WorldWideScience

Sample records for watson rosemary callingham

  1. Weighted Watson-Crick automata

    Energy Technology Data Exchange (ETDEWEB)

    Tamrin, Mohd Izzuddin Mohd [Department of Information System, Kulliyyah of Information and Communication Technology, International Islamic University Malaysia, 50728 Gombak, Selangor (Malaysia); Turaev, Sherzod; Sembok, Tengku Mohd Tengku [Department of Computer Science, Kulliyyah of Information and Communication Technology, International Islamic University Malaysia, 50728 Gombak, Selangor (Malaysia)

    2014-07-10

    There are tremendous works in biotechnology especially in area of DNA molecules. The computer society is attempting to develop smaller computing devices through computational models which are based on the operations performed on the DNA molecules. A Watson-Crick automaton, a theoretical model for DNA based computation, has two reading heads, and works on double-stranded sequences of the input related by a complementarity relation similar with the Watson-Crick complementarity of DNA nucleotides. Over the time, several variants of Watson-Crick automata have been introduced and investigated. However, they cannot be used as suitable DNA based computational models for molecular stochastic processes and fuzzy processes that are related to important practical problems such as molecular parsing, gene disease detection, and food authentication. In this paper we define new variants of Watson-Crick automata, called weighted Watson-Crick automata, developing theoretical models for molecular stochastic and fuzzy processes. We define weighted Watson-Crick automata adapting weight restriction mechanisms associated with formal grammars and automata. We also study the generative capacities of weighted Watson-Crick automata, including probabilistic and fuzzy variants. We show that weighted variants of Watson-Crick automata increase their generative power.

  2. Weighted Watson-Crick automata

    International Nuclear Information System (INIS)

    Tamrin, Mohd Izzuddin Mohd; Turaev, Sherzod; Sembok, Tengku Mohd Tengku

    2014-01-01

    There are tremendous works in biotechnology especially in area of DNA molecules. The computer society is attempting to develop smaller computing devices through computational models which are based on the operations performed on the DNA molecules. A Watson-Crick automaton, a theoretical model for DNA based computation, has two reading heads, and works on double-stranded sequences of the input related by a complementarity relation similar with the Watson-Crick complementarity of DNA nucleotides. Over the time, several variants of Watson-Crick automata have been introduced and investigated. However, they cannot be used as suitable DNA based computational models for molecular stochastic processes and fuzzy processes that are related to important practical problems such as molecular parsing, gene disease detection, and food authentication. In this paper we define new variants of Watson-Crick automata, called weighted Watson-Crick automata, developing theoretical models for molecular stochastic and fuzzy processes. We define weighted Watson-Crick automata adapting weight restriction mechanisms associated with formal grammars and automata. We also study the generative capacities of weighted Watson-Crick automata, including probabilistic and fuzzy variants. We show that weighted variants of Watson-Crick automata increase their generative power

  3. Closure properties of Watson-Crick grammars

    Science.gov (United States)

    Zulkufli, Nurul Liyana binti Mohamad; Turaev, Sherzod; Tamrin, Mohd Izzuddin Mohd; Azeddine, Messikh

    2015-12-01

    In this paper, we define Watson-Crick context-free grammars, as an extension of Watson-Crick regular grammars and Watson-Crick linear grammars with context-free grammar rules. We show the relation of Watson-Crick (regular and linear) grammars to the sticker systems, and study some of the important closure properties of the Watson-Crick grammars. We establish that the Watson-Crick regular grammars are closed under almost all of the main closure operations, while the differences between other Watson-Crick grammars with their corresponding Chomsky grammars depend on the computational power of the Watson-Crick grammars which still need to be studied.

  4. Effects of Ripening Duration and Rosemary Powder Addition on Salchichon Modified Sausage Quality

    Directory of Open Access Journals (Sweden)

    Jong-Hyun Jung

    2015-05-01

    Full Text Available The ripening durations and ingredients for the Salchichon sausages were modified to increase pork rear leg consumption by Korean consumers. The salchichon, a ripened pork sausage, was produced to evaluate the efficacy of two different ripening durations with and without rosemary powder on salchichon sausage quality, and the treatments were: i 45 days of ripening without rosemary, ii 60 days of ripening without rosemary, iii 45 days of ripening with 0.05% rosemary, and iv 60 days of ripening with 0.05% rosemary. Significant differences were observed in both moisture and fat content for ripening durations, with the highest moisture and least fat content observed in salchichon modified sausage (SMS ripened for 45 days. Ripening duration and rosemary addition appeared to influence water activity (aw of salchichon sausages. The aw of SMS ripened for 45 days was 0.80, whereas the other had aw values <0.80. Lactic acid bacteria were predominant, as Korean traditional fermented red pepper paste was added to sausages; however, the Bacillus cereus population was significantly affected by rosemary powder addition. Chewiness and gumminess decreased significantly due to the addition of rosemary powder compared to SMS without rosemary powder, and both 45 days of ripening and rosemary powder addition influenced the hardness of SMS. In conclusion, ripening duration of SMS for 45 days in the presence of rosemary powder provided superior SMS quality with an economical ripening duration compared to that of ripening with rosemary powder or ripening for 60 days.

  5. Test Review: Watson, G., & Glaser, E. M. (2010), "Watson-Glaser™ II Critical Thinking Appraisal." Washington State University, Pullman, USA

    Science.gov (United States)

    Sternod, Latisha; French, Brian

    2016-01-01

    The Watson-Glaser™ II Critical Thinking Appraisal (Watson-Glaser II; Watson & Glaser, 2010) is a revised version of the "Watson-Glaser Critical Thinking Appraisal®" (Watson & Glaser, 1994). The Watson-Glaser II introduces a simplified model of critical thinking, consisting of three subdimensions: recognize assumptions, evaluate…

  6. Data Discovery with IBM Watson

    Science.gov (United States)

    Fessler, J.

    2016-12-01

    BM Watson is a cognitive computing system that uses machine learning, statistical analysis, and natural language processing to find and understand the clues in questions posed to it. Watson was made famous when it bested two champions on TV's Jeopardy! show. Since then, Watson has evolved into a platform of cognitive services that can be trained on very granular fields up study. Watson is being used to support a number of subject domains, such as cancer research, public safety, engineering, and the intelligence community. IBM will be providing a presentation and demonstration on the Watson technology and will discuss its capabilities including Natural Language Processing, text analytics and enterprise search, as well as cognitive computing with deep Q&A. The team will also be giving examples of how IBM Watson technology is being used to support real-world problems across a number of public sector agencies

  7. The effect of the essential oils of lavender and rosemary on the ...

    African Journals Online (AJOL)

    Therefore, the essential oils of rosemary and lavender have significantly increased the image memory compared to the control. Inhalation of the rosemary essential oil increased the memorization of numbers, and inhalation of the lavender essential oil weakened this process. Keywords: Lavender essential oil, Rosemary ...

  8. Antimicrobial and Antioxidant Activities of Rosemary Essential Oil Treated By Gamma Irradiation

    International Nuclear Information System (INIS)

    Abdeldaiem, M.H.; Mohamed, H.G.; Abdel-Khalek, H.H.

    2009-01-01

    The antibacterial and antioxidant activity of the irradiated rosemary essential oil at doses of 0, 5, 10 and 15 kGy were studied. Rosemary essential oil was analyzed by gas chromatography/mass spectrometry (GC/MS). The major components were camphor (20.85%), caryophyllene (18.37%), 1, 8-cineole (14.49%), δ-Cadinene (9.59%) and α-Pinene (8.47%). The antibacterial of the rosemary essential oil as well as the minimum inhibitory dosage (MID) values were recorded. The irradiated rosemary essential oil was generally more effective against bacteria than non-irradiated essential oil. The gram-positive Staphylococcus epidermidis, lactic acid bacteria, Staphylococcus aureus and Bacillus megaterium were more sensitive to non-irradiated and irradiated rosemary essential oil than the gram-negative Escherichia coli, Pseudomonas aeroginosa and Pseudomonas hydrophila. The MID values of tested bacteria to rosemary were in the range of 4-16 μl.ml -1 . The in vitro antioxidant activity was investigated with two methods, 2,2-diphenylpicrylhydrazyl radical (DPPH) scavenging assay and tert-butyl hydroquinone (TBHQ) was employed as positive control. The natural essential oil showed antioxidant and DPPH radical scavenging activities and it displayed the inhibition of lipid peroxidation. Then, 0.1% of irradiated rosemary essential oil was added to sunflower oil as natural antioxidant comparing to 0.02% TBHQ as artificial antioxidant. The results showed that irradiation treatment increased the antioxidant activity of rosemary essential oil

  9. Investigation into the Aroma of Rosemary using Multi-Channel ...

    African Journals Online (AJOL)

    NICO

    ... or GC-MS analyses. The aroma of different headspace samples was character- ... on the effects of drying herbs such as basil7 and rosemary.8 However, these studies were ... The approach is very simple and cost- effective; no ... Experimental. 2.1. .... true for applications such as cooking where the rosemary products will ...

  10. Distributional Watson transforms

    NARCIS (Netherlands)

    Dijksma, A.; Snoo, H.S.V. de

    1974-01-01

    For all Watson transforms W in L2(R+) a triple of Hilbert space LG ⊂ L2(R+) ⊂ L'G is constructed such that W may be extended to L'G. These results allow the construction of a triple L ⊂ L2(R+) ⊂ L', where L is a Gelfand-Fréchet space. This leads to a theory of distributional Watson transforms.

  11. Multi-head Watson-Crick automata

    OpenAIRE

    Chatterjee, Kingshuk; Ray, Kumar Sankar

    2015-01-01

    Inspired by multi-head finite automata and Watson-Crick automata in this paper, we introduce new structure namely multi-head Watson-Crick automata where we replace the single tape of multi-head finite automaton by a DNA double strand. The content of the second tape is determined using a complementarity relation similar to Watson-Crick complementarity relation. We establish the superiority of our model over multi-head finite automata and also show that both the deterministic and non-determinis...

  12. Possible hypocholesterolemic effect of ginger and rosemary oils in rats

    African Journals Online (AJOL)

    Group (Ic): rats received i.p 2.5 g/Kg b.w of rosemary oil. Group (Id): Rats received i.p 5 g/Kg b.w mixture of ginger oil and rosemary oil (1:1). The second main ... Full Text: EMAIL FREE FULL TEXT EMAIL FREE FULL TEXT · DOWNLOAD FULL ...

  13. Rosemary supplementation (Rosmarinus oficinallis L. attenuates cardiac remodeling after myocardial infarction in rats.

    Directory of Open Access Journals (Sweden)

    Bruna Paola Murino Rafacho

    Full Text Available Myocardial infarction (MI is one of the leading causes of morbidity and mortality worldwide. Dietary intervention on adverse cardiac remodeling after MI has significant clinical relevance. Rosemary leaves are a natural product with antioxidant/anti-inflammatory properties, but its effect on morphology and ventricular function after MI is unknown.To determine the effect of the dietary supplementation of rosemary leaves on cardiac remodeling after MI, male Wistar rats were divided into 6 groups after sham procedure or experimental induced MI: 1 Sham group fed standard chow (SR0, n = 23; 2 Sham group fed standard chow supplemented with 0.02% rosemary (R002 (SR002, n = 23; 3 Sham group fed standard chow supplemented with 0.2% rosemary (R02 (SR02, n = 22; 4 group submitted to MI and fed standard chow (IR0, n = 13; 5 group submitted to MI and fed standard chow supplemented with R002 (IR002, n = 8; and 6 group submitted to MI and fed standard chow supplemented with R02 (IR02, n = 9. After 3 months of the treatment, systolic pressure evaluation, echocardiography and euthanasia were performed. Left ventricular samples were evaluated for: fibrosis, cytokine levels, apoptosis, energy metabolism enzymes, and oxidative stress. Rosemary dietary supplementation attenuated cardiac remodeling by improving energy metabolism and decreasing oxidative stress. Rosemary supplementation of 0.02% improved diastolic function and reduced hypertrophy after MI. Regarding rosemary dose, 0.02% and 0.2% for rats are equivalent to 11 mg and 110 mg for humans, respectively.Our findings support further investigations of the rosemary use as adjuvant therapy in adverse cardiac remodeling.

  14. Effect of dietary olive leaves and rosemary on microbial growth and ...

    African Journals Online (AJOL)

    Effect of dietary olive leaves and rosemary on microbial growth and lipid oxidation of turkey breast during refrigerated storage. ... During this period olive leaves were more effective in inhibiting bacterial growth than rosemary. Keywords: Antioxidant additives, α-tocopherol, turkey meat, herbs, spices, meat quality ...

  15. Engineering spray-dried rosemary extracts with improved physicomechanical properties: a design of experiments issue

    Directory of Open Access Journals (Sweden)

    Luiza T. Chaul

    Full Text Available ABSTRACT A 33 Box–Behnken design and Response Surface Methodology were performed to evaluate the influence of extract feed rate, drying air inlet temperature and spray nozzle airflow rate on the process yield, stability parameters (moisture content and water activity and on several physicomechanical properties of spray-dried rosemary extracts. Powder yield ranged from 17.1 to 74.96%. The spray-dried rosemary extracts showed moisture content and water activity below 5% and 0.5%, respectively, which indicate their chemical and microbiological stabilities. Even without using drying aids, some sets of experimental conditions rendered dried products with suitable flowability and compressibility characteristics for direct preparation of solid dosage forms. Analysis of variance and Response Surface Methodology proved that studied factors significantly affected most of the spray-dried rosemary extract quality indicators at different levels. The main processing parameter affecting the spray-dried rosemary extract characteristics was inlet temperature. The best combination of parameters used to obtain a reasonable yield of stable dry rosemary extracts with adequate technological properties for pharmaceutical purpose involves an extract feed rate of 2 ml/min, 80 °C inlet temperature and 40 l/min SA. The design of experiments approach is an interesting strategy for engineering spray-dried rosemary extracts with improved characteristics for pharmaceutical industrial purpose.

  16. Investigation of the Effects of Rosemary Extract on Barrier and Colorimetric Properties of Mungbean Starch Films

    Directory of Open Access Journals (Sweden)

    H. Safari Maznabi

    2013-08-01

    Full Text Available Barrier properties are one of the most important factors in the edible film. In this study, edible mungbean films were prepared containing (0%, 15%, 30%, 45% concentrations of rosemary aqueous extract. Then the effect of rosemary was investigated on colorimetric and barrier properties (water vapor permeability, oxygen permeability. Rosemary extract increased the absorption of color in the visible region, which in turn led to increase of the parameters a (index color tends toward green and b (index color tends towards yellow. The results showed that increasing concentrations of rosemary extract have a significant effect( p <0.05 to reduce the amount of oxygen and water vapor permeability.  Also turbidity of mungbean starch was increased with increasing concentrations of rosemary in the film. Improving barrier properties and the colorimetric properties were showed by rosemary extract compounds that these materials can use as the safety of food and pharmaceutical packaging industry.

  17. Role of Rosemary leaves extract against radiation-induced hematological and biochemical alterations in mice

    Directory of Open Access Journals (Sweden)

    Acharya Garima S.

    2008-01-01

    Full Text Available The present paper is a study of the modulatory effect of Rosmarinus officinalis leaves extract on radiation-induced hematological and biochemical changes in Swiss albino mice. The dose reduction factor for the Rosemary extract against gamma rays was calculated 1.53 from LD50/30 values. The Rosemary extract was administered orally for 5 consecutive days prior to radiation exposure. The hematological and biochemical parameters were assessed from day 1 to 30 post-irradiation intervals. The total erythrocyte count, total leucocytes count, hemoglobin, and hematocrit values in the experimental group were found to be elevated as compared to the control group of mice. Furthermore, the Rosemary extract treatment enhanced reduced glutathione content in the liver and blood against radiation-induced depletion. Treatment with the plant extract brought a significant fall in the lipid peroxidation level, suggesting rosemary's role in protection against radiation-induced membrane and cellular damage. The results from the present study suggest a radio-protective effect of the Rosemary extract against radiation-induced hematological and biochemical alterations in mice.

  18. Making IBM's Computer, Watson, Human

    Science.gov (United States)

    Rachlin, Howard

    2012-01-01

    This essay uses the recent victory of an IBM computer (Watson) in the TV game, "Jeopardy," to speculate on the abilities Watson would need, in addition to those it has, to be human. The essay's basic premise is that to be human is to behave as humans behave and to function in society as humans function. Alternatives to this premise are considered…

  19. How a low-fidelity DNA polymerase chooses non-Watson-Crick from Watson-Crick incorporation.

    Science.gov (United States)

    Wu, Wen-Jin; Su, Mei-I; Wu, Jian-Li; Kumar, Sandeep; Lim, Liang-Hin; Wang, Chun-Wei Eric; Nelissen, Frank H T; Chen, Ming-Chuan Chad; Doreleijers, Jurgen F; Wijmenga, Sybren S; Tsai, Ming-Daw

    2014-04-02

    A dogma for DNA polymerase catalysis is that the enzyme binds DNA first, followed by MgdNTP. This mechanism contributes to the selection of correct dNTP by Watson-Crick base pairing, but it cannot explain how low-fidelity DNA polymerases overcome Watson-Crick base pairing to catalyze non-Watson-Crick dNTP incorporation. DNA polymerase X from the deadly African swine fever virus (Pol X) is a half-sized repair polymerase that catalyzes efficient dG:dGTP incorporation in addition to correct repair. Here we report the use of solution structures of Pol X in the free, binary (Pol X:MgdGTP), and ternary (Pol X:DNA:MgdGTP with dG:dGTP non-Watson-Crick pairing) forms, along with functional analyses, to show that Pol X uses multiple unprecedented strategies to achieve the mutagenic dG:dGTP incorporation. Unlike high fidelity polymerases, Pol X can prebind purine MgdNTP tightly and undergo a specific conformational change in the absence of DNA. The prebound MgdGTP assumes an unusual syn conformation stabilized by partial ring stacking with His115. Upon binding of a gapped DNA, also with a unique mechanism involving primarily helix αE, the prebound syn-dGTP forms a Hoogsteen base pair with the template anti-dG. Interestingly, while Pol X prebinds MgdCTP weakly, the correct dG:dCTP ternary complex is readily formed in the presence of DNA. H115A mutation disrupted MgdGTP binding and dG:dGTP ternary complex formation but not dG:dCTP ternary complex formation. The results demonstrate the first solution structural view of DNA polymerase catalysis, a unique DNA binding mode, and a novel mechanism for non-Watson-Crick incorporation by a low-fidelity DNA polymerase.

  20. Isolation by different processes and in vitro bioactivities of rosemary (Rosmarinus officinalis L.) essential oil

    Science.gov (United States)

    Thanh, Tran Truc; Lan, Lao Xuan; Thu, Huynh; Tam, Nguyen Kim Minh

    2017-09-01

    Essential oil of Rosemary (Rosmarinus officinalis L) was solvent-free microwave extracted and analysed by GC/MS. 36 compounds were identified, and the main constituents of the oil included 1,8-cineole (16.87%), camphor (24.12%), α-pinene (11.04%), β-pinene (5,51%) etc,… The results demonstrate that rosemary essential oil exhibited free radical scavenging activity against DPPH with IC50 = 472.46 µg/ml. Rosemary oil has also been proven effective against all of examined pathogens except P. aeruginosa. The Minimum Inhibitory Concentration (MIC) was 8 µl/ml for Salmonella typhimurium and 4 µl/ml for the other four studied strains (Enterococcus faecalis, Staphylococcus aureus, MRSA, Escherichia coli). These results will open new venues for rosemary oil medical use.

  1. A Comprehensive Characterisation of Rosemary tea Obtained from Rosmarinus officinalis L. Collected in a sub-Humid Area of Tunisia.

    Science.gov (United States)

    Achour, Mariem; Mateos, Raquel; Ben Fredj, Maha; Mtiraoui, Ali; Bravo, Laura; Saguem, Saad

    2018-01-01

    Rosemary (Rosmarinus officinalis L.) is an aromatic plant common in Tunisia and it is widely consumed as a tea in traditional cuisine and in folk medicine to treat various illnesses. Currently, most research efforts have been focused on rosemary essential oil, alcoholic and aqueous extracts, however, little is reported on rosemary infusion composition. To investigate compounds present in rosemary tea obtained from Rosmarinus officinalis L. collected in a sub-humid area of Tunisia in order to assess whether the traditional rosemary tea preparation method could be considered as a reference method for rosemary's compounds extraction. Qualitative characterisation of Rosmarinus officinalis tea obtained after rosemary infusion in boiled water was determined by high performance liquid chromatography coupled with electrospray ionisation quadrupole time-of-flight mass spectrometry (HPLC-ESI-QTOF-MS). Quantitative analysis relies on high performance liquid chromatography with diode array detector (HPLC-DAD). Forty-nine compounds belonging to six families, namely flavonoids, phenolic acids, phenolic terpenes, jasmonate, phenolic glycosides, and lignans were identified. To the best of the authors' knowledge eucommin A is characterised for the first time in rosemary. Rosmarinic acid (158.13 μg/g dried rosemary) was the main compound followed then by feruloylnepitrin (100.87 μg/g) and luteolin-3'-O-(2″-O-acetyl)-β-d-glucuronide (44.04 μg/g). Among quantified compounds, luteolin-7-O-rutinoside was the compound with the lowest concentration. The infusion method allows several polyphenols present in rosemary tea to be extracted, therefore it could be a reference method for rosemary's compounds extraction. Moreover, traditional Tunisian Rosmarinus officinalis tea consumption is of interest for its rich phenolic content. Copyright © 2017 John Wiley & Sons, Ltd. Copyright © 2017 John Wiley & Sons, Ltd.

  2. 78 FR 43198 - Watson Cogeneration Company; Notice of Filing

    Science.gov (United States)

    2013-07-19

    ... DEPARTMENT OF ENERGY Federal Energy Regulatory Commission [Docket No. TX13-1-000] Watson... Commission's (Commission) Regulations, 18 CFR 36.1, Watson Cogeneration Company filed an application... physical interconnection to the Watson facility; (2) direct SCE and California Independent System Operator...

  3. Occurrence of Target Spot on Rosemary Caused by Corynespora cassiicola in Korea

    Directory of Open Access Journals (Sweden)

    Wang-Hyu Lee

    2013-03-01

    Full Text Available The purpose of this experiment was to investigate the development of new spot disease on the leaf and stem of rosemary (Rosmarinus officinalis in commercial greenhouses at Jeonju and Namwon in Korea. Incidence of target spot on rosemary was higher at the end of the rainy season with high humidity. Those symptoms were black ring spots (3−5 mm in diameter and withering on green leaves and stems. Conidiophores and conidia were formed on the infected tissue in moist chamber and conidia were shown as the cylindrical and oval types in chain, ranged from 55 to 275 μm in length, and 7 to 14 μm in width. Conidia with eight to ten pseudosepta were formed on the conidiapore. The optimum growth temperature of isolates was 30oC on the PDA medium under the dark condition. In the pathogenesis test, the target spot and withering symptoms were appeared on the leaves and stems 3 days after inoculation showing similar symptoms compared to those of in nature. The same fungus was re-isolated from infected lesion, indicating that Corynespora cassiicola caused leaf target spot and twig blight on rosemary. The rDNA ITS nucleotide sequences of the pure cultured isolate from the diseased area on rosemary showed 100% similarity to the sequences of C. cassiicola available in the GenBank database (JQ595296, JQ595297, FJ852715 and AY238606. Therefore, we report that the target spot of leaves and stems in rosemary was caused by C. cassiicola.

  4. Evaluation of drying methods with respect to drying kinetics, mineral content and colour characteristics of rosemary leaves

    International Nuclear Information System (INIS)

    Arslan, Derya; Musa Ozcan, M.

    2008-01-01

    Rosemary leaves (Rosmarinus officinalis L., Lamiaceae) were dried by using sun, oven (50 deg. C) and microwave oven (700 W, 2450 MHz) drying methods. Microwave oven drying shortened the drying time more than 99% when compared to the sun and oven drying methods. K, Ca, Na, Mg and P were the most abundant elements in the rosemary samples. The mineral content of oven dried rosemary leaves was higher than that of the sun and microwave dried samples. The logarithmic and Midilli and Kuecuek models were shown to give a good fit to the sun and oven drying. The Page, Modified Page and Midilli and Kuecuek models have shown a better fit to the experimental microwave oven drying data of rosemary leaves. Microwave oven drying revealed optimum colour values. Oven drying resulted in a considerable decrease in the colour quality of the rosemary leaves

  5. Antioxidant activity of rosemary (Rosmarinus officinalis L.) essential oil and its hepatoprotective potential

    Science.gov (United States)

    2014-01-01

    Background Natural antioxidant products are increasingly being used to treat various pathological liver conditions considering the role of oxidative stress in their pathogenesis. Rosemary essential oil has already being used as a preservative in food industry due to its antioxidant and antimicrobial activities, but it was shown to possess additional health benefits. The aim of our study was to evaluate the protective effect of rosemary essential oil on carbon tetrachloride - induced liver injury in rats and to explore whether its mechanism of action is associated with modulation of hepatic oxidative status. Methods Chemical composition of isolated rosemary essential oil was determined by gas chromatography and mass spectrometry. Antioxidant activity was determined in vitro using DPPH assay. Activities of enzyme markers of hepatocellular damage in serum and antioxidant enzymes in the liver homogenates were measured using the kinetic spectrophotometric methods. Results In this research, we identified 29 chemical compounds of the studied rosemary essential oil, and the main constituents were 1,8-cineole (43.77%), camphor (12.53%), and α-pinene (11.51%). Investigated essential oil was found to exert hepatoprotective effects in the doses of 5 mg/kg and 10 mg/kg by diminishing AST and ALT activities up to 2-fold in serum of rats with carbon tetrachloride - induced acute liver damage. Rosemary essential oil prevented carbon tetrachloride - induced increase of lipid peroxidation in liver homogenates. Furthermore, pre-treatment with studied essential oil during 7 days significantly reversed the activities of antioxidant enzymes catalase, peroxidase, glutathione peroxidase and glutathione reductase in liver homogenates, especially in the dose of 10 mg/kg. Conclusions Our results demonstrate that rosemary essential oil, beside exhibiting free radical scavenging activity determined by DPPH assay, mediates its hepatoprotective effects also through activation of

  6. Odour-based context reinstatement effects with indirect measures of memory: the curious case of rosemary.

    Science.gov (United States)

    Ball, Linden J; Shoker, Jaswinder; Miles, Jeremy N V

    2010-11-01

    Previous studies examining environmental context-dependent memory (ECDM) effects using indirect measures of memory have produced inconsistent findings. We report three experiments that examined ECDM in an indirect memory paradigm (word-fragment completion) using ambient odours as environmental contexts. Expt 1 manipulated the odour present at learning and testing (rosemary or lemon) to produce reinstated-context or switched-context conditions. Reinstating rosemary led to a striking ECDM effect, indicating that indirect memory testing can be sensitive to ECDM manipulations. Odour ratings also indicated that rosemary induced a more unpleasant mood in participants than lemon. Expt 2 assessed the influence on indirect retrieval of odour-based mood induction as well as odour distinctiveness, and indicated that rosemary's capacity to promote ECDM effects appears to arise from an additive combination of its unpleasantness-inducing properties and its distinctiveness. Expt 3 partially supported these proposals. Overall, our findings indicate that some odours are capable of producing ECDM effects using indirect testing procedures. Moreover, it appears that it is the inherent proprieties of odours on dimensions such as unpleasantness and distinctiveness that mediate the emergence of ECDM effects, thereby explaining the particular potency of rosemary's mnemonic influence when it is reinstated.

  7. In vitro toxicity and control of Meloidogyne incognita in soybean by rosemary extract

    Directory of Open Access Journals (Sweden)

    Mônica Anghinoni Müller

    2016-02-01

    Full Text Available The control of nematodes in plants can be challenging, and there is a need for alternative, environmentally conscious methods for their management. The purpose of this study was to evaluate the effect of rosemary extract (Rosmarinus officinalis on the in vitro toxicity and control of Meloidogyne incognita in CD 206 and CD 215 soybean cultivars. Using an in vitro assay, 500 M. incognita eggs per plate were observed for 15 days after incubation with rosemary extract at concentrations of 1%, 5%, and 10%. Soybean plants were studied under greenhouse conditions, and starting at V3 stage, were sprayed weekly with the same concentration of rosemary extract for 64 days. Three days after the first treatment, each soybean plant was inoculated with 1800 eggs and 400 second-stage juveniles (J2. At the end of this essay, number of eggs and J2 in the roots and soil, number of galls, and the reproduction factor (RF were evaluated. Our results showed that in the in vitro assay, rosemary extract reduced the number of M. incognita eggs that hatched. Under greenhouse conditions, the CD 206 cultivar showed a 48% reduction in the number of galls, as well as fewer eggs in the soil and a lower RF. Similarly, in the CD 215 cultivar, the number of eggs was reduced and the RF was lower. These results indicate the potential for rosemary extract to control M. incognita in soybean crops.

  8. The multiple personalities of Watson and Crick strands.

    Science.gov (United States)

    Cartwright, Reed A; Graur, Dan

    2011-02-08

    In genetics it is customary to refer to double-stranded DNA as containing a "Watson strand" and a "Crick strand." However, there seems to be no consensus in the literature on the exact meaning of these two terms, and the many usages contradict one another as well as the original definition. Here, we review the history of the terminology and suggest retaining a single sense that is currently the most useful and consistent. The Saccharomyces Genome Database defines the Watson strand as the strand which has its 5'-end at the short-arm telomere and the Crick strand as its complement. The Watson strand is always used as the reference strand in their database. Using this as the basis of our standard, we recommend that Watson and Crick strand terminology only be used in the context of genomics. When possible, the centromere or other genomic feature should be used as a reference point, dividing the chromosome into two arms of unequal lengths. Under our proposal, the Watson strand is standardized as the strand whose 5'-end is on the short arm of the chromosome, and the Crick strand as the one whose 5'-end is on the long arm. Furthermore, the Watson strand should be retained as the reference (plus) strand in a genomic database. This usage not only makes the determination of Watson and Crick unambiguous, but also allows unambiguous selection of reference stands for genomics. This article was reviewed by John M. Logsdon, Igor B. Rogozin (nominated by Andrey Rzhetsky), and William Martin.

  9. The multiple personalities of Watson and Crick strands

    Directory of Open Access Journals (Sweden)

    Graur Dan

    2011-02-01

    Full Text Available Abstract Background In genetics it is customary to refer to double-stranded DNA as containing a "Watson strand" and a "Crick strand." However, there seems to be no consensus in the literature on the exact meaning of these two terms, and the many usages contradict one another as well as the original definition. Here, we review the history of the terminology and suggest retaining a single sense that is currently the most useful and consistent. Proposal The Saccharomyces Genome Database defines the Watson strand as the strand which has its 5'-end at the short-arm telomere and the Crick strand as its complement. The Watson strand is always used as the reference strand in their database. Using this as the basis of our standard, we recommend that Watson and Crick strand terminology only be used in the context of genomics. When possible, the centromere or other genomic feature should be used as a reference point, dividing the chromosome into two arms of unequal lengths. Under our proposal, the Watson strand is standardized as the strand whose 5'-end is on the short arm of the chromosome, and the Crick strand as the one whose 5'-end is on the long arm. Furthermore, the Watson strand should be retained as the reference (plus strand in a genomic database. This usage not only makes the determination of Watson and Crick unambiguous, but also allows unambiguous selection of reference stands for genomics. Reviewers This article was reviewed by John M. Logsdon, Igor B. Rogozin (nominated by Andrey Rzhetsky, and William Martin.

  10. Effect of Thyme and Rosemary on The Quality Characteristics, Shelf-life, and Residual Nitrite Content of Sausages During Cold Storage

    Science.gov (United States)

    Jin, Sang Keun; Choi, Jung Seok; Lee, Seung Jae

    2016-01-01

    The effects of thyme and rosemary on the quality characteristics of sausages during cold storage were investigated. Sausages were prepared with thyme and rosemary powder (1 and 2%) and stored for 6 weeks at 10℃. The pH was significantly decreased in sausages by addition of thyme and rosemary compared to that observed in the control before and after storage. At 4 weeks of storage, the residual nitrite content was decreased by thyme and rosemary compared to the control. Lightness (L*) and yellowness (b*) were increased during storage, whereas redness (a*) and whiteness (W) were decreased before and after storage by addition of thyme and rosemary. The amount of TPC and lactic acid bacteria was lower at the end of storage in sausage containing thyme and rosemary. The 2, 2-diphenyl-1-picryl-hydrazyl-hydrate (DPPH) radical scavenging capacity of sausages was increased by addition of thyme and rosemary compared to that in the control before and after storage. In particular, T2 (0.2% thyme addition) showed the highest DPPH radical scavenging capacity during storage. In a sensory evaluation, flavor and overall acceptability were lower in sausages containing thyme and rosemary than in the control. However, at the end of storage (6 wk), aroma, flavor and overall acceptability were not significantly different among the sausage samples. PMID:27857542

  11. The essential oil of rosemary and its effect on the human image and numerical short-term memory

    Directory of Open Access Journals (Sweden)

    O.V. Filiptsova

    2017-06-01

    Full Text Available The research results of the effect of essential oil of rosemary on the human short-term image and numerical memory have been described. The study involved 53 secondary school students (24 boys and 29 girls aged 13–15 years, residents of the Ukrainian metropolis. Participants were divided into the control group and “Rosemary” group, in which the rosemary essential oil was sprayed. The statistically significant differences in productivity of the short-term memory of the participants of these two groups have been found, while sex differences in uniform groups were absent. Therefore, the essential oil of rosemary has significantly increased the image memory compared to the control. Inhalation of the rosemary essential oil increased the memorization of numbers as well.

  12. Phytochemical Profiling of Flavonoids, Phenolic Acids, Terpenoids, and Volatile Fraction of a Rosemary (Rosmarinus officinalis L. Extract

    Directory of Open Access Journals (Sweden)

    Pedro Mena

    2016-11-01

    Full Text Available This paper presents a comprehensive analysis of the phytochemical profile of a proprietary rosemary (Rosmarinus officinalis L. extract rich in carnosic acid. A characterization of the (polyphenolic and volatile fractions of the extract was carried out using mass spectrometric techniques. The (polyphenolic composition was assessed by ultra-high performance liquid chromatography-electrospray ionization-mass spectrometry (UHPLC-ESI-MSn and a total of 57 compounds were tentatively identified and quantified, 14 of these being detected in rosemary extract for the first time. The rosemary extract contained 24 flavonoids (mainly flavones, although flavonols and flavanones were also detected, 5 phenolic acids, 24 diterpenoids (carnosic acid, carnosol, and rosmanol derivatives, 1 triterpenoid (betulinic acid, and 3 lignans (medioresinol derivatives. Carnosic acid was the predominant phenolic compound. The volatile profile of the rosemary extract was evaluated by head space solid-phase microextraction (HS-SPME linked to gas chromatography-mass spectrometry (GC-MS. Sixty-three volatile molecules (mainly terpenes, alcohols, esters, aldehydes, and ketones were identified. This characterization extends the current knowledge on the phytochemistry of Rosmarinus officinalis and is, to our knowledge, the broadest profiling of its secondary metabolites to date. It can assist in the authentication of rosemary extracts or rosemary-containing products or in testing its bioactivity. Moreover, this methodological approach could be applied to the study of other plant-based food ingredients.

  13. Phytochemical Profiling of Flavonoids, Phenolic Acids, Terpenoids, and Volatile Fraction of a Rosemary (Rosmarinus officinalis L.) Extract.

    Science.gov (United States)

    Mena, Pedro; Cirlini, Martina; Tassotti, Michele; Herrlinger, Kelli A; Dall'Asta, Chiara; Del Rio, Daniele

    2016-11-19

    This paper presents a comprehensive analysis of the phytochemical profile of a proprietary rosemary ( Rosmarinus officinalis L.) extract rich in carnosic acid. A characterization of the (poly)phenolic and volatile fractions of the extract was carried out using mass spectrometric techniques. The (poly)phenolic composition was assessed by ultra-high performance liquid chromatography-electrospray ionization-mass spectrometry (UHPLC-ESI-MS n ) and a total of 57 compounds were tentatively identified and quantified, 14 of these being detected in rosemary extract for the first time. The rosemary extract contained 24 flavonoids (mainly flavones, although flavonols and flavanones were also detected), 5 phenolic acids, 24 diterpenoids (carnosic acid, carnosol, and rosmanol derivatives), 1 triterpenoid (betulinic acid), and 3 lignans (medioresinol derivatives). Carnosic acid was the predominant phenolic compound. The volatile profile of the rosemary extract was evaluated by head space solid-phase microextraction (HS-SPME) linked to gas chromatography-mass spectrometry (GC-MS). Sixty-three volatile molecules (mainly terpenes, alcohols, esters, aldehydes, and ketones) were identified. This characterization extends the current knowledge on the phytochemistry of Rosmarinus officinalis and is, to our knowledge, the broadest profiling of its secondary metabolites to date. It can assist in the authentication of rosemary extracts or rosemary-containing products or in testing its bioactivity. Moreover, this methodological approach could be applied to the study of other plant-based food ingredients.

  14. Rosemary Essential Oil-Loaded Lipid Nanoparticles: In Vivo Topical Activity from Gel Vehicles

    Directory of Open Access Journals (Sweden)

    Lucia Montenegro

    2017-10-01

    Full Text Available Although rosemary essential oil (EO shows many biological activities, its topical benefits have not been clearly demonstrated. In this work, we assessed the effects on skin hydration and elasticity of rosemary EO after topical application via gel vehicles in human volunteers. To improve its topical efficacy, rosemary EO was loaded into lipid nanoparticles (NLCs consisting of cetyl palmitate as a solid lipid, and non-ionic surfactants. Such NLCs were prepared using different ratios of EO/solid lipid and those containing EO 3% w/w and cetyl pamitate 7% w/w were selected for in vivo studies, showing the best technological properties (small particle size, low polydispersity index and good stability. Gels containing free EO or EO-loaded NLCs were applied on the hand skin surface of ten healthy volunteers twice a day for one week. Skin hydration and elasticity changes were recorded using the instrument Soft Plus. Gels containing EO-loaded NLCs showed a significant increase in skin hydration in comparison with gels containing free EO. Skin elasticity increased, as well, although to a lesser extent. The results of this study point out the usefulness of rosemary EO-loaded NLCs for the treatment of cutaneous alterations involving loss of skin hydration and elasticity.

  15. Rosemary, the beneficial chemistry of a garden herb.

    Science.gov (United States)

    Hanson, James R

    2016-01-01

    The major natural products that are present in the garden herb, rosemary (Rosmarinus officinalis) including the mono di- and triterpenoid, flavonoid and phenolic constituents together with their biological activity as anti-microbial, anti-oxidant, anti-inflammatory, memory-enhancing and tumour-inhibitory agents, are reviewed.

  16. Therapeutic Effects of Topical Minoxidil or Rosemary and the Combination of Both on the treatment of Alopecia areata

    Directory of Open Access Journals (Sweden)

    Mohammad Hossein Lohrasb

    2015-02-01

    Full Text Available Background & Objectives: Considering the prevalence of Alopecia areata, , failure of treatment, and the unknown pathogenesis of this illness, a comparative study was performed by using topical Minoxidil 2% and topical rosemary solution alone and in combination to treatment this disease. Materials & Methods: This study is a clinical trial performed on 200 patients with Alopecia areata referring to Hamzeh clinic of Fasa during the years 2012 and 2013. They were divided into four groups by random permutation, each group contained 50 patients. Group one received the combination of topical Minoxidil 2% and topical rosemary, group two received only topical Minoxidil 2% solution, group three received only topical rosemary solution and the fourth group, the case-control group, did not receive any medication and were just advised to rub the site of the disease for the same period of time. The patients were under observation for one year. Results: The Results of this investigation showed that the best remissions after treatments were as follow (respectively: combination of topical Minoxidil 2% and topical rosemary (27 patient=54 %, Minoxidil 2% solution (23 patients =46%, rosemary solution (21 patients =42%, and case- control group (9 patients =18%. These results showed that despite better response to the combination of rosemary and Minoxidil solutions in comparison to the two other treated groups, the changes were minimal and statistically insignificant (P-value =0.0411. Conclusion: Using the combination of both rosemary and Minoxidil is more effective than the individual one on treatment of Alopecia areata.

  17. Combined effect of gamma irradiation and rosemary extract on the shelf-life of refrigerated ready-to-cook chicken sausages

    International Nuclear Information System (INIS)

    Tawfik, S.S.; EL-Kabbany, H.M.; Atia, A.E.; Sallam, M.H.; Aly, S.M.E.

    2006-01-01

    Combined treatment of gamma irradiation and rosemary extract as natural anti-microbial and anti-oxidative food flavouring was used in the formulation of ready-to-cook chicken sausage for shelf-life extension and improvement of its microbiological quality. Sausages were treated with 500 ppm of rosemary extract, gamma irradiation with doses of 6 and 8 KGy and stored at 5 ± 1 degree C for 30 days.From the microbiological aspects, 8 KGy irradiation was sufficient to inactivate the microbial load during storage period. Addition of the antioxidant rosemary extract modulated releasing of thiobarbituric acid (TBA) and total volatile bases nitrogen (TVBN) occurred during storage. Sensory and textural evaluation results were significantly different in groups supplied with rosemary extract.Fresh ready-to-cook chicken sausage with rosemary exposed to 8 KGy were microbiologically safe and well acceptable for consumers when stored at 5± 1 degree C up to 30 days

  18. Bioaccessibility and inhibitory effects on digestive enzymes of carnosic acid in sage and rosemary.

    Science.gov (United States)

    Ercan, Pınar; El, Sedef Nehir

    2018-04-28

    In this study, the aim was to determine the bioaccessibilities of carnosic acid in sage and rosemary and in vitro inhibitory effects of these samples on lipid and starch digestive enzymes by evaluating the lipase, α-amylase and α-glucosidase enzyme inhibition activities. The content of carnosic acid in rosemary (18.72 ± 0.33 mg/g) was found to be higher than that content of that in sage (3.76 ± 0.13 mg/g) (p sage and rosemary, respectively. The tested sage and rosemary showed inhibitory activity against α-glucosidase (Concentration of inhibitor required to produce a 50% inhibition of the initial rate of reaction - IC 50 88.49 ± 2.35, 76.80 ± 1.68 μg/mL, respectively), α-amylase (IC 50 107.65 ± 12.64, 95.65 ± 2.73 μg/mL, respectively) and lipase (IC 50 6.20 ± 0.63, 4.31 ± 0.62 μg/mL, respectively). Furthermore, to the best of our knowledge, this is the first work that carnosic acid standard equivalent inhibition capacities (CAEIC 50 ) for these food samples were determined and these values were in agreement with the IC 50 values. These results show that sage and rosemary are potent inhibitors of lipase, α-amylase and α-glucosidase digestive enzymes. Copyright © 2018 Elsevier B.V. All rights reserved.

  19. Training IBM Watson using Automatically Generated Question-Answer Pairs

    OpenAIRE

    Lee, Jangho; Kim, Gyuwan; Yoo, Jaeyoon; Jung, Changwoo; Kim, Minseok; Yoon, Sungroh

    2016-01-01

    IBM Watson is a cognitive computing system capable of question answering in natural languages. It is believed that IBM Watson can understand large corpora and answer relevant questions more effectively than any other question-answering system currently available. To unleash the full power of Watson, however, we need to train its instance with a large number of well-prepared question-answer pairs. Obviously, manually generating such pairs in a large quantity is prohibitively time consuming and...

  20. Short-term study on the effects of rosemary on cognitive function in an elderly population.

    Science.gov (United States)

    Pengelly, Andrew; Snow, James; Mills, Simon Y; Scholey, Andrew; Wesnes, Keith; Butler, Leah Reeves

    2012-01-01

    Rosemary (Rosmarinus officinalis L.) has traditional reputations that justify investigation for a potential role in reducing widespread cognitive decline in the elderly. A randomized, placebo-controlled, double-blinded, repeated-measures crossover study was conducted to investigate possible acute effects of dried rosemary leaf powder on cognitive performance. Twenty-eight older adults (mean age, 75 years) were tested using the Cognitive Drug Research computerized assessment system 1, 2.5, 4, and 6 hours following a placebo and four different doses of rosemary. Doses were counterbalanced, and there was a 7-day washout between visits. There was a biphasic dose-dependent effect in measures of speed of memory: the lowest dose (750 mg) of rosemary had a statistically significant beneficial effect compared with placebo (P=.01), whereas the highest dose (6,000 mg) had a significant impairing effect (Pmemory is a potentially useful predictor of cognitive function during aging. The positive effect of the dose nearest normal culinary consumption points to the value of further work on effects of low doses over the longer term.

  1. Uporaba orodja poslovne inteligence IBM Watson za predvidevanje prodaje

    OpenAIRE

    Stojić, Igor

    2016-01-01

    Diplomska naloga obravnava uporabo orodja IBM Watson in njegovo poslovno vrednost, ki jo ima v okviru oblikovanja napovedi prihodnje prodaje produktov. V teoretičnem delu podrobneje opredeljuje napovedovanje in smoter le-tega. V okviru empiričnega dela pa je bila izvedena primerjava uporabe ERP sistemov SAP in IBM Watson, pri čemer je bil dosledno prikazan postopek oblikovanja napovedi, tako s SAP kot tudi z IBM Watson, s slednjim pa tudi identificiran parameter, ki vpliva na prodajo nekateri...

  2. ELEMENTAL COMPOSITION OF ROSEMARY SHOOTS (ROSMARINUS OFFICINALIS L., INTRODUCED IN THE BOTANICAL GARDEN OF PYATIGORSK MEDICAL-PHARMACEUTICAL INSTITUTE

    Directory of Open Access Journals (Sweden)

    A. S. Nikitina

    2017-01-01

    Full Text Available Nowadays studying plant objects in the framework of environmental monitoring to improve the quality of herbal remedies is a very important area of research.The aim of the work is to determine the elemental composition and assessment of environmental cleanliness of rosemary shoots (Rosmarinus offi cinalis L., introduced in Botanical garden of Pyatigorsk medical-pharmaceutical Institute (PMPI, Pyatigorsk (Russia.Materials and methods. An experimental study was performed at the Central research laboratories spectral analysis (“Kavkazgeolsyemka” on diffraction spectrograph DFS-8-1 by evaporation from a crater of the carbon electrode. Photometric measurement of spectrograms was performed using the Atlas of spectral lines and spectra of standards with an accuracy of not more than 2% in terms of ash.Results and discussion. For the fi rst time there were 25 elements identifi ed in rosemary shoots introduced in the North Caucasus. The prevailing macro elements were K, Ca, Mg, Na, P and the trace elements were Al, Si and Fe. The toxic elements As, Cd, Hg, Bi, Sb were not detected in the rosemary shoots. Rosemary does not accumulate heavy metals or they are present in trace amounts.Conclusion. The absence of heavy metals or their low content in rosemary shoots can be explained prosperous environmental conditions of Pyatigorsk Botanical garden. The use of rosemary shoots as a source of natural compounds of primary and secondary synthesis and minerals, are involved in the regulation of life processes. This underlines the therapeutic importance of the raw materials and the possibility of creating drugs of combined action on the basis of rosemary for the treatment and prevention of pathologies associated with disorders of mineral metabolism.

  3. Theoretical study of the Hoogsteen-Watson-Crick junctions in DNA.

    Science.gov (United States)

    Cubero, Elena; Luque, F Javier; Orozco, Modesto

    2006-02-01

    A series of d (AT)(n) oligonucleotides containing mixtures of normal B-type Watson-Crick and antiparallel Hoogsteen helices have been studied using molecular dynamics simulation techniques to analyze the structural and thermodynamic impact of the junction between Watson-Crick and antiparallel Hoogsteen structures. Analysis of molecular dynamics simulations strongly suggests that for all oligonucleotides studied the antiparallel Hoogsteen appears as a reasonable conformation, only slightly less stable than the canonical B-type Watson-Crick one. The junctions between the Watson-Crick and Hoogsteen structures introduces a priori a sharp discontinuity in the helix, because the properties of each type of conformation are very well preserved in the corresponding fragments. However, and quite counterintuitively, junctions do not largely distort the duplex in structural, dynamics or energetic terms. Our results strongly support the possibility that small fragments of antiparallel Hoogsteen duplex might be embedded into large fragments of B-type Watson-Crick helices, making possible protein-DNA interactions that are specific of the antiparallel Hoogsteen conformation.

  4. Theoretical Study of the Hoogsteen–Watson-Crick Junctions in DNA

    Science.gov (United States)

    Cubero, Elena; Luque, F. Javier; Orozco, Modesto

    2006-01-01

    A series of d (AT)n oligonucleotides containing mixtures of normal B-type Watson-Crick and antiparallel Hoogsteen helices have been studied using molecular dynamics simulation techniques to analyze the structural and thermodynamic impact of the junction between Watson-Crick and antiparallel Hoogsteen structures. Analysis of molecular dynamics simulations strongly suggests that for all oligonucleotides studied the antiparallel Hoogsteen appears as a reasonable conformation, only slightly less stable than the canonical B-type Watson-Crick one. The junctions between the Watson-Crick and Hoogsteen structures introduces a priori a sharp discontinuity in the helix, because the properties of each type of conformation are very well preserved in the corresponding fragments. However, and quite counterintuitively, junctions do not largely distort the duplex in structural, dynamics or energetic terms. Our results strongly support the possibility that small fragments of antiparallel Hoogsteen duplex might be embedded into large fragments of B-type Watson-Crick helices, making possible protein-DNA interactions that are specific of the antiparallel Hoogsteen conformation. PMID:16287814

  5. Allelopathic effect of melissa, lemongrass, lavender and rosemary on germination and vigor of lettuce seeds

    Directory of Open Access Journals (Sweden)

    Daniela Aparecida Teixeira

    2014-12-01

    Full Text Available The objective of this study was to evaluate the influence of four herbal plants on the germination and vigor of lettuce seeds, using aqueous preparations and teas of Melissa oficinalis L. (melissa, Rosmarinus oficinalis L. (rosemary, Lavandula angustifolia Mill. (lavender and Cymbopogon citratus (DC. Stapf. (lemongrass. A randomized complete block design was used with 9 treatments and 4 repetitions. The treatments were: Melissa tea, melissa aqueous preparation, rosemary tea, rosemary aqueous preparation, lavender tea, lavender aqueous preparation, lemongrass tea, lemongrass aqueous preparation and control. The variables evaluated were: germination speed index, percentage of abnormal plants, percentage of germinated plants, fresh matter, dry matter, shoot length and radicle length. Lemongrass showed negative allelopathic effects on germination and vigor of L. sativa L. Melissa tea had a stimulatory effect.

  6. Anti-inflammatory activity of the basolateral fraction of Caco-2 cells exposed to a rosemary supercritical extract

    NARCIS (Netherlands)

    Arranz, E.; Mes, J.J.; Wichers, H.J.; Jaime, L.; Reglero, G.; Santoyo, S.

    2015-01-01

    The anti-inflammatory activity of the basolateral fraction of Caco-2 cells exposed to a rosemary supercritical extract was examined. Uptake of rosemary extract fractions was tested on Caco-2 cell monolayers (2–12 h incubation times) and the quantification of carnosic acid and carnosol was performed

  7. Method for attaining rosemary essential oil with differential composition from dried or fresh material.

    Science.gov (United States)

    Zheljazkov, Valtcho D; Astatkie, Tess; Zhalnov, Ivan; Georgieva, Tonya D

    2015-01-01

    Rosemary (Rosemarinus officinalis L.) is a well-known medicinal and essential oil plant, utilized by humankind since ancient times. The objective was to determine the effect of steam distillation time (DT) and material (dry or fresh biomass) on essential oil yield, composition, and bioactivity; and to develop regression models that can predict oil yield and composition at specific DT. The oil yield (content) from dry biomass was higher (0.43%) than that from fresh biomass (0.35%) and ranged from 0.18% in the 1.25 min DT to 0.51% in the 40 min DT. There was no yield advantage in extending the DT beyond 40 min, which is much shorter than the DT used by industry. In this study, the antioxidant capacity of the rosemary oil using the ORACoil method was 4,108 μmolVE/L. Rosemary oil did not exhibit significant antileishmanial, antimalarial, or antimicrobial activity. In general, the low-boiling constituents eluted earlier than the higher boiling constituents of the essential oil, resulting in a great variation of essential oil composition obtained at different DT. The most important constituents are α-pinene, eucalyptol, and camphor. The highest α-pinene concentration in the oil (30.4%) was obtained from dry biomass at 2.5 min DT; eucalyptol (23.3% of the total oil) from fresh biomass at 2.5 min DT; and camphor (15.9% of the total oil) from fresh biomass at 160 min DT. The DT could be used as an inexpensive tool to alter essential oil composition of the essential oil from fresh or dried rosemary biomass, and to produce rosemary oils with elevated or lowered concentration of specific targeted oil constituents to meet specific market demands.

  8. [Under what conditions does G.C Watson-Crick DNA base pair acquire all four configurations characteristic for A.T Watson-Crick DNA base pair?].

    Science.gov (United States)

    Brovarets', O O

    2013-01-01

    At the MP2/6-311++G(2df,pd)//B3LYP/6-311++G(d,p) level of theory it was established for the first time, that the Löwdin's G*.C* DNA base pair formed by the mutagenic tautomers can acquire, as the A-T Watson-Crick DNA base pair, four biologically important configurations, namely: Watson-Crick, reverse Watson-Crick, Hoogsteen and reverse Hoogsteen. This fact demonstrates rather unexpected role of the tautomerisation of the one of the Watson-Crick DNA base pairs, in particular, via double proton transfer: exactly the G.C-->G*.C* tautomerisation allows to overcome steric hindrances for the implementation of the above mentioned configurations. Geometric, electron-topological and energetic properties of the H-bonds that stabilise the studied pairs, as well as the energetic characteristics of the latters are presented.

  9. Potato Sprout Inhibition and Tuber Quality after Post-Harvest Treatment with Rosemary (Rosmarinus Officinalis L.) Leaves and Branches

    DEFF Research Database (Denmark)

    Talei, Daryush; Bina, Fatemeh; Valdiani, Alireza

    2017-01-01

    Storage of potatoes is one of the most important concerns in maintaining freshness and nutritional quality in the storage process. To achieve this, an experiment was carried out with five different storage conditions at various temperatures using fresh rosemary leaves and branches with three...... replicates. The results revealed that storage of potatoes at 25°C with rosemary leaves and branches resulted in the lowest sprout development and weight loss after 10 weeks. This was significantly different from either 4°C or 30°C. The findings indicated the potential of rosemary fresh leaves and branches...

  10. Effect of organic fertilization on yield and quality of rosemary (Rosmarinus officinalis L.) essential oil

    OpenAIRE

    Cáceres, Jeimmy Alexandra; Cuervo A, Jairo Leonardo; Rodríguez C, Javier Leonardo

    2017-01-01

    ABSTRACT Rosemary production (Rosmarinus officinalis L.) in Colombia is destined mainly for international markets (2.898 t in 2006), Although the national demand is low, this is a promising crop in some areas of the country, having potential to enhance producers life quality through the implementation of sustainable crops allowing the decrease of non-beneficial conditions in agriculture labors. Studying the response to the application of biofertilizers as an alternative to implement rosemary ...

  11. Biochemical Studies on Rosemary Extracts as an Antioxidant in Irradiated Rats

    International Nuclear Information System (INIS)

    Abady, M.M.; Zahran, A.M.; Mansour, S.Z.; Ragab, E.A.

    2003-01-01

    The antioxidant properties of rosemary (Rosmarinus officinalis) essential oil and crude ethanolic extract, have been attributed to its phenolic diterpene, carnosol, carnosic acid, caffeic acid and its derivatives such as rosmarinic acid. These aroma compounds were identified to protect biological membranes from oxidative stress in addition to divers pharmacological and therapeutic activities. This study was undertaken to investigate the effect of natural extract derived from rosemary herb, as an antioxidant defensive element in irradiated rats. Mixture of essential oil and hydroalcoholic extract was orally administered to rats by gavage (150 mg/kg B.w.) for 35 days before exposure to the first fraction of irradiation exposure and during the whole period of irradiation treatment (12 days). Whole body irradiation was delivered as fractionated doses at 1 Gy increment every other day up to total cumulative dose of 6 Gy. Changes in the content of reduced glutathion (GSH), glutathion peroxidase (GSHPx), glucose -6- phosphate dehydrogenase (G-6-PD), superoxide dismutase (SOD) and catalase (Cat.) in blood, liver and spleen were evaluated in different rat groups. The results revealed that transient noticeable increase during the 1st hour post irradiation in the aforementioned parameters, followed by significant decrease recorded after 7 days. Rats supplemented rosemary extract before irradiation have significantly ameliorate the radiation induced depletion in the antioxidant component system

  12. Allelopathic effect of melissa, lemongrass, lavender and rosemary on germination and vigor of lettuce seeds

    Directory of Open Access Journals (Sweden)

    Daniela Aparecida Teixeira

    2014-09-01

    Full Text Available http://dx.doi.org/10.5007/2175-7925.2014v27n4p37 The objective of this study was to evaluate the influence of four herbal plants on the germination and vigor of lettuce seeds, using aqueous preparations and teas of Melissa officinalis L. (melissa, Rosmarinus officinalis L. (rosemary, Lavandula angustifolia Mill. (lavender and Cymbopogon citratus (DC. Stapf. (lemongrass. A randomized complete block design was used with 9 treatments and 4 repetitions. The treatments were: melissa tea, melissa aqueous preparation, rosemary tea, rosemary aqueous preparation, lavender tea, lavender aqueous preparation, lemongrass tea, lemongrass aqueous preparation and control. The variables evaluated were: germination speed index, percentage of abnormal plants, percentage of germinated plants, fresh matter, dry matter, shoot length and radicle length. Lemongrass showed negative allelopathic effects on germination and vigor of L. sativa L. Melissa tea had a stimulatory effect.

  13. Expression of microRNA-15b and the glycosyltransferase GCNT3 correlates with antitumor efficacy of Rosemary diterpenes in colon and pancreatic cancer.

    Directory of Open Access Journals (Sweden)

    Margarita González-Vallinas

    Full Text Available Colorectal and pancreatic cancers remain important contributors to cancer mortality burden and, therefore, new therapeutic approaches are urgently needed. Rosemary (Rosmarinus officinalis L. extracts and its components have been reported as natural potent antiproliferative agents against cancer cells. However, to potentially apply rosemary as a complementary approach for cancer therapy, additional information regarding the most effective composition, its antitumor effect in vivo and its main molecular mediators is still needed. In this work, five carnosic acid-rich supercritical rosemary extracts with different chemical compositions have been assayed for their antitumor activity both in vivo (in nude mice and in vitro against colon and pancreatic cancer cells. We found that the antitumor effect of carnosic acid together with carnosol was higher than the sum of their effects separately, which supports the use of the rosemary extract as a whole. In addition, gene and microRNA expression analyses have been performed to ascertain its antitumor mechanism, revealing that up-regulation of the metabolic-related gene GCNT3 and down-regulation of its potential epigenetic modulator miR-15b correlate with the antitumor effect of rosemary. Moreover, plasmatic miR-15b down-regulation was detected after in vivo treatment with rosemary. Our results support the use of carnosic acid-rich rosemary extract as a complementary approach in colon and pancreatic cancer and indicate that GCNT3 expression may be involved in its antitumor mechanism and that miR-15b might be used as a non-invasive biomarker to monitor rosemary anticancer effect.

  14. Dietary rosemary extract in dairy goats organically managed: effects on immune response, mammary infections and milk quality

    Directory of Open Access Journals (Sweden)

    G. Pisoni

    2011-03-01

    Full Text Available Natural polyphenols found in the leaves of rosemary (Rosmarinus officinalis L. have potential therapeutic benefits, because of their potent antioxidant activity and their anticancerogenic and antiviral properties, observed in vitro and in human liver (Aruoma et al., 1996; Offord et al., 1997. Main active components in rosemary extract are carnosol, carnosic acid, rosmarinic acid and rosmanol (Pearson et al., 1997...

  15. Replication infidelity via a mismatch with Watson-Crick geometry.

    Science.gov (United States)

    Bebenek, Katarzyna; Pedersen, Lars C; Kunkel, Thomas A

    2011-02-01

    In describing the DNA double helix, Watson and Crick suggested that "spontaneous mutation may be due to a base occasionally occurring in one of its less likely tautomeric forms." Indeed, among many mispairing possibilities, either tautomerization or ionization of bases might allow a DNA polymerase to insert a mismatch with correct Watson-Crick geometry. However, despite substantial progress in understanding the structural basis of error prevention during polymerization, no DNA polymerase has yet been shown to form a natural base-base mismatch with Watson-Crick-like geometry. Here we provide such evidence, in the form of a crystal structure of a human DNA polymerase λ variant poised to misinsert dGTP opposite a template T. All atoms needed for catalysis are present at the active site and in positions that overlay with those for a correct base pair. The mismatch has Watson-Crick geometry consistent with a tautomeric or ionized base pair, with the pH dependence of misinsertion consistent with the latter. The results support the original idea that a base substitution can originate from a mismatch having Watson-Crick geometry, and they suggest a common catalytic mechanism for inserting a correct and an incorrect nucleotide. A second structure indicates that after misinsertion, the now primer-terminal G • T mismatch is also poised for catalysis but in the wobble conformation seen in other studies, indicating the dynamic nature of the pathway required to create a mismatch in fully duplex DNA.

  16. Nisin, rosemary, and ethylenediaminetetraacetic acid affect the growth of Listeria monocytogenes on ready-to-eat turkey ham stored at four degrees Celsius for sixty-three days.

    Science.gov (United States)

    Ruiz, A; Williams, S K; Djeri, N; Hinton, A; Rodrick, G E

    2009-08-01

    The objectives of this study were to determine the anti-Listeria and general antimicrobial properties of nisin, rosemary, and EDTA alone and in combination on Listeria monocytogenes inoculated on ready-to-eat vacuum-packaged diced turkey ham and to ascertain the effects of the treatments on pH and objective color. The turkey hams were cut into 0.5-cm pieces, inoculated with a L. monocytogenes cocktail containing 5 strains of the bacterium, and treated with either no treatment and no inoculum (negative control), inoculum only (positive control), 0.5% nisin, 20 mM EDTA, 1% rosemary, 0.5% nisin + 20 mM EDTA, 0.5% nisin + 1% rosemary, 0.5% nisin + 20 mM EDTA + 1% rosemary, or 20 mM EDTA + 1% rosemary. All samples were vacuum-packaged, stored for 63 d at 4 degrees C +/- 1 degrees C, and analyzed at 1-wk intervals for total aerobes, L. monocytogenes, lactic acid organisms, pH, and objective color. Nisin, nisin with rosemary, nisin with EDTA, and nisin with rosemary and EDTA treatments reduced (P hams treated with nisin. The EDTA and rosemary treatments alone and in combination were ineffective in inhibiting growth of L. monocytogenes. Although none of the treatments completely eliminated L. monocytogenes, the results indicated that ready-to-eat turkey ham can have significantly decreased L. monocytogenes when treated with nisin alone or in combination with rosemary or EDTA, or both.

  17. Supercritical carbon dioxide extraction of antioxidants from rosemary (Rosmarinus officinalis L. and sage (Salvia officinalis L.

    Directory of Open Access Journals (Sweden)

    JASNA IVANOVIĆ

    2009-07-01

    Full Text Available The aim of the present study was to isolate and characterize antioxidant extracts obtained from dried leaves of rosemary (Rosmarinus officinalis L. and sage (Salvia officinalis L., originating from the southern Balkan Region. The antioxidant fraction was isolated from the plant material by supercritical carbon dioxide (SC-CO2 fractional extraction under a pressure of 30 MPa and at temperatures of 40 and 100 °C. In the present study, kinetic data and yields of antioxidant extracts obtained from dried leaves of rosemary and sage under different conditions were determined. Electron spin resonance (ESR spectroscopy assay on the ability of the extracts to scavenge stable 2,2-diphenyl-1-picrylhydrazyl (DPPH free radicals and reactive hydroxyl radicals during the Fenton reaction trapped by 5,5-dimethyl-1-pyrroline-N-oxide (DMPO showed that the investigated extracts had antioxidant activity comparable to that of butylated hydroxyanisole (BHA and commercial rosemary extract. The antioxidant fractions isolated at the higher temperature had higher antioxidant activities. A tentative analysis of the chemical composition of the antioxidant fractions obtained at the higher temperature was accomplished by LC-DAD and LC-MS analytical methods. Abietane-type diterpenoids, flavonoids and fatty acids were identified in the SC-CO2 extract of rosemary and sage.

  18. Antioxidant and antimicrobial properties of ethanolic extracts of guarana, boldo, rosemary and cinnamon

    Directory of Open Access Journals (Sweden)

    Jeannine Bonilla

    2017-06-01

    Full Text Available Abstract In this investigation, the ethanolic extracts of two less known plants, little reported in the literature (guarana and boldo leaves were studied in comparison with the ethanolic extracts of two well studied plants (cinnamon and rosemary, regarding their colour, GC-MS profile, phenolic content and their antioxidant and antimicrobial properties. The rosemary (59.20 ± 0.28 and guarana (56.63 ± 0.54 extracts showed the highest values for luminosity (L* and the UV-Vis absorption increased when L* decreased. GC-MS identified a limited number of compounds in the cinnamon and guarana extracts. The cinnamon extract showed the highest value for the total phenolic content (172 mg GA/g extract as compared to the other extracts. The highest antioxidant capacity was observed for the boldo leaves extract in the TEAC (6.66 ± 0.17 mM assay and for the rosemary extract in the DPPH (0.80 ± 0.14 mg/L test. In addition, all the extracts showed antimicrobial activity against the S. aureus strain, indicating that all the extracts studied could be used by food industries to develop new active food packaging materials.

  19. The effect of the essential oils of lavender and rosemary on the human short-term memory

    Directory of Open Access Journals (Sweden)

    O.V. Filiptsova

    2018-03-01

    Full Text Available The research results of the effect of essential oils on the human short-term image and numerical memory have been described. The study involved 79 secondary school students (34 boys and 45 girls aged 13 to 17 years, residents of the Ukrainian metropolis. Participants were divided into three groups: the control group, “Lavender” group, in which the lavender essential oil was sprayed, and “Rosemary” group, in which the rosemary essential oil was sprayed. The statistically significant differences in productivity of the short-term memory of the participants of different groups have been found. Therefore, the essential oils of rosemary and lavender have significantly increased the image memory compared to the control. Inhalation of the rosemary essential oil increased the memorization of numbers, and inhalation of the lavender essential oil weakened this process.

  20. A Challenge to Watson

    Science.gov (United States)

    Detterman, Douglas K.

    2011-01-01

    Watson's Jeopardy victory raises the question of the similarity of artificial intelligence and human intelligence. Those of us who study human intelligence issue a challenge to the artificial intelligence community. We will construct a unique battery of tests for any computer that would provide an actual IQ score for the computer. This is the same…

  1. Ed Watson - 1940-2006

    CERN Multimedia

    2006-01-01

    Ed Watson passed away suddenly on 1 August in Geneva, he was 66. He leaves his wife and two children. Ed Watson arrived at CERN in March 1973 to work on digital electronics and CAMAC systems under Bob Dobinson, after many years at Rolls Royce in Scotland. He joined the European Muon Collaboration in 1976, where he played a major role in the design, deployment and running of its data acquisition system (DAQ) with David Botterill, Bob Dobinson, and Vicky White. The CAMAC-ROMULUS system was by far the largest and most advanced of its time, and it became a defining standard for DAQ systems for years to come. Ed was deeply involved in the detailed planning of the control rooms and the experiment cabling, as well as sharing the responsibility for the CAMAC readout system. He had a real talent for trouble shooting and played a vital part in supporting the experiment throughout its lifetime. He offered great moral support to the younger members of the collaboration and helped them a great deal with their work. The...

  2. Chuck Watson's ``differential psychoacoustics:'' Individual differences in auditory abilities

    Science.gov (United States)

    Kidd, Gary R.

    2004-05-01

    Chuck Watson was among the first in the psychoacoustic community to seriously address the topic of individual differences. At a time when there was little concern with variation among ``normal listeners'' in psychoacoustic research, Watson began a research program to document the range of human auditory abilities. The primary goals were to determine the number of distinct abilities, to specify the nature of each ability, and to document the distribution of these abilities in the general population. Thanks to Watson's talent for organizing and directing large-scale projects and his workmanlike approach to science, a large and valuable body of data on human individual differences has been collected. The research program began about 20 years ago with the study of basic auditory abilities, and it has expanded to include other modalities and cognitive/intellectual abilities in adults and children. A somewhat biased view of the importance of this work will be presented by one of Watson's many colleagues in this endeavor. The talk will provide an overview of this ongoing research program as well as a brief review of some related research by other investigators. New findings from recent extensions of this work will also be discussed.

  3. 78 FR 17231 - Importer of Controlled Substances, Notice of Registration, Watson Pharma, Inc.

    Science.gov (United States)

    2013-03-20

    ... Registration, Watson Pharma, Inc. By Notice dated November 5, 2012, and published in the Federal Register on November 13, 2012, 77 FR 67675, Watson Pharma, Inc., 2455 Wardlow Road, Corona, California 92880-2882, made.... 823(a) and Sec. 952(a) and determined that the registration of Watson Pharma, Inc., to import the...

  4. 78 FR 64016 - Importer of Controlled Substances; Notice of Registration; Watson Pharma, Inc.

    Science.gov (United States)

    2013-10-25

    ... Registration; Watson Pharma, Inc. By Notice dated May 24, 2013, and published in the Federal Register on June 4, 2013, 78 FR 33440, Watson Pharma, Inc., 2455 Wardlow Road, Corona, California 92880-2882, made... in 21 U.S.C. 823(a) and 952(a) and determined that the registration of Watson Pharma, Inc., to import...

  5. Rosemary oil vs minoxidil 2% for the treatment of androgenetic alopecia: a randomized comparative trial.

    Science.gov (United States)

    Panahi, Yunes; Taghizadeh, Mohsen; Marzony, Eisa Tahmasbpour; Sahebkar, Amirhossein

    2015-01-01

    Rosmarinus officinalis L. is a medicinal plant with diverse activities including enhancement microcapillary perfusion. The present study aimed to investigate the clinical efficacy of rosemary oil in the treatment of androgenetic alopecia (AGA) and compare its effects with minoxidil 2%. Patients with AGA were randomly assigned to rosemary oil (n = 50) or minoxidil 2% (n = 50) for a period of 6 months. After a baseline visit, patients returned to the clinic for efficacy and safety evaluations every 3 months. A standardized professional microphotographic assessment of each volunteer was taken at the initial interview and after 3 and 6 months of the trial. No significant change was observed in the mean hair count at the 3-month endpoint, neither in the rosemary nor in the minoxidil group (P > .05). In contrast, both groups experienced a significant increase in hair count at the 6-month endpoint compared with the baseline and 3-month endpoint (P .05). The frequencies of dry hair, greasy hair, and dandruff were not found to be significantly different from baseline at either month 3 or month 6 trial in the groups (P > .05). The frequency of scalp itching at the 3- and 6-month trial points was significantly higher compared with baseline in both groups (P minoxidil group at both assessed endpoints (P < .05). The findings of the present trial provided evidence with respect to the efficacy of rosemary oil in the treatment of AGA.

  6. The effectiveness of fixative addition on Zodia (Evodia suaveolens S. and rosemary (Rosmarinus officinalis l. gel against Aedes aegypti

    Directory of Open Access Journals (Sweden)

    Mutiara Widawati

    2014-02-01

    Full Text Available AbstrakLatar belakang: Nyamuk Aedes aegypti merupakan salah satu penyebab penyakit Demam Berdarah Dengue (DBD. Sebagai salah satu upaya pencegahannya, bahan tanaman sering dijadikan sebagai bahan penolak nyamuk, di antaranya Zodia (Evodia suaveolens Scheff dan Rosemary (Rosmarinus officinalis L.. Salah satu pengembangan yang banyak dilakukan adalah modifikasi sediaan yang mudah dipakai agar lebih tahan lama, misalnya formulasi gel minyak atsiri. Tujuan dari penelitian ini yaitu mengetahui efek penambahan zat fiksatif (minyak nilam terhadap daya proteksi repelan gel Rosemary dan Zodia.Metode:Penelitian ini bersifat ekperimen yang menggunakan minyak atsiri dari bunga Rosemary dan daun Zodia dengan konsentrasi masing-masing 0,1%, 0,5%, 1%, 2%, 4%. Kontrol (+ menggunakan N,Ndiethyl-3-methylbenzamide (DEET dan kontrol (- menggunakan lengan tanpa perlakuan. Uji repelan menggunakan lengan sukarelawan yang sudah dilatih. Pengamatan dilakukan tiap jam selama enam jam. Daya proteksi baik jika bernilai 90% atau lebih. Hasil:Data menunjukkan bahwa penambahan zat fiksatif meningkatkan daya proteksi repelan mulai dari konsentrasi 2% untuk Rosemary dan konsentrasi 4% untuk Zodia. Daya proteksi di atas 90% selama 6 jam. Kesimpulan:Penambahan zat fiksatif gel Rosseamary dan Zodia terbuti efektif untuk meningkatkan daya proteksi repelen terhadap nyamuk Aedes aegypti. (Health Science Indones 2013;2:103-6Kata kunci:Aedes, Efektivitas repellent,Evodia suaveolens S., Rosmarinus officinalis L.AbstractBackground: Aedes aegyptiis a mosquito is one of the vectors for dengue. One method of preventing dengue is to use bio insecticides from plants. A plant that is often used as a mosquito repellent is Zodia (Evodia suaveolens scheff and Rosemary (Rosmarinus officinalis l.. Some studies have modified the dosage of bio insecticides to achieve more durable repellent, including developing a gel form. The aim of this study is to measure the protective effect of additional

  7. Modulation of T-type Ca2+ channels by Lavender and Rosemary extracts.

    Directory of Open Access Journals (Sweden)

    Chaymae El Alaoui

    Full Text Available Medicinal plants represent a significant reservoir of unexplored substances for early-stage drug discovery. Of interest, two flowering Mediterranean plants have been used for thousands of years for their beneficial effects on nervous disorders, including anxiety and mood. However, the therapeutic potential of these plants regarding their ability to target ion channels and neuronal excitability remains largely unknown. Towards this goal, we have investigated the ability of Lavender and Rosemary to modulate T-type calcium channels (TTCCs. TTCCs play important roles in neuronal excitability, neuroprotection, sensory processes and sleep. These channels are also involved in epilepsy and pain. Using the whole-cell patch-clamp technique, we have characterized how Lavender and Rosemary extracts, as well as their major active compounds Linalool and Rosmarinic acid, modulate the electrophysiological properties of recombinant TTCCs (CaV3.2 expressed in HEK-293T cells. Both the methanolic and essential oil extracts as well as the active compounds of these plants inhibit Cav3.2 current in a concentration-dependent manner. In addition, these products also induce a negative shift of the steady-state inactivation of CaV3.2 current with no change in the activation properties. Taken together, our findings reveal that TTCCs are a molecular target of the Lavender and Rosemary compounds, suggesting that inhibition of TTCCs could contribute to the anxiolytic and the neuroprotective effects of these plants.

  8. Protective Effect of Rosemary (Rosmarinus Officinalis) Extract on Naphthalene Induced Nephrotoxicity in Adult Male Albino Rat

    OpenAIRE

    Neveen M. El-Sherif; Noha Mohy Issa

    2015-01-01

    Background: Naphthalene (NA) is a common environmental contaminant and is abundant in tobacco smoke. Rosemary (Rosmarinus officinalis) is a herb commonly used as a spice and flavoring agents in food processing and is useful in the treatment of many diseases. Aim of the work: To study the nephrotoxicity of NA and to evaluate the possible protective role of rosemary extract in adult male albino rat. Materials and Methods: 25 animals were divided into three groups: Group I (Control group), G...

  9. Rosemary Extracts Upregulate Nrf2, Sestrin2, and MRP2 Protein Level in Human Hepatoma HepG2 Cells

    Directory of Open Access Journals (Sweden)

    Xiao-pei Tong

    2017-01-01

    Full Text Available In the past few decades, the incidence of liver cancer has been rapidly rising across the world. Rosemary is known to possess antioxidant activity and is used as natural antioxidant food preservative. It is proposed to have anticancer activity in treating different tumor models. In this study, we try to explore the impact of rosemary extracts on upregulating the level of Nrf2 and Nrf2-regulatory proteins, Sestrin2 and MRP2 in HepG2 cells, and to speculate its potential mechanism. The anticancer activity of rosemary extract, including its polyphenolic diterpenes carnosic acid and carnosol, was evaluated to understand the potential effect on HepG2 cells. Rosemary extract, carnosic acid, and carnosol induced the expression of Sestrin2 and MRP2 associate with enhancement of Nrf2 protein level in HepG2 cells, in which carnosic acid showed most obvious effect. Although the activation pathway of Nrf2/ARE was not exactly assessed, it can be assumed that the enhancement of expression of Sestrin2 and MRP2 may result from upregulation of Nrf2.

  10. Laser-assisted collisions: The Kroll-Watson formula and bremsstrahlung theory

    International Nuclear Information System (INIS)

    Geltman, S.

    1996-01-01

    Recent measurements on CO 2 -laser-assisted electron-atom collisions have shown large inconsistencies with the Kroll-Watson formula for small-angle scattering. We have carried out a detailed study to compare the predictions of Kroll-Watson theory (for both single and multimode fields) with those of conventional perturbation theory for stimulated free-free transitions. It is found that for E 0 /2ω 2 <1, where perturbation theory is valid, there are large differences with the Kroll-Watson theory. Comparisons of experimental variations with respect to scattering angle and electron energy show much better agreement with perturbation theory than with Kroll-Watson theory. A study of the angular variations in perturbation theory shows that use of the open-quote open-quote outgoing close-quote close-quote wave final state gives much better agreement with experiment than does the open-quote open-quote ingoing close-quote close-quote wave final state, which is different from the choice made in early bremsstrahlung theory. copyright 1996 The American Physical Society

  11. On the scaling limits of Galton Watson processes in varying environment

    NARCIS (Netherlands)

    Bansaye, V.; Simatos, F.

    2011-01-01

    Renormalized sequences of Galton Watson processes converge to Continuous State Branching Processes (CSBP), characterized by a L\\'evy triplet of two numbers and a measure. This paper investigates the case of Galton Watson processes in varying environment and provides an explicit sufficient condition

  12. Sommerfeld-Watson transformation for nuclear fission

    International Nuclear Information System (INIS)

    Alexandru, G.

    1978-01-01

    It is proved that the fission matrix element can be written like a Sommerfeld-Watson relation. This leads to a dispersion relation for the fission process in which the substraction term is uniquely determined. (author)

  13. Little Albert's alleged neurological impairment: Watson, Rayner, and historical revision.

    Science.gov (United States)

    Digdon, Nancy; Powell, Russell A; Harris, Ben

    2014-11-01

    In 2012, Fridlund, Beck, Goldie, and Irons (2012) announced that "Little Albert"-the infant that Watson and Rayner used in their 1920 study of conditioned fear (Watson & Rayner, 1920)-was not the healthy child the researchers described him to be, but was neurologically impaired almost from birth. Fridlund et al. also alleged that Watson had committed serious ethical breaches in regard to this research. Our article reexamines the evidentiary bases for these claims and arrives at an alternative interpretation of Albert as a normal infant. In order to set the stage for our interpretation, we first briefly describe the historical context for the Albert study, as well as how the study has been construed and revised since 1920. We then discuss the evidentiary issues in some detail, focusing on Fridlund et al.'s analysis of the film footage of Albert, and on the context within which Watson and Rayner conducted their study. In closing, we return to historical matters to speculate about why historiographical disputes matter and what the story of neurologically impaired Albert might be telling us about the discipline of psychology today.

  14. Protective effects of different marigold (Calendula officinalis L.) and rosemary cream preparations against sodium-lauryl-sulfate-induced irritant contact dermatitis.

    Science.gov (United States)

    Fuchs, S M; Schliemann-Willers, S; Fischer, T W; Elsner, P

    2005-01-01

    In the present study, we evaluated the protective action of cream preparations containing seven different types of marigold and rosemary extracts in vivo in healthy volunteers with experimentally induced irritant contact dermatitis (ICD). Marigold and rosemary extracts in base cream DAC (Deutscher Arzneimittel-Codex = German Pharmaceutical Codex) were tested in a 4-day repetitive irritation test using sodium lauryl sulfate. The effect was evaluated visually and quantified by noninvasive bioengineering methods, namely chromametry and tewametry. When the test products were applied parallel to the induction period of ICD, a statistically significant protective effect of all cream preparations was observed by all methods. This effect, although not statistically significant, was superior to control by undyed marigold und faradiol ester-enriched extracts in chromametry and by dyed and undyed rosemary extracts in tewametry. The sequential treatment (postirritation) once a day for 5 days was without any effect. Thus, a protective effect of some marigold and rosemary extracts against ICD could be shown in the elicitation phase. Copyright (c) 2005 S. Karger AG, Basel.

  15. Antioxidant activity of rosemary essential oil fractions obtained by molecular distillation and their effect on oxidative stability of sunflower oil.

    Science.gov (United States)

    Mezza, Gabriela N; Borgarello, Ana V; Grosso, Nelson R; Fernandez, Héctor; Pramparo, María C; Gayol, María F

    2018-03-01

    The objective of this study was to evaluate the antioxidant activity of rosemary essential oil fractions obtained by molecular distillation (MD) and investigate their effect on the oxidative stability of sunflower oil. MD fractions were prepared in a series of low-pressure stages where rosemary essential oil was the first feed. Subsequently, a distillate (D1) and residue (R1) were obtained and the residue fraction from the previous stage used as the feed for the next. The residue fractions had the largest capacity to capture free radicals, and the lowest peroxide values, conjugated dienes and conjugated trienes. The antioxidant activity of the fractions was due to oxygenated monoterpenes, specifically α-terpineol and cis-sabinene hydrate. Oxidative stability results showed the residues (R1 and R4) and butylated hydroxytoluene had greater antioxidant activity than either the distillate fractions or original rosemary essential oil. The residue fractions obtained by short path MD of rosemary essential oil could be used as a natural antioxidants by the food industry. Copyright © 2017. Published by Elsevier Ltd.

  16. Anti-oxidant supplementation improves boar sperm characteristics and fertility after cryopreservation: comparison between cysteine and rosemary (Rosmarinus officinalis).

    Science.gov (United States)

    Malo, C; Gil, L; Gonzalez, N; Martínez, F; Cano, R; de Blas, I; Espinosa, E

    2010-08-01

    Anti-oxidants partially ameliorated the detrimental effects of reactive oxidative substances produced during cryopreservation. The objective of the study was to determine the effect of anti-oxidant addition to the freezing extender on boar semen qualities and fertility capacity. Ejaculates were collected from a previously selected boar and semen samples were processed using the straw freezing procedure. In experiment 1, semen samples were cryopreserved in lactose-egg yolk solution supplemented with various concentrations of cysteine (0, 5 and 10mM) to determinate a cysteine concentration capable of producing a protective effect during cryopreservation. Semen quality (total motility, progressive motility, viability, acrosome integrity and hypoosmotic swelling test) was evaluated after freezing and thawing and then every hour for 3h. In experiment 2, ejaculates were cryopreserved with lactose-egg yolk extender with or without the following anti-oxidants: cysteine, rosemary (Rosmarinus officinalis) and cysteine plus rosemary. Semen quality was evaluated. In the experiment 3, fertility capacity of semen frozen in anti-oxidant supplementation extenders was examined in vitro. A total of 2232 oocytes were in vitro matured and inseminated with frozen-thawed sperm. In summary: (i) the effective concentration of cysteine in freezing extender was 10mM; (ii) the addition of exogenous rosemary or cysteine to the freezing extender positively affected post-thawed viability and acrosome integrity. Only rosemary supplementation improved total motility at 3h and progressive motility at any time; (iii) the inclusion of rosemary into the extender was effective in penetration and cleavage rate and also in the efficiency of the fertilization system. (c) 2010 Elsevier Inc. All rights reserved.

  17. Theoretical Study of the Hoogsteen–Watson-Crick Junctions in DNA

    OpenAIRE

    Cubero, Elena; Luque, F. Javier; Orozco, Modesto

    2005-01-01

    A series of d (AT)n oligonucleotides containing mixtures of normal B-type Watson-Crick and antiparallel Hoogsteen helices have been studied using molecular dynamics simulation techniques to analyze the structural and thermodynamic impact of the junction between Watson-Crick and antiparallel Hoogsteen structures. Analysis of molecular dynamics simulations strongly suggests that for all oligonucleotides studied the antiparallel Hoogsteen appears as a reasonable conformation, only slightly less ...

  18. The essential oil of rosemary and its effect on the human image and numerical short-term memory

    OpenAIRE

    O.V. Filiptsova; L.V. Gazzavi-Rogozina; I.A. Timoshyna; O.I. Naboka; Ye.V. Dyomina; A.V. Ochkur

    2017-01-01

    The research results of the effect of essential oil of rosemary on the human short-term image and numerical memory have been described. The study involved 53 secondary school students (24 boys and 29 girls) aged 13–15 years, residents of the Ukrainian metropolis. Participants were divided into the control group and “Rosemary” group, in which the rosemary essential oil was sprayed. The statistically significant differences in productivity of the short-term memory of the participants of these t...

  19. Transfer of metals and metalloids from soil to shoots in wild rosemary (Rosmarinus officinalis L.) growing on a former lead smelter site: human exposure risk.

    Science.gov (United States)

    Affholder, Marie-Cécile; Prudent, Pascale; Masotti, Véronique; Coulomb, Bruno; Rabier, Jacques; Nguyen-The, Bénédicte; Laffont-Schwob, Isabelle

    2013-06-01

    This study aimed at estimating exposition risks to wild rosemary used as herbs in the contaminated area of the former smelting factory of L'Escalette (South of Marseille, France). Metals and metalloids i.e. Pb, As, Sb, Zn, and Cu concentrations were analyzed in soils and in rosemary aerial parts (stems and leaves) on two sites: one heavily contaminated and the other far away from the pollution source, considered as reference. The metal and metalloid transfer into water during the brewing process of herbal tea was also determined. A mixed contamination by the above-cited contaminants was demonstrated in soils of the factory site, with average concentrations of 9253, 1127, 309, 2698 and 32 mg/kg for Pb, As, Sb, Zn and Cu, respectively. However, metals and metalloids' transfer in rosemary aerial parts was limited, as bioaccumulation factors were under 1. Thus, Pb, As and Cu concentrations in leaves were below international regulation limits concerning ingestion of medicinal herbs (no regulation values available for Sb and Zn). This study highlighted that, if contaminated rosemary leaves were ingested, health risks may be limited since acceptable daily intake (ADI) for Pb, As, Sb and Cu (no ADI value available for Zn) will only be reached if very high quantities are consumed. Furthermore, we aimed to establish if this mixed contamination could alter rosemary's essential oil quality, and thereby the compositions of essential oils obtained from individuals on the heavily contaminated soil were compared to those obtained from the reference population. An increased biosynthesis of antioxidant compounds was favored in essential oils from rosemary individuals growing in contaminated site. Although the health risk of a long-term exposition of low level of the mixed contamination by rosemary ingestion is not easy to elucidate, the use of rosemary essential oils from contaminated site appears as safe. Copyright © 2013 Elsevier B.V. All rights reserved.

  20. How the challenge of explaining learning influenced the origins and development of John B. Watson's behaviorism.

    Science.gov (United States)

    Rilling, M

    2000-01-01

    Before he invented behaviorism, John B. Watson considered learning one of the most important topics in psychology. Watson conducted excellent empirical research on animal learning. He developed behaviorism in part to promote research and elevate the status of learning in psychology. Watson was much less successful in the adequacy and originality of the mechanisms he proposed to explain learning. By assimilating the method of classical conditioning and adopting Pavlov's theory of stimulus substitution, Watson linked behaviorism with a new method that could compete with both Titchener's method of introspection and Freud's methods of psychoanalysis. Watson's interest in explaining psychopathology led to the discovery of conditioned emotional responses and a behavioristic explanation for the learning of phobic behavior. Watson established learning as a central topic for basic research and application in American psychology.

  1. Aromas of rosemary and lavender essential oils differentially affect cognition and mood in healthy adults.

    Science.gov (United States)

    Moss, Mark; Cook, Jenny; Wesnes, Keith; Duckett, Paul

    2003-01-01

    This study was designed to assess the olfactory impact of the essential oils of lavender (Lavandula angustifolia) and rosemary (Rosmarlnus officinalis) on cognitive performance and mood in healthy volunteers. One hundred and forty-four participants were randomly assigned to one of three independent groups, and subsequently performed the Cognitive Drug Research (CDR) computerized cognitive assessment battery in a cubicle containing either one of the two odors or no odor (control). Visual analogue mood questionnaires were completed prior to exposure to the odor, and subsequently after completion of the test battery. The participants were deceived as to the genuine aim of the study until the completion of testing to prevent expectancy effects from possibly influencing the data. The outcome variables from the nine tasks that constitute the CDR core battery feed into six factors that represent different aspects of cognitive functioning. Analysis of performance revealed that lavender produced a significant decrement in performance of working memory, and impaired reaction times for both memory and attention based tasks compared to controls. In contrast, rosemary produced a significant enhancement of performance for overall quality of memory and secondary memory factors, but also produced an impairment of speed of memory compared to controls. With regard to mood, comparisons of the change in ratings from baseline to post-test revealed that following the completion of the cognitive assessment battery, both the control and lavender groups were significantly less alert than the rosemary condition; however, the control group was significantly less content than both rosemary and lavender conditions. These findings indicate that the olfactory properties of these essential oils can produce objective effects on cognitive performance, as well as subjective effects on mood.

  2. Graham Watson: Eesti vajab enam riigi sekkumist majandusse

    Index Scriptorium Estoniae

    Watson, Graham

    2009-01-01

    18. aprillil pidasid keskerakondlased Tallinnas Euroopa Parlamendi valimiste konverentsi. Euroopa Parlamendi demokraatide ja liberaalide fraktsiooni juht Graham Watson saatis Keskerakonnale videotervituse

  3. From theory to practice: caring science according to Watson and Brewer.

    Science.gov (United States)

    Clarke, Pamela N; Watson, Jean; Brewer, Barbara B

    2009-10-01

    Caring science is presented by Jean Watson and Barbara Brewer through an interview and dialogue format. Jean Watson presents caring science and its philosophy and evolution and the impact of her model on nursing and other disciplines. Barbara Brewer addresses the implementation of the model in a Magnet hospital setting and describes how her leadership facilitated implementation.

  4. Oncologists partner with Watson on genomics.

    Science.gov (United States)

    2015-08-01

    A new collaboration between IBM Watson Health and more than a dozen cancer centers uses the power of cognitive computing to dramatically reduce the time it takes to analyze data from patients' DNA and identify targeted treatment options. ©2015 American Association for Cancer Research.

  5. Did John B. Watson Really "Found" Behaviorism?

    Science.gov (United States)

    Malone, John C

    2014-05-01

    Developments culminating in the nineteenth century, along with the predictable collapse of introspective psychology, meant that the rise of behavioral psychology was inevitable. In 1913, John B. Watson was an established scientist with impeccable credentials who acted as a strong and combative promoter of a natural science approach to psychology when just such an advocate was needed. He never claimed to have founded "behavior psychology" and, despite the acclaim and criticism attending his portrayal as the original behaviorist, he was more an exemplar of a movement than a founder. Many influential writers had already characterized psychology, including so-called mental activity, as behavior, offered many applications, and rejected metaphysical dualism. Among others, William Carpenter, Alexander Bain, and (early) Sigmund Freud held views compatible with twentieth-century behaviorism. Thus, though Watson was the first to argue specifically for psychology as a natural science, behaviorism in both theory and practice had clear roots long before 1913. If behaviorism really needs a "founder," Edward Thorndike might seem more deserving, because of his great influence and promotion of an objective psychology, but he was not a true behaviorist for several important reasons. Watson deserves the fame he has received, since he first made a strong case for a natural science (behaviorist) approach and, importantly, he made people pay attention to it.

  6. John B. Watson's Alleged Sex Research: An Appraisal of the Evidence

    Science.gov (United States)

    Benjamin, Ludy T. Jr.; Whitaker, Jodi L.; Ramsey, Russell M.; Zeve, Daniel R.

    2007-01-01

    In 1974, a story was published about clandestine research done by John B. Watson that was judged to be so reprehensible that it was offered as the real reason he was fired from his faculty position at Johns Hopkins University in 1920, at perhaps the peak of his academic career. Watson's dismissal from Johns Hopkins may have been the most important…

  7. [From humanism to nihilism: dialectics on Jean Watson's caring theory].

    Science.gov (United States)

    Krol, Pawel J; Lavoie, Mireille

    2015-09-01

    nursing today is heir to values that have developed over many years. In addition to the values of human care, present-day nursing embraces values that shape our modern world. This dialectical study first traces the evolution of a number of the traditional values associated with human care that nursing has retained. It goes on to show how some of the values of human care have been cast aside in favour of modern--neoliberal, technocratic and bureaucratic--values which have in turn given rise to disturbing problems of instrumentalization. Watson's theory of caring proposes two ways to remedy such instrumentalization: espousing a transcendental, metaphysical mode of thought and adopting an altruistic humanism. However, many critics have questioned the theoretical consistency and very legitimacy of the theory as a means of dealing with instrumentalization. this study analyses Watson's proposals, using a Nietzschean dialectic approach to test them and to suggest possible solutions. Significant problems in terms of both consistency and relevance are brought to light, tending to refute Watson's notions. the study findings suggest that the application of Watson's theory may paradoxically perpetuate dualism and nihilism and, rather than curb their invasive impact, lead inevitably to a conversion to instrumental values. it's suggested an alternative, ethics-of-life approach based on the synthesis of our dialectics that would foster a return to, and respect for, humanity's essential nature.

  8. Comparison of the Therapeutic Effect of 2% Topical Minoxidil with Rosemary Solution in the Treatment of Alopecia Areata on the Scalp

    Directory of Open Access Journals (Sweden)

    R Yaghmaei

    2014-12-01

    Full Text Available Background & aim: Alopecia Areata is a chronic inflammatory disease which affects the hair roots. Different drugs and methods are used to treat this disease, nevertheless there is still no cure. The aim of this study was to compare the therapeutic effect of topical Minoxidil 2% solution in the treatment of alopecia areata on the scalp with rosemary solution. Methods: The present clinical-trial study was conducted on 78 patients with Alopecia Areata. Block randomization was designed in two groups of four Minoxidil 2% (n=39 and Rosemary (n=39. During the initial evaluation, patients were assessed in terms of location, number and extent of lesions by a dermatologist, and then the data were recorded. Patients in the intervention group were administered rosemary, as well as those in the control group were given Minoxidil 2%. The patients were instructed to apply the medication to the lesion twice a day. The lesion was re-evaluated two months later. Data were analyzed using SPSS version 18 as well as T-test and Chi-square test and descriptive statistics. Results: There were no significant differences in terms of mean age, mean duration of disease, and alopecia conflict in the patients of two groups (p>0.05. There was no significant difference in cure rates between the two groups (05/0 p>0.05. Conclusions: The findings of this study revealed that both Rosemary and Minoxidil had the same effects on alopecia areata. Due to the fact that the treatment of alopecia areata by rosemary plant is effective and affordable, it can be recommended.

  9. Comparison of the Therapeutic Effect of 2% Topical Minoxidil with Rosemary Solution in the Treatment of Alopecia Areata on the Scalp

    Directory of Open Access Journals (Sweden)

    R Yaghmaei

    2014-09-01

    Full Text Available Background & aim: Alopecia Areata is a chronic inflammatory disease which affects the hair roots. Different drugs and methods are used to treat this disease, nevertheless there is still no cure. The aim of this study was to compare the therapeutic effect of topical Minoxidil 2% solution in the treatment of alopecia areata on the scalp with rosemary solution. Methods: The present clinical-trial study was conducted on 78 patients with Alopecia Areata. Block randomization was designed in two groups of four Minoxidil 2% (n=39 and Rosemary (n=39. During the initial evaluation, patients were assessed in terms of location, number and extent of lesions by a dermatologist, and then the data were recorded. Patients in the intervention group were administered rosemary, as well as those in the control group were given Minoxidil 2%. The patients were instructed to apply the medication to the lesion twice a day. The lesion was re-evaluated two months later. Data were analyzed using SPSS version 18 as well as T-test and Chi-square test and descriptive statistics. Results: There were no significant differences in terms of mean age, mean duration of disease, and alopecia conflict in the patients of two groups (p>0.05. There was no significant difference in cure rates between the two groups (05/0 p>0.05. Conclusions: The findings of this study revealed that both Rosemary and Minoxidil had the same effects on alopecia areata. Due to the fact that the treatment of alopecia areata by rosemary plant is effective and affordable, it can be recommended.

  10. Histological and histochemical study of the protective role of rosemary extract against harmful effect of cell phone electromagnetic radiation on the parotid glands.

    Science.gov (United States)

    Ghoneim, Fatma M; Arafat, Eetmad A

    2016-06-01

    Electromagnetic fields (EMFs) are a class of non-ionizing radiation (NIR) that is emitted from mobile phone. It may have hazardous effects on parotid glands. So, we aimed to investigate the histological and histochemical changes of the parotid glands of rats exposed to mobile phone and study the possible protective role of rosemary against its harmful effect. Forty adult male albino rats were used in this study. They were classified into 4 equal groups. Group I (control), group II (control receiving rosemary), group III (mobile phone exposed group) and group IV (mobile exposed, rosemary treated group). Parotid glands were dissected out for histological and histochemical study. Moreover, measurement of oxidative stress markers; malondialdehyde (MDA) and total antioxidant capacity (TAC) was done. The results of this study revealed that rosemary has protective effect through improving the histological and histochemical picture of the parotid gland in addition of its antioxidant effect. It could be concluded from the current study, that exposure of parotid gland of rat models to electromagnetic radiation of mobile phone resulted in structural changes at the level of light and electron microscopic examination which could be explained by oxidative stress effect of mobile phone. Rosemary could play a protective role against this harmful effect through its antioxidant activity. Copyright © 2016 Elsevier GmbH. All rights reserved.

  11. Rosemary tea consumption results to anxiolytic- and anti-depressant-like behavior of adult male mice and inhibits all cerebral area and liver cholinesterase activity; phytochemical investigation and in silico studies.

    Science.gov (United States)

    Ferlemi, Anastasia-Varvara; Katsikoudi, Antigoni; Kontogianni, Vassiliki G; Kellici, Tahsin F; Iatrou, Grigoris; Lamari, Fotini N; Tzakos, Andreas G; Margarity, Marigoula

    2015-07-25

    Our aim was to investigate the possible effects of regular drinking of Rosmarinus officinalis L. leaf infusion on behavior and on AChE activity of mice. Rosemary tea (2% w/w) phytochemical profile was investigated through LC/DAD/ESI-MS(n). Adult male mice were randomly divided into two groups: "Rosemary-treated" that received orally the rosemary tea for 4weeks and "control" that received drinking water. The effects of regular drinking of rosemary tea on behavioral parameters were assessed by passive avoidance, elevated plus maze and forced swimming tests. Moreover, its effects on cerebral and liver cholinesterase (ChE) isoforms activity were examined colorimetricaly. Phytochemical analysis revealed the presence of diterpenes, flavonoids and hydroxycinnamic derivatives in rosemary tea; the major compounds were quantitatively determined. Its consumption rigorously affected anxiety/fear and depression-like behavior of mice, though memory/learning was unaffected. ChE isoforms activity was significantly decreased in brain and liver of "rosemary treated" mice. In order to explain the tissue ChE inhibition, principal component analysis, pharmacophore alignment and molecular docking were used to explore a possible relationship between main identified compounds of rosemary tea, i.e. rosmarinic acid, luteolin-7-O-glucuronide, caffeic acid and known AChE inhibitors. Results revealed potential common pharmacophores of the phenolic components with the inhibitors. Our findings suggest that rosemary tea administration exerts anxiolytic and antidepressant effects on mice and inhibits ChE activity; its main phytochemicals may function in a similar way as inhibitors. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  12. 77 FR 67675 - Importer of Controlled Substances; Notice of Application; Watson Pharma, Inc.

    Science.gov (United States)

    2012-11-13

    ... DEPARTMENT OF JUSTICE Drug Enforcement Administration Importer of Controlled Substances; Notice of Application; Watson Pharma, Inc. Pursuant to Title 21 Code of Federal Regulations 1301.34(a), this is notice that on August 28, 2012, Watson Pharma, Inc., 2455 Wardlow Road, Corona, California 92880-2882, made...

  13. 78 FR 33440 - Importer of Controlled Substances, Notice of Application; Watson Pharma, Inc.

    Science.gov (United States)

    2013-06-04

    ... DEPARTMENT OF JUSTICE Drug Enforcement Administration Importer of Controlled Substances, Notice of Application; Watson Pharma, Inc. Pursuant to Title 21 Code of Federal Regulations 1301.34 (a), this is notice that on May 3, 2013, Watson Pharma, Inc., 2455 Wardlow Road, Corona, California 92880-2882, made...

  14. A history of the term radical behaviorism: From Watson to Skinner

    Science.gov (United States)

    Schneider, Susan M.; Morris, Edward K.

    1987-01-01

    This paper describes the origins and evolution of the term radical behaviorism. John B. Watson's coining of behaviorism in 1913 is presented first, followed by a discussion of the uses of “radical” within psychology during these early years. When the term radical behaviorism first emerged in the early 1920s, its referent was Watson's behaviorism, most specifically his stance on consciousness. In the 1930s, B. F. Skinner described his own position with the term radical behaviorism in an unpublished manuscript, and then in 1945 first referred in print to his views as such. Today, radical behaviorism is generally applied to Skinner's views alone. The paper concludes with a brief discussion of a similarity in Watson's and Skinner's positions on consciousness, which seems a possible historical and philosophical connection between their respective radical behaviorisms. PMID:22477958

  15. Rosemary as natural antioxidant to prevent oxidation in chicken burgers

    Directory of Open Access Journals (Sweden)

    Daiane PEREIRA

    Full Text Available Abstract Rosemary (Rosmarinus officinalis is known for their sensory characteristics and antioxidant properties, mainly due to the presence of several phenolic compounds. The aim of this work, was determine the antioxidant activity and apply the Rosemary lyophilized extract (RLE in chicken burger, for assess their ability to reduce the lipid oxidation. Total antioxidant capacity and phenolic compounds profile were analyzed by colorimetric tests and liquid chromatography analysis, respectively. Thiobarbituric acid reactive substances assay was used to evaluate the ability of the RLE to prevent lipid peroxidation in chicken burger stored at 4 °C. Three treatments of chicken burgers were prepared (T1 – control, without addition of synthetic antioxidant BHT: butylated hydroxytoluene or RLE, T2 – with addition of BHT, and T3 – experimental, containing RLE. The high contents of total phenolic compounds (40.91 mg GAE g-1: Gallic Acid Equivalent and total flavonoids (24.26 mg QE g-1: Quercetin Equivalents were found in RLE. Rutin was the major phenolic compound identified in the RLE. The RLE showed strong antioxidant capacity and inhibited 48.29% of lipid oxidation (21 days of storage in comparison to the control (T1, with low production of malonaldehyde, which has potential to be used in chicken burgers.

  16. Combined effects of gamma irradiation and rosemary extract on the shelf-life of a ready-to-eat hamburger steak

    Energy Technology Data Exchange (ETDEWEB)

    Lee, J.W.Ju-Woon; Park, K.S.Kyung-Sook; Kim, J.G.Jong-Goon; Oh, S.H.Sang-Hee; Lee, Y.S.You-Seok; Kim, J.H.Jang-Ho; Byun, M.W.Myung-Woo. E-mail: mwbyun@nanum.kaeri.re.krmwbyun@kaeri.re.kr

    2005-01-01

    To evaluate the effects of the combined treatment of gamma irradiation and rosemary extract powder (rosemary) for improving the quality of a ready-to-eat hamburger steak by changing the storage condition from frozen (-20 deg. C) to a chilled temperature (4 deg. C), an accelerated storage test was carried out. The hamburger steak was prepared with 200 or 500 ppm of rosemary, or 200 ppm of butylated hydroxyanisole by a commercially used recipe, gamma irradiated at absorbed doses of 5.0, 10.0 and 20.0 kGy, and stored at 30 deg. C. From the microbiological aspect, irradiation at 20 kGy or a higher dose was needed to inactivate the normal microflora. Little effect of the antioxidant was, if any, observed. Thiobarbituric acid values were not very different during storage regardless of the irradiation dose and the addition of the antioxidant. Textural and sensory results were also not significantly different in all the samples.

  17. Combined effects of gamma irradiation and rosemary extract on the shelf-life of a ready-to-eat hamburger steak

    International Nuclear Information System (INIS)

    Lee, J.W.Ju-Woon; Park, K.S.Kyung-Sook; Kim, J.G.Jong-Goon; Oh, S.H.Sang-Hee; Lee, Y.S.You-Seok; Kim, J.H.Jang-Ho; Byun, M.W.Myung-Woo.

    2005-01-01

    To evaluate the effects of the combined treatment of gamma irradiation and rosemary extract powder (rosemary) for improving the quality of a ready-to-eat hamburger steak by changing the storage condition from frozen (-20 deg. C) to a chilled temperature (4 deg. C), an accelerated storage test was carried out. The hamburger steak was prepared with 200 or 500 ppm of rosemary, or 200 ppm of butylated hydroxyanisole by a commercially used recipe, gamma irradiated at absorbed doses of 5.0, 10.0 and 20.0 kGy, and stored at 30 deg. C. From the microbiological aspect, irradiation at 20 kGy or a higher dose was needed to inactivate the normal microflora. Little effect of the antioxidant was, if any, observed. Thiobarbituric acid values were not very different during storage regardless of the irradiation dose and the addition of the antioxidant. Textural and sensory results were also not significantly different in all the samples

  18. Watson's theorem and resonant pion photoproduction amplitude in the delta channel

    International Nuclear Information System (INIS)

    Wittman, R.; Davidson, R.; Mukhopadhyay, N.C.

    1984-01-01

    The CGLN and BL theories of the pion photoproduction on nucleons, used in nuclear calculations, are examined regarding their predictions of the resonant M 1 + and E 1 + multipoles. The nonunitary BL approach violates Watson's theorem, and predicts these multipoles porly. In the static limit, the CGLN multipoles satisfy Watson's theorem and are in fine agreement with data. The unitarized BL multipoles agree with those from the Olsson theory and data. (orig.)

  19. Effect of methanol extracts of rosemary and olive vegetable water on the stability of olive oil and sunflower oil

    Directory of Open Access Journals (Sweden)

    Gamel, T. H.

    1999-10-01

    Full Text Available Effect of methanol extracts of rosemary and olive vegetable water on the stability of olive oil and sunflower oil. Methanol phenolic extracts of dry rosemary leaves and olive vegetable water filtrate, in combination with BHA, were added to olive oil (blend of refined and virgin olive oil, 3 to 1 and to sunflower oil and their antioxidant effects under accelerated conditions were evaluated. Accelerated conditions included the oven test (at 63 °C and the conductivity method (Rancimat at 120 °C. Frying process at 180 °C was also applied. The methanol phenolic extracts and the BHA were added to each oil at the following concentrations: 200 ppm rosemary extract; 200 ppm olive vegetable water extract; 100 ppm rosemary extract + 100 ppm BHA; 100 ppm vegetable water extract + 100 ppm BHA and 200 ppm BHA. In general, antioxidant effect of phenolic additives of rosemary and of BHA was in the following order: 200 ppm rosemary extract > 100 ppm rosemary extract + 100 ppm BHA > and 200 ppm BHA. The addition of 200 ppm vegetable water extract and 100 ppm vegetable water extract + 100 ppm BHA exhibited similar antioxidant effect to that of 200 ppm BHA.

    Extractos metanólicos de fenoles de hojas secas de romero y filtrados de agua de vegetación de la aceituna, en combinación con BHA, se añadieron al aceite de oliva (mezcla de aceite de oliva refinado y virgen, 3 a 1 y al aceite de girasol, evaluándose sus efectos antioxidantes usando condiciones aceleradas. Estas condiciones incluyeron el test del horno de oxidación (a 63 °C y el método de conductividad (Rancimat a 120 °C. También se aplicó al proceso de fritura a 180 °C. Los extractos metanólicos de fenoles y el BHA se añadieron a cada aceite en las siguientes concentraciones: 200 ppm de extracto de romero, 200 ppm de extracto de agua de vegetación de la aceituna, 100 ppm de extracto de romero + 100 ppm de BHA, 100 ppm de extracto de agua de vegetación + 100 ppm de BHA y 200 ppm de BHA

  20. The Antioxidant Capacity of Rosemary and Green Tea Extracts to Replace the Carcinogenic Antioxidant (BHA in Chicken Burgers

    Directory of Open Access Journals (Sweden)

    Manoela A. Pires

    2017-01-01

    Full Text Available The present study aimed to evaluate the effect of natural extracts (rosemary and green tea extracts in frozen storage of chicken burgers. Chicken burger treatments were prepared as follows: control (CON, 20 mg BHA/kg (BHA20, 10 mg green tea extract/kg (GT10, 38 mg green tea extract/kg (GT38, 18.6 mg rosemary extract/kg (RO18, and 480 mg rosemary extract/kg (RO480. Analysis of physicochemical parameters, color, TBAR index, and sensory acceptance were performed at 0, 30, 60, and 120 days of storage at −18°C in burgers packaged in LDPE plastic bags. The addition of natural antioxidants did not affect (p>0.05 the color and physicochemical parameters of the chicken burgers. After 120 days at −18°C, the RO480 sample showed a TBAR index similar (p>0.05 to BHA20 (0.423 and 0.369 mg, resp.. Sensory acceptance did not differ (p>0.05 among the treatments throughout the storage period (p>0.05.

  1. The effect of applying different water levels and irrigation frequencies in propagating rosemary (Rosmarinus officinalis L.

    Directory of Open Access Journals (Sweden)

    Javier Giovanni Álvarez Herrera

    2010-01-01

    Full Text Available Rosemary seedlings are obtained by vegetative propagation because the seeds present low viability. Despite being an expanding crop, there is little information on water consumption during the propagation stage. Water levels and irrigation frequencies were therefore applied using a completely randomised design having a 4 x 2 factorial arrangement. The first factor concerned irrigation frequency (4 and 8 days and the second concerned water level (0.6, 0.8, 1.0 and 1.2 evaporation inside the greenhouse. A 1.0 coefficient combined with 4-day irrigation frequency presented the best results regarding height (39.3 cm, fresh weight, dry weight and branch length (146 cm. Water level affected the fresh and dry weight of leaves regardless of frequency. Relative water content in leaves did not present differences due to environmental conditions minimising treatment effect. Rooting percent- tage showed no significant differences regarding irrigation frequency or water level. Irrigation frequency did not affect rosemary growing pattern because sphagnum retains high moisture content. The best branch number (34 was obtained with 1.0 coefficient and 4-day frequency, this being important from the production point of view because this is the material which is sold. Water management changes photoassimilate distribution in rosemary plants.

  2. Control of Passion Fruit Fungal Diseases Using Essential Oils Extracted from Rosemary (Rosmarinus officinalis) and Eucalyptus (Eucalyptus agglomerata) in Egerton University Main Campus Njoro, Kenya.

    Science.gov (United States)

    Waithaka, Paul Njenga; Gathuru, Eliud Mugu; Githaiga, Benson Muriuki; Kimani, Salome Nduta

    2017-01-01

    Growth of fruits which form an important part of human diet has been jeopardized by the many fungal diseases that are present today. This study was conceived to isolate the most common fungal pathogens in passion fruits. Fungi were isolated using potato dextrose agar in addition to characterization using morphological, cultural, and biochemical means. Extraction of essential oils from rosemary ( Rosmarinus officinalis ) and eucalyptus ( Eucalyptus agglomerata ) was done. Before carrying the sensitivity test of essential oils to the fungal isolates, constituents of the essential oils were determined. The most common fungal pathogens isolated from passion fruits were Alternaria spp. (45%), Fusarium spp. (22%), Colletotrichum spp. (17%), and Penicillium spp. (16%). There was a relationship between heating time and yield of essential oils in rosemary ( r = 0.99) and eucalyptus ( r = 0.99). Conversely, there was no significant difference in the amount of essential oils produced by rosemary and eucalyptus ( P = 0.08). Furthermore, there was a significant difference in growth inhibition of the fungal pathogens between essential oils from rosemary and eucalyptus ( P = 0.000438). Fungal pathogens isolated from passion fruits can be controlled using essential oils from rosemary and eucalyptus. The oils need to be produced in large scale.

  3. Comparative Phenolic Fingerprint and LC-ESI+QTOF-MS Composition of Oregano and Rosemary Hydrophilic Extracts in Relation to their Antibacterial Effect

    Directory of Open Access Journals (Sweden)

    Florina Bunghez

    2015-05-01

    Full Text Available Rosemary (Rosmarinus officinalis and oregano (Origanum vulgare are known aromatic plants used as spice, with good flavoring, preservative, antioxidant and antibacterial activity. Beside their known terpenoid content responsible for the antibacterial activity, the water-soluble compounds (phenolic derivatives are of high interest not only for their antioxidant activity but as a good alternative or as a hydrophilic new antibacterial solution. Two hydrophilic extracts from each plant were obtained (15% plant in hot water and the phytochemicals were fingerprinted by UV-Vis and FTIR spectrometry and quantified. The total phenolic content was higher in case of oregano (54.2 mg GAE/g DW comparing to rosemary (54.25 vs 15.35 mg GAE/g dry matter. By LC-ESI+QTOF-MS analysis there were identified mainly, in both extracts, flavonoid and diterpene derivatives, mainly carnosol, carnosic acid, rosmarinic acid, kaempferol 3-O-glucuronide. Other flavonoid glucuronides were more specific to one or the other plant, e.g. Luteolin 3'-(4''-acetylglucuronide for rosemary and Apigenin 7-O-glucuronide for oregano. Water favorized increased extraction of flavonoid derivatives and soluble diterpenes, but not non-soluble  terpenes. The antibacterial activity of both extracts was tested against B.cereus, L. monocytogenes, Salmonella, S. aureus and E.coli. Both oregano and rosemary extracts showed a slight antibacterial activity, which can be related to the low concentration of terpenoids, known to have the most important antibacterial activity in these plants. Nevertheless, the antibacterial activity seems to be strain dependent, Bacillus cereus being the most sensitive bacterial strain comparing with the other four bacteria, the oregano extract having a slightly superior activity comparing to the rosemary extract.

  4. Watson's behaviorism: a comparison of the two editions (1925 and 1930).

    Science.gov (United States)

    Carpintero, Helio

    2004-05-01

    J.B. Watson's Behaviorism, a complete presentation of the mature psychological points of view of its author, had 2 editions, in 1925 and 1930, which presented significant differences in their texts. Although Watson maximized such variations, to the point of considering the 2nd edition as nearly a brand-new book, both suppressions and additions reveal his feelings when presenting his ideas to a general audience. Such variations are here presented through an in-depth analysis.

  5. Watson will see you now: a supercomputer to help clinicians make informed treatment decisions.

    Science.gov (United States)

    Doyle-Lindrud, Susan

    2015-02-01

    IBM has collaborated with several cancer care providers to develop and train the IBM supercomputer Watson to help clinicians make informed treatment decisions. When a patient is seen in clinic, the oncologist can input all of the clinical information into the computer system. Watson will then review all of the data and recommend treatment options based on the latest evidence and guidelines. Once the oncologist makes the treatment decision, this information can be sent directly to the insurance company for approval. Watson has the ability to standardize care and accelerate the approval process, a benefit to the healthcare provider and the patient.

  6. A conversation with Geoff Watson

    OpenAIRE

    Beran, R. J.; Fisher, N. I.

    1998-01-01

    Geoffrey Stuart Watson, Professor Emeritus at Princeton University, celebrated his 75th birthday on December 3, 1996. A native Australian, his early education included Bendigo High School and Scotch College in Melbourne. After graduating with a B.A. (Hons.) from Melbourne University in December 1942, he spent the next few years, during and after World War II, doing research and teaching on applied mathematical topics. His wandering as a scholar began in 1947, when he became ...

  7. Effect of Vermicompost and Nitroxin on Vegetative Growth and some Biochemical Properties of Rosemary Herb (Rosmarinus officinalis L.

    Directory of Open Access Journals (Sweden)

    Farzaneh Nourbakhsh

    2017-02-01

    Full Text Available Introduction: Rosemary (Rosmarinus officinalis L. is a perennial, ever green and fragrant plant belongs to Lamiaceae family. Vegetative parts of this plant have essential oil and compounds with anti oxidant and antibacterial properties which are used extensively in pharmaceutical, food and cosmetic industries. The use of biofertilizers such as vermicompost and Nitroxin could have beneficial effect on production of rosemary by increasing the production of plant growth hormones and the availability of macro and micro nutrients in growing media. Materials and Methods: The effect of vermicompost and Nitroxin biofertilizers was investigated on growth, yield, the amounts of photosynthetic pigments, flavonoid, essential oil percentage and yield of rosemary. The experiment was based on a randomized complete block design with two factors, including vermicompost (0, 10, 20, 30 and 40% w/w and Nitroxin (inoculated and non-inoculated with Nitroxin with four replications. This research was done at Sari Agricultural Sciences and Natural Resources University, Sari, Iran, in 2012-2013. Uniform one-year old rooted rosemary cuttings were selected for this experiment. Before planting, rooted cuttings were treated in diluted Nitroxin solution in water (1:10 for 10 minutes. After planting, rosemary plants were fertilized twice by Nitroxin for every 45 days according to the producing company recommendation. During growth period, irrigation was done according to plants requirement. At the end of experiment, parameters such as plant height, shoot fresh and dry weight, root dry weight, chlorophyll a, total chlorophyll, leaf flavonoid and essential oil yield were measured. Data was analyzed using standard analysis of variance (ANOVA using the general linear models procedure of SAS, (version 9.1; SAS Institute, Cary, N.C.. Differences among means were tested by least significant difference (LSD (p ≤ 0.05. Results and Discussion: Obtained results showed that the

  8. The effect of the essential oils of lavender and rosemary on the ...

    African Journals Online (AJOL)

    O.V. Filiptsova

    a b s t r a c t. The research results of the effect of essential oils on the human short-term image and numerical memory ... the stimulating effects of the rosemary essential oil on the brain wave activity.2 ..... gender and ethnicity on children's attitudes and preferences for essential oils: a ... CG,: Bpl-do «Gbnep», 2000. – 560 c ...

  9. Predicting the Mechanism and Kinetics of the Watson-Crick to Hoogsteen Base Pairing Transition

    NARCIS (Netherlands)

    Vreede, J.; Bolhuis, P.G.; Swenson, D.W.H.

    2016-01-01

    DNA duplexes predominantly contain Watson-Crick (WC) base pairs. Yet, a non-negligible number of base pairs converts to the Hoogsteen (HG) hydrogen bonding pattern, involving a 180° rotation of the purine base relative to Watson-Crick. These WC to HG conversions alter the conformation of DNA, and

  10. Lipid Oxidation, Color Changes, and Microbiological Quality of Frozen Beef Burgers Incorporated with Shirazi Thyme, Cinnamon, and Rosemary Extracts

    Directory of Open Access Journals (Sweden)

    Hadi Hashemi Gahruie

    2017-01-01

    Full Text Available In this study, the oxidative stability of beef burgers incorporated with Shirazi thyme, cinnamon, and rosemary extracts was compared with that of BHT-incorporated and antioxidant-free samples. The chemical composition, TBARS, metmyoglobin, pH, color, and microbial and sensory characteristics were evaluated during storage at −18°C for 2 months. The results indicated that Shirazi thyme and cinnamon extracts did not change the colorimetric properties significantly (P BHT > Shirazi thyme > rosemary > control. Finally, the results showed that these plant extracts can be utilized as an alternative to synthetic antioxidants in formulation of burgers.

  11. Conformational analysis of a covalently cross-linked Watson-Crick base pair model.

    Science.gov (United States)

    Jensen, Erik A; Allen, Benjamin D; Kishi, Yoshito; O'Leary, Daniel J

    2008-11-15

    Low-temperature NMR experiments and molecular modeling have been used to characterize the conformational behavior of a covalently cross-linked DNA base pair model. The data suggest that Watson-Crick or reverse Watson-Crick hydrogen bonding geometries have similar energies and can interconvert at low temperatures. This low-temperature process involves rotation about the crosslink CH(2)C(5') (psi) carbon-carbon bond, which is energetically preferred over the alternate CH(2)N(3) (phi) carbon-nitrogen bond rotation.

  12. Elementary? Question Answering, IBM's Watson, and the Jeopardy ...

    Indian Academy of Sciences (India)

    IAS Admin

    One of the most readable accounts of early AI systems, including. NLP systems, may be .... tions of these questions to annotations of information segments in ..... Watson as a decision-aide rather than as a decision-maker will be a safe step ...

  13. Relativistic generalisation of the Kroll-Watson formula

    International Nuclear Information System (INIS)

    Kaminski, J.Z.

    1985-01-01

    The relativistic analogue of the space-translation method is derived. Using this method the generalisation of the Kroll-Watson formula [1973, Phys. Rev. A. 8 804] is obtained for the scattering of an arbitrary charged particle (e.g. mesons, hyperons, quarks, etc). The separation of the background and resonant parts of the scattering amplitude is predicted. (author)

  14. Conformational Analysis of a Covalently Cross-Linked Watson-Crick Base Pair Model

    OpenAIRE

    Jensen, Erik A.; Allen, Benjamin D.; Kishi, Yoshito; O'Leary, Daniel J.

    2008-01-01

    Low temperature NMR experiments and molecular modeling have been used to characterize the conformational behavior of a covalently cross-linked DNA base pair model. The data suggest that Watson-Crick or reverse Watson-Crick hydrogen bonding geometries have similar energies and can interconvert at low temperatures. This low-temperature process involves rotation about the crosslink CH2–C(5′) (ψ) carbon-carbon bond, which is energetically preferred over the alternate CH2–N(3) (ϕ) carbon-nitrogen ...

  15. A comparative study of the second-order Born and Faddeev-Watson approximations for electron-atom collisions

    International Nuclear Information System (INIS)

    Fargher, H.E.; Roberts, M.J.

    1983-01-01

    Simplified versions of the second-order Born and Faddeev-Watson approximations are applied to the excitation of the n=2 levels of atomic hydrogen by the impact of 54.4 eV electrons. The theories are compared with the measurements of differential cross sections and angular correlation parameters. The results indicate that the Born approximation is better at low angles of scattering but that the Faddeev-Watson approximation is better at high angles. The importance of the phases of the two-body T matrices in the Faddeev-Watson approximation is illustrated. (author)

  16. Oxidative stability of chilled broiler breast meat as affected by?dietary supplementation with rosemary (Rosmarinus officinalis L.) powder and vitamin E

    OpenAIRE

    Rostami, Hossein; Seidavi, Alireza; Dadashbeiki, Mohammad; Asadpour, Yadollah; Sim?es, Jo?o; Laudadio, Vito; Milis, Chrysostomos; Tufarelli, Vincenzo

    2017-01-01

    Abstract The aim of the present study was to evaluate the effect of rosemary (Rosmarinus officinalis L.) powder and vitamin E, as feed additives combined at different levels, on oxidative stability of broiler meat up to 14th day after chilling. A total of 270 1?day?old male chicks of Ross 308 strain were randomly assigned to nine dietary groups with three replicates having 10 birds each. Diets were supplemented with 0, 0.5, or 1.0% of rosemary (R) powder and 0, 100, or 200?mg/kg of vitamin E ...

  17. Dietary supplementation of garlic and rosemary: effects on colour stability and lipid oxidation in lamb meat

    Directory of Open Access Journals (Sweden)

    M. Scafizzari

    2010-01-01

    Full Text Available The colour of fresh meat is an important criterion consumers take into consideration when purchasing meat. Meat colour depends on the occurrence of chemical and microbial deterioration processes. The role of vitamin E and other antioxidants on ruminant meat colour stability and prevention of lipid oxidation has been widely investigated (Macit et al., 2003; Realini et al., 2004. Many natural herbs and plant extracts exert antioxidant effects such as garlic (Yin and Cheng, 2003 and rosemary (Sánchez-Escalante et al., 2001. Their use as additives for animal feeding may be a valid alternative to synthetic antioxidants since they show beneficial effects also on animal welfare and other physiological functions (Tedesco, 2001. The aim of this study was to evaluate whether garlic and rosemary dietary supplementation as compared with vitamin E affects lamb meat colour and lipid stability during storage.

  18. In vitro uptake and immune functionality of digested Rosemary extract delivered through food grade vehicles.

    Science.gov (United States)

    Arranz, E; Guri, A; Fornari, T; Mendiola, J A; Reglero, G; Corredig, M

    2017-07-01

    The digestion, absorption, uptake and bioavailability of a rosemary supercritical fluid extract encapsulated in oil in water emulsion were studied. Two emulsions with opposite surface charge were prepared, containing 7% canola oil, and either 2% lactoferrin or whey protein isolate. When absorption and uptake of carnosic acid and carnosol were followed on Caco-2 cell monolayers, there were no differences with protein type. However, when co-cultures of HT-29 MTX were employed, the presence of mucus caused a higher retention of carnosic acid in the apical layer for lactoferrin emulsions. The immune activity of the bioavailable fractions collected from cell absorption experiments was tested ex vivo on murine splenocytes. Although transport through the intestinal barrier models was low, the bioavailable fractions showed a significant effect on splenocytes proliferation. These results demonstrated the potential of using rosemary supercritical extract through protein stabilized oil in water emulsions, as a food with immunomodulatory functionality. Copyright © 2017 Elsevier Ltd. All rights reserved.

  19. Effect of Rosemary Transglutaminase on Yoghurt Fortified with Whey Protein Isolate

    Directory of Open Access Journals (Sweden)

    Ibrahim Osama

    2017-12-01

    Full Text Available Rosemary (Rosmarinus officinalis L. transglutaminase (RTGase was used to cross-link whey protein isolate (WPI and its ability to induce gelation was investigated. The rheological and textural properties of WPI were improved with RTGase treatment. Set-type yoghurts fortified with 1% WPI powder treated with RTGase at the level of 2.5 and 10 unit/g protein were studied. Chemical, rheological, textural and organoleptic properties of the yoghurt treated with RTGase were better than these of the control yoghurt.

  20. Oxidative stability of chicken’s breast after vacuum packaging, EDTA, sage and rosemary essential oils treatment

    Directory of Open Access Journals (Sweden)

    Adriana Pavelková

    2016-07-01

    Full Text Available In the present work, the effect of the sage and rosemary essential oils on oxidative stability of chicken breast muscles during chilled storage was investigated. In the experiment were chickens of hybrid combination Cobb 500 after 42 days of the fattening period slaughtered.  All the broiler chickens were fed with the same feed mixtures and were kept under the same conditions. The feed mixtures were produced without any antibiotic preparations and coccidiostats. After slaughtering was dissection obtained fresh chicken breast with skin from left half-carcass, which were divided into five groups (n = 5: C - control air-packaged group; A1 - vacuum-packaged experimental group; A2 - vacuum-packaged experimental group with EDTA solution 1.50% w/w; A3 - vacuum-packaged experimental group with Salvia officinalis L. oil 2.0% v/w and A4 - vacuum-packaged experimental group with Rosmarinus officinalis L. essential oil 2.0% v/w. The sage and rosemary essential oils were applicate on surface chicken breasts and immediately after dipping, each sample was packaged using a vacuum packaging machine and storage in refrigerate at 4  ±0.5 °C. The value of thiobarbituric acid (TBA expressed as amount of malondialdehyde (MDA in 1 kg sample was measured during storage in 1st, 4th, 8th, 12th and 16th day. The treatments of chicken breasts with sage and rosemary essential oils show statistically significant differences between all testing groups and control group, where higher average value of MDA measured in breast muscle of broiler chickens was in samples of control group (0.396 mg.kg-1 compared to experimental groups A1 (0.060 mg.kg-1, A2 (0.052 mg.kg-1, A3 (0.042 mg.kg-1 and A4 (0.041 mg.kg-1 after 16-day of chilled storage. The results of experiment showed that the treatment of chicken breast with sage and rosemary essential oils had positive effect on the decrease of oxidative processes in breast muscles during chilling storage and use of plant essential oils

  1. Protective Effect of Rosemary (Rosmarinus Officinalis Extract on Naphthalene Induced Nephrotoxicity in Adult Male Albino Rat

    Directory of Open Access Journals (Sweden)

    Neveen M. El-Sherif

    2015-02-01

    Full Text Available Background: Naphthalene (NA is a common environmental contaminant and is abundant in tobacco smoke. Rosemary (Rosmarinus officinalis is a herb commonly used as a spice and flavoring agents in food processing and is useful in the treatment of many diseases. Aim of the work: To study the nephrotoxicity of NA and to evaluate the possible protective role of rosemary extract in adult male albino rat. Materials and Methods: 25 animals were divided into three groups: Group I (Control group, Group II (NA treated group received NA at a dose of 200 mg/kg/day dissolved in 5 ml/kg corn oil orally by gastric tube, Group III (protected group received rosemary extract (10 ml/kg/day followed after 60 min by NA at the same previous dose orally by gastric tube. The experiment lasted 30 days. The following parameters were studied: Biochemical assessment of renal function, histological, immunohistochemical, morphometric studies and statistical analysis of the results. Results: NA treatment resulted in a highly significant increase in the mean values of serum urea and creatinine. NA induced histological changes in the form of glomerular congestion. Some glomeruli demonstrated marked mesangial expansion and hence that Bowman's spaces were almost completely obliterated. Shrinkage of renal glomeruli with widening of Bowman's spaces could also be seen. Focal tubular dilatation with appearance of casts inside the tubules was observed. Congested peritubular blood vessels and interstitial hemorrhage were also seen. The medullary region demonstrated vascular congestion and fibrosis. Focal cellular infiltration was presented in the interstitium. The renal cortex of NA treated rats showed a noticeable down regulation in alkaline phosphatase positive immunoreactive cells in some proximal convoluted tubules. NA induced up regulation of positive immunoreaction for inducible nitric oxide synthase in the proximal and distal convoluted tubules as well as in the collecting tubules

  2. First a hero of science and now a martyr to science: the James Watson Affair - political correctness crushes free scientific communication.

    Science.gov (United States)

    Charlton, Bruce G

    2008-01-01

    In 2007 James D. Watson, perhaps the most famous living scientist, was forced to retire from his position and retreat from public life in the face of international mass media condemnation following remarks concerning genetically-caused racial differences in intelligence. Watson was punished for stating forthright views on topics that elite opinion has determined should be discussed only with elaborate caution, frequent disclaimers, and solemn deference to the currently-prevailing pieties. James Watson has always struck many people as brash; however this blunt, truth-telling quality was intrinsic to his role in one of the greatest scientific discoveries. Much more importantly than 'good manners', Watson has consistently exemplified the cardinal scientific virtue: he speaks what he understands to be the truth without regard for the opinion of others. The most chilling aspect of the Watson Affair was the way in which so many influential members of the scientific research community joined the media condemnation directed against Watson. Perhaps the most egregious betrayal of science was an article by editorialists of the premier UK scientific journal Nature. Instead of defending the freedom of discourse in pursuit of scientific truth, Nature instead blamed Watson for being 'crass' and lacking 'sensitivity' in discussing human genetic differences. But if asked to choose between the 'sensitive' editors of Nature or the 'crass' genius of James D. Watson, all serious scientists must take the side of Watson. Because when a premier researcher such as Watson is hounded from office by a vicious, arbitrary and untruthful mob; all lesser scientists are made vulnerable to analogous treatment at the whim of the media. A zealous and coercive brand of 'political correctness' is now making the biological truth of human genetic differences intolerably difficult to discover and discuss in US and UK. This needs to change. My hope is that truth will prevail over political correctness and

  3. The form of electron-atom excitation amplitudes at high momentum transfers in the Faddeev-Watson approximation

    International Nuclear Information System (INIS)

    Catalan, G.; Roberts, M.J.

    1979-01-01

    A form of the off-shell Coulomb T matrix, which has a well defined on-shell limit, is used in the Faddeev-Watson multiple-scattering expansion for a direct three-body collision process. Using the excitation of atomic hydrogen by electron impact as an example, approximations to the second-order terms, which are valid for high momentum transfers of the incident electron, are derived. It is shown how the resulting asymptotic behaviour of the second-order Faddeev-Watson approximation is related to the high momentum transfer limit of the second Born approximation. The results are generalised to the excitation of more complex atoms. The asymptotic forms of the Faddeev-Watson and Born approximations are compared with other theories and with measurements of differential cross sections and angular correlation parameters for the excitation of H(2p) and He(2 1 P). The results indicate that the Faddeev-Watson approximation converges more rapidly at high momentum transfers than does the Born approximation. (author)

  4. Antioxidant and pro-oxidant factors in oregano and rosemary gourmet olive oils

    Directory of Open Access Journals (Sweden)

    Tsimidou, Maria

    2001-08-01

    Full Text Available The study was carried out to examine the presence of antioxidants and pro-oxidants in oregano and rosemary gourmet oils. Dry, ground plant material (5% w/w was infused to olive oil for 24, 48 and 72 hours and then it was removed by filtration. All preparations were found acceptable using a panel test. The total polar phenol content increased 3.5 and 1.7 times in oregano and rosemary gourmet oils with respect to that of the control sample. A qualitative enrichment of the methanol:water fraction of olive oil with phenolic compounds from herbs were found using HPLC. No rosmarinic acid was detected in the gourmet oils. Vanillic acid was only found in the rosemary gourmet oil. The presence of flavonoids was assessed using TLC. a-Tocopherol content of the oil matrix was not changed after herb infusion. A significant increase was found in pheophytin, a,b-carotene and lutein content of oregano flavoured oils. The oxidative stability of gourmet oils was greater to that of the control using the Rancimat test. In photo-oxidation, oregano flavoured oil was less stable than the rosemary one. Total chlorophyll content may be a critical factor for the shelf life of these preparations. Suitable labelling suggesting avoidance of light may be useful for a safe domestic use.El estudio fue realizado para examinar la presencia de antioxidantes y pro-oxidantes en aceites de oliva con aroma a orégano y romero. El material vegetal seco y molido se añade al aceite de oliva en proporción (5% w/w durante 24, 48 y 72 horas y posteriormente se elimina por filtración. Todas las preparaciones se encontraron aceptables usando un panel de catadores. El contenido de fenoles polares totales aumentó 3,5 y 1,7 veces, en aceites con aroma a orégano y romero, con respecto al de las muestras control. Un enriquecimiento cualitativo de la fracción metanol: agua del aceite de oliva, con compuestos fenólicos de las hierbas, se encontró usando HPLC. No se detectó

  5. O pensamento em Watson: rompendo com o legado metafísico e buscando uma referência materializante

    Directory of Open Access Journals (Sweden)

    Cláudio Ivan de Oliveira

    Full Text Available O trabalho de Watson sobre o pensamento foi tratado inadequadamente por muitos intérpretes, gerando uma lacuna na interpretação histórica visto que Watson exerceu ampla influência sobre a Psicologia. Nosso objetivo é sanar parte deste problema esclarecendo as principais posições de Watson sobre pensamento. Nossa hipótese é que a teoria watsoniana sobre o pensamento como hábito é uma forma de referencialização materializante influenciada pela desmetafisicização do pensamento Ocidental proveniente do Iluminismo. Admitimos que a teoria de Watson reproduziu premissas do erro de categoria cartesiano. Assumimos também que a prioritária associação entre pensamento e linguagem watsoniana denuncia influências indiretas da tradição filosófica grega clássica.

  6. A comparative study of the second-order Born and Faddeev-Watson approximations: Pt. 3

    International Nuclear Information System (INIS)

    Roberts, M.J.

    1988-01-01

    Singularities which arise in the second-order Born and Faddeev-Watson approximations for ionisation processes are examined. A regularisation procedure for the latter is suggested. Comparison with He(e,2e)He + experimental data in symmetric coplanar energy-sharing kinematics shows that the second-order Faddeev-Watson approximation is inferior to the second Born results of Byron et al. (1985. J. Phys. B: At. Mol. Phys. 18, 3203). (author)

  7. Characterization of two genes for the biosynthesis of abietane-type diterpenes in rosemary (Rosmarinus officinalis) glandular trichomes

    NARCIS (Netherlands)

    Brückner, K.; Bozic, D.; Manzano, D.; Papaefthimiou, D.; Pateraki, I.; Scheler, U.; Ferrer, A.; Vos, de R.C.H.; Kanellis, A.K.; Tissier, A.

    2014-01-01

    Rosemary (Rosmarinus officinalis) produces the phenolic diterpenes carnosic acid and carnosol, which, in addition to their general antioxidant activities, have recently been suggested as potential ingredients for the prevention and treatment of neurodegenerative diseases. Little is known about the

  8. The Game is aFoot, Watson: DeepQA systems and the future of HCI

    OpenAIRE

    Keates, Simeon; Varker, Philip

    2012-01-01

    In February 2011, the IBM Watson DeepQA (deep question and answer) system took part in a special challenge, pitting its question and answer capability against former Jeopardy!TM grand champions in a televised match. Watson emerged victorious from the challenge, demonstrating that current question answering technology has advanced to the point where it can arguably be more dependable than human experts. This new system represents a significant breakthrough in humanity’s decades-long endeavour ...

  9. A comment on Watson, Deary, and Austin and Watson, Roberts, Gow, and Deary : How to investigate whether personality items form a hierarchical scale?

    NARCIS (Netherlands)

    Meijer, Rob R.

    I comment on two recent papers by Watson et al. (2007, 2008) who investigated whether personality items form a hierarchical scale. I discuss that the methods they used are inappropriate and discuss alternative methods presented in the literature. (C) 2009 Elsevier Ltd All rights reserved..

  10. Rosemary and Pitanga Aqueous Leaf Extracts On Beef Patties Stability under Cold Storage

    Directory of Open Access Journals (Sweden)

    Flávia Carolina Vargas

    Full Text Available ABSTRACT Because processing and storage conditions affect several beef quality attributes, the food industry uses a variety of synthetic antioxidants. However, some synthetic antioxidants have been questioned regarding its safety, and thus the interest in using natural antioxidants in food products is increasing. This paper aimed at assessing leaf aqueous extracts of Rosemary (Rosmarinus officinalis Linnaeus and Pitanga (Eugenia uniflora Linnaeus as antioxidants in beef cold storage. After 48h storage, patties added of Rosemary leaf extracts showed increased pH. Patties added of Pitanga extracts had the lowest a* color values. Oxymyoglobin levels were significantly higher for Negative control, than for Pitanga treatment. The 10% extract addition increased lipid oxidation of beef patties. Correlation coefficients between lipid and myoglobin oxidations were all above 0.85. Pitanga leaf extracts negatively influenced beef color, probably because of its higher chlorophyll content. Lipid oxidation of beef patties was increased with the addition of leaf extracts. The inclusion of 10% leaf extract into beef patties seems not suitable, because it may enhance the amount of prooxidant compounds, as well as the amount of substances capable of reacting with lipid secondary products. Correlations between lipid and myoglobin oxidations demonstrated strong relationship.

  11. Introduction of distillate rosemary leaves into the diet of the Murciano-Granadina goat: transfer of polyphenolic compounds to goats' milk and the plasma of suckling goat kids.

    Science.gov (United States)

    Jordán, Maria José; Moñino, María Inmaculada; Martínez, Cristina; Lafuente, Arturo; Sotomayor, José Antonio

    2010-07-28

    The effect of the introduction of distilled rosemary leaves into the diet of the Murciano-Granadina goat on the polyphenolic profile of the goats' milk during the physiological stages of gestation and lactation was studied. The inclusion of rosemary leaves into the animal diet modified neither animal productivity (milk yield) nor milk quality. The following components were found in increased concentration (P goats' milk after the introduction of rosemary leaves into their diet: flavonoids hesperidin, naringin, and genkwanin; gallic acid; and phenolic diterpenes carnosol and carnosic acid. With regard to the transfer of polyphenols to the plasma of the suckling goat kid, a statistically significant increase (P goats' milk and allow for an increased concentration of polyphenolic components in the goats' milk and in the plasma of the suckling goat kid.

  12. Fit for Practice: Analysis and Evaluation of Watson's Theory of Human Caring.

    Science.gov (United States)

    Pajnkihar, Majda; McKenna, Hugh P; Štiglic, Gregor; Vrbnjak, Dominika

    2017-07-01

    The aim of the authors of this paper is to analyze Watson's theory of human caring for its usefulness and worth in education, practice, and research. The reason for undertaking this analysis is to evaluate if Watson's theory would be useful for nursing in those countries where such theories were not an established part of the nursing curriculum. Furthermore, in some European countries, their political past or cultural influences led to an unquestioned adoption of the biomedical model. As their political culture changes, many social structures have had to be revisited, and for nursing, this has meant the introduction of theoretical reasoning, teaching, and practice.

  13. Watson-Crick hydrogen bonding of unlocked nucleic acids

    DEFF Research Database (Denmark)

    Langkjær, Niels; Wengel, Jesper; Pasternak, Anna

    2015-01-01

    We herein describe the synthesis of two new unlocked nucleic acid building blocks containing hypoxanthine and 2,6-diaminopurine as nucleobase moieties and their incorporation into oligonucleotides. The modified oligonucleotides were used to examine the thermodynamic properties of UNA against unmo...... unmodified oligonucleotides and the resulting thermodynamic data support that the hydrogen bonding face of UNA is Watson-Crick like....

  14. Watson, Skinner y Algunas Disputas dentro del Conductismo

    Directory of Open Access Journals (Sweden)

    RICARDO PELLÓN SUÁREZ DE PUGA

    2013-01-01

    Full Text Available Con motivo del primer centenario de la publicación del manifiesto conductista, se revisa brevemente la concepción de Watson (1913 sobre el aprendizaje y la conducta, y se extiende dicho análisis al conductismo de B. F. Skinner y a las disputas entre enfoques molares y moleculares en el análisis de la conducta.

  15. IBM Watson: How Cognitive Computing Can Be Applied to Big Data Challenges in Life Sciences Research.

    Science.gov (United States)

    Chen, Ying; Elenee Argentinis, J D; Weber, Griff

    2016-04-01

    Life sciences researchers are under pressure to innovate faster than ever. Big data offer the promise of unlocking novel insights and accelerating breakthroughs. Ironically, although more data are available than ever, only a fraction is being integrated, understood, and analyzed. The challenge lies in harnessing volumes of data, integrating the data from hundreds of sources, and understanding their various formats. New technologies such as cognitive computing offer promise for addressing this challenge because cognitive solutions are specifically designed to integrate and analyze big datasets. Cognitive solutions can understand different types of data such as lab values in a structured database or the text of a scientific publication. Cognitive solutions are trained to understand technical, industry-specific content and use advanced reasoning, predictive modeling, and machine learning techniques to advance research faster. Watson, a cognitive computing technology, has been configured to support life sciences research. This version of Watson includes medical literature, patents, genomics, and chemical and pharmacological data that researchers would typically use in their work. Watson has also been developed with specific comprehension of scientific terminology so it can make novel connections in millions of pages of text. Watson has been applied to a few pilot studies in the areas of drug target identification and drug repurposing. The pilot results suggest that Watson can accelerate identification of novel drug candidates and novel drug targets by harnessing the potential of big data. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

  16. Rosemary and oxygen scavenger in active packaging for prevention of high-pressure induced lipid oxidation in pork patties

    DEFF Research Database (Denmark)

    Bolumar Garcia, Jose Tomas; Lapena Gomez, David; Skibsted, Leif Horsfelt

    2016-01-01

    Three different packaging systems: vacuum packaging, rosemary active packaging, and oxygen scavenger packaging were compared for their ability to counteract lipid oxidation in pork patties upon storage at 5 °C for 60 days following high pressure processing (HPP) (700 MPa, 10 min, 5 °C). Lipid...... oxidation was studied at the surface and the inner part by measuring secondary lipid oxidation products (TBARs) and the tendency to form radicals by electron spin resonance (ESR) spectroscopy. Lipid oxidation was lower in the inner part than at the surface for all three packaging systems. Rosemary active...... packaging was the most effective method to protect pork patties from the HPP-induced lipid oxidation, while oxygen scavenger packaging was not effective since residual oxygen remained in the package in the initial period of storage. The kinetics of the oxygen trapping by oxygen scavengers appears...

  17. Inhibition of DNA virus: Herpes-1 (HSV-1 in cellular culture replication, through an antioxidant treatment extracted from rosemary spice

    Directory of Open Access Journals (Sweden)

    Dalva Assunção Portari Mancini

    2009-03-01

    Full Text Available This work aimed to evaluate antiviral properties in antioxidants from spices. Phenolic compounds extracted from rosemary (Rosmarinus officinallis, L by hot water, had their antioxidant activity determined by spectrophotometry using β carotene/linoleic acid system. The rosemary extract was evaluated by antiviral assay of Herpes Virus type-1 (HSV-1 replication in VERO cells, in the presence or absence of the spice. 10,000 TCID50/mL of the HSV-1 was kept for 3 h at 4º C, with 300 ppm of rosemary extract, and 100 ppm of butyl hydroxyl toluene (BHT. Then, these viruses were inoculated in VERO cells incubated at 37º C in CO2-5 %, for seven days. Daily, they were examined and the end point was based on 100% of CPE in virus control (without antioxidants. The HSV-1 replication inhibition percentage (IP measured the antiviral action from antioxidants, showing viral reductions of the 82.0, 82.5%, in the presence of rosemary and rosemary + BHT, respectively. As an extension, cell test corresponded to the similar viral decrease (IP = 85.0 and 86.3% in both aforementioned situations. Results lead to conclude that phenolic compounds from rosemary revealed an antiviral action on herpesvirus-1.Neste estudo foi avaliada a ação antiviral de antioxidantes de especiaria. Extrato aquoso de alecrim (Rosmarinus officinalis, L, que apresentou atividade antioxidante através de espectrofotometria usando o sistema β caroteno/ácido linoléico, foi avaliado em ensaios com vírus herpes-1 na replicação em células VERO. Nestes ensaios foram utilizados 10.000 TCID50%/mL do vírus HSV-1, mantidos em contato com 300 ppm do extrato de alecrim e com 100 ppm de butil hidroxi tolueno (BHT, durante 3h a 4°C. Esses vírus, em seguida, foram inoculados em células VERO incubadas a 37 °C/5% de CO2 por sete dias. Pelo efeito citopático (ECP e o "end point" de ECP do controle de vírus (sem antioxidante, foi possível observar que houve reduções na replicação viral de 82

  18. J. B. Watson y la Publicidad, los Inicios de la Psicología del Consumidor

    Directory of Open Access Journals (Sweden)

    FELIPE PARRADO CORREDOR

    2013-01-01

    Full Text Available La investigación del comportamiento de las personas frente a los productos y servicios se remonta a los inicios del siglo XX y J. B. Watson es uno de sus principales precursores. Watson ofreció un curso de psicología aplicada titulado Psicología de la Publicidad, introdujo en varias empresas las técnicas experimentales para el mercadeo de sus productos y, tras su retiro de la vida académica, se vinculó a la agencia de publicidad Walter Thompson, donde desarrolló campañas masivas con los mismos principios de las reacciones emocionales condicionadas. En este ensayo se expone la importancia del trabajo de Watson en la psicología de la publicidad, como precursor de los desarrollos científicos de la psicología del consumidor.

  19. Suitability of TBA method for the evaluation of the oxidative effect of non-water-soluble and water-soluble rosemary extracts.

    Science.gov (United States)

    Wada, Mitsuhiro; Nagano, Minori; Kido, Hirotsugu; Ikeda, Rie; Kuroda, Naotaka; Nakashima, Kenichiro

    2011-01-01

    The antioxidative effects of rosemary and grape-seed extracts spiked in human plasma were examined using the thiobarbituric acid (TBA) method. The TBA values of plasma spiked with reagents to generate reactive oxygen species, such as singlet oxygen ((1)O(2)), hydroxyl radicals ((·)OH), peroxynitrite (ONOO(-)), and superoxide anions (O(2)(·-)), were measured by a flow injection analysis method with fluorescence (FL) detection. TBA values obtained by the addition of 50 mg/mL of rosemary extracts for (1)O(2), (·)OH, ONOO(-), and O(2)(·-) increased to 964 ± 65%, 1063 ± 61%, 758 ± 78%, and 698 ± 41%, respectively (n = 3, P TBA-malondialdehyde, could be detected using wavelengths of 532 (λ(ex)) and 553 nm (λ(em)).

  20. Performing Transnational Arab American Womanhood: Rosemary Hakim, US Orientalism, and Cold War Diplomacy

    OpenAIRE

    Koegeler-Abdi, Martina

    2016-01-01

    The first Miss Lebanon-America, Rosemary Hakim, landed at Beirut Airport in July 1955 to start a public diplomacy tour. As an American beauty queen from Detroit visiting Lebanon, her parents' homeland, she was greeted enthusiastically by the local press and closely monitored by US government representatives. After her return to the States, she documented her experiences abroad in an unpublished memoir, entitled "Arabian Antipodes." However, this 1955 account does not just chronicle her travel...

  1. Annual Quality Assurance Conference Files by Nicola Watson and Rui Li

    Science.gov (United States)

    26th Annual Quality Assurance Conference. Abstract: An Innovative Water Management Device for Online and Canister-based Thermal Desorption of Trace-level VVOCs in High Humidity Ambient Air by Nicola Watson and Rui Li

  2. Interview with Mark Watson

    Directory of Open Access Journals (Sweden)

    Katy Shaw

    2016-04-01

    Full Text Available Mark Watson is a British comedian and novelist. His five novels to date – 'Bullet Points' (2004, 'A Light-Hearted Look At Murder' (2007, 'Eleven' (2010, 'The Knot' (2012 and 'Hotel Alpha' (2014 – explore human relationships and communities in contemporary society. His latest novel Hotel Alpha tells the story of an extraordinary hotel in London and two mysterious disappearances that raise questions no one seems willing to answer. External to the novel, readers can also discover more about the hotel and its inhabitants in one hundred extra stories that expand the world of the novel and can be found at http://www.hotelalphastories.com. In conversation here with Dr Katy Shaw, Mark offers some reflections on his writing process, the field of contemporary literature, and the vitality of the novel form in the twenty-first century.

  3. Wild Sicilian rosemary: phytochemical and morphological screening and antioxidant activity evaluation of extracts and essential oils.

    Science.gov (United States)

    Napoli, Edoardo M; Siracusa, Laura; Saija, Antonella; Speciale, Antonio; Trombetta, Domenico; Tuttolomondo, Teresa; La Bella, Salvatore; Licata, Mario; Virga, Giuseppe; Leone, Raffaele; Leto, Claudio; Rubino, Laura; Ruberto, Giuseppe

    2015-07-01

    To identify the best biotypes, an extensive survey of Sicilian wild rosemary was carried out by collecting 57 samples from various sites, followed by taxonomic characterization from an agronomic perspective. All the biotypes collected were classified as Rosmarinus officinalis L. A cluster analysis based on the morphological characteristics of the plants allowed the division of the biotypes into seven main groups, although the characteristics examined were found to be highly similar and not area-dependent. Moreover, all samples were analyzed for their phytochemical content, applying an extraction protocol to obtain the nonvolatile components and hydrodistillation to collect the essential oils for the volatile components. The extracts were characterized by LC-UV-DAD/ESI-MS, and the essential oils by GC-FID and GC/MS analyses. In the nonvolatile fractions, 18 components were identified, namely, 13 flavones, two organic acids, and three diterpenes. In the volatile fractions, a total of 82 components were found, with as predominant components α-pinene and camphene among the monoterpene hydrocarbons and 1,8-cineole, camphor, borneol, and verbenone among the oxygenated monoterpenes. Cluster analyses were carried out on both phytochemical profiles, allowing the separation of the rosemary samples into different chemical groups. Finally, the total phenol content and the antioxidant activity of the essential oils and extracts were determined with the Folin-Ciocalteu (FC) colorimetric assay, the UV radiation-induced peroxidation in liposomal membranes (UV-IP test), and the scavenging activity of the superoxide radical (O$\\rm{{_{2}^{{^\\cdot} -}}}$). The present study confirmed that the essential oils and organic extracts of the Sicilian rosemary samples analyzed showed a considerable antioxidant/free radical-scavenging activity. Copyright © 2015 Verlag Helvetica Chimica Acta AG, Zürich.

  4. Improving the sensory and oxidative stability of cooked and chill-stored lamb using dietary rosemary diterpenes.

    Science.gov (United States)

    Serrano, Rafael; Ortuño, Jordi; Bañón, Sancho

    2014-09-01

    Two dietary rosemary extracts (DREs) containing diterpenes (carnosic acid and carnosol at 1:1 and 2:1 w:w) were tested in fattening lambs to stabilize the sensory quality of cooked and chill-stored patties. A total of 63 lambs were fed freely for 80 ± 5 d with a basal diet supplemented or not with DRE. Minced leg meat from each lamb was used to make patty batches. The patties were cooked at 72 ºC for 2 min, aerobically packed, kept at 2 ºC for up to 4 d and then reheated. Sensory traits (color, odor, flavor, and texture), CIELab color, and lipid oxidation (assessed as TBARS) were determined. In a first experiment, the lamb diet was supplemented with 600 mg of 1:1-DRE or 2:1-DRE kg(-1) feed. The 1:1-DRE diet delayed discoloration, flavor deterioration, and rancidity, while the 2:1-DRE diet was ineffective in this respect. In a second experiment, 4 supplementation levels of 1:1-DRE (0, 200, 400, and 600 mg kg(-1) feed) were compared. Flavor deterioration was delayed when the lamb diet was supplemented with at least 400 mg 1:1-DRE kg(-1) feed. The effects of the diet on the odor, flavor, and color were corroborated by differences in TBARS and CIELab. The results obtained suggest that rosemary diterpenes and/or their active secondary compounds deposited in muscle can act as endogenous antioxidants in cooked lamb. The carnosol intake seems crucial in the antioxidant actions achieved through DRE. The use of rosemary antioxidants in animal feeding would allow meat-based dishes to be preserved longer without adding preservatives. © 2014 Institute of Food Technologists®

  5. Watson: A new link in the IIE iron chain

    Science.gov (United States)

    Olsen, Edward; Davis, Andrew; Clarke, Roy S., Jr.; Schultz, Ludolf; Weber, Hartwig W.; Clayton, Robert; Mayeda, Toshiko; Jarosewich, Eugene; Sylvester, Paul; Grossman, Lawrence

    1994-01-01

    Watson, which was found in 1972 in South Australia, contains the largest single silicate rock mass seen in any known iron meteorite. A comprehensive study has been completed on this unusual meteorite: petrography, metallography, analyses of the silicate inclusion (whole rock chemical analysis, INAA, RNAA, noble gases, and oxygen isotope analysis) and mineral compositions (by electron microprobe and ion microprobe). The whole rock has a composition of an H-chondrite minus the normal H-group metal and troilite content. The oxygen isotope composition is that of the silicates in the IIE iron meteorites and lies along an oxygen isotope fractionation line with the H-group chondrites. Trace elements in the metal confirm Watson is a new IIE iron. Whole rock Watson silicate shows an enrichment in K and P (each approximately 2X H-chondrites). The silicate inclusion has a highly equilibrated igneous (peridotite-like) texture with olivine largely poikilitic within low-Ca pyroxene: olivine (Fa20), opx (Fs17Wo3), capx (Fs9Wo14)(with very fine exsolution lamellae), antiperthite feldspar (An1-3Or5) with less than 1 micron exsolution lamellae (An1-3Or greater than 40), shocked feldspar with altered stoichiometry, minor whitlockite (also a poorly characterized interstitial phosphate-rich phase) and chromite, and only traces of metal and troilite. The individual silicate minerals have normal chondritic REE patterns, but whitlockite has a remarkable REE pattern. It is very enriched in light REE (La is 720X C1, and Lu is 90X C1, as opposed to usual chonditic values of approximately 300X and 100-150X, respectively) with a negative Eu anomaly. The enrichment of whole rock K is expressed both in an unusually high mean modal Or content of the feldspar, Or13, and in the presence of antiperthite.

  6. Complexes of DNA bases and Watson-Crick base pairs with small neutral gold clusters.

    Science.gov (United States)

    Kryachko, E S; Remacle, F

    2005-12-08

    The nature of the DNA-gold interaction determines and differentiates the affinity of the nucleobases (adenine, thymine, guanine, and cytosine) to gold. Our preliminary computational study [Kryachko, E. S.; Remacle, F. Nano Lett. 2005, 5, 735] demonstrates that two major bonding factors govern this interaction: the anchoring, either of the Au-N or Au-O type, and the nonconventional N-H...Au hydrogen bonding. In this paper, we offer insight into the nature of nucleobase-gold interactions and provide a detailed characterization of their different facets, i.e., geometrical, energetic, and spectroscopic aspects; the gold cluster size and gold coordination effects; proton affinity; and deprotonation energy. We then investigate how the Watson-Crick DNA pairing patterns are modulated by the nucleobase-gold interaction. We do so in terms of the proton affinities and deprotonation energies of those proton acceptors and proton donors which are involved in the interbase hydrogen bondings. A variety of properties of the most stable Watson-Crick [A x T]-Au3 and [G x C]-Au3 hybridized complexes are described and compared with the isolated Watson-Crick A x T and G x C ones. It is shown that enlarging the gold cluster size to Au6 results in a rather short gold-gold bond in the Watson-Crick interbase region of the [G x C]-Au6 complex that bridges the G x C pair and thus leads to a significant strengthening of G x C pairing.

  7. Efficacy of a Combined Rosemary and Lavender Topical Ointment in the Treatment of Patients with Osteoarthritis of the Knee

    Directory of Open Access Journals (Sweden)

    Alireza Ghannadi

    2013-06-01

    Full Text Available Background: One of the preservative treatments of knee osteoarthritis is the use of topical medications. This study is aimed to clinically evaluate the effect of topical products containing essential oils of rosemary and lavender herbs on the treatment of patients with osteoarthritis of the knee. Materials and Methods: Rosemary and lavender essential oils were prepared by steam distillation method and inserted into the ointment with the hydrophilic base. In this study, 15 patients with knee osteoarthritis were treated with this ointment for three months. The results were assessed using WOMAC and Lequesne indices and were evaluated by the Wilcoxon statistical test.Results: At the week of admission to the hospital, mean WOMAC index was equal to 71.4, mean Lequesne index was equal to 18 and the average time of passing through the distance of fifty feet by patients was equal to 19.4. After 4, 8 and 12 weeks, all these indices significantly decreased (p≤ 0.05. The WOMAC questionnaire denotative survey also showed that the pain and physical function at the 4th, 8th and 12th weeks were significantly less than the first week of admission (p≤ 0.05, but there was no significant difference as far as joint stiffness is concerned.Conclusion: Topical application of essential oils of rosemary and lavender herbs in a hydrophilic ointment base can be useful as a preservative treatment for the patients with knee osteoarthritis.

  8. Evaluation of the intestinal permeability of rosemary (Rosmarinus officinalis L. extract polyphenols and terpenoids in Caco-2 cell monolayers.

    Directory of Open Access Journals (Sweden)

    Almudena Pérez-Sánchez

    Full Text Available Rosemary (Rosmarinus officinalis is grown throughout the world and is widely used as a medicinal herb and to season and preserve food. Rosemary polyphenols and terpenoids have attracted great interest due to their potential health benefits. However, complete information regarding their absorption and bioavailability in Caco-2 cell model is scarce. The permeation properties of the bioactive compounds (flavonoids, diterpenes, triterpenes and phenylpropanoids of a rosemary extract (RE, obtained by supercritical fluid extraction, was studied in Caco-2 cell monolayer model, both in a free form or liposomed. Compounds were identified and quantitated by liquid chromatography coupled to quadrupole time-of-flight with electrospray ionization mass spectrometry analysis (HPLC-ESI-QTOF-MS, and the apparent permeability values (Papp were determined, for the first time in the extract, for 24 compounds in both directions across cell monolayer. For some compounds, such as triterpenoids and some flavonoids, Papp values found were reported for the first time in Caco-2 cells.Our results indicate that most compounds are scarcely absorbed, and passive diffusion is suggested to be the primary mechanism of absorption. The use of liposomes to vehiculize the extract resulted in reduced permeability for most compounds. Finally, the biopharmaceutical classification (BCS of all the compounds was achieved according to their permeability and solubility data for bioequivalence purposes. BCS study reveal that most of the RE compounds could be classified as classes III and IV (low permeability; therefore, RE itself should also be classified into this category.

  9. Evaluation of the intestinal permeability of rosemary (Rosmarinus officinalis L.) extract polyphenols and terpenoids in Caco-2 cell monolayers

    Science.gov (United States)

    Arráez-Román, David; González-Álvarez, Isabel; Ibáñez, Elena; Segura-Carretero, Antonio; Bermejo, Marival; Micol, Vicente

    2017-01-01

    Rosemary (Rosmarinus officinalis) is grown throughout the world and is widely used as a medicinal herb and to season and preserve food. Rosemary polyphenols and terpenoids have attracted great interest due to their potential health benefits. However, complete information regarding their absorption and bioavailability in Caco-2 cell model is scarce. The permeation properties of the bioactive compounds (flavonoids, diterpenes, triterpenes and phenylpropanoids) of a rosemary extract (RE), obtained by supercritical fluid extraction, was studied in Caco-2 cell monolayer model, both in a free form or liposomed. Compounds were identified and quantitated by liquid chromatography coupled to quadrupole time-of-flight with electrospray ionization mass spectrometry analysis (HPLC-ESI-QTOF-MS), and the apparent permeability values (Papp) were determined, for the first time in the extract, for 24 compounds in both directions across cell monolayer. For some compounds, such as triterpenoids and some flavonoids, Papp values found were reported for the first time in Caco-2 cells.Our results indicate that most compounds are scarcely absorbed, and passive diffusion is suggested to be the primary mechanism of absorption. The use of liposomes to vehiculize the extract resulted in reduced permeability for most compounds. Finally, the biopharmaceutical classification (BCS) of all the compounds was achieved according to their permeability and solubility data for bioequivalence purposes. BCS study reveal that most of the RE compounds could be classified as classes III and IV (low permeability); therefore, RE itself should also be classified into this category. PMID:28234919

  10. Effect of rosemary (Rosmarinus officinalis extract on weight, hematology and cell-mediated immune response of newborn goat kids

    Directory of Open Access Journals (Sweden)

    Borhan Shokrollahi

    2015-06-01

    Full Text Available This study aimed at evaluating the effects of different levels of rosemary (Rosmarinus officinalis extract on growth rate, hematology and cell-mediated immune response in Markhoz newborn goat kids. Twenty four goat kids (aged 7±3 days were randomly allotted to four groups with six replicates. The groups included: control, T1, T2 and T3 groups which received supplemented-milk with 0, 100, 200 and 400mg aqueous rosemary extract per kg of live body weight per day for 42 days. Body weights of kids were measured weekly until the end of the experiment. On day 42, 10 ml blood samples were collected from each kid through the jugular vein. Cell-mediated immune response was assessed through the double skin thickness after intradermal injection of phyto-hematoglutinin (PHA at day 21 and 42. No significant differences were seen in initial body weight, average daily gain (ADG and total gain. However, significant differences in globulin (P<0.05, and white blood cells (WBC (P<0.001 were observed. There were no significant differences in haemoglobin (Hb, packed cell volume (PCV, red blood cells (RBC, lymphocytes and neutrophils between the treatments. Skin thickness in response to intra dermal injection of PHA significantly increased in the treated groups as compared to the control group at day 42 (P<0.01 with the T3 group showing the highest response to PHA injection. In conclusion, the results indicated that aqueous rosemary extract supplemented-milk had a positive effect on immunity and skin thickness of newborn goat kids.

  11. Non-Watson Crick base pairs might stabilize RNA structural motifs in ...

    Indian Academy of Sciences (India)

    Watson Crick base pairs, internal loops and pseudoknots have been the highlighting feature of recent structural determination of RNAs. The recent crystal structure of group-I introns has demonstrated that these might constitute RNA structural ...

  12. WATSON: Detecting organic material in subsurface ice using deep-UV fluorescence and Raman spectroscopy

    Science.gov (United States)

    Eshelman, E.; Wanger, G.; Manatt, K.; Malaska, M.; Willis, M.; Abbey, W.; Doloboff, I.; Beegle, L. W.; DeFlores, L. P.; Priscu, J. C.; Lane, A. L.; Carrier, B. L.; Mellerowicz, B.; Kim, D.; Paulsen, G.; Zacny, K.; Bhartia, R.

    2017-12-01

    Future astrobiological missions to Europa and other ocean worlds may benefit from next-generation instrumentation capable of in situ organic and life detection in subsurface ice environments. WATSON (Wireline Analysis Tool for in Situ Observation of Northern ice sheets) is an instrument under development at NASA's Jet Propulsion Laboratory. WATSON contains high-TRL instrumentation developed for SHERLOC, the Mars 2020 deep-UV fluorescence and Raman spectrometer, including a 248.6 nm NeCu hollow cathode laser as an excitation source. In WATSON, these technologies provide spectroscopic capabilities highly sensitive to many organic compounds, including microbes, in an instrument package approximately 1.2 m long with a 101.6 mm diameter, designed to accommodate a 108 mm ice borehole. Interrogation into the ice wall with a laser allows for a non-destructive in situ measurement that preserves the spatial distribution of material within the ice. We report on a successful deployment of WATSON to Kangerlussuaq, Greenland, where the instrument was lowered to a 4.5 m depth in a hand-cored hole on the Kangerlussuaq sector of the Greenland ice sheet. Motorized stages within the instrument were used to raster a laser across cm-scale regions of the interior surface of the borehole, obtaining fluorescence spectral maps with a 200 µm spatial resolution and a spectral range from 265 nm to 440 nm. This region includes the UV emission bands of many aromatic compounds and microbes, and includes the water and ice Raman O-H stretching modes. We additionally report on experiments designed to inform an early-2018 deployment to Kangerlussuaq where WATSON will be incorporated into a Honeybee Robotics planetary deep drill, with a goal of drilling to a depth of 100 m and investigating the distribution of organic material within the ice sheet. These experiments include laboratory calibrations to determine the sensitivity to organic compounds embedded in ice at various depths, as well as

  13. Portrait of a discovery. Watson, Crick, and the double helix.

    Science.gov (United States)

    de Chadarevian, Soraya

    2003-03-01

    This essay examines an iconic image of twentieth-century science: Antony Barrington Brown's photograph of James Watson, Francis Crick, and the double-helical model of DNA. The detailed reconstruction of the production, reception, and uses of the photograph reveals the central role of the image in making the discovery it portrays. Taken in May 1953, two full months after the scientists built the model, to accompany a report on the structure in Time magazine, the photograph (like the report) was never published. It came into circulation only fifteen years later, as an illustration in Watson's best-selling book The Double Helix. While the image served as a historical document and advertisement for the book, only the book provided the description that made the image as well as the people and the model it represented famous. The history of the image provides insights into the retrospective construction of the discovery, which has since been celebrated as the origin of a new science of life.

  14. Oxidative stability of the meat of broilers supplemented with rosemary leaves, rosehip fruits, chokeberry pomace, and entire nettle, and effects on performance and meat quality.

    Science.gov (United States)

    Loetscher, Y; Kreuzer, M; Messikommer, R E

    2013-11-01

    Prevention of lipid oxidation needs special attention because a high proportion of fatty acids in broiler meat are unsaturated. A feeding experiment was conducted to evaluate the antioxidant effect of dietary addition of rosemary, chokeberry pomace, rosehip, or nettle in comparison with vitamin E. Male Ross PM3 broilers caged in groups of 6 (4 replicated cages per treatment) were fed a balanced diet supplemented with 25 g/kg of herbal additive, 200 IU of α-tocopheryl acetate/kg, or without supplementation from d 7 to 35. Intake, performance, and with the help of excreta samples, apparent fiber digestibility, ME content, and metabolizability of nitrogen and energy were recorded per cage. Feed was analyzed for total phenols and tocopherols. In each bird (n = 24 per treatment), carcass weight and relative organ weights were recorded, and skin and liver color were assessed. Abdominal fat was analyzed for induction time (h) of lipid oxidation (Rancimat). Breast meat was analyzed for total tocopherol content (mg/kg) and development of TBA reactive substances (TBARS; μg of MDA/kg) over 9 d of storage. Data were subjected to ANOVA considering treatment and, where applicable, storage time. Rosemary supplementation reduced oxidation (TBARS d 9: 201; induction time: 2.48) and elevated tocopherol content (5.72) of the meat compared with control (470, 1.87, and 3.53, respectively). Rosemary-treated birds had a slightly lower carcass weight and a reduced nitrogen and energy metabolizability. Rosehip addition numerically decreased TBARS (319) and enhanced carcass weight (1.71 kg) compared with rosemary-treated birds (1.54 kg). Only a trend in antioxidant activity could be ascribed to chokeberry pomace, although dietary phenolic content was highest. Nettle did not improve oxidative stability (TBARS: 506; induction time: 1.91), although tocopherol content was elevated (6.51). Nettle treatment strongly intensified skin yellowness (b* of 20.6) compared with the control treatment

  15. Watson-Crick base pairing controls excited-state decay in natural DNA.

    Science.gov (United States)

    Bucher, Dominik B; Schlueter, Alexander; Carell, Thomas; Zinth, Wolfgang

    2014-10-13

    Excited-state dynamics are essential to understanding the formation of DNA lesions induced by UV light. By using femtosecond IR spectroscopy, it was possible to determine the lifetimes of the excited states of all four bases in the double-stranded environment of natural DNA. After UV excitation of the DNA duplex, we detected a concerted decay of base pairs connected by Watson-Crick hydrogen bonds. A comparison of single- and double-stranded DNA showed that the reactive charge-transfer states formed in the single strands are suppressed by base pairing in the duplex. The strong influence of the Watson-Crick hydrogen bonds indicates that proton transfer opens an efficient decay path in the duplex that prohibits the formation or reduces the lifetime of reactive charge-transfer states. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  16. Visualizing Transient Watson-Crick Like Mispairs in DNA and RNA Duplexes

    Science.gov (United States)

    Kimsey, Isaac J.; Petzold, Katja; Sathyamoorthy, Bharathwaj; Stein, Zachary W.; Al-Hashimi, Hashim M.

    2015-01-01

    Rare tautomeric and anionic nucleobases are believed to play fundamental biological roles but their prevalence and functional importance has remained elusive because they exist transiently, in low-abundance, and involve subtle movements of protons that are difficult to visualize. Using NMR relaxation dispersion, we show that wobble dG•dT and rG•rU mispairs in DNA and RNA duplexes exist in dynamic equilibrium with short-lived, low-populated Watson-Crick like mispairs that are stabilized by rare enolic or anionic bases. These mispairs can evade Watson-Crick fidelity checkpoints and form with probabilities (10−3-10−5) that strongly imply a universal role in replication and translation errors. Our results indicate that rare tautomeric and anionic bases are widespread in nucleic acids, expanding their structural and functional complexity beyond that attainable with canonical bases. PMID:25762137

  17. Visualizing transient Watson-Crick-like mispairs in DNA and RNA duplexes.

    Science.gov (United States)

    Kimsey, Isaac J; Petzold, Katja; Sathyamoorthy, Bharathwaj; Stein, Zachary W; Al-Hashimi, Hashim M

    2015-03-19

    Rare tautomeric and anionic nucleobases are believed to have fundamental biological roles, but their prevalence and functional importance has remained elusive because they exist transiently, in low abundance, and involve subtle movements of protons that are difficult to visualize. Using NMR relaxation dispersion, we show here that wobble dG•dT and rG•rU mispairs in DNA and RNA duplexes exist in dynamic equilibrium with short-lived, low-populated Watson-Crick-like mispairs that are stabilized by rare enolic or anionic bases. These mispairs can evade Watson-Crick fidelity checkpoints and form with probabilities (10(-3) to 10(-5)) that strongly imply a universal role in replication and translation errors. Our results indicate that rare tautomeric and anionic bases are widespread in nucleic acids, expanding their structural and functional complexity beyond that attainable with canonical bases.

  18. Jokulhlaups and sediment transport in Watson River, Kangerlussuaq, West Greenland

    DEFF Research Database (Denmark)

    Mikkelsen, A. B.; Hasholt, Bent; Knudsen, N. T.

    2013-01-01

    For 3 years, during a 4-year observation period (2007-2010), jokulhlaups were observed from a lake at the northern margin of Russells Gletscher. At a gauging station located on a bedrock sill near the outlet of Watson River into Sdr Stromfjord, discharge and sediment transport was monitored during...

  19. Comparable stability of Hoogsteen and Watson-Crick base pairs in ionic liquid choline dihydrogen phosphate.

    Science.gov (United States)

    Tateishi-Karimata, Hisae; Nakano, Miki; Sugimoto, Naoki

    2014-01-08

    The instability of Hoogsteen base pairs relative to Watson-Crick base pairs has limited biological applications of triplex-forming oligonucleotides. Hydrated ionic liquids (ILs) provide favourable environments for a wide range of chemical reactions and are known to impact the stabilities of Watson-Crick base pairs. We found that DNA triplex formation was significantly stabilized in hydrated choline dihydrogen phosphate as compared with an aqueous buffer at neutral pH. Interestingly, the stability of Hoogsteen base pairs was found to be comparable with that of Watson-Crick base pairs in the hydrated IL. Molecular dynamics simulations of a DNA triplex in the presence of choline ions revealed that the DNA triplex was stabilized because of the binding of choline ion around the third strand in the grooves. Our finding will facilitate the development of new DNA materials. Our data also indicate that triplex formation may be stabilized inside cells where choline ions and their derivatives are abundant in vivo.

  20. Modulation of estrogen and epidermal growth factor receptors by rosemary extract in breast cancer cells.

    Science.gov (United States)

    González-Vallinas, Margarita; Molina, Susana; Vicente, Gonzalo; Sánchez-Martínez, Ruth; Vargas, Teodoro; García-Risco, Mónica R; Fornari, Tiziana; Reglero, Guillermo; Ramírez de Molina, Ana

    2014-06-01

    Breast cancer is the leading cause of cancer-related mortality among females worldwide, and therefore the development of new therapeutic approaches is still needed. Rosemary (Rosmarinus officinalis L.) extract possesses antitumor properties against tumor cells from several organs, including breast. However, in order to apply it as a complementary therapeutic agent in breast cancer, more information is needed regarding the sensitivity of the different breast tumor subtypes and its effect in combination with the currently used chemotherapy. Here, we analyzed the antitumor activities of a supercritical fluid rosemary extract (SFRE) in different breast cancer cells, and used a genomic approach to explore its effect on the modulation of ER-α and HER2 signaling pathways, the most important mitogen pathways related to breast cancer progression. We found that SFRE exerts antitumor activity against breast cancer cells from different tumor subtypes and the downregulation of ER-α and HER2 receptors by SFRE might be involved in its antitumor effect against estrogen-dependent (ER+) and HER2 overexpressing (HER2+) breast cancer subtypes. Moreover, SFRE significantly enhanced the effect of breast cancer chemotherapy (tamoxifen, trastuzumab, and paclitaxel). Overall, our results support the potential utility of SFRE as a complementary approach in breast cancer therapy. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  1. IBM Watson Analytics: Automating Visualization, Descriptive, and Predictive Statistics.

    Science.gov (United States)

    Hoyt, Robert Eugene; Snider, Dallas; Thompson, Carla; Mantravadi, Sarita

    2016-10-11

    We live in an era of explosive data generation that will continue to grow and involve all industries. One of the results of this explosion is the need for newer and more efficient data analytics procedures. Traditionally, data analytics required a substantial background in statistics and computer science. In 2015, International Business Machines Corporation (IBM) released the IBM Watson Analytics (IBMWA) software that delivered advanced statistical procedures based on the Statistical Package for the Social Sciences (SPSS). The latest entry of Watson Analytics into the field of analytical software products provides users with enhanced functions that are not available in many existing programs. For example, Watson Analytics automatically analyzes datasets, examines data quality, and determines the optimal statistical approach. Users can request exploratory, predictive, and visual analytics. Using natural language processing (NLP), users are able to submit additional questions for analyses in a quick response format. This analytical package is available free to academic institutions (faculty and students) that plan to use the tools for noncommercial purposes. To report the features of IBMWA and discuss how this software subjectively and objectively compares to other data mining programs. The salient features of the IBMWA program were examined and compared with other common analytical platforms, using validated health datasets. Using a validated dataset, IBMWA delivered similar predictions compared with several commercial and open source data mining software applications. The visual analytics generated by IBMWA were similar to results from programs such as Microsoft Excel and Tableau Software. In addition, assistance with data preprocessing and data exploration was an inherent component of the IBMWA application. Sensitivity and specificity were not included in the IBMWA predictive analytics results, nor were odds ratios, confidence intervals, or a confusion matrix

  2. Impact parameter representation from the Watson-Sommerfeld transform

    International Nuclear Information System (INIS)

    Islam, M.M.

    1976-01-01

    Using the Watson-Sommerfeld transform the elastic scattering amplitude of two spinless particles is shown to have an exact and unique impact parameter, or Fourier-Bessel (FB) representation. The representation is valid for all physical energies and scattering angles. Wallace's recent work is found to be an asymptotic expansion of the FB amplitude obtained from the partial-wave expansion. The way singularities of the partial-wave amplitude in the l-plane enter in the FB amplitude is also explicitly shown. (Auth.)

  3. Evaluation of in vitro anti-inflammatory effects of crude ginger and rosemary extracts obtained through supercritical CO2 extraction on macrophage and tumor cell line: the influence of vehicle type.

    Science.gov (United States)

    Justo, Oselys Rodriguez; Simioni, Patricia Ucelli; Gabriel, Dirce Lima; Tamashiro, Wirla Maria da Silva Cunha; Rosa, Paulo de Tarso Vieira; Moraes, Ângela Maria

    2015-10-29

    Numerous plants from have been investigated due to their anti-inflammatory activity and, among then, extracts or components of ginger (Zingiber officinale Roscoe) and rosemary (Rosmarinus officinalis L.), sources of polyphenolic compounds. 6-gingerol from ginger rhizome and carnosic acid and carnosol from rosemary leaves present anti-tumor, anti-inflammatory and antioxidant activities. However, the evaluation of the mechanisms of action of these and other plant extracts is limited due to their high hydrophobicity. Dimethylsulfoxide (DMSO) is commonly used as a vehicle of liposoluble materials to mammalian cells in vitro, presenting enhanced cell penetration. Liposomes are also able to efficiently deliver agents to mammalian cells, being capable to incorporate in their structure not only hydrophobic molecules, but also hydrophilic and amphiphilic compounds. Another strategy is based on the use of Pluronic F-68, a biocompatible low-foaming, non-ionic surfactant, to disperse hydrophobic components. Here, these three delivery approaches were compared to analyze their influence on the in vitro anti-inflammatory effects of ginger and rosemary extracts, at different concentrations, on primary mammalian cells and on a tumor cell line. Ginger and rosemary extracts free of organic solvents were obtained by supercritical fluid extraction and dispersed in DMSO, Pluronic F-68 or liposomes, in variable concentrations. Cell viability, production of inflammatory mediators and nitric oxide (NO) release were measured in vitro on J774 cell line and murine macrophages primary culture stimulated with bacterial lipopolysaccharide and interferon-γ after being exposed or not to these extracts. Ginger and rosemary extracts obtained by supercritical CO2 extraction inhibited the production of pro-inflammatory cytokines and the release of NO by peritoneal macrophages and J774 cells. The delivery vehicles influenced the anti-inflammatory effects. Comparatively, the ginger extract showed the

  4. Some Econometric Results for the Blanchard-Watson Bubble Model

    DEFF Research Database (Denmark)

    Johansen, Soren; Lange, Theis

    The purpose of the present paper is to analyse a simple bubble model suggested by Blanchard and Watson. The model is defined by y(t) =s(t)¿y(t-1)+e(t), t=1,…,n, where s(t) is an i.i.d. binary variable with p=P(s(t)=1), independent of e(t) i.i.d. with mean zero and finite variance. We take ¿>1 so...

  5. Green tea or rosemary extract added to foods reduces nonheme- iron absorption

    DEFF Research Database (Denmark)

    Samman, S.; Sandstrøm, B.; Toft, M.B.

    2001-01-01

    the effect of phenolic-rich extracts obtained from green tea or rosemary on nonheme-iron absorption. Design: Young women aged 19-39 y consumed test meals on 4 separate occasions. The meals were identical except for the absence (meal A) or presence (meal B) of a phenolic-rich extract from green tea (study 1......-body retention of 59Fe and the ratio of Fe-55 to 59Fe activity in blood samples. Results: The presence of the phenolic-rich extracts resulted in decreased nonheme-iron absorption. Mean (+/-SD) iron absorption decreased from 12.1 +/- 4.5% to 8.9 +/- 5.2% (P tea extract and from 7...

  6. DNA base dimers are stabilized by hydrogen-bonding interactions including non-Watson-Crick pairing near graphite surfaces.

    Science.gov (United States)

    Shankar, Akshaya; Jagota, Anand; Mittal, Jeetain

    2012-10-11

    Single- and double-stranded DNA are increasingly being paired with surfaces and nanoparticles for numerous applications, such as sensing, imaging, and drug delivery. Unlike the majority of DNA structures in bulk that are stabilized by canonical Watson-Crick pairing between Ade-Thy and Gua-Cyt, those adsorbed on surfaces are often stabilized by noncanonical base pairing, quartet formation, and base-surface stacking. Not much is known about these kinds of interactions. To build an understanding of the role of non-Watson-Crick pairing on DNA behavior near surfaces, one requires basic information on DNA base pair stacking and hydrogen-bonding interactions. All-atom molecular simulations of DNA bases in two cases--in bulk water and strongly adsorbed on a graphite surface--are conducted to study the relative strengths of stacking and hydrogen bond interactions for each of the 10 possible combinations of base pairs. The key information obtained from these simulations is the free energy as a function of distance between two bases in a pair. We find that stacking interactions exert the dominant influence on the stability of DNA base pairs in bulk water as expected. The strength of stability for these stacking interactions is found to decrease in the order Gua-Gua > Ade-Gua > Ade-Ade > Gua-Thy > Gua-Cyt > Ade-Thy > Ade-Cyt > Thy-Thy > Cyt-Thy > Cyt-Cyt. On the other hand, mutual interactions of surface-adsorbed base pairs are stabilized mostly by hydrogen-bonding interactions in the order Gua-Cyt > Ade-Gua > Ade-Thy > Ade-Ade > Cyt-Thy > Gua-Gua > Cyt-Cyt > Ade-Cyt > Thy-Thy > Gua-Thy. Interestingly, several non-Watson-Crick base pairings, which are commonly ignored, have similar stabilization free energies due to interbase hydrogen bonding as Watson-Crick pairs. This clearly highlights the importance of non-Watson-Crick base pairing in the development of secondary structures of oligonucleotides near surfaces.

  7. Volume Estimates in Chronic Hemodialysis Patients by the Watson Equation and Bioimpedance Spectroscopy and the Impact on the Kt/Vurea calculation.

    Science.gov (United States)

    Noori, Nazanin; Wald, Ron; Sharma Parpia, Arti; Goldstein, Marc B

    2018-01-01

    Accurate assessment of total body water (TBW) is essential for the evaluation of dialysis adequacy (Kt/V urea ). The Watson formula, which is recommended for the calculation of TBW, was derived in healthy volunteers thereby leading to potentially inaccurate TBW estimates in maintenance hemodialysis recipients. Bioimpedance spectroscopy (BIS) may be a robust alternative for the measurement of TBW in hemodialysis recipients. The primary objective of this study was to evaluate the accuracy of Watson formula-derived TBW estimates as compared with TBW measured with BIS. Second, we aimed to identify the anthropometric characteristics that are most likely to generate inaccuracy when using the Watson formula to calculate TBW. Finally, we derived novel anthropometric equations for the more accurate estimation of TBW. This was a cross-sectional study of prevalent in-center HD patients at St Michael's Hospital. One hundred eighty-four hemodialysis patients (109 men and 75 women) were evaluated in this study. Anthropometric measurements including weight, height, waist circumference, midarm circumference, and 4-site skinfold (biceps, triceps, subscapular, and suprailiac) thickness were measured; fat mass was measured using the formula by Durnin and Womersley. We measured TBW by BIS using the Body Composition Monitor (Fresenius Medical Care, Bad Homburg, Germany). We used the Bland-Altman method to calculate the difference between the TBW derived from the Watson method and the BIS. To derive new equations for TBW estimation, Pearson's correlation coefficients between BIS-TBW (the reference test) and other variables were examined. We used the least squares regression analysis to develop parsimonious equations to predict TBW. TBW values based on the Watson method had a high correlation with BIS-TBW (correlation coefficients = 0.87 and P Watson formula overestimated TBW by 5.1 (4.5-5.8) liters and 3.8 (3.0-4.5) liters, in men and women, respectively. Higher fat mass and waist

  8. de Jean Watson

    Directory of Open Access Journals (Sweden)

    Thaís Schossler

    2008-01-01

    Full Text Available Este estudio tuvo como objetivo conocer la percepción del cuidador domiciliario del anciano acerca del cuidado de sí mismo, teniendo como base teórica a Jean Watson en su Teoría del Cuidado Humano. La investigación se caracterizó por un abordaje cualitativo, de tipo exploratorio-descriptivo, el cual fue desarrollado en la Unidad de la Vila Floresta con nueve cuidadores domiciliarios de ancianos, integrantes del Programa de Atención a Domicilio. La recolección de informaciones se realizó en el período de agosto a octubre de 2006, por medio de una entrevista parcialmente estructurada. Se utilizó el análisis de contenido de Bardin y emergieron las categorías: compartir el cuidado al anciano - una posibilidad para cuidar de sí mismo; descansar, pasear, dormir, uno no tiene más ese derecho; presencia de la familia: una necesidad sentida por el cuidador domiciliar; (desequilibrio del cuerpo físico y mental, una resultante percibida en el (descuidado de sí mismo. Se concluye que el cuidador domiciliario es el principal responsable por el cuidado del anciano y que el cuidado de sí mismo se hace presente en su realidad.

  9. Formation of base triplets by non-Watson-Crick bonds mediates homologous recognition in RecA recombination filaments.

    OpenAIRE

    Rao, B J; Radding, C M

    1994-01-01

    Whereas complementary strands of DNA recognize one another by forming Watson-Crick base pairs, the way in which RecA protein enables a single strand to recognize homology in duplex DNA has remained unknown. Recent experiments, however, have shown that a single plus strand in the RecA filament can recognize an identical plus strand via bonds that, by definition, are non-Watson-Crick. In experiments reported here, base substitutions had the same qualitative and quantitative effects on the pairi...

  10. Direct NMR Evidence that Transient Tautomeric and Anionic States in dG·dT Form Watson-Crick-like Base Pairs.

    Science.gov (United States)

    Szymanski, Eric S; Kimsey, Isaac J; Al-Hashimi, Hashim M

    2017-03-29

    The replicative and translational machinery utilizes the unique geometry of canonical G·C and A·T/U Watson-Crick base pairs to discriminate against DNA and RNA mismatches in order to ensure high fidelity replication, transcription, and translation. There is growing evidence that spontaneous errors occur when mismatches adopt a Watson-Crick-like geometry through tautomerization and/or ionization of the bases. Studies employing NMR relaxation dispersion recently showed that wobble dG·dT and rG·rU mismatches in DNA and RNA duplexes transiently form tautomeric and anionic species with probabilities (≈0.01-0.40%) that are in concordance with replicative and translational errors. Although computational studies indicate that these exceptionally short-lived and low-abundance species form Watson-Crick-like base pairs, their conformation could not be directly deduced from the experimental data, and alternative pairing geometries could not be ruled out. Here, we report direct NMR evidence that the transient tautomeric and anionic species form hydrogen-bonded Watson-Crick-like base pairs. A guanine-to-inosine substitution, which selectively knocks out a Watson-Crick-type (G)N2H 2 ···O2(T) hydrogen bond, significantly destabilized the transient tautomeric and anionic species, as assessed by lack of any detectable chemical exchange by imino nitrogen rotating frame spin relaxation (R 1ρ ) experiments. An 15 N R 1ρ NMR experiment targeting the amino nitrogen of guanine (dG-N2) provides direct evidence for Watson-Crick (G)N2H 2 ···O2(T) hydrogen bonding in the transient tautomeric state. The strategy presented in this work can be generally applied to examine hydrogen-bonding patterns in nucleic acid transient states including in other tautomeric and anionic species that are postulated to play roles in replication and translational errors.

  11. Probing the Watson-Crick, wobble, and sugar-edge hydrogen bond sites of uracil and thymine.

    Science.gov (United States)

    Müller, Andreas; Frey, Jann A; Leutwyler, Samuel

    2005-06-16

    The nucleobases uracil (U) and thymine (T) offer three hydrogen-bonding sites for double H-bond formation via neighboring N-H and C=O groups, giving rise to the Watson-Crick, wobble and sugar-edge hydrogen bond isomers. We probe the hydrogen bond properties of all three sites by forming hydrogen bonded dimers of U, 1-methyluracil (1MU), 3-methyluracil (3MU), and T with 2-pyridone (2PY). The mass- and isomer-specific S1 origins exhibit large spectral blue shifts relative to the 2PY monomer. Ab initio CIS calculations of the spectral shifts of the different hydrogen-bonded dimers show a linear correlation with experiment. This correlation allows us to identify the R2PI spectra of the weakly populated Watson-Crick and wobble isomers of both 2PY.U and 2PY.T. (3) PW91 density functional calculation of the ground-state binding and dissociation energies De and D0 are in agreement with the assignment of the dominant hydrogen bond isomers of 2PY.U, 2PY.3MU and 2PY.T as the sugar-edge form. For 2PY.U, 2PY.T and 2PY.1MU the measured wobble:Watson-Crick:sugar-edge isomer ratios are in good agreement with the calculated ratios, based on the ab initio dissociation energies and gas-phase statistical mechanics. The Watson-Crick and wobble isomers are thereby determined to be several kcal/mol less strongly bound than the sugar-edge isomers. The 36 observed intermolecular frequencies of the nine different H-bonded isomers give detailed insight into the intermolecular force field.

  12. Ed Watson 1940-2006

    CERN Multimedia

    2006-01-01

    Ed Watson arrived at CERN in March 1973 to work on digital electronics and CAMAC systems under Bob Dobinson, after many years at Rolls Royce in Scotland. He joined the European Muon Collaboration in 1976, where he played a major role in the design, deployment and running of its data acquisition system (DAQ) with David Botterill, Bob Dobinson, and Vicky White. The CAMAC-ROMULUS system was by far the largest and most advanced of its time, and it became a defining standard for DAQ systems for years to come. Ed was deeply involved in the detailed planning of the control rooms and the experiment cabling, as well as sharing the responsibility for the CAMAC readout system. He had a real talent for trouble shooting and played a vital part in supporting the experiment throughout its lifetime. He offered great moral support to the younger members of the collaboration and helped them a great deal with their work. The EMC had a wonderful social life to which Ed was a major contributor - who can forget its barbecues?  In...

  13. When a clear strong voice was needed: A retrospective review of Watson's (1924/1930) behaviorism.

    Science.gov (United States)

    Malone, John C; García-Penagos, Andrés

    2014-07-25

    Despite the attention given John B. Watson during the century since he introduced behaviorism, there remain questions about what he really contributed. He is still appropriately criticized for his arrogant self-promotion and especially for his perceived emphasis on a simple S-R reflexology. However, we argue that the former was necessary at the time and that criticism of Watson on the second count only diverts attention from the genuine contributions that he did make. In support of these contentions we examine several aspects of his contributions that warrant clarification, namely, his promotion of applied comparative psychology, his views on the nature of mind, his originality, criticism from and respect afforded by contemporaries, his relation to recent interest in "the embodiment of mind," his treatment of thinking, and his appreciation of Freud's work. We organize our discussion around specific chapters of the two editions of Behaviorism, but in support of our arguments we include publications of Watson that are less well known. Those works develop some important points that are only briefly treated in both editions of Behaviorism. © Society for the Experimental Analysis of Behavior.

  14. Polyphenols from the Mediterranean herb rosemary (Rosmarinus officinalis for prostate cancer

    Directory of Open Access Journals (Sweden)

    Sakina M Petiwala

    2013-03-01

    Full Text Available The Mediterranean diet is rich in fruits and vegetables and has been associated with a variety of health benefits including cancer prevention. One aspect of the diet that has not received enough attention is Mediterranean herbs. Specifically, rosemary and its polyphenolic diterpenes (carnosic acid and carnosol are known to possess antioxidant activity that may be beneficial for cancer control. Herein, we describe the in vitro and in vivo studies carried out towards understanding the molecular mechanisms of carnosic acid and carnosol leading to inhibition of prostate cancer. The reported findings suggest that these polyphenols target multiple signaling pathways involved in cell cycle modulation and apoptosis. Further work is required to understand its potential for health promotion and potential drug discovery for prostate cancer chemoprevention.

  15. Ultraviolet Absorption Induces Hydrogen-Atom Transfer in G⋅C Watson-Crick DNA Base Pairs in Solution.

    Science.gov (United States)

    Röttger, Katharina; Marroux, Hugo J B; Grubb, Michael P; Coulter, Philip M; Böhnke, Hendrik; Henderson, Alexander S; Galan, M Carmen; Temps, Friedrich; Orr-Ewing, Andrew J; Roberts, Gareth M

    2015-12-01

    Ultrafast deactivation pathways bestow photostability on nucleobases and hence preserve the structural integrity of DNA following absorption of ultraviolet (UV) radiation. One controversial recovery mechanism proposed to account for this photostability involves electron-driven proton transfer (EDPT) in Watson-Crick base pairs. The first direct observation is reported of the EDPT process after UV excitation of individual guanine-cytosine (G⋅C) Watson-Crick base pairs by ultrafast time-resolved UV/visible and mid-infrared spectroscopy. The formation of an intermediate biradical species (G[-H]⋅C[+H]) with a lifetime of 2.9 ps was tracked. The majority of these biradicals return to the original G⋅C Watson-Crick pairs, but up to 10% of the initially excited molecules instead form a stable photoproduct G*⋅C* that has undergone double hydrogen-atom transfer. The observation of these sequential EDPT mechanisms across intermolecular hydrogen bonds confirms an important and long debated pathway for the deactivation of photoexcited base pairs, with possible implications for the UV photochemistry of DNA. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  16. J. B. Watson y la Publicidad, los Inicios de la Psicología del Consumidor

    Directory of Open Access Journals (Sweden)

    FELIPE PARRADO CORREDOR

    2013-12-01

    Full Text Available Research regarding the behavior of individuals with respect to products and services dates back to the beginning of the 20th century, and J. B. Watson is one of its main precursors. Watson taught an applied psychology course called Psychology of Advertising, introduced many companies to experimental techniques for the marketing of their products, and, after retiring from academic life, joined the Walter Thompson advertising agency, where he developed massive campaigns using the principles of conditioned emotional responses. The article highlights the importance of Watson’s work in the psychology of advertising, as a forerunner of the scientific developments of consumer psychology.

  17. On the extension of the Fermi-Watson Theorem to high energy diffraction

    International Nuclear Information System (INIS)

    Malecki, A.; Istituto Nazionale di Fisica Nucleare, Frascati

    1995-12-01

    The Fermi-Watson theorem, established for low energy reactions and then applied to high energy collision, is revisited. Its use for the processes of inelastic diffraction is discussed. The theorem turns out to be valid in the case inclusive cross-section of diffractive transition

  18. The Thurgood Marshall School of Law Empirical Findings: A Report of the Watson-Glaser for the 2009-2010 Test Takers

    Science.gov (United States)

    Kadhi, T.; Palasota, A.; Holley, D.; Rudley, D.

    2010-01-01

    The following report gives the statistical findings of the 2009-2010 Watson-Glaser test. Data is pre-existing and was given to the Evaluator by email from the Director, Center for Legal Pedagogy. Statistical analyses were run using SPSS 17 to address the following questions: 1. What are the statistical descriptors of the Watson-Glaser results of…

  19. "Elementary, my dear Watson". Per una falsa citazione

    Directory of Open Access Journals (Sweden)

    Irene Minella

    2014-12-01

    Full Text Available Nowhere, among Sir Arthur Conan Doyle's pages concerning one of the most celebrated characters of British literature, Sherlock Holmes, is to be found the interjection: "Elementary, my dear Watson!". Exploring the creation of the London investigator as well as Holmes' first appearance in theatre, cinema and literature, this essay will help to understand why he is still so popular and why the 'non-quotation' keeps haunting the collective imagination. Despite its philological inaccuracy, the interjection has become so famous that it has been used even outside its original context.

  20. Crick's gossip test and Watson's boredom principle: A pseudo-mathematical analysis of effort in scientific research.

    Science.gov (United States)

    Charlton, Bruce G

    2008-01-01

    Crick and Watson gave complementary advice to the aspiring scientist based on the insight that to do your best work you need to make your greatest possible effort. Crick made the positive suggestion to work on the subject which most deeply interests you, the thing about which you spontaneously gossip - Crick termed this 'the gossip test'. Watson made the negative suggestion of avoiding topics and activities that bore you - which I have termed 'the boredom principle'. This is good advice because science is tough and the easy things have already been done. Solving the harder problems that remain requires a lot of effort. But in modern biomedical science individual effort does not necessarily correlate with career success as measured by salary, status, job security, etc. This is because Crick and Watson are talking about revolutionary science - using Thomas Kuhn's distinction between paradigm-shifting 'revolutionary' science and incremental 'normal' science. There are two main problems with pursuing a career in revolutionary science. The first is that revolutionary science is intrinsically riskier than normal science, the second that even revolutionary success in a scientific backwater may be less career-enhancing than mundane work in a trendy field. So, if you pick your scientific problem using the gossip test and the boredom principle, you might also be committing career suicide. This may explain why so few people follow Crick and Watson's advice. The best hope for future biomedical science is that it will evolve towards a greater convergence between individual effort and career success.

  1. Finding Little Albert: A Journey to John B. Watson's Infant Laboratory

    Science.gov (United States)

    Beck, Hall P.; Levinson, Sharman; Irons, Gary

    2009-01-01

    In 1920, John Watson and Rosalie Rayner claimed to have conditioned a baby boy, Albert, to fear a laboratory rat. In subsequent tests, they reported that the child's fear generalized to other furry objects. After the last testing session, Albert disappeared, creating one of the greatest mysteries in the history of psychology. This article…

  2. Does the Watson-Jones or Modified Smith-Petersen Approach Provide Superior Exposure for Femoral Neck Fracture Fixation?

    Science.gov (United States)

    Lichstein, Paul M; Kleimeyer, John P; Githens, Michael; Vorhies, John S; Gardner, Michael J; Bellino, Michael; Bishop, Julius

    2018-04-24

    A well-reduced femoral neck fracture is more likely to heal than a poorly reduced one, and increasing the quality of the surgical exposure makes it easier to achieve anatomic fracture reduction. Two open approaches are in common use for femoral neck fractures, the modified Smith-Petersen and Watson-Jones; however, to our knowledge, the quality of exposure of the femoral neck exposure provided by each approach has not been investigated. (1) What is the respective area of exposed femoral neck afforded by the Watson-Jones and modified Smith-Petersen approaches? (2) Is there a difference in the ability to visualize and/or palpate important anatomic landmarks provided by the Watson-Jones and modified Smith-Petersen approaches? Ten fresh-frozen human pelvi underwent both modified Smith-Petersen (utilizing the caudal extent of the standard Smith-Petersen interval distal to the anterosuperior iliac spine and parallel to the palpable interval between the tensor fascia lata and the sartorius) and Watson-Jones approaches. Dissections were performed by three fellowship-trained orthopaedic traumatologists with extensive experience in both approaches. Exposure (in cm) was quantified with calibrated digital photographs and specialized software. Modified Smith-Petersen approaches were analyzed before and after rectus femoris tenotomy. The ability to visualize and palpate seven clinically relevant anatomic structures (the labrum, femoral head, subcapital femoral neck, basicervical femoral neck, greater trochanter, lesser trochanter, and medial femoral neck) was also recorded. The quantified area of the exposed proximal femur was utilized to compare which approach afforded the largest field of view of the femoral neck and articular surface for assessment of femoral neck fracture and associated femoral head injury. The ability to visualize and palpate surrounding structures was assessed so that we could better understand which approach afforded the ability to assess structures that

  3. A chat with James Watson

    CERN Multimedia

    2011-01-01

    On 6 September, Nobel laureate James Watson paid a visit to CERN. In this interview, he shares his views with CERN's Paola Catapano.      var flash_video_player=get_video_player_path(); insert_player_for_external('Video/Public/Movies/2011/CERN-MOVIE-2011-144/CERN-MOVIE-2011-144-0753-kbps-640x360-25-fps-audio-64-kbps-44-kHz-stereo', 'mms://mediastream.cern.ch/MediaArchive/Video/Public/Movies/2011/CERN-MOVIE-2011-144/CERN-MOVIE-2011-144-0480-kbps-512x288-25-fps-audio-128-kbps-48-kHz-stereo.wmv', 'false', 480, 360, 'https://mediastream.cern.ch/MediaArchive/Video/Public/Movies/2011/CERN-MOVIE-2011-144/CERN-MOVIE-2011-144-posterframe-640x360-at-10-percent.jpg', '1384418', true, 'Video/Public/Movies/2011/CERN-MOVIE-2011-144/CERN-MOVIE-2011-144-0600-kbps-maxH-360-25-fps-audio-128-kbps-48-kHz-stereo.mp4');

  4. The effect of the essential oils of lavender and rosemary on the human short-term memory

    OpenAIRE

    O.V. Filiptsova; L.V. Gazzavi-Rogozina; I.A. Timoshyna; O.I. Naboka; Ye.V. Dyomina; A.V. Ochkur

    2018-01-01

    The research results of the effect of essential oils on the human short-term image and numerical memory have been described. The study involved 79 secondary school students (34 boys and 45 girls) aged 13 to 17 years, residents of the Ukrainian metropolis. Participants were divided into three groups: the control group, “Lavender” group, in which the lavender essential oil was sprayed, and “Rosemary” group, in which the rosemary essential oil was sprayed. The statistically significant differenc...

  5. Building Watson: An Overview of the DeepQA Project

    OpenAIRE

    Ferrucci, David; Brown, Eric; Chu-Carroll, Jennifer; Fan, James; Gondek, David; Kalyanpur, Aditya A.; Lally, Adam; Murdock, J. William; Nyberg, Eric; Prager, John; Schlaefer, Nico; Welty, Chris

    2010-01-01

    IBM Research undertook a challenge to build a computer system that could compete at the human champion level in real time on the American TV Quiz show, Jeopardy! The extent of the challenge includes fielding a real-time automatic contestant on the show, not merely a laboratory exercise. The Jeopardy! Challenge helped us address requirements that led to the design of the DeepQA architecture and the implementation of Watson. After 3 years of intense research and development by a core team of ab...

  6. Charge transport properties of DNA aperiodic molecule: The role of interbase hopping in Watson-Crick base pair

    Science.gov (United States)

    Sinurat, E. N.; Yudiarsah, E.

    2017-07-01

    The charge transport properties of DNA aperiodic molecule has been studied by considering various interbase hopping parameter on Watson-Crick base pair. 32 base pairs long double-stranded DNA aperiodic model with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. Transfer matrix method has been used to calculate transmission probabilities, for determining I-V characteristic using Landauer Büttiker formula. DNA molecule is modeled using tight binding hamiltonian combined with the theory of Slater-Koster. The result show, the increment of Watson-Crick hopping value leads to the transmission probabilities and current of DNA aperiodic molecule increases.

  7. Meltwater chemistry and solute export from a Greenland ice sheet catchment, Watson River, West Greenland

    DEFF Research Database (Denmark)

    Yde, Jacob C.; Knudsen, N. Tvis; Hasholt, Bent

    2014-01-01

    –2010 for the Watson River sector of the GrIS that drains into the fjord Kangerlussuaq. The hydrochemistry is dominated by Ca2+ and HCO3− with a relatively high molar K+/Na+ ratio of 0.6 ± 0.1, typical for meltwaters draining a gneissic lithology. Low molar Ca2+/Na+ and Mg2+/Na+ ratios indicate that weathering....... However, when normalized by discharge the denudation rates are comparable to other Arctic sites. When extrapolating the results from the Watson River catchment to the entire Greenland for 2007–2010, the solute export from Greenland meltwater varied between 7.1 × 106 and 7.8 × 106 tons, whilst the major...

  8. The extension of a DNA double helix by an additional Watson-Crick base pair on the same backbone

    DEFF Research Database (Denmark)

    Kumar, P.; Sharma, P. K.; Madsen, Charlotte S.

    2013-01-01

    Additional base pair: The DNA duplex can be extended with an additional Watson-Crick base pair on the same backbone by the use of double-headed nucleotides. These also work as compressed dinucleotides and form two base pairs with cognate nucleobases on the opposite strand.......Additional base pair: The DNA duplex can be extended with an additional Watson-Crick base pair on the same backbone by the use of double-headed nucleotides. These also work as compressed dinucleotides and form two base pairs with cognate nucleobases on the opposite strand....

  9. AVE bond index in the H-bond of the Watson-Crick pairs

    International Nuclear Information System (INIS)

    Giambiagi, M.; Giambiagi, M.S. de; Barroso Filho, W.

    1981-01-01

    The normal Watson-Crick base pairs are treated as super-molecules. The properties of the electronic distribution along the N-H...Y bonds are studied in an all-valence-electrons calculation, through a bond index formula devised for non-orthogonal basis. Eletronic density diagrams of the adenine-uracil base pair are analysed. (Auhor) [pt

  10. Feeding rosemary leaves powder ameliorates rooster age-related subfertility.

    Science.gov (United States)

    Borghei-Rad, Seyyed Mohsen; Zeinoaldini, Saeed; Zhandi, Mahdi; Moravej, Hossein; Ansari, Mahdi

    2017-10-01

    Having a high proportion of polyunsaturated fatty acids avian spermatozoa predispose to lipoperoxidation which results in fertility reduction. In the current study, rosemary leaves powder (RLP) was fed to senescent breeder roosters to improve their reproductive performance. Twenty four 70-week-old roosters were randomly divided into four groups and received following treatments including 0 (RLP-0), 2.5 (RLP-2.5), 5 (RLP-5) or 7.5 (RLP-7.5) g of RLP/kg of diet for eight consecutive weeks. Semen characteristics were evaluated weekly. Sperm penetration rate was assessed once, however, fertility, hatchability, embryonic mortality and hatchling quality evaluated twice (using eggs collected during 1st and 2nd weeks following AI) at the end of experiment. Excluding body weight and sperm abnormality percentage, other traits including semen concentration (RLP-2.5 = 3.57, RLP-5 = 4.21 and RLP-7.5 = 3.79; SEM = 0.12; p roosters. Further studies are needed to divulge the causal mechanisms involved. Copyright © 2017 Elsevier Inc. All rights reserved.

  11. The effect of rosemary (Rosmarinus officinalis L.) extract on the oxidative stability of lipids in cow and soy milk enriched with fish oil.

    Science.gov (United States)

    Qiu, Xujian; Jacobsen, Charlotte; Sørensen, Ann-Dorit Moltke

    2018-10-15

    Lipid oxidation of fish oil enriched cow milk and soy milk supplemented with rosemary extract stored at 2 °C was studied. Both peroxide value and volatile secondary lipid oxidation products were determined to monitor the progress of lipid oxidation. Rosemary extract inhibited lipid oxidation in fish oil enriched cow milk. In contrast, soy milk samples having much higher unsaturated fatty acid content showed higher lipid oxidation stability compared to cow milk. Reduction in the content of chlorogenic acid during storage suggested that this compound may contribute to the lipid oxidation stability of fish oil enriched soy milk product. Total carnosic acid and carnosol concentration declined much faster in soy milk than in cow milk. It is suggested from the results that food components could have significant impact on the fate of bioactive antioxidant compounds in a specific food product during storage. Copyright © 2018 Elsevier Ltd. All rights reserved.

  12. Artificial intelligence in neurodegenerative disease research: use of IBM Watson to identify additional RNA-binding proteins altered in amyotrophic lateral sclerosis.

    Science.gov (United States)

    Bakkar, Nadine; Kovalik, Tina; Lorenzini, Ileana; Spangler, Scott; Lacoste, Alix; Sponaugle, Kyle; Ferrante, Philip; Argentinis, Elenee; Sattler, Rita; Bowser, Robert

    2018-02-01

    Amyotrophic lateral sclerosis (ALS) is a devastating neurodegenerative disease with no effective treatments. Numerous RNA-binding proteins (RBPs) have been shown to be altered in ALS, with mutations in 11 RBPs causing familial forms of the disease, and 6 more RBPs showing abnormal expression/distribution in ALS albeit without any known mutations. RBP dysregulation is widely accepted as a contributing factor in ALS pathobiology. There are at least 1542 RBPs in the human genome; therefore, other unidentified RBPs may also be linked to the pathogenesis of ALS. We used IBM Watson ® to sieve through all RBPs in the genome and identify new RBPs linked to ALS (ALS-RBPs). IBM Watson extracted features from published literature to create semantic similarities and identify new connections between entities of interest. IBM Watson analyzed all published abstracts of previously known ALS-RBPs, and applied that text-based knowledge to all RBPs in the genome, ranking them by semantic similarity to the known set. We then validated the Watson top-ten-ranked RBPs at the protein and RNA levels in tissues from ALS and non-neurological disease controls, as well as in patient-derived induced pluripotent stem cells. 5 RBPs previously unlinked to ALS, hnRNPU, Syncrip, RBMS3, Caprin-1 and NUPL2, showed significant alterations in ALS compared to controls. Overall, we successfully used IBM Watson to help identify additional RBPs altered in ALS, highlighting the use of artificial intelligence tools to accelerate scientific discovery in ALS and possibly other complex neurological disorders.

  13. Effect of rosemary extract and TBHQ on the stability of radish seed oil

    International Nuclear Information System (INIS)

    Gongling, Z.; Yancheng, G.

    2016-01-01

    The effects of rosemary extract (RE) and tert-Butylhydroquinone (TBHQ) on the storage stability of radish seed oil were studied according to the change of the acid value, peroxide value, tocopherol and sulforaphene in radish seed oil. The results showed that under conditions of accelerated oxidation by (60+-1) degree C, the storage stability of the radish seed oil with antioxidants could be significantly improved, among which TBHQ was better than RE. Besides, RE and TBHQ had a synergistic effect on antioxidation. The compound of 0.01% RE and 0.01% TBHQ had a better antioxidation effect than 0.07% RE and 0.02% TBHQ respectively, which recommended it can be a suitable antioxidant of radish seed oil. (author)

  14. Hazardous Waste Cleanup: IBM Corporation-TJ Watson Research Center in Yorktown Heights, New York

    Science.gov (United States)

    IBM Corporation -TJ Watson Research Center is located in southern Yorktown near the boundary separating the Town of Yorktown from the Town of New Castle. The site occupies an area of approximately 217 acres and adjoins land uses are predominantly residenti

  15. Effects of Fertilizer Types and Irrigation Intervals of on Quantity Criteria of Lavender (Lavandula angustifolia, Rosemary (Rosemarinus officinalis and Hyssop (Hyssopus officinalis

    Directory of Open Access Journals (Sweden)

    A Koocheki

    2012-02-01

    Full Text Available In order to investigate the effects of fertilizer types and irrigation regimes on quantitative criteria of three medicinal plants: lavander, rosemary and hyssop, an experiment was conducted at Research Field of Faculty of Agriculture, Ferdowsi University of Mashhad, during two growing years of 2007-2010. A split-split plot design with three replications was used. Treatments were three irrigation intervals (10, 20, 30 days as main plots and three types of fertilizers in six levels: control, Nitroxin containing Azotobacter sp. and Azospirilum sp. (5lit/ha, nitrogen fertilizer (50 and 100 kg/ha, cow manure (10 and 20 ton/ha as subplots. Animal manure and chemical fertilizer were applied at the time of transferring seedlings to the field and Nitroxin was used with the first irrigation. Shoot harvesting was performed twice during the plant growth at the time of full flowering. Increasing irrigation intervals reduced dry matter yield of three species and the highest yield of lavender (3990 kg/ha, rosemary (2380 kg/ha and hyssop (7380 kg/ha were obtained with 10 days interval. Also the effect of fertilizer was not significant but the highest yield for lavender (3930kg/ha, rosemary (2535kg/ha was obtained with 50 kg/ha chemical fertilizer and the highest yield of hyssop (6117kg/ha resulted in application of 20 ton/ha animal manure. The ratio of leaf dry weight to stem dry weight for both years was gained with 30 days irrigation interval at 20 ton/ha animal manure. In general, the best treatment was 30 days interval irrigation and 20 ton/ha animal manure for the best yield and respective in local conditions

  16. The circumstances of the missing biographer or why Watson didn't narrate these four Sherlock Holmes stories.

    Science.gov (United States)

    Caplan, R M

    1982-06-01

    The author provides arguments to explain why four of Arthur Conan Doyle's sixty stories about Sherlock Holmes were not narrated by Dr. Watson. The arguments relate to logical demands of the plot in the cases of the two stories told by an unidentified narrator. The two told by Holmes seem to demand Watson's absence because the final elucidation requires skill in cutaneous diagnosis; the presence of a medical man would have, or should have, relieved the dramatic tension of the mystery too soon. The Sherlock Holmes stories can provide delightful diversion as well as serve constantly to enhance our appreciation for highly alert and careful physical examination.

  17. Hydration of Watson-Crick base pairs and dehydration of Hoogsteen base pairs inducing structural polymorphism under molecular crowding conditions.

    Science.gov (United States)

    Miyoshi, Daisuke; Nakamura, Kaori; Tateishi-Karimata, Hisae; Ohmichi, Tatsuo; Sugimoto, Naoki

    2009-03-18

    It has been revealed recently that molecular crowding, which is one of the largest differences between in vivo and in vitro conditions, is a critical factor determining the structure, stability, and function of nucleic acids. However, the effects of molecular crowding on Watson-Crick and Hoogsteen base pairs remain unclear. In order to investigate directly and quantitatively the molecular crowding effects on base pair types in nucleic acids, we designed intramolecular parallel- and antiparallel-stranded DNA duplexes consisting of Hoogsteen and Watson-Crick base pairs, respectively, as well as an intramolecular parallel-stranded triplex containing both types of base pairs. Thermodynamic analyses demonstrated that the values of free energy change at 25 degrees C for Hoogsteen base-pair formations decreased from +1.45 +/- 0.15 to +1.09 +/- 0.13 kcal mol(-1), and from -1.89 +/- 0.13 to -2.71 +/- 0.11 kcal mol(-1) in the intramolecular duplex and triplex, respectively, when the concentration of PEG 200 (polyethylene glycol with average molecular weight 200) increased from 0 to 20 wt %. However, corresponding values for Watson-Crick formation in the duplex and triplex increased from -10.2 +/- 0.2 to -8.7 +/- 0.1 kcal mol(-1), and from -10.8 +/- 0.2 to -9.2 +/- 0.2 kcal mol(-1), respectively. Furthermore, it was revealed that the opposing effects of molecular crowding on the Hoogsteen and Watson-Crick base pairs were due to different behaviors of water molecules binding to the DNA strands.

  18. Silver(I)-Mediated Base Pairs in DNA Sequences Containing 7-Deazaguanine/Cytosine: towards DNA with Entirely Metallated Watson-Crick Base Pairs.

    Science.gov (United States)

    Méndez-Arriaga, José M; Maldonado, Carmen R; Dobado, José A; Galindo, Miguel A

    2018-03-26

    DNA sequences comprising noncanonical 7-deazaguanine ( 7C G) and canonical cytosine (C) are capable of forming Watson-Crick base pairs via hydrogen bonds as well as silver(I)-mediated base pairs by coordination to central silver(I) ions. Duplexes I and II containing 7C G and C have been synthesized and characterized. The incorporation of silver(I) ions into these duplexes has been studied by means of temperature-dependent UV spectroscopy, circular dichroism, and DFT calculations. The results suggest the formation of DNA molecules comprising contiguous metallated 7C G-Ag I -C Watson-Crick base pairs that preserve the original B-type conformation. Furthermore, additional studies performed on duplex III indicated that, in the presence of Ag I ions, 7C G-C and 7C A-T Watson-Crick base pairs ( 7C A, 7-deazadenine; T, thymine) can be converted to metallated 7C G-Ag I -C and 7C A-Ag I -T base pairs inside the same DNA molecule whilst maintaining its initial double helix conformation. These findings are very important for the development of customized silver-DNA nanostructures based on a Watson-Crick complementarity pattern. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  19. The Watson-Glaser Critical Thinking Appraisal and the Performance of Business Management Students.

    Science.gov (United States)

    Hicks, R. E.; Southey, G. N.

    1990-01-01

    The 80-item Watson-Glaser Critical Thinking Appraisal-Form A was administered to 415 business management students in Australia as a step toward adapting the test for Australian use. The results correspond reasonably closely to the U.S. data. Analysis of group results and item statistics provided information about necessary modifications. (SLD)

  20. New insights into the parametrization of temperature and light responses of mono - and sesquiterpene emissions from Aleppo pine and rosemary

    Science.gov (United States)

    Staudt, M.; Bourgeois, I.; Al Halabi, R.; Song, W.; Williams, J.

    2017-03-01

    Phytogenic emission of large volatile organic compounds (VOCs) such as monoterpenes (MTs) and sesquiterpenes (SQTs) are key precursors to the formation and growth of atmospheric particles. However, controlled environment studies to elucidate emission responses to temperature and light are still sparse. In this study, the volatile contents and emission responses of Aleppo pine and Rosemary have been investigated. These two common Mediterranean species store semivolatiles inside (resin ducts) and outside (trichomes) their foliage tissues respectively. Both species emitted mainly MTs with basal emission rates of around 5 (Rosemary) and 10 (pine) μg g-1 h-1 and SQTs about one order of magnitude lower. In Aleppo pine, two volatile sources could be clearly distinguished: 1) de-novo synthesized emission of (E)-β-ocimene and linalool, which accounted for about 70% of the total VOC release, were not found in foliar VOC extracts and expressed light dependency (LD) and temperature responses typical for enzyme driven emissions; and 2) storage-derived emissions of various MTs and SQTs whose emissions increased exponentially with temperature, showed no light dependency and were all present in leaf extracts. In Rosemary, all emitted MTs and SQTs including many oxygenated compounds, showed responses typical for stored volatiles and were all found in leaf extracts. The emissions of individual volatiles or volatile classes could be well described with the commonly applied empirical algorithms developed for LD or non LD emissions. However, the shapes of the temperature responses, and hence the deduced coefficient values, were significantly different between oxygenated and non-oxygenated compounds. They also differed between the storage-derived emissions of the two plant species, for individual VOCs or VOC classes. We address the possible reasons for this variation in temperature responses and argue that they are mostly due to molecular interactions along the species specific leaf

  1. Quasi-four-particle first-order Faddeev-Watson-Lovelace terms in proton-helium scattering

    Science.gov (United States)

    Safarzade, Zohre; Akbarabadi, Farideh Shojaei; Fathi, Reza; Brunger, Michael J.; Bolorizadeh, Mohammad A.

    2017-06-01

    The Faddeev-Watson-Lovelace equations, which are typically used for solving three-particle scattering problems, are based on the assumption of target having one active electron while the other electrons remain passive during the collision process. So, in the case of protons scattering from helium or helium-like targets, in which there are two bound-state electrons, the passive electron has a static role in the collision channel to be studied. In this work, we intend to assign a dynamic role to all the target electrons, as they are physically active in the collision. By including an active role for the second electron in proton-helium-like collisions, a new form of the Faddeev-Watson-Lovelace integral equations is needed, in which there is no disconnected kernel. We consider the operators and the wave functions associated with the electrons to obey the Pauli exclusion principle, as the electrons are indistinguishable. In addition, a quasi-three-particle collision is assumed in the initial channel, where the electronic cloud is represented as a single identity in the collision.

  2. The Effect of Nonzero Autocorrelation Coefficients on the Distributions of Durbin-Watson Test Estimator: Three Autoregressive Models

    Directory of Open Access Journals (Sweden)

    Mei-Yu LEE

    2014-11-01

    Full Text Available This paper investigates the effect of the nonzero autocorrelation coefficients on the sampling distributions of the Durbin-Watson test estimator in three time-series models that have different variance-covariance matrix assumption, separately. We show that the expected values and variances of the Durbin-Watson test estimator are slightly different, but the skewed and kurtosis coefficients are considerably different among three models. The shapes of four coefficients are similar between the Durbin-Watson model and our benchmark model, but are not the same with the autoregressive model cut by one-lagged period. Second, the large sample case shows that the three models have the same expected values, however, the autoregressive model cut by one-lagged period explores different shapes of variance, skewed and kurtosis coefficients from the other two models. This implies that the large samples lead to the same expected values, 2(1 – ρ0, whatever the variance-covariance matrix of the errors is assumed. Finally, comparing with the two sample cases, the shape of each coefficient is almost the same, moreover, the autocorrelation coefficients are negatively related with expected values, are inverted-U related with variances, are cubic related with skewed coefficients, and are U related with kurtosis coefficients.

  3. Identification and quantification of a major anti-oxidant and anti-inflammatory phenolic compound found in basil, lemon, thyme, mint, oregano, rosemary, sage, and thyme

    Science.gov (United States)

    Basil, lemon thyme, mint, oregano, rosemary, sage, and thyme are in the mint family of plants that are used as culinary herbs world-wide. These herbs contain phenolic compounds that are believed to have strong antioxidant and anti-inflammatory activities. Therefore, the major phenolic compounds fr...

  4. Stability of non-Watson-Crick G-A/A-G base pair in synthetic DNA and RNA oligonucleotides.

    Science.gov (United States)

    Ito, Yuko; Sone, Yumiko; Mizutani, Takaharu

    2004-03-01

    A non-Watson-Crick G-A/A-G base pair is found in SECIS (selenocysteine-insertion sequence) element in the 3'-untranslated region of Se-protein mRNAs and in the functional site of the hammerhead ribozyme. We studied the stability of G-A/A-G base pair (bold) in 17mer GT(U)GACGGAAACCGGAAC synthetic DNA and RNA oligonucleotides by thermal melting experiments and gel electrophoresis. The measured Tm value of DNA oligonucleotide having G-A/A-G pair showed an intermediate value (58 degrees C) between that of Watson-Crick G-C/C-G base pair (75 degrees C) and that of G-G/A-A of non-base-pair (40 degrees C). Similar thermal melting patterns were obtained with RNA oligonucleotides. This result indicates that the secondary structure of oligonucleotide having G-A/A-G base pair is looser than that of the G-C type Watson-Crick base pair. In the comparison between RNA and DNA having G-A/A-G base pair, the Tm value of the RNA oligonucleotide was 11 degrees C lower than that of DNA, indicating that DNA has a more rigid structure than RNA. The stained pattern of oligonucleotide on polyacrylamide gel clarified that the mobility of the DNA oligonucleotide G-A/A-G base pair changed according to the urea concentration from the rigid state (near the mobility of G-C/C-G oligonucleotide) in the absence of urea to the random state (near the mobility of G-G/A-A oligonucleotide) in 7 M urea. However, the RNA oligonucleotide with G-A/A-G pair moved at an intermediate mobility between that of oligonucleotide with G-C/C-G and of the oligonucleotide with G-G/A-A, and the mobility pattern did not depend on urea concentration. Thus, DNA and RNA oligonucleotides with the G-A/A-G base pair showed a pattern indicating an intermediate structure between the rigid Watson-Crick base pair and the random structure of non-base pair. RNA with G-A/A-G base pair has the intermediate structure not influenced by urea concentration. Finally, this study indicated that the intermediate rigidity imparted by Non-Watson

  5. The McLean-Watson line strength formula and its implementation

    International Nuclear Information System (INIS)

    Hey, J D

    2009-01-01

    We consider the application of the line strength formula recently derived by Watson (2006 J. Phys. B: At. Mol. Opt. Phys. 39 L291) to transitions between states of high principal quantum number in hydrogenic atoms and ions (Rydberg-Rydberg transitions). Apparent difficulties in the implementation of this formula are overcome by the use of recurrence relations derived by the ladder operator technique of Infeld and Hull (1951 Rev. Mod. Phys. 23 21), and set out in an earlier paper by the present author (2006 J. Phys. B: At. Mol. Opt. Phys. 39 2641). The use of the McLean-Watson formula for such cases is illustrated by the determination of the radiative lifetimes for levels with n ∼ 1000 and comparison of present results with approximate formulae. Interest in this work on the radial matrix elements for large n and n' is related both to measurements of radio recombination lines from tenuous space plasmas, e.g. Stepkin et al (2007 Mon. Not. R. Astron. Soc. 374 852) and to the calculation of Stark broadening for such spectra, e.g. Gigosos et al (2007 Astron. Astrophys. 466 1189), Stambulchik et al (2007 Phys. Rev. E 75 016401) and Stambulchik and Maron (2008 J. Phys. B: At. Mol. Opt. Phys. 41 095703). In addition, we discuss the question of inaccuracy caused by the omission of fine structure in such calculations, and the numerical stability of the recurrence relations used to implement the line strength formulae.

  6. [Analysis of Conformational Features of Watson-Crick Duplex Fragments by Molecular Mechanics and Quantum Mechanics Methods].

    Science.gov (United States)

    Poltev, V I; Anisimov, V M; Sanchez, C; Deriabina, A; Gonzalez, E; Garcia, D; Rivas, F; Polteva, N A

    2016-01-01

    It is generally accepted that the important characteristic features of the Watson-Crick duplex originate from the molecular structure of its subunits. However, it still remains to elucidate what properties of each subunit are responsible for the significant characteristic features of the DNA structure. The computations of desoxydinucleoside monophosphates complexes with Na-ions using density functional theory revealed a pivotal role of DNA conformational properties of single-chain minimal fragments in the development of unique features of the Watson-Crick duplex. We found that directionality of the sugar-phosphate backbone and the preferable ranges of its torsion angles, combined with the difference between purines and pyrimidines. in ring bases, define the dependence of three-dimensional structure of the Watson-Crick duplex on nucleotide base sequence. In this work, we extended these density functional theory computations to the minimal' fragments of DNA duplex, complementary desoxydinucleoside monophosphates complexes with Na-ions. Using several computational methods and various functionals, we performed a search for energy minima of BI-conformation for complementary desoxydinucleoside monophosphates complexes with different nucleoside sequences. Two sequences are optimized using ab initio method at the MP2/6-31++G** level of theory. The analysis of torsion angles, sugar ring puckering and mutual base positions of optimized structures demonstrates that the conformational characteristic features of complementary desoxydinucleoside monophosphates complexes with Na-ions remain within BI ranges and become closer to the corresponding characteristic features of the Watson-Crick duplex crystals. Qualitatively, the main characteristic features of each studied complementary desoxydinucleoside monophosphates complex remain invariant when different computational methods are used, although the quantitative values of some conformational parameters could vary lying within the

  7. Flouting maxim by sherlock holmes and dr. Watson in tv series Of sherlock season

    Directory of Open Access Journals (Sweden)

    Lina Affifatusholihah

    2017-04-01

    In running daily activities, people will always meet and interact with other people, and language is a medium that is used by humans to interact with each other. In a conversation or discussion, everyone should pay attention to the four maxims in order that there are no errors in communication. However, it is not uncommon that the four rules above are breached by the speakers. This is called non-observance of the maxims, and one of a non-observance of the maxims that often occurs in is flouting maxim. The aims of this paper are to describe types of maxims that are flouted by Sherlock Holmes and dr. Watson as well as to describe how the maxims are flouted in Sherlock TV series season 1. This research used qualitative descriptive method. The researcher classifies the utterances to know what kind of maxim which are flouted, categorizes those into the category based on the Grice’s theory of Cooperative Principle, namely: maxim of quantity, quality, relation and manner. The research procedure begin by searching the script in the internet, matching the utterances in the script and in film and sorting the utterances between Sherlock Holmes and dr. Watson as well observing every word or sentence which are flouted by the main characters. The findings find that all kinds of maxims are flouted by Sherlock and dr. Watson. The result of analysis shows that the maxim flouted when the speakers say something irrelevant; something roguishness or lied to hide the truth in the form of rhetorical question; the information becomes more or too informative than what is required; and something obscurity of expression, ambiguity, or unnecessary prolixity.

  8. Effect of Irrigation Intervals, Type of Fertilizers and Harvesting Time on Essence Content and Yield of Three Medicinal Plants: Lavender (lavandula angustifolia, Rosemary (Rosemarinus officinalis and Hyssop (Hyssopus officinalis in Mashhad Condition.

    Directory of Open Access Journals (Sweden)

    A Koocheki

    2012-12-01

    Full Text Available In order to investigate the effect of fertilizer types and irrigation regimes on quality criteria of three medicinal plants: Lavander, Rosemary and Hyssop, an experiment was conducted at Research Field of Faculty of Agriculture, Ferdowsi University of Mashhad, during two growing years of 2007-2009. A split plot design with three replications was used. Treatments were three irrigation intervals (10, 20, 30 days as main plots and six fertilizers: including (control, Nitroxin (5lit/ha, nitrogen fertilizer (50 and 100 (kg/ha, cow manure (10 and 20 ton/ha and three medicinal plants as sub-subplots. Animal manure and chemical fertilizer were applied at the time of transferring seedlings to the field and Nitroxin was used with the first irrigation. Results indicated that the effect of irrigation intervals on yield of essential oil in all species was significant (p≤0.01. The highest essential oil content was from Rosemary (1.5% but the highest yield of essential oil was obtained from three species, Lavander (10kg/ha, Rosemary (7kg/ha and Hyssop (12kg/ha with application of biological fertilizer. Application of fertilizer affected significantly (P

  9. James Watson's most inconvenient truth: race realism and the moralistic fallacy.

    Science.gov (United States)

    Rushton, J Philippe; Jensen, Arthur R

    2008-11-01

    Recent editorials in this journal have defended the right of eminent biologist James Watson to raise the unpopular hypothesis that people of sub-Saharan African descent score lower, on average, than people of European or East Asian descent on tests of general intelligence. As those editorials imply, the scientific evidence is substantial in showing a genetic contribution to these differences. The unjustified ill treatment meted out to Watson therefore requires setting the record straight about the current state of the evidence on intelligence, race, and genetics. In this paper, we summarize our own previous reviews based on 10 categories of evidence: The worldwide distribution of test scores; the g factor of mental ability; heritability differences; brain size differences; trans-racial adoption studies; racial admixture studies; regression-to-the-mean effects; related life-history traits; human origins research; and the poverty of predictions from culture-only explanations. The preponderance of evidence demonstrates that in intelligence, brain size, and other life-history variables, East Asians average a higher IQ and larger brain than Europeans who average a higher IQ and larger brain than Africans. Further, these group differences are 50-80% heritable. These are facts, not opinions and science must be governed by data. There is no place for the "moralistic fallacy" that reality must conform to our social, political, or ethical desires.

  10. Comparative Study of Green Sub- and Supercritical Processes to Obtain Carnosic Acid and Carnosol-Enriched Rosemary Extracts with in Vitro Anti-Proliferative Activity on Colon Cancer Cells

    Directory of Open Access Journals (Sweden)

    Andrea del Pilar Sánchez-Camargo

    2016-12-01

    Full Text Available In the present work, four green processes have been compared to evaluate their potential to obtain rosemary extracts with in vitro anti-proliferative activity against two colon cancer cell lines (HT-29 and HCT116. The processes, carried out under optimal conditions, were: (1 pressurized liquid extraction (PLE, using an hydroalcoholic mixture as solvent at lab-scale; (2 Single-step supercritical fluid extraction (SFE at pilot scale; (3 Intensified two-step sequential SFE at pilot scale; (4 Integrated PLE plus supercritical antisolvent fractionation (SAF at pilot scale. Although higher extraction yields were achieved by using PLE (38.46% dry weight, this extract provided the lowest anti-proliferative activity with no observed cytotoxic effects at the assayed concentrations. On the other hand, extracts obtained using the PLE + SAF process provided the most active rosemary extracts against both colon cancer cell lines, with LC50 ranging from 11.2 to 12.4 µg/mL and from 21.8 to 31.9 µg/mL for HCT116 and HT-29, respectively. In general, active rosemary extracts were characterized by containing carnosic acid (CA and carnosol (CS at concentrations above 263.7 and 33.9 mg/g extract, respectively. Some distinct compounds have been identified in the SAF extracts (rosmaridiphenol and safficinolide, suggesting their possible role as additional contributors to the observed strong anti-proliferative activity of CA and CS in SAF extracts.

  11. Short-term effects of black pepper (Piper nigrum) and rosemary (Rosmarinus officinalis and Rosmarinus eriocalyx) on sustained attention and on energy and fatigue mood states in young adults with low energy.

    Science.gov (United States)

    Lindheimer, Jacob B; Loy, Bryan D; O'Connor, Patrick J

    2013-08-01

    The purpose was to test whether a single dose of black pepper or rosemary produced short-term enhancements in sustained attention, motivation to perform cognitive tasks, or feelings of mental energy and fatigue. Outcomes were measured in 40 young adults with below average feelings of energy before and twice after they orally consumed capsules containing either black pepper (2.0 g), rosemary (1.7 g), or a placebo (3.1 g rice flour). Sustained attention was measured using a 16-min dual task, in which, single-digit numbers were presented every second on a screen and the participant performed both a primary task [detection of three successive, different odd digits] and a secondary task [detection of the number 6]. Feelings of energy and fatigue were measured using the vigor and fatigue subscales of the Profile of Mood States and visual analog scales (VAS). Analysis of variance showed nonsignificant condition (spice versus placebo)×time (T1, T2, & T3) effects for motivation, measured with a VAS, and the intensity of energy and fatigue feelings. Unadjusted effect sizes revealed that rosemary induced small, transient reductions in false alarm errors (d=0.21) and mental fatigue (d=0.40) at isolated time periods. Time-varying analysis of covariance, controlling for motivation to perform cognitive tasks, showed no significant effects on the primary or secondary task outcomes of correct responses (hits), errors (false alarms, misses), speed of response (reaction time), and signal detection sensitivity. It is concluded that black pepper and rosemary, consumed in a capsule form, in the doses used and while wearing a nose clip to block olfactory effects, do not induce consistent short-term improvements in sustained attention, motivation to perform cognitive tasks, or feelings of mental energy and fatigue in young adults with low energy.

  12. Human DNA primase uses Watson-Crick hydrogen bonds to distinguish between correct and incorrect nucleoside triphosphates.

    Science.gov (United States)

    Moore, Chad L; Zivkovic, Aleksandra; Engels, Joachim W; Kuchta, Robert D

    2004-09-28

    Human DNA primase synthesizes short RNA primers that DNA polymerase alpha further elongates. Primase readily misincorporates the natural NTPs and will generate a wide variety of mismatches. In contrast, primase exhibited a remarkable resistance to polymerizing NTPs containing unnatural bases. This included bases whose shape was almost identical to the natural bases (4-aminobenzimidazole and 4,6-difluorobenzimidazole), bases shaped very differently than a natural base [e.g., 5- and 6-(trifluoromethyl)benzimidazole], bases much more hydrophobic than a natural base [e.g., 4- and 7-(trifluoromethyl)benzimidazole], bases of similar hydrophobicity as a natural base but with the Watson-Crick hydrogen-bonding groups in unusual positions (7-beta-D-guanine), and bases capable of forming only one Watson-Crick hydrogen bond with the template base (purine and 4-aminobenzimidazole). Primase only polymerized NTP analogues containing bases capable of forming hydrogen bonds between the equivalent of both N-1 and the exocyclic group at C-6 of a purine NTP (2-fluoroadenine, 2-chloroadenine, 3-deazaadenine, and hypoxanthine) and N-3 and the exocyclic group at C-4 of a pyrimidine. These data indicate that human primase requires the formation of Watson-Crick hydrogen bonds in order to polymerize a NTP, a situation very different than what is observed with some DNA polymerases. The implications of these results with respect to current theories of how polymerases discriminate between right and wrong (d)NTPs are discussed.

  13. Rosemary Aromatization of Extra Virgin Olive Oil and Process Optimization Including Antioxidant Potential and Yield

    Directory of Open Access Journals (Sweden)

    Erkan Karacabey

    2016-08-01

    Full Text Available Aromatization of olive oil especially by spices and herbs has been widely used technique throughout the ages in Mediterranean diets. The present study was focused on aromatization of olive oil by rosemary (Rosmarinus officinalis L.. Aromatization process was optimized by response surface methodology as a function of malaxation’s conditions (temperature and time. According to authors’ best knowledge it was first time for examination of oil yield performance with antioxidant potential and pigments under effect of aromatization parameters. For all oil samples, values of the free acidity, peroxide, K232 and K270 as quality parameters fell within the ranges established for the highest quality category “extra virgin oil”. Oil yield (mL oil/kg olive paste changed from 158 to 208 with respect to design parameters. Total phenolic content and free radical scavenging activity as antioxidant potential of olive oil samples were varied in the range of 182.44 – 348.65 mg gallic acid equivalent/kg oil and 28.91 – 88.75 % inhibition of 2,2-Diphenyl-1-picrylhydrazyl-(DPPH•, respectively. Total contents of carotenoid, chlorophyll and pheophytin a as pigments in oil samples were found to be in between 0.09 – 0.48 mg carotenoid/kg oil, 0.11 – 0.96 mg chlorophyll/kg oil, 0.15 – 4.44 mg pheo α/kg oil, respectively. The proposed models for yield, pigments and antioxidant potential responses were found to be good enough for successful prediction of experimental results. Total phenolics, carotenoids and free radical scavenging activity of aromatized olive oil and oil yield were maximized to gather and optimal conditions were determined as 25°C, 84 min, and 2 % (Rosemary/olive paste; w/w.

  14. Crystal structure of an intermolecular 2:1 complex between adenine and thymine. Evidence for both Hoogsteen and 'quasi-Watson-Crick' interactions.

    Science.gov (United States)

    Chandrasekhar, Sosale; Naik, Tangali R Ravikumar; Nayak, Susanta K; Row, Tayur N Guru

    2010-06-15

    The titled complex, obtained by co-crystallization (EtOH/25 degrees C), is apparently the only known complex of the free bases. Its crystal structure, as determined by X-ray diffraction at both 90 K and 313 K, showed that one A-T pair involves a Hoogsteen interaction, and the other a Watson-Crick interaction but only with respect to the adenine unit. The absence of a clear-cut Watson-Crick base pair raises intriguing questions about the basis of the DNA double helix. Copyright 2010 Elsevier Ltd. All rights reserved.

  15. Comparative Phenolic Fingerprint and LC-ESI+QTOF-MS Composition of Oregano and Rosemary Hydrophilic Extracts in Relation to their Antibacterial Effect

    OpenAIRE

    Florina Bunghez; Mihaela Ancuţa Morar; Raluca Maria Pop; Florina Romanciuc; Florina Csernatoni; Florinela Fetea; Zoriţa Diaconeasa; Carmen Socaciu

    2015-01-01

    Rosemary (Rosmarinus officinalis) and oregano (Origanum vulgare) are known aromatic plants used as spice, with good flavoring, preservative, antioxidant and antibacterial activity. Beside their known terpenoid content responsible for the antibacterial activity, the water-soluble compounds (phenolic derivatives) are of high interest not only for their antioxidant activity but as a good alternative or as a hydrophilic new antibacterial solution. Two hydrophilic extracts from each plant were obt...

  16. Substituent effif ects on hydrogen bonding in Watson-Crick base pairs. A theoretical study

    NARCIS (Netherlands)

    Fonseca Guerra, C.; van der Wijst, T.; Bickelhaupt, F.M.

    2005-01-01

    We have theoretically analyzed Watson-Crick AT and GC base pairs in which purine C8 and/or pyrimidine C6 positions carry a substituent X = H, F, Cl or Br, using the generalized gradient approximation (GGA) of density functional theory at BP86/TZ2P. The purpose is to study the effects on structure

  17. Whitefly attraction to rosemary (Rosmarinus officinialis L. is associated with volatile composition and quantity.

    Directory of Open Access Journals (Sweden)

    Dganit Sadeh

    Full Text Available Whitefly (Bemisia tabaci is an important insect pest, causing severe damage to agricultural crops. The pest was recorded in a commercial rosemary (Rosmarinus officinalis, Lamiaceae field, colonizing rosemary variety (var. '2', but not '11'. A series of field and controlled laboratory choice bioassays confirmed the observed phenomenon. Mature potted plants of the two varieties were randomly organized in a lemon verbena (Lippia citrodora and lemon grass (Cymbopogon spp. fields. Seven days later var. '2' was significantly more colonized by whiteflies than var. '11'. Under lab conditions, whiteflies were significantly more attracted to var. '2' plantlets than to var. '11' following choice bioassays. Furthermore, cotton plants dipped in an essential oil emulsion of var. '2' had significantly greater colonization than cotton plants dipped in the essential oil emulsion of var. '11'. Similar results were obtained in 'plant-plant', 'plant-no plant' as well as, 'essential oil-essential oil' choice bioassay designs. Analyses of the essential oils of the two varieties identified a set of common and unique volatiles in each variety. Among these volatiles were β-caryophyllene and limonene, two compounds known to be associated with plant-insect interactions. The attraction of B. tabaci to pure (>95% β-caryophyllene and limonene using a range of concentrations was examined in vitro by choice bioassays. The compounds were attractive to the insect at moderate concentration, but not at the lowest or highest concentrations used, where the insect was not attracted or repelled, respectively. Limonene attracted the insects at rates that were 10-fold lower than β-caryophyllene. The results emphasized the role of host plant volatiles in shaping the structure of B. tabaci populations in nature and in agricultural systems, and provided insights into the factors that contribute to the development of insect populations with unique characteristics. The results could also

  18. Photoinduced electron transfer in a Watson-Crick base-paired, 2-aminopurine:uracil-C60 hydrogen bonding conjugate.

    Science.gov (United States)

    D'Souza, Francis; Gadde, Suresh; Islam, D-M Shafiqul; Pang, Siew-Cheng; Schumacher, Amy Lea; Zandler, Melvin E; Horie, Rumiko; Araki, Yasuyaki; Ito, Osamu

    2007-02-07

    A fluorescent reporter molecule, 2-aminopurine was self-assembled via Watson-Crick base-pairing to a uracil appended fullerene to form a donor-acceptor conjugate; efficient photoinduced charge separation was confirmed by time-resolved emission and transient absorption spectral studies.

  19. Mispairs with Watson-Crick base-pair geometry observed in ternary complexes of an RB69 DNA polymerase variant.

    Science.gov (United States)

    Xia, Shuangluo; Konigsberg, William H

    2014-04-01

    Recent structures of DNA polymerase complexes with dGMPCPP/dT and dCTP/dA mispairs at the insertion site have shown that they adopt Watson-Crick geometry in the presence of Mn(2+) indicating that the tautomeric or ionization state of the base has changed. To see whether the tautomeric or ionization state of base-pair could be affected by its microenvironment, we determined 10 structures of an RB69 DNA polymerase quadruple mutant with dG/dT or dT/dG mispairs at position n-1 to n-5 of the Primer/Template duplex. Different shapes of the mispairs, including Watson-Crick geometry, have been observed, strongly suggesting that the local environment of base-pairs plays an important role in their tautomeric or ionization states. © 2014 The Protein Society.

  20. Aplicação da Teoria do Cuidado Transpessoal de Jean Watson: uma década de produção brasileira Aplicación de la Teoría del Cuidado Transpersonal de Jean Watson: una década de producción brasileña Jean Watson's Theory of Human Caring: a decade of Brazilian publications

    Directory of Open Access Journals (Sweden)

    Luciane Favero

    2009-01-01

    Full Text Available Esta revisão sistemática objetivou descrever e analisar a aplicação da Teoria do Cuidado Transpessoal de Jean Watson nas pesquisas divulgadas em publicações de Enfermagem brasileiras dos últimos dez anos. O levantamento bibliográfico abrangeu 34 produções científicas selecionadas nas bases de dados eletrônicas MEDLINE (MEDLARS [Medical Literature Analysis and Retrieval System] On-line, LILACS (Literatura Latino Americana e do Caribe em Ciências da Saúde, BDENF (Base de dados de Enfermagem e SciELO (Scientific Electronic Library On-line, que após aplicação dos critérios de inclusão estabelecidos, compuseram a amostra do estudo. Os resultados apontaram que a Região Sul concentra 61,8% das produções referidas ao tema de estudo, que ela pode ser aplicada nos níveis de atenção primária, secundária e terciária e que 64,7% das produções utilizam os fatores de cuidado propostos por Jean Watson em 1979. Emerge a necessidade de aprimoramento das pesquisas acerca da transformação ocorrida na Teoria do Cuidado Transpessoal, com abordagem do Processo Clinical Caritas, porém como são escassos os estudos referentes a esta temática, dificultam sua utilização prática.Esta revisión sistemática tuvo como objetivo describir y analizar la aplicación de la Teoría del Cuidado Transpersonal de Jean Watson en las investigaciones divulgadas en publicaciones de Enfermería brasileñas de los últimos diez años. El levantamiento bibliográfico abarcó 34 producciones seleccionadas en las bases de datos electrónicas MEDLINE (MEDLARS [Medical Literature Analysis and Retrieval System] On-line, LILACS (Literatura Latinoamericana y del Caribe en Ciencias de la Salud, BDENF (Base de datos de Enfermería y SciELO (Scientific Electronic Library On-line, que después de la aplicación de los criterios de inclusión establecidos, compusieron la muestra del estudio. Los resultados señalaron que la región Sur concentra el 61,8% de las

  1. DNA polymerase catalysis in the absence of Watson-Crick hydrogen bonds

    Science.gov (United States)

    Potapova, Olga; Chan, Chikio; DeLucia, Angela M.; Helquist, Sandra A.; Kool, Eric T.; Grindley, Nigel D. F.; Joyce, Catherine M.

    2008-01-01

    We report the first pre-steady-state kinetic studies of DNA replication in the absence of hydrogen bonds. We have used nonpolar nucleotide analogues that mimic the shape of a Watson-Crick base pair in order to investigate the kinetic consequences of a lack of hydrogen bonds in the polymerase reaction catalyzed by the Klenow fragment of DNA Polymerase I from Escherichia coli. With a thymine isostere lacking hydrogen bonding ability in the nascent pair, the efficiency (kpol/Kd) of the polymerase reaction is decreased by 30-fold, affecting ground state (Kd) and transition state (kpol) approximately equally. When both thymine and adenine analogues in the nascent pair lack hydrogen bonding ability, the efficiency of the polymerase reaction is decreased by about 1000-fold, with most the decrease attributable to the transition state. Reactions using nonpolar analogues at the primer terminal base pair demonstrated the requirement for a hydrogen bond between the polymerase and the minor groove of the primer-terminal base. The R668A mutation of Klenow fragment abolished this requirement, identifying R668 as the probable hydrogen bond donor. Detailed examination of the kinetic data suggested that Klenow fragment has an extremely low tolerance of even minor deviations of the analogue base pairs from ideal Watson-Crick geometry. Consistent with this idea, some analogue pairings were better tolerated by Klenow fragment mutants having more spacious active sites. By contrast, the Y-family polymerase Dbh was much less sensitive to changes in base pair dimensions, and more dependent on hydrogen bonding between base-paired partners. PMID:16411765

  2. Watson-Crick base pairs with thiocarbonyl groups: How sulfur changes the hydrogen bonds in DNA

    NARCIS (Netherlands)

    Fonseca Guerra, C.; Baerends, E.J.; Bickelhaupt, F.M.

    2008-01-01

    We have theoretically analyzed mimics of Watson-Crick AT and GC base pairs in which N-H•••O hydrogen bonds are replaced by N-H•••S, using the generalized gradient approximation (GGA) of density functional theory at BP86/TZ2P level. The general effect of the above substitutions is an elongation and a

  3. Spatial, Hysteretic, and Adaptive Host-Guest Chemistry in a Metal-Organic Framework with Open Watson-Crick Sites.

    Science.gov (United States)

    Cai, Hong; Li, Mian; Lin, Xiao-Rong; Chen, Wei; Chen, Guang-Hui; Huang, Xiao-Chun; Li, Dan

    2015-09-01

    Biological and artificial molecules and assemblies capable of supramolecular recognition, especially those with nucleobase pairing, usually rely on autonomous or collective binding to function. Advanced site-specific recognition takes advantage of cooperative spatial effects, as in local folding in protein-DNA binding. Herein, we report a new nucleobase-tagged metal-organic framework (MOF), namely ZnBTCA (BTC=benzene-1,3,5-tricarboxyl, A=adenine), in which the exposed Watson-Crick faces of adenine residues are immobilized periodically on the interior crystalline surface. Systematic control experiments demonstrated the cooperation of the open Watson-Crick sites and spatial effects within the nanopores, and thermodynamic and kinetic studies revealed a hysteretic host-guest interaction attributed to mild chemisorption. We further exploited this behavior for adenine-thymine binding within the constrained pores, and a globally adaptive response of the MOF host was observed. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  4. Fanconi anaemia and the repair of Watson and Crick DNA crosslinks.

    Science.gov (United States)

    Kottemann, Molly C; Smogorzewska, Agata

    2013-01-17

    The function of Fanconi anaemia proteins is to maintain genomic stability. Their main role is in the repair of DNA interstrand crosslinks, which, by covalently binding the Watson and the Crick strands of DNA, impede replication and transcription. Inappropriate repair of interstrand crosslinks causes genomic instability, leading to cancer; conversely, the toxicity of crosslinking agents makes them a powerful chemotherapeutic. Fanconi anaemia proteins can promote stem-cell function, prevent tumorigenesis, stabilize replication forks and inhibit inaccurate repair. Recent advances have identified endogenous aldehydes as possible culprits of DNA damage that may induce the phenotypes seen in patients with Fanconi anaemia.

  5. Microbiological quality and other characteristics of refrigerated chicken meat in contact with cellulose acetate-based film incorporated with rosemary essential oil

    Directory of Open Access Journals (Sweden)

    Adriane Alexandre Machado de Melo

    2012-12-01

    Full Text Available Antimicrobial active packaging delays or inhibits microorganism growth in packed products, and it can be used in a variety of food systems. The objective of the present research was to develop packaging incorporated with natural antimicrobial agents (active film. The effects of the active film on the spoilage, pathogenic microorganism counts, pH and color of the refrigerated chicken breast cuts were analyzed. Cellulose acetate-based active films incorporating two concentrations (20% and 50%, v/w of rosemary (Rosmarinus officinalis L. essential oil were manufactured and placed in contact with the chicken breast cuts for six days. An analysis of variance and mean comparison tests (Tukey's test, p<0.05 were performed on the results. The films that contained 20% essential oil and were intercalated with chicken breast samples did not demonstrate significant effects on the control of psychrotrophic or total coliform microorganisms during the storage period; however, the films incorporated with 50% essential oil demonstrated efficacy toward the control of coliforms during the storage of the samples (6 days, 2 ± 2ºC. The pH was related to the psychrotrophic microorganism count and was not influenced by the treatment. The color was not influenced by the time of storage or the treatment. The results demonstrate that active films incorporating 50% rosemary essential oil are effective at controlling certain microorganisms in chicken breast cuts.

  6. Antioxidant capacity and inhibitory effect of grape seed and rosemary extract in marinades on the formation of heterocyclic amines in fried beef patties.

    Science.gov (United States)

    Gibis, Monika; Weiss, Jochen

    2012-09-15

    The effect of oil-based marinades containing grape seed extract (Vitis vinifera L.; 0.2, 0.4, 0.6 and 0.8 g/100g) formulated in a water/oil emulsion or rosemary extract (Rosmarinus officinalis; 0.12, 0.2, 0.6, 1.0 and 1.5 g/100g) in oil on the formation of heterocyclic amines (HAs) in fried beef patties was examined. After application of marinades and frying, four HAs MeIQx (2-amino-3,8-dimethylimidazo[4,5-f]quinoxaline), PhIP (2-amino-1-methyl-6-phenylimidazo[4,5b]pyridine), Norharman, and Harman were found at low levels in all fried patties, MeIQx (0.3-1.0 ng/g), and PhIP (0.02-0.3 ng/g). The content of MeIQx and PhIP were significantly reduced by approx. 57% and 90% (pextract concentration. The antioxidant capacity of grape seed was about two-times greater than that of rosemary extract. A correlation between inhibition of HAs and Trolox-equivalents (MeIQx, R(2)=0.85, p<0.001; PhIP, R(2)=0.83, p<0.001) was found. Sensory tests showed a high acceptance of flavour and colour for controls and samples. Copyright © 2012 Elsevier Ltd. All rights reserved.

  7. Improvement of spatial memory of male parkinsonian rats after treatment with adipose stem cells and rosemary leaf extract

    Directory of Open Access Journals (Sweden)

    Mahdieh Ramezanihossienabadi

    2018-01-01

    Full Text Available Background: Due to the neuroprotective effect of rosemary extract, this study aimed at examining the effect of co-treatment of adipose stem cells transplantation and the extract on memory disability of parkinsonian rats. Materials and Methods: In this experimental study, male parkinsonian rats were prepared by bilateral injection of 6-OHDA. The sham group was injected normal saline into the substantia nigra. The extract+medium group was gavaged with the extract 14 days before until 8 weeks after the injury, and the medium was intravenously injected. The extract+cell group was orally gavaged with the extract and the cells were injected. Morris water maze training was conducted one week before and after the lesion and also a retrieval test was performed 4 and 8 weeks after the lesion. Results: There was no significant difference in distance moved and escape latency at training days, before the injury, between the groups. However, a week after the injury, learning ability in lesioned animals was significantly decreased as compared to the sham group (P<0.05. Results of retention tests in four and eight weeks were similar. Duration of escape latency and time spent in target quadrant of lesioned rats were significantly increased and decreased respectively as compared to the sham (P<0.05. The extract+medium and extract+cell groups showed significant decrease and increase in escape latency and time spent in target quadrant as compared to the lesioned group (P<0.05, respectively. Conclusion: The cell therapy accompanied with orally administration of the rosemary extract can improve memory deficit in Parkinson’s disease.

  8. Assistência em Enfermagem e Jean Watson: Uma reflexão sobre a empatia

    Directory of Open Access Journals (Sweden)

    Roberta Maria Savieto

    2016-03-01

    Full Text Available Resumo Objetivo: Relacionar a empatia com a Teoria do Cuidado Humano, de Jean Watson, no contexto atual da Enfermagem. Métodos: Trata-se de um ensaio teórico-reflexivo que propõe uma discussão acerca da empatia e sua relação com a Teoria do Cuidado Humano, de Jean Watson, na prática contemporânea da Enfermagem. Resultado: É apresentado o processo Clinical Caritas e cada elemento de cuidado que o compõe visando propor e discutir as conexões com a empatia na assistência em Enfermagem. Torna-se imperioso aliar aspectos técnicos e humanísticos na oferta do cuidado de Enfermagem, além de resgatar a valorização da abordagem da empatia na formação de profissionais da saúde, bem como na continuidade dos estudos após a graduação. Conclusão: Entende-se que essa reflexão pode contribuir para a reorganização de ideias e conceitos sobre aprimoramentos essenciais que se mostram necessários à prática atual da Enfermagem, além de reforçar seu crescimento enquanto ciência.

  9. Effect of sodium alginate coating incorporated with nisin, Cinnamomum zeylanicum, and rosemary essential oils on microbial quality of chicken meat and fate of Listeria monocytogenes during refrigeration.

    Science.gov (United States)

    Raeisi, Mojtaba; Tabaraei, Alijan; Hashemi, Mohammad; Behnampour, Nasser

    2016-12-05

    The present study was conducted to preserve the microbial quality of chicken meat fillets during storage time by using sodium alginate active coating solutions incorporated with different natural antimicrobials including nisin, Cinnamomum zeylanicum (cinnamon), and rosemary essential oils (EOs) which were added individually and in combination. The samples were stored in refrigeration condition for 15days and were analyzed for total viable count, Enterobacteriaceae count, lactic acid bacteria count, Pseudomonas spp. count, psychrotrophic count, and yeast and mold count, as well as fate of inoculated Listeria monocytogenes at 3-day intervals. Results indicated that values of tested microbial indicators in all samples increased during storage. Antimicrobial agents, when used in combination, had stronger effect in preserving the microbial quality of chicken meat samples rather than their individual use and the strongest effect was observed in samples coated with alginate solution containing both cinnamon and rosemary EOs (CEO+REO). However, all treatments significantly inhibited microbial growth when compared to the control (Ppreservatives is recommended in meat products especially in chicken meats. Copyright © 2016. Published by Elsevier B.V.

  10. Thermodynamic stability of Hoogsteen and Watson-Crick base pairs in the presence of histone H3-mimicking peptide.

    Science.gov (United States)

    Pramanik, Smritimoy; Nakamura, Kaori; Usui, Kenji; Nakano, Shu-ichi; Saxena, Sarika; Matsui, Jun; Miyoshi, Daisuke; Sugimoto, Naoki

    2011-03-14

    We found that Hoogsteen base pairs were stabilized by molecular crowding and a histone H3-mimicking peptide, which was not observed for Watson-Crick base pairs. Our findings demonstrate that the type of DNA base pair is critical for the interaction between DNA and histones.

  11. Effect of pomegranate (Punica granutum) and rosemary (Rosmarinus officinalis L.) extracts on shelf-life for chilled Greenland halibut (Reinhardtius hippoglossoides) fillets in modified atmosphere packaging at 2 ºC

    DEFF Research Database (Denmark)

    Ünalan, U.; Dalgaard, Paw; Korel, F.

    2011-01-01

    The present study evaluated the effect of pomegranate extract (1% v/w) and rosemary extract (1% v/w) as natural preservatives as well as their combination (1% v/w) on shelf life extension of previously frozen and chilled Greenland halibut fillets in modified atmosphere packaging (MAP, 40%CO2/60%N2...

  12. Efeito do extrato aquoso de alecrim (Rosmarinus officinalis L. sobre o estresse oxidativo em ratos diabéticos Effect of aqueous rosemary extract (Rosmarinus officinalis L. on the oxidative stress of diabetic rats

    Directory of Open Access Journals (Sweden)

    Ana Mara de Oliveira e Silva

    2011-02-01

    Full Text Available OBJETIVO: Avaliar o efeito do extrato aquoso de alecrim sobre o estresse oxidativo em ratos diabéticos. MÉTODOS: O extrato aquoso de alecrim foi obtido por método sequencial. Os fenólicos totais foram determinados pelo método de Folin Ciocateau e a atividade antioxidante in vitro foi determinada através de três métodos: β-caroteno/ácido linoleico, varredura do radical 2,2 Difenil-1-Picril-hidrazil e oxigen radical absorbance capacity. Ratos Wistar machos foram distribuídos em 5 grupos: controle, diabético, e três grupos de animais diabéticos tratados com extrato aquoso de alecrim em concentrações diferentes: 25, 50 ou 100mg/kg por via oral durante 30 dias. O diabetes foi induzido por estreptozotocina e, no final do experimento, foi coletado sangue para avaliar o percentual de hemoglobina glicada e os tecidos hepático e cerebral para determinação das enzimas antioxidantes: superóxido dismutase, catalase, glutationa peroxidase e glutationa redutase. RESULTADOS: Constatou-se que o extrato aquoso de alecrim apresentou altos teores de compostos fenólicos totais e expressiva atividade antioxidante in vitro nos três métodos de avaliação. O extrato aquoso de alecrim na concentração de 50mg/kg diminuiu o percentual de hemoglobina glicada e aumentou a atividade das enzimas catalase e glutationa peroxidase no fígado, e da superóxido dismutase no cérebro de ratos diabéticos. No entanto, não foi observado efeito dose-resposta nas demais concentrações analisadas. CONCLUSÃO: O extrato aquoso de alecrim apresenta significativa capacidade antioxidante in vitro, atribuída à presença de compostos fenólicos em sua composição. E, quando administrado em ratos na concentração de 50mg/kg, demonstrou-se eficiente na atenuação do estresse oxidativo presente no diabetes experimental.OBJECTIVE: This study assessed the effect of aqueous rosemary extract on the oxidative stress of diabetic rats. METHODS: Aqueous rosemary extract

  13. Mass of 17O from Penning-trap mass spectrometry and molecular spectroscopy: A precision test of the Dunham-Watson model in carbon monoxide

    International Nuclear Information System (INIS)

    Mount, Brianna J.; Redshaw, Matthew; Myers, Edmund G.; Mueller, Holger S. P.

    2010-01-01

    By fitting the Dunham-Watson model to extensive rotational and vibrational spectroscopic data of isotopic variants of CO, and by using existing precise masses of 13 C, 16 O, and 18 O from Penning-trap mass spectrometry, we determine the atomic mass of 17 O to be M[ 17 O]=16.999 131 644(30) u, where the uncertainty is purely statistical. Using Penning-trap mass spectrometry, we have also directly determined the atomic mass of 17 O with the more precise result M[ 17 O]=16.999 131 756 6(9) u. The Dunham-Watson model applied to the molecular spectroscopic data hence predicts the mass of 17 O to better than 1 part in 10 8 .

  14. Skin photoprotective and antiageing effects of a combination of rosemary (Rosmarinus officinalis) and grapefruit (Citrus paradisi) polyphenols

    Science.gov (United States)

    Nobile, Vincenzo; Michelotti, Angela; Cestone, Enza; Caturla, Nuria; Castillo, Julián; Benavente-García, Obdulio; Pérez-Sánchez, Almudena; Micol, Vicente

    2016-01-01

    Background Plant polyphenols have been found to be effective in preventing ultraviolet radiation (UVR)-induced skin alterations. A dietary approach based of these compounds could be a safe and effective method to provide a continuous adjunctive photoprotection measure. In a previous study, a combination of rosemary (Rosmarinus officinalis) and grapefruit (Citrus paradisi) extracts has exhibited potential photoprotective effects both in skin cell model and in a human pilot trial. Objective We investigated the efficacy of a combination of rosemary (R. officinalis) and grapefruit (C. paradisi) in decreasing the individual susceptibility to UVR exposure (redness and lipoperoxides) and in improving skin wrinkledness and elasticity. Design A randomised, parallel group study was carried out on 90 subjects. Furthermore, a pilot, randomised, crossover study was carried out on five subjects. Female subjects having skin phototype from I to III and showing mild to moderate chrono- or photoageing clinical signs were enrolled in both studies. Skin redness (a* value of CIELab colour space) after UVB exposure to 1 minimal erythemal dose (MED) was assessed in the pilot study, while MED, lipoperoxides (malondialdehyde) skin content, wrinkle depth (image analysis), and skin elasticity (suction and elongation method) were measured in the main study. Results Treated subjects showed a decrease of the UVB- and UVA-induced skin alterations (decreased skin redness and lipoperoxides) and an improvement of skin wrinkledness and elasticity. No differences were found between the 100 and 250 mg extracts doses, indicating a plateau effect starting from 100 mg extracts dose. Some of the positive effects were noted as short as 2 weeks of product consumption. Conclusions The long-term oral intake of Nutroxsun™ can be considered to be a complementary nutrition strategy to avoid the negative effects of sun exposure. The putative mechanism for these effects is most likely to take place through the

  15. Skin photoprotective and antiageing effects of a combination of rosemary (Rosmarinus officinalis and grapefruit (Citrus paradisi polyphenols

    Directory of Open Access Journals (Sweden)

    Vincenzo Nobile

    2016-07-01

    Full Text Available Background: Plant polyphenols have been found to be effective in preventing ultraviolet radiation (UVR-induced skin alterations. A dietary approach based of these compounds could be a safe and effective method to provide a continuous adjunctive photoprotection measure. In a previous study, a combination of rosemary (Rosmarinus officinalis and grapefruit (Citrus paradisi extracts has exhibited potential photoprotective effects both in skin cell model and in a human pilot trial. Objective: We investigated the efficacy of a combination of rosemary (R. officinalis and grapefruit (C. paradisi in decreasing the individual susceptibility to UVR exposure (redness and lipoperoxides and in improving skin wrinkledness and elasticity. Design: A randomised, parallel group study was carried out on 90 subjects. Furthermore, a pilot, randomised, crossover study was carried out on five subjects. Female subjects having skin phototype from I to III and showing mild to moderate chrono- or photoageing clinical signs were enrolled in both studies. Skin redness (a* value of CIELab colour space after UVB exposure to 1 minimal erythemal dose (MED was assessed in the pilot study, while MED, lipoperoxides (malondialdehyde skin content, wrinkle depth (image analysis, and skin elasticity (suction and elongation method were measured in the main study. Results: Treated subjects showed a decrease of the UVB- and UVA-induced skin alterations (decreased skin redness and lipoperoxides and an improvement of skin wrinkledness and elasticity. No differences were found between the 100 and 250 mg extracts doses, indicating a plateau effect starting from 100 mg extracts dose. Some of the positive effects were noted as short as 2 weeks of product consumption. Conclusions: The long-term oral intake of Nutroxsun™ can be considered to be a complementary nutrition strategy to avoid the negative effects of sun exposure. The putative mechanism for these effects is most likely to take place

  16. [The Watson-Crick model of the DNA doublehelix. The history of the discovery and the role of the protein paradigm].

    Science.gov (United States)

    Hagemann, Rudolf

    2007-01-01

    At the beginning, the two fundamental papers by Watson and Crick published in 1953 are presented. Subsequently, the main phases of protein and nucleic acids research, starting in the middle of the 19th century, are shortly reviewed. It is outlined, how the 'protein-paradigm' was gradually developed and ultimately became widely accepted. It is then described how Caspersson in 1936 newly raised the question what the chemical nature of genes was: proteins or nucleic acids ? In the main part of this report six lines of research are reviewed, the results of which led to the demise of the 'protein paradigm', the creation of the Watson-Crick model of the DNA and the elaboration of the mechanism of DNA replication: (a) mutation experiments with UV and determination of the UV action spectrum, (b) determination of the chemical identity of the transforming agent in bacteria, (c) detailed chemical analysis of the DNA of different organisms, (d) molecular investigation of the infection of bacteria by bacteriophages, (e) X-ray analysis of DNA fibers, (f) model building and theoretical treatment of all data obtained. In this article, the factors promoting and inhibiting scientific progress in this field are described (and, above all, the relations between scientists with fixated concepts). The results from these lines of research led to the recognition of the decisive role of nucleic acids as the carriers of genetic information and, in this way, formally established the 'nucleic acid paradigm'. Finally the question is discussed why Watson and Crick found the right solution for the DNA structure (and not one of their competitors).

  17. Accommodation of an N-(deoxyguanosin-8-yl)-2-acetylaminofluorene adduct in the active site of human DNA polymerase iota: Hoogsteen or Watson-Crick base pairing?

    Science.gov (United States)

    Donny-Clark, Kerry; Shapiro, Robert; Broyde, Suse

    2009-01-13

    Bypass across DNA lesions by specialized polymerases is essential for maintenance of genomic stability. Human DNA polymerase iota (poliota) is a bypass polymerase of the Y family. Crystal structures of poliota suggest that Hoogsteen base pairing is employed to bypass minor groove DNA lesions, placing them on the spacious major groove side of the enzyme. Primer extension studies have shown that poliota is also capable of error-free nucleotide incorporation opposite the bulky major groove adduct N-(deoxyguanosin-8-yl)-2-acetylaminofluorene (dG-AAF). We present molecular dynamics simulations and free energy calculations suggesting that Watson-Crick base pairing could be employed in poliota for bypass of dG-AAF. In poliota with Hoogsteen-paired dG-AAF the bulky AAF moiety would reside on the cramped minor groove side of the template. The Hoogsteen-capable conformation distorts the active site, disrupting interactions necessary for error-free incorporation of dC opposite the lesion. Watson-Crick pairing places the AAF rings on the spacious major groove side, similar to the position of minor groove adducts observed with Hoogsteen pairing. Watson-Crick-paired structures show a well-ordered active site, with a near reaction-ready ternary complex. Thus our results suggest that poliota would utilize the same spacious region for lesion bypass of both major and minor groove adducts. Therefore, purine adducts with bulk on the minor groove side would use Hoogsteen pairing, while adducts with the bulky lesion on the major groove side would utilize Watson-Crick base pairing as indicated by our MD simulations for dG-AAF. This suggests the possibility of an expanded role for poliota in lesion bypass.

  18. RNAHelix: computational modeling of nucleic acid structures with Watson-Crick and non-canonical base pairs.

    Science.gov (United States)

    Bhattacharyya, Dhananjay; Halder, Sukanya; Basu, Sankar; Mukherjee, Debasish; Kumar, Prasun; Bansal, Manju

    2017-02-01

    Comprehensive analyses of structural features of non-canonical base pairs within a nucleic acid double helix are limited by the availability of a small number of three dimensional structures. Therefore, a procedure for model building of double helices containing any given nucleotide sequence and base pairing information, either canonical or non-canonical, is seriously needed. Here we describe a program RNAHelix, which is an updated version of our widely used software, NUCGEN. The program can regenerate duplexes using the dinucleotide step and base pair orientation parameters for a given double helical DNA or RNA sequence with defined Watson-Crick or non-Watson-Crick base pairs. The original structure and the corresponding regenerated structure of double helices were found to be very close, as indicated by the small RMSD values between positions of the corresponding atoms. Structures of several usual and unusual double helices have been regenerated and compared with their original structures in terms of base pair RMSD, torsion angles and electrostatic potentials and very high agreements have been noted. RNAHelix can also be used to generate a structure with a sequence completely different from an experimentally determined one or to introduce single to multiple mutation, but with the same set of parameters and hence can also be an important tool in homology modeling and study of mutation induced structural changes.

  19. The extension of a DNA double helix by an additional Watson-Crick base pair on the same backbone.

    Science.gov (United States)

    Kumar, Pawan; Sharma, Pawan K; Madsen, Charlotte S; Petersen, Michael; Nielsen, Poul

    2013-06-17

    Additional base pair: The DNA duplex can be extended with an additional Watson-Crick base pair on the same backbone by the use of double-headed nucleotides. These also work as compressed dinucleotides and form two base pairs with cognate nucleobases on the opposite strand. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  20. Assessing the Watson-Barker Listening Test (WBLT)-Form C in Measuring Listening Comprehension of Post-Secondary Hispanic-American Students

    Science.gov (United States)

    Worthington, Debra L.; Keaton, Shaughan; Cook, John; Fitch-Hauser, Margaret; Powers, William G.

    2014-01-01

    The Watson-Barker Listening Test (WBLT) is one of the most popular measures of listening comprehension. However, participants in studies utilizing this scale have been almost exclusively Anglo-American. At the same time, previous research questions the psychometric properties of the test. This study addressed both of these issues by testing the…

  1. Influence of spray drying operating conditions on microencapsulated rosemary essential oil properties

    Directory of Open Access Journals (Sweden)

    Regiane Victória de Barros Fernandes

    2013-02-01

    Full Text Available Spray drying is an important method used by the food industry in the production of microencapsulated flavors to improve handling and dispersion properties. The objective of this study was to evaluate the influence of the process conditions on the properties of rosemary essential oil microencapsulated by spray drying using gum Arabic as encapsulant. The effects of the wall material concentration (10-30%, inlet air temperature (135-195 ºC, and feed flow rate (0.5-1.0 L.h-1 on the moisture content, hygroscopicity, wettability, solubility, bulk and tapped densities, particle density, flowability, and cohesiveness were evaluated using a 2³ central composite rotational experimental design. Moisture content, hygroscopicity and wettability were significantly affected by the three factors analyzed. Bulk density was positively influenced by the wall material concentration and negatively by the inlet air temperature. Particle density was influenced by the wall material concentration and the inlet air temperature variables, both in a negative manner. As for the solubility, tapped density, flowability, and cohesiveness, the models did not fit the data well. The results indicated that moderate wall material concentration (24%, low inlet air temperature (135 ºC, and moderate feed flow rate (0.7 L.h-1 are the best spray drying conditions.

  2. Assessment of Mexican Arnica (Heterotheca inuloides Cass) and Rosemary (Rosmarinus officinalis) Extracts on Dopamine and Selected Biomarkers of Oxidative Stress in Stomach and Brain of Salmonella typhimurium Infected rats.

    Science.gov (United States)

    Guzmàn, David Calderón; Herrera, Maribel Ortiz; Brizuela, Norma Osnaya; Mejía, Gerardo Barragàn; García, Ernestina Hernàndez; Olguín, Hugo Juàrez; Peraza, Armando Valenzuela; Ruíz, Norma Labra; Del Angel, Daniel Santamaría

    2017-01-01

    The effects of some natural products on dopamine (DA) and 5-hydroxyindole acetic acid (5-HIAA) in brain of infected models are still unclear. The purpose of this study was to measure the effect of Mexican arnica/rosemary (MAR) water extract and oseltamivir on both biogenic amines and some oxidative biomarkers in the brain and stomach of young rats under infection condition. Female Wistar rats (weight 80 g) in the presence of MAR or absence (no-MAR) were treated as follows: group 1, buffer solution (controls); oseltamivir (100 mg/kg), group 2; culture of Salmonella typhimurium ( S.Typh ) (1 × 10 6 colony-forming units/rat) group 3; oseltamivir (100 mg/kg) + S.Typh (same dose) group 4. Drug and extracts were administered intraperitoneally every 24 h for 5 days, and S.Typh was given orally on days 1 and 3. On the fifth day, blood was collected to measure glucose and hemoglobin. The brains and stomachs were obtained to measure levels of DA, 5-HIAA, glutathione (GSH), TBARS, H 2 O 2 , and total ATPase activity using validated methods. DA levels increased in MAR group treated with oseltamivir alone but decreased in no-MAR group treated with oseltamivir plus S.Typh . 5-HIAA, GSH, and H 2 O 2 decreased in this last group, and ATPase activity increased in MAR group treated with oseltamivir plus S.Typh . TBARS (lipid peroxidation) increased in MAR group that received oseltamivir alone. Most of the biomarkers were not altered significantly in the stomach. MAR extract alters DA and metabolism of 5-HIAA in the brain of young animals infected. Antioxidant capacity may be involved in these effects. The purpose of this study was to measure the effect of Mexican arnica/rosemary water extract and oseltamivir on both biogenic amines and some oxidative biomarkers in the brain and stomach of young rats under infection condition. Results: Mexican arnica and rosemary extract alter dopamine and metabolism of 5-HIAA in the brain of young animals infected. Antioxidant capacity may be

  3. Dissociation of single-strand DNA: single-walled carbon nanotube hybrids by Watson-Crick base-pairing.

    Science.gov (United States)

    Jung, Seungwon; Cha, Misun; Park, Jiyong; Jeong, Namjo; Kim, Gunn; Park, Changwon; Ihm, Jisoon; Lee, Junghoon

    2010-08-18

    It has been known that single-strand DNA wraps around a single-walled carbon nanotube (SWNT) by pi-stacking. In this paper it is demonstrated that such DNA is dissociated from the SWNT by Watson-Crick base-pairing with a complementary sequence. Measurement of field effect transistor characteristics indicates a shift of the electrical properties as a result of this "unwrapping" event. We further confirm the suggested process through Raman spectroscopy and gel electrophoresis. Experimental results are verified in view of atomistic mechanisms with molecular dynamics simulations and binding energy analyses.

  4. Enol tautomers of Watson-Crick base pair models are metastable because of nuclear quantum effects.

    Science.gov (United States)

    Pérez, Alejandro; Tuckerman, Mark E; Hjalmarson, Harold P; von Lilienfeld, O Anatole

    2010-08-25

    Intermolecular enol tautomers of Watson-Crick base pairs could emerge spontaneously via interbase double proton transfer. It has been hypothesized that their formation could be facilitated by thermal fluctuations and proton tunneling, and possibly be relevant to DNA damage. Theoretical and computational studies, assuming classical nuclei, have confirmed the dynamic stability of these rare tautomers. However, by accounting for nuclear quantum effects explicitly through Car-Parrinello path integral molecular dynamics calculations, we find the tautomeric enol form to be dynamically metastable, with lifetimes too insignificant to be implicated in DNA damage.

  5. The influence of anharmonic and solvent effects on the theoretical vibrational spectra of the guanine-cytosine base pairs in Watson-Crick and Hoogsteen configurations.

    Science.gov (United States)

    Bende, Attila; Muntean, Cristina M

    2014-03-01

    The theoretical IR and Raman spectra of the guanine-cytosine DNA base pairs in Watson-Crick and Hoogsteen configurations were computed using DFT method with M06-2X meta-hybrid GGA exchange-correlation functional, including the anharmonic corrections and solvent effects. The results for harmonic frequencies and their anharmonic corrections were compared with our previously calculated values obtained with the B3PW91 hybrid GGA functional. Significant differences were obtained for the anharmonic corrections calculated with the two different DFT functionals, especially for the stretching modes, while the corresponding harmonic frequencies did not differ considerable. For the Hoogtseen case the H⁺ vibration between the G-C base pair can be characterized as an asymmetric Duffing oscillator and therefore unrealistic anharmonic corrections for normal modes where this proton vibration is involved have been obtained. The spectral modification due to the anharmonic corrections, solvent effects and the influence of sugar-phosphate group for the Watson-Crick and Hoogsteen base pair configurations, respectively, were also discussed. For the Watson-Crick case also the influence of the stacking interaction on the theoretical IR and Raman spectra was analyzed. Including the anharmonic correction in our normal mode analysis is essential if one wants to obtain correct assignments of the theoretical frequency values as compared with the experimental spectra.

  6. Accommodation of an N-(deoxyguanosin-8-yl)-2-acetylaminofluorene adduct in the active site of human DNA polymerase ι: Hoogsteen or Watson-Crick base pairing?†

    Science.gov (United States)

    Donny-Clark, Kerry; Shapiro, Robert; Broyde, Suse

    2009-01-01

    Bypass across DNA lesions by specialized polymerases is essential for maintenance of genomic stability. Human DNA polymerase ι (polι) is a bypass polymerase of the Y family. Crystal structures of polι suggest that Hoogsteen base pairing is employed to bypass minor groove DNA lesions, placing them on the spacious major groove side of the enzyme. Primer extension studies have shown that polι is also capable of error-free nucleotide incorporation opposite the bulky major groove adduct N-(deoxyguanosin-8-yl)-2-acetyl-aminofluorene (dG-AAF). We present molecular dynamics simulations and free energy calculations suggesting that Watson-Crick base pairing could be employed in polι for bypass of dG-AAF. In polι with Hoogsteen paired dG-AAF the bulky AAF moiety would reside on the cramped minor groove side of the template. The Hoogsteen-capable conformation distorts the active site, disrupting interactions necessary for error-free incorporation of dC opposite the lesion. Watson-Crick pairing places the AAF rings on the spacious major groove side, similar to the position of minor groove adducts observed with Hoogsteen pairing. Watson-Crick paired structures show a well-ordered active site, with a near reaction-ready ternary complex. Thus our results suggest that polι would utilize the same spacious region for lesion bypass of both major and minor groove adducts. Therefore, purine adducts with bulk on the minor groove side would use Hoogsteen pairing, while adducts with the bulky lesion on the major groove side would utilize Watson-Crick base pairing as indicated by our MD simulations for dG-AAF. This suggests the possibility of an expanded role for polι in lesion bypass. PMID:19072536

  7. Rosemary extract and celery-based products used as natural quality enhancers for colonial type salami with different ripening times Extrato de alecrim e produtos derivados do aipo como agentes naturais potencializadores da qualidade de salames coloniais com diferentes tempos de maturação

    Directory of Open Access Journals (Sweden)

    Teresinha Marisa Bertol

    2012-12-01

    Full Text Available This study aimed to evaluate the use of rosemary (Rosmarinus officinalis extract (RE, celery (Apium graveolis, and low levels of NO3 and NO2 as natural agents to enhance the quality of colonial salami. Salami was produced according to three treatments: (A Control: 0.1% curing salt; (B Rosemary: 0.05% curing salt + 0.5% RE (rosemary extract; and (C Rosemary+celery: 0.14% Veg 503 + 0.27% Veg 504 (sea salt plus celery + 0.5% of RE (rosemary extract. There was no effect (P > 0.05 of the treatments on water activity, Na content, and residual NO3 and NO2. Fatty acids C18:2 and C20:4 were reduced (P Objetivou-se avaliar o efeito do extrato de alecrim (EA; Rosmarinus officinalis e do aipo (Apium graveolis e de baixos níveis de adição de NO3 e NO2, como agentes naturais potencializadores da qualidade dos salames coloniais. Foram produzidos salames de acordo com três tratamentos: (A Controle: 0,1% de sal de cura; (B Alecrim: 0,05% de sal de cura + 0,5% de EA; (C Alecrim+aipo: 0,14% de Veg 503 + 0,27% de Veg 504 (sal marinho e aipo + 0,5% de EA. Não houve efeito (p > 0,05 dos tratamentos sobre o conteúdo de Na, atividade de água e NO3 e NO2 residuais. Houve redução (p < 0,05 dos ácidos graxos C18:2 e C20:4 durante o período de maturação no tratamento Controle, indicando sua possível oxidação. O uso do aipo resultou em baixo (p < 0,05 pH no salame. A redução da adição de NO3 e NO2 resultou em salames com coloração mais clara (valores de L* mais elevados, p < 0,05 aos 12 dias de maturação. Conclui-se que o aipo foi efetivo como fonte de NO3 e NO2 para desenvolvimento da cor, mas o baixo pH do produto indica a necessidade de melhor avaliar sua utilização em salames fermentados. Os salames produzidos com EA poderão apresentar diferencial de qualidade pela menor oxidação das gorduras, mas isto necessita ser confirmado em estudo futuros.

  8. Non-Watson-Crick basepairing and hydration in RNA motifs: molecular dynamics of 5S rRNA loop E

    Czech Academy of Sciences Publication Activity Database

    Réblová, K.; Špačková, Naďa; Štefl, R.; Csaszar, K.; Koča, J.; Leontis, N. B.; Šponer, Jiří

    2003-01-01

    Roč. 84, č. 6 (2003), s. 3564-3582 ISSN 0006-3495 R&D Projects: GA MŠk LN00A016 Grant - others:National Institutes of Health(US) 2R15 GM55898; National Science Foundation(US) CHE-9732563 Institutional research plan: CEZ:AV0Z5004920 Keywords : non-Watson-Crick base pairs * ribosomal RNA * Loop E Subject RIV: BO - Biophysics Impact factor: 4.463, year: 2003

  9. Immersion in the Field: The Elementary Block Network in the Watson College of Education at the University of North Carolina Wilmington

    Science.gov (United States)

    Roseboro, Donyell; Lewis, Somer; Buchanan, Lisa; Higgins, Heidi; Schlichting, Katie; Brinkley, Brian

    2014-01-01

    In 1989, the Watson College of Education at the University of North Carolina Wilmington started the Model Clinical Teaching Project and the Consortium for the Advancement of Public Education's School Reform Initiative (CAPE). Since that time, the partnership system has grown to include 146 schools across twelve traditional school districts and…

  10. Consumer profile and acceptability of cooked beef steaks with edible and active coating containing oregano and rosemary essential oils.

    Science.gov (United States)

    Vital, Ana Carolina Pelaes; Guerrero, Ana; Kempinski, Emilia Maria Barbosa Carvalho; Monteschio, Jessica de Oliveira; Sary, Cesar; Ramos, Tatiane Rogelio; Campo, María Del Mar; Prado, Ivanor Nunes do

    2018-09-01

    Fresh animal products are highly perishable and characterized by a short shelf-life. Edible coatings with natural antioxidants (essential oils: EOs) could improve stability, ensure quality, and increase the shelf-life of fresh products. Due to the strong flavor of EOs, their use should consider consumer preferences and sensory acceptability. This study evaluated the effects of edible coating (with oregano and rosemary essential oil) on beef in relation to consumer preferences, besides the determination of habits of consumption and buying intentions of consumers. Acceptability scores from three clusters of consumers was described. Coating with oregano was the preferred. The higher consumer acceptance and willingness to buy this product indicate a great potential and possibility of using coatings with essential oils in fresh animal products. Copyright © 2018. Published by Elsevier Ltd.

  11. The first example of a Hoogsteen base-paired DNA duplex in dynamic equilibrium with a Watson-Crick base-paired duplex--a structural (NMR), kinetic and thermodynamic study.

    Science.gov (United States)

    Isaksson, J; Zamaratski, E; Maltseva, T V; Agback, P; Kumar, A; Chattopadhyaya, J

    2001-06-01

    A single-point substitution of the O4' oxygen by a CH2 group at the sugar residue of A6 (i.e. 2'-deoxyaristeromycin moiety) in a self-complementary DNA duplex, 5'-d(C1G2C3G4A5A6T7T8C9G10C11G12)2(-3), has been shown to steer the fully Watson-Crick basepaired DNA duplex (1A), akin to the native counterpart, to a doubly A6:T7 Hoogsteen basepaired (1B) B-type DNA duplex, resulting in a dynamic equilibrium of (1A)(1B): Keq = k1/k(-1) = 0.56+/-0.08. The dynamic conversion of the fully Watson-Crick basepaired (1A) to the partly Hoogsteen basepaired (1B) structure is marginally kinetically and thermodynamically disfavoured [k1 (298K) = 3.9 0.8 sec(-1); deltaHdegrees++ = 164+/-14 kJ/mol; -TdeltaS degrees++ (298K) = -92 kJ/mol giving a deltaG degrees++ 298 of 72 kJ/mol. Ea (k1) = 167 14 kJ/mol] compared to the reverse conversion of the Hoogsteen (1B) to the Watson-Crick (1A) structure [k-1 (298K) = 7.0 0.6 sec-1, deltaH degrees++ = 153 13 kJ/mol; -TdeltaSdegrees++ (298K) = -82 kJ/mol giving a deltaGdegrees++(298) of 71 kJ/mol. Ea (k-1) = 155 13 kJ/mol]. Acomparison of deltaGdegrees++(298) of the forward (k1) and backward (k-1) conversions, (1A)(1B), shows that there is ca 1 kJ/mol preference for the Watson-Crick (1A) over the double Hoogsteen basepaired (1B) DNA duplex, thus giving an equilibrium ratio of almost 2:1 in favour of the fully Watson-Crick basepaired duplex. The chemical environments of the two interconverting DNA duplexes are very different as evident from their widely separated sets of chemical shifts connected by temperature-dependent exchange peaks in the NOESY and ROESY spectra. The fully Watson-Crick basepaired structure (1A) is based on a total of 127 intra, 97 inter and 17 cross-strand distance constraints per strand, whereas the double A6:T7 Hoogsteen basepaired (1B) structure is based on 114 intra, 92 inter and 15 cross-strand distance constraints, giving an average of 22 and 20 NOE distance constraints per residue and strand, respectively. In addition

  12. Wobble↔Watson-Crick tautomeric transitions in the homo-purine DNA mismatches: a key to the intimate mechanisms of the spontaneous transversions.

    Science.gov (United States)

    Brovarets', Ol'ha O; Hovorun, Dmytro M

    2015-01-01

    The intrinsic capability of the homo-purine DNA base mispairs to perform wobble↔Watson-Crick/Topal-Fresco tautomeric transitions via the sequential intrapair double proton transfer was discovered for the first time using QM (MP2/DFT) and QTAIM methodologies that are crucial for understanding the microstructural mechanisms of the spontaneous transversions.

  13. Principles of RNA base pairing: Structures and energies of cis and trans-Watson-Crick/Sugar Edge base pairs revealed by quantum chemical calculations

    Czech Academy of Sciences Publication Activity Database

    Šponer, Judit E.; Leszczynski, J.; Šponer, Jiří

    2005-01-01

    Roč. 22, č. 6 (2005), s. 826 ISSN 0739-1102. [Albany 2005. Conversation /14./. 14.06.2005-18.06.2005, Albany] Institutional research plan: CEZ:AV0Z50040507 Keywords : RNA base pairing * DNA * Watson-Crick/Sugar Edge Subject RIV: BO - Biophysics

  14. DFT investigation of the vibrational properties of GC Watson-Crick and Hoogsteen base pairs in the presence of Mg²⁺, Ca²⁺, and Cu²⁺ ions.

    Science.gov (United States)

    Morari, Cristian; Muntean, Cristina M; Tripon, Carmen; Buimaga-Iarinca, Luiza; Calborean, Adrian

    2014-04-01

    The binding effects of Mg²⁺, Ca²⁺, and Cu²⁺ ions on the vibrational properties of guanine-cytosine base pairs have been performed using density functional theory investigations. Both Watson-Crick and Hoogsteen configurations of the base pairs were investigated. In Watson-Crick configuration, the metal was coordinated at N7 atom of guanine, while in the case of Hoogsteen configuration, the coordination is at N3 atom of guanine. We have pointed out the geometric properties of the metal-GC base pairs structure, as well as the vibrational bands that can be used to detect the presence of metallic ions in the Watson-Crick and Hoogsteen GC structures. For the geometric models used by us, the vibrational amplitudes of metallic atoms were stronger for wavenumbers lower than 500 cm⁻¹. This suggests that in the experimental studies on DNA the presence of the three metallic atoms (Mg, Ca, and Cu) can be explicitly detected at low frequencies.

  15. Antimicrobial activity of rosemary-pepper essential oil and barbatimao dry crude extract against bacteria isolated from milk

    Directory of Open Access Journals (Sweden)

    João Paulo Ramos Costa

    2011-12-01

    Full Text Available The aim of this study was to evaluate the in vitro antimicrobial activity of Lippia sidoides essential oil (LsEO, popularly known as “rosemary-pepper”, and the Stryphnodendron adstringens dry crude extract (SaDCE, or “barbatimao”, against bacteria isolated from total milk flock, from small farms of northern Minas Gerais state. SaDCE was obtained from the peel of the vegetable through static distillation in ethanol 99.9% during eight days. LsEO was obtained through hydro-distillation of its fresh leaves. The bacteria Escherichia coli and Staphylococcus aureus isolated from milk underwent the test of disk-diffusion and minimum bacterial concentration (MBC, using concentrations of 320, 160, 80, 40, 20 and 0μl/mL of LsEO and 400, 200, 100, 50, 25 and 0mg/mL of SaDCE. All bacteria were sensitive to the vegetable extracts, except the Escherichia coli which was not inhibited by any test when SaDCE was used.

  16. Evidence for Watson-Crick and not Hoogsteen or wobble base pairing in the selection of nucleotides for insertion opposite pyrimidines and a thymine dimer by yeast DNA pol eta.

    Science.gov (United States)

    Hwang, Hanshin; Taylor, John-Stephen

    2005-03-29

    We have recently reported that pyrene nucleotide is preferentially inserted opposite an abasic site, the 3'-T of a thymine dimer, and most undamaged bases by yeast DNA polymerase eta (pol eta). Because pyrene is a nonpolar molecule with no H-bonding ability, the unusually high efficiencies of dPMP insertion are ascribed to its superior base stacking ability, and underscore the importance of base stacking in the selection of nucleotides by pol eta. To investigate the role of H-bonding and base pair geometry in the selection of nucleotides by pol eta, we determined the insertion efficiencies of the base-modified nucleotides 2,6-diaminopurine, 2-aminopurine, 6-chloropurine, and inosine which would make a different number of H-bonds with the template base depending on base pair geometry. Watson-Crick base pairing appears to play an important role in the selection of nucleotide analogues for insertion opposite C and T as evidenced by the decrease in the relative insertion efficiencies with a decrease in the number of Watson-Crick H-bonds and an increase in the number of donor-donor and acceptor-acceptor interactions. The selectivity of nucleotide insertion is greater opposite the 5'-T than the 3'-T of the thymine dimer, in accord with previous work suggesting that the 5'-T is held more rigidly than the 3'-T. Furthermore, insertion of A opposite both Ts of the dimer appears to be mediated by Watson-Crick base pairing and not by Hoogsteen base pairing based on the almost identical insertion efficiencies of A and 7-deaza-A, the latter of which lacks H-bonding capability at N7. The relative efficiencies for insertion of nucleotides that can form Watson-Crick base pairs parallel those for the Klenow fragment, whereas the Klenow fragment more strongly discriminates against mismatches, in accord with its greater shape selectivity. These results underscore the importance of H-bonding and Watson-Crick base pair geometry in the selection of nucleotides by both pol eta and the

  17. El relato de la experiencia depresiva: Aplicando los factores cuidativos de Jean Watson The expression of the depressive experience: the application of Jean Watson caring factors

    Directory of Open Access Journals (Sweden)

    Carme Ferré-Grau

    2008-03-01

    Full Text Available La elevada frecuencia de personas con trastornos depresivos en todos los niveles de atención y la complejidad de los cuidados, conlleva la necesidad, para la enfermera, de desarrollar nuevas habilidades y competencias en el abordaje integral de los pacientes y su familia. Para la comprensión de una persona con depresión es útil una mirada etnográfica que nos permita conocer la expresión subjetiva de la vivencia de la enfermedad. Un marco adecuado de referencia para ayudar en el cuidado de estos procesos es la teoría de Jean Watson sobre la Filosofía y Ciencia de los Cuidados Humanos, que a través de sus diez factores cuidativos enmarca el rol de la enfermera en "cómo tener cuidado de...". Este artículo trata de analizar, a través de los factores cuidativos de Watson, las vivencias subjetivas relacionadas con la transformación del cuerpo y la mente de las personas con depresión: el sufrimiento y el dolor, la autoimagen y el reconocimiento, la falta de energía, la pérdida de la esperanza. Se concluye que no es posible controlar el cuerpo sin controlar la mente y para ello nos puede ayudar el análisis subjetivo de la experiencia y la aplicación de los factores cuidativos.The high frequency of people with depressive disorders in Primary Health Care as well as in Hospital and the complexity of care, carry for nurses the need to develop new skills and competences to deal with complete care of patiens and families. To understand a person suffering depressive disorders may be useful an ethnographic look that let us know the subjective expression of the experience of being ill. An appropriate framework to help care is Jean Watson’s Philosophy and Science of Human Caring, trough 10 caring factors that frame the nursing role "to take care of…". This paper tries to analyze the subjective experience related to body and mind changes: suffering and pain, self-image and acceptance, lack of energy, loss of hope… in patients with

  18. The Towers Watson Approach to Improving Corporate Wellness.

    Science.gov (United States)

    Wootton, Adam

    2012-06-01

    Encouraging employees to take care of their health is in the interests of everyone. Employees benefit from being healthier and happier, employers benefit from having an engaged workforce, lower absenteeism, and lower medical costs, and society as a whole benefits from using less medical resources. Employers have been trying to push healthy messages to employees for a long time and have had some good success. For example, an increased emphasis on the dangers of tobacco use in employer and government communications has helped bring about a significant decrease in smoking. However, overall population health in key risk areas (such as obesity and diabetes) continues to decline. These areas are where employers can really make a difference in health outcomes-and effective communications are critical to success. Towers Watson helps many companies educate employees about health and wellness and encourage more effective use of healthcare. The challenge is to find new and engaging ways to deliver this information so that employees take notice-and take action. After all, the amount of material employees receive on a daily basis from marketers, employers, and each other across the wide range of available media makes it extremely difficult to be heard. This is where gaming comes in-and why we think it's the tool to be incorporating into communication and engagement plans.

  19. Case study: IBM Watson Analytics cloud platform as Analytics-as-a-Service system for heart failure early detection

    OpenAIRE

    Guidi, Gabriele; Miniati, Roberto; Mazzola, Matteo; Iadanza, Ernesto

    2016-01-01

    In the recent years the progress in technology and the increasing availability of fast connections have produced a migration of functionalities in Information Technologies services, from static servers to distributed technologies. This article describes the main tools available on the market to perform Analytics as a Service (AaaS) using a cloud platform. It is also described a use case of IBM Watson Analytics, a cloud system for data analytics, applied to the following research scope: detect...

  20. Teoria do cuidado transpessoal de jean watson no cuidado domiciliar de enfermagem a crianca: uma reflexao

    Directory of Open Access Journals (Sweden)

    Ingrid Meireles Gomes

    2013-09-01

    Full Text Available Trata-se de um ensaio reflexivo sobre o potencial de utilização da Teoria do Cuidado Transpessoal de Jean Watson, na realização do cuidado domiciliar de enfermagem direcionado à criança, desenvolvido à luz dos 10 elementos do Processo Clinical Caritas. Este referencial teórico permite desenvolver a transpessoalidade no cuidado domiciliar da criança, momento em que o enfermeiro precisa desenvolver autoconhecimento, ter suporte teórico-filosófico e valer-se deste conhecimento, a fim de ultrapassar o paradigma da objetividade e do biologicismo.

  1. A variação denominativa nos textos especializados da aromaterapia: o caso da unidade terminológica Alecrim = Rosemary variation within Aromatherapy texts

    Directory of Open Access Journals (Sweden)

    Neide Munhoz Albano

    2010-07-01

    Full Text Available Este artigo objetiva discutir a variação da planta Alecrim, no âmbito da denominação científica e popular, na ótica do prescritivismo das teorias da variação linguística. A análise concentra-se nas variantes terminológicas em consonância com seu uso.This article aims to discuss variation with respect to the scientific and common denominations of the Rosemary plant, based on the approach of prescription of the theories of linguistic variation. The analysis focuses on the terminological variants in consonance with their use by experts in the field.

  2. Robonaut 2 and Watson: Cognitive Dexterity for Future Exploration

    Science.gov (United States)

    Badger, Julia M.; Strawser, Philip; Farrell, Logan; Goza, S. Michael; Claunch, Charles A.; Chancey, Raphael; Potapinski, Russell

    2018-01-01

    Future exploration missions will dictate a level of autonomy never before experienced in human spaceflight. Mission plans involving the uncrewed phases of complex human spacecraft in deep space will require a coordinated autonomous capability to be able to maintain the spacecraft when ground control is not available. One promising direction involves embedding intelligence into the system design both through the employment of state-of-the-art system engineering principles as well as through the creation of a cognitive network between a smart spacecraft or habitat and embodiments of cognitive agents. The work described here details efforts to integrate IBM's Watson and other cognitive computing services into NASA Johnson Space Center (JSC)'s Robonaut 2 (R2) anthropomorphic robot. This paper also discusses future directions this work will take. A cognitive spacecraft management system that is able to seamlessly collect data from subsystems, determine corrective actions, and provide commands to enable those actions is the end goal. These commands could be to embedded spacecraft systems or to a set of robotic assets that are tied into the cognitive system. An exciting collaboration with Woodside provides a promising Earth-bound testing analog, as controlling and maintaining not normally manned off-shore platforms have similar constraints to the space missions described.

  3. Effect of Edible and Active Coating (with Rosemary and Oregano Essential Oils) on Beef Characteristics and Consumer Acceptability

    Science.gov (United States)

    Vital, Ana Carolina Pelaes; Guerrero, Ana; Monteschio, Jessica de Oliveira; Valero, Maribel Velandia; Carvalho, Camila Barbosa; de Abreu Filho, Benício Alves; Madrona, Grasiele Scaramal; do Prado, Ivanor Nunes

    2016-01-01

    The effects of an alginate-based edible coating containing natural antioxidants (rosemary and oregano essential oils) on lipid oxidation, color preservation, water losses, texture and pH of beef steaks during 14 days of display were studied. The essential oil, edible coating and beef antioxidant activities, and beef consumer acceptability were also investigated. The edible coatings decreased lipid oxidation of the meat compared to the control. The coating with oregano was most effective (46.81% decrease in lipid oxidation) and also showed the highest antioxidant activity. The coatings significantly decreased color losses, water losses and shear force compared to the control. The coatings had a significant effect on consumer perception of odor, flavor and overall acceptance of the beef. In particular, the oregano coating showed significantly high values (approximately 7 in a 9-point scale). Active edible coatings containing natural antioxidants could improve meat product stability and therefore have potential use in the food industry. PMID:27504957

  4. Effect of Edible and Active Coating (with Rosemary and Oregano Essential Oils on Beef Characteristics and Consumer Acceptability.

    Directory of Open Access Journals (Sweden)

    Ana Carolina Pelaes Vital

    Full Text Available The effects of an alginate-based edible coating containing natural antioxidants (rosemary and oregano essential oils on lipid oxidation, color preservation, water losses, texture and pH of beef steaks during 14 days of display were studied. The essential oil, edible coating and beef antioxidant activities, and beef consumer acceptability were also investigated. The edible coatings decreased lipid oxidation of the meat compared to the control. The coating with oregano was most effective (46.81% decrease in lipid oxidation and also showed the highest antioxidant activity. The coatings significantly decreased color losses, water losses and shear force compared to the control. The coatings had a significant effect on consumer perception of odor, flavor and overall acceptance of the beef. In particular, the oregano coating showed significantly high values (approximately 7 in a 9-point scale. Active edible coatings containing natural antioxidants could improve meat product stability and therefore have potential use in the food industry.

  5. Effect of Edible and Active Coating (with Rosemary and Oregano Essential Oils) on Beef Characteristics and Consumer Acceptability.

    Science.gov (United States)

    Vital, Ana Carolina Pelaes; Guerrero, Ana; Monteschio, Jessica de Oliveira; Valero, Maribel Velandia; Carvalho, Camila Barbosa; de Abreu Filho, Benício Alves; Madrona, Grasiele Scaramal; do Prado, Ivanor Nunes

    2016-01-01

    The effects of an alginate-based edible coating containing natural antioxidants (rosemary and oregano essential oils) on lipid oxidation, color preservation, water losses, texture and pH of beef steaks during 14 days of display were studied. The essential oil, edible coating and beef antioxidant activities, and beef consumer acceptability were also investigated. The edible coatings decreased lipid oxidation of the meat compared to the control. The coating with oregano was most effective (46.81% decrease in lipid oxidation) and also showed the highest antioxidant activity. The coatings significantly decreased color losses, water losses and shear force compared to the control. The coatings had a significant effect on consumer perception of odor, flavor and overall acceptance of the beef. In particular, the oregano coating showed significantly high values (approximately 7 in a 9-point scale). Active edible coatings containing natural antioxidants could improve meat product stability and therefore have potential use in the food industry.

  6. Tautomeric transition between wobble A·C DNA base mispair and Watson-Crick-like A·C* mismatch: microstructural mechanism and biological significance.

    Science.gov (United States)

    Brovarets', Ol'ha O; Hovorun, Dmytro M

    2015-06-21

    Here, we use MP2/DFT quantum-chemical methods combined with Quantum Theory of Atoms in Molecules to study the tautomeric transition between wobble A·C(w) mismatch and Watson-Crick-like A·C*(WC) base mispair, proceeding non-dissociatively via sequential proton transfer between bases through the planar, highly stable and zwitterionic TS(A∙C-)(A∙C(W)A∙C&(WC)) transition state joined by the participation of (A)N6(+)H∙∙∙N4(-)(C), (A)N1(+)H∙∙∙N4(-)(C) and (A)C2(+)H∙∙∙N3(-)(C) H-bonds. Notably, the A·C(w) ↔ A·C*(WC) tautomerization reaction is accompanied by 10 unique patterns of the specific intermolecular interactions that consistently replace each other. Our data suggest that biologically significant A·C(w) → A·C*(WC) tautomerization is a kinetically controlled pathway for formation of the enzymatically competent Watson-Crick-like A·C*(WC) DNA base mispair in the essentially hydrophobic recognition pocket of the high-fidelity DNA-polymerase, responsible for the occurrence of spontaneous point AC/CA incorporation errors during DNA biosynthesis.

  7. Automatic Determination of the Need for Intravenous Contrast in Musculoskeletal MRI Examinations Using IBM Watson's Natural Language Processing Algorithm.

    Science.gov (United States)

    Trivedi, Hari; Mesterhazy, Joseph; Laguna, Benjamin; Vu, Thienkhai; Sohn, Jae Ho

    2018-04-01

    Magnetic resonance imaging (MRI) protocoling can be time- and resource-intensive, and protocols can often be suboptimal dependent upon the expertise or preferences of the protocoling radiologist. Providing a best-practice recommendation for an MRI protocol has the potential to improve efficiency and decrease the likelihood of a suboptimal or erroneous study. The goal of this study was to develop and validate a machine learning-based natural language classifier that can automatically assign the use of intravenous contrast for musculoskeletal MRI protocols based upon the free-text clinical indication of the study, thereby improving efficiency of the protocoling radiologist and potentially decreasing errors. We utilized a deep learning-based natural language classification system from IBM Watson, a question-answering supercomputer that gained fame after challenging the best human players on Jeopardy! in 2011. We compared this solution to a series of traditional machine learning-based natural language processing techniques that utilize a term-document frequency matrix. Each classifier was trained with 1240 MRI protocols plus their respective clinical indications and validated with a test set of 280. Ground truth of contrast assignment was obtained from the clinical record. For evaluation of inter-reader agreement, a blinded second reader radiologist analyzed all cases and determined contrast assignment based on only the free-text clinical indication. In the test set, Watson demonstrated overall accuracy of 83.2% when compared to the original protocol. This was similar to the overall accuracy of 80.2% achieved by an ensemble of eight traditional machine learning algorithms based on a term-document matrix. When compared to the second reader's contrast assignment, Watson achieved 88.6% agreement. When evaluating only the subset of cases where the original protocol and second reader were concordant (n = 251), agreement climbed further to 90.0%. The classifier was

  8. The effect of rosemary extract on spatial memory, learning and antioxidant enzymes activities in the hippocampus of middle-aged rats.

    Science.gov (United States)

    Rasoolijazi, Homa; Mehdizadeh, Mehdi; Soleimani, Mansoureh; Nikbakhte, Farnaz; Eslami Farsani, Mohsen; Ababzadeh, Shima

    2015-01-01

    The Rosemary extract (RE) possesses various antioxidant, cytoprotective and cognition- improving bioactivities. In this study, we postulated which doses of RE have a more effect on the hippocampus of middle-aged rats. In this experimental study, thirty-two middle-aged male Wistar rats were fed by different doses (50,100 and 200 mg/kg/day) of RE (containing 40% carnosic acid) or distilled water for 12 weeks. The effects of different RE doses on learning and spatial memory scores, hippocampal neuronal survival, antioxidant enzymes and lipid peroxidation amount were evaluated by one and two way analysis of variance (ANOVA). It seemed that RE (100mg/kg) could recover the spatial memory retrieval score (prosemary extract (40% carnosic acid) may improve the memory score and oxidative stress activity in middle aged rats in a dose dependent manner, especially in 100mg/kg.

  9. Structural variability and the nature of intermolecular interactions in Watson-Crick B-DNA base pairs.

    Science.gov (United States)

    Czyznikowska, Z; Góra, R W; Zaleśny, R; Lipkowski, P; Jarzembska, K N; Dominiak, P M; Leszczynski, J

    2010-07-29

    A set of nearly 100 crystallographic structures was analyzed using ab initio methods in order to verify the effect of the conformational variability of Watson-Crick guanine-cytosine and adenine-thymine base pairs on the intermolecular interaction energy and its components. Furthermore, for the representative structures, a potential energy scan of the structural parameters describing mutual orientation of the base pairs was carried out. The results were obtained using the hybrid variational-perturbational interaction energy decomposition scheme. The electron correlation effects were estimated by means of the second-order Møller-Plesset perturbation theory and coupled clusters with singles and doubles method adopting AUG-cc-pVDZ basis set. Moreover, the characteristics of hydrogen bonds in complexes, mimicking those appearing in B-DNA, were evaluated using topological analysis of the electron density. Although the first-order electrostatic energy is usually the largest stabilizing component, it is canceled out by the associated exchange repulsion in majority of the studied crystallographic structures. Therefore, the analyzed complexes of the nucleic acid bases appeared to be stabilized mainly by the delocalization component of the intermolecular interaction energy which, in terms of symmetry adapted perturbation theory, encompasses the second- and higher-order induction and exchange-induction terms. Furthermore, it was found that the dispersion contribution, albeit much smaller in terms of magnitude, is also a vital stabilizing factor. It was also revealed that the intermolecular interaction energy and its components are strongly influenced by four (out of six) structural parameters describing mutual orientation of bases in Watson-Crick pairs, namely shear, stagger, stretch, and opening. Finally, as a part of a model study, much of the effort was devoted to an extensive testing of the UBDB databank. It was shown that the databank quite successfully reproduces the

  10. Applications of the Galton-Watson process to human DNA evolution and demography

    CERN Document Server

    Neves, A G M

    2005-01-01

    We show that the problem of existence of a mitochondrial Eve can be understood as an application of the Galton--Watson process and presents interesting analogies with critical phenomena in Statistical Mechanics. In the approximation of small survival probability, and assuming limited progeny, we are able to find for a genealogic tree the maximum and minimum survival probabilities over all probability distributions for the number of children per woman constrained to a given mean. As a consequence, we can relate existence of a mitochondrial Eve to quantitative demographic data of early mankind. In particular, we show that a mitochondrial Eve may exist even in an exponentially growing population, provided that the mean number of children per woman $\\overline N$ is constrained to a small range depending on the probability $p$ that a child is a female. Assuming that the value $p \\approx 0.488$ valid nowadays has remained fixed for thousands of generations, the range where a mitochondrial Eve occurs with sizeable p...

  11. William Watson Cheyne (1852-1932): a life in medicine and his innovative surgical treatment of congenital hydrocephalus.

    Science.gov (United States)

    Watson, Caroline C; Griessenauer, Christoph J; Loukas, Marios; Blount, Jeffrey P; Tubbs, R Shane

    2013-11-01

    William Watson Cheyne lived and trained during a period of great advances in medical knowledge and surgical techniques. Despite his various contributions to the fields of bacteriology and surgery, little is known about his career or his life apart from his affiliations with Joseph Lister. This article aims to identify Cheyne as a pioneer in the treatment of congenital hydrocephalus and sheds light on the man who existed in Lister's shadow for most of his life. Cheyne's technique for surgical intervention of hydrocephalus was a great turning point and contributes to the current treatment strategy utilized today for hydrocephalus.

  12. Storage method, drying processes and extraction procedures strongly affect the phenolic fraction of rosemary leaves: an HPLC/DAD/MS study.

    Science.gov (United States)

    Mulinacci, N; Innocenti, M; Bellumori, M; Giaccherini, C; Martini, V; Michelozzi, M

    2011-07-15

    The Rosmarinus officinalis L. is widely known for its numerous applications in the food field but also for the increasing interest in its pharmaceutical properties. Two groups of compounds are mainly responsible for the biological activities of the plant: the volatile fraction and the phenolic constituents. The latter group is mainly constituted by rosmarinic acid, by a flavonoidic fraction and by some diterpenoid compounds structurally derived from the carnosic acid. The aim of our work was to optimize the extractive and analytical procedure for the determination of all the phenolic constituents. Moreover the chemical stability of the main phenols, depending on the storage condition, the different drying procedures and the extraction solvent, have been evaluated. This method allowed to detect up to 29 different constituents at the same time in a relatively short time. The described procedure has the advantage to being able to detect and quantify several classes of compounds, among them numerous minor flavonoids, thus contributing to improving knowledge of the plant. The findings from this study have demonstrated that storing the raw fresh material in the freezer is not appropriate for rosemary, mainly due to the rapid disappearing of the rosmarinic acid during the freezing/thawing process. Regarding the flavonoidic fraction, consistent decrements, were highlighted in the dried samples at room temperature if compared with the fresh leaf. Rosmarinic acid, appeared very sensitive also to mild drying processes. The total diterpenoidic content undergoes to little changes when the leaves are freeze dried or frozen and limited losses are observed working on dried leaves at room temperature. Nevertheless it can be taken in account that this fraction is very sensitive to the water presence during the extraction that favors the conversion of carnosic acid toward it oxidized form carnosol. From our findings, it appear evident that when evaluating the phenolic content in

  13. Various extraction methods influence the adhesive properties of DDGS .... pennycress (Thlaspi arvense L.) and lesquerella (Lesquerella fendleri A. Gary (S. Watson) in the fabrication of lignocellulosic composites

    Science.gov (United States)

    Lignocellulosic composite (LC) panels were fabricated using an adhesive matrix prepared from three different agricultural by-products: dried distillers grains with solubles (DDGS), pennycress (Thlaspi arvense L.) press cake (PPC) or lesquerella (Lesquerella fendleri A. Gary (S. Watson) press cake (L...

  14. Impact of cooked functional meat enriched with omega-3 fatty acids and rosemary extract on inflammatory and oxidative status; a randomised, double-blind, crossover study.

    Science.gov (United States)

    Bermejo, L M; López-Plaza, B; Weber, T K; Palma-Milla, S; Iglesias, C; Reglero, G; Gómez-Candela, C

    2014-11-01

    n-3 fatty acid intake has been associated with inflammatory benefits in cardiovascular disease (CVD). Functionalising meat may be of great interest. The aim of the present study was to assess the effect of functional meat containing n-3 and rosemary extract on inflammatory and oxidative status markers in subjects with risk for CVD. A randomised, double-blind, cross-over study was undertaken to compare the effects on the above markers of consuming functional or control meat products. 43 volunteers with at least two lipid profile variables showing risk for CVD were randomly assigned to receive functional meat (FM) or control meat (CM) over 12-weeks with a 4-week wash-out interval before crossover. Functional effects were assessed by examining lipid profile, CRP, PAI-1, TNF-alpha, IL-6, fibrinogen (inflammatory markers), and TBARS, FRAP and 8-iso-PGF2 (oxidative status markers). 33 subjects (24 women) aged 50.7±8.8 years completed the study. In FM treatment, PAI-1, fibrinogen and 8-iso-PGF2 decreased significantly after 12 weeks, while FRAP significantly increased. In contrast, in CM treatment, a significant increase was seen in PAI-1, while FRAP significantly declined. Significant differences were also seen between the FM and CM treatments after 12 weeks in terms of the change observed in PAI-1, FRAP and 8-iso-PGF2 values. No significant differences were seen in anthropometric variables nor were adverse effects reported. The consumption of FM containing n-3 and rosemary extract improved oxidative and inflammatory status of people with at least two lipid profile variables showing risk for CVD. The inclusion of such functional meat in a balanced diet might be a healthy lifestyle option. Copyright AULA MEDICA EDICIONES 2014. Published by AULA MEDICA. All rights reserved.

  15. Critique of the Watson-Glaser Critical Thinking Appraisal Test: The More You Know, the Lower Your Score

    Directory of Open Access Journals (Sweden)

    Kevin Possin

    2014-12-01

    Full Text Available The Watson-Glaser Critical Thinking Appraisal Test is one of the oldest, most frequently used, multiple-choice critical-thinking tests on the market in business, government, and legal settings for purposes of hiring and promotion. I demonstrate, however, that the test has serious construct-validity issues, stemming primarily from its ambiguous, unclear, misleading, and sometimes mysterious instructions, which have remained unaltered for decades. Erroneously scored items further diminish the test’s validity. As a result, having enhanced knowledge of formal and informal logic could well result in test subjects receiving lower scores on the test. That’s not how things should work for a CT assessment test.

  16. Fingerprints of Both Watson-Crick and Hoogsteen Isomers of the Isolated (Cytosine-Guanine)H+ Pair.

    Science.gov (United States)

    Cruz-Ortiz, Andrés F; Rossa, Maximiliano; Berthias, Francis; Berdakin, Matías; Maitre, Philippe; Pino, Gustavo A

    2017-11-16

     Gas phase protonated guanine-cytosine (CGH + ) pair was generated using an electrospray ionization source from solutions at two different pH (5.8 and 3.2). Consistent evidence from MS/MS fragmentation patterns and differential ion mobility spectra (DIMS) point toward the presence of two isomers of the CGH + pair, whose relative populations depend strongly on the pH of the solution. Gas phase infrared multiphoton dissociation (IRMPD) spectroscopy in the 900-1900 cm -1 spectral range further confirms that the Watson-Crick isomer is preferentially produced (91%) at pH = 5.8, while the Hoogsteen isomer predominates (66%) at pH = 3.2). These fingerprint signatures are expected to be useful for the development of new analytical methodologies and to trigger isomer selective photochemical studies of protonated DNA base pairs.

  17. How many tautomerization pathways connect Watson-Crick-like G*·T DNA base mispair and wobble mismatches?

    Science.gov (United States)

    Brovarets', Ol'ha O; Hovorun, Dmytro M

    2015-01-01

    In this study, we have theoretically demonstrated the intrinsic ability of the wobble G·T(w)/G*·T*(w)/G·T(w1)/G·T(w2) and Watson-Crick-like G*·T(WC) DNA base mispairs to interconvert into each other via the DPT tautomerization. We have established that among all these transitions, only one single G·T(w) ↔ G*·T(WC) pathway is eligible from a biological perspective. It involves short-lived intermediate - the G·T*(WC) base mispair - and is governed by the planar, highly stable, and zwitterionic [Formula: see text] transition state stabilized by the participation of the unique pattern of the five intermolecular O6(+)H⋯O4(-), O6(+)H⋯N3(-), N1(+)H⋯N3(-), N1(+)H⋯O2(-), and N2(+)H⋯O2(-) H-bonds. This non-dissociative G·T(w) ↔ G*·T(WC) tautomerization occurs without opening of the pair: Bases within mispair remain connected by 14 different patterns of the specific intermolecular interactions that successively change each other along the IRC. Novel kinetically controlled mechanism of the thermodynamically non-equilibrium spontaneous point GT/TG incorporation errors has been suggested. The mutagenic effect of the analogues of the nucleotide bases, in particular 5-bromouracil, can be attributed to the decreasing of the barrier of the acquisition by the wobble pair containing these compounds of the enzymatically competent Watson-Crick's geometry via the intrapair mutagenic tautomerization directly in the essentially hydrophobic recognition pocket of the replication DNA-polymerase machinery. Proposed approaches are able to explain experimental data, namely growth of the rate of the spontaneous point incorporation errors during DNA biosynthesis with increasing temperature.

  18. ANALISIS KESALAHAN SISWA KELAS X MIA 3 SMA NEGERI 1 TANJUNGPINANG TAHUN PELAJARAN 2015/2016 DALAM MENYELESAIKAN PERMASALAHAN PELUANG DENGAN MENGGUNAKAN KATEGORI KESALAHAN WATSON

    Directory of Open Access Journals (Sweden)

    Susilawati Susilawati

    2016-06-01

    Full Text Available Studi ini bertujuan untuk menganalisa dan mengklasifikasi kesalahan siswa dalam menyelesaikan permasalahan peluang. Subjek studi ini adalah 38 siswa dari kelas X MIA 3 di SMA Negeri 1 Tanjungpinang. Instrumen yang digunakan adalah tes tertulis yang memuat 5 butir soal uraian yang disusun dan divalidasi bersama oleh peneliti dan guru matematika kelas X MIA 3. Kesalahan yang dianalisis dikategorikan dengan menggunakan kategori kesalahan Watson diantaranya data tidak tepat (inappropriate data/id, prosedur tidak tepat (inappropriate procedure/ip, data hilang (ommited data/od, kesimpulan hilang (ommited conclusion/oc, konflik level respon (response level conflict/rlc, manipulasi tidak langsung (undirected manipulation/um, masalah hierarki keterampilan (skills hierarchy problem/shp, dan jenis kesalahan lain dalam kategori terakhir. Hasil analisis kesalahan menunjukkan persentase data tidak tepat sebesar 14,43 %, prosedur tidak tepat sebesar 12,08 %, data hilang sebesar 19,13%, kesimpulan hilang sebesar 21,14%, konflik level respon sebesar 1,34 %, manipulasi tidak langsung sebesar 12,75 %, serta persentase masalah hirarki keterampilan sebesar 19,13 %. Kata Kunci: Peluang, Kesalahan Siswa, Kategori Kesalahan Menurut Watson DOI: http://dx.doi.org/10.22342/jpm.10.2.3630.39-52

  19. A comprehensive study on the phenolic profile of widely used culinary herbs and spices: rosemary, thyme, oregano, cinnamon, cumin and bay.

    Science.gov (United States)

    Vallverdú-Queralt, Anna; Regueiro, Jorge; Martínez-Huélamo, Miriam; Rinaldi Alvarenga, José Fernando; Leal, Leonel Neto; Lamuela-Raventos, Rosa M

    2014-07-01

    Herbs and spices have long been used to improve the flavour of food without being considered as nutritionally significant ingredients. However, the bioactive phenolic content of these plant-based products is currently attracting interest. In the present work, liquid chromatography coupled to high-resolution/accurate mass measurement LTQ-Orbitrap mass spectrometry was applied for the comprehensive identification of phenolic constituents of six of the most widely used culinary herbs (rosemary, thyme, oregano and bay) and spices (cinnamon and cumin). In this way, up to 52 compounds were identified in these culinary ingredients, some of them, as far as we know, for the first time. In order to establish the phenolic profiles of the different herbs and spices, accurate quantification of the major phenolics was performed by multiple reaction monitoring in a triple quadrupole mass spectrometer. Multivariate statistical treatment of the results allowed the assessment of distinctive features among the studied herbs and spices. Copyright © 2014 Elsevier Ltd. All rights reserved.

  20. An unusual mode of DNA duplex association: Watson-Crick interaction of all-purine deoxyribonucleic acids.

    Science.gov (United States)

    Battersby, Thomas R; Albalos, Maria; Friesenhahn, Michel J

    2007-05-01

    Nucleic acid duplexes associating through purine-purine base pairing have been constructed and characterized in a remarkable demonstration of nucleic acids with mixed sequence and a natural backbone in an alternative duplex structure. The antiparallel deoxyribose all-purine duplexes associate specifically through Watson-Crick pairing, violating the nucleobase size-complementarity pairing convention found in Nature. Sequence-specific recognition displayed by these structures makes the duplexes suitable, in principle, for information storage and replication fundamental to molecular evolution in all living organisms. All-purine duplexes can be formed through association of purines found in natural ribonucleosides. Key to the formation of these duplexes is the N(3)-H tautomer of isoguanine, preferred in the duplex, but not in aqueous solution. The duplexes have relevance to evolution of the modern genetic code and can be used for molecular recognition of natural nucleic acids.

  1. End of the Line? Paul Watson and the Future of the Sea Shepherd Conservation Society

    Directory of Open Access Journals (Sweden)

    Gerry Joseph Nagtzaam

    2014-03-01

    Full Text Available This paper critically examines the Sea Shepherd Conservation Society (‘SSCS’ and the legal challenges they are currently facing to continue its self-appointed role to protect oceanic life through direct action.  In Part One, the article examines the history of this radical environmental group and; the role performed by its charismatic leader Paul Watson; it’s organisational structure and its strategies and tactics; its governing philosophy and its attitudes to violence.  Part Two provides a history of the various direct actions carried out by the group; it further examines the organisation’s ongoing confrontations with the Japanese whaling fleet; documents the current legal travails the group and its leader are experiencing; and lastly asks what impact these issues will have on the group’s viability as a direct action group going forward.

  2. Quality traits of Ciauscolo salami from meat of pigs fed rosemary extract enriched diet

    Directory of Open Access Journals (Sweden)

    David Ranucci

    2013-06-01

    Full Text Available The microbiological, chemical-physical and organoleptic characteristics of four batches of Ciauscolo salami, two made from meat of pigs fed diet integrated with 0.2% of rosemary extract (RS and two controls (CSs, were considered. Three samples for each batch were in double analyzed for total bacterial count at 30°C, enumeration of lactococci, lactobacilli, staphylococcus coagulase positive, enterococci, Enterobacteriaceae, and isolation of Salmonella spp. and Listeria monocytogenes, after filling and at 7 and 20 days of ripening. On the same samples, measurement of pH (pHmeter MP120; Mettler-Toledo Spa, Schwerzenbach, Switzerland, activity water (aw (Hygroscope BT-RS1 Rotronic; PBI International, Milan, Italy and CIE L*a*b* colour (Chromameter Minolta C400; Minolta Ltd., Osaka, Japan were performed. Proximal composition, NaCl content (AOAC, 1990 thiobarbituric reactive substances (TBARs and panel test (ISO 8586-1:1993 and ISO 8586 were performed only on samples obtained at the end of the ripening time. No difference in proximal composition, pH, aw values and microbial counts between CS and RS samples were observed along the whole production period. Colour analyses reveal higher a* values in RS (10.79 vs 9.68, P<0.05. Higher TBARs mean value was recorded in CS at the end of ripening (1.12 vs 0.91 mg MDA/100g, P<0.01. Even if no statistical differences were recorded in all the parameters considered in sensory evaluation, the overall acceptance of RS samples tended to be higher than CS.

  3. LEOPARD syndrome is not linked to the Marfan syndrome and the Watson syndrome loci

    Energy Technology Data Exchange (ETDEWEB)

    Rass-Rothchild, A.: Abeliovitch, D.; Kornstein, A. [Tel Aviv Univ. (Israel)]|[Hebrew Univ., Jerusalem (Israel)

    1994-09-01

    The acronym LEOPARD stands for a syndromic association of Lentigines, Eletrocardiographic changes, Ocular hypertelorism, Pulmonic stenosis, Abnormal genitalia, Retardation of growth and sensorineural Deafness. Inheritance is autosomal dominant with high penetrance and variable expressivity. In 1990 Torok et al. reported on the association of LEOPARD and Marfan syndrome. In addition a clinical similarity (cardiac and cutaneous involvement) exists with the Watson syndrome (neurofibromatosis and pulmonic stenosis) which is linked to the marker D17S33 on chromosome 17. We studied possible linkage of LEOPARD syndrome to the Marfan syndrome locus on chromosome 15 (D15S1, MF13, and (TAAAA)n repeats) and to the NF-1 locus on chromosome 17 in a family with 9 cases of LEOPARD syndrome. Close linkage between LEOPARD syndrome and both the Marfan locus on chromosome 15 and the NF-1 locus on chromosome 17 was excluded (lod score <-2.0 through {theta} = 0.1).

  4. Proton tunneling in the A∙T Watson-Crick DNA base pair: myth or reality?

    Science.gov (United States)

    Brovarets', Ol'ha O; Hovorun, Dmytro M

    2015-01-01

    The results and conclusions reached by Godbeer et al. in their recent work, that proton tunneling in the A∙T(WC) Watson-Crick (WC) DNA base pair occurs according to the Löwdin's (L) model, but with a small (~10(-9)) probability were critically analyzed. Here, it was shown that this finding overestimates the possibility of the proton tunneling at the A∙T(WC)↔A*∙T*(L) tautomerization, because this process cannot be implemented as a chemical reaction. Furthermore, it was outlined those biologically important nucleobase mispairs (A∙A*↔A*∙A, G∙G*↔G*∙G, T∙T*↔T*∙T, C∙C*↔C*∙C, H∙H*↔H*∙H (H - hypoxanthine)) - the players in the field of the spontaneous point mutagenesis - where the tunneling of protons is expected and for which the application of the model proposed by Godbeer et al. can be productive.

  5. Watson-Crick Base Pair Radical Cation as a Model for Oxidative Damage in DNA.

    Science.gov (United States)

    Feketeová, Linda; Chan, Bun; Khairallah, George N; Steinmetz, Vincent; Maitre, Philippe; Radom, Leo; O'Hair, Richard A J

    2017-07-06

    The deleterious cellular effects of ionizing radiation are well-known, but the mechanisms causing DNA damage are poorly understood. The accepted molecular events involve initial oxidation and deprotonation at guanine sites, triggering hydrogen atom abstraction reactions from the sugar moieties, causing DNA strand breaks. Probing the chemistry of the initially formed radical cation has been challenging. Here, we generate, spectroscopically characterize, and examine the reactivity of the Watson-Crick nucleobase pair radical cation in the gas phase. We observe rich chemistry, including proton transfer between the bases and propagation of the radical site in deoxyguanosine from the base to the sugar, thus rupturing the sugar. This first example of a gas-phase model system providing molecular-level details on the chemistry of an ionized DNA base pair paves the way toward a more complete understanding of molecular processes induced by radiation. It also highlights the role of radical propagation in chemistry, biology, and nanotechnology.

  6. Preservative effects of rosemary extract (Rosmarinus officinalis L. on quality and storage stability of chicken meat patties

    Directory of Open Access Journals (Sweden)

    M. AL-HIJAZEEN

    2017-11-01

    Full Text Available Abstract The effect of different level of rosemary extract (RE (Rosmarinus officinalis Linn. cultivated in Jordan, and other preservative on quality and stability of ground chicken meat was investigated. Treatments, were involved 1 Control (No additive, 2 300 ppm (RE, 3 350 ppm RE, 4 300 ppm L-Ascorbic acid (E-300, 5 200 ppm Sodium nitrite (E-250, 6 5 ppm butylatedhydroxyanisole (BHA for breast, and 14 ppm for thigh meat were prepared. TBARS, total carbonyl, and color values, were measured and analyzed at 0, 4, and 7 day. Samples of cooked thigh meat were prepared, and sensory evaluation was reported. Cooking loss %, ultimate pH, and total aldehydes were analyzed. Both RE and E-250 were showed the highest significant effect maintaining low values of TBARS and total carbonyl at 7 day. However, no significant differences were found among all treatments measuring ultimate pH values, and their cooking loss %. The RE and E-250 also showed the highest significant effect delaying aldehydes formation, and positively affect meat sensory attributes. In conclusion, RE (350 ppm was very effective antioxidant and comparable to the other commercial antioxidants. Thus, RE could be a good substitution to many synthetic antioxidants used in meat industry.

  7. Highly Accurate Classification of Watson-Crick Basepairs on Termini of Single DNA Molecules

    Science.gov (United States)

    Winters-Hilt, Stephen; Vercoutere, Wenonah; DeGuzman, Veronica S.; Deamer, David; Akeson, Mark; Haussler, David

    2003-01-01

    We introduce a computational method for classification of individual DNA molecules measured by an α-hemolysin channel detector. We show classification with better than 99% accuracy for DNA hairpin molecules that differ only in their terminal Watson-Crick basepairs. Signal classification was done in silico to establish performance metrics (i.e., where train and test data were of known type, via single-species data files). It was then performed in solution to assay real mixtures of DNA hairpins. Hidden Markov Models (HMMs) were used with Expectation/Maximization for denoising and for associating a feature vector with the ionic current blockade of the DNA molecule. Support Vector Machines (SVMs) were used as discriminators, and were the focus of off-line training. A multiclass SVM architecture was designed to place less discriminatory load on weaker discriminators, and novel SVM kernels were used to boost discrimination strength. The tuning on HMMs and SVMs enabled biophysical analysis of the captured molecule states and state transitions; structure revealed in the biophysical analysis was used for better feature selection. PMID:12547778

  8. Growth performance, carcass and noncarcass traits and meat quality of Barbarine lambs fed rosemary distillation residues.

    Science.gov (United States)

    Yagoubi, Y; Hajji, H; Smeti, S; Mahouachi, M; Kamoun, M; Atti, N

    2018-02-15

    The aim of this experiment was to study the effect of total replacement of oat hay by rosemary distillation residues (RR) on growth, carcass characteristics and meat quality of Barbarine lambs. A total of 21 lambs were divided into three groups. The control group (C) was offered 600 g of oat hay; the RR87 and RR60 groups received 600 g of pellets containing 87% and 60% of RR, respectively. The CP content was 9% and 14% for RR87 and RR60, respectively. All animals were supplemented by 600 g of concentrate. After 77 days of fattening, lambs were slaughtered. The DM and CP intakes were significantly increased with RR diets. The average daily gain was higher (Pcarcass composition did not differ among groups. The bony organs and gut weights were similar among groups, while functional ones (skin, liver, kidney and testicles) were significantly heavier for both RR groups than control. The ultimate pH, water cooking loss and color variables were similar among groups and the chemical composition (protein, fat, myoglobin, collagen and iron) did not differ also among groups. These results revealed the opportunity of RR use in fattening lambs without adverse effects on carcass and meat characteristics. Moreover, 9% CP in RR pellets are enough given the same growth performance recorded as that of RR with 14% CP.

  9. Capturing student mathematical engagement through differently enacted classroom practices: applying a modification of Watson's analytical tool

    Science.gov (United States)

    Patahuddin, Sitti Maesuri; Puteri, Indira; Lowrie, Tom; Logan, Tracy; Rika, Baiq

    2018-04-01

    This study examined student mathematical engagement through the intended and enacted lessons taught by two teachers in two different middle schools in Indonesia. The intended lesson was developed using the ELPSA learning design to promote mathematical engagement. Based on the premise that students will react to the mathematical tasks in the forms of words and actions, the analysis focused on identifying the types of mathematical engagement promoted through the intended lesson and performed by students during the lesson. Using modified Watson's analytical tool (2007), students' engagement was captured from what the participants' did or said mathematically. We found that teachers' enacted practices had an influence on student mathematical engagement. The teacher who demonstrated content in explicit ways tended to limit the richness of the engagement; whereas the teacher who presented activities in an open-ended manner fostered engagement.

  10. Silver (I) as DNA glue: Ag+-mediated guanine pairing revealed by removing Watson-Crick constraints

    Science.gov (United States)

    Swasey, Steven M.; Leal, Leonardo Espinosa; Lopez-Acevedo, Olga; Pavlovich, James; Gwinn, Elisabeth G.

    2015-01-01

    Metal ion interactions with DNA have far-reaching implications in biochemistry and DNA nanotechnology. Ag+ is uniquely interesting because it binds exclusively to the bases rather than the backbone of DNA, without the toxicity of Hg2+. In contrast to prior studies of Ag+ incorporation into double-stranded DNA, we remove the constraints of Watson-Crick pairing by focusing on homo-base DNA oligomers of the canonical bases. High resolution electro-spray ionization mass spectrometry reveals an unanticipated Ag+-mediated pairing of guanine homo-base strands, with higher stability than canonical guanine-cytosine pairing. By exploring unrestricted binding geometries, quantum chemical calculations find that Ag+ bridges between non-canonical sites on guanine bases. Circular dichroism spectroscopy shows that the Ag+-mediated structuring of guanine homobase strands persists to at least 90 °C under conditions for which canonical guanine-cytosine duplexes melt below 20 °C. These findings are promising for DNA nanotechnology and metal-ion based biomedical science. PMID:25973536

  11. Silver (I) as DNA glue: Ag(+)-mediated guanine pairing revealed by removing Watson-Crick constraints.

    Science.gov (United States)

    Swasey, Steven M; Leal, Leonardo Espinosa; Lopez-Acevedo, Olga; Pavlovich, James; Gwinn, Elisabeth G

    2015-05-14

    Metal ion interactions with DNA have far-reaching implications in biochemistry and DNA nanotechnology. Ag(+) is uniquely interesting because it binds exclusively to the bases rather than the backbone of DNA, without the toxicity of Hg(2+). In contrast to prior studies of Ag(+) incorporation into double-stranded DNA, we remove the constraints of Watson-Crick pairing by focusing on homo-base DNA oligomers of the canonical bases. High resolution electro-spray ionization mass spectrometry reveals an unanticipated Ag(+)-mediated pairing of guanine homo-base strands, with higher stability than canonical guanine-cytosine pairing. By exploring unrestricted binding geometries, quantum chemical calculations find that Ag(+) bridges between non-canonical sites on guanine bases. Circular dichroism spectroscopy shows that the Ag(+)-mediated structuring of guanine homobase strands persists to at least 90 °C under conditions for which canonical guanine-cytosine duplexes melt below 20 °C. These findings are promising for DNA nanotechnology and metal-ion based biomedical science.

  12. Energy Landscape and Pathways for Transitions between Watson-Crick and Hoogsteen Base Pairing in DNA.

    Science.gov (United States)

    Chakraborty, Debayan; Wales, David J

    2018-01-04

    The recent discovery that Hoogsteen (HG) base pairs are widespread in DNA across diverse sequences and positional contexts could have important implications for understanding DNA replication and DNA-protein recognition. While evidence is emerging that the Hoogsteen conformation could be a thermodynamically accessible conformation of the DNA duplex and provide a means to expand its functionality, relatively little is known about the molecular mechanism underlying the Watson-Crick (WC) to HG transition. In this Perspective, we describe pathways and kinetics for this transition at an atomic level of detail, using the energy landscape perspective. We show that competition between the duplex conformations results in a double funnel landscape, which explains some recent experimental observations. The interconversion pathways feature a number of intermediates, with a variable number of WC and HG base pairs. The relatively slow kinetics, with possible deviations from two-state behavior, suggest that this conformational switch is likely to be a challenging target for both simulation and experiment.

  13. Single-stranded γPNAs for in vivo site-specific genome editing via Watson-Crick recognition.

    Science.gov (United States)

    Bahal, Raman; Quijano, Elias; McNeer, Nicole A; Liu, Yanfeng; Bhunia, Dinesh C; Lopez-Giraldez, Francesco; Fields, Rachel J; Saltzman, William M; Ly, Danith H; Glazer, Peter M

    2014-01-01

    Triplex-forming peptide nucleic acids (PNAs) facilitate gene editing by stimulating recombination of donor DNAs within genomic DNA via site-specific formation of altered helical structures that further stimulate DNA repair. However, PNAs designed for triplex formation are sequence restricted to homopurine sites. Herein we describe a novel strategy where next generation single-stranded gamma PNAs (γPNAs) containing miniPEG substitutions at the gamma position can target genomic DNA in mouse bone marrow at mixed-sequence sites to induce targeted gene editing. In addition to enhanced binding, γPNAs confer increased solubility and improved formulation into poly(lactic-co-glycolic acid) (PLGA) nanoparticles for efficient intracellular delivery. Single-stranded γPNAs induce targeted gene editing at frequencies of 0.8% in mouse bone marrow cells treated ex vivo and 0.1% in vivo via IV injection, without detectable toxicity. These results suggest that γPNAs may provide a new tool for induced gene editing based on Watson-Crick recognition without sequence restriction.

  14. Benchmark studies on the building blocks of DNA. 3. Watson-Crick and stacked base pairs.

    Science.gov (United States)

    Szalay, Péter G; Watson, Thomas; Perera, Ajith; Lotrich, Victor; Bartlett, Rodney J

    2013-04-18

    Excited states of stacked adenine-thymine and guanine-cytosine pairs as well as the Watson-Crick pair of guanine-thymine have been investigated using the equation of motion coupled-cluster (EOM-CC) method with single and double as well as approximate triple excitations. Transitions have been assigned, and the form of the excitations has been analyzed. The majority of the excitations could be classified as localized on the nucleobases, but for all three studied systems, charge-transfer (CT) transitions could also be identified. The main aim of this study was to compare the performance of lower-level methods (ADC(2) and TDDFT) to the high-level EOM-CC ones. It was shown that both ADC(2) and TDDFT with long-range correction have nonsystematic error in excitation energies, causing alternation of the energetic ordering of the excitations. Considering the high costs of the EOM-CC calculations, there is a need for reliable new approximate methods.

  15. Silver (I) as DNA glue: Ag+-mediated guanine pairing revealed by removing Watson-Crick constraints

    Science.gov (United States)

    Swasey, Steven M.; Leal, Leonardo Espinosa; Lopez-Acevedo, Olga; Pavlovich, James; Gwinn, Elisabeth G.

    2015-05-01

    Metal ion interactions with DNA have far-reaching implications in biochemistry and DNA nanotechnology. Ag+ is uniquely interesting because it binds exclusively to the bases rather than the backbone of DNA, without the toxicity of Hg2+. In contrast to prior studies of Ag+ incorporation into double-stranded DNA, we remove the constraints of Watson-Crick pairing by focusing on homo-base DNA oligomers of the canonical bases. High resolution electro-spray ionization mass spectrometry reveals an unanticipated Ag+-mediated pairing of guanine homo-base strands, with higher stability than canonical guanine-cytosine pairing. By exploring unrestricted binding geometries, quantum chemical calculations find that Ag+ bridges between non-canonical sites on guanine bases. Circular dichroism spectroscopy shows that the Ag+-mediated structuring of guanine homobase strands persists to at least 90 °C under conditions for which canonical guanine-cytosine duplexes melt below 20 °C. These findings are promising for DNA nanotechnology and metal-ion based biomedical science.

  16. Non-Watson-Crick structures in oligodeoxynucleotides: Self-association of d(TpCpGpA) stabilized at acidic pH

    International Nuclear Information System (INIS)

    Topping, R.J.; Stone, M.P.; Brush, C.K.; Harris, T.M.

    1988-01-01

    The 1 H NMR spectrum of the tetradeoxynucleotide d(TpCpGpA) was examined as a function of temperature, pH, and concentration. At pH 7 and above the solution conformation for this oligodeoxynucleotide appears to be a mixture of random coil and Watson-Crick duplex. At 25 degree C, a pH titration of d(TpCpGaA) shown that distinct conformational changes occur as the pH is lowered below 7.0. These conformational changes are reversible upon readjusting the pH to neutrality, indicating the presence of a pH-dependent set of conformational equilibria. At 25 degree C, the various conformational state in the mixture are in rapid exchange on the NMR time scale. Examination of the titration curve shown the presence of distinct conformational states at pH greater than 7, and between pH 4 and pH 5. When the pH titration is repeated at 5 degree C, the conformational equilibria are in slow exchange on the NMR time scale; distinct signals from each conformational state are observable. The stable conformational state present between pH 4 and pH 5 represents an ordered conformation of d(TpCpGpA) which dissociates to a less ordered structure upon raising the temperature. The ordered conformation differs from the Watson-Crick helix, as is shown from nuclear Overhauser enhancement experiments, as well as chemical shift data. These results indicate that their ordered conformation is similar to the conformation of d(TpCpGpA) observed between pH 4 and pH 5. In the present case it is likely that stabilization of an ordered duplex conformation for d(TpCpGpA) is achieved by protonation of cytosine. A possible model which could explain the data involves formation of Hoogsteen C + :G base pairs

  17. Can an Excess Electron Localise on a Purine Moiety in the Adenine-thymine Watson-Crick Base Pair? A Computational Study

    International Nuclear Information System (INIS)

    Mazurkiewicz, Kamil; Haranczyk, Maciej; Gutowski, Maciej S.; Rak, Janusz

    2007-01-01

    The electron affinity and the propensity to electron-induced proton transfer (PT) of hydrogen-bonded complexes between the Watson-Crick adenine-thymine pair (AT) and simple organic acid (HX), attached to adenine in the Hoogsteen-type configuration, were studied at the B3LYP/6-31+G** level. Although the carboxyl group is deprotonated at physiological pH, its neutral form, COOH, resembles the peptide bond or the amide fragment in the side chain of asparagine (Asn) or glutamine (Gln). Thus, these complexes mimic the interaction between the DNA environment (e.g., proteins) and nucleobase pairs incorporated in the biopolymer. Electron attachment is thermodynamically feasible and adiabatic electron affinities range from 0.41 to 1.28 eV, while the vertical detachment energies of the resulting anions span the range of 0.39-2.88 eV. Low-energy activation barriers separate the anionic minima: aHX(AT) from the more stable single-PT anionic geometry, aHX(AT)-SPT, and aHX(AT)-SPT from the double-PT anionic geometry, aHX(AT)-DPT. Interaction between the adenine of the Watson-Crick AT base pair with an acidic proton donor probably counterbalances the larger EA of isolated thymine, as SOMO is almost evenly delocalized over both types of nucleic bases in the aHX(AT) anions. Moreover, as a result of PT the excess electron localizes entirely on adenine. Thus, in DNA interacting with its physiological environment, damage induced by low-energy electrons could begin, contrary to the current view, with the formation of purine anions, which are not formed in isolated DNA because of the greater stability of anionic pyrimidines.

  18. pH-Modulated Watson-Crick duplex-quadruplex equilibria of guanine-rich and cytosine-rich DNA sequences 140 base pairs upstream of the c-kit transcription initiation site.

    Science.gov (United States)

    Bucek, Pavel; Jaumot, Joaquim; Aviñó, Anna; Eritja, Ramon; Gargallo, Raimundo

    2009-11-23

    Guanine-rich regions of DNA are sequences capable of forming G-quadruplex structures. The formation of a G-quadruplex structure in a region 140 base pairs (bp) upstream of the c-kit transcription initiation site was recently proposed (Fernando et al., Biochemistry, 2006, 45, 7854). In the present study, the acid-base equilibria and the thermally induced unfolding of the structures formed by a guanine-rich region and by its complementary cytosine-rich strand in c-kit were studied by means of circular dichroism and molecular absorption spectroscopies. In addition, competition between the Watson-Crick duplex and the isolated structures was studied as a function of pH value and temperature. Multivariate data analysis methods based on both hard and soft modeling were used to allow accurate quantification of the various acid-base species present in the mixtures. Results showed that the G-quadruplex and i-motif coexist with the Watson-Crick duplex over the pH range from 3.0 to 6.5, approximately, under the experimental conditions tested in this study. At pH 7.0, the duplex is practically the only species present.

  19. Long-Range Vibrational Dynamics Are Directed by Watson-Crick Base Pairing in Duplex DNA.

    Science.gov (United States)

    Hithell, Gordon; Shaw, Daniel J; Donaldson, Paul M; Greetham, Gregory M; Towrie, Michael; Burley, Glenn A; Parker, Anthony W; Hunt, Neil T

    2016-05-05

    Ultrafast two-dimensional infrared (2D-IR) spectroscopy of a 15-mer A-T DNA duplex in solution has revealed structure-dependent vibrational coupling and energy transfer processes linking bases with the sugar-phosphate backbone. Duplex melting induces significant changes in the positions of off-diagonal peaks linking carbonyl and ring-stretching vibrational modes of the adenine and thymine bases with vibrations of the phosphate group and phosphodiester linkage. These indicate that Watson-Crick hydrogen bonding and helix formation lead to a unique vibrational coupling arrangement of base vibrational modes with those of the phosphate unit. On the basis of observations from time-resolved 2D-IR data, we conclude that rapid energy transfer processes occur between base and backbone, mediated by additional modes located on the deoxyribose moiety within the same nucleotide. These relaxation dynamics are insensitive to duplex melting, showing that efficient intramolecular energy relaxation to the solvent via the phosphate groups is the key to excess energy dissipation in both single- and double-stranded DNA.

  20. [Quantum-chemical investigation of tautomerization ways of Watson-Crick DNA base pair guanine-cytosine].

    Science.gov (United States)

    Brovarets', O O; Hovorun, D M

    2010-01-01

    A novel physico-chemical mechanism of the Watson-Crick DNA base pair Gua.Cyt tautomerization Gua.Cyt*Gua.CytGua*.Cyt (mutagenic tautomers of bases are marked by asterisks) have been revealed and realized in a pathway of single proton transfer through two mutual isoenergetic transition states with Gibbs free energy of activation 30.4 and 30.6 kcal/mol and they are ion pairs stabilized by three (N2H...N3, N1H...N4- and O6+H...N4-) and five (N2H...O2, N1H...O2, N1H...N3, O6+H...N4- and 06+H...N4-) H-bonds accordingly. Stable base pairs Gua-Cyt* and Gua*.Cyt which dissociate comparably easy into monomers have acceptable relative Gibbs energies--12.9 and 14.3 kcal/mol--for the explanation of the nature of the spontaneous transitions of DNA replication. Results are obtained at the MP2/6-311++G(2df,pd)//B3LYP/6-31 1++G(d,p) level of theory in vacuum approach.

  1. Determining the Walker exponent and developing a modified Smith-Watson-Topper parameter model

    Energy Technology Data Exchange (ETDEWEB)

    Lv, Zhiqiang; Huang, Hong Zhong; Wang, Hai Kun; Gao, Huiying; Zuo, Fang Jun [University of Electronic Science and Technology of China, Chengdu (China)

    2016-03-15

    Mean stress effects significantly influence the fatigue life of components. In general, tensile mean stresses are known to reduce the fatigue life of components, whereas compressive mean stresses are known to increase it. To date, various methods that account for mean stress effects have been studied. In this research, considering the high accuracy of mean stress correction and the difficulty in obtaining the material parameter of the Walker method, a practical method is proposed to describe the material parameter of this method. The test data of various materials are then used to verify the proposed practical method. Furthermore, by applying the Walker material parameter and the Smith-Watson-Topper (SWT) parameter, a modified strain-life model is developed to consider sensitivity to mean stress of materials. In addition, three sets of experimental fatigue data from super alloy GH4133, aluminum alloy 7075-T651, and carbon steel are used to estimate the accuracy of the proposed model. A comparison is also made between the SWT parameter method and the proposed strainlife model. The proposed strain-life model provides more accurate life prediction results than the SWT parameter method.

  2. The case of the missing fingerprints or Dr Watson's cosmology

    International Nuclear Information System (INIS)

    Longair, M.S.

    1987-01-01

    The cosmological problem has four main areas of uncertainty -the origin of isotropy of the universe, the origin of the fluctuations from which galaxies form, the explanation of why we live in a matter universe rather than one composed of equal amounts of matter and antimatter and why the Universe seems to be within a factor of 10 of the critical, flat universe. These cannot be explained satisfactorily within the Hot Big Bang theory after a millisecond or so. The solutions are presumed, therefore, to lie in the very early universe when it was less than about a millisecond old. The clues which lead to this conclusion are set out in terms of a detective story with Sherlock Holmes explaining the facts about the universe to Dr Watson. Holmes first explains the size of the universe in terms of distances and sizes of stars, galaxies and galaxy clusters. Evidence from pictures of the universe at different temperatures, (X-ray pictures, gamma-ray pictures, far infra-red pictures and pictures at radio and millimetre wavelengths) is presented. Holmes then starts to build up a realistic model of the universe using two of the facts collected (the isotropy of the universe and the expansion of the universe), one assumption (the cosmological principle) and one theory of gravity (General Relativity). However the universe which emerges does not solve the four problems mentioned. Quasars, which provide information (illustrated) from earlier epochs of the universe may, therefore, help to solve the problems. (U.K.)

  3. INIBIÇÃO DE SALMONELLA POR EXTRATO DE ALECRIM (Rosmarinus officinalis: OBTENÇÃO DE EXTRATOS DE ALECRIM EM SOLVENTES ORGÂNICOS INHIBITION OF Salmonella BY ROSEMARY (Rosmarinus officinalis EXTRACTS: ORGANIC SOLVENTS ROSEMARY EXTRACT OBTENTION

    Directory of Open Access Journals (Sweden)

    Maria Célia Lopes Torres

    2007-09-01

    Full Text Available

    Com o objetivo de se obter um extrato de alecrim em solvente orgânico, a ser utilizado na inibição de Salmonella, em alimentos, foram testados quatro tipos de solventes, a saber: metanol, etanol, acetona e hexano. Na obtenção dos extratos foi adotada a técnica recomendada para determinação de lipídeos, conforme as NORMAS ANALÍTICAS DO INSTITUTO ADOLFO LUTZ (1976. A análise dos resultados evidenciou um excelente desempenho do metanol, não sendo contudo recomendada a utilização em produtos alimentares em virtude da sua toxidez. Também o etanol apresentou elevados índices de extração, sem os inconvenientes associados ao uso do metanol, sendo por isto o solvente indicado para a continuidade do estudo proposto.

    Aiming to obtain a rosemary extract in organic solvent to be used in Salmonella inhibition, in food, were tested four kinds of solvents, namely: methane alcohol, ethyl alcohol, acetone and hexane. It was used the recommended technique for lipids determination in extracts determination according to the analytic rules used by Instituto Adolfo Lutz. Analysis results showed an excellent performance for methane alcohol, but its use is not recommended in feed products due to its toxicity. Ethyl alcohol presented also elevated extraction indexes without inconvenients associated to methane alcohol use, by this reason being a solvent indicated for continuity to the proposed study.

  4. Effects of Nursing Care Based on Watson's Theory of Human Caring on Anxiety, Distress, And Coping, When Infertility Treatment Fails: A Randomized Controlled Trial.

    Science.gov (United States)

    Durgun Ozan, Yeter; Okumuş, Hülya

    2017-06-01

    Introduction: The failure of infertility treatment leads to individual, familial, and social problems. The objective of this study was to evaluate the effectiveness of the nursing care program based on Watson's "Theory of Human Caring" on anxiety and distress caused by coping when the treatment fails. Methods: This study randomized controlled trial study was conducted from April to November 2012, with 86 Turkish women with infertility (intervention group: 45, control group: 41). Follow-up of 32 infertile women, who failed infertility treatment from intervention group, and 35 infertile women, who failed infertility treatment from control group, continued for another four weeks. Data were collected through Spiel Berger's State/Trait Anxiety Inventory, Distress Scale, and Ways of Coping Questionnaire. The analyses of data were conducted using SPSS ver 13. Results: The intervention and control groups significantly differed in terms of anxiety, distress, and coping levels. The intervention group's mean anxiety score decreased by thirteen points and distress by fourteen points (in a positive direction). The intervention group's mean positive coping style score increased. Whereas a negative increase was observed in the control group's values depending on the failure of the treatment. Conclusion: Watson's theory of human caring is recommended as a guide to nursing patients with infertility treatment to decrease levels of anxiety and distress, and to increase the positive coping style among infertile women.

  5. Comparación entre bioimpedancia espectroscópica y fórmula de Watson para medición de volumen corporal en pacientes en diálisis peritoneal

    Directory of Open Access Journals (Sweden)

    Gonzalo Martínez Fernández

    2016-01-01

    Conclusiones: Existen diferencias en el V de los pacientes de una unidad de DP según sea calculado por fórmula de Watson o por BIS. La presencia de hipertensión, diabetes, hipoalbuminemia, obesidad, malnutrición, inflamación, E/I ratio ≥1 y la ausencia de diuresis residual se asocia con la aparición de estas diferencias.

  6. Effect of Watson-Crick and Hoogsteen base pairing on the conformational stability of C8-phenoxyl-2'-deoxyguanosine adducts.

    Science.gov (United States)

    Millen, Andrea L; Churchill, Cassandra D M; Manderville, Richard A; Wetmore, Stacey D

    2010-10-14

    Bulky DNA addition products (adducts) formed through attack at the C8 site of guanine can adopt the syn orientation about the glycosidic bond due to changes in conformational stability or hydrogen-bonding preferences directly arising from the bulky group. Indeed, the bulky substituent may improve the stability of (non-native) Hoogsteen pairs. Therefore, such adducts often result in mutations upon DNA replication. This work examines the hydrogen-bonded pairs between the Watson-Crick and Hoogsteen faces of the ortho or para C8-phenoxyl-2'-deoxyguanosine adduct and each natural (undamaged) nucleobase with the goal to clarify the conformational preference of this type of damage, as well as provide insight into the likelihood of subsequent mutation events. B3LYP/6-311+G(2df,p)//B3LYP/6-31G(d) hydrogen-bond strengths were determined using both nucleobase and nucleoside models for adduct pairs, as well as the corresponding complexes involving natural 2'-deoxyguanosine. In addition to the magnitude of the binding strengths, the R(C1'···C1') distances and ∠(N9C1'C1') angles, as well as the degree of propeller-twist and buckle distortions, were carefully compared to the values observed in natural DNA strands. Due to structural changes in the adduct monomer upon inclusion of the sugar moiety, the monomer deformation energy significantly affects the relative hydrogen-bond strengths calculated with the nucleobase and nucleoside models. Therefore, we recommend the use of at least a nucleoside model to accurately evaluate hydrogen-bond strengths of base pairs involving flexible, bulky nucleobase adducts. Our results also emphasize the importance of considering both the magnitude of the hydrogen-bond strength and the structure of the base pair when predicting the preferential binding patterns of nucleobases. Using our best models, we conclude that the Watson-Crick face of the ortho phenoxyl adduct forms significantly more stable complexes than the Hoogsteen face, which

  7. Watson-Crick Base Pairing, Electronic and Photophysical Properties of Triazole Modified Adenine Analogues: A Computational Study

    KAUST Repository

    Das, Shubhajit

    2015-09-17

    We employ first-principles Density Functional Theory (DFT) and time-dependent DFT (TDDFT) to elucidate structural, electronic and optical properties of a few recently reported triazole adenine nucleobase analogues. The results are compared against the findings obtained for both natural adenine nucleobase and available experimental data. The optical absorption of these adenine analogues are calculated both in gas-phase and in solvent (methanol) using Polarized Continuum Model (PCM). We find that all the analogues show a red-shifted absorption profile as compared to adenine. Our simulated emission spectra in solvent compare fairly well with experimentally observed results. We investigate base paring ability of these adenine analogues with thymine. The calculations on the intrinsic stability of these base pairs ascertain that all the adenine analogues form the hydrogen bonded Watson-Crick base pair with similar H-bonding energy as obtained for natural adenine-thymine base pair. In our study, we provide a microscopic origin of the low-energy absorption and emission peaks, observed experimentally.

  8. Effect of electronic coupling of Watson-Crick hopping in DNA poly(dA)-poly(dT)

    Science.gov (United States)

    Risqi, A. M.; Yudiarsah, E.

    2017-07-01

    Charge transport properties of poly(dA)-poly(dT) DNA has been studied by using thigh binding Hamiltonian approach. Molecule DNA that we use consist of 32 base pair of adenine (A) and thymine (T) and backbone is consist of phosphate and sugar. The molecule DNA is contacted electrode at both ends. Charge transport in molecule DNA depend on the environment, we studied the effect of electronic coupling of Watson-Crick hopping in poly(dA)-poly(dT) DNA to transmission probability and characteristic I-V. The electronic coupling constant influence charge transport between adenine-thymine base pairs at the same site. Transmission probability is studied by using transfer matrix and scattering matrix method, and the result of transmission probability is used to calculate the characteristic I-V by using formula Landauer Buttiker. The result shows that when the electronic coupling increase then transmission probability and characteristic I-V increase slightly.

  9. Watson-Crick Base Pairing, Electronic and Photophysical Properties of Triazole Modified Adenine Analogues: A Computational Study

    KAUST Repository

    Das, Shubhajit; Samanta, Pralok Kumar; Pati, Swapan

    2015-01-01

    We employ first-principles Density Functional Theory (DFT) and time-dependent DFT (TDDFT) to elucidate structural, electronic and optical properties of a few recently reported triazole adenine nucleobase analogues. The results are compared against the findings obtained for both natural adenine nucleobase and available experimental data. The optical absorption of these adenine analogues are calculated both in gas-phase and in solvent (methanol) using Polarized Continuum Model (PCM). We find that all the analogues show a red-shifted absorption profile as compared to adenine. Our simulated emission spectra in solvent compare fairly well with experimentally observed results. We investigate base paring ability of these adenine analogues with thymine. The calculations on the intrinsic stability of these base pairs ascertain that all the adenine analogues form the hydrogen bonded Watson-Crick base pair with similar H-bonding energy as obtained for natural adenine-thymine base pair. In our study, we provide a microscopic origin of the low-energy absorption and emission peaks, observed experimentally.

  10. Pyrrolo-dC Metal-Mediated Base Pairs in the Reverse Watson-Crick Double Helix: Enhanced Stability of Parallel DNA and Impact of 6-Pyridinyl Residues on Fluorescence and Silver-Ion Binding.

    Science.gov (United States)

    Yang, Haozhe; Mei, Hui; Seela, Frank

    2015-07-06

    Reverse Watson-Crick DNA with parallel-strand orientation (ps DNA) has been constructed. Pyrrolo-dC (PyrdC) nucleosides with phenyl and pyridinyl residues linked to the 6 position of the pyrrolo[2,3-d]pyrimidine base have been incorporated in 12- and 25-mer oligonucleotide duplexes and utilized as silver-ion binding sites. Thermal-stability studies on the parallel DNA strands demonstrated extremely strong silver-ion binding and strongly enhanced duplex stability. Stoichiometric UV and fluorescence titration experiments verified that a single (2py) PyrdC-(2py) PyrdC pair captures two silver ions in ps DNA. A structure for the PyrdC silver-ion base pair that aligns 7-deazapurine bases head-to-tail instead of head-to-head, as suggested for canonical DNA, is proposed. The silver DNA double helix represents the first example of a ps DNA structure built up of bidentate and tridentate reverse Watson-Crick base pairs stabilized by a dinuclear silver-mediated PyrdC pair. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  11. Highly Stable Double-Stranded DNA Containing Sequential Silver(I)-Mediated 7-Deazaadenine/Thymine Watson-Crick Base Pairs.

    Science.gov (United States)

    Santamaría-Díaz, Noelia; Méndez-Arriaga, José M; Salas, Juan M; Galindo, Miguel A

    2016-05-17

    The oligonucleotide d(TX)9 , which consists of an octadecamer sequence with alternating non-canonical 7-deazaadenine (X) and canonical thymine (T) as the nucleobases, was synthesized and shown to hybridize into double-stranded DNA through the formation of hydrogen-bonded Watson-Crick base pairs. dsDNA with metal-mediated base pairs was then obtained by selectively replacing W-C hydrogen bonds by coordination bonds to central silver(I) ions. The oligonucleotide I adopts a duplex structure in the absence of Ag(+) ions, and its stability is significantly enhanced in the presence of Ag(+) ions while its double-helix structure is retained. Temperature-dependent UV spectroscopy, circular dichroism spectroscopy, and ESI mass spectrometry were used to confirm the selective formation of the silver(I)-mediated base pairs. This strategy could become useful for preparing stable metallo-DNA-based nanostructures. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  12. Case of the missing fingerprints or Dr. Watson's cosmology

    Energy Technology Data Exchange (ETDEWEB)

    Longair, M.S.

    1987-01-01

    The cosmological problem has four main areas of uncertainty -the origin of isotropy of the universe, the origin of the fluctuations from which galaxies form, the explanation of why we live in a matter universe rather than one composed of equal amounts of matter and antimatter and why the Universe seems to be within a factor of 10 of the critical, flat universe. These cannot be explained satisfactorily within the Hot Big Bang theory after a millisecond or so. The solutions are presumed, therefore, to lie in the very early universe when it was less than about a millisecond old. The clues which lead to this conclusion are set out in terms of a detective story with Sherlock Holmes explaining the facts about the universe to Dr Watson. Holmes first explains the size of the universe in terms of distances and sizes of stars, galaxies and galaxy clusters. Evidence from pictures of the universe at different temperatures, (X-ray pictures, gamma-ray pictures, far infra-red pictures and pictures at radio and millimetre wavelengths) is presented. Holmes then starts to build up a realistic model of the universe using two of the facts collected (the isotropy of the universe and the expansion of the universe), one assumption (the cosmological principle) and one theory of gravity (General Relativity). However the universe which emerges does not solve the four problems mentioned. Quasars, which provide information (illustrated) from earlier epochs of the universe may, therefore, help to solve the problems. (U.K.).

  13. Case Study: IBM Watson Analytics Cloud Platform as Analytics-as-a-Service System for Heart Failure Early Detection

    Directory of Open Access Journals (Sweden)

    Gabriele Guidi

    2016-07-01

    Full Text Available In the recent years the progress in technology and the increasing availability of fast connections have produced a migration of functionalities in Information Technologies services, from static servers to distributed technologies. This article describes the main tools available on the market to perform Analytics as a Service (AaaS using a cloud platform. It is also described a use case of IBM Watson Analytics, a cloud system for data analytics, applied to the following research scope: detecting the presence or absence of Heart Failure disease using nothing more than the electrocardiographic signal, in particular through the analysis of Heart Rate Variability. The obtained results are comparable with those coming from the literature, in terms of accuracy and predictive power. Advantages and drawbacks of cloud versus static approaches are discussed in the last sections.

  14. On the calculation of line strengths, oscillator strengths and lifetimes for very large principal quantum numbers in hydrogenic atoms and ions by the McLean–Watson formula

    International Nuclear Information System (INIS)

    Hey, J D

    2014-01-01

    As a sequel to an earlier study (Hey 2009 J. Phys. B: At. Mol. Opt. Phys. 42 125701), we consider further the application of the line strength formula derived by Watson (2006 J. Phys. B: At. Mol. Opt. Phys. 39 L291) to transitions arising from states of very high principal quantum number in hydrogenic atoms and ions (Rydberg–Rydberg transitions, n > 1000). It is shown how apparent difficulties associated with the use of recurrence relations, derived (Hey 2006 J. Phys. B: At. Mol. Opt. Phys. 39 2641) by the ladder operator technique of Infeld and Hull (1951 Rev. Mod. Phys. 23 21), may be eliminated by a very simple numerical device, whereby this method may readily be applied up to n ≈ 10 000. Beyond this range, programming of the method may entail greater care and complexity. The use of the numerically efficient McLean–Watson formula for such cases is again illustrated by the determination of radiative lifetimes and comparison of present results with those from an asymptotic formula. The question of the influence on the results of the omission or inclusion of fine structure is considered by comparison with calculations based on the standard Condon–Shortley line strength formula. Interest in this work on the radial matrix elements for large n and n′ is related to measurements of radio recombination lines from tenuous space plasmas, e.g. Stepkin et al (2007 Mon. Not. R. Astron. Soc. 374 852), Bell et al (2011 Astrophys. Space Sci. 333 377), to the calculation of electron impact broadening parameters for such spectra (Watson 2006 J. Phys. B: At. Mol. Opt. Phys. 39 1889) and comparison with other theoretical methods (Peach 2014 Adv. Space Res. in press), to the modelling of physical processes in H II regions (Roshi et al 2012 Astrophys. J. 749 49), and the evaluation bound–bound transitions from states of high n during primordial cosmological recombination (Grin and Hirata 2010 Phys. Rev. D 81 083005, Ali-Haïmoud and Hirata 2010 Phys. Rev. D 82 063521

  15. Effect of rosemary (Rosmarinus officinalis) extracts and glutathione antioxidants on bull semen quality after cryopreservation

    Energy Technology Data Exchange (ETDEWEB)

    Daghigh-Kia, H.; Olfati-Karaji, R.; Hoseinkhani, A.; Ashrafi, I.

    2014-06-01

    The present study determined the effects of the addition of rosemary extract (ROM), glutathione (GSH), and their combination (ROM + GSH) to freezing extender on the quality of bull semen after cryopreservation. Before cryoperservation, the samples were diluted in a tris-egg yolk (TEY) extender containing 5 mM GSH (treatment I), 5 or 10 g L{sup -}1 ROM (treatments II and III), and ROM with GSH (5 mM GSH with 5 or 10 g L{sup -}1 of ROM) (treatments IV and V). An extender containing no antioxidants (non-ROM/GSH-treated) served as control group. Kinematic parameters were evaluated by means of a computer-assisted semen analysis (CASA). The viability and membrane integrity of the sperm were assessed using eosin-nigrosin stain and the hypo-osmotic swelling test (HOST) at 0 and 2 h after freezethawing. Lipooxidative parameters, superoxide dismutase, and glutathione peroxidase (GPx) activity were assessed after thawing. Treatment III showed positive effects for total motility (TM) (p < 0.01), average path velocity (VAP) (p < 0.001), viability (p < 0.01) and HOST (p < 0.01); however, lipid peroxidation (LPO) decreased (p < 0.05) and GPx activity increased (p < 0.05) immediately after thawing compared to the control. The TM (p < 0.01), VAP (p < 0.01), viability (p < 0.01), HOST (p < 0.01) decreased in LPO (p < 0.01) and GPx activity (p < 0.05) for treatment V and the viability and GPx activity (p < 0.05) for treatment I were significantly higher than for the control group at 2 h after thawing. It was concluded that the inclusion of ROM and its combination with GSH improves the post-thaw quality of bull semen. (Author)

  16. Can tautomerization of the A·T Watson-Crick base pair via double proton transfer provoke point mutations during DNA replication? A comprehensive QM and QTAIM analysis.

    Science.gov (United States)

    Brovarets, Ol'ha O; Hovorun, Dmytro M

    2014-01-01

    Trying to answer the question posed in the title, we have carried out a detailed theoretical investigation of the biologically important mechanism of the tautomerization of the A·T Watson-Crick DNA base pair, information that is hard to establish experimentally. By combining theoretical investigations at the MP2 and density functional theory levels of QM theory with quantum theory of atoms in molecules analysis, the tautomerization of the A·T Watson-Crick base pair by the double proton transfer (DPT) was comprehensively studied in vacuo and in the continuum with a low dielectric constant (ϵ = 4) corresponding to a hydrophobic interfaces of protein-nucleic acid interactions. Based on the sweeps of the electron-topological, geometric, and energetic parameters, which describe the course of the tautomerization along its intrinsic reaction coordinate (IRC), it was proved that the A·T → A(∗)·T(∗) tautomerization through the DPT is a concerted (i.e. the pathway without an intermediate) and asynchronous (i.e. protons move with a time gap) process. The limiting stage of this phenomenon is the final PT along the N6H⋯O4 hydrogen bond (H-bond). The continuum with ϵ = 4 does not affect qualitatively the course of the tautomerization reaction: similar to that observed in vacuo, it proceeds via a concerted asynchronous process with the same structure of the transition state (TS). For the first time, the nine key points along the IRC of the A·T base pair tautomerization, which could be considered as electron-topological "fingerprints" of a concerted asynchronous process of the tautomerization via the DPT, have been identified and fully characterized. These nine key points have been used to define the reactant, TS, and product regions of the DPT in the A·T base pair. Considering the energy dependence of each of the three H-bonds, which stabilize the Watson-Crick and Löwdin's base pairs, along the IRC of the tautomerization, it was found that all these H

  17. Seabed morphology and the bottom-current pathways around Rosemary Bank seamount, northern Rockall Trough, North Atlantic

    Energy Technology Data Exchange (ETDEWEB)

    Howe, J.A. [Dunstaffnage Marine Laboratory, Scottish Association for Marine Science, Oban, Argyll PA37 1QA, Scotland (United Kingdom); Stoker, M.S.; Bulat, J. [British Geological Survey, Murchison House, West Mains Road, Edinburgh EH9 3LA, Scotland (United Kingdom); Masson, D.G. [Southampton Oceanography Centre, Empress Dock, European Way, Southampton SO14 3ZH (United Kingdom); Pudsey, C.J.; Morris, P.; Larter, R.D. [British Antarctic Survey, High Cross, Madingley Road, Cambridge CB3 OET (United Kingdom)

    2006-02-15

    Rosemary Bank is a broadly domed and elongate seamount with a diameter of 70km, occurring in water depths of between 300 and 2300m, 120km west of the UK mainland in the northern Rockall Trough. Recent multibeam bathymetry and sub-bottom profiles, together with pre-existing current meter and CTD data, seismic reflection profiles and seabed core samples were examined in order to evaluate past and present bottom-current pathways and processes. The multibeam data image volcanic parasitic cones, concave slide scars and the terraced slopes of the bank. Bottom-current sedimentation is interpreted as producing a drift-moat complex surrounding the entire seamount and including two sediment wave-fields, developed to the west and east of the bank in water depths of 1500-2000m. The western drift covers an area of over 1000km{sup 2}. Sediment waves to the west of the bank are up to 150m high with wave lengths of 1.5-2km. Four 100m deep, 3km wide, linear depressions, bisect the waves and are interpreted as 25-30km long extensions of the moat. Seismic reflection profiles show the main phase of drift construction was during the mid-Miocene to Pliocene with the Pliocene to Holocene being an interval of drift maintenance. Cores from sediments draping over and adjacent to the seamount contain sandy and gravelly contourites interbedded with hemipelagites of late Pleistocene to Holocene age. Current meter and CTD data from the western moat indicate Labrador Sea Water flowing northwest, in contrast to the previously assumed anticlockwise circulation pattern around the seamount. (author)

  18. Detection of protonated non-Watson-Crick base pairs using electrospray ionization mass spectrometry.

    Science.gov (United States)

    Ishida, Riyoko; Iwahashi, Hideo

    2018-03-01

    Many studies have shown that protonated nucleic acid base pairs are involved in a wide variety of nucleic acid structures. However, little information is available on relative stability of hemiprotonated self- and non-self-dimers at monomer level. We used electrospray ionization mass spectrometry (ESI-MS) to evaluate the relative stability under various concentrations of hydrogen ion. These enable conjecture of the formation of protonated non-Watson-Crick base pairs based on DNA and RNA base sequence. In the present study, we observed that ESI-MS peaks corresponded to respective self-dimers for all examined nucleosides except for adenosine. Peak heights depended on the concentration of hydrogen ion. The ESI-MS peak heights of the hemiprotonated cytidine dimers and the hemiprotonated thymidine dimer sharply increased with increased concentration of hydrogen ion, suggesting direct participation of hydrogen ion in dimer formations. In ESI-MS measurements of the solutions containing adenosine, cytidine, thymidine and guanosine, we observed protonated cytidine-guanosine dimer (CH+-G) and protonated cytidine-thymidine dimer (CH+-T) in addition to hemiprotonated cytidine-cytidine dimer (CH+-C) with following relative peak height, (CH+-C) > (CH+-G) ≈ (CH+-T) > (CH+-A). Additionally, in the ESI-MS measurements of solutions containing adenosine, thymidine and guanosine, we observed a considerable amount of protonated adenosine-guanosine (AH+-G) and protonated adenosine-thymidine (AH+-T).

  19. Light-emitting self-assembled peptide nucleic acids exhibit both stacking interactions and Watson-Crick base pairing.

    Science.gov (United States)

    Berger, Or; Adler-Abramovich, Lihi; Levy-Sakin, Michal; Grunwald, Assaf; Liebes-Peer, Yael; Bachar, Mor; Buzhansky, Ludmila; Mossou, Estelle; Forsyth, V Trevor; Schwartz, Tal; Ebenstein, Yuval; Frolow, Felix; Shimon, Linda J W; Patolsky, Fernando; Gazit, Ehud

    2015-04-01

    The two main branches of bionanotechnology involve the self-assembly of either peptides or DNA. Peptide scaffolds offer chemical versatility, architectural flexibility and structural complexity, but they lack the precise base pairing and molecular recognition available with nucleic acid assemblies. Here, inspired by the ability of aromatic dipeptides to form ordered nanostructures with unique physical properties, we explore the assembly of peptide nucleic acids (PNAs), which are short DNA mimics that have an amide backbone. All 16 combinations of the very short di-PNA building blocks were synthesized and assayed for their ability to self-associate. Only three guanine-containing di-PNAs-CG, GC and GG-could form ordered assemblies, as observed by electron microscopy, and these di-PNAs efficiently assembled into discrete architectures within a few minutes. The X-ray crystal structure of the GC di-PNA showed the occurrence of both stacking interactions and Watson-Crick base pairing. The assemblies were also found to exhibit optical properties including voltage-dependent electroluminescence and wide-range excitation-dependent fluorescence in the visible region.

  20. Modulation of radiation-induced histological and biochemical alterations in mice by Rosemary (Rosemarinus officinalis)

    International Nuclear Information System (INIS)

    Jindal, Archana; Goyal, P.K.

    2012-01-01

    depletion in lipid peroxidation and an elevation in glutathione and catalase levels both. The results from the present study suggest the protective activity of Rosemary leaves extract against gamma irradiation. (author)

  1. UK Institute of Physics (IOP) President Sir Gareth Roberts (right) at CERN on 9 July with (right to left) IOP council vice-president and distinguished physicist Peter Kalmus, CERN engineer Tim Watson and IOP director of science Peter Cooper

    CERN Multimedia

    Patrice Loiez

    1999-01-01

    UK Institute of Physics (IOP) President Sir Gareth Roberts (right) at CERN on 9 July with (right to left) IOP council vice-president and distinguished physicist Peter Kalmus, CERN engineer Tim Watson and IOP director of science Peter Cooper

  2. The influence of N-7 guanine modifications on the strength of Watson-Crick base pairing and guanine N-1 acidity: Comparison of gas-phase and condensed-phase trends

    Czech Academy of Sciences Publication Activity Database

    Burda, J. V.; Šponer, Jiří; Hrabáková, J.; Zeizinger, M.; Leszczynski, J.

    2003-01-01

    Roč. 107, č. 22 (2003), s. 5349-5356 ISSN 1520-6106 R&D Projects: GA MŠk ME 517; GA MŠk LN00A016 Grant - others:Wellcome Trust(GB) GR067507MF; ONR(US) N00034-03-1-0116; National Science Foundation(US) CREST 9805465 Institutional research plan: CEZ:AV0Z5004920 Keywords : Watson-Crick base pairing * guanines * gas-phase and condensed-phase trends Subject RIV: BO - Biophysics Impact factor: 3.679, year: 2003

  3. Kinetics and Thermodynamics of Watson-Crick Base Pairing Driven DNA Origami Dimerization.

    Science.gov (United States)

    Zenk, John; Tuntivate, Chanon; Schulman, Rebecca

    2016-03-16

    We investigate the kinetics and thermodynamics of DNA origami dimerization using flat rectangle origami components and different architectures of Watson-Crick complementary single-stranded DNA ("sticky end") linking strategies. We systematically vary the number of linkers, the length of the sticky ends on the linker, and linker architecture and measure the corresponding yields as well as forward and reverse reaction rate constants through fluorescence quenching assays. Yields were further verified using atomic force microscopy. We calculate values of H° and ΔS° for various interface designs and find nonlinear van't Hoff behavior, best described by two linear equations, suggesting distinct regimes of dimerization between those with and those without well-formed interfaces. We find that self-assembly reactions can be tuned by manipulating the interface architecture without suffering a loss in yield, even when yield is high, ∼75-80%. We show that the second-order forward reaction rate constant (k(on)) depends on both linker architecture and number of linkers used, with typical values on the order of 10(5)-10(6) (M·s)(-1), values that are similar to those of bimolecular association of small, complementary DNA strands. The k(on) values are generally non-Arrhenius, tending to increase with decreasing temperature. Finally, we use kinetic and thermodynamic information about the optimal linking architecture to extend the system to an infinite, two-component repeating lattice system and show that we can form micron-sized lattices, with well-formed structures up to 8 μm(2).

  4. Determination of h2JNN and h1JHN coupling constants across Watson-Crick base pairs in the Antennapedia homeodomain-DNA complex using TROSY

    International Nuclear Information System (INIS)

    Pervushin, Konstantin; Fernandez, Cesar; Riek, Roland; Ono, Akira; Kainosho, Masatsune; Wuethrich, Kurt

    2000-01-01

    This paper describes NMR measurements of 15 N- 15 N and 1 H- 15 N scalar couplings across hydrogen bonds in Watson-Crick base pairs, h2 J NN and h1 J HN , in a 17 kDa Antennapedia homeodomain-DNA complex. A new NMR experiment is introduced which relies on zero-quantum coherence-based transverse relaxation-optimized spectroscopy (ZQ-TROSY) and enables measurements of h1 J HN couplings in larger molecules. The h2 J NN and h1 J HN couplings open a new avenue for comparative studies of DNA duplexes and other forms of nucleic acids free in solution and in complexes with proteins, drugs or possibly other classes of compounds

  5. 8 May 2014 - W. Watson-Wright, Assistant Director General and Executive Secretary UNESCO Intergovernmental Oceanographic Commission Assistant Director-General for the Natural Sciences Sector ad interim visiting the CMS cavern with CMS Collaboration Deputy Spkokesperson K. Borras. Adviser to the Director-General, in charge of Relations with International Organisations M. Bona present throughout.

    CERN Multimedia

    Brice, Maximilien

    2014-01-01

    Ms Wendy Watson-Wright Assistant Director General and Executive Secretary UNESCO Intergovernmental Oceanographic Commission Assistant Director-General for the Natural Sciences Sector ad interim UNESCO

  6. Free energy landscape and transition pathways from Watson-Crick to Hoogsteen base pairing in free duplex DNA.

    Science.gov (United States)

    Yang, Changwon; Kim, Eunae; Pak, Youngshang

    2015-09-18

    Houghton (HG) base pairing plays a central role in the DNA binding of proteins and small ligands. Probing detailed transition mechanism from Watson-Crick (WC) to HG base pair (bp) formation in duplex DNAs is of fundamental importance in terms of revealing intrinsic functions of double helical DNAs beyond their sequence determined functions. We investigated a free energy landscape of a free B-DNA with an adenosine-thymine (A-T) rich sequence to probe its conformational transition pathways from WC to HG base pairing. The free energy landscape was computed with a state-of-art two-dimensional umbrella molecular dynamics simulation at the all-atom level. The present simulation showed that in an isolated duplex DNA, the spontaneous transition from WC to HG bp takes place via multiple pathways. Notably, base flipping into the major and minor grooves was found to play an important role in forming these multiple transition pathways. This finding suggests that naked B-DNA under normal conditions has an inherent ability to form HG bps via spontaneous base opening events. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  7. Anthelmintic activity of Rosmarinus officinalis against Dactylogyrus minutus (Monogenea) infections in Cyprinus carpio.

    Science.gov (United States)

    Zoral, M A; Futami, K; Endo, M; Maita, M; Katagiri, T

    2017-11-30

    Monogenean parasites are important ectoparasites of fish, and are responsible for severe economic impacts in the aquaculture industry. They are usually treated with chemicals, but the chemicals can have harmful side effects in the fish and may pose threats to human health. Rosemary (Rosmarinus officinalis) is a common medicinal herb, with antimicrobial and antitumor properties. Here, we examined the anthelmintic activity of rosemary extract against the monogenean (Dactylogyrus minutus) in vitro and in vivo using bath treatment and oral administration. The in vitro experiments showed that parasite survival was affected by both rosemary extract concentration and the solvent (water and ethanol). Parasites were dead at 61.8±5.6 and 7.8±1.4min when exposed to 100 and 200g aqueous rosemary extract solution/L of water respectively. It took 166.7±48.2 and 5.4±1.01min to kill the parasites when exposed to 1 and 32g ethanol rosemary extract solution/L of water respectively. Moreover, pure component of rosemary extract obtained commercially used in in vitro experiments showed that 1,8-Cineole was the most toxic component of the main components tested. Parasite intensity and prevalence in fish exposed to 50 and 100g aqueous rosemary solution/L water for 30min were significantly lower than they were in controls (p<0.05). In oral treatment experiments, diets of Cyprinus carpio were supplemented with eight different concentrations of aqueous rosemary extract. The intensity of parasites was significantly less in fish fed for 30days with feed containing 60, 80 and 100ml aqueous extract/100g feed than in control (p<0.05). Together these results indicate that rosemary is a promising candidate for prevention and control of monogenean infection. Copyright © 2017. Published by Elsevier B.V.

  8. Application of the Faddeev-Watson expansion to thermal collisions of Rydberg atoms with neutral particles

    International Nuclear Information System (INIS)

    de Prunele, E.

    1983-01-01

    The Faddeev-Watson expansion (FWE) for the T operator is applied to the study of thermal collisions between Rydberg atom and neutral atom. These collisions are considered as a three-body problem (the perturber, the Rydberg electron, and its parent core) and it is assumed, as already done in most theoretical works dealing with Rydberg-atom--atom collisions, that the core-perturber interaction can be neglected. Then the evaluation of the FWE first- and second-order terms is made tractable by using an appropriate separable potential for the Rydberg-electron--perturber interaction. The evaluation of the second-order term allows us to estimate the importance of taking into account explicitly the Rydberg-electron--core interaction in the expression of the (three-body) T operator for the thermal collisions considered. Detailed calculations for the process Rb(n, l = 0)+He →Rb(n',l')+He are presented and discussed. The FWE second-order term has been evaluated for the first time by taking the (two-body) t operator associated with the Rydberg atom (valence electron plus parent core) as the Coulomb potential. The contribution of the FWE second-order term to the scattering amplitude decreases as n increases and is found especially significant when both the momentum transfers involved in the collision are large and the values of l and l' are small

  9. Higher order structural effects stabilizing the reverse watson-crick guanine-cytosine base pair in functional RNAs

    KAUST Repository

    Chawla, Mohit

    2013-10-10

    The G:C reverse Watson-Crick (W:W trans) base pair, also known as Levitt base pair in the context of tRNAs, is a structurally and functionally important base pair that contributes to tertiary interactions joining distant domains in functional RNA molecules and also participates in metabolite binding in riboswitches. We previously indicated that the isolated G:C W:W trans base pair is a rather unstable geometry, and that dicationic metal binding to the Guanine base or posttranscriptional modification of the Guanine can increase its stability. Herein, we extend our survey and report on other H-bonding interactions that can increase the stability of this base pair. To this aim, we performed a bioinformatics search of the PDB to locate all the occurencies of G:C trans base pairs. Interestingly, 66% of the G:C trans base pairs in the PDB are engaged in additional H-bonding interactions with other bases, the RNA backbone or structured water molecules. High level quantum mechanical calculations on a data set of representative crystal structures were performed to shed light on the structural stability and energetics of the various crystallographic motifs. This analysis was extended to the binding of the preQ1 metabolite to a preQ1-II riboswitch. 2013 The Author(s).

  10. Estimation of strength in different extra Watson-Crick hydrogen bonds in DNA double helices through quantum chemical studies.

    Science.gov (United States)

    Bandyopadhyay, D; Bhattacharyya, D

    2006-10-15

    It was shown earlier, from database analysis, model building studies, and molecular dynamics simulations that formation of cross-strand bifurcated or Extra Watson-Crick hydrogen (EWC) bonds between successive base pairs may lead to extra rigidity to DNA double helices of certain sequences. The strengths of these hydrogen bonds are debatable, however, as they do not have standard linear geometry criterion. We have therefore carried out detailed ab initio quantum chemical studies using RHF/6-31G(2d,2p) and B3LYP/6-31G(2p,2d) basis sets to determine strengths of several bent hydrogen bonds with different donor and acceptors. Interaction energy calculations, corrected for the basis set superposition errors, suggest that N-H...O type bent EWC hydrogen bonds are possible along same strands or across the strands between successive base pairs, leading to significant stability (ca. 4-9 kcal/mol). The N-H...N and C-H...O type interactions, however, are not so stabilizing. Hence, consideration of EWC N-H...O H-bonds can lead to a better understanding of DNA sequence directed structural features. Copyright (c) 2006 Wiley Periodicals, Inc.

  11. The role of rosemary extract in degeneration of hippocampal neurons induced by kainic acid in the rat: A behavioral and histochemical approach.

    Science.gov (United States)

    Naderali, Elahe; Nikbakht, Farnaz; Ofogh, Sattar Norouzi; Rasoolijazi, Homa

    2018-01-01

    Systemic Kainic Acid (KA) administration has been used to induce experimental temporal lobe epilepsy in rats. The aim of this study was to evaluate the neuroprotective effect of rosemary extract (RE, 40% Carnosic acid) against KA-induced neurotoxicity in hippocampus and impaired learning and memory. Animals received a single dose of KA (9.5 mg/kg) intraperitoneally (i.p.) (KA group) and were observed for 2 h and were scored from 0 (for normal, no convulsion) to 5 (for continuous generalized limbic seizures). RE (100 mg/kg, orally) was administered daily for 23 days, starting a week before KA injection (KA+RE group). Neuronal degeneration in hippocampus was demonstrated by using Fluoro-Jade B immunofluorescence. The number of pyramidal cells in hippocampus was evaluated by Nissl staining. Also, the Morris Water Maze and Shuttle box have been used to assess spatial memory and passive avoidance learning, respectively. Our results revealed that, after treatment with RE, neuronal loss in CA1 decreased significantly in the animals in KA+RE group. The Morris water navigation task results revealed that spatial memory impairment decreased in the animals in KA+RE group. Furthermore, results in Shuttle box test showed that passive avoidance learning impairment significantly, upgraded in the animals in KA+RE group. These results suggest that RE may improve the spatial and working memory deficits and also neuronal degeneration induced by toxicity of KA in the rat hippocampus, due to its antioxidant activities.

  12. Performance characterization of Watson Ahumada motion detector using random dot rotary motion stimuli.

    Directory of Open Access Journals (Sweden)

    Siddharth Jain

    Full Text Available The performance of Watson & Ahumada's model of human visual motion sensing is compared against human psychophysical performance. The stimulus consists of random dots undergoing rotary motion, displayed in a circular annulus. The model matches psychophysical observer performance with respect to most parameters. It is able to replicate some key psychophysical findings such as invariance of observer performance to dot density in the display, and decrease of observer performance with frame duration of the display.Associated with the concept of rotary motion is the notion of a center about which rotation occurs. One might think that for accurate estimation of rotary motion in the display, this center must be accurately known. A simple vector analysis reveals that this need not be the case. Numerical simulations confirm this result, and may explain the position invariance of MST(d cells. Position invariance is the experimental finding that rotary motion sensitive cells are insensitive to where in their receptive field rotation occurs.When all the dots in the display are randomly drawn from a uniform distribution, illusory rotary motion is perceived. This case was investigated by Rose & Blake previously, who termed the illusory rotary motion the omega effect. Two important experimental findings are reported concerning this effect. First, although the display of random dots evokes perception of rotary motion, the direction of motion perceived does not depend on what dot pattern is shown. Second, the time interval between spontaneous flips in perceived direction is lognormally distributed (mode approximately 2 s. These findings suggest the omega effect fits in the category of a typical bistable illusion, and therefore the processes that give rise to this illusion may be the same processes that underlie much of other bistable phenomenon.

  13. Assessment of Cytotoxic Activity of Rosemary (Rosmarinus officinalis L.), Turmeric (Curcuma longa L.), and Ginger (Zingiber officinale R.) Essential Oils in Cervical Cancer Cells (HeLa)

    Science.gov (United States)

    Santos, P. A. S. R.; Avanço, G. B.; Nerilo, S. B.; Marcelino, R. I. A.; Janeiro, V.; Valadares, M. C.

    2016-01-01

    The objective of this study was to evaluate the cytotoxic activity of rosemary (REO, Rosmarinus officinalis L.), turmeric (CEO, Curcuma longa L.), and ginger (GEO, Zingiber officinale R.) essential oils in HeLa cells. Cytotoxicity tests were performed in vitro, using tetrazolium (MTT) and neutral red assays for evaluation of antiproliferative activity by different mechanisms, trypan blue assay to assess cell viability and evaluation of cell morphology for Giemsa to observe the cell damage, and Annexin V to evaluate cell death by apoptosis. CEO and GEO exhibited potent cytotoxic activity against HeLa cells. IC50 obtained was 36.6 μg/mL for CEO and 129.9 μg/mL for GEO. The morphology of HeLa cells showed condensation of chromatin, loss of cell membrane integrity with protrusions (blebs), and cell content leakage for cells treated with CEO and GEO, from the lowest concentrations studied, 32.81 μg/mL of CEO and 32.12 μg/mL of GEO. The Annexin V assay revealed a profile of cell death by apoptosis for both CEO and GEO. The results indicate cytotoxic activity in vitro for CEO and GEO, suggesting potential use as anticancer agents for cervical cancer cells. PMID:28042599

  14. Assessment of Cytotoxic Activity of Rosemary (Rosmarinus officinalis L., Turmeric (Curcuma longa L., and Ginger (Zingiber officinale R. Essential Oils in Cervical Cancer Cells (HeLa

    Directory of Open Access Journals (Sweden)

    P. A. S. R. Santos

    2016-01-01

    Full Text Available The objective of this study was to evaluate the cytotoxic activity of rosemary (REO, Rosmarinus officinalis L., turmeric (CEO, Curcuma longa L., and ginger (GEO, Zingiber officinale R. essential oils in HeLa cells. Cytotoxicity tests were performed in vitro, using tetrazolium (MTT and neutral red assays for evaluation of antiproliferative activity by different mechanisms, trypan blue assay to assess cell viability and evaluation of cell morphology for Giemsa to observe the cell damage, and Annexin V to evaluate cell death by apoptosis. CEO and GEO exhibited potent cytotoxic activity against HeLa cells. IC50 obtained was 36.6 μg/mL for CEO and 129.9 μg/mL for GEO. The morphology of HeLa cells showed condensation of chromatin, loss of cell membrane integrity with protrusions (blebs, and cell content leakage for cells treated with CEO and GEO, from the lowest concentrations studied, 32.81 μg/mL of CEO and 32.12 μg/mL of GEO. The Annexin V assay revealed a profile of cell death by apoptosis for both CEO and GEO. The results indicate cytotoxic activity in vitro for CEO and GEO, suggesting potential use as anticancer agents for cervical cancer cells.

  15. Assessment of Cytotoxic Activity of Rosemary (Rosmarinus officinalis L.), Turmeric (Curcuma longa L.), and Ginger (Zingiber officinale R.) Essential Oils in Cervical Cancer Cells (HeLa).

    Science.gov (United States)

    Santos, P A S R; Avanço, G B; Nerilo, S B; Marcelino, R I A; Janeiro, V; Valadares, M C; Machinski, Miguel

    2016-01-01

    The objective of this study was to evaluate the cytotoxic activity of rosemary (REO, Rosmarinus officinalis L.), turmeric (CEO, Curcuma longa L.), and ginger (GEO, Zingiber officinale R.) essential oils in HeLa cells. Cytotoxicity tests were performed in vitro , using tetrazolium (MTT) and neutral red assays for evaluation of antiproliferative activity by different mechanisms, trypan blue assay to assess cell viability and evaluation of cell morphology for Giemsa to observe the cell damage, and Annexin V to evaluate cell death by apoptosis. CEO and GEO exhibited potent cytotoxic activity against HeLa cells. IC 50 obtained was 36.6  μ g/mL for CEO and 129.9  μ g/mL for GEO. The morphology of HeLa cells showed condensation of chromatin, loss of cell membrane integrity with protrusions (blebs), and cell content leakage for cells treated with CEO and GEO, from the lowest concentrations studied, 32.81  μ g/mL of CEO and 32.12  μ g/mL of GEO. The Annexin V assay revealed a profile of cell death by apoptosis for both CEO and GEO. The results indicate cytotoxic activity in vitro for CEO and GEO, suggesting potential use as anticancer agents for cervical cancer cells.

  16. Effects of an Addition of Different Essential Oils and Their Combinations to Diets on Performance and Carcass Characteristics Parameters in Broilers

    Directory of Open Access Journals (Sweden)

    Behlül Sevim

    2017-08-01

    Full Text Available This study was conducted to determine the effect of dietary supplementation of thymus (Thymus vulgaris L., rosemary (Rosmarinus officinalis L. and French lavender (Lavandua stoechas L. essential oils and their mixtures on body weight and body weight gain, feed consumption, feed conversion ratio, carcass characteristics in broiler. A total of one day old 640 broiler chicks (Ross 308 were used divided into 8 groups each having five replicates, ramdomly. There were 80 chicks in each experimental group. The experimental diets were consisted of control (0 mg/kg, addition to thymus essential oil (50 mg/kg, rosemary essential oil (50 mg/kg, lavandula essential oil (50 mg/kg tymus + rosemary (25+25 mg/kg, tymus + lavandula (25+25 mg/kg, rosemary + lavandula (25+25 mg/kg, tymus + rosemary + lavandula (16.7+16.7+16.7 mg/kg, respectively. Feed and water were provided as ad libitum. Experimental period was six weeks. The according to results that dietary different essential oil and their combinations did not significantly effect on body weight, body weight gain, feed consumption, feed conversion ratio and carcass characteristics.

  17. Evaluation of the rosemary essential oil (Rosmarinus officinalis L. as modulator of bacterial resistanceAvaliação do óleo essencial de alecrim (Rosmarinus officinalis L. como modulador da resistência bacteriana

    Directory of Open Access Journals (Sweden)

    Eudes Silva Velozo

    2012-05-01

    Full Text Available Microorganisms can be transmitted by food causing diseases in humans. The antibiotics commonly used in treatment of these diseases have shown little or no effect, and in view of the resistance that many microorganisms have acquired. This study evaluated the essential oil leaves of Rosmarinus officinalis L. as a modulator of resistance bacterial drug. The essential oil was obtained by hydrodistillation in a Clevenger apparatus for 3 hours. We tested four strains of E.coli resistant ampicillin (AMP and tetracycline (TET and four strains of Salmonella spp. Resistant to nitrofurantoin (NIT. The strains in 0.5 MacFarland scale suspension were inoculated on Mueller Hinton agar, then soaked antibiotic disks with 10 and 20?L oil pure rosemary were placed on the plates. After 24h/37 º C were measured halos around the discs. All strains tested showed susceptibility to the combined action of essential oil with antibiotics tested. The results indicate that the use of promising rosemary essential oil in combination with antibiotics to combat pathogenic bacteria. Diversos microrganismos podem ser veiculados por alimentos causando doenças nos seres humanos. Os antibióticos comumente utilizados no tratamento dessas doenças têm apresentado baixo ou nenhum efeito, tendo em vista à resistência que muitos microrganismos têm adquirido. Diante deste quadro, o objetivo desta pesquisa foi avaliar o óleo essencial das folhas de Rosmarinus officinalis L. como modulador da resistência bacteriana a drogas. O óleo essencial foi obtido através de hidrodestilação em aparelho de Clevenger por 3h. Foram testadas 4 cepas de E.coli resistentes a Amplicilina (AMP e a Tetraciclina (TET e 4 cepas de Salmonella spp. resistentes a Nitrofurantoína (NIT. As cepas em suspensão escala MacFarland 0,5 foram inoculadas em agar Mueller Hinton, em seguida os discos dos antibióticos embebidos com 10 e 20?L do óleo de alecrim puro foram dispostos sobre as placas. Após 24h/37º

  18. Leucaena lanceolata S. Watson ssp. lanceolata, ESPECIE FORESTAL CON POTENCIAL PARA SER INTRODUCIDA EN SISTEMAS SILVOPASTORILES

    Directory of Open Access Journals (Sweden)

    María L. Román-Miranda

    2013-01-01

    Full Text Available La utilización de especies forestales en los sistemas de producción agropecuaria contribuye a reducir la presión en los bosques naturales y se pueden incorporar en áreas no arboladas. El objetivo de este estudio fue evaluar la calidad nutritiva, germinación, desarrollo de plántula en vivero y diversidad de usos de Leucaena lanceolata S. Watson ssp. lanceolata. El material comestible y las semillas se colectaron en Tomatlán, Jalisco. Se realizaron análisis bromatológicos, pruebas de escarificación y evaluación de plántula en vivero sobre tres suelos con diferente pH. El experimento se analizó en un diseño completamente al azar con comparación de medias de Tukey (P ≤ 0.05. Además, se hicieron entrevistas a productores, una revisión bibliográfica y consulta de ejemplares en los herbarios para conocer los usos locales y potenciales de la especie. Los resultados indican alto contenido de materia seca (97.40 % y proteína cruda (29.05 %, mayor germinación en los tratamientos térmicos, mejor desarrollo de la plántula en el suelo ligeramente ácido (6.57 y la diversidad de usos incluye leña, forraje y madera, entre otros. Por el alto valor nutritivo y diversidad de usos en el medio rural, L. lanceolata representa una opción viable para utilizarse en sistemas silvopastoriles del trópico seco.

  19. High-Resolution Crystal Structure of a Silver(I)-RNA Hybrid Duplex Containing Watson-Crick-like C-Silver(I)-C Metallo-Base Pairs.

    Science.gov (United States)

    Kondo, Jiro; Tada, Yoshinari; Dairaku, Takenori; Saneyoshi, Hisao; Okamoto, Itaru; Tanaka, Yoshiyuki; Ono, Akira

    2015-11-02

    Metallo-base pairs have been extensively studied for applications in nucleic acid-based nanodevices and genetic code expansion. Metallo-base pairs composed of natural nucleobases are attractive because nanodevices containing natural metallo-base pairs can be easily prepared from commercially available sources. Previously, we have reported a crystal structure of a DNA duplex containing T-Hg(II)-T base pairs. Herein, we have determined a high-resolution crystal structure of the second natural metallo-base pair between pyrimidine bases C-Ag(I)-C formed in an RNA duplex. One Ag(I) occupies the center between two cytosines and forms a C-Ag(I)-C base pair through N3-Ag(I)-N3 linear coordination. The C-Ag(I)-C base pair formation does not disturb the standard A-form conformation of RNA. Since the C-Ag(I)-C base pair is structurally similar to the canonical Watson-Crick base pairs, it can be a useful building block for structure-based design and fabrication of nucleic acid-based nanodevices. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  20. Delay oil oxidation during frying process

    International Nuclear Information System (INIS)

    Atta, N.M.M.; Shams Eldin, N.M.M.

    2010-01-01

    Blend oil (mixed of refined sunflower and soy beans oils 1:1 w/w) containing add 200 ppm of rosemary leaves methanolic extract (rosemary extract) (RE) and 3% refined rice bran oil (RRBO), were used in frying process at 1800 degree c for 5 hrs/ day, four consecutive days to delay oil oxidation during frying. Therefore, rosemary extract (methanolic extract) was analyzed by HPLC technique for identification of flavonoids compounds (as a specific active compounds; gives high protection to frying oil). Physical and chemical properties, including refractive index(RI). Red color unit (R), viscosity, acidity (FFA), peroxide value (PV), iodine value (IV) oxidized fatty acid (OFA), polymer content (PC), total polar components (TPC) and trans fatty acid (TFA) as eliadic acid were determined. The results indicated that; rosemary extract contained about eight flavonoids compounds (hypersoid, rutin, 3-OH flavon, luleotin, kempferol, sakarutin, querectrin and apeginin). Addition of RE or RRBO to frying oil caused delay oil oxidation during frying process compared with frying oil without any addition. Also, the results indicated that rosemary extract was more effective in reducing formation of PV, FFA, OFA, PC, TPC and TFA in frying oil than refined rice bran oil

  1. Intramolecular CH···O hydrogen bonds in the AI and BI DNA-like conformers of canonical nucleosides and their Watson-Crick pairs. Quantum chemical and AIM analysis.

    Science.gov (United States)

    Yurenko, Yevgen P; Zhurakivsky, Roman O; Samijlenko, Svitlana P; Hovorun, Dmytro M

    2011-08-01

    The aim of this work is to cast some light on the H-bonds in double-stranded DNA in its AI and BI forms. For this purpose, we have performed the MP2 and DFT quantum chemical calculations of the canonical nucleoside conformers, relative to the AI and BI DNA forms, and their Watson-Crick pairs, which were regarded as the simplest models of the double-stranded DNA. Based on the atoms-in-molecules analysis (AIM), five types of the CH···O hydrogen bonds, involving bases and sugar, were detected numerically from 1 to 3 per a conformer: C2'H···O5', C1'H···O2, C6H···O5', C8H···O5', and C6H···O4'. The energy values of H-bonds occupy the range of 2.3-5.6 kcal/mol, surely exceeding the kT value (0.62 kcal/mol). The nucleoside CH···O hydrogen bonds appeared to "survive" turns of bases against the sugar, sometimes in rather large ranges of the angle values, pertinent to certain conformations, which points out to the source of the DNA lability, necessary for the conformational adaptation in processes of its functioning. The calculation of the interactions in the dA·T nucleoside pair gives evidence, that additionally to the N6H···O4 and N1···N3H canonical H-bonds, between the bases adenine and thymine the third one (C2H···O2) is formed, which, though being rather weak (about 1 kcal/mol), satisfies the AIM criteria of H-bonding and may be classified as a true H-bond. The total energy of all the CH···O nontraditional intramolecular H-bonds in DNA nucleoside pairs appeared to be commensurable with the energy of H-bonds between the bases in Watson-Crick pairs, which implies their possible important role in the DNA shaping.

  2. Improving the lean muscle color of dark-cutting beef by aging, antioxidant-enhancement, and modified atmospheric packaging.

    Science.gov (United States)

    Wills, K M; Mitacek, R M; Mafi, G G; VanOverbeke, D L; Jaroni, D; Jadeja, R; Ramanathan, R

    2017-12-01

    The objective was to evaluate the effects of wet-aging, rosemary-enhancement, and modified atmospheric packaging on the color of dark-cutting beef during simulated retail display. No-roll dark-cutting strip loins ( = 12; pH > 6.0) were selected from a commercial packing plant within 3 d postharvest. Using a balanced incomplete block design, dark-cutting loins were sectioned in half, and assigned to 1 of 3 aging periods: 7, 14, or 21 d. After respective aging, each aged section was divided into 3 equal parts, and randomly assigned to 1 of 3 enhancement treatments: nonenhanced dark-cutting, dark-cutter enhanced with 0.1% rosemary, and dark-cutter enhanced with 0.2% rosemary. Following enhancement, steaks were randomly assigned to 1 of 3 packaging treatments: high-oxygen modified atmospheric packaging (HiOx-MAP; 80% O and 20% CO), carbon monoxide modified atmospheric packaging (CO-MAP; 0.4% CO, 69.6% N, and 30% CO), and polyvinyl chloride overwrap (PVC; 20% O). Instrumental and visual color measurements were recorded during 5 d simulated retail display. Lipid oxidation was determined utilizing the thiobarbituric acid reactive substances (TBARS) method. There was a significant packaging × enhancement × display time interaction for values and chroma ( 0.001). On d 0 of display, dark-cutting steaks enhanced with 0.1% and 0.2% rosemary and packaged in HiOx-MAP had greater ( 0.001) values and chroma than other dark-cutting packaging/enhancement treatments. A significant packaging × enhancement × display time interaction resulted for values ( 0.001). Dark-cutting steaks enhanced with 0.2% rosemary and packaged in HiOx-MAP was lighter ( 0.001; greater values) than other dark-cutting treatments on d 5 of display. There were no differences ( 0.34) in discoloration scores on d 5 among different dark-cutting treatments when steaks were packaged in HiOx- and CO-MAP. There was an aging period × enhancement × packaging interaction ( cutting steaks enhanced with 0.2% rosemary

  3. Effects of Rosmarinus officinalis L. on memory performance, anxiety, depression, and sleep quality in university students: A randomized clinical trial.

    Science.gov (United States)

    Nematolahi, Pouya; Mehrabani, Mitra; Karami-Mohajeri, Somayyeh; Dabaghzadeh, Fatemeh

    2018-02-01

    To evaluate the effects of oral rosemary on memory performance, anxiety, depression, and sleep quality in university students. In this double-blinded randomized controlled trial, the 68 participating students randomly received 500 mg rosemary and placebo twice daily for one month. Prospective and retrospective memory performance, depression, anxiety and sleep quality of the students were measured using Prospective and Retrospective Memory Questionnaire, Hospital Anxiety and Depression Scale, and Pittsburgh Sleep Quality Inventory at baseline and after one month. The scores of all the scales and subscales except the sleep latency and sleep duration components of Pittsburgh Sleep Quality Inventory were significantly decreased in the rosemary group in comparison with the control group after one month. Rosemary as a traditional herb could be used to boost prospective and retrospective memory, reduce anxiety and depression, and improve sleep quality in university students. Copyright © 2017 Elsevier Ltd. All rights reserved.

  4. Determination of redox potentials for the Watson-Crick base pairs, DNA nucleosides, and relevant nucleoside analogues.

    Science.gov (United States)

    Crespo-Hernandez, Carlos E; Close, David M; Gorb, Leonid; Leszczynski, Jerzy

    2007-05-17

    Redox potentials for the DNA nucleobases and nucleosides, various relevant nucleoside analogues, Watson-Crick base pairs, and seven organic dyes are presented based on DFT/B3LYP/6-31++G(d,p) and B3YLP/6-311+G(2df,p)//B3LYP/6-31+G* levels of calculations. The values are determined from an experimentally calibrated set of equations that correlate the vertical ionization (electron affinity) energy of 20 organic molecules with their experimental reversible oxidation (reduction) potential. Our results are in good agreement with those estimated experimentally for the DNA nucleosides in acetonitrile solutions (Seidel et al. J. Phys. Chem. 1996, 100, 5541). We have found that nucleosides with anti conformation exhibit lower oxidation potentials than the corresponding syn conformers. The lowering in the oxidation potential is due to the formation of an intramolecular hydrogen bonding interaction between the 5'-OH group of the sugar and the N3 of the purine bases or C2=O of the pyrimidine bases in the syn conformation. Pairing of adenine or guanine with its complementary pyrimidine base decreases its oxidation potential by 0.15 or 0.28 V, respectively. The calculated energy difference between the oxidation potential for the G.C base pair and that of the guanine base is in good agreement with the experimental value estimated recently (0.34 V: Caruso, T.; et al. J. Am. Chem. Soc. 2005, 127, 15040). The complete and consistent set of reversible redox values determined in this work for the DNA constituents is expected to be of considerable value to those studying charge and electronic energy transfer in DNA.

  5. Metal-mediated DNA base pairing: alternatives to hydrogen-bonded Watson-Crick base pairs.

    Science.gov (United States)

    Takezawa, Yusuke; Shionoya, Mitsuhiko

    2012-12-18

    With its capacity to store and transfer the genetic information within a sequence of monomers, DNA forms its central role in chemical evolution through replication and amplification. This elegant behavior is largely based on highly specific molecular recognition between nucleobases through the specific hydrogen bonds in the Watson-Crick base pairing system. While the native base pairs have been amazingly sophisticated through the long history of evolution, synthetic chemists have devoted considerable efforts to create alternative base pairing systems in recent decades. Most of these new systems were designed based on the shape complementarity of the pairs or the rearrangement of hydrogen-bonding patterns. We wondered whether metal coordination could serve as an alternative driving force for DNA base pairing and why hydrogen bonding was selected on Earth in the course of molecular evolution. Therefore, we envisioned an alternative design strategy: we replaced hydrogen bonding with another important scheme in biological systems, metal-coordination bonding. In this Account, we provide an overview of the chemistry of metal-mediated base pairing including basic concepts, molecular design, characteristic structures and properties, and possible applications of DNA-based molecular systems. We describe several examples of artificial metal-mediated base pairs, such as Cu(2+)-mediated hydroxypyridone base pair, H-Cu(2+)-H (where H denotes a hydroxypyridone-bearing nucleoside), developed by us and other researchers. To design the metallo-base pairs we carefully chose appropriate combinations of ligand-bearing nucleosides and metal ions. As expected from their stronger bonding through metal coordination, DNA duplexes possessing metallo-base pairs exhibited higher thermal stability than natural hydrogen-bonded DNAs. Furthermore, we could also use metal-mediated base pairs to construct or induce other high-order structures. These features could lead to metal-responsive functional

  6. Acrylamide in bread. Effect of prooxidants and antioxidants

    DEFF Research Database (Denmark)

    Hedegaard, Rikke Susanne Vingborg; Granby, Kit; Frandsen, Henrik Lauritz

    2008-01-01

    . Increasing the addition of aqueous rosemary extract to 10% did not decrease the acrylamide content further compared to the addition of a 1% extract. The spice dittany showed less effect in wheat buns compared to rosemary and even increased acrylamide formation slightly. The effect of antioxidants...

  7. Rosmarinus Officinalis Leaves as a Natural Source of Bioactive Compounds

    Directory of Open Access Journals (Sweden)

    Isabel Borrás-Linares

    2014-11-01

    Full Text Available In an extensive search for bioactive compounds from plant sources, the composition of different extracts of rosemary leaves collected from different geographical zones of Serbia was studied. The qualitative and quantitative characterization of 20 rosemary (Rosmarinus officinalis samples, obtained by microwave-assisted extraction (MAE, was determined by high performance liquid chromatography coupled to electrospray quadrupole-time of flight mass spectrometry (HPLC–ESI-QTOF-MS. The high mass accuracy and true isotopic pattern in both MS and MS/MS spectra provided by the QTOF-MS analyzer enabled the characterization of a wide range of phenolic compounds in the extracts, including flavonoids, phenolic diterpenes and abietan-type triterpenoids, among others. According to the data compiled, rosemary samples from Sokobanja presented the highest levels in flavonoids and other compounds such as carnosol, rosmaridiphenol, rosmadial, rosmarinic acid, and carnosic acid. On the other hand, higher contents in triterpenes were found in the extracts of rosemary from Gložan (Vojvodina.

  8. Enhancing Lipid Stability in Irradiated Beef Mince by Oleoresins and/ or Ascorbic Acid during Chilling Storage

    International Nuclear Information System (INIS)

    Zahran, D.A.

    2008-01-01

    Lipid Oxidation, fatty acids profile and sensory properties of irradiated beef mince (2.5 kGy) treated with oleoresins (rosemary or ginger), ascorbic acid, or combination of ascorbic acid and oleoresins were investigated during 30 days of chilled storage. Thiobarbituric acid reactive substances (TBARS) as an indication of lipid oxidation, of irradiated control samples were significantly higher than those of non irradiated control and samples treated with rosemary and ginger oleoresins. By GC-MS analysis, it was found that the relative percentage of total saturated fatty acids (TSFA) increased in all treatments. However, the highest increase was recorded in irradiated control samples compared to non irradiated control samples. Beef mince samples treated with oleoresins (rosemary or ginger) had the best scores for discoloration and off odour. Thus, the addition of oleoresins (rosemary or ginger) to beef mince before irradiation could be an easily applied method to minimize oxidative degradation of irradiated meat

  9. 2-Methoxypyridine as a Thymidine Mimic in Watson-Crick Base Pairs of DNA and PNA: Synthesis, Thermal Stability, and NMR Structural Studies.

    Science.gov (United States)

    Novosjolova, Irina; Kennedy, Scott D; Rozners, Eriks

    2017-11-02

    The development of nucleic acid base-pair analogues that use new modes of molecular recognition is important both for fundamental research and practical applications. The goal of this study was to evaluate 2-methoxypyridine as a cationic thymidine mimic in the A-T base pair. The hypothesis was that including protonation in the Watson-Crick base pairing scheme would enhance the thermal stability of the DNA double helix without compromising the sequence selectivity. DNA and peptide nucleic acid (PNA) sequences containing the new 2-methoxypyridine nucleobase (P) were synthesized and studied by using UV thermal melting and NMR spectroscopy. Introduction of P nucleobase caused a loss of thermal stability of ≈10 °C in DNA-DNA duplexes and ≈20 °C in PNA-DNA duplexes over a range of mildly acidic to neutral pH. Despite the decrease in thermal stability, the NMR structural studies showed that P-A formed the expected protonated base pair at pH 4.3. Our study demonstrates the feasibility of cationic unnatural base pairs; however, future optimization of such analogues will be required. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  10. 40 CFR 152.25 - Exemptions for pesticides of a character not requiring FIFRA regulation.

    Science.gov (United States)

    2010-07-01

    ... solids Rosemary and rosemary oil Sesame (includes ground sesame plant) and sesame oil Sodium chloride (common salt) Sodium lauryl sulfate Soybean oil Thyme and thyme oil White pepper Zinc metal strips... Geraniol Geranium oil Lauryl sulfate Lemongrass oil Linseed oil Malic acid Mint and mint oil Peppermint and...

  11. Enhancing the efficacy of AREDS antioxidants in light-induced retinal degeneration.

    Science.gov (United States)

    Wong, Paul; Markey, M; Rapp, C M; Darrow, R M; Ziesel, A; Organisciak, D T

    2017-01-01

    Light-induced photoreceptor cell degeneration and disease progression in age-related macular degeneration (AMD) involve oxidative stress and visual cell loss, which can be prevented, or slowed, by antioxidants. Our goal was to test the protective efficacy of a traditional Age-related Eye Disease Study antioxidant formulation (AREDS) and AREDS combined with non-traditional antioxidants in a preclinical animal model of photooxidative retinal damage. Male Sprague-Dawley rats were reared in a low-intensity (20 lux) or high-intensity (200 lux) cyclic light environment for 6 weeks. Some animals received a daily dietary supplement consisting of a small cracker infused with an AREDS antioxidant mineral mixture, AREDS antioxidants minus zinc, or zinc oxide alone. Other rats received AREDS combined with a detergent extract of the common herb rosemary, AREDS plus carnosic acid, zinc oxide plus rosemary, or rosemary alone. Antioxidant efficacy was determined by measuring retinal DNA levels 2 weeks after 6 h of intense exposure to white light (9,000 lux). Western blotting was used to determine visual cell opsin and arrestin levels following intense light treatment. Rhodopsin regeneration was determined after 1 h of exposure to light. Gene array analysis was used to determine changes in the expression of retinal genes resulting from light rearing environment or from antioxidant supplementation. Chronic high-intensity cyclic light rearing resulted in lower levels of rod and cone opsins, retinal S-antigen (S-ag), and medium wavelength cone arrestin (mCAR) than found for rats maintained in low cyclic light. However, as determined by retinal DNA, and by residual opsin and arrestin levels, 2 weeks after acute photooxidative damage, visual cell loss was greater in rats reared in low cyclic light. Retinal damage decreased with AREDS plus rosemary, or with zinc oxide plus rosemary whereas AREDS alone and zinc oxide alone (at their daily recommended levels) were both ineffective. One

  12. Avaliação do potencial antioxidante de extratos ativos de plantas obtidos por extração com fluido supercrítico Evaluation of the antioxidant potential of plant extracts obtained by supercritical fluid extraction

    Directory of Open Access Journals (Sweden)

    Oselys Rodriguez Justo

    2008-01-01

    Full Text Available The aim of this work was to evaluate the antioxidant properties of ginger and rosemary extracts, obtained by supercritical extraction. The extracts were characterized by HPLC, GC-MS, phenolic compounds content and antioxidant activity. The main active compounds were identified and high content of phenolic compounds was observed. The extracts presented high antioxidant activity against the free radicals ABTS•+ (350 and 200 mM Trolox/g, for ginger and rosemary, respectively and DPPH•+ (145 and 80 mM Trolox/g, for ginger and rosemary, respectively. These results suggested that the attained extracts are potential substitutes of synthetic antioxidants used in chemical, food and pharmaceutical industries.

  13. NMR solution structure of an N2-guanine DNA adduct derived from the potent tumorigen dibenzo[a,l]pyrene: Intercalation from the minor groove with ruptured Watson-Crick base pairing

    Science.gov (United States)

    Tang, Yijin; Liu, Zhi; Ding, Shuang; Lin, Chin H.; Cai, Yuqin; Rodriguez, Fabian A.; Sayer, Jane M.; Jerina, Donald M.; Amin, Shantu; Broyde, Suse; Geacintov, Nicholas E.

    2012-01-01

    The most potent tumorigen identified among the polycyclic aromatic hydrocarbons (PAH) is the non-planar fjord region dibenzo[a,l]pyrene (DB[a,l]P). It is metabolically activated in vivo through the widely-studied diol epoxide (DE) pathway to form covalent adducts with DNA bases, predominantly guanine and adenine. The (+)-11S,12R,13R,14S DE enantiomer forms adducts via its C14-position with the exocyclic amino group of guanine. Here, we present the first NMR solution structure of a DB[a,l]P-derived adduct, the 14R (+)-trans-anti-DB[a,l]P–N2-dG (DB[a,l]P-dG) lesion in double-stranded DNA. In contrast to the stereochemically identical benzo[a]pyrene-derived N2-dG adduct (B[a]P-dG) in which the B[a]P rings reside in the B-DNA minor groove on the 3’-side of the modifed deoxyguanosine, in the DB[a,l]P-derived adduct the DB[a,l]P rings intercalate into the duplex on the 3’-side of the modified base from the sterically crowded minor groove. Watson-Crick base pairing of the modified guanine with the partner cytosine is broken, but these bases retain some stacking with the bulky DB[a,l]P ring system. This new theme in PAH DE - DNA adduct conformation differs from: (1) the classical intercalation motif where Watson-Crick base-pairing is intact at the lesion site, and (2) the base-displaced intercalation motif in which the damaged base and its partner are extruded from the helix . The structural considerations that lead to the intercalated conformation of the DB[a,l]P-dG lesion in contrast to the minor groove alignment of the B[a]P-dG adduct, and the implications of the DB[a,l]P-dG conformational motif for the recognition of such DNA lesions by the human nucleotide excision repair apparatus, are discussed. PMID:23121427

  14. Prevention Of Radiation Induced Hematological Alterations By ...

    African Journals Online (AJOL)

    The modulatory influence of Rosmarinus officinalis (rosemary) leaves extract was investigated in Swiss albino mice at a dose of 3 Gy gamma radiation. For this purpose, adult Swiss albino mice were irradiated with 3 Gy gamma rays in the presence (experimental) or absence (control) of rosemary (1000 mg/kg body wt.).

  15. FT-IR and FT-Raman spectra of 5-chlorocytosine: Solid state simulation and tautomerism. Effect of the chlorine substitution in the Watson-Crick base pair 5-chlorodeoxycytidine-deoxyguanosine

    Science.gov (United States)

    Alcolea Palafox, M.; Rastogi, V. K.; Singh, S. P.

    2018-01-01

    The laser Raman and IR spectra of 5-chlorocytosine have been recorded and accurately assigned in the solid state using Density functional calculations (DFT) together with the linear scaling equation procedure (LSE) and the solid state simulation of the crystal unit cell through a tetramer form. These results remarkably improve those reported previously by other authors. Several new scaling equations were proposed to be used in related molecules. The six main tautomers of the biomolecule 5-chlorocytosine were determined and optimized at the MP2 and CCSD levels, using different basis sets. The relative stabilities were compared with those obtained in cytosine and their 5-halo derivatives. Several relationships between energies, geometric parameters and NBO atomic charges were established. The effect of the chlorine substitution in the fifth position was evaluated through the stability of the Watson-Crick (WC) base pair of 5-chlorodeoxycytidine with deoxyguanosine, and through their vibrational spectra.

  16. Studies on The Synergistic Effect of Some Irradiated Essential Oils in Some Food Products

    International Nuclear Information System (INIS)

    Hanafy, M.A.A.

    2013-01-01

    Cumin, rosemary and thyme essential oils were gamma irradiated. Then, antibacterial and antioxidant activities were studied to measure the synergistic effect of their essential oils mixtures. 4, 6 and 4 kGy were the recommended doses for cumin, rosemary and thyme, respectively according to antimicrobial activity (agar well-diffusion) against S. typhimurium, S. aureus, B. cereus and E. coli. There were no changes in the physiochemical properties due to irradiation but, some changes occurred in the GC/MS analysis where, the amount of oxygenated compounds increased in cumin and thyme essential oils while, the oxygenated compounds decreased in rosemary essential oil. The mixture made from non-irradiated cumin (C 0 ) and rosemary (R 0 ) essential oils were showed the highest antimicrobial activity against E. coil and B. cereus at 50 μl. Mixtures made from non-irradiated cumin and thyme (T 0 ) essential oils showed the highest antimicrobial activity against B. cereus. Mixtures made form irradiated cumin at dose 4 kGy (C 4 ) and rosemary at dose 6 kGy (R 6 ) essential oils introduced promising antimicrobial activity as well as C 0 XR 0 mixture. Fraction inhibitory concentrations (FIC) were studied against selected four bacterial strains for measuring synergistic activity however, (FIC) represented indifference in all essential oils mixtures but, the C 0 X R 0 mixture against B. cereus (0.375) and E. coli (0.375) was synergy (below 0.5). Furthermore, the FIC shows addition in case of R 0 XT 0 , C 2 XR 6 , C 4 XR 6 and R 6 XT 4 against B. cereus. And in case of C 4 XR 6 against S. typhimurium. Preliminary experiment represented that 0.2, 0.4 and 0.1% were the acceptable odor in sunflower oil supplemented with rosemary, cumin and thyme essential oils, respectively.

  17. Inhibition of gastric lipase as a mechanism for body weight and plasma lipids reduction in Zucker rats fed a rosemary extract rich in carnosic acid.

    Directory of Open Access Journals (Sweden)

    María Romo Vaquero

    Full Text Available BACKGROUND: Rosemary (Rosmarinus officinalis L. extracts (REs exhibit hepatoprotective, anti-obesity and anti-inflammatory properties and are widely used in the food industry. REs are rich in carnosic acid (CA and carnosol which may be responsible for some of the biological activities of REs. The aim of this study was to investigate whether inhibition of lipase activity in the gut may be a mechanism by which a RE enriched in CA (40% modulates body weight and lipids levels in a rat model of metabolic disorders and obesity. METHODS AND PRINCIPAL FINDINGS: RE was administered for 64 days to lean (fa/+ and obese (fa/fa female Zucker rats and body weight, food intake, feces weight and blood biochemical parameters were monitored throughout the study. Lipase activity (hydrolysis of p-nitrophenylbutyrate was measured in the gastrointestinal tract at the end of the study and the contents of CA, carnosol and methyl carnosate were also determined. Sub-chronic administration of RE moderately reduced body weight gain in both lean and obese animals but did not affect food intake. Serum triglycerides, cholesterol and insulin levels were also markedly decreased in the lean animals supplemented with RE. Importantly, lipase activity was significantly inhibited in the stomach of the RE-supplemented animals where the highest content of intact CA and carnosol was detected. CONCLUSIONS: Our results confirm that long-term administration of RE enriched in CA moderates weight gain and improves the plasma lipids profile, primarily in the lean animals. Our data also suggest that these effects may be caused, at least in part, by a significant inhibition of gastric lipase and subsequent reduction in fat absorption.

  18. Inhibition of Gastric Lipase as a Mechanism for Body Weight and Plasma Lipids Reduction in Zucker Rats Fed a Rosemary Extract Rich in Carnosic Acid

    Science.gov (United States)

    Romo Vaquero, María; Yáñez-Gascón, María-Josefa; García Villalba, Rocío; Larrosa, Mar; Fromentin, Emilie; Ibarra, Alvin; Roller, Marc; Tomás-Barberán, Francisco; Espín de Gea, Juan Carlos; García-Conesa, María-Teresa

    2012-01-01

    Background Rosemary (Rosmarinus officinalis L.) extracts (REs) exhibit hepatoprotective, anti-obesity and anti-inflammatory properties and are widely used in the food industry. REs are rich in carnosic acid (CA) and carnosol which may be responsible for some of the biological activities of REs. The aim of this study was to investigate whether inhibition of lipase activity in the gut may be a mechanism by which a RE enriched in CA (40%) modulates body weight and lipids levels in a rat model of metabolic disorders and obesity. Methods and Principal Findings RE was administered for 64 days to lean (fa/+) and obese (fa/fa) female Zucker rats and body weight, food intake, feces weight and blood biochemical parameters were monitored throughout the study. Lipase activity (hydrolysis of p-nitrophenylbutyrate) was measured in the gastrointestinal tract at the end of the study and the contents of CA, carnosol and methyl carnosate were also determined. Sub-chronic administration of RE moderately reduced body weight gain in both lean and obese animals but did not affect food intake. Serum triglycerides, cholesterol and insulin levels were also markedly decreased in the lean animals supplemented with RE. Importantly, lipase activity was significantly inhibited in the stomach of the RE-supplemented animals where the highest content of intact CA and carnosol was detected. Conclusions Our results confirm that long-term administration of RE enriched in CA moderates weight gain and improves the plasma lipids profile, primarily in the lean animals. Our data also suggest that these effects may be caused, at least in part, by a significant inhibition of gastric lipase and subsequent reduction in fat absorption. PMID:22745826

  19. Nuclear magnetic resonance solution structure of an N(2)-guanine DNA adduct derived from the potent tumorigen dibenzo[a,l]pyrene: intercalation from the minor groove with ruptured Watson-Crick base pairing.

    Science.gov (United States)

    Tang, Yijin; Liu, Zhi; Ding, Shuang; Lin, Chin H; Cai, Yuqin; Rodriguez, Fabian A; Sayer, Jane M; Jerina, Donald M; Amin, Shantu; Broyde, Suse; Geacintov, Nicholas E

    2012-12-04

    The most potent tumorigen identified among the polycyclic aromatic hydrocarbons (PAH) is the nonplanar fjord region dibenzo[a,l]pyrene (DB[a,l]P). It is metabolically activated in vivo through the widely studied diol epoxide (DE) pathway to form covalent adducts with DNA bases, predominantly guanine and adenine. The (+)-11S,12R,13R,14S DE enantiomer forms adducts via its C14 position with the exocyclic amino group of guanine. Here, we present the first nuclear magnetic resonance solution structure of a DB[a,l]P-derived adduct, the 14R-(+)-trans-anti-DB[a,l]P-N(2)-dG (DB[a,l]P-dG) lesion in double-stranded DNA. In contrast to the stereochemically identical benzo[a]pyrene-derived N(2)-dG adduct (B[a]P-dG) in which the B[a]P rings reside in the B-DNA minor groove on the 3'-side of the modifed deoxyguanosine, in the DB[a,l]P-derived adduct the DB[a,l]P rings intercalate into the duplex on the 3'-side of the modified base from the sterically crowded minor groove. Watson-Crick base pairing of the modified guanine with the partner cytosine is broken, but these bases retain some stacking with the bulky DB[a,l]P ring system. This new theme in PAH DE-DNA adduct conformation differs from (1) the classical intercalation motif in which Watson-Crick base pairing is intact at the lesion site and (2) the base-displaced intercalation motif in which the damaged base and its partner are extruded from the helix. The structural considerations that lead to the intercalated conformation of the DB[a,l]P-dG lesion in contrast to the minor groove alignment of the B[a]P-dG adduct, and the implications of the DB[a,l]P-dG conformational motif for the recognition of such DNA lesions by the human nucleotide excision repair apparatus, are discussed.

  20. Complexes of DNA bases and Watson-Crick base pairs interaction with neutral silver Agn (n = 8, 10, 12) clusters: a DFT and TDDFT study.

    Science.gov (United States)

    Srivastava, Ruby

    2018-03-01

    We study the binding of the neutral Ag n (n = 8, 10, 12) to the DNA base-adenine (A), guanine (G) and Watson-Crick -adenine-thymine, guanine-cytosine pairs. Geometries of complexes were optimized at the DFT level using the hybrid B3LYP functional. LANL2DZ effective core potential was used for silver and 6-31 + G ** was used for all other atoms. NBO charges were analyzed using the Natural population analysis. The absorption properties of Ag n -A,G/WC complexes were also studied using time-dependent density functional theory. The absorption spectra for these complexes show wavelength in the visible region. It was revealed that silver clusters interact more strongly with WC pairs than with isolated DNA complexes. Furthermore, it was found that the electronic charge transferred from silver to isolated DNA clusters are less than the electronic charge transferred from silver to the Ag n -WC complexes. The vertical ionization potential, vertical electron affinity, hardness, and electrophilicity index of Ag n -DNA/WC complexes have also been discussed.

  1. Inhibition of microbial growth by spice extracts and their effect of irradiation

    International Nuclear Information System (INIS)

    Ito, Hitoshi; Meixu, G.

    1994-01-01

    The antimicrobial activity of black pepper, rosemary and red pepper has been tested against 12 microorganisms. Alcoholic extracts of these spices were not exhibited strong activity against gram-negative bacteria in laboratory media. The growth of Bacillus subtilis and Clostridium botulinum type A was inhibited by 1% of black pepper, 0.5% rosemary and 0.03% red pepper. A little reduction of antimicrobial activity to B. subtilis was observed on extracts of gamma-irradiated black pepper or rosemary at 10 and 50 kGy. In the case of red pepper, irradiation of 10 or 50 kGy enhanced a little of antimicrobial activity to B. subtilis. Similar effect of irradiation was also observed on the inhibition of aflatoxin production by Aspergillus parasiticus in SL broth. (author)

  2. Physico-chemical profiles of the wobble ↔ Watson-Crick G*·2AP(w) ↔ G·2AP(WC) and A·2AP(w) ↔ A*·2AP(WC) tautomerisations: a QM/QTAIM comprehensive survey.

    Science.gov (United States)

    Brovarets', Ol'ha O; Voiteshenko, Ivan S; Hovorun, Dmytro M

    2017-12-20

    This study is intended to clarify in detail the tautomeric transformations of the wobble (w) G*·2AP(w) and A·2AP(w) nucleobase mispairs involving 2-aminopurine (2AP) into the Watson-Crick (WC) G·2AP(WC) and A*·2AP(WC) base mispairs (asterisks denote mutagenic tautomers of the DNA bases), respectively, by quantum-mechanical methods and Bader's Quantum Theory of Atoms in Molecules. Our previously reported methodology has been used, which allows the evolution of the physico-chemical parameters to be tracked along the entire internal reaction coordinate (IRC), not exclusively in the stationary states of these reactions. These biologically important G*·2AP(w) ↔ G·2AP(WC) and A·2AP(w) ↔ A*·2AP(WC) w ↔ WC tautomerisations, which are involved in mutagenic tautomerically-conformational pathways, determine the origin of the transitions and transversions induced by 2AP. In addition, it is established that they proceed through planar, highly stable, zwitterionic transition states and they exhibit similar physico-chemical profiles and stages of sequential intrapair proton transfer, followed by spatial rearrangement of the nucleobases relative to each other within the base pairs. These w ↔ WC tautomerisations occur non-dissociatively and are accompanied by a significant alteration in geometry (from wobble to Watson-Crick and vice versa) and redistribution of the specific intermolecular interactions, which can be divided into 10 patterns including AHB H-bonds and loosened A-H-B covalent bridges along the IRC of tautomerisation. Based on the redistribution of the geometrical and electron-topological parameters of the intrapair hydrogen bonds, exactly 9 key points have been allocated to characterize the evolution of these reactions.

  3. Antioxidant activity of rosemary and oregano ethanol extracts in soybean oil under thermal oxidation Ação antioxidante de extratos etanólicos de alecrim (Rosmarinus officinalis L. e orégano (Origanum vulgare L. em óleo de soja submetido à termoxidação

    Directory of Open Access Journals (Sweden)

    R.F. ALMEIDA-DORIA

    2000-08-01

    Full Text Available Four experiments were conducted to measure the antioxidant activity of ethanol extracts of rosemary and oregano compared with synthetic antioxidants such as TBHQ and BHA/BHT. The antioxidant activity was determined and results differed from those of the Oven test at 63º C. Peroxide values and absorptivities at 232 nm of soybean oil under Oven test were lower in treatments with 25, 50, 75, 100 and 200 mg.Kg-1 TBHQ than in treatments with 1000 mg.Kg-1 oregano extract (O, 500 mg.Kg-1 rosemary extract (R and their mixture R+O. All the treatments were effective in controlling the thermal oxidation of oils; the natural extracts were as effective as BHA+BHT and less effective than TBHQ. The natural extracts were mixed with 25, 50, 75 and 100 mg.Kg-1 TBHQ and then added to the oil. No improvement in antioxidative properties was observed. The best antioxidant concentration could be determined from polynomial regression and quadratic equation from the experimental data.Foram realizados quatro ensaios para verificação da atividade antioxidante de extratos etanólicos de alecrim (A e orégano (O comparados com os antioxidantes sintéticos TBHQ e BHA+BHT. Os resultados de atividade antioxidante do teste usando sistema modelo diferiram das respostas do teste acelerado em estufa. Nos ensaios em estufa os valores de peróxido e absortividade em 232nm dos óleos de soja, adicionados de 25, 50, 75, 100 e 200mg TBHQ. Kg-1, foram menores do que os dos óleos adicionados dos extratos de orégano (O (1000mg.Kg-1, de alecrim (A (500mg.Kg-1 ou da mistura deles (A + O. Todos os tratamentos retardaram a oxidação do óleo, entretanto os extratos naturais não atingiram a eficiência do TBHQ, mas foram tão efetivos quanto a mistura BHA+BHT. A adição dos extratos naturais a doses reduzidas de TBHQ não melhorou a eficiência em retardar a oxidação.

  4. NMR studies of echinomycin bisintercalation complexes with d(A1-C2-G3-T4) and d(T1-C2-G3-A4) duplexes in aqueous solution: sequence-dependent formation of Hoogsteen A1 x T4 and Watson-Crick T1 x A4 base pairs flanking the bisintercalation site

    International Nuclear Information System (INIS)

    Gao, X.; Patel, D.J.

    1988-01-01

    The authors report on two-dimensional proton NMR studies of echinomycin complexes with the self-complementary d(A1-C2-G3-Tr) and d(T1-C2-G3-A4) duplexes in aqueous solution. The exchangeable and nonexchangeable antibiotic and nucleic acid protons in the 1 echinomycin per tetranucleotide duplex complexes have been assigned from analyses of scalar coupling and distance connectivities in two-dimensional data sets records in H 2 O and D 2 O solution. An analysis of the intermolecular NOE patterns for both complexes combined with large upfield imino proton and large downfield phosphorus complexation chemical shift changes demonstrates that the two quinoxaline chromophores of echinomycin bisintercalate into the minor groove surrounding the dC-dG step of each tetranucleotide duplex. Further, the quinoxaline rings selectively stack between A1 and C2 bases in the d(ACGT) complex and between T1 and C2 bases in the d(TCGA) complex. The intermolecular NOE patterns and the base and sugar proton chemical shifts for residues C2 and G3 are virtually identical for the d(ACGT) and d(TCGA) complexes. A large set of intermolecular contacts established from nuclear Overhauser effects (NOEs) between antibiotic and nucleic acid protons in the echinomycin-tetranucleotide complexes in solution are consistent with corresponding contacts reported for echinomycin-oligonucleotide complexes in the crystalline state. The authors demonstrate that the G x G base pairs adopt Watson-Crick pairing in both d(ACGT) and d(TCGA) complexes in solution. By contrast, the A1 x T4 base pairs adopt Hoogsteen pairing for the echinomycin-d(A1-C2-G3-Tr) complex while the T1 x A4 base pairs adopt Watson-Crick pairing for the echinomycin-d(T1-C2-G3-A4) complex in aqueous solution. These results emphasize the role of sequence in discriminating between Watson-Crick and Hoogsteen pairs at base pairs flanking the echinomycin bisintercalation site in solution

  5. Anti-listerial effects of essential oils and herbs in fresh-cut produce: opportunities and limitations

    OpenAIRE

    Scollard, Johann

    2011-01-01

    peer-reviewed The potential anti-listerial benefits of essential oils and herbs in fresh-cut produce systems were investigated. Interactions with modified atmospheres and product types were examined in detail, including effects on quality. A strong anti-listerial response from rosemary herb was discovered during maceration and the chemical basis of this determined for future exploitation. The anti-listerial properties of essential oils (thyme, oregano and rosemary), under a ...

  6. Insights into Watson-Crick/Hoogsteen breathing dynamics and damage repair from the solution structure and dynamic ensemble of DNA duplexes containing m1A.

    Science.gov (United States)

    Sathyamoorthy, Bharathwaj; Shi, Honglue; Zhou, Huiqing; Xue, Yi; Rangadurai, Atul; Merriman, Dawn K; Al-Hashimi, Hashim M

    2017-05-19

    In the canonical DNA double helix, Watson-Crick (WC) base pairs (bps) exist in dynamic equilibrium with sparsely populated (∼0.02-0.4%) and short-lived (lifetimes ∼0.2-2.5 ms) Hoogsteen (HG) bps. To gain insights into transient HG bps, we used solution-state nuclear magnetic resonance spectroscopy, including measurements of residual dipolar couplings and molecular dynamics simulations, to examine how a single HG bp trapped using the N1-methylated adenine (m1A) lesion affects the structural and dynamic properties of two duplexes. The solution structure and dynamic ensembles of the duplexes reveals that in both cases, m1A forms a m1A•T HG bp, which is accompanied by local and global structural and dynamic perturbations in the double helix. These include a bias toward the BI backbone conformation; sugar repuckering, major-groove directed kinking (∼9°); and local melting of neighboring WC bps. These results provide atomic insights into WC/HG breathing dynamics in unmodified DNA duplexes as well as identify structural and dynamic signatures that could play roles in m1A recognition and repair. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  7. Presenting a new kinetic model for methanol to light olefins reactions over a hierarchical SAPO-34 catalyst using the Langmuir-Hinshelwood-Hougen-Watson mechanism

    Science.gov (United States)

    Javad Azarhoosh, Mohammad; Halladj, Rouein; Askari, Sima

    2017-10-01

    In this study, a new kinetic model for methanol to light olefins (MTO) reactions over a hierarchical SAPO-34 catalyst using the Langmuir-Hinshelwood-Hougen-Watson (LHHW) mechanism was presented and the kinetic parameters was obtained using a genetic algorithm (GA) and genetic programming (GP). Several kinetic models for the MTO reactions have been presented. However, due to the complexity of the reactions, most reactions are considered lumped and elementary, which cannot be deemed a completely accurate kinetic model of the process. Therefore, in this study, the LHHW mechanism is presented as kinetic models of MTO reactions. Because of the non-linearity of the kinetic models and existence of many local optimal points, evolutionary algorithms (GA and GP) are used in this study to estimate the kinetic parameters in the rate equations. Via the simultaneous connection of the code related to modelling the reactor and the GA and GP codes in the MATLAB R2013a software, optimization of the kinetic models parameters was performed such that the least difference between the results from the kinetic models and experiential results was obtained and the best kinetic parameters of MTO process reactions were achieved. A comparison of the results from the model with experiential results showed that the present model possesses good accuracy.

  8. Thiamine losses during storage of pasteurised and sterilized model systems of minced chicken meat with addition of fresh and oxidized fat, and antioxidants.

    Science.gov (United States)

    Szymandera-Buszka, Krystyna; Hęś, Marzanna; Waszkowiak, Katarzyna; Jędrusek-Golińska, Anna

    2014-01-01

    The aim of the study was to determine the effect of pasteurisation and sterilization of model systems of minced chicken meat in the presence of low or high-oxidised pork lard, soy and sunflower oil, as well as casein hydrolysate and rosemary extract, on losses of thiamine in model systems. In the samples, the thiamine content was analysed periodically by thiochromium method, as well as rate of lipid oxidation based on measurement of peroxide value (PV) by iodometric method and p-anisidine value (AV) by spectrophotometric method. It was observed that the thiamine losses in model systems of minced chicken after pasteurisation (61-71%) were higher than after sterilization (57-67%). Introduction of high-oxidised fat increased the total thiamine losses both during thermal processing and storage of meat samples (to 23%). A strong relationship was established between thiamine losses and rate of fat oxidation. The lowest total thiamine losses were observed in the samples with low-oxidised pork lard. Antioxidant addition (rosemary extract or casein hydrolysate) into meat samples limited the thiamine losses. However, the effect depended on oxidation of fat that was mixed with meat. In the samples with low-oxidised fat, higher protective effect was found for rosemary extract (7-11%). In the samples with high-oxidised fat, casein hydrolysate was superior to rosemary extract (14%). In order to increase the stability of thiamine in pasteurized or sterilized meat products with fats, the influence of fat type and its oxidative stability should be taken under consideration. Moreover, the addition of rosemary extract or casein hydrolysate has impact on the thiamine losses since it slows down lipid oxidation to a significant extent.

  9. Effect of botanical extracts containing carnosic acid or rosmarinic acid on learning and memory in SAMP8 mice.

    Science.gov (United States)

    Farr, Susan A; Niehoff, Michael L; Ceddia, Michael A; Herrlinger, Kelli A; Lewis, Brandon J; Feng, Shulin; Welleford, Andrew; Butterfield, D Allan; Morley, John E

    2016-10-15

    Oxidative damage is one of the hallmarks of the aging process. The current study evaluated effects of two proprietary antioxidant-based ingredients, rosemary extract and spearmint extract containing carnosic acid and rosmarinic acid, respectively, on learning and memory in the SAMP8 mouse model of accelerated aging. The two rosemary extracts contained carnosic acid (60% or 10% carnosic acid) and one spearmint extract contained 5% rosmarinic acid. Three doses of actives in each extract were tested: 32, 16, 1.6 or 0mg/kg. After 90days of treatment mice were tested in T-maze foot shock avoidance, object recognition and lever press. Rosemary extract containing 60% carnosic acid improved acquisition and retention in T-maze foot shock, object recognition and lever press. Rosemary extract with 10% carnosic acid improved retention in T-maze foot shock avoidance and lever press. Spearmint with 5% rosmarinic acid improved acquisition and retention in T-maze foot shock avoidance and object recognition. 4-hydroxynonenal (HNE) was reduced in the brain cortex after treatment with all three extracts (Prosemary with 10% carnosic acid (Prosemary have beneficial effects on learning and memory and brain tissue markers of oxidation that occur with age in SAMP8 mice. Published by Elsevier Inc.

  10. Use of Allelopathic Traits of Several Medicinal Plants on Some Germination Characteristics and Early Growth of Wheat and Wild Oat

    Directory of Open Access Journals (Sweden)

    H Piraste Anoshe

    2012-02-01

    Full Text Available Ecosystem pollution and weed resistance to herbicides have led researchers to pay more attention to natural herbicides. To examine allelopathic effects of liquorice, rosemary, chamomile and eucalypt on germination characteristics and early growth of wheat (Triticum aestivum L. and wild oat (Avena fatua L., a factorial experiment based on completely randomized design with 20 treatments and four replicates was conducted at Cereal Laboratory of College of Agricultural, Shiraz University, Iran in 2010. The results showed that rosemary essential oil had most negative effect on germination percentage (G%, seedling length (SL, radicle length (RL, shoot to root length ratio (S/R, relative water content (RWC and total water content (TWC. The lowest negative effect on G%, SL, RL and TWC was obtained from eucalypt essential oil and the least effect on RWC was observed from liquorice essential oil treatments. Most reduction on S/R was obtained from chamomile essential oil. The effect of stem essential oil on all measured traits, except G%, was more than leaf essential oil. Also wild oat was found to be more responsive than wheat to rosemary and chamomile essential oils. Considering these results, it appeared that control of wild oat by using such essential oil as rosemary and chamomile might be possible under some conditions with appropriate cautions.

  11. Intercropping Between Achillea millefolium L. and Rosmarinus officinalis L. and its effects on essential oil yield, biomass and anti-microbial activity

    OpenAIRE

    Arashiro, Munique Polito; Centro Universitário de Maringá - CESUMAR; Ziroldo, Débora Fernanda; Centro Universitário de Maringá - CESUMAR; Yamaguchi, Mirian Ueda; Centro Universitário de Maringá - CESUMAR; Sartor, Claudenice Francisca Providelo; Centro Universitário de Maringá - CESUMAR; Patroni, Sandra Sanches; Centro Universitário de Maringá - CESUMAR; Oliveira, Pérsio Sandir D'; EMBRAPA; Cortez, Lúcia Elaine Elaine Ranieri; Centro Universitário de Maringá - CESUMAR

    2011-01-01

    The rosemary (Rosmarinus officinalis) and the yarrow (Achillea millefolium) are medicinal aromatic herbs and produce essential oil. Current experiment evaluated the effect of intercropping between two species in biomass and essential oil yield and the antimicrobial activity of the essential oil of rosemary. After the plants’ culture and harvest, the biomass and the essential oil yields of the dry leaves and flowers were obtained by steam water distillation. Data of biomass and essential oil y...

  12. Richard Watson.

    Science.gov (United States)

    Wright, Ian; Bevin, William

    2017-11-25

    An inspirational equine veterinary surgeon with a keen interest in racing, to whom horses were a way of life. He took much pride in the success of his homebred racehorses. British Veterinary Association.

  13. The nature of the transition mismatches with Watson-Crick architecture: the G*·T or G·T* DNA base mispair or both? A QM/QTAIM perspective for the biological problem.

    Science.gov (United States)

    Brovarets', Ol'ha O; Hovorun, Dmytro M

    2015-01-01

    This study provides the first accurate investigation of the tautomerization of the biologically important guanine*·thymine (G*·T) DNA base mispair with Watson-Crick geometry, involving the enol mutagenic tautomer of the G and the keto tautomer of the T, into the G·T* mispair (∆G = .99 kcal mol(-1), population = 15.8% obtained at the MP2 level of quantum-mechanical theory in the continuum with ε = 4), formed by the keto tautomer of the G and the enol mutagenic tautomer of the T base, using DFT and MP2 methods in vacuum and in the weakly polar medium (ε = 4), characteristic for the hydrophobic interfaces of specific protein-nucleic acid interactions. We were first able to show that the G*·T↔G·T* tautomerization occurs through the asynchronous concerted double proton transfer along two antiparallel O6H···O4 and N1···HN3 H-bonds and is assisted by the third N2H···O2 H-bond, that exists along the entire reaction pathway. The obtained results indicate that the G·T* base mispair is stable from the thermodynamic point of view complex, while it is dynamically unstable structure in vacuum and dynamically stable structure in the continuum with ε = 4 with lifetime of 6.4·10(-12) s, that, on the one side, makes it possible to develop all six low-frequency intermolecular vibrations, but, on the other side, it is by three orders less than the time (several ns) required for the replication machinery to forcibly dissociate a base pair into the monomers during DNA replication. One of the more significant findings to emerge from this study is that the short-lived G·T* base mispair, which electronic interaction energy between the bases (-23.76 kcal mol(-1)) exceeds the analogical value for the G·C Watson-Crick nucleobase pair (-20.38 kcal mol(-1)), "escapes from the hands" of the DNA replication machinery by fast transforming into the G*·T mismatch playing an indirect role of its supplier during the DNA replication. So

  14. Synergistic effects of some essential oils against fungal spoilage on pear fruit.

    Science.gov (United States)

    Nikkhah, Mehdi; Hashemi, Maryam; Habibi Najafi, Mohammad B; Farhoosh, Reza

    2017-09-18

    The development of natural protective agents as alternatives to chemical fungicides is currently in the spotlight. In the present investigation, chemical composition and antifungal activities of thyme, cinnamon, rosemary and marjoram essential oils (EO), as well as synergism of their possible double and triple combinations were investigated. The compositions of the oils were determined by GC/MS. For determination of antifungal activity against Penicillium expansum and Botrytis cinerea, a broth microdilution method was used. The possible interactions of some essential oil combinations were performed by the two and three-dimensional checkerboard assay and isobologram construction. An in vivo antifungal assay was performed by artificial wounding of pear fruits. The maximum antifungal activity was demonstrated by thyme and cinnamon oils which displayed lower MIC values whereas rosemary and marjoram oils with MIC range between 2500 and 10,000μg/mL exhibited weak antifungal activities against tested fungi. In synergy testing, some double combinations (thyme/cinnamon, thyme/rosemary, cinnamon/rosemary) were found to be synergistic (FICi≤0.5). The triple combination of thyme, cinnamon and rosemary was synergistic for B. cinerea and P. expansum (FICi values of 0.5 and 0.375, respectively); while combination of cinnamon, marjoram and thyme exhibited additive and synergistic effect against P. expansum (FIC=0.625) and B. cinerea (FIC=0.375) respectively. The usage of a mathematical Gompertz model in relation to fungal kinetics, showed that the model could be used to predict growth curves (R 2 =0.993±0.05). For B. cinerea, Gompertz parameters for double and triple combination treatments showed significant increase in lag phase (1.92 and 2.92days, respectively) compared to single treatments. Increase lag time up to 2.82days (P<0.05) also observed in P. expansum treated by triple combination of EOs. Base on the results, the lowest maximum growth rate (0.37mm/day) was observed

  15. Chemotypic Characterization and Biological Activity of Rosmarinus officinalis.

    Science.gov (United States)

    Satyal, Prabodh; Jones, Tyler H; Lopez, Elizabeth M; McFeeters, Robert L; Ali, Nasser A Awadh; Mansi, Iman; Al-Kaf, Ali G; Setzer, William N

    2017-03-05

    Rosemary ( Rosmarinus officinalis L.) is a popular herb in cooking, traditional healing, and aromatherapy. The essential oils of R. officinalis were obtained from plants growing in Victoria (Australia), Alabama (USA), Western Cape (South Africa), Kenya, Nepal, and Yemen. Chemical compositions of the rosemary oils were analyzed by gas chromatography-mass spectrometry as well as chiral gas chromatography. The oils were dominated by (+)-α-pinene (13.5%-37.7%), 1,8-cineole (16.1%-29.3%), (+)-verbenone (0.8%-16.9%), (-)-borneol (2.1%-6.9%), (-)-camphor (0.7%-7.0%), and racemic limonene (1.6%-4.4%). Hierarchical cluster analysis, based on the compositions of these essential oils in addition to 72 compositions reported in the literature, revealed at least five different chemotypes of rosemary oil. Antifungal, cytotoxicity, xanthine oxidase inhibitory, and tyrosinase inhibitory activity screenings were carried out, but showed only marginal activities.

  16. Sleeping under the stars

    Science.gov (United States)

    Zirkel, Jack

    Sherlock Holmes and Dr. Watson went on a camping trip. As they lay down for the night, Holmes said, “Watson, look up at the sky and tell me what you see.”Watson:“! see millions and millions of stars.”

  17. Influence of natural antioxidants on lipid composition of beef burgers submitted to irradiation in {sup 60} Co source and electron beams; Influencia de antioxidantes naturais sobre o perfil lipidico de hamburgueres bovinos submetidos a irradiacao por {sup 60}Co e aceleradores de eletrons

    Energy Technology Data Exchange (ETDEWEB)

    Trindade, Reginaldo Almeida da

    2007-07-01

    Radiation processing has been employed in some countries as a mean of treatment to assure microbiological safety of meat and meat products, avoiding the occurrence of food-borne disease. The ionizing radiation may cause some undesirable changes on chemistry composition of food and the lipid oxidation is one of the main reactions. In meat products processing industry, the lipid composition is directly related to nutritional and sensory quality of the product. For preventing oxidation, use of antioxidants which can be synthetic or natural, has been practically applied in some products. Currently, most attention has been given to natural antioxidants from herbs and spices like rosemary and oregano. The aim this study was to assess the antioxidant effects of either rosemary and oregano extract in beef burgers submitted to irradiation in {sup 60}Co source with dose 6, 7 e 8 kGy, electron beams with dose 3,5 e 7 kGy and storage under freeze along 0, 45 e 90 days. The results showed that rosemary extract has the major antioxidant effects when it is used on heterogeneous food matrix like beef burger, but oregano extract was better efficient to delay lipid oxidation along storage time when it is used in synergism with rosemary and/or BHT/BHA. Although to have occurred changes in the fatty acids composition it was not possible to demonstrate a straight dependence of irradiation dose and/or storage time. Sensory analysis showed that between the samples prepared with natural antioxidants, the beef burger prepared with oregano has received better scores by panelists. Irradiated beef burger prepared with rosemary has received better scores when compared to non-irradiated one. The use of spices with antioxidant activity to avoid the oxidative damage in foods that contain fats in their formulation is thought to be promising to application in food facilities. (author)

  18. Influence of natural antioxidants on lipid composition of beef burgers submitted to irradiation in 60 Co source and electron beams

    International Nuclear Information System (INIS)

    Trindade, Reginaldo Almeida da

    2007-01-01

    Radiation processing has been employed in some countries as a mean of treatment to assure microbiological safety of meat and meat products, avoiding the occurrence of food-borne disease. The ionizing radiation may cause some undesirable changes on chemistry composition of food and the lipid oxidation is one of the main reactions. In meat products processing industry, the lipid composition is directly related to nutritional and sensory quality of the product. For preventing oxidation, use of antioxidants which can be synthetic or natural, has been practically applied in some products. Currently, most attention has been given to natural antioxidants from herbs and spices like rosemary and oregano. The aim this study was to assess the antioxidant effects of either rosemary and oregano extract in beef burgers submitted to irradiation in 60 Co source with dose 6, 7 e 8 kGy, electron beams with dose 3,5 e 7 kGy and storage under freeze along 0, 45 e 90 days. The results showed that rosemary extract has the major antioxidant effects when it is used on heterogeneous food matrix like beef burger, but oregano extract was better efficient to delay lipid oxidation along storage time when it is used in synergism with rosemary and/or BHT/BHA. Although to have occurred changes in the fatty acids composition it was not possible to demonstrate a straight dependence of irradiation dose and/or storage time. Sensory analysis showed that between the samples prepared with natural antioxidants, the beef burger prepared with oregano has received better scores by panelists. Irradiated beef burger prepared with rosemary has received better scores when compared to non-irradiated one. The use of spices with antioxidant activity to avoid the oxidative damage in foods that contain fats in their formulation is thought to be promising to application in food facilities. (author)

  19. Anti-tumorigenic activity of five culinary and medicinal herbs grown under greenhouse conditions and their combination effects.

    Science.gov (United States)

    Yi, Weiguang; Wetzstein, Hazel Y

    2011-08-15

    Herbs and spices have been used as food preservatives, flavorings, and in traditional medicines for thousands of years. More and more scientific evidence supports the medicinal properties of culinary herbs. Colon cancer is the third leading cause of cancer death in the USA, and the fourth most common form of cancer worldwide. The objectives of this study were to evaluate the antitumor activity of five selected herbs grown under greenhouse conditions, and to study the potential synergistic effects among different herbal extract combinations. Thyme, rosemary, sage, spearmint, and peppermint extracts significantly inhibited SW-480 colon cancer cell growth, with sage extracts exhibiting the highest bioactivity, with 50% inhibition at 35.9 µg mL⁻¹, which was equivalent to 93.9 µg dried leaves mL⁻¹ of culture medium. Some mixtures of different herbal extracts had combination effects on cancer cell growth. The inhibitory effects of peppermint + sage combinations at a 1:1 ratio were significantly higher than rosemary + sage combinations at 1:1 ratio, although peppermint extracts showed lower inhibition than rosemary extracts. Extracts from herb species (thyme, rosemary, sage, spearmint and peppermint) can significantly inhibit the growth of human colon cancer cells. Mixtures of herb extracts can have combination effects on cancer cell growth. The study suggests that these five herbs may have potential health benefits to suppress colon cancer. Copyright © 2011 Society of Chemical Industry.

  20. Sensory and physicochemical characteristics of salamis added with vegetable-based curing ingredients

    OpenAIRE

    Kawski, Vicky Lilge; Bertol, Teresinha Marisa; Santos, Maria José Honorato dos; Sawitzki, Maristela Cortez; Fiorentini, Angela Maria; Coldebella, Arlei; Agnes, Ingrid Beatriz Lermen

    2017-01-01

    ABSTRACT: The aim of this study was to evaluate the sensory and physicochemical quality of colonial salamis added with vegetable-based curing ingredients as potential enhancers of quality products. Salamis were produced according to three treatments: (A) Control: 0.1% curing salt; (B) rosemary: 0.05% curing salt + 0.5% rosemary extract (RE); and (C) RE+celery: 0.14% Veg 503 + 0.27% Veg 504 (sea salt plus celery, nitrate and nitrite supplies, respectively) + 0.5% of RE. No significant differe...

  1. Chemotypic Characterization and Biological Activity of Rosmarinus officinalis

    Directory of Open Access Journals (Sweden)

    Prabodh Satyal

    2017-03-01

    Full Text Available Rosemary (Rosmarinus officinalis L. is a popular herb in cooking, traditional healing, and aromatherapy. The essential oils of R. officinalis were obtained from plants growing in Victoria (Australia, Alabama (USA, Western Cape (South Africa, Kenya, Nepal, and Yemen. Chemical compositions of the rosemary oils were analyzed by gas chromatography-mass spectrometry as well as chiral gas chromatography. The oils were dominated by (+-α-pinene (13.5%–37.7%, 1,8-cineole (16.1%–29.3%, (+-verbenone (0.8%–16.9%, (−-borneol (2.1%–6.9%, (−-camphor (0.7%–7.0%, and racemic limonene (1.6%–4.4%. Hierarchical cluster analysis, based on the compositions of these essential oils in addition to 72 compositions reported in the literature, revealed at least five different chemotypes of rosemary oil. Antifungal, cytotoxicity, xanthine oxidase inhibitory, and tyrosinase inhibitory activity screenings were carried out, but showed only marginal activities.

  2. Dentifrice Containing Extract of Rosmarinus officinalis Linn.: An Antimicrobial Evaluation.

    Science.gov (United States)

    Valones, Marcela Agne Alves; Higino, Jane Sheila; Souza, Paulo Roberto Eleutério; Crovella, Sérgio; Caldas, Arnaldo de França; Carvalho, Alessandra de Albuquerque Tavares

    2016-01-01

    This study aimed to evaluate the antimicrobial activity of a dentifrice containing an alcoholic extract of rosemary on oral bacteria, compared to a commercially available herbal dentifrice. Standard strains of Streptococcus mutans (ATCC 25175), Streptococcus oralis (ATCC 9811) and Lactobacillus rhamnosus (ATCC 7469) were used, as well as different toothpastes based on rosemary (TR), on propolis (TH), triclosan (positive control) (TPC) and non-fluoridated dentifrice (negative control) (TNC). Bacteria were seeded in Petri dishes and paper discs soaked with dilutions of dentifrice placed on the plates. The inhibition halos were analyzed. It was observed that TR did not show statistical difference in relation to the TH to inhibit S. mutans and S. oralis, while TH was more active against L. rhamnosus. The toothpaste containing rosemary extract had the ability to inhibit the growth of S. mutans, S. oralis and L. rhamnosus, revealing an antimicrobial activity similar to commercially available toothpastes for inhibition of S. mutans and S. oralis.

  3. Antifungal activity of essential oils evaluated by two different application techniques against rye bread spoilage fungi

    DEFF Research Database (Denmark)

    Suhr, Karin Isabel; Nielsen, Per Væggemose

    2003-01-01

    Aims: To study how antifungal activity of natural essential oils depends on the assay method used.Methods and Results: Oils of bay, cinnamon leaf, clove, lemongrass, mustard, orange, sage, thyme and two rosemary oils were tested by two methods: (1) a rye bread-based agar medium was supplemented...... with 100 and 250 mu l l(-1) essential oil and (2) real rye bread was exposed to 136 and 272 mu l l(-1) volatile oil in air. Rye bread spoilage fungi were used for testing. Method 1 proved thyme oil to be the overall best growth inhibitor, followed by clove and cinnamon. On the contrary, orange, sage...... and rosemary oils had very limited effects. Mustard and lemongrass were the most effective oils by the volatile method, and orange, sage and one rosemary showed some effects. Oil compositions were analysed by gas chromatography-mass spectrography.Conclusions: Antifungal effects of the essential oils depended...

  4. Improving oxidative stability of liquid fish oil supplements for pets

    DEFF Research Database (Denmark)

    Thomsen, Birgitte Raagaard; Griinari, Mikko; Jacobsen, Charlotte

    2017-01-01

    oxidative stability to the same extent as 2000 ppm mixed tocopherols in Oxipres. Overall, oxidative stability of fish oil or fish oil + vegetable oil blends was improved the most by addition of 5000 ppm rosemary extract and 500 ppm mixed tocopherols. A commercial oil blend with composition optimized based...... of fish oil by adding vegetable oils, mixed tocopherols and rosemary extract, and to formulate a commercial product according to the results obtained. The formulated product was evaluated against commercial fish oil products. An initial screening for antioxidative effect was performed by using Oxipres...... equipment. The effect of antioxidant and vegetable oil blends was examined in oils stored at 30 and 40°C by measuring peroxide value, volatile compounds with GC-MS and tocopherol content. Addition of vegetable oil and rosemary extract at high level (4000–6000 ppm) plus 600 ppm of mixed tocopherols increased...

  5. Oxidative stability of fish oil-enriched mayonnaise-based salads

    DEFF Research Database (Denmark)

    Sørensen, Ann-Dorit Moltke; Nielsen, Nina Skall; Jacobsen, Charlotte

    2010-01-01

    The oxidative stability of fish oil-enriched mayonnaise-based salads and the influence of different vegetables in shrimp and tuna salads were evaluated. Moreover, the lipid oxidation in the presence of 1% oregano, rosemary, or thyme in fish oil-enriched tuna salad was assessed. The results obtain......-oxidative effect of shrimp. The effect of ingredients in tuna salads was inconclusive, possibly due to a high content of volatiles in the vegetables themselves. However, the addition of spices increased the oxidative stability of tuna salad (oregano>rosemary>thyme)....

  6. On Fair Lotteries

    OpenAIRE

    STONE, PETER

    2008-01-01

    PUBLISHED When James Watson and Francis Crick submitted to Nature their groundbreaking paper relating DNA structure to protein synthesis, they faced a choice. In what order were their names to be listed? Would it be ?Watson and Crick,? or ?Crick and Watson?? They resolved the matter by tossing a coin (Crick, 1988, p. 66)

  7. ATIVIDADE INSETICIDA DE ÓLEOS VEGETAIS SOBRE Sitophilus zeamais MOTS. (COLEOPTERA: CURCULIONIDAE EM MILHO ARMAZENADO

    Directory of Open Access Journals (Sweden)

    Rodrigo Leandro Braga de Castro Coitinho

    2006-01-01

    Full Text Available Oils of andiroba (Carapa guianensis Aubl., copaiba (Copaifera sp., Eucaliptus globulus Labill. and Eucaliptus citriodora Hook., neem (Azadirachta indica A. Juss, eugenol, souari nut (Caryocar brasiliense Camb., rosemary (Lippia gracillis HBK., and cedar (Cedrela fissilis Vell. were evaluated in adults of Sitophilus zeamais Mots. (Coleoptera: Curculionidae. In the non-choice test, 20 g of corn grains per plot were treated with 50¿L of each oil and homogenized for two minutes. The plot was infested with eight 0 to 15 days-old S. zeamais adults. The E. globulus, eugenol, rosemary, and neem oils caused 100% mortality in S. zeamais adults. Except for copaiba, all oils caused mortality above 87% and the reduction in emergence of 100%. In the free-choice tests, arenas consisting of two plastic containers symmetrically interconnected to a central box by two plastic tubes were used. Twenty grams of non-treated corn (control were placed in one of the boxes and the same amount of grain treated with 50¿L of each oil comprised the other treatment. Sixteen non-sexed S. zeamais adults (0-15 days old were released in the central box. The rosemary, E. citriodora, eugenol and copaiba oils were the most repellent for S. zeamais adults, with repellence percentage varying from 97.3 to 87.7. Rosemary, andiroba, neem, and cedar reduced S. zeamais emergence in 100%, while the reduction caused by the other oils ranged from 72.7 to 97.9%.

  8. The effects of acute administration of the hydroalcoholic extract of rosemary (Rosmarinus officinalis L. (Lamiaceae in animal models of memory

    Directory of Open Access Journals (Sweden)

    Camila Angela Zanella

    2012-09-01

    Full Text Available Rosmarinus officinalis (Rosemary demonstrates antioxidant, antidepressant, diuretic, antinociceptive and antiulcerogenic activities. The present study was designed to examine the effects of the hydroalcoholic extract of R. officinalis on the memory of male mice. The behavioral tasks employed were social recognition (SR, the Morris water maze (MWM and an inhibitory avoidance task (IA. The treatment with 150 and 300 mg/kg of R. officinalis improved the acquisition phase of learning of a new social memory in the SR task because a decrease was observed in the duration of social investigation. In the Morris water maze, no significant effect was observed on spatial memory when the groups were compared for the time spent in the correct quadrant. In the inhibitory avoidance task, the decrease in the step-down latencies in the test session indicate that 150 mg/kg of R. officinalis improved long-term memory when administered in the consolidation phase of learning. In conclusion, the present study showed that, the hydroalcoholic extract of R. officinalis at 150 and 300 mg/kg modulated the short- and long-term memories of mice, in a social recognition and inhibitory avoidance task, respectively. This modulator effect was shown to improve learning and memory processes.Rosmarinus officinalis L. (Alecrim possui atividade antioxidante, antidepressiva, diurética, antinociceptiva e antiulcerogênica. O presente estudo foi delineado para investigar o efeito do extrato hidroalcoólico de R. officinallis na memória de camundongos machos. Os modelos comportamentais utilizados foram a tarefa de reconhecimento social (RS, labirinto aquático de Morris (MWM e esquiva inibitória (EI. O tratamento com 150 e 300mg/kg de R. officinallis, mostrou ter efeito positivo na aquisição de uma nova memória social, na tarefa de reconhecimento social, mostrando redução significativa do tempo de investigação social. No labirinto aquático de Morris, não foi visto efeito

  9. Effect of the extract of persimmon (Diospyros kaki L. cv. ‘Rama Forte’and rosemary oily extract (Rosmarinus officinalis L. on the sensory characteristics and color stability of frozen beef burgersEfeito de extratos de caqui (Diospyros kaki L. cultivar Rama Forte e do extrato oleoso de alecrim (Rosmarinus officinalis L. nas características sensoriais e na estabilidade da cor de hambúrguer de carne bovina congelado

    Directory of Open Access Journals (Sweden)

    Leadir Lucy Martins Fries

    2012-06-01

    Full Text Available This study aimed to evaluate the effect of the extract of persimmon cv. ‘Rama Forte’ and rosemary oily extract on the sensory characteristics and color stability of frozen beef burgers. The crude hydroethanolic extract was prepared and subjected to fractionation resulting in the hexane, chloroform and ethyl acetate fractions as well as residual fraction. For the preparation of the burger samples a basic formulation was prepared and divided into parts: control, standard formulation ( 0.1% of sodium erythorbate, treatment 1 (0.5% of hydroethanolic crude extract, treatment 2 (0.7% of hydroethanolic crude extract, treatment 3 (0.5% of the residual fraction, treatment 4 (0.7% of the residual fraction , treatment 5 ( 0.5% of ethyl acetate fraction, Treatment 6 (0.7% of ethyl acetate fraction and treatment 7 (0.10% of oily extract of rosemary. The beef burger samples were stored at-25° C for 14 months and subjected to sensory analysis (color, aroma, flavor, and texture at the beginning of the experiment and the measurement of color (parameters L a*, b* and h* every two months. The addition of the extracts did not promote changes in the sensory attributes of the beef burgers at time zero of storage. A tendency to decrease a* values and increase of the h* values of the samples of frozen beef burgers occurred over the period of storage. Samples added with ethyl acetate fraction (0.5 and 0.7% and the oily extract of rosemary showed higher a* values than the other samples throughout the storage period and lower h* values than the standard sample at the end of the period evaluated. This indicates that the addition of ethyl acetate fraction and rosemary extract contributed to the retention and stability of the red color of the samples of beef burgers during the storage of the frozen product.O objetivo deste estudo foi avaliar o efeito de extratos de caqui cv. Rama Forte e do extrato oleoso de alecrim sobre as características sensoriais e a estabilidade

  10. The application of natural organic compounds in bakery industry

    Directory of Open Access Journals (Sweden)

    Davidović Dejan N.

    2010-01-01

    Full Text Available Investigations include the analysis of the impact of commercial products: complex additive (0.1, 0.3, and 0.5%, L-ascorbic acid (0.002, 0.004 and 0.012%, diacetyl ester of tartaric acid with monoglycerides (DATEM E472e, 0.1, 0.3, and 0.5%, α-amylase (0.002, 0.006 and 0.012%, xylanase (0.004, 0.012 and 0.024%, alcohol extract of rosemary, thyme or sage (0.5, 1.0 and 2.0%, as well as the combination of complex additive and rosemary, thyme and sage extract on rheological characteristics of dough. The study includes amylograph, farinograph and extensograph analysis of dough with and without additives (control sample. The volume of lost CO2 gas (mL is the lowest in dough samples with an added combination of complex additive and thyme extract (0.05 and 0.5% and rosemary extract (2.0%. In the samples with thyme extract (1.0% added, the volume of lost gas is at a level of samples with added complex additive, DATEM, and L-ascorbic acid.

  11. Determination of the Efficiency of Some Essential Oil Compounds on the Development of Jonsongrass [(Sorghum halepense (L. Pers.

    Directory of Open Access Journals (Sweden)

    Ayşe YAZLIK

    2015-09-01

    Full Text Available Jonsongrass (Sorghum halepense (L. Pers. (SORHA is one of the most troublesome perennial weeds caused important yield reductions in the agricultural and environmental problems in the non-agricultural fields. Using a combination of several control strategies is required because Sorha cannot be effectively controlled by a single control method. One of the methods that can be used for the control of Sorha is the usage of allelopathic chemicals. The efficiency of the plants [oregano (Origanum vulgare L., lavender (Lavandula angustifolia L. and rosemary (Rosmarinus officinalis L.] that have allelochemicals on the SORHA were examined with this study. Using rosemary oil at the high rate (16 μl 38.465 cm2 gave the best results and reduced dry weight at 41.0% when it was applied as pre-emergence. The same essential oil rate obtained from rosemary was the highest adversely effects on the Sorha growth (48.0% when it was used as post-emergence. Post-emergence application of all three volatile oils has provided more influence on the Sorha growth compared to the pre-emergence application.

  12. Mitigation of 3-Monochloro-1,2-propanediol Ester Formation by Radical Scavengers.

    Science.gov (United States)

    Zhang, Hai; Jin, Pengwei; Zhang, Min; Cheong, Ling-Zhi; Hu, Peng; Zhao, Yue; Yu, Liangli; Wang, Yong; Jiang, Yuanrong; Xu, Xuebing

    2016-07-27

    The present study investigated the possible mechanism of free radical scavengers on mitigation of 3-monochloro-1,2-propanediol (3-MCPD) fatty acid ester formation in vegetable oils. The electron spin resonance investigation showed that the concentration of free radicals could be clearly decreased in 1,2-distearoyl-sn-glycerol (DSG) samples by all four antioxidants (l-ascorbyl palmitate, α-tocopherol, lipophilic tea polyphenols, and rosemary extract) at 120 °C for 20 min under a N2 atmosphere. Moreover, the rosemary extract exhibited the highest inhibition efficiency. The Fourier transform infrared spectroscopy examination of DSG with α-tocopherol at 25 and 120 °C revealed that α-tocopherol could prevent the involvement of an ester carbonyl group of DSG in forming the cyclic acyloxonium free radical intermediate. Furthermore, the ultraperformance liquid chromatography-quadrupole-time-of-flight mass spectrometry analysis showed that α-tocopherol could suppress the formation of 3-MCPD di- and monoesters. Finally, the four antioxidants could decrease 3-MCPD esters in the palm oil during deodorization. Particularly, the rosemary extract also showed the highest efficiency in 3-MCPD ester mitigation.

  13. Superimposed Code Theorectic Analysis of DNA Codes and DNA Computing

    Science.gov (United States)

    2010-03-01

    that the hybridization that occurs between a DNA strand and its Watson - Crick complement can be used to perform mathematical computation. This research...ssDNA single stranded DNA WC Watson – Crick A Adenine C Cytosine G Guanine T Thymine ... Watson - Crick (WC) duplex, e.g., TCGCA TCGCA . Note that non-WC duplexes can form and such a formation is called a cross-hybridization. Cross

  14. Molecular dynamics analysis of stabilities of the telomeric Watson-Crick duplex and the associated i-motif as a function of pH and temperature.

    Science.gov (United States)

    Panczyk, Tomasz; Wolski, Pawel

    2018-06-01

    This work deals with a molecular dynamics analysis of the protonated and deprotonated states of the natural sequence d[(CCCTAA) 3 CCCT] of the telomeric DNA forming the intercalated i-motif or paired with the sequence d[(CCCTAA) 3 CCCT] and forming the Watson-Crick (WC) duplex. By utilizing the amber force field for nucleic acids we built the i-motif and the WC duplex either with native cytosines or using their protonated forms. We studied, by applying molecular dynamics simulations, the role of hydrogen bonds between cytosines or in cytosine-guanine pairs in the stabilization of both structures in the physiological fluid. We found that hydrogen bonds exist in the case of protonated i-motif and in the standard form of the WC duplex. They, however, vanish in the case of the deprotonated i-motif and protonated form of the WC duplex. By determining potentials of mean force in the enforced unwrapping of these structures we found that the protonated i-motif is thermodynamically the most stable. Its deprotonation leads to spontaneous and observed directly in the unbiased calculations unfolding of the i-motif to the hairpin structure at normal temperature. The WC duplex is stable in its standard form and its slight destabilization is observed at the acidic pH. However, the protonated WC duplex unwraps very slowly at 310 K and its decomposition was not observed in the unbiased calculations. At higher temperatures (ca. 400 K or more) the WC duplex unwraps spontaneously. Copyright © 2018. Published by Elsevier B.V.

  15. Evaluation of the Effects of Mitigation on Methane and Ammonia Production by Using Origanum vulgare L. and Rosmarinus officinalis L. Essential Oils on in Vitro Rumen Fermentation Systems

    Directory of Open Access Journals (Sweden)

    Gabriella Cobellis

    2015-09-01

    Full Text Available The effects of increasing concentrations of oregano (Origanum vulgare L. and rosemary (Rosmarinus officinalis L. essentials oil (EO on ruminal gas emissions were tested in vitro using 50 mL serum bottles. Each bottle contained a 200 mg substrate (alfalfa hay and corn meal 1:1 and a 20 mL solution composed of a buffered medium and rumen fluid (1:2. The percentage of ruminal fermentation products was quantified by an infrared analyzer. The reduction of total gas production was 6% and 9% respectively when using the 1.5 and 2.0 g/L oregano EO measurements. The reduction of methane production was 55%, 72% and 71% respectively with regard to the 1.0, 1.5 and 2.0 g/L oregano EO doses, while rosemary EO (2.0 g/L reduced the methane production by 9%. The production of ammonia was significantly reduced (59%–78% by all treatments with the exception of rosemary EO at the lowest dose. Dry matter and neutral detergent fiber degradability was reduced by most of the treatments (respectively 4%–9% and 8%–24%. The total volatile fatty acids (VFA concentration was markedly decreased by oregano EO and was not affected by rosemary EO. Both EOs mitigated rumen fermentations, but oregano EO gave rise to the highest reduction in methane and ammonia production. However, further research is needed to evaluate the use of these essential oils as dietary supplements by taking into account the negative effects on feed degradability.

  16. Bioactive compounds from culinary herbs inhibit a molecular target for type 2 diabetes management, dipeptidyl peptidase IV.

    Science.gov (United States)

    Bower, Allyson M; Real Hernandez, Luis M; Berhow, Mark A; de Mejia, Elvira Gonzalez

    2014-07-02

    Greek oregano (Origanum vulgare), marjoram (Origanum majorana), rosemary (Rosmarinus officinalis), and Mexican oregano (Lippia graveolens) are concentrated sources of bioactive compounds. The aims were to characterize and examine extracts from greenhouse-grown or commercially purchased herbs for their ability to inhibit dipeptidyl peptidase IV (DPP-IV) and protein tyrosine phosphatase 1B (PTP1B), enzymes that play a role in insulin secretion and insulin signaling, respectively. Greenhouse herbs contained more polyphenols (302.7-430.1 μg of gallic acid equivalents/mg of dry weight of extract (DWE)) and flavonoids (370.1-661.4 μg of rutin equivalents/mg of DWE) compared to the equivalent commercial herbs. Greenhouse rosemary, Mexican oregano, and marjoram extracts were the best inhibitors of DPP-IV (IC₅₀=16, 29, and 59 μM, respectively). Commercial rosemary, Mexican oregano, and marjoram were the best inhibitors of PTP1B (32.4-40.9% at 500 μM). The phytochemicals eriodictyol, naringenin, hispidulin, cirsimaritin, and carnosol were identified by LC-ESI-MS as being present in greenhouse-grown Mexican oregano and rosemary. Computational modeling indicated that hispidulin, carnosol, and eriodictyol would have the best binding affinities for DPP-IV. Biochemically, the best inhibitors of DPP-IV were cirsimaritin (IC₅₀=0.43±0.07 μM), hispidulin (IC₅₀=0.49±0.06 μM), and naringenin (IC₅₀=2.5±0.29 μM). Overall, herbs contain several flavonoids that inhibit DPP-IV and should be investigated further regarding their potential in diabetes management.

  17. Voltametria de Pulso Diferencial (VPD em estado sólido de manchas de Cromatografia de Camada Delgada (CCD: um novo método de análise para fitoativos antioxidantes

    Directory of Open Access Journals (Sweden)

    Darlene Gonçalves

    2011-01-01

    Full Text Available A new electroanalytical method coupling TLC-DPV in solid state was developed for quantitative determination of phytoantioxidants with medicinal purpose, e.g. rosmarinic acid (RA in samples of phytopharmaceuticals, e.g. rosemary (Rosmarinus officinalis L.. The method showed to be feasible, presenting linearity in concentrations ranging from 0.694 x 10-3 to 9.526 x 10-3 mol L-1 (r = 0.9945, good sensibility, selectivity, reproducibility, repeatability, agility and affordable cost. The concentrations of RA in different extracts of rosemary ranged from 0.05 to 0.52 (% w/w, presenting high recovery levels when compared to HPLC.

  18. Effects of herbal supplements on growth performance of sea bass (Dicentrarchus labrax: Change in body composition and some blood parameters

    Directory of Open Access Journals (Sweden)

    SEVDAN YILMAZ

    2012-01-01

    Full Text Available This study was conducted to investigate the effects of dietary thyme (Thymus vulgaris, rosemary (Rosmarinus officinalis and fenugreek (Trigonella foenum graecum as feed additives on growth performance, proximate composition and ammonia excretion of European sea bass Dicentrarchus labrax. Four isonitrogenous (48% crude protein and isocaloric (21 kj/g diets were formulated to contain 0% (control or 1% of thyme, rosemary or fenugreek. The thyme supplementation significantly increased protein efficiency ratio, fillet protein levels, protein and energy retentions (P0.05. The results indicate that dietary thyme improved the protein and energy retentions of sea bass.

  19. Widespread Transient Hoogsteen Base-Pairs in Canonical Duplex DNA with Variable Energetics

    Science.gov (United States)

    Alvey, Heidi S.; Gottardo, Federico L.; Nikolova, Evgenia N.; Al-Hashimi, Hashim M.

    2015-01-01

    Hoogsteen base-pairing involves a 180 degree rotation of the purine base relative to Watson-Crick base-pairing within DNA duplexes, creating alternative DNA conformations that can play roles in recognition, damage induction, and replication. Here, using Nuclear Magnetic Resonance R1ρ relaxation dispersion, we show that transient Hoogsteen base-pairs occur across more diverse sequence and positional contexts than previously anticipated. We observe sequence-specific variations in Hoogsteen base-pair energetic stabilities that are comparable to variations in Watson-Crick base-pair stability, with Hoogsteen base-pairs being more abundant for energetically less favorable Watson-Crick base-pairs. Our results suggest that the variations in Hoogsteen stabilities and rates of formation are dominated by variations in Watson-Crick base pair stability, suggesting a late transition state for the Watson-Crick to Hoogsteen conformational switch. The occurrence of sequence and position-dependent Hoogsteen base-pairs provide a new potential mechanism for achieving sequence-dependent DNA transactions. PMID:25185517

  20. Sources of solutes to the proglacial Watson River (Akuliarusiarsuup Kuua) near Kangerlussuaq, West Greenland

    Science.gov (United States)

    Deuerling, K. M.; Martin, J. B.; Martin, E. E.; Scribner, C. A.

    2013-12-01

    Chemical weathering of silicate rocks in glacial forelands is a potential sink for atmospheric CO2 and therefore may impact long-term climate variability. Physical weathering in glacial environments enhances the rate of chemical weathering, particularly through subglacial production of rock flour with a high surface area to volume ratio. This reactive material is transported to and chemically weathered within the proglacial system, increasing concentrations of solutes as water flows downstream. Water from proglacial rivers may also acquire solutes and draw down atmospheric CO2 through reactions driven by hyporheic zone (HZ) exchange in the broad, braided reaches of the river channel. However, few studies have addressed this process and none to date have directly examined porewater contributions. We address these questions in the Watson River/Akuliarusiarsuup Kuua (WR), which flows approximately 40 km from its headwaters, through the town of Kangerlussuaq, and into Søndre Strømfjord. We have collected river water samples five times from six sites over the 2012 and 2013 summer melt seasons and three transects of PW from sand flats located along the river. Specific conductivity (SpC), pH, and dissolved ion concentrations increase downstream, consistent with ongoing chemical weathering reactions along the flow path. Relative abundances of Na+, K+, and SiO2 increase downstream relative to Ca2+ and Mg2+ concentrations. These signals indicate preferential dissolution of biotite and/or alkali feldspar. Additionally, 206Pb/204Pb ratios become more nonradiogenic downstream, lending further evidence to dissolution of readily weathered minerals. Over the course of the melt season, SpC, pH, and dissolved ion concentrations decrease, consistent with the increase in discharge due to supraglacial melting. The greatest downstream SpC increase (~2x) occurs where the river exits largely bedrock channeled flow and enters the braided portion at the Sandflugtdalen. In general, PW

  1. Why the tautomerization of the G·C Watson-Crick base pair via the DPT does not cause point mutations during DNA replication? QM and QTAIM comprehensive analysis.

    Science.gov (United States)

    Brovarets', Ol'ha O; Hovorun, Dmytro M

    2014-01-01

    The ground-state tautomerization of the G·C Watson-Crick base pair by the double proton transfer (DPT) was comprehensively studied in vacuo and in the continuum with a low dielectric constant (ϵ = 4), corresponding to a hydrophobic interface of protein-nucleic acid interactions, using DFT and MP2 levels of quantum-mechanical (QM) theory and quantum theory "Atoms in molecules" (QTAIM). Based on the sweeps of the electron-topological, geometric, polar, and energetic parameters, which describe the course of the G·C ↔ G*·C* tautomerization (mutagenic tautomers of the G and C bases are marked with an asterisk) through the DPT along the intrinsic reaction coordinate (IRC), it was proved that it is, strictly speaking, a concerted asynchronous process both at the DFT and MP2 levels of theory, in which protons move with a small time gap in vacuum, while this time delay noticeably increases in the continuum with ϵ = 4. It was demonstrated using the conductor-like polarizable continuum model (CPCM) that the continuum with ϵ = 4 does not qualitatively affect the course of the tautomerization reaction. The DPT in the G·C Watson-Crick base pair occurs without any intermediates both in vacuum and in the continuum with ϵ = 4 at the DFT/MP2 levels of theory. The nine key points along the IRC of the G·C base pair tautomerization, which could be considered as electron-topological "fingerprints" of a concerted asynchronous process of the tautomerization via the DPT, have been identified and fully characterized. These key points have been used to define the reactant, transition state, and product regions of the DPT reaction in the G·C base pair. Analysis of the energetic characteristics of the H-bonds allows us to arrive at a definite conclusion that the middle N1H⋯N3/N3H⋯N1 and the lower N2H⋯O2/N2H⋯O2 parallel H-bonds in the G·C/G*·C* base pairs, respectively, are anticooperative, that is, the strengthening of the middle H-bond is accompanied

  2. Whey protein isolate/cellulose nanofibre/TiO2 nanoparticle/rosemary essential oil nanocomposite film: Its effect on microbial and sensory quality of lamb meat and growth of common foodborne pathogenic bacteria during refrigeration.

    Science.gov (United States)

    Alizadeh Sani, Mahmood; Ehsani, Ali; Hashemi, Mohammad

    2017-06-19

    The use of biodegradable nanocomposite films in active packaging is of great importance since they can have a controlled release of antimicrobial compounds. This study was conducted to evaluate the efficacy of whey protein isolate (WPI)/cellulose nanofibre (CNF) nanocomposite films containing 1.0% (w/w) titanium dioxide (TiO 2 ) and 2.0% (w/v) rosemary essential oil (REO) in preserving the microbial and sensory quality of lamb meat during the storage at 4±1°C. Initially, the best concentration of each compound to be added to the film was determined by micro-dilution and disc diffusion methods. The microbial and sensory properties of lamb meat were controlled in two groups (control and treatment) over 15days of storage. Then, the samples were analysed for total viable count (TVC), Pseudomonas spp. count, Enterobacteriaceae count, Lactic acid bacteria (LAB) count, inoculated Staphylococcus aureus count, Listeria monocytogenes count, and Escherichia coli O 157 :H 7 count. Microbial analysis and nine-point hedonic scale was applied for the sensory analysis. Results indicated that the use of nanocomposite films significantly reduced the bacterial counts of treatment group. Higher inhibition effect was observed on Gram-positive bacteria than on Gram-negative bacteria (Psensory evaluations also showed that the use of nanocomposite films significantly increased the shelf life of treated meat (15days) compared to the control meat (6days). Based on the results of this study, the edible nanocomposite films were effective in preserving the microbial and sensory qualities of lamb meat; therefore, this application is recommended in meat especially red meat. Copyright © 2017 Elsevier B.V. All rights reserved.

  3. Targeting Micrornas With Small Molecules: A Novel Approach to Treating Breast Cancer

    Science.gov (United States)

    2010-10-01

    DNAzyme, or deoxyribozyme, is a catalytic DNA that site-specifically cleaves the target RNA Watson – Crick base pairing to a complementary target...conserved antiparallel RNA A-helix fold among the selected pre- miRNA targets (Fig. 1a). Furthermore, 3D characteristics including Watson - Crick base pairs... Watson – Crick binding, leading to RNAse-H- mediated cleavage of the mRNA of the target gene. The ASOs also inhibit transcription, splicing, and

  4. Targeting MicroRNAs with Small Molecules a Novel Approach to Treating Breast Cancer

    Science.gov (United States)

    2011-10-01

    or deoxyribozyme, is a catalytic DNA that site-specifically cleaves the target RNA Watson – Crick base pairing to a complementary target sequence...RNA A-helix fold among the selected pre- miRNA targets. Furthermore, 3D characteristics including Watson - Crick base pairs and wobble base pairs...phosphorothioate backbone in addition to 2′-O-methoxyethyl AMOs are ASOs against miRNAs and therefore produce ASO–miRNA duplexes through Watson – Crick binding

  5. Scientific and Technological Achievements, 1946-2011, of the AFRL Electromagnetics Technology Division (AFRL/RYH) and Its Progenitors

    Science.gov (United States)

    2012-07-01

    like saying Cambridge University, not Watson and Crick , deciphered the double helix structure of DNA . Consequently, I have endeavored to attribute...were reflected off the ionosphere to the earth’s surface, then back to the ionosphere, and so on. During the late 1940s the Army Air Forces’ Watson ...NM, Proving Grounds (The Army Signal Corps transferred Watson Laboratories to the Army Air Forces in 1945). A critical observation that enabled OTH

  6. VALOR NUTRICIO Y CONTENIDO DE SAPONINAS EN GERMINADOS DE HUAUZONTLE (Chenopodium nuttalliae Saff., CALABACITA (Cucurbita pepo L., CANOLA (Brassica napus L. Y AMARANTO (Amaranthus leucocarpus S. Watson syn. hypochondriacus L.

    Directory of Open Access Journals (Sweden)

    M. R. Barrón-Yánez

    2009-01-01

    (Brassica napus L. y amaranto (Amaranthus leucocarpus S. Watson syn. hypochondriacus L.. Se realizó un análisis proximal y la cuantificación de saponinas en semillas y germinados de las cuatro especies. El contenido de proteína fue más alto en los germinados de canola que en las semillas, pero en huauzontle, calabacita y amaranto no varió. El contenido de lípidos en las semillas de canola, huauzontle y amaranto disminuyó en sus germinados, pero se incrementó en calabacita. El contenido de saponinas en los germinados fue de 2,873.23 en huauzontle, 155.40 en calabacita, 429.81 en canola, y 491.45 mg 100·g-1 de peso seco en amaranto. El contenido de saponinas en semillas fue de 5280.57, 0.00, 35.77 y 42.84 mg 100·g-1 en peso seco, respectivamente. Los niveles del contenido de saponinas en semillas y germinados para las cuatro especies estudiadas no representan toxicidad para humanos. El valor nutricio fue mejor en el germinado de canola que en el de huauzontle, calabaza y amaranto. El sabor de los germinados de huauzontle y amaranto fue mejor que en los de canola y calabacita.

  7. Effect of micro-encapsulated n-3 fatty acids on quality properties of two types of dry sausages

    Directory of Open Access Journals (Sweden)

    Zdeněk Pavlík

    2014-01-01

    Full Text Available Dry sausages are popular traditional meat products. As these products are a rich source of animal fat, there is an effort to improve their fatty acid ratio. The aim of this work was to study the effect of micro-encapsulated n-3 fatty acids added into dry sausages. Samples of dry sausages (Poličan and Vysočina enriched with unsaturated fatty acids (36 g for 6 kg of mixture and rosemary extract (0.3 g·kg-1 were made along with control samples. Physicochemical, instrumental analyses were performed, fatty acid profile was measured by gas chromatography, and oxidation processes were monitored by determination of thiobarbituric acid reactive substances. No significant differences (P ≥ 0.05 in quality indicators were found between samples, however, there were differences in oxidation processes. Sausages enriched with unsaturated fatty acids showed an increase in thiobarbituric acid reactive substances (> 2 mg·kg-1 and > 3 mg·kg-1 in Poličan and Vysočina, respectively, compared to control. Sausages enriched with unsaturated fatty acids and also with rosemary extract have the similar concentration of thiobarbituric acid reactive substances as the control. An increase in the proportion of monounsaturated fatty acids and polyunsaturated fatty acids was seen in samples of Poličan supplemented with unsaturated fatty acids in combination with rosemary extract. The addition of rosemary extract had also a significant effect in increasing the proportion of unsaturated fatty acids in samples of Vysočina. From the viewpoint of quality indicators, changes in the properties of the product were not seen in any samples.

  8. Observation of H-bond mediated 3hJH2H3coupling constants across Watson-Crick AU base pairs in RNA

    International Nuclear Information System (INIS)

    Luy, Burkhard; Richter, Uwe; DeJong, Eric S.; Sorensen, Ole W.; Marino, John P.

    2002-01-01

    3h J H2H3 trans-hydrogen bond scalar coupling constants have been observed for the first time in Watson-Crick AU base pairs in uniformly 15 N-labeled RNA oligonucleotides using a new 2h J NN -HNN-E. COSY experiment. The experiment utilizes adenosine H2 (AH2) for original polarization and detection, while employing 2h J NN couplings for coherence transfer across the hydrogen bonds (H-bonds). The H3 protons of uracil bases are unperturbed throughout the experiment so that these protons appear as passive spins in E. COSY patterns. 3h J H2H3 coupling constants can therefore be accurately measured in the acquisition dimension from the displacement of the E. COSY multiplet components, which are separated by the relatively large 1 J H3N3 coupling constants in the indirect dimension of the two-dimensional experiment. The 3h J H2H3 scalar coupling constants determined for AU base pairs in the two RNA hairpins examined here have been found to be positive and range in magnitude up to 1.8 Hz. Using a molecular fragment representation of an AU base pair, density functional theory/finite field perturbation theory (DFT/FPT) methods have been applied to attempt to predict the relative contributions of H-bond length and angular geometry to the magnitude of 3h J H2H3 coupling constants. Although the DFT/FPT calculations did not reproduce the full range of magnitude observed experimentally for the 3h J H2H3 coupling constants, the calculations do predict the correct sign and general trends in variation in size of these coupling constants. The calculations suggest that the magnitude of the coupling constants depends largely on H-bond length, but can also vary with differences in base pair geometry. The dependency of the 3h J H2H3 coupling constant on H-bond strength and geometry makes it a new probe for defining base pairs in NMR studies of nucleic acids

  9. Studies of Single Biomolecules, DNA Conformational Dynamics, and Protein Binding

    Science.gov (United States)

    2008-07-11

    Nucleotide Base pairs Hydrogen bonds FIG. 1: Ladder structure of DNA showing the Watson - Crick bonding of the bases A, T, G, and C which are suspended by a...protected against unwanted action of chemicals and proteins. The three-dimensional structure of DNA is the famed Watson - Crick double-helix, the equilibrium...quantitative analysis [88]. [1] A. Kornberg and T. A. Baker, DNA Replication (W. H. Freeman, New York, 1992). [2] J. D. Watson and F. H. C. Crick

  10. Temperature Effect on Rheological Behavior of Portuguese Honeys

    Directory of Open Access Journals (Sweden)

    Afonso Maria João

    2018-09-01

    Full Text Available In the present work the temperature effect on rheological properties of Portuguese honeys was studied for the first time. Two unifloral honeys – heather and rosemary – and a polyflower honey were analyzed. All honeys showed flow independence over time and behaved as Newtonian fluids at the studied temperature and shear rate ranges. For all honeys it was found that the viscosity decreased with temperature and the rosemary honey was the one that always presented the lowest viscosity at 30°C (6120 mPa·s, 50°C (603 mPa·s and 70°C (145 mPa·s. The temperature dependence of viscosity was well described by the K0×eAT-B$K_0 \\times e^{{A \\over {T - B}}} $ equation. Nevertheless, good regression coefficients were also obtained when fitting the experimental data to the Arrhenius model, showing the rosemary honey to be less temperature sensitive. The results obtained in this study are of great interest to beekeepers and industrials that handle and prepare eatable honey-based products because they will be better informed about the best type of honey to use.

  11. Fidelity Mechanisms of DNA Polymerase Alpha

    Science.gov (United States)

    2008-07-23

    between right and wrong dNTPs. With purine dNTPs, the enzyme uses a combination of positive and negative selectivity. The Watson - Crick hydrogen...dNTP as a dCTP analogue despite the lack of a Watson - Crick hydrogen bond. We specifically examined the role of O2 of a pyrimidine by synthesizing 4...cases the compounds could form 2 Watson - Crick hydrogen bonds. The lack of polymerization resulted from very weak binding of the dNTPs to pol α

  12. A randomised double-blind placebo-controlled pilot trial of a combined extract of sage, rosemary and melissa, traditional herbal medicines, on the enhancement of memory in normal healthy subjects, including influence of age.

    Science.gov (United States)

    Perry, N S L; Menzies, R; Hodgson, F; Wedgewood, P; Howes, M-J R; Brooker, H J; Wesnes, K A; Perry, E K

    2018-01-15

    To evaluate for the first time the effects of a combination of sage, rosemary and melissa (Salvia officinalis L., Rosmarinus officinalis L. and Melissa officinalis L.; SRM), traditional European medicines, on verbal recall in normal healthy subjects. To devise a suitable study design for assessing the clinical efficacy of traditional herbal medicines for memory and brain function. Forty-four normal healthy subjects (mean age 61 ± 9.26y SD; m/f 6/38) participated in this study. A double-blind, randomised, placebo-controlled pilot study was performed with subjects randomised into an active and placebo group. The study consisted of a single 2-week term ethanol extract of SRM that was chemically-characterised using high resolution LC-UV-MS/MS analysis. Immediate and delayed word recall were used to assess memory after taking SRM or placebo (ethanol extract of Myrrhis odorata (L.) Scop.). In addition analysis was performed with subjects divided into younger and older subgroups (≤ 62 years mean age n = 26: SRM n = 10, Placebo n = 16; ≥ 63 years n = 19: SRM n = 13, Placebo n = 6). Overall there were no significant differences between treatment and placebo change from baseline for immediate or delayed word recall. However subgroup analysis showed significant improvements to delayed word recall in the under 63 year age group (p memory in healthy subjects under 63 years of age. Short- and long- term supplementation with SRM extract merits more robust investigation as an adjunctive treatment for patients with Alzheimer's disease and in the general ageing population. The study design proved a simple cost effective trial protocol to test the efficacy of herbal medicines on verbal episodic memory, with future studies including broader cognitive assessment. Copyright © 2017 Elsevier GmbH. All rights reserved.

  13. How Healthcare Can Refocus on Its Super-Customers (Patients, n =1) and Customers (Doctors and Nurses) by Leveraging Lessons from Amazon, Uber, and Watson.

    Science.gov (United States)

    Kolker, Evelyne; Özdemir, Vural; Kolker, Eugene

    2016-06-01

    Healthcare is transforming with data-intensive omics technologies and Big Data. The "revolution" has already happened in technology, but the bottlenecks have shifted to the social domain: Who can be empowered by Big Data? Who are the users and customers? In this review and innovation field analysis, we introduce the idea of a "super-customer" versus "customer" and relate both to 21st century healthcare. A "super-customer" in healthcare is the patient, sample size of n = 1, while "customers" are the providers of healthcare (e.g., doctors and nurses). The super-customers have been patients, enabled by unprecedented social practices, such as the ability to track one's physical activities, personal genomics, patient advocacy for greater autonomy, and self-governance, to name but a few. In contrast, the originally intended customers-providers, doctors, and nurses-have relatively lagged behind. With patients as super-customers, there are valuable lessons to be learned from industry examples, such as Amazon and Uber. To offer superior quality service, healthcare organizations have to refocus on the needs, pains, and aspirations of their super-customers by enabling the customers. We propose a strategic solution to this end: the PPT-DAM (People-Process-Technology empowered by Data, Analytics, and Metrics) approach. When applied together with the classic Experiment-Execute-Evaluate iterative methodology, we suggest PPT-DAM is an extremely powerful approach to deliver quality health services to super-customers and customers. As an example, we describe the PPT-DAM implementation by the Benchmarking Improvement Program at the Seattle Children's Hospital. Finally, we forecast that cognitive systems in general and IBM Watson in particular, if properly implemented, can bring transformative and sustainable capabilities in healthcare far beyond the current ones.

  14. Improving the lipid stability and sensory characteristics of irradiated minced beef by using natural herbal extracts

    International Nuclear Information System (INIS)

    Mansour, H. A.; Moliarned, H.M.; El-Niely, H.F.G.

    2007-01-01

    The objective of the present work was to use natural herbal extracts to minimize lipid oxidation and improve the sensory characteristics of irradiated minced beef. Beef longissimus dorsi were minced, mixed with herbal extracts as appropriate and packed in polyethylene bags (50 g each). There were four treatment groups: (1) untreated controls, (2) irradiated with cobalt-60 gamma-rays to either 2 or 4.5 kGy, (3) addition of extracts of one of marjoram, rosemary or sage to a final concentration of 0.04 % (v/w), (4) combination treatment with either 2 or 4.5 kGy irradiation, plus herbal extract at 0.04 % (v/w) added pre-irradiation. Aerobically packaged samples were then placed into storage at 5 degree C. At specified time intervals samples were withdrawn to be analyzed for thiobarbituric acid reactive substances (TEARS), sensory characteristics and psychrotrophic bacterial counts, Results demonstrated a significant benefit of the addition of herbal extracts to the minced beef prior to irradiation. All three extracts generally lowered the TBARS values in both control and irradiated samples, with marjoram being the most effective, followed by sage and rosemary in that order of efficacy. As regards radiation effected off-odour, all three extracts generally lowered the off-odour score, with marjoram and sage being most effective, and rosemary being somewhat less so. All three extracts protected against radiation effected colour loss. Addition of herbal extracts prior to irradiation resulted in significant increase (p< 0.05) in the acceptability scores for all irradiated samples in the post-irradiation period, with rosemary being somewhat less effective than sage and marjoram. Addition of herbal extracts alone to the minced meat did not affect the psychrotrophic bacterial counts of treated samples. The combination treatment with herbal extracts plus

  15. Control of lipid oxidation in extruded salmon jerky snacks.

    Science.gov (United States)

    Kong, Jian; Perkins, L Brian; Dougherty, Michael P; Camire, Mary Ellen

    2011-01-01

    A shelf-life study was conducted to evaluate the effect of antioxidants on oxidative stability of extruded jerky-style salmon snacks. Deterioration of docosahexaenoic acid (DHA) and eicosapentaenoic acid (EPA) due to lipid oxidation is a major concern for this healthy snack. A control jerky with no added antioxidants and 4 jerkies with antioxidants (rosemary, mixed tocopherols, tertiary butylhydroquinone, and ascorbyl palmitate) added as 0.02% of the lipid content were extruded in duplicate in a Coperion ZSK-25 twin screw extruder. Salmon jerkies from each formulation were placed in 3 mil barrier pouches, flushed with nitrogen, and stored at 35 °C and 75% relative humidity. Lipid oxidation was evaluated as by peroxide value and malonaldehyde content. Other chemical analyses included total fatty acid composition, lipid content, moisture, water activity, pH, and salt. Astaxanthin and CIE L*, a*, b* color were also analyzed at 4-wk intervals. Rosemary inhibited peroxide formation better than did other antioxidants at week 8; no treatment inhibited malonaldehyde levels. All jerkies had lower astaxanthin levels after 8 wk, but rosemary-treated jerky had higher pigment concentrations than did the control at weeks 4 and 8. Protection of omega-3 lipids in these extruded jerkies must be improved to offer consumers a convenient source of these healthful lipids. Practical Application: Salmon flesh can be extruded to produce a jerky that provides 410 mg of omega-3 lipids per serving. Natural antioxidants such as rosemary should be added at levels over 0.02% of the lipid content to help control lipid oxidation. Astaxanthin and CIE a* values correlated well with lipid stability and could be used to monitor quality during storage if initial values are known.

  16. Nuclear techniques to determine microbial protein synthesis and productive performance of barki lambs fed rations containing some medicinal plants

    International Nuclear Information System (INIS)

    Mohamed, M.M.S.

    2009-01-01

    This study included two experiments, the first experiment was carried out in vitro to evaluate the effect of adding two levels of Lemongrass or Rosemary in ruminant rations on microbial protein synthesis using radio active sulfur S 35 . While, the second experiment was to study the effect of Lemongrass (CC) and Rosemary (RO) as feed additives in rations of lambs on feed intake, nutrient digestibility, some parameters of blood and rumen activity. Meanwhile, body weight and economical efficiency were studied. Twenty five of Barki male lambs with average body weight of 19.8 kg ± 1 kg and 3- 4 months of age were divided into 5 similar groups (5 lambs each). The first group (control) (R1) was fed on a concentrate feed mixture (CFM) plus rice straw (RS). While, R2 and R3 were fed as R1 ration supplemented with 100 or 200 mg Lemongrass /kg LBW/d respectively. Meantime, R4 and R5 were fed as R1 ration supplemented with 100 or 200 mg Rosemary /kg LBW/d respectively.The results indicated that more microbial protein synthesis was noticed with 4 mg of Lemongrass followed by 2 mg Rosemary, 2 mg Lemongrass and control which was higher than 4 mg Rosemary/ 0.5 g concentrate mixture. The differences were not statistically significant. The dry matter intake (DMI) was not significantly different for R4 and R3 when compared with R1 (control) and it significantly decreased in R5 and R2 compared with R1. The digestibilities of DM, OM, CP, EE and NFE in the supplemented groups were not significantly differing compared with R1. The digestibility of CF was significantly increased in R2 and R4 compared with R1 and there were no significant differences for R3 and R5 compared with R1. There were no significant differences in nutritive values as TDN, DCP and SV among all supplemented groups compared with R1. Rumen liquor TVFA,s was not significantly differ at zero time, but it decreased at 3 h and 6 h with all additives compared with the control with no significant differences among all

  17. Contemporary Danish book art

    DEFF Research Database (Denmark)

    Larsen, Poul Steen

    the Metropolitan Museum of Art, Thomas J. Watson Library, Helge Ernst, illustrator, Poul Kristensen, printer, Ole Olsen, bookbinder, exhibition catalog......the Metropolitan Museum of Art, Thomas J. Watson Library, Helge Ernst, illustrator, Poul Kristensen, printer, Ole Olsen, bookbinder, exhibition catalog...

  18. Effects of herbs and spice on health status of tilapia (Oreochromis mossambicus challenged with Streptococcus iniae

    Directory of Open Access Journals (Sweden)

    Nejdet Gültepe

    2014-01-01

    Full Text Available Effects of different herbal extracts on the growth and immune defense of fish were researched in the last decade. The aim of this study was to determine the dietary effects of thyme (Thymus vulgaris, rosemary (Rosmarinus officinalis and fenugreek (Trigonella foenum graecum as a feed additive on haematology, innate immune response, and disease resistance of tilapia (Oreochromis mossambicus. In total 228 healthy fish tilapia were divided into four groups (57 fish in one group and fed diets supplemented with thyme, rosemary and fenugreek at levels of 1%, respectively; fish in the control group were fed diet without any spices. Fish were fed ad libitum three times a day for 45 days. All fish of the experimental groups significantly (P P P > 0.05 changed during the whole experiment. After 45 days of feeding, fish were injected intraperitoneally with 100 μl of Streptococcus iniae (8 × 108 colony forming unit. The cumulative mortality was 22%, 27% and 31% in fish receiving diets supplemented with 1% thyme, rosemary and fenugreek, respectively, compared to 61% mortality in the control group. The results indicate that all three supplements used improved the haematological status, non-specific immune response and disease resistance of tilapia against S. iniae; this is the first similar study.

  19. Evaluation of antibacterial effect of Rosmarinus officinalis L. essential oil on three food-borne pathogens in vegetables by propidium monoazide quantitative PCR

    Directory of Open Access Journals (Sweden)

    M Azizkhani

    2015-08-01

    Full Text Available Essential oils (EOs have long been applied as flavoring agents in foods. Nowadays, due to the antimicrobial properties of EOs, they have been used as natural food preservatives. In this study, initial experiments were performed in order to elucidate the minimum bactericidal concentration of Rosmarinus officinalis L.EO on Escherichia coli O157:H7, Salmonella enterica and Listeria monocytogenes. Thereafter, PMA-qPCR was applied in order to selectively quantify living cells within a bacterial population treated with rosemary EO. Inactivation was obtained at EO concentrations of 1%, 0.45%, 0.9% for L. monocytogenes, E. coli O157:H7 and S. enterica, respectively. L. monocytogenes were totally killed within 45 min while it took 90 min for E. coli O157:H7and S. enterica. It was concluded that rosemary EO has the potential to be used as a natural food additive or bio-preservative since it was able to irreversibly inactivate the three tested pathogens at lower concentrations and short exposition times in comparison with the other EOs. In addition, PMA-qPCR approach proved quantitatively precise and specific to selectively detect live pathogenic bacteria in vegetables following inactivation with rosemary EO.

  20. 78 FR 6805 - Information Collection: Arctic National Wildlife Refuge Recreation Visitor Study-2013

    Science.gov (United States)

    2013-01-31

    .... ADDRESSES: Comments concerning this notice should be addressed to Alan E. Watson, Aldo Leopold Wilderness... . The public may inspect comments received at the Aldo Leopold Wilderness Research Institute, USDA... FURTHER INFORMATION CONTACT: Alan E. Watson, Aldo Leopold Wilderness Research Institute, (406) 542-4197...

  1. Nanoswitches based on DNA base pairs: why adenine-thymine is less suitable than guanine-cytosine

    NARCIS (Netherlands)

    Fonseca Guerra, C.; van der Wijst, T.; Bickelhaupt, F.M.

    2006-01-01

    Substituted Watson-Crick guanine-cytosine (GC) base pairs were recently shown to yield robust three-state nanoswitches. Here, we address the question: Can such supramolecular switches also be based on Watson-Crick adenine-thymine (AT) base pairs? We have theoretically analyzed AT pairs in which

  2. Comparison of approximate methods for multiple scattering in high-energy collisions. II

    International Nuclear Information System (INIS)

    Nolan, A.M.; Tobocman, W.; Werby, M.F.

    1976-01-01

    The scattering in one dimension of a particle by a target of N like particles in a bound state has been studied. The exact result for the transmission probability has been compared with the predictions of the Glauber theory, the Watson optical potential model, and the adiabatic (or fixed scatterer) approximation. The approximate methods optical potential model is second best. The Watson method is found to work better when the kinematics suggested by Foldy and Walecka are used rather than that suggested by Watson, that is to say, when the two-body of the nucleon-nucleon reduced mass

  3. 75 FR 54296 - Information Collection; Trends in Use and Users in the Boundary Waters Canoe Area Wilderness, MN

    Science.gov (United States)

    2010-09-07

    ... notice should be addressed to Alan E. Watson, Aldo Leopold Wilderness Research Institute, USDA Forest... submitted by e-mail to: [email protected] . The public may inspect comments received at the Aldo Leopold... to the building. FOR FURTHER INFORMATION CONTACT: Alan E. Watson, Aldo Leopold Wilderness Research...

  4. Oxidative stability of the lipid fraction in cookies – the EPR study

    Directory of Open Access Journals (Sweden)

    Zawada Katarzyna

    2015-07-01

    Full Text Available Cookies are a group of convenient food products that are popular among consumers. They may contain high amounts of fats, which can be prone to oxidation. To retard the oxidative deterioration, synthetic and natural antioxidants may be added. Herb and spice extracts can be sources of natural biologically active substances with antioxidant activity. In this work, electron paramagnetic resonance spectroscopy was used to monitor the lipid oxidation in cookies with rosemary and thyme extracts subjected to the storage in elevated temperature. It was shown that thyme extract can be used as a natural antioxidant source for the preparation of bakery products, while the rosemary extract should be used with care in fat-rich products exposed to high temperatures.

  5. Commentary on Malone: Who Founded Behaviorism?

    Science.gov (United States)

    Reese, Hayne W

    2015-05-01

    Malone (The Behavior Analyst, 37, 1-12 2014) argued that the emergence of behaviorism was inevitable with or without Watson's participation, mainly because protobehavioral ideas and dissatisfaction with classical structuralism were already widespread. However, the first premise is questionable because many of the ideas Malone cited were consistent with structuralism rather than behaviorism, and even if both premises were true they would not make the emergence of behaviorism-or anything else-inevitable. Historical evidence for inevitability is always retrospective and therefore always allows the logical fallacy of "after this, therefore because of this." In the relevant real world Watson existed, he was a psychologist, he was the first to publish an article that described a "behaviorism," and he promoted his behaviorism in later works. Stories about what would have happened without Watson's participation are therefore counterfactual and this lack of historicity makes the stories fictional rather than scientific. In the real world, Watson founded behaviorism.

  6. A Boyer-Moore (or Watson-Watson) type algorithm for regular tree pattern matching

    NARCIS (Netherlands)

    Watson, B.W.; Aarts, E.H.L.; Eikelder, ten H.M.M.; Hemerik, C.; Rem, M.

    1995-01-01

    In this chapter, I outline a new algorithm for regular tree pattern matching. The existence of this algorithm was first mentioned in the statements accompanying my dissertation, [2]. In order to avoid repeating the material in my dissertation, it is assumed that the reader is familiar with Chapters

  7. Analyzing the Teaching of Advanced Mathematics Courses via the Enacted Example Space

    Science.gov (United States)

    Fukawa-Connelly, Timothy Patrick; Newton, Charlene

    2014-01-01

    Examples are believed to be very important in developing conceptual understanding of mathematical ideas, useful both in mathematics research and instruction (Bills & Watson in "Educational Studies in Mathematics" 69:77-79, 2008; Mason & Watson, 2008; Bills & Tall, 1998; Tall & Vinner, 1981). In this study, we draw on the…

  8. the use of research in protected area management in Madagascar

    African Journals Online (AJOL)

    they are also expected to contribute to social objectives (Watson et al. 2014). ...... . Chapman, J. M., Algera ... Fuller, R. A., Lee, J. R. and Watson, J. E. M. 2014. Achieving open ... Kremen, C., Cameron, A., Moilanen, A., Phillips, S. J., Thomas, C. D., et al. 2008. Aligning ...

  9. Differential stabilities and sequence-dependent base pair opening dynamics of Watson-Crick base pairs with 5-hydroxymethylcytosine, 5-formylcytosine, or 5-carboxylcytosine.

    Science.gov (United States)

    Szulik, Marta W; Pallan, Pradeep S; Nocek, Boguslaw; Voehler, Markus; Banerjee, Surajit; Brooks, Sonja; Joachimiak, Andrzej; Egli, Martin; Eichman, Brandt F; Stone, Michael P

    2015-02-10

    5-Hydroxymethylcytosine (5hmC), 5-formylcytosine (5fC), and 5-carboxylcytosine (5caC) form during active demethylation of 5-methylcytosine (5mC) and are implicated in epigenetic regulation of the genome. They are differentially processed by thymine DNA glycosylase (TDG), an enzyme involved in active demethylation of 5mC. Three modified Dickerson-Drew dodecamer (DDD) sequences, amenable to crystallographic and spectroscopic analyses and containing the 5'-CG-3' sequence associated with genomic cytosine methylation, containing 5hmC, 5fC, or 5caC placed site-specifically into the 5'-T(8)X(9)G(10)-3' sequence of the DDD, were compared. The presence of 5caC at the X(9) base increased the stability of the DDD, whereas 5hmC or 5fC did not. Both 5hmC and 5fC increased imino proton exchange rates and calculated rate constants for base pair opening at the neighboring base pair A(5):T(8), whereas 5caC did not. At the oxidized base pair G(4):X(9), 5fC exhibited an increase in the imino proton exchange rate and the calculated kop. In all cases, minimal effects to imino proton exchange rates occurred at the neighboring base pair C(3):G(10). No evidence was observed for imino tautomerization, accompanied by wobble base pairing, for 5hmC, 5fC, or 5caC when positioned at base pair G(4):X(9); each favored Watson-Crick base pairing. However, both 5fC and 5caC exhibited intranucleobase hydrogen bonding between their formyl or carboxyl oxygens, respectively, and the adjacent cytosine N(4) exocyclic amines. The lesion-specific differences observed in the DDD may be implicated in recognition of 5hmC, 5fC, or 5caC in DNA by TDG. However, they do not correlate with differential excision of 5hmC, 5fC, or 5caC by TDG, which may be mediated by differences in transition states of the enzyme-bound complexes.

  10. Impact of essential oils on the taste acceptance of tomato juice, vegetable soup, or poultry burgers.

    Science.gov (United States)

    Espina, Laura; García-Gonzalo, Diego; Pagán, Rafael

    2014-08-01

    Despite the vast body of available literature on the possibilities of essential oils (EOs) as food preservatives or functional ingredients, the sensory impact of their addition to foods has barely been approached. This work focuses on the hedonic taste acceptance of 3 food products (tomato juice, vegetable soup, and poultry burgers) when they are incorporated with potentially antimicrobial concentrations (20 to 200 μL/L) of 6 selected EOs (lemon, pennyroyal mint, thyme, and rosemary) and individual compounds (carvacrol, p-cymene). Although addition of 20 μL/L of pennyroyal mint or lemon EO did not change the taste acceptance of tomato juice, higher concentrations of these compounds or any concentration of the other 4 compounds did. In vegetable soup, the tolerance limit for rosemary EO, thyme EO, carvacrol, or p-cymene was 20 μL/L, while the addition of 200 μL/L of lemon EO was accepted. Tolerance limits in poultry burgers were established in 20 μL/L for carvacrol and thyme EOs, 100 μL/L for pennyroyal mint EO and p-cymene, and 200 μL/L for lemon and rosemary EOs. Moreover, incorporation of pennyroyal mint EO to tomato juice or poultry burgers, and enrichment of vegetable soup with lemon EO, could contribute to the development of food products with an improved sensory appeal. © 2014 Institute of Food Technologists®

  11. Free Radicals Scavenging Activity of Essential Oils and Different Fractions of Methanol Extract of Zataria Multiflora, Salvia Officinalis, Rosmarinus Officinalis, Mentha Pulegium and Cinnamomum Zeylanicum

    Directory of Open Access Journals (Sweden)

    S Changizi Ashtiani

    2012-04-01

    Full Text Available Introduction: Essential oils and extracts from medicinal plants are regarded as natural food preservatives and health promoting drugs. Considering their antioxidant activity, most of them can prevent oxidative stress. The present study was aimed to evaluate free radicals scavenging activity of essential oils and different fractions of methanol extracts from cinnamon, pennyroyal, black cumin, sage, rosemary and azkand. Methods: Antioxidant property of essential oils and different fractions of these medicinal plants was studied by determining their DPPH(2,2-diphenyl-1-picrylhydrazyl free radicals scavenging activity. Results: There were significant differences among the free radical scavenging activity of studied essential oils and different fractions. Ethyl acetate fractions were identified as the most active fractions than other ones and even synthetic antioxidant (BHT, IC50 value of 239.5μg/ml with the highest activity in Mentha pulegium (47.2 μg/ml μg/ml. Among others, n-hexane fraction of rosemary (969 μg/ml, dichloromethane fraction of rosemary (205.46 μg/ml and zatar (344 μg/ml and aqueous fractions of cinnamon (117.6 μg/ml and sage (321.3 μg/ml exhibited appreciable antioxidant activity. Conclusion: Regarding considerable activity of studied extracts, they have the potential to be used as natural antioxidants in relevant industries.

  12. Impact of pecan nut shell aqueous extract on the oxidative properties of margarines during storage.

    Science.gov (United States)

    Engler Ribeiro, Paula Cristina; de Britto Policarpi, Priscila; Dal Bo, Andrea; Barbetta, Pedro Alberto; Block, Jane Mara

    2017-07-01

    The oxidative properties of margarines supplemented with pecan nut shell extract, rosemary extract and butylated hydroxytoluene (BHT) were investigated. The extracts of pecan nut shell and rosemary showed a high content of total phenolics and condensed tannins (93 and 102.9 mg GAE g -1 and 46 and 38.9 mg CE g -1 respectively) as well as a high antioxidant activity (1257 and 2306 µmol TEAC g -1 and 293 and 856 mg TEAC g -1 by ABTS and DPPH methods respectively). Gallic acid, chlorogenic acid, p-hydroxybenzoic acid, epicatechin and epicatechin gallate were identified in the pecan nut shell extract. Peroxide and p-anisidine values of 3.75-4.43 meq kg -1 and 1.22-2.73 respectively, Totox values of 9.88-10.8 and specific extinction values of 4.38-4.59 and 0.92-0.94 at 232 and 268 nm respectively were observed after 8 months of storage in the studied samples. Margarines supplemented with pecan nut shell extract, rosemary extract or BHT during prolonged storage were found to be of equal quality within the degree of confidence limits. The extract of pecan nut shell may be considered as a natural product replacement for the synthetic antioxidant BHT. © 2016 Society of Chemical Industry. © 2016 Society of Chemical Industry.

  13. Genetics by the Numbers

    Science.gov (United States)

    ... t understand how. All that changed when James Watson and Francis Crick showed that DNA is shaped like a spiral staircase that can ... split, copied and passed on to future generations. Watson and Crick received a Nobel Prize in 1962 for ... National DNA Day This Inside Life Science article also appears ...

  14. Managing Epilepsy (A Cup of Health with CDC)

    Centers for Disease Control (CDC) Podcasts

    Approximately three million people in the U.S. have been diagnosed with epilepsy, a brain disorder that results in seizures. In this podcast, Rosemarie Kobau discusses the importance of recognizing and treating epilepsy.

  15. Consumer's evaluation of the effects of gamma irradiation and natural antioxidants on general acceptance of frozen beef burger

    International Nuclear Information System (INIS)

    Trindade, R.A.; Lima, A.; Andrade-Wartha, E.R.; Oliveira e Silva, A.M.; Mancini-Filho, J.; Villavicencio, A.L.C.H.

    2009-01-01

    The effect of addition of rosemary and oregano extracts on the sensory quality of irradiated beef burger was investigated. Batches of beef burgers were prepared with 400 ppm of rosemary or oregano extract and a group prepared with 200 ppm of synthetic butyl-hydroxytoluene (BHT)/butyl-hydroxy-anisol (BHA) was used as a control. Half of each formulation was irradiated at the maximum dose allowed for frozen meat (7 kGy). Samples were kept under frozen conditions (-20 deg. C) during the whole storage period, including during irradiation. Two analyses were performed after 20 and 90 days to verify the influence of the addition of the different types of antioxidants and the effect of irradiation and storage time on the acceptance of the product. Thirty-three and thirty-four untrained panelists were invited to participate in the first and second test, respectively. A structured hedonic scale ranging from 1 to 9 points was used in both analyses. BHT/BHA formulation obtained the highest score (6.73) and regarding the natural antioxidants, oregano received better acceptance (6.36). Irradiated samples formulated with oregano received a lower score, 6.03 in the first test and 5.06 in the second one, compared to the non-irradiated sample (6.36 and 5.79). In the second test (90 days), the sample formulated with BHT/BHA and which was irradiated received a higher score (6.59) when compared to the non-irradiated one (5.85). In both tests, the irradiated samples formulated with rosemary extract obtained a better score compared to the non-irradiated one, the scores being 5.00-3.82 and 5.00-3.76 in the first and second test, respectively. Our results allowed us to conclude that the natural antioxidants, rosemary and oregano extracts, present a good alternative for replacing synthetic additives in food industries, and that the irradiation process, in some cases, may help to enhance the sensory quality of food

  16. Consumer's evaluation of the effects of gamma irradiation and natural antioxidants on general acceptance of frozen beef burger

    Science.gov (United States)

    Trindade, R. A.; Lima, A.; Andrade-Wartha, E. R.; Oliveira e Silva, A. M.; Mancini-Filho, J.; Villavicencio, A. L. C. H.

    2009-04-01

    The effect of addition of rosemary and oregano extracts on the sensory quality of irradiated beef burger was investigated. Batches of beef burgers were prepared with 400 ppm of rosemary or oregano extract and a group prepared with 200 ppm of synthetic butyl-hydroxytoluene (BHT)/butyl-hydroxy-anisol (BHA) was used as a control. Half of each formulation was irradiated at the maximum dose allowed for frozen meat (7 kGy). Samples were kept under frozen conditions (-20 °C) during the whole storage period, including during irradiation. Two analyses were performed after 20 and 90 days to verify the influence of the addition of the different types of antioxidants and the effect of irradiation and storage time on the acceptance of the product. Thirty-three and thirty-four untrained panelists were invited to participate in the first and second test, respectively. A structured hedonic scale ranging from 1 to 9 points was used in both analyses. BHT/BHA formulation obtained the highest score (6.73) and regarding the natural antioxidants, oregano received better acceptance (6.36). Irradiated samples formulated with oregano received a lower score, 6.03 in the first test and 5.06 in the second one, compared to the non-irradiated sample (6.36 and 5.79). In the second test (90 days), the sample formulated with BHT/BHA and which was irradiated received a higher score (6.59) when compared to the non-irradiated one (5.85). In both tests, the irradiated samples formulated with rosemary extract obtained a better score compared to the non-irradiated one, the scores being 5.00-3.82 and 5.00-3.76 in the first and second test, respectively. Our results allowed us to conclude that the natural antioxidants, rosemary and oregano extracts, present a good alternative for replacing synthetic additives in food industries, and that the irradiation process, in some cases, may help to enhance the sensory quality of food.

  17. Antimicrobial activities of the essential oils of various plants against tomato late blight disease agent Phytophthora infestans.

    Science.gov (United States)

    Soylu, E Mine; Soylu, Soner; Kurt, Sener

    2006-02-01

    The aim of this study was to find an alternative to synthetic fungicides currently used in the control of devastating oomycete pathogen Phytophthora infestans, causal agent of late blight disease of tomato. Antifungal activities of essential oils obtained from aerial parts of aromatic plants such as oregano (Origanum syriacum var. bevanii), thyme (Thymbra spicata subsp. spicata), lavender (Lavandula stoechas subsp. stoechas), rosemary (Rosmarinus officinalis), fennel (Foeniculum vulgare), and laurel (Laurus nobilis), were investigated against P. infestans. Both contact and volatile phase effects of different concentrations of the essential oils used were determined by using two in vitro methods. Chemical compositions of the essential oils were also determined by GC-MS analysis. Major compounds found in essential oils of thyme, oregano, rosemary, lavender, fennel and laurel were carvacrol (37.9%), carvacrol (79.8), borneol (20.4%), camphor (20.2%), anethole (82.8%) and 1,8-cineole (35.5%), respectively. All essential oils were found to inhibit the growth of P. infestans in a dose-dependent manner. Volatile phase effect of oregano and thyme oils at 0.3 microg/ml air was found to completely inhibit the growth of P. infestans. Complete growth inhibition of pathogen by essential oil of fennel, rosemary, lavender and laurel was, however, observed at 0.4-2.0 microg/ml air concentrations. For the determination of the contact phase effects of the tested essential oils, oregano, thyme and fennel oils at 6.4 microg/ml were found to inhibit the growth of P. infestans completely. Essential oils of rosemary, lavender and laurel were inhibitory at relatively higher concentrations (12.8, 25.6, 51.2 microg/ml respectively). Volatile phase effects of essential oils were consistently found to be more effective on fungal growth than contact phase effect. Sporangial production was also inhibited by the essential oil tested. Light and scanning electron microscopic (SEM) observation on

  18. Does Size Matter?

    Science.gov (United States)

    Watson, David

    2014-01-01

    In this article, David Watson debates the pros and cons of leadership skills in both a small and large university. Watson relates his own experiences regarding the changing atmosphere of leadership. He states that his experiences have caused him to reflect on what is genuinely generic about individual capacities for institutional leadership: that…

  19. Educational Technologists: Leading Change for a New Paradigm of Education

    Science.gov (United States)

    Aslan, Sinem; Reigeluth, Charles M.

    2013-01-01

    The transition from the industrial age to the information age has happened and is still happening in our society (Duffy, 2009). However, our current educational systems still operate based on the needs of the industrial-age society (Watson, Watson, & Reigeluth, n.d), making them among the least impacted organizations (Reigeluth & Joseph,…

  20. Comparing Effects Of GAMMA And Electron Beam Irradiation On Microbiological And Biochemical Characters Of Selected Egyptian Aromatic Herbs

    International Nuclear Information System (INIS)

    FARAG, S.A.; YUSSEF, B.M.; SHAMS EL DIEEN, N.M.; ABDALLA, M.

    2009-01-01

    Selected Egyptian aromatic herbs (AH) which face demand for exporting abroad, such as spearmint (Mentha viridis Linn.), rosemary (Rosmarinus officinalis L.) and marjoram (Origanum majorana L.), were exposed to gamma and electron beam (EB) irradiation at different doses (5 and 10 kGy). The evaluation of irradiation efficiency was based on microbiological and biochemical studies including changes in volatile compounds and antioxidative activity. The microbiological assay revealed presence of high load levels in raw AH with log of total bacteria of rosemary (6.862 cfu.g-1) and spearmint (6.762 cfu.g -1 ) while marjoram was the lowest one (5.771 cfu.g -1 ). The highest levels of the log of total molds and yeast counts were observed in marjoram (5.097 cfu.g -1 ) while the less levels were observed in rosemary and spearmint. Using gamma irradiation was more effective than EB in decontamination of microbes either in reducing numbers to safe levels at 5 kGy or completely elimination at high dose (10 kGy) in all tested samples. Some specific bacteria were present in AH such as Enterococcus faecalis, Bacillus cereus and Clostridium perfringens at different levels whereas the log of E. faecalis was detected only in marjoram and spearmint with heavy load as 4.554 and 3.427 cfu.g -1 , respectively, while rosemary was less than 2 cfu.g -1 . Irradiation with both sources at 5 kGy reduced the count by about 2 log cycles in marjoram and 1 log cycle in spearmint. No colonies of the same microbe were detected at high dose (10 kGy) in all herbs with exception of marjoram. The log of B. cereus contamination was higher in spearmint than marjoram then rosemary. Irradiation of AH at 5 kGy reduced these values whereas high dose (10 kGy) caused complete elimination of B. cereus.GLC analysis of AH volatile oils showed presence of 22 compounds in spearmint included mainly carvon specific smells of spearmint besides monoterpens as α- -pinen (1.6%), Β-pinen (2.06%), limonene (4.75%). Also

  1. Music Technology and Musical Creativity: Making Connections

    Science.gov (United States)

    Thompson, Douglas Earl

    2012-01-01

    This article is a preview of Scott Watson's new book, "Using Technology to Unlock Musical Creativity" (Oxford University Press, 2011). The book's main contents are summarized and one of the volume's 29 lessons is provided to assist readers in evaluating the book for their use. Particular attention is given to Watson's success in making the…

  2. Bringing Precision Medicine to Community Oncologists.

    Science.gov (United States)

    2017-01-01

    Quest Diagnostics has teamed up with Memorial Sloan Kettering Cancer Center and IBM Watson Health to offer IBM Watson Genomics to its network of community cancer centers and hospitals. This new service aims to advance precision medicine by combining genomic tumor sequencing with the power of cognitive computing. ©2017 American Association for Cancer Research.

  3. Behaviorism

    Science.gov (United States)

    Moore, J.

    2011-01-01

    Early forms of psychology assumed that mental life was the appropriate subject matter for psychology, and introspection was an appropriate method to engage that subject matter. In 1913, John B. Watson proposed an alternative: classical S-R behaviorism. According to Watson, behavior was a subject matter in its own right, to be studied by the…

  4. Anti-parallel triplexes

    DEFF Research Database (Denmark)

    Kosbar, Tamer R.; Sofan, Mamdouh A.; Waly, Mohamed A.

    2015-01-01

    about 6.1 °C when the TFO strand was modified with Z and the Watson-Crick strand with adenine-LNA (AL). The molecular modeling results showed that, in case of nucleobases Y and Z a hydrogen bond (1.69 and 1.72 Å, respectively) was formed between the protonated 3-aminopropyn-1-yl chain and one...... of the phosphate groups in Watson-Crick strand. Also, it was shown that the nucleobase Y made a good stacking and binding with the other nucleobases in the TFO and Watson-Crick duplex, respectively. In contrast, the nucleobase Z with LNA moiety was forced to twist out of plane of Watson-Crick base pair which......The phosphoramidites of DNA monomers of 7-(3-aminopropyn-1-yl)-8-aza-7-deazaadenine (Y) and 7-(3-aminopropyn-1-yl)-8-aza-7-deazaadenine LNA (Z) are synthesized, and the thermal stability at pH 7.2 and 8.2 of anti-parallel triplexes modified with these two monomers is determined. When, the anti...

  5. Possible role of double scattering in electron-atom scattering in a laser field

    International Nuclear Information System (INIS)

    Rabadan, I.; Mendez, L.; Dickinson, A.S.

    1996-01-01

    By considering observations of double-scattering effects in the excitation of the 2 1 P level of He, gas density values estimated for the laser-assisted elastic scattering experiments of Wallbank and Holmes (1993, 1994a,b) for which the Kroll-Watson approximation appears to fail. Using comparable densities for He and lower densities for Ar, and assuming the Kroll-Watson approximation for single-scattering events, differential cross sections are calculated including double scattering for laser-assisted scattering for a range of energies and scattering angles. Comparison with the observed values shows that double-scattering effects can give a semi-quantitative explanation of the apparent breakdown of the Kroll-Watson approximation in both He and Ar. (author)

  6. Extended low-frequency approximation for laser-modified electron scattering: Coulomb effects

    International Nuclear Information System (INIS)

    Mittleman, M.H.

    1988-01-01

    The Kroll-Watson [N.M. Kroll and K. M. Watson, Phys. Rev. A 8, 804 (1973)] theory for electron scattering in the field of a low-frequency laser has been extended by L. Rosenberg [Phys. Rev. A 23, 2283 (1981); 28, 2727 (1983)] to apply to higher intensities. That result is rederived in another way so as to make the correction second order. The correction terms are obtained and shown to be small in the high-intensity low-energy regime in which the original theory is weakest. The special case of a Coulomb potential is analyzed and shown to present special peculiarities in the extended theory just as in the original Kroll-Watson theory

  7. Various Extraction Methods Influence the Adhesive Properties of Dried Distiller’s Grains and Solubles, and Press Cakes of Pennycress (Thlaspi arvense L. and Lesquerella [Lesquerella fendleri (A. Gary S. Watson], in the Fabrication of Lignocellulosic Composites

    Directory of Open Access Journals (Sweden)

    Brent Tisserat

    2018-04-01

    Full Text Available Lignocellulosic composite (LC panels were fabricated using an adhesive matrix prepared from three different agricultural by-products: dried distillers grains with solubles (DDGS, pennycress (Thlaspi arvense L. press cake (PPC, or lesquerella [Lesquerella fendleri (A. Gary S. Watson] press cake (LPC reinforced with Paulownia elongata L. wood (PW particles. The goal in this study was to assess the mechanical properties of composites utilizing these low-cost matrix materials, which were subjected to various oil extraction methods. Three types of oil extraction methods were utilized: ethanol, supercritical CO2, and hexane, in order to generate matrix materials. These matrix materials were mixed with equal proportions of PW and hot pressed to generate panels. Overall, hexane extraction was the best method to enhance the mechanical properties of the matrices used to fabricate lignocellulosic composites. LPC’s produced a matrix that gave the resulting composite superior flexural properties compared to composites generated from DDGS and PPC matrices. The mechanical properties of composites generated from soy products (soybean meal flour or soy protein isolate were similar to those derived from DDGS, PPC, or LPC. The dimensional stability properties of LCs were improved when the hexane extraction method was employed, unlike with the other extraction methods that were used to generate matrices.

  8. Apple and quince peroxidase activity in response to essential oils ...

    African Journals Online (AJOL)

    Jane

    2011-09-28

    Sep 28, 2011 ... activities of edible coatings enriched with natural plant extracts such as rosemary ..... its oxidation by ascorbate peroxidase activity (Talano et al., 2008). ... delicious and quince improved the antioxidant protection of the fruits ...

  9. Eating Well with Scleroderma

    Science.gov (United States)

    ... Add antioxidant rich, anti-inflam- matory herbs and spices, such as basil, rosemary, oregano, cin- namon, ginger, ... or Culturelle ® ) and/or eat yogurt with active cultures regularly. Remember to increase your fluid intake. • Inflammation: ...

  10. A Systems Thinking Framework for Assessing and Addressing Malaria Locally: An Alternative to the Globalization of Anti-Malaria Policies

    Science.gov (United States)

    Willis, Derek W.

    2010-01-01

    This dissertation analyzes a decision system that was used in the early 1900s in the Federated Malay States (FMS) by Malcolm Watson in order to make anti-malaria program recommendations to decision makers in a wide range of ecological settings. Watson's recommendations to decision makers throughout the FMS led to a dramatic suppression of malaria…

  11. Comparative study of the chemical composition of the essential oils ...

    African Journals Online (AJOL)

    USER

    2010-02-08

    Feb 8, 2010 ... essential oils from organs of Annona senegalensis ..... rosemary, oregano and coriander essential oils, J. Essent. Oil Res. 10 : 618-27. Bouquet A ... antibacterial activity of plant volatile oil, J. Appl. Microbiol. 88: 308-. 316.

  12. Inhibitory action of conventional food-grade natural antioxidants and of natural antioxidants of new development on the thermal-induced oxidation of cholesterol.

    Science.gov (United States)

    Valenzuela, Alfonso; Sanhueza, Julio; Alonso, Pilar; Corbari, Alicia; Nieto, Susana

    2004-03-01

    Cholesterol is a molecule with an unsaturated bond; therefore, like polyunsaturated fatty acids, it is prone to oxidation. Cholesterol oxidation products (COPs) are found in many common foods and have been shown to be atherogenic, cytotoxic, mutagenic and possibly carcinogenic. Therefore, efforts to prevent or to avoid COPs formation during manufacture and/or processing of foods are of high priority. The effect of natural antioxidants on COPs formation has not been extensively studied. We assayed the effect of some widely applied natural antioxidants, such as tocopherol homologs (alpha-T, gamma-T, and delta-T) and rosemary extract, and of some natural products of newly developed as antioxidants, such as the flavonoids quercetin, catechin, morin, and rutin, and also of an alkaloid-derived product, boldine, to inhibit cholesterol oxidation of soybean oil, added of cholesterol, induced in the Rancimat test conditions (150 degrees C and air bubbling). Formation of six different COPs at the induction period and at the 100 microS conductivity value was monitored by gas chromatography. Under the experimental conditions gamma-T, quercetin, and rosemary extract prove effective to inhibit both soybean oil oxidation and COP formation. alpha-T, catechin, and morin are less efficient to prevent COP formation. delta-T, rutin and boldine are devoid of protective action against COP formation. gamma-T, quercetin and rosemary extract may inhibit COP formation from the nucleus and from the lateral chain of the cholesterol molecule.

  13. Interaction between rancidity and organoleptic parameters of anchovy marinade (Engraulis encrasicolus L. 1758) include essential oils.

    Science.gov (United States)

    Turan, Hülya; Kocatepe, Demet; Keskin, İrfan; Altan, Can Okan; Köstekli, Bayram; Candan, Canan; Ceylan, Asuman

    2017-09-01

    This study was carried out to evaluate the lipid oxidation and sensory attributes of anchovy marinated with 10% NaCl+4% alcohol vinegar+0.2% citric acid solution and 0.1% different essential oils. Group A Control: only sunflower seed oil, Group B: sunflower seed oil+0.1% rosemary oil, Group C: sunflower seed oil+0.1% coriander oil, Group D: sunflower seed oil+0.1% laurel oil and Group E: sunflower seed oil+0.1% garlic oil. During storage, lipid oxidation as indicated by the 2-thiobarbituric acid reactive substances (TBARs) values of the control group were significantly higher than the other groups containing essential oils. The results showed that the essential oils have retarding effect on lipids oxidation. This effect was the highest in laurel oil during initial 3 months; and it was similar to laurel oil and rosemary oil in the fourth month; in all the essential oil added groups in 6 month. L*(brightness) values were similar for all groups in first fourth months but, at the last 2 months, group using laurel oil was found better. Yellowness (b*) was similar in all groups during the intial 3 months whereas, after that lower values in the groups that used laurel and rosemary oils were detected. The study concluded that marination with 0.1% laurel oil of anchovy can retard lipid oxidation and improve the sensory attributes of the product during refrigerated storage.

  14. Epilepsy Awareness (A Cup of Health with CDC)

    Centers for Disease Control (CDC) Podcasts

    2017-08-10

    Epilepsy is a brain disorder that leads to recurring seizures. In this podcast, Rosemarie Kobau discusses the signs of and treatment for epilepsy.  Created: 8/10/2017 by MMWR.   Date Released: 8/10/2017.

  15. Tagasivaade veebruarikuu tegevusele Ehatares / Linda Püssa ; fotod: Linda Püssa

    Index Scriptorium Estoniae

    Püssa, Linda

    2009-01-01

    tegevusjuhi Rosemarie Lindau sünnipäevast, sõbrapäevast, EV aastapäeva tähistamisest Ehatare kirikusaalis ja Vana-Andrese kirikus, Inna ja Aadu Randpalule Eesti Punase Risti III klassi teenetemärgi andmisest

  16. Browse Title Index

    African Journals Online (AJOL)

    Items 8101 - 8150 of 11090 ... Vol 8, No 19 (2009), Phenotypic and molecular evaluation of genetic ... to proline and tyrosine in rosemary callus culture, Abstract PDF ... aurea and monthly dynamics of alkaloid contents in its bulbs, Abstract PDF.

  17. The Efficacy of Specific Essential Oils on Yeasts Isolated from the Royal Tomb Paintings at Tanis, Egypt

    Directory of Open Access Journals (Sweden)

    Akmal Ali SAKR

    2012-06-01

    Full Text Available Yeast strains play an important role in the biodeterioration and biodegradation of paintings in ancient Egyptian tombs. Thirteen yeast were isolated from the royal tombs at Tanis (Oserkon II, Psunes and Shashanq, Sharkia Governorate, Egypt, dated back to 840 B.C., by using a sterile cotton swab. Those strains were identified as Saccharomyces cerevisiae, Candida albicans, C. lipolytica and Lodderomyces elongspous. The S. cerevisiae strains were halotolerant for sodium chloride, up to 10 %. Moreover, they caused a fading for the azurite blue color in laboratory cultures and S. cerevisiae was the most potent agent in fading the color. Five essential oils (lemon, spearmint, fennel, marjonam and rosemary were used to control their growth. Spearmint and lemon oils were the most effective oils in inhibiting the growth of those strains, whereas marjonam, fennel and rosemary had no effect on their growth.

  18. Vehicle and enhancer effects on human skin penetration of aminophylline from cream formulations: evaluation in vivo.

    Science.gov (United States)

    Wang, Lai-Hao; Wang, Chia-Chen; Kuo, Su-Ching

    2007-01-01

    The effects of four essential oils (rosemary, ylang, lilacin, and peppermint oils), and three plant oils (jojoba oil, corn germ oil, and olive oil) on the permeation of aminophylline were studied using human skin. The permeation effects of these oils were compared with those of three chemical penetration enhancers. Although all oils enhanced the permeation of aminophylline, their effects were less than that of ethanol. Jojoba oil was found to be the most active, causing about a 32% peak height decrease of N-H bending absorbances in comparison with the control, while peppermint, lilacin, rosemary, and ylang oils caused 28%, 24%, 18%, and 12% peak height decreases, respectively. Microemulsions containing 10% jojoba oil and 30% corn germ oil were found to be superior vehicles for the percutaneous absorption of aminophylline. Comparision with results obtained from high-performance liquid chromatography shows good agreement.

  19. Bioactive compounds from culinary herbs inhibit a molecular target for type 2 diabetes management, dipeptidyl peptidase IV

    Science.gov (United States)

    Greek oregano (Origanum vulgare), marjoram (Origanum majorana), rosemary (Rosmarinus officinalis) and Mexican oregano (Lippia graveolens) are concentrated sources of bioactive compounds. The aims of this study were to characterize extracts from greenhouse grown or commercially purchased herbs for th...

  20. A double-blind placebo controlled trial of paroxetine in the ...

    African Journals Online (AJOL)

    A double-blind placebo controlled trial of paroxetine in the management of social phobia (social anxiety disorder) in South Africa. Dan J. Stein, Michael Berk, Charl Els, Robin A. Emsley, Leon Gittelson, Don Wilson, Rosemary Oakes, Brian Hunter ...

  1. Examining Current Conceptualizations of Psychopathology With the MMPI-2/MMPI-2-RF Restructured Clinical Scales: Preliminary Findings From a Cross-Cultural Study.

    Science.gov (United States)

    Shkalim, Eleanor; Almagor, Moshe; Ben-Porath, Yossef S

    2017-01-01

    Watson ( 2005 ) proposed a hierarchical reorganization of the underlying structure of emotional disorders. This study cross-culturally evaluated Watson's (2005) structure of mood and anxiety disorders, using mainly dichotomous criteria, and explored the placement of obsessive-compulsive disorder (OCD) in this model. It also tested Sellbom, Ben-Porath, and Bagby's (2008) proposed elaboration of the 2-factor model (positive and negative activation) that incorporates a higher order dimension of demoralization. One hundred men and 133 women from psychiatric settings in Israel completed the Minnesota Multiphasic Personality Inventory-2 (Butcher et al., 2001 ) and the Maudsley Obsessional-Compulsive Inventory (Hodgson & Rachman, 1977 ). They were interviewed using the Mini International Neuropsychiatric Interview (Sheehan et al., 1998 ). Confirmatory factor analyses replicated Watson's structure for women but not for men. Mixed results were obtained regarding OCD's location in the model. Findings among women support the applicability of Watson's (2005) model across a variety of assessment modalities, as well as in a different language and for diversified cultural backgrounds. This conclusion, however, should be tempered in consideration of the results among men. Findings also provide evidence of the importance of demoralization in mood and anxiety disorders.

  2. Quantitative Analysis of Bioactive Compounds from Aromatic Plants by Means of Dynamic Headspace Extraction and Multiple Headspace Extraction-Gas Chromatography-Mass Spectrometry

    NARCIS (Netherlands)

    Omar, Jone; Olivares, Maitane; Alonso, Ibone; Vallejo, Asier; Aizpurua-Olaizola, Oier; Etxebarria, Nestor

    2016-01-01

    Seven monoterpenes in 4 aromatic plants (sage, cardamom, lavender, and rosemary) were quantified in liquid extracts and directly in solid samples by means of dynamic headspace-gas chromatography-mass spectrometry (DHS-GC-MS) and multiple headspace extraction-gas chromatography-mass spectrometry

  3. Luulesõit kui bänditegemine : [reisikiri] / Igor Kotjuh

    Index Scriptorium Estoniae

    Kotjuh, Igor, 1978-

    2011-01-01

    Neli luuletajat, kes kirjutavad oma riigi vähemuskeeles, Rootsist saamikeelne Rose-Marie Huuva, Soomest rootsikeelne Agneta Enckell, Lätist liivikeelne Valts Ernštreits ja Eestist Igor Kotjuh tegid kirjandusliku tuuri viies linnas: Helsingis, Visbys, Stockholmis, Tallinnas ja Liepajas

  4. Toll-Like Receptor-9-Mediated Invasion in Breast Cancer

    Science.gov (United States)

    2011-07-01

    AMBER starting from the in-vacuum minimized Watson - Crick based paired 9-mer hairpin structures. These models were then used with NMR derived distance...the cell. The oligonucleotides studied adopt many different secondary structures such as Watson - Crick duplex, hairpin, quadruplex, and single...deoxyoligonucleotide. Although the mechanism(s) for this induction is unknown, our studies reveal key insights into the structural and sequence requirements for DNA

  5. Nonequilibrium Phase Transitions Associated with DNA Replication

    Science.gov (United States)

    2011-02-11

    polymerases) catalyzing the growth of a DNA primer strand (the nascent chain of nucleotides complementary to the template strand) based on the Watson ...the fraction (error rate) of monomers for which y, where y is the correct Watson - Crick complementary base of , can be obtained by ¼ X...Nonequilibrium Phase Transitions Associated with DNA Replication Hyung-June Woo* and Anders Wallqvist Biotechnology High Performance Computing

  6. Automated problem list generation and physicians perspective from a pilot study.

    Science.gov (United States)

    Devarakonda, Murthy V; Mehta, Neil; Tsou, Ching-Huei; Liang, Jennifer J; Nowacki, Amy S; Jelovsek, John Eric

    2017-09-01

    An accurate, comprehensive and up-to-date problem list can help clinicians provide patient-centered care. Unfortunately, problem lists created and maintained in electronic health records by providers tend to be inaccurate, duplicative and out of date. With advances in machine learning and natural language processing, it is possible to automatically generate a problem list from the data in the EHR and keep it current. In this paper, we describe an automated problem list generation method and report on insights from a pilot study of physicians' assessment of the generated problem lists compared to existing providers-curated problem lists in an institution's EHR system. The natural language processing and machine learning-based Watson 1 method models clinical thinking in identifying a patient's problem list using clinical notes and structured data. This pilot study assessed the Watson method and included 15 randomly selected, de-identified patient records from a large healthcare system that were each planned to be reviewed by at least two internal medicine physicians. The physicians created their own problem lists, and then evaluated the overall usefulness of their own problem lists (P), Watson generated problem lists (W), and the existing EHR problem lists (E) on a 10-point scale. The primary outcome was pairwise comparisons of P, W, and E. Six out of the 10 invited physicians completed 27 assessments of P, W, and E, and in process evaluated 732 Watson generated problems and 444 problems in the EHR system. As expected, physicians rated their own lists, P, highest. However, W was rated higher than E. Among 89% of assessments, Watson identified at least one important problem that physicians missed. Cognitive computing systems like this Watson system hold the potential for accurate, problem-list-centered summarization of patient records, potentially leading to increased efficiency, better clinical decision support, and improved quality of patient care. Copyright © 2017

  7. Microbial contamination of spices used in production of meat products

    Directory of Open Access Journals (Sweden)

    Marcela Klimešová

    2015-05-01

    Full Text Available There was investigated microbial quality of spices used in production of meat products (black pepper, allspice, coriander, juniper, cumin, cinnamon, badian, mustard, bay leaf, paprika, rosemary, garlic, ginger, thyme, cardamom. The spices were analysed on the presence of total count of mesophilic, thermoresistant and coliforming microorganisms, Staphylococcus aureus, methicilin resistant S. aureus (MRSA, Escherichia coli, Salmonella spp., Bacillus cereus, Bacillus licheniformis and moulds. For the detection of fungal contamination was used agar with glucose, yeast extract and oxytetracyklin and dichloran-glycerol agar. The cultivation was performed at 25 ±1°C for 5 - 7 days. The microscopic method was used for species identification. The aflatoxin presence was confirmed by ELISA test in all of tested spices and was performed in ppb (pars per billion = μg/kg. TCM ranged from 200 to 5600000 cfu/g, TRM from 20 to 90000 cfu/g and coliforming bacteria from 30 to 3200 cfu/g. B. cereus was present in juniper, mustard, bay leaf, thyme and cardamom (32%, while B. licheniformis was confirmed in 58% of cases (allspice, pepper, ground juniper, badian, bay leaf, paprika, garlic, thyme and cardamom. S. aureus was detected in whole coriander, cinnamon, badian and mustard but only in law number (30, 40, 20 and 10 cfu/g respectively. No strains S. aureus was identified as MRSA. The presence of Salmonella spp. and E. coli was not confirmed. The fungal contamination was found in 14 spices and the their count varied from 0 to 1550 cfu/g. There were confirmed the presence of Aspergillus flavus (allspice whole and ground, black pepper whole and ground, whole coriander, ground cumin, ground bay leaf, Aspergillus niger (allspice whole and ground, black pepper ground, ground juniper, cumin ground, bay leaf ground, ground rosemary, ground thyme, Penicillium glaucum (allspice whole and ground, whole juniper, whole cinnamon, Penicillium claviforme (whole black pepper

  8. Screening of free radical scavenging capacity and antioxidant activities of Rosmarinus officinalis extracts with focus on location and harvesting times

    NARCIS (Netherlands)

    Yesil Celiktas, O.; Girgin, G.; Orhan, H.; Wichers, H.J.; Bedir, E.; Vardar Sukan, F.

    2007-01-01

    Methanolic extracts from the leaves of Rosmarinus officinalis (rosemary) harvested from different locations of Turkey at four different times of the year were analyzed by HPLC, and their radical scavenging capacities and antioxidant activities were studied by various assays. The amounts of carnosol,

  9. Responding to Seizures (A Cup of Health with CDC)

    Centers for Disease Control (CDC) Podcasts

    As traumatic as epilepsy can be for the person experiencing seizures, it can be just as troubling for witnesses who want to try and help. In this podcast, Rosemarie Kobau discusses the appropriate way to help someone who is experiencing a seizure.

  10. Design and Integration of a Scent Delivery System in the Computer Assisted Rehabilitation Environment (CAREN)

    Science.gov (United States)

    2013-12-06

    1637 Barnyard/Livestock 1655 Seashore 1644 Roasting Meat 1855 Pacific Breeze 1913 Street Waste 1928 Charcoal Pit Body 2037 Marina 1623...Vehicle 1664 Cumin 1650 Tar Asphalt 1680 Rosemary Focaccia Bread 1680 Car Bomb 1990 Garlic 1905 Turpentine 1992 Mesquite BBQ Scent System

  11. Improved Properties and Microbiological Safety of Novel Cottage Cheese Containing Spices

    Directory of Open Access Journals (Sweden)

    Zvonimira Medverec Knežević

    2015-01-01

    Full Text Available The study focuses on developing novel cott age cheese containing spices with acceptable sensory properties, increased biological value and extended shelf life. Thirty types of cheese with added fresh or dried parsley, dill, pepper, garlic and rosemary were produced. Characterisation of phenolic compounds, antioxidant capacity and antibacterial activity of spices and cheese samples were evaluated. The cheese containing fresh pepper and fresh and dried herbs showed excellent sensory properties, with the best results obtained with fresh sweet red pepper. Dry rosemary had the highest antioxidant and antibacterial activity due to high mass fractions of caffeic and rosmarinic acids as well as high mass fractions of flavones and phenolic diterpenes. The plant extracts examined in vitro and in situ effectively reduce numbers of foodborne pathogens like Salmonella typhimurium, Escherichia coli, Staphylococcus aureus and Listeria monocytogenes, and therefore have potential as natural preservatives and antioxidants.

  12. Improving the Army’s Next Effort in Technology Forecasting

    Science.gov (United States)

    2010-09-01

    DC: Center for Technology and National Security Policy, National Defense University, August 2005). 6 James D. Watson and Francis Crick , “A...occurred within the life sciences disciplines. Most notably this occurred early on in 1953 via the discovery of DNA’s double helix structure by Watson and... Crick .6 A confluence of organic chemistry, physics, genomics, and information technology further provided the ability to amplify and replicate the

  13. OSA Proceedings on Ultrafast Electronics and Optoelectronics Held in San Francisco, California on January 25 -27, 1993. Volume 14,

    Science.gov (United States)

    1993-01-27

    Fetterman , University of California, Los Angeles M. Fischetti, IBM T. J. Watson Research Center D. Grischkowski, IBM T. J. Watson Research Center E. P. Ippen...Spectroscopy System ............................. 112 Jeffrey S. Bostak, Daniel W. Van Der Weide, Ikuro Aoki, Bertram A. Aul" and David M. Bloom Sub-Picosecond...Martin, F. K. Oshita, and H. R. Fetterman ix On-Wafer Optoelectronic Techniques for Millimeter-Wave Generation, Control, and Circuit Characterization

  14. How does the long G·G* Watson-Crick DNA base mispair comprising keto and enol tautomers of the guanine tautomerise? The results of a QM/QTAIM investigation.

    Science.gov (United States)

    Brovarets', Ol'ha O; Hovorun, Dmytro M

    2014-08-14

    The double proton transfer (DPT) in the long G·G* Watson-Crick base mispair (|C6N1(G*)N1C6(G)| = 36.4°; C1 symmetry), involving keto and enol tautomers of the guanine (G) nucleobase, along two intermolecular neighboring O6H···O6 (8.39) and N1···HN1 (6.14 kcal mol(-1)) H-bonds that were established to be slightly anti-cooperative, leads to its transformation into the G*·G base mispair through a single transition state (|C6N1N1C6| = 37.1°; C1), namely to the interconversion into itself. It was shown that the G·G* ↔ G*·G tautomerisation via the DPT is assisted by the third specific contact, that sequentially switches along the intrinsic reaction coordinate (IRC) in an original way: (G)N2H···N2(G*) H-bond (-25.13 to -10.37) → N2···N2 van der Waals contact (-10.37 to -9.23) → (G)N2···HN2(G*) H-bond (-9.23 to 0.79) → (G*)N2···HN2(G) H-bond (0.79 to 7.35 Bohr). The DPT tautomerisation was found to proceed through the asynchronous concerted mechanism by employing the QM/QTAIM approach and the methodology of the scans of the geometric, electron-topological, energetic, polar and NBO properties along the IRC. Nine key points, that can be considered as part of the tautomerisation repertoire, have been established and analyzed in detail. Furthermore, it was shown that the G·G* or G*·G base mispair is a thermodynamically and dynamically stable structure with a lifetime of 8.22 × 10(-10) s and all 6 low-frequency intermolecular vibrations are able to develop during this time span. Lastly, our results highlight the importance of the G·G* ↔ G*·G DPT tautomerisation, which can have implications for biological and chemical sensing applications.

  15. 08 Van Coller pp 117-133

    African Journals Online (AJOL)

    Tienie

    Acts of Memory. Cultural Recall in the Present. Hanover & London: University Press of New England. Brink, André. 1998. Interrogating silence: new possibilities faced by South African literature. In Derek. Attridge & Rosemary Jolly (eds.). Writing South Africa. Literature, Apartheid, and Democracy, 1970-1995. Cambridge: ...

  16. Effects of various additives on antioxidant and antimicrobial ...

    African Journals Online (AJOL)

    We investigated the effects of rosemary extract (RE), α-tocopherol (AT) and chitosan (CH) added individually or in combination as compared with butylated hydroxyanisole (BHA) on microbiological parameters [total viable count (TVC), lactic acid bacteria (LAB), enterobacteria (ENB), pseudomonas bacteria (PSY)], pH and ...

  17. Effect of Temperature and Drought Stress on Germination of Slender Amaranth (Amaranthus viridis L. and Prostrate Pigweed (Amaranthus blitoides S. Watson Seeds

    Directory of Open Access Journals (Sweden)

    Marjan Diayanat

    2018-02-01

    Full Text Available Introduction: Slender amaranth (Amaranthus viridis L. and prostrate pigweed (Amaranthus blitoides S. Watson are two common weeds in vegetables and summer crop fields of Iran. The two Amaranthus species have all the attributes required by ecologically successful annual weeds: rapid growth, early reproduction and continuous seed production. Knowledge of the germination requirements of these weeds will helps determine the proper conditions for germination and emergence and allow better management of them. Water and temperature are determining factors for seed germination of weed. Both factors can, separately or jointly, affect the germination percentage and germination rate. Water stress is one of the main constraints on plant growth and the most common environmental stresses around the world. Water stress affects the different aspects of plant growth and causes reduction and delay in seed germination. Seed germination of all plant species requires a minimum of water to be absorbed and swelled and that is why osmotic potential should not be less than a certain amount. Materials and Methods: Seeds were harvested from vegetable fields of Karaj. For breaking dormancy, seeds were treated with concentrated sulfuric acid for two minutes. Two experiments were conducted at Islamic Azad University, Science and Research Branch, Ecology lab, in 2016. First experiment was based on completely randomized design with 4 replications .The seeds were treated with different temperatures (5, 10, 15, 20, 25, 30, 35, 40 and 45oC. Germination percentage and germination rate were measured and seed were considered to have germinated with the emergence of the radical. Intersected lines model is used to determine the cardinal temperature. Second experiment was conducted to determine the effects of simulated dry conditions (use PEG and temperature on seed germination of slender amaranth and prostrate pigweed. Exposure to polyethylene glycol (PEG-6000 solutions has been

  18. Glutamate Receptor Aptamers and ALS

    Science.gov (United States)

    2009-01-01

    considered difficult because such a process uses the one-to-one correspondence of Watson - Crick pairing. In contrast, the transfer of function is...same nucleotides in M1 exhibited no NMIA reactivity. In general, non-reactive nucleotides were thought to be Watson - Crick based- paired. A number of...about 14 rounds of selections, the SELEX was terminated. The DNA pool from the 11th, 12th and 14th rounds were cloned and sequenced. Consensus

  19. 77 FR 75082 - Notice of Receipt of Several Pesticide Petitions Filed for Residues of Pesticide Chemicals in or...

    Science.gov (United States)

    2012-12-19

    ...) following sample extraction, hydrolysis (to convert CHNP-glucoside to its aglycone, CHNP) and solid-phase... method for analysis of large animal tissues includes extraction of the residues of concern, followed by... analysis of milk eliminated the initial extraction step in the tissue method. Contact: Rosemary Kearns...

  20. Tips from the Classroom.

    Science.gov (United States)

    TESOL Journal, 1993

    1993-01-01

    Seven articles on classroom icebreakers are compiled: "Picture Stories and Other Opportunities" (Joy Egbert, Deborah Hanley, Rosemary Delaney); "Hey, What's Your Name" (Janet Leamy); "Surprise!" (Lynne Burgess); "Memory Game" (Sally Winn); "Picturesque" (Margaret Beiter); "The Name Game" (Jeanne-Marie Garcia); "Exercise the Body--And the Mind…

  1. Antioxidant Activities of á-Tocopherol, Herbalox and ...

    African Journals Online (AJOL)

    This study was carried out to determine possible synergism and antagonism in blends of natural and synthetic antioxidants for protection of palm olein at high temperatures. Three primary antioxidants: (±)-á-tocopherol (Vitamin E), Rosemary extract (Herbalox) and butylated hydroxytoluene (BHT) were used in a mixture ...

  2. Overcoming the plasticity of plant specialized metabolism for selective diterpene production in yeast

    DEFF Research Database (Denmark)

    Ignea, Codruta; Athanasakoglou, Anastasia; Andreadelli, Aggeliki

    2017-01-01

    of the enzymes involved. The pathway of carnosic acid-related diterpenes in rosemary and sage involves promiscuous cytochrome P450s whose combined activity results in a multitude of structurally related compounds. Some of these minor products, such as pisiferic acid and salviol, have established bioactivity...

  3. THE VARIATION OF SOME BIOCHEMICAL PARAMETERS FROM FRESH COW CHEESE CREAM TYPE WITH ADDED AROMATIC PLANTS

    Directory of Open Access Journals (Sweden)

    CRISTIANA DIACONESCU

    2007-10-01

    Full Text Available Recent advanced studies in the field of cheese fabrication technology include, amongother, the usage of aromatic plants and spices as a mean of improving theorganoleptic properties and as a mean of decreasing the lipidic peroxidationphenomenon. For this purpose, three types of fresh cow cheese produced by S.C.Marion Invest Trade 94 SRL, experimentally added with dill, savory and rosemary,were comparatively studied from a chemical point of view (pH, acidity, humidity, ashand a biochemical point of view(raw fat, total proteins, total cholesterol, acidphosphatase’s enzymatic activity, superoxide dismutase’s enzymatic activity, calciumcontent.From a chemical point of view, no significant differences appeared between the creamcheese types analyzed, excepting the pH( lower in the cheeses with dill and rosemaryFrom a biochemical point of view, two phenomenon can be observed: a significantdecrease of the acidic phosphatase activity in the cheeses with added dill androsemary ( positively correlating with the pH value and decreased values of the SODactivity in all cheese types.

  4. Suitability of antioxidant capacity, flavonoids and phenolic acids for floral authentication of honey. Impact of industrial thermal treatment.

    Science.gov (United States)

    Escriche, Isabel; Kadar, Melinda; Juan-Borrás, Marisol; Domenech, Eva

    2014-01-01

    Total antioxidant activity, physicochemical parameters, and the profile of flavonoids and phenolic acid compounds were evaluated for: their ability to distinguish between the botanical origins of four types of Spanish honey, the impact of industrial thermal treatment, and the effect of the year of collection. Citrus honey had the lowest levels of all the analysed variables, then rosemary and polyfloral, and honeydew the highest ones. Botanical origin affects the profile of flavonoids and phenolic compounds sufficiently to permit discrimination thanks to the predominance of particular compounds such as: hesperetin (in citrus honey); kaempferol, chrysin, pinocembrin, caffeic acid and naringenin (in rosemary honey) and myricetin, quercetin, galangin and particularly p-coumaric acid (in honeydew honey). The impact of industrial thermal treatments is lower than the expected variability as a consequence of the year of collection, though neither factor has enough influence to alter these constituent compounds to the point of affecting the discrimination of honey by botanical origin. Copyright © 2013 Elsevier Ltd. All rights reserved.

  5. Combined effects of gamma-irradiation and modified atmosphere packaging on quality of some spices.

    Science.gov (United States)

    Kirkin, Celale; Mitrevski, Blagoj; Gunes, Gurbuz; Marriott, Philip J

    2014-07-01

    Thyme (Thymus vidgaris L.), rosemary (Rosmarinus officinalis L.), black pepper (Piper nigrum L.) and cumin (Cuminum cyminum L.) in ground form were packaged in either air or 100% N2 and γ-irradiated at 3 different irradiation levels (7kGy, 12kGy, 17kGy). Total viable bacterial count, yeast and mould count, colour, essential oil yield and essential oil composition were determined. Microbial load was not detectable after 12kGy irradiation of all samples. Irradiation resulted in significant changes in colour values of rosemary and black pepper. The discolouration of the irradiated black pepper was lower in modified atmosphere packaging (MAP) compared to air packaging. Essential oil yield of irradiated black pepper and cumin was lower in air packaging compared to MAP. Gamma-irradiation generally decreased monoterpenes and increased oxygenated compounds, but the effect was lower in MAP. Overall, spices should be irradiated under an O2-free atmosphere to minimise quality deterioration. Copyright © 2014 Elsevier Ltd. All rights reserved.

  6. Stabilisation of phytosterols by natural and synthetic antioxidants in high temperature conditions.

    Science.gov (United States)

    Kmiecik, Dominik; Korczak, Józef; Rudzińska, Magdalena; Gramza-Michałowska, Anna; Hęś, Marzanna; Kobus-Cisowska, Joanna

    2015-04-15

    The aim of the study was to assess the potential applicability of natural antioxidants in the stabilisation of phytosterols. A mixture of β-sitosterol and campesterol was incorporated into triacylglycerols (TAGs). The following antioxidants were added to the prepared matrix: green tea extract, rosemary extract, a mix of tocopherols from rapeseed oil, a mix of synthetic tocopherols, phenolic compounds extracted from rapeseed meal, sinapic acid and butylated hydroxytoluene (BHT). Samples were heated at a temperature of 180 °C for 4 h. After the completion of heating, the losses of phytosterols were analysed, as well as the contents of β-sitosterol and campesterol oxidation products. The total content of phytosterol oxidation products in samples ranged from 96.69 to 268.35 μg/g of oil. The effectiveness of antioxidants decreased in the following order: phenolic compounds from rapeseed meal>rosemary extract>mix of tocopherols from rapeseed oil>mix of synthetic tocopherols>green tea extract>sinapic acid>BHT. Copyright © 2014 Elsevier Ltd. All rights reserved.

  7. The susceptibility of dental plaque bacteria to the herbs included in Longo Vital®

    DEFF Research Database (Denmark)

    Larsen, T.; Fiehn, N. E.; Østergaard, E.

    1996-01-01

    Longo Vital® herbal tablets have been shown to have a protective effect against periodontal bone loss in rats. This may be ascribed either to a previously demonstrated immuno-stimulatory effect of the tablets, to an antimicrobial effect of the herbs or to a combination of both. In the present study...... the in vitro susceptibility of 12 dental plaque bacteria to six individual herbs included in Longo Vital® was determined by a broth dilution method. Paprika, rosemary leaves and peppermint inhibited two thirds of the tested bacteria at 2.8-45 mg/ml, 0.75-12 mg/ml and 3-24 mg/ml corresponding to 0.8-12.5 per...... cent, 1.6-25 per cent and 12.5-100 per cent of the recommended daily dose, respectively. A combination of paprika and rosemary leaves tested towards five susceptible bacteria revealed a decreased inhibitory effect on two of these bacteria, especially of Actinobacillus actinomycetemcomitans to paprika...

  8. Susceptibility of Postharvest Pathogens to Esential Oils

    Directory of Open Access Journals (Sweden)

    Božik M.

    2017-09-01

    Full Text Available Antimicrobial volatile substances from plants represent alternatives to synthetic pesticides and food preservatives. In this study, the compositions of some essential oils were determined by gas chromatography with mass spectrometry, and the inhibitory properties of the essential oils and their components against the bacterial postharvest pathogens Pectobacterium carotovorum subsp. carotovorum (CCM 1008, Pseudomonas syringae (CCM 7018, Xanthomonas campestris (CCM 22 were determined by the microdilution method. Essential oils from oregano, cinnamon, lemongrass, lavender, clove, rosemary, tea tree, eucalyptus, garlic, and ginger and their components cinnamaldehyde, eugenol, thymol, and carvacrol were used in the tests. The essential oil components exhibited strong antibacterial activity against all tested bacteria. The oregano and cinnamon essential oils were most effective. The rosemary, lavender, tea tree, eucalyptus, garlic, and ginger oils were not effective at the tested concentrations. In conclusion, certain essential oils, particularly their components, are highly effective and could be used for the control of postharvest bacterial pathogens.

  9. Composition and biological activity of essential oils against Metopolophium dirhodum (Hemiptera: Aphididae) cereal crop pest.

    Science.gov (United States)

    Chopa, Carolina Sánchez; Descamps, Lilian R

    2012-11-01

    Natural pesticides based on plant essential oils may represent alternative crop protectants. This study analysed the chemical constituents and bioactivities of essential oils from Schinus areira L., Rosmarinus officinalis L. and Tagetes terniflora Kunth against winged and wingless adults of Metopolophium dirhodum (Walk.). The major component of S. areira was α-phellandrene, that of R. officinalis was 1,8-cineole and that of T. terniflora was cis-ocimene. Rosemary essential oil was more effective than the others in immersion method tests. In contact toxicity, the rosemary oil was the most toxic to wingless adults and the S. areira leaf oil was the most toxic to winged adults. All the EOs produced some degrees of repellency in adults and effects on the reproduction and demographic parameters. These results showed that the essential oils from S. areira, R. officinalis and T. terniflora could be used as an alternative in the management of M. dirhodum. Copyright © 2012 Society of Chemical Industry.

  10. Relativistic jet feedback - II. Relationship to gigahertz peak spectrum and compact steep spectrum radio galaxies

    Science.gov (United States)

    Bicknell, Geoffrey V.; Mukherjee, Dipanjan; Wagner, Alexander Y.; Sutherland, Ralph S.; Nesvadba, Nicole P. H.

    2018-04-01

    We propose that Gigahertz Peak Spectrum (GPS) and Compact Steep Spectrum (CSS) radio sources are the signposts of relativistic jet feedback in evolving galaxies. Our simulations of relativistic jets interacting with a warm, inhomogeneous medium, utilizing cloud densities and velocity dispersions in the range derived from optical observations, show that free-free absorption can account for the ˜ GHz peak frequencies and low-frequency power laws inferred from the radio observations. These new computational models replace a power-law model for the free-free optical depth a more fundamental model involving disrupted log-normal distributions of warm gas. One feature of our new models is that at early stages, the low-frequency spectrum is steep but progressively flattens as a result of a broader distribution of optical depths, suggesting that the steep low-frequency spectra discovered by Callingham et al. may possibly be attributed to young sources. We also investigate the inverse correlation between peak frequency and size and find that the initial location on this correlation is determined by the average density of the warm ISM. The simulated sources track this correlation initially but eventually fall below it, indicating the need for a more extended ISM than presently modelled. GPS and CSS sources can potentially provide new insights into the phenomenon of AGN feedback since their peak frequencies and spectra are indicative of the density, turbulent structure, and distribution of gas in the host galaxy.

  11. Overlapping Residual Herbicides for Control of Photosystem (PS) II- and 4-Hydroxyphenylpyruvate Dioxygenase (HPPD)-Inhibitor-Resistant Palmer amaranth (Amaranthus palmeri S. Watson) in Glyphosate-Resistant Maize

    Science.gov (United States)

    Chahal, Parminder S.; Ganie, Zahoor A.; Jhala, Amit J.

    2018-01-01

    A Palmer amaranth (Amaranthus palmeri S. Watson) biotype has evolved resistance to photosystem (PS) II- (atrazine) and 4-hydroxyphenylpyruvate dioxygenase (HPPD)-inhibiting herbicides (mesotrione, tembotrione, and topramezone) in maize seed production field in Nebraska, USA. The objectives of this study were to determine the effect of soil residual pre-emergence (PRE) herbicides followed by (fb) tank-mixture of residual and foliar active post-emergence (POST) herbicides on PS-II- and HPPD-inhibitor-resistant Palmer amaranth control, maize yield, and net economic returns. Field experiments were conducted in a grower's field infested with PS II- and HPPD-inhibitor-resistant Palmer amaranth near Shickley in Fillmore County, Nebraska, USA in 2015 and 2016. The contrast analysis suggested that saflufenacil plus dimethenamid-P or pyroxasulfone plus saflufenacil applied PRE provided 80–82% Palmer amaranth control compared to 65 and 39% control with saflufenacil and pyroxasulfone applied alone at 3 weeks after PRE (WAPRE), respectively. Among the PRE fb POST herbicide programs, 95–98% Palmer amaranth control was achieved with pyroxasulfone plus safluefenacil, or saflufenacil plus dimethenamid-P applied PRE, fb glyphosate plus topramezone plus dimethenamid-P plus atrazine, glyphosate plus diflufenzopyr plus dicamba plus pyroxasulfone, glyphosate plus diflufenzopyr plus pendimethalin, or glyphosate plus diflufenzopyr plus dicamba plus atrazine applied POST at 3 weeks after POST (WAPOST) through maize harvest. Based on contrast analysis, PRE fb POST programs provided 77–83% Palmer amaranth control at 3 WAPOST through maize harvest compared to 12–15% control with PRE-only and 66–84% control with POST-only programs. Similarly, PRE fb POST programs provided 99% biomass reduction at 6 WAPOST compared to PRE-only (28%) and POST-only (87%) programs. PRE fb POST programs provided higher maize yield (13,617 kg ha−1) and net return (US $1,724 ha−1) compared to the PRE

  12. Automated Information Enrichment for a Better Search

    OpenAIRE

    José Luis Preza

    2016-01-01

    The process of adding the Metadata when uploading a digital object onto a repository is usually manual. This means that the user has to have already at hand the keywords and all the other information about the asset. This paper addresses the possibility of enriching the “manual metadata” by generating automated metadata using the cognitive services provided by technologies like IBM Watson platform. The cognitive computing services offered by IBM Watson automatically generate Semantic Data (in...

  13. Healthcare Information Technology (HIT) in an Anti-Access (A2) and Area Denial (AD) Environment

    Science.gov (United States)

    2014-03-01

    point for multiple sites to connect to each other so radiologists can read diagnostic images by managing firewall connections. The idea of multiple...learn from them.41 Although IBM’s Watson isn’t living up to the hype just yet, the artificial intelligent ( AI ) computer system is a precursor for a...on the ground can control a UAV with two passengers in it; one technician and one AI healthcare machine (Medical IBM Watson). Once the UAV lands

  14. Development of a triple hyphenated HPLC-radical scavenging detection-DAD-SPE-NMR system for the rapid identification of antioxidants in complex plant extracts

    NARCIS (Netherlands)

    Pukalskas, A.; Beek, van T.A.; Waard, de P.

    2005-01-01

    A rapid method for the simultaneous detection and identification of radical scavenging compounds in plant extracts was developed by combining an HPLC with on-line radical scavenging using DPPH as a model radical and an HPLC¿DAD¿SPE¿NMR system. Using this method a commercial rosemary extract was

  15. Managing Epilepsy (A Cup of Health with CDC)

    Centers for Disease Control (CDC) Podcasts

    2018-04-19

    Approximately three million people in the U.S. have been diagnosed with epilepsy, a brain disorder that results in seizures. In this podcast, Rosemarie Kobau discusses the importance of recognizing and treating epilepsy.  Created: 4/19/2018 by MMWR.   Date Released: 4/19/2018.

  16. The Nightingale murder.

    Science.gov (United States)

    Trueland, Jennifer

    Queen's Nursing Institute director Rosemary Cook has published a book on the unsolved murder of Florence Nightingale Shore, an eminent early 20th century nurse and god-daughter of her famous namesake. Ms Shore's remarkable nursing career provides an insight into the profession during the Victorian/Edwardian era.

  17. Apple and quince peroxidase activity in response to essential oils ...

    African Journals Online (AJOL)

    Enzymatic browning arises by peroxidase in fruits. However, essential oils are recognized as natural antioxidant agents. So in this study, the effect of thyme, coriander and rosemary essential oils were evaluated on the reduction of peroxidase activity in apples (Malus domestica Mill. cv Golden delicious), (M. domestica Mill.

  18. Antioxidant activity of the methanolic extracts of some species of ...

    African Journals Online (AJOL)

    Antioxidant effects of the methanolic extract of Phlomis bruguieri, P. herba-venti, P. olivieri, Stachys byzantina, S. inflata, S. lavandulifolia and S. laxa were tested in sunflower oil stored at 70ºC, by measuring peroxide values after regular intervals and compared with rosemary-, green tea- and BHAcontaining samples.

  19. Comparative study of the antifungal activity of some essential oils ...

    African Journals Online (AJOL)

    This study aimed to evaluate the antimould activity of oregano, thyme, rosemary and clove essential oils and some of their main constituents: eugenol, carvacrol and thymol against Aspergillus niger. This antifungal activity was assessed using broth dilution, disc diffusion and micro atmosphere methods. In both agar diffusion ...

  20. Changing oxidation in whey fat concentrate upon addition of green tea extract

    DEFF Research Database (Denmark)

    Jensen, Bente Marianne; Nielsen, J; Sørensen, J

    2011-01-01

    was measured using a number of different antioxidants: Trolox (TRX), propyl gallate (PG), Grindox 1021 (GRX), green tea extract (GTE) and rosemary extract (RE). The development of the secondary lipid oxidation product hexanal was inhibited by all the tested antioxidants, and GTE was found to be the most...