for this inquiry was: How do students engage in the engineering design process in a course where technology…

  11. A Multidisciplinary Engineering Summer School in an Industrial Setting

    Science.gov (United States)

    Larsen, Peter Gorm; Fernandes, Joao M.; Habel, Jacek; Lehrskov, Hanne; Vos, Richard J. C.; Wallington, Oliver; Zidek, Jan

    2009-01-01

    Most university-level engineering studies produce technically skilled engineers. However, typically students face several difficulties when working in multidisciplinary teams when they initiate their industrial careers. In a globalised world, it becomes increasingly important that engineers are capable of collaborating across disciplinary…

  12. Analyzing the Function of Cartilage Replacements: A Laboratory Activity to Teach High School Students Chemical and Tissue Engineering Concepts

    Science.gov (United States)

    Renner, Julie N.; Emady, Heather N.; Galas, Richards J., Jr.; Zhange, Rong; Baertsch, Chelsey D.; Liu, Julie C.

    2013-01-01

    A cartilage tissue engineering laboratory activity was developed as part of the Exciting Discoveries for Girls in Engineering (EDGE) Summer Camp sponsored by the Women In Engineering Program (WIEP) at Purdue University. Our goal was to increase awareness of chemical engineering and tissue engineering in female high school students through a…

  13. Math, Science, and Engineering Integration in a High School Engineering Course: A Qualitative Study

    Science.gov (United States)

    Valtorta, Clara G.; Berland, Leema K.

    2015-01-01

    Engineering in K-12 classrooms has been receiving expanding emphasis in the United States. The integration of science, mathematics, and engineering is a benefit and goal of K-12 engineering; however, current empirical research on the efficacy of K-12 science, mathematics, and engineering integration is limited. This study adds to this growing…

  14. Integration of Engineering Education by High School Teachers to Meet Standards in the Physics Classroom

    Science.gov (United States)

    Kersten, Jennifer Anna

    In recent years there has been increasing interest in engineering education at the K-12 level, which has resulted in states adopting engineering standards as a part of their academic science standards. From a national perspective, the basis for research into engineering education at the K-12 level is the belief that it is of benefit to student learning, including to "improve student learning and achievement in science and mathematics; increase awareness of engineering and the work of engineers; boost youth interest in pursuing engineering as a career; and increase the technological literacy of all students" (National Research Council, 2009a, p. 1). The above has led to a need to understand how teachers are currently implementing engineering education in their classrooms. High school physics teachers have a history of implementing engineering design projects in their classrooms, thus providing an appropriate setting to look for evidence of quality engineering education at the high school level. Understanding the characteristics of quality engineering integration can inform curricular and professional development efforts for teachers asked to implement engineering in their classrooms. Thus, the question that guided this study is: How, and to what extent, do physics teachers represent quality engineering in a physics unit focused on engineering? A case study research design was implemented for this project. Three high school physics teachers were participants in this study focused on the integration of engineering education into the physics classroom. The data collected included observations, interviews, and classroom documents that were analyzed using the Framework for Quality K-12 Engineering Education (Moore, Glancy et al., 2013). The results provided information about the areas of the K-12 engineering framework addressed during these engineering design projects, and detailed the quality of these lesson components. The results indicate that all of the design

  15. Watson: A new link in the IIE iron chain

    Science.gov (United States)

    Olsen, Edward; Davis, Andrew; Clarke, Roy S., Jr.; Schultz, Ludolf; Weber, Hartwig W.; Clayton, Robert; Mayeda, Toshiko; Jarosewich, Eugene; Sylvester, Paul; Grossman, Lawrence

    1994-01-01

    Watson, which was found in 1972 in South Australia, contains the largest single silicate rock mass seen in any known iron meteorite. A comprehensive study has been completed on this unusual meteorite: petrography, metallography, analyses of the silicate inclusion (whole rock chemical analysis, INAA, RNAA, noble gases, and oxygen isotope analysis) and mineral compositions (by electron microprobe and ion microprobe). The whole rock has a composition of an H-chondrite minus the normal H-group metal and troilite content. The oxygen isotope composition is that of the silicates in the IIE iron meteorites and lies along an oxygen isotope fractionation line with the H-group chondrites. Trace elements in the metal confirm Watson is a new IIE iron. Whole rock Watson silicate shows an enrichment in K and P (each approximately 2X H-chondrites). The silicate inclusion has a highly equilibrated igneous (peridotite-like) texture with olivine largely poikilitic within low-Ca pyroxene: olivine (Fa20), opx (Fs17Wo3), capx (Fs9Wo14)(with very fine exsolution lamellae), antiperthite feldspar (An1-3Or5) with less than 1 micron exsolution lamellae (An1-3Or greater than 40), shocked feldspar with altered stoichiometry, minor whitlockite (also a poorly characterized interstitial phosphate-rich phase) and chromite, and only traces of metal and troilite. The individual silicate minerals have normal chondritic REE patterns, but whitlockite has a remarkable REE pattern. It is very enriched in light REE (La is 720X C1, and Lu is 90X C1, as opposed to usual chonditic values of approximately 300X and 100-150X, respectively) with a negative Eu anomaly. The enrichment of whole rock K is expressed both in an unusually high mean modal Or content of the feldspar, Or13, and in the presence of antiperthite.

  16. IBM Watson Analytics: Automating Visualization, Descriptive, and Predictive Statistics.

    Science.gov (United States)

    Hoyt, Robert Eugene; Snider, Dallas; Thompson, Carla; Mantravadi, Sarita

    2016-10-11

    We live in an era of explosive data generation that will continue to grow and involve all industries. One of the results of this explosion is the need for newer and more efficient data analytics procedures. Traditionally, data analytics required a substantial background in statistics and computer science. In 2015, International Business Machines Corporation (IBM) released the IBM Watson Analytics (IBMWA) software that delivered advanced statistical procedures based on the Statistical Package for the Social Sciences (SPSS). The latest entry of Watson Analytics into the field of analytical software products provides users with enhanced functions that are not available in many existing programs. For example, Watson Analytics automatically analyzes datasets, examines data quality, and determines the optimal statistical approach. Users can request exploratory, predictive, and visual analytics. Using natural language processing (NLP), users are able to submit additional questions for analyses in a quick response format. This analytical package is available free to academic institutions (faculty and students) that plan to use the tools for noncommercial purposes. To report the features of IBMWA and discuss how this software subjectively and objectively compares to other data mining programs. The salient features of the IBMWA program were examined and compared with other common analytical platforms, using validated health datasets. Using a validated dataset, IBMWA delivered similar predictions compared with several commercial and open source data mining software applications. The visual analytics generated by IBMWA were similar to results from programs such as Microsoft Excel and Tableau Software. In addition, assistance with data preprocessing and data exploration was an inherent component of the IBMWA application. Sensitivity and specificity were not included in the IBMWA predictive analytics results, nor were odds ratios, confidence intervals, or a confusion matrix

  17. Engineering-Based Problem Solving in the Middle School: Design and Construction with Simple Machines

    Science.gov (United States)

    English, Lyn D.; Hudson, Peter; Dawes, Les

    2013-01-01

    Incorporating engineering concepts into middle school curriculum is seen as an effective way to improve students' problem-solving skills. A selection of findings is reported from a science, technology, engineering and mathematics (STEM)-based unit in which students in the second year (grade 8) of a three-year longitudinal study explored…

  18. Gender Differences in the Consistency of Middle School Students' Interest in Engineering and Science Careers

    Science.gov (United States)

    Ing, Marsha; Aschbacher, Pamela R.; Tsai, Sherry M.

    2014-01-01

    This longitudinal study analyzes survey responses in seventh, eighth, and ninth grade from diverse public school students (n = 482) to explore gender differences in engineering and science career preferences. Females were far more likely to express interest in a science career (31%) than an engineering career (13%), while the reverse was true for…

  19. Engineering Design Challenges in High School STEM Courses: A Compilation of Invited Position Papers

    Science.gov (United States)

    Householder, Daniel L., Ed.

    2011-01-01

    Since its initial funding by the National Science Foundation in 2004, the National Center for Engineering and Technology Education (NCETE) has worked to understand the infusion of engineering design experiences into the high school setting. Over the years, an increasing number of educators and professional groups have participated in the expanding…

  20. Engineering for Sustainable Energy Education within Suburban, Urban and Developing Secondary Schools

    Science.gov (United States)

    Kaikai, Moijue; Baker, Erin

    2016-01-01

    It is crucial that the younger generation be included in the conversation of sustainable development, given the urgent need of a global transition to cleaner energy solutions. Sustainable energy engineering (SEE) taught as early as secondary school can not only increase the number of students that will potentially study engineering to solve global…

  1. Building Watson: An Overview of the DeepQA Project

    OpenAIRE

    Ferrucci, David; Brown, Eric; Chu-Carroll, Jennifer; Fan, James; Gondek, David; Kalyanpur, Aditya A.; Lally, Adam; Murdock, J. William; Nyberg, Eric; Prager, John; Schlaefer, Nico; Welty, Chris

    2010-01-01

    IBM Research undertook a challenge to build a computer system that could compete at the human champion level in real time on the American TV Quiz show, Jeopardy! The extent of the challenge includes fielding a real-time automatic contestant on the show, not merely a laboratory exercise. The Jeopardy! Challenge helped us address requirements that led to the design of the DeepQA architecture and the implementation of Watson. After 3 years of intense research and development by a core team of ab...

  2. Impact parameter representation from the Watson-Sommerfeld transform

    International Nuclear Information System (INIS)

    Islam, M.M.

    1976-01-01

    Using the Watson-Sommerfeld transform the elastic scattering amplitude of two spinless particles is shown to have an exact and unique impact parameter, or Fourier-Bessel (FB) representation. The representation is valid for all physical energies and scattering angles. Wallace's recent work is found to be an asymptotic expansion of the FB amplitude obtained from the partial-wave expansion. The way singularities of the partial-wave amplitude in the l-plane enter in the FB amplitude is also explicitly shown. (Auth.)

  3. "Elementary, my dear Watson". Per una falsa citazione

    Directory of Open Access Journals (Sweden)

    Irene Minella

    2014-12-01

    Full Text Available Nowhere, among Sir Arthur Conan Doyle's pages concerning one of the most celebrated characters of British literature, Sherlock Holmes, is to be found the interjection: "Elementary, my dear Watson!". Exploring the creation of the London investigator as well as Holmes' first appearance in theatre, cinema and literature, this essay will help to understand why he is still so popular and why the 'non-quotation' keeps haunting the collective imagination. Despite its philological inaccuracy, the interjection has become so famous that it has been used even outside its original context.

  4. Effect of Middle School Students' Motivation to Learn Technology on Their Attitudes toward Engineering

    Science.gov (United States)

    Kwon, Hyuksoo

    2016-01-01

    The purpose of this study was to investigate the effect of motivation to learn technology, as perceived by South Korean middle school students, on their attitudes toward engineering. Using the instruments of Glynn et al. (2011) and Lee (2008), the study focused on eighth and ninth grade students in four middle schools located in South Korea's…

  5. Implementation of a Project-Based Engineering School: Increasing Student Motivation and Relevant Learning

    Science.gov (United States)

    Terrón-López, María-José; García-García, María-José; Velasco-Quintana, Paloma-Julia; Ocampo, Jared; Vigil Montaño, María-Reyes; Gaya-López, María-Cruz

    2017-01-01

    The School of Engineering at Universidad Europea de Madrid (UEM) implemented, starting in the 2012-2013 period, a unified academic model based on project-based learning as the methodology used throughout the entire School. This model expects that every year, in each grade, all the students should participate in a capstone project integrating the…

  6. Challenges and Opportunities: Building a Relationship Between a Department of Biomedical Engineering and a Medical School.

    Science.gov (United States)

    George, Steven C; Meyerand, M Elizabeth

    2017-03-01

    A department of biomedical engineering can significantly enhance the impact of their research and training programs if a productive relationship with a medical school can be established. In order to develop such a relationship, significant hurdles must be overcome. This editorial summarizes some of the major challenges and opportunities for a department of biomedical engineering as they seek to build or enhance a relationship with a medical school. The ideas were formulated by engaging the collective wisdom from the Council of Chairs of the biomedical engineering departments.

  7. Portrait of a discovery. Watson, Crick, and the double helix.

    Science.gov (United States)

    de Chadarevian, Soraya

    2003-03-01

    This essay examines an iconic image of twentieth-century science: Antony Barrington Brown's photograph of James Watson, Francis Crick, and the double-helical model of DNA. The detailed reconstruction of the production, reception, and uses of the photograph reveals the central role of the image in making the discovery it portrays. Taken in May 1953, two full months after the scientists built the model, to accompany a report on the structure in Time magazine, the photograph (like the report) was never published. It came into circulation only fifteen years later, as an illustration in Watson's best-selling book The Double Helix. While the image served as a historical document and advertisement for the book, only the book provided the description that made the image as well as the people and the model it represented famous. The history of the image provides insights into the retrospective construction of the discovery, which has since been celebrated as the origin of a new science of life.

  8. [Under what conditions does G.C Watson-Crick DNA base pair acquire all four configurations characteristic for A.T Watson-Crick DNA base pair?].

    Science.gov (United States)

    Brovarets', O O

    2013-01-01

    At the MP2/6-311++G(2df,pd)//B3LYP/6-311++G(d,p) level of theory it was established for the first time, that the Löwdin's G*.C* DNA base pair formed by the mutagenic tautomers can acquire, as the A-T Watson-Crick DNA base pair, four biologically important configurations, namely: Watson-Crick, reverse Watson-Crick, Hoogsteen and reverse Hoogsteen. This fact demonstrates rather unexpected role of the tautomerisation of the one of the Watson-Crick DNA base pairs, in particular, via double proton transfer: exactly the G.C-->G*.C* tautomerisation allows to overcome steric hindrances for the implementation of the above mentioned configurations. Geometric, electron-topological and energetic properties of the H-bonds that stabilise the studied pairs, as well as the energetic characteristics of the latters are presented.

  9. 77 FR 67675 - Importer of Controlled Substances; Notice of Application; Watson Pharma, Inc.

    Science.gov (United States)

    2012-11-13

    ... DEPARTMENT OF JUSTICE Drug Enforcement Administration Importer of Controlled Substances; Notice of Application; Watson Pharma, Inc. Pursuant to Title 21 Code of Federal Regulations 1301.34(a), this is notice that on August 28, 2012, Watson Pharma, Inc., 2455 Wardlow Road, Corona, California 92880-2882, made...

  10. 78 FR 33440 - Importer of Controlled Substances, Notice of Application; Watson Pharma, Inc.

    Science.gov (United States)

    2013-06-04

    ... DEPARTMENT OF JUSTICE Drug Enforcement Administration Importer of Controlled Substances, Notice of Application; Watson Pharma, Inc. Pursuant to Title 21 Code of Federal Regulations 1301.34 (a), this is notice that on May 3, 2013, Watson Pharma, Inc., 2455 Wardlow Road, Corona, California 92880-2882, made...

  11. On the scaling limits of Galton Watson processes in varying environment

    NARCIS (Netherlands)

    Bansaye, V.; Simatos, F.

    2011-01-01

    Renormalized sequences of Galton Watson processes converge to Continuous State Branching Processes (CSBP), characterized by a L\\'evy triplet of two numbers and a measure. This paper investigates the case of Galton Watson processes in varying environment and provides an explicit sufficient condition

  12. John B. Watson's Alleged Sex Research: An Appraisal of the Evidence

    Science.gov (United States)

    Benjamin, Ludy T. Jr.; Whitaker, Jodi L.; Ramsey, Russell M.; Zeve, Daniel R.

    2007-01-01

    In 1974, a story was published about clandestine research done by John B. Watson that was judged to be so reprehensible that it was offered as the real reason he was fired from his faculty position at Johns Hopkins University in 1920, at perhaps the peak of his academic career. Watson's dismissal from Johns Hopkins may have been the most important…

  13. From theory to practice: caring science according to Watson and Brewer.

    Science.gov (United States)

    Clarke, Pamela N; Watson, Jean; Brewer, Barbara B

    2009-10-01

    Caring science is presented by Jean Watson and Barbara Brewer through an interview and dialogue format. Jean Watson presents caring science and its philosophy and evolution and the impact of her model on nursing and other disciplines. Barbara Brewer addresses the implementation of the model in a Magnet hospital setting and describes how her leadership facilitated implementation.

  14. Predicting the Mechanism and Kinetics of the Watson-Crick to Hoogsteen Base Pairing Transition

    NARCIS (Netherlands)

    Vreede, J.; Bolhuis, P.G.; Swenson, D.W.H.

    2016-01-01

    DNA duplexes predominantly contain Watson-Crick (WC) base pairs. Yet, a non-negligible number of base pairs converts to the Hoogsteen (HG) hydrogen bonding pattern, involving a 180° rotation of the purine base relative to Watson-Crick. These WC to HG conversions alter the conformation of DNA, and

  15. A Innovative Engineering Summer School V2.0

    DEFF Research Database (Denmark)

    Bennedsen, Jens; Larsen, Peter Gorm

    2010-01-01

    This article describes a summer school which focuses on a conceive-design project. The summer school has been run three times; each of the implementations is described. The last implementation (v2.0) is discussed and four challenges are identified and discussed in detail: assignments, the role...

  16. Multiple case study analysis of young women's experiences in high school engineering

    Science.gov (United States)

    Pollock, Meagan C.

    At a time when engineers are in critical demand, women continue to be significantly underrepresented in engineering fields (11.7%) and degree programs (21.3%) in the United States. As a result, there is a national demand for improved K-12 STEM education and targeted efforts to improve equity and access to engineering and science careers for every underrepresented group. High school engineering has become a nascent and growing market for developers and an emergent opportunity for students across the United States to learn introductory engineering skills through strategic career pathways; however there is a disparity in participation at this level as well. Much useful research has been used to examine the problematization of underrepresentation (K Beddoes, 2011), but there is a dearth of literature that helps us to understand the experiences of young women in high school engineering. By examining the experiences of young women in high school engineering, we can learn ways to improve the curriculum, pedagogy, and environment for underrepresented groups such as females to ensure they have equitable access to these programs and are subsequently motivated to persist in engineering. Understanding the needs of marginalized groups is complex, and intersectional feminism seeks to understand gender in relation to other identities such as race, class, ethnicity, sexuality, and nationality. This theory asserts that gender alone is neither a total identity nor a universal experience, and it is thus advantageous to consider each of the intersecting layers of identity so as to not privilege a dominate group as representative of all women. Thus, to understand how female students engage with and experience engineering in grade school, it is useful to examine through the lens of gender, class, race, and sexuality, because this intersection frames much of the human experience. The purpose of this study is to examine high school females' experiences in engineering, with a goal to

  17. Re-Engineering Primary School Teachers for Sustainable ...

    African Journals Online (AJOL)

    Nekky Umera

    discipline conditions, sabbaticals for research and study are expected to improve ... needs such as money, status, and security are work context factors that affect teachers' ... give tecahers the satisfaction to committing themselves to school.

  18. Summary of Research 2001, Department of Mechanical Engineering, Graduate School of Engineering and Applied Sciences

    National Research Council Canada - National Science Library

    McNelley, Terry

    2002-01-01

    This report contains project summaries of the research projects in the Department of Mechanical Engineering A list of recent publications is also included, which consists of conference presentations...

  19. Effect of Engineering Education by Science Classroom for High School, Junior High School and Elementary School Students

    Science.gov (United States)

    Yukita, Kazuto; Goto, Tokimasa; Mizuno, Katsunori; Nakano, Hiroyuki; Ichiyanagi, Katsuhiro; Goto, Yasuyuki; Mori, Tsuyoshi

    Recently the importance of Monozukuri (manufacturing) has been watched with keen interest as a social; problem, which has a relation with schoolchildren's decline of their academic standards, pointed out by the reports of PISA of OECD and TIMSS, etc., and their “losing interest in science” and “dislike of science”, some people worry about, which will lead to the decline of technology in the home industry, the top-class personnel shortage, and the decrease of economical power in this country in the future. In order to solve such a problem, science pavilions, universities, and academic societies of science and engineering etc. in various places hold “Monozukuiri Classrooms” or “Science Classrooms”. We can say that various activities which try to hold off “losing interest in science” and “dislike of science.” in the whole society. Under such a situation, Aichi Institute of Technology (AIT) to which we belong, also tries to contribute to the activity of solving the problem, and holds various engineering education lectures which intend for elementary, junior high school and senior high school students. AIT has held “The Whole Experience World” which tries to bring up a talented person who has a dream and hope towards science and technology, grows his/her originality, intellectual curiosity and spirit of inquiry, and supports the nation based on science and technology in the summer vacation since 2001. This paper reports the result of a questionnaire about what kind of the long-term learning effect on the children who participated in “The Whole Experience World” and “Boys and Girls Robot Lectures”. As the conclusion of the study, we can say that the lectures could give the participants who were interested in science and technology more interest. And we could give them the idea of what the study of science and technology is. As a result, we could contribute to the participants' decision of the courses' selection in life.

  20. Watson will see you now: a supercomputer to help clinicians make informed treatment decisions.

    Science.gov (United States)

    Doyle-Lindrud, Susan

    2015-02-01

    IBM has collaborated with several cancer care providers to develop and train the IBM supercomputer Watson to help clinicians make informed treatment decisions. When a patient is seen in clinic, the oncologist can input all of the clinical information into the computer system. Watson will then review all of the data and recommend treatment options based on the latest evidence and guidelines. Once the oncologist makes the treatment decision, this information can be sent directly to the insurance company for approval. Watson has the ability to standardize care and accelerate the approval process, a benefit to the healthcare provider and the patient.

  1. The High School Environment and the Gender Gap in Science and Engineering

    Science.gov (United States)

    Legewie, Joscha; DiPrete, Thomas A.

    2016-01-01

    Despite the striking reversal of the gender gap in education, women pursue science, technology, engineering, and mathematics (STEM) degrees at much lower rates than those of their male peers. This study extends existing explanations for these gender differences and examines the role of the high school context for plans to major in STEM fields. Building on recent gender theories, we argue that widely shared and hegemonic gender beliefs manifest differently across schools so that the gender-specific formation of study plans is shaped by the local environment of high schools. Using the National Education Longitudinal Study, we first show large variations between high schools in the ability to attract students to STEM fields conditional on a large set of pre–high school measures. Schools that are successful in attracting students to these fields reduce the gender gap by 25 percent or more. As a first step toward understanding what matters about schools, we then estimate the effect of two concrete high school characteristics on plans to major in STEM fields in college—a high school's curriculum in STEM and gender segregation of extracurricular activities. These factors have a substantial effect on the gender gap in plans to major in STEM: a finding that is reaffirmed in a number of sensitivity analyses. Our focus on the high school context opens concrete avenues for policy intervention and is of central theoretical importance to understand the gender gap in orientations toward STEM fields. PMID:27857451

  2. Model Wind Turbine Design in a Project-Based Middle School Engineering Curriculum Built on State Frameworks

    Science.gov (United States)

    Cogger, Steven D.; Miley, Daniel H.

    2012-01-01

    This paper proposes that project-based active learning is a key part of engineering education at the middle school level. One project from a comprehensive middle school engineering curriculum developed by the authors is described to show how active learning and state frameworks can coexist. The theoretical basis for learning and assessment in a…

  3. The High School Environment and the Gender Gap in Science and Engineering

    Science.gov (United States)

    Legewie, Joscha; DiPrete, Thomas A.

    2014-01-01

    Despite the striking reversal of the gender gap in education, women pursue science, technology, engineering, and mathematics (STEM) degrees at much lower rates than those of their male peers. This study extends existing explanations for these gender differences and examines the role of the high school context for plans to major in STEM fields.…

  4. Education and Research Related to Organic Waste Management at Agricultural Engineering Schools

    Science.gov (United States)

    Soliva, Montserrat; Bernat, Carles; Gil, Emilio; Martinez, Xavier; Pujol, Miquel; Sabate, Josep; Valero, Jordi

    2007-01-01

    Purpose: The purpose of this paper is to describe the experience of the Agriculture Engineering School of Barcelona (ESAB), where undergraduate students were involved in field research experiments on organic waste use in agricultural systems. Design/methodology/approach: The paper outlines how the formation of professionals oriented to work for…

  5. Bioinformatics Education in High School: Implications for Promoting Science, Technology, Engineering, and Mathematics Careers

    Science.gov (United States)

    Kovarik, Dina N.; Patterson, Davis G.; Cohen, Carolyn; Sanders, Elizabeth A.; Peterson, Karen A.; Porter, Sandra G.; Chowning, Jeanne Ting

    2013-01-01

    We investigated the effects of our Bio-ITEST teacher professional development model and bioinformatics curricula on cognitive traits (awareness, engagement, self-efficacy, and relevance) in high school teachers and students that are known to accompany a developing interest in science, technology, engineering, and mathematics (STEM) careers. The…

  6. Library Service to Industry at USC: The Industrial Associates of the School of Engineering.

    Science.gov (United States)

    Frohmberg, Katherine A.

    Special libraries in Southern California and the San Francisco Bay Area who were members of the University of Southern California (USC) School of Engineering Industrial Associate program were surveyed on their use of the USC program and other similar programs. The questionnaire was designed to discover the attitudes and needs of the Industrial…

  7. Home school student visit and introduction to rail transportation and engineering.

    Science.gov (United States)

    2016-06-22

    This project consisted of hosting local Champaign-Urbana, Illinois home school students for a visit to : the Rail Transportation and Engineering Center (RailTEC) at the University of Illinois at Urbana- : Champaign (UIUC). Beyond visiting RailTEC, st...

  8. Evaluating Blended and Flipped Instruction in Numerical Methods at Multiple Engineering Schools

    Science.gov (United States)

    Clark, Renee; Kaw, Autar; Lou, Yingyan; Scott, Andrew; Besterfield-Sacre, Mary

    2018-01-01

    With the literature calling for comparisons among technology-enhanced or active-learning pedagogies, a blended versus flipped instructional comparison was made for numerical methods coursework using three engineering schools with diverse student demographics. This study contributes to needed comparisons of enhanced instructional approaches in STEM…

  9. Effectiveness of E-Learning for Students Vocational High School Building Engineering Program

    Science.gov (United States)

    Soeparno; Muslim, Supari

    2018-04-01

    Implementation of vocational learning in accordance with the 2013 curriculum must meet the criteria, one of which is learning to be consistent with advances in technology and information. Technology-based learning in vocational commonly referred to as E-Learning, online (in the network) and WBL (Web-Based Learning). Facts on the ground indicate that based learning technology and information on Vocational High School of Building Engineering is still not going well. The purpose of this research is to know: advantages and disadvantages of learning with E-Learning, conformity of learning with E-Learning with characteristics of students on Vocational High School of Building Engineering and effective learning method based on E-Learning for students on Vocational High School of Building Engineering. Research done by literature method, get the following conclusion as follow: the advantages of E-Learning is learning can be done anywhere and anytime, efficient in accessing materials and tasks, ease of communication and discussion; while the shortage is the need for additional costs for good internet access and lack of social interaction between teachers and students. E-learning is appropriate to basic knowledge competencies, and not appropriate at the level of advanced competencies and skills. Effective E-Learning Based Learning Method on Vocational High School of Building Engineering is a Blended method that is a mix between conventional method and e-learning.

  10. Annual Quality Assurance Conference Files by Nicola Watson and Rui Li

    Science.gov (United States)

    26th Annual Quality Assurance Conference. Abstract: An Innovative Water Management Device for Online and Canister-based Thermal Desorption of Trace-level VVOCs in High Humidity Ambient Air by Nicola Watson and Rui Li

  11. Non-Watson Crick base pairs might stabilize RNA structural motifs in ...

    Indian Academy of Sciences (India)

    Watson Crick base pairs, internal loops and pseudoknots have been the highlighting feature of recent structural determination of RNAs. The recent crystal structure of group-I introns has demonstrated that these might constitute RNA structural ...

  12. Implementation of a project-based engineering school: increasing student motivation and relevant learning

    Science.gov (United States)

    Terrón-López, María-José; García-García, María-José; Velasco-Quintana, Paloma-Julia; Ocampo, Jared; Vigil Montaño, María-Reyes; Gaya-López, María-Cruz

    2017-11-01

    The School of Engineering at Universidad Europea de Madrid (UEM) implemented, starting in the 2012-2013 period, a unified academic model based on project-based learning as the methodology used throughout the entire School. This model expects that every year, in each grade, all the students should participate in a capstone project integrating the contents and competencies of several courses. This paper presents the academic context under which this experience has been implemented, and a summary of the work done to design and implement the Project-Based Engineering School at the UEM. The steps followed, the structure used, some sample projects, as well as the difficulties and benefits of implementing the programme are discussed in this paper. The results are encouraging as students are more motivated and the initial set objectives were accomplished.

  13. Innovative Methods of Teaching Science and Engineering in Secondary Schools

    Directory of Open Access Journals (Sweden)

    Nathan BALASUBRAMANIAN

    2006-12-01

    Full Text Available This article describes the design of an interactive learning environment to increase student achievement in middle schools by addressing students' preconceptions, and promoting purposeful social collaboration, distributed cognition, and contextual learning. The paper presents the framework that guided our design efforts to immerse all students in a progression of guided-inquiry hands-on activities. Students find compelling reasons to learn by responding to authentic science-based challenges, both in simulations and hands-on activities, based on specific instructional objectives from the national standards.

  14. The Investigation of STEM Self-Efficacy and Professional Commitment to Engineering among Female High School Students

    Science.gov (United States)

    Liu, Yi-hui; Lou, Shi-jer; Shih, Ru-chu

    2014-01-01

    This study employed social cognitive theory and social cognitive career theory (SCCT) as foundations to explore the influence of high school students' beliefs about female gender roles and female engineer role models on science, technology, engineering, and mathematics (STEM) self-efficacy and professional commitment to engineering. A total of 88…

  15. The Influence of Toy Design Activities on Middle School Students' Understanding of the Engineering Design Processes

    Science.gov (United States)

    Zhou, Ninger; Pereira, Nielsen L.; Tarun, Thomas George; Alperovich, Jeffrey; Booth, Joran; Chandrasegaran, Senthil; Tew, Jeffrey David; Kulkarni, Devadatta M.; Ramani, Karthik

    2017-01-01

    The societal demand for inspiring and engaging science, technology, engineering, and mathematics (STEM) students and preparing our workforce for the emerging creative economy has necessitated developing students' self-efficacy and understanding of engineering design processes from as early as elementary school levels. Hands-on engineering design…

  16. The Game is aFoot, Watson: DeepQA systems and the future of HCI

    OpenAIRE

    Keates, Simeon; Varker, Philip

    2012-01-01

    In February 2011, the IBM Watson DeepQA (deep question and answer) system took part in a special challenge, pitting its question and answer capability against former Jeopardy!TM grand champions in a televised match. Watson emerged victorious from the challenge, demonstrating that current question answering technology has advanced to the point where it can arguably be more dependable than human experts. This new system represents a significant breakthrough in humanity’s decades-long endeavour ...

  17. Watson's theorem and resonant pion photoproduction amplitude in the delta channel

    International Nuclear Information System (INIS)

    Wittman, R.; Davidson, R.; Mukhopadhyay, N.C.

    1984-01-01

    The CGLN and BL theories of the pion photoproduction on nucleons, used in nuclear calculations, are examined regarding their predictions of the resonant M 1 + and E 1 + multipoles. The nonunitary BL approach violates Watson's theorem, and predicts these multipoles porly. In the static limit, the CGLN multipoles satisfy Watson's theorem and are in fine agreement with data. The unitarized BL multipoles agree with those from the Olsson theory and data. (orig.)

  18. A comparative study of the second-order Born and Faddeev-Watson approximations: Pt. 3

    International Nuclear Information System (INIS)

    Roberts, M.J.

    1988-01-01

    Singularities which arise in the second-order Born and Faddeev-Watson approximations for ionisation processes are examined. A regularisation procedure for the latter is suggested. Comparison with He(e,2e)He + experimental data in symmetric coplanar energy-sharing kinematics shows that the second-order Faddeev-Watson approximation is inferior to the second Born results of Byron et al. (1985. J. Phys. B: At. Mol. Phys. 18, 3203). (author)

  19. Theoretical Study of the Hoogsteen–Watson-Crick Junctions in DNA

    OpenAIRE

    Cubero, Elena; Luque, F. Javier; Orozco, Modesto

    2005-01-01

    A series of d (AT)n oligonucleotides containing mixtures of normal B-type Watson-Crick and antiparallel Hoogsteen helices have been studied using molecular dynamics simulation techniques to analyze the structural and thermodynamic impact of the junction between Watson-Crick and antiparallel Hoogsteen structures. Analysis of molecular dynamics simulations strongly suggests that for all oligonucleotides studied the antiparallel Hoogsteen appears as a reasonable conformation, only slightly less ...

  20. Watson's behaviorism: a comparison of the two editions (1925 and 1930).

    Science.gov (United States)

    Carpintero, Helio

    2004-05-01

    J.B. Watson's Behaviorism, a complete presentation of the mature psychological points of view of its author, had 2 editions, in 1925 and 1930, which presented significant differences in their texts. Although Watson maximized such variations, to the point of considering the 2nd edition as nearly a brand-new book, both suppressions and additions reveal his feelings when presenting his ideas to a general audience. Such variations are here presented through an in-depth analysis.

  1. PROFESSIONALS BACK TO SCHOOL - AN ENGINEERING OUTREACH PROGRAMME: A CASE STUDY IN MALAYSIA

    Directory of Open Access Journals (Sweden)

    BALAMURALITHARA BALAKRISHNAN

    2017-10-01

    Full Text Available The introduction of engineering education in K-12 classrooms opens up a number of opportunities for STEM learning to support the acquisition of knowledge and skills related to science and mathematics subjects. Several initiatives, including outreach programmes, have been carried out to promote engineering subjects and professions. To supplement the existing Malaysian curricula, an outreach programme seems a viable solution to help improve the understanding and awareness of the importance of engineering among students. In this regard, an engineering outreach program called Professionals Back to School was carried out involving a group of 40 students with the participation of several engineering practitioners. Later all the participants were interviewed to elicit feedback on the programme. The findings of the interview showed that all the participants agreed that the outreach programme was beneficial, and a majority found it to be motivational. Given these positive findings, engineering outreach programmes are highly recommended to Malaysian secondary schools to help create interest among schoolchildren in STEM education and professions.

  2. The case of the missing fingerprints or Dr Watson's cosmology

    International Nuclear Information System (INIS)

    Longair, M.S.

    1987-01-01

    The cosmological problem has four main areas of uncertainty -the origin of isotropy of the universe, the origin of the fluctuations from which galaxies form, the explanation of why we live in a matter universe rather than one composed of equal amounts of matter and antimatter and why the Universe seems to be within a factor of 10 of the critical, flat universe. These cannot be explained satisfactorily within the Hot Big Bang theory after a millisecond or so. The solutions are presumed, therefore, to lie in the very early universe when it was less than about a millisecond old. The clues which lead to this conclusion are set out in terms of a detective story with Sherlock Holmes explaining the facts about the universe to Dr Watson. Holmes first explains the size of the universe in terms of distances and sizes of stars, galaxies and galaxy clusters. Evidence from pictures of the universe at different temperatures, (X-ray pictures, gamma-ray pictures, far infra-red pictures and pictures at radio and millimetre wavelengths) is presented. Holmes then starts to build up a realistic model of the universe using two of the facts collected (the isotropy of the universe and the expansion of the universe), one assumption (the cosmological principle) and one theory of gravity (General Relativity). However the universe which emerges does not solve the four problems mentioned. Quasars, which provide information (illustrated) from earlier epochs of the universe may, therefore, help to solve the problems. (U.K.)

  3. The Towers Watson Approach to Improving Corporate Wellness.

    Science.gov (United States)

    Wootton, Adam

    2012-06-01

    Encouraging employees to take care of their health is in the interests of everyone. Employees benefit from being healthier and happier, employers benefit from having an engaged workforce, lower absenteeism, and lower medical costs, and society as a whole benefits from using less medical resources. Employers have been trying to push healthy messages to employees for a long time and have had some good success. For example, an increased emphasis on the dangers of tobacco use in employer and government communications has helped bring about a significant decrease in smoking. However, overall population health in key risk areas (such as obesity and diabetes) continues to decline. These areas are where employers can really make a difference in health outcomes-and effective communications are critical to success. Towers Watson helps many companies educate employees about health and wellness and encourage more effective use of healthcare. The challenge is to find new and engaging ways to deliver this information so that employees take notice-and take action. After all, the amount of material employees receive on a daily basis from marketers, employers, and each other across the wide range of available media makes it extremely difficult to be heard. This is where gaming comes in-and why we think it's the tool to be incorporating into communication and engagement plans.

  4. The investigation of STEM Self-Efficacy and Professional Commitment to Engineering among female high school students

    Directory of Open Access Journals (Sweden)

    Yi-hui Liu

    2014-06-01

    Full Text Available This study employed social cognitive theory and social cognitive career theory (SCCT as foundations to explore the influence of high school students' beliefs about female gender roles and female engineer role models on science, technology, engineering, and mathematics (STEM self-efficacy and professional commitment to engineering. A total of 88 students from a national girls' high school participated in STEM project-based learning. A survey questionnaire named The STEM Self-efficacy and Professional Commitment to Engineering Questionnaire, developed by the researchers, was administered to collect data, and a structured equation model was employed to confirm the multi-theoretical model developed in this study. The results of this study show that enhancing the gender role beliefs and engineer role models of female students may increase their STEM self-efficacy and professional commitment to engineering. In other words, the female high school students' professional commitment to engineering model can explain students' intentions for future engineering careers. Thus, this study suggests integrating STEM project-based learning into the curricula of various schools and integrating female engineer role models into STEM project-based learning activities for female students, which can enhance female high school students' STEM self-efficacy and professional commitment to engineering.

  5. Emeritus Scientists, Mathematicians and Engineers (ESME) program. Summary of activities for school year 1991--1992

    Energy Technology Data Exchange (ETDEWEB)

    Sharlin, H.I.

    1992-09-01

    The Emeritus Scientists, Mathematicians and Engineers (ESME) program matches retired scientists and engineers with wide experience with elementary school children in order to fuel the children`s natural curiosity about the world in which they live. The long-range goal is to encourage students to maintain the high level of mathematical and science capability that they exhibit at an early age by introducing them to the fun and excitement of the world of scientific investigation and engineering problem solving. Components of the ESME program are the emeriti, established teacher-emeriti teams that work to produce a unit of 6 class hours of demonstration or hands-on experiments, and the encounter by students with the world of science/engineering through the classroom sessions and a field trip to a nearby plant or laboratory.

  6. A comment on Watson, Deary, and Austin and Watson, Roberts, Gow, and Deary : How to investigate whether personality items form a hierarchical scale?

    NARCIS (Netherlands)

    Meijer, Rob R.

    I comment on two recent papers by Watson et al. (2007, 2008) who investigated whether personality items form a hierarchical scale. I discuss that the methods they used are inappropriate and discuss alternative methods presented in the literature. (C) 2009 Elsevier Ltd All rights reserved..

  7. Book of abstracts Chemical Engineering: IV All-Russian Conference on chemical engineering, All-Russian Youth Conference on chemical engineering, All-Russian school on chemical engineering for young scientists and specialists. Engineering of polymers and composite materials. Catalysis in chemical engineering

    International Nuclear Information System (INIS)

    Zakhodyaeva, Yu.A.; Belova, V.V.

    2012-01-01

    In the given volume of abstracts of the IV All-Russian Conference on chemical engineering, All-Russian Youth Conference on chemical engineering, All-Russian school on chemical engineering for young scientists and specialists (Moscow, March 18-23, 2012) there are the abstracts of the reports concerning polymer and composite materials technology as well as catalysis in chemical engineering. The abstracts deal with state-of-the-art and future development of theoretical and experimental investigations as well as with experience in practical realization of development works in the field of chemical engineering and relative areas [ru

  8. XVI 'Jacques-Louis Lions' Spanish-French School on Numerical Simulation in Physics and Engineering

    CERN Document Server

    Roldán, Teo; Torrens, Juan

    2016-01-01

    This book presents lecture notes from the XVI ‘Jacques-Louis Lions’ Spanish-French School on Numerical Simulation in Physics and Engineering, held in Pamplona (Navarra, Spain) in September 2014. The subjects covered include: numerical analysis of isogeometric methods, convolution quadrature for wave simulations, mathematical methods in image processing and computer vision, modeling and optimization techniques in food processes, bio-processes and bio-systems, and GPU computing for numerical simulation. The book is highly recommended to graduate students in Engineering or Science who want to focus on numerical simulation, either as a research topic or in the field of industrial applications. It can also benefit senior researchers and technicians working in industry who are interested in the use of state-of-the-art numerical techniques in the fields addressed here. Moreover, the book can be used as a textbook for master courses in Mathematics, Physics, or Engineering.

  9. School Climate in the Engineering and Architecture Campus of a Mexican Public University: Students’ Perspectives

    Directory of Open Access Journals (Sweden)

    María del Carmen Sandoval-Caraveo

    2017-04-01

    Full Text Available The objective of this research was to identify the school climate that prevails in the students of the faculty of Engineering and Architecture in a Mexican public University. This study was conducted in response to a need to take care of the recommendations of the agencies evaluating the educational programs. It was done with a quantitative approach, of a descriptive and correlational type with non-experimental transactional design. The studied dimensions of the school climate were: organization structure, functionality, pedagogical practices, climate between peer interaction and satisfaction. The data were collected using a Likert scale questionnaire, with a reliability of .880 of Cronbach’s Alpha coefficient and validity through confirmatory factorial analysis. The results obtained from the descriptive statistics pointed the favorable school climate in peer interaction and pedagogical practices. Organizational structure, however, was the lowest rated classroom climate dimension. ANOVA results showed significant statistical differences between the school climate and educational programs, the years that the students have remained in the university, the age and the school cycle. Pearson’s correlation analysis revealed weak and negative correlation between school climate and student age.

  10. Theoretical study of the Hoogsteen-Watson-Crick junctions in DNA.

    Science.gov (United States)

    Cubero, Elena; Luque, F Javier; Orozco, Modesto

    2006-02-01

    A series of d (AT)(n) oligonucleotides containing mixtures of normal B-type Watson-Crick and antiparallel Hoogsteen helices have been studied using molecular dynamics simulation techniques to analyze the structural and thermodynamic impact of the junction between Watson-Crick and antiparallel Hoogsteen structures. Analysis of molecular dynamics simulations strongly suggests that for all oligonucleotides studied the antiparallel Hoogsteen appears as a reasonable conformation, only slightly less stable than the canonical B-type Watson-Crick one. The junctions between the Watson-Crick and Hoogsteen structures introduces a priori a sharp discontinuity in the helix, because the properties of each type of conformation are very well preserved in the corresponding fragments. However, and quite counterintuitively, junctions do not largely distort the duplex in structural, dynamics or energetic terms. Our results strongly support the possibility that small fragments of antiparallel Hoogsteen duplex might be embedded into large fragments of B-type Watson-Crick helices, making possible protein-DNA interactions that are specific of the antiparallel Hoogsteen conformation.

  11. Theoretical Study of the Hoogsteen–Watson-Crick Junctions in DNA

    Science.gov (United States)

    Cubero, Elena; Luque, F. Javier; Orozco, Modesto

    2006-01-01

    A series of d (AT)n oligonucleotides containing mixtures of normal B-type Watson-Crick and antiparallel Hoogsteen helices have been studied using molecular dynamics simulation techniques to analyze the structural and thermodynamic impact of the junction between Watson-Crick and antiparallel Hoogsteen structures. Analysis of molecular dynamics simulations strongly suggests that for all oligonucleotides studied the antiparallel Hoogsteen appears as a reasonable conformation, only slightly less stable than the canonical B-type Watson-Crick one. The junctions between the Watson-Crick and Hoogsteen structures introduces a priori a sharp discontinuity in the helix, because the properties of each type of conformation are very well preserved in the corresponding fragments. However, and quite counterintuitively, junctions do not largely distort the duplex in structural, dynamics or energetic terms. Our results strongly support the possibility that small fragments of antiparallel Hoogsteen duplex might be embedded into large fragments of B-type Watson-Crick helices, making possible protein-DNA interactions that are specific of the antiparallel Hoogsteen conformation. PMID:16287814

  12. IBM Watson: How Cognitive Computing Can Be Applied to Big Data Challenges in Life Sciences Research.

    Science.gov (United States)

    Chen, Ying; Elenee Argentinis, J D; Weber, Griff

    2016-04-01

    Life sciences researchers are under pressure to innovate faster than ever. Big data offer the promise of unlocking novel insights and accelerating breakthroughs. Ironically, although more data are available than ever, only a fraction is being integrated, understood, and analyzed. The challenge lies in harnessing volumes of data, integrating the data from hundreds of sources, and understanding their various formats. New technologies such as cognitive computing offer promise for addressing this challenge because cognitive solutions are specifically designed to integrate and analyze big datasets. Cognitive solutions can understand different types of data such as lab values in a structured database or the text of a scientific publication. Cognitive solutions are trained to understand technical, industry-specific content and use advanced reasoning, predictive modeling, and machine learning techniques to advance research faster. Watson, a cognitive computing technology, has been configured to support life sciences research. This version of Watson includes medical literature, patents, genomics, and chemical and pharmacological data that researchers would typically use in their work. Watson has also been developed with specific comprehension of scientific terminology so it can make novel connections in millions of pages of text. Watson has been applied to a few pilot studies in the areas of drug target identification and drug repurposing. The pilot results suggest that Watson can accelerate identification of novel drug candidates and novel drug targets by harnessing the potential of big data. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

  13. Iterative development of engineering-at-school teaching capacities in Danish primary and lower secondary schools

    DEFF Research Database (Denmark)

    Daugbjerg, Peer; Sillasen, Martin Krabbe

    with projectorganised problembased engineering challenges. The teacher training programme was developed through iterative action learning processes. Starting with a collaboration on developing the didactics and teaching materiale between 12 teachers in two municipalities and 12 consultants from two university colleges...... the classroom testing of the didactics and teaching materials. This repeated iterative development of the programme intended to integrate teachers experimentation with engineering in their own practice and to let this integration inform the intervention courses to be conducted in the spring of 2018. The session...... will start with a presentation of the overall design and the results from the development and the test phase leading to the final programme description with didactical models, differentiation schemes, evaluation rubrics and teaching materials. The session will then open for the participants to comment...

  14. J. B. Watson y la Publicidad, los Inicios de la Psicología del Consumidor

    Directory of Open Access Journals (Sweden)

    FELIPE PARRADO CORREDOR

    2013-01-01

    Full Text Available La investigación del comportamiento de las personas frente a los productos y servicios se remonta a los inicios del siglo XX y J. B. Watson es uno de sus principales precursores. Watson ofreció un curso de psicología aplicada titulado Psicología de la Publicidad, introdujo en varias empresas las técnicas experimentales para el mercadeo de sus productos y, tras su retiro de la vida académica, se vinculó a la agencia de publicidad Walter Thompson, donde desarrolló campañas masivas con los mismos principios de las reacciones emocionales condicionadas. En este ensayo se expone la importancia del trabajo de Watson en la psicología de la publicidad, como precursor de los desarrollos científicos de la psicología del consumidor.

  15. A history of the term radical behaviorism: From Watson to Skinner

    Science.gov (United States)

    Schneider, Susan M.; Morris, Edward K.

    1987-01-01

    This paper describes the origins and evolution of the term radical behaviorism. John B. Watson's coining of behaviorism in 1913 is presented first, followed by a discussion of the uses of “radical” within psychology during these early years. When the term radical behaviorism first emerged in the early 1920s, its referent was Watson's behaviorism, most specifically his stance on consciousness. In the 1930s, B. F. Skinner described his own position with the term radical behaviorism in an unpublished manuscript, and then in 1945 first referred in print to his views as such. Today, radical behaviorism is generally applied to Skinner's views alone. The paper concludes with a brief discussion of a similarity in Watson's and Skinner's positions on consciousness, which seems a possible historical and philosophical connection between their respective radical behaviorisms. PMID:22477958

  16. Characterizing Design Cognition of High School Students: Initial Analyses Comparing Those with and without Pre-Engineering Experiences

    Science.gov (United States)

    Wells, John; Lammi, Matthew; Gero, John; Grubbs, Michael E.; Paretti, Marie; Williams, Christopher

    2016-01-01

    Reported in this article are initial results from of a longitudinal study to characterize the design cognition and cognitive design styles of high school students with and without pre-engineering course experience over a 2-year period, and to compare them with undergraduate engineering students. The research followed a verbal protocol analysis…

  17. Fueling Chemical Engineering Concepts with Biodiesel Production: A Professional Development Experience for High School Pre-Service Teachers

    Science.gov (United States)

    Gupta, Anju

    2015-01-01

    This one-day workshop for pre-service teachers was aimed at implementing a uniquely designed and ready-to-implement chemical engineering curriculum in high school coursework. This educational and professional development opportunity introduced: 1) chemical engineering curriculum and career opportunities, 2) basic industrial processes and flow…

  18. Book of abstracts Chemical Engineering: IV All-Russian Conference on chemical engineering, All-Russian Youth Conference on chemical engineering, All-Russian school on chemical engineering for young scientists and specialists. Chemical engineering of nanomaterials. Energy- and resource-saving chemical-engineering processes and problems of their intensification. Processes and apparatuses of chemical engineering, chemical cybernetics. Ecological problems of chemical engineering and related fields

    International Nuclear Information System (INIS)

    Zakhodyaeva, Yu.A.; Belova, V.V.

    2012-01-01

    In the given volume of abstracts of the IV All-Russian Conference on chemical engineering, All-Russian Youth Conference on chemical engineering, All-Russian school on chemical engineering for young scientists and specialists (Moscow, March 18-23, 2012) there are the abstracts of the reports concerning chemical engineering of nanomaterials, energy- and resource-saving chemical-engineering processes, processes and apparatuses of chemical engineering, chemical cybernetics, ecological problems of chemical engineering and related fields. The abstracts deal with state-of-the-art and future development of theoretical and experimental investigations as well as with experience in practical realization of development works in the field of chemical engineering and relative areas [ru

  19. Differences between the Sexes among Protestant Christian Middle School Students and Their Attitudes toward Science, Technology, Engineering and Math (STEM)

    Science.gov (United States)

    Michael, Kurt Y.; Alsup, Philip R.

    2016-01-01

    Research focusing on science, technology, engineering, and math (STEM) education among conservative Protestant Christian school students is scarce. Crenshaw's intersectionality theory is examined as it pertains to religion as a group identifier. The STEM Semantic Survey was completed by 157 middle school students attending six different private…

  20. Culturally responsive engineering education: A case study of a pre-college introductory engineering course at Tibetan Children's Village School of Selakui

    Science.gov (United States)

    Santiago, Marisol Mercado

    Culturally responsive teaching has been argued to be effective in the education of Indigenous youth. This approach emphasizes the legitimacy of a group's cultural heritage, helps to associate abstract academic knowledge with the group's sociocultural context, seeks to incorporate a variety of strategies to engage students who have different learning styles, and strives to integrate multicultural information in the educational contents, among other considerations. In this work, I explore the outcomes of a culturally responsive introductory engineering short course that I developed and taught to Tibetan students at Tibetan Children's Village of Selakui (in Uttarakhand, India). Based on my ethnographic research in Tibetan communities in northern India, I examine two research questions: (a) What are the processes to develop and implement a pre-college culturally responsive introductory engineering course? and (b) How do Tibetan culture and Buddhism influence the engineering design and teamwork of the pre-college Tibetan students who took the course? I designed then taught the course that featured elementary lectures on sustainability, introductory engineering design, energy alternatives, and manufacturing engineering. The course also included a pre-college engineering design project through which Tibetan high school students investigated a problem at the school and designed a possible solution to it. Drawing from postcolonial studies, engineering studies, engineering and social justice, Buddhist studies, and Tibetan studies, I provide an analysis of my findings. Based on my findings, I conclude that my culturally responsive approach of teaching was an effective method to help students feel that their cultural background was respected and included in a pre-college engineering course; however, some students felt resistance toward the teaching approach. In addition, the culturally relevant content that connected with their ways of living in their school, Tibetan

  1. STEM Career Cluster Engineering and Technology Education pathway in Georgia: Perceptions of Georgia engineering and technology education high school teachers and CTAE administrators as measured by the Characteristics of Engineering and Technology Education survey

    Science.gov (United States)

    Crenshaw, Mark VanBuren

    This study examined the perceptions held by Georgia Science, Technology, Engineering, and Mathematics (STEM) Career Cluster Engineering and Technology Education (ETE) high school pathway teachers and Georgia's Career, Technical and Agriculture Education (CTAE) administrators regarding the ETE pathway and its effect on implementation within their district and schools. It provides strategies for ETE teaching methods, curriculum content, STEM integration, and how to improve the ETE pathway program of study. Current teaching and curricular trends were examined in ETE as well as the role ETE should play as related to STEM education. The study, using the Characteristics of Engineering and Technology Education Survey, was conducted to answer the following research questions: (a) Is there a significant difference in the perception of ETE teaching methodology between Georgia ETE high school teachers and CTAE administrators as measured by the Characteristics of Engineering and Technology Education Survey? (b) Is there a significant difference in the perception of ETE curriculum content between Georgia ETE high school teachers and CTAE administrators as measured by the Characteristics of Engineering and Technology Education Survey? (c) Is there a significant difference in the perception of STEM integration in the ETE high school pathway between Georgia ETE high school teachers and CTAE administrators as measured by the Characteristics of Engineering and Technology Education Survey? and (d) Is there a significant difference in the perception of how to improve the ETE high school pathway between Georgia ETE high school teachers and CTAE administrators as measured by the Characteristics of Engineering and Technology Education Survey? Suggestions for further research also were offered.

  2. Fit for Practice: Analysis and Evaluation of Watson's Theory of Human Caring.

    Science.gov (United States)

    Pajnkihar, Majda; McKenna, Hugh P; Štiglic, Gregor; Vrbnjak, Dominika

    2017-07-01

    The aim of the authors of this paper is to analyze Watson's theory of human caring for its usefulness and worth in education, practice, and research. The reason for undertaking this analysis is to evaluate if Watson's theory would be useful for nursing in those countries where such theories were not an established part of the nursing curriculum. Furthermore, in some European countries, their political past or cultural influences led to an unquestioned adoption of the biomedical model. As their political culture changes, many social structures have had to be revisited, and for nursing, this has meant the introduction of theoretical reasoning, teaching, and practice.

  3. Conformational analysis of a covalently cross-linked Watson-Crick base pair model.

    Science.gov (United States)

    Jensen, Erik A; Allen, Benjamin D; Kishi, Yoshito; O'Leary, Daniel J

    2008-11-15

    Low-temperature NMR experiments and molecular modeling have been used to characterize the conformational behavior of a covalently cross-linked DNA base pair model. The data suggest that Watson-Crick or reverse Watson-Crick hydrogen bonding geometries have similar energies and can interconvert at low temperatures. This low-temperature process involves rotation about the crosslink CH(2)C(5') (psi) carbon-carbon bond, which is energetically preferred over the alternate CH(2)N(3) (phi) carbon-nitrogen bond rotation.

  4. Conformational Analysis of a Covalently Cross-Linked Watson-Crick Base Pair Model

    OpenAIRE

    Jensen, Erik A.; Allen, Benjamin D.; Kishi, Yoshito; O'Leary, Daniel J.

    2008-01-01

    Low temperature NMR experiments and molecular modeling have been used to characterize the conformational behavior of a covalently cross-linked DNA base pair model. The data suggest that Watson-Crick or reverse Watson-Crick hydrogen bonding geometries have similar energies and can interconvert at low temperatures. This low-temperature process involves rotation about the crosslink CH2–C(5′) (ψ) carbon-carbon bond, which is energetically preferred over the alternate CH2–N(3) (ϕ) carbon-nitrogen ...

  5. J. B. Watson y la Publicidad, los Inicios de la Psicología del Consumidor

    Directory of Open Access Journals (Sweden)

    FELIPE PARRADO CORREDOR

    2013-12-01

    Full Text Available Research regarding the behavior of individuals with respect to products and services dates back to the beginning of the 20th century, and J. B. Watson is one of its main precursors. Watson taught an applied psychology course called Psychology of Advertising, introduced many companies to experimental techniques for the marketing of their products, and, after retiring from academic life, joined the Walter Thompson advertising agency, where he developed massive campaigns using the principles of conditioned emotional responses. The article highlights the importance of Watson’s work in the psychology of advertising, as a forerunner of the scientific developments of consumer psychology.

  6. Genetic engineering: a matter that requires further refinement in Spanish secondary school textbooks

    Science.gov (United States)

    Martínez-Gracia, M. V.; Gil-Quýlez, M. J.

    2003-09-01

    Genetic engineering is now an integral part of many high school textbooks but little work has been done to assess whether it is being properly addressed. A checklist with 19 items was used to analyze how genetic engineering is presented in biology textbooks commonly used in Spanish high schools, including the content, its relationship with fundamental genetic principles, and how it aims to improve the genetic literacy of students. The results show that genetic engineering was normally introduced without a clear reference to the universal genetic code, protein expression or the genetic material shared by all species. In most cases it was poorly defined, without a clear explanation of all the relevant processes involved. Some procedures (such as vectors) were explained in detail without considering previous student knowledge or skills. Some books emphasized applications such as the human genome project without describing DNA sequencing. All books included possible repercussions, but in most cases only fashionable topics such as human cloning. There was an excess of information that was not always well founded and hence was unsuitable to provide a meaningful understanding of DNA technology required for citizens in the twenty-first century.

  7. Massachusetts Institute of Technology School of Chemical Engineering Practice, Brookhaven station: Summary of projects, 1983-1986

    International Nuclear Information System (INIS)

    1987-11-01

    The MIT Graduate School of Chemical Engineering Practice stresses engineering problem solving. The Practice School program, as it is commonly called, develops in a unique and particularly effective way the student's ability to apply fundamentals to problems in the chemical industry and thus accelerates one's professional development. The themes of atomization, emthanol production and utilization, hydrogen production and compression, localized electrochemical corrosion and biochemical engineering reflect some of the major programs at the Laboratory. The titles of all the projects are listed in chronological order in the index at the end of this document. Brief summaries are presented for each project with related projects grouped together

  8. Quality Assessment Survey at the School of Civil Engineering at Aalborg University

    DEFF Research Database (Denmark)

    Brohus, Henrik

    2008-01-01

    the study board of civil engineering. The questionnaire was jointly developed for all study boards at Aalborg University. The questionnaire forms an investigation of students' satisfaction and evaluation of the overall structure of the education including self-reported performance assessment. The paper......As part of an improved quality assessment procedure at the School of Civil Engineering at Aalborg University, an online survey has been undertaken among all students. Due to external requirements and a wish for more structured feedback, an online questionnaire was presented to all students under...... discusses the structure of the questionnaire and presents the results. Finally, suggestions for improvements regarding the questionnaire and further quality assessment are included. The response rate was 40%. Overall, the results showed a general satisfaction with the studies although substantial variance...

  9. Distortions and gender-related differences in the perception of mechanical engineering in high school students.

    Science.gov (United States)

    Ferrando Piera, Pere Joan; Gutiérrez-Colón Plana, Mar; Paleo Cageao, Paloma; de la Flor López, Silvia; Ferrando Piera, Francesc

    2013-01-01

    The reason for this study was the low interest that high school students, particularly females, show for the subject of mechanical engineering (ME). We assumed that this problem was partly due to: (a) lack of understanding of the tasks involved in ME, and (b) a distorted and negative perception of the professional environment and working conditions. To assess these two assumptions, two measurement instruments (tasks and perceptions) were developed and administered in a sample of 496 high school students. A multiple-group design was used and data was analyzed by using an extended item response theory model. In general terms, the results agreed with our expectations. However, no significant gender differences were found. The implications of the results for future improvements are discussed.

  10. High School Graphics Experience Influencing the Self-Efficacy of First-Year Engineering Students in an Introductory Engineering Graphics Course

    Science.gov (United States)

    Metraglia, Riccardo; Villa, Valerio; Baronio, Gabriele; Adamini, Riccardo

    2015-01-01

    Today's students enter engineering colleges with different technical backgrounds and prior graphics experience. This may due to their high school of provenience, which can be technical or non-technical. The prior experience affects students' ability in learning and hence their motivation and self-efficacy beliefs. This study intended to evaluate…

  11. The Watson-Glaser Critical Thinking Appraisal and the Performance of Business Management Students.

    Science.gov (United States)

    Hicks, R. E.; Southey, G. N.

    1990-01-01

    The 80-item Watson-Glaser Critical Thinking Appraisal-Form A was administered to 415 business management students in Australia as a step toward adapting the test for Australian use. The results correspond reasonably closely to the U.S. data. Analysis of group results and item statistics provided information about necessary modifications. (SLD)

  12. Laser-assisted collisions: The Kroll-Watson formula and bremsstrahlung theory

    International Nuclear Information System (INIS)

    Geltman, S.

    1996-01-01

    Recent measurements on CO 2 -laser-assisted electron-atom collisions have shown large inconsistencies with the Kroll-Watson formula for small-angle scattering. We have carried out a detailed study to compare the predictions of Kroll-Watson theory (for both single and multimode fields) with those of conventional perturbation theory for stimulated free-free transitions. It is found that for E 0 /2ω 2 <1, where perturbation theory is valid, there are large differences with the Kroll-Watson theory. Comparisons of experimental variations with respect to scattering angle and electron energy show much better agreement with perturbation theory than with Kroll-Watson theory. A study of the angular variations in perturbation theory shows that use of the open-quote open-quote outgoing close-quote close-quote wave final state gives much better agreement with experiment than does the open-quote open-quote ingoing close-quote close-quote wave final state, which is different from the choice made in early bremsstrahlung theory. copyright 1996 The American Physical Society

  13. On the extension of the Fermi-Watson Theorem to high energy diffraction

    International Nuclear Information System (INIS)

    Malecki, A.; Istituto Nazionale di Fisica Nucleare, Frascati

    1995-12-01

    The Fermi-Watson theorem, established for low energy reactions and then applied to high energy collision, is revisited. Its use for the processes of inelastic diffraction is discussed. The theorem turns out to be valid in the case inclusive cross-section of diffractive transition

  14. AVE bond index in the H-bond of the Watson-Crick pairs

    International Nuclear Information System (INIS)

    Giambiagi, M.; Giambiagi, M.S. de; Barroso Filho, W.

    1981-01-01

    The normal Watson-Crick base pairs are treated as super-molecules. The properties of the electronic distribution along the N-H...Y bonds are studied in an all-valence-electrons calculation, through a bond index formula devised for non-orthogonal basis. Eletronic density diagrams of the adenine-uracil base pair are analysed. (Auhor) [pt

  15. Watson-Crick base pairs with thiocarbonyl groups: How sulfur changes the hydrogen bonds in DNA

    NARCIS (Netherlands)

    Fonseca Guerra, C.; Baerends, E.J.; Bickelhaupt, F.M.

    2008-01-01

    We have theoretically analyzed mimics of Watson-Crick AT and GC base pairs in which N-H•••O hydrogen bonds are replaced by N-H•••S, using the generalized gradient approximation (GGA) of density functional theory at BP86/TZ2P level. The general effect of the above substitutions is an elongation and a

  16. Substituent effif ects on hydrogen bonding in Watson-Crick base pairs. A theoretical study

    NARCIS (Netherlands)

    Fonseca Guerra, C.; van der Wijst, T.; Bickelhaupt, F.M.

    2005-01-01

    We have theoretically analyzed Watson-Crick AT and GC base pairs in which purine C8 and/or pyrimidine C6 positions carry a substituent X = H, F, Cl or Br, using the generalized gradient approximation (GGA) of density functional theory at BP86/TZ2P. The purpose is to study the effects on structure

  17. Finding Little Albert: A Journey to John B. Watson's Infant Laboratory

    Science.gov (United States)

    Beck, Hall P.; Levinson, Sharman; Irons, Gary

    2009-01-01

    In 1920, John Watson and Rosalie Rayner claimed to have conditioned a baby boy, Albert, to fear a laboratory rat. In subsequent tests, they reported that the child's fear generalized to other furry objects. After the last testing session, Albert disappeared, creating one of the greatest mysteries in the history of psychology. This article…

  18. Hazardous Waste Cleanup: IBM Corporation-TJ Watson Research Center in Yorktown Heights, New York

    Science.gov (United States)

    IBM Corporation -TJ Watson Research Center is located in southern Yorktown near the boundary separating the Town of Yorktown from the Town of New Castle. The site occupies an area of approximately 217 acres and adjoins land uses are predominantly residenti

  19. Continuous CS Analysis of Using the SIEM to Introduction to Computer Programming Education in the School of Engineering Evening Division at the Department of Electrical and Electronic Engineering

    Science.gov (United States)

    Dohi, Shinichi; Miyakawa, Osamu; Konno, Noriko

    In order to improve students’ motivation, the SIEM (School of Information Environment Method) which is the education method for the introduction of the computer programming education was developed. We focus on students’ motivation, and we have measured students’ motivation as the educational effects. After the SIEM was developed in the School of Information Environment, it applied to introduction to the computer programming education in the School of Engineering Evening Division at the Department of Electrical and Electronic Engineering. It is effective for the improvement of students’ motivation. By adding the Customer Satisfaction Analysis to the SIEM Analysis, it was able to clarify the priority level of the SIEM assessment item. In this paper, we describe results of the Customer Satisfaction Analysis.

  20. On a Vision to Educating Students in Sustainability and Design—The James Madison University School of Engineering Approach

    Directory of Open Access Journals (Sweden)

    Olga Pierrakos

    2011-12-01

    Full Text Available In order for our future engineers to be able to work toward a sustainable future, they must be versed not only in sustainable engineering but also in engineering design. An engineering education must train our future engineers to think flexibly and to be adaptive, as it is unlikely that their future will have them working in one domain. They must, instead, be versatilists. The School of Engineering at James Madison University has been developed from the ground up to provide this engineering training with an emphasis on engineering design, systems thinking, and sustainability. Neither design nor sustainability are mutually exclusive, and consequently, an education focusing on design and sustainability must integrate these topics, teaching students to follow a sustainable design process. This is the goal of the James Madison University School of Engineering. In this paper, we present our approach to curricular integration of design and sustainability as well as the pedagogical approaches used throughout the curriculum. We do not mean to present the School’s model as an all or nothing approach consisting of dependent elements, but instead as a collection of independent approaches, of which one or more may be appropriate at another university.

  1. Pioneering Integrated Education and Research Program in Graduate School of Engineering and its Inquiry by Questionnaire

    Science.gov (United States)

    Minamino, Yoritoshi

    Department of Adaptive Machine Systems, Department of Materials and Manufucturing Science and Department of Business engineering have constructed the educational programs of consecutive system from master to doctor courses in graduate school of engineering, “Pioneering Integrated Education and Research Program (PP) ”, to produce volitional and original mind researchers with high abilities of research, internationality, leader, practice, management and economics by cooperation between them for reinforcement of their ordinary curriculums. This program consists of the basic PP for master course students and the international exchange PP, leadership pp and tie-up PP of company and University for Doctor course students. In 2005th the basic PP was given to the master course students and then their effectiveness of the PP was investigated by questionnaire. The results of questionnaire proved that the graduate school students improved their various abilities by the practical lesson in cooperation between companies and our Departments in the basic PP, and that the old boys after basic PP working in companies appreciated the advantages to business planning, original conception, finding solution, patents, discussion, report skills required in companies.

  2. Book of abstracts Chemical Engineering: IV All-Russian Conference on chemical engineering, All-Russian Youth Conference on chemical engineering, All-Russian school on chemical engineering for young scientists and specialists. Organic substances and pharmaceuticals engineering. Petrochemistry and chemical processing of alternative feedstock

    International Nuclear Information System (INIS)

    Zakhodyaeva, Yu.A.; Belova, V.V.

    2012-01-01

    In the given volume of abstracts of the IV All-Russian Conference on chemical engineering, All-Russian Youth Conference on chemical engineering, All-Russian school on chemical engineering for young scientists and specialists (Moscow, March 18-23, 2012) there are the abstracts of the reports concerning organic substances and pharmaceuticals engineering, petrochemistry and chemical processing of alternative feedstock. The abstracts deal with state-of-the-art and future development of theoretical and experimental investigations as well as with experience in practical realization of development works in the field of chemical engineering and relative areas [ru

  3. Book of abstracts Chemical Engineering: IV All-Russian Conference on chemical engineering, All-Russian Youth Conference on chemical engineering, All-Russian school on chemical engineering for young scientists and specialists. Plenary reports. Engineering of inorganic substances and materials

    International Nuclear Information System (INIS)

    Zakhodyaeva, Yu.A.; Belova, V.V.

    2012-01-01

    In the given volume of abstracts of the IV All-Russian Conference on chemical engineering, All-Russian Youth Conference on chemical engineering, All-Russian school on chemical engineering for young scientists and specialists (Moscow, March 18-23, 2012) there are the abstracts of the reports concerning chemical engineering of inorganic substances and materials. The abstracts deal with state-of-the-art and future development of theoretical and experimental investigations as well as with experience in practical realization of development works in the field of chemical engineering and relative areas [ru

  4. Discourses of Indiscipline: An Informal Hobbesian Riposte to Cate Watson

    Science.gov (United States)

    McManus, Michael

    2006-01-01

    Classroom battles are real and not a metaphor. Warfare is a historical and present fact of human life. Life really is a battle and conflict inevitable; injuries to the psyche are just as real as those to the body. Schools cannot step outside society. It is not Foucault but Thomas Hobbes who offers the most perceptive insight into human behaviour…

  5. Multicultural and multilingual approach: Mathematics, science, and engineering education for junior high school minority students and high school administrators. Final report

    Energy Technology Data Exchange (ETDEWEB)

    Crumbly, I.J.; Hodges, J.

    1994-09-01

    During the 1993 school year, LLNL and the US Department of Energy`s San Francisco Field Office provided funds through grant {number_sign}DE-FG03-93SF20045/A000 to assist Cooperative Developmental Energy Program (CDEP) with its network coalition of high school counselors from 19 states and with its outreach and early intervention program in mathematics, science and engineering for minority junior high school students. The program for high school counselors is called the National Educators Orientation Program (NEOP) and the outreach program for minority junior high school students is called the Mathematics, Science and Engineering Academy (MSEA). A total of 35 minority and female rising eighth grade students participated in the Second Annual Mathematics, Science, and Engineering Academy sponsored by the Cooperative Developmental Energy Program of Fort Valley State College (FVSC). There were 24 students from the middle Georgia area, 4 students from Oakland, California, and 7 students from Portland, Oregon. Each student was selected by counselor in his or her respective school. The selection criteria were based on the students` academic performance in science and mathematics courses.

  6. EXPLORING THE PROBLEMS FACED BY TECHNICAL SCHOOL STUDENTS IN LEARNING ENGINEERING COURSES

    Directory of Open Access Journals (Sweden)

    RAMLEE MUSTAPHA

    2014-12-01

    Full Text Available The teaching of engineering courses is relatively challenging due to the nature of the courses that are perceived as “difficult courses” by a number of students. Thus, the purpose of this action research was to explore the problems faced by electrical and electronic engineering (PKEE students studying a difficult topic–transistor. This research was also aimed at identifying the students’ attitude towards Problem-based Learning (PBL. Literature has shown that PBL could enhance students’ understanding and make the learning more meaningful. The theoretical framework of this study was based on Kemmis and Mc Taggart model. Cooperative learning method was also utilised in this study consisted of Jigsaw technique in the first and second rounds of the study. In the final round, the discussion method was used. In an action research design, a classroom is a usual research site. Thus, an engineering class of 30 Form 5 students in a Technical School was selected. The PBL method was applied in the class for a nine-week duration. Empirical data were gathered from peer assessment, observation, and pre- and post-tests. The data were described descriptively using frequency, mean and standard deviation. The main results show that the students were more interactive and their post-test result shows significant increases. In terms of the attitude towards PBL, the participants rated PBL highly. The participants also assert that the main benefits of PBL include enhancing their collaborative and problem-solving skills.

  7. Base Input - Enrollment and Graduation Data for Naval Postgraduate School for the School of Business and Public Policy, Meyer Institute of Systems Engineering, and PhD Grads by curriculum by year.

    OpenAIRE

    2005-01-01

    Graphs of Base Input - Enrollment and Graduation Data for Naval Postgraduate School for the School of Business and Public Policy, Meyer Institute of Systems Engineering, and PhD Grads by curriculum by year.

  8. Evaluation of American Indian Science and Engineering Society Intertribal Middle School Science and Math Bowl Project

    Energy Technology Data Exchange (ETDEWEB)

    AISES, None

    2013-09-25

    The American Indian Science and Engineering Society (AISES) has been funded under a U.S. Department of Energy (DOE) grant (Grant Award No. DE-SC0004058) to host an Intertribal Middle-School Science and Math Bowl (IMSSMB) comprised of teams made up of a majority of American Indian students from Bureau of Indian Education-funded schools and public schools. The intent of the AISES middle school science and math bowl is to increase participation of American Indian students at the DOE-sponsored National Science Bowl. Although national in its recruitment scope, the AISES Intertribal Science and Math Bowl is considered a “regional” science bowl, equivalent to the other 50 regional science bowls which are geographically limited to states. Most regional bowls do not have American Indian student teams competing, hence the AISES bowl is meant to encourage American Indian student teams to increase their science knowledge in order to participate at the national level. The AISES competition brings together teams from various American Indian communities across the nation. Each team is provided with funds for travel to and from the event, as well as for lodging and meals. In 2011 and 2012, there were 10 teams participating; in 2013, the number of teams participating doubled to 20. Each Science and Math Bowl team is comprised of four middle school — grades 6 through 8 — students, one alternate, and a teacher who serves as advisor and coach — although in at least two cases, the coach was not a teacher, but was the Indian Education Coordinator. Each team member must have at least a 3.0 GPA. Furthermore, the majority of students in each team must be comprised of American Indian, Alaska Native or Native Hawaiian students. Under the current DOE grant, AISES sponsored three annual middle school science bowl competitions over the years 2011, 2012 and 2013. The science and math bowls have been held in late March concurrently with the National American Indian Science and

  9. The Engineering Graphics Olimpiad as a Means for Students’ Creative Professional Competence Formation in the Technical Higher School

    Directory of Open Access Journals (Sweden)

    N. S. Bushmakina

    2013-01-01

    Full Text Available The paper is devoted to the creative professional competence development by the technical high school students – the prospective building engineers – by means of the Engineering Graphics Olympiad. The authors in- vestigate the concepts of the creative competences, creative abilities, creative professional competences, and denote the structure of the engineering- graphic competence. Its main components, singled out by the group expert assessment, form the basis for the Olympiad content regarding its selection and major rounds. For the more argumentative selection it is recommended to provide the pedagogic expertise corresponding with the requirements of the Federal State Educational Standards and considering the students’ level. The formation levels of the competence in question are discussed along with the corresponding knowledge and skills. The authors present the brief analysis of the research outcomes and make a conclusion about the necessity of stu- dents’ additional preparatory work regarding the specificity of the engineering graphics training in the technical higher school

  10. A comparative study of the second-order Born and Faddeev-Watson approximations for electron-atom collisions

    International Nuclear Information System (INIS)

    Fargher, H.E.; Roberts, M.J.

    1983-01-01

    Simplified versions of the second-order Born and Faddeev-Watson approximations are applied to the excitation of the n=2 levels of atomic hydrogen by the impact of 54.4 eV electrons. The theories are compared with the measurements of differential cross sections and angular correlation parameters. The results indicate that the Born approximation is better at low angles of scattering but that the Faddeev-Watson approximation is better at high angles. The importance of the phases of the two-body T matrices in the Faddeev-Watson approximation is illustrated. (author)

  11. Analysis of nuclear and radiological events. Textbook for lecture in graduate school of engineering in the University of Tokyo

    International Nuclear Information System (INIS)

    Watanabe, Norio

    2007-02-01

    The Japan Atomic Energy Agency is carrying out the cooperative activity by providing specialized educational and training staff and making our facilities available for the graduate school of engineering in The University of Tokyo as part of developing human resources in nuclear technology. This report is prepared as a textbook for the lecture in the graduate school of engineering in The University of Tokyo and provides the outlines of activities on the analysis of nuclear and radiological events and analysis methods as well as the summaries of major incidents and accidents that occurred. (author)

  12. Evaluation of the Academy of Math, Science, and Engineering at Luther Burbank High School During the 1984-85 School Year. Evaluation Report No. 21.

    Science.gov (United States)

    Sacramento City Unified School District, CA.

    The Academy of Math, Science, and Engineering was established at the Luther Burbank High School of Sacramento, California as a rigorous and competitive academic alternative program. This report contains an evaluation of the second year (1984-85) of the program. Program accomplishments are reviewed in the categories of: (1) student enrollment; (2)…

  13. Engineering Encounters: Engineering Adaptations

    Science.gov (United States)

    Gatling, Anne; Vaughn, Meredith Houle

    2015-01-01

    Engineering is not a subject that has historically been taught in elementary schools, but with the emphasis on engineering in the "Next Generation Science Standards," curricula are being developed to explicitly teach engineering content and design. However, many of the scientific investigations already conducted with students have…

  14. Seeking new paths by attempting avant-garde teaching methods through translation and creative writing for classes of English for Academic Purposes (EAP) . The cases of the Schools of Engineering, Departments of Mechanical Engineering, Informatics and Tele

    OpenAIRE

    CHRISTIDOU, SOFIA; KAMAROUDIS, STAVROS E.

    2016-01-01

    The aim of our paper is to discuss how the courses of English Language of the Department of Applied and Visual Arts of the School of Fine Arts and of the Departments of Mechanical Engineering, Informatics and Telecommunications Engineering of the School of Engineering of the University of Western Macedonia were taught during the academic year 2014-5 and how students reacted towards the teaching approaches that were adopted. For reasons of economy of space we present here only the experiment t...

  15. Students' and teachers' perceptions: initial achievements of a Project-Based Engineering School

    Science.gov (United States)

    Terrón-López, María-José; Velasco-Quintana, Paloma-Julia; García-García, María-José; Ocampo, Jared R.

    2017-11-01

    A unified academic model based on the project-based learning (PBL) methodology was implemented, in the 2012-2013 period, in the School of Engineering at Universidad Europea de Madrid. The purpose of this paper is to explore whether teachers and students participating in the capstone projects feel that the objectives for which this methodology was designed for are being achieved. The data were collected through interviews to participants at the end of the PBL experience. The results are encouraging, as students seem to be more motivated, and they say that they are experiencing deeper learning, and have developed key competitive skills required for their professional lives. Findings also suggest that teachers face positively the PBL as a learning approach since they perceive that students obtain a deeper learning, develop transversal skills with the projects and are more engaged with their studies. Implications and recommendations for the future of the model are also discussed.

  16. O pensamento em Watson: rompendo com o legado metafísico e buscando uma referência materializante

    Directory of Open Access Journals (Sweden)

    Cláudio Ivan de Oliveira

    Full Text Available O trabalho de Watson sobre o pensamento foi tratado inadequadamente por muitos intérpretes, gerando uma lacuna na interpretação histórica visto que Watson exerceu ampla influência sobre a Psicologia. Nosso objetivo é sanar parte deste problema esclarecendo as principais posições de Watson sobre pensamento. Nossa hipótese é que a teoria watsoniana sobre o pensamento como hábito é uma forma de referencialização materializante influenciada pela desmetafisicização do pensamento Ocidental proveniente do Iluminismo. Admitimos que a teoria de Watson reproduziu premissas do erro de categoria cartesiano. Assumimos também que a prioritária associação entre pensamento e linguagem watsoniana denuncia influências indiretas da tradição filosófica grega clássica.

  17. Meltwater chemistry and solute export from a Greenland ice sheet catchment, Watson River, West Greenland

    DEFF Research Database (Denmark)

    Yde, Jacob C.; Knudsen, N. Tvis; Hasholt, Bent

    2014-01-01

    –2010 for the Watson River sector of the GrIS that drains into the fjord Kangerlussuaq. The hydrochemistry is dominated by Ca2+ and HCO3− with a relatively high molar K+/Na+ ratio of 0.6 ± 0.1, typical for meltwaters draining a gneissic lithology. Low molar Ca2+/Na+ and Mg2+/Na+ ratios indicate that weathering....... However, when normalized by discharge the denudation rates are comparable to other Arctic sites. When extrapolating the results from the Watson River catchment to the entire Greenland for 2007–2010, the solute export from Greenland meltwater varied between 7.1 × 106 and 7.8 × 106 tons, whilst the major...

  18. Watson-Crick base pairing controls excited-state decay in natural DNA.

    Science.gov (United States)

    Bucher, Dominik B; Schlueter, Alexander; Carell, Thomas; Zinth, Wolfgang

    2014-10-13

    Excited-state dynamics are essential to understanding the formation of DNA lesions induced by UV light. By using femtosecond IR spectroscopy, it was possible to determine the lifetimes of the excited states of all four bases in the double-stranded environment of natural DNA. After UV excitation of the DNA duplex, we detected a concerted decay of base pairs connected by Watson-Crick hydrogen bonds. A comparison of single- and double-stranded DNA showed that the reactive charge-transfer states formed in the single strands are suppressed by base pairing in the duplex. The strong influence of the Watson-Crick hydrogen bonds indicates that proton transfer opens an efficient decay path in the duplex that prohibits the formation or reduces the lifetime of reactive charge-transfer states. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  19. Visualizing Transient Watson-Crick Like Mispairs in DNA and RNA Duplexes

    Science.gov (United States)

    Kimsey, Isaac J.; Petzold, Katja; Sathyamoorthy, Bharathwaj; Stein, Zachary W.; Al-Hashimi, Hashim M.

    2015-01-01

    Rare tautomeric and anionic nucleobases are believed to play fundamental biological roles but their prevalence and functional importance has remained elusive because they exist transiently, in low-abundance, and involve subtle movements of protons that are difficult to visualize. Using NMR relaxation dispersion, we show that wobble dG•dT and rG•rU mispairs in DNA and RNA duplexes exist in dynamic equilibrium with short-lived, low-populated Watson-Crick like mispairs that are stabilized by rare enolic or anionic bases. These mispairs can evade Watson-Crick fidelity checkpoints and form with probabilities (10−3-10−5) that strongly imply a universal role in replication and translation errors. Our results indicate that rare tautomeric and anionic bases are widespread in nucleic acids, expanding their structural and functional complexity beyond that attainable with canonical bases. PMID:25762137

  20. Visualizing transient Watson-Crick-like mispairs in DNA and RNA duplexes.

    Science.gov (United States)

    Kimsey, Isaac J; Petzold, Katja; Sathyamoorthy, Bharathwaj; Stein, Zachary W; Al-Hashimi, Hashim M

    2015-03-19

    Rare tautomeric and anionic nucleobases are believed to have fundamental biological roles, but their prevalence and functional importance has remained elusive because they exist transiently, in low abundance, and involve subtle movements of protons that are difficult to visualize. Using NMR relaxation dispersion, we show here that wobble dG•dT and rG•rU mispairs in DNA and RNA duplexes exist in dynamic equilibrium with short-lived, low-populated Watson-Crick-like mispairs that are stabilized by rare enolic or anionic bases. These mispairs can evade Watson-Crick fidelity checkpoints and form with probabilities (10(-3) to 10(-5)) that strongly imply a universal role in replication and translation errors. Our results indicate that rare tautomeric and anionic bases are widespread in nucleic acids, expanding their structural and functional complexity beyond that attainable with canonical bases.

  1. Project-based learning in a high school engineering program: A case study

    Science.gov (United States)

    France, Todd

    Generating greater student interest in science, technology, engineering, and mathematics (STEM) has been a major topic of discussion among educators, policymakers, and researchers in recent years, as increasing the number of graduates in these fields is widely considered a necessary step for sustaining the progress of today's society. Fostering this interest must occur before students reach college, and substantial efforts have been made to engage students at K-12 levels in STEM-focused learning. Attempts to involve students in engineering, a vital and growing profession, yet one in which students often have little experience, have frequently emphasized the design and construction of physical products, a practice supported by project-based learning. This thesis examines the environment of an engineering high school course that employed the project-based model. The course is part of a dedicated curricular program which aims to provide students with positive experiences in engineering-related activities while also preparing them for the rigors of college. A case study was conducted to provide insight into the benefits and drawbacks of the learning model. The study's outcomes are intended to provide guidance to educators participating in the design and/or facilitation of project-based activities, particularly those involved with engineering education. The research was performed using a qualitative approach. Long-term engagement with course participants was deemed critical to gaining a comprehensive understanding of the interactions and events that transpired on a daily basis. Nine educators involved with the program were interviewed, as were nineteen of the course's thirty-nine students. A wealth of other relevant data -- including surveys, field notes, and evaluations of student work -- was compiled for analysis as well. The study findings suggest that experiences in problem solving and teamwork were the central benefits of the course. Limitations existed due to a

  2. Complexes of DNA bases and Watson-Crick base pairs with small neutral gold clusters.

    Science.gov (United States)

    Kryachko, E S; Remacle, F

    2005-12-08

    The nature of the DNA-gold interaction determines and differentiates the affinity of the nucleobases (adenine, thymine, guanine, and cytosine) to gold. Our preliminary computational study [Kryachko, E. S.; Remacle, F. Nano Lett. 2005, 5, 735] demonstrates that two major bonding factors govern this interaction: the anchoring, either of the Au-N or Au-O type, and the nonconventional N-H...Au hydrogen bonding. In this paper, we offer insight into the nature of nucleobase-gold interactions and provide a detailed characterization of their different facets, i.e., geometrical, energetic, and spectroscopic aspects; the gold cluster size and gold coordination effects; proton affinity; and deprotonation energy. We then investigate how the Watson-Crick DNA pairing patterns are modulated by the nucleobase-gold interaction. We do so in terms of the proton affinities and deprotonation energies of those proton acceptors and proton donors which are involved in the interbase hydrogen bondings. A variety of properties of the most stable Watson-Crick [A x T]-Au3 and [G x C]-Au3 hybridized complexes are described and compared with the isolated Watson-Crick A x T and G x C ones. It is shown that enlarging the gold cluster size to Au6 results in a rather short gold-gold bond in the Watson-Crick interbase region of the [G x C]-Au6 complex that bridges the G x C pair and thus leads to a significant strengthening of G x C pairing.

  3. Enhancing non-technical skills by a multidisciplinary engineering summer school

    Science.gov (United States)

    Larsen, Peter Gorm; Kristiansen, Erik Lasse; Bennedsen, Jens; Bjerge, Kim

    2017-11-01

    In general engineering studies focus on the technical skills in their own discipline. However, in their subsequent industrial careers, a significant portion of their time needs to be devoted to non-technical skills. In addition, in an increasingly globalised world collaboration in teams across cultures and disciplines is paramount to the creation of new and innovative products. In order to enhance the non-technical skills for groups of engineering students a series of innovation courses has been arranged and delivered in close collaboration with an industrial company (Bang & Olufsen). These courses have been organised as summer schools called 'Conceptual Design and Development of Innovative Products' (CD-DIP) and delivered outside the usual educational environment. In order to explore the impact of this single course, we have conducted a study among the students participating from 2007 to 2013. This has been carried out both qualitatively using interviews with selected students as well as quantitatively using a survey. The results are outstanding in demonstrating that the non-technical skills obtained in this single course have been of high value for a large portion of the students' subsequent professional life.

  4. DEVELOPMENT OF INTEGRATED ELECTROCHEMISTRY TEACHING MATERIAL BASED CONTEXTUAL FOR VOCATIONAL HIGH SCHOOL IN MACHINE ENGINEERING DEPARTEMENT

    Directory of Open Access Journals (Sweden)

    Wiwik Widodo

    2017-10-01

    Full Text Available The chemistry teaching at Vocational High School which tends to be theoretical and not directly connected to vocational lesson has caused students to have low interest, low motivation, and low achievement. The problem is becoming more complex due to limited time allotment and limited teaching materials. One of the efforts to solve the problem is by providing the relevant teaching material using contextual learning approach. The aims of this Research and Development (R&D research are: (1 to produce an appropriate chemistry teaching material on electrochemistry integrated with skill program subjects using Contextual approach for Vocational High School students of Machinery Engineering Department; (2 to know the feasibility of development result of teaching material. The development of the teaching material uses the 4D developmental model from Thiagarajan et al consisting of four phases namely Define, Design, Develop, and Desiminate. The dominate phase was not done. The scores of evaluation of the feasibility or the appropriateness of the product from the content expert are 88.75% (very feasible for the teachers’ book and 91.25% (very feasible for the students’ book. The expert on media gave 89.25% (very feasible for the teachers’ book and 89.9% (very feasible for the students’ book. The result of readability test shows that the teachers’ book is feasible (83.81% and the students’ book is very feasible (93.61%.

  5. Introducing High School Students to Chemical Engineering Kinetics with a Simple Experiment-Based Smartphone Education Application

    Science.gov (United States)

    Stanley, Simone; Ymele-Leki, Patrick

    2017-01-01

    A community outreach project was integrated in a District of Columbia public schools summer internship program for students from underrepresented minorities in STEM. The project introduced these students to fundamental engineering principles by leveraging a smartphone application (App) so readily accessible and attractive to them that it boosted…

  6. Girls in Engineering, Mathematics and Science, GEMS: A Science Outreach Program for Middle-School Female Students

    Science.gov (United States)

    Dubetz, Terry A.; Wilson, Jo Ann

    2013-01-01

    Girls in Engineering, Mathematics and Science (GEMS) is a science and math outreach program for middle-school female students. The program was developed to encourage interest in math and science in female students at an early age. Increased scientific familiarity may encourage girls to consider careers in science and mathematics and will also help…

  7. Effects of South Korean High School Students' Motivation to Learn Science and Technology on Their Concern Related to Engineering

    Science.gov (United States)

    Lee, Eunsang

    2017-01-01

    This study investigated the gender difference among South Korean high school students in science learning motivation, technology learning motivation, and concern related engineering, as well as the correlation between these factors. It also verified effects of the sub-factors of science learning motivation and technology learning motivation on…

  8. National STEM School Education Strategy: A Comprehensive Plan for Science, Technology, Engineering and Mathematics Education in Australia

    Science.gov (United States)

    Education Council, 2015

    2015-01-01

    There are many factors that affect student engagement in science, technology, engineering and mathematics (STEM). Underlying this are the views of the broader community--and parents in particular--about the relevance of STEM, and the approach to the teaching and learning of STEM from the early years and continuing throughout schooling. Connected…

  9. Comparable stability of Hoogsteen and Watson-Crick base pairs in ionic liquid choline dihydrogen phosphate.

    Science.gov (United States)

    Tateishi-Karimata, Hisae; Nakano, Miki; Sugimoto, Naoki

    2014-01-08

    The instability of Hoogsteen base pairs relative to Watson-Crick base pairs has limited biological applications of triplex-forming oligonucleotides. Hydrated ionic liquids (ILs) provide favourable environments for a wide range of chemical reactions and are known to impact the stabilities of Watson-Crick base pairs. We found that DNA triplex formation was significantly stabilized in hydrated choline dihydrogen phosphate as compared with an aqueous buffer at neutral pH. Interestingly, the stability of Hoogsteen base pairs was found to be comparable with that of Watson-Crick base pairs in the hydrated IL. Molecular dynamics simulations of a DNA triplex in the presence of choline ions revealed that the DNA triplex was stabilized because of the binding of choline ion around the third strand in the grooves. Our finding will facilitate the development of new DNA materials. Our data also indicate that triplex formation may be stabilized inside cells where choline ions and their derivatives are abundant in vivo.

  10. When a clear strong voice was needed: A retrospective review of Watson's (1924/1930) behaviorism.

    Science.gov (United States)

    Malone, John C; García-Penagos, Andrés

    2014-07-25

    Despite the attention given John B. Watson during the century since he introduced behaviorism, there remain questions about what he really contributed. He is still appropriately criticized for his arrogant self-promotion and especially for his perceived emphasis on a simple S-R reflexology. However, we argue that the former was necessary at the time and that criticism of Watson on the second count only diverts attention from the genuine contributions that he did make. In support of these contentions we examine several aspects of his contributions that warrant clarification, namely, his promotion of applied comparative psychology, his views on the nature of mind, his originality, criticism from and respect afforded by contemporaries, his relation to recent interest in "the embodiment of mind," his treatment of thinking, and his appreciation of Freud's work. We organize our discussion around specific chapters of the two editions of Behaviorism, but in support of our arguments we include publications of Watson that are less well known. Those works develop some important points that are only briefly treated in both editions of Behaviorism. © Society for the Experimental Analysis of Behavior.

  11. A sociocultural analysis of Latino high school students' funds of knowledge and implications for culturally responsive engineering education

    Science.gov (United States)

    Mejia, Joel Alejandro

    Previous studies have suggested that, when funds of knowledge are incorporated into science and mathematics curricula, students are more engaged and often develop richer understandings of scientific concepts. While there has been a growing body of research addressing how teachers may integrate students' linguistic, social, and cultural practices with science and mathematics instruction, very little research has been conducted on how the same can be accomplished with Latino and Latina students in engineering. The purpose of this study was to address this gap in the literature by investigating how fourteen Latino and Latina high school adolescents used their funds of knowledge to address engineering design challenges. This project was intended to enhance the educational experience of underrepresented minorities whose social and cultural practices have been traditionally undervalued in schools. This ethnographic study investigated the funds of knowledge of fourteen Latino and Latina high school adolescents and how they used these funds of knowledge in engineering design. Participant observation, bi-monthly group discussion, retrospective and concurrent protocols, and monthly one-on-one interviews were conducted during the study. A constant comparative analysis suggested that Latino and Latina adolescents, although profoundly underrepresented in engineering, bring a wealth of knowledge and experiences that are relevant to engineering design thinking and practice.

  12. Effects of Engineering Design-Based Science on Elementary School Science Students' Engineering Identity Development across Gender and Grade

    Science.gov (United States)

    Capobianco, Brenda M.; Yu, Ji H.; French, Brian F.

    2015-01-01

    The integration of engineering concepts and practices into elementary science education has become an emerging concern for science educators and practitioners, alike. Moreover, how children, specifically preadolescents (grades 1-5), engage in engineering design-based learning activities may help science educators and researchers learn more about…

  13. Student and high-school characteristics related to completing a science, technology, engineering or mathematics (STEM) major in college

    Science.gov (United States)

    LeBeau, Brandon; Harwell, Michael; Monson, Debra; Dupuis, Danielle; Medhanie, Amanuel; Post, Thomas R.

    2012-04-01

    Background: The importance of increasing the number of US college students completing degrees in science, technology, engineering or mathematics (STEM) has prompted calls for research to provide a better understanding of factors related to student participation in these majors, including the impact of a student's high-school mathematics curriculum. Purpose: This study examines the relationship between various student and high-school characteristics and completion of a STEM major in college. Of specific interest is the influence of a student's high-school mathematics curriculum on the completion of a STEM major in college. Sample: The sample consisted of approximately 3500 students from 229 high schools. Students were predominantly Caucasian (80%), with slightly more males than females (52% vs 48%). Design and method: A quasi-experimental design with archival data was used for students who enrolled in, and graduated from, a post-secondary institution in the upper Midwest. To be included in the sample, students needed to have completed at least three years of high-school mathematics. A generalized linear mixed model was used with students nested within high schools. The data were cross-sectional. Results: High-school predictors were not found to have a significant impact on the completion of a STEM major. Significant student-level predictors included ACT mathematics score, gender and high-school mathematics GPA. Conclusions: The results provide evidence that on average students are equally prepared for the rigorous mathematics coursework regardless of the high-school mathematics curriculum they completed.

  14. Middle School Engineering Problem Solving Using Traditional vs. e-PBL Module Instruction

    Science.gov (United States)

    Baele, Loren C.

    This multiple methods (Denzin, 1978) study investigated two instructional approaches, traditional module and electronic Problem-Based Learning instruction (e-PBL), used within a middle school engineering classroom focused on the variables of engagement, content knowledge, student self-assessment and teacher assessment of problem solving solutions. A non-equivalent group quasi-experimental research design (Creswell, 2015) was used on middle school students (N = 100) between those that received traditional module instruction (n = 51) and e-PBL instruction (n = 49). The qualitative approach of triangulation (Jick, 1979) was used to identify emergent themes for both between and within methods of data analysis on student engagement survey responses, two days of field observations notes, and six student interview transcripts. The quantitative results identified that students who received e-PBL instruction self-reported significantly greater engagement than those who received traditional module instruction. Further, there was a significant interaction effect between engineering content knowledge by group and gender as males who received e-PBL instruction had greater growth of content knowledge scores than males receiving traditional instruction, while females who received traditional instruction had greater growth of content knowledge scores than females in the e-PBL group. Through triangulation of the qualitative data, the emergent themes of the study suggest that hands-on learning produces higher levels of reported engagement independent of instructional method. The emergence of problem solving fatigue developed when both study groups reported a decline in engagement when entering into the final phase of the quantitative study suggesting that too many complex, ill-structured problems in rapid succession may negatively impact student engagement. Although females within the treatment group were most engaged, they did not achieve the knowledge growth of the females in the

  15. Middle-School Teachers' Understanding and Teaching of the Engineering Design Process: A Look at Subject Matter and Pedagogical Content Knowledge

    Science.gov (United States)

    Hynes, Morgan M.

    2012-01-01

    This paper reports on research investigating six middle school teachers without engineering degrees as they taught an engineering unit on the engineering design process. Videotaped classroom sessions and teacher interviews were analyzed to understand the subject matter and pedagogical content knowledge the teachers used and developed as they…

  16. Reassessing the English Course Offered to Computer Engineering Students at the National School of Applied Sciences of Al-Hoceima in Morocco: An Action Research Project

    Science.gov (United States)

    Dahbi, M.

    2015-01-01

    In computer engineering education, specific English language practices are needed to enable computer engineering students to succeed in professional settings. This study was conducted for two purposes. First, it aimed at investigating to what extent the English courses offered to computer engineering students at the National School of Applied…

  17. WATSON: Detecting organic material in subsurface ice using deep-UV fluorescence and Raman spectroscopy

    Science.gov (United States)

    Eshelman, E.; Wanger, G.; Manatt, K.; Malaska, M.; Willis, M.; Abbey, W.; Doloboff, I.; Beegle, L. W.; DeFlores, L. P.; Priscu, J. C.; Lane, A. L.; Carrier, B. L.; Mellerowicz, B.; Kim, D.; Paulsen, G.; Zacny, K.; Bhartia, R.

    2017-12-01

    Future astrobiological missions to Europa and other ocean worlds may benefit from next-generation instrumentation capable of in situ organic and life detection in subsurface ice environments. WATSON (Wireline Analysis Tool for in Situ Observation of Northern ice sheets) is an instrument under development at NASA's Jet Propulsion Laboratory. WATSON contains high-TRL instrumentation developed for SHERLOC, the Mars 2020 deep-UV fluorescence and Raman spectrometer, including a 248.6 nm NeCu hollow cathode laser as an excitation source. In WATSON, these technologies provide spectroscopic capabilities highly sensitive to many organic compounds, including microbes, in an instrument package approximately 1.2 m long with a 101.6 mm diameter, designed to accommodate a 108 mm ice borehole. Interrogation into the ice wall with a laser allows for a non-destructive in situ measurement that preserves the spatial distribution of material within the ice. We report on a successful deployment of WATSON to Kangerlussuaq, Greenland, where the instrument was lowered to a 4.5 m depth in a hand-cored hole on the Kangerlussuaq sector of the Greenland ice sheet. Motorized stages within the instrument were used to raster a laser across cm-scale regions of the interior surface of the borehole, obtaining fluorescence spectral maps with a 200 µm spatial resolution and a spectral range from 265 nm to 440 nm. This region includes the UV emission bands of many aromatic compounds and microbes, and includes the water and ice Raman O-H stretching modes. We additionally report on experiments designed to inform an early-2018 deployment to Kangerlussuaq where WATSON will be incorporated into a Honeybee Robotics planetary deep drill, with a goal of drilling to a depth of 100 m and investigating the distribution of organic material within the ice sheet. These experiments include laboratory calibrations to determine the sensitivity to organic compounds embedded in ice at various depths, as well as

  18. ENGage: The use of space and pixel art for increasing primary school children's interest in science, technology, engineering and mathematics

    Science.gov (United States)

    Roberts, Simon J.

    2014-01-01

    The Faculty of Engineering at The University of Nottingham, UK, has developed interdisciplinary, hands-on workshops for primary schools that introduce space technology, its relevance to everyday life and the importance of science, technology, engineering and maths. The workshop activities for 7-11 year olds highlight the roles that space and satellite technology play in observing and monitoring the Earth's biosphere as well as being vital to communications in the modern digital world. The programme also provides links to 'how science works', the environment and citizenship and uses pixel art through the medium of digital photography to demonstrate the importance of maths in a novel and unconventional manner. The interactive programme of activities provides learners with an opportunity to meet 'real' scientists and engineers, with one of the key messages from the day being that anyone can become involved in science and engineering whatever their ability or subject of interest. The methodology introduces the role of scientists and engineers using space technology themes, but it could easily be adapted for use with any inspirational topic. Analysis of learners' perceptions of science, technology, engineering and maths before and after participating in ENGage showed very positive and significant changes in their attitudes to these subjects and an increase in the number of children thinking they would be interested and capable in pursuing a career in science and engineering. This paper provides an overview of the activities, the methodology, the evaluation process and results.

  19. Knowledge Transfer and Culture Exchange between HEU and TAMU through a Summer School on Nuclear Power Engineering

    International Nuclear Information System (INIS)

    Gao, P.; Zhang, Z.; Kurwitz, R. C.; Shao, L.

    2016-01-01

    Full text: Since 2012, Harbin Engineering University (HEU) and Texas A&M University (TAMU) hold an annual Summer School on Nuclear Engineering. By now, the activity has been held four times. Each year, 15–20 students are selected from their respective institutions and paired with a counterpart to form partners. They study lectures in the first week at HEU and tour three nuclear power plants (NPP) in the second week, visit the NPP simulators, and learn the nuclear safety culture. This activity expands the scale of international nuclear educational exchange, provide a platform for the students from different countries to communicate and exchange insights into their respective culture. (author

  20. NASA Space Science Days: An Out of School Program Using National Partnerships to Further Influence Future Scientists and Engineers.

    Science.gov (United States)

    Galindo, Charles; Allen, Jaclyn; Garcia, Javier; Hrrera, Stephanie

    2012-01-01

    The National Math and Science Initiative states that American students are falling behind in the essential subjects of math and science, putting our position in the global economy at risk a foreboding statement that has caused the U.S. to re-evaluate how we view STEM education. Developing science and engineering related out of school programs that expose middle school students to math and science in a nontraditional university environment has the potential to motivate young students to look at the physical sciences in an exciting out of the norm environment.

  1. Bioinformatics education in high school: implications for promoting science, technology, engineering, and mathematics careers.

    Science.gov (United States)

    Kovarik, Dina N; Patterson, Davis G; Cohen, Carolyn; Sanders, Elizabeth A; Peterson, Karen A; Porter, Sandra G; Chowning, Jeanne Ting

    2013-01-01

    We investigated the effects of our Bio-ITEST teacher professional development model and bioinformatics curricula on cognitive traits (awareness, engagement, self-efficacy, and relevance) in high school teachers and students that are known to accompany a developing interest in science, technology, engineering, and mathematics (STEM) careers. The program included best practices in adult education and diverse resources to empower teachers to integrate STEM career information into their classrooms. The introductory unit, Using Bioinformatics: Genetic Testing, uses bioinformatics to teach basic concepts in genetics and molecular biology, and the advanced unit, Using Bioinformatics: Genetic Research, utilizes bioinformatics to study evolution and support student research with DNA barcoding. Pre-post surveys demonstrated significant growth (n = 24) among teachers in their preparation to teach the curricula and infuse career awareness into their classes, and these gains were sustained through the end of the academic year. Introductory unit students (n = 289) showed significant gains in awareness, relevance, and self-efficacy. While these students did not show significant gains in engagement, advanced unit students (n = 41) showed gains in all four cognitive areas. Lessons learned during Bio-ITEST are explored in the context of recommendations for other programs that wish to increase student interest in STEM careers.

  2. Evaluation and suggestions for optional electrical engineering classes curriculum changes in elementary school

    OpenAIRE

    Štulac, Anja

    2014-01-01

    The aim of the thesis is to make a survey about teaching of elective subject in the 8th or 9th grade named electrical engineering. The findings could be helpful to teachers of electrical engineering, engineering and technology, physics, as well as for amateur electrical engineering enthusiasts. It is also aimed at those who seek to make changes in the optional electrical engineering course curriculum which represents a plan of work for teachers of this course. It is therefore an important fac...

  3. Flouting maxim by sherlock holmes and dr. Watson in tv series Of sherlock season

    Directory of Open Access Journals (Sweden)

    Lina Affifatusholihah

    2017-04-01

    In running daily activities, people will always meet and interact with other people, and language is a medium that is used by humans to interact with each other. In a conversation or discussion, everyone should pay attention to the four maxims in order that there are no errors in communication. However, it is not uncommon that the four rules above are breached by the speakers. This is called non-observance of the maxims, and one of a non-observance of the maxims that often occurs in is flouting maxim. The aims of this paper are to describe types of maxims that are flouted by Sherlock Holmes and dr. Watson as well as to describe how the maxims are flouted in Sherlock TV series season 1. This research used qualitative descriptive method. The researcher classifies the utterances to know what kind of maxim which are flouted, categorizes those into the category based on the Grice’s theory of Cooperative Principle, namely: maxim of quantity, quality, relation and manner. The research procedure begin by searching the script in the internet, matching the utterances in the script and in film and sorting the utterances between Sherlock Holmes and dr. Watson as well observing every word or sentence which are flouted by the main characters. The findings find that all kinds of maxims are flouted by Sherlock and dr. Watson. The result of analysis shows that the maxim flouted when the speakers say something irrelevant; something roguishness or lied to hide the truth in the form of rhetorical question; the information becomes more or too informative than what is required; and something obscurity of expression, ambiguity, or unnecessary prolixity.

  4. Fanconi anaemia and the repair of Watson and Crick DNA crosslinks.

    Science.gov (United States)

    Kottemann, Molly C; Smogorzewska, Agata

    2013-01-17

    The function of Fanconi anaemia proteins is to maintain genomic stability. Their main role is in the repair of DNA interstrand crosslinks, which, by covalently binding the Watson and the Crick strands of DNA, impede replication and transcription. Inappropriate repair of interstrand crosslinks causes genomic instability, leading to cancer; conversely, the toxicity of crosslinking agents makes them a powerful chemotherapeutic. Fanconi anaemia proteins can promote stem-cell function, prevent tumorigenesis, stabilize replication forks and inhibit inaccurate repair. Recent advances have identified endogenous aldehydes as possible culprits of DNA damage that may induce the phenotypes seen in patients with Fanconi anaemia.

  5. Enol tautomers of Watson-Crick base pair models are metastable because of nuclear quantum effects.

    Science.gov (United States)

    Pérez, Alejandro; Tuckerman, Mark E; Hjalmarson, Harold P; von Lilienfeld, O Anatole

    2010-08-25

    Intermolecular enol tautomers of Watson-Crick base pairs could emerge spontaneously via interbase double proton transfer. It has been hypothesized that their formation could be facilitated by thermal fluctuations and proton tunneling, and possibly be relevant to DNA damage. Theoretical and computational studies, assuming classical nuclei, have confirmed the dynamic stability of these rare tautomers. However, by accounting for nuclear quantum effects explicitly through Car-Parrinello path integral molecular dynamics calculations, we find the tautomeric enol form to be dynamically metastable, with lifetimes too insignificant to be implicated in DNA damage.

  6. Teoria do cuidado transpessoal de jean watson no cuidado domiciliar de enfermagem a crianca: uma reflexao

    Directory of Open Access Journals (Sweden)

    Ingrid Meireles Gomes

    2013-09-01

    Full Text Available Trata-se de um ensaio reflexivo sobre o potencial de utilização da Teoria do Cuidado Transpessoal de Jean Watson, na realização do cuidado domiciliar de enfermagem direcionado à criança, desenvolvido à luz dos 10 elementos do Processo Clinical Caritas. Este referencial teórico permite desenvolver a transpessoalidade no cuidado domiciliar da criança, momento em que o enfermeiro precisa desenvolver autoconhecimento, ter suporte teórico-filosófico e valer-se deste conhecimento, a fim de ultrapassar o paradigma da objetividade e do biologicismo.

  7. Richard Watson.

    Science.gov (United States)

    Wright, Ian; Bevin, William

    2017-11-25

    An inspirational equine veterinary surgeon with a keen interest in racing, to whom horses were a way of life. He took much pride in the success of his homebred racehorses. British Veterinary Association.

  8. Integration of Engineering Education by High School Teachers to Meet Standards in the Physics Classroom

    Science.gov (United States)

    Kersten, Jennifer Anna

    2013-01-01

    In recent years there has been increasing interest in engineering education at the K-12 level, which has resulted in states adopting engineering standards as a part of their academic science standards. From a national perspective, the basis for research into engineering education at the K-12 level is the belief that it is of benefit to student…

  9. High School Pre-Engineering Programs: Do They Contribute to College Retention?

    Science.gov (United States)

    Cole, Belinda; High, Karen; Weinland, Kathryn

    2013-01-01

    The study examines the retention of students in the College of Engineering, Architecture and Technology at Oklahoma State University that enter college with a defined course sequence in a pre-engineering program from a regional career technology center as compared with the retention rates of university engineering students for the same time…

  10. The Competence Readiness of the Electrical Engineering Vocational High School Teachers in Manado towards the ASEAN Economic Community Blueprint in 2025

    OpenAIRE

    Fid Jantje Tasiam; Djoko Kustono; Purnomo Purnomo; Hakkun Elmunsyah

    2017-01-01

    This paper presents the competence readiness of the electrical engineering vocational high school teachers in Manado towards ASEAN Economic Community blueprint in 2025. The objective of this study is to get the competencies readiness description of the electrical engineering vocational high school teachers in Manado towards ASEAN Economic Community blueprint in 2025. Method used quantitative and qualitative approach which the statistical analysis in quantitative and the inductive analysis use...

  11. RELATED VOCATIONAL INTEREST TO LEARNING AND ENTREPRENEURIAL LEARNING ACHIEVEMENT WITH ENTREPRENEURSHIP INTEREST ON THE STUDENS AUTOMOTIVE ENGINEERING ISLAMIC VOCATIONAL SCHOOL YOGYAKARTA ACADEMIC YEAR 2013/2014

    OpenAIRE

    Choiruddin Nurcholis Suwondo; Subagyo Subagyo

    2014-01-01

    The purpose of the study (1) to determine whether there is a positive relationship between vocational interest to learning with entrepreneurship interest on the studens Automotive Engineering Islamic Vocational School Yogyakarta Academic Year 2013/2014; (2) to determine whether there is a positive relationship between entrepreneurial learning achivement with entrepreneurship interest on the studens Automotive Engineering Islamic Vocational School Yogyakarta Academic Year 2013/2014; (3) to det...

  12. James Watson's most inconvenient truth: race realism and the moralistic fallacy.

    Science.gov (United States)

    Rushton, J Philippe; Jensen, Arthur R

    2008-11-01

    Recent editorials in this journal have defended the right of eminent biologist James Watson to raise the unpopular hypothesis that people of sub-Saharan African descent score lower, on average, than people of European or East Asian descent on tests of general intelligence. As those editorials imply, the scientific evidence is substantial in showing a genetic contribution to these differences. The unjustified ill treatment meted out to Watson therefore requires setting the record straight about the current state of the evidence on intelligence, race, and genetics. In this paper, we summarize our own previous reviews based on 10 categories of evidence: The worldwide distribution of test scores; the g factor of mental ability; heritability differences; brain size differences; trans-racial adoption studies; racial admixture studies; regression-to-the-mean effects; related life-history traits; human origins research; and the poverty of predictions from culture-only explanations. The preponderance of evidence demonstrates that in intelligence, brain size, and other life-history variables, East Asians average a higher IQ and larger brain than Europeans who average a higher IQ and larger brain than Africans. Further, these group differences are 50-80% heritable. These are facts, not opinions and science must be governed by data. There is no place for the "moralistic fallacy" that reality must conform to our social, political, or ethical desires.

  13. The McLean-Watson line strength formula and its implementation

    International Nuclear Information System (INIS)

    Hey, J D

    2009-01-01

    We consider the application of the line strength formula recently derived by Watson (2006 J. Phys. B: At. Mol. Opt. Phys. 39 L291) to transitions between states of high principal quantum number in hydrogenic atoms and ions (Rydberg-Rydberg transitions). Apparent difficulties in the implementation of this formula are overcome by the use of recurrence relations derived by the ladder operator technique of Infeld and Hull (1951 Rev. Mod. Phys. 23 21), and set out in an earlier paper by the present author (2006 J. Phys. B: At. Mol. Opt. Phys. 39 2641). The use of the McLean-Watson formula for such cases is illustrated by the determination of the radiative lifetimes for levels with n ∼ 1000 and comparison of present results with approximate formulae. Interest in this work on the radial matrix elements for large n and n' is related both to measurements of radio recombination lines from tenuous space plasmas, e.g. Stepkin et al (2007 Mon. Not. R. Astron. Soc. 374 852) and to the calculation of Stark broadening for such spectra, e.g. Gigosos et al (2007 Astron. Astrophys. 466 1189), Stambulchik et al (2007 Phys. Rev. E 75 016401) and Stambulchik and Maron (2008 J. Phys. B: At. Mol. Opt. Phys. 41 095703). In addition, we discuss the question of inaccuracy caused by the omission of fine structure in such calculations, and the numerical stability of the recurrence relations used to implement the line strength formulae.

  14. Assistência em Enfermagem e Jean Watson: Uma reflexão sobre a empatia

    Directory of Open Access Journals (Sweden)

    Roberta Maria Savieto

    2016-03-01

    Full Text Available Resumo Objetivo: Relacionar a empatia com a Teoria do Cuidado Humano, de Jean Watson, no contexto atual da Enfermagem. Métodos: Trata-se de um ensaio teórico-reflexivo que propõe uma discussão acerca da empatia e sua relação com a Teoria do Cuidado Humano, de Jean Watson, na prática contemporânea da Enfermagem. Resultado: É apresentado o processo Clinical Caritas e cada elemento de cuidado que o compõe visando propor e discutir as conexões com a empatia na assistência em Enfermagem. Torna-se imperioso aliar aspectos técnicos e humanísticos na oferta do cuidado de Enfermagem, além de resgatar a valorização da abordagem da empatia na formação de profissionais da saúde, bem como na continuidade dos estudos após a graduação. Conclusão: Entende-se que essa reflexão pode contribuir para a reorganização de ideias e conceitos sobre aprimoramentos essenciais que se mostram necessários à prática atual da Enfermagem, além de reforçar seu crescimento enquanto ciência.

  15. El relato de la experiencia depresiva: Aplicando los factores cuidativos de Jean Watson The expression of the depressive experience: the application of Jean Watson caring factors

    Directory of Open Access Journals (Sweden)

    Carme Ferré-Grau

    2008-03-01

    Full Text Available La elevada frecuencia de personas con trastornos depresivos en todos los niveles de atención y la complejidad de los cuidados, conlleva la necesidad, para la enfermera, de desarrollar nuevas habilidades y competencias en el abordaje integral de los pacientes y su familia. Para la comprensión de una persona con depresión es útil una mirada etnográfica que nos permita conocer la expresión subjetiva de la vivencia de la enfermedad. Un marco adecuado de referencia para ayudar en el cuidado de estos procesos es la teoría de Jean Watson sobre la Filosofía y Ciencia de los Cuidados Humanos, que a través de sus diez factores cuidativos enmarca el rol de la enfermera en "cómo tener cuidado de...". Este artículo trata de analizar, a través de los factores cuidativos de Watson, las vivencias subjetivas relacionadas con la transformación del cuerpo y la mente de las personas con depresión: el sufrimiento y el dolor, la autoimagen y el reconocimiento, la falta de energía, la pérdida de la esperanza. Se concluye que no es posible controlar el cuerpo sin controlar la mente y para ello nos puede ayudar el análisis subjetivo de la experiencia y la aplicación de los factores cuidativos.The high frequency of people with depressive disorders in Primary Health Care as well as in Hospital and the complexity of care, carry for nurses the need to develop new skills and competences to deal with complete care of patiens and families. To understand a person suffering depressive disorders may be useful an ethnographic look that let us know the subjective expression of the experience of being ill. An appropriate framework to help care is Jean Watson’s Philosophy and Science of Human Caring, trough 10 caring factors that frame the nursing role "to take care of…". This paper tries to analyze the subjective experience related to body and mind changes: suffering and pain, self-image and acceptance, lack of energy, loss of hope… in patients with

  16. Earthquakes, Cities, and Lifelines: lessons integrating tectonics, society, and engineering in middle school Earth Science

    Science.gov (United States)

    Toke, N.; Johnson, A.; Nelson, K.

    2010-12-01

    Earthquakes are one of the most widely covered geologic processes by the media. As a result students, even at the middle school level, arrive in the classroom with preconceptions about the importance and hazards posed by earthquakes. Therefore earthquakes represent not only an attractive topic to engage students when introducing tectonics, but also a means to help students understand the relationships between geologic processes, society, and engineering solutions. Facilitating understanding of the fundamental connections between science and society is important for the preparation of future scientists and engineers as well as informed citizens. Here, we present a week-long lesson designed to be implemented in five one hour sessions with classes of ~30 students. It consists of two inquiry-based mapping investigations, motivational presentations, and short readings that describe fundamental models of plate tectonics, faults, and earthquakes. The readings also provide examples of engineering solutions such as the Alaskan oil pipeline which withstood multi-meter surface offset in the 2002 Denali Earthquake. The first inquiry-based investigation is a lesson on tectonic plates. Working in small groups, each group receives a different world map plotting both topography and one of the following data sets: GPS plate motion vectors, the locations and types of volcanoes, the location of types of earthquakes. Using these maps and an accompanying explanation of the data each group’s task is to map plate boundary locations. Each group then presents a ~10 minute summary of the type of data they used and their interpretation of the tectonic plates with a poster and their mapping results. Finally, the instructor will facilitate a class discussion about how the data types could be combined to understand more about plate boundaries. Using student interpretations of real data allows student misconceptions to become apparent. Throughout the exercise we record student preconceptions

  17. Charge transport properties of DNA aperiodic molecule: The role of interbase hopping in Watson-Crick base pair

    Science.gov (United States)

    Sinurat, E. N.; Yudiarsah, E.

    2017-07-01

    The charge transport properties of DNA aperiodic molecule has been studied by considering various interbase hopping parameter on Watson-Crick base pair. 32 base pairs long double-stranded DNA aperiodic model with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. Transfer matrix method has been used to calculate transmission probabilities, for determining I-V characteristic using Landauer Büttiker formula. DNA molecule is modeled using tight binding hamiltonian combined with the theory of Slater-Koster. The result show, the increment of Watson-Crick hopping value leads to the transmission probabilities and current of DNA aperiodic molecule increases.

  18. The extension of a DNA double helix by an additional Watson-Crick base pair on the same backbone

    DEFF Research Database (Denmark)

    Kumar, P.; Sharma, P. K.; Madsen, Charlotte S.

    2013-01-01

    Additional base pair: The DNA duplex can be extended with an additional Watson-Crick base pair on the same backbone by the use of double-headed nucleotides. These also work as compressed dinucleotides and form two base pairs with cognate nucleobases on the opposite strand.......Additional base pair: The DNA duplex can be extended with an additional Watson-Crick base pair on the same backbone by the use of double-headed nucleotides. These also work as compressed dinucleotides and form two base pairs with cognate nucleobases on the opposite strand....

  19. Formation of base triplets by non-Watson-Crick bonds mediates homologous recognition in RecA recombination filaments.

    OpenAIRE

    Rao, B J; Radding, C M

    1994-01-01

    Whereas complementary strands of DNA recognize one another by forming Watson-Crick base pairs, the way in which RecA protein enables a single strand to recognize homology in duplex DNA has remained unknown. Recent experiments, however, have shown that a single plus strand in the RecA filament can recognize an identical plus strand via bonds that, by definition, are non-Watson-Crick. In experiments reported here, base substitutions had the same qualitative and quantitative effects on the pairi...

  20. The circumstances of the missing biographer or why Watson didn't narrate these four Sherlock Holmes stories.

    Science.gov (United States)

    Caplan, R M

    1982-06-01

    The author provides arguments to explain why four of Arthur Conan Doyle's sixty stories about Sherlock Holmes were not narrated by Dr. Watson. The arguments relate to logical demands of the plot in the cases of the two stories told by an unidentified narrator. The two told by Holmes seem to demand Watson's absence because the final elucidation requires skill in cutaneous diagnosis; the presence of a medical man would have, or should have, relieved the dramatic tension of the mystery too soon. The Sherlock Holmes stories can provide delightful diversion as well as serve constantly to enhance our appreciation for highly alert and careful physical examination.

  1. Distance Art Education: The Federal School and Social Engineering in the United States, 1900 to 1925

    Science.gov (United States)

    Funk, Clayton

    2009-01-01

    The Federal School was a correspondence art school in Minneapolis, Minnesota in the early 20th century. At that time, scientific methods changed the organization and practice of commercial art training and industrial education, which included correspondence courses from the Federal School. Standards of intelligence were determined with…

  2. Pushing and Pulling Sara: A Case Study of the Contrasting Influences of High School and University Experiences on Engineering Agency, Identity, and Participation

    Science.gov (United States)

    Godwin, Allison; Potvin, Geoff

    2017-01-01

    This manuscript reports a longitudinal case study of how one woman, Sara, who had previously considered dropping out of high school, authored strong mathematics and science identities and purposefully exhibited agency through her experiences in high school science. These experiences empowered her to choose an engineering major in college; however,…

  3. Influence of High School Vocational Agriculture on the Matriculation, Graduation, and Employment of Agricultural Engineering Graduates from the Iowa State University of Science and Technology.

    Science.gov (United States)

    Ahrens, Donald Louis

    To determine the influence of high school vocational agriculture on college achievement and subsequent employment of agricultural engineering majors, data were collected from 419 graduates of Iowa State University representing the period from 1942 to 1964. The 112 graduates who had taken at least 3 or more semesters of high school vocational…

  4. Engineering-Based Problem Solving Strategies in AP Calculus: An Investigation into High School Student Performance on Related Rate Free-Response Problems

    Science.gov (United States)

    Thieken, John

    2012-01-01

    A sample of 127 high school Advanced Placement (AP) Calculus students from two schools was utilized to study the effects of an engineering design-based problem solving strategy on student performance with AP style Related Rate questions and changes in conceptions, beliefs, and influences. The research design followed a treatment-control multiple…

  5. Science, Technology, Engineering and Math Readiness: Ethno-linguistic and gender differences in high-school course selection patterns

    Science.gov (United States)

    Adamuti-Trache, Maria; Sweet, Robert

    2014-03-01

    The study examines science-related course choices of high-school students in the culturally diverse schools of the province of British Columbia, Canada. The analysis employs K-12 provincial data and includes over 44,000 students born in 1990 who graduated from high school by 2009. The research sample reflects the presence of about 27% of students for whom English is not a first language. We construct an empirical model that examines ethno-linguistic and gender differences in Grade 12 course choices while accounting for personal and situational differences among students. The study employs a course selection typology that emphasizes readiness for science, technology, engineering and math fields of study. Findings indicate that math- and science-related course selection patterns are strongly associated with ethnicity, qualified not only by gender and prior math and science achievement but also by the individual's grade level at entry to the system and enrollment in English as a Second Language program. Students who are more likely to engage in math and science courses belong to Asian ethno-linguistic groups and entered the provincial school system during the senior high-school years. We suggest that ethnic diversity and broader academic exposure may play a crucial role in changing the gender composition of science classrooms, university fields of study and science-related occupations.

  6. Experiences of high school Hispanic girls in pursuit of science, technology, engineering, and mathematics-related coursework and careers

    Science.gov (United States)

    Vijil, Veronica G.

    2011-12-01

    An overall increased awareness of the importance of science, technology, engineering, and mathematics (STEM) has prompted attention toward the continued underrepresentation of Hispanic women in this field. The purpose of this collective case study was to explore the support systems, perceived barriers, and prior experiences influencing high school Hispanic girls' decisions to pursue advanced coursework and related careers through a career pathway in science, technology, engineering, and mathematics (STEM) areas. Specifically, participants were interviewed regarding their mathematics and science experiences in elementary and middle schools, as well as perceived supports and barriers to their choices to pursue STEM careers and advanced coursework. Results indicated that the participants linked their elementary and middle school experiences with their teachers rather than specific activities. Accolades such as certificates and good grades for academic achievement contributed to the girls' strong self-efficacy at an early age. The participants possessed self-discipline and self-confidence, using intrinsic motivation to pursue their goals. Support systems included families and a few teachers. Barriers were revealed in different forms including derogatory comments by boys in class, difficult curricula with limited tutors available for higher level courses, and receipt of financial assistance to attend a university of their choice.

  7. Innovative teaching: Use of Screencast in the Agronomist Engineer High School of the UPM

    Science.gov (United States)

    Mediola, Maria Angeles; Aguado, Pedro Luis; Espejo, Rafael

    2013-04-01

    In the last academic courses, the Polytechnic University of Madrid (UPM) has supported the use of multimedia materials and methods in education and learning processes to improve the efficiency and impact obtained by faculty and students. With this aim during 2011-2012 course the multimedia method titled "Screencast" has been implemented in the subject "Plantas de Interés Agroalimentario" included in the curricula of the Agronomist Engineer High School. Next year will be apply in the subject "Soil Science" in the new degree. The Screencast tools allow record digital videos with sound directly into a computer so lecture and class can be recorded directly. The videos can be edited after including narrations, special effects as zoom, notes, images, etc. Screencast tools are simple use tools which are easy made tutorials, manuals, presentations and shows that help to students with different processes that are very hard to understand for students (1) (2). There are different Screencast tools in the market and after an evaluation process the most suitable for our need has been BB FlashBack Express (3) because is easy use, free and compatible with WEBCAM. This software allows export to Flash and AVI video formats. In our case the format chosen was the Flash format because the file sizes obtained were smaller than in AVI format. The use of BB FlashBack Express of the studied subject allowed make easy self-learning multimedia material and testing different methodologies and procedures for the use of this multimedia source in Internet. The BB FlashBack Express software was used during the course by teachers and students of this subject achieving a good improvement in the education and learning processes. The evaluation of the results obtained in the application of this method had shown that ability of students to use new technologies and spread their ideas has been increased as much into as outside classrooms. The materials made in this work had been joined to different

  8. Book of abstracts Chemical Engineering: IV All-Russian Conference on chemical engineering, All-Russian Youth Conference on chemical engineering, All-Russian school on chemical engineering for young scientists and specialists. Materials of All-Russian Symposium on chemistry and extraction engineering. Chemical-metallurgical processes of ore and secondary raw material processing. Analytical control of chemical industries, man-made and natural objects

    International Nuclear Information System (INIS)

    Zakhodyaeva, Yu.A.; Belova, V.V.

    2012-01-01

    In the given volume of abstracts of the IV All-Russian Conference on chemical engineering, All-Russian Youth Conference on chemical engineering, All-Russian school on chemical engineering for young scientists and specialists (Moscow, March 18-23, 2012) there are the abstracts of the reports concerning polymer and composite materials technology as well as catalysis in chemical engineering. The abstracts deal with state-of-the-art and future development of theoretical and experimental investigations as well as with experience in practical realization of development works in the field of chemical engineering and relative areas [ru

  9. The form of electron-atom excitation amplitudes at high momentum transfers in the Faddeev-Watson approximation

    International Nuclear Information System (INIS)

    Catalan, G.; Roberts, M.J.

    1979-01-01

    A form of the off-shell Coulomb T matrix, which has a well defined on-shell limit, is used in the Faddeev-Watson multiple-scattering expansion for a direct three-body collision process. Using the excitation of atomic hydrogen by electron impact as an example, approximations to the second-order terms, which are valid for high momentum transfers of the incident electron, are derived. It is shown how the resulting asymptotic behaviour of the second-order Faddeev-Watson approximation is related to the high momentum transfer limit of the second Born approximation. The results are generalised to the excitation of more complex atoms. The asymptotic forms of the Faddeev-Watson and Born approximations are compared with other theories and with measurements of differential cross sections and angular correlation parameters for the excitation of H(2p) and He(2 1 P). The results indicate that the Faddeev-Watson approximation converges more rapidly at high momentum transfers than does the Born approximation. (author)

  10. Thermodynamic stability of Hoogsteen and Watson-Crick base pairs in the presence of histone H3-mimicking peptide.

    Science.gov (United States)

    Pramanik, Smritimoy; Nakamura, Kaori; Usui, Kenji; Nakano, Shu-ichi; Saxena, Sarika; Matsui, Jun; Miyoshi, Daisuke; Sugimoto, Naoki

    2011-03-14

    We found that Hoogsteen base pairs were stabilized by molecular crowding and a histone H3-mimicking peptide, which was not observed for Watson-Crick base pairs. Our findings demonstrate that the type of DNA base pair is critical for the interaction between DNA and histones.

  11. The extension of a DNA double helix by an additional Watson-Crick base pair on the same backbone.

    Science.gov (United States)

    Kumar, Pawan; Sharma, Pawan K; Madsen, Charlotte S; Petersen, Michael; Nielsen, Poul

    2013-06-17

    Additional base pair: The DNA duplex can be extended with an additional Watson-Crick base pair on the same backbone by the use of double-headed nucleotides. These also work as compressed dinucleotides and form two base pairs with cognate nucleobases on the opposite strand. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  12. Crick's gossip test and Watson's boredom principle: A pseudo-mathematical analysis of effort in scientific research.

    Science.gov (United States)

    Charlton, Bruce G

    2008-01-01

    Crick and Watson gave complementary advice to the aspiring scientist based on the insight that to do your best work you need to make your greatest possible effort. Crick made the positive suggestion to work on the subject which most deeply interests you, the thing about which you spontaneously gossip - Crick termed this 'the gossip test'. Watson made the negative suggestion of avoiding topics and activities that bore you - which I have termed 'the boredom principle'. This is good advice because science is tough and the easy things have already been done. Solving the harder problems that remain requires a lot of effort. But in modern biomedical science individual effort does not necessarily correlate with career success as measured by salary, status, job security, etc. This is because Crick and Watson are talking about revolutionary science - using Thomas Kuhn's distinction between paradigm-shifting 'revolutionary' science and incremental 'normal' science. There are two main problems with pursuing a career in revolutionary science. The first is that revolutionary science is intrinsically riskier than normal science, the second that even revolutionary success in a scientific backwater may be less career-enhancing than mundane work in a trendy field. So, if you pick your scientific problem using the gossip test and the boredom principle, you might also be committing career suicide. This may explain why so few people follow Crick and Watson's advice. The best hope for future biomedical science is that it will evolve towards a greater convergence between individual effort and career success.

  13. Photoinduced electron transfer in a Watson-Crick base-paired, 2-aminopurine:uracil-C60 hydrogen bonding conjugate.

    Science.gov (United States)

    D'Souza, Francis; Gadde, Suresh; Islam, D-M Shafiqul; Pang, Siew-Cheng; Schumacher, Amy Lea; Zandler, Melvin E; Horie, Rumiko; Araki, Yasuyaki; Ito, Osamu

    2007-02-07

    A fluorescent reporter molecule, 2-aminopurine was self-assembled via Watson-Crick base-pairing to a uracil appended fullerene to form a donor-acceptor conjugate; efficient photoinduced charge separation was confirmed by time-resolved emission and transient absorption spectral studies.

  14. Engineering Design in the Primary School: Applying STEM Concepts to Build an Optical Instrument

    Science.gov (United States)

    King, Donna; English, Lyn D.

    2016-01-01

    Internationally there is a need for research that focuses on STEM (Science, Technology, Engineering and Mathematics) education to equip students with the skills needed for a rapidly changing future. One way to do this is through designing engineering activities that reflect real-world problems and contextualise students' learning of STEM concepts.…

  15. Latinx and Caucasian Elementary School Children's Knowledge of and Interest in Engineering Activities

    Science.gov (United States)

    Ozogul, Gamze; Miller, Cindy Faith; Reisslein, Martin

    2017-01-01

    Ethnic minorities, such as Latinx people of Hispanic or Latino origin, and women earn fewer engineering degrees than Caucasians and men. With shifting population dynamics and high demands for a technically qualified workforce, it is important to achieve broad participation in the engineering workforce by all ethnicities and both genders. Previous…

  16. A Pre-Engineering Program Using Robots to Attract Underrepresented High School and Community College Students

    Science.gov (United States)

    Mosley, Pauline Helen; Liu, Yun; Hargrove, S. Keith; Doswell, Jayfus T.

    2010-01-01

    This paper gives an overview of a new pre-engineering program--Robotics Technician Curriculum--that uses robots to solicit underrepresented students pursuing careers in science, technology, engineering, and mathematics (STEM). The curriculum uses a project-based learning environment, which consists of part lecture and part laboratory. This program…

  17. Competition preparation guideline in undergraduate program of information system school of Industrial Engineering Telkom University based on knowledge conversion

    Science.gov (United States)

    Darmawan, F. R.; Soesanto, R. P.; Kurniawati, A.; Kurniawan, M. T.

    2017-12-01

    The role of higher education in the development of science and technology is not only from the contribution of the high-quality alumni but also from the research and relevant competition with the needs of development in such a country. In a competition, the student can improve their soft skill and academic skill such as analytical and critical thinking, communication skills and mental. The number of relevant competition by students is also included in accreditation clause, therefore student involvement in competition is seen as important for the undergraduate program in University. The most problem in university is the high turnover from the student. Bachelor program in Indonesia usually takes 4 years to complete, and the high turnover causes the student come and go as they are a graduate from the institution without preserving the knowledge and experience from the competition to other students. This research aims to develop a guidance for competition preparation in the university by using knowledge conversion. The object of this research is an information system undergraduate program in the school of industrial engineering Telkom University. The best practice selection is done by using factor rating method. Delphi method is used to identify the criteria, and AHP method is used to calculate the weight of each criterion. From the factor rating result it is known that from 3 respondent, best practice from respondent A (7.321) is used for preparing the programming competition in an undergraduate program of information system in the school of industrial engineering Telkom University. FGD is done to disseminate the selected best practice into the process stakeholder which is head of the student affair of the school of industrial engineering, students, and laboratory assistants. Future research can be done to create more comprehensive criteria for selecting the best practice.

  18. A BLUEPRINT FOR RESEARCH-LED TEACHING ENGINEERING AT SCHOOLS: A CASE STUDY FOR TAYLOR’S UNIVERSITY

    Directory of Open Access Journals (Sweden)

    MUSHTAK AL-ATABI

    2013-04-01

    Full Text Available Although it is expected that research conducted at universities and institutions of higher learning will have some positive impact on the teaching quality, the literature seem to point in another direction. Available literature reports zero correlation between teaching and research. However, this need not be the case and a number of recommendations to create a positive correlation between teaching and research are proposed. This paper outlines a framework that utilises the Grand Challenges for Engineering and CDIO to create a clear link between teaching and research in Taylor’s School of Engineering. Aligning the academic staff research objectives to the Grand Challenges, creates a sense of purpose that extends beyond the academic staff to their students. Ensuring that students’ projects and other CDIO activities are derived from the academic staff research interests help creates a learning environment in which research and teaching are integrated. This integration is highly desirable as it benefits both the students and the academic staff.

  19. Historical rock collection of the Commission for the Geological Map of Spainpreserved in the Madrid School of Civil Engineering

    International Nuclear Information System (INIS)

    Sanz Pérez, E.; Pérez Ruy-Díaz, J.A.; Menéndez-Pidal de Navascués, I.; Sanz Ojeda, P.; Pascual-Arribas, C.

    2017-01-01

    The collection of 200 rocks prepared by the Commission for the Geological Map of Spain for the Madrid School of Civil Engineering, without known author and dated between 1898 and 1907, is one of the collections sent by the Commission to meet the specific needs of engineering institutes, and in which have survived 200 explanatory index cards accompanying each of the specimens. The collection is national in scope and is designed with a clear teaching purpose focused on civil engineering students. Its main feature is to teach the historical geology of Spain summarized in a collection of representative rocks from the Spanish territory classified by geological periods. So that, by knowing the most common rocks that appear in the synthetic stratigraphic column of Spain, this could provide for uses for coeval type of rocks, such as building materials or as foundations. Petrologic classifications and the division of geological periods are used according to these times. The index cards, where many observations about uses of civil engineering rocks are made, endeavor to identify rocks as samples with one’s own eyes and at scale of outcrop in the field, within the regional stratigraphic context. [es

  20. Watson-Crick Base Pair Radical Cation as a Model for Oxidative Damage in DNA.

    Science.gov (United States)

    Feketeová, Linda; Chan, Bun; Khairallah, George N; Steinmetz, Vincent; Maitre, Philippe; Radom, Leo; O'Hair, Richard A J

    2017-07-06

    The deleterious cellular effects of ionizing radiation are well-known, but the mechanisms causing DNA damage are poorly understood. The accepted molecular events involve initial oxidation and deprotonation at guanine sites, triggering hydrogen atom abstraction reactions from the sugar moieties, causing DNA strand breaks. Probing the chemistry of the initially formed radical cation has been challenging. Here, we generate, spectroscopically characterize, and examine the reactivity of the Watson-Crick nucleobase pair radical cation in the gas phase. We observe rich chemistry, including proton transfer between the bases and propagation of the radical site in deoxyguanosine from the base to the sugar, thus rupturing the sugar. This first example of a gas-phase model system providing molecular-level details on the chemistry of an ionized DNA base pair paves the way toward a more complete understanding of molecular processes induced by radiation. It also highlights the role of radical propagation in chemistry, biology, and nanotechnology.

  1. Energy Landscape and Pathways for Transitions between Watson-Crick and Hoogsteen Base Pairing in DNA.

    Science.gov (United States)

    Chakraborty, Debayan; Wales, David J

    2018-01-04

    The recent discovery that Hoogsteen (HG) base pairs are widespread in DNA across diverse sequences and positional contexts could have important implications for understanding DNA replication and DNA-protein recognition. While evidence is emerging that the Hoogsteen conformation could be a thermodynamically accessible conformation of the DNA duplex and provide a means to expand its functionality, relatively little is known about the molecular mechanism underlying the Watson-Crick (WC) to HG transition. In this Perspective, we describe pathways and kinetics for this transition at an atomic level of detail, using the energy landscape perspective. We show that competition between the duplex conformations results in a double funnel landscape, which explains some recent experimental observations. The interconversion pathways feature a number of intermediates, with a variable number of WC and HG base pairs. The relatively slow kinetics, with possible deviations from two-state behavior, suggest that this conformational switch is likely to be a challenging target for both simulation and experiment.

  2. LEOPARD syndrome is not linked to the Marfan syndrome and the Watson syndrome loci

    Energy Technology Data Exchange (ETDEWEB)

    Rass-Rothchild, A.: Abeliovitch, D.; Kornstein, A. [Tel Aviv Univ. (Israel)]|[Hebrew Univ., Jerusalem (Israel)

    1994-09-01

    The acronym LEOPARD stands for a syndromic association of Lentigines, Eletrocardiographic changes, Ocular hypertelorism, Pulmonic stenosis, Abnormal genitalia, Retardation of growth and sensorineural Deafness. Inheritance is autosomal dominant with high penetrance and variable expressivity. In 1990 Torok et al. reported on the association of LEOPARD and Marfan syndrome. In addition a clinical similarity (cardiac and cutaneous involvement) exists with the Watson syndrome (neurofibromatosis and pulmonic stenosis) which is linked to the marker D17S33 on chromosome 17. We studied possible linkage of LEOPARD syndrome to the Marfan syndrome locus on chromosome 15 (D15S1, MF13, and (TAAAA)n repeats) and to the NF-1 locus on chromosome 17 in a family with 9 cases of LEOPARD syndrome. Close linkage between LEOPARD syndrome and both the Marfan locus on chromosome 15 and the NF-1 locus on chromosome 17 was excluded (lod score <-2.0 through {theta} = 0.1).

  3. End of the Line? Paul Watson and the Future of the Sea Shepherd Conservation Society

    Directory of Open Access Journals (Sweden)

    Gerry Joseph Nagtzaam

    2014-03-01

    Full Text Available This paper critically examines the Sea Shepherd Conservation Society (‘SSCS’ and the legal challenges they are currently facing to continue its self-appointed role to protect oceanic life through direct action.  In Part One, the article examines the history of this radical environmental group and; the role performed by its charismatic leader Paul Watson; it’s organisational structure and its strategies and tactics; its governing philosophy and its attitudes to violence.  Part Two provides a history of the various direct actions carried out by the group; it further examines the organisation’s ongoing confrontations with the Japanese whaling fleet; documents the current legal travails the group and its leader are experiencing; and lastly asks what impact these issues will have on the group’s viability as a direct action group going forward.

  4. DNA polymerase catalysis in the absence of Watson-Crick hydrogen bonds

    Science.gov (United States)

    Potapova, Olga; Chan, Chikio; DeLucia, Angela M.; Helquist, Sandra A.; Kool, Eric T.; Grindley, Nigel D. F.; Joyce, Catherine M.

    2008-01-01

    We report the first pre-steady-state kinetic studies of DNA replication in the absence of hydrogen bonds. We have used nonpolar nucleotide analogues that mimic the shape of a Watson-Crick base pair in order to investigate the kinetic consequences of a lack of hydrogen bonds in the polymerase reaction catalyzed by the Klenow fragment of DNA Polymerase I from Escherichia coli. With a thymine isostere lacking hydrogen bonding ability in the nascent pair, the efficiency (kpol/Kd) of the polymerase reaction is decreased by 30-fold, affecting ground state (Kd) and transition state (kpol) approximately equally. When both thymine and adenine analogues in the nascent pair lack hydrogen bonding ability, the efficiency of the polymerase reaction is decreased by about 1000-fold, with most the decrease attributable to the transition state. Reactions using nonpolar analogues at the primer terminal base pair demonstrated the requirement for a hydrogen bond between the polymerase and the minor groove of the primer-terminal base. The R668A mutation of Klenow fragment abolished this requirement, identifying R668 as the probable hydrogen bond donor. Detailed examination of the kinetic data suggested that Klenow fragment has an extremely low tolerance of even minor deviations of the analogue base pairs from ideal Watson-Crick geometry. Consistent with this idea, some analogue pairings were better tolerated by Klenow fragment mutants having more spacious active sites. By contrast, the Y-family polymerase Dbh was much less sensitive to changes in base pair dimensions, and more dependent on hydrogen bonding between base-paired partners. PMID:16411765

  5. Data Driven Professional Development Design for Out-of-School Time Educators Using Planetary Science and Engineering Educational Materials

    Science.gov (United States)

    Clark, J.; Bloom, N.

    2017-12-01

    Data driven design practices should be the basis for any effective educational product, particularly those used to support STEM learning and literacy. Planetary Learning that Advances the Nexus of Engineering, Technology, and Science (PLANETS) is a five-year NASA-funded (NNX16AC53A) interdisciplinary and cross-institutional partnership to develop and disseminate STEM out-of-school time (OST) curricular and professional development units that integrate planetary science, technology, and engineering. The Center for Science Teaching and Learning at Northern Arizona University, the U.S. Geological Survey Astrogeology Science Center, and the Museum of Science Boston are partners in developing, piloting, and researching the impact of three out of school time units. Two units are for middle grades youth and one is for upper elementary aged youth. The presentation will highlight the data driven development process of the educational products used to provide support for educators teaching these curriculum units. This includes how data from the project needs assessment, curriculum pilot testing, and professional support product field tests are used in the design of products for out of school time educators. Based on data analysis, the project is developing and testing four tiers of professional support for OST educators. Tier 1 meets the immediate needs of OST educators to teach curriculum and include how-to videos and other direct support materials. Tier 2 provides additional content and pedagogical knowledge and includes short content videos designed to specifically address the content of the curriculum. Tier 3 elaborates on best practices in education and gives guidance on methods, for example, to develop cultural relevancy for underrepresented students. Tier 4 helps make connections to other NASA or educational products that support STEM learning in out of school settings. Examples of the tiers of support will be provided.

  6. The Competence Readiness of the Electrical Engineering Vocational High School Teachers in Manado towards the ASEAN Economic Community Blueprint in 2025

    Directory of Open Access Journals (Sweden)

    Fid Jantje Tasiam

    2017-08-01

    Full Text Available This paper presents the competence readiness of the electrical engineering vocational high school teachers in Manado towards ASEAN Economic Community blueprint in 2025. The objective of this study is to get the competencies readiness description of the electrical engineering vocational high school teachers in Manado towards ASEAN Economic Community blueprint in 2025. Method used quantitative and qualitative approach which the statistical analysis in quantitative and the inductive analysis used in qualitative. There were 46 teachers of the electrical engineering vocational high school in Manado observed. The results have shown that the competencies readiness of the electrical engineering vocational high school teachers in Manado such as: pedagogical, professional, personality, and social were 13.04%, 19.56%, 19.56%, and 19.56% respectively. The results were still far from the focus of the ASEAN economic community blueprint in 2025, so they need to be improved through in-house training, internship programs, school partnerships, distance learning, tiered training and special training, short courses in educational institutions, internal coaching by schools, discussion of educational issues, workshops, research and community service, textbook writing, learning media making, and the creation of technology and art.

  7. Partnership model of vocational education with the business sector in civil engineering expertise program of Vocational Secondary Schools

    Directory of Open Access Journals (Sweden)

    I Kadek Budi Sandika

    2018-01-01

    Full Text Available This study aims to: (1 develop a partnership model of vocational education with business sectors in civil engineering expertise program of vocational secondary schools in Bali and (2testing the effectiveness and efficiency of partnership model developed. The study used the design and development model of Richey & Klein (2009, which consists of three main phases, namely the phase of model development, model validation, and model testing. The phase of model development used the qualitative approach, through literature review, observation and interview. Expert review techniques were used in the model validation phase. The model testing used pre-experimental design with one-shot case study. The study found that the partnership model of vocational education with the business sector in civil engineering expertise program of vocational secondary schools in Bali involves several components, such as key stakeholders, the underlying principle of partnership, orientation/common goal, the management of educational resources (teachers and facilities, curriculum development, implementation of learning/training and work practices, competency test of graduates, distribution of learning outcomes/output, as well as monitoring, evaluation and feedback of partnership program. Experimental results show that the partnership model developed has met all of the criteria (effective, practical and efficient.

  8. Summer Research Program - 1996 High School Apprenticeship Program. Volume 16, Arnold Engineering Development Center

    National Research Council Canada - National Science Library

    Moore, Gary

    1996-01-01

    The United States Air Force Summer Research Program (USAF-SRP) is designed to introduce university, college, and technical institute faculty members, graduate students, and high school students to Air Force research...

  9. Summer Research Program - 1997 High School Appenticeship Program Volume 16 Arnold Engineering Development Center

    National Research Council Canada - National Science Library

    Moore, Gary

    1997-01-01

    The United States Air Force Summer Research Program (USAF-SRP) is designed to introduce university, college, and technical institute faculty members, graduate students, and high school students to Air Force research...

  10. First a hero of science and now a martyr to science: the James Watson Affair - political correctness crushes free scientific communication.

    Science.gov (United States)

    Charlton, Bruce G

    2008-01-01

    In 2007 James D. Watson, perhaps the most famous living scientist, was forced to retire from his position and retreat from public life in the face of international mass media condemnation following remarks concerning genetically-caused racial differences in intelligence. Watson was punished for stating forthright views on topics that elite opinion has determined should be discussed only with elaborate caution, frequent disclaimers, and solemn deference to the currently-prevailing pieties. James Watson has always struck many people as brash; however this blunt, truth-telling quality was intrinsic to his role in one of the greatest scientific discoveries. Much more importantly than 'good manners', Watson has consistently exemplified the cardinal scientific virtue: he speaks what he understands to be the truth without regard for the opinion of others. The most chilling aspect of the Watson Affair was the way in which so many influential members of the scientific research community joined the media condemnation directed against Watson. Perhaps the most egregious betrayal of science was an article by editorialists of the premier UK scientific journal Nature. Instead of defending the freedom of discourse in pursuit of scientific truth, Nature instead blamed Watson for being 'crass' and lacking 'sensitivity' in discussing human genetic differences. But if asked to choose between the 'sensitive' editors of Nature or the 'crass' genius of James D. Watson, all serious scientists must take the side of Watson. Because when a premier researcher such as Watson is hounded from office by a vicious, arbitrary and untruthful mob; all lesser scientists are made vulnerable to analogous treatment at the whim of the media. A zealous and coercive brand of 'political correctness' is now making the biological truth of human genetic differences intolerably difficult to discover and discuss in US and UK. This needs to change. My hope is that truth will prevail over political correctness and

  11. DoD Science and Engineering Apprenticeship Program for High School Students, 1996-󈨥 Activities

    Science.gov (United States)

    1997-05-01

    Science Fair, A Honor Roll Baseball, Cross Country, Athletics, Weightlifting , Computers Robert Sidney Cox, III Other Male Leon High School...Sports Medicine Honor Roll Weightlifting , Swimming Marcus Mills Black Male Godby High School Florida State University Undecided FSU Incentive...paid for by the program. Seven of the students took a Psy- chology course, one a Nutritional Science class and two a Mathematics course. Eight of these

  12. Hazards in the Solar System: Out-of-School Time Student Activities Focused on Engineering Protective Space Gloves

    Science.gov (United States)

    Vaughan, R. G.; Meyer, N.; Anderson, R. B.; Sokol, K.; Nolan, B.; Edgar, L. A.; Gaither, T. A.; Milazzo, M. P.; Clark, J.

    2017-12-01

    "In Good Hands: Engineering Space Gloves" is a new Engineering Adventures® curriculum unit created for students in grades 3-5 in out-of-school time programs. It was designed and created by the Engineering is Elementary® team at the Museum of Science in Boston, MA, in collaboration with subject matter experts at the USGS Astrogeology Science Center and teacher professional development experts at Northern Arizona University's Center for Science Teaching and Learning. As part of the NASA-funded PLANETS (Planetary Learning that Advances the Nexus of Engineering, Technology, and Science) project, the goals for this unit are to introduce students to some of the potential hazards that would be faced by astronauts exploring planetary bodies in the solar system, and to engage students in thinking about how to engineer solutions to these challenges. Potential human health hazards in planetary exploration include: little to no breathable oxygen, exposure to extreme temperatures and pressures, radiation, dusty or toxic environments, and/or high velocity debris. First, students experiment with gloves made of different materials to accomplish tasks like picking up paper clips, entering numbers on a calculator, and using simple tools, while also testing for insulating properties, protection from crushing forces, and resistance to dust contamination. Students explore the trade-offs between form and multiple desired functions, and gain an introduction to materials engineering. Students are then presented with three different missions. Mission 1 is to collect and return a sample from Saturn's moon, Titan; Mission 2 is mining asteroids for useful minerals; and Mission 3 is to build a radio tower on the far side of Earth's moon. Each of these missions exhibits different potential hazards. Based on their previous experiments with different types of glove materials, students develop and test glove designs that will protect astronauts from mission-specific hazards, while still

  13. Improving Science Scores of Middle School Students with Learning Disabilities through Engineering Problem Solving Activities

    Science.gov (United States)

    Starling, A. Leyf Peirce; Lo, Ya-Yu; Rivera, Christopher J.

    2015-01-01

    This study evaluated the differential effects of three different science teaching methods, namely engineering teaching kit (ETK), explicit instruction (EI), and a combination of the two methods (ETK+EI), in two sixth-grade science classrooms. Twelve students with learning disabilities (LD) and/or attention deficit hyperactivity disorder (ADHD)…

  14. Mitigating the Mathematical Knowledge Gap between High School and First Year University Chemical Engineering Mathematics Course

    Science.gov (United States)

    Basitere, Moses; Ivala, Eunice

    2015-01-01

    This paper reports on a study carried out at a University of Technology, South Africa, aimed at identifying the existence of the mathematical knowledge gap and evaluating the intervention designed to bridge the knowledge gap amongst students studying first year mathematics at the Chemical Engineering Extended Curriculum Program (ECP). In this…

  15. Enhancing Non-Technical Skills by a Multidisciplinary Engineering Summer School

    Science.gov (United States)

    Larsen, Peter Gorm; Kristiansen, Erik Lasse; Bennedsen, Jens; Bjerge, Kim

    2017-01-01

    In general engineering studies focus on the technical skills in their own discipline. However, in their subsequent industrial careers, a significant portion of their time needs to be devoted to non-technical skills. In addition, in an increasingly globalised world collaboration in teams across cultures and disciplines is paramount to the creation…

  16. Developing a Pre-Engineering Curriculum for 3D Printing Skills for High School Technology Education

    Science.gov (United States)

    Chien, Yu-Hung

    2017-01-01

    This study developed an integrated-STEM CO[subscript 2] dragster design course using 3D printing technology. After developing a pre-engineering curriculum, we conducted a teaching experiment to assess students' differences in creativity, race forecast accuracy, and learning performance. We compared student performance in both 3D printing and…

  17. Professional Development for the Integration of Engineering in High School STEM Classrooms

    Science.gov (United States)

    Singer, Jonathan E.; Ross, Julia M.; Jackson-Lee, Yvette

    2016-01-01

    Science, Technology, Engineering, and Mathematics (STEM) education in the U.S. is in transition. The recently published "A Framework for K-12 Science Education: Practices, Crosscutting Concepts, and Core Ideas" as well as the "Next Generation Science Standards" are responsive to this call and clearly articulate a vision that…

  18. Technology to Advance High School and Undergraduate Students with Disabilities in Science, Technology, Engineering, and Mathematics

    Science.gov (United States)

    Leddy, Mark H.

    2010-01-01

    Americans with disabilities are underemployed in science, technology, engineering and mathematics (STEM) at higher rates than their nondisabled peers. This article provides an overview of the National science Foundation's Research in Disabilities Education (RDE) program, of technology use by students with disabilities (SWD) in STEM, and of…

  19. Mispairs with Watson-Crick base-pair geometry observed in ternary complexes of an RB69 DNA polymerase variant.

    Science.gov (United States)

    Xia, Shuangluo; Konigsberg, William H

    2014-04-01

    Recent structures of DNA polymerase complexes with dGMPCPP/dT and dCTP/dA mispairs at the insertion site have shown that they adopt Watson-Crick geometry in the presence of Mn(2+) indicating that the tautomeric or ionization state of the base has changed. To see whether the tautomeric or ionization state of base-pair could be affected by its microenvironment, we determined 10 structures of an RB69 DNA polymerase quadruple mutant with dG/dT or dT/dG mispairs at position n-1 to n-5 of the Primer/Template duplex. Different shapes of the mispairs, including Watson-Crick geometry, have been observed, strongly suggesting that the local environment of base-pairs plays an important role in their tautomeric or ionization states. © 2014 The Protein Society.

  20. DoD Science and Engineering Apprenticeship Program for High School Students, 1995-󈨤 Activities

    Science.gov (United States)

    1996-06-01

    University of Florida Sports Medicine Honor Roll Weightlifting , Swimming NAME: RACE: SEX: HIGH SCHOOL: ANTICIPATED COLLEGE: ANTICIPATED MAJOR...program. Three of the students took a Psychology course, one took a Nutritional Science class, one a Math course and two of them took a Meteorology...Awards and Scholarships: Honor Roll 13. Activities/Hobbies: Weightlifting , Swimming (Suggested Form) INFORMATION FOR EACH APPRENTICE

  1. A Study on the Game Programming Education Based on Educational Game Engine at School

    Science.gov (United States)

    Jeon, Jongho; Kim, Kwanwoong; Jung, Soonyoung

    2012-01-01

    It is believed that the game programming education at school should be conducted in consideration of an individual student's ability, an elementary programmer. Language to be used in the programming education also need to be associated with the ones that are actually used in the game industry. Lately, many researches on the educational programming…

  2. Hydration of Watson-Crick base pairs and dehydration of Hoogsteen base pairs inducing structural polymorphism under molecular crowding conditions.

    Science.gov (United States)

    Miyoshi, Daisuke; Nakamura, Kaori; Tateishi-Karimata, Hisae; Ohmichi, Tatsuo; Sugimoto, Naoki

    2009-03-18

    It has been revealed recently that molecular crowding, which is one of the largest differences between in vivo and in vitro conditions, is a critical factor determining the structure, stability, and function of nucleic acids. However, the effects of molecular crowding on Watson-Crick and Hoogsteen base pairs remain unclear. In order to investigate directly and quantitatively the molecular crowding effects on base pair types in nucleic acids, we designed intramolecular parallel- and antiparallel-stranded DNA duplexes consisting of Hoogsteen and Watson-Crick base pairs, respectively, as well as an intramolecular parallel-stranded triplex containing both types of base pairs. Thermodynamic analyses demonstrated that the values of free energy change at 25 degrees C for Hoogsteen base-pair formations decreased from +1.45 +/- 0.15 to +1.09 +/- 0.13 kcal mol(-1), and from -1.89 +/- 0.13 to -2.71 +/- 0.11 kcal mol(-1) in the intramolecular duplex and triplex, respectively, when the concentration of PEG 200 (polyethylene glycol with average molecular weight 200) increased from 0 to 20 wt %. However, corresponding values for Watson-Crick formation in the duplex and triplex increased from -10.2 +/- 0.2 to -8.7 +/- 0.1 kcal mol(-1), and from -10.8 +/- 0.2 to -9.2 +/- 0.2 kcal mol(-1), respectively. Furthermore, it was revealed that the opposing effects of molecular crowding on the Hoogsteen and Watson-Crick base pairs were due to different behaviors of water molecules binding to the DNA strands.

  3. Case study: IBM Watson Analytics cloud platform as Analytics-as-a-Service system for heart failure early detection

    OpenAIRE

    Guidi, Gabriele; Miniati, Roberto; Mazzola, Matteo; Iadanza, Ernesto

    2016-01-01

    In the recent years the progress in technology and the increasing availability of fast connections have produced a migration of functionalities in Information Technologies services, from static servers to distributed technologies. This article describes the main tools available on the market to perform Analytics as a Service (AaaS) using a cloud platform. It is also described a use case of IBM Watson Analytics, a cloud system for data analytics, applied to the following research scope: detect...

  4. Non-Watson-Crick basepairing and hydration in RNA motifs: molecular dynamics of 5S rRNA loop E

    Czech Academy of Sciences Publication Activity Database

    Réblová, K.; Špačková, Naďa; Štefl, R.; Csaszar, K.; Koča, J.; Leontis, N. B.; Šponer, Jiří

    2003-01-01

    Roč. 84, č. 6 (2003), s. 3564-3582 ISSN 0006-3495 R&D Projects: GA MŠk LN00A016 Grant - others:National Institutes of Health(US) 2R15 GM55898; National Science Foundation(US) CHE-9732563 Institutional research plan: CEZ:AV0Z5004920 Keywords : non-Watson-Crick base pairs * ribosomal RNA * Loop E Subject RIV: BO - Biophysics Impact factor: 4.463, year: 2003

  5. Probing the Watson-Crick, wobble, and sugar-edge hydrogen bond sites of uracil and thymine.

    Science.gov (United States)

    Müller, Andreas; Frey, Jann A; Leutwyler, Samuel

    2005-06-16

    The nucleobases uracil (U) and thymine (T) offer three hydrogen-bonding sites for double H-bond formation via neighboring N-H and C=O groups, giving rise to the Watson-Crick, wobble and sugar-edge hydrogen bond isomers. We probe the hydrogen bond properties of all three sites by forming hydrogen bonded dimers of U, 1-methyluracil (1MU), 3-methyluracil (3MU), and T with 2-pyridone (2PY). The mass- and isomer-specific S1 origins exhibit large spectral blue shifts relative to the 2PY monomer. Ab initio CIS calculations of the spectral shifts of the different hydrogen-bonded dimers show a linear correlation with experiment. This correlation allows us to identify the R2PI spectra of the weakly populated Watson-Crick and wobble isomers of both 2PY.U and 2PY.T. (3) PW91 density functional calculation of the ground-state binding and dissociation energies De and D0 are in agreement with the assignment of the dominant hydrogen bond isomers of 2PY.U, 2PY.3MU and 2PY.T as the sugar-edge form. For 2PY.U, 2PY.T and 2PY.1MU the measured wobble:Watson-Crick:sugar-edge isomer ratios are in good agreement with the calculated ratios, based on the ab initio dissociation energies and gas-phase statistical mechanics. The Watson-Crick and wobble isomers are thereby determined to be several kcal/mol less strongly bound than the sugar-edge isomers. The 36 observed intermolecular frequencies of the nine different H-bonded isomers give detailed insight into the intermolecular force field.

  6. PREFACE: 1st International School and Conference "Saint Petersburg OPEN 2014" on Optoelectronics, Photonics, Engineering and Nanostructures

    Science.gov (United States)

    2014-09-01

    Dear Colleagues, 1st International School and Conference "Saint Petersburg OPEN 2014" on Optoelectronics, Photonics, Engineering and Nanostructures was held on March 25 - 27, 2014 at St. Petersburg Academic University - Nanotechnology Research and Education Centre of the Russian Academy of Sciences. The School and Conference included a series of invited talks given by leading professors with the aim to introduce young scientists with actual problems and major advances in physics and technology. The keynote speakers were: Mikhail Glazov (Ioffe Physico-Technical Institute RAS, Russia) Vladimir Dubrovskii (Saint Petersburg Academic University RAS, Russia) Alexey Kavokin (University of Southampton, United Kingdom and St. Petersburg State University, Russia) Vladimir Korenev (Ioffe Physico-Technical Institute RAS, Russia) Sergey Kukushkin (Institute of Problems of Mechanical Engineering RAS, Russia) Nikita Pikhtin (Ioffe Physico-Technical Institute RAS, Russia and "Elfolum" Ltd., Russia) Dmitry Firsov (Saint Petersburg State Polytechnical University, Russia) During the poster session all undergraduate and graduate students attending the conference presented their works. Sufficiently large number of participants with more than 160 student attendees from all over the world allowed the Conference to provide a fertile ground for the fruitful discussions between the young scientists as well as to become a perfect platform for the valuable discussions between student authors and highly experienced scientists. The best student papers, which were selected by the Program Committee and by the invited speakers basing on the theses and their poster presentation, were awarded with diplomas of the conference - see the photos. This year's School and Conference is supported by SPIE (The International Society for Optics and Photonics), OSA (The Optical Society), St. Petersburg State Polytechnical University and by Skolkovo Foundation. It is a continuation of the annual schools and

  7. Research and Researchers in the Field of Works of Art and Historical Monuments. The School of Bridges and Roads in France -- the first school of engineers in this field in the world

    Directory of Open Access Journals (Sweden)

    Ana-Raluca Chiriac

    2006-01-01

    Full Text Available Romanian higher education began a long time ago, having its own national specificity but being also influenced by the education from other developed countries. Between 1813 -- 1840 Gh. Asachi created the School of Terminal Engineering, establi-shing the foundations of the Technical Engineering University. In Moldavia, higher education in engineering, in the field of roads and bridges, coincides with the official opening of the Faculty of Construction of Jassy, in 1941, as part of the Polytechnic Institute, today the „Gheorghe Asachi” Technical University. Over the years, this type of education has evolved and developed, under the influence of schools of engineering such as The School of Bridges and Roads in France. The French School of Bridges and Roads was created by a decree of the king, on the 14th of February 1747. In two and a half centuries, it has trained about 15,000 engineers, who accomplished great works both in their native country and abroad. The reputation of this school is based especially on the discoveries, the accomplishments and the activity of these engineers, who have a great impact on the development of this institution. Most of these engineers did not go down in history (we seldom know the name of the person who built a bridge or a road. We remember some of them by a formula, a machine, a plate on a road, without actually knowing who is the person behind the name. Shaping their portraits, we could bring them back to the memory of the public, emphasizing the common aspects of their professional training at the School of Bridges and Roads. A free professional background, of a high scientific level, comprising a lot of practical issues, based on public transport in the beginning, where reflection and action play an important part. Except a lot of great scientists (among them, a Nobel prize laureate, inventors, entrepreneurs, engineers with prestigious accomplishments, there are also politicians (even a president, writers

  8. Human DNA primase uses Watson-Crick hydrogen bonds to distinguish between correct and incorrect nucleoside triphosphates.

    Science.gov (United States)

    Moore, Chad L; Zivkovic, Aleksandra; Engels, Joachim W; Kuchta, Robert D

    2004-09-28

    Human DNA primase synthesizes short RNA primers that DNA polymerase alpha further elongates. Primase readily misincorporates the natural NTPs and will generate a wide variety of mismatches. In contrast, primase exhibited a remarkable resistance to polymerizing NTPs containing unnatural bases. This included bases whose shape was almost identical to the natural bases (4-aminobenzimidazole and 4,6-difluorobenzimidazole), bases shaped very differently than a natural base [e.g., 5- and 6-(trifluoromethyl)benzimidazole], bases much more hydrophobic than a natural base [e.g., 4- and 7-(trifluoromethyl)benzimidazole], bases of similar hydrophobicity as a natural base but with the Watson-Crick hydrogen-bonding groups in unusual positions (7-beta-D-guanine), and bases capable of forming only one Watson-Crick hydrogen bond with the template base (purine and 4-aminobenzimidazole). Primase only polymerized NTP analogues containing bases capable of forming hydrogen bonds between the equivalent of both N-1 and the exocyclic group at C-6 of a purine NTP (2-fluoroadenine, 2-chloroadenine, 3-deazaadenine, and hypoxanthine) and N-3 and the exocyclic group at C-4 of a pyrimidine. These data indicate that human primase requires the formation of Watson-Crick hydrogen bonds in order to polymerize a NTP, a situation very different than what is observed with some DNA polymerases. The implications of these results with respect to current theories of how polymerases discriminate between right and wrong (d)NTPs are discussed.

  9. Ultraviolet Absorption Induces Hydrogen-Atom Transfer in G⋅C Watson-Crick DNA Base Pairs in Solution.

    Science.gov (United States)

    Röttger, Katharina; Marroux, Hugo J B; Grubb, Michael P; Coulter, Philip M; Böhnke, Hendrik; Henderson, Alexander S; Galan, M Carmen; Temps, Friedrich; Orr-Ewing, Andrew J; Roberts, Gareth M

    2015-12-01

    Ultrafast deactivation pathways bestow photostability on nucleobases and hence preserve the structural integrity of DNA following absorption of ultraviolet (UV) radiation. One controversial recovery mechanism proposed to account for this photostability involves electron-driven proton transfer (EDPT) in Watson-Crick base pairs. The first direct observation is reported of the EDPT process after UV excitation of individual guanine-cytosine (G⋅C) Watson-Crick base pairs by ultrafast time-resolved UV/visible and mid-infrared spectroscopy. The formation of an intermediate biradical species (G[-H]⋅C[+H]) with a lifetime of 2.9 ps was tracked. The majority of these biradicals return to the original G⋅C Watson-Crick pairs, but up to 10% of the initially excited molecules instead form a stable photoproduct G*⋅C* that has undergone double hydrogen-atom transfer. The observation of these sequential EDPT mechanisms across intermolecular hydrogen bonds confirms an important and long debated pathway for the deactivation of photoexcited base pairs, with possible implications for the UV photochemistry of DNA. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  10. The Effect of Nonzero Autocorrelation Coefficients on the Distributions of Durbin-Watson Test Estimator: Three Autoregressive Models

    Directory of Open Access Journals (Sweden)

    Mei-Yu LEE

    2014-11-01

    Full Text Available This paper investigates the effect of the nonzero autocorrelation coefficients on the sampling distributions of the Durbin-Watson test estimator in three time-series models that have different variance-covariance matrix assumption, separately. We show that the expected values and variances of the Durbin-Watson test estimator are slightly different, but the skewed and kurtosis coefficients are considerably different among three models. The shapes of four coefficients are similar between the Durbin-Watson model and our benchmark model, but are not the same with the autoregressive model cut by one-lagged period. Second, the large sample case shows that the three models have the same expected values, however, the autoregressive model cut by one-lagged period explores different shapes of variance, skewed and kurtosis coefficients from the other two models. This implies that the large samples lead to the same expected values, 2(1 – ρ0, whatever the variance-covariance matrix of the errors is assumed. Finally, comparing with the two sample cases, the shape of each coefficient is almost the same, moreover, the autocorrelation coefficients are negatively related with expected values, are inverted-U related with variances, are cubic related with skewed coefficients, and are U related with kurtosis coefficients.

  11. Benchmark studies on the building blocks of DNA. 3. Watson-Crick and stacked base pairs.

    Science.gov (United States)

    Szalay, Péter G; Watson, Thomas; Perera, Ajith; Lotrich, Victor; Bartlett, Rodney J

    2013-04-18

    Excited states of stacked adenine-thymine and guanine-cytosine pairs as well as the Watson-Crick pair of guanine-thymine have been investigated using the equation of motion coupled-cluster (EOM-CC) method with single and double as well as approximate triple excitations. Transitions have been assigned, and the form of the excitations has been analyzed. The majority of the excitations could be classified as localized on the nucleobases, but for all three studied systems, charge-transfer (CT) transitions could also be identified. The main aim of this study was to compare the performance of lower-level methods (ADC(2) and TDDFT) to the high-level EOM-CC ones. It was shown that both ADC(2) and TDDFT with long-range correction have nonsystematic error in excitation energies, causing alternation of the energetic ordering of the excitations. Considering the high costs of the EOM-CC calculations, there is a need for reliable new approximate methods.

  12. Determining the Walker exponent and developing a modified Smith-Watson-Topper parameter model

    Energy Technology Data Exchange (ETDEWEB)

    Lv, Zhiqiang; Huang, Hong Zhong; Wang, Hai Kun; Gao, Huiying; Zuo, Fang Jun [University of Electronic Science and Technology of China, Chengdu (China)

    2016-03-15

    Mean stress effects significantly influence the fatigue life of components. In general, tensile mean stresses are known to reduce the fatigue life of components, whereas compressive mean stresses are known to increase it. To date, various methods that account for mean stress effects have been studied. In this research, considering the high accuracy of mean stress correction and the difficulty in obtaining the material parameter of the Walker method, a practical method is proposed to describe the material parameter of this method. The test data of various materials are then used to verify the proposed practical method. Furthermore, by applying the Walker material parameter and the Smith-Watson-Topper (SWT) parameter, a modified strain-life model is developed to consider sensitivity to mean stress of materials. In addition, three sets of experimental fatigue data from super alloy GH4133, aluminum alloy 7075-T651, and carbon steel are used to estimate the accuracy of the proposed model. A comparison is also made between the SWT parameter method and the proposed strainlife model. The proposed strain-life model provides more accurate life prediction results than the SWT parameter method.

  13. Detection of protonated non-Watson-Crick base pairs using electrospray ionization mass spectrometry.

    Science.gov (United States)

    Ishida, Riyoko; Iwahashi, Hideo

    2018-03-01

    Many studies have shown that protonated nucleic acid base pairs are involved in a wide variety of nucleic acid structures. However, little information is available on relative stability of hemiprotonated self- and non-self-dimers at monomer level. We used electrospray ionization mass spectrometry (ESI-MS) to evaluate the relative stability under various concentrations of hydrogen ion. These enable conjecture of the formation of protonated non-Watson-Crick base pairs based on DNA and RNA base sequence. In the present study, we observed that ESI-MS peaks corresponded to respective self-dimers for all examined nucleosides except for adenosine. Peak heights depended on the concentration of hydrogen ion. The ESI-MS peak heights of the hemiprotonated cytidine dimers and the hemiprotonated thymidine dimer sharply increased with increased concentration of hydrogen ion, suggesting direct participation of hydrogen ion in dimer formations. In ESI-MS measurements of the solutions containing adenosine, cytidine, thymidine and guanosine, we observed protonated cytidine-guanosine dimer (CH+-G) and protonated cytidine-thymidine dimer (CH+-T) in addition to hemiprotonated cytidine-cytidine dimer (CH+-C) with following relative peak height, (CH+-C) > (CH+-G) ≈ (CH+-T) > (CH+-A). Additionally, in the ESI-MS measurements of solutions containing adenosine, thymidine and guanosine, we observed a considerable amount of protonated adenosine-guanosine (AH+-G) and protonated adenosine-thymidine (AH+-T).

  14. Proton tunneling in the A∙T Watson-Crick DNA base pair: myth or reality?

    Science.gov (United States)

    Brovarets', Ol'ha O; Hovorun, Dmytro M

    2015-01-01

    The results and conclusions reached by Godbeer et al. in their recent work, that proton tunneling in the A∙T(WC) Watson-Crick (WC) DNA base pair occurs according to the Löwdin's (L) model, but with a small (~10(-9)) probability were critically analyzed. Here, it was shown that this finding overestimates the possibility of the proton tunneling at the A∙T(WC)↔A*∙T*(L) tautomerization, because this process cannot be implemented as a chemical reaction. Furthermore, it was outlined those biologically important nucleobase mispairs (A∙A*↔A*∙A, G∙G*↔G*∙G, T∙T*↔T*∙T, C∙C*↔C*∙C, H∙H*↔H*∙H (H - hypoxanthine)) - the players in the field of the spontaneous point mutagenesis - where the tunneling of protons is expected and for which the application of the model proposed by Godbeer et al. can be productive.

  15. Long-Range Vibrational Dynamics Are Directed by Watson-Crick Base Pairing in Duplex DNA.

    Science.gov (United States)

    Hithell, Gordon; Shaw, Daniel J; Donaldson, Paul M; Greetham, Gregory M; Towrie, Michael; Burley, Glenn A; Parker, Anthony W; Hunt, Neil T

    2016-05-05

    Ultrafast two-dimensional infrared (2D-IR) spectroscopy of a 15-mer A-T DNA duplex in solution has revealed structure-dependent vibrational coupling and energy transfer processes linking bases with the sugar-phosphate backbone. Duplex melting induces significant changes in the positions of off-diagonal peaks linking carbonyl and ring-stretching vibrational modes of the adenine and thymine bases with vibrations of the phosphate group and phosphodiester linkage. These indicate that Watson-Crick hydrogen bonding and helix formation lead to a unique vibrational coupling arrangement of base vibrational modes with those of the phosphate unit. On the basis of observations from time-resolved 2D-IR data, we conclude that rapid energy transfer processes occur between base and backbone, mediated by additional modes located on the deoxyribose moiety within the same nucleotide. These relaxation dynamics are insensitive to duplex melting, showing that efficient intramolecular energy relaxation to the solvent via the phosphate groups is the key to excess energy dissipation in both single- and double-stranded DNA.

  16. Highly Accurate Classification of Watson-Crick Basepairs on Termini of Single DNA Molecules

    Science.gov (United States)

    Winters-Hilt, Stephen; Vercoutere, Wenonah; DeGuzman, Veronica S.; Deamer, David; Akeson, Mark; Haussler, David

    2003-01-01

    We introduce a computational method for classification of individual DNA molecules measured by an α-hemolysin channel detector. We show classification with better than 99% accuracy for DNA hairpin molecules that differ only in their terminal Watson-Crick basepairs. Signal classification was done in silico to establish performance metrics (i.e., where train and test data were of known type, via single-species data files). It was then performed in solution to assay real mixtures of DNA hairpins. Hidden Markov Models (HMMs) were used with Expectation/Maximization for denoising and for associating a feature vector with the ionic current blockade of the DNA molecule. Support Vector Machines (SVMs) were used as discriminators, and were the focus of off-line training. A multiclass SVM architecture was designed to place less discriminatory load on weaker discriminators, and novel SVM kernels were used to boost discrimination strength. The tuning on HMMs and SVMs enabled biophysical analysis of the captured molecule states and state transitions; structure revealed in the biophysical analysis was used for better feature selection. PMID:12547778

  17. Case of the missing fingerprints or Dr. Watson's cosmology

    Energy Technology Data Exchange (ETDEWEB)

    Longair, M.S.

    1987-01-01

    The cosmological problem has four main areas of uncertainty -the origin of isotropy of the universe, the origin of the fluctuations from which galaxies form, the explanation of why we live in a matter universe rather than one composed of equal amounts of matter and antimatter and why the Universe seems to be within a factor of 10 of the critical, flat universe. These cannot be explained satisfactorily within the Hot Big Bang theory after a millisecond or so. The solutions are presumed, therefore, to lie in the very early universe when it was less than about a millisecond old. The clues which lead to this conclusion are set out in terms of a detective story with Sherlock Holmes explaining the facts about the universe to Dr Watson. Holmes first explains the size of the universe in terms of distances and sizes of stars, galaxies and galaxy clusters. Evidence from pictures of the universe at different temperatures, (X-ray pictures, gamma-ray pictures, far infra-red pictures and pictures at radio and millimetre wavelengths) is presented. Holmes then starts to build up a realistic model of the universe using two of the facts collected (the isotropy of the universe and the expansion of the universe), one assumption (the cosmological principle) and one theory of gravity (General Relativity). However the universe which emerges does not solve the four problems mentioned. Quasars, which provide information (illustrated) from earlier epochs of the universe may, therefore, help to solve the problems. (U.K.).

  18. Application of the Faddeev-Watson expansion to thermal collisions of Rydberg atoms with neutral particles

    International Nuclear Information System (INIS)

    de Prunele, E.

    1983-01-01

    The Faddeev-Watson expansion (FWE) for the T operator is applied to the study of thermal collisions between Rydberg atom and neutral atom. These collisions are considered as a three-body problem (the perturber, the Rydberg electron, and its parent core) and it is assumed, as already done in most theoretical works dealing with Rydberg-atom--atom collisions, that the core-perturber interaction can be neglected. Then the evaluation of the FWE first- and second-order terms is made tractable by using an appropriate separable potential for the Rydberg-electron--perturber interaction. The evaluation of the second-order term allows us to estimate the importance of taking into account explicitly the Rydberg-electron--core interaction in the expression of the (three-body) T operator for the thermal collisions considered. Detailed calculations for the process Rb(n, l = 0)+He →Rb(n',l')+He are presented and discussed. The FWE second-order term has been evaluated for the first time by taking the (two-body) t operator associated with the Rydberg atom (valence electron plus parent core) as the Coulomb potential. The contribution of the FWE second-order term to the scattering amplitude decreases as n increases and is found especially significant when both the momentum transfers involved in the collision are large and the values of l and l' are small

  19. Applications of the Galton-Watson process to human DNA evolution and demography

    CERN Document Server

    Neves, A G M

    2005-01-01

    We show that the problem of existence of a mitochondrial Eve can be understood as an application of the Galton--Watson process and presents interesting analogies with critical phenomena in Statistical Mechanics. In the approximation of small survival probability, and assuming limited progeny, we are able to find for a genealogic tree the maximum and minimum survival probabilities over all probability distributions for the number of children per woman constrained to a given mean. As a consequence, we can relate existence of a mitochondrial Eve to quantitative demographic data of early mankind. In particular, we show that a mitochondrial Eve may exist even in an exponentially growing population, provided that the mean number of children per woman $\\overline N$ is constrained to a small range depending on the probability $p$ that a child is a female. Assuming that the value $p \\approx 0.488$ valid nowadays has remained fixed for thousands of generations, the range where a mitochondrial Eve occurs with sizeable p...

  20. Stability of non-Watson-Crick G-A/A-G base pair in synthetic DNA and RNA oligonucleotides.

    Science.gov (United States)

    Ito, Yuko; Sone, Yumiko; Mizutani, Takaharu

    2004-03-01

    A non-Watson-Crick G-A/A-G base pair is found in SECIS (selenocysteine-insertion sequence) element in the 3'-untranslated region of Se-protein mRNAs and in the functional site of the hammerhead ribozyme. We studied the stability of G-A/A-G base pair (bold) in 17mer GT(U)GACGGAAACCGGAAC synthetic DNA and RNA oligonucleotides by thermal melting experiments and gel electrophoresis. The measured Tm value of DNA oligonucleotide having G-A/A-G pair showed an intermediate value (58 degrees C) between that of Watson-Crick G-C/C-G base pair (75 degrees C) and that of G-G/A-A of non-base-pair (40 degrees C). Similar thermal melting patterns were obtained with RNA oligonucleotides. This result indicates that the secondary structure of oligonucleotide having G-A/A-G base pair is looser than that of the G-C type Watson-Crick base pair. In the comparison between RNA and DNA having G-A/A-G base pair, the Tm value of the RNA oligonucleotide was 11 degrees C lower than that of DNA, indicating that DNA has a more rigid structure than RNA. The stained pattern of oligonucleotide on polyacrylamide gel clarified that the mobility of the DNA oligonucleotide G-A/A-G base pair changed according to the urea concentration from the rigid state (near the mobility of G-C/C-G oligonucleotide) in the absence of urea to the random state (near the mobility of G-G/A-A oligonucleotide) in 7 M urea. However, the RNA oligonucleotide with G-A/A-G pair moved at an intermediate mobility between that of oligonucleotide with G-C/C-G and of the oligonucleotide with G-G/A-A, and the mobility pattern did not depend on urea concentration. Thus, DNA and RNA oligonucleotides with the G-A/A-G base pair showed a pattern indicating an intermediate structure between the rigid Watson-Crick base pair and the random structure of non-base pair. RNA with G-A/A-G base pair has the intermediate structure not influenced by urea concentration. Finally, this study indicated that the intermediate rigidity imparted by Non-Watson

  1. DNA base dimers are stabilized by hydrogen-bonding interactions including non-Watson-Crick pairing near graphite surfaces.

    Science.gov (United States)

    Shankar, Akshaya; Jagota, Anand; Mittal, Jeetain

    2012-10-11

    Single- and double-stranded DNA are increasingly being paired with surfaces and nanoparticles for numerous applications, such as sensing, imaging, and drug delivery. Unlike the majority of DNA structures in bulk that are stabilized by canonical Watson-Crick pairing between Ade-Thy and Gua-Cyt, those adsorbed on surfaces are often stabilized by noncanonical base pairing, quartet formation, and base-surface stacking. Not much is known about these kinds of interactions. To build an understanding of the role of non-Watson-Crick pairing on DNA behavior near surfaces, one requires basic information on DNA base pair stacking and hydrogen-bonding interactions. All-atom molecular simulations of DNA bases in two cases--in bulk water and strongly adsorbed on a graphite surface--are conducted to study the relative strengths of stacking and hydrogen bond interactions for each of the 10 possible combinations of base pairs. The key information obtained from these simulations is the free energy as a function of distance between two bases in a pair. We find that stacking interactions exert the dominant influence on the stability of DNA base pairs in bulk water as expected. The strength of stability for these stacking interactions is found to decrease in the order Gua-Gua > Ade-Gua > Ade-Ade > Gua-Thy > Gua-Cyt > Ade-Thy > Ade-Cyt > Thy-Thy > Cyt-Thy > Cyt-Cyt. On the other hand, mutual interactions of surface-adsorbed base pairs are stabilized mostly by hydrogen-bonding interactions in the order Gua-Cyt > Ade-Gua > Ade-Thy > Ade-Ade > Cyt-Thy > Gua-Gua > Cyt-Cyt > Ade-Cyt > Thy-Thy > Gua-Thy. Interestingly, several non-Watson-Crick base pairings, which are commonly ignored, have similar stabilization free energies due to interbase hydrogen bonding as Watson-Crick pairs. This clearly highlights the importance of non-Watson-Crick base pairing in the development of secondary structures of oligonucleotides near surfaces.

  2. [Analysis of Conformational Features of Watson-Crick Duplex Fragments by Molecular Mechanics and Quantum Mechanics Methods].

    Science.gov (United States)

    Poltev, V I; Anisimov, V M; Sanchez, C; Deriabina, A; Gonzalez, E; Garcia, D; Rivas, F; Polteva, N A

    2016-01-01

    It is generally accepted that the important characteristic features of the Watson-Crick duplex originate from the molecular structure of its subunits. However, it still remains to elucidate what properties of each subunit are responsible for the significant characteristic features of the DNA structure. The computations of desoxydinucleoside monophosphates complexes with Na-ions using density functional theory revealed a pivotal role of DNA conformational properties of single-chain minimal fragments in the development of unique features of the Watson-Crick duplex. We found that directionality of the sugar-phosphate backbone and the preferable ranges of its torsion angles, combined with the difference between purines and pyrimidines. in ring bases, define the dependence of three-dimensional structure of the Watson-Crick duplex on nucleotide base sequence. In this work, we extended these density functional theory computations to the minimal' fragments of DNA duplex, complementary desoxydinucleoside monophosphates complexes with Na-ions. Using several computational methods and various functionals, we performed a search for energy minima of BI-conformation for complementary desoxydinucleoside monophosphates complexes with different nucleoside sequences. Two sequences are optimized using ab initio method at the MP2/6-31++G** level of theory. The analysis of torsion angles, sugar ring puckering and mutual base positions of optimized structures demonstrates that the conformational characteristic features of complementary desoxydinucleoside monophosphates complexes with Na-ions remain within BI ranges and become closer to the corresponding characteristic features of the Watson-Crick duplex crystals. Qualitatively, the main characteristic features of each studied complementary desoxydinucleoside monophosphates complex remain invariant when different computational methods are used, although the quantitative values of some conformational parameters could vary lying within the

  3. Corrosion Engineering.

    Science.gov (United States)

    White, Charles V.

    A description is provided for a Corrosion and Corrosion Control course offered in the Continuing Engineering Education Program at the General Motors Institute (GMI). GMI is a small cooperative engineering school of approximately 2,000 students who alternate between six-week periods of academic study and six weeks of related work experience in…

  4. NEW STUDY ABOUT STUDENTS PROFILE IN THE FIRST COURSE OF THE TECHNICAL INDUSTRIAL ENGINEERING SCHOOL

    Directory of Open Access Journals (Sweden)

    Angel Valea

    2014-12-01

    Full Text Available The paper assesses the results of a questionnaire answered by Industrial Engineering students specialized in Mechanics and Industrial Chemistry, who are taking their obligatory and first university course in Chemistry. The questionnaire has 30 multiple selection questions related to 4 significant areas (subject contents, methodology, faculty and student body. The study results were grouped in 12 significant blocks that report statistical results and/or results interpretation. The aim is to know, from the standpoint of the students, their habits and weakness as students.

  5. The United States Particle Accelerator School: Educating the Next Generation of Accelerator Scientists and Engineers

    International Nuclear Information System (INIS)

    Barletta, William A.

    2009-01-01

    Only a handful of universities in the US offer any formal training in accelerator science. The United States Particle Accelerator School (USPAS) is National Graduate Educational Program that has developed a highly successful educational paradigm that, over the past twenty-years, has granted more university credit in accelerator/beam science and technology than any university in the world. Sessions are held twice annually, hosted by major US research universities that approve course credit, certify the USPAS faculty, and grant course credit. The USPAS paradigm is readily extensible to other rapidly developing, cross-disciplinary research areas such as high energy density physics.

  6. The United States Particle Accelerator School: Educating the next generation of accelerator scientists and engineers

    International Nuclear Information System (INIS)

    Barletta, William A.

    2008-01-01

    Only a handful of universities in the US offer any formal training in accelerator science. The United States Particle Accelerator School (USPAS) is National Graduate Educational Program that has developed a highly successful educational paradigm that, over the past twenty-years, has granted more university credit in accelerator / beam science and technology than any university in the world. Sessions are held twice annually, hosted by major US research universities that approve course credit, certify the USPAS faculty, and grant course credit. The USPAS paradigm is readily extensible to other rapidly developing, crossdisciplinary research areas such as high energy density physics

  7. Industrial Education. "Small Engines".

    Science.gov (United States)

    Parma City School District, OH.

    Part of a series of curriculum guides dealing with industrial education in junior high schools, this guide provides the student with information and manipulative experiences on small gasoline engines. Included are sections on shop adjustment, safety, small engines, internal combustion, engine construction, four stroke engines, two stroke engines,…

  8. Kinetics and Thermodynamics of Watson-Crick Base Pairing Driven DNA Origami Dimerization.

    Science.gov (United States)

    Zenk, John; Tuntivate, Chanon; Schulman, Rebecca

    2016-03-16

    We investigate the kinetics and thermodynamics of DNA origami dimerization using flat rectangle origami components and different architectures of Watson-Crick complementary single-stranded DNA ("sticky end") linking strategies. We systematically vary the number of linkers, the length of the sticky ends on the linker, and linker architecture and measure the corresponding yields as well as forward and reverse reaction rate constants through fluorescence quenching assays. Yields were further verified using atomic force microscopy. We calculate values of H° and ΔS° for various interface designs and find nonlinear van't Hoff behavior, best described by two linear equations, suggesting distinct regimes of dimerization between those with and those without well-formed interfaces. We find that self-assembly reactions can be tuned by manipulating the interface architecture without suffering a loss in yield, even when yield is high, ∼75-80%. We show that the second-order forward reaction rate constant (k(on)) depends on both linker architecture and number of linkers used, with typical values on the order of 10(5)-10(6) (M·s)(-1), values that are similar to those of bimolecular association of small, complementary DNA strands. The k(on) values are generally non-Arrhenius, tending to increase with decreasing temperature. Finally, we use kinetic and thermodynamic information about the optimal linking architecture to extend the system to an infinite, two-component repeating lattice system and show that we can form micron-sized lattices, with well-formed structures up to 8 μm(2).

  9. Leucaena lanceolata S. Watson ssp. lanceolata, ESPECIE FORESTAL CON POTENCIAL PARA SER INTRODUCIDA EN SISTEMAS SILVOPASTORILES

    Directory of Open Access Journals (Sweden)

    María L. Román-Miranda

    2013-01-01

    Full Text Available La utilización de especies forestales en los sistemas de producción agropecuaria contribuye a reducir la presión en los bosques naturales y se pueden incorporar en áreas no arboladas. El objetivo de este estudio fue evaluar la calidad nutritiva, germinación, desarrollo de plántula en vivero y diversidad de usos de Leucaena lanceolata S. Watson ssp. lanceolata. El material comestible y las semillas se colectaron en Tomatlán, Jalisco. Se realizaron análisis bromatológicos, pruebas de escarificación y evaluación de plántula en vivero sobre tres suelos con diferente pH. El experimento se analizó en un diseño completamente al azar con comparación de medias de Tukey (P ≤ 0.05. Además, se hicieron entrevistas a productores, una revisión bibliográfica y consulta de ejemplares en los herbarios para conocer los usos locales y potenciales de la especie. Los resultados indican alto contenido de materia seca (97.40 % y proteína cruda (29.05 %, mayor germinación en los tratamientos térmicos, mejor desarrollo de la plántula en el suelo ligeramente ácido (6.57 y la diversidad de usos incluye leña, forraje y madera, entre otros. Por el alto valor nutritivo y diversidad de usos en el medio rural, L. lanceolata representa una opción viable para utilizarse en sistemas silvopastoriles del trópico seco.

  10. Performance characterization of Watson Ahumada motion detector using random dot rotary motion stimuli.

    Directory of Open Access Journals (Sweden)

    Siddharth Jain

    Full Text Available The performance of Watson & Ahumada's model of human visual motion sensing is compared against human psychophysical performance. The stimulus consists of random dots undergoing rotary motion, displayed in a circular annulus. The model matches psychophysical observer performance with respect to most parameters. It is able to replicate some key psychophysical findings such as invariance of observer performance to dot density in the display, and decrease of observer performance with frame duration of the display.Associated with the concept of rotary motion is the notion of a center about which rotation occurs. One might think that for accurate estimation of rotary motion in the display, this center must be accurately known. A simple vector analysis reveals that this need not be the case. Numerical simulations confirm this result, and may explain the position invariance of MST(d cells. Position invariance is the experimental finding that rotary motion sensitive cells are insensitive to where in their receptive field rotation occurs.When all the dots in the display are randomly drawn from a uniform distribution, illusory rotary motion is perceived. This case was investigated by Rose & Blake previously, who termed the illusory rotary motion the omega effect. Two important experimental findings are reported concerning this effect. First, although the display of random dots evokes perception of rotary motion, the direction of motion perceived does not depend on what dot pattern is shown. Second, the time interval between spontaneous flips in perceived direction is lognormally distributed (mode approximately 2 s. These findings suggest the omega effect fits in the category of a typical bistable illusion, and therefore the processes that give rise to this illusion may be the same processes that underlie much of other bistable phenomenon.

  11. 3rd International School and Conference “Saint Petersburg OPEN 2016” on Optoelectronics, Photonics, Engineering and Nanostructures

    International Nuclear Information System (INIS)

    2016-01-01

    Dear Colleagues, 3rd International School and Conference “Saint Petersburg OPEN 2016” on Optoelectronics, Photonics, Engineering and Nanostructures was held on March 28 - 30, 2016 at St. Petersburg Academic University of the Russian Academy of Sciences. The School and Conference included a series of invited talks given by leading professors with the aim of introducing young scientists to the actual problems and major advances in modern physics and technology. The keynote speakers were Mircea Guina (Tampere University of Technology, Finland) Evgeny I. Terukov (Ioffe Institute RAS, Russia) Victor M. Ustinov (Ioffe Institute RAS, Russia) Peter G. Kazansky (University of Southampton, UK) Alexander O. Golubok (ITMO University, Russia) Georgy E. Cirlin (St Petersburg Academic University RAS, Russia) Levon V. Asryan (Virginia Polytechnic Institute and State University, USA) Andrey A. Lipovskii (Peter the Great St.Petersburg Polytechnic University, Russia) During the poster session all undergraduate and graduate students attending the conference presented their works. A large number of participants with more than 280 student attendees from all over the world allowed the Conference to provide a fertile ground for the fruitful discussions between the young scientists as well as to become a perfect platform for the valuable discussions between student authors and highly experienced scientists. The best student papers, which were selected by the Program Committee and by the invited speakers based on the theses and their poster presentation, were awarded with diplomas of the conference - see the photos. This year “Saint Petersburg OPEN 2016” is organized by St. Petersburg Academic University in cooperation with Peter the Great St. Petersburg Polytechnic University. The School and Conference is supported by the Russian Foundation for Basic Research (Project N 16-32-10060) , Russian Science Foundation, SPIE (The International Society for Optics and Photonics) and OSA (The

  12. Assessment for English Language Education on the Programs at the Agricultural Engineering School of Madrid

    Science.gov (United States)

    Rodriguez Sinobas, Leonor; San José Martínez, Fernando; Hontoria, Kira; Adán, Angeles; Blanco, María; Calderón, Fernando; Carbonell, Victoria; Chaya, Carolina; Fondevila, Guillermo; González, Trinidad; Marín, Carmen; Mira, Sara; Molina, Antonio; Pereira, David; Quemada, Miguel; Ricote, Luis; Sánchez Monje, Rosa; Sanz, Alberto; Albir, Maria

    2014-05-01

    The convergence process among European academic degrees pursues the exchange of graduate students and the adaptation of university programs to social demand. Within the framework of the European Higher Education, European universities will need to be more competitive not only by increasing or maintaining the student enrolment, but also in their academic performance. Thus, the reinforcing of English language education within the University Programs might play an important role to reach these objectives. In this sense, a complete survey was accomplished at the Agricultural Egineering School of Madrid (ETSIA ) addressing issues such as: identification the needs for bilingual instruction at ETSIA, identification resources needed and interest and background in English language of students and professors (San José et al., 2013). The conclusions and recommendations to promote the bilingual instruction in the ETSIA, taking into account the approaches followed by other Spanish universities, are presented in this work.

  13. A Trial of PBL Education with Emphasis on Improving Practical Competence of Engineering Students-A Trial Connected with the Support for Science Education in Elementary School

    Science.gov (United States)

    Tsutsumi, Hirotaka; Nikkuni, Hiroyuki; Kitakoshi, Daisuke; Yasuda, Toshitaka; Kikuchi, Akira; Mitani, Tomoyo

    Recently Colleges of technology as well as universities have some experience-oriented classes in sciences for elementary school students. These have proved to be successful as good motivation for students in the primary education to be engineers. This research has tried the PBL education, which combined the Support of Science Education in Elementary School and the improvement of students‧ practical competence in their careers. The support of science education in elementary school was carried out by using LEGO blocks, widely utilized in the educational researches of robots, and was conducted in the practical class with the autonomous robots. Finally, the method for the class was evaluated by the elementary school students on the basis of the questionnaire.

  14. The Implementation of a One-Day Science, Technology, Engineering and Mathematics (STEM) Career Exploration Workshop for Middle School Girls in Elmira, New York

    Science.gov (United States)

    Turner, Carol-Witkowski CW

    Even now, women are underrepresented in Science, Technology, Engineering, and Mathematics (STEM) careers. The literature shows that one significant approach to address this issue is to work with middle school girls, ages eleven to thirteen, to get them interested and excited about STEM career paths. In addition to appropriate in-school support a review of many different middle school programs indicates that such programs exist in certain service areas but are still missing in others, especially the rural areas. To address this situation, a one-day STEM workshop called "Full STEAHM Ahead!" was implemented spring 2012 in Elmira, New York, to address the career exploration "turning point" for rural middle school girls. The implementation involved pre-workshop, workshop, and post-workshop phases. The success and effectiveness of the workshop was demonstrated by survey comments and verbal feedback from both the girls and educators who attended.

  15. Volume Estimates in Chronic Hemodialysis Patients by the Watson Equation and Bioimpedance Spectroscopy and the Impact on the Kt/Vurea calculation.

    Science.gov (United States)

    Noori, Nazanin; Wald, Ron; Sharma Parpia, Arti; Goldstein, Marc B

    2018-01-01

    Accurate assessment of total body water (TBW) is essential for the evaluation of dialysis adequacy (Kt/V urea ). The Watson formula, which is recommended for the calculation of TBW, was derived in healthy volunteers thereby leading to potentially inaccurate TBW estimates in maintenance hemodialysis recipients. Bioimpedance spectroscopy (BIS) may be a robust alternative for the measurement of TBW in hemodialysis recipients. The primary objective of this study was to evaluate the accuracy of Watson formula-derived TBW estimates as compared with TBW measured with BIS. Second, we aimed to identify the anthropometric characteristics that are most likely to generate inaccuracy when using the Watson formula to calculate TBW. Finally, we derived novel anthropometric equations for the more accurate estimation of TBW. This was a cross-sectional study of prevalent in-center HD patients at St Michael's Hospital. One hundred eighty-four hemodialysis patients (109 men and 75 women) were evaluated in this study. Anthropometric measurements including weight, height, waist circumference, midarm circumference, and 4-site skinfold (biceps, triceps, subscapular, and suprailiac) thickness were measured; fat mass was measured using the formula by Durnin and Womersley. We measured TBW by BIS using the Body Composition Monitor (Fresenius Medical Care, Bad Homburg, Germany). We used the Bland-Altman method to calculate the difference between the TBW derived from the Watson method and the BIS. To derive new equations for TBW estimation, Pearson's correlation coefficients between BIS-TBW (the reference test) and other variables were examined. We used the least squares regression analysis to develop parsimonious equations to predict TBW. TBW values based on the Watson method had a high correlation with BIS-TBW (correlation coefficients = 0.87 and P Watson formula overestimated TBW by 5.1 (4.5-5.8) liters and 3.8 (3.0-4.5) liters, in men and women, respectively. Higher fat mass and waist

  16. The experiences of female high school students and interest in STEM: Factors leading to the selection of an engineering or computer science major

    Science.gov (United States)

    Genoways, Sharon K.

    STEM (Science, Technology, Engineering and Math) education creates critical thinkers, increases science literacy, and enables the next generation of innovators, which leads to new products and processes that sustain our economy (Hossain & Robinson, 2012). We have been hearing the warnings for several years, that there simply are not enough young scientists entering into the STEM professional pathways to replace all of the retiring professionals (Brown, Brown, Reardon, & Merrill, 2011; Harsh, Maltese, & Tai, 2012; Heilbronner, 2011; Scott, 2012). The problem is not necessarily due to a lack of STEM skills and concept proficiency. There also appears to be a lack of interest in these fields. Recent evidence suggests that many of the most proficient students, especially minority students and women, have been gravitating away from science and engineering toward other professions. (President's Council of Advisors on Science and Technology, 2010). The purpose of this qualitative research study was an attempt to determine how high schools can best prepare and encourage young women for a career in engineering or computer science. This was accomplished by interviewing a pool of 21 women, 5 recent high school graduates planning to major in STEM, 5 college students who had completed at least one full year of coursework in an engineering or computer science major and 11 professional women who had been employed as an engineer or computer scientist for at least one full year. These women were asked to share the high school courses, activities, and experiences that best prepared them to pursue an engineering or computer science major. Five central themes emerged from this study; coursework in physics and calculus, promotion of STEM camps and clubs, teacher encouragement of STEM capabilities and careers, problem solving, critical thinking and confidence building activities in the classroom, and allowing students the opportunity to fail and ask questions in a safe environment. These

  17. Does the Watson-Jones or Modified Smith-Petersen Approach Provide Superior Exposure for Femoral Neck Fracture Fixation?

    Science.gov (United States)

    Lichstein, Paul M; Kleimeyer, John P; Githens, Michael; Vorhies, John S; Gardner, Michael J; Bellino, Michael; Bishop, Julius

    2018-04-24

    A well-reduced femoral neck fracture is more likely to heal than a poorly reduced one, and increasing the quality of the surgical exposure makes it easier to achieve anatomic fracture reduction. Two open approaches are in common use for femoral neck fractures, the modified Smith-Petersen and Watson-Jones; however, to our knowledge, the quality of exposure of the femoral neck exposure provided by each approach has not been investigated. (1) What is the respective area of exposed femoral neck afforded by the Watson-Jones and modified Smith-Petersen approaches? (2) Is there a difference in the ability to visualize and/or palpate important anatomic landmarks provided by the Watson-Jones and modified Smith-Petersen approaches? Ten fresh-frozen human pelvi underwent both modified Smith-Petersen (utilizing the caudal extent of the standard Smith-Petersen interval distal to the anterosuperior iliac spine and parallel to the palpable interval between the tensor fascia lata and the sartorius) and Watson-Jones approaches. Dissections were performed by three fellowship-trained orthopaedic traumatologists with extensive experience in both approaches. Exposure (in cm) was quantified with calibrated digital photographs and specialized software. Modified Smith-Petersen approaches were analyzed before and after rectus femoris tenotomy. The ability to visualize and palpate seven clinically relevant anatomic structures (the labrum, femoral head, subcapital femoral neck, basicervical femoral neck, greater trochanter, lesser trochanter, and medial femoral neck) was also recorded. The quantified area of the exposed proximal femur was utilized to compare which approach afforded the largest field of view of the femoral neck and articular surface for assessment of femoral neck fracture and associated femoral head injury. The ability to visualize and palpate surrounding structures was assessed so that we could better understand which approach afforded the ability to assess structures that

  18. William Watson Cheyne (1852-1932): a life in medicine and his innovative surgical treatment of congenital hydrocephalus.

    Science.gov (United States)

    Watson, Caroline C; Griessenauer, Christoph J; Loukas, Marios; Blount, Jeffrey P; Tubbs, R Shane

    2013-11-01

    William Watson Cheyne lived and trained during a period of great advances in medical knowledge and surgical techniques. Despite his various contributions to the fields of bacteriology and surgery, little is known about his career or his life apart from his affiliations with Joseph Lister. This article aims to identify Cheyne as a pioneer in the treatment of congenital hydrocephalus and sheds light on the man who existed in Lister's shadow for most of his life. Cheyne's technique for surgical intervention of hydrocephalus was a great turning point and contributes to the current treatment strategy utilized today for hydrocephalus.

  19. Dissociation of single-strand DNA: single-walled carbon nanotube hybrids by Watson-Crick base-pairing.

    Science.gov (United States)

    Jung, Seungwon; Cha, Misun; Park, Jiyong; Jeong, Namjo; Kim, Gunn; Park, Changwon; Ihm, Jisoon; Lee, Junghoon

    2010-08-18

    It has been known that single-strand DNA wraps around a single-walled carbon nanotube (SWNT) by pi-stacking. In this paper it is demonstrated that such DNA is dissociated from the SWNT by Watson-Crick base-pairing with a complementary sequence. Measurement of field effect transistor characteristics indicates a shift of the electrical properties as a result of this "unwrapping" event. We further confirm the suggested process through Raman spectroscopy and gel electrophoresis. Experimental results are verified in view of atomistic mechanisms with molecular dynamics simulations and binding energy analyses.

  20. A Social Cognitive Approach to Understanding Engineering Career Interest and Expectations among Underrepresented Students in School-Based Clubs

    Science.gov (United States)

    Dika, Sandra L.; Alvarez, Jaquelina; Santos, Jeannette; Suárez, Oscar Marcelo

    2016-01-01

    Interest in engineering at early stages of the educational career is one important precursor to choosing to study engineering in college, and engineering-related clubs are designed to foster such interest and diversify the engineering pipeline. In this study, the researchers employed a social cognitive career theory framework to examine level of…

  1. High School Student Perceptions of the Utility of the Engineering Design Process: Creating Opportunities to Engage in Engineering Practices and Apply Math and Science Content

    Science.gov (United States)

    Berland, Leema; Steingut, Rebecca; Ko, Pat

    2014-01-01

    Research and policy documents increasingly advocate for incorporating engineering design into K-12 classrooms in order to accomplish two goals: (1) provide an opportunity to engage with science content in a motivating real-world context; and (2) introduce students to the field of engineering. The present study uses multiple qualitative data…

  2. Metal-mediated DNA base pairing: alternatives to hydrogen-bonded Watson-Crick base pairs.

    Science.gov (United States)

    Takezawa, Yusuke; Shionoya, Mitsuhiko

    2012-12-18

    With its capacity to store and transfer the genetic information within a sequence of monomers, DNA forms its central role in chemical evolution through replication and amplification. This elegant behavior is largely based on highly specific molecular recognition between nucleobases through the specific hydrogen bonds in the Watson-Crick base pairing system. While the native base pairs have been amazingly sophisticated through the long history of evolution, synthetic chemists have devoted considerable efforts to create alternative base pairing systems in recent decades. Most of these new systems were designed based on the shape complementarity of the pairs or the rearrangement of hydrogen-bonding patterns. We wondered whether metal coordination could serve as an alternative driving force for DNA base pairing and why hydrogen bonding was selected on Earth in the course of molecular evolution. Therefore, we envisioned an alternative design strategy: we replaced hydrogen bonding with another important scheme in biological systems, metal-coordination bonding. In this Account, we provide an overview of the chemistry of metal-mediated base pairing including basic concepts, molecular design, characteristic structures and properties, and possible applications of DNA-based molecular systems. We describe several examples of artificial metal-mediated base pairs, such as Cu(2+)-mediated hydroxypyridone base pair, H-Cu(2+)-H (where H denotes a hydroxypyridone-bearing nucleoside), developed by us and other researchers. To design the metallo-base pairs we carefully chose appropriate combinations of ligand-bearing nucleosides and metal ions. As expected from their stronger bonding through metal coordination, DNA duplexes possessing metallo-base pairs exhibited higher thermal stability than natural hydrogen-bonded DNAs. Furthermore, we could also use metal-mediated base pairs to construct or induce other high-order structures. These features could lead to metal-responsive functional

  3. Increasing the motivation of high school students to pursue engineering careers through an application-oriented active learning boot-camp

    DEFF Research Database (Denmark)

    Jensen, Kjeld; Dyrmann, Mads; Midtiby, Henrik Skov

    2017-01-01

    The main objective of this work is to increase the motivation of high school students to pursue a career in engineering. This is achieved through a 3-day university boot camp with a high focus on applying theoretical knowledge to real world problems, technology development and working in teams....... The learning outcomes are therefore both related to academic/technical topics and to career decisions....

  4. Direct NMR Evidence that Transient Tautomeric and Anionic States in dG·dT Form Watson-Crick-like Base Pairs.

    Science.gov (United States)

    Szymanski, Eric S; Kimsey, Isaac J; Al-Hashimi, Hashim M

    2017-03-29

    The replicative and translational machinery utilizes the unique geometry of canonical G·C and A·T/U Watson-Crick base pairs to discriminate against DNA and RNA mismatches in order to ensure high fidelity replication, transcription, and translation. There is growing evidence that spontaneous errors occur when mismatches adopt a Watson-Crick-like geometry through tautomerization and/or ionization of the bases. Studies employing NMR relaxation dispersion recently showed that wobble dG·dT and rG·rU mismatches in DNA and RNA duplexes transiently form tautomeric and anionic species with probabilities (≈0.01-0.40%) that are in concordance with replicative and translational errors. Although computational studies indicate that these exceptionally short-lived and low-abundance species form Watson-Crick-like base pairs, their conformation could not be directly deduced from the experimental data, and alternative pairing geometries could not be ruled out. Here, we report direct NMR evidence that the transient tautomeric and anionic species form hydrogen-bonded Watson-Crick-like base pairs. A guanine-to-inosine substitution, which selectively knocks out a Watson-Crick-type (G)N2H 2 ···O2(T) hydrogen bond, significantly destabilized the transient tautomeric and anionic species, as assessed by lack of any detectable chemical exchange by imino nitrogen rotating frame spin relaxation (R 1ρ ) experiments. An 15 N R 1ρ NMR experiment targeting the amino nitrogen of guanine (dG-N2) provides direct evidence for Watson-Crick (G)N2H 2 ···O2(T) hydrogen bonding in the transient tautomeric state. The strategy presented in this work can be generally applied to examine hydrogen-bonding patterns in nucleic acid transient states including in other tautomeric and anionic species that are postulated to play roles in replication and translational errors.

  5. Invisible Engineers

    Science.gov (United States)

    Ohashi, Hideo

    Questionnaire to ask “mention three names of scientists you know” and “three names of engineers you know” was conducted and the answers from 140 adults were analyzed. The results indicated that the image of scientists is represented by Nobel laureates and that of engineers by great inventors like Thomas Edison and industry founders like Soichiro Honda. In order to reveal the image of engineers among young generation, questionnaire was conducted for pupils in middle and high schools. Answers from 1,230 pupils were analyzed and 226 names mentioned as engineers were classified. White votes reached 60%. Engineers who are neither big inventors nor company founders collected less than 1% of named votes. Engineers are astonishingly invisible from young generation. Countermeasures are proposed.

  6. Quasi-four-particle first-order Faddeev-Watson-Lovelace terms in proton-helium scattering

    Science.gov (United States)

    Safarzade, Zohre; Akbarabadi, Farideh Shojaei; Fathi, Reza; Brunger, Michael J.; Bolorizadeh, Mohammad A.

    2017-06-01

    The Faddeev-Watson-Lovelace equations, which are typically used for solving three-particle scattering problems, are based on the assumption of target having one active electron while the other electrons remain passive during the collision process. So, in the case of protons scattering from helium or helium-like targets, in which there are two bound-state electrons, the passive electron has a static role in the collision channel to be studied. In this work, we intend to assign a dynamic role to all the target electrons, as they are physically active in the collision. By including an active role for the second electron in proton-helium-like collisions, a new form of the Faddeev-Watson-Lovelace integral equations is needed, in which there is no disconnected kernel. We consider the operators and the wave functions associated with the electrons to obey the Pauli exclusion principle, as the electrons are indistinguishable. In addition, a quasi-three-particle collision is assumed in the initial channel, where the electronic cloud is represented as a single identity in the collision.

  7. RNAHelix: computational modeling of nucleic acid structures with Watson-Crick and non-canonical base pairs.

    Science.gov (United States)

    Bhattacharyya, Dhananjay; Halder, Sukanya; Basu, Sankar; Mukherjee, Debasish; Kumar, Prasun; Bansal, Manju

    2017-02-01

    Comprehensive analyses of structural features of non-canonical base pairs within a nucleic acid double helix are limited by the availability of a small number of three dimensional structures. Therefore, a procedure for model building of double helices containing any given nucleotide sequence and base pairing information, either canonical or non-canonical, is seriously needed. Here we describe a program RNAHelix, which is an updated version of our widely used software, NUCGEN. The program can regenerate duplexes using the dinucleotide step and base pair orientation parameters for a given double helical DNA or RNA sequence with defined Watson-Crick or non-Watson-Crick base pairs. The original structure and the corresponding regenerated structure of double helices were found to be very close, as indicated by the small RMSD values between positions of the corresponding atoms. Structures of several usual and unusual double helices have been regenerated and compared with their original structures in terms of base pair RMSD, torsion angles and electrostatic potentials and very high agreements have been noted. RNAHelix can also be used to generate a structure with a sequence completely different from an experimentally determined one or to introduce single to multiple mutation, but with the same set of parameters and hence can also be an important tool in homology modeling and study of mutation induced structural changes.

  8. Spatial, Hysteretic, and Adaptive Host-Guest Chemistry in a Metal-Organic Framework with Open Watson-Crick Sites.

    Science.gov (United States)

    Cai, Hong; Li, Mian; Lin, Xiao-Rong; Chen, Wei; Chen, Guang-Hui; Huang, Xiao-Chun; Li, Dan

    2015-09-01

    Biological and artificial molecules and assemblies capable of supramolecular recognition, especially those with nucleobase pairing, usually rely on autonomous or collective binding to function. Advanced site-specific recognition takes advantage of cooperative spatial effects, as in local folding in protein-DNA binding. Herein, we report a new nucleobase-tagged metal-organic framework (MOF), namely ZnBTCA (BTC=benzene-1,3,5-tricarboxyl, A=adenine), in which the exposed Watson-Crick faces of adenine residues are immobilized periodically on the interior crystalline surface. Systematic control experiments demonstrated the cooperation of the open Watson-Crick sites and spatial effects within the nanopores, and thermodynamic and kinetic studies revealed a hysteretic host-guest interaction attributed to mild chemisorption. We further exploited this behavior for adenine-thymine binding within the constrained pores, and a globally adaptive response of the MOF host was observed. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  9. Crystal structure of an intermolecular 2:1 complex between adenine and thymine. Evidence for both Hoogsteen and 'quasi-Watson-Crick' interactions.

    Science.gov (United States)

    Chandrasekhar, Sosale; Naik, Tangali R Ravikumar; Nayak, Susanta K; Row, Tayur N Guru

    2010-06-15

    The titled complex, obtained by co-crystallization (EtOH/25 degrees C), is apparently the only known complex of the free bases. Its crystal structure, as determined by X-ray diffraction at both 90 K and 313 K, showed that one A-T pair involves a Hoogsteen interaction, and the other a Watson-Crick interaction but only with respect to the adenine unit. The absence of a clear-cut Watson-Crick base pair raises intriguing questions about the basis of the DNA double helix. Copyright 2010 Elsevier Ltd. All rights reserved.

  10. Implementing Student-Level Random Assignment during Summer School: Lessons Learned from an Efficacy Study of Online Algebra I for Credit Recovery

    Science.gov (United States)

    Heppen, Jessica; Allensworth, Elaine; Walters, Kirk; Pareja, Amber Stitziel; Kurki, Anja; Nomi, Takako; Sorensen, Nicholas

    2011-01-01

    Credit recovery is one strategy to deal with high failure rates. The primary goal of credit recovery programs is to give students an opportunity to retake classes that they failed in an effort to get them back on track and keep them in school (Watson & Gemin, 2008). Most recently, as schools across the nation struggle to keep students on track…

  11. Examining Elementary School Students' Mental Models of Sun-Earth Relationships as a Result of Engaging in Engineering Design

    Science.gov (United States)

    Dankenbring, Chelsey; Capobianco, Brenda M.

    2016-01-01

    Current reform efforts in science education in the United States call for students to learn science through the integration of science and engineering practices. Studies have examined the effect of engineering design on students' understanding of engineering, technology, and science concepts. However, the majority of studies emphasize the accuracy…

  12. Factors Influencing the Self-Efficacy of Black High School Students Enrolled in PLTW Pre-Engineering Courses

    Science.gov (United States)

    Martin, Brandon R.

    2011-01-01

    With the increasing demand for trained engineers (especially Black engineers) it is imperative that the US invests more money and resources into programs that provide quality engineering experiences and exposures, this study evaluates the effect of various K-12 outreach initiatives and their ability to inspire students enrolled in Project Lead the…

  13. Sources of solutes to the proglacial Watson River (Akuliarusiarsuup Kuua) near Kangerlussuaq, West Greenland

    Science.gov (United States)

    Deuerling, K. M.; Martin, J. B.; Martin, E. E.; Scribner, C. A.

    2013-12-01

    Chemical weathering of silicate rocks in glacial forelands is a potential sink for atmospheric CO2 and therefore may impact long-term climate variability. Physical weathering in glacial environments enhances the rate of chemical weathering, particularly through subglacial production of rock flour with a high surface area to volume ratio. This reactive material is transported to and chemically weathered within the proglacial system, increasing concentrations of solutes as water flows downstream. Water from proglacial rivers may also acquire solutes and draw down atmospheric CO2 through reactions driven by hyporheic zone (HZ) exchange in the broad, braided reaches of the river channel. However, few studies have addressed this process and none to date have directly examined porewater contributions. We address these questions in the Watson River/Akuliarusiarsuup Kuua (WR), which flows approximately 40 km from its headwaters, through the town of Kangerlussuaq, and into Søndre Strømfjord. We have collected river water samples five times from six sites over the 2012 and 2013 summer melt seasons and three transects of PW from sand flats located along the river. Specific conductivity (SpC), pH, and dissolved ion concentrations increase downstream, consistent with ongoing chemical weathering reactions along the flow path. Relative abundances of Na+, K+, and SiO2 increase downstream relative to Ca2+ and Mg2+ concentrations. These signals indicate preferential dissolution of biotite and/or alkali feldspar. Additionally, 206Pb/204Pb ratios become more nonradiogenic downstream, lending further evidence to dissolution of readily weathered minerals. Over the course of the melt season, SpC, pH, and dissolved ion concentrations decrease, consistent with the increase in discharge due to supraglacial melting. The greatest downstream SpC increase (~2x) occurs where the river exits largely bedrock channeled flow and enters the braided portion at the Sandflugtdalen. In general, PW

  14. Mathematical Knowledge and Skills Expected by Higher Education in Engineering and the Social Sciences: Implications for High School Mathematics Curriculum

    Science.gov (United States)

    Basaran, Mehmet; Özalp, Gülümser; Kalender, Ilker; Alacaci, Cengiz

    2015-01-01

    One important function of school mathematics curriculum is to prepare high school students with the knowledge and skills needed for university education. Identifying them empirically will help making sound decisions about the contents of high school mathematics curriculum. It will also help students to make informed choices in course selection at…

  15. XRF, XRD and SEM facilities in the School of Materials and Mineral Resources Engineering, Universiti Sains Malaysia

    International Nuclear Information System (INIS)

    Azmi Rahmat

    1996-01-01

    The School has acquired excellent facilities for elemental analysis by XRF and EDX and phase analysis by XRD. The type of research work carried out in the School is described. The school also assists the local industries in trying to solve their problems fully utilizing these facilities along with other testing units

  16. Automatic Determination of the Need for Intravenous Contrast in Musculoskeletal MRI Examinations Using IBM Watson's Natural Language Processing Algorithm.

    Science.gov (United States)

    Trivedi, Hari; Mesterhazy, Joseph; Laguna, Benjamin; Vu, Thienkhai; Sohn, Jae Ho

    2018-04-01

    Magnetic resonance imaging (MRI) protocoling can be time- and resource-intensive, and protocols can often be suboptimal dependent upon the expertise or preferences of the protocoling radiologist. Providing a best-practice recommendation for an MRI protocol has the potential to improve efficiency and decrease the likelihood of a suboptimal or erroneous study. The goal of this study was to develop and validate a machine learning-based natural language classifier that can automatically assign the use of intravenous contrast for musculoskeletal MRI protocols based upon the free-text clinical indication of the study, thereby improving efficiency of the protocoling radiologist and potentially decreasing errors. We utilized a deep learning-based natural language classification system from IBM Watson, a question-answering supercomputer that gained fame after challenging the best human players on Jeopardy! in 2011. We compared this solution to a series of traditional machine learning-based natural language processing techniques that utilize a term-document frequency matrix. Each classifier was trained with 1240 MRI protocols plus their respective clinical indications and validated with a test set of 280. Ground truth of contrast assignment was obtained from the clinical record. For evaluation of inter-reader agreement, a blinded second reader radiologist analyzed all cases and determined contrast assignment based on only the free-text clinical indication. In the test set, Watson demonstrated overall accuracy of 83.2% when compared to the original protocol. This was similar to the overall accuracy of 80.2% achieved by an ensemble of eight traditional machine learning algorithms based on a term-document matrix. When compared to the second reader's contrast assignment, Watson achieved 88.6% agreement. When evaluating only the subset of cases where the original protocol and second reader were concordant (n = 251), agreement climbed further to 90.0%. The classifier was

  17. Assessing the Watson-Barker Listening Test (WBLT)-Form C in Measuring Listening Comprehension of Post-Secondary Hispanic-American Students

    Science.gov (United States)

    Worthington, Debra L.; Keaton, Shaughan; Cook, John; Fitch-Hauser, Margaret; Powers, William G.

    2014-01-01

    The Watson-Barker Listening Test (WBLT) is one of the most popular measures of listening comprehension. However, participants in studies utilizing this scale have been almost exclusively Anglo-American. At the same time, previous research questions the psychometric properties of the test. This study addressed both of these issues by testing the…

  18. Wobble↔Watson-Crick tautomeric transitions in the homo-purine DNA mismatches: a key to the intimate mechanisms of the spontaneous transversions.

    Science.gov (United States)

    Brovarets', Ol'ha O; Hovorun, Dmytro M

    2015-01-01

    The intrinsic capability of the homo-purine DNA base mispairs to perform wobble↔Watson-Crick/Topal-Fresco tautomeric transitions via the sequential intrapair double proton transfer was discovered for the first time using QM (MP2/DFT) and QTAIM methodologies that are crucial for understanding the microstructural mechanisms of the spontaneous transversions.

  19. Principles of RNA base pairing: Structures and energies of cis and trans-Watson-Crick/Sugar Edge base pairs revealed by quantum chemical calculations

    Czech Academy of Sciences Publication Activity Database

    Šponer, Judit E.; Leszczynski, J.; Šponer, Jiří

    2005-01-01

    Roč. 22, č. 6 (2005), s. 826 ISSN 0739-1102. [Albany 2005. Conversation /14./. 14.06.2005-18.06.2005, Albany] Institutional research plan: CEZ:AV0Z50040507 Keywords : RNA base pairing * DNA * Watson-Crick/Sugar Edge Subject RIV: BO - Biophysics

  20. Various extraction methods influence the adhesive properties of DDGS .... pennycress (Thlaspi arvense L.) and lesquerella (Lesquerella fendleri A. Gary (S. Watson) in the fabrication of lignocellulosic composites

    Science.gov (United States)

    Lignocellulosic composite (LC) panels were fabricated using an adhesive matrix prepared from three different agricultural by-products: dried distillers grains with solubles (DDGS), pennycress (Thlaspi arvense L.) press cake (PPC) or lesquerella (Lesquerella fendleri A. Gary (S. Watson) press cake (L...

  1. Silver(I)-Mediated Base Pairs in DNA Sequences Containing 7-Deazaguanine/Cytosine: towards DNA with Entirely Metallated Watson-Crick Base Pairs.

    Science.gov (United States)

    Méndez-Arriaga, José M; Maldonado, Carmen R; Dobado, José A; Galindo, Miguel A

    2018-03-26

    DNA sequences comprising noncanonical 7-deazaguanine ( 7C G) and canonical cytosine (C) are capable of forming Watson-Crick base pairs via hydrogen bonds as well as silver(I)-mediated base pairs by coordination to central silver(I) ions. Duplexes I and II containing 7C G and C have been synthesized and characterized. The incorporation of silver(I) ions into these duplexes has been studied by means of temperature-dependent UV spectroscopy, circular dichroism, and DFT calculations. The results suggest the formation of DNA molecules comprising contiguous metallated 7C G-Ag I -C Watson-Crick base pairs that preserve the original B-type conformation. Furthermore, additional studies performed on duplex III indicated that, in the presence of Ag I ions, 7C G-C and 7C A-T Watson-Crick base pairs ( 7C A, 7-deazadenine; T, thymine) can be converted to metallated 7C G-Ag I -C and 7C A-Ag I -T base pairs inside the same DNA molecule whilst maintaining its initial double helix conformation. These findings are very important for the development of customized silver-DNA nanostructures based on a Watson-Crick complementarity pattern. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  2. Effect of electronic coupling of Watson-Crick hopping in DNA poly(dA)-poly(dT)

    Science.gov (United States)

    Risqi, A. M.; Yudiarsah, E.

    2017-07-01

    Charge transport properties of poly(dA)-poly(dT) DNA has been studied by using thigh binding Hamiltonian approach. Molecule DNA that we use consist of 32 base pair of adenine (A) and thymine (T) and backbone is consist of phosphate and sugar. The molecule DNA is contacted electrode at both ends. Charge transport in molecule DNA depend on the environment, we studied the effect of electronic coupling of Watson-Crick hopping in poly(dA)-poly(dT) DNA to transmission probability and characteristic I-V. The electronic coupling constant influence charge transport between adenine-thymine base pairs at the same site. Transmission probability is studied by using transfer matrix and scattering matrix method, and the result of transmission probability is used to calculate the characteristic I-V by using formula Landauer Buttiker. The result shows that when the electronic coupling increase then transmission probability and characteristic I-V increase slightly.

  3. An unusual mode of DNA duplex association: Watson-Crick interaction of all-purine deoxyribonucleic acids.

    Science.gov (United States)

    Battersby, Thomas R; Albalos, Maria; Friesenhahn, Michel J

    2007-05-01

    Nucleic acid duplexes associating through purine-purine base pairing have been constructed and characterized in a remarkable demonstration of nucleic acids with mixed sequence and a natural backbone in an alternative duplex structure. The antiparallel deoxyribose all-purine duplexes associate specifically through Watson-Crick pairing, violating the nucleobase size-complementarity pairing convention found in Nature. Sequence-specific recognition displayed by these structures makes the duplexes suitable, in principle, for information storage and replication fundamental to molecular evolution in all living organisms. All-purine duplexes can be formed through association of purines found in natural ribonucleosides. Key to the formation of these duplexes is the N(3)-H tautomer of isoguanine, preferred in the duplex, but not in aqueous solution. The duplexes have relevance to evolution of the modern genetic code and can be used for molecular recognition of natural nucleic acids.

  4. Fingerprints of Both Watson-Crick and Hoogsteen Isomers of the Isolated (Cytosine-Guanine)H+ Pair.

    Science.gov (United States)

    Cruz-Ortiz, Andrés F; Rossa, Maximiliano; Berthias, Francis; Berdakin, Matías; Maitre, Philippe; Pino, Gustavo A

    2017-11-16

     Gas phase protonated guanine-cytosine (CGH + ) pair was generated using an electrospray ionization source from solutions at two different pH (5.8 and 3.2). Consistent evidence from MS/MS fragmentation patterns and differential ion mobility spectra (DIMS) point toward the presence of two isomers of the CGH + pair, whose relative populations depend strongly on the pH of the solution. Gas phase infrared multiphoton dissociation (IRMPD) spectroscopy in the 900-1900 cm -1 spectral range further confirms that the Watson-Crick isomer is preferentially produced (91%) at pH = 5.8, while the Hoogsteen isomer predominates (66%) at pH = 3.2). These fingerprint signatures are expected to be useful for the development of new analytical methodologies and to trigger isomer selective photochemical studies of protonated DNA base pairs.

  5. Case Study: IBM Watson Analytics Cloud Platform as Analytics-as-a-Service System for Heart Failure Early Detection

    Directory of Open Access Journals (Sweden)

    Gabriele Guidi

    2016-07-01

    Full Text Available In the recent years the progress in technology and the increasing availability of fast connections have produced a migration of functionalities in Information Technologies services, from static servers to distributed technologies. This article describes the main tools available on the market to perform Analytics as a Service (AaaS using a cloud platform. It is also described a use case of IBM Watson Analytics, a cloud system for data analytics, applied to the following research scope: detecting the presence or absence of Heart Failure disease using nothing more than the electrocardiographic signal, in particular through the analysis of Heart Rate Variability. The obtained results are comparable with those coming from the literature, in terms of accuracy and predictive power. Advantages and drawbacks of cloud versus static approaches are discussed in the last sections.

  6. Critique of the Watson-Glaser Critical Thinking Appraisal Test: The More You Know, the Lower Your Score

    Directory of Open Access Journals (Sweden)

    Kevin Possin

    2014-12-01

    Full Text Available The Watson-Glaser Critical Thinking Appraisal Test is one of the oldest, most frequently used, multiple-choice critical-thinking tests on the market in business, government, and legal settings for purposes of hiring and promotion. I demonstrate, however, that the test has serious construct-validity issues, stemming primarily from its ambiguous, unclear, misleading, and sometimes mysterious instructions, which have remained unaltered for decades. Erroneously scored items further diminish the test’s validity. As a result, having enhanced knowledge of formal and informal logic could well result in test subjects receiving lower scores on the test. That’s not how things should work for a CT assessment test.

  7. Enrichment Experiences in Engineering (E[superscript 3]) for Teachers Summer Research Program: An Examination of Mixed-Method Evaluation Findings on High School Teacher Implementation of Engineering Content in High School STEM Classrooms

    Science.gov (United States)

    Page, Cheryl A.; Lewis, Chance W.; Autenrieth, Robin L.; Butler-Purry, Karen L.

    2013-01-01

    Ongoing efforts across the U.S. to encourage K-12 students to consider science, technology, engineering and mathematics (STEM) careers have been motivated by concerns that the STEM pipeline is shrinking because of declining student enrollment and increasing rates of retirement in industry. The Enrichment Experiences in Engineering (E[superscript…

  8. [Projects to accelerate the practical use of innovative medical devices to collaborate with TWIns, Center for Advanced Biomedical Sciences, Waseda University and School of Engineering, The University of Tokyo].

    Science.gov (United States)

    Niimi, Shingo; Umezu, Mitsuo; Iseki, Hiroshi; Harada, Hiroshi Kasanuki Noboru; Mitsuishi, Mamoru; Kitamori, Takehiko; Tei, Yuichi; Nakaoka, Ryusuke; Haishima, Yuji

    2014-01-01

    Division of Medical Devices has been conducting the projects to accelerate the practical use of innovative medical devices to collaborate with TWIns, Center for Advanced Biomedical Sciences, Waseda University and School of Engineering, The University of Tokyo. The TWIns has been studying to aim at establishment of preclinical evaluation methods by "Engineering Based Medicine", and established Regulatory Science Institute for Medical Devices. School of Engineering, The University of Tokyo has been studying to aim at establishment of assessment methodology for innovative minimally invasive therapeutic devices, materials, and nanobio diagnostic devices. This report reviews the exchanges of personnel, the implement systems and the research progress of these projects.

  9. Structural variability and the nature of intermolecular interactions in Watson-Crick B-DNA base pairs.

    Science.gov (United States)

    Czyznikowska, Z; Góra, R W; Zaleśny, R; Lipkowski, P; Jarzembska, K N; Dominiak, P M; Leszczynski, J

    2010-07-29

    A set of nearly 100 crystallographic structures was analyzed using ab initio methods in order to verify the effect of the conformational variability of Watson-Crick guanine-cytosine and adenine-thymine base pairs on the intermolecular interaction energy and its components. Furthermore, for the representative structures, a potential energy scan of the structural parameters describing mutual orientation of the base pairs was carried out. The results were obtained using the hybrid variational-perturbational interaction energy decomposition scheme. The electron correlation effects were estimated by means of the second-order Møller-Plesset perturbation theory and coupled clusters with singles and doubles method adopting AUG-cc-pVDZ basis set. Moreover, the characteristics of hydrogen bonds in complexes, mimicking those appearing in B-DNA, were evaluated using topological analysis of the electron density. Although the first-order electrostatic energy is usually the largest stabilizing component, it is canceled out by the associated exchange repulsion in majority of the studied crystallographic structures. Therefore, the analyzed complexes of the nucleic acid bases appeared to be stabilized mainly by the delocalization component of the intermolecular interaction energy which, in terms of symmetry adapted perturbation theory, encompasses the second- and higher-order induction and exchange-induction terms. Furthermore, it was found that the dispersion contribution, albeit much smaller in terms of magnitude, is also a vital stabilizing factor. It was also revealed that the intermolecular interaction energy and its components are strongly influenced by four (out of six) structural parameters describing mutual orientation of bases in Watson-Crick pairs, namely shear, stagger, stretch, and opening. Finally, as a part of a model study, much of the effort was devoted to an extensive testing of the UBDB databank. It was shown that the databank quite successfully reproduces the

  10. How many tautomerization pathways connect Watson-Crick-like G*·T DNA base mispair and wobble mismatches?

    Science.gov (United States)

    Brovarets', Ol'ha O; Hovorun, Dmytro M

    2015-01-01

    In this study, we have theoretically demonstrated the intrinsic ability of the wobble G·T(w)/G*·T*(w)/G·T(w1)/G·T(w2) and Watson-Crick-like G*·T(WC) DNA base mispairs to interconvert into each other via the DPT tautomerization. We have established that among all these transitions, only one single G·T(w) ↔ G*·T(WC) pathway is eligible from a biological perspective. It involves short-lived intermediate - the G·T*(WC) base mispair - and is governed by the planar, highly stable, and zwitterionic [Formula: see text] transition state stabilized by the participation of the unique pattern of the five intermolecular O6(+)H⋯O4(-), O6(+)H⋯N3(-), N1(+)H⋯N3(-), N1(+)H⋯O2(-), and N2(+)H⋯O2(-) H-bonds. This non-dissociative G·T(w) ↔ G*·T(WC) tautomerization occurs without opening of the pair: Bases within mispair remain connected by 14 different patterns of the specific intermolecular interactions that successively change each other along the IRC. Novel kinetically controlled mechanism of the thermodynamically non-equilibrium spontaneous point GT/TG incorporation errors has been suggested. The mutagenic effect of the analogues of the nucleotide bases, in particular 5-bromouracil, can be attributed to the decreasing of the barrier of the acquisition by the wobble pair containing these compounds of the enzymatically competent Watson-Crick's geometry via the intrapair mutagenic tautomerization directly in the essentially hydrophobic recognition pocket of the replication DNA-polymerase machinery. Proposed approaches are able to explain experimental data, namely growth of the rate of the spontaneous point incorporation errors during DNA biosynthesis with increasing temperature.

  11. Artificial intelligence in neurodegenerative disease research: use of IBM Watson to identify additional RNA-binding proteins altered in amyotrophic lateral sclerosis.

    Science.gov (United States)

    Bakkar, Nadine; Kovalik, Tina; Lorenzini, Ileana; Spangler, Scott; Lacoste, Alix; Sponaugle, Kyle; Ferrante, Philip; Argentinis, Elenee; Sattler, Rita; Bowser, Robert

    2018-02-01

    Amyotrophic lateral sclerosis (ALS) is a devastating neurodegenerative disease with no effective treatments. Numerous RNA-binding proteins (RBPs) have been shown to be altered in ALS, with mutations in 11 RBPs causing familial forms of the disease, and 6 more RBPs showing abnormal expression/distribution in ALS albeit without any known mutations. RBP dysregulation is widely accepted as a contributing factor in ALS pathobiology. There are at least 1542 RBPs in the human genome; therefore, other unidentified RBPs may also be linked to the pathogenesis of ALS. We used IBM Watson ® to sieve through all RBPs in the genome and identify new RBPs linked to ALS (ALS-RBPs). IBM Watson extracted features from published literature to create semantic similarities and identify new connections between entities of interest. IBM Watson analyzed all published abstracts of previously known ALS-RBPs, and applied that text-based knowledge to all RBPs in the genome, ranking them by semantic similarity to the known set. We then validated the Watson top-ten-ranked RBPs at the protein and RNA levels in tissues from ALS and non-neurological disease controls, as well as in patient-derived induced pluripotent stem cells. 5 RBPs previously unlinked to ALS, hnRNPU, Syncrip, RBMS3, Caprin-1 and NUPL2, showed significant alterations in ALS compared to controls. Overall, we successfully used IBM Watson to help identify additional RBPs altered in ALS, highlighting the use of artificial intelligence tools to accelerate scientific discovery in ALS and possibly other complex neurological disorders.

  12. Engineering for Everyone

    Science.gov (United States)

    Cunningham, Christine M.; Higgins, Melissa

    2015-01-01

    The new Next Generation Science Standards make it a priority for schools to focus more on the E in STEM, to help students learn the skills and practices of engineering. Schools that are doing so face a challenge, however: How to design educational experiences in engineering that engage all students--including girls and minorities, who are…

  13. 19 January 2011 - British University of Manchester, Vice-President and Dean for the Faculty of Engineering and Physical Sciences Professor of Structural Engineering School of Mechanical, Aerospace and Civil Engineering C. Bailey in CERN Control Centre with Department Head P. Collier; at LHCb with R. Lindner and ATLAS underground experimental area with Deputy Spokesperson D. Charlton, througout accompanied by . Collier with R. Appleby and F. Loebinger

    CERN Multimedia

    Maximilien Brice

    2011-01-01

    19 January 2011 - British University of Manchester, Vice-President and Dean for the Faculty of Engineering and Physical Sciences Professor of Structural Engineering School of Mechanical, Aerospace and Civil Engineering C. Bailey in CERN Control Centre with Department Head P. Collier; at LHCb with R. Lindner and ATLAS underground experimental area with Deputy Spokesperson D. Charlton, througout accompanied by . Collier with R. Appleby and F. Loebinger

  14. An Interdisciplinary Collaboration between Computer Engineering and Mathematics/Bilingual Education to Develop a Curriculum for Underrepresented Middle School Students

    Science.gov (United States)

    Celedón-Pattichis, Sylvia; LópezLeiva, Carlos Alfonso; Pattichis, Marios S.; Llamocca, Daniel

    2013-01-01

    There is a strong need in the United States to increase the number of students from underrepresented groups who pursue careers in Science, Technology, Engineering, and Mathematics. Drawing from sociocultural theory, we present approaches to establishing collaborations between computer engineering and mathematics/bilingual education faculty to…

  15. Interactive physics apparatus: influence on interest of secondary school students in pursuing a career path in science, technology, engineering and mathematics (STEM)

    Science.gov (United States)

    Lubrica, Joel V.; Abiasen, Jovalson T.; Dolipas, Bretel B.; Ramos, Jennifer Lyn S.

    2017-01-01

    In this article, we present results of our endeavours as physics educators to facilitate and support pedagogical change and development in the educational system of a developing country, the Philippines. We have discovered that the interaction of junior high school (years 7-10) students with physics apparatus can influence students’ interest in pursuing a career in science, technology, engineering and mathematics (STEM). This assertion stems from self-reports of students who gave their views immediately after their exposure to interactive apparatus in their own school, outside of their usual lessons. Participants claimed that their interest in following a STEM career path was ‘greatly increased’ due to their exposure to these apparatus. This was true even for students who were intending to take a non-STEM career path. Thus, we recommend that, in settings that have constraints involving access to practical equipment, ways to introduce school level interactive physics apparatus to secondary school students be conducted in order to attract more students towards STEM courses. Possibly, policies encouraging this type of exposure should also be formulated.

  16. After-school enrichment and the activity theory: How can a management service organization assist schools with reducing the achievement gap among minority and non-minority students in science, technology, engineering, and mathematics (STEM) during the after-school hours?

    Science.gov (United States)

    Flowers, Reagan D.

    The primary purpose of this study was to investigate how a management service organization can assist schools with reducing the achievement gap between minority and non-minority students in science, technology, engineering, and mathematics (STEM) during the after-school hours. Developing a strategic plan through creating a program that provides support services for the implementation of hands-on activities in STEM for children during the after-school hours was central to this purpose. This Project Demonstrating Excellence (PDE), a social action project, also presents historical and current after-school program developments in the nation. The study is quantitative and qualitative in nature. Surveys were utilized to quantitatively capture the opinions of participants in the social action project on three specific education related issues: (1) disparity in academic motivation of students to participate in after-school STEM enrichment programs; (2) whether teachers and school administrators saw a need for STEM after-school enrichment; and (3) developing STEM after-school programs that were centered on problem-solving and higher-order thinking skills to develop students' interest in STEM careers. The sample consisted of 50 participants comprised of students, teachers, and administrators. The focus groups and interviews provided the qualitative data for the study. The qualitative sample consisted of 14 participants comprised of students, parents and teachers, administrators, an education consultant, and a corporate sponsor. The empirical data obtained from the study survey, focus groups, and interviews provided a comprehensive profile on the current views and future expectations of STEM after-school enrichment, student and school needs, and community partnerships with STEM companies. Results of the study and review of the implementation of the social action project, C-STEM (communication, science, technology, engineering, and mathematics) Teacher and Student Support

  17. The Impact of Training and Culture on Leadership Values and Perceptions at the United States Army Engineer School

    National Research Council Canada - National Science Library

    Thomas, Ted

    1998-01-01

    .... The EOBC students are training to assume leadership positions which the EOAC students were in. A random sample of business leaders values were then compared to the Army engineers values to draw cultural leadership...

  18. Effect of Watson-Crick and Hoogsteen base pairing on the conformational stability of C8-phenoxyl-2'-deoxyguanosine adducts.

    Science.gov (United States)

    Millen, Andrea L; Churchill, Cassandra D M; Manderville, Richard A; Wetmore, Stacey D

    2010-10-14

    Bulky DNA addition products (adducts) formed through attack at the C8 site of guanine can adopt the syn orientation about the glycosidic bond due to changes in conformational stability or hydrogen-bonding preferences directly arising from the bulky group. Indeed, the bulky substituent may improve the stability of (non-native) Hoogsteen pairs. Therefore, such adducts often result in mutations upon DNA replication. This work examines the hydrogen-bonded pairs between the Watson-Crick and Hoogsteen faces of the ortho or para C8-phenoxyl-2'-deoxyguanosine adduct and each natural (undamaged) nucleobase with the goal to clarify the conformational preference of this type of damage, as well as provide insight into the likelihood of subsequent mutation events. B3LYP/6-311+G(2df,p)//B3LYP/6-31G(d) hydrogen-bond strengths were determined using both nucleobase and nucleoside models for adduct pairs, as well as the corresponding complexes involving natural 2'-deoxyguanosine. In addition to the magnitude of the binding strengths, the R(C1'···C1') distances and ∠(N9C1'C1') angles, as well as the degree of propeller-twist and buckle distortions, were carefully compared to the values observed in natural DNA strands. Due to structural changes in the adduct monomer upon inclusion of the sugar moiety, the monomer deformation energy significantly affects the relative hydrogen-bond strengths calculated with the nucleobase and nucleoside models. Therefore, we recommend the use of at least a nucleoside model to accurately evaluate hydrogen-bond strengths of base pairs involving flexible, bulky nucleobase adducts. Our results also emphasize the importance of considering both the magnitude of the hydrogen-bond strength and the structure of the base pair when predicting the preferential binding patterns of nucleobases. Using our best models, we conclude that the Watson-Crick face of the ortho phenoxyl adduct forms significantly more stable complexes than the Hoogsteen face, which

  19. Mass of 17O from Penning-trap mass spectrometry and molecular spectroscopy: A precision test of the Dunham-Watson model in carbon monoxide

    International Nuclear Information System (INIS)

    Mount, Brianna J.; Redshaw, Matthew; Myers, Edmund G.; Mueller, Holger S. P.

    2010-01-01

    By fitting the Dunham-Watson model to extensive rotational and vibrational spectroscopic data of isotopic variants of CO, and by using existing precise masses of 13 C, 16 O, and 18 O from Penning-trap mass spectrometry, we determine the atomic mass of 17 O to be M[ 17 O]=16.999 131 644(30) u, where the uncertainty is purely statistical. Using Penning-trap mass spectrometry, we have also directly determined the atomic mass of 17 O with the more precise result M[ 17 O]=16.999 131 756 6(9) u. The Dunham-Watson model applied to the molecular spectroscopic data hence predicts the mass of 17 O to better than 1 part in 10 8 .

  20. Accommodation of an N-(deoxyguanosin-8-yl)-2-acetylaminofluorene adduct in the active site of human DNA polymerase iota: Hoogsteen or Watson-Crick base pairing?

    Science.gov (United States)

    Donny-Clark, Kerry; Shapiro, Robert; Broyde, Suse

    2009-01-13

    Bypass across DNA lesions by specialized polymerases is essential for maintenance of genomic stability. Human DNA polymerase iota (poliota) is a bypass polymerase of the Y family. Crystal structures of poliota suggest that Hoogsteen base pairing is employed to bypass minor groove DNA lesions, placing them on the spacious major groove side of the enzyme. Primer extension studies have shown that poliota is also capable of error-free nucleotide incorporation opposite the bulky major groove adduct N-(deoxyguanosin-8-yl)-2-acetylaminofluorene (dG-AAF). We present molecular dynamics simulations and free energy calculations suggesting that Watson-Crick base pairing could be employed in poliota for bypass of dG-AAF. In poliota with Hoogsteen-paired dG-AAF the bulky AAF moiety would reside on the cramped minor groove side of the template. The Hoogsteen-capable conformation distorts the active site, disrupting interactions necessary for error-free incorporation of dC opposite the lesion. Watson-Crick pairing places the AAF rings on the spacious major groove side, similar to the position of minor groove adducts observed with Hoogsteen pairing. Watson-Crick-paired structures show a well-ordered active site, with a near reaction-ready ternary complex. Thus our results suggest that poliota would utilize the same spacious region for lesion bypass of both major and minor groove adducts. Therefore, purine adducts with bulk on the minor groove side would use Hoogsteen pairing, while adducts with the bulky lesion on the major groove side would utilize Watson-Crick base pairing as indicated by our MD simulations for dG-AAF. This suggests the possibility of an expanded role for poliota in lesion bypass.

  1. I "Still" Wanna Be an Engineer! Women, Education and the Engineering Profession

    Science.gov (United States)

    Gill, Judith; Sharp, Rhonda; Mills, Julie; Franzway, Suzanne

    2008-01-01

    Women's low enrolment in post-school engineering degrees continues to be a problem for engineering faculties and the profession generally. A qualitative interview-based study of Australian women engineers across the range of engineering disciplines showed the relevance of success in math and science at school to their enrolling in engineering at…

  2. The influence of anharmonic and solvent effects on the theoretical vibrational spectra of the guanine-cytosine base pairs in Watson-Crick and Hoogsteen configurations.

    Science.gov (United States)

    Bende, Attila; Muntean, Cristina M

    2014-03-01

    The theoretical IR and Raman spectra of the guanine-cytosine DNA base pairs in Watson-Crick and Hoogsteen configurations were computed using DFT method with M06-2X meta-hybrid GGA exchange-correlation functional, including the anharmonic corrections and solvent effects. The results for harmonic frequencies and their anharmonic corrections were compared with our previously calculated values obtained with the B3PW91 hybrid GGA functional. Significant differences were obtained for the anharmonic corrections calculated with the two different DFT functionals, especially for the stretching modes, while the corresponding harmonic frequencies did not differ considerable. For the Hoogtseen case the H⁺ vibration between the G-C base pair can be characterized as an asymmetric Duffing oscillator and therefore unrealistic anharmonic corrections for normal modes where this proton vibration is involved have been obtained. The spectral modification due to the anharmonic corrections, solvent effects and the influence of sugar-phosphate group for the Watson-Crick and Hoogsteen base pair configurations, respectively, were also discussed. For the Watson-Crick case also the influence of the stacking interaction on the theoretical IR and Raman spectra was analyzed. Including the anharmonic correction in our normal mode analysis is essential if one wants to obtain correct assignments of the theoretical frequency values as compared with the experimental spectra.

  3. Infusing Engineering Concepts: Teaching Engineering Design

    Science.gov (United States)

    Daugherty, Jenny

    2012-01-01

    Engineering has gained considerable traction in many K-12 schools. However, there are several obstacles or challenges to an effective approach that leads to student learning. Questions such as where engineering best fits in the curriculum; how to include it authentically and appropriately; toward what educational end; and how best to prepare…

  4. Silver (I) as DNA glue: Ag+-mediated guanine pairing revealed by removing Watson-Crick constraints

    Science.gov (United States)

    Swasey, Steven M.; Leal, Leonardo Espinosa; Lopez-Acevedo, Olga; Pavlovich, James; Gwinn, Elisabeth G.

    2015-01-01

    Metal ion interactions with DNA have far-reaching implications in biochemistry and DNA nanotechnology. Ag+ is uniquely interesting because it binds exclusively to the bases rather than the backbone of DNA, without the toxicity of Hg2+. In contrast to prior studies of Ag+ incorporation into double-stranded DNA, we remove the constraints of Watson-Crick pairing by focusing on homo-base DNA oligomers of the canonical bases. High resolution electro-spray ionization mass spectrometry reveals an unanticipated Ag+-mediated pairing of guanine homo-base strands, with higher stability than canonical guanine-cytosine pairing. By exploring unrestricted binding geometries, quantum chemical calculations find that Ag+ bridges between non-canonical sites on guanine bases. Circular dichroism spectroscopy shows that the Ag+-mediated structuring of guanine homobase strands persists to at least 90 °C under conditions for which canonical guanine-cytosine duplexes melt below 20 °C. These findings are promising for DNA nanotechnology and metal-ion based biomedical science. PMID:25973536

  5. Silver (I) as DNA glue: Ag(+)-mediated guanine pairing revealed by removing Watson-Crick constraints.

    Science.gov (United States)

    Swasey, Steven M; Leal, Leonardo Espinosa; Lopez-Acevedo, Olga; Pavlovich, James; Gwinn, Elisabeth G

    2015-05-14

    Metal ion interactions with DNA have far-reaching implications in biochemistry and DNA nanotechnology. Ag(+) is uniquely interesting because it binds exclusively to the bases rather than the backbone of DNA, without the toxicity of Hg(2+). In contrast to prior studies of Ag(+) incorporation into double-stranded DNA, we remove the constraints of Watson-Crick pairing by focusing on homo-base DNA oligomers of the canonical bases. High resolution electro-spray ionization mass spectrometry reveals an unanticipated Ag(+)-mediated pairing of guanine homo-base strands, with higher stability than canonical guanine-cytosine pairing. By exploring unrestricted binding geometries, quantum chemical calculations find that Ag(+) bridges between non-canonical sites on guanine bases. Circular dichroism spectroscopy shows that the Ag(+)-mediated structuring of guanine homobase strands persists to at least 90 °C under conditions for which canonical guanine-cytosine duplexes melt below 20 °C. These findings are promising for DNA nanotechnology and metal-ion based biomedical science.

  6. Light-emitting self-assembled peptide nucleic acids exhibit both stacking interactions and Watson-Crick base pairing.

    Science.gov (United States)

    Berger, Or; Adler-Abramovich, Lihi; Levy-Sakin, Michal; Grunwald, Assaf; Liebes-Peer, Yael; Bachar, Mor; Buzhansky, Ludmila; Mossou, Estelle; Forsyth, V Trevor; Schwartz, Tal; Ebenstein, Yuval; Frolow, Felix; Shimon, Linda J W; Patolsky, Fernando; Gazit, Ehud

    2015-04-01

    The two main branches of bionanotechnology involve the self-assembly of either peptides or DNA. Peptide scaffolds offer chemical versatility, architectural flexibility and structural complexity, but they lack the precise base pairing and molecular recognition available with nucleic acid assemblies. Here, inspired by the ability of aromatic dipeptides to form ordered nanostructures with unique physical properties, we explore the assembly of peptide nucleic acids (PNAs), which are short DNA mimics that have an amide backbone. All 16 combinations of the very short di-PNA building blocks were synthesized and assayed for their ability to self-associate. Only three guanine-containing di-PNAs-CG, GC and GG-could form ordered assemblies, as observed by electron microscopy, and these di-PNAs efficiently assembled into discrete architectures within a few minutes. The X-ray crystal structure of the GC di-PNA showed the occurrence of both stacking interactions and Watson-Crick base pairing. The assemblies were also found to exhibit optical properties including voltage-dependent electroluminescence and wide-range excitation-dependent fluorescence in the visible region.

  7. Free energy landscape and transition pathways from Watson-Crick to Hoogsteen base pairing in free duplex DNA.

    Science.gov (United States)

    Yang, Changwon; Kim, Eunae; Pak, Youngshang

    2015-09-18

    Houghton (HG) base pairing plays a central role in the DNA binding of proteins and small ligands. Probing detailed transition mechanism from Watson-Crick (WC) to HG base pair (bp) formation in duplex DNAs is of fundamental importance in terms of revealing intrinsic functions of double helical DNAs beyond their sequence determined functions. We investigated a free energy landscape of a free B-DNA with an adenosine-thymine (A-T) rich sequence to probe its conformational transition pathways from WC to HG base pairing. The free energy landscape was computed with a state-of-art two-dimensional umbrella molecular dynamics simulation at the all-atom level. The present simulation showed that in an isolated duplex DNA, the spontaneous transition from WC to HG bp takes place via multiple pathways. Notably, base flipping into the major and minor grooves was found to play an important role in forming these multiple transition pathways. This finding suggests that naked B-DNA under normal conditions has an inherent ability to form HG bps via spontaneous base opening events. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  8. [Quantum-chemical investigation of tautomerization ways of Watson-Crick DNA base pair guanine-cytosine].

    Science.gov (United States)

    Brovarets', O O; Hovorun, D M

    2010-01-01

    A novel physico-chemical mechanism of the Watson-Crick DNA base pair Gua.Cyt tautomerization Gua.Cyt*Gua.CytGua*.Cyt (mutagenic tautomers of bases are marked by asterisks) have been revealed and realized in a pathway of single proton transfer through two mutual isoenergetic transition states with Gibbs free energy of activation 30.4 and 30.6 kcal/mol and they are ion pairs stabilized by three (N2H...N3, N1H...N4- and O6+H...N4-) and five (N2H...O2, N1H...O2, N1H...N3, O6+H...N4- and 06+H...N4-) H-bonds accordingly. Stable base pairs Gua-Cyt* and Gua*.Cyt which dissociate comparably easy into monomers have acceptable relative Gibbs energies--12.9 and 14.3 kcal/mol--for the explanation of the nature of the spontaneous transitions of DNA replication. Results are obtained at the MP2/6-311++G(2df,pd)//B3LYP/6-31 1++G(d,p) level of theory in vacuum approach.

  9. Estimation of strength in different extra Watson-Crick hydrogen bonds in DNA double helices through quantum chemical studies.

    Science.gov (United States)

    Bandyopadhyay, D; Bhattacharyya, D

    2006-10-15

    It was shown earlier, from database analysis, model building studies, and molecular dynamics simulations that formation of cross-strand bifurcated or Extra Watson-Crick hydrogen (EWC) bonds between successive base pairs may lead to extra rigidity to DNA double helices of certain sequences. The strengths of these hydrogen bonds are debatable, however, as they do not have standard linear geometry criterion. We have therefore carried out detailed ab initio quantum chemical studies using RHF/6-31G(2d,2p) and B3LYP/6-31G(2p,2d) basis sets to determine strengths of several bent hydrogen bonds with different donor and acceptors. Interaction energy calculations, corrected for the basis set superposition errors, suggest that N-H...O type bent EWC hydrogen bonds are possible along same strands or across the strands between successive base pairs, leading to significant stability (ca. 4-9 kcal/mol). The N-H...N and C-H...O type interactions, however, are not so stabilizing. Hence, consideration of EWC N-H...O H-bonds can lead to a better understanding of DNA sequence directed structural features. Copyright (c) 2006 Wiley Periodicals, Inc.

  10. Single-stranded γPNAs for in vivo site-specific genome editing via Watson-Crick recognition.

    Science.gov (United States)

    Bahal, Raman; Quijano, Elias; McNeer, Nicole A; Liu, Yanfeng; Bhunia, Dinesh C; Lopez-Giraldez, Francesco; Fields, Rachel J; Saltzman, William M; Ly, Danith H; Glazer, Peter M

    2014-01-01

    Triplex-forming peptide nucleic acids (PNAs) facilitate gene editing by stimulating recombination of donor DNAs within genomic DNA via site-specific formation of altered helical structures that further stimulate DNA repair. However, PNAs designed for triplex formation are sequence restricted to homopurine sites. Herein we describe a novel strategy where next generation single-stranded gamma PNAs (γPNAs) containing miniPEG substitutions at the gamma position can target genomic DNA in mouse bone marrow at mixed-sequence sites to induce targeted gene editing. In addition to enhanced binding, γPNAs confer increased solubility and improved formulation into poly(lactic-co-glycolic acid) (PLGA) nanoparticles for efficient intracellular delivery. Single-stranded γPNAs induce targeted gene editing at frequencies of 0.8% in mouse bone marrow cells treated ex vivo and 0.1% in vivo via IV injection, without detectable toxicity. These results suggest that γPNAs may provide a new tool for induced gene editing based on Watson-Crick recognition without sequence restriction.

  11. Higher order structural effects stabilizing the reverse watson-crick guanine-cytosine base pair in functional RNAs

    KAUST Repository

    Chawla, Mohit

    2013-10-10

    The G:C reverse Watson-Crick (W:W trans) base pair, also known as Levitt base pair in the context of tRNAs, is a structurally and functionally important base pair that contributes to tertiary interactions joining distant domains in functional RNA molecules and also participates in metabolite binding in riboswitches. We previously indicated that the isolated G:C W:W trans base pair is a rather unstable geometry, and that dicationic metal binding to the Guanine base or posttranscriptional modification of the Guanine can increase its stability. Herein, we extend our survey and report on other H-bonding interactions that can increase the stability of this base pair. To this aim, we performed a bioinformatics search of the PDB to locate all the occurencies of G:C trans base pairs. Interestingly, 66% of the G:C trans base pairs in the PDB are engaged in additional H-bonding interactions with other bases, the RNA backbone or structured water molecules. High level quantum mechanical calculations on a data set of representative crystal structures were performed to shed light on the structural stability and energetics of the various crystallographic motifs. This analysis was extended to the binding of the preQ1 metabolite to a preQ1-II riboswitch. 2013 The Author(s).

  12. Watson-Crick Base Pairing, Electronic and Photophysical Properties of Triazole Modified Adenine Analogues: A Computational Study

    KAUST Repository

    Das, Shubhajit

    2015-09-17

    We employ first-principles Density Functional Theory (DFT) and time-dependent DFT (TDDFT) to elucidate structural, electronic and optical properties of a few recently reported triazole adenine nucleobase analogues. The results are compared against the findings obtained for both natural adenine nucleobase and available experimental data. The optical absorption of these adenine analogues are calculated both in gas-phase and in solvent (methanol) using Polarized Continuum Model (PCM). We find that all the analogues show a red-shifted absorption profile as compared to adenine. Our simulated emission spectra in solvent compare fairly well with experimentally observed results. We investigate base paring ability of these adenine analogues with thymine. The calculations on the intrinsic stability of these base pairs ascertain that all the adenine analogues form the hydrogen bonded Watson-Crick base pair with similar H-bonding energy as obtained for natural adenine-thymine base pair. In our study, we provide a microscopic origin of the low-energy absorption and emission peaks, observed experimentally.

  13. Silver (I) as DNA glue: Ag+-mediated guanine pairing revealed by removing Watson-Crick constraints

    Science.gov (United States)

    Swasey, Steven M.; Leal, Leonardo Espinosa; Lopez-Acevedo, Olga; Pavlovich, James; Gwinn, Elisabeth G.

    2015-05-01

    Metal ion interactions with DNA have far-reaching implications in biochemistry and DNA nanotechnology. Ag+ is uniquely interesting because it binds exclusively to the bases rather than the backbone of DNA, without the toxicity of Hg2+. In contrast to prior studies of Ag+ incorporation into double-stranded DNA, we remove the constraints of Watson-Crick pairing by focusing on homo-base DNA oligomers of the canonical bases. High resolution electro-spray ionization mass spectrometry reveals an unanticipated Ag+-mediated pairing of guanine homo-base strands, with higher stability than canonical guanine-cytosine pairing. By exploring unrestricted binding geometries, quantum chemical calculations find that Ag+ bridges between non-canonical sites on guanine bases. Circular dichroism spectroscopy shows that the Ag+-mediated structuring of guanine homobase strands persists to at least 90 °C under conditions for which canonical guanine-cytosine duplexes melt below 20 °C. These findings are promising for DNA nanotechnology and metal-ion based biomedical science.

  14. Watson-Crick Base Pairing, Electronic and Photophysical Properties of Triazole Modified Adenine Analogues: A Computational Study

    KAUST Repository

    Das, Shubhajit; Samanta, Pralok Kumar; Pati, Swapan

    2015-01-01

    We employ first-principles Density Functional Theory (DFT) and time-dependent DFT (TDDFT) to elucidate structural, electronic and optical properties of a few recently reported triazole adenine nucleobase analogues. The results are compared against the findings obtained for both natural adenine nucleobase and available experimental data. The optical absorption of these adenine analogues are calculated both in gas-phase and in solvent (methanol) using Polarized Continuum Model (PCM). We find that all the analogues show a red-shifted absorption profile as compared to adenine. Our simulated emission spectra in solvent compare fairly well with experimentally observed results. We investigate base paring ability of these adenine analogues with thymine. The calculations on the intrinsic stability of these base pairs ascertain that all the adenine analogues form the hydrogen bonded Watson-Crick base pair with similar H-bonding energy as obtained for natural adenine-thymine base pair. In our study, we provide a microscopic origin of the low-energy absorption and emission peaks, observed experimentally.

  15. "Back-fire to lust": G. Stanley Hall, sex-segregated schooling, and the engine of sublimation.

    Science.gov (United States)

    Graebner, William

    2006-08-01

    G. Stanley Hall was an advocate of sex-segregated schooling long after most Americans had accepted coeducation. His position was based in part on personal experience: observations of his father and mother, a repressed and guilt-ridden boyhood sexuality, and his conviction that his own career success was a product of sublimated sexual desire, of erotic energy converted into mental energy. Hall theorized that coeducation put sublimation at risk, and that sex-segregated schools, by contributing to proper gendered development and by prolonging and sublimating the sexual tensions of adolescence, would produce social progress.

  16. Assessment of Knowledge and Competences in Agricultural Engineering Acquired by the Senior Secondary School Students for Farm Mechanisation

    Science.gov (United States)

    Ndem, Joseph; Ogba, Ernest; Egbe, Benjamin

    2015-01-01

    This study was designed to assess the agricultural engineering knowledge and competencies acquired by the senior secondary students for farm mechanization in technical colleges in Ebonyi state of Nigeria. A survey research design was adopted for the study. Three research questions and two null hypotheses guided the study. The population of the…

  17. PREFACE: 2nd International School and Conference Saint-Petersburg OPEN on Optoelectronics, Photonics, Engineering and Nanostructures (SPbOPEN2015)

    Science.gov (United States)

    2015-11-01

    The 2nd International School and Conference ''Saint Petersburg OPEN 2015'' on Optoelectronics, Photonics, Engineering and Nanostructures was held on April 6 - 8, 2015 at St. Petersburg Academic University. The School and Conference included a series of invited talks given by leading professors with the aim to introduce young scientists with actual problems and major advances in physics and technology. The keynote speakers were Mikhail V. Maximov (Ioffe Physico-Technical Institute RAS, Russia) Vladimir G. Dubrovskii (St. Petersburg Academic University and St. Petersburg State University, Russia) Anton Yu. Egorov (JSC Connector Optics, Russia) Victor V. Luchinin (St. Petersburg State Electrotechnical University, Russia) Vladislav E. Bugrov (St. Petersburg University of Internet Technologies, Mechanics and Optics, Russia) Vitali A. Schukin (VI Systems, Germany) Yuri P. Svirko (University of Eastern Finland, Finland) During the poster session all undergraduate and graduate students attending the conference presented their works. A sufficiently large number of participants, with more than 170 student attendees from all over the world, allowed the Conference to provide a fertile ground for fruitful discussions between the young scientists as well as to become a perfect platform for valuable discussions between student authors and highly experienced scientists. The best student papers, which were selected by the Program Committee and by the invited speakers basing on the theses and their poster presentation, were awarded with diplomas of the conference - see the photos. This year ''Saint Petersburg OPEN 2015'' is organized by St. Petersburg Academic University in cooperation with Peter the Great St. Petersburg Polytechnic University. The School and Conference is supported by Russian Science Foundation, SPIE (The International Society for Optics and Photonics), OSA (The Optical Society) and by Skolkovo Foundation. It is a continuation of the annual schools and seminars for

  18. The Process, Dialogues, and Attitudes of Vocational Engineering High School Students in a Web Problem-Based Learning (WPBL) System

    Science.gov (United States)

    Tseng, Kuo-Hung; Chang, Chi-Cheng; Lou, Shi-Jer

    2012-01-01

    This study aims to explore how high school students collaboratively solve problems in a web problem-based learning (WPBL) system in an 8-week digital logic course using discourse analysis. Employing in-depth interviews, this study also investigated the students' attitudes toward the WPBL system. The number of teaching assistants' responses had a…

  19. "But Aren't Diesel Engines Just for Big, Smelly Trucks?" An Interdisciplinary Curriculum Project for High School Chemistry Students

    Science.gov (United States)

    Zoellner, Brian P.; Chant, Richard H.; Wood, Kelly

    2014-01-01

    In a collaboration between the University of North Florida College of Education and Human Services and Sandalwood High School in Duval County, Florida, social studies and science education professors and a science teacher worked together to develop student understanding about the limited use of diesel-fueled cars in the United States when compared…

  20. The Implementation of Integrated Science Technology, Engineering and Mathematics (STEM) Instruction Using Robotics in the Middle School Science Classroom

    Science.gov (United States)

    Ntemngwa, Celestin; Oliver, J. Steve

    2018-01-01

    The research study reported here was conducted to investigate the implementation of integrated STEM lessons within courses that have a single subject science focus. The purpose also included development of a pedagogical theory. This technology-based teaching was conceptualized by school administrators and teachers in order to provide middle school…

  1. Developing students' worksheets applying soft skill-based scientific approach for improving building engineering students' competencies in vocational high schools

    Science.gov (United States)

    Suparno, Sudomo, Rahardjo, Boedi

    2017-09-01

    Experts and practitioners agree that the quality of vocational high schools needs to be greatly improved. Many construction services have voiced their dissatisfaction with today's low-quality vocational high school graduates. The low quality of graduates is closely related to the quality of the teaching and learning process, particularly teaching materials. In their efforts to improve the quality of vocational high school education, the government have implemented Curriculum 2013 (K13) and supplied teaching materials. However, the results of monitoring and evaluation done by the Directorate of Vocational High School, Directorate General of Secondary Education (2014), the provision of tasks for students in the teaching materials was totally inadequate. Therefore, to enhance the quality and the result of the instructional process, there should be provided students' worksheets that can stimulate and improve students' problem-solving skills and soft skills. In order to develop worksheets that can meet the academic requirements, the development needs to be in accordance with an innovative learning approach, which is the soft skill-based scientific approach.

  2. Where is the engineering I applied for?

    DEFF Research Database (Denmark)

    Holmegaard, Henriette Tolstrup; Madsen, Lene Møller; Ulriksen, Lars

    2016-01-01

    This paper presents results from a qualitative longitudinal study of students' transition into higher education engineering. The study aims at comparing upper-secondary school students' expectations of engineering with their actual experiences when encountering the engineering programme...

  3. Implementation of partnership management model of SMK (Vocational High School) with existing industries in mechanical engineering expertise in Central Java

    Science.gov (United States)

    Sumbodo, Wirawan; Pardjono, Samsudi, Rahadjo, Winarno Dwi

    2018-03-01

    This study aims to determine the existing conditions of implementation of partnership management model of SMK with the industry on the mechanical engineering expertise in Central Java. The method used is descriptive analysis. The research result shows that the implementation of partnership management model of SMK based on new existing industry produces ready graduates of 62.5% which belongs to low category, although the partnership program of SMK with the industry is done well with the average score of 3.17. As many as 37.5% of SMK graduates of Mechanical Engineering Expertise Program choose to continue their studies or to be an entrepreneur. It is expected that the partnership model of SMK with the industry can be developed into a reference for government policy in developing SMK that is able to produce graduates who are ready to work according to the needs of partner industry.

  4. `I Actually Contributed to Their Research': The influence of an abbreviated summer apprenticeship program in science and engineering for diverse high-school learners

    Science.gov (United States)

    Burgin, Stephen R.; McConnell, William J.; Flowers, Alonzo M., III

    2015-02-01

    This study describes an investigation of a research apprenticeship program that we developed for diverse high-school students often underrepresented in similar programs and in science, technology, engineering, and math (STEM) professions. Through the apprenticeship program, students spent 2 weeks in the summer engaged in biofuels-related research practices within working university chemistry and engineering laboratories. The experience was supplemented by discussions and activities intended to impact nature of science (NOS) and inquiry understandings and to allow for an exploration of STEM careers and issues of self-identity. Participants completed a NOS questionnaire before and after the experience, were interviewed multiple times, and were observed while working in the laboratories. Findings revealed that as a result of the program, participants (1) demonstrated positive changes in their understandings of certain NOS aspects many of which were informed by their laboratory experiences, (2) had an opportunity to explore and strengthen STEM-related future plans, and (3) examined their self-identities. A majority of participants also described a sense of belonging within the laboratory groups and believed that they were making significant contributions to the ongoing work of those laboratories even though their involvement was necessarily limited due to the short duration of the program. For students who were most influenced by the program, the belonging they felt was likely related to issues of identity and career aspirations.

  5. `It didn't really change my opinion': exploring what works, what doesn't and why in a school science, technology, engineering and mathematics careers intervention

    Science.gov (United States)

    Archer, Louise; DeWitt, Jennifer; Dillon, Justin

    2014-01-01

    Background: It is widely agreed that more needs to be done to improve participation in science, technology, engineering and mathematics (STEM). Despite considerable investment in interventions, it has been difficult to discern their effectiveness and/or impact on participation. Purpose: This paper discusses findings from a six-week pilot STEM careers intervention that was designed and overseen by a teacher from one London girls' school. We reflect on the challenges for those attempting such interventions and the problems associated with evaluating them. Sample: Data were collected from Year 9 students (girls aged 13-14 years) at the school. Design and methods: Pre- and post-intervention surveys of 68 students, classroom observations of intervention activities, three post-intervention discussion groups (five or six girls per group) and a post-intervention interview with the lead teacher were conducted. Results: Although the intervention did not significantly change students' aspirations or views of science, it did appear to have a positive effect on broadening students' understanding of the range of jobs that science can lead to or be useful for. Conclusions: Student aspirations may be extremely resistant to change and intervention, but students' understanding of 'where science can lead' may be more amenable to intervention. Implications are discussed, including the need to promote the message that science is useful for careers in and beyond science, at degree and technical levels.

  6. Determination of redox potentials for the Watson-Crick base pairs, DNA nucleosides, and relevant nucleoside analogues.

    Science.gov (United States)

    Crespo-Hernandez, Carlos E; Close, David M; Gorb, Leonid; Leszczynski, Jerzy

    2007-05-17

    Redox potentials for the DNA nucleobases and nucleosides, various relevant nucleoside analogues, Watson-Crick base pairs, and seven organic dyes are presented based on DFT/B3LYP/6-31++G(d,p) and B3YLP/6-311+G(2df,p)//B3LYP/6-31+G* levels of calculations. The values are determined from an experimentally calibrated set of equations that correlate the vertical ionization (electron affinity) energy of 20 organic molecules with their experimental reversible oxidation (reduction) potential. Our results are in good agreement with those estimated experimentally for the DNA nucleosides in acetonitrile solutions (Seidel et al. J. Phys. Chem. 1996, 100, 5541). We have found that nucleosides with anti conformation exhibit lower oxidation potentials than the corresponding syn conformers. The lowering in the oxidation potential is due to the formation of an intramolecular hydrogen bonding interaction between the 5'-OH group of the sugar and the N3 of the purine bases or C2=O of the pyrimidine bases in the syn conformation. Pairing of adenine or guanine with its complementary pyrimidine base decreases its oxidation potential by 0.15 or 0.28 V, respectively. The calculated energy difference between the oxidation potential for the G.C base pair and that of the guanine base is in good agreement with the experimental value estimated recently (0.34 V: Caruso, T.; et al. J. Am. Chem. Soc. 2005, 127, 15040). The complete and consistent set of reversible redox values determined in this work for the DNA constituents is expected to be of considerable value to those studying charge and electronic energy transfer in DNA.

  7. Analysis and Design of the Innovation and Entrepreneurship Training Management System based on School Enterprise Cooperation (Taking the School of Computer and Information Engineering of Beijing University of Agriculture as an example)

    Science.gov (United States)

    Qianyi, Zhang; Xiaoshun, Li; Ping, Hu; Lu, Ning

    2018-03-01

    With the promotion of undergraduate training mode of “3+1” in Beijing University of Agriculture, the mode and direction of applied and compound talents training should be further visualized, at the same time, in order to make up for the shortage of Double Teachers in the school and the lack of teaching cases that cover the advanced technology in the industry, the school actively encourages the cooperation between the two teaching units and enterprises, and closely connects the enterprise resources with the school teaching system, using the “1” in “3+1” to carry out innovative training work for students. This method is beneficial for college students to integrate theory into practice and realize the purpose of applying knowledge in Higher Education. However, in the actual student training management, this kind of cooperation involves three party units and personnel, so it is difficult to form a unified management, on the other hand, it may also result from poor communication, which leads to unsatisfactory training results. At the same time, there is no good training supervision mechanism, causes the student training work specious. To solve the above problem,this paper designs a training management system of student innovation and Entrepreneurship Based on school enterprise cooperation,the system can effectively manage the relevant work of students’ training, and effectively solve the above problems. The subject is based on the training of innovation and entrepreneurship in the school of computer and information engineering of Beijing University of Agriculture. The system software architecture is designed using B/S architecture technology, the system is divided into three layers, the application of logic layer includes student training management related business, and realized the user’s basic operation management for student training, users can not only realize the basic information management of enterprises, colleges and students through the system

  8. 8 May 2014 - W. Watson-Wright, Assistant Director General and Executive Secretary UNESCO Intergovernmental Oceanographic Commission Assistant Director-General for the Natural Sciences Sector ad interim visiting the CMS cavern with CMS Collaboration Deputy Spkokesperson K. Borras. Adviser to the Director-General, in charge of Relations with International Organisations M. Bona present throughout.

    CERN Multimedia

    Brice, Maximilien

    2014-01-01

    Ms Wendy Watson-Wright Assistant Director General and Executive Secretary UNESCO Intergovernmental Oceanographic Commission Assistant Director-General for the Natural Sciences Sector ad interim UNESCO

  9. Effectiveness of mathematics education in secondary schools to meet the local universities missions in producing quality engineering and science undergraduates

    Science.gov (United States)

    Bakar Hasan, Abu; Fatah Abdul, Abdul; Selamat, Zalilah

    2018-01-01

    Critical claims by certain quarters that our local undergraduates are not performing well in Mathematics, Statistics and Numerical Methods needs a serious thinking and actions. Yearly examinations results from the Sijil Pelajaran Malaysia (SPM equivalent to A-Level) and Sijil Tinggi Pelajaran Malaysia (STPM equivalent to O-Level) levels have been splendid whereby it is either increasing or decreasing in a very tight range. A good foundation in mathematics and additional mathematics will tremendously benefit these students when they enter their university education especially in engineering and science courses. This paper uses SPM results as the primary data, questionnaires as secondary, and apply the Fish Bones technique for analysis. The outcome shows that there is a clear correlation between the causes and effect.

  10. Developing learning community model with soft skill integration for the building engineering apprenticeship programme in vocational high school

    Science.gov (United States)

    Sutrisno, Dardiri, Ahmad; Sugandi, R. Machmud

    2017-09-01

    This study aimed to address the procedure, effectiveness, and problems in the implementation of learning model for Building Engineering Apprenticeship Training Programme. This study was carried out through survey method and experiment. The data were collected using questionnaire, test, and assessment sheet. The collected data were examined through description, t-test, and covariance analysis. The results of the study showed that (1) the model's procedure covered preparation course, readiness assessment, assignment distribution, handing over students to apprenticeship instructors, task completion, assisting, field assessment, report writing, and follow-up examination, (2) the Learning Community model could significantly improve students' active learning, but not improve students' hard skills and soft skills, and (3) the problems emerging in the implementation of the model were (1) students' difficulties in finding apprenticeship places and qualified instructors, and asking for relevant tasks, (2) teachers' difficulties in determining relevant tasks and monitoring students, and (3) apprenticeship instructors' difficulties in assigning, monitoring, and assessing students.

  11. [The Watson-Crick model of the DNA doublehelix. The history of the discovery and the role of the protein paradigm].

    Science.gov (United States)

    Hagemann, Rudolf

    2007-01-01

    At the beginning, the two fundamental papers by Watson and Crick published in 1953 are presented. Subsequently, the main phases of protein and nucleic acids research, starting in the middle of the 19th century, are shortly reviewed. It is outlined, how the 'protein-paradigm' was gradually developed and ultimately became widely accepted. It is then described how Caspersson in 1936 newly raised the question what the chemical nature of genes was: proteins or nucleic acids ? In the main part of this report six lines of research are reviewed, the results of which led to the demise of the 'protein paradigm', the creation of the Watson-Crick model of the DNA and the elaboration of the mechanism of DNA replication: (a) mutation experiments with UV and determination of the UV action spectrum, (b) determination of the chemical identity of the transforming agent in bacteria, (c) detailed chemical analysis of the DNA of different organisms, (d) molecular investigation of the infection of bacteria by bacteriophages, (e) X-ray analysis of DNA fibers, (f) model building and theoretical treatment of all data obtained. In this article, the factors promoting and inhibiting scientific progress in this field are described (and, above all, the relations between scientists with fixated concepts). The results from these lines of research led to the recognition of the decisive role of nucleic acids as the carriers of genetic information and, in this way, formally established the 'nucleic acid paradigm'. Finally the question is discussed why Watson and Crick found the right solution for the DNA structure (and not one of their competitors).

  12. Tautomeric transition between wobble A·C DNA base mispair and Watson-Crick-like A·C* mismatch: microstructural mechanism and biological significance.

    Science.gov (United States)

    Brovarets', Ol'ha O; Hovorun, Dmytro M

    2015-06-21

    Here, we use MP2/DFT quantum-chemical methods combined with Quantum Theory of Atoms in Molecules to study the tautomeric transition between wobble A·C(w) mismatch and Watson-Crick-like A·C*(WC) base mispair, proceeding non-dissociatively via sequential proton transfer between bases through the planar, highly stable and zwitterionic TS(A∙C-)(A∙C(W)A∙C&(WC)) transition state joined by the participation of (A)N6(+)H∙∙∙N4(-)(C), (A)N1(+)H∙∙∙N4(-)(C) and (A)C2(+)H∙∙∙N3(-)(C) H-bonds. Notably, the A·C(w) ↔ A·C*(WC) tautomerization reaction is accompanied by 10 unique patterns of the specific intermolecular interactions that consistently replace each other. Our data suggest that biologically significant A·C(w) → A·C*(WC) tautomerization is a kinetically controlled pathway for formation of the enzymatically competent Watson-Crick-like A·C*(WC) DNA base mispair in the essentially hydrophobic recognition pocket of the high-fidelity DNA-polymerase, responsible for the occurrence of spontaneous point AC/CA incorporation errors during DNA biosynthesis.

  13. ANALISIS KESALAHAN SISWA KELAS X MIA 3 SMA NEGERI 1 TANJUNGPINANG TAHUN PELAJARAN 2015/2016 DALAM MENYELESAIKAN PERMASALAHAN PELUANG DENGAN MENGGUNAKAN KATEGORI KESALAHAN WATSON

    Directory of Open Access Journals (Sweden)

    Susilawati Susilawati

    2016-06-01

    Full Text Available Studi ini bertujuan untuk menganalisa dan mengklasifikasi kesalahan siswa dalam menyelesaikan permasalahan peluang. Subjek studi ini adalah 38 siswa dari kelas X MIA 3 di SMA Negeri 1 Tanjungpinang. Instrumen yang digunakan adalah tes tertulis yang memuat 5 butir soal uraian yang disusun dan divalidasi bersama oleh peneliti dan guru matematika kelas X MIA 3. Kesalahan yang dianalisis dikategorikan dengan menggunakan kategori kesalahan Watson diantaranya data tidak tepat (inappropriate data/id, prosedur tidak tepat (inappropriate procedure/ip, data hilang (ommited data/od, kesimpulan hilang (ommited conclusion/oc, konflik level respon (response level conflict/rlc, manipulasi tidak langsung (undirected manipulation/um, masalah hierarki keterampilan (skills hierarchy problem/shp, dan jenis kesalahan lain dalam kategori terakhir. Hasil analisis kesalahan menunjukkan persentase data tidak tepat sebesar 14,43 %, prosedur tidak tepat sebesar 12,08 %, data hilang sebesar 19,13%, kesimpulan hilang sebesar 21,14%, konflik level respon sebesar 1,34 %, manipulasi tidak langsung sebesar 12,75 %, serta persentase masalah hirarki keterampilan sebesar 19,13 %. Kata Kunci: Peluang, Kesalahan Siswa, Kategori Kesalahan Menurut Watson DOI: http://dx.doi.org/10.22342/jpm.10.2.3630.39-52

  14. Effects of Nursing Care Based on Watson's Theory of Human Caring on Anxiety, Distress, And Coping, When Infertility Treatment Fails: A Randomized Controlled Trial.

    Science.gov (United States)

    Durgun Ozan, Yeter; Okumuş, Hülya

    2017-06-01

    Introduction: The failure of infertility treatment leads to individual, familial, and social problems. The objective of this study was to evaluate the effectiveness of the nursing care program based on Watson's "Theory of Human Caring" on anxiety and distress caused by coping when the treatment fails. Methods: This study randomized controlled trial study was conducted from April to November 2012, with 86 Turkish women with infertility (intervention group: 45, control group: 41). Follow-up of 32 infertile women, who failed infertility treatment from intervention group, and 35 infertile women, who failed infertility treatment from control group, continued for another four weeks. Data were collected through Spiel Berger's State/Trait Anxiety Inventory, Distress Scale, and Ways of Coping Questionnaire. The analyses of data were conducted using SPSS ver 13. Results: The intervention and control groups significantly differed in terms of anxiety, distress, and coping levels. The intervention group's mean anxiety score decreased by thirteen points and distress by fourteen points (in a positive direction). The intervention group's mean positive coping style score increased. Whereas a negative increase was observed in the control group's values depending on the failure of the treatment. Conclusion: Watson's theory of human caring is recommended as a guide to nursing patients with infertility treatment to decrease levels of anxiety and distress, and to increase the positive coping style among infertile women.

  15. An Engineer Does What Now?

    Science.gov (United States)

    Gilbert, Amy; Wade, Katherine

    2014-01-01

    For an introductory engineering class at an all-girls urban high school in the Southeast, the authors planned an experience that would align with the engineering aspects of the "Next Generation Science Standards" (NGSS Lead States 2013). The goal was to better relate science, technology, engineering, and mathematics (STEM) to everyday…

  16. Incorporating Engineering Design Challenges into STEM Courses

    Science.gov (United States)

    Householder, Daniel L., Ed.; Hailey, Christine E., Ed.

    2012-01-01

    Successful strategies for incorporating engineering design challenges into science, technology, engineering, and mathematics (STEM) courses in American high schools are presented in this paper. The developers have taken the position that engineering design experiences should be an important component of the high school education of all American…

  17. Implementation of project based learning on the Prakerin subject of vocational high school students of the building engineering to enhance employment skill readiness of graduates in the construction services field

    Science.gov (United States)

    Sugandi, Machmud

    2017-09-01

    Implementation of the Prakerin subject in the field of Building Engineering study program in vocational high school (VHS) are facing many issues associated to non-compliance unit of work in the industry and the expected competencies in learning at school. Project Based Learning (PBL) is an appropriate model learning used for Prakerin subject to increase student competence as the extension of the Prakerin implementation in the construction industry services. Assignments based on the selected project during their practical industry work were given to be completed by student. VHS students in particular field of Building Engineering study program who has been completed Prakerin subject will have a better job readiness, and therefore they will have an understanding on the knowledge, skills, and attitudes and good vision on the construction project in accordance with their experience during Prakerin work in the industry.

  18. On the calculation of line strengths, oscillator strengths and lifetimes for very large principal quantum numbers in hydrogenic atoms and ions by the McLean–Watson formula

    International Nuclear Information System (INIS)

    Hey, J D

    2014-01-01

    As a sequel to an earlier study (Hey 2009 J. Phys. B: At. Mol. Opt. Phys. 42 125701), we consider further the application of the line strength formula derived by Watson (2006 J. Phys. B: At. Mol. Opt. Phys. 39 L291) to transitions arising from states of very high principal quantum number in hydrogenic atoms and ions (Rydberg–Rydberg transitions, n > 1000). It is shown how apparent difficulties associated with the use of recurrence relations, derived (Hey 2006 J. Phys. B: At. Mol. Opt. Phys. 39 2641) by the ladder operator technique of Infeld and Hull (1951 Rev. Mod. Phys. 23 21), may be eliminated by a very simple numerical device, whereby this method may readily be applied up to n ≈ 10 000. Beyond this range, programming of the method may entail greater care and complexity. The use of the numerically efficient McLean–Watson formula for such cases is again illustrated by the determination of radiative lifetimes and comparison of present results with those from an asymptotic formula. The question of the influence on the results of the omission or inclusion of fine structure is considered by comparison with calculations based on the standard Condon–Shortley line strength formula. Interest in this work on the radial matrix elements for large n and n′ is related to measurements of radio recombination lines from tenuous space plasmas, e.g. Stepkin et al (2007 Mon. Not. R. Astron. Soc. 374 852), Bell et al (2011 Astrophys. Space Sci. 333 377), to the calculation of electron impact broadening parameters for such spectra (Watson 2006 J. Phys. B: At. Mol. Opt. Phys. 39 1889) and comparison with other theoretical methods (Peach 2014 Adv. Space Res. in press), to the modelling of physical processes in H II regions (Roshi et al 2012 Astrophys. J. 749 49), and the evaluation bound–bound transitions from states of high n during primordial cosmological recombination (Grin and Hirata 2010 Phys. Rev. D 81 083005, Ali-Haïmoud and Hirata 2010 Phys. Rev. D 82 063521

  19. Gender Differences in Self-Efficacy and Sense of Class and School Belonging for Majors in Science, Technology, Engineering, and Mathematics (STEM) Disciplines

    Science.gov (United States)

    Hogue, Barbara A.

    Research into women's underrepresentation in science, technology, engineering, and mathematics (STEM) disciplines has become a topic of interest due to the increasing need for employees with technical expertise and a shortage of individuals to fill STEM jobs. The discrepancy in women's representation between STEM and other fields cannot adequately be explained by factors such as women's need to balance work and family (medicine and law are both extremely demanding careers), women's fear of competition (admissions into medical and law schools are highly competitive), or women's inability to excel in science (e.g., entry into medicine requires excellent achievement in the basic sciences). The purpose of this study is to gain a deeper understanding of the role and/or impact a sense of belonging has inside and outside of STEM classrooms. Research questions focused on the role and/or impact of belonging contributes to students' self-efficacy beliefs as a STEM major. Bandura's self-efficacy theory serves as the theoretical framework. Data sources include close-ended surveys of 200 sophomore- and junior-level college students majoring in a STEM discipline. A quantitative exploratory approach allowed participants' responses to be analyzed using both correlation and multiple regression analyses to understand whether a student's sense of belonging is associated with his or her self-efficacy beliefs. Findings suggested that positive support systems impact students' self-efficacy and play a role in fostering students' motivation and decision to major in STEM disciplines. This study contributes to positive social change by providing empirical evidence faculty and administrators may use to promote university-based STEM support programs reflecting the impact belonging has on students' self-efficacy and potentially increasing the number of students majoring in STEM disciplines.

  20. Aplicação da Teoria do Cuidado Transpessoal de Jean Watson: uma década de produção brasileira Aplicación de la Teoría del Cuidado Transpersonal de Jean Watson: una década de producción brasileña Jean Watson's Theory of Human Caring: a decade of Brazilian publications

    Directory of Open Access Journals (Sweden)

    Luciane Favero

    2009-01-01

    Full Text Available Esta revisão sistemática objetivou descrever e analisar a aplicação da Teoria do Cuidado Transpessoal de Jean Watson nas pesquisas divulgadas em publicações de Enfermagem brasileiras dos últimos dez anos. O levantamento bibliográfico abrangeu 34 produções científicas selecionadas nas bases de dados eletrônicas MEDLINE (MEDLARS [Medical Literature Analysis and Retrieval System] On-line, LILACS (Literatura Latino Americana e do Caribe em Ciências da Saúde, BDENF (Base de dados de Enfermagem e SciELO (Scientific Electronic Library On-line, que após aplicação dos critérios de inclusão estabelecidos, compuseram a amostra do estudo. Os resultados apontaram que a Região Sul concentra 61,8% das produções referidas ao tema de estudo, que ela pode ser aplicada nos níveis de atenção primária, secundária e terciária e que 64,7% das produções utilizam os fatores de cuidado propostos por Jean Watson em 1979. Emerge a necessidade de aprimoramento das pesquisas acerca da transformação ocorrida na Teoria do Cuidado Transpessoal, com abordagem do Processo Clinical Caritas, porém como são escassos os estudos referentes a esta temática, dificultam sua utilização prática.Esta revisión sistemática tuvo como objetivo describir y analizar la aplicación de la Teoría del Cuidado Transpersonal de Jean Watson en las investigaciones divulgadas en publicaciones de Enfermería brasileñas de los últimos diez años. El levantamiento bibliográfico abarcó 34 producciones seleccionadas en las bases de datos electrónicas MEDLINE (MEDLARS [Medical Literature Analysis and Retrieval System] On-line, LILACS (Literatura Latinoamericana y del Caribe en Ciencias de la Salud, BDENF (Base de datos de Enfermería y SciELO (Scientific Electronic Library On-line, que después de la aplicación de los criterios de inclusión establecidos, compusieron la muestra del estudio. Los resultados señalaron que la región Sur concentra el 61,8% de las

  1. Engineering Encounters: Reverse Engineering

    Science.gov (United States)

    McGowan, Veronica Cassone; Ventura, Marcia; Bell, Philip

    2017-01-01

    This column presents ideas and techniques to enhance your science teaching. This month's issue shares information on how students' everyday experiences can support science learning through engineering design. In this article, the authors outline a reverse-engineering model of instruction and describe one example of how it looked in our fifth-grade…

  2. The relevance of surveying content in mining engineering education ...

    African Journals Online (AJOL)

    The University of the Witwatersrand School of Mining Engineering (Wits Mining) has its origins in the South African School of Mines, which was established in 1896. It is currently recognised as one of the world's top mining engineering schools that educate mining engineering candidates to become qualified to specialise in ...

  3. teaching and learning methodologies in engineering education

    African Journals Online (AJOL)

    Global Journal

    and learning of engineering in Nigerian Universities and suggests ways of improving engineering education in ... and inadequate collaboration between industries and schools. .... can book at their convenient time without conflicting with their ...

  4. Biology: An Important Agricultural Engineering Mechanism

    Science.gov (United States)

    Henderson, S. M.

    1974-01-01

    Describes the field of bioengineering with particular emphasis on agricultural engineering, and presents the results of a survey of schools that combine biology and engineering in their curricula. (JR)

  5. Can tautomerization of the A·T Watson-Crick base pair via double proton transfer provoke point mutations during DNA replication? A comprehensive QM and QTAIM analysis.

    Science.gov (United States)

    Brovarets, Ol'ha O; Hovorun, Dmytro M

    2014-01-01

    Trying to answer the question posed in the title, we have carried out a detailed theoretical investigation of the biologically important mechanism of the tautomerization of the A·T Watson-Crick DNA base pair, information that is hard to establish experimentally. By combining theoretical investigations at the MP2 and density functional theory levels of QM theory with quantum theory of atoms in molecules analysis, the tautomerization of the A·T Watson-Crick base pair by the double proton transfer (DPT) was comprehensively studied in vacuo and in the continuum with a low dielectric constant (ϵ = 4) corresponding to a hydrophobic interfaces of protein-nucleic acid interactions. Based on the sweeps of the electron-topological, geometric, and energetic parameters, which describe the course of the tautomerization along its intrinsic reaction coordinate (IRC), it was proved that the A·T → A(∗)·T(∗) tautomerization through the DPT is a concerted (i.e. the pathway without an intermediate) and asynchronous (i.e. protons move with a time gap) process. The limiting stage of this phenomenon is the final PT along the N6H⋯O4 hydrogen bond (H-bond). The continuum with ϵ = 4 does not affect qualitatively the course of the tautomerization reaction: similar to that observed in vacuo, it proceeds via a concerted asynchronous process with the same structure of the transition state (TS). For the first time, the nine key points along the IRC of the A·T base pair tautomerization, which could be considered as electron-topological "fingerprints" of a concerted asynchronous process of the tautomerization via the DPT, have been identified and fully characterized. These nine key points have been used to define the reactant, TS, and product regions of the DPT in the A·T base pair. Considering the energy dependence of each of the three H-bonds, which stabilize the Watson-Crick and Löwdin's base pairs, along the IRC of the tautomerization, it was found that all these H

  6. Determination of h2JNN and h1JHN coupling constants across Watson-Crick base pairs in the Antennapedia homeodomain-DNA complex using TROSY

    International Nuclear Information System (INIS)

    Pervushin, Konstantin; Fernandez, Cesar; Riek, Roland; Ono, Akira; Kainosho, Masatsune; Wuethrich, Kurt

    2000-01-01

    This paper describes NMR measurements of 15 N- 15 N and 1 H- 15 N scalar couplings across hydrogen bonds in Watson-Crick base pairs, h2 J NN and h1 J HN , in a 17 kDa Antennapedia homeodomain-DNA complex. A new NMR experiment is introduced which relies on zero-quantum coherence-based transverse relaxation-optimized spectroscopy (ZQ-TROSY) and enables measurements of h1 J HN couplings in larger molecules. The h2 J NN and h1 J HN couplings open a new avenue for comparative studies of DNA duplexes and other forms of nucleic acids free in solution and in complexes with proteins, drugs or possibly other classes of compounds

  7. Epistemic Practices of Engineering for Education

    Science.gov (United States)

    Cunningham, Christine M.; Kelly, Gregory J.

    2017-01-01

    Engineering offers new educational opportunities for students, yet also poses challenges about how to conceptualize the disciplinary core ideas, crosscutting concepts, and science and engineering practices of the disciplinary fields of engineering. In this paper, we draw from empirical studies of engineering in professional and school settings to…

  8. Can an Excess Electron Localise on a Purine Moiety in the Adenine-thymine Watson-Crick Base Pair? A Computational Study

    International Nuclear Information System (INIS)

    Mazurkiewicz, Kamil; Haranczyk, Maciej; Gutowski, Maciej S.; Rak, Janusz

    2007-01-01

    The electron affinity and the propensity to electron-induced proton transfer (PT) of hydrogen-bonded complexes between the Watson-Crick adenine-thymine pair (AT) and simple organic acid (HX), attached to adenine in the Hoogsteen-type configuration, were studied at the B3LYP/6-31+G** level. Although the carboxyl group is deprotonated at physiological pH, its neutral form, COOH, resembles the peptide bond or the amide fragment in the side chain of asparagine (Asn) or glutamine (Gln). Thus, these complexes mimic the interaction between the DNA environment (e.g., proteins) and nucleobase pairs incorporated in the biopolymer. Electron attachment is thermodynamically feasible and adiabatic electron affinities range from 0.41 to 1.28 eV, while the vertical detachment energies of the resulting anions span the range of 0.39-2.88 eV. Low-energy activation barriers separate the anionic minima: aHX(AT) from the more stable single-PT anionic geometry, aHX(AT)-SPT, and aHX(AT)-SPT from the double-PT anionic geometry, aHX(AT)-DPT. Interaction between the adenine of the Watson-Crick AT base pair with an acidic proton donor probably counterbalances the larger EA of isolated thymine, as SOMO is almost evenly delocalized over both types of nucleic bases in the aHX(AT) anions. Moreover, as a result of PT the excess electron localizes entirely on adenine. Thus, in DNA interacting with its physiological environment, damage induced by low-energy electrons could begin, contrary to the current view, with the formation of purine anions, which are not formed in isolated DNA because of the greater stability of anionic pyrimidines.

  9. Non-Watson-Crick structures in oligodeoxynucleotides: Self-association of d(TpCpGpA) stabilized at acidic pH

    International Nuclear Information System (INIS)

    Topping, R.J.; Stone, M.P.; Brush, C.K.; Harris, T.M.

    1988-01-01

    The 1 H NMR spectrum of the tetradeoxynucleotide d(TpCpGpA) was examined as a function of temperature, pH, and concentration. At pH 7 and above the solution conformation for this oligodeoxynucleotide appears to be a mixture of random coil and Watson-Crick duplex. At 25 degree C, a pH titration of d(TpCpGaA) shown that distinct conformational changes occur as the pH is lowered below 7.0. These conformational changes are reversible upon readjusting the pH to neutrality, indicating the presence of a pH-dependent set of conformational equilibria. At 25 degree C, the various conformational state in the mixture are in rapid exchange on the NMR time scale. Examination of the titration curve shown the presence of distinct conformational states at pH greater than 7, and between pH 4 and pH 5. When the pH titration is repeated at 5 degree C, the conformational equilibria are in slow exchange on the NMR time scale; distinct signals from each conformational state are observable. The stable conformational state present between pH 4 and pH 5 represents an ordered conformation of d(TpCpGpA) which dissociates to a less ordered structure upon raising the temperature. The ordered conformation differs from the Watson-Crick helix, as is shown from nuclear Overhauser enhancement experiments, as well as chemical shift data. These results indicate that their ordered conformation is similar to the conformation of d(TpCpGpA) observed between pH 4 and pH 5. In the present case it is likely that stabilization of an ordered duplex conformation for d(TpCpGpA) is achieved by protonation of cytosine. A possible model which could explain the data involves formation of Hoogsteen C + :G base pairs

  10. Incorporating Engineering Design Challenges into STEM Courses

    OpenAIRE

    Householder, Daniel L.; Hailey, Christine E.

    2012-01-01

    Successful strategies for incorporating engineering design challenges into science, technology, engineering, and mathematics (STEM) courses in American high schools are presented in this paper. The developers have taken the position that engineering design experiences should be an important component of the high school education of all American youth. In most instances, these experiences in engineering design are infused into instruction programs in standards-based courses in science, technol...

  11. NASA, Engineering, and Swarming Robots

    Science.gov (United States)

    Leucht, Kurt

    2015-01-01

    This presentation is an introduction to NASA, to science and engineering, to biologically inspired robotics, and to the Swarmie ant-inspired robot project at KSC. This presentation is geared towards elementary school students, middle school students, and also high school students. This presentation is suitable for use in STEM (science, technology, engineering, and math) outreach events. The first use of this presentation will be on Oct 28, 2015 at Madison Middle School in Titusville, Florida where the author has been asked by the NASA-KSC Speakers Bureau to speak to the students about the Swarmie robots.

  12. Capturing Student Mathematical Engagement through Differently Enacted Classroom Practices: Applying a Modification of Watson's Analytical Tool

    Science.gov (United States)

    Patahuddin, Sitti Maesuri; Puteri, Indira; Lowrie, Tom; Logan, Tracy; Rika, Baiq

    2018-01-01

    This study examined student mathematical engagement through the intended and enacted lessons taught by two teachers in two different middle schools in Indonesia. The intended lesson was developed using the ELPSA learning design to promote mathematical engagement. Based on the premise that students will react to the mathematical tasks in the forms…

  13. Paired peer learning through engineering education outreach

    Science.gov (United States)

    Fogg-Rogers, Laura; Lewis, Fay; Edmonds, Juliet

    2017-01-01

    Undergraduate education incorporating active learning and vicarious experience through education outreach presents a critical opportunity to influence future engineering teaching and practice capabilities. Engineering education outreach activities have been shown to have multiple benefits; increasing interest and engagement with science and engineering for school children, providing teachers with expert contributions to engineering subject knowledge, and developing professional generic skills for engineers such as communication and teamwork. This pilot intervention paired 10 pre-service teachers and 11 student engineers to enact engineering outreach in primary schools, reaching 269 children. A longitudinal mixed methods design was employed to measure change in attitudes and Education Outreach Self-Efficacy in student engineers; alongside attitudes, Teaching Engineering Self-Efficacy and Engineering Subject Knowledge Confidence in pre-service teachers. Highly significant improvements were noted in the pre-service teachers' confidence and self-efficacy, while both the teachers and engineers qualitatively described benefits arising from the paired peer mentor model.

  14. Engineer Ethics

    International Nuclear Information System (INIS)

    Lee, Dae Sik; Kim, Yeong Pil; Kim, Yeong Jin

    2003-03-01

    This book tells of engineer ethics such as basic understanding of engineer ethics with history of engineering as a occupation, definition of engineering and specialized job and engineering, engineer ethics as professional ethics, general principles of ethics and its limitation, ethical theory and application, technique to solve the ethical problems, responsibility, safety and danger, information engineer ethics, biotechnological ethics like artificial insemination, life reproduction, gene therapy and environmental ethics.

  15. Purposeful engineering economics

    CERN Document Server

    Chadderton, Ronald A

    2015-01-01

    This textbook/course supplement stands as a unique and highly original complement to the traditional engineering economics curriculum. Its primarily narrative approach conveys the essence of an “Austrian" economic perspective on cash flow analysis and decision making in engineering, without extensive tables and graphs, and requires very little mathematics. The book’s objective is to add a new perspective to the usual study of cash flow analysis and solely econometric engineering decision making. The author draws on the methodology of the Austrian Economists—a school of economic thought that bases its study of economic phenomena on the interpretation and analysis of the purposeful actions of individuals. The book includes an array of illustrative case studies examined in detail by the author and emphasizes the importance of market processes and price signals to coordinate engineering plans. Purposeful Engineering Economics is an ideal resource for students, teaching faculty, and practicing professional ...

  16. Teaching engineering design research

    DEFF Research Database (Denmark)

    Blessing, Lucienne; Andreasen, Mogens Myrup

    2005-01-01

    The importance og engineering design as an industrial activity, and the increasingly complex and dynamic context in which it takes place, has led to the wish to improve the effectiveness and efficiency of engineering design in practice as well as in education. Although attempts have been made...... to improve design for centuries, it was not until well in the second half of the 20th century that engineering design became a research topic (see pahl and Beitz (1996), Heymann (2004) for historical overviews). Engineering research, such as research into thermodynamics, mechanics and materials, has a much...... by PhD students. This has created the demand for a clear, efficient way of learning the crafmanship of doing design research, a demand which is in strong contrast to the state of design research in general. This article reflects the authors' efforts in running a summer school om engineering design...

  17. KEK Engineering Department -activity report FY 2003

    International Nuclear Information System (INIS)

    2005-03-01

    This report includes all kinds of activities of the Engineering Department of KEK from 2002 to 2003 FY. There are fourteen chapters, which contain KEK Prize for engineering, KEK meeting of engineering technologies, Engineering Seminar, COACK (Component Oriented Advanced Control Kernel) for cooperation R and D project, Forum on engineering technologies from 1998 to 2003 FY, Engineering Department Symposium, service trainings, Engineering Department research study, English training, training for professional worker, training for technical expert, report on joint training for technical expert, training for middle school students, and the Engineering Department system and the main events from 1971 to 2003. (S.Y. )

  18. THE CORRELATION BETWEEN STUDENTS’ LEARNING STYLES AND PARENTS’ ATTENTION WITH MEASURING EQUIPMENT ACHIEVEMENT OF THE TENTH GRADE STUDENTS OF AUTOMOTIVE ENGINEERING EXPERTISE PROGRAM OF STATE VOCATIONAL HIGH SCHOOL PIRI SLEMAN IN THE ACADEMIC YEAR 2013/2014

    Directory of Open Access Journals (Sweden)

    Moh. Sulhan Haidi

    2014-12-01

    Full Text Available This research is aimed at finding out (1 the correlation  between students’ learning styles and measuring equipment achievement of the tenth grade students of Automotive Engineering Expertise Program of State Vocational High School Piri Sleman in the academic year 2013/2014; (2 the correlation between parents’ attention with measuring equipment achievement of the tenth grade students of Automotive Engineering Expertise Program of State Vocational High School Piri Sleman in the academic year 2013/2014; (3 the correlation between students’ learning styles and parents’ attention with measuring equipment achievement of the tenth grade students of Automotive Engineering Expertise Program of State Vocational High School Piri Sleman in the Academic Year 2013/2014. The kind of this research is correlation study and categorized as ex post facto. The population of the research was 105 students while the sample was 82 students counted from Isaac and Michael formula. The technique of sampling used in this research was simple random sampling. The technique of the data collection was questionnaire and documentation. Item validity was computed from product moment correlation. Item reliability was calculated by using alpha formula. The technique of data analysis used in this study was partial correlation and doubled correlation analyses. Precondition testing analysis (normality, linearity, and multi co linearity testing, Based on the data analysis, the results were as follows: (1 there is a positive and significant correlation between students’ learning styles (X1 and measuring equipment achievement (Y; (2 there is a positive and significant correlation between parents’ attention (X2 with measuring equipment achievement (Y; (3 there is a positive and significant correlation between students’ learning styles (X1 and parents’ attention (X2 with measuring equipment achievement (Y.

  19. What Types of Instructional Shifts Do Students Experience? Investigating Active Learning in Science, Technology, Engineering, and Math Classes across Key Transition Points from Middle School to the University Level

    Directory of Open Access Journals (Sweden)

    Kenneth Akiha

    2018-01-01

    Full Text Available Despite the need for a strong Science, Technology, Engineering, and Math (STEM workforce, there is a high attrition rate for students who intend to complete undergraduate majors in these disciplines. Students who leave STEM degree programs often cite uninspiring instruction in introductory courses, including traditional lecturing, as a reason. While undergraduate courses play a critical role in STEM retention, little is understood about the instructional transitions students encounter upon moving from secondary to post-secondary STEM courses. This study compares classroom observation data collected using the Classroom Observation Protocol for Undergraduate STEM from over 450 middle school, high school, introductory-level university, and advanced-level university classes across STEM disciplines. We find similarities between middle school and high school classroom instruction, which are characterized by a large proportion of time spent on active-learning instructional strategies, such as small-group activities and peer discussion. By contrast, introductory and advanced university instructors devote more time to instructor-centered teaching strategies, such as lecturing. These instructor-centered teaching strategies are present in classes regardless of class enrollment size, class period length, or whether or not the class includes a separate laboratory section. Middle school, high school, and university instructors were also surveyed about their views of what STEM instructional practices are most common at each educational level and asked to provide an explanation of those perceptions. Instructors from all levels struggled to predict the level of lecturing practices and often expressed uncertainty about what instruction looks like at levels other than their own. These findings suggest that more opportunities need to be created for instructors across multiple levels of the education system to share their active-learning teaching practices and

  20. Engineering Design Challenge

    Science.gov (United States)

    Wheeler, Lindsay B.; Whitworth, Brooke A.; Gonczi, Amanda L.

    2014-01-01

    The number of students majoring in science, technology, engineering, and math (STEM) is declining due in part to a lack of student interest (Fairweather 2008; NRC 2012; PCAST 2010). One reason may be the difference between how science is done in school and how it is done in the field (Osborne, Simon, and Collins 2003). An interdisciplinary…

  1. Using Notable Women in Environmental Engineering to Dispel Misperceptions of Engineers

    Science.gov (United States)

    Hoh, Yin Kiong

    2009-01-01

    This paper describes an activity the author has carried out with 72 high school science teachers to enable them to overcome their stereotypical perceptions of engineers. The activity introduced them to notable women in environmental engineering, and raised their awareness of these female engineers' contributions to engineering and society. The…

  2. Engineering at the Elementary Level

    Science.gov (United States)

    McGrew, Cheryl

    2012-01-01

    Can engineering technology be taught at the elementary level? Designing and building trebuchets, catapults, solar cars, and mousetrap vehicles in a west central Florida elementary class was considered very unusual in recent years. After a review of current research on failing schools and poor curriculum, the author wondered what her school could…

  3. Rethinking the Systems Engineering Process in Light of Design Thinking

    Science.gov (United States)

    2016-04-30

    systems engineering process models (Blanchard & Fabrycky, 1990) and the majority of engineering design education (Dym et al., 2005). The waterfall model ...Engineering Career Competency Model Clifford Whitcomb, Systems Engineering Professor, NPS Corina White, Systems Engineering Research Associate, NPS...Postgraduate School (NPS) in Monterey, CA. He teaches and conducts research in the design of enterprise systems, systems modeling , and system

  4. EnQuest | College of Engineering & Applied Science

    Science.gov (United States)

    engineering camp, in which high school girls explore careers in engineering. It is held at the University of Engineering Concentration on Ergonomics M.S. Program in Computer Science Interdisciplinary Concentration on Energy Doctoral Programs in Engineering Non-Degree Candidate Departments Biomedical Engineering

  5. Engineering opportunities in nuclear engineering

    International Nuclear Information System (INIS)

    Walton, D.G.

    1980-01-01

    The pattern of education and training of Nuclear Engineers in the UK is outlined under the headings; degree courses for professional engineers, postgraduate courses, education of technician engineers. Universities which offer specific courses are stated and useful addresses listed. (UK)

  6. Diversifying Schools and Leveraging School Improvement: A Comparative Analysis of the English Radical, and Singapore Conservative, Specialist Schools' Policies

    Science.gov (United States)

    Dimmock, Clive

    2011-01-01

    Within the context of fierce global economic competition, school diversification and specialist schools have been seen by governments as cornerstones of education policy to engineer school improvement in both England and Singapore for more than a decade. In both systems, the policy has manifested in different school types, school names and…

  7. Accommodation of an N-(deoxyguanosin-8-yl)-2-acetylaminofluorene adduct in the active site of human DNA polymerase ι: Hoogsteen or Watson-Crick base pairing?†

    Science.gov (United States)

    Donny-Clark, Kerry; Shapiro, Robert; Broyde, Suse

    2009-01-01

    Bypass across DNA lesions by specialized polymerases is essential for maintenance of genomic stability. Human DNA polymerase ι (polι) is a bypass polymerase of the Y family. Crystal structures of polι suggest that Hoogsteen base pairing is employed to bypass minor groove DNA lesions, placing them on the spacious major groove side of the enzyme. Primer extension studies have shown that polι is also capable of error-free nucleotide incorporation opposite the bulky major groove adduct N-(deoxyguanosin-8-yl)-2-acetyl-aminofluorene (dG-AAF). We present molecular dynamics simulations and free energy calculations suggesting that Watson-Crick base pairing could be employed in polι for bypass of dG-AAF. In polι with Hoogsteen paired dG-AAF the bulky AAF moiety would reside on the cramped minor groove side of the template. The Hoogsteen-capable conformation distorts the active site, disrupting interactions necessary for error-free incorporation of dC opposite the lesion. Watson-Crick pairing places the AAF rings on the spacious major groove side, similar to the position of minor groove adducts observed with Hoogsteen pairing. Watson-Crick paired structures show a well-ordered active site, with a near reaction-ready ternary complex. Thus our results suggest that polι would utilize the same spacious region for lesion bypass of both major and minor groove adducts. Therefore, purine adducts with bulk on the minor groove side would use Hoogsteen pairing, while adducts with the bulky lesion on the major groove side would utilize Watson-Crick base pairing as indicated by our MD simulations for dG-AAF. This suggests the possibility of an expanded role for polι in lesion bypass. PMID:19072536

  8. Comparación entre bioimpedancia espectroscópica y fórmula de Watson para medición de volumen corporal en pacientes en diálisis peritoneal

    Directory of Open Access Journals (Sweden)

    Gonzalo Martínez Fernández

    2016-01-01

    Conclusiones: Existen diferencias en el V de los pacientes de una unidad de DP según sea calculado por fórmula de Watson o por BIS. La presencia de hipertensión, diabetes, hipoalbuminemia, obesidad, malnutrición, inflamación, E/I ratio ≥1 y la ausencia de diuresis residual se asocia con la aparición de estas diferencias.

  9. What do K-12 students feel when dealing with technology and engineering issues? Gardner's multiple intelligence theory implications in technology lessons for motivating engineering vocations at Spanish Secondary School

    Science.gov (United States)

    Sánchez-Martín, Jesús; Álvarez-Gragera, García J.; Dávila-Acedo, M. Antonia; Mellado, Vicente

    2017-11-01

    The interest on engineering and scientific studies can be raised up even from the early years of academic instructional process. This vocation may be linked to emotions and aptitudes towards technological education. Particularly, students get in touch with these technological issues (namely STEM) during the Compulsory Secondary Education in Spain (12-16 years old).This work presents a preliminary evaluation of how relevant is Gardner's multiple intelligence theory (MIT) in the teaching-learning process within the Technology Lessons. In this sense, MIT was considered as an explanation variable of the emotional response within the different educational parts (so-called syllabus units, SU) in the Technology spanish curriculum. Different intelligence style (IS) will orient the student to a vision of the engineering and technology. This work tries to identify which relationships can be established between IS and specific technology and engineering learning. This research involved up to 135 students were subsequently tested about their predominant (IS) and on the emotions that arouse in them when working with each SU. The results were statistically significant and only those with a Logic-arithmetic or Environmental IS were not affected by the SU.Best teaching and learning practicesare required for encouraging further engineering studies.

  10. What Do K-12 Students Feel When Dealing with Technology and Engineering Issues? Gardner's Multiple Intelligence Theory Implications in Technology Lessons for Motivating Engineering Vocations at Spanish Secondary School

    Science.gov (United States)

    Sánchez-Martín, Jesús; Álvarez-Gragera, García J.; Dávila-Acedo, M. Antonia; Mellado, Vicente

    2017-01-01

    The interest on engineering and scientific studies can be raised up even from the early years of academic instructional process. This vocation may be linked to emotions and aptitudes towards technological education. Particularly, students get in touch with these technological issues (namely STEM) during the Compulsory Secondary Education in Spain…

  11. Innovation and STEM Schools

    Science.gov (United States)

    Roberts, Julia Link

    2015-01-01

    How do schools with a focus on science, technology, engineering, and mathematics (STEM) fit in with state goals to increase innovation and to boost the economy? This article briefly discusses how educators can encourage creativity and innovation.

  12. DFT investigation of the vibrational properties of GC Watson-Crick and Hoogsteen base pairs in the presence of Mg²⁺, Ca²⁺, and Cu²⁺ ions.

    Science.gov (United States)

    Morari, Cristian; Muntean, Cristina M; Tripon, Carmen; Buimaga-Iarinca, Luiza; Calborean, Adrian

    2014-04-01

    The binding effects of Mg²⁺, Ca²⁺, and Cu²⁺ ions on the vibrational properties of guanine-cytosine base pairs have been performed using density functional theory investigations. Both Watson-Crick and Hoogsteen configurations of the base pairs were investigated. In Watson-Crick configuration, the metal was coordinated at N7 atom of guanine, while in the case of Hoogsteen configuration, the coordination is at N3 atom of guanine. We have pointed out the geometric properties of the metal-GC base pairs structure, as well as the vibrational bands that can be used to detect the presence of metallic ions in the Watson-Crick and Hoogsteen GC structures. For the geometric models used by us, the vibrational amplitudes of metallic atoms were stronger for wavenumbers lower than 500 cm⁻¹. This suggests that in the experimental studies on DNA the presence of the three metallic atoms (Mg, Ca, and Cu) can be explicitly detected at low frequencies.

  13. Presenting a new kinetic model for methanol to light olefins reactions over a hierarchical SAPO-34 catalyst using the Langmuir-Hinshelwood-Hougen-Watson mechanism

    Science.gov (United States)

    Javad Azarhoosh, Mohammad; Halladj, Rouein; Askari, Sima

    2017-10-01

    In this study, a new kinetic model for methanol to light olefins (MTO) reactions over a hierarchical SAPO-34 catalyst using the Langmuir-Hinshelwood-Hougen-Watson (LHHW) mechanism was presented and the kinetic parameters was obtained using a genetic algorithm (GA) and genetic programming (GP). Several kinetic models for the MTO reactions have been presented. However, due to the complexity of the reactions, most reactions are considered lumped and elementary, which cannot be deemed a completely accurate kinetic model of the process. Therefore, in this study, the LHHW mechanism is presented as kinetic models of MTO reactions. Because of the non-linearity of the kinetic models and existence of many local optimal points, evolutionary algorithms (GA and GP) are used in this study to estimate the kinetic parameters in the rate equations. Via the simultaneous connection of the code related to modelling the reactor and the GA and GP codes in the MATLAB R2013a software, optimization of the kinetic models parameters was performed such that the least difference between the results from the kinetic models and experiential results was obtained and the best kinetic parameters of MTO process reactions were achieved. A comparison of the results from the model with experiential results showed that the present model possesses good accuracy.

  14. Complexes of DNA bases and Watson-Crick base pairs interaction with neutral silver Agn (n = 8, 10, 12) clusters: a DFT and TDDFT study.

    Science.gov (United States)

    Srivastava, Ruby

    2018-03-01

    We study the binding of the neutral Ag n (n = 8, 10, 12) to the DNA base-adenine (A), guanine (G) and Watson-Crick -adenine-thymine, guanine-cytosine pairs. Geometries of complexes were optimized at the DFT level using the hybrid B3LYP functional. LANL2DZ effective core potential was used for silver and 6-31 + G ** was used for all other atoms. NBO charges were analyzed using the Natural population analysis. The absorption properties of Ag n -A,G/WC complexes were also studied using time-dependent density functional theory. The absorption spectra for these complexes show wavelength in the visible region. It was revealed that silver clusters interact more strongly with WC pairs than with isolated DNA complexes. Furthermore, it was found that the electronic charge transferred from silver to isolated DNA clusters are less than the electronic charge transferred from silver to the Ag n -WC complexes. The vertical ionization potential, vertical electron affinity, hardness, and electrophilicity index of Ag n -DNA/WC complexes have also been discussed.

  15. High-Resolution Crystal Structure of a Silver(I)-RNA Hybrid Duplex Containing Watson-Crick-like C-Silver(I)-C Metallo-Base Pairs.

    Science.gov (United States)

    Kondo, Jiro; Tada, Yoshinari; Dairaku, Takenori; Saneyoshi, Hisao; Okamoto, Itaru; Tanaka, Yoshiyuki; Ono, Akira

    2015-11-02

    Metallo-base pairs have been extensively studied for applications in nucleic acid-based nanodevices and genetic code expansion. Metallo-base pairs composed of natural nucleobases are attractive because nanodevices containing natural metallo-base pairs can be easily prepared from commercially available sources. Previously, we have reported a crystal structure of a DNA duplex containing T-Hg(II)-T base pairs. Herein, we have determined a high-resolution crystal structure of the second natural metallo-base pair between pyrimidine bases C-Ag(I)-C formed in an RNA duplex. One Ag(I) occupies the center between two cytosines and forms a C-Ag(I)-C base pair through N3-Ag(I)-N3 linear coordination. The C-Ag(I)-C base pair formation does not disturb the standard A-form conformation of RNA. Since the C-Ag(I)-C base pair is structurally similar to the canonical Watson-Crick base pairs, it can be a useful building block for structure-based design and fabrication of nucleic acid-based nanodevices. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  16. Insights into Watson-Crick/Hoogsteen breathing dynamics and damage repair from the solution structure and dynamic ensemble of DNA duplexes containing m1A.

    Science.gov (United States)

    Sathyamoorthy, Bharathwaj; Shi, Honglue; Zhou, Huiqing; Xue, Yi; Rangadurai, Atul; Merriman, Dawn K; Al-Hashimi, Hashim M

    2017-05-19

    In the canonical DNA double helix, Watson-Crick (WC) base pairs (bps) exist in dynamic equilibrium with sparsely populated (∼0.02-0.4%) and short-lived (lifetimes ∼0.2-2.5 ms) Hoogsteen (HG) bps. To gain insights into transient HG bps, we used solution-state nuclear magnetic resonance spectroscopy, including measurements of residual dipolar couplings and molecular dynamics simulations, to examine how a single HG bp trapped using the N1-methylated adenine (m1A) lesion affects the structural and dynamic properties of two duplexes. The solution structure and dynamic ensembles of the duplexes reveals that in both cases, m1A forms a m1A•T HG bp, which is accompanied by local and global structural and dynamic perturbations in the double helix. These include a bias toward the BI backbone conformation; sugar repuckering, major-groove directed kinking (∼9°); and local melting of neighboring WC bps. These results provide atomic insights into WC/HG breathing dynamics in unmodified DNA duplexes as well as identify structural and dynamic signatures that could play roles in m1A recognition and repair. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  17. 2-Methoxypyridine as a Thymidine Mimic in Watson-Crick Base Pairs of DNA and PNA: Synthesis, Thermal Stability, and NMR Structural Studies.

    Science.gov (United States)

    Novosjolova, Irina; Kennedy, Scott D; Rozners, Eriks

    2017-11-02

    The development of nucleic acid base-pair analogues that use new modes of molecular recognition is important both for fundamental research and practical applications. The goal of this study was to evaluate 2-methoxypyridine as a cationic thymidine mimic in the A-T base pair. The hypothesis was that including protonation in the Watson-Crick base pairing scheme would enhance the thermal stability of the DNA double helix without compromising the sequence selectivity. DNA and peptide nucleic acid (PNA) sequences containing the new 2-methoxypyridine nucleobase (P) were synthesized and studied by using UV thermal melting and NMR spectroscopy. Introduction of P nucleobase caused a loss of thermal stability of ≈10 °C in DNA-DNA duplexes and ≈20 °C in PNA-DNA duplexes over a range of mildly acidic to neutral pH. Despite the decrease in thermal stability, the NMR structural studies showed that P-A formed the expected protonated base pair at pH 4.3. Our study demonstrates the feasibility of cationic unnatural base pairs; however, future optimization of such analogues will be required. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  18. Highly Stable Double-Stranded DNA Containing Sequential Silver(I)-Mediated 7-Deazaadenine/Thymine Watson-Crick Base Pairs.

    Science.gov (United States)

    Santamaría-Díaz, Noelia; Méndez-Arriaga, José M; Salas, Juan M; Galindo, Miguel A

    2016-05-17

    The oligonucleotide d(TX)9 , which consists of an octadecamer sequence with alternating non-canonical 7-deazaadenine (X) and canonical thymine (T) as the nucleobases, was synthesized and shown to hybridize into double-stranded DNA through the formation of hydrogen-bonded Watson-Crick base pairs. dsDNA with metal-mediated base pairs was then obtained by selectively replacing W-C hydrogen bonds by coordination bonds to central silver(I) ions. The oligonucleotide I adopts a duplex structure in the absence of Ag(+) ions, and its stability is significantly enhanced in the presence of Ag(+) ions while its double-helix structure is retained. Temperature-dependent UV spectroscopy, circular dichroism spectroscopy, and ESI mass spectrometry were used to confirm the selective formation of the silver(I)-mediated base pairs. This strategy could become useful for preparing stable metallo-DNA-based nanostructures. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  19. Engineering Institute

    Science.gov (United States)

    Projects Past Projects Publications NSEC » Engineering Institute Engineering Institute Multidisciplinary engineering research that integrates advanced modeling and simulations, novel sensing systems and new home of Engineering Institute Contact Institute Director Charles Farrar (505) 665-0860 Email UCSD EI

  20. Transient simulation of a catalytic converter for a dual fuel engine

    Energy Technology Data Exchange (ETDEWEB)

    Liu, B.; Checkel, D. [Alberta Univ., Dept. of Mechanical Enginering, Edmonton, AB (Canada); Hayes, R. E. [Alberta Univ., Department of Chemical and Material Engineering, Edmonton, AB (Canada); Zheng, M.; Mirosh, E. [Alternative Fuel Systems Inc., Calgary, AB (Canada)

    2000-06-01

    A catalytic converter of a ceramic monolith honeycomb substrate, coated with a washcoat of catalyst and attached to a natural gas/diesel dual fuel engine was simulated and studied experimentally. The paper describes the application of one-dimensional finite element model for the transient and steady state operation. Laminar flow was approximated using a dispersed plug flow model, and chemical kinetics were simulated using LHHW (Langmuir/ Hinshelwood/ Hougan/ Watson) type expressions. Simulation results were compared with experimental results for heating and cooling cycles which resulted from speed and load changes on the engine. The comparison showed a maximum difference between the two sets of emission levels of about 10 per cent, showing that the one-dimensional model is acceptable model for this dual fuel engine converter combination. 50 refs., 3 tabs., 13 figs.

  1. Engineering Encounters: Elephant Trunks and Dolphin Tails

    Science.gov (United States)

    Hefty, Lukas

    2014-01-01

    This article describes how one class at Douglas Jamerson Elementary School in St. Petersburg, Florida, a center for engineering and mathematics, incorporated an Engineering Design Process into its curriculum. At Jamerson Elementary, all students in kindergarten through fifth grade engage in teacher-created, integrated engineering units of study,…

  2. Making Recycled Paper: An Engineering Design Challenge

    Science.gov (United States)

    Song, Ting; Becker, Kurt

    2013-01-01

    Science, technology, engineering, and mathematics (STEM) educators are facing the challenge of attracting more students. The disparity between the need for engineers and the enrollment of engineering students is growing (Genalo, Bruning, & Adams, 2000), and career aspirations of high school students are inconsistent with the employment…

  3. Mechanical engineering

    CERN Document Server

    Darbyshire, Alan

    2010-01-01

    Alan Darbyshire's best-selling text book provides five-star high quality content to a potential audience of 13,000 engineering students. It explains the most popular specialist units of the Mechanical Engineering, Manufacturing Engineering and Operations & Maintenance Engineering pathways of the new 2010 BTEC National Engineering syllabus. This challenging textbook also features contributions from specialist lecturers, ensuring that no stone is left unturned.

  4. Evidence for Watson-Crick and not Hoogsteen or wobble base pairing in the selection of nucleotides for insertion opposite pyrimidines and a thymine dimer by yeast DNA pol eta.

    Science.gov (United States)

    Hwang, Hanshin; Taylor, John-Stephen

    2005-03-29

    We have recently reported that pyrene nucleotide is preferentially inserted opposite an abasic site, the 3'-T of a thymine dimer, and most undamaged bases by yeast DNA polymerase eta (pol eta). Because pyrene is a nonpolar molecule with no H-bonding ability, the unusually high efficiencies of dPMP insertion are ascribed to its superior base stacking ability, and underscore the importance of base stacking in the selection of nucleotides by pol eta. To investigate the role of H-bonding and base pair geometry in the selection of nucleotides by pol eta, we determined the insertion efficiencies of the base-modified nucleotides 2,6-diaminopurine, 2-aminopurine, 6-chloropurine, and inosine which would make a different number of H-bonds with the template base depending on base pair geometry. Watson-Crick base pairing appears to play an important role in the selection of nucleotide analogues for insertion opposite C and T as evidenced by the decrease in the relative insertion efficiencies with a decrease in the number of Watson-Crick H-bonds and an increase in the number of donor-donor and acceptor-acceptor interactions. The selectivity of nucleotide insertion is greater opposite the 5'-T than the 3'-T of the thymine dimer, in accord with previous work suggesting that the 5'-T is held more rigidly than the 3'-T. Furthermore, insertion of A opposite both Ts of the dimer appears to be mediated by Watson-Crick base pairing and not by Hoogsteen base pairing based on the almost identical insertion efficiencies of A and 7-deaza-A, the latter of which lacks H-bonding capability at N7. The relative efficiencies for insertion of nucleotides that can form Watson-Crick base pairs parallel those for the Klenow fragment, whereas the Klenow fragment more strongly discriminates against mismatches, in accord with its greater shape selectivity. These results underscore the importance of H-bonding and Watson-Crick base pair geometry in the selection of nucleotides by both pol eta and the

  5. A criação do curso de engenharia química na escola nacional de química da universidade do Brasil The creation of the chemical engineering course at the national school of chemistry of the university of Brazil

    Directory of Open Access Journals (Sweden)

    Alexandro Pereira da Silva

    2006-07-01

    Full Text Available The goal of this work was to establish the origins of the chemical engineering course at the National School of Chemistry of the University of Brazil (at present, the School of Chemistry of the Federal University of Rio de Janeiro. There was a previous Industrial Chemistry course at the Higher School of Agriculture and Veterinary, established in 1920, following the French model. This course was the basis of the creation of the National School of Chemistry in 1933. During the 1940s, teachers and students claimed for a new course in true connection with the needs of the country and to reach full valorization of their job. The structure of the new Chemical Engineering course was approved in 1946 and the first class begun in 1952. This course was of great importance during the Brazilian industrial development during the 1950s and 1960s.

  6. Tsunami engineering study in India

    Digital Repository Service at National Institute of Oceanography (India)

    Mandal, S.

    ronmental Laboratory at NOAA, USA has the tsunami - research program ( http://www.pmel.noaa.gov/tsunami/). Th e t sunami research group is part of the Civi l Engineering Department at the Universit y of Southern California where undergra - duate... the engineering point of view. The Tsunami Engineering Labor a tory at the graduate School of Engineering, Tohoku Unive r sit y (http://www.tsunami.civil.tohoku.a c.jp/ hokusai2/main/eng/index.html) offers r e- se arch programmes on tsunami. The Uni - versity...

  7. The first example of a Hoogsteen base-paired DNA duplex in dynamic equilibrium with a Watson-Crick base-paired duplex--a structural (NMR), kinetic and thermodynamic study.

    Science.gov (United States)

    Isaksson, J; Zamaratski, E; Maltseva, T V; Agback, P; Kumar, A; Chattopadhyaya, J

    2001-06-01

    A single-point substitution of the O4' oxygen by a CH2 group at the sugar residue of A6 (i.e. 2'-deoxyaristeromycin moiety) in a self-complementary DNA duplex, 5'-d(C1G2C3G4A5A6T7T8C9G10C11G12)2(-3), has been shown to steer the fully Watson-Crick basepaired DNA duplex (1A), akin to the native counterpart, to a doubly A6:T7 Hoogsteen basepaired (1B) B-type DNA duplex, resulting in a dynamic equilibrium of (1A)(1B): Keq = k1/k(-1) = 0.56+/-0.08. The dynamic conversion of the fully Watson-Crick basepaired (1A) to the partly Hoogsteen basepaired (1B) structure is marginally kinetically and thermodynamically disfavoured [k1 (298K) = 3.9 0.8 sec(-1); deltaHdegrees++ = 164+/-14 kJ/mol; -TdeltaS degrees++ (298K) = -92 kJ/mol giving a deltaG degrees++ 298 of 72 kJ/mol. Ea (k1) = 167 14 kJ/mol] compared to the reverse conversion of the Hoogsteen (1B) to the Watson-Crick (1A) structure [k-1 (298K) = 7.0 0.6 sec-1, deltaH degrees++ = 153 13 kJ/mol; -TdeltaSdegrees++ (298K) = -82 kJ/mol giving a deltaGdegrees++(298) of 71 kJ/mol. Ea (k-1) = 155 13 kJ/mol]. Acomparison of deltaGdegrees++(298) of the forward (k1) and backward (k-1) conversions, (1A)(1B), shows that there is ca 1 kJ/mol preference for the Watson-Crick (1A) over the double Hoogsteen basepaired (1B) DNA duplex, thus giving an equilibrium ratio of almost 2:1 in favour of the fully Watson-Crick basepaired duplex. The chemical environments of the two interconverting DNA duplexes are very different as evident from their widely separated sets of chemical shifts connected by temperature-dependent exchange peaks in the NOESY and ROESY spectra. The fully Watson-Crick basepaired structure (1A) is based on a total of 127 intra, 97 inter and 17 cross-strand distance constraints per strand, whereas the double A6:T7 Hoogsteen basepaired (1B) structure is based on 114 intra, 92 inter and 15 cross-strand distance constraints, giving an average of 22 and 20 NOE distance constraints per residue and strand, respectively. In addition

  8. The Nuclear Department, Royal Naval School of Marine Engineering - Provision of nuclear education and training to the naval nuclear propulsion programme and beyond

    International Nuclear Information System (INIS)

    Trethewey, K.R.; Beeley, P.A.; Lockwood, R.S.; Harrop, I.

    2004-01-01

    The Nuclear Department at HMS SULTAN provides education, training and research support to the Royal Navy Nuclear Propulsion Programme, as well as a growing number of civilian programmes within the wider British nuclear industry. As an aspiring centre of excellence in nuclear engineering, the Department will play an important role as a repository of nuclear knowledge for the foreseeable future. (author)

  9. Girls and STEM (Science, Technology, Engineering, and Mathematics) in Catholic Schools: A Mixed Methods Exploration of Interest, Confidence, and Perceptions of STEM

    Science.gov (United States)

    McKenna, Rachel Lynn-Pleis

    2016-01-01

    Over the past decade, there has been a considerable push in emphasizing STEM--an acronym standing for Science, Technology, Engineering, and Math--as an integral aspect of educational curriculums. Even though research suggests that females tend to outperform males in standardized testing in STEM areas, they remain underrepresented in STEM careers…

  10. The Experiences of Female High School Students and Interest in STEM: Factors Leading to the Selection of an Engineering or Computer Science Major

    Science.gov (United States)

    Genoways, Sharon K.

    2017-01-01

    STEM (Science, Technology, Engineering and Math) education creates critical thinkers, increases science literacy, and enables the next generation of innovators, which leads to new products and processes that sustain our economy (Hossain & Robinson, 2012). We have been hearing the warnings for several years, that there simply are not enough…

  11. New Ideas for School Construction.

    Science.gov (United States)

    Producers' Council, Inc., Washington, DC.

    Present educators, architects, engineers, and building product manufacturers with a medium of common interest for discussion of mutual school construction problems, objectives, needs, ideas, capabilities and limitations. Contents include--(1) modern wood construction, (2) school room in a steel mill, (3) masonry in new school design, (4) the…

  12. How Healthcare Can Refocus on Its Super-Customers (Patients, n =1) and Customers (Doctors and Nurses) by Leveraging Lessons from Amazon, Uber, and Watson.

    Science.gov (United States)

    Kolker, Evelyne; Özdemir, Vural; Kolker, Eugene

    2016-06-01

    Healthcare is transforming with data-intensive omics technologies and Big Data. The "revolution" has already happened in technology, but the bottlenecks have shifted to the social domain: Who can be empowered by Big Data? Who are the users and customers? In this review and innovation field analysis, we introduce the idea of a "super-customer" versus "customer" and relate both to 21st century healthcare. A "super-customer" in healthcare is the patient, sample size of n = 1, while "customers" are the providers of healthcare (e.g., doctors and nurses). The super-customers have been patients, enabled by unprecedented social practices, such as the ability to track one's physical activities, personal genomics, patient advocacy for greater autonomy, and self-governance, to name but a few. In contrast, the originally intended customers-providers, doctors, and nurses-have relatively lagged behind. With patients as super-customers, there are valuable lessons to be learned from industry examples, such as Amazon and Uber. To offer superior quality service, healthcare organizations have to refocus on the needs, pains, and aspirations of their super-customers by enabling the customers. We propose a strategic solution to this end: the PPT-DAM (People-Process-Technology empowered by Data, Analytics, and Metrics) approach. When applied together with the classic Experiment-Execute-Evaluate iterative methodology, we suggest PPT-DAM is an extremely powerful approach to deliver quality health services to super-customers and customers. As an example, we describe the PPT-DAM implementation by the Benchmarking Improvement Program at the Seattle Children's Hospital. Finally, we forecast that cognitive systems in general and IBM Watson in particular, if properly implemented, can bring transformative and sustainable capabilities in healthcare far beyond the current ones.

  13. Molecular dynamics analysis of stabilities of the telomeric Watson-Crick duplex and the associated i-motif as a function of pH and temperature.

    Science.gov (United States)

    Panczyk, Tomasz; Wolski, Pawel

    2018-06-01

    This work deals with a molecular dynamics analysis of the protonated and deprotonated states of the natural sequence d[(CCCTAA) 3 CCCT] of the telomeric DNA forming the intercalated i-motif or paired with the sequence d[(CCCTAA) 3 CCCT] and forming the Watson-Crick (WC) duplex. By utilizing the amber force field for nucleic acids we built the i-motif and the WC duplex either with native cytosines or using their protonated forms. We studied, by applying molecular dynamics simulations, the role of hydrogen bonds between cytosines or in cytosine-guanine pairs in the stabilization of both structures in the physiological fluid. We found that hydrogen bonds exist in the case of protonated i-motif and in the standard form of the WC duplex. They, however, vanish in the case of the deprotonated i-motif and protonated form of the WC duplex. By determining potentials of mean force in the enforced unwrapping of these structures we found that the protonated i-motif is thermodynamically the most stable. Its deprotonation leads to spontaneous and observed directly in the unbiased calculations unfolding of the i-motif to the hairpin structure at normal temperature. The WC duplex is stable in its standard form and its slight destabilization is observed at the acidic pH. However, the protonated WC duplex unwraps very slowly at 310 K and its decomposition was not observed in the unbiased calculations. At higher temperatures (ca. 400 K or more) the WC duplex unwraps spontaneously. Copyright © 2018. Published by Elsevier B.V.

  14. Engineering Cartilage

    Science.gov (United States)

    ... Research Matters NIH Research Matters March 3, 2014 Engineering Cartilage Artistic rendering of human stem cells on ... situations has been a major goal in tissue engineering. Cartilage contains water, collagen, proteoglycans, and chondrocytes. Collagens ...

  15. Governing Engineering

    DEFF Research Database (Denmark)

    Buch, Anders

    2012-01-01

    Most people agree that our world face daunting problems and, correctly or not, technological solutions are seen as an integral part of an overall solution. But what exactly are the problems and how does the engineering ‘mind set’ frame these problems? This chapter sets out to unravel dominant...... perspectives in challenge per-ception in engineering in the US and Denmark. Challenge perception and response strategies are closely linked through discursive practices. Challenge perceptions within the engineering community and the surrounding society are thus critical for the shaping of engineering education...... and the engineering profession. Through an analysis of influential reports and position papers on engineering and engineering education the chapter sets out to identify how engineering is problematized and eventually governed. Drawing on insights from governmentality studies the chapter strives to elicit the bodies...

  16. Industrial Engineering

    DEFF Research Database (Denmark)

    Karlsson, Christer

    2015-01-01

    Industrial engineering is a discipline that is concerned with increasing the effectiveness of (primarily) manufacturing and (occasionally).......Industrial engineering is a discipline that is concerned with increasing the effectiveness of (primarily) manufacturing and (occasionally)....

  17. Governing Engineering

    DEFF Research Database (Denmark)

    Buch, Anders

    2011-01-01

    Abstract: Most people agree that our world faces daunting problems and, correctly or not, technological solutions are seen as an integral part of an overall solution. But what exactly are the problems and how does the engineering ‘mind set’ frame these problems? This chapter sets out to unravel...... dominant perspectives in challenge perception in engineering in the US and Denmark. Challenge perception and response strategies are closely linked through discursive practices. Challenge perceptions within the engineering community and the surrounding society are thus critical for the shaping...... of engineering education and the engineering profession. Through an analysis of influential reports and position papers on engineering and engineering education the chapter sets out to identify how engineering is problematized and eventually governed. Drawing on insights from governmentality studies the chapter...

  18. Computer Engineers.

    Science.gov (United States)

    Moncarz, Roger

    2000-01-01

    Looks at computer engineers and describes their job, employment outlook, earnings, and training and qualifications. Provides a list of resources related to computer engineering careers and the computer industry. (JOW)

  19. Engineering _ litteraturliste

    DEFF Research Database (Denmark)

    Sillasen, Martin Krabbe; Daugbjerg, Peer; Nielsen, Keld

    2017-01-01

    Litteraturliste udarbejdet som grundlag for artiklen ”Engineering – svaret på naturfagenes udfordringer?”......Litteraturliste udarbejdet som grundlag for artiklen ”Engineering – svaret på naturfagenes udfordringer?”...

  20. Jim Sanovia - South Dakota School of Mines and Technology Undergrad: Geological Engineering (Jr.) September 7, 2004 thesanoves@hotmail.com Abstract Experiences Interning at NASA/GSFC

    Science.gov (United States)

    Sanovia, J. J.

    2004-12-01

    In the summer of 2001 and 2004 I experienced internships at the NASA/ Goddard Space Flight Center in Greenbelt, MD. Through these internships I was introduced to Geographical Information Systems and Remote Sensing. My experiences at NASA have also helped me acquire the ability to learn how I can now best utilize my networking contacts at NASA and other connections to facilitate my future plans as an engineer working on Indian and non-Indian Reservation lands. My experiences working at a large agency such as NASA have shown me the significance how a Native American engineer can strive to improve and preserve Indian and non-Indian lands for future generations. Formulating new and inventive methodologies on how to better approach Indian Reservation research while incorporating Native American culture I feel are vital for success. My accomplishments throughout the recent past years have also allowed me conduct outreach to Indian K-12 kids and college students alike.

  1. Accounting engineering for sustainable development

    Directory of Open Access Journals (Sweden)

    Sidornya A.

    2017-01-01

    Full Text Available The article deals with the sustainable development of industrial enterprises in Russia, accounting for sustainable industrial growth of the national economy, tools of accounting engineering aimed at creating an information basis of transformation the Russian economic model to knowledge based economy. The proposed mechanism of ownership control of industrial enterprises in the context of long-term planning of the national economy. Theoretical bases of accounting engineering, its tools are defined. A brief review of the literature on the problem of accounting engineering is provided. A practical example of the application of the accounting engineering logic for the industrial enterprise is reviewed. It describes the research results obtained during the last 25 years of Russian scientific school of accounting engineering. Conclusions and recommendations on the use of accounting engineering to sustainable development of the Russian economy are formulated.

  2. The Electric Vehicle Project for High School Students in Nagoya City Science Museum : As the First Step of Global Engineering Education to Create Value from Knowledge

    OpenAIRE

    馬渕, 浩一; Mabuchi, Koichi

    2014-01-01

    This paper gives an account of "The Electric Vehicle Project", a science museum activity in cooperation with Nagoya Institute of Technology and major manufacturing companies. The project is intended to encourage Japanese high school students' interest in science and technology, based on Nagoya, Japan and Asia, the center of the manufacturing industries. The project contains three programs: 1) Students make practical lead acid batteries. 2) Students drive an electric vehicle of their own desig...

  3. African American Adolescent Female Identification with Engineering and Participation in Engineering Education

    Science.gov (United States)

    Cornick, Shayla L.

    2012-01-01

    Experiences that females have during middle and high school have been found to influence the perceptions that they have of their ability to be successful as an engineer and the value that they place on participating in engineering education. Engineering education continues to suffer from a lack of female participation. Several efforts have been…

  4. Effect of an Engineering Camp on Students' Perceptions of Engineering and Technology

    Science.gov (United States)

    Hammack, Rebekah; Ivey, Toni A.; Utley, Juliana; High, Karen A.

    2015-01-01

    Students' knowledge about a profession influences their future decisions about careers. Research indicates that students tend to hold stereotypical views of engineers, which would hinder engineering as a career choice. The purpose of this study was to measure how participating in a week long engineering summer camp affected middle school students'…

  5. Computational engineering

    CERN Document Server

    2014-01-01

    The book presents state-of-the-art works in computational engineering. Focus is on mathematical modeling, numerical simulation, experimental validation and visualization in engineering sciences. In particular, the following topics are presented: constitutive models and their implementation into finite element codes, numerical models in nonlinear elasto-dynamics including seismic excitations, multiphase models in structural engineering and multiscale models of materials systems, sensitivity and reliability analysis of engineering structures, the application of scientific computing in urban water management and hydraulic engineering, and the application of genetic algorithms for the registration of laser scanner point clouds.

  6. Transportation engineering advancement and mentoring program : phase I.

    Science.gov (United States)

    2010-05-01

    The numbers of female and minority students enrolled in engineering schools are increasing slowly; however, there are still : relatively small percentages drawn to the field of transportation civil engineering. As a consequence, there is a need to ed...

  7. Gearing up for transportation engineering, a summer institute : phase IX.

    Science.gov (United States)

    2009-02-01

    The numbers of female and minority students enrolled in engineering schools are increasing slowly, however there is still a relatively small percentage drawn to the field of transportation civil engineering. As a consequence, there is a need to educa...

  8. Gearing up for transportation engineering, a summer institute : phase 2

    Science.gov (United States)

    2001-12-31

    The numbers of female and minority students enrolled in engineering schools are increasing slowly; however, a relatively small percentage of these students are drawn to the field of transportation engineering. For this reason, there is a need to educ...

  9. Gearing up for transportation engineering summer program (GUTEP) : phase VIII.

    Science.gov (United States)

    2008-12-01

    The numbers of female and minority students enrolled in engineering schools are increasing slowly, however there is still a relatively small percentage drawn to the field of transportation civil engineering. As a consequence, there is a need to educa...

  10. Architectural Engineers

    DEFF Research Database (Denmark)

    Petersen, Rikke Premer

    engineering is addresses from two perspectives – as an educational response and an occupational constellation. Architecture and engineering are two of the traditional design professions and they frequently meet in the occupational setting, but at educational institutions they remain largely estranged....... The paper builds on a multi-sited study of an architectural engineering program at the Technical University of Denmark and an architectural engineering team within an international engineering consultancy based on Denmark. They are both responding to new tendencies within the building industry where...... the role of engineers and architects increasingly overlap during the design process, but their approaches reflect different perceptions of the consequences. The paper discusses some of the challenges that design education, not only within engineering, is facing today: young designers must be equipped...

  11. Tissue engineering

    CERN Document Server

    Fisher, John P; Bronzino, Joseph D

    2007-01-01

    Increasingly viewed as the future of medicine, the field of tissue engineering is still in its infancy. As evidenced in both the scientific and popular press, there exists considerable excitement surrounding the strategy of regenerative medicine. To achieve its highest potential, a series of technological advances must be made. Putting the numerous breakthroughs made in this field into a broad context, Tissue Engineering disseminates current thinking on the development of engineered tissues. Divided into three sections, the book covers the fundamentals of tissue engineering, enabling technologies, and tissue engineering applications. It examines the properties of stem cells, primary cells, growth factors, and extracellular matrix as well as their impact on the development of tissue engineered devices. Contributions focus on those strategies typically incorporated into tissue engineered devices or utilized in their development, including scaffolds, nanocomposites, bioreactors, drug delivery systems, and gene t...

  12. Long-term performance of borehole heat exchangers. A project conducted at the Burgdorf engineering school, Switzerland; Langzeitverhalten von Erdwaermesonden am Beispiel des Projektes an der Ingenieurschule Burgdorf (CH)

    Energy Technology Data Exchange (ETDEWEB)

    Berdat, F. [Wasser- und Energiewirtschaftsamt, Bern (Switzerland)

    1997-12-01

    In 1981, the canton of Bern passed modern energy legislation. It promotes, for instance, the harnessing of thermal energy in the environment. The canton has made great efforts to strengthen knowledge of the use of water and the ground as sources of thermal energy. From 1985 to 1995, six so-called `Thermo Programmes` with a total cost of around 9.5 million Swiss Francs were carried out. They made essential contributions to the understanding of thermal energy flow, the making-up of thermal energy budgets and, thereby, to the assessment of the useful thermal energy potentials of water and the ground. The last and, at the same time, most comprehensive project was the `thermo programme borehole heat exchangers` conducted at the canton`s engineering school (technical school) at Burgdurf. (orig.) [Deutsch] Im Jahr 1981 wurde im Kanton Bern ein modernes Energiegesetz eingefuehrt. Unter anderem foerdert es die Nutzung der Umgebungswaerme. Deshalb hat der Kanton Bern grosse Anstrengungen unternommen, das Wissen um die Nutzung von Wasser und Boden als Waermequelle zu festigen. In den Jahren 1985-1995 wurden sechs sogenannte `Thermoprogramme` durchgefuehrt, die zusammen rund 9.5 Mio. Franken gekostet und wesentlich zum Verstaendnis der Waermestroeme, zur Erstellung von Waermebilanzen und damit zur Ermittlung der nutzbaren Waermepotentiale von Wasser und Boden beigetragen haben. Das letzte und gleichzeitig umfangreichste Projekt war das `Thermoprogramm Erdwaermesonden` an der kantonalen Ingenieurschule Burgdorf (FH). (orig.)

  13. Greenhouse gas (GHG) emission in organic farming. Approximate quantification of its generation at the organic garden of the School of Agricultural, Food and Biosystems Engineering (ETSIAAB) in the Technical University of Madrid (UPM)

    Science.gov (United States)

    Campos, Jorge; Barbado, Elena; Maldonado, Mariano; Andreu, Gemma; López de Fuentes, Pilar

    2016-04-01

    As it well-known, agricultural soil fertilization increases the rate of greenhouse gas (GHG) emission production such as CO2, CH4 and N2O. Participation share of this activity on the climate change is currently under study, as well as the mitigation possibilities. In this context, we considered that it would be interesting to know how this share is in the case of organic farming. In relation to this, a field experiment was carried out at the organic garden of the School of Agricultural, Food and Biosystems Engineering (ETSIAAB) in the Technical University of Madrid (UPM). The orchard included different management growing areas, corresponding to different schools of organic farming. Soil and gas samples were taken from these different sites. Gas samples were collected throughout the growing season from an accumulated atmosphere inside static chambers inserted into the soil. Then, these samples were carried to the laboratory and there analyzed. The results obtained allow knowing approximately how ecological fertilization contributes to air pollution due to greenhouse gases.

  14. Accreditation of Biomedical Engineering Programs in Europe - Challenge and Opportunity

    National Research Council Canada - National Science Library

    Nagel, Joachim

    2001-01-01

    Today, more than 100 universities and polytechnic schools in Europe offer educational programs in Biomedical Engineering at all academic levels, but without any international coordination of contents...

  15. Development and Evaluation of an Undergraduate Multidisciplinary Project Activity in Engineering and Design

    Science.gov (United States)

    Smith, David R.; Cole, Joanne

    2012-01-01

    The School of Engineering and Design Multidisciplinary Project (MDP) at Brunel University is a one week long project based activity involving first year undergraduate students from across the School subject areas of Electronic and Computer Engineering, Mechanical Engineering, Civil Engineering and Design. This paper describes the main aims of the…

  16. The influence of N-7 guanine modifications on the strength of Watson-Crick base pairing and guanine N-1 acidity: Comparison of gas-phase and condensed-phase trends

    Czech Academy of Sciences Publication Activity Database

    Burda, J. V.; Šponer, Jiří; Hrabáková, J.; Zeizinger, M.; Leszczynski, J.

    2003-01-01

    Roč. 107, č. 22 (2003), s. 5349-5356 ISSN 1520-6106 R&D Projects: GA MŠk ME 517; GA MŠk LN00A016 Grant - others:Wellcome Trust(GB) GR067507MF; ONR(US) N00034-03-1-0116; National Science Foundation(US) CREST 9805465 Institutional research plan: CEZ:AV0Z5004920 Keywords : Watson-Crick base pairing * guanines * gas-phase and condensed-phase trends Subject RIV: BO - Biophysics Impact factor: 3.679, year: 2003

  17. United States Air Force Summer Research Program -- 1991. High School Apprenticeship Program (HSAP) Reports, Volume 12: Rome Laboratory, Arnold Engineering Development Plan

    Science.gov (United States)

    1991-12-01

    convenient document retrieval and internal voice communications system. 12-12 AFOSR High School Apprenticeship Program July 22-August 16 1991 Gene ...with the computer software packages used here at Sverdrup; Gene Smith and Gail Arnold for their aid in faxing my pay voucher every two weeks. GENERAL...10M .,.n Z~ w z .; z z ZZ r3r M z X E X 2 z Y ZiMZ . Z Z Z Z X2X Z X Z X 2 rZ Z Z W: I. I 1 It W6 hfe II 1 - -- m _ V m-! ’ =t2Csu C1 M 0 oNt - ;I

  18. EXPERIENCE OF USING THE “ANTI-PLAGIARISM. HIGHER SCHOOL INSTITUTION” SYSTEM IN THE COURSE OF CHEMISTRY FOR STUDENTS OF ENGINEERING ACADEMY RUDN

    Directory of Open Access Journals (Sweden)

    Елена Юрьевна Невская

    2017-12-01

    Full Text Available When checking the written work of students each teacher faced with the problem of determining the originality of the work. At the department of General Chemistry RUDN University the system “Anti-plagiarism. Higher School Institution” is used for this purpose. Using this system when checking the work for borrowings from online sources, saves the teacher the routine of searching for matching blocks. In addition, the using of this system is aimed at improving the implementation of a culture of scientific citation, without which no research project in chemistry can be done, is aimed at increasing the level of scientific educational process of the students.

  19. Graduate School and Fellowship Discussion

    Energy Technology Data Exchange (ETDEWEB)

    Farrar, Charles Reed [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)

    2016-07-25

    This was a presentation presented for the Los Alamos Dynamics Summer School. This is a set of slides about how to prepare for college, specifically graduate school. It gives instructions for succeeding and getting into a good school with financial aid through assistantships and scholarships, specifically applying to engineering backgrounds. Also, there are tips given for applying for fellowships and concludes with some general recommendations for graduate school.

  20. Engineering mechanics

    CERN Document Server

    Gross, Dietmar; Schröder, Jörg; Wall, Wolfgang A; Rajapakse, Nimal

    Statics is the first volume of a three-volume textbook on Engineering Mechanics. The authors, using a time-honoured straightforward and flexible approach, present the basic concepts and principles of mechanics in the clearest and simplest form possible to advanced undergraduate engineering students of various disciplines and different educational backgrounds. An important objective of this book is to develop problem solving skills in a systematic manner. Another aim of this volume is to provide engineering students as well as practising engineers with a solid foundation to help them bridge the gap between undergraduate studies on the one hand and advanced courses on mechanics and/or practical engineering problems on the other. The book contains numerous examples, along with their complete solutions. Emphasis is placed upon student participation in problem solving. The contents of the book correspond to the topics normally covered in courses on basic engineering mechanics at universities and colleges. Now in i...

  1. Global engineering

    International Nuclear Information System (INIS)

    Plass, L.

    2001-01-01

    This article considers the challenges posed by the declining orders in the plant engineering and contracting business in Germany, the need to remain competitive, and essential preconditions for mastering the challenge. The change in engineering approach is illustrated by the building of a methanol plant in Argentina by Lurgi with the basic engineering completed in Frankfurt with involvement of key personnel from Poland, completely engineered subsystems from a Brazilian subsupplier, and detailed engineering work in Frankfurt. The production of methanol from natural gas using the LurgiMega/Methanol process is used as a typical example of the industrial plant construction sector. The prerequisites for successful global engineering are listed, and error costs in plant construction, possible savings, and process intensification are discussed

  2. Construction of a solar water heater sustainable in the amazon: using the methodology PBL for interaction between engineering courses and high schools

    Directory of Open Access Journals (Sweden)

    Patricia Mota Milhomem

    2015-12-01

    Full Text Available Across the country is being widely spread the use of energy  renewable, one of the clearest examples of this is to obtain energy by the sun's rays, as well as the latest advances in wind turbine deployment in the South and Northeast. Thus, in order to encourage high school students to engage in the study of science and research development intertwined with energy efficiency. The Laboratório de Engenhocas (hereafter, translated: Gadget Lab extension program of the Federal University of Pará (UFPA/CAMTUC, approved projects CNPq (National Council for Scientific and Technological Development in order to insert into in state high schools of the municipality the methodology PBL (Project Based Learning in order teach the students to learn, be proactive and spark interest in the field of applied sciences. Thus, students sought to develop activities that contribute to minimize the problems of society, thus, was the built and implemented a Low Cost Solar Heater in a single family residence Tucuruí where it was possible to analyze its feasibility and efficiency.

  3. Overlapping Residual Herbicides for Control of Photosystem (PS) II- and 4-Hydroxyphenylpyruvate Dioxygenase (HPPD)-Inhibitor-Resistant Palmer amaranth (Amaranthus palmeri S. Watson) in Glyphosate-Resistant Maize

    Science.gov (United States)

    Chahal, Parminder S.; Ganie, Zahoor A.; Jhala, Amit J.

    2018-01-01

    A Palmer amaranth (Amaranthus palmeri S. Watson) biotype has evolved resistance to photosystem (PS) II- (atrazine) and 4-hydroxyphenylpyruvate dioxygenase (HPPD)-inhibiting herbicides (mesotrione, tembotrione, and topramezone) in maize seed production field in Nebraska, USA. The objectives of this study were to determine the effect of soil residual pre-emergence (PRE) herbicides followed by (fb) tank-mixture of residual and foliar active post-emergence (POST) herbicides on PS-II- and HPPD-inhibitor-resistant Palmer amaranth control, maize yield, and net economic returns. Field experiments were conducted in a grower's field infested with PS II- and HPPD-inhibitor-resistant Palmer amaranth near Shickley in Fillmore County, Nebraska, USA in 2015 and 2016. The contrast analysis suggested that saflufenacil plus dimethenamid-P or pyroxasulfone plus saflufenacil applied PRE provided 80–82% Palmer amaranth control compared to 65 and 39% control with saflufenacil and pyroxasulfone applied alone at 3 weeks after PRE (WAPRE), respectively. Among the PRE fb POST herbicide programs, 95–98% Palmer amaranth control was achieved with pyroxasulfone plus safluefenacil, or saflufenacil plus dimethenamid-P applied PRE, fb glyphosate plus topramezone plus dimethenamid-P plus atrazine, glyphosate plus diflufenzopyr plus dicamba plus pyroxasulfone, glyphosate plus diflufenzopyr plus pendimethalin, or glyphosate plus diflufenzopyr plus dicamba plus atrazine applied POST at 3 weeks after POST (WAPOST) through maize harvest. Based on contrast analysis, PRE fb POST programs provided 77–83% Palmer amaranth control at 3 WAPOST through maize harvest compared to 12–15% control with PRE-only and 66–84% control with POST-only programs. Similarly, PRE fb POST programs provided 99% biomass reduction at 6 WAPOST compared to PRE-only (28%) and POST-only (87%) programs. PRE fb POST programs provided higher maize yield (13,617 kg ha−1) and net return (US $1,724 ha−1) compared to the PRE

  4. Observation of H-bond mediated 3hJH2H3coupling constants across Watson-Crick AU base pairs in RNA

    International Nuclear Information System (INIS)

    Luy, Burkhard; Richter, Uwe; DeJong, Eric S.; Sorensen, Ole W.; Marino, John P.

    2002-01-01

    3h J H2H3 trans-hydrogen bond scalar coupling constants have been observed for the first time in Watson-Crick AU base pairs in uniformly 15 N-labeled RNA oligonucleotides using a new 2h J NN -HNN-E. COSY experiment. The experiment utilizes adenosine H2 (AH2) for original polarization and detection, while employing 2h J NN couplings for coherence transfer across the hydrogen bonds (H-bonds). The H3 protons of uracil bases are unperturbed throughout the experiment so that these protons appear as passive spins in E. COSY patterns. 3h J H2H3 coupling constants can therefore be accurately measured in the acquisition dimension from the displacement of the E. COSY multiplet components, which are separated by the relatively large 1 J H3N3 coupling constants in the indirect dimension of the two-dimensional experiment. The 3h J H2H3 scalar coupling constants determined for AU base pairs in the two RNA hairpins examined here have been found to be positive and range in magnitude up to 1.8 Hz. Using a molecular fragment representation of an AU base pair, density functional theory/finite field perturbation theory (DFT/FPT) methods have been applied to attempt to predict the relative contributions of H-bond length and angular geometry to the magnitude of 3h J H2H3 coupling constants. Although the DFT/FPT calculations did not reproduce the full range of magnitude observed experimentally for the 3h J H2H3 coupling constants, the calculations do predict the correct sign and general trends in variation in size of these coupling constants. The calculations suggest that the magnitude of the coupling constants depends largely on H-bond length, but can also vary with differences in base pair geometry. The dependency of the 3h J H2H3 coupling constant on H-bond strength and geometry makes it a new probe for defining base pairs in NMR studies of nucleic acids

  5. Differential stabilities and sequence-dependent base pair opening dynamics of Watson-Crick base pairs with 5-hydroxymethylcytosine, 5-formylcytosine, or 5-carboxylcytosine.

    Science.gov (United States)

    Szulik, Marta W; Pallan, Pradeep S; Nocek, Boguslaw; Voehler, Markus; Banerjee, Surajit; Brooks, Sonja; Joachimiak, Andrzej; Egli, Martin; Eichman, Brandt F; Stone, Michael P

    2015-02-10

    5-Hydroxymethylcytosine (5hmC), 5-formylcytosine (5fC), and 5-carboxylcytosine (5caC) form during active demethylation of 5-methylcytosine (5mC) and are implicated in epigenetic regulation of the genome. They are differentially processed by thymine DNA glycosylase (TDG), an enzyme involved in active demethylation of 5mC. Three modified Dickerson-Drew dodecamer (DDD) sequences, amenable to crystallographic and spectroscopic analyses and containing the 5'-CG-3' sequence associated with genomic cytosine methylation, containing 5hmC, 5fC, or 5caC placed site-specifically into the 5'-T(8)X(9)G(10)-3' sequence of the DDD, were compared. The presence of 5caC at the X(9) base increased the stability of the DDD, whereas 5hmC or 5fC did not. Both 5hmC and 5fC increased imino proton exchange rates and calculated rate constants for base pair opening at the neighboring base pair A(5):T(8), whereas 5caC did not. At the oxidized base pair G(4):X(9), 5fC exhibited an increase in the imino proton exchange rate and the calculated kop. In all cases, minimal effects to imino proton exchange rates occurred at the neighboring base pair C(3):G(10). No evidence was observed for imino tautomerization, accompanied by wobble base pairing, for 5hmC, 5fC, or 5caC when positioned at base pair G(4):X(9); each favored Watson-Crick base pairing. However, both 5fC and 5caC exhibited intranucleobase hydrogen bonding between their formyl or carboxyl oxygens, respectively, and the adjacent cytosine N(4) exocyclic amines. The lesion-specific differences observed in the DDD may be implicated in recognition of 5hmC, 5fC, or 5caC in DNA by TDG. However, they do not correlate with differential excision of 5hmC, 5fC, or 5caC by TDG, which may be mediated by differences in transition states of the enzyme-bound complexes.

  6. Effect of Temperature and Drought Stress on Germination of Slender Amaranth (Amaranthus viridis L. and Prostrate Pigweed (Amaranthus blitoides S. Watson Seeds

    Directory of Open Access Journals (Sweden)

    Marjan Diayanat

    2018-02-01

    Full Text Available Introduction: Slender amaranth (Amaranthus viridis L. and prostrate pigweed (Amaranthus blitoides S. Watson are two common weeds in vegetables and summer crop fields of Iran. The two Amaranthus species have all the attributes required by ecologically successful annual weeds: rapid growth, early reproduction and continuous seed production. Knowledge of the germination requirements of these weeds will helps determine the proper conditions for germination and emergence and allow better management of them. Water and temperature are determining factors for seed germination of weed. Both factors can, separately or jointly, affect the germination percentage and germination rate. Water stress is one of the main constraints on plant growth and the most common environmental stresses around the world. Water stress affects the different aspects of plant growth and causes reduction and delay in seed germination. Seed germination of all plant species requires a minimum of water to be absorbed and swelled and that is why osmotic potential should not be less than a certain amount. Materials and Methods: Seeds were harvested from vegetable fields of Karaj. For breaking dormancy, seeds were treated with concentrated sulfuric acid for two minutes. Two experiments were conducted at Islamic Azad University, Science and Research Branch, Ecology lab, in 2016. First experiment was based on completely randomized design with 4 replications .The seeds were treated with different temperatures (5, 10, 15, 20, 25, 30, 35, 40 and 45oC. Germination percentage and germination rate were measured and seed were considered to have germinated with the emergence of the radical. Intersected lines model is used to determine the cardinal temperature. Second experiment was conducted to determine the effects of simulated dry conditions (use PEG and temperature on seed germination of slender amaranth and prostrate pigweed. Exposure to polyethylene glycol (PEG-6000 solutions has been

  7. Human engineering

    International Nuclear Information System (INIS)

    Yang, Seong Hwan; Park, Bum; Gang, Yeong Sik; Gal, Won Mo; Baek, Seung Ryeol; Choe, Jeong Hwa; Kim, Dae Sung

    2006-07-01

    This book mentions human engineering, which deals with introduction of human engineering, Man-Machine system like system design, and analysis and evaluation of Man-Machine system, data processing and data input, display, system control of man, human mistake and reliability, human measurement and design of working place, human working, hand tool and manual material handling, condition of working circumstance, working management, working analysis, motion analysis working measurement, and working improvement and design in human engineering.

  8. Engineering Electromagnetics

    International Nuclear Information System (INIS)

    Kim, Se Yun

    2009-01-01

    This book deals with engineering electromagnetics. It contains seven chapters, which treats understanding of engineering electromagnetics such as magnet and electron spin, current and a magnetic field and an electromagnetic wave, Essential tool for engineering electromagnetics on rector and scalar, rectangular coordinate system and curl vector, electrostatic field with coulomb rule and method of electric images, Biot-Savart law, Ampere law and magnetic force, Maxwell equation and an electromagnetic wave and reflection and penetration of electromagnetic plane wave.

  9. Information engineering

    Energy Technology Data Exchange (ETDEWEB)

    Hunt, D.N.

    1997-02-01

    The Information Engineering thrust area develops information technology to support the programmatic needs of Lawrence Livermore National Laboratory`s Engineering Directorate. Progress in five programmatic areas are described in separate reports contained herein. These are entitled Three-dimensional Object Creation, Manipulation, and Transport, Zephyr:A Secure Internet-Based Process to Streamline Engineering Procurements, Subcarrier Multiplexing: Optical Network Demonstrations, Parallel Optical Interconnect Technology Demonstration, and Intelligent Automation Architecture.

  10. Software engineering

    CERN Document Server

    Sommerville, Ian

    2010-01-01

    The ninth edition of Software Engineering presents a broad perspective of software engineering, focusing on the processes and techniques fundamental to the creation of reliable, software systems. Increased coverage of agile methods and software reuse, along with coverage of 'traditional' plan-driven software engineering, gives readers the most up-to-date view of the field currently available. Practical case studies, a full set of easy-to-access supplements, and extensive web resources make teaching the course easier than ever.

  11. Mechanical Engineering | Classification | College of Engineering & Applied

    Science.gov (United States)

    Engineering Concentration on Ergonomics M.S. Program in Computer Science Interdisciplinary Concentration on Energy Doctoral Programs in Engineering Non-Degree Candidate Departments Biomedical Engineering Biomedical Engineering Industry Advisory Council Civil & Environmental Engineering Civil &

  12. Biomedical Engineering | Classification | College of Engineering & Applied

    Science.gov (United States)

    Engineering Concentration on Ergonomics M.S. Program in Computer Science Interdisciplinary Concentration on Energy Doctoral Programs in Engineering Non-Degree Candidate Departments Biomedical Engineering Biomedical Engineering Industry Advisory Council Civil & Environmental Engineering Civil &

  13. Materials Science & Engineering | Classification | College of Engineering &

    Science.gov (United States)

    Biomedical Engineering Concentration on Ergonomics M.S. Program in Computer Science Interdisciplinary Concentration on Energy Doctoral Programs in Engineering Non-Degree Candidate Departments Biomedical Engineering Biomedical Engineering Industry Advisory Council Civil & Environmental Engineering Civil &

  14. Electrical Engineering | Classification | College of Engineering & Applied

    Science.gov (United States)

    Engineering Concentration on Ergonomics M.S. Program in Computer Science Interdisciplinary Concentration on Energy Doctoral Programs in Engineering Non-Degree Candidate Departments Biomedical Engineering Biomedical Engineering Industry Advisory Council Civil & Environmental Engineering Civil &

  15. Engineering tribology

    CERN Document Server

    Stachowiak, Gwidon; Batchelor, A W; Batchelor, Andrew W

    2005-01-01

    As with the previous edition, the third edition of Engineering Tribology provides a thorough understanding of friction and wear using technologies such as lubrication and special materials. Tribology is a complex topic with its own terminology and specialized concepts, yet is vitally important throughout all engineering disciplines, including mechanical design, aerodynamics, fluid dynamics and biomedical engineering. This edition includes updated material on the hydrodynamic aspects of tribology as well as new advances in the field of biotribology, with a focus throughout on the engineering ap

  16. Food Engineering

    NARCIS (Netherlands)

    Boom, R.M.; Janssen, A.E.M.

    2014-01-01

    Food engineering is a rapidly changing discipline. Traditionally, the main focus was on food preservation and stabilization, whereas trends now are on diversity, health, taste, and sustainable production. Next to a general introduction of the definition of food engineering, this article gives a

  17. Fluids engineering

    International Nuclear Information System (INIS)

    Anon.

    1991-01-01

    Fluids engineering has played an important role in many applications, from ancient flood control to the design of high-speed compact turbomachinery. New applications of fluids engineering, such as in high-technology materials processing, biotechnology, and advanced combustion systems, have kept up unwaining interest in the subject. More accurate and sophisticated computational and measurement techniques are also constantly being developed and refined. On a more fundamental level, nonlinear dynamics and chaotic behavior of fluid flow are no longer an intellectual curiosity and fluid engineers are increasingly interested in finding practical applications for these emerging sciences. Applications of fluid technology to new areas, as well as the need to improve the design and to enhance the flexibility and reliability of flow-related machines and devices will continue to spur interest in fluids engineering. The objectives of the present seminar were: to exchange current information on arts, science, and technology of fluids engineering; to promote scientific cooperation between the fluids engineering communities of both nations, and to provide an opportunity for the participants and their colleagues to explore possible joint research programs in topics of high priority and mutual interest to both countries. The Seminar provided an excellent forum for reviewing the current state and future needs of fluids engineering for the two nations. With the Seminar ear-marking the first formal scientific exchange between Korea and the United States in the area of fluids engineering, the scope was deliberately left broad and general

  18. Biomedical Engineering

    CERN Document Server

    Suh, Sang C; Tanik, Murat M

    2011-01-01

    Biomedical Engineering: Health Care Systems, Technology and Techniques is an edited volume with contributions from world experts. It provides readers with unique contributions related to current research and future healthcare systems. Practitioners and researchers focused on computer science, bioinformatics, engineering and medicine will find this book a valuable reference.

  19. Genetic Engineering

    Science.gov (United States)

    Phillips, John

    1973-01-01

    Presents a review of genetic engineering, in which the genotypes of plants and animals (including human genotypes) may be manipulated for the benefit of the human species. Discusses associated problems and solutions and provides an extensive bibliography of literature relating to genetic engineering. (JR)

  20. pH-Modulated Watson-Crick duplex-quadruplex equilibria of guanine-rich and cytosine-rich DNA sequences 140 base pairs upstream of the c-kit transcription initiation site.

    Science.gov (United States)

    Bucek, Pavel; Jaumot, Joaquim; Aviñó, Anna; Eritja, Ramon; Gargallo, Raimundo

    2009-11-23

    Guanine-rich regions of DNA are sequences capable of forming G-quadruplex structures. The formation of a G-quadruplex structure in a region 140 base pairs (bp) upstream of the c-kit transcription initiation site was recently proposed (Fernando et al., Biochemistry, 2006, 45, 7854). In the present study, the acid-base equilibria and the thermally induced unfolding of the structures formed by a guanine-rich region and by its complementary cytosine-rich strand in c-kit were studied by means of circular dichroism and molecular absorption spectroscopies. In addition, competition between the Watson-Crick duplex and the isolated structures was studied as a function of pH value and temperature. Multivariate data analysis methods based on both hard and soft modeling were used to allow accurate quantification of the various acid-base species present in the mixtures. Results showed that the G-quadruplex and i-motif coexist with the Watson-Crick duplex over the pH range from 3.0 to 6.5, approximately, under the experimental conditions tested in this study. At pH 7.0, the duplex is practically the only species present.